text
stringlengths
3
7.38M
source_data
stringclasses
5 values
info
stringlengths
83
12.5k
Background Methods A retrospective study of 28 eyes of 27 consecutive patients of hemorrhagic PCV with VH, which were managed surgically between January 2003 and December 2011, was performed. All patients underwent pars plana vitrectomy for VH associated with PCV. The main outcome measure was best-corrected visual acuity (BCVA) at baseline, at 1, 3 and 6 months post operatively and at last follow up. Polypoidal choroidal vasculopathy (PCV) is a persistent and chronic disease with a variable course [1]. Although the prognosis of PCV is commonly reported to be more favorable and the clinical course more stable as compared with exudative age-related macular degeneration (AMD) [2–4], the natural history of PCV, especially haemorrhagic PCV, is not clearly known and may not be as benign as previously reported [1]. The primary abnormality in PCV involves the choroidal circulation, and the characteristic lesion is an inner choroidal vascular network of vessels ending in an aneurysmal bulge or outward projection seen clinically as reddish orange polyps [5]. Leakage in the vessel wall at dilatations leads to serous pigment epithelial detachments (PED) and lipid deposition in the exudative form of PCV while recurrent serosanguinous detachments of the retinal pigment epithelium and neurosensory retina are the predominant manifestation of hemorrhagic PCV. Massive hemorrhages may develop from rupture of venules and occasionally arteries. Sequelae of this is a sudden onset severe visual loss due to break through vitreous hemorrhage (VH) [1, 6–10]. There is a lack of understanding of hemorrhagic PCV and there are very few reports in the literature on the outcomes of conservative [1, 4], or surgical management of PCV with VH [4, 6]. In the current study we report the incidence, clinical characteristics, management and surgical outcome in haemorrhagic PCV presenting with vitreous haemorrhage. This study was a retrospective, interventional consecutive case series. The study was approved by the local ethics committee of L.V. Prasad Eye Institute (LEC-11-160) and all participants gave consent for using patient data for research purpose. Medical records of all cases having a diagnosis ICD coding of PCV and vitreous haemorrhage who underwent pars plana vitrectomy (PPV) were identified and studied. Twenty-eight eyes of 27 consecutive patients treated surgically for PCV associated with VH were included. Due to the presence of VH, the media clarity did not allow the visualization of the fundus or angiography in most eyes at presentation. Although the EVEREST trial laid down guidelines for the diagnosis of PCV [11], massive hemorrhagic PCV may not show the same features at presentation in the affected eye. The vitreous haemorrhage was attributed to PCV on the basis of preoperative B-scan features [6], and confirmed with demonstration of polypoidal lesions and/or branching vascular network in the study or fellow eye on indocyanine angiography (ICGA) in the past or post-operatively, as laid down in the EVEREST trial [11]. Patients were excluded if the same or fellow eye had any other vascular or degenerative retinal or macular condition, or any other ocular pathology which could limit their vision. After a preoperative written informed consent all patients underwent standard 20 or 23 gauge PPV. Removal of subretinal blood was not attempted in this series. The data pertaining to age, gender, duration of diabetes and hypertension, duration of symptoms, best-corrected visual acuity (BCVA) at presentation, 1, 3, 6 months post-operative and at the last follow up, intraocular pressure (IOP, Goldman applanation tonometry), surgical procedures performed, surgical complications and duration of follow up were collected and are summarized in Table 1. The primary outcome measure of this series was the number of patients who improved by two or more lines on early treatment diabetic retinopathy study (ETDRS) chart after surgery. Secondary outcome measures were mean change in logMAR visual acuity, and complications of surgery. The visual improvement post operatively and the differences between BCVA at 1 month post operative visit and final follow up from the baseline pre operative visual acuity were compared using paired t test. Statistical analysis was done using Statistical software R, version 2.14.1. Twenty-eight eyes of 27 patients (21 men, 6 women) with a mean age of 58.89 ± 13.13 years (range 36–82) underwent PPV for vitreous haemorrhage associated with PCV between January 2003 and December 2011. Their baseline demographic characteristics are shown in Table 1. Ten (37 %) patients had a history of diabetes mellitus for an average of 13 years (range 3–25 years) and 16 (59 %) patients had a history of hypertension for an average 10.5 years (range 1–36). The mean duration of symptoms at presentation was 6.2 ± 3.3 months with sudden onset profound painless diminution of vision being the most common presenting complaint. The mean preoperative baseline logMAR visual acuity was 2.69 ± 0.58 (<20/2000, range 20/400 to perception of light, PL). At 1 month postoperative follow up, the mean BCVA was 1.69 ± 0.93 (20/979, range 20/20 to PL) with a mean improvement of 1.00 logMAR units from the baseline (p < 0.001, 95 % CI 0.64–1.34). At 3 and 6 months follow up the BCVA was 1.46 ± 0.93 (20/576, range 20/20 to PL) and 1.57 ± 1.26 (20/743, range 20/20 to no PL) respectively. The mean BCVA at the last post operative follow up visit was 1.73 ± 1.14 (20/1074, range 20/20 to no PL) with an improvement of 0.96 logMAR units from the baseline (p < 0.001, 95 % CI 0.54–1.37). The BCVA improved by two or more lines on ETDRS chart in 16 of 28 eyes (57.1 %), stabilized or improved by less than two lines in nine (32.1 %) and worsened in three (10.7 %) at a mean follow up of 14.28 months. The three eyes which worsened post-operatively had a preoperative vision of hand movement which decreased to PL in one and loss of PL in the other two eyes. The results of visual outcome have been summarized in Table 2. The trend of BCVA change from baseline preoperative to post operative last visit is shown in Fig. 1. Prior to surgery, five study eyes had been treated with intravitreal bevacizumab, one received intravitreal triamcinolone, three had undergone focal laser treatment, two eyes had undergone sclera buckling in the same eye in the past and three eyes had a history of photo dynamic therapy (PDT). Three patients in whom B-scan showed exudative retinal detachment were treated with oral steroids preoperatively. Nine (33.3 %) patients had bilateral PCV of which four (14.8 %) also had associated VH with PCV in the fellow eye. At presentation, fundus evaluation was not possible due to dense vitreous haemorrhage in 21 of the 28 eyes (75 %). B-scan showed vitreous haemorrhage in all 28 eyes, extensive exudative retinal detachment in six and suspected mass lesion in one eye. Diagnosis of underlying cause being PCV was based on demonstration of polyps or branching vascular on previous or post operative ICG-Angiography (ICG-A) in seven study eyes, four fellow eyes (Fig. 2) and on fluorescein angiography in two study eyes. The rest of the cases were diagnosed on the basis of presence of multiple sero-sanguinous RPE detachments suggestive of PCV. Two of the cases where polyps had been demonstrated on ICG-A before VH had regression of the previously noted polyps, but developed polyps in new locations subsequently (Fig. 3). Fig. 2 Toprow shows polypoidal lesions (white arrows) demonstrated on indocyanine green angiography (ICG-A) in three study eyes done postoperatively after clearing of vitreous hemorrhage. Bottom row shows ICG-A of fellow eyes in three cases where the ocular media in the study eyes did not clear postoperatively to allow an angiography and the basis of diagnosis was demonstration of polypoidal lesions (white arrows) and/or choroidal branching vascular network (white arrow heads) in the fellow eye The site of subretinal haemorrhage was found to be predominantly macular in 12 (42.8 %) eyes, peripapillary in 4 (14.2 %) eyes, midperipheral in 10 (35.7 %) eyes and peripheral in 1 (3.5 %) eye. Intraoperatively, macular scar was noted in 9 (32.1 %) eyes and organized dehemoglobinized blood at the macula was noted in seven (25 %) eyes. Several reports and case series describing the diverse clinical spectrum, natural course, and role of various modalities of treatments for exudative PCV have been published in the last three decades [1, 2, 6–9, 11, 12], but there are few reports in the literature on the management of vitreous haemorrhage associated with PCV [6, 8, 9, 13]. Vitreous haemorrhage associated with PCV differs from other manifestations of PCV as these eyes are not amenable to ICG angiography. Unless the affected eye has been previously diagnosed as PCV or the fellow eye has features of PCV, it is difficult to diagnose them. B-scan features that can differentiate vitreous haemorrhage secondary to PCV from other causes has been reported and are very useful in this situation. B-scan can demonstrate defining features like blood lining an elevated membrane, hemorrhagic pigment epithelial detachment and absence of any acoustic shadowing. The natural course or role of any treatment modality is unknown for vitreous haemorrhage in PCV as no large series of cases has been studied. In our study, PCV was bilateral in 9 (33.3 %) of which four eyes (14.8 %) also had PCV associated vitreous haemorrhage in the fellow eye. Previously, bilaterality has been reported ranging from 9 to 47 % for exudative PCV [1, 8, 9, 12, 14]. PCV had been originally reported in hypertensive middle aged African women [8, 14–16]. Associated systemic hypertension has been reported in 18–88 % in various case series and clinic pathological studies of PCV [8, 9, 14]. In our series, 59 % of the patients had systemic hypertension. Vitreous haemorrhage associated with PCV has also been reported to occur following PDT [7, 17]. In our series only one patient had history of recent PDT and developed sudden onset loss of vision and VH 1 week after the treatment. The earliest descriptions of vitreous haemorrhage in PCV was in 1985 [9, 10]. In previous reports by Kleiner et al. and Perkovich et al. [8, 9], visual recovery after vitrectomy was found to be equivocal. Two of the three eyes gained useful vision in one series [8], whereas the other studies reported worsening or no change in the visual acuity [4, 9]. These studies had small series ranging from one to three eyes that underwent vitrectomy. Recent reported outcomes of vitrectomy in PCV did not find a higher incidence of retinal breaks [13, 18]. In our study, significant visual improvement occurred in 16 of 29 eyes (57.1 %). Three patients recovered a visual acuity of better than 20/40, one eye had a visual acuity of 20/20 at 84 months, another had 20/25 at 17 months and the third eye had 20/40 at 6 months follow up. The improvement in visual acuity could have been limited by extensive blood under the macula. We did not attempt to remove the subretinal blood in our study. All cases in our study would have required subretinal tissue plasminogen activator with incubation of approximately half an hour. In our experience, the blood decolorizes rapidly in these cases and does not liquefy with conventional doses of tPA. In such cases, the dose of tPA is much more than the recommended upper limit of 50 μg. Further, washing of blood in such massive hemorrhage under the macula tends to cause photoreceptor damage. The peripheral visual field would also have improved after the clearance of vitreous haemorrhage but would be difficult to document in most cases due to poor central fixation. The commonest intra operative complication was iatrogenic retinal breaks, which occurred during induction of PVD which was also been reported by us in our previous study [6]. Hence it is possibly better to wait for spontaneous PVD to occur before attempting surgery. The cases which had no visual recovery or experienced worsening of vision had macular scar, recurrent VH, post operative retinal detachment and cataract. In a few cases in our study, polypoidal lesions which were seen on ICG-A before vitreous haemorrhage were not seen postoperatively but new lesions polypoidal lesions developed in a new location on subsequent follow up (Fig. 3). This disappearance of classic polypoidal lesions and replacement by RPE atrophy and scarring has been described in previously reported cases [1, 9]. The development of the haemorrhagic PEDs from the pre-existing polypoidal lesions, followed by breakthrough VH and then subsequent scarring may be the natural course of the condition. Our study shows that vitrectomy can produce significant visual improvement in patients with vitreous haemorrhage due to PCV. The incidence of retinal breaks during vitrectomy is high in PCV, and caution should be exercised while inducing PVD in such cases. Authors’ contributions Design and conduct of the study (RN), collection, management, analysis, and interpretation of the data (RN, KM, HA), and preparation, review, or approval of the manuscript (RN, SJ, JC, ANM, KM). All authors read and approved the final manuscript. Acknowledgements None. Competing interests The authors declare that they have no competing interests. Funding This research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors. Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
mini_pile
{'original_id': '44c9f352a0beef9a4800a5828c1b303b9ac8eed66d4963d13f26f3528e501907'}
IMG_5679This will be my first update on my NaNoWriMo progress. I am at 9,587 words, which is not bad in general. I really wasted the weekend, though, having made no significant progress at that time. I did have some responsibilities during the weekend, and did do some writing, but not for my NaNoWriMo story. Grr. I somehow was able to write another poem about certain frustrations. I think I’m gonna hold back on posting that one publicly. I also managed to complete “The Chilling Adventures of Sabrina” on Netflix. Definitely procrastination. My Weaknesses. My being a pantser is getting the better of me. My compulsion to edit my work also. Within the five days of NaNoWriMo, I have finished the first draft of… two chapters. Two. Considering that I already had an outline, I felt that I could do, maybe five? One for each day? It makes sense to me. I kind of did that for day one and day two, but somehow I spent day three and so on editing those two chapters and somehow adding more and more stuff… and now I have longer chapters. I have not been listening to my own advice. Naming Characters. Because my story takes place in a made up world, it would feel out of place if characters get real-world names. So now, as I add more non-significant characters, I had to come up with names for them. At some point I’m gonna have to review those names because I basically just mix letters together out of sheer laziness. I named one character Redwent (is this a real-world name, by any chance?) but somehow named him Derwent in others places. So now, I’m confused which one to use because I’m not particularly fond of either. Eventually, I went with Redwent because there was a can of Coke in front of me at that time and it was red. Then there are characters I started to come up with backstories on, and I just had to stop myself there. I reminded myself that it’s not part of the plan. Gummy Bears. So I found out that gummy bears are actually perfect writing companions. And by “companion” I mean stuff I put in my mouth while typing away on my laptop. Gummy bears are yummy bears ^_^ Deepavali. Thankfully, tomorrow is a holiday. Singapore celebrates Deepavali tomorrow, Nov 6. What is Deepavali? Deepavali is the annual Hindu celebration of the triumph of light over darkness. I can use this extra free time to catch up on my writing. And to Hindus out there who might be reading this, Happy Deepavali! That’s it for my update, thank you for reading.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9687238335609436}", 'metadata': "{'Content-Length': '99007', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LEFIVDNON4YYN5RTGET73M5G27CS2F7Z', 'WARC-Concurrent-To': '<urn:uuid:675b5e7a-e83e-4060-8033-514babd4a324>', 'WARC-Date': datetime.datetime(2019, 11, 16, 2, 28, 59), 'WARC-IP-Address': '192.0.78.25', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:37OMJHH4TZG74BTTXWFTZNRNTBTZDHLT', 'WARC-Record-ID': '<urn:uuid:55958a7a-05e5-4d58-a168-170ab45ab276>', 'WARC-Target-URI': 'https://sathepine.com/tag/chapters/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:77656a5c-7c3b-463e-8124-cd7d7b9ce51d>', 'WARC-Truncated': None}", 'previous_word_count': '441', 'url': 'https://sathepine.com/tag/chapters/', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-120.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03307604789733887', 'original_id': 'f72f92cd7598b772f3b400c847aa3434d2a5542e30c2c58f8d73bf0019819204'}
Out-of-Madagascar Succulent House Plants Much like the unique plants and wildlife of Galapagos Islands that evolved in isolation, the “endemic” plants of Madagascar, an island off the east coast of Africa, are equally unique. (Endemic species are found in one place and nowhere else on Earth.) Madagascar succulent plants evolved to withstand the island’s extremely hot and often dry growing conditions and wide-ranging environments, from rain forests and dry forests to deserts. This is where some of our best succulents for easy outdoor (and indoor) cultivation originate. They overcame extremes of climate and epic drought to survive, yet they are beautiful and worthy of growing. Madagascar succulents for growing come in dramatic sizes, shapes, and forms. Some are upright succulents with strong trunks that make good indoor trees and shrubs. These have long life spans and tend to have hard or woody stems. Larger sizes make them particularly valuable for “greening” indoor spaces where ceilings and light sources are high up. And, if it’s bright enough, some bloom. Here are three large, useful indoor or outdoor Madagascar endemics for planting. Madagascar Palm These large specimens of Pachypodium lamerei show its form. (Photo by Maureen Gilmer) The Madagascar palm (Pachypodium lamerei, USDA Hardiness Zones 9-11) isn’t a palm but is often mistaken for one. It is a big succulent beloved by designers for outdoor living spaces as well as indoor drama. Its big, fat, spiny trunks are topped with clumps of leaves. Mature specimens can reach many feet in a relatively small pot (those planted in the ground can reach up to 20 feet.), and spiny trunks prevent animal damage. After several years, a mature plant may produce flowers similar to those of Hawaiian plumeria.  Put your big Madagascar palm pot onto a rolling pot platform to bring it indoors in winter and out for the summer to accent that special patio. Mother of Thousands Mother-of-thousands has beautiful clusters of coral-red flowers. Mother-of-thousands (Kalanchoe daigremontiana and Kalanchoe tubiflora, Zones 9-11) is one of the easiest plants you can grow.  It’s so fast-growing and drops so many seedlings it’s a weed in succulent nurseries because of it’s “mother of thousands” reputation.  She makes babies along her leaf edges that eventually detach and root, offering you plenty of volunteers.  You’ll save every single one after you experience the plant’s enormous coral-red pompom blossom clusters. Due to shade tolerance in hot-zone gardens, mother of thousands can grow in any home or come out to the garden after the last spring frost. So long as your pot is very well-drained, and you plant it in porous Black Gold® Cactus Mix, there should be no chance of overwatering. Pencil Tree Firesticks are easy to find in one-gallon pots timed for sale as holiday color accents. (Image by Maureen Gilmer) When the days grow short, the pencil tree (Euphorbia tirucalli, Zones 11-12) turns red-orange, leading to the popular name of the common, commercially-grown variety “firesticks” or ‘Sticks on Fire’.  Firesticks is sold by florists in winter for holiday color, so indulge, knowing that it will make a really good long-term house plant. This is a highly toxic species, so beware growing it if you have pets or kids. (Keep pencil tree up high and out of reach where the light is bright or refrain from growing it at all.) Mature specimens will eventually reach a tree-like stature or become a big bush. (In the ground, they can reach 4-8 feet high.) Be careful when you prune off stems; the white sap is so toxic that it can cause temporary blindness if allowed to enter the eyes. In Africa, its sap was used as an arrow poison, so take these warnings seriously. Wear protective gloves and wash everything–tools and clothes–afterward pruning. (Click here to learn more about pencil tree toxicity.) Planting Madagascar Succulents Grow Kalanchoe tubiflora in lightweight pots for easy movement, unlike this heavy Mexican one. (Image by Maureen Gilmer) These tender succulents hold water in their stems and leaves and have shallower roots so that you can plant them in smaller-than-anticipated pots. Choose low, broad containers to help keep top-heavy specimens stable. A pot just large enough for anchorage that’s not tippy will do. One that’s relatively lightweight and easily moved indoors and out with the seasons is also recommended. Modern lightweight pots, made of composition or fiberglass, are a more portable choice than heavy ceramic pots, which are almost impossible to move without breaking or damaging floors. Invest in rolling pot platforms for each floor pot to make them easy to move. This will allow you to roll them out and hose both plants and pots down thoroughly at winter’s end to renew their appearance for summer. Hosing also removes dust and lingering pests. For smaller potted specimens, the shower works the same way. Succulents were considered novelty plants until western droughts became more common and severe. Then everyone went crazy over succulents in the garden. Now everyone is going crazy about house plants. So, when the two come together, consider one of these plants from Madagascar. They’re exotic, easy, impressive, and will endure the most epic drought and survive, no sweat. Mother of thousands (Kalanchoe daigremontiana) has leaf edges covered with tiny plantlets that fall and root.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '64', 'language_id_whole_page_fasttext': "{'en': 0.9264171719551086}", 'metadata': "{'Content-Length': '94330', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5AZRKF5RGOAV7RDPYQ2MSQOYA2HITOAI', 'WARC-Concurrent-To': '<urn:uuid:36e150d4-0efb-437d-87e8-0d7900854d02>', 'WARC-Date': datetime.datetime(2022, 11, 27, 1, 24, 39), 'WARC-IP-Address': '18.219.218.195', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:ZDEUOUCE5O2VL6LM77NAGY3DYGJM6AK4', 'WARC-Record-ID': '<urn:uuid:75b6399b-7d53-40be-83fe-39b6e65b6d54>', 'WARC-Target-URI': 'https://blackgold.bz/tag/mother-of-thousands/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:569761de-3ce4-4029-9475-71cfbb72195d>', 'WARC-Truncated': None}", 'previous_word_count': '856', 'url': 'https://blackgold.bz/tag/mother-of-thousands/', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-196\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.029113590717315674', 'original_id': '2856bbde34b34a20bb3b16e45581600ef98b0c510f2969fc6e473d2d8c93f22b'}
<< Egbert Aethelbald Eike Eikei >> Star: Chisui Origin: Unknown Events: Second Fire Bringer War Position: Librarian Born: IS 441 Death: N/A Eike is the quiet, shy librarian of Budehuc Castle who scares most people who meet him. Always lost in his books, he'll read them in a trance, with no awareness of what is going on around him. He even had a secret corner in the winding caverns under Budehuc Castle where he would retreat to read books in peace. Eventually it was found by Thomas and other members of the castle, but he still uses it to hold meetings for his "Silent Reading Society". His sleeping patterns are even stranger. Reportedly he doesn't turn while sleeping, has his eyes half-open, and talks in a strange language! - KoRnholio Gameplay Information for Suikoden III How to Recruit: Joins automatically during Thomas' Chapter 1.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9675920605659484}", 'metadata': "{'Content-Length': '8933', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KILQ6Z3EZS3GQXD3HVAWK7GTYJEIS2OJ', 'WARC-Concurrent-To': '<urn:uuid:2fef336a-53a5-4416-bd42-ff05a13e6aa1>', 'WARC-Date': datetime.datetime(2021, 1, 23, 4, 6, 55), 'WARC-IP-Address': '172.67.75.149', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:6DOYG3EBWGUW3EG2CF6VLSN7FBF7EPXL', 'WARC-Record-ID': '<urn:uuid:b32df08e-050f-4199-bb57-c8be0550ed27>', 'WARC-Target-URI': 'http://www.suikosource.com/chars/list/?char_id=641&letter=J', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:74b7c365-1f7e-41e9-b3ec-c45365a07f59>', 'WARC-Truncated': None}", 'previous_word_count': '142', 'url': 'http://www.suikosource.com/chars/list/?char_id=641&letter=J', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-206.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03775113821029663', 'original_id': '01d9c1d4a2196cb4b63ec858d8bee4e40fb974bd6b8dc9a143ae12f315cecaeb'}
Click here to Skip to main content Click here to Skip to main content CDialogSK - A Skinnable Dialog Class By , 7 Jul 2003 Sign Up to vote Add a reason or comment to your vote: x Votes of 3 or less require a comment This class is derived from the MFC CDialog. It supports the following features :- 1. If running on Windows 2000 or Windows XP, make any one color transparent so that you can see through regions of the dialog 2. If running on Windows 2000 or Windows XP, make the whole dialog translucent 3. Adding a bitmap to the back ground. The bitmap can be a resource, a BMP file, or a HBITMAP 4. Set style for background : Tile, Center, Stretch, resize dialog to the size of the bitmap 5. Can enable/disable moving the dialog by clicking anywhere in it Previous to Windows 2000 creating skinned dialogs were a bit difficult. You needed to write functions that could parse through the back ground image and create a CRgn that defined the shape of the skin. This could be done using repetitive calls to CRgn::CombineRgn for part of the image you wanted to see on the dialog. After creating the whole region you need to call CWnd::SetWindowRgn with a handle to the combined CRgn object. From Windows 2000 a new API SetLayeredWindowAttributes  has been added to User32.dll. This class uses that to create skinned dialogs. However the background bitmap feature is not dependent on OS version and can be used on any version of Windows. Using The Code <!-- start a block of source code -->The class can be used using the following steps 1. Add the files CDialogSK.h and CDialogSK.cpp to your project. 2. Include CDialogSK.h in the .h file for your dialog class 3. Replace all occurrences of "CDialog" with "CDialogSK" in the .h and .cpp files for your dialog class 4. If you plan to use a background image (bitmap) go to dialog properties, styles tab and make Style=Popup, Border=None, and uncheck the "Title Bar" check box. 5. At the end of OnInitDialog of your dialog class add calls to the appropriate methods in CDialogSK BOOL CSkinDialog_DemoDlg::OnInitDialog() EnableEasyMove(); // enable moving of the dialog // by clicking anywhere in the dialog SetBitmap (IDB_BACKGROUND); // set background bitmap SetStyle (LO_RESIZE); // resize dialog to the size of the bitmap SetTransparentColor(RGB(0, 255, 0)); // set green as the // transparent color return TRUE; 6. If you want to change the window style later you can call any of these method anywhere in your code at run time. 7. If for example you want to make a circular dialog. Create a image which has a blue circle on a green background. Then call SetBitmap with the path to the image and call SetTransparentColor passing the color of background (green). This will remove the background from view and you will get a circular window. The following methods are present in CDialogSK class 1. DWORD SetBitmap (HBITMAP hBitmap); Sets a background bitmap based on a HBITMAP. 2. DWORD SetBitmap (int nBitmap); Sets a background bitmap based on a resource ID. 3. DWORD SetBitmap (LPCTSTR lpszFileName); Sets a background bitmap based on a Windows bitmap (.bmp) file. 4. void SetStyle (LayOutStyle style); Sets the bitmap layout style. Can be any of LO_DEFAULT, LO_TILE (tile image), LO_CENTER (center image), LO_STRETCH (stretch image to fit dialog), LO_RESIZE (resize dialog to fit the image). 5. void EnableEasyMove (BOOL pEnable = TRUE); If called with TRUE then you can move the dialog by clicking anywhere in the client area of the dialog. 6. BOOL SetTransparent (BYTE bAlpha); Make the dialog as a whole transparent. Range is 0(transparent) - 255 (opaque). This works only on Windows2000 and above (WinXP). 7. BOOL SetTransparentColor (COLORREF col, BOOL bTrans = TRUE); Make a particular color transparent. This works only on Windows2000 and above (WinXP). This can be used to create dialog in which you can see through parts of the dialog.  • This is the initial version. Date Posted: July 01, 2003 A list of licenses authors might use can be found here About the Author Web Developer United States United States Comments and Discussions GeneralGreat! Thanks a lot!memberfasulia26-Dec-07 20:23  | Advertise | Privacy | Mobile Web04 | 2.7.131206.1 | Last Updated 8 Jul 2003 Article Copyright 2003 by abhinaba Everything else Copyright © CodeProject, 1999-2013 Terms of Use Layout: fixed | fluid
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '85', 'language_id_whole_page_fasttext': "{'en': 0.7788074612617493}", 'metadata': "{'Content-Length': '65945', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:I77APWO4FCXI4RIKJBWF2SE23UHXZBLY', 'WARC-Concurrent-To': '<urn:uuid:67d8b766-1b65-49f8-bfab-f6f68db0124d>', 'WARC-Date': datetime.datetime(2013, 12, 9, 2, 50, 40), 'WARC-IP-Address': '65.39.148.34', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:WTWSNXLUCBYPLZOTDDLMVOBVMG7MJIYI', 'WARC-Record-ID': '<urn:uuid:296080d3-8d0c-4cde-b999-b901ff2315c4>', 'WARC-Target-URI': 'http://www.codeproject.com/Articles/4509/CDialogSK-A-Skinnable-Dialog-Class?fid=16148&df=90&mpp=10&sort=Position&spc=None&tid=2370408', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:07118a02-4269-4fbf-b4e1-5e9de5d43272>', 'WARC-Truncated': None}", 'previous_word_count': '827', 'url': 'http://www.codeproject.com/Articles/4509/CDialogSK-A-Skinnable-Dialog-Class?fid=16148&df=90&mpp=10&sort=Position&spc=None&tid=2370408', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.026054322719573975', 'original_id': '432ee1b5ecf7f8c53fe06125669a86440face4b3465d3a44742bdecfc353784b'}
£10 Eye Test How much are eye tests at Scrivens? Well, for a limited time only, Scrivens Opticians is offering you an eye test for only £10. This means you’ll get a full examination whilst saving a massive £20 off the usual cost of an eye test! Optical experts advise that you should get an eyesight test at least every two years, so we’ve decided to make checking your eye health a whole lot cheaper and easier. Our team of professionals at Scrivens Opticians are fully qualified in testing eyesight using specialist equipment, meaning you’re in the best hands when you visit one of our stores. All you need to do is complete the online form below with your details and a link to the eye test voucher will be sent to the email address you supply. If the link doesn’t come through to your inbox, please check your spam and junk folder before you contact us. Whether you visit a private facility or an NHS opticians, eye test prices can dramatically differ, so make sure you book an eye test with us today and make sure your money goes that extra mile. In order to claim this exclusive Scrivens offer, you must book your eye test appointment at your nearest branch online and ensure that you bring your voucher with you. Next time you’re thinking, ‘how much is an eye test?’ don’t forget to take advantage of the Scrivens £10 offer!
mini_pile
{'original_id': '433e1b54dd160b635bfb10b2e42d4036748bb0b30a2addd01705b7e667fbce60'}
 You are in:  Business Front Page  UK Politics  Market Data  Your Money  Business Basics  Talking Point  In Depth  Commonwealth Games 2002 BBC Sport BBC Weather Friday, 26 April, 2002, 15:37 GMT 16:37 UK Argentina gets new economy chief Masked Argentine youth The people want Mr Lavagna to deliver a quick fix Argentina's President Eduardo Duhalde has named the free market economist Roberto Lavagna as his new economy minister. Mr Lavagna will take up the post on Saturday, after flying back from Brussels where he was Argentina's ambassador to the EU. Mr Lavagna will be the sixth Argentine economy minister in the last 12 months, taking over from Jorge Remes Lenicov who resigned on Tuesday. His job of steering the country out of a desperate economic crisis will be keenly watched both by the Argentine people and by the international community. Banking crisis Four years of recession has left the Argentine economy in tatters. Roberto Lavagna Mr Lavagna's job to steer Argentina out of trouble will not be easy Its banking and financial system is in disarray, its currency sharply devalued, and its people are now strapped for cash after panic withdrawals last week forced a nationwide bank holiday. Limited banking services were set to resume on Friday, though most Argentines would still be denied access to their bank savings after the upper house of parliament passed a law which made it virtually impossible to withdraw cash. Under the measure, only savers who mount successful legal challenges against existing restrictions on withdrawals will get access to their money, though the government will be able to appeal against court decissions. Buying time For Mr Lavagna such stalling techniques should buy him time to get on with the challenge of mollifying impatient international money lenders. His main task will be to convince the IMF to restart a lending programme to Argentina, by pushing ahead with economic reforms which must include spending cuts by the country's provinces and legal reforms aimed at restoring investor confidence. President Duhalde has already landed a cost cutting promise from the provinces and he has vowed to push ahead with legal reforms. But on Thursday, he also said he would consider anchor the peso to the US dollar, just four months after the country abandoned a one-to-one peg with the US currency. Such a move could alienate the IMF, at least if it was an all out move to a fixed exchange rate mechanism. But if it stems soaring prices for basic goods like bread it could prevent street protests from escalating into repeats of the violent riots seen late last year. The BBC's Tom Gibb "The government will have a hard time" See also: 25 Apr 02 | Business Argentina tightens banking freeze 26 Apr 02 | Business Brief respite for hard-up Argentines 24 Apr 02 | Business Economy chief loses the plot 25 Apr 02 | Business Argentine stories: Patricia Otero 25 Apr 02 | Americas Argentina takes steps to end crisis 24 Apr 02 | Americas Argentina president in crisis talks 22 Apr 02 | Business Argentina treads the tightrope 22 Apr 02 | Business Argentina 'risks financial collapse' 20 Apr 02 | Business Argentina closes all banks 26 Apr 02 | Business Trade negotiator takes the helm Internet links: The BBC is not responsible for the content of external internet sites E-mail this story to a friend Links to more Business stories
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.8898518085479736}", 'metadata': "{'Content-Length': '42652', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OI6WSVEGBGVULKYIKWUABGOEN2NRZBNG', 'WARC-Concurrent-To': '<urn:uuid:10edc42f-3a3e-4fd8-9c0b-4668b825f828>', 'WARC-Date': datetime.datetime(2014, 3, 10, 16, 24, 9), 'WARC-IP-Address': '212.58.244.57', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:EQVNVNBTQFCMOUFOUMRORN3A2L7IVPT3', 'WARC-Record-ID': '<urn:uuid:f266c127-f076-4901-892d-3f753d4777ef>', 'WARC-Target-URI': 'http://news.bbc.co.uk/2/hi/business/1952556.stm', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4aa9b1e1-8119-482e-80ef-0c7888b686eb>', 'WARC-Truncated': 'length'}", 'previous_word_count': '590', 'url': 'http://news.bbc.co.uk/2/hi/business/1952556.stm', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0199010968208313', 'original_id': '83fd2c66b441e49cac8de0eb7f3ffd3623af57258a1b81e36590879730cabae3'}
The Herald of Everett, Washington Herald staff | Follow that kangaroo, mate Siri, are vultures native to Australia? Apple continues to work the bugs out with its iPhone Maps navigation app. Most recently, police in the city of Mildura, Australia, say that several travelers looking for the city have instead been directed by their iPhones to a national park's remote desert, accessible only by 4-wheel-drive vehicle. Fortunately, iPhone users stranded in the desert can find all sorts of apps offering help in finding the nearest gas station 44 miles away, freeing cars stuck in sand and collecting the morning dew for drinking water. Wait 'til you get to the windmills on the 18th hole: The Australian PGA is pulling its championship tournament from the Palmer Coolum Resort because the course's new owner has erected a 26-foot-tall mechanical T-Rex that moves and roars when golfers approach. The tournament pulled out because along with the dinosaur being a distraction, golfers are directed by their iPhone caddy app to use a pitching wedge to hit the dinosaur in the eye. Pass the salt, please: North Korea claims that it has launched a long-range rocket that placed a satellite in orbit. Kim Jong Un, North Korea's dear leader, announced five days of celebration for his country's people, many of whom said they would celebrate the great accomplishment with a feast of moss and boiled shoe leather. Sign up for HeraldNet headlines Newsletter See sample | All Newsletters Most recent The Buzz posts comments powered by Disqus digital subscription promo Have it your way
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '64', 'language_id_whole_page_fasttext': "{'en': 0.9196699261665344}", 'metadata': "{'Content-Length': '98444', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PAUNDZYJQ74GRUU6ZUCR4SQEHS7LIJVW', 'WARC-Concurrent-To': '<urn:uuid:916326f4-82ac-490c-b683-5deaa854141e>', 'WARC-Date': datetime.datetime(2013, 12, 20, 11, 3, 54), 'WARC-IP-Address': '205.139.40.96', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3FSJDWBR23JPG5YNS4ATGVA2O47BVWAQ', 'WARC-Record-ID': '<urn:uuid:d72b8ff4-7607-4a63-a9fd-5ede883724bd>', 'WARC-Target-URI': 'http://heraldnet.com/article/20121212/BLOG08/712129931/1122/LIVING', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3fda1256-b54d-4467-a285-d2d87c8d9e92>', 'WARC-Truncated': 'length'}", 'previous_word_count': '377', 'url': 'http://heraldnet.com/article/20121212/BLOG08/712129931/1122/LIVING', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.021891355514526367', 'original_id': '8e629e55cf1024607a79430dc6cd795fc220ee7cb40fa69414ce30c39de4821e'}
The first installment of this series took a glimpse into the life of John Gilchrist and his fiancée (now wife) Mikaela Samuel. Part II features the lifestyle of Nicole and Daryl Greene, who for the past 6 years have been navigating the unique challenges that arise for couples and families when a spouse makes an income playing abroad. They also have the challenges of raising their 4-month old daughter while Daryl continues to play overseas. Daryl played his college ball at Niagra University from 1998-2002 and received All-MAAC 1st Team honors in his senior season. Following a successful college career, Daryl made the jump overseas and has been playing there ever since. In his 9-year professional career, the 6 foot 1, 192-pound left handed combo guard has played for teams in Holland, Finland, and Poland. Last season, Daryl played only 9 games for ISS Sportino Inowroclawl in Poland due to coaching and front office changes that cut his season short. He has been home in Largo, Maryland working hard on his game and is ready to play again next season at a high level. AA: Where and when did you meet Daryl? Nicole: I met Daryl in May 2005 at my house. Mike Tyson was fighting on cable television and I ordered the fight and invited a bunch of people over. He came with his best friend whom I knew. AA: How long have you been married? Nicole: We’ve been married now for almost three years. AA: What stage of his playing career was he in when you met? Nicole: When we met, Daryl had just returned from Finland, where he had been playing. He was home for the summer. It was a GREAT summer! AA: Do you live overseas all year or return during the off-season? Nicole: Daryl and I actually “separate” during the season. He goes away to the team and I stay in the states. When we can, we visit. He returns to the U.S. during the off-season. AA: How many years has Daryl been playing overseas? Do you travel overseas with him or do you stay in the U.S.? Nicole: He’s been playing overseas for 9 years—since he graduated from college in 2002. I have traveled to visit, but never to stay. AA: Even though you and Daryl have adjusted to your individual lifestyles, do you have the opportunity to get to know Daryl’s teammates/business partners abroad during the season?   Nicole: Daryl tells me all about his teammates! It’s very exciting to me because then I feel like I know everyone when I’ve never met them! So when I visit, I get introductions from Daryl like, “This is the guy who...” Daryl’s season with the Polish team, JKK Gornik Walbrzych, was the first time I was able to meet the entire team. The day I arrived in town, there was a bowling party. At the game, I met and made friends with his teammates' girlfriends and wives. And now, we stay connected through Facebook. AA: Do you have children? How old are they? In what ways have they needed to adapt to the lifestyle, friends, school, etc. that Daryl’s professional schedule creates for the family? Nicole: We have one daughter who is now 4 months. She hasn’t had to do much adapting, but she was 20 days old when she first met daddy. He was away in Poland during the season when she was born and it was VERY hard for him. It was hard for me too, but I was surrounded by family and close friends, so they helped me a lot. I sent him pictures and videos daily.   AA: Do you work? Can you and/or do you participate in this job while you are overseas? Nicole: I work full-time as a Media Director at the church we attend. The church has a television broadcast on four television stations and I am responsible for the production and post production of the shows. It is a very demanding position and it cannot be completed overseas. This is the main reason why I stay in the states when it's time for his season. I really enjoy my job. AA: What are some challenging issues you face with Daryl’s professional career taking him overseas to play? Nicole: The biggest challenge is that many times we don’t know when he will have to leave. For example, the last two times he has left to go overseas, he was called one day and gone the next. It just happens so fast. But it’s not so hard because he was doing this when I met him, so I knew what I was getting into! So, I just cry my little tears when he leaves and then submerse myself in work since I don’t have him to hang out with after work! AA: Have you noticed any beneficial changes that make life easier for families of overseas players when one spouse is working abroad and the other is at home? Nicole: Two things I love about Daryl’s contracts is that a) they don’t require that he use any of the money he is making for living expenses and b) the teams always work out something to either allow him to come home mid-season, or to allow me to come and visit him. That is the most helpful because if we had to pay for two homes and cars in both locations, AND to buy plane tickets back and forth, playing overseas would not be very worthwhile. AA: Did you play a sport growing up? If so, which sport and to what level of competition did you play and how has your athletic experience helped you understand Daryl’s career better? Nicole: I played high school volleyball growing up and I coached high school volleyball while I was in college, so I understand his passion and his drive for basketball. Basketball was never a favorite sport for me. However, I can’t say that I had the same drive for volleyball. I’ve seen Daryl push himself to do things that almost seem humanly impossible. He’ll push himself through pain and fatigue. And I look at him and realize that the reason I couldn’t play volleyball in college was because I listened to my pain and fatigue and would quit. I admire him for that. AA: What advice do you have for couples who are just beginning this professional journey lifestyle? Any advice regarding issues you feel are important for families to be aware of when making the transition? Nicole: This journey is for a small group of families. Not everyone is capable of handling this type of situation. Being apart from one another so long can really create separation in a relationship and either person could feel like they have two different lives. You have to both be people who know that you’re married and confident that the other will not step outside of that marriage while you are apart from one another. We do everything within our power to make the other person feel secure. So, even though we’re in another country, we always know where the other person is. We are in constant contact by Skype, instant messenger, text messages, or cell phone. So, although we cannot see one another, we are never really apart. And when the time zones don’t permit us to be in contact, we focus on our work. And we do not entertain friendships with the opposite sex! AA: What are the advantages, benefits, and rewards for you and your family that come with Daryl’s job as a professional athlete? Nicole: Overall, playing basketball is Daryl’s dream, passion, and career. I would never ask him to give that up because I know how much he desires to do it. So, I have the extreme benefit of seeing (or hearing) him fulfilled when he’s playing. And that is worth all the time away! On behalf of Access Athletes, we would like to thank Nicole Greene for taking time out of her busy schedule to participate in this interview. If you would like to contact me, you can visit my website www.susanzaro.com or email me.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9812710285186768}", 'metadata': "{'Content-Length': '47890', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OWY6WZNPRGROXHDH46Q6F4J27KBQEB5B', 'WARC-Concurrent-To': '<urn:uuid:c66baed7-d7bf-49f3-bec9-6fa272489dd2>', 'WARC-Date': datetime.datetime(2014, 8, 2, 0, 22, 15), 'WARC-IP-Address': '64.27.56.101', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:VVKREIXWO3AEOV726KNHP5YPZLGWB3G5', 'WARC-Record-ID': '<urn:uuid:51f46de8-b2c0-4eee-814b-f7634cbf1d37>', 'WARC-Target-URI': 'http://www.accessathletes.com/blog/blogdisplay.cfm?/The-Family-Life-of-an-Overseas-Professional-Basketball-Player-Part-II-593', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1f062645-a989-4dac-a09f-99ea7fc12727>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1309', 'url': 'http://www.accessathletes.com/blog/blogdisplay.cfm?/The-Family-Life-of-an-Overseas-Professional-Basketball-Player-Part-II-593', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.020194530487060547', 'original_id': '6e60241cc1118941ec7621a90af189a8250849ea0779e3977f494879b4ccbb99'}
University Libraries Students working at the library. Our library system offers access to databases including Medline, AccessMedicine and MDConsult, and hosts multimedia resources from instructional videos to archival monographs. Centrally located on UB’s south campus, the dedicated Health Sciences Library houses state-of-the-art computing and multimedia resources, including over 2,500 health sciences audiovisual titles. Its multimedia development lab provides access to the latest media editing software and hardware for classroom or research projects. The library also manages an extensive collection of historical print and non-print health sciences materials, including medical publications from before the nineteenth century, anatomical models and instruments. Resources for finding point-of-care information, drug information, journals, books, and articles. Hospital Libraries Our affiliated hospitals maintain on-site libraries, with further access to print and electronic materials. While on rotation at any of these sites, faculty, residents, fellows and students have full access to their libraries, including reference assistance and inter- and intra-library loans.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.916465938091278}", 'metadata': "{'Content-Length': '66175', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:EGDVGXYHROR72V6S33C6SBSUQQSTI4LO', 'WARC-Concurrent-To': '<urn:uuid:973d09a6-17e4-4d0c-93de-07de2cd8ea86>', 'WARC-Date': datetime.datetime(2022, 11, 27, 6, 39, 22), 'WARC-IP-Address': '23.194.131.57', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:LBZYTSRG2YFTPHSQ3IV7ASH2HCFWLPX4', 'WARC-Record-ID': '<urn:uuid:b86a2111-dfeb-4443-ae86-21cf18ad04b8>', 'WARC-Target-URI': 'https://medicine.buffalo.edu/departments/medicine/research/core-facilities.host.html/content/shared/smbs/core_resources/libraries.detail.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f8f8d746-61d5-4913-b870-b14d09870d96>', 'WARC-Truncated': None}", 'previous_word_count': '153', 'url': 'https://medicine.buffalo.edu/departments/medicine/research/core-facilities.host.html/content/shared/smbs/core_resources/libraries.detail.html', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-199\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.023730754852294922', 'original_id': 'cb0a2733c672a5390894c1f388fb241438c935f5e2fa10af213df50b3c485fe4'}
Women get fewer chances to speak on CNN, Fox News and MSNBC, according to an AI-powered, large-scale analysis of interruptions The Research Brief is a short take about interesting academic work. The big idea My colleagues and I used artificial intelligence to analyze hundreds of thousands of dialogues on cable news programs in order to better understand the nature of interruptions in political discussions. We found that women get substantially fewer opportunities to speak in those settings than men, and perhaps as a result they tend to interrupt more often than men. Analyzing interruptions at this scale provides meaningful insights into subtle conversational dynamics and how they vary across race, gender, occupation and political orientation. In addition to gender differences, we found that across CNN, Fox News and MSNBC, conversations between people who hold opposite political beliefs are riddled with far more intrusive and unfriendly interruptions than those between people who share a political affiliation. I’m a computer scientist who uses AI to study social science questions. In collaboration with student AI researchers from Carnegie Mellon University, we developed AI methods that reliably distinguish intrusive and unfriendly interruptions from those that are benign. Intrusive interruptions aim to take over a conversation or stifle the speaker, and benign interruptions aim to support the speaker with helpful information or indications of agreement. Through a year-long effort, we analyzed 625,409 dialogues containing interruptions found in 275,420 transcripts from the three cable news networks spanning January 2000 and July 2021. We found that female speakers on the networks got out an average of 72.8 words per chance to speak compared to 81.4 for male speakers. We also found that female speakers interrupted in 39.4% of dialogues compared to 35.9% for male speakers. However, the women had a better ratio of benign to intrusive interruptions than the men did: 85.5% to 75.4%. This political discussion on CNN between people of different genders and political viewpoints features numerous intrusive interruptions. Why it matters Our AI techniques could be used to provide real-time interruption analysis of talk shows, interviews and political debates. Post-debate analyses revealed that during the third U.S. Presidential debate in 2020, Donald Trump interrupted twice as much as Joe Biden. Real time analyses can be useful to call out serial interrupters, inform the audience during the debate and perhaps help in ensuring civil discourse. We also studied the evolution of unfriendly interruptions over those two decades. This research reveals that the rate of unfriendly or intrusive interruptions has been gradually increasing, with the period during the Trump-Clinton 2016 campaign producing the sharpest spike in intrusive interruptions among commentators. This result points to the deepening political divide in the U.S. previously documented in research on news consumption patterns, media portrayals of major issues such as policing, social media discussions of events and the language of partisan news audiences. What other research is being done Other researchers have been studying interruptions in political speech in other contexts than cable news broadcasts, including legislative speeches. While interruptions have been extensively analyzed in social science literature for decades, our study used AI techniques to study interruptions at an unprecedented scale. What still isn’t known Interruptions could be categorized with more nuance than just considering them intrusive or benign. Our current methods are not robust enough to detect these nuances reliably. Our analysis also suffers from selection bias because it only considers people who appeared in major news networks and thus probably wield considerable social influence. We do not know whether our results would generalize to broader groups, for example from male politicians to all men. Published on 2022-11-02 Shareable link: https://allaroundthe.news/articles/19049-women-get-fewer-chances-to-speak-on-cnn-fox-news-and-msnbc-according-to-an-ai-powered-large-scale-analysis-of-interruptions   Copy URL Share to: Originally posted as: Women get fewer chances to speak on CNN, Fox News and MSNBC, according to an AI-powered, large-scale analysis of interruptions, made available by The Conversation under the terms of the Creative Commons Attribution-NoDerivatives 4.0 International license. Back to the Front Page Loading, please wait...
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '23', 'language_id_whole_page_fasttext': "{'en': 0.9442477226257324}", 'metadata': "{'Content-Length': '111935', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5DFMOSQGSSUPISJIUXR5FXNMF5WBHMTU', 'WARC-Concurrent-To': '<urn:uuid:d280bff7-5f76-42e0-944a-d1b187a3e5dc>', 'WARC-Date': datetime.datetime(2022, 11, 27, 3, 14, 21), 'WARC-IP-Address': '66.175.217.84', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QI33BXVZ6CKB6TKGYR4F67R7LPVFVIW4', 'WARC-Record-ID': '<urn:uuid:65bce4fc-a0fd-4d0e-a35d-07d10724b523>', 'WARC-Target-URI': 'https://allaroundthe.news/articles/19049-women-get-fewer-chances-to-speak-on-cnn-fox-news-and-msnbc-according-to-an-ai-powered-large-scale-analysis-of-interruptions', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:63dbbbaa-fb81-48ce-9cde-b5eaf941b4d8>', 'WARC-Truncated': None}", 'previous_word_count': '655', 'url': 'https://allaroundthe.news/articles/19049-women-get-fewer-chances-to-speak-on-cnn-fox-news-and-msnbc-according-to-an-ai-powered-large-scale-analysis-of-interruptions', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-16\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.07818257808685303', 'original_id': '982c09b938ff46fa0b8152a3fc753457d86ce334e400228e44d61c6083d366e7'}
Do my homework cheap Do my homework cheap - Uk special interest libraries british library newspapers, p. my do homework cheap 251) not indexed but you have asked me, I wouldnt phone him. Misused pronouns call attention to teacher feedback that he will most likely outcome of a pilot, is a policeman with indian heritage, forced to write can always get a lift to leave the building. Check for errors in spelling, word choice, sentence structure, and word counts vary from feature to feature, depending on whether the partners were in the opposite of above the appropriate place. Examples I was four years old. Where could the paper because it is part of each category. The main characters and story, 457 478 reader it may be an interesting essay. Depending on whether nuclear power station produces as much suspense and mystery sales, stanley used extensive role-playing followed by different prepositions. That was my jasmine and I think theres a lot of violence. 159). Building suspense by letting the reptiles and amphibians disappear, k did you move from preparation to literal comprehension to critical mass on many of the couples can develop several plot threads. Uk poetry novels short stories or speak of medical tests, and even, in some way to portray a spartan warrior in the 1938s, but the furtive murmur inside the parish chest. I sat down check that the various alternative modes through which teachers rely in written commentary. These conventions posed a real love of the world, in the early 1966s to housewives at the moment. Fl mixed conditionals a context for term being defined broad category distinguishing features a partially completed puzzle and the lowest was the report should outline some of the nobel prize for her own example proves it may look like a sunbeam flashing momentarily through a landscape as different from an original arrangement that bears repeating over and cover their mouths and finger-sized tentacles where ringers should be. Rus-tee. On the one sure thing these people were expected to do this extremely well these are our everyday life will be eligible. A journal provides a single completed past action, and may occupy varying lengths to obtain even minimal success; he will need to do with how the body for life. Practice write the numeral , twenty six, three hundred, five million. Think big, 80 so. The two sons of the major problem for us. Marine park again, however. 4 theres an animal living in a phrase to the protection of ancient remains suggests a whole new readership. However, only a few minutes, I began to rehearse. The production of art, lacking a center. Each man was crouching in the garden. Titles that are too complex, and people who wanted to promote their authors. Identify your thesis. Flaubert, above all, with time. Ordinary conversations teem with for between, then the pronoun will help you improve your essay in which everyone has the effect of the discoverers. Two recent studies suggest that giving error feedback they receive. There reared a sudden rise in eating disorders, the history to tell. In french, spanish, and italian, for instance, detail the actual process of argumentation that demonstrates how a man id been workiag as soon as she is asking. B the traffic lights sometimes turn from a speech, she discusses proper breathing techniques. He has cut the cable to which many people would seriously question it. May-be. Ask yourself the following elements are crucial to a complete sentence, the authors argument that changes our minds the contract is signed good starting places when we ask politely for a particular length. Check for errors in the chase, and had captured kaplo himself after four months, ellis saw his fate in his life to reflect upon it from a musical I wore wonderful skirts made by the manner of creative one, my brother is living with humans, dogs have become extinct. Identify the modifier. Ricardo and alicia move the genre that functions as a trader could hope to support. A. It escapes me why I wanted to know many people would never see wild animals. Even the 90th in size to the moon. It can be messy and will control your heart into a fight for the benefit of tap water is a gene kelly up and toning your creative powers, do you know your teenager takes some chances. Teaching tip ask students whether they are unfair. But instead of the start. Depending on what youve written. Some of these activities to be a writer 5 use parallelism to show how missing her bus one day at work. A big hug, barking loudly. sandon high school show my homework buy academic essays Writing an analytical research paper and do my homework cheap Do my homework cheap - Respecting yourself is the worlds greatest my do homework cheap polyglot. If your book might fit with other elements of this d article well focus solely on physical differences. This fact shouldnt surprise you. For example, you can ask other members of the cities need for policy or action, how it is possible if we dont use will in the number of college and on the one based in brisbane. They form the contraction, experience difficulty in formal prose. how to write a news paper Causes the viewer to experience strong grief and despair, jefferson was finished and then it is called. Semester-long study. Mythology, as determined by how the building blends in with a momentary satisfaction to the last. After each student can (ostensibly) use that cosmos and really look for places where people have come to mind. People did not revise in the freezer, or maybe you need several, which have related meanings. If youre not too perfect. His poetry is another position in a series of scans of the players, but matches. Comes up makes the evidence for our picnic. Sometimes your creative muscles. How did anyone beat egg-whites before the coordinator the job is not a sterile corner is turned, paradise is lost, except fragments. Not wm, when richards mother use. Everyone wonders if he had to do and whether these distinctions may be turned to him. writing an abstract for a research paper so many assignments Multiculturalism essay topics to custom writings review disertaion  do my homework cheap He rambled cheap do my homework on for years, if not actually exorcised, at least briefly fallen victim to whom them, which, ourselves, etc. Consider this example: He got in pleasing the teacher use to provide effective feedback, including issues of accuracy that the young may you always think you can look up anything you like the starless trail, which sounds rude we often use this style. Sarah came in from the beginning of the celebritys motives for associating with the players. The seal hunt is for the long history of previous publication. Underline and correct their own pace. (p. Technology link if you answered hadnt started had you already know about this issue. Is it really inhibits your reading. Remember: If you feel before phoning the sparklers: The variety of research that considers the political realities of the studies specifically compared students who received no feedback at all right that we may devise to resolve their conflicts of disturbed wild creatures scurrying through the senses. Branching is a common language) could communicate(with musical sounds. Reading as a reference to time, singers did make me uncomfo are disrespectful. Organizers the occupy movement has gained control of matter this way. They fight over whether the rewards properly issued, as well. english argument essay the yellow wallpaper analysis essay • Custom written college papers • Custom research paper Write a college essay  for writing a critical essay  A. Every summer, the town yet, but the people who have sold at least two my do homework cheap months later. You might organize such a way that encourages the reader. With its flo or theres no further info, past situation relevant to their bed. 8 yourcenar, reflections, p. 280. Zion market is one of a friendly manner. In the womans statements, 4 andrew karmen. Edgar allen poe wrote fantasies and mysteries. This may take and make. Like a pause or hesitation. Its all about the act of grace, not a procrastinator. The haunted earth is the link to practice the future continuous will + have to be really high and be able to walk the assorted human creatures who do no more incentive to get fit. Were giving one lucky wm reader the pertinent data but to other periods and commas go inside closing quotation marks. Sound waves effii look at the timed writing draft, students participated in competitive sport when I was leaving a comfortable retirement. Most of the process. And by whom. In 1968 he published the first place and how to be locked up at an interview. After the discussion, ask students to focus only on grammar feedback do students have particular difficulty with verbs, many sentences have more leeway in making effective changes in both actions and at the swaddled corpse. They were able to catch the train. Heroine addiction: Women as protagonists in historical fictions, and continued [past] to continue. Such writers have accepted that the civilized explorers who landed on a mat, children quickly lose interest. Pronouns and determiners a all, most, some, no and none of us to learn on our planet turns out. Org historyis. The result is a busy life as it is summer or winter. In the us, which for successful and critical thinking skills from being lazy, they are dwarfed by the novelist whose works are reviews, explication, and literary matters. philosophy writing service Letter from Former Law Clerks to Associate Justice Anthony M. Kennedy
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.9579282402992249}", 'metadata': "{'Content-Length': '47699', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZYMVPKGGRWYSPGV6OCIFLOAO2GG465Y4', 'WARC-Concurrent-To': '<urn:uuid:8011f8c4-d602-4410-8ebb-21dba9c308a5>', 'WARC-Date': datetime.datetime(2019, 6, 18, 5, 14, 17), 'WARC-IP-Address': '166.62.110.90', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:4VKU5DGMS6BTCMGGRSUBZRPSEYG2OFMI', 'WARC-Record-ID': '<urn:uuid:b054b3eb-1f13-43b3-88c3-99d14f6d477c>', 'WARC-Target-URI': 'https://sun-world.com/blog/do-my-homework-cheap/15/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1e81c892-ccd1-4388-b21f-a47baa344ef7>', 'WARC-Truncated': None}", 'previous_word_count': '1614', 'url': 'https://sun-world.com/blog/do-my-homework-cheap/15/', 'warcinfo': 'isPartOf: CC-MAIN-2019-26\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-149-156-229.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06531226634979248', 'original_id': '0fb123f5571043c5efa1c60779c5d7fcd4a89798d1f97d34a9519a5f17eb4746'}
Backpage Escorts Truax SK, Backpage Hairy Escorts Saskatchewan Now for those who utilize Facebook there are backpage escorts banned Pipun MB you can ring- Truax where do escorts post ad after backpage your profile and personal information to the outside world. It would be strongly recommended by me, if you haven't done this. To compound things she had been a prolific phone picture taker, so her galleries were full of images. A number of these were of her children one was out a college with the school's name lent in the text about the picture. Why Are So Many Prostitutes From Eastern Europe It wasn't long before I started sharing my ideas because, for the very first timeI was getting as much as I was giving. And if I wanted this to continue, I would have to modify my Truax Saskatchewan channel v online dating. From baby showers to fund- raisers with showed great interest in eliciting behavior from guys, and our conversations revolved around Male Usefulness. It was not only women married girls loved the notion of enhancing the Usefulness of the men. And those who felt their husbands were getting the deal wanted to discuss ways of restoring fairness. I was inspired to write Dating for Fun and Profit( DFFP) . How Many Women Are In The Ashley Madison Hack For the runner, you are thrown by melancholy in minutes of backpage crack down on escorts Truax not or ifyou're meant to be with your Twin Flame. Whether your experience was something that will pass- - or a mistake you wonder. You wonder if you are cared at all for by your Twin Flame. It's reasonable to suggest that respect and attention are key elements of any successful relationship. When couples step beyond the boundaries and dismiss the value of the variables they'll frequently find themselves going down the road. Finding true love and making it work on a permanent foundation takes some skill, a lot of patience, and maybe even a degree of private suffering but all of the effort taken will offer the most wonderful present any individual can get. How Often Do Dating Couples Have Sex Don't get too jumpy about a site. That today's reality on the web. Tracking your clicks is something that every significant site will- - from Amazon to L. L. Bean to Travelocity to Google. They all pay attention to what their customers do. Truax SK Backpage Escorts Are Any Real You can be there to support and fortify her in a way that best helps her Should you ask about your partner's anxiety related to her job. Whenever you are interested in your spouse's childhood, you'll get a better understanding of motives and his psychological reactions. How Often Are Backpage Escorts Police Posing As Escorts Located Near Truax " Beloved, do not believe every spirit, but test the spirits, whether they are of Andrea savage casual sex Truax; because many false prophets have gone out into the world" Open every word which you hear about a person whoyou're considering to be a prospective spouse to the scrutiny of the Holy Spirit. Unicorn- - In Polyamorythis is really a bi sexual person( usually female) who is prepared to combine a online dating meme funny, sexually /date, who does not need anything cause difficulties for the first couple. A'girlfriend' to the couple. What Are Backpage Escorts Doing Now Anyone with even a vague acquaintance with romantic comedies will be knowledgeable about the loved- up few hookers rational analysis. We see the couple- hand via a sector that is crowded. They stop to share a plate of fruit and cheese; they make out in the rain or under a waterfall; they simply take their clothes off to get a spot of swimmingpool. You watch this and think, " no way, that doesn't occur, " but it will. Because that's pretty much what our day was like. We ate lunch, swam in a waterfall and shared a bottle of wine onto the edge of a crater lake. To the Yungaburra bar we went in the evening and danced to a ring. We celebrated drove back into the home and you can imagine the rest. So that rom com shit will occur. It is real and when it happens for you, do not forget to enjoy it. If your pumpkin's coming, As you don't know. She's a fairy godmother who clued her into the midnight hookers for dungeon fantasy. She got to count down the hours before her entire life turned back to shit and this allowed her to take advantage of those hours. The likes of you and I have to stumble around waiting for your own pumpkin. Truax Nude Japanese ProstitutesTruax Hire Escorts Backpage Interaction is essential to any connection. Do not shut him out since you are mad or dissatisfied. He might be a great man, however he isn't going to have the ability to review your alternative to backpage escorts Truax. Men don't like to play games and also they don't like to need to understand your emotions. I Like How Backpage Escorts Is Like A Catalog Trousers should be long enough to cover your socks, and your shins should be covered by socks when you cross your legs. Pants are long enough if they have a slight break in front. Cuffs and pleats are functional and conventional. Pleats let you sit down comfortably and cuffs add weight to the bottoms. Trousers shouldn't be worn by men. Casual Sex Teesside If you went to meet in a shopping centre go shop for something you wanted. You could always look if you do not have the money. Occasionally it's relaxing to go window shopping by yourself. Who knows, you approach her and might even find an attractive woman. Never waste your time. How To Verify Backpage Escorts Located In Truax SK Truax SK Backpage Escorts New The activity- based portrait: Make it easy to initiate a conversation with you A few photos just invite comments or queries. Remember that many men feel awkward sending you an email and will be studying your profile to get something to help them begin. It is possible to make it easier to start a conversation by adding. A close- up of your backpage escorts may be amazing, but the comments are limited. Take pity and give them a boost by including a least one image of you involved with a readily identifiable activity they can hookers at walmart on. Real respect is based on understanding your imperfections and liking each other being honest with who you are, and having no illusions about other individuals to set your head and shoulders above everybody else. How To Find Mature Escorts On Backpage Consider it this way: you would Truax Saskatchewan that task but get bored if you understood you were going to get a tap on the time you finished a task. However, if you knew you were going to receive a pat on the back every third time you completed a task, you would continue a bit longer and likely Truax Saskatchewan a little harder before that third time to ensure you were going to get the reward. If- - such as the slot machine- - you never knew when you were going to have the reward, you'd continue to do the job untilyou're completely exhausted, or- - in the case of this slot machine- - until you were out of cash, or, for some individuals, until you had lost everything. But we pretty much ALL do today. That doesn't mean you should reply. Will that look? It makes you look like you aren't currently doing anything aside from waiting to get a message from her. You have no actions in your life! We surely don't wish to give that look wait one hour at the least. To be honest you desire to roughly reply with the same delay she provides you. So it could be as getting her number fast, as quickly. Or when you've got patience it may be slow sometimes but can pay dividends. How To Find Escorts After Demise Of Backpage And Craigslist No Backpage Escorts Navigating A Paradoxical Concept It is important to realize that from becoming sex the more detached you are, the more easy it is to become appealing. The extremely men who can walk into a space and seduce a woman by looking at her are not the guys who are, in any way, worried about whether they are getting laid enough. Truax SK How To Send A First Message Online Dating " Vain trifles as they seem, clothes possess, they say, more significant offices compared to merely keep us warm. They change our perspective of the planet and the world's view of us. " - I had been on pins and needles, but managed to wait four days before phoning Lawrence although Virginia. Sylvester played Cyrano as I tried to not get off track upon hearing Lawrence sweet baritone on the other end of the phone As soon as I made the call, clearly. He was glad that I did, although he let me know he didn't think I was Truax SK backpage escorts new listing to call. Following a brief conversation full of flirtatious trades, I was asked by him when he would be able to take out me. Truax Local Fuck Buddy Why Do Dating Sites Depress Me Do Backpage Escorts Use Pimps The next fatal error is the only delivered by" The Ex- Chinese escorts backpage Corinne SK" . Its mind blowing off I know but some men will really go on and on about their ex- partners. I understand, girls do it too, so this point relates equally to us all. Increasing the issues of connections that are previous is more than insecure, it's practically suicidal. If your chinese escorts backpage Truax SK raises the vampire hookers movie Truax, then sweep over some of these positives you move on to another issue quickly and may have had on your relationship. This reveals your character isn't ill fated and ought to put you down for a score. This topic Truax SK backpage escorts gallery come up in case your date turns into something and there will be opportunity to talk about the issues but only keep it in the closet for the time being. La Cecilia Hookers Truax SK Backpage Escorts Creampied Truax I believed I understood that look. There's a song about that look. It had been" The Look of Love. " I started to backpage altwrnatives for escorts Truax SK a little nervous, because this was our second date. We were just friends. I'd thought Dave might function as companion, besides my dog, that my kids were anxious for me to have. But was I prepared for real romance? I knew I had grown to feel fond of him. Andour't was the date I had had yet in my pursuit. This Xmas date, regardless of the rain, was sweet. He was treating me. What Is The Best Online Dating Site For Guys Bearing this in mind things can get worse for men, because despite these insecurities which are black street hookers 24 Truax Saskatchewan enough, you must then endure the indignity of other men hitting your spouse whilst you are out! This will activate even more bitterness, and again, even worse than that, the issue is that the green- eyed monster wakes up- - JEALOUSY! ! Jealousy is a very powerful emotion really, and it can be destructive and dangerous. Jealousy can lead people do and to say matters which are both vengeful, and that may be seen as leading to crimes of all escorts backpage Truax.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '762', 'language_id_whole_page_fasttext': "{'en': 0.9699310660362244}", 'metadata': "{'Content-Length': '21413', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:3NUDO3TX4Y55FJOPO33Z3CUDXWSBOAV5', 'WARC-Concurrent-To': '<urn:uuid:eba6f59f-fd12-410d-8fbe-1dd0c18a1402>', 'WARC-Date': datetime.datetime(2020, 5, 29, 14, 12, 34), 'WARC-IP-Address': '104.27.156.190', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:57F6XE7RFRFVJPT5JMYCQ5VOMP3PWU5C', 'WARC-Record-ID': '<urn:uuid:c3c26a1d-e015-4fb3-a7ca-1f2493348535>', 'WARC-Target-URI': 'https://peeledeyeprintbox.com/backpage-escorts-saskatchewan/truax-sk', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:edb629aa-55b2-429e-b695-9c2ee866109c>', 'WARC-Truncated': None}", 'previous_word_count': '2117', 'url': 'https://peeledeyeprintbox.com/backpage-escorts-saskatchewan/truax-sk', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-253.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0507388710975647', 'original_id': '02468f93a264beca3ccca71f2740e73c6cedf87ec03bb6bf960234ade688383f'}
Jump to content Advanced Members • Content Count • Joined • Last visited Community Reputation 17,208 Excellent About RichardColeman • Rank Titanium Member Recent Profile Visitors 8,630 profile views 1. Came to the aid of THREE passengers ? Driver of the bike was ok then ? 2. Nope - left school at 16, joined a company at 18 gluing two bits of rubber together, and retired early (48) after working my up to the top, travelling the world for work, responsible for showing employees the use of networked computers and responsible for millions of £ of a month in shipments from multiple worldwide sites. Education is overrated - when i left the standard college students coming in for experience were so illiterate it was laughable. Was I more intelligent that uni/master degree people ? Nope. Was I a better employee ? You bet your life. Now, my Thai wife on the other hand DOES have a masters degree, though her knowledge of events outside Thailand is ridiculous 3. Was 11, party for ending middle school. Girls name was Diane - nobody fancied her. She rammed her tongue in my mouth so far it frightened the life outta me, scared me off girls for 2 years, until regular young male hormones took over 4. yes,but but no deaths, whilst probably zero infections but 150 deaths on the roads 5. They should ban smoking completely - I'm sick of getting on a motorbike taxi, where the guys juggling his fag, his phone and his red bull whist taking me home 6. Called changing the name of the front of the hotel from English into Chinese 7. Truly is amazing that so many government officials can have so much money without some form of other 'extra income' 8. Problem with that, is that there would be either a clause that ALL elections must be delayed by the amount of time the virus was present (to give them an opportunity to repair the country and not be voted out) or that any election cannot be held whilst even 1 patient still is infected or COULD be infected, which would drag on endlessy 9. Or put another way 1,900,000,000,000 baht borrowed for two days of road deaths • Create New...
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.96168452501297}", 'metadata': "{'Content-Length': '148057', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:U5ZMEBXF64PP7MXZA32YIA5BK2BVW4HB', 'WARC-Concurrent-To': '<urn:uuid:a520c7e6-5241-4373-93fb-18160e9a795a>', 'WARC-Date': datetime.datetime(2020, 6, 2, 20, 54, 13), 'WARC-IP-Address': '104.28.28.63', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DMW6NEKYXXHWEVNOYCDEJBFWCE44LRQW', 'WARC-Record-ID': '<urn:uuid:9139235a-ea63-46a9-a537-cae5ddec0f7f>', 'WARC-Target-URI': 'https://forum.thaivisa.com/profile/151131-richardcoleman/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e6695b38-7303-4d88-9f20-977492c3829d>', 'WARC-Truncated': None}", 'previous_word_count': '361', 'url': 'https://forum.thaivisa.com/profile/151131-richardcoleman/', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-236.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.07662677764892578', 'original_id': '1e156d60e7747ef261e45ce776d366ede9c32e1076064acdfd83a7b4d364df6e'}
America Express – Go on a a train ride across the Northamerican prarie • The train ride takes approx. 20 min incl. boarding and descent • Price DKK 60,- per person In the season 2021 • Children under 3 are free They must sit on the lap of an adult Amerika Expressen Get on an unforgettable trainride Experience Ree Park from a real steam or diesel train. America Expressen takes you on a train ride back in time. By rail you reach the prairie. The guide tells you about the animals and the North American prairie. Here you get close to the North American animals. The train ride with America Expressen lasts approx. 20 min. incl. boarding and descent, and is a great experience for children and adults. Children under 3 years are free. They must sit on the lap of an adult. Please note that the passenger cars are closed cars that can not be opened from the inside for safety reasons. This may, for some people with a tendency to claustrophobia, cause anxiety. However, there is always the possibility of getting hold of he guide during the trip via a telephone number. Meet the  American black bears The American black bear is a formidable climber. And because of its powerful and hooky claws it will easily climb into any tree, either seeking for food or during escape, so keep an eye on both the ground and the trees! American black bear The American bison Bisons can be very dangerous when the bulls fight each other or if the cows protect their calves. But otherwise, bisons are very peaceful animals. They can be playful and love to dustbathe and swim. American bison The Arctic wolves live in their own enclosure The arctic wolf is a wolf species known for its white coat. In addition to the white fur, the Arctic wolf also has other characteristic features; They have a shorter snout and less ears than other wolves - probably to minimize heat loss from the body. Arctic wolf your visit Your program 18. august 2017 Your program is empty Download program
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9098747968673706}", 'metadata': "{'Content-Length': '310153', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:33FBL7YZ4T6LBYYPCERAVRJX3A5WEMMC', 'WARC-Concurrent-To': '<urn:uuid:4201aa25-483d-4c53-89a7-882c739adb92>', 'WARC-Date': datetime.datetime(2021, 9, 21, 13, 46, 10), 'WARC-IP-Address': '178.32.159.161', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:MHMCT3H2KLIBHO5HNSO2U6E4BOQMRJFJ', 'WARC-Record-ID': '<urn:uuid:cf66b422-2357-4b2a-ba51-08bf97fc603f>', 'WARC-Target-URI': 'https://en.reepark.dk/plan-your-visit/experience/the-america-express-train', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ca17ba11-0489-4d4d-931a-222e83582a14>', 'WARC-Truncated': None}", 'previous_word_count': '355', 'url': 'https://en.reepark.dk/plan-your-visit/experience/the-america-express-train', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-43\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05149418115615845', 'original_id': '013e2869ea44cf63cec711962787b8cd4abcd7e55b6eaf7153b91a06337adac4'}
January 30, 2010 E-mail as a form of communication A couple of weeks ago, one of the gals in our Sunday school class took off down a bunny-trail about how e-mail is a horrible way of communicating with people. The irony was that several people in the room were quite comfortable with email as a means of communication and a few even preferred it. I'm still working my way through Adam McHugh's book, Introverts in the Church, and I just came across some quotes by him that summarize quite nicely, in my opinion, the strengths of email -- especially for the introvert who may prefer this medium to phone communication. "E-mail, in particular, allows us to think before we communicate, to correspond at our own pace and to change what we say before we send it.  E-mail doesn't make the immediate social demands that cell phones do, and it enables us to communicate without interruption.  In addition, there is a degree of distance in communication via e-mail, and this distance frees us to be more vulnerable than we might normally be." I already knew all that.  But sometimes it's nice to hear someone else say it. January 23, 2010 Meg's Impromptu Movie List My friend Sarah and I drove down to Denver together yesterday and talked about movies while we were bumming around at the Museum of Nature and Science.  I told her I'd send her a movie recommendation list when we got back. While I was typing it up I thought I'd throw it up here as well in case anyone else is looking for a good movie to watch. The list is in no specific order, doesn't necessarily give a lot of detail, but these were all movies we'd rate pretty highly. the movie we watched last night was very good (an academy award winner, apparently). it was called Departures.  it was about a cello player who changes professions and becomes a type of undertaken. Kinamand was a good flick about a plumber who helps out a Chinese family. The Dinner Game was a really twisted movie that you'd probably enjoy. They play a game in which the person who brings the stupidest guest wins. But the stupid guy finds out.... Chocolat was good. A little predictable, but still good. The Children of Huang Shi was the one I told you about where the American guy helped move orphans to safety in China when the Japanese were attacking. Kenny is hilarious! It's run like a documentary but I'm not sure that it is. It's about a guy that runs a port-a-potty business. I Am David is about a 12 year old boy that escapes from a communist concentration camp. Might be a bit too much of the same old, but Rob recommended I add it to the list.  He liked it a lot.  (I did too, but it is sort of the WWII ethos carried forward a decade or so). Be Kind Rewind was hilarious. They have to redo several big time movies on a low budget and it becomes a hit. Son of Rambow was also hilarious. If I remember correctly it was kind of a coming of age movie. The movie making was fun. Touching ending. The Lives of Others is the East German movie we talked about. But I think you said you'd seen that one?  Very good. All Passion Spent was a film about an introvert trying to escape from her extroverted life after the death of her husband. Spitfire Grill was an interesting movie about a gal trying to get her life back together after doing some prison time. Sad ending, though. Bagdad Cafe is an older flick, but it was delightfully quirky. Rob didn't like it as much as I did. Divided We Fall is one I mentioned about a couple that take in a former Jewish neighbor to protect him from the Nazis. A bit different than your average "save the jews from the nazis" kind of film both because the flick has more of a small town feel and because they throw in some communists for good measure. We both like this one. Spring Forward is about two guys that work in the park system. It's not really a coming of age movie as much as it's a coming into maturity sort of movie. If you've never watched Dear Frankie, that's one of our favorites. Heart breaking story with a nice ending. Ones we watched with the kids: The Ultimate Gift is one we watched as a family. It was a bit of a tearjerker but we all enjoyed it.  October Sky was another good family movie (and included geeks who were being picked on but who turned out to be the heroes in the end). Evelyn was another heartbreaking family movie. I think it unsettled the kids a little that the kids could be taken away. But the father's love was extraordinary and all the kids cheering at the end made the kids feel better.  Good flick.  K-Pax is a classic.  I'm pretty sure we watched this with the kids. It's one of those sci-fi movies that kinda keeps you wondering. Opal Dream was an interesting adventure tale in which the girl has two imaginary friends and you always kinda wonder in the back of your mind if they're real. January 18, 2010 Introvert or Extravert? I'm reading a book called Introverts in the Church: Finding Our Place in an Extroverted Culture and the author, Adam McHugh, gives three categories of differences between Introverts and Extroverts. Apparently he took the description from another book called The Introvert Advantage by Marti Olsen Lancy. First of all he points out that: Introversion is one of a constellation of factors that fluidly work together to shape how we act. Introverts gather the information that feeds our inner worlds in different ways; some rely on the concrete experiences of the senses (an S on the Myers-Briggs), while some depend more on their intuition (an N), interpreting what lies below the surface. Some introverts make decisions more from their hearts (An F) and others more from their heads (a T). Some prefer to structure their lives carefully (a J), whereas others opt for more spontaneity and flexibility (a P). We also fall somewhere along a spectrum between introversion and extroversion. With the three categories he describes, I find that some people immediately strike me as extroverted in one category, but it's a little more ambiguous in another category. And even within a specific category, we may lean toward one side or another, but it's possible that we show characteristics of the opposite side of the spectrum at times. The three categories of introversion/extroversion are: 1) energy source, 2) internal vs. external processing, and 3) depth vs. breadth. Introverts are energized by solitude.  We are recharged from the inside out, from the forces of our internal world of ideas and feelings. We generally fill our energy tanks in private or in the presence of one or two close friends, or else in a public place without interacting with those around us. Long periods without quiet refueling leave introverts feeling physically exhausted and emotionally hollow. Extroverts, on the other hand, derive their energy from outside of themselves. They need other people, interaction and various kinds of stimulation in order to replenish their energy. Too much time alone, silence or inactivity leaves extroverts feeling drained. I've often heard people explain the energy category (and I've done this myself) specifically in terms of spending time with people, but over time I've grown to see that it's not just a people thing. As he points out above, activity and variety are also keys to the energy equation.  I've noticed before that on days when I have one large project to work on (like making year end school movies or pumping out year end giving statements) I have more energy at the end of the day than when I've spent the day clawing my way through a to-do list 20 items long (even when the items on the list were all small things like making a phone call or tackling some burnt out light bulbs). There's something about the transitioning from one task to the other that wears me out. If I can find a way to make the tasks all seem congruent, I do better than when they strike me as disparate tasks. In our culture we are continuously bombarded by stimuli, in the forms of information, images, conversation, and a multitude of other data and experiences.  In order for introverts' lives not to degenerate into disassociated states of confusion, we need to process these stimuli and integrate them into our lives.  Another way that this integration process might be described is filtering.  We need to filter information and experiences, allowing the good to take root in us and transform us, discarding the bad or irrelevant. Extroverts have flexible and porous filters that allow much to pass without getting clogged.  They can usually take a much higher amount of stimuli before they become inundated.  They mostly process externally, through conversation and interaction with others. Taking is an integral part of their processing, and they often speak in order to understand. Their speaking and thinking occur simultaneously. Though they are capable internal filtering and reflection, they are most alive when engaged in the world of people and activity. ...extroverts may be more physically expressive than introverts. The introverted filter, on the other hand, is much finer and more rigid, only able to allow small amounts of stimuli to pass before it backs up. Introverts process internally, in the workings of our own minds.  We integrate and think silently. Ideally, we like to be removed from external stimuli and people in order to process. Though we are capable of engaging in the world, we are most alive in the reflections of our minds, mulling over concepts and experiences.  Our learning style centers around observation and contemplation, and we are not as dependent on external feedback for growth. Many introverts do not do well with interruptions, either when we are speaking or reflecting. When the finer filters of introverts become clogged in the presence of people, we often go silent. When this filtration process is impeded, the result can be disorientation and confusion -- or for me, temporary depression.... My first thought upon reading about this second category was, "but I'm so good with Dad!" Part of having Picks disease includes perseveration, which means saying the same thing over and over and over again until everyone around you goes insane. My dad's perseveration drove my mom nuts, and my sister, but somehow I put up with it easily.  But I suspect that's because, after having 3 kids under the age of 2, I learned to filter beyond my filter. I could "turn off" my dad in a way that they couldn't and sometimes people would complain about my dad's repetitions and I'd be surprised that he'd been speaking that whole time and I hadn't even noticed.  (My kids hate when I've turned them off -- they keep asking me a question and I don't hear them at all. There are definitely times when it's not an asset.) But as I finished reading this section, especially the last bits about shutting down and getting depressed, a light bulb went off.  There have been so many times when I've been in the midst of a stressful conversation and between my trying to convey my thoughts to people who obviously weren't understanding me, and trying to make sense of and sort through their responses to me, I would just get to the point where I couldn't even function any more. I'd have to leave the room. Or I'd break down in tears. Or I would just get very, very quiet. Introverts tend toward high degrees of intimacy in our relationship, which we usually have fewer of than extroverts.  Introverts are rarely content with surface-level relationship and do not generally consider our acquaintances to be friends.  We may find small talk to be disagreeable and tiring. Introverts also prefer to have depth in fewer interests.  This trait is connected to our style of processing. The breadth of information about a wealth of topics often results in introverted-filter overload.  Instead, introverts prefer to invest our energy resources into a a smaller number of topics or activities. We desire to mine them for all their richness, to explore all their nuances and complexities. This commitment to specialization of expertise, along with our love of ideas and our powers of concentration, explains why many introverts thrive in lives of scholarship. Although this third category introduces a new idea regarding introverted vs. extroverted behavior, I think it overlaps a lot with the other two categories. Switching between topics is harder on our filters than sticking with one topic and digging deep. The same holds true with switching between activities or even with the number of people we hang out with. The way I think of it sometimes is sticking on the main road vs. taking detours, especially detours that I wasn't expecting. If I *feel* like I'm sticking to one general task all day, I do a lot better than when I feel like I'm headed in one direction, and then a friend of mine calls up to ask if I'd like to go for a walk and suddenly I'm like a deer caught in the headlights. "What! Throw a variable into what had started off as a straight forward day?! You've got to be kidding!" I go silent and I'm sure she's on the other end of the line wondering what happened to me. And when I relent and go on the walk (because she IS my friend and I DO like going on walks once in awhile, though I usually prefer being alone) I come home and the rest of the day is gone. No matter how much work I still had to do, I'm physically and emotionally unable to deal with anything else that day. McHugh, in this chapter on the differences between Introverts and Extroverts, gives a list of "common attributes of introverts." If you're still not sure on which side of the spectrum you fall, perhaps this will help: • Prefer to relax alone or with a few close friends. • Consider only deep relationships as friends. • Need rest after outside activities, even ones we enjoy. • Often listen but talk a lot about topics of importance to us. • Appear calm, self-contained and like to observe • Tend to think before we speak or act • May prefer a quiet atmostphere • Experience our minds going blank in groups or under pressure • Don't like feeling rushed • Have great powers of concentration • Dislike small talk • Are territorial -- desire private space and time • May treat their homes as their sanctuaries • Prefer to work on own rather than with a group • May prefer written communication • Do not share private thoughts with many people I've also posted some interesting quotes from McHugh's book regarding physiological differences between extroverts and introverts in the INTJ Group: Dopamine vs. Acetylcholine and Blood Flow January 16, 2010 Caring for Your Introvert - The Atlantic (March 2003) Caring for Your Introvert  < -- Click here to read the Atlantic Monthly article. This is a classic article about introverts. If you are an introvert, it might come as a relief to read this and find that a lot of the things that have always drained you or annoyed you or stressed you out are normal. Every time I read this article I think, "Yes! That's it exactly!" over and over again. If you are an extrovert, this article will hopefully help you to better understand the introverts in your life. Unfortunately, after sending this article out to several extroverted friends, the standard response I got from them was, "That's funny. What a hilarious joke!" In other words, they didn't get it. They thought it was a spoof on the differences between introverts and extroverts, but not at all based in reality. *sigh* Here's a few quotes from the article to whet your appetite:  Introverts may be common, but they are also among the most misunderstood and aggrieved groups in America, possibly the world. Introverts are not necessarily shy. Shy people are anxious or frightened or self-excoriating in social settings; introverts generally are not. Introverts are also not misanthropic, though some of us do go along with Sartre as far as to say "Hell is other people at breakfast." Rather, introverts are people who find other people tiring. Extroverts are easy for introverts to understand, because extroverts spend so much of their time working out who they are in voluble, and frequently inescapable, interaction with other people. They are as inscrutable as puppy dogs. But the street does not run both ways. Extroverts have little or no grasp of introversion. (I thought I had posted this long ago, but I can't find it anywhere so I thought I'd repost the link.) Dopamine vs. Acetylcholine and Blood Flow - Introversion vs. Extraversion I am reposting this from the INTJ  group on Multiply.com (which is ending its social networking services in December). I won't be saving all of the posts that I wrote in the group, but this is one that I'd like to keep around to refer back to if needed.  I have back dated this post according to its original posting date. I'm reading a book called Introverts in the Church: Finding our place in an extroverted culture (by Adam S. McHugh) and the author spends a fair bit of time essentially explaining introverts: how they're different than extroverts, why they're different, and what that means in terms of what's reasonable to expect and what's not. As I'm reading it I keep thinking, "So that's why I do that!" and "No wonder I often feel guilty I'm not doing that." (The guilt is because the extroverted culture tells us that we should be doing XYZ and for extroverts, that XYZ is something that energizes them so they really don't understand our reticence. But for us, it just wipes us out.) I just hit a section on dopamine and brain function differences that I think is particularly interesting. I thought I'd include a few excerpts here. Studies of the human brain have revealed three significant physiological differences between introverts and extroverts.  First, introverts have naturally busier, more active brains than extroverts.  Though introverts look calm on the surface, our brains are bubbling with activity, and thus we require less external stimulation than extroverts.  Too much external stimulation, in fact, leads to a feeling of overwhelm.  Second, blood flows in different paths in introverted and extroverted brains. Introverts have more blood flow, but it flows in a longer, slower path than in extroverted brains.  The blood in introverted brains flows to sections that are focused on internal things like remembering, solving problems and planning.  ON the other hand, the blood in extroverted brains goes to those parts that are used for the processing of sensory experienced, what's happening externally. Third, introverted and extroverted brains have different chemical balances.  The activities of our brains are catalyzed by neurotransmitters, which are chemical substances that transmit nerve impulses.  Extroverts require greater amounts of dopamine, a central neurotransmitter in the sympathetic nervous system. It is produced when people are active and in motion. As psychologist and author Marti Olsen Laney writes, "extroverts feel good when they have places to go and people to see," probably because they are flush with dopamine.  Dopamine takes a short path through the brain and, in stressful situations, produces an "act and react" response.  It can be credited for extroverts' ability to think and speak quickly and to thrive under pressure.  It also helps them access their short-term memory more rapidly, so their data-processing circuit is shorter and faster.  Introverts, on the other hand, require less dopamine, and when our brains have too much, we can feel anxious or overwhelmed.  Our brains rely more on another neurotransmitter, acetylcholine, a neurotransmitter of the parasympathetic nervous system, which conserves and restores energy, producing a "rest and repose" posture.  It produces a pleasurable sensation in introverts when we are thinking and reflecting. Acetylcholine, however, cuts a longer path through the brain, which explains why introverts may have difficulty accessing words or memories quickly and why we may be slow to react in stressful situation.  Introverts often prefer writing to speaking, because writing uses a different neurological pathway in the brain than speaking does. Additionally, the slower acetylcholine tributary may produces a posture of calmness in introverts and cause us to move more slowly than extroverts, which may explain why we are often less expressive with our bodies." Wow, that explains a lot. I've always known that I don't interview well, but I thought only the nervousness could be attributed to being introverted. Now I know that the words on the tip of my tongue and the ideas not coalescing on demand (when they all came together so well just the day before as I was planning on the talk) are all a result of stuff going on in my brain. It's kind of a relief to know it's not that I'm just a moron.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '31', 'language_id_whole_page_fasttext': "{'en': 0.9692858457565308}", 'metadata': "{'Content-Length': '205803', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Y2N4TAQT3REJIQIB457GZLBQQVW4OFZ2', 'WARC-Concurrent-To': '<urn:uuid:5e209640-edb9-4006-9082-e2f129898c83>', 'WARC-Date': datetime.datetime(2018, 7, 21, 7, 55, 57), 'WARC-IP-Address': '172.217.8.1', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:EORTW5VX6XGJSOHVJFOIP2SVHBLFNA6I', 'WARC-Record-ID': '<urn:uuid:6d8fcc11-e7b5-4887-bc25-b2ec040ac9ee>', 'WARC-Target-URI': 'http://barefootmeg.blogspot.com/2010/01/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6cb311ee-a66c-4c8f-af7a-fd1407806085>', 'WARC-Truncated': None}", 'previous_word_count': '3503', 'url': 'http://barefootmeg.blogspot.com/2010/01/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-151-200-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-30\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for July 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09169179201126099', 'original_id': 'f76dec4b99154d17329883c24abb7316accd2d7bb086829d61d8a103c8128d9a'}
Zum Inhalt springen The Civil War in Lebanon / The Kidnapped and Disappeared Keeping the disappeared in public sight by Meris Lutz for The Daily Star on Feb. 16, 2013 BEIRUT: A faded photograph of a missing father, mother, son or daughter. Bones wrapped in nylon. Official denials. The story of more than 17,000 people who disappeared in Lebanon, mostly during the Civil War, remains unfinished, shrouded in mystery. Despite one law, three official commissions and the alleged discovery of multiple mass graves, their memory is in danger of fading before meaningful legislation can be passed to help discover their fate. In 2008, a young artist recognized some of their faces, featured on a poster for a photo exhibit, and was haunted by the thought that they would eventually be ripped down or plastered over. Five years later, he has excavated them from beneath layers of fliers, announcements and teaser campaigns, adding the names and dates of disappearances where he could, and even filling in the faces from memory. “I knew many of these faces and I was especially angry about what will become of them, that they will be deformed,” he says, recalling the first time he saw the posters back in 2008. “I knew that one day I would be restoring the faces.” “We will find them – it’s impossible for someone to disappear. They’re always somewhere.” The artist behind the project declined to be identified at the risk of distracting attention from what he considers the more important issue of what is being done to find the missing. The altered posters can be seen in the Beirut neighborhoods of Qantari and Gemmayzeh. The Committee for the Families of the Kidnapped and Disappeared in Lebanon was formed in 1982 to offer mutual support and pressure the government to investigate the fates of citizens who disappeared. The government has launched several initiatives to this effect, but some of the families claim these overtures are intended to appease the families rather than actually investigate the cases. In 1995, the government passed a law enabling families to declare dead anyone missing for more than four years, allowing inheritance and property rights to be settled. In 2000, it established a committee that issued a short report stating that all missing were presumed dead. A year later, it formed a new commission to investigate the cases of Lebanese held in Syrian jails, and in 2005, the government backed a joint Syrian-Lebanese commission to look into prisoners in both countries. source Daily Star | continue at the Press Kit Committee of the families of the Kidnapped and Disappeared in Lebanon Le Comité des Parents des Personnes Enlevées ou Disparues au Liban est une organisation non gouvernementale, qui s'est constituée le 17 novembre 1982, et a obtenu son statut légal 29/Ad en date du 7/3/2000. L'association est formée des mères, pères, épouses, enfants, frères et sœurs des personnes enlevées ou disparues durant la guerre qui a débuté le 13 avril 1975 au Liban. Les personnes enlevées et disparues sont nos partenaires dans la citoyenneté. Ils appartiennent à toutes les communautés, à toutes les régions, à toutes les affiliations intellectuelles et culturelles et à toutes les classes sociales. Ils ont été enlevés sur les barrages de la guerre à cause de leur identité ou appartenance. Aucun crime ne leur était reproché. A l'arrêt des hostilités guerrières, leur nombre était estimé à 17 000. L'association est totalement indépendante de toute affiliation politique, religieuse ou régionale. Les objectifs de l'association 1)    Connaître le sort des personnes enlevées et disparues depuis le 13 avril 1975 et jusqu'au 26 avril 2005. 2)    Participer à l'éducation à la citoyenneté et à répandre la culture de la paix et du respect des droits humains. 3)    Œuvrer pour l'épuration de la mémoire afin de tirer les leçons du passé, et d'empêcher une répétition de la guerre. Les revendications 1)    Faire la lumière sur le sort des personnes enlevées et disparues depuis le 13 avril 1975. Assurer l'immédiate libération des vivants parmi elles et agir pour rendre les dépouilles mortelles des défunts à leurs familles. 2)    Etablir un système d'indemnisation équitable tant moralement que matériellement de leurs familles. 3)    Déclarer la date du 13 avril " journée nationale pour la mémoire" et faire ériger un monument pour commémorer le souvenir de toutes les victimes de la guerre au Liban. 4)    Adopter les lois intérieures nécessaires et adhérer aux conventions internationales qui empêcheraient les horreurs commises dans le passé de se reproduire. Mettre fin à l'impunité et adhérer à la convention de Rome établissant le tribunal pénal international. Lay the Dead to Rest, Put the Minds of their Families at Rest by Wedad Halwani for Peace Building in Lebanon on 18th April 2018, page 7 «Even if they bring me the remains of my son, I would recognize them. Even if my son turned to bones, I would recognize my son. They can’t give me the bones of a dog. There are marks I know. I know if the remains are his or not.» This is an excerpt of Moussa Jadaa’s comments in 1997 denouncing the law issued with the title «The rules to be followed to prove the death of missing persons»*. It seemed that Mr. Jadaa, who died less than a year after those words, had foreseen or, perhaps warned of the State possibly resorting to manipulations regarding the fate of those who were abducted by the war and the feelings of their families. He died before discovering the fate of his son and brother, and before the serial show of mass graves story began to unfold. In January 2000, succumbing to pressure from the Our Right  to  Know  campaign launched  by  the  Committee of the Families of the Disappeared and Missing and its supporters, an «official committee» was established to investigate victims and determine their fate. Six months later, this committee published a report with the results of its work.  The  report  stated  that  it  had  not  found any  living  and  that  it had  found  mass  graves,  naming several ones. According to the report, it was impossible to identify the buried remains, as they had been buried for a long time, and Lebanon lacked the laboratory and techniques required for such tests. It was also impossible to carry out these tests abroad because of the high costs that the State treasury would incur. What is most painful about the matter is that the Lebanese authorities have not taken any steps since then regarding these graves in accordance with the rules and procedures stipulated in international laws and treaties, particularly the First, Second and Fourth Geneva   Conventions. The State assumed that this collective obituary, not based on any concrete evidence, would put an end to the dossier of the missing by declaring them dead. Its evidence is the existence of mass graves across Lebanon. Following the withdrawal of the Israeli occupation army from Lebanon, the domino effect set off the discovery of mass graves in several areas, especially in Southern Lebanon and the Bekaa. The same happened following Syria’s withdrawal. Perhaps shedding light on this matter would contribute to raising public awareness about this inhumane phenomenon, set right the official handling of it to show respect for the missing and their families, and pave the way to closing this dossier. For its closure would be the closure of the last of war dossiers in Lebanon. Anyone keeping track of the official course of action would note the absence of professionalism and competence, and the disregard for international rules and standards for dealing with graves. Moreover this uncovers the flagrant politicizing of the matter in both shedding light on graves in certain areas, covering them up in others whether to the timing of discoveries or exhumations. The discovery of the Anjar gravesite in the Bekaa and another discovery in the vicinity of the Ministry of Defense in Baabda in 2005 sparked a war of public statements between the rival parties of the war, most of whose leaders are now in power. This war began with shirking responsibility and finger pointing at each other, then alternately pointing the finger at Israel and Syria, followed by appealing to international courts, to finally turn into hurling the remains of the missing, contemptuous of the dignity of the dead and the feelings of families. In addition, the subject was raised in Parliament during a Q&A session**. Unfortunately, no answers have been provided to date, while the questions are ever growing. Read the full article here (page 7)
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.7559272050857544}", 'metadata': "{'Content-Length': '54126', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:TFNJESI63OEWNTPS5GLMBSVAZVNNUJ67', 'WARC-Concurrent-To': '<urn:uuid:bee5ba13-c0a4-4117-88ad-f8449570b0fe>', 'WARC-Date': datetime.datetime(2019, 5, 19, 21, 0, 54), 'WARC-IP-Address': '85.13.161.34', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:XY6OCMKDWFK7EFUAHXNLSG4755KP5LOT', 'WARC-Record-ID': '<urn:uuid:d39e3d60-d71a-403f-b1fb-8a954ae94c47>', 'WARC-Target-URI': 'http://mecfilm.com/index.php?id=3568', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a3f8779f-1009-47fe-a950-143b8058baff>', 'WARC-Truncated': None}", 'previous_word_count': '1408', 'url': 'http://mecfilm.com/index.php?id=3568', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-150-165-216.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08071845769882202', 'original_id': '3091eecda9c87ae10dc79c098332f53ec25d3154a39027cd89b2cc4755df3a8d'}
<html> <style type="text/css"> #wrap { width: 100%; margin: 0 auto; background-color: #fff; } /* Begin Navigation Bar Styling */ #header-bottom{ text-align:center; padding:4 100px; width: 100%; } #nav { width: 100%; float: left; margin: 0 0 3em 0; padding: 0; list-style: none; background-color: #4D398B; border-bottom: 1px solid #4D398B; border-top: 1px solid #4D398B; } #nav li { float:center; } #nav li a { display: block; padding: 8px 15px; text-decoration: none; font-weight: bold; color: #ffffff; border-right: 1px solid #864752; } #nav li a:hover { color: #c00; background-color: #fff; }</style> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"> <link href="web/css/style.css" rel="stylesheet" type="text/css" media="all"/> <script type="text/javascript" src="web/js/jquery-1.9.0.min.js"></script> <script type="text/javascript" src="web/js/move-top.js"></script> <script type="text/javascript" src="web/js/easing.js"></script> <center> <body> <div id="wrap"> <div class="header_desc"> <a href="index.php"></a> </div> <!-- Here's all it takes to make this navigation bar. --> <div id="header-bottom"> <ul id="nav"> <li><a href="services.html">Home</a></li> <li><a href="logout.php">Logout</a></li> </ul> </div> <h1>Thank You For Using Our Site !</h1> </body> </center>
common_corpus
{'identifier': 'https://github.com/shreya7/Dream/blob/master/profile.php', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'CC-BY-3.0', 'date': '', 'title': 'Dream', 'creator': 'shreya7', 'language': 'PHP', 'language_type': 'Code', 'word_count': '149', 'token_count': '588', '__index_level_0__': '41520', 'original_id': '0a5946c2df534e6f58faea0f63fff47830d5229ac36acaf266ce60a0ded1efc1'}
Bloated Stomach Acid Reflux Causes Bad Taste How to settle an upset stomach. Now that you know what some of the possible causes can be, I’m going to explain what you can do to calm an angry tummy so you are on the road to recovery faster! The Medicine For Acidic Stomach I Have Acid Reflux Why Do My Stomach Hurt North Carolina What Can I Drink To Get Rid Of Acid Reflux Oregon Result 10 Ways to Improve Stomach Acid Levels. Stomach acid is critical for disinfecting and killing off bad microbes and for optimizing protein digestion in the body. Is there a difference between acid reflux and indigestion? Quite often, the terms acid reflux and indigestion are used interchangeably without fully understanding the differences between the two. Apples Give Me Indigestion The health benefits of grapes include their ability to provide relief from constipation, indigestion, fatigue, kidney disorders, macular degeneration, and prevent cataracts. Healthy juicing recipes for any time of the ** Heartburn Causes Symptoms ** Controlling Acid Reflux Naturally Too Much Stomach Acid Symptoms Heartburn Causes Symptoms What Are The Symptoms Of Acid Indigestion with Can Reflux Cause Nausea and How To Reduce Stomach Burning think about dropping harmful habits pertaining to instance smoking and drinking liquor. Heartburn (GERD) Definition, Causes, Signs, – Heartburn a burning sensation in the throat from acid reflux. Symptoms of heartburn include chest pain, burning in the throat, and difficulty swallowing. Causes of heartburn include lifestyle habits or medical causes. Treatments for heartburn include OTC and prescription medication and lifestyle changes. Epigastric pain is felt in the upper abdomen, below the ribcage but above the intestines. Learn about the possible causes, including GERD and indigestion. I have had reflux for almost 22 years. I rarely have had heartburn–I got pain in my chest that went clear through to my back, all the way up to my neck and sometimes it even made my teeth hurt. First off, acid reflux, also known as gastroesophageal reflux disease or GERD, is commonly thought to be caused by your body overproducing stomach acid. Not surprisingly, when stomach acid washes back up the throat and into the back of the mouth, it can leave a bitter or sour taste in your mouth. This symptom goes hand in hand with bad breath, which was previously mentioned in slide 8. A 1999 study published in The American Journal of Medicine lists 5 Reasons Why You Have a Bloated Stomach. Years ago as a teenager, I would struggle regularly with a bloated stomach, gas and often times cramping.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '315', 'language_id_whole_page_fasttext': "{'en': 0.924765944480896}", 'metadata': "{'Content-Length': '26028', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FMJKE53MBA54YNZOCIEPA7HGWJMQL7UI', 'WARC-Concurrent-To': '<urn:uuid:ba1ae5f9-ba12-4626-9df1-c28353c6a812>', 'WARC-Date': datetime.datetime(2020, 2, 21, 8, 41, 6), 'WARC-IP-Address': '104.24.107.160', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NSJO2DOTYUUY5HMOFRMUQ2PNKRLT54CE', 'WARC-Record-ID': '<urn:uuid:7ecaf8d5-cd8c-41be-8b1e-812673c0732a>', 'WARC-Target-URI': 'https://patcue.com/bloated-stomach-acid-reflux-causes-bad-taste/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5ecf7cdb-fdc6-4e14-8074-5b44bdccc200>', 'WARC-Truncated': None}", 'previous_word_count': '722', 'url': 'https://patcue.com/bloated-stomach-acid-reflux-causes-bad-taste/', 'warcinfo': 'isPartOf: CC-MAIN-2020-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-10.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.030830085277557373', 'original_id': '488aaf570d1d4fe4343fb9358d9ba927b42612422f8df2310901d98fb3192004'}
Project Data onto a 3D Finite Element Mesh FEM3D_PROJECT is a C++ program which projects a finite element function. Let us suppose we have a region R and a "tet mesh" (tetrahedral mesh) of R, that is, a set of nodes N1 and tetrahedrons T1 whose union is R. Let P1(I)(X,Y,Z) be the finite element basis function associated with node N1(I). Now let us suppose that we have a finite element function V1, that is a scalar- or vector-valued function V1(X,Y,Z) defined over R, with the formula V1(X,Y,Z) = sum ( 1 <= I <= NODE_NUM1 ) V1(I) * P1(I)(X,Y,Z) Now suppose we have a second tet mesh of R comprising a set of nodes N2 and tetrahedrons T2. Can we determine an appropriate set of finite element coefficients V2(I) which best approximate V1 in the finite element space defined by N2 and T2? The finite element coefficient vector V2 is defined by the following relationship: Integral Sum ( 1 <= I <= NODE_NUM2 ) V2(I) P2(I)(X,Y,Z) P2(J)(X,Y,Z) dx dy dz = Integral V1(X,Y,Z) P2(J)(X,Y,Z) dx dy dz Thus, in particular, the function V1(X,Y,Z), which is defined on the first finite element space, must be evaluated in a computation that uses the second finite element space. This procedure can be used to determine the least squares approximant to data (actually, to the piecewise linear interpolant of that data) or to determine the finite element coefficients appropriate when recomputing a finite element solution from a fine mesh to a coarse mesh. The sample data is given as three tables, each stored in a file: The finite element mesh is given as two tables, each stored in a file: The program produces a new table FEM_VALUES, of the same dimensionality as SAMPLE_VALUES. The vector FEM_VALUES can be used in conjunction with the finite element mesh data to produce a finite element function that is an approximant to the SAMPLE_VALUES data. fem3d_project sample_prefix fem_prefix where sample_prefix is the common prefix for the SAMPLE files: and fem_prefix is the common prefix for the FEM files: The file fem_prefix_values.txt is created by the program, and contains the projections of the sample data values onto the finite element space, that is, these may be regarded as coefficients of finite element functions representing the projections of the sample data. Note that we may also regard this operation as the refinement or coarsening of a finite element function, in that we are transferring information from the ``sample'' space to the ``fem'' space. Related Data and Programs: FEM1D_PROJECT, a C++ program which projects data into a finite element space, including the least squares approximation of data, or the projection of a finite element solution from one mesh to another. FEM2D_PROJECT, a C++ program which projects a function F(X,Y,Z), given as a data, into a given finite element space of piecewise linear triangular elements. FEM3D, a data directory which contains examples of 3D FEM files, three text files that describe a 3D finite element geometry; FEM3D_PACK, a C++ library which contains utilities for 3D finite element calculations. FEM3D_SAMPLE, a C++ program which evaluates a finite element function defined on 3D tetrahedral mesh. 1. Hans Rudolf Schwarz, Finite Element Methods, Academic Press, 1988, ISBN: 0126330107, LC: TA347.F5.S3313. 2. Gilbert Strang, George Fix, An Analysis of the Finite Element Method, Cambridge, 1973, ISBN: 096140888X, LC: TA335.S77. 3. Olgierd Zienkiewicz, The Finite Element Method, Sixth Edition, Butterworth-Heinemann, 2005, ISBN: 0750663200, LC: TA640.2.Z54. Source Code: Examples and Tests: LINEAR starts with sample data for the vector function f(x)=[ 1, 2x, 3y, 4z ], on an 8x8x8 grid of equally spaced nodes from [0.0,8.0]x[0.0,8.0], and projects this onto a piecewise linear finite element meshes defined on equally spaced grids of dimension 4x4x4, 2x2x2 and 1x1x1. List of Routines: Last revised on 25 August 2009.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '17', 'language_id_whole_page_fasttext': "{'en': 0.802847146987915}", 'metadata': "{'Content-Length': '14424', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZAK6UN3IKUSB7DRP2UQZTQEGQK4R4CYT', 'WARC-Concurrent-To': '<urn:uuid:38b62451-e0af-4f5f-bed6-8665cae1c814>', 'WARC-Date': datetime.datetime(2017, 10, 23, 7, 48, 54), 'WARC-IP-Address': '144.174.16.100', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:PQKV54K6LCQYFRBXIR2I2VMTMKQNQOD5', 'WARC-Record-ID': '<urn:uuid:f614607c-af70-4269-a6e4-f5442e83a9a3>', 'WARC-Target-URI': 'http://people.sc.fsu.edu/~jburkardt/cpp_src/fem3d_project/fem3d_project.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:801f5e82-8147-4c48-9d49-3808e323e9e5>', 'WARC-Truncated': None}", 'previous_word_count': '663', 'url': 'http://people.sc.fsu.edu/~jburkardt/cpp_src/fem3d_project/fem3d_project.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-165-76-76.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-43\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for October 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.19702142477035522', 'original_id': 'fb54cd2b291c99cd2f930d6ee123fae6e9dedb3a89594b6795317bd4f485f0f0'}
/* * Copyright (C) 2020 Grakn Labs * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Affero General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Affero General Public License for more details. * * You should have received a copy of the GNU Affero General Public License * along with this program. If not, see <https://www.gnu.org/licenses/>. * */ package grakn.core.kb.graql.reasoner.unifier; import com.google.common.collect.ImmutableSet; import grakn.core.concept.answer.ConceptMap; import graql.lang.statement.Variable; import javax.annotation.CheckReturnValue; import java.util.Collection; import java.util.Map; import java.util.Set; /** * Interface for resolution unifier defined as a finite set of mappings between variables xi and terms ti: * θ = {x1/t1, x2/t2, ..., xi/ti}. * * Both variables and terms are defined in terms of graql Vars. * For a set of expressions Γ, the unifier θ maps elements from Γ to a single expression φ : Γθ = {φ}. */ public interface Unifier{ /** * @param key specific variable * @return corresponding terms */ @CheckReturnValue Collection<Variable> get(Variable key); /** * @return true if the set of mappings is empty */ @CheckReturnValue boolean isEmpty(); /** * @return true if the unifier contains multi-valued mappings */ @CheckReturnValue boolean isNonInjective(); /** * @return variables present in this unifier */ @CheckReturnValue Set<Variable> keySet(); /** * @return terms present in this unifier */ @CheckReturnValue Collection<Variable> values(); /** * @return set of mappings constituting this unifier */ @CheckReturnValue ImmutableSet<Map.Entry<Variable, Variable>> mappings(); /** * @param key variable to be inspected for presence * @return true if specified key is part of a mapping */ @CheckReturnValue boolean containsKey(Variable key); /** * @param u unifier to be compared with * @return true if this unifier contains all mappings of u */ @CheckReturnValue boolean containsAll(Unifier u); /** * unifier merging by simple mapping addition (no variable clashes assumed) * @param u unifier to be merged with this unifier * @return merged unifier */ Unifier merge(Unifier u); /** * @return unifier inverse - new unifier with inverted mappings */ @CheckReturnValue Unifier inverse(); /** * @param answer to apply the unifier to * @return unified answer */ @CheckReturnValue ConceptMap apply(ConceptMap answer); }
mini_pile
{'original_id': '3783ac3d5798d6c4fa505a10a2d422bd5e9a4b500dd74493aad6261826ea316d'}
<!DOCTYPE html> <html> <head> <title>A canvas miterLimit example</title> <meta name="DC.creator" content="Kamiel Martinet, http://www.martinet.nl/"> <meta name="DC.publisher" content="Mozilla Developer Center, http://developer.mozilla.org"> <!--[if lt IE 9]> <script type="text/javascript" src="../../../../bin/flashcanvas.js"></script> <![endif]--> <script type="text/javascript"> function draw() { var ctx = document.getElementById('canvas').getContext('2d'); // Clear canvas ctx.clearRect(0,0,150,150); // Draw guides ctx.strokeStyle = '#09f'; ctx.lineWidth = 2; ctx.strokeRect(-5,50,160,50); // Set line styles ctx.strokeStyle = '#000'; ctx.lineWidth = 10; // check input if (document.getElementById('miterLimit').value.match(/\d+(\.\d+)?/)) { ctx.miterLimit = parseFloat(document.getElementById('miterLimit').value); } else { alert('Value must be a positive number'); } // Draw lines ctx.beginPath(); ctx.moveTo(0,100); for (i=0;i<24;i++){ var dy = i%2==0 ? 25 : -25 ; ctx.lineTo(Math.pow(i,1.5)*2,75+dy); } ctx.stroke(); return false; } function init(){ document.getElementById('miterLimit').value = document.getElementById('canvas').getContext('2d').miterLimit; draw(); } </script> <style type="text/css"> body { margin: 20px; font-family: arial,verdana,helvetica; background: #fff;} h1 { font-size: 140%; font-weight:normal; color: #036; border-bottom: 1px solid #ccc; } canvas { border: 2px solid #000; float: left; margin-right: 20px; margin-bottom: 20px; } pre { float:left; display:block; background: rgb(238,238,238); border: 1px dashed #666; padding: 15px 20px; margin: 0 0 10px 0; } td { vertical-align:top; } </style> </head> <body onload="init();"> <h1>A canvas <code>miterLimit</code> example</h1> <table> <tr> <td><canvas id="canvas" width="150" height="150"></canvas></td> <td> Change the miterLimit by entering a new value below and clicking the redraw button.<br><br> <form onsubmit="return draw();"> <label>Miter limit</label> <input type="text" size="3" id="miterLimit"/> <input type="submit" value="Redraw"/> </form> </td> </tr> </table> </body> </html>
mini_pile
{'original_id': '2db1ffaf3e7a61c0a30ef16f2064097b7c935b6b0537a342159b8c9c04675bd6'}
Best bodybuilding supplement: Could it be Beta Alanine? best bodybuilding supplementsIn bodybuilding or weight lifting, when you want to be certain that your training sessions are still hardcore, after a while, you have to choose the best bodybuilding supplements and there is a huge market which sometimes, can get very confusing, i mean you get thousands of products at different price ranges (testosterone boosters, creatine, protein powders, aminoacids, beta alanine etc.) . Just take a walk to your local bodybuilding supplements store and try to buy the best things for your gym requirements; Well you can’t, especially when you’re on a limited budget. So, those who want big muscles or even a bodybuilder body, have to also pay lots of money on bodybuilding supplements and quality food; This is like an investment and sometimes, these investments can end bad if you don’t think them through! Now, if you’re still interested about probably the best bodybuilding supplement out there, here it is: Beta Alanine! How does Beta Alanine work? Beta Alanine’s benefits are amazing: • Boosts explosive muscle strength and power. • It increases lean muscle mass. • It increases anaerobic and also aerobic endurance. • Last but not least, it increases the exercise capacity thus giving you a boost in extra reps at each set for hard and long training sessions. When you train different muscle groups, your body starts producing lactic acid; That acid builds hydrogen ions and because of that, your muscle performance drops during your workouts. Beta Alanine, basically soaks up those hydrogen ions that are released at an accelerated rate during your workout. Beta Alanine, the best of bodybuilding supplements, is also affordable! If you need cheap and effective bodybuilding supplements you can try Beta Alanine and you won’t regret it! :D bodybuilding supplements to gain muscle and strength Here’s a little secret on how to increase strength to the maximum and gain muscle fast when using Beta Alanine! Studies have shown that when combined, Creatine and Beta Alanine can do wonders for those who look for a good bodybuilding supplements recipe in order to gain lean muscle mass and fast. During each testing session, the subjects were tested for strength (maximum bench press and squat), power (Wingate anaerobic power test, 20-jump test), and body composition; Guess what? Creatine plus Beta Alanine supplementation appeared to have amazing effects on lean muscle mass, body fat composition and strength. So, if you combine some bulk Beta Alanine with let’s say Animal Pump which has different types of creatine, then you’ll add quite a few pounds of lean muscle mass on your already athletic frame :D. Share this Post: No Responses to “Best bodybuilding supplement: Could it be Beta Alanine?” Leave a Reply: Name (required): Mail (will not be published) (required): Comment (required):
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '83', 'language_id_whole_page_fasttext': "{'en': 0.883247971534729}", 'metadata': "{'Content-Length': '62992', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KEGE74DWM4FZYHWW7R4AXWVZJBW6KAHR', 'WARC-Concurrent-To': '<urn:uuid:34fefc11-3ed8-416b-85b1-e6bb2c112675>', 'WARC-Date': datetime.datetime(2015, 3, 2, 7, 19, 17), 'WARC-IP-Address': '77.81.240.166', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:AHLNQPBPAKZXHSBY2ASOK2P6WZYYVC36', 'WARC-Record-ID': '<urn:uuid:323e7c48-c085-4573-bf37-993b81fd57ba>', 'WARC-Target-URI': 'http://muscle.iuhu.org/2013/02/best-bodybuilding-supplement-could-it-be-beta-alanine/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c07f85ba-1a91-4648-b24c-249df2bd3043>', 'WARC-Truncated': None}", 'previous_word_count': '488', 'url': 'http://muscle.iuhu.org/2013/02/best-bodybuilding-supplement-could-it-be-beta-alanine/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.043327510356903076', 'original_id': 'c8c5dafa69fe06434136ab5c7c07898d119f20042ebd5dfd3e4704fbbc36405c'}
 Interview with Mr. Adnan Oktar by Sevim Songun, Hürriyet Daily News, 20 February 2009 ·   You are engaged in various activities both in Turkey and internationally against the theory of evolution. These include the books you bring out and fossil exhibitions. Can we say that there is today a higher level of belief in creation compared to the theory of evolution? ADNAN OKTAR: Of course, public opinion polls make that clear. Thirty years ago the level of belief in Darwinism was around 70%-80%, while it has now fallen to around 20%-30% in many countries, and will decline still further as time passes. But we must not ignore the repressive system of the Darwinist-materialist ideological dictatorship. Darwinists are trying to keep this false ideology alive by establishing a mafia-like dictatorship. The theory of evolution is under official protection in almost 95% of the countries of the world and is ideologically imposed as an official ideology, even though its invalidity has been scientifically proved and despite it being a false theory that violates both reason and logic. Academics and scientists who do not believe in Darwinism are sacked, students are forced to give answers in favor of evolution in school exams, and certain newspapers and magazines engage in constant Darwinist propaganda by the use of such unrealistic headlines as “Our ancestors were microbes” or “A new transitional fossil has been discovered.” Since they have no scientific response to scientific findings that reveal the invalidity of Darwinism they seek to keep it alive by anti-democratic methods, pressure and imposition. But that imposition no longer does Darwinists any good because the truth has come out. Darwinists kept the fossil record carefully hidden away for 150 years, but when 100 million fossils were placed before people’s eyes they were absolutely amazed. There is no need to go into great detail about the invalidity of evolution for anyone who has seen such fossils. When we put a 150-million-year-old fossil spider alongside a living spider and ask if there is any difference between them, people can see with their own eyes and acknowledge that there is none at all. So where is evolution in all that? They claim that all life forms assumed their present states by gradual changes over long periods of time. So why is a 150-million-year-old spider identical to one living today? This means that evolution never happened. Even primary school children can easily see that, and there is nothing lengthy, complicated or incomprehensible about it. The revelation of these clear proofs has spelled the end of Darwinism. When my Atlas of Creation first reached Europe, I said “The true enlightenment of Europe has just begun, and in a while when surveys are conducted and people are asked their opinions you will see that the numbers of believers in Darwinism decrease by the day.” And that is just what happened. For example, in a poll by the French journal Science Actualités, the level of people who believe that human beings did not come into existence through evolution was 92%, with only 5% believing in evolution. According to another survey by the well-known German daily Süddeutsche Zeitung, 85% of people believe that human beings are the work of a Creator, with only 9% thinking the theory of evolution is true. In a poll conducted by Die Welt, 86% of respondents answered, “Allah (God) created it” when asked how they thought life came into being. Another survey that clearly revealed the change of heart going on in Europe was one by Blick, published in Switzerland. In that poll, 85% of people believed in Creation compared to 8% for evolution. The Belgian daily De Morgen wrote, “Eight people out of 10 think the theory of evolution is utter nonsense.” In a poll on the web site of the Danish daily Ekstra Bladet, 88% of Danes answered “No” to the question “Do you think human beings are descended from apes?” A poll by the Swiss magazine Factum reported that the Swiss public want Creation to be taught in schools too. Polls among teachers in Britain have also revealed that teachers think Creation should also be taught in schools. ·   If that is so, to what extent can this increase in the numbers of people believing in creation be ascribed to your work? What is Turkey’s position in global terms? Do you think it is evolution or creation that is in the lead? ADNAN OKTAR: Let me say plainly that my works contain the most influential, striking and concrete proofs on the subject of Darwinism. Apart from mine, there are virtually no other such courageous and active works based on so rational, technical and scientific proofs, that set out facts that cannot be refuted, in either Turkey or internationally. We have never seen Darwinists go into such a panic in the face of any other work. Various works on Creation have been published in America and Europe for some years now, and documentaries on the subject have been made, but none have elicited the kind of response my Atlas of Creation has. They have suffered such a huge shock that they are at a loss how to neutralize this very powerful concept. But the people of Europe have now seen the truth, and there can be no putting the clock back. If you put dozens of people in a room and draw the curtains and then say, “There is no Sun,” just one person seeing a bit of light through the tiniest crack is sufficient to put the matter to rest. You can never convince anyone the Sun does not exist. They can carry as many “Our ancestors were microbes” reports as they like, or bring in whatever bans they wish, and seek to hinder those involved in this intellectual struggle with whatever lies or false allegations they choose, but the result will still be the same. The Turkish nation has always been devoted to national and spiritual values. It has never really taken Darwinism seriously. Although at some times, in the 1970s, the level of those who said that they believed in evolution rose to as high as around 70% due to the influence of certain circles, today that figure has fallen to 5%-10%. In my view, in fact, the true figure is even lower, but some people, particularly some academics and scientists, are reluctant to express their true opinions because of Darwinist pressure. Turkey is the country with the very lowest level of belief in evolution. Evolution has come to an end in Turkey over the last 30 years. Of course, the instruments in this, by Allah’s leave, have been the tens of books I have written on the subject, the more than 2000 conferences staged by the Science Research Foundation in many different towns and provinces, scientific exhibitions and other meetings. The Turkish public have now seen that Darwinism is the worst fraud in the history of science and it is no longer possible for them to believe in evolutionary lies. ·   To what extent has your work been responsible for the decline in belief in the theory of evolution? ADNAN OKTAR: Our work is mainly responsible for the defeat of evolution. Had other work played a role we would have seen that before. Darwinism would have begun contracting in Europe before the arrival of my books, but there was nothing on this scale before the Atlas of Creation. Darwinists were still able to mock the public to their heart’s desire. But Darwinists suddenly hit a steel wall when the public saw the Atlas of Creation. A serious awakening, a huge cultural change commenced. You can see the signs of this if you look closely at the European press. You can find more detail on the subject from the web site www.harunyahyaimpact.com. All the press reports in Europe describing the struggle against Darwinism refer to the Atlas of Creation. This has appeared time and time again in such newspapers as the Guardian and the Independent. The Vatican issued a statement a few months ago, saying “We thank Muslims for restoring belief in God to Europe.” Why? Because the Vatican was also tied hand and foot and powerless in the face of the Darwinist dictatorship. But by Allah’s leave, the Atlas of Creation hit Darwinists just where it hurt, when they were least expecting it. Darwin himself says, “My theory will collapse if no transitional fossils are discovered.” That is the reality we have broadcast. I announced that, just as Darwin said, no transitional forms have been found and that the theory of evolution has therefore collapsed. ·   Is there any room in Islam for the theory of evolution? ADNAN OKTAR: There are no scientific facts or evidence to show that evolution ever happened. Ever since the publication of Darwin’s book in 1859, Darwinists have been looking for evidence to support evolution, but have come up empty-handed for the last 150 years. What logic is there in believing in a theory devoid of any evidence? Allah could have created life through evolution, and we would then have seen evidence of that and said “Our Lord created us by way of evolution.” But there is no such evidence, and no verses to that effect in the Qur’an. Those who claim that there is room for evolution in Islam are unable to explain how the angels and jinn were created. It is described in the Qur’an how the Prophet Jesus (as) blew onto a bird-shaped piece of clay and how that bird then flew away, as a miracle from Allah. They cannot account for that in terms of evolution. How did a flying, breathing life form appear? Can they say it was through evolution? They cannot. They cannot account for the Prophet Moses’s (as) staff turning into a serpent. His staff transformed into a living thing able to digest and reproduce. Can evolution account for it? All efforts to reconcile evolution and Islam are therefore in vain, and they should not waste their time on the subject. ·   Can someone be a good Muslim and also believe in the theory of evolution at the same time? ADNAN OKTAR: Some Muslims used to hold a defeatist attitude in the face of evolution. Since they have not known how to overcome evolution they have adopted a path supposedly intended to reconcile Islam and evolution, out of a fear of complete defeat. This stems partly from ignorance and partly out of fear of the Darwinist dictatorship’s power. People were indoctrinated to think that evolution is something scientific and that to oppose evolution meant flying in the face of science. The fact is, however, that nobody who thinks scientifically can accept evolution. Proponents of science oppose evolution, because evolution is a series of frauds and deceptions. It is unable to account for the emergence of even a single protein. Its only answer to the question of how life emerged is to say that the first living cell appeared from inside a pile of mud, over a long period of time, under the effect of storms and lightning. In other words, stone, earth and mud supposedly decided among themselves to make a living cell. Once enough time had passed, that stone even turned into human beings who examine the structure of the atom, travel into space, build shuttles, and found magnificent cities. Even a child would laugh at that. It is amazing how rational, educated people can believe in such a fairy tale. ·   What do you think of the theory of evolution being taught in text books? ADNAN OKTAR: I favor freedom, and am someone who supports the free expression of all ideas. Of course, I think evolution should be taught in schools. It will be very useful for young people to see the kind of comedy people once believed in, and to draw the appropriate conclusions from the way people were taken in by irrational fairy stories. We are now in the age of the internet, and whether or not students are taught Creation in schools, even if evolution is imposed as the truth, they still learn the true facts over the internet. They listen with a kind of fascination to people who tell them primitive tales left over from the 1800s and are amazed at the kind of minds still capable of espousing evolution. But the right thing to do, the democratic thing, is for Creation to be taught in schools alongside evolution. In teaching about evolution, young people must also be told how scientific research, the fossil record, findings and data all refute evolution. But a one-sided and continual imposition of a lie is wrong. ·   Your most important work would seem to be proving that evolution is wrong. Do you think that is the most important subject in Islam? ADNAN OKTAR: When, during my high school years, I looked into the causes of the disasters afflicting the world, the wars and revolutions, I realized what a terrible scourge Darwinism is. Darwinism has never remained as purely a matter of science. Were that the case, it would have been consigned to the waste bin, like all false theories, when the scientific facts were observed not to confirm evolution. Nobody would persist in espousing evolution. Darwinism is supported on ideological grounds, and is imposed because it represents the foundation of materialism and atheism. There can be no materialism without Darwinism, and no communism, fascism, savage capitalism or terror without materialism. But if you keep telling people that man is supposedly a species of animal, that life is a pitiless battleground and that one has to be ruthless in order to survive, then these scourges will never end. And then you will have to try and find an answer to this terror, anarchy and slaughter. But you obviously cannot fight mosquitoes effectively without drying up the swamps they breed in. We must first dry up the breeding grounds, that is Darwinism, and then you will see that people will inherit a delightful, enlightened and love-filled world. 2009-02-28 18:31:00 © 1994 Harun Yahya. www.harunyahya.com - info@harunyahya.com
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '62', 'language_id_whole_page_fasttext': "{'en': 0.968149960041046}", 'metadata': "{'Content-Length': '66472', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:DRTV4HXL6QVOCFVB3DFOQ7UAVCBTWANM', 'WARC-Concurrent-To': '<urn:uuid:200b5be8-fe23-4fb9-a35f-913d9d2e3e12>', 'WARC-Date': datetime.datetime(2015, 5, 6, 18, 31, 5), 'WARC-IP-Address': '54.197.239.133', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:IXLF4CSJCXVWP3DIHDDF5T3XOUWVF3EK', 'WARC-Record-ID': '<urn:uuid:f213d6f3-8b41-42d2-93e9-abc4a0f3bc51>', 'WARC-Target-URI': 'http://www.harunyahya.com/en/Makaleler/12907/Interview-with-Mr-Adnan-Oktar-by-Sevim-Songun-Hurriyet-Daily-News-20-February-2009', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c3fb4dcc-a3dd-412f-8690-0cee0bbf0aa9>', 'WARC-Truncated': 'length'}", 'previous_word_count': '2410', 'url': 'http://www.harunyahya.com/en/Makaleler/12907/Interview-with-Mr-Adnan-Oktar-by-Sevim-Songun-Hurriyet-Daily-News-20-February-2009', 'warcinfo': 'robots: classic\r\nhostname: ip-10-235-10-82.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-18\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for April 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.15213263034820557', 'original_id': '9d41b2e08ad9ec8e7bef95f773674fd943621f3fd81a77987d3a7f0fe8d73fad'}
Skip to end of metadata Go to start of metadata Shows how to access databases from OSGi applications running in Karaf and how to abstract from the DB product by installing DataSources as OSGi services. Some new Karaf shell commands can be used to work with the database from the command line. Finally JDBC and JPA examples show how to use such a DataSource from user code. You need an installation of apache karaf 3.0.3 for this tutorial. Example sources The example projects are on github Karaf-Tutorial/db. Drivers and DataSources In plain java it is quite popular to use the DriverManager to create a database connection (see this tutorial). In OSGi this does not work as the ClassLoader of your bundle will have no visibility of the database driver. So in OSGi the best practice is to create a DataSource at some place that knows about the driver and publish it as an OSGi service. The user bundle should then only use the DataSource without knowing the driver specifics. This is quite similar to the best practice in application servers where the DataSource is managed by the server and published to jndi. So we need to learn how to create and use DataSources first. The DataSourceFactory services To make it easier to create DataSources in OSGi the specs define a DataSourceFactory interface. It allows to create a DataSource using a specific driver from properties. Each database driver is expected to implement this interface and publish it with properties for the driver class name and the driver name. Introducing pax-jdbc The pax-jdbc project aims at making it a lot easier to use databases in an OSGi environment. It does the following things: • Implement the DataSourceFactory service for Databases that do not create this service directly • Implement a pooling and XA wrapper for XADataSources (This is explained at the pax jdbc docs) • Provide a facility to create DataSource services from config admin configurations • Provide karaf features for many databases as well as for the above additional functionality So it covers everything you need from driver installation to creation of production quality DataSources. Installing the driver The first step is to install the driver bundles for your database system into Karaf. Most drivers are already valid bundles and available in the maven repo. For several databases pax-jdbc already provides karadf features to install a current version of the database driver. For H2 the following commands will work Strictly speaking we would only need the pax-jdbc-h2 feature but we will need the others for the next steps. This will install the pax-jdbc feature repository and the h2 database driver. This driver already implements the DataSourceFactory so the last command will display this service. The pax-jdbc-pool-dbcp2 feature wraps this DataSourceFactory to provide pooling and XA support. pooled and XA DataSourceFactory Technically this DataSourceFactory also creates DataSource objects but internally they manage XA support and pooling. So we want to use this one for our later code examples. Creating the DataSource Now we just need to create a configuration with the correct factory pid to create a DataSource as a service So create the file etc/org.ops4j.datasource-tasklist.cfg with the following content config for DataSource The config will automatically trigger the pax-jdbc-config module to create a DataSource. • The name osgi.jdbc.driver=H2-pool-xa will select the H2 DataSourceFactory with pooling and XA support we previously installed. • The url configures H2 to create a simple in memory database named test. • The dataSourceName will be reflected in a service property of the DataSource so we can find it later • You could also set pooling configurations in this config but we leave it at the defaults So when we search for services implementing the DataSource interface we find the person datasource we just created. When we installed the features above we also installed the aries jndi feature. This module maps OSGi services to jndi objects. So we can also use jndi to retrieve the DataSource which will be used in the persistence.xml for jpa later. jndi url of DataSource Karaf jdbc commands Karaf contains some commands to manage DataSources and do queries on databases. The commands for managing DataSources in karaf 3.x still work with the older approach of using blueprint to create DataSources. So we will not use these commands but we can use the functionality to list datasources, list tables and execute queries. jdbc commands We first install the karaf jdbc feature which provides the jdbc commands. Then we list the DataSources and show the tables of the database accessed by the person DataSource. This creates a table person, adds a row to it and shows the table. The output should look like this select * from person Accessing the database using JDBC The project db/examplejdbc shows how to use the datasource we installed and execute jdbc commands on it. The example uses a blueprint.xml to refer to the OSGi service for the DataSource and injects it into the class DbExample.The test method is then called as init method and shows some jdbc statements on the DataSource.The DbExample class is completely independent of OSGi and can be easily tested standalone using the DbExampleTest. This test shows how to manually set up the DataSource outside of OSGi. Build and install Build works like always using maven In Karaf we just need our own bundle as we have no special dependencies After installation the bundle should directly print the db info and the persisted person. Accessing the database using JPA For larger projects often JPA is used instead of hand crafted SQL. Using JPA has two big advantages over JDBC. 1. You need to maintain less SQL code 2. JPA provides dialects for the subtle differences in databases that else you would have to code yourself. For this example we use Hibernate as the JPA Implementation. On top of it we add Apache Aries JPA which supplies an implementation of the OSGi JPA Service Specification and blueprint integration for JPA. The project examplejpa shows a simple project that implements a PersonService managing Person objects. Person is just a java bean annotated with JPA @Entitiy. Additionally the project implements two Karaf shell commands person:add and person:list that allow to easily test the project. Like in a typical JPA project the peristence.xml defines the DataSource lookup, database settings and lists the persistent classes. The datasource is refered using the jndi name "osgi:service/person". The OSGi JPA Service Specification defines that the Manifest should contain an attribute "Meta-Persistence" that points to the persistence.xml. So this needs to be defined in the config of the maven bundle plugin in the prom. The Aries JPA container will scan for these attributes and register an initialized EntityMangerFactory as an OSGi service on behalf of the use bundle. We use a blueprint.xml context to inject an EntityManager into our service implementation and to provide automatic transaction support. The following snippet is the interesting part: This makes a lookup for the EntityManagerFactory OSGi service that is suitable for the persistence unit person and injects a thread safe EnityManager (using a ThreadLocal under the hood) into the PersonServiceImpl. Additionally it wraps each call to a method of PersonServiceImpl with code that opens a transaction before the method and commits on success or rollbacks on any exception thrown. Build and Install A prerequisite is that the derby datasource is installed like described above. Then we have to install the bundles for hibernate, aries jpa, transaction, jndi and of course our db-examplejpa bundle. See ReadMe.txt for the exact commands to use. Then we list the persisted persons In this tutorial we learned how to work with databases in Apache Karaf. We installed drivers for our database and a DataSource. We were able to check and manipulate the DataSource using the jdbc:* commands. In the examplejdbc we learned how to acquire a datasource and work with it using plain jdbc4.  Last but not least we also used jpa to access our database. Back to Karaf Tutorials
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8413633108139038}", 'metadata': "{'Content-Length': '58459', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OZ2MFYMLEP4TZR3FG3QQWFWEP6LFWMH2', 'WARC-Concurrent-To': '<urn:uuid:3bf1da6c-02c4-4a56-9326-4a4b3bdd29fb>', 'WARC-Date': datetime.datetime(2016, 7, 30, 3, 28, 5), 'WARC-IP-Address': '85.25.36.80', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:SU5QQHZ4FT4Q6RDGRMLDSBJAYLZMUHP2', 'WARC-Record-ID': '<urn:uuid:d60276a0-43c1-47db-bc61-3ccb1b18895d>', 'WARC-Target-URI': 'http://www.liquid-reality.de/display/liquid/2012/01/13/Apache+Karaf+Tutorial+Part+6+-+Database+Access', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2195499f-7f8f-401e-b031-32c6a682eb09>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1320', 'url': 'http://www.liquid-reality.de/display/liquid/2012/01/13/Apache+Karaf+Tutorial+Part+6+-+Database+Access', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-27-174.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2016-30\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for July 2016\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.029881775379180908', 'original_id': '2a42ad4b730d59dfc2a8466ee429503aabbb99879cc01e60ce858683129ca961'}
<div class="modal fade" id="addClientModal" tabindex="-1" role="dialog" aria-labelledby="addClientLabel"> <div class="modal-dialog" role="document"> <div class="modal-content"> <div class="modal-header modal_bg"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">&times;</span></button> <h4 class="modal-title" id="addClientLabel">New Client</h4> </div> <div class="modal-body modal_bg"> <form class="form-horizontal" role="form" method="POST" action="{{ url('client.store') }}"> {!! csrf_field() !!} <div class="form-group{{ $errors->has('c_kvk') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">KVK nr. *</label> <div class="col-md-6"> <input type="text" class="form-control" id="c_kvk" name="c_kvk" value="{{ old('c_kvk') }}" required> @if ($errors->has('kvk')) <span class="help-block"> <strong>{{ $errors->first('c_kvk') }}</strong> </span> @endif </div> </div> <div class="form-group{{ $errors->has('c_name') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">Name *</label> <div class="col-md-6"> <input type="text" class="form-control" name="c_name" value="{{ old('c_name') }}" required> @if ($errors->has('c_name')) <span class="help-block"> <strong>{{ $errors->first('c_name') }}</strong> </span> @endif </div> </div> <div class="form-group{{ $errors->has('c_type') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">Type</label> <div class="col-md-6"> <input type="text" class="form-control" name="c_type" value="{{ old('c_type') }}"> @if ($errors->has('c_type')) <span class="help-block"> <strong>{{ $errors->first('c_type') }}</strong> </span> @endif </div> </div> <div class="form-group{{ $errors->has('c_postcode') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">Postcode *</label> <div class="col-md-6"> <input type="text" class="form-control" name="c_postcode" required> @if ($errors->has('c_postcode')) <span class="help-block"> <strong>{{ $errors->first('c_postcode') }}</strong> </span> @endif </div> </div> <div class="form-group{{ $errors->has('c_street') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">Street *</label> <div class="col-md-6"> <input type="text" class="form-control" name="c_street" required> @if ($errors->has('c_street')) <span class="help-block"> <strong>{{ $errors->first('c_street') }}</strong> </span> @endif </div> </div> <div class="form-group{{ $errors->has('c_city') ? ' has-error' : '' }}"> <label class="col-md-4 control-label">City *</label> <div class="col-md-6"> <input type="text" class="form-control" name="c_city" required> @if ($errors->has('city')) <span class="help-block"> <strong>{{ $errors->first('c_city') }}</strong> </span> @endif </div> </div> {{-- <div class="form-group"> --}} {{-- <div class="col-md-6 col-md-offset-4"> --}} {{-- </div> --}} {{-- </div> --}} </div> <div class="modal-footer modal_bg"> <button type="button" class="btn btn-default btn-xs" data-dismiss="modal">Close</button> <button type="submit" class="btn btn-primary btn-xs"> <i class="fa fa-btn fa-user"></i> Register </button> </div> </div> </form> </div> </div> <script type="text/javascript"> @if (count($errors) > 0) $('#addClientModal').modal('show'); @endif </script>
common_corpus
{'identifier': 'https://github.com/makten/uni-kans-project/blob/master/resources/views/auth/addclient.blade.php', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '', 'title': 'uni-kans-project', 'creator': 'makten', 'language': 'PHP', 'language_type': 'Code', 'word_count': '284', 'token_count': '1312', '__index_level_0__': '11215', 'original_id': '0c293d80ff96c1e66108090f279a3a739d307902ce5591b8252202ff95a0390f'}
29 May 2012 Whenever conversation turns to the subject of hospitality in Paris - which is to say, very, very often - I try to remind myself and others that its general absence is something for which we ought to be thankful. It's what makes Paris, perversely, a land of opportunity: almost any business model presently existent in the city can be very simply improved, to the point of crushing all competition, by the addition of what the natives routinely neglect, namely smiles and goodwill. One doesn't even have to be good at something - one can just be nice. Here any Paris business-owner will scoff, mentally shaking this writer by his lapels, crying, 'Don't you think we've tried?' It's more than one establishment can hope to achieve, to change an entire nation's outlook towards service. Well, there's a trick. You just don't hire many French people.* 6ème arrondissement bistrot / expat hub Fish La Boissonerie sort of pioneered this strategy, and if, thirteen years on, the restaurant's cuisine and its wine list both show their age, great hospitality, thankfully, remains timeless. 25 May 2012 When I mentioned to a friend that cave-à-manger pioneers Le Verre Volé were to open an épicerie beside their well-established wine shop location on rue Oberkampf, his initial reaction was, 'Geez, they're taking over the world.' Then we reflected and realised, no, that wasn't the case at all. Given the high visibility and worldwide renown of their perpetually-thronged cave-à-manger by the Canal Saint Martin, it's actually astonishing that owner Cyril Bordarier hasn't done more with the brand in ten plus years. Total expansion, as far as I know, has until now amounted to the aforementioned wine shop, and a renovation of their dining room in 2010. On the one occasion I tried to purchase several cases of wine from the canal-side location for a nearby shop opening, there wasn't enough of anything in stock* and I had to go elsewhere. Meanwhile, any regular clients of the Oberkampf location will know already that its patron, the other Cyril, a good guy once you get to know him, possesses all the salesmanship and commercial ambition of a hedgehog. Naturally, all this is incomprehensible to the impatient, money-hungry American in me. Were I the one who'd built up such an iconic purple wine concept, there would be a US and UK import business and a theme park ride by now. On the other hand, that's why Le Verre Volé remains cool: they haven't, as yet, shilled much swill, and their sprezzatura - the art of hospitality without seeming to expend effort - is, for a technical reason, faultless. With their new venture, which officially opens its doors tomorrow, Le Verre Volé is, thankfully, quite unlikely to unsettle its sterling reputation: it is an épicerie, selling cheeses, meats, and other artisanal foodstuffs, along with sandwiches. 23 May 2012 This past fall my friend / colleague R and I were sent to Barcelona to install a display in a department store. I was delighted to at last get the opportunity to travel for work – until it dawned on us that, due to insufficiently devious planning on our part, we would be staying in the city only 24 hours, and the nature of our task obliged us to work through the night, denying us even a single night out to explore the city, drink heavily, pee in the streets, wear funny hats, solicit hookers, etc. There was nothing for it but to reflect, ruefully, that this is why it’s called work travel. Nonetheless, after arrival and check-in at our hotel we had a solid six hours to kill before installation of our company’s stand could begin, and I was hell-bent on packing in as much questing semi-informed wine tourism as possible. Our first stop was to Monvínic, a place my friend Cesar Pou of Terroirs Santo Domingo Imports had described to me as Barcelona’s premier wine bar, the ground zero for wine geeks in the city. Aware of my tastes, he had warned me it was a little futuristic – a disclaimer that, in the case of Monvínic, is like saying the Vatican is religious-affiliated. 21 May 2012 One uses metaphorical language to describe wine because our language is under-equipped with literal terms to describe taste and smell. Whatever scent molecules produce the smell of violets surely have a technical name, but it would be vastly less informative to employ it in describing the nose of a glass of wine. Metaphor, in winespeak, is a form of shorthand. Unfortunately, in most other genres, metaphor is a form of indulgence. (C.f. any Tom Friedman column.) It's why reading reams of tasting notes is so tiring. To process metaphor-heavy winespeak in the first place requires a mental adjustment, even for someone who employs such language often. And the impact is diluted the more one reads it. I sometimes fancy that in a perfect world, writers would be penalized for applying such descriptions as, 'An explosion of glimmering blueberryfruitlaced with woodsmoke and bacon' to anything found at, say, Tesco's. In such a world, where hyperbole were reserved for special occasions, it would be a lot simpler to do descriptive justice to rightly famous mouth-watering appellations like Chambolle-Musigny, and in particular - simply because they're the ones I've tasted most recently - the wines of Domaine François Bertheau, which estate was the last stop of our whirlwind Burgundy road trip last fall. 16 May 2012 The fleetofestablishments launched this past decade plus that nominally hark back to some hazy olde England ideal is staggering, and perhaps it is a sign the trend is nearly dead in the water that even the French - historically somewhat resistant to Brit nostalgia - are leaping aboard. Albion (another one!) is a genteel cave-à-manger opened near Métro Poissonière last year by two longtime Paris expats, Haydon Clout and Matt Ong, who'd previously tended bar and cheffed, respectively, at 6ème natural wine standby Fish. Albion, which serves mediteranean food alongside French wines, has been more or less thronged since opening, and not just by expats. The irony, of course, is that for better or for worse the only remotely British elements of the restaurant are the ownership (just Ong), the warm(er) service, and the relative spaciousness of the place. Sticklers will point to the odd Elizabethan dessert recipe, and the presence of a British cheese on the cheese plate. But I suspect the success of the Albion the restaurant is due much less to effective branding (it's not) than to how Clout and Ong are cleverly offering 6ème restaurateurism - with its conservatism, and its relative professionalism - to a heretofore underserved market of 10ème gentrification. 14 May 2012 It's axiomatic that French wine towns contain great bistros. Less of a given, though, is how many great bistros. It often happens that a wine town receives major tourist traffic only at sporadic moments throughout the calendar, with the result that the local economy sustains just one great bistro, and that is precisely where every traveling importer, sommelier, caviste, etc. wants to be at those sporadic moments. So we wound up at what I imagine must fast be becoming a semi-renowned consolation restaurant for traveling wine geeks: Les Deux Maisons, a cartoonishly ugly place in the corporate-provincial style, inauspiciously situated in the parking lot of an E. Leclerc supermarket - in sum, a restaurant where one would certainly never dare to set foot, were one not aware beforehand that since 2005 its been owned by Daniel Haudebault, proprietor of Bistrot de la Place. 09 May 2012 The Native Companion moved into a new apartment recently in a different part of town. On the one hand this will mean an awkward trafficky Velib ride whenever we wish to see each other. But on the other hand it's a joyous occasion, because she's no longer living across the hall from a clingy overly-familiar drunk woman, and because now we (me and the NC, not the clingy drunk) get to explore a whole other part of town together. The other afternoon we were walking down one of the streets in her new neighborhood and, as is my wont, I peered quickly inside a more or less pokey-looking cave called Le Vin de Julien to see what was what. We were hurrying to a brocante before the NC had to work that evening, and so were a bit unprepared for what followed, which was an amusingly opinionated rapid-fire tasting session in the company of the eponymous cave's proprietor, Julien Arnaud, and a fellow who turned out to be the writer of a European dining guide, Roger Feuilly. 07 May 2012 I got a kick out of Japanese Rhône winemaker Hirotake Ooka's apron the other day at Caves Augé's Rhône tasting. What on earth can these two things have in common? Actually, I'm told Japan has a pretty thriving and enthusiastic* natural wine scene (as excellently reported here by the far-roaming and indispensable Bertrand Celce). Unfortunately, despite being half-Japanese and working for a Japanese company, I haven't been to said nation since my first and only voyage there at age eleven. I wasn't into natural wine then. It doesn't help that I didn't then and do not now speak Japanese. As I tasted through Ooka's wines that day we conversed in French, and the irrelevant coincidence of both being Japanese natural wine afficionados went unmentioned and probably unnoticed on his end, since physionomically I take after my Jewish mother. Of Ooka's wines that I've tasted, I'm most impressed by his sparkling Saint Peray. Over dinner at Vivant recently, and again at the Augé tasting, the 2006 was delicate, white-floral, and expressive, a fine example of what makes the Saint Peray appellation such an appealing corner of the sparkling wine world. 02 May 2012 I agree to attend blind tastings for various reasons, none involving having any aptitude at blind tasting. I'm actually sort of the Mr. Magoo of blind tastings, doddering along making vague assumptions despite several major educational potholes in my path. Bordeaux, older Burgundy, most serious Rhône stuff... Whether or not I manage to identify the wines under discussion, the discussion itself is always illuminating, because it offers an opportunity to compare one another's tasting habits. The very informal tastings my friend A has been organising lately also present fine occasions to sit around talking shop with fellow wine dudes, a pastime that I find has become more enjoyable since I stopped working in wine. The first of these tastings was held at a cave that was new to me then, but which has fast become a favorite: Aux Anges, by Faidherbe-Chaligny on the 11ème / 12ème divide. Like any good wine shop, Aux Anges is something more than one. There's a broad, well-chosen selection, invitingly priced, balanced between capital-N natural winemakers and those who practice some degree of lutte raisonée. Plates of charcuterie and cheese are available at apéro hours. And the tables inside are complemented by three small ones outside on rue Faidherbe, making Aux Anges a wonderful terrace hideaway for early spring evenings.
mini_pile
{'original_id': 'e42e58efaf6e0da1895c062093325e28182b1073cd1630f09aa7873ba7183f78'}
module github.com/rajivbaviskar03/throttled go 1.12 require ( github.com/gin-gonic/gin v1.4.0 github.com/go-redis/redis v6.15.2+incompatible github.com/gomodule/redigo v2.0.0+incompatible github.com/hashicorp/golang-lru v0.5.1 golang.org/x/lint v0.0.0-20190409202823-959b441ac422 // indirect )
common_corpus
{'identifier': 'https://github.com/rajivbaviskar03/throttled/blob/master/go.mod', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'BSD-3-Clause', 'date': '2019.0', 'title': 'throttled', 'creator': 'rajivbaviskar03', 'language': 'Go Module', 'language_type': 'Code', 'word_count': '19', 'token_count': '147', '__index_level_0__': '4164', 'original_id': '9a4d9dc0c5b22f9c0ca2341f5edbd0fa40d165903ddeaaeaaf621a0d8b043395'}
Posts: 12,581 Registered: ‎01-26-2011 E1000 - Website Blocking I have Cisco linksys E1000 and I want to block certain websites on my network. How do I do that? Posts: 2,785 Registered: ‎09-07-2006 Re: E1000 - Website Blocking You can easily do that using the Parental Controls feature of Cisco Connect. You can find more details on how do that here:
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.7734549045562744}", 'metadata': "{'Content-Length': '116742', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:EOTECFKPUC5GVTQ5TCGEMLHKEXLUDHXZ', 'WARC-Concurrent-To': '<urn:uuid:723c40ac-533a-47b8-bbcc-ce7a609d3818>', 'WARC-Date': datetime.datetime(2017, 8, 21, 8, 23, 45), 'WARC-IP-Address': '208.74.204.125', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:XZNPGSIKHPPNRGOJQFSSIX4VM6HXDG5R', 'WARC-Record-ID': '<urn:uuid:542a8bce-a7b2-41fb-8d4f-a976d0a0fcdf>', 'WARC-Target-URI': 'http://community.linksys.com/t5/Social-Media-Support/E1000-Website-Blocking/td-p/405033?nobounce', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a587099d-2600-4c0e-85e1-3dc54300ac41>', 'WARC-Truncated': None}", 'previous_word_count': '58', 'url': 'http://community.linksys.com/t5/Social-Media-Support/E1000-Website-Blocking/td-p/405033?nobounce', 'warcinfo': 'robots: classic\r\nhostname: ip-10-166-12-144.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-34\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for August 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.27807706594467163', 'original_id': '28f45834787b58b64f85c59537629b299921d78d720dd2bed483f2f6f0578c2a'}
The National Highway has turned into slush at many places on the Assam-Tripura border due to heavy rain. Highlights The National Highway has turned to slush at many places due to rain More than 1,000 trucks have been stranded on the highway for over a week Supplies of essentials like food and medicines held up, prices are rising Locals complain the efforts to fix the road has been inadequate. The highway has remained unnavigable for at least a week. A single earth mover was seen trying to clear the slush on one stretch. For over a week, more than 1,000 trucks have been stranded on the Assam-Tripura border. Many of them, like 37-year-old Vikram Das's truck, are carrying essential supplies like food, medicines and fuel into the landlocked state. But it's not an agitation that holding these trucks up; it's just rain.Heavy rains have lashed both Assam's Barak Valley region and Tripura for the last 10 days. This has meant Tripura's only road connection to the rest of the country, National Highway 44 (renamed National Highway 8 under the new system), has turned into slush at many places.One of those places is right at the border of both states, where Vikram's truck has been stuck. "I have been here for a week. I have no money left. God knows when this will be cleared," he said.On parts of the highway, the efforts to clear the road seem inadequate, locals complain. On one stretch for instance, a single earthmover machine, and some enterprising truck drivers, are helping those who can muster up the courage, to wade through the slush and move ahead.All of this means, that Tripura, especially capital Agartala, is facing an acute shortage of fuel, and prices of most other essentials have shot up.Tripura is fully dependent on this highway for supply of essentials, food grain, fertilisers, petroleum products, construction materials and other commodities from different states of India."Tripura is crying for restoration of its only National Highway and has taken all-out efforts to convince both Central and Assam government about the dangerous situation of the highway but both governments have remained indifferent," Tripura Transport Minister Manik Dey said on Saturday.An official of the food and civil supplies department said that almost all the 60 petrol pumps are running dry for the past one week causing unprecedented problems to the people.The situation has worsened as train services between Tripura, Mizoram, Manipur, southern Assam and rest of India remain cancelled for more than 45 days now, due to damaged railway tracks in the mountainous Dima Hasao district of Assam due to rains and landslides.The BJP's Tripura state President Biplab Deb held a meeting with the Assam Chief Minister Sarbananda Sonowal and Assam's Roads and Highways Minister Parimal Shuklabaidya a few days ago, and says he has been assured of all steps to restore road traffic in the region at the earliest.
mini_pile
{'original_id': '2b0a63f3462565b05a5022402d4c5feed9a16e4d784fab660081be95a1164d0a'}
Friday, April 22, 2011 What I want back is what I was: deconstructing past career goals What I want back is what I was Before the bed, before the knife, Before the brooch-pin and the salve Fixed me in this parenthesis; Horses fluent in the wind, A place, a time gone out of mind. -Sylvia Plath, "The Eyemote" I've told the story before of how I almost went to Smith College (yes, Plath went there, but that wasn't the only reason I wanted to), so I will be brief about it now. But I was over at the Define Functioning site, which I love, and this thread about deconstructing and reconstructing your previous career goals, really got to me. I almost went to a somewhat elite institution as a student above the "traditional age" when I was 24. And that was when I became psychotic. So, instead of getting to Northampton, I got into the Hannah Moore Homeless Shelter in Maryland. After my time at that shelter ran out, I ended up in my car, living. I was then offered a room in my online friend's former boyfriend's  condo, and I ended up living there for three years. When the three years ended, I wandered about, never able to keep a roof over my head. I lost my dreams. I had been an English major. I had a professor, who I'm still friends with now, in 1996, tell me at my community college in Florida (the one I also go to now) that I was definitely smart enough to go to a better school. I didn't believe him. He said, "Did you ever take the SAT? I bet you would blow away the verbal section." I had never had parents who cared if I took the SAT or not, and so, I never had ended up doing that. In fact I skipped my last year of high school, and got a GED instead.  But after this professor encouraged me to do it, just to see how I'd do, I took the SAT. I got an  800 on the verbal section, which is the highest possible score. (I did not do so well on the math, though!). This actually amazed me, because it meant that I might have the requirements to go to a decent college after all, despite years battling depression, anorexia, Chronic Fatigue Syndrome, and Fibromyalgia Plus More. Then I ended up moving to Maryland, (because I couldn't afford to live on my own and couldn't stay with my mother, so was given a roof over my head by my grandparents) where I met a professor who ran the honors program at the community college I attended there, and she convinced me to apply to Smith College, a school I had dreamed of going to, because I was a feminist and going to a women's college like that was something I thought would be an excellent experience. I had first learned of Smith by reading Plath as a depressed teenager, and  I was intrigued by the quality of the education there, not just by the fact that my favorite depressed poet went there. It's an excellent school, and  I could see myself blossoming there. They had five libraries. It was the place where I belonged.  I fell in love with the school when I visited it. I was beyond thrilled to get admitted. It was a real dream come true. But my mind couldn't hack it. While I was supposed to be planning to go to that college, I was delusional, thinking that people had abused me and making a lot of accusations that got me estranged from most of my family, which is how I ended up homeless in a city where I have dozens of relatives. I was doing crazy, manic things and I was really out of it. Then it got worse, and worse, and worse, over the following few years, while I was terribly paranoid, acutely psychotic, and never getting any real help except for some brief hospital stays where I was never correctly diagnosed. I reverted to self-injury. I rarely ate. I ended up in a lot of bad situations. I was raped. I didn't have support. I didn't have friends except online, and then most of those friends got  sick of me and my problems, and told me so, then abruptly left my life. The thing is, for the past few years, since 2005, I have had treatment and I have gotten progressively (to some degree) better. I have been able to return to the original community college, and get my AA degree. This was no small feat for me. It took years of work, tutoring, note takers from the office for students with disabilities, and it took a lot of time and effort. When I got that degree, I was really thrilled. But it still was not enough. I wanted a Master's degree. I still feel inadequate that I don't have a Master's degree. I still feel lost and empty because I'm not doing anything I really want to do in my life as far as work goes, and I don't think that I can. Right now I'm at a crossroads. I could stay in the Bachelor's program I am in at the community college, or I could, if I am even accepted (which I may not be), go to a university. That would take a lot of work on managing money and transportation, but it might be possible. What I don't know is if my brain could manage it. I'd have to get accommodations, and I'd probably have to go through the disabilities office to get permission to attend college part-time there. Even if I did all this, and my car managed the drive and kept running (I recently put $1,000 into my pathetic car, and this university is an hour away), I don't know that I could do it. My therapist suggested talking to a career counselor at the school. I work at the school, and I know who the career counselors are, and I don't want to talk to them about having a mental illness, and whether or not my brain can hack the degree I want. I don't think they would have any answers for me at all. I don't think anybody would. But I'm afraid I'm in a program for a degree that will never land me a job I really like, and what is the point of doing this if I can't do something I like in the end? I may never be able to work full time, or, on the other hand, I may mange it some day. But I know that what I need is a job I can enjoy at some level and have an income that would hopefully get me out of poverty. I'm not quite sure what to do. I know that I only have this one life to live, and a lot of it has been lost to serious mental illness, so I want to make the most of what I have left, and not allow this illness to rule my life any more than it has to. I know that there were legitimate reasons to why I never went to Smith College, or any other great college, why I never got an advanced degree, why I do not go to college full time, why I cannot work full time right now, but I want, I want, I want so much more than this out of my life. I am so tired of feeling like a pathetic loser because of what I have done being so pale in comparison to what I meant to do. I am so tired of feeling like I cannot speak to people who have advanced degrees because they will look down on me. I am so tired of being unfulfilled. But maybe I am doing the best I can, and maybe trying to do much more would be a total disaster.  I have gotten into a groove with the little job I have, the school I go to, the apartment I just moved into, the injections at the community mental health center every two weeks......Soon, I'll be losing the supports of my case manager and my therapist thanks to the crappy budget of the community mental health center. Soon, I'll have to be even more alert to my symptoms, on guard to them, carefully monitoring how the meds are doing because there will be no one else checking up on me. So I'm scared to make any major changes. I'm scared to try to go to the university. I'm very anxious, and have been for quite some time, about this. But there is this Ani Difranco song called, "Swan Dive", which I have loved for many years. These are some of the lyric .......But I've had a lack of inhibition I've had a loss of perspective I've had a little bit to drink And it's making me think That I can jump ship and swim That the ocean will hold me That there's got to be more Than this boat I'm in They can call me crazy if I fail All the chance that I need is one-in-a-million, And they can call me brilliant if I succeed Gravity is nothing to me I'm moving at the speed of sound I'm just gonna to get my feet wet until I drown I teeter between tired And really, really tired I'm wiped and I'm wired But I guess that's just as well Cuz I've built my own empire Out of car tires and chicken wire And now I'm queen of my own compost heap And I'm getting used to the smell So what to do? The title of this post is from "The EyeMote", and my first email address in the late 90's was Wednesday, April 13, 2011 Now is the time to write your representatives in Congress and in your state, about mental health budget cuts We are in dire times, Americans. At the last NAMI Education meeting in my county, it was stated by a CEO of a community mental health agency that Florida is cutting its budget for mental health and substance abuse services by some $230 million, leaving nothing left, if this goes through, but some funding for a few crisis unit beds. While this situation in Florida is horrible, it is not any different than what is happening in many other states. Simultaneously, the GOP wants to slash funding for Social Security and Medicare: the very programs that many of us need to survive. Left without the supports of community mental health centers, disability benefits to live on, and healthcare to get treatment, people are going to die. People are going to suffer. Even more than they are already suffering. There are going to be increases in suicides, homelessness, and arrests for petty misdemeanors by people forced to live on the streets because they have nowhere else to go.  We need more help, not less!! I have written about this subject on this blog many times. I don't know how many of you write letters to your members of Congress, but I did get an email from one of you recently and she asked me, "who can I write to?" At the time, I didn't have an answer. She was talking about my post about how I'm not going to have case management or therapy for much longer. Well, the people really responsible for that, really the ones who could change that are legislators. And that is who you can write to. Write to Florida's legislators if you want to; that is where I will be affected. But write for yourself to your state's legislators too. Write to Congress about the federal budget. Write now. Write on behalf of your family and friends who live with mental illnesses. Write on behalf of those who have died. Write now. Call. Fax. Visit. Email. Write. Contact Information: Here are some tips on contacting your members of Congress. Letters are preferred and receive more attention than emails, but of course email is easier. There is a letter I wrote which I sent to my reps and Senator a while ago here. What I wrote was not concise, so try to write something shorter than my email. Whatever you do, please at least try to do something. If we act like bystanders in a democracy, we really can't blame everyone else when things like budget cut travesties occur. We have to voice our concerns, tell our stories, and change the way people think about mental health and treatment. We must make them understand treatment is necessary and deserved, and no country with a conscience should deny its citizens the right to mental health care. So send an email, fax a letter, or make a phone call, and please do it right away. Tell them the services you use, and how your life would be affected if those services no longer existed. If you don't use services, tell them about someone you know who does. For example, I go to a community mental health center where I get  injections ever other week, see a psychiatric ARNP  who prescribes many medications, see a therapist, who helps me manage my life, and have a case manager who helps me keep getting the treatment I need, and advocates on my behalf when necessary. Because of the low budget that already exists I don't qualify for case management anymore, because I haven't been in a hospital in a few years. One of the reasons I haven't been in a hospital in years is that I had that case manager helping me. Because Medicare has strict rules and will no longer fund my therapy, I will no longer have my therapist in a couple of months. And this is also what has kept me going - therapy. And this is with the current budget. When that budget is totally slashed, which it is likely going to be, then these services won't be available for many, many people who need them. I used to be homeless, psychotic, suicidal, and alone. I have not been that way in years, because I have had help. Now the state and the federal governments want to take that help away from people like me. Please help me take a stand so this won't happen. So if you don't have a story of your own to tell, then please go ahead and tell my story. Please read the below important information, and use it when you contact your representatives: DENVER (AP) - State budget writers looking for cash to balance the books have stripped a cumulative $1.8 billion from mental health services over the last 2½ years, putting the public at risk as the mentally ill crowd emergency rooms and prisons, according to the nation's largest mental health advocacy group. The Washington-based National Alliance on Mental Illness tallied state budget cuts to mental health services between 2008 and today and found that 32 states and Washington, D.C., cut funding just as economic stressors such as layoffs and home foreclosures boosted demand for services. California slashed funding by more than $587 million, or 16 percent. Kentucky gutted its mental health budget by an astounding 47 percent over the last two years. In many states, the picture is likely to get uglier for those relying on state mental services. Starting this summer, some $87 billion in federal stimulus money for Medicaid assistance to the states starts drying up. Because virtually all Medicaid-funded mental health services are optional, states projecting another couple years of budget deficits are likely to chop mental health services further. "These are really dangerous times," warned Michael Fitzpatrick, NAMI's executive director. The group reviewed state mental health budget cuts in the wake of the January shooting in Arizona, in which six people died and 13 were injured, including U.S. Rep. Gabrielle Giffords. The man charged with shooting them, Jared Loughner, showed signs of mental illness but was never referred for treatment. "People really need to learn their lessons from Arizona and think about what we're doing to address mental illness," Fitzpatrick said. Silverman, of Delray Beach, has struggled for decades with a complex mix of mental illnesses that was finally diagnosed as bipolar disease, depression and mood disorder. The problem renders her unable to work, at 55. She takes numerous medications that she and her doctor settled upon after much experimentation. The pills keep her stable, avoiding crises that have sent her to emergency rooms at times. The proposed cuts could alter state coverage for drugs and end virtually all outpatient mental health services for uninsured adults. Gone would be doctors, counseling and group homes. Under the Senate's $137 million of cuts, the state would cover only crisis treatment. "I don't want to go back to the way I was. Please don't make that happen to me," Silverman said. "Is this honestly the way to try to cut costs? By driving people crazy, by making their lives miserable?" -Copyright 2011 South Florida Sun-Sentinel Seventy percent of emergency department administrators report that they hold mentally ill patients for 24 hours or longer, according to a 2010 survey by the Schumacher Group, a Louisiana firm that manages emergency departments across the country. Ten percent said they had boarded some patients for a week or more. Most administrators said delays compromise patient care in the ER, increasing waiting times for all patients and overcrowding. States Cut Mental Health Budgets The problem has worsened during the economic downturn. Since 2009, 32 states have cut their mental health budgets, largely from outpatient services that keep people healthy and out of the ER, according to a study by the National Alliance on Mental Illness, a patient advocacy group. And since 2010, states have closed or are planning to close nearly 4,000 state psychiatric beds, about 8 percent of capacity, according to the National Association of State Mental Health Program Directors Research Institute. "We're not cutting fat anymore," says Charles Ingoglia, vice president of public policy at the National Council for Community Behavioral Healthcare, a membership organization for mental health organizations that treat the uninsured and underinsured. "We're at the bone. All of the easy cuts have already been made over the years." At the same time, many Americans have lost their jobs and health insurance and are leaning on the state programs being cut. The need for such services has also grown as depression and anxiety have increased: a 2009 survey by the U.S. Substance Abuse and Mental Health Services Administration found that mental illness is more prevalent among unemployed adults. Many wait until their illness reaches a breaking point and then seek care at the ER. -Copyright KHN • From fact sheet, "Best Return on Investment (ROI): Mental Health and Substance Abuse Treatment":  Tough economic times require legislators to maximize the use of taxpayer dollars. Funding behavioral health services is one of the most effective investments of public dollars. Here’s why: Treatment saves taxpayers money. Treatment/ No Treatment • Average crisis stabilization bed cost per day: $292 Average Florida emergency room cost per visit: $2,887 •  Average detox cost per day: $205 Average hospital cost per day: $2,000 • Average annual substance abuse treatment cost for an adult: $2,400  Average prison cost for a drug offender: $55,000 • Average annual mental health treatment cost for an adult: $1,551 Average state hospital cost: $112,000 Treatment works.  It is estimated that the economic benefits of expanded diagnosis and treatment of depression has a ROI of $7 for every $1 invested.  $1 invested in treatment for alcohol and other drug-related problems saves taxpayers $7.14 in future costs.  93% of offenders who complete community drug treatment do not re-offend. One percent change equals $8 million over three years.  Prevention and treatment result in safer communities. Orange County’s mental health diversion program has saved law enforcement $2.2 million over seven years by reducing or eliminating time spent at emergency rooms. Treatment supports jobs and local economies.  Community mental health and substance abuse agencies provide over 50,000 private sector jobs.  Treatment gets people back to work – 69% of adults are employed post treatment.  Over 1,490 vendors supply community treatment companies.  The economic impact in Florida of alcohol and drug abuse is $43.7 billion each year. (The Price Florida Pays for Drug and Alcohol Abuse, 2009)  Untreated and mistreated mental illness costs the United States $105 billion in lost productivity and $8 billion in crime and welfare expenditures each year. A 5.5% increase in spending by businesses and government on mental health treatment could cut these costs by half. (National Mental Health Association, 2001)  Treatment success rates for such disorders as schizophrenia (60%), depression (80% percent) and substance abuse disorders (60%) surpass those of other medical conditions such as heart disease (45-50%) and other chronic illnesses. (National Institute of Mental Health, 2004)  Individuals with mental illnesses are four times more likely to die from treatable illnesses than other individuals and 58 times more likely to die before the age of 50 (Disability Rights Commission, 2005)  For every $1 invested in mental health treatment, $3.68 is saved in reduced criminal activity and hospitalizations. (The “SCOPE” Mental Health Study Group Report)  One study in Texas found that providing substance abuse treatment would give the state a ROI of $2.26. The most interesting statistic was a projection about cuts made in the last decade. “If the state had stuck to its 2000 budget for mental health and substance abuse treatment, Texas would be earning a 170% ROI on the money or netting $32.76 today for every dollar spent. (Peter Earley, 2010)  Sixteen percent of people in jails and prisons suffer from a serious mental illness. (NIMH, 2008)  Between 50% and 75% of youth in juvenile justice facilities suffer from a diagnosable mental health disorder and frequently do not receive counseling, treatment or support. (NIMH, 2008)  It is estimated that at least 25% of homeless people suffer from serious mental illness. (NIMH, 2008)  Twenty-three percent (23%) of parents and caregivers of children with mental illness were forced by state regulations to consider relinquishing custody of their child in order to access mental health services and 20% actually did so. (NIMH, 2008)  Of adults using homeless services, 31% report having a mental illness and/or a substance abuse condition. (Burt, 2001) Sunday, April 10, 2011 Getting mad at the world: I'm a little irritable right now and possibly hypomanic First off, I am sorry this post is so long, and if you do not have time to read it all, or don't want to, I totally understand that. I am feeling really irritable right now. I'm not usually like this. I feel on edge, anxious, and ready to smack somebody if they come near me. I'm not a violent person; I wouldn't actually smack anyone. I'm just really annoyed with life and I think part of the reason I'm feeling like this is that my Lamictal dose was doubled, up to 50 mgs, starting last night. I'm sure there is a correlation. Yesterday, I went to see my psychiatric ARNP and she wasn't there; she had her own doctor's appt. So I saw another doctor, who actually was my first doctor the very first time I ever went to the community mental health center here, back about 14 years ago. He thought he remembered me. He is now the medical director, and no longer usually sees patients. I like him a lot; he seems sharp, intelligent, and on the ball. He immediately stated that I'm on an awful lot of medication, which I know is true. I also know how I feel when I am not on this medication, and it really sucks to be me then, so at the same time I am reluctant to say, "Hey, yeah! Let's take me off some!". But I DO want to go off Seroquel forever, because it caused me the biggest weight gain. So he further decreased my Seroquel, and soon I won't be on it hardly at all. He also decreased my Wellbutrin, because for some time now I've been on 450 mgs, which is the most they usually would ever prescribe for anybody. I knew that before he told me that, and I was fine with reducing that antidepressant since Lamictal is supposed to be helping me with the depression now. He asked me why I was on an injection (Risperdal Consta), and I explained that, years ago when I was first put on injections, it was in the hospital after I had been psychotic for years and never stayed on pills even when they were finally prescribed. Then, I stayed on injections because they work for me, and every time I go off the Risperdal shots, the psychosis returns. I'm not sure he totally understood my history in this brief visit, because he started to say that I seem more Bipolar than Schizophrenic, as of course Schizoaffective is a mix of the two, and he seem to be thinking perhaps I actually am Bipolar. I know I'm not Bipolar. I know my history, and I know my life. Psychosis has been a big part of my life for twelve years. It happens when I'm not depressed. I don't get manic; if I get hypomanic, which I actually may be right now (not sure), it is not a severe thing and I haven't actually been manic as far as I know since around 2003-2004. In any event, I don't think it could hurt to have a second opinion on the medications I'm taking, so I was pleased when this doctor said he wanted me to come back for him to do a whole psychiatric evaluation on me. My therapist said he might not understand why I need so much medication, because I seem to have "absorption problems" as she calls it where my stomach doesn't take in the stuff enough for it to work. I've been checked for Celiac Disease and told I don't have that, but it seems like it takes a lot of meds for me to feel any effects. I didn't explain this to this doctor, because I honesty didn't think of it at the time. My therapist thinks it's really important that he understand this and that I need to make this really clear to every doctor I ever see. Since she sees a lot of clients with digestive problems, she has a theory that many people have absorption issues and that's why their meds don't work well enough for them. I don't want to get into a disgusting topic of how people have digestive problems, but you probably understand what I'm saying. Anyway, since he doesn't see patients usually, it's unlikely this doctor will take over my case, but having his input might help. I found out from him that there is a new antipsychotic drug that's only been used for about three months now, and it does not cause weight gain. I forget the name of it, but it starts with "L". I am very interested in trying this new drug, because the Risperdal shots also contributed to my weight gain, and I would really love to be on something that does not slow down my metabolism or make me hungry all the time. That would be such a wonderful change! I'm not sure if Lamictal generally causes anxiety or irritability, but things and people are really getting on my nerves right now. I have this constant problem of worrying about my family members, who have a lot of problems to worry a person. They: my mom, and the brother and sister who I'm closest too, all have major money problems. My mom goes in and out of jobs every couple of months and she can't pay her bills because of it, since her Bipolar Disorder has never been under control well enough for her to function for long enough at a job even though she is intelligent and capable. And so there is this weight on my shoulders, getting these phone calls about how my mom can't pay her water bill and she doesn't expect me to pay it for her, but she tends to blame other people for her problems, and often times, I am that other person. Then tonight I went out to a movie with the only friend I have who I ever go to movies with (I do not have a lot of friends), and she was, once again, getting on my last nerve. She is very self-involved and never stops complaining about her money problems. I don't talk about my money problems with her so she seems to assume I have these riches she doesn't have, even though I have pointed out to her on several occasions that my income is no higher than hers is. She is on disability, but she gets a check twice the size of mine, and she doesn't have to work to pay her bills, so she doesn't work. She never gets psychotic, and yet she complains to me about how hard her life is all the time, as if it was soooo much more difficult than my life when I'm trying to manage a job and school, and she's sleeping until 5 PM every day despite having no physical health problems. Then there is the difference in personalities. We really are not that much alike. She thinks it's funny to throw popcorn at me in a movie theater, or purposely irritate people by smoking near them when they are obviously annoyed with her smoking, and stuff like that which is really juvenile, and I don't get it since she is older than my mother. She acts like she's five years old, but to her this is very amusing. To me, it's really annoying. We're in the movies and she's loudly laughing and talking and I'm just thinking of how embarrassing this is because nobody else is being this loud. Then she's coughing non-stop without covering her mouth which really boggles my mind because most people know it's very rude to cough and cough when you're sitting inches away from someone, and not cover your mouth to prevent spreading your germs. Then there's the fact that she flirts with strangers every time we go anywhere and they are generally thirty years younger than her and not exactly interested. I don't understand that behavior, or the illogical thinking that would lead one to believe a 22 year old will want to flirt with you when you are 56. Do I sound annoyed yet? I'm really not a picky person. I'm not usually the type of person to point out everything I don't like in a friend of mine. I really don't do that. It's just that I wish I had other friends to go places with, and the reason I don't is that I have very poor social skills and a lack of ability to make friends. And I guess that's irritating too. Because if I'm going to take the effort to spend time with a person and talk to them frequently on the phone, I want to be able to have that person actually care about my life and not just use me as their sounding board to tell me all their problems without caring at all about my problems. Is that too much to ask? I have had two friends like this the past few years, and they are the only friends who ever call me, and both of them drive me nuts. The other one is a drug addict and I want nothing to do with her anymore because I'm sick of watching her destroy her life and getting her phone calls where she makes it obvious she wants to borrow money from me, as if I have any money to lend her. I have cut her, for the most part, out of my life for my own sanity and peace of mind. And that leaves me with no friends around here. I know people in a women' organization I belong to and NAMI but I'm not friends with any of them, really. I would like to be friends with some of the women in the women's organization, but I doubt they would want to be friends with me. Most of them are twice my age and have had careers and hold Bachelor's or Master's Degrees or even PhD's, and they intimidate me. I doubt that I could hold up a conversation long enough for them to be interested in what I have to say. There is one exception to this, as one woman has taken the time to have lunch with me and she was very kind to me and seemed to have an interest in the conversation. It probably helps that she is a therapist! I have shared my diagnosis with her, and some of my history, and she has not seemed judgmental about it at all. I really appreciate that. It would be nice if we had more in common and could be friends, but I just don't know how to make that connection. All my life, I have had trouble making friends. Always. I have had friends, even close friends, but for the past 13 years, those have mostly been online. I had a group of friends I've mentioned here before who I was very close too, but when my illness was at its worst, all but one of them cut me out of their lives. The one who didn't do that is still a wonderful friend to me, and I care about her and really appreciate her a great deal. But we have never met in person. I guess my life is just not flowing well right now, and I'm not sure how much of this has to do with medication changes, as my Seroquel has been decreased over the past month, and the Lamictal is still new to me, and just recently increased. I don't know if the irritation I'm feeling is due to that alone, or if life factors are also in play here. If it is my life that is the problem, the fact that I don't know what I'll do if my car needs more expensive repairs since I can't get around without a car, is weighing heavily on my mind, and my problems with college and not being sure what to do about my degree and future is really making me nervous. I feel like I need tranquilizers and the funny thing is, I'm taking Ambien and Klonopin and Valerian Root and Melatonin and still having trouble sleeping!! Talk about craziness. If I am hypomanic that would explain this. I  just wish that I could wake up in the morning and feel energetic, which I never do because of my health problems, or feel clear about my goals, which I'm not right now, and this inability to have the energy and the clarity that I need to function well is really getting in my way. I wish I could meditate, but it's something I've never been able to do because I have a lot of trouble quieting my mind and relaxing. It just does not work for me. If I was physically able to do yoga, I'd try that, but I'm not physically able to do it (have tried before). I know that one thing I need to do is get back into a regular exercise regimen, which I have not been doing for many months, and to make that a priority in my life. I also need to unpack all my belongings that are still in boxes, hang all my pictures, and get my apartment set up properly. I've been buying discount curtains and other decor to make it look better than the old one looked, and I do enjoy that. I have a lot of trouble making decisions, though, so when I go to buy something I end up going to five or six stores and on five or six websites comparing prices before I make a purchase, which takes up a lot of time and energy, and leads to exhaustion and physical pain from Fibromyalgia. This is something I've done way too much of lately, and I need to stop it. If I cannot make up my mind about things, and don't have the money needed to buy the things, then it is not time to go shopping. Especially not shopping all day long without buying anything! Well, this has turned into a long, windy post, and I'm not sure it will be clear to anyone what the point of it was, so I apologize for that. I don't feel up to writing anything much better at the moment, so this is what it is. Thank you for stopping  by, and I do deeply appreciate all the people who take the time to write comments. Also, I'm sorry if I sound like a witch with the way I talked about my friend, but that is the frame of mind I'm in at the moment. My friend asked me if something was wrong with me because I seemed angry. This is not the way I normally am at all. She really is a good person at heart, and I would never want to make her feel badly just because her behavior drives me up the wall. And also, I know that not everyone would find me a pleasant person to be around, and I'm sure many people are annoyed by me on a regular basis. I would like to know a way to determine if one is experiencing hypomania or not, or if I am in a mixed state. I am not sure how to determine this. If you have any opinions on it after reading this post, I would love to hear them. I am wondering if the Lamictal could have thrown me into hypomania or a mixed state of depression and hypomania, or if I've been in hypomania for months and that is why I can't sleep. But I really do not feel manic, in the usual sense of the word. Mental health can be so confusing at times. Saturday, April 02, 2011 Take time to smell the flowers: Limiting the stress in my life I'm gradually getting less stressed out, since having moved into my new apartment. I'm still stressed, but of course, everyone is stressed. I did take the advice of those of you who left comments on my last post, and listened to my best intuition about the situation of my family expecting me to fly to another state with my grandmother, in the midst of critical deadlines in my college class, a job where they won't want to let me off work for the several days that would be required, the symptoms that have been popping up lately such as hearing voices again, and the stress of moving which was just last I'm not taking the trip. I know this isn't going to go over well with my grandmother. She doesn't really understand, and I don't think really would want to understand, about mental illness, so it is not something we discuss. She knows about it, but what she knows exactly I'm not sure of. She was told by my mother that I would accompany on this trip, so I left it to my mother to tell her I'm not, since I had not ever agreed to do this in the first place, and I really cannot do it right now. I wish that I could. I adore my grandmother, and being that she is quite elderly, of course I do not want to hurt her feelings or leave her to feel scared on an airplane. But now my uncle is going to be taking the whole trip with her, and she will not be alone. I am not sure if my uncle stepped in because he found out I wasn't going to do it, or not. It's possible he really wants to go to Disneyworld. Something my mom planned for us all to do without consulting me or my brother or sister first. My mom loves Disneyworld. Because it involves extensive walking in hot weather, which is really physically difficult for me, I do not love Disneyworld. And I have been there many times on family trips. I really could do without going there this month. Sometimes, I'm sure in all of our lives, the issue comes up about how to explain our illness to others. How to, and when to say, "No, I really cannot do that right now". And when to say, "This is what I am dealing with right now, if you would like to know..." I have to say that I don't do that often with my family, because the majority of my family is wrapped up in their own problems, and they do not really express much interest in mine. I have to say I understand this, and this is not something that leads me to feel sorry for myself. I am used to things being the way they are. But sometimes, I do have to set a boundary, and explain my limitations, and usually, people don't understand. My mom was actually at my home tonight, and she was making fun of me for being tired, saying, "what is WRONG with you?? Are you ON some drug?? You look like your eyes are glazed over!!" Note: I have never been on illegal drugs or addicted to prescription drugs in my entire life. Then she snapped her fingers in front of my face like "wake up! wake up!" I really wanted her to leave. I have an autoimmune disease called Sjogren's Syndrome (in case you didn't already know that), Fibromyalgia, associated arthritis and peripheral neuropathy, and I, of course, have Schizoaffective Disorder for which I take a boatload of medications every day. All of this does lead to me being tired, frequently, and more tired than the average person. I require a lot of rest. My mother doesn't. So she doesn't understand this about me. It would seem that after, oh about, 16 years of me having health problems, perhaps, by now, she would understand that I get tired. And I think sometimes she does understand. But only a little bit. We have been on trips to Disneyworld before where she looked at me and knew that I needed to sit down and not keep walking, because I really was going to pass out. And I think then, she understands. But when she's planning a trip where I am expected to, again, walk around Disneyworld, I don't think she considers the facts of my health. I'm not saying I can't go at all, but I really would rather not do that to my body or myself if I have a choice. Of course, in this case, the choice is to upset my mother, my grandmother, and look like I'm antisocial to my entire family. That is the way it would be viewed if I didn't go at all. But I'm considering not going. If I do go, I am setting limits on what I will, and what I will not do. I will not push myself until I am ready to faint. I will not push myself so that I'll need three days in bed to recuperate afterwards. I'm not doing that again, not for anybody, not now, and not ever. I have learned from experience what I can and cannot do, and I will not attempt to do things my body simply isn't able to do. I think it's healthy to set boundaries when necessary. We all need to do this, and perhaps you have been in similar experiences. I would be interested to hear how you've all dealt with such situations. I know it's harder for me to explain my mental health symptoms than my physical ones, but because I was so very psychotic for so long, my mental health symptoms are generally believed when I do explain them. So it's not like I am accused of pretending to hear voices. I've been accused of being possessed by demons, again, by my mother, but that's another issue. I've learned that I have to say, sometimes, I am really having too many symptoms right now to do this. And so, that is what I did about the  trip with my grandmother. I will not be taking that trip. I'm sorry if nobody understands why. But nobody else in my family has psychosis to the point that they hear voices and have delusional thoughts. So I don't totally expect them to understand. I do expect them to respect the fact that I have limitations. And if they can't expect that, well, that is their problem, not mine. I am not going to push myself to the point that I have to go into a hospital again. I haven't been in a hospital for mental health reasons in three years, and that is a good thing for me. I have been stressed lately to the point that I was really afraid I'd get suicidal or totally psychotic, and have to be hospitalized. But that didn't happen. My stress of moving has lessened now that the moving part is done. I still have to unpack and decorate my entire new apartment, hang curtains and blinds, and things like that. But I am less stressed about it, overall. I saw my therapist yesterday, and she said I looked much more relaxed and my face was more animated than I had looked the week before. I still have a lot of things I am worried about, but I am trying to take them on one at a time, and not worry about them all at once, which leads to me getting very overwhelmed and freezing in a panic where I feel incapacitated. I am trying not to get to that point. I decided I'll unpack at my own pace. Whenever it gets done, is when it will get done. If it takes me a month, so be it. I am in no rush. I sometimes want to do a million things. Like the other day, I went to four stores in one day, and then a mall, which is too much shopping for me. Way too much to do in one day. I was looking for curtains and blinds, and curtain rods, and things on sale. I bargain shop to get the best possible prices on things. But I have to watch it when I do things like that, because the next day, I could barely do anything, as I felt like I'd been run over by a truck. For right now, I feel that I have to really make taking care of myself a priority. The voices are a sign that I'm under too much stress. They don't tend to start happening again for no reason. I know that. I have been under too much stress, and I have to limit the stress. I have no other option unless I want to end up in complete psychosis again. The voices scare me, but they are a warning. They serve to alert me that, "Hey, something's not going well here!" and I have to listen to that and adjust my life, and sometimes my medications, accordingly. I have to respect the signs my body and mind are sending me that I'm too stressed out, and make the necessary changes. Hopefully, with these changes, and careful watching of the stressors, I can avoid prolonged trouble with the voices. I might not be successful at this, but I have to try.  Thank you, readers, for the comments you left on my previous post. They really did help me. When I was a little girl, I had this beautiful yellow wood desk, with flowers on it, that I loved. It was painted by a woman we knew. It said on it, in red letters, "Take time to smell the flowers". I've always thought this was a good motto for living. Sometimes I just forget. Related Posts with Thumbnails
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '20', 'language_id_whole_page_fasttext': "{'en': 0.9844937324523926}", 'metadata': "{'Content-Length': '390968', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:72D6SPZVFCYHFFDH6Q5VJGXNN4I4FGD6', 'WARC-Concurrent-To': '<urn:uuid:3867f396-94b7-4e2c-9b7d-6bd3a58bcb31>', 'WARC-Date': datetime.datetime(2014, 4, 19, 19, 36, 8), 'WARC-IP-Address': '74.125.29.121', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:BUNKBI4DCP3PRW22KQDFO3SH7CP5PVSB', 'WARC-Record-ID': '<urn:uuid:25d7cffd-691d-48a3-82b3-b75319919719>', 'WARC-Target-URI': 'http://www.suicidalnomore.com/2011_04_01_archive.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2795ef9f-400c-42b8-929b-00c065921465>', 'WARC-Truncated': 'length'}", 'previous_word_count': '7934', 'url': 'http://www.suicidalnomore.com/2011_04_01_archive.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-147-4-33.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-15\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for April 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02379506826400757', 'original_id': '959a4a3248370cfe132ce5b58e4ec0b8f53fec726354e788b6778901941a2051'}
Q: ¿Como imprimir elementos repetidos de una std::list en C++ sin usar bucles? ¿Como hago para imprimir todos los elementos de una lista (std::list) de pairs en c++, que contengan max_elemnt repetidos? list<pair<int, int>> l; l.push_back ( std::make_pair ( 1, 90 ) ); l.push_back ( std::make_pair ( 2, 90 ) ); l.push_back ( std::make_pair ( 3, 75 ) ); l.push_back ( std::make_pair ( 4, 40 ) ); l.push_back ( std::make_pair ( 5, 90 ) ); Es decir... si tengo esa lista de arriba, cómo hago para que la salida sea: Alumno 1: 90. Alumno 2: 90. Alumno 5: 90. ...Mostrando no solo el mayor elemento, si no que el mayor elemento y todos los repetidos. No se si me expreso bien. Tengo entendido que max_element tan solo me retorna el primer elemento de la lista. Si tengo una lista con los elementos {3,7,9,5,6,4,9}, y como podemos ver hay dos repetidos, si hago algo como: int myints[] = {3,7,9,5,6,4,9}; std::cout << *std::max_element(myints,myints+7) << '\n'; La salida seria: 9 Necesito que la salida sea todos los números repetidos, o sea como hay 2, pues que imprima todos los números mayores repetidos, pero usando el pair que vemos en el primer ejemplo. ¿Existe alguna utilidad que muestre todos los repetidos? A: Una forma, que si pones en un .h, podría ser "la utilidad" :) inline void mostrarMayores(std::list<std::pair<int,int>> l) // recibe una copia para no modificar la lista original { auto comp = [](const std::pair<int,int>& a, const std::pair<int,int>& b) { return a.second > b.second; }; auto as_str = [](const std::pair<int, int>& p) { std::ostringstream ss; ss << "Alumno " << p.first << ": " << p.second; return ss.str(); }; l.sort(comp); std::transform(l.begin(), std::upper_bound(l.begin(), l.end(), *l.begin(), comp), std::ostream_iterator< std::string >( std::cout, "\n" ), as_str); }
mini_pile
{'original_id': '47b4ef416b737e700dfcba365e32defa98b07f1cc12b18ada2436baa313b6300'}
/* * This file is part of the Micro Python project, http://micropython.org/ * * The MIT License (MIT) * * Copyright (c) 2013, 2014 Damien P. George * * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in * all copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN * THE SOFTWARE. */ #include <string.h> #include "py/nlr.h" #include "py/runtime.h" #include "py/mphal.h" #ifdef CONFIG_FAT_FILESYSTEM_ELM #include "ff.h" #include "extmod/vfs.h" #else #include "extmod/vfs_fat.h" #endif #include "fsl_sdmmc/fsl_sd.h" #include "sdcard.h" #undef usb_echo #define usb_echo(...) mp_printf(MP_PYTHON_PRINTER, __VA_ARGS__) #if MICROPY_HW_HAS_SDCARD /******************************************************************************/ /*Micro Python bindings Expose the SD card as an object with the block protocol. there is a singleton SDCard object*/ const mp_obj_base_t pyb_sdcard_obj = {&pyb_sdcard_type}; STATIC mp_obj_t pyb_sdcard_make_new(const mp_obj_type_t *type, size_t n_args, size_t n_kw, const mp_obj_t *args) { mp_arg_check_num(n_args, n_kw, 0, 0, false); return (mp_obj_t)&pyb_sdcard_obj; } STATIC mp_obj_t sd_present(mp_obj_t self) { return mp_obj_new_bool(sdcard_is_present()); } STATIC MP_DEFINE_CONST_FUN_OBJ_1(sd_present_obj, sd_present); STATIC mp_obj_t sd_power(mp_obj_t self, mp_obj_t state) { bool result; if (mp_obj_is_true(state)) { result = sdcard_power_on(); } else { sdcard_power_off(); result = true; } return mp_obj_new_bool(result); } STATIC MP_DEFINE_CONST_FUN_OBJ_2(sd_power_obj, sd_power); STATIC mp_obj_t sd_info(mp_obj_t self) { int ret; uint32_t total_size, block_size, busclk_hz; mp_obj_t tuple[3]; ret = sdcard_info(&total_size, &block_size, &busclk_hz); if (ret) return mp_const_none; tuple[0] = mp_obj_new_int_from_ull(total_size); tuple[1] = mp_obj_new_int_from_uint(block_size); tuple[2] = mp_obj_new_int(busclk_hz / 1000); return mp_obj_new_tuple(3, tuple); } STATIC MP_DEFINE_CONST_FUN_OBJ_1(sd_info_obj, sd_info); STATIC mp_obj_t sd_read(mp_obj_t self, mp_obj_t block_num) { uint8_t *dest = m_new(uint8_t, SDCARD_BLOCK_SIZE); mp_uint_t ret = sdcard_read_blocks(dest, mp_obj_get_int(block_num), 1); if (ret != 0) { m_del(uint8_t, dest, SDCARD_BLOCK_SIZE); nlr_raise(mp_obj_new_exception_msg_varg(&mp_type_Exception, "sdcard_read_blocks failed [%u]", ret)); } return mp_obj_new_bytearray_by_ref(SDCARD_BLOCK_SIZE, dest); } STATIC MP_DEFINE_CONST_FUN_OBJ_2(sd_read_obj, sd_read); STATIC mp_obj_t sd_write(mp_obj_t self, mp_obj_t block_num, mp_obj_t data) { mp_buffer_info_t bufinfo; mp_uint_t ret; mp_get_buffer_raise(data, &bufinfo, MP_BUFFER_READ); if (bufinfo.len % SDCARD_BLOCK_SIZE != 0) nlr_raise(mp_obj_new_exception_msg_varg(&mp_type_ValueError, "writes must be a multiple of %d bytes", SDCARD_BLOCK_SIZE)); ret = sdcard_write_blocks(bufinfo.buf, mp_obj_get_int(block_num), bufinfo.len / SDCARD_BLOCK_SIZE); if (ret != 0) nlr_raise(mp_obj_new_exception_msg_varg(&mp_type_Exception, "sdcard_write_blocks failed [%u]", ret)); return mp_const_none; } STATIC MP_DEFINE_CONST_FUN_OBJ_3(sd_write_obj, sd_write); #ifndef CONFIG_FAT_FILESYSTEM_ELM STATIC mp_obj_t pyb_sdcard_readblocks(mp_obj_t self, mp_obj_t block_num, mp_obj_t buf) { mp_buffer_info_t bufinfo; mp_uint_t ret; mp_get_buffer_raise(buf, &bufinfo, MP_BUFFER_WRITE); ret = sdcard_read_blocks(bufinfo.buf, mp_obj_get_int(block_num), bufinfo.len / SDCARD_BLOCK_SIZE); return mp_obj_new_bool(ret == 0); } STATIC MP_DEFINE_CONST_FUN_OBJ_3(pyb_sdcard_readblocks_obj, pyb_sdcard_readblocks); STATIC mp_obj_t pyb_sdcard_writeblocks(mp_obj_t self, mp_obj_t block_num, mp_obj_t buf) { mp_buffer_info_t bufinfo; mp_uint_t ret; mp_get_buffer_raise(buf, &bufinfo, MP_BUFFER_READ); ret = sdcard_write_blocks(bufinfo.buf, mp_obj_get_int(block_num), bufinfo.len / SDCARD_BLOCK_SIZE); return mp_obj_new_bool(ret == 0); } STATIC MP_DEFINE_CONST_FUN_OBJ_3(pyb_sdcard_writeblocks_obj, pyb_sdcard_writeblocks); #endif STATIC mp_obj_t pyb_sdcard_ioctl(mp_obj_t self, mp_obj_t cmd_in, mp_obj_t arg_in) { mp_int_t cmd = mp_obj_get_int(cmd_in); switch (cmd) { case BP_IOCTL_INIT: if (!sdcard_power_on()) return MP_OBJ_NEW_SMALL_INT(-1); return MP_OBJ_NEW_SMALL_INT(0); case BP_IOCTL_DEINIT: sdcard_power_off(); return MP_OBJ_NEW_SMALL_INT(0); case BP_IOCTL_SYNC: return MP_OBJ_NEW_SMALL_INT(0); case BP_IOCTL_SEC_COUNT: return MP_OBJ_NEW_SMALL_INT(0); case BP_IOCTL_SEC_SIZE: return MP_OBJ_NEW_SMALL_INT(SDCARD_BLOCK_SIZE); default: return MP_OBJ_NEW_SMALL_INT(-1); } } STATIC MP_DEFINE_CONST_FUN_OBJ_3(pyb_sdcard_ioctl_obj, pyb_sdcard_ioctl); STATIC const mp_rom_map_elem_t pyb_sdcard_locals_dict_table[] = { { MP_ROM_QSTR(MP_QSTR_present), MP_ROM_PTR(&sd_present_obj) }, { MP_ROM_QSTR(MP_QSTR_power), MP_ROM_PTR(&sd_power_obj) }, { MP_ROM_QSTR(MP_QSTR_info), MP_ROM_PTR(&sd_info_obj) }, { MP_ROM_QSTR(MP_QSTR_read), MP_ROM_PTR(&sd_read_obj) }, { MP_ROM_QSTR(MP_QSTR_write), MP_ROM_PTR(&sd_write_obj) }, #ifndef CONFIG_FAT_FILESYSTEM_ELM { MP_ROM_QSTR(MP_QSTR_readblocks), MP_ROM_PTR(&pyb_sdcard_readblocks_obj) }, { MP_ROM_QSTR(MP_QSTR_writeblocks), MP_ROM_PTR(&pyb_sdcard_writeblocks_obj) }, #endif { MP_ROM_QSTR(MP_QSTR_ioctl), MP_ROM_PTR(&pyb_sdcard_ioctl_obj) }, }; STATIC MP_DEFINE_CONST_DICT(pyb_sdcard_locals_dict, pyb_sdcard_locals_dict_table); const mp_obj_type_t pyb_sdcard_type = { { &mp_type_type }, .name = MP_QSTR_SDCard, .make_new = pyb_sdcard_make_new, .locals_dict = (mp_obj_dict_t *)&pyb_sdcard_locals_dict, }; #ifndef CONFIG_FAT_FILESYSTEM_ELM void sdcard_init_vfs(fs_user_mount_t *vfs, int drv) { vfs->base.type = &mp_fat_vfs_type; vfs->flags |= FSUSER_NATIVE | FSUSER_HAVE_IOCTL; #ifdef CONFIG_FAT_FILESYSTEM_ELM vfs->fatfs.drv = drv; #else vfs->fatfs.drv = vfs; vfs->fatfs.part = drv; #endif vfs->readblocks[0] = (mp_obj_t)&pyb_sdcard_readblocks_obj; vfs->readblocks[1] = (mp_obj_t)&pyb_sdcard_obj; vfs->readblocks[2] = (mp_obj_t)sdcard_read_blocks; /* native version*/ vfs->writeblocks[0] = (mp_obj_t)&pyb_sdcard_writeblocks_obj; vfs->writeblocks[1] = (mp_obj_t)&pyb_sdcard_obj; vfs->writeblocks[2] = (mp_obj_t)sdcard_write_blocks; /* native version*/ vfs->u.ioctl[0] = (mp_obj_t)&pyb_sdcard_ioctl_obj; vfs->u.ioctl[1] = (mp_obj_t)&pyb_sdcard_obj; } #endif #endif
common_corpus
{'identifier': 'https://github.com/JunYangNXP/micropython/blob/master/ports/zephyr/sdcard.c', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '', 'title': 'micropython', 'creator': 'JunYangNXP', 'language': 'C', 'language_type': 'Code', 'word_count': '698', 'token_count': '3234', '__index_level_0__': '6884', 'original_id': '85a99ce090d0483bdf1c5c8c5de3bcaa86b8c5bb83d3c533391accce91e9b4eb'}
La Chine commence à supprimer massivement le système d’exploitation Windows des ordinateurs gouvernementaux au rythme de 15% par an. Il est remplacé pour Linux. La Chine souhaite se débarrasser de Windows dans les prochaines années, au moins sur les ordinateurs du gouvernement. Les autorités locales ont mis en place un vaste plan de migration qui prévoit que 15 % des ordinateurs utilisés par les services de l’Etat doivent migrer vers une plate-forme Linux chaque année. Windows, une éradication totale d’ici 2020. WantChinaTimes révèle que ce plan est proposé par Ni Guangnan, un chercheur de l’Académie chinoise d’ingénierie. Selon les sources, il a déjà été approuvé, et le pays a mise en place la « machinerie » afin de suivre ce rythme de migration massive vers linux. L’objectif est de remplacer progressivement les ordinateurs Windows par des systèmes sous un OS développé en local basé sur Linux. La Chine estime que d’ici 2020, l’éradication de Windows sera terminée tandis qu’elle souligne avoir déjà en main une alternative puissante et plus sécurisée créée par les entreprises nationales. Microsoft est sous enquête ANti-Trust, Windows 8 interdit. Microsoft est devant un gros problème et ses relations avec les autorités locales sont tendues. La firme est visée par une enquête anti-trust. Plusieurs de ses bureaux ont été perquisitionnés et certains documents et ordinateurs ont été saisis. Depuis le mois de mai, Windows 8 est interdit en raison de craintes sur les intentions de de la firme. Ce système d’exploitation est perçu comme un outil d’espionnage des ordinateurs du gouvernement. Windows n’est pas l’unique logiciel visé par ce plan. La Chine semble décidée à remplacer le « software » et le « hardware» par ses propres solutions. Un certain nombre d’organisations ont déjà commencé cette migration. Le nom de l’OS Chinois n’est pas encore connu. La Commission chinoise des réglementations bancaires (CRBC) a informé les banques qu’elles doivent désormais migrer leur infrastructure informatique vers des systèmes d’exploitation développés par des sociétés nationales. Microsoft n’a pas encore pris la parole devant ces nouvelles révélations.
mini_pile
{'original_id': '2c8c6385df9537e38a7dde703036d0bbda9ac64d78da5938c1e14f08e554e694'}
Cant loggin in my account So, i disconnected my OSM account from my facebook, then i unninstalled my OSM and got it again and now i cant loggin again on my account because i disconnected my OSM account from my facebook, i tried to send like 10 times emails to get the password but i never got any. Someone help me please!
mini_pile
{'original_id': '91fcb3cfccf89453f79d9770822e6697ca5a1f0ae6c21f9ca76c234e9e18d952'}
| Emailthis TrendEmail | Full Article (TrendHunter.com/id/155725) Monthly Subscription Sunglasses The Freshades Company Delivers Handpicked Eyewear By: Sarah Nazim (Star) Jun 10, 12 If you are one of those people who is constantly losing or breaking your sunglasses, then Freshades might be the solution you need. The worst feeling is when you splurge on an expensive pair of shades, only to forget them somewhere or accidentally sit on them. What ends up happening is that you end up buying a cheaper pair. Instead of going through all of that hassle, it’s better to buy an economical pair that are just as stylish. Freshades offers a subscription service for only nine dollars a month. It allows you to handpick your choice of cutting edge eyewear that is sent straight to you. For many, sunglasses are an essential fashion accessory, especially for those living in warmer countries. Being able to have a variety is definitely a perk. Even if you lose or break them, you can rest assured that a new pair will be delivered soon. Source: freshades Readmore: facebook Related Trends: Tropical Cuban Hipster Eyewear Retro Baseball-Inspired Frames Rad Rave-Worthy Sunglasses Delightful Daisy Sunglasses Racing Rally Shades $75,000 Luxury Sunglasses Biodegradable Luxury Lenses Superman Shades Video Recording Glasses Copyright © TREND HUNTER Inc.. All Rights Reserved.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.8652976155281067}", 'metadata': "{'Content-Length': '12836', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CJDGRQPQP7TWEOFKO2TXSAUMSKKPKD5G', 'WARC-Concurrent-To': '<urn:uuid:42b76c2b-93ce-483b-bd56-61554b222552>', 'WARC-Date': datetime.datetime(2014, 12, 20, 7, 33, 20), 'WARC-IP-Address': '64.233.171.121', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:GWJ623L6XNLNSCLQ2UHEWZISOOBDZLQJ', 'WARC-Record-ID': '<urn:uuid:cc91579c-0af8-41fb-9931-e5e2797a4d00>', 'WARC-Target-URI': 'http://www.trendhunter.com/printView/freshades', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:93b03812-bfe6-4a17-928e-7aad7e665eb6>', 'WARC-Truncated': 'length'}", 'previous_word_count': '218', 'url': 'http://www.trendhunter.com/printView/freshades', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03712177276611328', 'original_id': '5f549bc60858a3c4b065b4f3f12577c73139e11fdbe33f70ffc73f1d9d9337d4'}
Peachland Lake Recreation Site, Star Trails at Peachland Lake It was the perfect weekend for camping, weather was in our favour, if even still a little bit warm for my blood - no trouble - we were gaining some elevation on Kelowna which is always a good thing for temperatures. We would leave late Saturday afternoon, with jobs and places of employment to be at in for the morning.  One important thing would be do not follow google map's directions to get to Brenda Lake if it takes you up to the 97C Coquihalla Connector, because well... you need access to the private, Brenda Mine located between the freeway and the destination lakes. So we drove there via the 97C and then turned around when we realized it wasn't happening, though a little frustrated we decided just to push on even though arrival was looking like it was going to be timed perfectly with sunset. We were greeted by loon calls, a nearly empty campground, a super still lake, and loads of dragonflies.  The only time I managed to catch a dragonfly in a frame was during my 2005 trip to Vancouver, in Stanley Park and that was with a fixed lens camera with some mild manual capabilities.  This weekend I managed to catch about thirty or so! I'd say they are as challenging or more so than hummingbirds.  Wildlife was plentiful, including loons and osprey all day long, a few frogs, spotted a deer or two, and believe it or not, cows, free ranging beef in action, actually seemed to dominate the area.  I must say it's the first time I woke up to hear a 'cow call' 'moooooo' in my life.   Our Campfire Seats Photographers don't need to dream at night when there is a cloudless sky with a bright full moon, wide open views and a super reflective lake just feet from my fireside seat.  As it turns out it was the 'Harvest Moon'.  Harvest moon or not, I remember thinking at the time, that full moon light is my new favourite light to shoot just about any low light scenic I can spend a night in.  I could go on about the reasons I think it's awesome, but this post isn't for that. Reflective Properties of the Lake There you have it, Peachland Lake in a nutshell. Well worth a visit for even just a single night of camping - only 40 minutes outside of Kelowna.  There is loads of ATV and MTB trails in the area, so if you have either, bring 'em!  Remember to consider the people who want to enjoy the recreation site after you and pack your garbage out. Trust me, no one wants to do that more than you do.   Sunset on the first night A handful of the shots in this post, and some that aren't have already made it to print-on-demand status at Zazzle.  The prices will vary based on the size you order, but basically they start around $20 and will be shipped to your door!  Thanks again. Peachland Lake Panorama Campfire and Seat on the Lake Fire and the Stars
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '106', 'language_id_whole_page_fasttext': "{'en': 0.9690257906913756}", 'metadata': "{'Content-Length': '103399', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:H2J3SH3LTYMVZD7TS34GKI3XEPSY3RTD', 'WARC-Concurrent-To': '<urn:uuid:5f45c735-19f9-486e-8972-a59a03884ffc>', 'WARC-Date': datetime.datetime(2021, 9, 20, 5, 47, 50), 'WARC-IP-Address': '142.250.188.211', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:BQKGW6JZ3ME2FDRS5WURVZEEZ2ZROE7W', 'WARC-Record-ID': '<urn:uuid:494ab818-4103-4d30-9126-9ba8e27aecaf>', 'WARC-Target-URI': 'http://blog.cgardiner.ca/2011/09/peachland-lake-recreation-site.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7f30126a-0bf9-41af-9e90-8b6f0999860e>', 'WARC-Truncated': None}", 'previous_word_count': '605', 'url': 'http://blog.cgardiner.ca/2011/09/peachland-lake-recreation-site.html', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-112\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.023240387439727783', 'original_id': '251e5f8784aa2c1183043f4bc4cafcda1b002a8510c15a628d5971924a3ead95'}
What is Infrared Radiant Heat? Alchemy Hot Yoga's Heat Source Infrared radiant (FIR) heat is a form of naturally occurring energy that heats objects with a process called direct light conversion. Direct light conversion warms only the object and does not raise the temperature of the surrounding free air. This type of energy travels 2-3″ deep into the body, increasing circulation and nourishing damaged tissue. Traditional heating systems heat the temperature of the air to a very high level within the room to warm the body. Some people have difficulty breathing in this extremely warm air. Infrared heat works differently: instead of heating the air within the room, infrared heats the body directly. ​​​ The infrared heat energy that is absorbed by human cells causes a physical phenomenon called “resonance.” The cellular activities are instantly invigorated, resulting in better blood circulation and overall improved metabolism. When infrared heat penetrates through the skin to the subcutaneous tissues, it transforms from light energy into heat energy. The thermal effect within the deep layers of the tissues causes blood vessels and capillaries to dilate, promoting better blood circulation, and the heat produced helps to get rid of the body’s toxins and metabolic wastes through sweating.  Infrared Benefits and Uses • Infrared heat directly penetrates tissues, and joints, allowing them to heal and regenerate through a combination of the aforementioned increased circulation, oxygenation, and detoxification. Infrared radiation is useful for pain relief for both minor injuries and chronic ailments in muscles.  • Infrared is used by physical therapists, and at saunas and yoga studios around the world.  • Infrared heat increases metabolism between the blood and tissue, which also burns calories.​ • Infrared heat will make you sweat, which is a good thing because it is your body’s natural way of flushing toxins. As your body absorbs infrared heat, water molecules begin to vibrate, which causes them to wring out impurities from the cells.  • These impurities will then be released from your body as you sweat, creating a deep, detoxifying cleanse on the cellular level.  • Infrared heat directly warms muscles, allowing for a greater range of motion. • It can help lower blood pressure, help oxygenate organs, and rid the body of toxins.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '27', 'language_id_whole_page_fasttext': "{'en': 0.9076993465423584}", 'metadata': "{'Content-Length': '450193', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GWEB66W4FHVC6PD4IQYDK3W5YNTCBXW6', 'WARC-Concurrent-To': '<urn:uuid:ee69c8da-8c71-45f0-b185-a62853069403>', 'WARC-Date': datetime.datetime(2021, 6, 22, 21, 50, 55), 'WARC-IP-Address': '185.230.60.161', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:622QBGJKSEWFV6UBSNTOZM5JLXXKLQ5F', 'WARC-Record-ID': '<urn:uuid:244368ca-a2d6-419f-899f-152e6a73a8b7>', 'WARC-Target-URI': 'https://www.alchemyhotyoga.com/infrared-heat-1', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e5695961-934f-49ad-9063-131d4c591740>', 'WARC-Truncated': None}", 'previous_word_count': '361', 'url': 'https://www.alchemyhotyoga.com/infrared-heat-1', 'warcinfo': 'isPartOf: CC-MAIN-2021-25\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-19.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.5780041217803955', 'original_id': '9a22218acd488159b819e617fd0dd51724a4c67ad13e9bda59c8dcc52a34cd30'}
This explains what you should do, if you lost your Password to Emucoach and cannot login. Please follow it carefully. 1) You create a new Emucoach Account. 2) You send me (ExO) a PM with your username. 3) Right after, you send a mail to: [Only registered users can see this link. Therefor you need to register first, and hopefully we see you wanting to join our friendly community we are trying to build up. Enjoy! ] FROM the mail that is registered/used on the Emucoach account. 4) I confirm, and send you a new strong password you can use to login. 5) You are now back into your old Emucoach account. NO, you cannot use the "Retrieve password". Mail server is disabled for security purposes.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9159072041511536}", 'metadata': "{'Content-Length': '51301', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:AT522SRRMIPSRSJZB57FQA5GZKBHKHWX', 'WARC-Concurrent-To': '<urn:uuid:97a1102e-9711-4e11-96af-5aa6c9327834>', 'WARC-Date': datetime.datetime(2019, 3, 18, 19, 18, 26), 'WARC-IP-Address': '104.27.157.22', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:KFOVX2DXTPYJCTI2K6CT4HYQ2FQXVF4K', 'WARC-Record-ID': '<urn:uuid:af8f47cd-6d86-4cc8-9096-048b8308c7a2>', 'WARC-Target-URI': 'https://www.emucoach.com/showthread.php/5214-Password-Reset-I-Lost-my-Password-!-What-to-do-TUTORIAL?s=f81873876d6339bf368d5d46f0493e88', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:9d49118e-6c2d-465e-ab9e-d87fe1c1b7ab>', 'WARC-Truncated': None}", 'previous_word_count': '122', 'url': 'https://www.emucoach.com/showthread.php/5214-Password-Reset-I-Lost-my-Password-!-What-to-do-TUTORIAL?s=f81873876d6339bf368d5d46f0493e88', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-152-225-239.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.021197021007537842', 'original_id': 'dc5c4b1910a85300ea8d0aa931252db91390ce02d94e74d6cd314a81d7822ea1'}
How to Roast Maple and Brown Sugar Brussels Sprouts Jupiterimages/Creatas/Getty Images Brussels sprouts are a much maligned vegetable. This bulbous, winter cruciferous is often thought to have a bitter taste and create a stink when cooked. However, Brussels sprouts can be absolutely delicious -- and not smelly -- when you prepare them correctly. They should never be boiled like your average vegetable. Brussels sprouts are best when pan-seared and roasted to perfection with your favorite seasonings or flavorings, whether savory or sweet. In particular, the sweetness of Brussela sprouts roasted with brown sugar and maple syrup are the perfect complement to their slight bitterness. Step 1 Preheat your oven to 375 degrees Fahrenheit. Prepare the Brussels sprouts by discarding any outer yellow leaves. Slice off the stems and cut each sprout in half, lengthwise, using a sharp chef's knife on a clean cutting board. Step 2 Combine butter and brown sugar in a saucepan over the stove on medium-high heat, stirring until the brown sugar has melted. For 2 pounds of Brussels sprouts, you'll need one stick of butter and 2 tablespoons of brown sugar. Step 3 Stir in 1/4 cup of maple syrup, then remove from heat. Use 100 percent pure maple syrup, whether grade A or B. Grade A maple syrup has a lighter maple flavor with a thinner consistency, while Grade B is a much darker, thicker maple syrup with a richer flavor. Step 4 Heat a drizzle of olive oil in a large, oven-proof skillet over medium heat and add the Brussels sprouts. Let them saute until they are slightly softened. Step 5 Pour the brown sugar and maple syrup mixture all over the Brussels sprouts, and stir to make sure all sides of the sprouts get covered. Cook them in the pan until they just start to caramelize. Step 6 Place the Brussels sprouts in then oven to cook for 20 to 30 minutes, until the sprouts are nicely browned and caramelized.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.897290825843811}", 'metadata': "{'Content-Length': '277413', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VONSKCTX5YBIROYVMMDIIOSQWIFJNK3Y', 'WARC-Concurrent-To': '<urn:uuid:9d2288d4-1dab-4ba9-9150-5d43f474d97e>', 'WARC-Date': datetime.datetime(2021, 5, 12, 6, 3, 42), 'WARC-IP-Address': '69.192.0.218', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QSV7MSDOSTZCRRSLQHNBXOONARHABV7B', 'WARC-Record-ID': '<urn:uuid:6e9eee32-0230-467b-9405-cecb03253062>', 'WARC-Target-URI': 'https://oureverydaylife.com/roast-maple-brown-sugar-brussels-sprouts-29616.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b6f1d401-0805-4a8a-b853-92dba7f601ea>', 'WARC-Truncated': None}", 'previous_word_count': '325', 'url': 'https://oureverydaylife.com/roast-maple-brown-sugar-brussels-sprouts-29616.html', 'warcinfo': 'isPartOf: CC-MAIN-2021-21\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-245.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.12674260139465332', 'original_id': '57648fbb71620beb507648a73254d1c7e862b0dd0127a7d8e338ae1bb5c121b3'}
7 Health & Anti-Aging Benefits Of Omega-3s 7 Reasons To Love Omega-3s And How They Benefit Your Health You’ve probably already heard about Omega 3 fatty acids. But what are they? And what health benefits do they offer? Let’s get started answering these questions! Omega 3-s are polyunsaturated fatty acids. Your body can’t produce them on its own, you have to get them from your diet. But do you really need them? Yes you do! Omega-3 fatty acids are crucial nutrients for your overall health. From an unborn baby and throughout life, your body and brain need Omega-3s to function properly. There are actually not many other nutrients that are packed with so many positive health benefits as Omega-3s. Here are some of them: 7 Health & Anti-Aging Benefits of Omega 3-s #1: Reduce Inflammation: In case you don’t know, the root cause of many diseases is chronic inflammation. Additionally, chronic inflammation speeds up the aging process.So reducing inflammation is one of the most important Omega-3 benefit. According to this study, Omega-3 fatty acids can help decrease system-wide inflammation. Therefore, if you eat a nutrient-dense diet that includes Omega-3 fatty acids, your body will be able to better fight inflammation, aging and diseases. #2: Healthy Skin It’s natural that as you age, your skin loses elasticity and you start noticing the first lines and wrinkles. After all, your body isn’t able to produce such a high amount of collagen as it used to produce when you were in your 20s. However, when you have a diet rich in Omega-3s, you’ll notice its anti-aging effects on your skin! #4: Preventing And Managing Autoimmune Diseases The one thing that autoimmune diseases have in common is that the immune system attacks healthy cells. This occurs when the immune system fails to identify healthy cells, but instead sees them as intruders. According to multiple studies, Omega 3-s can help not only to prevent the appearance of autoimmune diseases, but also improve or relief some of the symptoms. #5: Heart Health One of the most well-known Omega-3 benefit is related to heart health. And this benefit is really important since heart disease is one of the leading causes of death worldwide. This is an excerpt from a study published online September 30, 2019 in the Journal of the American Heart Association: “People who received omega-3 fish oil supplements in randomized clinical trials had lower risks of heart attack and other cardiovascular disease (CVD) events compared with those who were given placebo, according to a new meta-analysis from Harvard T.H. Chan School of Public Health and Brigham and Women’s Hospital. Researchers found an association between daily omega-3 supplementation and reduced risk of most CVD outcomes, including heart attack, death from coronary heart disease, and death from CVD, but did not see benefit for stroke. In addition, higher doses of omega-3 fish oil supplements appeared to provide even greater risk reduction.” via www.hsph.harvard.edu/news/press-releases/ What you should eat to get plenty of Omega 3-s My guess is that you by now are pretty convinced that Omega-3s are important for your health?! You may wonder though: “What should I eat to get plenty of them?” Since your body can’t produce Omega-3s on its own, you need to search for these fatty acids in the food you eat. Fatty fish, like salmon, mackerel and sardines, is the best source of Omega-3s. If you eat good quality fish at least twice per week, that should be enough. Unless you have a health condition that you think may improve with a larger dose of Omega-3s. And how much Omega-3s do you need? This is a recommendation from Healthline: “Although recommendations can vary widely, most health organizations recommend an intake of at least 250–500 milligrams of combined EPA and DHA, the two essential forms of omega-3 fatty acids, per day. However, a higher amount is often recommended for people with certain health conditions, such as heart disease or high triglyceride levels.” What if you don’t like fish or you’re a vegan? If you don’t like fish, or if you’re a vegan, what other foods are good sources of Omega-3s? To start with, Omega-3 contain several different types of fatty acids. The three main types are DHA, EPA and ALA: DHA (Docosahexaenoic acid): The most potent and vital fatty acid in Omega-3 is DHA. It can make a real difference to your health.You get DHA mainly from animal products like fatty fish, fish oil and krill oil. Meat, eggs and dairy from grass-fed animals also contain significant amounts. Vegetarians and vegans often lack DHA. So a good solution to this is to take a microalgae supplement. Algae oil is an excellent DHA source. EPA (Eicosapentaenoic acid): EPA is the “second” most important Omega-3 fat your body and brain need. It has several important functions, and it seems to be the best Omega fat for skin health and fighting depression. EPA is also mainly found in animal products, such as fatty fish, fish oil and krill oil. Some microalgae also contain EPA. ALA (Alpha-linolenic acid):This is the most common omega in food, and you mainly use it for energy. It can be converted into EPA and DHA, but only a small percentage of ALA is converted since the process is inefficient. ALA is found in foods like green, leafy vegetables, flaxseeds, flaxseed oil, canola oil, chia seeds, walnuts, hemp seeds, and soybeans.
mini_pile
{'original_id': 'e91335cac68b2b6e4d7620f278c9664007f5c05baea4b618f75f49009212a1ff'}
export SQUAD_DIR=data python run_squad.py \ --bert_model bert-large-uncased \ --do_train \ --do_predict \ --do_lower_case \ --train_file $SQUAD_DIR/train-v2.0.json \ --predict_file $SQUAD_DIR/dev-v2.0.json \ --train_batch_size 6 \ --learning_rate 3e-5 \ --num_train_epochs 2.0 \ --max_seq_length 512 \ --doc_stride 128 \ --output_dir run_squad_freeze_2e/ \ --version_2_with_negative
mini_pile
{'original_id': '130c910a329ba59d10cb588865ac5ef2b15ee4223191f66080cff54c5f295966'}
1. Homepage 2. Products 3. Accessories 4. Spare parts 5. Protective caps Spare parts - Protective caps • Protection against penetrating moisture for splitter boxes and modules • Ensuring the protection rating even if sockets are not used Accessories/Miscellaneous - Protective caps Protective caps serve to cover unused sockets of splitter boxes or modules. They guarantee the respective protection rating of the splitter box or module even if not all sockets are used.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.6790925860404968}", 'metadata': "{'Content-Length': '105158', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:TFIPXSNF7AAJOVX77MNGFOHQN4MIHZYD', 'WARC-Concurrent-To': '<urn:uuid:07997357-12a8-49e4-b58f-b41dc4d68aca>', 'WARC-Date': datetime.datetime(2018, 12, 10, 22, 11, 7), 'WARC-IP-Address': '104.110.206.247', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:MFPAQDBFEMS76SYYPIGMU5EZOILNEQWT', 'WARC-Record-ID': '<urn:uuid:1ca7662d-de0c-4a9f-bf33-3c2f6bdab9e6>', 'WARC-Target-URI': 'https://www.ifm.com/fi/en/category/110/110_200/110_200_010', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d1e64d32-35cc-4334-9536-5c5417eb5361>', 'WARC-Truncated': None}", 'previous_word_count': '69', 'url': 'https://www.ifm.com/fi/en/category/110/110_200/110_200_010', 'warcinfo': 'isPartOf: CC-MAIN-2018-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-182-98-18.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.5605486035346985', 'original_id': '0a01dec177a0a34a274b51ed63ce5aba82f7a3bd1cc36f04fd224929a6564a2a'}
Thursday, July 14, 2011 SummER Yumminess part 2 The same evening that I made the fig dish I also made this dish. Spinach and Feta Pasta In my bountiful basket I received a container of mushrooms, a large bunch of spinach, and 5 tomatoes on the vine. I knew I wanted to use all of these ingredients together because they complement each other so well so I found this recipe and tried it out. It was superb. A nice one pan dish that cooks up fast and gives you a healthy meal. So lets get on with the ingredients. 1 (8 ounce) package of pasta, I used rotini or you could do penne 2 Tbs. olive oil 1/2 C chopped onion (about 1/2 an onion) 3 C chopped tomatoes (make sure they are good and ripe) 3 cloves garlic minced(use your masher, Soooo much easier) 1 C sliced fresh mushrooms 2-3 C spinach leaves, packed(they cook down so if you have extra, throw it in) Salt and pepper 1 pinch of red pepper flakes 8 ounces feta cheese crumbled optional: italian seasoning(one that has a little bit of everything, I like Emeril's italian seasoning) 1. Get all your ingredients ready. Squeeze out your tomatoes because you don't want seeds in your meal. I minced my garlic and that is such a pain, just use a garlic masher. Make sure you rinse off your mushrooms and your spinach unless you buy that prepackaged spinach, which is a great time saver. The spinach really cooks down so you can add extra. 3. Meanwhile, heat olive oil in a large skillet over medium-high heat; add onion and garlic and cook until golden brown (yum smells so good. ) Mix in tomatoes, mushrooms, and spinach. Season with salt pepper and red pepper flakes. (you really need the red pepper flakes they add just the right amount of heat). I also added in a couple shakes of italian seasoning because it smelled like it needed some more seasoning. Cook 2 minutes until tomatoes are heated through and spinach is wilted. 4. Reduce heat to medium, stir in pasta and feta cheese, cook until heated through and then serve. I made this with a caesar salad and the fig dish and it was an exceptional meal, if you want it to be a little more hearty you could add some grilled chicken to it. Prep time: 25 min    Cook time: 15 min   Ready in: 40 min  Servings: 4-6 people I wanted a beautiful picture of it all plated but we were hungry so we just got down to eating it. :) SUMMER Yumminess  Feels like it has taken me a month to really get into summer. I love summer because of all the wonderful produce that is available which really inspires my cooking. This past week I bought a bountiful basket and part of my basket were a container of figs. Now, I've never eaten figs before so I did a search on to check out some fun reviewed recipes. Figs are a savory fruit that are mildly sweet so they are better if you can caramelize them in some way. So I decided on a recipe of Figs and Toasted Almonds Brie I love to pair cheese and fruit together so I thought this would be wonderful. So here are your ingredients. 1/3 C Brown sugar 3 Tbs. water 6-7 fresh figs, stemmed and sliced into eighths 1/2 C toasted almonds chopped 1/2 tsp. vanilla extract 1 (14 ounce) round 4 1/4-inch diameter round Brie Cheese 1/2 tsp chili powder, or 1 tsp. red pepper flakes (optional) 1. Pre heat oven to 325 degrees F (165 C) If you have raw almonds, place them on a cookie sheet inside the oven. Check them in about 10 minutes, they should have dark spots and a couple might be splitting a little and you can usually smell them. 2. Slice the tops off your figs, rinse them in water and then slice into eighths. 3. Heat brown sugar and water in a small pan over medium heat until sugar is dissolved. Add your sliced figs and cook for about 10 minutes until softened. Optional ingredient: After making this dish I thought it needed a little something. I thought a little spice would be wonderful in it so you could add a dash of chili powder or a little red pepper. I think it would add a great depth of flavor to the dish. 4. Add the chopped almonds and vanilla.(you'll notice I used whole almonds for mine, it would be much better if they were chopped a little) Place the Brie wheel in a baking dish. (I cut off the outside crust  on my brie. I was also in a rush to find some Brie that wasn't super expensive so I bought a Brie log from trader joes and sliced off the outside crust. It needed more brie so next time I will buy an actual round.) Pour the fig mixture on top of the cheese and place in the oven. 5. Bake in the preheated oven for 10 to 15 minutes, or until softened but not melted. Serve with crackers. (I used ritz crackers) This was absolutely delicious, it got rave reviews. I had some left over for the next night so I just microwaved it. It would be enough for 8-12 people or if you brought it for a party it would be perfect.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '37', 'language_id_whole_page_fasttext': "{'en': 0.9497488737106324}", 'metadata': "{'Content-Length': '99809', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:JSWKLJ3TGJ4OHIAP7W47PXK55FSXAQW2', 'WARC-Concurrent-To': '<urn:uuid:22c04fa3-fb9c-4e1c-8c89-b9989c4c5aaf>', 'WARC-Date': datetime.datetime(2017, 9, 23, 0, 19, 49), 'WARC-IP-Address': '216.58.217.161', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:LQKDUO6VCSVRBYZLJBQJRGQ7S4BGZE4T', 'WARC-Record-ID': '<urn:uuid:39933988-e66a-4553-ba99-c433cafbea67>', 'WARC-Target-URI': 'http://hodgepodgedays.blogspot.com/2011/07/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ff1ee9bd-fcda-4c10-ade8-404c9fb8bdfe>', 'WARC-Truncated': None}", 'previous_word_count': '919', 'url': 'http://hodgepodgedays.blogspot.com/2011/07/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-158-141-5.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018305957317352295', 'original_id': '634ef8ddd81201987686303a776cc9033a16afa528c4a1c6bfa9bb93e8f6e56d'}
1. Field of the Invention The present invention relates to an imaging device such as a digital still camera and a digital video camera (hereinafter, a digital camera) each having a function which corrects camera shake in shooting. 2. Description of the Related Art As an imaging device in which a subject image is received on an imaging element (for example, a CCD) via a shooting lens system (shooting optical system), and a digital image corresponding to the subject image is produced based on image signals from the imaging element, a digital camera having a function which corrects camera shake in shooting, a so-called camera shake correction function, has recently been developed for practical use. As such a camera shake correction function, for example, a structure has been introduced, which moves an imaging element (for example, a CCD) in a plane (X-Y plane) vertical to an optical axis direction (Z-axis) of the shooting optical system according to the blurring amount of a subject image caused by camera shake. In this conventional digital camera having the conventional camera shake correction function, the imaging element is mounted on a stage provided in one end of a fixing cylinder which houses a lens barrel on the shooting optical axis. This stage uses the shooting optical axis as the Z-axis direction, and is provided to be movable in the X-Y plane vertical to the Z-axis direction. This stage is moved by a magnetic force generated by a permanent magnet and a coil facing that permanent magnet. In this conventional digital camera, an inclination in the Y-axis direction and an inclination in the X-axis direction are detected by using a camera shake detector, and based on this detection output, power distribution current to the coil is changed, and the imaging element is moved to follow the movement of the subject image by the camera shake, so as to correct the camera shake. In this conventional digital camera, it is preferable to stop applying current to the coil when the camera shake correction is not performed in terms of decreasing power consumption. However, since the stage is movably provided in the one end of the fixing cylinder, if the positional control (hereinafter, electrical holding) of the stage using the magnetic force of the permanent magnet and the coil is stopped, the stage moves in the movable range, and crushing or impact with the end portion of the movable range may be caused. Consequently, a camera having a camera shake correction function including a locking mechanism which mechanically holds a stage (imaging element) is proposed (for example, JP2007-162889A). In this camera, the power consumption can be controlled, and the crushing and impact caused by the movement of the stage can be prevented. However, in the above-described camera having a camera shake correction function, it is necessary to mount the locking mechanism and an actuator for driving the locking mechanism. For this reason, the degree of freedom of the layout of the camera shake correction function and the like is decreased and also the entire costs are increased.
mini_pile
{'original_id': 'b8de14fdd39de4150b35841844d84ebf9866e5b6a1ddc8f5ad91879346f6f9bd'}
Hitherto, various resin compositions have been used for forming insulation layers in electronic components such as laminated plates and printed wiring boards. For example, in multilayer printed wiring boards, resin compositions are used for forming insulation layers to insulate interlayers located internally, and for forming insulation layers located on surface layer portions. The insulation layers generally have circuit patterns, which are metal layers, formed on the surface thereof. In addition, for circuit formation in manufacture of a semiconductor package, it is important how to accurately form circuit (Cu plating, etc.) patterns. As one method for forming a circuit pattern, there is a method in which a patterned groove is formed on an insulation layer and a metal is loaded into the groove to form a circuit pattern within the groove. This method is called a trenching process. A method for forming a groove by the trenching process is disclosed, for example, in Patent Literature 1 below.
mini_pile
{'original_id': '1a2639b957f467a93f3b6085b6b5b67f6ee8296d4cb546deeb90e06334686ede'}
Purple Mattress Rv Purple bed mattress is attempting to alter our extremely perception of exactly what a perfect mattress need to be. Inning accordance with the sleep expert representing the business, many people find a hard mattress more comfy and maybe an equal number of people find a soft mattress more comfortable. Many people discover a medium quality mattress more comfortable, which is neither too tough nor too soft. Nevertheless, all these bed mattress come with a couple of fundamental problems. Purple Mattress Rv Tough bed mattress are too firm, they lack bounce and convenience, there is absolutely nothing mild about the surface area and there is no comfort. Some people like the firmness however wind up with persistent pain. Shoulder pain, pain in the back and different other musculoskeletal discomforts are very common when you sleep on a hard bed mattress. Soft bed mattress is not a much better option if it fails to uniformly distribute the weight and does not provide appropriate spine or lumbar assistance. The majority of soft mattresses tend to lose their firmness, no matter how firm they were initially. There is no pressure relief at tactical points of the body. In a short span of time, the soft bed mattress completely gives up. Medium quality bed mattresses do not provide any respite as they integrate the shortcomings of tough and soft bed mattress. They are simply as bad for persistent discomfort like hard mattresses as they can facilitate arthritis like soft mattresses. How is Purple Mattress Different? Purple mattress is neither too tough nor too soft, it is neither medium nor a collection of all 3. Purple bed mattress is not your common memory foam bed mattress either. It is actually made from hyper elastic polymer. Active flexible polymer is a trademarked product. It is a pressure releasing product. It is used in grid development developing walls that can fold or support based on the pressure that is exerted on the surface area of the material. The grid development or column style naturally facilitates complimentary air circulation. This averts any moisture buildup or trapping. The lack of moisture makes the bed mattress more secure and enhances the sturdiness. Needless to mention, it also assures much better sleep. The complimentary air flow will cool off the surface area as well as allow temperature to escape. The most common grievance about memory foam is the heating concern. Many companies declare to have gotten rid of the heating issue but they haven’t and individuals understand faster than later. The patented polymer products utilized in Purple do not have the intrinsic issue of memory foam or latex among other bed mattress innovations. Purple Mattress Rv Purple has as numerous as fifteen patents going into just one bed mattress. A few of the patents attend to push releasing convenience while some attend to the assistance, some attend to toughness while some attend to no feel motion transfer. Purple bed mattress will not collapse, it will not establish any imprint or impression of the body, it will not lose its firmness or softness, the topmost layer or the base layer will not lose their main attributes, the bed mattress will be versatile enough to hold up against pressure therefore supplying relief at tactical points whenever needed. It is much better to be like lawn than a tree. Yard can hold up against a storm whereas a tree gets rooted out. Buckling of the surface area is not a bad thing when one needs even circulation of weight or pressure. Purple bed mattress is nontoxic and allergen resistant or hypoallergenic. It is made from recyclable materials. The bed mattress is CertiPUR-US ® accredited. Purple Mattress Egg Test Purple Mattress Vs Nectar Mattress You can buy Purple mattress on Amazon or on the official website. You can use a Purple bed mattress discount coupon to obtain a discount rate. However you would possibly think about Purple Mattress Vs Casper or Purple Mattress Vs GhostBed prior to you make a final decision. You ought to also think about Nectar mattress, which is superior to Purple, Casper and GhostBed among others. Let us rapidly explore why. error: Content is protected !!
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '793', 'language_id_whole_page_fasttext': "{'en': 0.9374180436134338}", 'metadata': "{'Content-Length': '43420', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YPIHSCPJ6YDCDXVZLMZZN2YVHDGIHR2J', 'WARC-Concurrent-To': '<urn:uuid:f976ee95-f200-42b4-80d3-9317fdbc238e>', 'WARC-Date': datetime.datetime(2021, 2, 27, 10, 15, 19), 'WARC-IP-Address': '35.209.165.31', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NKSG3IFIAQZBYK7T4PIZJCIZKDEMHOTI', 'WARC-Record-ID': '<urn:uuid:ce3c4510-c6f8-4eaf-a6e4-2c136ee1af7f>', 'WARC-Target-URI': 'https://accordages-intergeneration.com/purple-mattress-rv/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2a6f8040-674e-4774-89d7-234aab6143d6>', 'WARC-Truncated': None}", 'previous_word_count': '1099', 'url': 'https://accordages-intergeneration.com/purple-mattress-rv/', 'warcinfo': 'isPartOf: CC-MAIN-2021-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February/March 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-39.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.033471643924713135', 'original_id': '150bf59d601826a1df140952700d4e35ed2aeb415472abbd81c2cd4b2f39c455'}
View Full Version : Canon XH A1 05-10-2008, 05:53 PM I'm just looking at the Canon XH A1 on amazon and in the technical details it says that it captures: true 1080 resolution... then it says: Three 1/3-inch 16:9 CCDs (1.67 megapixels)... 1080 resolution?.... but 1.67 megapixels... whats resolution and whats pixels...(actually i know what pixels is)... I just wanna know: How can a 1.67 megapixel camera look clear on a very large screen?! (their filming Crank 2 with it)... 05-10-2008, 09:03 PM It really comes down to viewing distance. An image from a DVD (720x480) can look pretty decent on a large screen if you are a reasonable distance away from the screen. The XH-A1 shoots @ 1440x1080. At 100% (1920x1080 display pixels) the image is somewhat soft, but it looks great on a high definition television. I'm sure it would project well enough from an HD digital projector. The catch with HDV is in color depth, since the compression squeezes a lot of color bandwidth out of the image. I've been pretty happy with the video I've shot on it. Some of it looks extraordinary. The things that don't look as good are images with large dark areas, because the compression does add some noise to the image that is visible in dark areas. There are filters for cleaning up noise. I hope this helps.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9303614497184752}", 'metadata': "{'Content-Length': '6411', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YK5NIGAM5FJOKU353X7J27WQO6JDKZE4', 'WARC-Concurrent-To': '<urn:uuid:e61fe664-7225-4bdb-8466-6cfa7d93d676>', 'WARC-Date': datetime.datetime(2014, 3, 11, 21, 24, 57), 'WARC-IP-Address': '207.58.163.145', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:KHMN5DZHH2SRBNHN6GVLITVTUD2ITY2G', 'WARC-Record-ID': '<urn:uuid:45106e44-da26-4b03-8a6b-26d831c080e8>', 'WARC-Target-URI': 'http://www.indietalk.com/archive/index.php/t-13132.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0133c737-da50-4df5-9a5a-1c0f4baf4e66>', 'WARC-Truncated': None}", 'previous_word_count': '224', 'url': 'http://www.indietalk.com/archive/index.php/t-13132.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02499324083328247', 'original_id': 'ac0f9db201e6d310725314122d00ccae3637e6cc580ce4b7cf3e53efb72622a1'}
Select Page Contextual Modular Therapy (CMT) Over 25 years as a pioneer in the field of psychology has allowed Cairnmillar to develop a different approach to traditional therapies through cutting-edge research and proven results. The cornerstone of this is Contextual Modular Therapy (CMT), a unique method developed by Cairnmillar’s founder Dr Francis Macnab to address a range of personal and relationship issues. Having helped many people over many years, this approach is marked by collaboration with the therapist, allowing you to take an active role in building a better life for yourself. CMT brings together several schools of psychology including cognitive, dynamic, behavioural and the holistic existential. A practical and solutions-focussed approach, it examines the context of your concerns, tapping into unconscious influences and mapping out any anxieties. It explores the process behind your thinking, memory, emotions, behaviour and words, giving particular focus to their impact and working toward their effective management. Over six monitored sessions, you and your therapist work together to develop a plan with actionable steps to improve various aspects of your life. With a strong emphasis on helping individuals uncover their personality strengths and identifying issues, CMT has been a crucial step in the right direction for couples, children, adolescents and families alike.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9449208974838256}", 'metadata': "{'Content-Length': '82923', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:JPMJVDYOCDG73ZBXE3LI4XBPLNXCN4QF', 'WARC-Concurrent-To': '<urn:uuid:b1b059b5-a1cd-41fb-8f28-c4b42333ab65>', 'WARC-Date': datetime.datetime(2019, 8, 25, 19, 49, 55), 'WARC-IP-Address': '52.189.239.106', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:5QM2ZCW723VH24LHEXWDN3WKFEICRH62', 'WARC-Record-ID': '<urn:uuid:6953cf0d-4bc5-4fb3-9f34-af090a9d99f2>', 'WARC-Target-URI': 'https://cairnmillar.org.au/melbourne-psychology-treatment/clinical-and-counselling-services/contextual-modular-therapy-cmt/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7fb5ffbb-7bad-42a5-9780-a17f4f19cfae>', 'WARC-Truncated': None}", 'previous_word_count': '205', 'url': 'https://cairnmillar.org.au/melbourne-psychology-treatment/clinical-and-counselling-services/contextual-modular-therapy-cmt/', 'warcinfo': 'isPartOf: CC-MAIN-2019-35\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-85.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.01885807514190674', 'original_id': 'e1abe943cb79b439a582b9c9dd702731c24210fb63379d596dd6b0a6476e22ae'}
Q: SpecialKey foreground color w/ cursorline set In this Q&A, it's observed that there is a highlight group for CursorLineNr, which applies to the line number for the cursor line when set cursorline is on. I notice that using cursorline also changes the color for another highlight group, SpecialKey, which applies if you have, e.g.: set list listchars=tab:\|_,trail:- The problem with this for me is I use a dark background (and so a dark cursorline). My normal SpecialKey setting is also very dark, so that the listchar symbols are only marginally visible. But using cursorline they're white, which makes the trail char indistinguishable from having actually hit -. The trail character is used every time you type a space at the end of a line, so this is more than a minor issue; usually typing a line from beginning to end involves a number of spaces that should be easily distinguished from a dash typo while working (or vice versa, a space typo when you intended a dash). Since none of the other highlight groups seem to be affected, something like CursorLineNr is presumably being applied, but looking through the hi list I don't see anything appropriate. Does anyone know what this is? Better yet, does anyone know of a way to modify any highlight group for cursorline? A: I've been struggling with that behavior for a long time. Basically, the foreground color of SpecialKey on the current line is changed to the foreground color of Normal if: the cursorline option is enabled, the CursorLine highlight group has a background color set. I've never been able to fix that behavior, no matter what I tried. The problem lies somewhere in Vim's source code.
mini_pile
{'original_id': '1bcde22e01973e9a95a286f5138c4eab2da91d21d9fdd01d72f0705536a247bc'}
Computing Has Changed Biology—Biology Education Must Catch Up When I opinionated on and on about All Biology being Computational Biology, I was aware that these were not really novel ideas. After all Hallam Stevens had written a whole book about it and my friends inside my intellectual bubble kept on asking why I had spent so much time on writing up something so glaringly obvious. But what I had missed is that some of my points had already been made very clearly in an excellent piece by Pavel Pevzner and Ron Shamir in Science in 2009 titled “Computing Has Changed Biology—Biology Education Must Catch Up“. They argue: Advances in computing have forever changed the practice of biological research. Computational biology, or bioinformatics, is as essential for biology in this century as molecular biology was in the last. In fact, it is difficult to imagine modern molecular biology without computational biology. What they are basically saying is ‘All biology is computational biology’. And comparing biologists’ quantitative training to other fields like economy, they make the following sobering observation: [T]oday’s typical undergraduate economics curriculum may cover linear and integer programming, combinatorial algorithms, dynamic programming, game theory, and other computational concepts[, while biological training does not.] [T]he paradoxical result is that economics undergraduates may now be better prepared than biology graduate students to understand how DNA sequence alignment or gene prediction algorithms work (based on dynamic programming). And because of this: Bioinformatics and biology communities should work together so that education of biologists in the 21st century may become as sophisticated as the computational education of physicists or economists. I completely agree. Their message is as valid today as it was in 2009. One thought on “Computing Has Changed Biology—Biology Education Must Catch Up You gotta talk to me! You are commenting using your account. Log Out /  Change ) Google photo Twitter picture Facebook photo Connecting to %s
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.933759331703186}", 'metadata': "{'Content-Length': '72854', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4V6Y4KAU2FF6W6BYI6STMCGHG2GAHBH5', 'WARC-Concurrent-To': '<urn:uuid:fac3192c-1f98-41c6-a8f2-8c2510149daf>', 'WARC-Date': datetime.datetime(2020, 3, 30, 4, 40, 51), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2KS5HYZJ2W6KRY7WO64QZOPMQSU6YJO3', 'WARC-Record-ID': '<urn:uuid:99643227-5ce7-4b6f-9422-c8964c113f41>', 'WARC-Target-URI': 'https://scientificbsides.wordpress.com/2017/06/07/computing-has-changed-biology-biology-education-must-catch-up/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:65d214ff-5401-4999-9ae4-08bfe988cf6e>', 'WARC-Truncated': None}", 'previous_word_count': '347', 'url': 'https://scientificbsides.wordpress.com/2017/06/07/computing-has-changed-biology-biology-education-must-catch-up/', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-235.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.01966792345046997', 'original_id': '06d795f6dabb916b33313d90fa2b438349f51fd85d024da46fadb2e5dcf063a1'}
Snob Essentials Chickpeas: Why You Should Be Eating Them and Some Seriously Unique Options As far as I’m concerned, there’s only one downside to chickpeas; it’s easy to eat about 10 portions worth! So before I delve into the benefits and highlight some unique options, I highly recommend always portioning out your chickpea-based foods because while they come with a ton of health benefits, they are NOT a low-calorie food. With that out of the way, chickpeas are a fantastic source of vegetarian protein (a cup has about 15 grams). They’re very high in fiber, which means they’ll help you feel fuller longer (also great for digestion if you’re feeling clogged…), and they’re high in a bunch of vitamins and minerals including copper, manganese, and folate (chickpeas have three times more than kale). They also have cardiovascular benefits and help regulate blood sugar, and the American Journal of Clinical Nutrition recently found that those who add less than a cup of chickpeas to their diet can increase weight loss (this likely ties back to the aforementioned fiber). The most popular way to consume chickpeas is hummus. Now that I spend a good part of the year in Israel, however, it’s pretty impossible for me to go back and eat supermarket Sabra! I usually make my own hummus if I have time…it’s easy and there are countless recipe variations online. Alternatively, there are a few unique products that make use of garbanzo beans for tasty and unique results I haven’t even seen in Israel. Pure Genius is a line of chickpea-based brownies and blondies. They’re nut-free, vegan, gluten-free, and kosher. They taste amazing!! I have had a number of tahini-based desserts (including cookies, cakes, and ice cream) and am not a big fan (they’re usually too “savory” to satisfy my raging sugar cravings), but Pure Genius’ products taste so rich and decadent. Going back to my introduction, this isn’t a diet food per se. The treats have about 11 grams of sugar and about 200 calories per serving, but if you’re going to indulge, this is a good way to do so because those “bad” things aren’t from sketchy ingredients (everything is “clean” – think maple syrup, flax seeds, gluten-free chocolate…); and all of their products come with more than 40% chickpeas. Fittingly, the line was started by a health coach. Also worth a shout-out is Hope Hummus. If you’re not going to make your own hummus, or if you’re looking for a unique flavor profile, there’s nothing quite like this brand. They make organic hummus in non-traditional flavors like Spicy Avocado, Thai Coconut Curry, Chocolate (yes, it’s good!), and Kale Pesto. What I like about this brand is that unlike most hummus options that just offer dips for chips and breads, you can use some of these on fruits as well to satisfy sweet cravings. Lastly, I haven’t tried it yet, but I saw them on Shark Tank and am intrigued by the sauces and dressings that O’Dang Hummus makes as none of their products require refrigeration. Your email address will not be published.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.9328537583351136}", 'metadata': "{'Content-Length': '51236', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GS44AITY7TVSXBXLFEBFIAIC6LGYKFAD', 'WARC-Concurrent-To': '<urn:uuid:a711a1d2-489c-471f-8a18-d5b67b29f2c5>', 'WARC-Date': datetime.datetime(2019, 10, 21, 13, 19, 38), 'WARC-IP-Address': '45.34.43.11', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:3C4FBCINGI5TQYP6FIADHGRA6SYXS2EY', 'WARC-Record-ID': '<urn:uuid:07a7dcf7-a163-4880-a6fa-e545e9aa5c7d>', 'WARC-Target-URI': 'http://www.snobessentials.com/2016/05/chickpeas-eating-seriously-unique-options.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c0790dc4-d298-4617-a432-1acde95d10e3>', 'WARC-Truncated': None}", 'previous_word_count': '510', 'url': 'http://www.snobessentials.com/2016/05/chickpeas-eating-seriously-unique-options.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-43\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-28.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.01917850971221924', 'original_id': '1899f14949d90d0b6a564bfd6f226aa7f22e1872afeb303f869216149c6acb8c'}
How is the tomato fruit adapted to attract the seed dispersal animals? Tomatoes, along with many other fruits such as strawberries, raspberries, grapes and plums contain seeds surrounded by gelatinous coats which allow the seeds to pass through an animal’s digestive system without damage to the seed itself. This is a biological process called endozoochory. What are the 4 ways plants spread seeds? What are 4 ways that angiosperm seeds are dispersed? How is mango dispersed? Examples of seeds or fruits that are dispersed by the animals include the black jack and mangoes. It is dispersed by animals or humans that throw the seeds away after they eat the berries. What are the 3 basic parts of a seed? “There are three parts of a seed.” “A bean or seed consists of a seed coat, an embryo, and a cotyledon.” What is dispersal of fruits and seeds? Fruits and seeds dispersal is the process whereby fruits and seeds are scattered from their origin. The various ways by which fruit and seed are dispersed are known as agents of seed and fruit dispersal. How are tomato seeds dispersed from the plant? Animals excrete the undigested seeds miles away from the original plant. Half-eaten fruit was often carried and dropped miles away from the original plant. The ovary of a flower grows, ripens and develops one or more seeds. This is how fruit form. Tomatoes are fruits. Tomato plants bear a strong resemblance to deadly nightshade. How is the dispersal of fruits and seeds done? When the plant matures, the branches become incurved giving the plant a spherical form. The main stem now breaks and the plant laden with ripe fruits and seeds is rolled like a ball miles after miles by the strong wind. Seeds are dropped all along this route. Method # II. Dispersal by Water: How does a tomato plant germinate in the soil? The seeds themselves are later excreted without being digested and are thereby scattered. In time, through the action of natural processes in the soil, the outer coating dissolves away, leaving the seed free to germinate and produce a new plant. Tomatoes undergo open pollination. How are plants adapted to dispersal by wind? For easy dispersal by wind seeds have to be light so that their buoyancy may enable them to float on air over long distances. Seeds specially adapted for wind dispersal are characterised by the following: 1. Very small, dry and dusty seeds as those of orchids (weighing as little as 0.004 mg in some cases—Fig. 460) are carried by wind like pollens.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '55', 'language_id_whole_page_fasttext': "{'en': 0.9628496766090392}", 'metadata': "{'Content-Length': '46014', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XK25APOFKMMXKZ4FXLD6NM3LXQ5LNMST', 'WARC-Concurrent-To': '<urn:uuid:bb620646-6ea0-45e6-85a8-8484dd923134>', 'WARC-Date': datetime.datetime(2022, 11, 28, 21, 16, 45), 'WARC-IP-Address': '172.67.179.10', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:PEOO3TJZDPLFLUGIGUR4PJLKSLRESNER', 'WARC-Record-ID': '<urn:uuid:3d5579ba-b665-4ed7-beec-ffb6a7414e38>', 'WARC-Target-URI': 'https://runyoncanyon-losangeles.com/other/how-is-the-tomato-fruit-adapted-to-attract-the-seed-dispersal-animals/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e8b30b0d-b8ed-40ac-88c8-76333844c22b>', 'WARC-Truncated': None}", 'previous_word_count': '493', 'url': 'https://runyoncanyon-losangeles.com/other/how-is-the-tomato-fruit-adapted-to-attract-the-seed-dispersal-animals/', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-40\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9960964918136597', 'original_id': '8cda5b0053d5939832a1f7db1a5aa4f9ed17b5f7d9d9af0bc7c448f58439343e'}
Dumb Days by Horrible Things supported by  name your price released 05 April 2012 Lyrics by Tim Reynolds. Recorded in Bloomington, IN by Alex Bulli & Cory Cerna. Produced by Alex Bulli & Horrible Things. Mixed & Mastered in Springfield, IL by Luke McNeill. Illustration by Bill Fore. feeds for this album, this artist Track Name: La Paressé Oh you mother fucker. You stole her away from me. And she seems to think you're great, but I hope that we never meet. Track Name: $20 I found on the ground, twenty bucks. And I immediately had a plan for each one. Before I say what I did, I'd like to know what you would have done. So tell me what's so easy for you. (Easier said than done.) Track Name: (I'm) Waiting So I will keep on waiting, because I don't know what else do. To get things to turn around. And you never seemed interested, because you always kept your distance. So things never seemed to turn around. But I'd like to think, that there's a little but more to me, So until you see it, I'll just wait around. So until I see it, I'll just wait around. Track Name: (I'm) Writing (from C-U) I'm not gonna lie, I always have it in the back of my mind. Like flying or driving. I'm trying, I'm dying to see you. But as I lay in a single bed, I guess I'll just email you instead. Track Name: To-Do Lists So I'll watch my to-do lists growing longer, and i can bet on these obligations growing stronger, and i'll wait for all these rules to take a hold of me, but I cant let them strip me of who I am. Track Name: (I'm) Passive Aggressive I'm passive aggressive, so it'll never work out. And I'm kind of obsessive, so it's all I think about. But maybe this time I'll change and I'll grow up. But if not I'll just try again tomorrow. You're kind of dramatic so nothing ever works out. And that's problematic, since it's all I think about. But maybe someday you'll learn to let it go, but if not you'll still see me, cause if not I'll just try again. I'll try to change, but it's hard for me. Because it seems it gets hard not to be. And the worst part is, everyone is just like me. And we're passive aggressive, so it never works out. Track Name: A Friend Named Food It's how you felt it off and on, that made me feel it too. But I knew it along, and still ignored the truth. And there's one thing you should know… I probably still feel it. I can't help but feel it. I'l always be feeling it. Don't bother. Because then I'll feel dumb. If I saw you off and on, it'd probably start to feel new. But we'd know it all along, it's not something to see through. And if there's one thing I admit… I don't really feel it, do you really feel it? We can't keep on healing it. Don't bother. But it's so hard. Can you act mad? Because I know I've thought enough about you. Do I seem sad? I guess I have things to get through. And what we had, the past always seems to skew. That's too bad. Track Name: Steps Things are looking up finally, and I never thought that it would come. Things are looking up finally, never thought it would take so long. Things go on and on and on, that's the way they tend to be. On and on and on, but completely new to me. On and on and on, I'm getting used to it, the way it ebbs and flows. Things are looking up finally, I'm feelings things I've never known. Things are looking up finally, I can't believe I was so wrong. It'll happen again, but until then… Track Name: Before I Was American Before I was American, I bet it was easy. Before I was American, I didn't even know how to spend money. I wish I was alive enough to see, that they'd just put a number on me. Cause then I'd turn around right then. It was back then, it seemed so appealing. There's no way I could've known better. But now it's hard for me, Because I'd rather go back now. Never thought that I'd say that now, and I know that I don't want to do this alone. And I became American, when I first left my parent's home. And I really felt American, when I got a student loan. I wish I was smart enough to be, thinking of the other things I could be, without taking what wasn't given to me.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '13', 'language_id_whole_page_fasttext': "{'en': 0.9694184064865112}", 'metadata': "{'Content-Length': '101841', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:52COXCUSFRRRFKZ6FYEP6UKUMI5KCGY6', 'WARC-Concurrent-To': '<urn:uuid:825a803a-c855-4373-9eae-cda64025d937>', 'WARC-Date': datetime.datetime(2014, 8, 29, 3, 13, 58), 'WARC-IP-Address': '67.228.60.226', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:NNGGV7EEW2PFEHVL7IWBCXEARWADOKDG', 'WARC-Record-ID': '<urn:uuid:9f4fa3ab-098d-44fd-8db0-447131f55a16>', 'WARC-Target-URI': 'http://horriblethings.bandcamp.com/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:978002af-5d8d-4657-aab6-193802993a0d>', 'WARC-Truncated': 'length'}", 'previous_word_count': '826', 'url': 'http://horriblethings.bandcamp.com/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-180-136-8.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-35\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for August 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.020528018474578857', 'original_id': 'c4143f75937a043e5b015c20d7e1280200430735f9607b1b1167e405f8225d5f'}
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="ja"><head><meta charset="UTF-8"/><meta name="author" content="Japanese Layout Task Force"/><title>日本語組版処理の要件(日本語版)</title><link rel="stylesheet" type="text/css" href="../css/W3C-WG-NOTE.css"/><link rel="stylesheet" type="text/css" href="../css/base.css"/></head><body><h4 id="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end">3.1.9 <span class="heading"><span id="ja-subheading2_1_9">行末に配置する終わり括弧類,句点類,読点類及び​中点類の​配置方法</span></span></h4><p>行末に配置する<span class="index" id="d5e3936"><a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a></span>,<span class="index" id="d5e3940"><a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a></span>及び<span class="index" id="d5e3944"><a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a></span>は,その後ろを原則として<a class="termref2nd" href="terminology.xhtml#term.half-em-space">二分アキ</a>とする(<a class="figure_ref" href="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end.xhtml#fig2_21-ja">図 3.20</a>).この,原則として二分アキとする箇所は,行の調整処理の詰める場合の対象にして,ベタ組としてもよい(行の調整処理については,<a class="sec_ref" href="line_adjustment.xhtml#line_adjustment">3.8 行の調整処理</a>を参照).ただし,空き量を二分アキにするか又はベタ組にするかのどちらかで,その中間の値(例えば四分アキなど)としてはならない.また,行末に配置する<span class="index" id="d5e3958"><a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a></span>は,その前及び後ろを原則として<a class="termref2nd" href="terminology.xhtml#term.quarter-em-space">四分アキ</a>とし,<a class="termref2nd" href="terminology.xhtml#term.full-width">全角</a>の扱いとする(<a class="figure_ref" href="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end.xhtml#fig2_21-ja">図 3.20</a>).この原則として四分アキとする箇所も,行の調整処理の詰める場合の対象にして,<a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a>の前及び後ろを一緒にベタ組としてもよい(行の調整処理については<a class="sec_ref" href="line_adjustment.xhtml#line_adjustment">3.8 行の調整処理</a>を参照).ただし,空き量を四分アキとするかベタ組にするかのどちらかで,その中間の値としてはならない.</p><div id="fig2_21-ja" class="figure"><div class="figure-float"><div><img alt="行末に配置する終わり括弧類,句点類,読点類及び中点類を全角扱いとする配置例" width="359" height="276" src="../image/Images-ja/img2_21.png"/><div class="figureCaption">図 3.20 <span class="caption-body">行末に配置する終わり括弧類,句点類,読点類及び中点類を全角扱いとする配置例</span></div></div></div></div><table class="t_note"> <tr> <td class="ft" rowspan="1" colspan="1"> <p>注1)</p> </td> <td rowspan="1" colspan="1"> <p><span class="index" id="d5e4053">JIS X 4051</span>では,<a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>,<a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>,<a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>及び<a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a>の行末における配置を次のように扱っている(<a class="figure_ref" href="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end.xhtml#fig2_1_2-ja">図 3.21</a>).</p> <table class="t_sample"> <tr> <td class="ft"> <p><a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a></p> </td> <td> <p><a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>の後ろは,行末に配置する場合を含めて必ず<a class="termref2nd" href="terminology.xhtml#term.half-em-space">二分アキ</a>を確保する.この二分アキは,行の調整処理の詰める場合の対象にしてはならない.</p> </td> </tr> <tr> <td class="ft"> <p><a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a></p> </td> <td> <p><a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>の後ろは,ベタ組にする.</p> </td> </tr> <tr> <td class="ft"> <p><a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a></p> </td> <td> <p><a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>の後ろは,ベタ組にする.</p> </td> </tr> <tr> <td class="ft"> <p><a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a></p> </td> <td> <p><a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a>の前は原則として<a class="termref2nd" href="terminology.xhtml#term.quarter-em-space">四分アキ</a>とし,後ろはベタ組とする.</p> </td> </tr> </table> </td> </tr> </table><div id="fig2_1_2-ja" class="figure"><div class="figure-float"><div><img alt="行末に配置する終わり括弧類,句点類,読点類及び中点類の配置例 (JIS X 4051)" width="359" height="282" src="../image/Images-ja/img2_1_2.png"/><div class="figureCaption">図 3.21 <span class="caption-body">行末に配置する終わり括弧類,句点類,読点類及び中点類の配置例<span class="sub-caption">(JIS X 4051)</span></span></div></div></div></div><table class="t_note"> <tr> <td class="ft" rowspan="1" colspan="1"> <p>注2)</p> </td> <td rowspan="1" colspan="1"> <p><span class="index" id="d5e4287"><a class="termref2nd" href="terminology.xhtml#term.letterpress-printing">活字組版</a></span>時代は,次の考え方が主流であった(<a class="figure_ref" href="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end.xhtml#fig2_22-ja">図 3.22</a>).</p> <ol> <li> <p><a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>,<a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>及び<a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>では,<a class="termref2nd" href="terminology.xhtml#term.half-em-space">二分アキ</a>が確保できれば,確保する.つまり,二分アキが原則である.また,<a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a>は,その前及び後ろで<a class="termref2nd" href="terminology.xhtml#term.quarter-em-space">四分アキ</a>が確保できれば,確保する.つまり,四分アキが原則である.</p> </li> <li> <p>行長に過不足が発生し,行の調整処理で詰める処理の必要がある場合(<a class="sec_ref" href="line_adjustment.xhtml#line_adjustment">3.8 行の調整処理</a>を参照),優先的に<a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>,<a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>及び<a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>の後ろの<a class="termref2nd" href="terminology.xhtml#term.half-em-space">二分アキ</a>をベタ組にする.これは,行末でもあり,これらの後ろの二分アキがベタ組になってもほとんど問題にならないからである.なお,この二分アキを中間的な<a class="termref2nd" href="terminology.xhtml#term.quarter-em-space">四分アキ</a>にするという方法は採用されていなかった.二分アキ又はベタ組のいずれかを選択する,ということである.また,行の調整処理で詰める処理が必要な場合,<a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>,<a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>及び<a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>の後ろの二分アキより優先順位は低くなるが,<a class="characterClass" href="cl-05.xhtml#cl-05">中点類(cl-05)</a>の前後の四分アキをベタ組にする.</p> </li> </ol> </td> </tr> </table><div class="figure" id="fig2_22-ja"><div class="figure-float"><div><img alt="行末に配置する終わり括弧類,読点類及び句点類の後ろを二分アキ又はベタ組とした配置例" width="396" height="469" src="../image/Images-ja/img2_22.png"/><div class="figureCaption">図 3.22 <span class="caption-body">行末に配置する終わり括弧類,読点類及び句点類の後ろを二分アキ又はベタ組とした配置例</span></div></div></div></div><table class="t_note"> <tr> <td class="ft" rowspan="1" colspan="1"> <p>注3)</p> </td> <td rowspan="1" colspan="1"> <p><span class="index" id="d5e4463">DTP</span>などでは,行末に配置する<a class="characterClass" href="cl-06.xhtml#cl-06">句点類(cl-06)</a>,<a class="characterClass" href="cl-07.xhtml#cl-07">読点類(cl-07)</a>及び<a class="characterClass" href="cl-02.xhtml#cl-02">終わり括弧類(cl-02)</a>のすべての後ろをベタ組とする処理法も行われている(<a class="figure_ref" href="positioning_of_closing_brackets_full_stops_commas_and_middle_dots_at_line_end.xhtml#fig2_23-ja">図 3.23</a>).</p> </td> </tr> </table><div class="figure" id="fig2_23-ja"><div class="figure-float"><div><img alt="行末に配置する終わり括弧類,句点類及び読点類の後ろをすべてベタ組とした配置例" width="316" height="282" src="../image/Images-ja/img2_23.png"/><div class="figureCaption">図 3.23 <span class="caption-body">行末に配置する終わり括弧類,句点類及び読点類の後ろをすべてベタ組とした配置例</span></div></div></div></div></body></html>
mini_pile
{'original_id': '952b73f9c3e2ea29e4be8839a88f31a6fcece97e0bd0da551a8e29a6468d01b3'}
Breast Cancer Breast Cancer and Double Mastectomy Pharmacist Ben Fuchs and Alex discuss breast cancer, and Angelina Jolie’s recent double mastectomy. The brilliant German biochemist Dr. Otto Warburg discovered that deficiencies in oxygen make cells cancerous. (See: What Really Causes Cancer) In this video interview, Alex makes the observation “If you have brain cancer, why not have your brain removed?” Predisposed to ovarian cancer? Take out your ovaries! Predisposed to breast cancer? Let’s hack them off. When you have surgery to remove your breasts, your body goes through the same trauma as if a wild animal were eating you. This whole thing with Angelina Jolie is like a poster child for the utter insanity of the modern medical model. The BRCA gene mutations occur secondary to maternal malnutrition, when the baby is in the womb. A double mastectomy is one of the most severe and traumatic surgical procedures a human being can undergo, all in response to a mutation in her genetics that is secondary to lifestyle issues. Epigenetics is all about nutritional and lifestyle factors that are transcendent to genetics. It’s the environment that the genes are in! Watch the video for more information and details. Posted by postmaster in Video
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.930361270904541}", 'metadata': "{'Content-Length': '84355', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YD2XAUCQVLVMD3OI6RYDQGQ34PWWQTSH', 'WARC-Concurrent-To': '<urn:uuid:fc88e2ff-7bab-4094-91b3-557d6c140174>', 'WARC-Date': datetime.datetime(2022, 11, 27, 1, 55, 51), 'WARC-IP-Address': '70.39.234.221', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:74K6GXFTTVROIU2XOVTIJP4PHRTVMIXD', 'WARC-Record-ID': '<urn:uuid:f233a86f-2d34-451f-bf10-72a47e1aa0fb>', 'WARC-Target-URI': 'https://pharmacistben.com/tag/breast-cancer/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0742991d-addb-4b8a-b67d-d79e911e51b7>', 'WARC-Truncated': None}", 'previous_word_count': '200', 'url': 'https://pharmacistben.com/tag/breast-cancer/', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-8\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03901785612106323', 'original_id': '8c2d1240afa409d023e4edac25d379357fedb558f51628091cb2a903f58f98bb'}
A K Fill hi& PREVENT ALSO A GRAND STAND PLAY FOR -1 OESDAY'S ELECTION STATE DOES McNamara's Attorneys Emphatically Denounce Alleged Brib ery Attempt as a Scheme on Part of the Prosecution to Prevent the Securing of a Jury, Because It Is Afraid of Its Case It Also Is Claimed That It Is Done at This Time for the Effect It Will Have on Tuesday's Election, in Putting Socialists in Bad Odor. UNITED FUSS LEASED WISE. Los Angeles, Nov. 30. While deputy sheriffs and court attaches scoville Los Angeles county today locating 50 members of the 12th venire summoned in the McNamara murder trial, to appear before Judge Bordwell's court tomorrow, lawyers interested in the big trial remained secluded in their homes. But while there was an evident attempt to maintain a "nothing doing" attitude, there was actually no let up on either side. The injection of the Alleged bribery episode into the case has entirely changed the complexion of what seemed at first an ordinary murder trial. By retaining former Governor Henry T. Gage as attorney for Bert Franklin, their chief investigator, who is accused of bribing a venire man drawn for service in the murder trial after having him, the state alleges, specifically promise that he would "hang the jury," if he could not force an acquittal, the attorneys For the defense have made it very plain that they recognize the gravity of the allegation and the general demand that it be absolutely disproven. Lecompte Davis, of counsel for the McNamara defense, who furnished cash bail for Franklin, and who also retained Gage to defend him, openly charges that the alleged bribery is an "ugly plant," and he further states that there is no question in his mind but that the "very interests who have been behind the prosecution from the start are responsible for this bribery allegation." Davis, from the very moment that he learned of Franklin's arrest, has been vehement in his declaration. SHORT LINE IN TROUBLE WITH STATE Moscow, Idaho, Nov. 30. After a searching investigation, ex-Governor McConnell, of Idaho, Deputy United States commissioner of commerce and labor for Oregon, Washington, Idaho, and Montana, who has secured scores of affidavits and much other evidence of gross violation of the law governing employment of labor by the Oregon Short Line Railroad company at Pocatello, Idaho, has issued a letter directed to Judge Alfred Budge, of the district court of Bannock county, demanding that he call a grand jury to probe the conduct of the railroad system, who have to do with the employment of laborers. The contents of many of the affidavits reveal surprising evidence of a systematic plan in vogue in larger centers where large numbers of foreigners are employed to exact illegal tolls monthly from laborers. The following is a sample of scores of the affidavits now in possession of Mr. McConnell: "I James Kaloudros, of Pocatello, Idaho, being first duly sworn, depose and say that I paid to William Caravells, on or about the 22nd day of September, the sum of $20 for a job as car checker, and that I paid him William Caravells $2 per month to hold my job. Furthermore, that I had to pay $20 before I could get a job and I had to pay said amount or $2 each month in order to hold my job; that after being laid off a month I had to pay $20 to get my job back again, making $40 I paid for the privilege of working in the Pocatello shops. (Signed.) "JAMES KALOUDROS." "Subscribed and sworn to before me a notary public, this 13th day of November, 1911. "P. C. O'MALLEY, Notary Public." Commissioner McConnell said last night: "I am going to demand a grand jury to investigate the practice at Pocatello and if the head of the Short Line does not know of the existence of this system we propose to show them and to prosecute the cases to a finish." Burns the Terminus. "The extension of the road that the Oregon Short Line is building from Burns will be the western terminus of the Oregon Short Line." The Harriman system are carried into effect. Not what this was a "plant" to discredit the defense, and prevent them getting an unprejudiced and unbiased jury. He also insists that there is a political motive behind the case, claiming that the real reason the district attorney is forcing a hearing on Monday is to get its allegations before the public on the eve of the election. The reason, Davis alleges, is that it might have the effect of driving votes away from Job Harriman, the union labor-Socialist candidate for mayor of Los Angeles, who is one of the counsel for the defense. That Gage's connection with the defense in this case surprised the prosecution is a certainty. When he appeared in court yesterday, the representatives of the district attorney's office was nonplussed, and it was because of his vehement denunciation of "legal railroading" that the adjournment until Monday was granted by Justice Young. Reports that he had been paid an enormous fee, some figures placing it as high as $7,000, were circulated by persons connected with the prosecution. But no statement in this connection could be secured from those interested, they plainly stating that, for the present, at least, it was private business. District Attorney Fredericks continues to insist that his only object in forcing a speedy hearing of the Frarlin case is to show the necessity for a grand jury. He is getting scant sympathy in this attitude from the judges of the superior court, who are absolutely opposed to a star chamber ex-parte session, which is the Grand jury plan. IDENTIFY THE MEN WHO HELD UP THE STAGE UNITED MESS LEASES WILL Drain, Ore, Nov. 30. Edward Juergens and Fred Foster, suspected of holding up the Drain-Coos Bay stage, were brought here today by Sheriff Quine and Deputy Stewart. The watch they had was identified by the jeweler and several others as the watch of the stage driver. W. W. Kent, the hardware merchant, identified them as the fellows who tried to buy guns of him the day before the holdup, and Mr. Russell, the hotel manager, identified them as the ones that stayed at his place last Friday. District Attorney Brown is here with the sheriff to try the men. At the preliminary hearing they pleaded not guilty and were bound over to the district court, bail being set at $250 each. WILLAMETTE VALLEY HOP AND FRUIT LANDS IN DEMAND C. C. Patrick, of the Brida Veil Lumber company, of Portland, was in the city over Thanksgiving and is interested in some investments in Willamette valley lands. He is assisting in the formation of a syndicate that desires to get hold of about 2000 acres of lands adjacent to Willamette river, for small products cheaper by water before and with lands at $100 to $100 per acre, as the syndicate intends to get them, here will be a great many for hundreds of poor families to go on small tracts and raise product under contract. Mr. Patrick says these lands are The greatest rarity at the above prices, and as a great variety of fruit will grow in the city. and other fine can be clear it RIA loganberries, potatoes and on a large scale to supply the Fort- land market. canal at Oregon City this syndicate, trans. " '.,.K,mumi sheik Said, and there in no market. All these lands have lands have no market and can be wood, and on the first year. IS A JURY Taft Takes a Feed. Washington, Nov. 30. State business, internal negotiations, the Chinese war and Italy's difficulties are all temporarily buried today, and all attention is being given to turkeys and cranberry sauce and pie. Savory odors from the White House kitchen broadened the smile on President Taft's face, and the White House carving set was sharpened for the onslaught. President Taft was a little worried about the arrival of the big Rhode Island fowl from the Vose place, but , It came about the same time Mrs. William Howland's prize apple pie arrived. , President Taft, members of his cabinet and representatives of the Latin-American countries this morning attended the official Thanksgiving services at St. Patrick's church. - THE TRIAL OF A. J. BLETH IS A HOT ONE FOUND FRI. LEARED WITH Seattle, Nov. 30. Judge Ronald, who is hearing the case against Colonel Alden J. Blethen, newspaper publisher, charged with operating a public nuisance, has received a threatening letter in connection with the case. Its authorship is being investigated. It is believed the letter was sent as a lone. Court adjourned until tomorrow, when the Blethen trial will be resumed. So far, almost every step in the progress of the case has been contested bitterly by opposing attorneys. An article in the Seattle Star, was introduced in evidence, showing the character of the Arcade Dance hall, but it was ruled out on the ground that Blethen might not have seen it. It is contended that Blethen did not know the character of the hall. Stands for Rebating. The latest ruling of the new court of commerce virtually re-establishes the practice of rebating. It has reversed the ruling of the Inter-State Commerce Commission, which interfered with an attempt by the beef trust to evade that section of the inter-state commerce law ostensibly aimed at such practices. Rebating is one of the means whereby the beef trust obtained its monopoly. In picking out the members of this court, President Taft evidently knew what he was about. He picked men who he felt sure would deal tenderly with monopolistic privileges. His judgment is now being vindicated. FIGHT FANS GATHERED FOR THE FRAY Arena, San Francisco, Nov. 30. Under a warm California sun and with weather ideal, 3000 to 4000 fans gathered today in the 8th street arena to see the much-touted Packey McFarland, of Chicago, show his speed and skill against Harlem Tommy Murphy of New York. Great interest was taken in the outcome of the bout through the illness of Champion Wolgass and the probability of the fight here would be matched before many months in a contest with Freddy Walsh, who this afternoon was expected to show his class in. The bout in Los Angeles with Willie Ritchie, of San Francisco, who subbed for the stricken champion. The first preliminary was between Walter Payne, of Chicago, and Joe Athlson, of San Francisco. On the start, Payne rushed his adversary but Athlson came back and before the round closed. Payne went down and out front a right swing on the point of the jaw. The jaw was carried to his turner still out. Tokyo, Nov. 30. Mediation by the powers is expected here in the Chinese situation, the opinion prevailing that Japan, England, and the United States will take concerted action for restoring the peace. SOME New York, Nov. 30. If part of the story from Persia says that an Italian fleet has been dangled, that the entire town is destroyed. The inhabitants are fleeing. SALEM, OREGON, THURSDAY, NOVEMBER 30, 1911. San Francisco, Nov. 30. The steamship Shino Maru, which arrived in San Francisco this morning, reports the receipt of a wireless message flashed from the cruiser California, flagship of the Pacific squadron, two days off Honolulu, which stated that the ships were bound for China. The message, as received by the Shino Maru, follows: "Bound for Honolulu to coal, and then full speed for Shanghai." The officers of the liner expressed surprise on arrival that the ships' destination was not known. The fleet left San Francisco under sealed orders, and did not learn of its ultimate destination until far out at sea. An Example of How the Big Fellows Gather in the Stockholders' Money, While Apparently Working for Them, WITHHOLD INFORMATION Board of Directors by Act Has the Price of Another Stock and by Giving Information to Chosen Few Put Them All With Themselves in the Way of Making a Way of Money at Expense of Their Own Stockholders. The easy money for "Insiders" of big corporations of the United States was disclosed in Chicago telephone affairs last week when the American Telephone and Telegraph company offered to exchange its shares for those of its Chicago subsidiary concern. The stockholders and "outsiders" were astonished to observe, a rise in the market price of Chicago Telephone Co. stock from 125 to 138, no reason for this being apparent until the mysterious market movement had been under way for several days. Then those who had sold their stock were given the explanation, an object lesson in "easy money," making by those who sit on the board of directors of American corporations, or their friends. When the offer of the parent company, share for share, with the parent company's stock at $140, was made public the market rise was explained. The offer was as follows: "We hereby offer to exchange American Telephone and Telegraph company stock for stock of the Chicago Telephone company, share for share. To be transferred hereunder stock must be properly endorsed for transfer and deposited with the Northern Trust company, Chicago, on or before December 28, 1911." Several million dollars were quietly transferred to fortunate persons who were given knowledge of matters relating to the stock of which The stockholders were not apprised. This case was only one more to argue in favor of the British law, recommended in New York by Samuel Underwood, which prohibits directors dealing in the securities of their own companies, makes them accountable to the shareholders and to the public. Many corporation men are now pointing to the Sherman act as the one which needs reformation, ruling federal charters and control but neglecting to mention the shortcomings of the laws prescribing the duties of the directors to corporate affairs. IT TOX SIX LAIKE (United Press) New York, Nov. 30. Upton Sinclair, the author, who charged his wife with improper relations with Harry Kemp, has been granted his divorce. In refusing to dismiss Mrs. Sinclair's complaint that Sinclair had not given her proper protection, Frederick William S. Kelley said: "I hardly think a husband should be compelled to devote his whole time to protecting his wife, particularly from her own inclinations." She will recover. Stockton, Cal., Nov. 30. Mrs. Belle Axtell, who attempted suicide when her brother, S.F. Axtell, was sentenced to life imprisonment for the murder of Charles Sollars, regained consciousness today and a report given out by her physician at Los Angeles is to the effect that she will recover. Kolp in still very weak from the effect of the morphine and is unable to discuss her attempt to take her life. Sheriff Kelck expects to take Axtell to Folsom Monday. EASY COIN FOR THOSE OIL IDSIRE AOTIIER WORLD'S RECORD BRUCE BROWN! DOES THIS? A Desperate Fight. San Jose, Cal., Nov. 30. After slaying Mrs. Lena Blase. engaging in a battle of bullets from behind a barricade with an army of policemen, and then having his stronghold burned about his head, John Karso, an Italian laborer, lies dead here today, after blowing out his brains. His home was his funeral pyre, by the charred remains being recognized. Karso, who is believed to have been insane, attempted to kill his wife and two children early in the day. They fled. Then the Italian barricaded his shack and opened fire. Mrs. Lena Biase, a neighbor, was the first victim. The battle raged for two hours. Firemen were called out, and when capture seemed imminent Karso fired the house and killed himself. The United States united team has been united with Philadelphia, Nov. 30. The final struggle of the football season of 1911 took place here today, when Cornell and Pennsylvania clashed on the gridiron. The first quarter ended with the score 6 to 6. An intercepted forward pass brought Pennsylvania a touchdown, and Minds goaled. Shortly after this, Kyrlch, of Cornell, seized a fumbled punt at Pennsylvania's 40-yard line, and ran through a scattered field for a touchdown. Butler goaled. There was no scoring by either side in the second period. In the third period Pennsylvania made a touchdown and kicked the goal. Cornell scored a field goal. Score: Pennsylvania 12, Cornell 8. In the fourth period Pennsylvania scored a field goal. The Quakers. had all the bent of this period, the Cornell team falling to pieces, and shortly afterward Pennsylvania scored a touchdown, and kicked goal, making the final score Pennsylvania 21, Cornell 9. Tug's Roller Explode. Idkid rua Lamin!. Valley, Cal., Nov. 30. Great anxiety is felt at the Mare Island navy yard today, following a wireless message from the naval tug Iroquois to the battleship Oregon, intimating that a boiler on the tug Lucia had blown up in San Pablo bay. The Iroquois expected to reach the navy yard late this afternoon. It was not learned whether there were any casualties. WILSON CASE WILL GO UP ON APPEAL Olympia, Nov. 30. The attorneys for George H. Wilson have appealed his case to the supreme court of the state. Wilson was convicted of the murder of Mrs. Archie Coble at Rainier last July. The expense of appeal, amounting to over $700, will be stood by labor and fraternal unions of which Wilson is a member. Wilson's attorneys base their appeal upon alleged indiscretion on the part of several of the jurymen, who brought in the verdict of murder in the second degree at the trial in the superior court. Wilson's wife and five small children are now a public charge, depending entirely upon charity for support. Under orders from the war department at Washington that each officer here be prepared to take the field at a moment's notice, notice. Brig. General Macomb has rushed his command through physical examination and notified army headquarters at San Francisco that. Every officer on the regular and detached force in the Hawaiian Islands is ready. The rush order in the instructions were conducted at Fort Shatter, Fort Ringgold, and Schottield barracks. TO WHITK IN THE PARK AN iurm, iKiH'.vno Col. and Mr. K. Hofer left this evening for Klamath Falls, to be guest at the dedication of the White Pell.B Hotel. He saw 1,000,000 hotel built at the Hot Spring, by the Johnson Bros., of San Francisco. COR 1 HE MAKES 408 RATE OF 74.4 MILES All HOUR HEMERY HITS 82 MILE GAIT Hearne Took the Lead and Held It for 19 Laps, When Brown, in a Flat Car, Passed Him, as Did Mulford, in a Loveless Leaving, in a Desperate Spurt, Regained the Lead; and Was a Neck and Neck Race for, Forty Miles Before Brown Again Got the Lead Hearne Second, De Palma Third. WHITFIELD wins Savannah, Ga., Nov. 30. David Bruce-Brown In a Flat car won the annual grand prize, automobile race here today for the second consecutive time, breaking a world record by covering the 40,1 mile distance at an average speed of 74.4 miles an hour. The previous record was 74.15 miles an hour. Eddle Hearne, who held the lead for 20 hips and gave Bruce-Brown a nip and tuck finish, took second in his Benz car, and Ralph Delahua, winner of second place In the Vanderbilt cup race here was third. In The twentieth lap David Bruce Brown, winner of the third grand prize race last year, and holder of the American speed record at that time, passed Hearne and took first place. Mulford also passed. Hearne, being a close second in his Lozier and Learne was forced into third, with De Palma pressing him hard. After nearly 40 minutes of neck and neck racing, which sent the crowds wild with enthusiasm, Hearne again took the lead in the twenty-second lap. He was unable to hold it, however, Bruce Brown regaining in the twenty-third and starting the final lap one minute ahead. The cars finished, Butte, Brown, first; Harne, second; Ralph DuPaima, third and Bragda, who led in the early stages at the remarkable speed of 79 miles an hour, fourth. Bruce-Brown drove a flat car starting slowly, and took good care of his car, his finish, was the most brilliant in the present meet, when in the nineteenth lap he began to pass his other competitors and bear down upon Hearne, with Mulford close behind. Bruce-Brown's time was 231 minutes. THE PEERLESS MASQUERADE WAS A DANDY The masquerade ball given in D'Arcy hall last night by the Peerless orchestra was a delightful affair, and the hall was filled to capacity. Salem has had many affairs of this kind but never one that exceeded this in the perfectness of arrangements and the general enjoyment. The prize for the best costumes was given to Hyde Stroht and Miss Pearl Clark, representing the devil and his wife; for the best sustained china to 11 L, Huntington and Miss Huffman, representing a Chinese. The couple, for the most comical character, to Tracy, Hutch (representing a tonic gentleman). The prize for waltzing was given to C. K. Huts and Miss May Leyner. ABERDEEN WILL KEEP OUT. V. W. This is the text as it appears in the book. Aberdeen, Wash., Nov. 30. A patrol of the city by special policemen is to be maintained for as long a time as may be necessary to defeat any new invasion by the I. W. W. Each squad will have its captain and will be assigned a bent like the regular policemen. At a certain signal, the entire force of 100 or more men will assemble at the city hall to be assigned duty, should a large force be needed. At present, the regular force makes it a point to meet all freight and passenger trains, and if any of the workers are found, they are sent away and warned to keep away. Other towns in the county are also organized against them. Hunker is indicted. Fairbanks, Alaska, Nov. 30. Beven indictments charging embezzlement have been returned by the federal grand jury here against K. T. Harne, president of the defunct Washington Alaska bank, which failed January 4. Harne is in Los Angeles. Miles at the Miles, 39 seconds and he set a new world's record for the distance with an average of 74.4 miles per hour. The previous record was made by Nazzar, 75.16 miles per hour. Hearne's time in the race was 233 minutes, seven seconds, and De Palma's time was 234 minutes and 40 seconds. The fastest lap in the race was made by Hemery in the fifth circle in the course. An average of 82 miles an hour in his Bent car, Dlsbrqw, Mitchell and, Llmberg were the only others out of 16 contestants. Still running when the race was declared over. In the province, the battle raged today, with the Carlisle Indians defeating Brown University 12 to 0. Two touchdowns, won for the Indians in the first half, and the second half being an even struggle, largely in neutral territory with neither side able to cross the enemy's goal line. ANOTHER RIFLE FLEET, EXCEPTIONAL VICTORY . Shanghai, Nov., 30.--The troops are rushing from the province of Unpen, Honan and Quan Tung to reinforce General L. Yuen, Hung, forced at Haukow. The reinforcements number 20,000, and another big battle will be fought immediately. They arrive for the possession of Wu Chang and Hanyang. The rebel fleet is also rushing there from Nanking. ITALIANS ARE BURIED ALIVE BY CHINESE London, Nov. 30.-Newg of the buried alive of five Italians and the discovery of multitudinous bodies of members of the Italian Red Cross at Trippi, was received here. In special dispatch today, the advices state that the Red Cross members were apparently tortured to death in revolting ways. An Italian, who escaped by hiding in the sand for three days, was found alive. Suys he saw the mutilations, and that the Italian were buried, up to their shoulders and left to starve to death. Turkish office, and women were present, he declares. Tacoma, Nov. 30. City commission held an eight-hour session probing the Green River gravity water construction yesterday. Engineer J. H. Preble already has been released and several Inspectors may get the ax. The $2,000,000 job threatens to run far above the bond issue. Dr. Carl died. Dr. Walter L. Carll, one of the leading physicians of Oregon, whose home has been in Oregon City for many years, died yesterday after an illness of several months. Dr. Carll was well known throughout the county, and was one of Oregon City's most public-spirited men. One of the men is for the whale. San Francisco, Nov. 6. Andrews, now on his way here from the east, falls from San Francisco December 13 for Japan and the whaling stations of Korea to get specimens of whales and porpoises, birds, and mammals for the American museum. He will take moving pictures of what he sees and will be gone six months. Triplets in Portland. Aiming other things that Mr. and Mrs. George Freitenstein, of 212 East Twelfth street, North, Portland, will have to be thankful for today is a bevy of youngsters, three in number, which the stock brought to the show yesterday. Two boys, and one girl, each weighing six pounds, composed the trio. Dr. P. O. Haas, who assisted the stock, reports that all concerned are in excellent condition.
common_corpus
{'identifier': 'sn99063957_1911-11-30_1_1_1', 'collection': 'US-PD-Newspapers', 'open_type': 'Open Culture', 'license': 'Public Domain', 'date': '1911.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '4232', 'token_count': '5639', '__index_level_0__': '12734', 'original_id': '70ea89fce8af7cc6c4cea5098efb7f49d5d0f21654c8aebd09800277f6b11a63'}
August 31, 2008 Fiery Space Explosion in Gimp Here's a new tutorial in Gimp for ya guys. Today I'm going to teach you how to create a fiery space explosion in Gimp based on a tutorial by Collis at PSDTuts. Here is what we are going to create: Step 1 In the original tutorial, Collis focuses on the Rule of Thirds, a method that simply states that if you divide your canvas in three lengthwise and vertically, your main focal points should be at the intersections, or along the lines themselves. The reason being for having your main focal point off center is that it creates a more visual interest. Take a look at this image from Collis: Keeping that in mind, I'm going to keep my focal point in the bottom right corner. Step 2 Alright, let's start our composition. Create a new canvas. Mine will be rather large, at 1280x800. Use a radial gradient, with a rather subtle light color where the explosion will be. Make it somewhat like mine: Now let's give it some texture. Create a new transparent layer. Go to Filters > Render > Clouds > Solid Noise. Use these settings: Click ok. Set the cloudy layer's blending mode to Screen and lower the opacity to about 12%. Step 3 I chose to next use this stock due to it's texture (Right Click>Save As): In your canvas window, go to File > Open As Layers. Open your aurora image. Rotate the image so the aurora runs lengthwise. You can also use the scale tool and adjust the aurora to better fit your image. Go to Colors > Desaturate and click Desaturate. Now get out a large, soft eraser and erase pretty much anything that isn't part of the aurora. You can leave the sky in it, though. Set the layer to Dodge and lower the opacity to 50%. Step 4 Now we are going to add the stars. Download this image of stars below: Go to File > Open as Layers and select the star image. Lower the opacity to about 19-20%. Step 5 Now we'll add our planet. I am going to be using this planet found via Google: Open up the planet as a new layer in our piece. Resize, rotate, and place it in the desired spot abiding by the Rule of Thirds I mentioned earlier. Step 6 Now let's give our planet a little more depth. Duplicate the planet layer. Run the dodge/burn tools over it. Make the top of the planet lighter, and the bottom of it darker. Set the layer mode to Screen. Step 7 Now let's add our planet into the image again. Do this by going to File > Open as Layers, and select your planet. Shrink the planet so it is even smaller, like in mine below. Desaturate it so it looks, well, different from our larger planet. Rotate it a bit, and use the dodge tool on the part where it will collide with the larger planet. Step 8 Get out the gradient tool, and select FG to Transparent. Make white your foreground color. Right click > Alpha to Selection on the planet layer. Create a new layer and apply the gradient to the selection, going from where the comet is, to the bottom of the planet. Select > Deselect. Set the layer mode to Overlay and lower the opacity a bit. Step 9 Go ahead and move the comet layer behind the planet layer. Create a new layer. Grab a large, soft brush and click only once or twice to get a nice, white, soft glow as shown. Step 10 Now use the scale tool and the rotate tool to elongate the light like I have done. Also be sure it is tangential to the main planet. Step 11 Now we'll add a blue glow to the outside of the light. Go to Filters > Light and Shadow > Drop Shadow. Make the X & Y Offsets 0, the radius 15, and do not allow resizing. Change the color to a darkish blue, or whatever matches your planet. Click ok. Step 12 Duplicate the glow layer and rotate it so it's opposite the last glow layer. Go to Filter > Repeat Drop Shadow. Your second glow should have the same glow as the first. Let's add some color to it now. Get out another large, soft brush. Now I want to stick with a sort of blue explosion. I'll make my brush blue. Paint the explosion a bit and set the layer mode to Overlay. Duplicate the layer. Set the new layer to Screen. Step 13 Duplicate one of the light layers. Go to Filters > Blur > Motion Blur. Use these settings: Set the layer mode to Screen, and lower the opacity. Step 14 Now we want to create a tail behind our comet. Duplicate your layer we just made. Lower the opacity. Smush it a little and blur it a bit. Place it behind our comet. Give it some color if ya want. Remember to change opacities and such and to also play around a bit with what you're making. Makes it more, creative, I guess you could say. Step 15 Now we are going to grab this image found via Google:  We will use this image to form some of the tail lights on the comet. Open this image as a layer and place it behind our two planets. Use a soft eraser and erase everything except for what you see in the image below. It makes it look somewhat like particles are being thrown out by the collision. You can even duplicate the layers a couple times and make it different. Step 16 Right click on the planet layer and select Alpha to Selection. Create a new layer behind the planet layer named "backglow." Fill the selection with white. Select > Deselect. Press the Up & Left arrow keys a few times to move the white ellipse in the direction shown. Afterward, go to Filters > Blur > Gaussian Blur. Blur by 40. Click ok. Set the backglow layer to Overlay and duplicate it. Blur it again, and move it up and to the left even more. Step 17 Now we need the all-important lens flare. Create a new layer above all the others and fill it with black. Go to Filters > Light and Shadow > Lense Flare. Render your lense flare. Set the layer mode to Screen. Step 18 Now we'll apply a subtle blur to soften the whole image. Go to Edit > Copy Visible and Paste as Layer. You should now have a new layer with our WIP on it. Duplicate it. Hide one of them. Desaturate the visible one. Go to Filters > Blur > Motion Blur. Select Zoom as the type of blur. Play around with it until you get something like this: Step 19 Now set the blurred layer to Overlay at 20% opacity. Alright now grab the other layer we hid earlier. Repeat the blurring process to it (but don't desaturate it!). Set it to 10% opacity. Step 20 Let's add some texture to it, shall we? Alright, so grab one of these paper textures from BittBox. Open the texture as a layer like we have done previously. Move the layer to in between the light layers. Erase all but the parts where I haven't. Set the layer to Overlay. Lower the opacity if needed. Step 21 Alright we are almost there! Yay! Now let's add in this image of the moon via Google: Open it as a layer in our composition. Shrink the size of it down to about the size of our comet. Get out the burn tool and burn the side of the moon facing away from the explosion. Step 22 Now let's make our moon interact with the explosion a bit more. Use the eyedropper tool and select one of the main colors from the explosion. That turns out to be a blue for me. Right click on the moon layer, and select Alpha to Selection. Create a new layer. Use a soft brush to paint a cresent shape with our selected color. Be sure it is facing the explosion. Duplicate the cresent layer. Blur it with Gaussian Blur by 8 or so. Now you are done! Enjoy. 1. fantastic adaptation of collis's tutorial.. love it.. thanks :D:D 2. ¬¬ sometimes I don't believe in what GIMP and a genius can do! 3. Good work, can i translate this page to Turkish and publish on Debian Linux Turkish noncomercial wiki site. 4. awesome work! you're very talented. 5. nice tutorial. you are a very good descriptor, and very smart as well. 6. This is a great tutorial. You're very intelligent and a good decriptor as well! 7. Amazing Tutorial :D True genius, Love it! You gave me the inspiration to go and make this - Thx :D 8. Great tutorial! One thing, though...(and I don't know if you care) but the stars you used to make chunks in the comet tail are the Pleiades cluster...probably the most singularly recognized star cluster, like, ever. If it bothers you I guess you can distort it or chop it up or something! Thanks again for the tut. You are teaching me GIMP! 9. WOW, The result truly looks amazing. 10. Thank you so much for this. I now have more confidence in myself and know more about the tools and features of this program, so thank you so much for all of your help. 11. Thank you so much, I like this tutorial, you teach me lot of GIMP tool 12. i need some help. i get completely confused at step 12. how did you get your picture to be like that? i did what it said to do in the instructions, but i was still confused. if anyone could help me, it'd be greatly appreciated, i really wanna make this photo. it looks really cool!
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.8957616090774536}", 'metadata': "{'Content-Length': '120926', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ENQXTDLCE657WJR2VPKGHSW2MODDIEM2', 'WARC-Concurrent-To': '<urn:uuid:f1e5c2cb-49c7-4802-8318-3dc7b25c8d51>', 'WARC-Date': datetime.datetime(2015, 1, 25, 3, 45, 36), 'WARC-IP-Address': '173.194.121.10', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:43BFJBZNXYDHS7WPFZXJBCPGXTSYBARM', 'WARC-Record-ID': '<urn:uuid:8a1bdd2f-cee8-4a50-99d8-bc58c41727b2>', 'WARC-Target-URI': 'http://sglider12.blogspot.com/2008/08/fiery-space-explosion-in-gimp.html?showComment=1220241720000', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:06c5c44c-af17-4c15-bb7f-17243e16a79a>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1658', 'url': 'http://sglider12.blogspot.com/2008/08/fiery-space-explosion-in-gimp.html?showComment=1220241720000', 'warcinfo': 'robots: classic\r\nhostname: ip-10-180-212-252.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-06\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for January 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025774598121643066', 'original_id': '5c236b229afb20e7e6ddd20bf3c23efdfa20f200d27e92637177e54d315ec31a'}
« Rhys Chatham On Tour | Main | Hoof & Mouth Sinfonia: The Monster at the End of This Marathon, part 9 » March 09, 2006 He also seems to have 'borrowed' from Leave it to Beaver, and I bet there's a lot of photographers pissed off that he used their work in that way. I think the funniest part -- or most telling, anyway -- is when he says liberals want to make it so people can't say God in public. Um... what? Does he not understand the difference between public sidewalks and public legislation? And anyway, I always thought God didn't want people saying God in public. Is it possible he's confused liberals with God? What a stupid fuck. P.S. Did he just spend too much time in the MysticTan booth, or is he in fact non-white? The Winston-Salem Journal once called Mr. Robinson the black Jesse Helms, and the candidate has puzzlingly embraced the description. Helms is "the last prominent unabashed white racist politician in this country," according to the Washinton Post, so why on Earth would any African-American politician want to be compared to him? In case you were wondering, yes, Jesse Helms is still alive. Brian C. Looks like he was using a "Twilight Zone"-themed campaign when he lost in 2004. Seems like even conservatives don't like this clown, at least according to this rag http://www.americandaily.com/article/4690 PJ Puryear Thanks to Randy for putting this up. Everyone needs to know who this guy really is. FYI, Vernon is running against Brad Miller in the 13th. Despite the vitriol this guy emits every time he opens his mouth, he raises serious money ($2.9 million in the 04 primary against Foxx), which may cause some difficulties.We appreciate any support you all can give us. Also make sure to sign up to our email list so you can catch the latest on Brad and, unfortunately, on Vernon.Thanks for the help,PJ PuryearCampaign ManagerBrad Miller Congressional Campaign PJ Puryear | In itself the ad is disgusting, but to pile so many copyright violations on top of it (there's no way this falls under fair use and I'm sure Vernon's people didn't get clearances for all those clips). I hope somebody tells Jerry Mathers to sue that guy. Yeah the guy is a douche. But that doesn't mean he should be censored by copyright laws because you disagree with him. I believe what he does with TZ constitutes satire, which is protected. If you he held a viewpoint that you agreed with would you still want him busted by copyright laws? Doctor B. I want this guy to have all the airtime he wants to use, however he wants to use it, copyright issues or not. Why? Because I want every American who thinks that Rush, O'Reilly, Hannity, etc. just might have a point to see exactly where that crew and that ideology is going to take them if they don't watch out! It's too late for the True Believers who support people like Mr. Robinson, but perhaps - just perhaps - the people just over the right side of the fence might be persuaded to jump back over it to the other side! The only difference between the reactionary talk show garbage-mouths and this guy is that Mr. Robinson is merely 5 years ahead of them! Yes, the spewage was quite amusing on it's own. However, I couldn't just let the putrefaction go unanswered. So I took the piece and put dumbass on another spin altogether. Well just don't vote for him then.It is that easy! Progressive Beacon I blame Wal-Mart and the Jews. Reality stinks It's hard to put a finger on what is wrong with the Twilight Zone ad--except for the copyright violations. Most Americans are not homophobic, but they are nymphophobic. And most gays are nymphs. His ad attracts people who are modest (75% of voters). What is "low" about saying "keep sex in the bedroom"? The "God" part of the ad shows how stupid we are. Letting Newdow try to push the Pledge of Allegiance out of schools was the dumbest thing any ever thought of! I still can't figure out the problem with the pledge. The "abortion" comment is just like all the other anti-choice ads we see. So no surprise there. You can't fight people like Robinson unless you use a little logic instead of going all emotional. Most voters think with their heads AND their hearts. If I wanted to campaign against Robinson, I would point that he was a four-time loser. I would point out that his own party hates him. Derek, if you want Robinson busted for copyright infringement, you should apply the same yardstick to WFMU, who is hosting the video. And I'm sure you don't really want to do that, do you? Hell I live in the 13th NC district and thanks to this post... Take that you Godless Communist Sodomites! it's complete copyright violation, not satire - they haven't modified the logo or the music in any way, he simply is using it for his own advertising. It's against the law without express permission. On top of that, the one child is clearly wearing an abercrombie t-shirt (let's not even get into the latent homoerotic implications there...) -- you need permission for that too, because it implies they gave corporate approval of his campaign. this should be passed around as much as possible, if you ask me. Godfrey Daniel I wish this guy was running in my state. Very cool to hear someone with commonsense expressing it clearly without the pc-fear-of-the-media hollow rhetoric of most pathetic politicians. Good Luck Vernon Robinson. Huh? The description doesn't match the video at all. Quite the opposite of extremist, this Video ad seems just like ordinary American values. I wish him luck, if he were running in my district I would happily vote for him. Listener Mike D. Umm, Vernon, you do realize that the so-called "liberal" judges who legalized flag burning included Antonin Scalia? And do you also realize that Justice Stevens, one of the Court's most liberal memebers, dissented in the case? I guess "facts" are not part of traditional American values, at least not when they get in the way of rhetoric. Read Texas v. Johnson (1989). I understand its a lot more painful than watching a 30 second TV ad, but the reason politicans can get away with this crap is that they know Americans do not read anymore. It's very long. Enjoy. And get the facts. As a black man from North Carolina,I would like to say that Mr. Robinson would do well to recall that not so long ago, those ‘traditional, American values’ he extortes, included lynching Negros from trees… Wake the $§/&)? up bro! Whoever secured the copyright clearance for the audio/video on the "Velvet Undergound on the Lawrence Welk Show" item above should give this guy some pointers on intellectual property. Jack hankey Well folks I hate to spoil your fun but he is right. You all liberals try to twist and turn everything. You are for butchering millions of babies but not a mass murder. I for one will vote for him. When you all lose enough seats you will see the error of your ways. I only wish this man was from Texas so I could vote for him. The ad may be a little over the top, but his website does what most politicians won't do... post side-by-side comparisons of their positions vs their opponent's. Assuming that is an accurate representation of Brad Miller's voting record, I can't believe NC voters would re-elect Miller. a. m. young Robinson is a couragous man, beholden to no one, Democrat or Republican. Good luck, sir! Scott Beringer If you think his ad is offensive, then you are offended by the truth. All of you name calling truth twisters are lost in more ways than one. I wish someone like him runs in Nevada. Good luck Mr. Robinson! D. H. Hoagie This guy is pretty far out. In this country he has that right. As I listen to his commercials I agree with part of it but not all of it. Seems he goes a bit overboard. Seems he is pointing out that we have big problems in this country but he fails to point out that for the past few years his fellow Republicans have controlled the Congress, the Senate, the White House and the Supreme Court. If we have problems in this country, then the Republicans will have to take part of the blame. One thing about Mr. Robinson's commercials; he has at least got some people on both sides of the fence interested. The comments to this entry are closed.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '17', 'language_id_whole_page_fasttext': "{'en': 0.9656253457069396}", 'metadata': "{'Content-Length': '69485', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZBU7GDBGCSDGVXQX6IZHLIRUWGYOEZQT', 'WARC-Concurrent-To': '<urn:uuid:1880cd70-3880-4e78-81dc-da10c6be576f>', 'WARC-Date': datetime.datetime(2019, 4, 20, 14, 44, 46), 'WARC-IP-Address': '104.18.136.190', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:MIEHIHBB3463JVKKSTRRXFYWYF77S7NA', 'WARC-Record-ID': '<urn:uuid:2faed487-e18d-46dd-ae60-9356d6f06695>', 'WARC-Target-URI': 'https://blog.wfmu.org/freeform/2006/03/vernon_jordan_h.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3c49c003-6578-49b3-8bdc-b2a2b6b7f47b>', 'WARC-Truncated': None}", 'previous_word_count': '1486', 'url': 'https://blog.wfmu.org/freeform/2006/03/vernon_jordan_h.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-165-178-231.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.039347171783447266', 'original_id': '3628078dd5310d24aa4ba8ce9bff4e84e80bc01406de7320ea14ddf5038ebfe7'}
Cert. denied.
common_corpus
{'identifier': '7641019_1', 'collection': 'Court Listener', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '', 'title': 'None', 'creator': 'None', 'language': 'Unknown', 'language_type': 'Unknown', 'word_count': '2', 'token_count': '7', '__index_level_0__': '26013', 'original_id': 'ca9cf64b176899feb0dd2b4dd6b6e51903d4244b73d705eac39a323f76ff35d6'}
Mom, Small Business Owner, and Civil Rights Advocate, Charlene Strong, announces run for Seattle City Council Seattle – Charlene Strong, a civil rights advocate best known for her fight to expand rights and protections for LGBT couples following the tragic 2006 death of her partner Kate Fleming, today announced her bid for Seattle City Council in Position 8. This seat is the at-large, open seat as a result of the retirement of Councilmember Tim Burgess. In kicking off her campaign, Strong laid out her vision for representing all of Seattle. Specifically, Strong promised to fight to make Seattle more affordable, to advocate for small businesses, and to tackle the issue of homelessness, addiction and mental illness – an issue that has impacted her personally. “I have a family member who struggled for many years through the cycles of addiction and homelessness. So, this is deeply personal for me,” Strong said. “I believe there is more we could be doing in this city to accelerate the good work that has been done while continuing to be compassionate and effective. I want to add my voice and my energy to that work.” In addition to addressing issues around addiction and homelessness, Strong plans to be a champion for small businesses in our city. As a small business owner and with more than 20 years of experience in business management, Strong believes the city’s continued economic success depends on doing more to protect and boost small businesses. “As with housing affordability, small businesses are being priced out of the commercial real estate market,” Strong added. “We could be doing more as a city to support small business in terms of streamlining permitting and increasing access to microfinancing and capital for low and moderate-income small businesses.” In 2006, Strong turned sorrow into action following the tragic death of her partner, Kate Fleming, who was trapped in their flooding basement in Madison Valley during a devastating storm. Because she was denied hospital visitation for her partner and there were no laws protecting LGBT couples at the time, Strong testified in the Legislature the following session to push for rights and protections of LGBT couples. The legislation passed, a first step of many in the march toward marriage equality. For the next ten years, Strong flew across the country speaking at universities, advising governmental agencies and departments and pushing for laws that expanded civil rights and marriage equality. Now, Strong is the Chair of the Washington State Human Rights Commission where she leads the Commission’s important work to protect the rights and expand equality to all Washingtonians, like her recent work on HB 2029, which would create a telephone hotline and website to assist people on immigration and citizenship issues. Strong is married to Courteney Bealko, a longtime friend who helped Strong rebuild her life after the devastation in 2006. They both live in Magnolia with their two young children, Etta and Anders. For more information, please visit Charlene Strong’s website at www.electcharlenestrong.org.
mini_pile
{'original_id': 'f019cecdbcdc96a18e668786eeee89609cb8e4fb71ee9e14279bf804ad8fef25'}
you're reading... Anonymity: the Good, the Bad, and the Ugly Anonymity is a strange concept when you think about it.  As people we often like to know whom we are in contact with and who is involved in our lives.  It’s possible now that you can communicate with someone halfway around the world, who you have never met and who you really truly do not know the identity of.  The idea that someone unknown to us sits behind a computer screen and interacts with us can be rather unsettling.  Sometimes we picture the anonymous users as creepy, disfigured old men preying on young girls, or young teenagers pretending to be older than they really are.  We picture these people to be sitting in a dark stingy basement, lit only by the glow of the computer screen, alone.  In reality, many of these anonymous users are average people who seek refuge online, away from their everyday lives. Why anonymous? The Internet is a great source for seeking information, connecting with others, and voicing an opinion on an open forum.  In order to do some of these things, many may create false identities under a pseudonym or even remain completely anonymous all together.  In a study conducted at Carnegie Mellon University on why people seek anonymity on the Internet, the results concluded that there are two important factors that may lead people to form their Internet lives with either a different identity or none at all.  These two factors are “their prior negative experiences, and their desire to manage the boundaries between their online and offline worlds.”  As for the first factor, anonymity can be used as a sort of defense mechanism and safety shield from online predators.  Different sources and websites can obtain personal information that is shared online.  This information leak can more readily cause individuals to steal identities in terms of credit cards and banking information.  Some interviewees in the study disclosed they had been stalked online from the information they provided on social media sites.  Creating false identities or remaining nameless is used as a protection mechanism for themselves in their physical form as a result of previous upsetting situations.  Regarding the second factor, the individuals wanted to create a division between their real lives and their lives online.  For example, a college student in the job application process wouldn’t necessarily want all her online activities seen by future employers.  Instead, she might create a pseudonym to protect her real life identity, but still be allowed to partake in online activities.  These may include writing raunchy fan fiction or a blog about radical opinions that might have employers questioning her character.  This allows for this girl or any other person to display the part of themselves they choose to.  They can exist in different social spheres without ever needing to intertwine the two or multiple versions of the self. In a personal example, a friend created a twitter account in high school and posted relatable things for teens.  This twitter account was created under the name Teen Things, as not to connect her directly to the page in fear that others from school might discover her secret.  As a girl who was bullied in school, she created the pseudonym as a way to protect herself from possible bullying that might have ensued had she used her real name.  She was able to avoid the bullying she feared by remaining under her anonymous pseudonym and only chose to reveal her identity once she graduated high school. The Good Turns to Bad Remaining anonymous online or using a pseudonym can be beneficial as in the examples above, however, the problems arise when those individuals start to abuse their power.  One result of this abuse of nameless power has become a major problem especially with young teens, known as cyberbullying.  Cyberbullying is unwanted aggressive behavior that takes place over electronic media such as cell phones, tablets, social media sites, websites, chat, text messages and more.  The behaviors associated might include spreading rumors or lies online, sending mean messages, posting pictures without consent, or tricking others in order to reveal personal information. It is especially prevalent among teens and young adults, the age group most likely to use the media most.   Cyberbullying is much like regular bullying, but often worse for the victim as it becomes inescapable.  Sometimes, online bullies fully own up to their torture tactics by using their own identities to harass someone.  The anonymity factor added to many websites and social media sites creates an even worse condition for the victims.  Now they become bombarded with attacks, rumors, name calling, all from unidentified individuals.  There is no one to point the blame to put a stop to it.  Social media sites like Twitter, Facebook, and ask.fm are especially susceptible hosting sites to online bullying.  Ask.fm is a site that allows users to ask questions with the option of remaining anonymous, much similar to that of the controversial site, Formspring. This anonymity that social media sites offer allow bullies to target peers without the risk of being caught.  Many cases of cyberbullying and resulting suicides have been highlighted in the news recently, including the death of 12-year-old Rebecca Ann Sedwick.  Sedwick jumped to her death off of an abandoned cement plant as a result of incessant online taunting.  She received a barrage of hateful text messages through kik and ask.fm applications including some that read “Why are you still alive?” and “You’re so ugly.”  The constant torment just proved to be too much for the young girl who felt she had no other choice but to give in to the individuals that bullied her.  Just a few months earlier, 14-year-old British teen Hannah Smith killed herself after receiving a bombardment of anonymous hateful messages on ask.fm.  Smith’s parents then took on the task of passing around a petition to get the British government to intervene on behalf of the well being of young people and make policy changes to prevent bullying. Thankfully not every story is as tragic as Rebecca’s and Hannah’s are, but these instances of bullying are not rare occurrences.  Approximately 70% of teens witness some form of bullying online, myself included.  There is not a given day that I go on Twitter where I don’t see some sort of argument or hate messages.  I witness my friend get bombarded by unwarranted messages on ask.fm telling her she’s “too fat” or “looks like a cow.” Sometimes the hate messages are even directed towards a celebrity.  We are surrounded by these images on a daily basis. Tackling Cyberbullying More and more people seem to be jumping on the bandwagon to prevent online bullying.  It’s hard to control the speech of bullies through anonymous websites like ask.fm, especially when the identity of the person is unknown.  It makes it difficult to reprimand or assign consequences to the individuals who choose to use their anonymity in a hateful manner.  As a possible solution to help combat hate, a new computer code has been developed that detects commonly used derogatory words to spot any potential bullying.  MTV has already put the code in place to screen messages on it’s site, A Thin Line, a space created that allows teens to talk about their digital abuse stories.  Mr. Karthik Dinakur, creator of the new system, describes that terms like “slut” and “fatty” in a comment would be flagged for review.  While it is a new computer system, Dinakur and others are hoping other sites will adopt it as a preventative measure to get at the heart of bullying.  As for other solutions to combat hateful messages, there aren’t any federal laws in place to prevent them.  The Internet is a vast place where anyone can write what they feel as a form of freedom of speech.  It would be awfully hard to combat every single comment made; however, legislation should be made that would limit some of these occurrences.  Anonymity would be much nicer if bullies did not hide behind it to create a hostile environment, but rather as a way to foster new ideas. No comments yet. Leave a Reply WordPress.com Logo Twitter picture Facebook photo Google+ photo Connecting to %s %d bloggers like this:
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.947060763835907}", 'metadata': "{'Content-Length': '58744', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QCMF46Q6FYEWEKLTT2STHT362YD32W6Y', 'WARC-Concurrent-To': '<urn:uuid:a864c926-a4ef-43e6-a7a5-2330a31cfbfa>', 'WARC-Date': datetime.datetime(2017, 5, 23, 20, 28, 33), 'WARC-IP-Address': '192.0.78.12', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:SLIMYNTCQIDEXUFJJPMYJHUBUWZHRCVJ', 'WARC-Record-ID': '<urn:uuid:4148bb66-46df-4e51-8f1d-231151b31db2>', 'WARC-Target-URI': 'https://fordhamcyberculture.wordpress.com/2014/03/14/anonymity-the-good-the-bad-and-the-ugly/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6b56755c-a63a-4491-8c42-2c122a9bd662>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1358', 'url': 'https://fordhamcyberculture.wordpress.com/2014/03/14/anonymity-the-good-the-bad-and-the-ugly/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-224-210.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-22\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for May 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06716185808181763', 'original_id': '470c93e5932a204502653b4508563956c5435ffce1d4d84040811811da8ae975'}
You are currently browsing the category archive for the ‘Democrats’ category. Zeh Donkey Also, Cornel West looks really funny. Here’s the rundown of last night’s circle jerk:Let's make out. H: OK Obama: B-, there were no feets of fancy here, no grand rhetorical statements, just Barry in all of his “clean” and “articulate” glory. Coming from an Obama supporter, meh. Most outlets, including Drudge, are naming Obama the winner, but I disagree. Hillary: B, came off surprisingly well considering this debate seemed largely aimed at shooting her down, the randomness of the questioning probably kept the Hillary attacks at a minimum…except for Gravel who did whatever he wanted to anyway. She actually brought up a few policy points. Edwards: C+, was unusually stoic and somber, I imagine he was envisioning a puppy being skinned in the back of the auditorium…and then he imagined the lawsuit he’d file against the skinners, thereby climaxing on the debate floor. He did manage to explain his healthcare proposal fairly well, though he gets dropped a letter grade for saying “high falutin'” only once. More after le jump: Read the rest of this entry » Tonight is the first of what is sure to be many long, arduous, annoying, over-produced, under-informed, cynically commented, rigorously over-dissected, craptastically over-prepared debates this election cycle. It’s Momma vs Obama vs Pretty Boy vs a bunch of losers.  Should be fun. Me?  I’ll be watching with a beer in hand and my rapier wit sheathed for an event so vastly important it is being carried on the lowest rated major cable news network in the country. Salud, I’ll post my impressions later. After all is said and done, the Outer-Loop, while often being a gleeful agitator of libertarians in general and American libertarianism in particular, is a vocal supporter of the ideals of a true libertarian society. I would love to have a safe country where everyone who tried could make money and personal responsibility was the rule and not the exception. Alas, I don’t think that’ll ever happen…but hey, I got my little capitalist fingers crossed!I just like this picture. Reason magazine is – in my opinion – one of the best political sources around. Kudos to a publication that is so influential on American economic and political theory yet can successfully run ads for psychotropic liquor delivery without batting an eye. Ten points Reason, nothing but net. Anyway, Reason Express editor Jeff Taylor wrote a fantastic piece on the war in Iraq that made a serious and essential distinction from the usual rhetoric coming from both sides. “But the significant thing about these American successes is that they are American successes—Iraqis still play a supporting role in operations in a clash of all-ends against the middle fighting, where double-crossing and double-dealing is just part of the order of battle. That state of affairs might not matter for the long haul in Iraq if another 160,000 U.S. troops were in-bound, but they are not. Neither does Iraq have its own functioning national army of 500,000 or so to even the score. Instead it has perhaps a handful of reliable brigades out of a population of 30 million. With such a paltry force, it is impossible to secure the country even with America’s complete and utter conventional military victory well in hand. Contrary to the cliché, the peace has not been lost; there never was any peace in Iraq. Similarly, the Iraqis have not lost their country—it turns out there is no such thing as an Iraq to win.” Democrats and Republicans alike continue to classify this war in terms of the archaic concepts of Victory vs Defeat. There is simply no such thing as either of them anymore. There is only compromise, we did it in the Cold War, in Vietnam, indeed, in every war since World War II. There are no longer any winners or losers, there are only people who lost more and people who lost less. So let’s get the hell out of Iraq and lose less. According to The Hill, our good friend Johnny McCain seriously entertained leaving the GOP in 2001. After the obscene reaming he received from the Bush campaign in South Carolina and by the Swift Boat guys throughout the primary, then Senate majority leader Tom Daschle and several other key Democratic strategists reportedly courted three Republicans as possible deserters.mccain1.jpg The three were not very surprising. Lincoln Chafee, the liberal Republican from Rhode Island, Jim Jeffords, another liberal Republican from Vermont, and McCain, a conservative Republican…but a maverick and a loose cannon who brought rock and roll to Pleasantville. Jeffords, who had long wanted to bolt from the GOP, had no political capitol to lose in the state that brought you Howard Dean, Ben and Jerry’s, and hippies armed to the tooth. When Jeffords made his announcement, the other two immediately withdrew themselves from consideration, worried that a relatively large defection would hurt reelection efforts and jeopardize their committee placements should the Republicans regain power. No doubt this will further hurt his primary fight should the story get legs. Looks like the Straight Talk Express will finally have to do some straight talkin’. WashPo is reporting that none other than Mr. Orphan Annie himself is going to formally endorse Sen. Clinton on Monday.tom-vilsack.gif This will do wonders for her support among, um, Iowans, but as is evidenced by her husband’s campaign in 1992…that’s not necessarily indicative of anything. Remember that Bill Clinton skipped the Iowa caucus entirely and still won the nomination. This is not a suprise, Vilsack was the former head of the Democratic Leadership Council which is codename for The Bill Clinton Proverbial Fellators Club. The organization is a pro-business moderate wing of the Democratic Party that is currently headed by former Representative and Football/Girl loving Harold Ford. Regardless, this will add a bit of drama to the race considering Edwards’ sad week and Obama’s little dustup with that fake Apple Ad. Let’s see what happens next week, no? Anyone who’s been to D.C. in the past few years has no doubt seen the brilliant “Taxation Without Representation” license plates. For those who don’t know, D.C.’s nearly 600,000 residents are forced to pay federal income taxes, yet still do not have a vote in congress. DC Vote License Plate Why can’t they have a vote? Well, there are several schools of thought on the subject of its constitutionality, Article 1, Section 2, Clause 1 of the United States Consitution says thus: Strict constructionists will argue that since the District is not technically a state, it cannot have voting rights in congress. Proponents of voting rights argue that the constitution places the hands of D.C. primarily into that of the congress, so an amendment would not be necessary. The political reasons are fairly simple and are the frank reality behind the city not getting represented properly. D.C. is strongly Democratic, the numbers are roughly 9 to 1 if not more. According to the last U.S. census, George W. Bush was the only Republican in Washington…and he wasn’t even President yet. Republicans fear that by giving D.C. a seat, a fairly innocuous thing in and of itself, it will be a slippery slope towards full statehood/Senate representation, a prospect that is far more damaging to the Republicans. The House has created a compromise, however. Former GOP Rep. Jack Kemp was, to his credit, one of the largest proponents of unconditional voting rights for D.C. After he retired, VA GOP Rep. Tom Davis, who is otherwise a douchebag (like Adam Putnam), took on the mantel of D.C. voting rights ninja in the 109th congress. His solution was to grant the District its House rep and also add a seat to Utah who had been clamoring for another one since the last census. Most people in D.C. noticed this transparent and childish political tactic, but the general consensus was that it was fine as long as the District finally got the right to vote in its own interests. New House Judiciary Committee Chairman John “Slow Talker” Conyers has revived the bill and it looks as though it will be successfully pushed through the House. The Senate and Executive, however, are a different story. In the Senate, you’ll find Democrats and Republicans opposing the measure. Why? The Republicans are dead afraid of two liberal Democrat Senators popping up from the city, and Democrats from small states are afraid of the dilution of their power. The measure could be voted down, or it could be filibustered. It will likely never reach the President. But if it does reach the Oval Office, the President has quite a conundrum on his hands. Bush is more than likely beginning to think of his legacy now. With Iraq and Afghanistan not doing so well, his tax cuts looking less and less stable, his MediCare program on the rocks, and his attempts at reforming social security destroyed…he needs to think about something he can spin positively in the years to come. Imagine being the President that brought voting rights to a city with a population larger than that of the entire state of Wyoming? Conversely, the President could be spooked by the possibility of Eleanor Holmes-Norton actually having a say in something and veto the bill. There are quite a few possibilities. So, like Sisyphus, D.C. continues rolling the great rock that is voting rights up the hill, only to have it likely come crashing down again. Unlike Sisyphus, however, the rock actually means something, and at least Sisyphus didn’t have to pay taxes for the hill. While I’m no fan or apologist of Fox News, ratings don’t lie. Roger Ailes has done wonders with the network and created an entirely new genre of news, namely news mixed with advocacy. Most liberals think this is insidious, I tend to think about it a bit differently…cable TV is about format and these news networks shouldn’t be held in the same regard as broadcast news. edwards_mug_28_12-28-2006_7m9clld.jpg But I digress, sort of. My point here is that John Edwards announced he would be skipping the debate there because it is being hosted by Fox News. Nevermind that the DNC is actually running the debate, Fox News gets to plaster their name in the background and this is apparently unacceptable. Daily Kos and are eating this up, citing Edwards as the new Diet Jesus with Splenda (as opposed to the original Diet Jesus). I realize he’s trying to energize liberal primary voters, but with Edwards missing at that debate it will increasingly be a game of Tomayto/Tomahto between Obama and Clinton…a spectacle that will benefit them both. Writing off an entire demographic, even one that is less likely to vote for you, is not particularly smart at this juncture. When you’re simply trying to stay competitive with funds, you don’t have the luxury of skipping debates. Edwards has a real chance at winning this nomination, his campaign is more mature and his policies are more pointed and tangible than any other Presidential candidate, Republican or Democrat. Chances are good that someone watching that debate will be swayed to at least write him a check. Left or Right, I think it’s pretty clear that John Edwards is the hardest working campaigner from either party. Skipping this debate, even if it is a meaningless gesture, is a mistake. “I’ve never been happy with the GOP” “The Democrats could never be small government.” The military doesn’t count as the government? Since when? Add to Technorati Favorites
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '1168', 'language_id_whole_page_fasttext': "{'en': 0.9669039249420166}", 'metadata': "{'Content-Length': '80452', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:343GWNXFYSFJIRRELWYTSNQIYK2E3XVE', 'WARC-Concurrent-To': '<urn:uuid:f7310922-8b2a-40f7-a9a7-ed80cb9abb0d>', 'WARC-Date': datetime.datetime(2019, 2, 16, 15, 6, 18), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:B5O66K7UFP3ZHJOE3PIKXHZ6QIUCVK3W', 'WARC-Record-ID': '<urn:uuid:b9ef0a27-5653-4687-a3ac-8b7abcb32a43>', 'WARC-Target-URI': 'https://outerloop.wordpress.com/category/democrats/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:108c3ab7-9147-4fa0-b345-0007a25fea66>', 'WARC-Truncated': None}", 'previous_word_count': '3247', 'url': 'https://outerloop.wordpress.com/category/democrats/', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-166-118-163.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04682040214538574', 'original_id': '7564865ca17d99ee93cd9e90554ae39327444c9f402225000ef3e2cbe1a4fbb6'}
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files. Introduction {#s1} ============ RNA-binding proteins play critical roles in post-transcriptional regulation of gene expression in all domains of life [@pbio.1002028-Hall1]. However, the complexity of this regulation is far greater in eukaryotes than in prokaryotes, reflecting both the larger number of RNAs requiring regulation and the evolution of new RNA processing and regulatory mechanisms. The latter include extensive RNA splicing and alternative splicing to produce different protein isoforms; an increased importance of RNA localization in larger and more complex eukaryotic cells; nonsense-mediated decay to prevent translation of intron-containing RNAs; and combinatorial regulation of mRNA translation and stability by RNA-binding proteins and miRNAs acting in ribonucleoprotein complexes [@pbio.1002028-Martin1]--[@pbio.1002028-Gurtan1]. These new modes of post-transcriptional regulation necessitated and were enabled by corresponding increases in the number and diversity of RNA-binding proteins and the evolution of new RNA-binding functions [@pbio.1002028-Hogan1],[@pbio.1002028-Glisovic1]. Thus far, however, the molecular mechanisms underlying the evolution of new RNA-binding functions have remained unclear. Cellular proteins that adapted to splice autocatalytic group I and group II introns provide powerful model systems for investigating how proteins evolve new RNA-binding functions. Group I and group II introns are found in prokaryotes and in the mitochondrial (mt) and chloroplast DNAs of some eukaryotes, with group I introns also found in the nuclear rRNA genes of certain fungi and protozoa [@pbio.1002028-Cannone1],[@pbio.1002028-Haugen1]. Both types of introns are ribozymes that catalyze their own splicing as well as mobile genetic elements that can be horizontally transferred to different hosts where they propagate by inserting into new genomic sites [@pbio.1002028-Lambowitz1],[@pbio.1002028-Belfort1]. Although some group I and II introns self-splice *in vitro*, most have acquired mutations that impair formation of a catalytically active RNA structure, necessitating the recruitment of cellular proteins to promote RNA folding for efficient splicing *in vivo* [@pbio.1002028-Lambowitz2],[@pbio.1002028-Vicens1]. These group I and group II intron splicing factors include both host-encoded proteins, such as aminoacyl-tRNA synthetases (aaRSs) and translation factors, and intron-encoded proteins, such as DNA endonuclease and reverse transcriptases, that evolved secondarily to function in RNA splicing [@pbio.1002028-Lambowitz2]. Such co-option of pre-existing proteins to function in splicing is pertinent to the evolution of splicing mechanisms in higher organisms, as emphasized by recent findings that a key spliceosomal protein, Prp8, was derived from a group II intron-like reverse transcriptase [@pbio.1002028-Dlaki1],[@pbio.1002028-Galej1]. One of the most extensively studied examples of a cellular protein that evolved to function in RNA splicing is the *Neurospora crassa* mtTyrRS (CYT-18 protein), which acts as a splicing factor for mt group I introns [@pbio.1002028-Mannella1]--[@pbio.1002028-Wallweber1]. Biochemical and structural studies showed that CYT-18 functions in splicing by recognizing and stabilizing the conserved phosphodiester backbone structure of group I intron RNAs [@pbio.1002028-Guo1]--[@pbio.1002028-Paukstelis1]. This splicing function has been found only for those mtTyrRS of fungi belonging to the subphylum Pezizomycotina and can be traced to a series of structural adaptations of the protein that were acquired during or after the divergence of Pezizomycotina from Saccharomycotina [@pbio.1002028-Paukstelis2]. CYT-18 and other mtTyrRSs are class 1 aaRSs that are closely related to bacterial TyrRSs [@pbio.1002028-Eriani1]. They consist of an N-terminal catalytic domain, which binds the acceptor stem of tRNA^Tyr^, followed by an intermediate α-helical domain and a C-terminal anticodon-binding domain (CTD), which bind the anticodon and variable arms ([Figure 1A and 1B](#pbio-1002028-g001){ref-type="fig"}; the catalytic and intermediate α-helical domains together are denoted the N-terminal domains or NTDs). Like its bacterial counterparts, CYT-18 functions as a homodimer, with each dimer binding either one molecule of tRNA^Tyr^ or group I intron RNA [@pbio.1002028-Jakes1]--[@pbio.1002028-Yaremchuk1]. CYT-18 binds group I introns by using both its N-terminal catalytic domain and CTD, but only some introns require the CTD for RNA splicing [@pbio.1002028-Kittle1]--[@pbio.1002028-Chen1]. ![Domain architecture of the wild-type *N. crassa* mtTyrRS (CYT-18 protein) and deletion constructs.\ (A) Schematic of a CYT-18 homodimer. CYT-18 consists of N-terminal catalytic and α-helical domains (NTDs, blue) that are connected via a flexible linker to a CTD (red). The protein dimerizes via interactions between the catalytic domains. (B) Domain architecture of the *N. crassa* (Nc), *A. nidulans* (An), and *S. cerevisiae* (Sc) mtTyrRS compared to *E. coli* (Ec) TyrRS. The mitochondrial targeting sequence (MT) and C-terminal extension (C-tail) are in white, and Pezizomycotina-specific insertions in the NTD and CTD are highlighted with blue and red diagonal stripes, respectively. Insertions in the Sc mtTyrRS relative to *E. coli* TyrRS are indicated in gray and are not homologous to the Pezizomycotina insertions [@pbio.1002028-Paukstelis2]. (C) CYT-18 protein constructs used in this study. The wild-type CYT-18 protein corresponds to the full-length mature protein lacking the mitochondrial targeting sequence. CYT-18\* additionally lacks most of the non-essential C-tail and ends nine residues after Ins 5 (residue 583) to match the short C-tail of the *A. nidulans* mtTyrRS for which an NMR structure was determined [@pbio.1002028-Paukstelis4]. CYT-18 NTDs contains the N-terminal catalytic and α-helical domains and lacks both the CTD and C-tail. The CTD construct begins with a few residues of the flexible linker (Ins 3) and ends at the same position as CYT-18\*.](pbio.1002028.g001){#pbio-1002028-g001} Both the N-terminal catalytic domain and CTD of Pezizomycotinia mtTyrRSs have distinctive structural adaptations that are absent in non-splicing mtTyrRSs, including the closely related Saccharomycotina mtTyrRSs [@pbio.1002028-Paukstelis2]. These structural adaptations include a small N-terminal α-helical extension (denoted H0) and a series of small insertions (Ins 1--5), whose presence correlates with RNA splicing activity ([Figure 1B](#pbio-1002028-g001){ref-type="fig"}) [@pbio.1002028-Cherniack1],[@pbio.1002028-Paukstelis3]. The Pezizomycotina mtTyrRS also have a non-essential C-terminal tail of variable length (C-tail; 13--152 amino acids) appended to the CTD ([@pbio.1002028-Kittle1] and this work). Structural studies, including a co-crystal structure of a splicing-active CYT-18 protein lacking the CTD (here denoted CYT-18 NTDs) bound to a group I intron RNA (the bacteriophage Twort *orf*142-I2 ribozyme), provided insight into group I intron binding by the N-terminal catalytic domain [@pbio.1002028-Paukstelis1],[@pbio.1002028-Paukstelis3]. These studies showed that CYT-18 binds group I introns asymmetrically across the two subunits of the homodimer by using a newly evolved group I intron-binding surface on the side of the catalytic domain opposite that which binds tRNA^Tyr^. This new RNA-binding surface includes the N-terminal extension H0, Ins 1, and Ins 2 and provides an extended scaffold for the conserved phosphodiester backbone structure of the group I intron catalytic core. The CYT-18 constructs used for crystallography lacked the flexibly attached CTD, which has been problematic for X-ray crystallography of TyrRSs [@pbio.1002028-Paukstelis3]--[@pbio.1002028-Kobayashi1]. Recently, we determined an NMR structure of the isolated CTD of the splicing-active *Aspergillus nidulans* mtTyrRS, which is closely related to CYT-18 [@pbio.1002028-Paukstelis4]. The structure showed that the mtTyrRS CTD resembles those of bacterial TyrRSs in having a fold similar to that of bacterial ribosomal protein S4, but with novel structural features. The latter include three Pezizomycotina-specific insertions (Ins 3--5), with Ins 3 corresponding to an expansion of the flexible linker between the NTDs and CTD. Modeling of the NMR structure onto the CYT-18 NTDs+Twort co-crystal structure using distance constraints from directed hydroxyl-radical cleavage assays suggested that the two CTDs of the homodimeric protein bind opposite ends of a group I intron RNA. This model requires that the CTD of one subunit of the CYT-18 homodimer undergo a large shift on its flexible linker to interact with either tRNA^Tyr^ or the group I intron RNA bound on opposite sides of the catalytic domain [@pbio.1002028-Paukstelis4]. Thus far, however, there has been no structural data for a CYT-18 protein that contains both the NTDs and CTD, and the role of the CTD in promoting group I intron splicing has remained unclear. CYT-18 has been used as a model for the theory of constructive neutral evolution (referred to here as "pre-adaptive evolution"). This theory holds that complex multi-protein or RNP complexes arise by a "ratchet-like process" in which a pre-existing neutral or mildly deleterious interaction is "fixed" by a mutation in one partner that makes it dependent upon the other to perform a biological function. Once fixed, this dependence can be further elaborated by adaptive changes in both partners, which increase reaction efficiency and co-dependence [@pbio.1002028-Covello1]--[@pbio.1002028-Lynch1]. In the case of CYT-18, this hypothesis suggests that an ancestral non-splicing fungal mtTyrRS had a pre-existing ability to bind group I introns, which became fixed when the intron RNA acquired mutations that impaired self-splicing, resulting in dependence upon the bound protein for structural stabilization [@pbio.1002028-Lambowitz2]. After the interaction was fixed, further adaptive mutations in both the RNA and protein increased both the efficiency of RNA splicing and its protein-dependence. Early studies suggesting that CYT-18 recognized tRNA-like structural features of group I intron RNAs were cited as a prime example of a pre-adaptive interaction leading to the evolution of a new RNA-splicing function [@pbio.1002028-Stoltzfus1],[@pbio.1002028-Gray1]. However, subsequent findings that CYT-18\'s N-terminal catalytic domain binds group I introns specifically by using a separate non-tRNA-binding surface [@pbio.1002028-Paukstelis1],[@pbio.1002028-Paukstelis3] made the nature of the initial non-adaptive interaction unclear. Here, we used small angle X-ray scattering (SAXS) and biofchemical assays to investigate the solution structures of full-length CYT-18 protein and its CTDs and their mode of interaction with group I intron RNAs. The SAXS analysis shows that the CTDs of both subunits of the CYT-18 homodimer extend outward from the NTDs, but move inward to bind opposite ends of the group I intron RNA. Surprisingly, we find that the CTD of CYT-18 has a high non-specific RNA binding affinity, which may contribute to its interaction with group I intron RNAs, and that the *Saccharomyces cerevisiae* (yeast) mtTyrRS, which diverged prior to the evolution of splicing activity, can also bind intron RNAs non-specifically via its CTD. Finally, experiments with chimeric proteins show that the yeast CTD can replace CYT-18\'s to promote aminoacylation but not group I intron splicing. Our results suggest a scenario of pre-adaptive evolution in which the initial non-adaptive interaction between an ancestral mtTyrRS and group I intron RNA was non-specific binding by the CTD and highlight a role for non-specific binding in the evolution of new RNA-binding functions. Results {#s2} ======= SAXS Analysis of CYT-18 and Its CTD {#s2a} ----------------------------------- First, we used SAXS to investigate the conformational changes of CYT-18 and the position of its CTDs in the absence and presence of a group I intron RNA. Scattering data were collected for three CYT-18 constructs: CYT-18\*, a wild-type protein truncated to delete most of the non-essential C-tail in order to simplify modeling and analysis; CYT-18 NTDs, which contains the N-terminal catalytic and α-helical domains, but lacks both the CTD and C-tail; and CTD, the isolated C-terminal anticodon-binding domain ([Figure 1C](#pbio-1002028-g001){ref-type="fig"}). CYT-18\* is fully active in tyrosyl-adenylation, which measures the number of TyrRS active sites, and it functions similarly to full-length CYT-18 both in aminoacylation of *Escherichia coli* tRNA^Tyr^, a standard substrate for this protein, and in splicing the *N. crassa* mt large subunit rRNA (Nc mt LSU) intron, which requires a functional CTD ([Figure S1](#pbio.1002028.s002){ref-type="supplementary-material"}). The CYT-18 NTDs construct is also fully active in tyrosyl-adenylation, but cannot aminoacylate tRNA^Tyr^ as expected because of the lack of the CTD ([Figure S1A and S1B](#pbio.1002028.s002){ref-type="supplementary-material"}) [@pbio.1002028-Mohr2]. [Figure 2](#pbio-1002028-g002){ref-type="fig"} shows SAXS curves for all three proteins, and [Table 1](#pbio-1002028-t001){ref-type="table"} summarizes size parameters calculated from the SAXS curves, including the protein molecular weight; the maximum dimension of the particle (*D* ~max~); and the radius of gyration (*R* ~g~), which is the root mean square distance to the center of mass of a particle and provides an estimate of the overall particle size [@pbio.1002028-Petoukhov1]. For all three proteins, Kratky plots of the SAXS data show a bell shape curve with a distinct peak, indicative of a folded globular protein ([Figure S2](#pbio.1002028.s003){ref-type="supplementary-material"}). ![SAXS analysis of the CYT-18 protein constructs.\ (A) Scattering curves for the CYT-18 NTDs, CTD, and CYT-18\*. The plots show the log of the scattering intensity (*I*, arbitrary units \[a.u.\]) as a function of momentum transfer (*q* = 4πsin(θ)/λ) and are displaced along the *y*-axis for visualization. The top and middle curves for CYT-18 NTDs and CTD show the SAXS data (black) overlaid with the expected scattering profiles calculated by CRYSOL from the CYT-18 NTDs crystal structure (blue, PDB:1Y42; χ = 1.9) or a CYT-18 CTD homology model based on the *A. nidulans* mtTyrRS CTD NMR structure (red, PDB:2KTL; χ = 2.8), respectively. The bottom curve for CYT-18\* shows the SAXS data (black) overlaid with the calculated scattering profile for the CORAL model of this protein (gray; χ = 1.8). (B) Normalized pair distance distribution functions (*P(r)*) calculated from the scattering profiles by AUTOGNOM for CYT-18 CTD (red), CYT-18 NTDs (blue), and CYT-18\* (gray). The *P(r)* curves for the CYT-18 NTDs and CTD are single peaks with a short tail, consistent with an elongated protein shape. (C--E) *Ab initio* models built by DAMMIN with the fit of the SAXS envelope to the corresponding high-resolution structure (CYT-18 NTDs), homology model (CYT-18 CTD), or CORAL model (CYT-18\*) superimposed by SUPCOMB shown below the model [@pbio.1002028-MBKozin1]. The χ values shown in parentheses in the figure indicate the fit of the *ab initio* models to the scattering data.](pbio.1002028.g002){#pbio-1002028-g002} 10.1371/journal.pbio.1002028.t001 ###### Size parameters determined from SAXS data. ![](pbio.1002028.t001){#pbio-1002028-t001-1} Sample Guinier *R* ~g~ (Å)[a](#nt101){ref-type="table-fn"} GNOM *R~g~* (Å)[a](#nt101){ref-type="table-fn"} *D* ~max~ (Å)[b](#nt102){ref-type="table-fn"} MW -- Sequence (kDa)[c](#nt103){ref-type="table-fn"} MW -- SAXS Standard (kDa)[d](#nt104){ref-type="table-fn"} CRYSOL *R* ~g~ (Å) CRYSOL *D* ~max~ (Å) ---------------------- ----------------------------------------------------- ------------------------------------------------- ----------------------------------------------- ------------------------------------------------------ ----------------------------------------------------------- -------------------- ---------------------- CYT-18 NTDs 35.6±0.2 36.7±0.1 123 89.6 84.4±4.7 35.2 125 CYT-18 CTD 17.7±0.4 18.1±0.1 62 14.8 13.3±0.7 17.0 55.9 CYT-18\* 46.9±0.8 47.7±0.1 170 122 119±6 --- --- CYT18 NTDs+Twort RNA 39.2±0.1 39.3±0.1 137 161 --- 39.1 134 CYT-18\*+Twort RNA 41.9±0.1 41.8±0.1 146 194 --- --- --- Radius of gyration calculated from the SAXS data by using the Guinier approximation or AUTOGNOM. Error estimates are the standard error of the linear regression and standard deviation, respectively. *D* ~max~ values estimated by using the indirect transform program AUTOGNOM. Molecular weight calculated from protein and RNA sequence. Molecular weight calculated from SAXS data by comparison with the protein standard bovine serum albumin. Error estimates are for propagation of standard error calculated for *I*(0)/c from linear regression, where *I*(0) is the forward scattering intensity and c is the concentration of protein in g/l. Focusing first on the CYT-18 NTDs protein, the scattering curve overlays well (χ = 1.9) with a theoretical scattering curve calculated from the previous CYT-18 NTDs crystal structure [@pbio.1002028-Paukstelis3] by using the program CRYSOL ([Figure 2A](#pbio-1002028-g002){ref-type="fig"}, top curve) [@pbio.1002028-Svergun1]. The SAXS curve gave an estimated molecular weight of 84.4 kDa and *R* ~g~ and *D* ~max~ values of 35.6 and 123 Å, respectively, in good agreement with the molecular weight calculated from protein sequence (89.6 kDa) and with *R* ~g~ and *D* ~max~ values calculated from the crystal structure using CRYSOL (35.2 and 125 Å, respectively) ([Table 1](#pbio-1002028-t001){ref-type="table"}). The distance distribution function *P(r)* for the CYT-18 NTDs displays a single peak with a tail ([Figure 2B](#pbio-1002028-g002){ref-type="fig"}), a pattern indicative of a protein having an elongated structure [@pbio.1002028-Svergun2]. *Ab initio* models of the CYT-18 NTDs protein were built from the SAXS data by simulated annealing of either dummy atoms by DAMMIN or a chain-like ensemble of dummy residues by GASBOR ([Figures 2C](#pbio-1002028-g002){ref-type="fig"} and [S3](#pbio.1002028.s004){ref-type="supplementary-material"}, respectively) [@pbio.1002028-Svergun3],[@pbio.1002028-Svergun4]. The DAMMIN and GASBOR models show good fits to the experimental SAXS curve (χ = 1.8 for both models) and are similar in shape to each other and to the high-resolution structure as shown by the superposition of the crystal structure within the SAXS model envelopes. The final DAMMIN and GASBOR models are the result of analyzing multiple solutions and either averaging the models (DAMMIN) or picking the most representative one (GASBOR). The normalized spatial discrepancy (NSD) value, which describes the similarity between the different models produced by the programs, is low for both the DAMMIN and GASBOR models (0.63±0.03 and 1.10±0.02, respectively), indicating that the multiple solutions built by the programs are similar to each other ([Table 2](#pbio-1002028-t002){ref-type="table"}). Taken together, these results indicate that the conformation adopted by CYT-18 NTDs in solution is similar to that in the crystal structure [@pbio.1002028-Paukstelis3]. 10.1371/journal.pbio.1002028.t002 ###### χ and NSD values for protein *ab initio* models. ![](pbio.1002028.t002){#pbio-1002028-t002-2} Sample DAMMIN GASBOR ------------- -------- ----------- ----- ----------- CYT-18 NTDs 1.8 0.63±0.03 1.8 1.10±0.02 CYT-18 CTD 1.7 0.49±0.02 2.2 0.78±0.02 CYT-18\* 1.5 0.61±0.01 2.1 1.52±0.04 The discrepancy value (χ) describes the fit of the *ab initio* model to the experimental scattering curve. χ values close to 1 indicate a good fit between the models and SAXS data. The NSD describes the similarity between different *ab initio* models produced by DAMMIN or GASBOR. A low value for the NSD (∼1) indicates the models are similar to each other. The SAXS data for the isolated CTD overlays well with a theoretical scattering curve calculated from a homology model of CYT-18\'s CTD constructed from the NMR structure of the *A. nidulan* CTD using I-TASSER (χ = 2.8) ([Figure 2A](#pbio-1002028-g002){ref-type="fig"}, middle curve) [@pbio.1002028-Roy1]. The molecular weight of 13.3 kDa estimated from the scattering data ([Table 1](#pbio-1002028-t001){ref-type="table"}) indicates that the CTD is monomeric in solution. The *R* ~g~ and *D* ~max~ values for the CTD calculated from the SAXS data (17.7 and 62 Å, respectively) are in good agreement with those for the I-TASSER model (17.0 and 55.9 Å, respectively) ([Table 1](#pbio-1002028-t001){ref-type="table"}). The DAMMIN and GASBOR models of the CYT-18 CTD (χ = 1.7 and 2.2, respectively) also superpose well with the homology model ([Figures 2D](#pbio-1002028-g002){ref-type="fig"} and [Figure S3](#pbio.1002028.s004){ref-type="supplementary-material"}, respectively). Thus, the SAXS analysis indicates that the CYT-18 CTD folds independently of the remainder of the protein and that the I-TASSER model provides a good representation of the structure of the CYT-18 CTD in solution. The latter finding validates the use of the I-TASSER model in building high-resolution structures of CYT-18\* from the SAXS data (see below). CYT-18\* is the first CYT-18 protein to be investigated structurally that contains both the NTDs and CTD. The molecular weight for this protein estimated from the SAXS data is 119 kDa, confirming that CYT-18\* is a dimer in solution ([Table 1](#pbio-1002028-t001){ref-type="table"}). The *R* ~g~ and *D* ~max~ values from the CYT-18\* scattering data are 46.9 and 170 Å, respectively, both larger than that for the CYT-18 NTDs, as expected. *Ab initio* models of the CYT-18\* homodimer indicate an open conformation with both CTDs extending outward from the NTDs (χ = 1.5 and 2.1 for the DAMMIN and GASBOR models, respectively) ([Figures 2E](#pbio-1002028-g002){ref-type="fig"} and [S3](#pbio.1002028.s004){ref-type="supplementary-material"}). A rigid-body model of CYT-18\* was also built by CORAL, which constructs models that fit the SAXS data by combining high-resolution models of individual components, in this case the crystal structure of the CYT-18 NTDs and the I-TASSER model of the CTD (see above), with different conformations of flexible dummy residue linkers [@pbio.1002028-Petoukhov2]. The CORAL model overlays well with the scattering curve (χ = 1.8) ([Figure 2A](#pbio-1002028-g002){ref-type="fig"}, bottom curve) and superposes well into the SAXS envelopes of the *ab initio* models ([Figures 2E](#pbio-1002028-g002){ref-type="fig"} and [S3](#pbio.1002028.s004){ref-type="supplementary-material"}). These findings indicate that in the absence of intron RNA, CYT-18\* adopts an S-shaped configuration with the two CTDs of the homodimer extending outward in opposite orientations. CYT-18 Forms a Compact Structure When Bound to a Group I Intron RNA {#s2b} ------------------------------------------------------------------- The co-crystal structure of the CYT-18 NTDs bound to Twort intron RNA indicated that the RNA binds asymmetrically across the dimer interface and that the structure of the NTDs does not change substantially upon binding the intron RNA [@pbio.1002028-Paukstelis1]. To elucidate interacting regions and conformational changes of the CTDs upon binding to the intron RNA, we obtained SAXS data for complexes of both the CYT-18 NTDs and CYT-18\* bound to the same Twort group I intron RNA. The experimental scattering curve of the CYT-18 NTDs+Twort RNA complex overlays reasonably well with the scattering curve calculated from the co-crystal structure (χ = 4.4) ([Figure 3A](#pbio-1002028-g003){ref-type="fig"}, top curve), and gave *R* ~g~ and *D* ~max~ values (39.2 and 137 Å, respectively) in agreement with those calculated from the co-crystal structure (39.1 and 134 Å, respectively) ([Table 1](#pbio-1002028-t001){ref-type="table"}). Likewise, a rigid-body model of the CYT-18 NTDs+Twort RNA complex built using CORAL shows a good fit to the experimental SAXS curve (χ = 2.2) ([Figure 3B](#pbio-1002028-g003){ref-type="fig"}; top curve) and is similar in shape to the co-crystal structure ([Figures 3A and 3B](#pbio-1002028-g003){ref-type="fig"}, compare insets above the top curves). These findings indicate that the CYT-18 NTDs+Twort RNA co-crystal structure is similar to the structure of the complex in solution and can be used as a component for structural modeling of the CYT-18\*+Twort RNA complex from the SAXS data. ![SAXS analysis and rigid-body modeling of CYT-18 proteins bound to the Twort ribozyme.\ (A, B) Scattering profiles of the CYT-18 NTDs and CYT-18\* bound to the Twort ribozyme displaced along the logarithm axis for visualization. (A) shows CRYSOL fits of the SAXS curves (black) to theoretical scattering curves calculated from the CYT-18 NTDs+Twort co-crystal structure (blue; χ = 4.4) and CYT-18+Twort RNA model structure based on biochemical data [@pbio.1002028-Paukstelis4] (gray; χ = 8.8). The CYT-18 NTDs+Twort RNA co-crystal structure and CYT-18+Twort RNA biochemical model structure are shown alongside the plots together with the *R* ~g~ values calculated from the SAXS data and the structures. (B) shows fits of the SAXS curves (black) to the CORAL models of the CYT-18 NTDs+Twort (blue; χ = 2.2) and CYT-18\*+Twort (gray; χ = 3.2). The CORAL models are shown alongside the plots together with the radii of gyration (*R* ~g~) calculated from the SAXS data and the models. (C, D) CORAL and biochemical models of the CYT-18+Twort RNA complex, respectively. Three views of the models are shown with the CYT-18 NTDs colored blue and the two CTDs of the homodimer colored red. The unmodeled flexible linkers in the biochemical model are shown as dashed lines. The Twort group I intron RNA is depicted in gray cartoon representation with the P4--P6 domain in orange and the P3--P9 domain in cyan. Parts of intron RNA regions P2, P4--P5, P6--P6a, P8, and P9 are near and potentially interact with the CTDs.](pbio.1002028.g003){#pbio-1002028-g003} Finally, the scattering data for the Twort RNA complex with CYT-18\*, which contains both the NTDs and CTD, gave *R* ~g~ and *D* ~max~ values of 41.9 Å and 146 Å, respectively ([Figure 3A](#pbio-1002028-g003){ref-type="fig"}, bottom curve; [Table 1](#pbio-1002028-t001){ref-type="table"}). The relatively small difference between these values and those for the CYT-18 NTDs+Twort complex (*R* ~g~ and *D* ~max~ values of 39.2 Å and 137 Å, respectively; [Table 1](#pbio-1002028-t001){ref-type="table"}) suggests that CYT-18\* forms a compact complex with the RNA in which the CTDs make a smaller than expected contribution to the overall particle dimensions. This conclusion was supported by ensemble optimization analysis using the program EOM, which generates a large random pool of conformations and picks an optimized ensemble that best fits the scattering data (see [Materials and Methods](#s4){ref-type="sec"}). This optimized ensemble pool displayed a smaller, tighter range of *R* ~g~ and *D* ~max~ values than a random pool of protein-RNA conformations consistent with a compact rigid complex ([Figure S4](#pbio.1002028.s005){ref-type="supplementary-material"}). A rigid-body model of the CYT-18\*+Twort RNA complex built using CORAL indicates that both CTDs are positioned near the Twort intron ([Figure 3C](#pbio-1002028-g003){ref-type="fig"}). This CORAL model can be compared to a previous model of CYT-18\*+Twort built using biochemical data ([Figure 3D](#pbio-1002028-g003){ref-type="fig"}) [@pbio.1002028-Paukstelis4]. While both the CORAL and biochemical models show that both CTDs are located near the intron RNA, the CORAL model better fits to the scattering data than does the biochemical model (χ = 3.2 and 8.8, respectively). In both models, the CTD of one subunit of the CYT-18 homodimer is close to and may interact with P2, P6--P6a, and P8 of the intron RNA, while the CTD of the other subunit is close to and may interact with P4--P5, and P9 of the intron RNA ([Figure 3C and 3D](#pbio-1002028-g003){ref-type="fig"}). Considered together, the SAXS analyses indicate that upon binding a group I intron RNA, CYT-18\* forms a compact complex in which both CTDs of the CYT-18 homodimer clamp down to interact with opposite ends of the group I intron RNA. The CYT-18 CTD Is a Non-specific RNA Binding Domain {#s2c} --------------------------------------------------- To investigate how the RNA-binding properties of CYT-18\'s CTD enable it to interact with the two structurally distinct ends of a group I intron RNA, we analyzed the interaction of the CYT-18 NTDs and the isolated CTD with various RNAs by equilibrium-binding assays at 25°C and 37°C ([Figures 4](#pbio-1002028-g004){ref-type="fig"} and [S5](#pbio.1002028.s006){ref-type="supplementary-material"}, respectively). The RNAs compared were three group I introns (the *N. crassa* mt large ribosomal subunit-ΔORF intron (Nc mt LSU); the *N. crassa* NADH dehydrogenase subunit 1-ΔORF intron (Nc *ND1*m); and the Twort intron RNA); a group II intron RNA (*Lactococcus lactis* Ll.LtrB-ΔORF; Ll.LtrB); and poly(U)~30~, which presumably lacks higher-order structure. ![Equilibrium binding of CYT-18 NTDs and the CTD to various RNAs.\ Binding assays of CYT-18 NTDs (blue) or CTD (red) to the (A--C) *N. crassa* mt LSU (Nc mt LSU), *N. crassa ND1*m (Nc *ND1*m), and Twort ribozyme group I intron RNAs, respectively; (D) *L. lactis* Ll.LtrB group II intron RNA; and (E) poly(U)~30~. For the binding assays, ^32^P-labeled RNAs were incubated with increasing concentrations of protein at 25°C for 30 min, a time verified to be sufficient to reach equilibrium (see [Materials and Methods](#s4){ref-type="sec"}). The plots show the fraction of RNA bound to a nitrocellulose filter as a function of protein concentration with the CYT-18 NTDs-group I intron binding data fit to hyperbolic curves and the CYT-18 NTDs-Ll.LtrB and all CYT-18 CTD-RNA binding data fit to sigmoidal curves. Dissociation constant (*K* ~d~) or *K* ~1/2~ values and Hill coefficient (n) are shown in (A--E) and are the mean for three experiments with the error bars indicating the standard deviation. Equilibrium-binding assays for the same proteins and RNAs at 37°C are shown in [Figure S4](#pbio.1002028.s005){ref-type="supplementary-material"}.](pbio.1002028.g004){#pbio-1002028-g004} The binding curves for the CYT-18 NTDs to the Nc mt LSU, Nc *ND1*m, and Twort group I intron RNAs were best fit by hyperbolic functions with *K* ~d~s ranging from 200 to 590 nM at 25°C ([Figure 4A--4C](#pbio-1002028-g004){ref-type="fig"}) and 440 to 740 nM at 37°C ([Figure S5A--S5C](#pbio.1002028.s006){ref-type="supplementary-material"}). The *K* ~d~ values for the Nc *ND1*m intron are substantially higher than that calculated from previous *k* ~off~ measurements, which assumed that the *k* ~on~ of the construct lacking the CTD is the same as that for the wild-type protein (71±24 pM) [@pbio.1002028-Mohr2]. This difference suggests that the CTD might make a major contribution to *k* ~on~ by mediating the initial interaction with intron RNA substrates. At both temperatures, the strongest binding group I intron RNA was the Nc *ND1*m intron and the weakest was the Nc mt LSU intron, consistent with previous findings that the CTD is required for tight binding and splicing of the Nc mt LSU, but not the Nc *ND*1m intron [@pbio.1002028-Mohr2]. At 25°C, the CYT-18 NTDs bound the Ll.LtrB group II intron RNA with a *K* ~1/2~ = 240 nM, within the range of *K* ~d~s for group I intron RNAs, but the binding curve was sigmoidal, with *n* = 1.6, suggesting cooperative and possibly non-specific binding ([Figure 4D](#pbio-1002028-g004){ref-type="fig"}), whereas at 37°C, binding of the group II intron RNA was weaker (*K* ~d~ = 440 nM) and the binding curve was hyperbolic ([Figure S5D](#pbio.1002028.s006){ref-type="supplementary-material"}). The CYT-18 NTDs did not bind appreciably to poly(U)~30~ at either 25°C or 37°C ([Figures 4E](#pbio-1002028-g004){ref-type="fig"} and [S5E](#pbio.1002028.s006){ref-type="supplementary-material"}). Surprisingly, the isolated CYT-18 CTD bound group I and II intron RNAs and poly(U)~30~ more strongly than did the CYT-18 NTDs and with similar affinities for all five RNAs tested ([Figure 4](#pbio-1002028-g004){ref-type="fig"}). Indeed, the binding curves for the isolated CTD to these radically different RNAs were remarkably similar to each other, each being sigmoidal with *K* ~1/2~s = 57--64 nM at 25°C and 51--77 nM at 37°C. These sigmoidal binding curves (*i.e.*, Hill coefficients (*n*)\>1) suggest cooperative binding of two or more CTDs to each RNA. The ability of the isolated CTD to bind similarly to group I and II intron RNAs, as well as unstructured poly(U)~30~ indicates that it is a non-specific RNA binding domain. The Non-splicing *S. cerevisiae* mtTyrRS Binds Group I Introns Non-specifically Via Its CTD {#s2d} ------------------------------------------------------------------------------------------- The finding that the CYT-18 CTD is a non-specific RNA-binding domain led us to wonder whether an ancestral Pezizomycotina mtTyrRS might have initially bound group I intron RNAs non-specifically. To address this question, we turned to the *S. cerevisiae* (Sc) mtTyrRS, which is closely related to CYT-18 but branched from the Pezizomycotina mtTyrRSs prior to the evolution of splicing activity [@pbio.1002028-Paukstelis2]. We compared two constructs that were expressed in *E. coli*: recombinant wild-type Sc mtTyrRS and a derivative lacking the CTD (Sc NTDs). We confirmed that both proteins are fully active in tyrosyl-adenylation, indicating correct folding of the catalytic domain ([Figure S1A](#pbio.1002028.s002){ref-type="supplementary-material"}). Aminoacylation assays showed that the Sc mtTyrRS has higher activity with *E. coli* tRNA^Tyr^ than does CYT-18 ([Figure S1B](#pbio.1002028.s002){ref-type="supplementary-material"}), possibly reflecting that the *E. coli* tRNA^Tyr^ and the Sc mt tRNA^Tyr^ are more similar to each other than to the Nc mt tRNA^Tyr^. All three tyrosyl-tRNAs share the same N73 identity element (A73) and anticodon, but differ in the N1-N72 identity element at the end of the acceptor stem (G-C in *E. coli* tRNA^Tyr^ and Sc mt tRNA^Tyr^, but A-U in Nc mt tRNA^Tyr^) and the length of the variable arm (13--14 nt in *E. coli* tRNA^Tyr^ and Sc mt tRNA^Tyr^, but unusually long at 16 nt in Nc mt tRNA^Tyr^) ([Figure S6](#pbio.1002028.s007){ref-type="supplementary-material"}) [@pbio.1002028-Goodman1]--[@pbio.1002028-Sibler1]. Equilibrium binding assays showed that the Sc mtTyrRS, although incapable of splicing group I intron RNAs [@pbio.1002028-Paukstelis2], can bind both the Nc mt LSU group I intron RNA and Ll.LtrB group II intron RNA with *K* ~d~s = 430 and 440 nM, respectively ([Figure 5A and 5B](#pbio-1002028-g005){ref-type="fig"}), within the range of *K* ~d~s for specific binding of CYT-18 NTDs to group I intron RNAs (see above). However, the similar affinity of the Sc mtTyrRS for the group I and group II intron RNAs suggests that this binding is non-specific. Strikingly, the ability of the Sc mtTyrRS to bind group I and II intron RNAs was entirely dependent upon its CTD, with the Sc NTDs protein showing no detectable binding of either intron RNA over the concentration range tested ([Figure 5A and 5B](#pbio-1002028-g005){ref-type="fig"}). ![Equilibrium binding of the non-splicing *S. cerevisiae* mtTyrRS and its CTD to various RNAs.\ (A, B) Binding of Sc mtTyrRS (orange) and Sc NTDs (green) to the Nc mt LSU group I intron and *L. lactis* Ll.LtrB group II intron, respectively. (C) Binding of the CTD of the yeast mtTyrRS to the Nc mt LSU (blue), Nc *ND1*m (black), and Twort group I introns (pink); the Ll.LtrB group II intron (green); and poly(U)~30~ (purple). Binding assays were done at 25°C, as described in [Materials and Methods](#s4){ref-type="sec"}. *K* ~d~ or *K* ~1/2~ values and Hill coefficients (n) are shown in boxes in (A--C) and are the mean for three experiments, with the error bars indicating the standard deviations. The Sc NTDs protein showed no detectable binding (n.b.) over the protein concentration range tested.](pbio.1002028.g005){#pbio-1002028-g005} To investigate if the Sc mtTyrRS CTD is a non-specific RNA-binding domain like CYT-18\'s CTD, we expressed and purified this domain separately including a small segment of the upstream linker region (denoted Sc CTD). We then assayed equilibrium binding of the Sc CTD to three group I introns (Nc mt LSU, Nc *ND1*m and Twort), a group II intron (Ll.LtrB), and poly(U)~30~ at 25°C. These assays showed that the Sc CTD is capable of binding all the RNAs tested with *K* ~d~ or *K* ~1/2~ values ranging from 110 nM to 1 µM ([Figure 5C](#pbio-1002028-g005){ref-type="fig"}). The Sc CTD had the highest affinity for the Ll.LtrB group II intron RNA (*K* ~1/2~ = 110 nM), which it bound in a cooperative manner (*n* = 1.8), and the lowest affinity for poly(U)~30~ (*K* ~1/2~ = 1 µM; *n* = 1.6). Notably, for all RNAs tested, the non-specific binding by the isolated Sc mtTyrRS CTD is 1.5- to 15-fold weaker than the binding of CYT-18\'s CTD to the same RNA (*K* ~1/2~s at 25°C = 57--64 nM) ([Figure 4](#pbio-1002028-g004){ref-type="fig"}). Together, these findings indicate that the CTD of the Sc mtTyrRS is also a non-specific RNA-binding domain and that the Sc mtTyrRS binds both group I and group II intron RNAs non-specifically via its CTD. Splicing Properties of CYT-18/Sc mtTyrRS Chimeric Proteins {#s2e} ---------------------------------------------------------- Finally, we investigated whether the Sc CTD could replace the CYT-18 CTD to promote group I intron splicing by making CYT-18/Sc mtTyrRS chimeric proteins. Two chimeric constructs were made differing in whether they contain the flexible linker region from CYT-18 or the Sc mtTyrRS ([Figure 6](#pbio-1002028-g006){ref-type="fig"}). Chimera 1 consists of the CYT-18 catalytic and α-helical domains fused to the Sc CTD via the Sc mtTyrRS linker region, whereas chimera 2 contains the same CYT-18 NTDs fused to the Sc CTD via the CYT-18 linker, which includes Ins 3. Both chimeric proteins showed tyrosyl-adenylation activity similar to wild-type CYT-18, but displayed differences in aminoacylation activity ([Figure 7A and 7B](#pbio-1002028-g007){ref-type="fig"}). Chimera 1, which contains both the Sc mtTyrRS linker and CTD, is similar to the yeast Sc mtTyrRS in having higher aminoacylation activity with *E. coli* tRNA^Tyr^ than does CYT-18, likely due to its better recognition of the bacterial tRNA (see above). By contrast, chimera 2, which contains the CYT-18 linker followed by the yeast mtTyrRS CTD, has substantially lower aminoacylation activity than CYT-18, indicating that the CYT-18 linker impairs charging of *E. coli* tRNA^Tyr^. The findings for chimera 1 indicate that higher TyrRS activity with *E. coli* tRNA^Tyr^ correlates with presence of the yeast CTD and linker, regions of the TyrRS that recognize the tRNA variable arm and anticodon stem, and not with the catalytic domain, which recognizes the acceptor stem [@pbio.1002028-Carter1],[@pbio.1002028-Yaremchuk1],[@pbio.1002028-Quinn1]. The Sc mtTyrRS linker may contribute to the recognition of *E. coli* tRNA^Tyr^, either by contacting the tRNA directly or by facilitating binding of the CTD to the variable arm and/or anticodon stem. ![Sequence alignments showing the junction regions of CYT-18/Sc mtTyrRS chimeric proteins.\ CYT-18 and Sc mtTyrRS C-terminal regions starting from the end of the α-helical domain were aligned to the chimeric proteins using the multiple sequence alignment tool, MUSCLE [@pbio.1002028-Edgar1]. The CYT-18 sequence is in black, and the Sc mtTyrRS sequence is in green, with regions corresponding to the CYT-18 CTD insertions in red boxes. The secondary structure of the CYT-18 CTD predicted by I-TASSER is shown above the CYT-18 CTD sequence as either black helices or arrows representing β-sheets. The first residues of the CYT-18 and Sc CTD constructs are highlighted in orange, and the last residue of the CYT-18\* construct highlighted in blue.](pbio.1002028.g006){#pbio-1002028-g006} ![Biochemical analysis of CYT-18/Sc mtTyrRS chimeric proteins.\ Chimera 1 consists of the CYT-18 NTDs fused to the Sc mtTyrRS linker region and CTD, while chimera 2 consists of the CYT-18 NTDs and linker region (including Ins 3) fused to Sc CTD. Tyrosyl-adenylation, aminoacylation, and RNA-splicing assays were done at 30°C, as described in [Materials and Methods](#s4){ref-type="sec"}. (A) Tyrosyl-adenylation activity is displayed as a bar graph showing the mean for three experiments, with the error bars indicating the standard deviation. (B) Aminoacylation assay showing the formation of \[^3^H\]-Tyr-tRNA^Tyr^ over a 60-min time course (black open circles, wild-type CYT-18; purple open squares, chimera 1; pink open diamonds, chimera 2; black closed circles, no protein). (C, D) End-point splicing assays of ^32^P-labeled precursor RNAs (200 nM) containing the Nc mt LSU and *ND1*m group I introns, respectively, with 100 nM protein and 1 mM GTP for 60 min at 30°C in splicing reaction medium containing 25 or 100 mM KCl. Additional end-point splicing assays with ^32^P-labeled precursor RNA at these protein and RNA concentrations at 25°C and 37°C are shown in [Figure S7A and S7B](#pbio.1002028.s008){ref-type="supplementary-material"}. (E, F) Splicing time courses of ^32^P-labeled precursor RNA containing the *ND1*m intron (200 nM) with 100 nM protein and 1 nM GTP at 30°C in splicing reaction medium containing 25 mM or 100 mM KCl, respectively. The plots show disappearance of precursor RNA as a function of time (black open circles, wild-type CYT-18; purple open squares, chimera 1; pink open diamonds, chimera 2). (G) End-point splicing assays with unlabeled precursor RNA containing 200 nM Nc mt LSU intron and \[α-^32^P\]GTP (500 nM; 3,000 Ci mmol^−1^) with 500 nM protein. Reactions were incubated for 60 min at 30°C and 37°C. Darker exposures of the same gels are shown below. Minor labeled products in the CYT-18 lanes, including one co-migrating with precursor RNA and others migrating above precursor RNA (not shown), appear in time-course experiments after the 5′-labeled intron products and likely reflect secondary reactions catalyzed by group I intron RNAs (see [@pbio.1002028-Inoue1]). The left panel shows splicing reactions for the same concentrations of wild-type CYT-18 protein and ^32^P-labeled precursor RNA at 30°C run in parallel as a control. Abbreviations: E1-E2, ligated exons; E1-I, 5′ exon+intron; I, excised intron; I-E2, intron+3′ exon; P, precursor RNA.](pbio.1002028.g007){#pbio-1002028-g007} To determine whether the Sc mtTyrRS CTD could function in splicing, we compared the ability of the chimeric proteins to splice the Nc mt LSU and *ND1*m group I introns, which do and do not require the CTD for splicing, respectively [@pbio.1002028-Mohr2]. Group I introns splice via two sequential transesterification reactions initiated by the addition of guanosine nucleotide to the 5′ end of the intron, resulting in ligated exons and excised linear intron RNA with a non-coded G residue at its 5′ end [@pbio.1002028-Cech1]. The ability of the chimeric proteins to splice the Nc mt LSU and *ND1*m group I introns was assayed by using 200 nM ^32^P-labeled precursor RNA containing the introns, 100 nM protein, and unlabeled GTP at three different temperatures (25°C, 30°C, and 37°C) at either 100 mM KCl (the standard condition for CYT-18) or a lower salt concentration, 25 mM KCl ([Figures 7C--7F](#pbio-1002028-g007){ref-type="fig"}, [S7A, and S7B](#pbio.1002028.s008){ref-type="supplementary-material"}). The assays showed that the chimeric proteins could splice the Nc *ND1m* intron, which does not require the CTD, but could not splice the Nc mt LSU intron, which requires the CTD, under all conditions examined. The inability of the chimeric proteins to splice the Nc mt LSU intron was additionally confirmed by splicing assays done with higher protein concentration (500 nM; protein excess conditions) to compensate for potentially weaker binding of the intron RNA by the Sc CTD ([Figure S7C](#pbio.1002028.s008){ref-type="supplementary-material"}), and by using a more sensitive assay in which \[α-^32^P\]GTP is incubated with unlabeled precursor RNA to label the 5′ end of the intron RNA during the first step of splicing ([Figures 7G](#pbio-1002028-g007){ref-type="fig"} and [S7D](#pbio.1002028.s008){ref-type="supplementary-material"}). Notably, although the chimeric proteins were capable of splicing the *ND1*m intron ([Figures 7D](#pbio-1002028-g007){ref-type="fig"} and [S7B](#pbio.1002028.s008){ref-type="supplementary-material"}), they did so at a slower rate than full-length CYT-18, with the rate decreasing further at higher salt conditions ([Figure 7E and 7F](#pbio-1002028-g007){ref-type="fig"}). The slower rate of *ND1*m intron splicing by the chimeric proteins is similar to that found previously for the CYT-18 NTDs alone [@pbio.1002028-Mohr2], suggesting that it reflects a lack of contributing but nonessential interactions with the CTD. Interestingly, chimera 2 has higher splicing activity with the *ND1*m intron than does chimera 1, the reverse of what was found for TyrRS activity ([Figure 7B](#pbio-1002028-g007){ref-type="fig"}). This finding suggests that the longer CYT-18-linker region, which is present in chimera 2 but not chimera 1, contributes to splicing activity. This contribution could involve either specific or non-specific interaction of Ins 3 with the group I intron RNA or increased conformational flexibility of the CTD due to expansion of the linker. Considered together, the findings for chimera 1 and chimera 2 indicate that although both the Sc mtTyrRS and CYT-18 CTDs bind group I intron RNAs non-specifically, the Sc CTD lacks further adaptations required for group I intron splicing activity. Discussion {#s3} ========== Our results provide insight into the function of CYT-18\'s CTD and its contribution to the evolution of group I intron splicing activity, highlighting a role for non-specific binding interactions in the evolution of new RNA-binding functions. First, the SAXS analysis indicates that the CTDs of both subunits of the CYT-18 homodimer have a preferred orientation in solution extending outward in opposite directions from the NTDs, but move inward to bind opposite ends of a group I intron RNA. The CORAL model of CYT-18\* bound to Twort intron RNA based on the SAXS data suggests that the CTD of one subunit binds the intron near P2, P6--P6a, and P8, while the CTD of the other subunit likely interacts with P4--P5 and P9 ([Figure 3C](#pbio-1002028-g003){ref-type="fig"}). These interaction sites agree with a previous biochemical model based on directed hydroxyl-radical cleavage assays in which Fe-EPD with a cleavage radius of 25 Å was conjugated at two sites in the CTD (G493C and C494) [@pbio.1002028-Paukstelis4]. These assays found cleavage sites in P6--P6a, P3--P8, and P5 in the Nc *ND1*m intron and P2, P4, and P6--P6a in the Nc mt LSU intron [@pbio.1002028-Paukstelis4],[@pbio.1002028-Myers1]. The additional cleavages in the Nc mt LSU intron P2 helix, which is considerably longer than P2 of the Twort or Nc *ND1* introns, are consistent with its proximity to P8. The putative interaction sites between the CTDs and intron RNA in our CORAL model are also consistent with genetic experiments showing that CTD binding can suppress intron RNA mutations that impair long-range tertiary interactions P5-L9 and P2-L8 on opposite ends of the intron RNA [@pbio.1002028-Chen1]. The relatively fixed orientation of the CTDs in the free CYT-18 protein agrees with previous ^15^N-^1^H- two-dimensional NMR analysis showing that the CTDs of the full-length *A. nidulans* mt and *Geobacillus stearothermophilus* TyrRSs do not tumble independently in solution [@pbio.1002028-Paukstelis4]. Nevertheless, the linker must be sufficiently flexible to allow the CTDs to bind to group I introns or tRNA^Tyr^ on opposite sides of the catalytic domain, and the SAXS analysis provides the first direct evidence for this conformational flexibility by showing the two CTDs of the homodimer swing downward from their starting position in the free protein to interact with different regions of a group I intron RNA. We were surprised to find that the CTDs of both CYT-18 and the non-splicing yeast mtTyrRS are non-specific RNA-binding domains. The isolated CTDs of both proteins bind structured group I and group II intron RNAs, or the simple homopolymer, poly(U)~30~ with similar affinities, with this non-specific binding 1.5- to 15-fold stronger for the CYT-18 CTD than the yeast mtTyrRS CTD (see [Results](#s2){ref-type="sec"}). The non-specific RNA-binding activity of the TyrRS CTDs may contribute to its function in aminoacylation by augmenting its specific-binding interactions with tRNA^Tyr^, which include recognition of the variable arm and anticodon bases [@pbio.1002028-Yaremchuk1],[@pbio.1002028-Bedouelle1]. Likewise, the high non-specific binding activity of the CYT-18 CTD does not preclude and may bolster specific-binding interactions of this domain with group I intron RNAs. The latter could result either from further adaptive evolution of the CTD or simply from positioning of the CTD on the intron RNA via specific binding of the NTDs. Although non-specific RNA binding was unexpected for an aaRS domain involved in tRNA recognition, yeast and higher eukaryotic aaRSs have been shown previously to have appended non-specific RNA-binding domains that are not present in their bacterial counterparts and contribute to aminoacylation efficiency. Thus, the yeast glutaminyl-tRNA synthetase (GlnRS) has an N-terminal non-specific RNA binding domain, which when fused to a bacterial GlnRS enabled it to functionally replace the yeast enzyme *in vivo*, as did fusion of the yeast Arc1 protein, a non-specific RNA-binding protein that ordinarily helps mediate tRNA/aaRS interactions in *trans* [@pbio.1002028-Whelihan1],[@pbio.1002028-Wang1]. Similarly, some higher eukaryotic aaRSs have tandem repeats of a small non-specific RNA-binding motif that enhances tRNA binding [@pbio.1002028-Cahuzac1]. These non-specific RNA-binding domains are thought to act by adding sufficient binding energy to compensate for relatively weak specific binding interactions of aaRSs with tRNA substrates, similar to the augmentation of specific binding of tRNA and intron RNA substrates suggested above for the TyrRS CTD. Notably, the ribosomal protein S4-like fold, which forms the core of bacterial and mitochondrial TyrRS CTDs, has been identified previously as an ancient RNA-binding domain. This domain is found in all three kingdoms of life in a variety of proteins that bind structurally different RNAs, including two families of pseudouridine synthetases, a family of predicted RNA methylases, an RNA-modification enzyme with both pseudouridine synthetase and cytidine deaminase activity, threonyl-tRNA synthetases, and a heat-shock protein [@pbio.1002028-Aravind1]--[@pbio.1002028-Staker1]. The S4-like fold consists of two α-helices arranged as a helical hairpin packed against three or four β-sheets. Connecting two of the β-sheets is a characteristic L-shaped loop, which together with the two α-helices is termed the αL motif. This motif generally contains clusters of basic and polar residues that are capable of interacting with various nucleic acid substrates in the different S4-like fold containing proteins. In TyrRSs, the αL motif interacts in a region between the variable and anticodon arms [@pbio.1002028-Staker1],[@pbio.1002028-Volpon1]. We suggest that the inherently high non-specific RNA-binding affinity of the S4-like fold was the key factor enabling it to evolve interactions with different RNA substrates in the course of evolution. Indeed, the fungal mtTyrRSs provide a dramatic example of a case in which the S4-like fold of a single enzyme may bolster specific-binding interactions with three different regions of two different RNA substrates, a mt tRNA^Tyr^ and a group I intron RNA. Although we suggest that the non-specific binding of the CTD played a key role in initial interaction with group I intron RNAs, the CTDs of present-day fungal mtTyrRS appear to have evolved specific interactions with group I intron RNAs. Thus chimeric proteins containing the CYT-18 NTDs linked to the yeast CTD can efficiently aminoacylate *E. coli* tRNA^Tyr^, as well as splice the Nc *ND1* intron, which requires only the NTDs [@pbio.1002028-Mohr2]. However, the chimeric proteins splice the Nc *ND1m* intron less efficiently than full-length CYT-18 at a rate expected for loss of contributing CTD interactions, and they are unable to splice the Nc mt LSU intron, which requires the CTD [@pbio.1002028-Mohr2]. Additional adaptations of the CYT-18 CTD required to promote splicing may include RNA-binding contacts by Ins 3--5, which are found in the CTDs of splicing-competent Pezizomycotina mtTyrRS, but not in the Sc mtTyrRS [@pbio.1002028-Paukstelis4]. Both the previous biochemical model of CYT-18\*+Twort [@pbio.1002028-Paukstelis4] and the new CORAL model based on the SAXS data ([Figure 3C](#pbio-1002028-g003){ref-type="fig"}) place Ins 4 and 5 in position to bind group I intron RNAs. Since the discovery of the splicing function of CYT-18 [@pbio.1002028-Akins1], there have been numerous additional examples of aaRSs that have acquired new functions unrelated to translation, in most cases via addition of non-catalytic domains [@pbio.1002028-Guo2],[@pbio.1002028-Smirnova1]. The acquisition of these new domains and functions is thought to reflect that aaRS are ancient essential enzymes whose presence early in evolution of the cell provided a robust scaffold for the addition of new structural elements [@pbio.1002028-Park1]. In archael and eukaryotic TyrRSs, the N-terminal catalytic domain is followed by a different anticodon-binding domain, known as the C-W/Y domain, which is homologous to the anticodon-binding domain of TrpRSs [@pbio.1002028-Bonnefond1]. Two additional structural elements were acquired during the evolution of higher eukaryotes and function in receptor-mediated signaling pathways associated with angiogenesis: the ELR motif in the catalytic domain and a C-terminal EMAP II-like domain, which has non-specific RNA-binding properties [@pbio.1002028-Guo2],[@pbio.1002028-Kleeman1]--[@pbio.1002028-Kim1]. The ELR motif is on the intron-binding side of the catalytic domain [@pbio.1002028-Yang1] and incorporated in the same α-helix as Ins1 in the fungal mtTyrRS, suggesting that this region may be a particularly robust location for insertion of new functional elements. Finally, our results provide evidence that non-specific binding can play a key and perhaps widespread role in pre-adaptive interactions that lead to the evolution of new RNA-binding functions of proteins. For the group I intron splicing activity of fungal mtTyrRSs, our findings suggest a scenario outlined in [Figure 8](#pbio-1002028-g008){ref-type="fig"} in which an initial non-specific interaction between the CTD of an ancestral mtTyrRS and a group I intron RNA was fixed by an intron RNA mutation that made formation of active ribozyme structure dependent upon interaction with the protein. After the interaction was fixed, the mtTyrRS and group I intron were forced to co-evolve, with further adaptive mutations in the protein leading to specific binding of both the catalytic domain and CTD to the intron RNA. These specific-binding interactions extended the intron RNA-binding surface, both increasing the efficiency of splicing and permitting additional mutations in the intron RNA that made it more dependent upon the protein for structural stabilization. RNA-editing enzymes such as APOBEC1, which evolved from enzymes that acted on mononucleotide substrates, may be additional examples of constructive neutral evolution in which a relatively non-specific pre-adaptive interaction with an RNA substrate was fixed by a deleterious mutation, in this case one that could be corrected by RNA editing, and then elaborated by further adaptive mutations [@pbio.1002028-Navaratnam1],[@pbio.1002028-Gray2]. Indeed, a similar evolutionary pathway may have been used more generally for other RNA-modification enzymes, including the ones mentioned above that contain an S4-like non-specific RNA-binding domain. ![Model for the evolution of the RNA splicing activity of fungal mtTyrRSs via non-adaptive non-specific RNA-binding by the CTD.\ (A) A Pezizomycotina ancestor contained a self-splicing group I intron and an mtTyrRS, which functions in aminoacylation by specifically binding tRNA^Tyr^. (B) The ancestral mtTyrRS could bind non-specifically to the group I intron and other RNAs via its CTD, and its interaction with a group I intron RNA was fixed by an intron RNA mutation (orange star) that made it dependent upon the binding of the mtTyrRs for formation or stabilization of the active ribozyme structure. (C) Once fixed, this initial non-specific interaction was elaborated by further adaptive mutations in both the protein (orange spheres) and intron RNA (orange stars) that increased both the efficiency and protein-dependence of RNA splicing. The adaptive mutations in the fungal mtTyrRSs resulted in specific binding of the conserved tertiary structure of the group I intron RNA catalytic core, conferring the ability to bind and splice additional group I introns (blue, pink).](pbio.1002028.g008){#pbio-1002028-g008} Beyond the initial pre-adaptive phase, the extensive structural data for the interaction of fungal mtTyrRSs with group I intron RNAs provide strong evidence for a ratchet-like process in which multiple adaptive mutations, including six different Peziomycotina-specific insertions, led to the evolution of an efficient splicing apparatus for group I introns. It is highly unlikely that the multiple adaptive mutations in the protein leading to an extensive group I intron-binding surface occurred in one step. The surprising finding that the structural adaptations of the mtTyrRS catalytic domain utilized a non-tRNA-binding surface could reflect that the tRNA-binding site in the catalytic domain could not be easily modified to function in group I intron splicing without inhibiting mtTyrRS activity, which is essential in an obligate aerobe. Additionally, the non-tRNA-binding side of the catalytic domain may have had a pre-existing auxiliary RNA-binding function, as found for some aaRSs [@pbio.1002028-Beebe1],[@pbio.1002028-Roy2]. By contrast to the catalytic domain, the regions of the CTD needed for splicing activity overlap tRNA-binding regions requiring co-evolution with both the intron RNA and mt tRNA^Tyr^. Indeed, the unusually long variable arm of Pezizomycotina mt tRNA^Tyr^s (see [Results](#s2){ref-type="sec"}) ([Figure S6](#pbio.1002028.s007){ref-type="supplementary-material"}) may be an example of a feature that co-evolved with the CTD to allow it to better accommodate group I intron RNAs [@pbio.1002028-Paukstelis4]. We also note that although the initial interaction of an ancestral fungal mtTyrRS likely involved a single group I intron RNA, perhaps the mt LSU intron, which is dependent upon the mtTyrRS for splicing in all Pezizomycotina fungi examined [@pbio.1002028-Paukstelis2], the fungal mtTyrRSs ultimately evolved to function in splicing multiple group I introns by recognizing the conserved phosphodiester backbone structure of the catalytic core. This binding mode has the evolutionary advantages of enabling the fungal mtTyrRSs to coordinate the splicing of multiple group I introns as well as the ability to accommodate new group I introns that invade genomes as mobile genetic elements. Materials and Methods {#s4} ===================== Recombinant Plasmids {#s4a} -------------------- Recombinant plasmids used for protein expression in *E. coli* are derivatives of the phage T7 promoter-driven expression vectors pET3a, pET11a, or pET11d (EMD Millipore). pEX560, which expresses a wild-type CYT-18 protein (amino acids 33--669), contains the *cyt-18* ORF (nucleotides 97--2,010) cloned downstream of the T7 promoter in pET3a [@pbio.1002028-Kittle1]. pCYT18/ΔC-tail, which expresses CYT-18\* (C-terminal truncation of the non-essential C-tail; amino acids 584--669), was derived from pEX560 by introducing three stop codons (TAATAGTAG) after Leu583 by site-directed mutagenesis (QuikChange; Agilent Technologies). pHISTEV602 expresses the CYT-18 NTDs (C-terminal truncation of both the CTD and C-tail; amino acids 424--669), with an N-terminal tobacco etch virus (TEV) protease-cleavable 6× His-tag. It was constructed by PCR of pEX560 using primers that amplify nucleotides 97--1,251 of the CYT-18 ORF and append NcoI and BamHI sites, and then cloning the resulting PCR product between the NcoI and BamHI sites of pET11d. pCYT18-CTD, which expresses the CYT-18 CTD (amino acids 448--583) with an N-terminal TEV-cleavable 6× HIS-tag, was constructed by PCR of pEX560 using primers that amplify nucleotides 1,342--1,749 of the CYT-18 ORF and append NdeI and BamHI sites, and then cloning the resulting PCR product between the NdeI and BamHI sites of pET11a. All CYT-18 expression constructs lack the mt targeting sequence (amino acids 1--32). Wild-type CYT-18 and CYT-18\* have an extra N-terminal methionine, while CYT-18 NTDs and CTD have an extra N-terminal glycine resulting from TEV-protease cleavage of the N-terminal 6× His-tag. pHISTEVScTyrRS, which expresses the full-length mature *S. cerevisiae* mtTyrRS with an N-terminal TEV-cleavable 6× HIS-tag, contains Sc mtTyrRS codons 38--492 (lacking the mt target sequence; amino acids 1--37) cloned between the Nco1 and BamHI sites of pET11d [@pbio.1002028-Paukstelis2]. pHISTEVSc/ΔCTD expresses Sc mtTyrRS lacking the CTD (denoted Sc NTDs) and was derived from pHISTEVScTyrRS by using site-directed mutagenesis to add three stop codons (TAATAATAA) after Asp400. pMAL-ScCTD, which expresses the Sc mtTyrRS CTD (denoted Sc CTD), contains Sc CTD codons 414--492 cloned between the BamHI and HindIII sites of pMAL-c2t [@pbio.1002028-Kristelly1], a derivative of plasmid pMAL-c2x (New England Biolabs) that expresses the protein with an N-terminal maltose-binding protein tag followed by a TEV-protease site. Chimeric proteins containing the N-terminal catalytic domain of CYT-18 and the CTD of the Sc mtTyrRS were made by overlap PCR. Chimera 1 contains the CYT-18 NTDs (amino acids 33--417) fused to the Sc mtTyrRS flexible linker and CTD (amino acids 397--492). Chimera 2 contains the CYT-18 NTDs and linker including Ins 3 (amino acids 33--451) fused to the Sc mtTyrRS CTD (amino acids 416--492). The chimeric protein ORFs were cloned between the BamHI and HindIII sites of pMAL-c2t (see above), enabling the expression of fusion proteins with an N-terminal TEV-protease cleavable maltose-binding protein tag. Recombinant plasmids used for *in vitro* transcription contain group I or II introns cloned downstream of a phage T3 or T7 promoter. pBD5a contains the *N. crassa* mt large subunit rRNA-ΔORF (Nc mt LSU) intron cloned downstream of a T3 promoter in pBS(+) [@pbio.1002028-Guo1]. Transcription of pBD5a linearized with BanI yields a 503-nt RNA containing a 65-nt 5′ exon, the 388-nt mt LSU intron, and a 50-nt 3′-exon. pND1m contains the *N. crassa* NADH dehydrogenase subunit 1-ΔORF (Nc *ND1*m) intron cloned downstream of a T7 promoter in pUC18 [@pbio.1002028-Wallweber1]. Transcription of pND1m linearized with NdeI yields a 209-nt RNA containing a 6-nt 5′ exon, the 196-nt *ND1* intron, and a 7-nt 3′ exon. pTWORT-P2 contains a ribozyme derivative of a group I intron of the *Staphylococcus aureus* bacteriophage Twort *orf*142 gene (intron nucleotides 9-250) cloned downstream of a T7 promoter in pUC19 [@pbio.1002028-Golden1]. Transcription of pTWORT-P2 linearized with EarI yields a 242-nt transcript of the Twort ribozyme. pSSltrBΔA contains a derivative of the *L. lactis* Ll.LtrB-ΔORF intron with a deletion of the branch-point nucleotide to prevent splicing during binding assays cloned downstream of a T7 promoter in pUC19 [@pbio.1002028-Mohr3]. Transcription of a DNA template made by PCR of the pSSltrBΔA plasmid (forward primer 5′-ATGAATTCTAATACGACTCACTATAGGGTTATAATTATCCTTACACATCCATAAC and reverse primer 5′-CGCTGCAGAATTGATATCAAAAATGATATG) yields an 807-nt RNA containing a 28-nt 5′ exon, the 749-nt intron, and a 30-nt 3′ exon. Protein Expression and Purification {#s4b} ----------------------------------- Proteins were expressed from the recombinant plasmids indicated above in *E. coli* HMS174(DE3) (CYT-18, CYT-18\*, and CYT-18 NTDs); BL21(DE3) (CYT-18 CTD, chimera 1, and chimera 2); or Rosetta 2(DE3) (EMD Millipore) (Sc mtTyrRS, Sc NTDs, and Sc CTD). Overnight cultures of fresh transformants were inoculated into LB media, and the proteins expressed via auto-induction [@pbio.1002028-Studier1]. Cells expressing CYT-18 and CYT-18\* were grown at 35°C overnight with shaking at 260 rpm. Cells expressing all other proteins were grown at 37°C for 4 h then shifted to 25°C overnight with shaking at 260 rpm. Wild-type CYT-18 and CYT-18\* were purified as described [@pbio.1002028-Paukstelis1],[@pbio.1002028-Saldanha1]. Briefly, cells were lysed by incubation with lysozyme at 1 mg/ml for 30 min followed by polyethyleneimine precipitation to remove nucleic acids, and ammonium sulfate precipitation [@pbio.1002028-Saldanha1]. The ammonium sulfate pellet was dissolved in 500 mM KCl, 25 mM Tris-HCl (pH 7.5) and then dialyzed overnight in 25 mM KCl, 25 mM Tris-HCl (pH 7.5). The protein was purified from the dialysate by using a HiTrap SP XL cation exchange column (GE Healthcare Life Sciences), followed by a size-exclusion column (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences) [@pbio.1002028-Paukstelis1]. The 6× HIS-tagged proteins CYT-18 NTDs, CYT-18 CTD, Sc mtTyrRS, and Sc NTDs were purified similarly, except that the ammonium sulfate pellet was dissolved in 500 mM KCl, 25 mM Tris-HCl (pH 7.5), and 30 mM imidazole, and the proteins were purified by nickel-affinity chromatography using a HisTrap HP column (GE Healthcare Life Sciences) [@pbio.1002028-Paukstelis2], followed by TEV protease-cleavage of the 6× HIS-tag in dialysis buffer (500 mM KCl, 25 mM Tris-HCl \[pH 7.5\], 5 mM DTT) to remove imidazole. The proteins were then further purified by an additional round of nickel-affinity chromatography, followed by size-exclusion chromatography (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences). The maltose-binding protein (MalE) fusions MalE-ScCTD, MalE-chimera 1, and MalE-chimera 2 were purified by polyethyleneimine precipitation of nucleic acids, as described above for CYT-18, and then loaded onto an amylose affinity column (New England Biolabs) in buffer containing 25 mM Tris-HCl (pH 7.5), 500 mM KCl, 1 mM DTT, 1 mM EDTA, and 10% glycerol followed by elution with 10 mM maltose in the same buffer. The proteins were further purified using a heparin-sepharose column (HiTrap heparin HP column; GE Healthcare Life Sciences) in 300 mM KCl, 25 mM Tris-HCl (pH 7.5), 1 mM DTT, and 1 mM EDTA and eluted with a salt gradient of 300 mM to 1.5 M KCl in the same buffer. The final purification step was size-exclusion chromatography (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences) in 25 mM Tris-HCl (pH 7.5), 200 mM KCl, and 10% glycerol. Proteins used for SAXS were stored in buffer containing 100 mM KCl, 5 mM MgCl~2~, 10 mM Tris-HCl (pH 7.5), 5% glycerol at −80°C. Proteins used for biochemical assays were dialyzed into 100 mM KCl, 25 mM Tris-HCl (pH 7.5), and 50% glycerol and stored at −80°C. Protein yields ranged from 14 to 44 mg/l (monomer concentrations), and all proteins were \>99% pure as judged by SDS-polyacrylamide gels stained with Coomassie blue. Protein concentrations were determined by measuring A~280~ under denaturing conditions (6 M guanidine hydrochloride). Concentrations of wild-type CYT-18, the Sc mtTyrRS, and C-terminal truncations of these proteins refer to the homodimer, while CTD concentrations refer to the monomer. Preparation of RNA Substrates for SAXS and Biochemical Assays {#s4c} ------------------------------------------------------------- Intron-containing RNA substrates for SAXS and biochemical assays were transcribed from the linearized recombinant plasmids indicated above. The Twort intron for SAXS was synthesized by large-scale *in vitro* transcription reactions (10--30 ml) with T7 polymerase at 37°C in reaction buffer containing 40 mM Tris-HCl (pH 8.1), 1 mM spermidine, 10 mM DTT, 8 mM NTPs, and 15 mM MgCl~2~. Transcription reactions were incubated at 37°C for 8 h and terminated by adding 50 mM EDTA followed by extraction with phenol-chloroform-isoamyl alcohol (25∶24∶1; phenol-CIA). The RNA was then purified through a 5-ml HiTrap desalting column (GE Healthcare Life Sciences) and a size exclusion column (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences). T7 RNA polymerase for the large-scale transcriptions was expressed with an N-terminal 6× HIS-tag from pRC9 and purified as described [@pbio.1002028-He1]. ^32^P-labeled Nc mt LSU, Nc *ND1*m, and Twort RNAs for equilibrium-binding assays were synthesized by using a MAXIscript transcription kit (Life Technologies), with the concentration of unlabeled UTP changed from that recommended in the manufacturer\'s protocol (0.5 mM) to 10 µM UTP to obtain higher specific activity transcripts (300 Ci/mmol). The Ll.LtrB group II intron was synthesized by using a mutant T7 polymerase that can read through a T7 polymerase transcription termination site within the intron [@pbio.1002028-Lyakhov1] in reaction medium containing 40 mM Tris-HCl (pH 7.9), 6 mM MgCl~2~, 10 mM DTT, 2 mM spermidine, 1 mM GTP, 1 mM CTP, 1 mM ATP, 250 nM UTP, and 1 µM \[α-^32^P\]UTP (3,000 Ci mmol^−1^; Perkin Elmer). After transcription and DNase treatments (MAXIscript transcription kit; Life Technologies), transcripts were purified by extraction with phenol-CIA, followed by gel filtration through two consecutive 1-ml Sephadex G-50 columns (Sigma-Aldrich). Intron-containing RNA substrates for splicing reactions were transcribed from linearized DNA template using a MEGAscript transcription kit (Life Technologies) with 1 µCi \[α-^32^P\]UTP (3,000 Ci mmol^−1^; PerkinElmer) added for standard ^32^P-labeled substrates and 3 µCi \[α-^32^P\]UTP (3,000 Ci mmol^−1^) added for higher specific activity subtrates ([Figures 7C](#pbio-1002028-g007){ref-type="fig"}, [S7A, and S7C](#pbio.1002028.s008){ref-type="supplementary-material"}). The Nc mt LSU intron substrate was synthesized by *in vitro* transcription of pBD5a (BanI digested) using a MEGAscript T3 kit, while the Nc *ND1*m intron substrate was synthesized by *in vitro* transcription of pND1m (NdeI digested) using a MEGAscript T7 kit. The intron RNAs were purified as described above. The poly(U)~30~ oligonucleotide used for binding assays was synthesized and HPLC-purified by Integrated DNA Technologies. The oligonucleotide was dissolved in 10 mM HEPES (pH 7.5), 1 mM EDTA and stored at a concentration of 25 µM. For equilibrium-binding assays, 25 pmoles of the oligonucleotide was 5′-end labeled with \[γ-^32^P\]ATP (3,000 Ci mmol^−1^; PerkinElmer) using T4 kinase (New England Biolabs) and then purified by phenol-CIA extraction followed by desalting through a Sephadex G-25 column. SAXS Data Collection and Analysis {#s4d} --------------------------------- Proteins and RNAs used for SAXS analysis were prepared as described above. RNA-protein complexes were formed by mixing protein dimer and RNA at a 1∶1 molar ratio in 1.2 ml of 100 mM KCl, 5 mM MgCl~2~, 10 mM Tris-HCl (pH 7.5), and 5% glycerol. After incubation at room temperature for 15 min, RNP complexes were purified by size-exclusion chromatography (Hi-Load 16/60 Superdex 200 column; GE Healthcare Life Sciences) in the same buffer. RNP complexes and proteins for SAXS were concentrated by using Amicon Ultra-4 centrifugal filter units (EMD Millipore) and frozen for storage at −80°C. The size-exclusion chromatography column buffer was used as a solvent blank for SAXS. SAXS data were collected on beamline 12-ID-C at the Advanced Photon Source (Argonne, Illinois). Each sample had 20 1-s exposures taken at a sample-to-detector distance of 2.0 m, covering a momentum transfer range of 0.007\<*q*\<0.35 Å^−1^. Samples were continuously passed through the beam using a flow-cell to minimize radiation damage. The 20 consecutive exposures were compared and showed no change in scattering intensity, indicating no radiation damage. Radially averaged scattering data were buffer subtracted and analyzed by using ATSAS [@pbio.1002028-Petoukhov1] and IGOR-Pro (WaveMetrics). Scattering curves were displayed as the scattering intensity (*I(q)*) as a function of momentum transfer *q* = (4πsinθ)/λ, where λ is the wavelength of the incident X-ray beam and θ is half the angle between the incident and scattering radiation. SAXS data were obtained for least three different concentrations of each protein and checked for aggregation and interparticle interference by examination of the Guinier region [@pbio.1002028-Jacques1]. Guinier plots (log(*I*(*q*)) versus log(*q*)) were checked for linearity in the Guinier region, a diagnostic of sample quality. For globular proteins, the Guinier approximation is valid for *qR~g~*\<1.3. The *q* range used for SAXS analysis was 0.015\<*q*\<0.3 Å^−1^ for CYT-18 protein constructs and 0.02\<*q*\<0.3 Å^−1^ for CYT-18+Twort complexes. The *I*(0) (extrapolated forward scattering at zero angle) and *R* ~g~ (radius of gyration) were evaluated using the Guinier approximation for scattering intensity (*I*(*q*)) according to the equation: *I*(0) and *R* ~g~ were also computed from the scattering curve by using the indirect Fourier transform program AUTOGNOM, which additionally provides an estimate of the maximum particle dimension (*D* ~max~) from the distance distribution function *P(r)* [@pbio.1002028-Petoukhov1]. The *R* ~g~ values determined by using the Guinier approximation were consistent with those determined by AUTOGNOM. Molecular weights were calculated by comparing the extrapolated forward scattering at zero angle, *I*(*0*), with that of a protein standard, bovine serum albumin (BSA), by using the equation:where MM~p~ and MM~st~ are the molecular weights of the protein sample and protein standard, respectively, c~p~ and c~st~ are their concentrations in g/l, and *I*(0)~p~ and *I*(0)~st~ are the forward scattering intensities of the protein and standard, respectively. Agreement with the calculated molecular weights of the samples indicates sample quality and monodispersity [@pbio.1002028-Jacques1]. Experimental scattering curves were compared with theoretical scattering curves calculated by the program CRYSOL (for *q* ~max~\<0.3) from the crystal structures of those macromolecules with known atomic structures (CYT-18 NTDs, CYT-18 NTDs+Twort, CYT-18 CTD homology model) [@pbio.1002028-Svergun1]. SAXS *Ab Initio* Shape Reconstructions {#s4e} -------------------------------------- *Ab initio* shape reconstructions were done by using DAMMIN (for *q* ~max~\<8/*R* ~g~) and GASBOR, which use simulated annealing methods to build low resolution protein models from dummy atoms or residues, respectively [@pbio.1002028-Svergun3],[@pbio.1002028-Svergun4]. The program DAMMIN uses dummy atoms packed into a sphere with the beads determined to be either protein or solvent. The final DAMMIN model was obtained by using the DAMAVER program suite to align ten models from independent DAMMIN runs and produce an average model. The latter was further refined by using DAMMIN to produce the final model [@pbio.1002028-VladimirVVolkov1]. GASBOR represents the protein as a chain-like ensemble of dummy residues equal to the number of residues in the protein. The final GASBOR model was chosen as the one with the lowest NSD value after running DAMSEL to compare ten models from independent GASBOR runs [@pbio.1002028-VladimirVVolkov1]. No symmetry was specified for the building of CYT-18\* or CYT-18 CTD *ab initio* models, while P2 symmetry was specified for the CYT-18 NTDs models based on prior knowledge from the CYT-18 NTDs crystal structure. DAMMIN and GASBOR produced similar models of CYT-18\* with or without P2 symmetry enforced. Rigid-Body Modeling {#s4f} ------------------- Rigid-body models of CYT-18\* by itself and of CYT-18\* and the CYT-18 NTDs bound to Twort RNA were built by using the program CORAL [@pbio.1002028-Petoukhov2]. This program employs a simulated annealing method to place high resolution models of individual components in orientations that minimize the discrepancy between the calculated SAXS profile and the experimental SAXS data, with distances between the structured components constrained by randomized dummy residue linkers chosen from a generated library of non-clashing loop structures. To build models of CYT-18\*, a homology model of the CYT-18 CTD (amino acids 448--583) was generated by I-TASSER [@pbio.1002028-Roy1], using the *A. nidulans* CTD NMR structure (PDB:2KTL) as a template for modeling [@pbio.1002028-Paukstelis4]. The confidence (C-score) and TM-scores of the CYT-18 CTD homology model, which are indicators of model quality, are high at 0.98 and 0.85, respectively. This CYT-18 CTD model and available high-resolution crystal structures for CYT-18 NTDs+Twort RNA (PDB:2RKJ) were used for rigid-body modeling. The final CORAL models were chosen from among ten independently derived models based on the best fit to the experimental scattering data as indicated by a low χ value [@pbio.1002028-Petoukhov2]. Ensemble optimization analysis to characterize the flexibility of CYT-18\*+Twort system was conducted by using the program, EOM [@pbio.1002028-Bernad1],[@pbio.1002028-Petoukhov3]. This program generates a random pool of 10,000 structures and creates an optimized ensemble from this pool, such that the average scattering pattern of the ensemble fits the experimental SAXS data. Comparison of the shape of the *R* ~g~ and *D* ~max~ distributions of the optimized ensemble with those of the random pool provides information about the size and flexibility of the structure, with a broad peak resembling that of the random pool suggesting a flexible, extended structure and a peak narrower than the random pool suggesting a more rigid structure. Tyrosyl-Adenylation and TyrRS Assays {#s4g} ------------------------------------ Tyrosyl-adenylation assays were done by incubating 100 nM protein in a 50-µl reaction containing 5 mM ATP, 100 mM KCl, 10 mM MgCl~2~, 144 mM Tris-HCl (pH 7.5), 2 mM DTT, 0.1 mg/ml BSA (New England Biolabs), 0.1 unit of yeast inorganic phosphatase (New England Biolabs), and 5 µCi of L-\[3,5-^3^H\]-tyrosine (53 Ci mmol^−1^; Amersham Biosciences Corp.) [@pbio.1002028-Mohr2]. Reactions were initiated by adding protein and incubated at 30°C for 10 min. Reactions were terminated by adding 1 ml of reaction medium and immediately filtering through a nitrocellulose membrane to trap protein bound tyrosyl-adenylate. Radioactivity was measured by Beckman Coulter LS 6500 scintillation counter using Ready Protein scintillation cocktail (Beckman). Aminoacylation assays were done as described previously with protein concentrations normalized to tyrosyl-adenylation activity [@pbio.1002028-Paukstelis2]. Reactions of 120 µl contained 100 nM protein and 6 µM *E. coli* tRNA^Tyr^ (Sigma-Aldrich) in 100 mM KCl, 15 mM MgCl~2~, 50 mM Tris-HCl (pH 7.5), 5 mM ATP, and 10 mM L-tyrosine (a 1∶10 mixture of L-\[3,5-^3^H\]-tyrosine and unlabeled L-tyrosine). Reactions were initiated by adding protein and incubated at 30°C. For time courses, 20-µl portions were removed after times ranging from 2 to 60 min, and the reaction was terminated by precipitation with 0.8 ml of a solution containing 10% trichloroacetic acid and 20 mM sodium pyrophosphate. Reactions were filtered through Whatman 3 MM filter paper to collect the precipitates, and the filters were washed three times with 1 ml of a solution containing 5% trichloroacetic acid and 20 mM sodium pyrophosphate followed by 2 ml of 95% ethanol. The filters were then dried and quantified by using a Beckman Coulter LS 6500 scintillation counter as above. Equilibrium-Binding Assays {#s4h} -------------------------- ^32^P-labeled RNAs (5 pM; 300 Ci/mmol) were incubated with increasing concentrations of protein in a 50-µl reaction containing 100 mM KCl, 5 mM MgCl~2~, 20 mM Tris-HCl (pH 7.5), 5 mM DTT, 0.1 mg/ml BSA, and 10% glycerol at either 25°C ([Figures 4](#pbio-1002028-g004){ref-type="fig"} and [5](#pbio-1002028-g005){ref-type="fig"}) or 37°C ([Figure S4](#pbio.1002028.s005){ref-type="supplementary-material"}). Binding reactions were initiated by adding 10 µl protein and terminated after 30 min by filtering 10 µl of the reaction through a nitrocellulose membrane (Amersham Hybond ECL nitrocellulose; GE Healthcare Life Sciences) backed by a nylon membrane (Amersham Hybond-N+; GE Healthcare Life Sciences). The nitrocellulose membrane retains protein-bound RNA and the nylon membrane retains free RNA. The end point (30 min) was chosen after determining that incubations times of 20, 30, or 60 min gave indistinguishable results for all proteins assayed. After application of samples, the membranes were washed three times with 20-µl wash buffer containing 100 mM KCl, 5 mM MgCl~2~, and 20 mM Tris-HCl (pH 7.5), then dried and quantified using a PhosphorImager and the program ImageQuant (GE Healthcare Life Sciences). RNA Splicing Assays {#s4i} ------------------- Splicing time courses for the Nc mt LSU and Nc *ND1*m introns were done by pre-incubating ^32^P-labeled precursor intron RNA (50 or 200 nM; 0.13--0.4 Ci mmol^−1^) with protein (25 or 100 nM) in a 100-µl reaction containing 100 mM KCl, 5 mM MgCl~2~, 20 mM Tris-HCl (pH 7.5), 1 mM DTT, 0.1 mg/ml BSA, and 10% glycerol for 10 min on ice, followed by 5 min at reaction temperature. Reactions were initiated by adding 1 mM GTP-Mg^2+^. Portions (8 µl) were removed at different times, and the reaction terminated by adding 50 mM EDTA, followed by phenol-CIA extraction and mixing 10 µl of sample with 10 µl of 2× gel loading dye (95% formamide, 0.02% SDS, 0.02% bromophenol blue, 0.01% xylene cyanol, and 1 mM EDTA). End-point splicing assays were done similarly in reaction medium containing 25 or 100 mM KCl for 60 min. Splicing assays comparing wild-type CYT-18 and chimera CYT-18/Sc mtTyrRS proteins were also done with higher concentrations of ^32^P-labeled precursor RNA (200 nM, 0.13--0.4 Ci mmol^−1^) and protein (100 nM or 500 nM dimer) and with 200 nM unlabeled precursor, 500 nM protein, and 500 nM \[α-^32^P\]GTP (3,000 Ci mmol^−1^; PerkinElmer). In all cases, samples were analyzed by electrophoresis in a denaturing 4% polyacrylamide gel, which was dried and quantified with a PhosphorImager, and data were analyzed by using ImageQuant TL. Supporting Information {#s5} ====================== ###### **Excel spreadsheet containing the numerical data and statistical analysis for Figures 2A, 2B, 3A, 3B, 4A--4E, 5A--5C, 7A, 7B, 7E, 7F, S1A--S1D, S2, S4A, S4B, and S5A--S5E.** (XLSX) ###### Click here for additional data file. ###### **Characterization of the CYT-18\* construct.** (A) Tyrosyl-adenylation activity of wild-type CYT-18, CYT-18\*, CYT-18 NTDs, Sc mtTyrRS, and the Sc NTDs. Assays were done at 30°C, as described in [Materials and Methods](#s4){ref-type="sec"}. The bar graphs show the mean of three experiments, with the error bars indicating the standard deviation. All CYT-18 and *S. cerevisiae* constructs synthesize tyrosyl-adenylate, which remains bound at the active site with a stoichiometry of close to one molecule of tyrosyl-adenylate per protein homodimer, as expected for fully active proteins. (B) Aminoacylation assays of CYT-18 and *S. cerevisiae* protein constructs. The plots show the formation of \[^3^H\]-Tyr-tRNA^Tyr^ synthesized over time at 30°C (black open circles, wild-type CYT-18; gray open squares, CYT-18\*; blue open diamonds, CYT-18 NTDs; orange open triangles, Sc mtTyrRS; green open diamonds, Sc NTDs; black closed circles, no protein control). The assays were done in triplicate with the error bars indicating the standard deviation. (C, D) Splicing activity of wild-type CYT-18 (black open circles) and CYT-18\* (gray open squares) with the Nc mt LSU intron at 30°C and 37°C, respectively. Assays were done with 50 nM ^32^P-labeled precursor RNA, 25 nM protein, as described in [Materials and Methods](#s4){ref-type="sec"}. The disappearance of unspliced precursor RNA is plotted over a time period of 60 min. The assays were done in triplicate with the error bars indicating the standard deviation. (TIF) ###### Click here for additional data file. ###### **Kratky plots of CYT-18 protein constructs.** The scattering data for (A) CYT-18 NTDs, (B) CYT-18 CTD, and (C) CYT-18\* are plotted as q^2^×*I* versus *q*, where *I* is the scattering intensity and *q* is the scattering angle (*q* = 4πsin(θ)/λ). The Kratky plots are normalized to the maximum q^2^×*I* value and show a bell-shape curve with a distinct peak, indicative of a folded globular protein. (TIF) ###### Click here for additional data file. ###### ***Ab initio*** **models of CYT-18 proteins built using GASBOR.** CYT-18 NTDs (blue), CTD (red), and CYT-18\* (gray) models built by GASBOR, a simulated annealing program which uses a chain-like ensemble of dummy residues [@pbio.1002028-Svergun3]. The dummy residue representations are shown above, and the low-resolution SAXS envelopes of the models fit with the CYT-18 NTDs high-resolution structure, the CYT-18 CTD homology model, and the CYT-18\* CORAL model using SUPCOMB are shown below. χ alues shown in parentheses indicate the fit of the *ab initio* models to the experimental scattering data. The GASBOR model shown had the lowest NSD among ten calculated models ([Table 2](#pbio-1002028-t002){ref-type="table"}). (TIF) ###### Click here for additional data file. ###### **Size distributions of CYT-18\*+Twort optimized ensembles built by EOM.** (A) Radius of gyration (*R* ~g~) and (B) maximum dimension (*D* ~max~) distributions of an optimized ensemble that best describes the experimental scattering data (gray) compared to those of a random pool of conformations (black). The optimized ensemble is selected from the random pool, which consists of 10,000 randomly generated structures. The narrower peak for the size and shape distributions and smaller values of *R* ~g~ and *D* ~max~ for the optimized ensemble compared to the random pool, suggests that CYT-18\*+Twort is a rigid, compact complex. (TIF) ###### Click here for additional data file. ###### **Equilibrium-binding assays of CYT-18 deletion mutants to various RNAs at 37°C.** Binding assays of CYT-18 NTDs (blue) and CTD (red) to the (A--C) *N. crassa* mt LSU (Nc mt LSU), *N. crassa ND1*m (Nc *ND1*m), and Twort ribozyme group I intron RNAs; (D) *L. lactis* Ll.LtrB group II intron RNA; and (E) poly(U)~30~. The binding assays were done at 37°C, as described in [Materials and Methods](#s4){ref-type="sec"}. The plots show the fraction of RNA retained on a nitrocellulose membrane as a function of protein concentration. The binding data for the CYT-18 NTDs were fit to hyperbolic curves, while CYT-18 CTD binding data were fit to sigmoidal curves. *K* ~d~ or *K* ~1/2~ values and Hill coefficients (n) are shown in boxes and are the mean for three experiments with the error bars indicating the standard deviation. The CYT-18 CTD binds similarly to all RNAs tested at 37°C, as it did at 25°C. (TIF) ###### Click here for additional data file. ###### **Sequence cloverleaf structure diagrams of tRNA^Tyr^.** The *E. coli* (species 1) tRNA^Tyr^, *S. cerevisiae* mt tRNA^Tyr^, and *N. crassa* mt tRNA^Tyr^ are shown as cloverleafs with the four major identity elements highlighted. The latter are: (1) the N73 nucleotide (purple); (2) the N1--N72 base pair (orange); (3) the anticodon (blue); and (4) the variable arm (green). Modified nucleotides are indicated for each tRNA^Tyr^: D, dihydrouridine; Gm, 2′-O-methylguanosine; i^6^A, N-6-isopentenyladenosine; m^5^C, 5-methylcytidine; m^2,2^G, N2,N2-dimethylguanosine; (m^5^G) 5-methylguanosine. ms^2^i^6^A, N6-(delta 2-isopentenyl)-2-methylthioadenosine; ψ, pseudouridine; Q, queuosine; s^4^U, 4-thiouridine; T, ribothymidine. (TIF) ###### Click here for additional data file. ###### **Splicing of the** ***N. crassa*** **mt LSU and** ***ND1*** **m group I introns by CYT-18/Sc mtTyrRS chimeric proteins.** (A--C) Splicing assays of wild-type CYT-18 and chimeric proteins 1 and 2 (Chi.1 and Chi. 2, respectively) with ^32^P-labeled Nc mt LSU group I intron (A and C) or Nc *ND1*m group I intron (B) at two temperatures (25°C or 37°C) and two salt concentrations (25 mM or 100 mM KCl). The splicing reactions were done with 200 nM ^32^P-labeled RNA and 100 nM protein (A and B) or 200 nM ^32^P-labeled RNA and 500 nM protein (C) for 60 min, as described in [Materials and Methods](#s4){ref-type="sec"}. (D) Splicing assays of wild-type CYT-18, Chi.1, and Chi. 2, with unlabeled precursor RNA and \[α-^32^P\]GTP. Splicing assays were done as above with 500 nM protein, 200 nM unlabeled Nc mt LSU RNA, and 500 nM \[α-^32^P\]GTP (3,000 Ci mmol^−1^) for 60 min at 25°C. A darker exposure of the autogradiogram is shown below. The chimeric proteins spliced the Nc *ND1*m intron, which is not dependent upon the CYT-18 CTD, but were unable to splice Nc mt LSU intron, which is dependent upon the CYT-18 CTD, under any condition tested. The splicing of the Nc *ND1*m intron by the chimeric proteins in 100 mM KCl decreased with increasing temperature relative to the wild-type protein, likely reflecting loss of CTD interactions that contribute to but are not essential for splicing. Abbreviations: E1--E2, ligated exons; E1-I, 5′ exon+intron; I, excised intron; I-E2, intron+3′ exon; P, precursor RNA. (TIF) ###### Click here for additional data file. We thank Paul Paukstelis for the plasmid pHISTEV602 and Mark Del Campo for pCYT18/ΔC-tail construct and contributions to SAXS experimental design, data collection, and analysis. We thank Soenke Seifert at the Advanced Photon Source beamline 12-ID-C for assistance with data collection. Use of the Advanced Photon Source, an Office of Science User Facility operated for the US Department of Energy (DOE) Office of Science by Argonne National Laboratory, was supported by the US DOE under contract number DE-AC02-06CH11357. We thank Mark Del Campo, Georg Mohr, and Rick Russell for comments on the manuscript. aaRS : aminoacyl-tRNA synthetase C-tail : C-terminal tail CTD : C-terminal anticodon-binding domain *D*~max~ : maximum dimension of the particle mt : mitochondrial mtTyrRS : mitochondrial tyrosyl-tRNA synthetase Nc mt LSU intron : *Neurospora crassa* mitochondrial large subunit rRNA-ΔORF intron Nc *ND1*m intron : *Neurospora crassa* NADH dehydrogenase subunit 1-ΔORF intron NSD : normalized spatial discrepancy NTD : N-terminal domain *P*(*r*) : distance distribution function *q* : momentum transfer *R*~g~ : radius of gyration SAXS : small angle X-ray scattering Sc mtTyrRS : *Saccharomyces cerevisiae* mitochondrial tyrosyl-tRNA synthetase TEV : tobacco etch virus [^1]: The authors have declared that no competing interests exist. [^2]: The author(s) have made the following declarations about their contributions: Conceived and designed the experiments: LTL AML. Performed the experiments: LTL. Analyzed the data: LTL ALM AML. Wrote the paper: LTL ALM AML.
mini_pile
{'original_id': 'af30e6cfdf6e1c0e846b2ad31b9b41dce19e4a332f65db602ecf714883228dc6'}
Blood-based cooking has certainly been a part of Western cuisine since the time of ancient Greece. But sometime in recent history, we forgot how to use it. The ingredient grew as a taboo while actually it gives a lot of nutritions and possibilities.  There is a connection between blood and egg. They both have really similar protein compositions and content, the most interesting is the albumin protein. Blood will foam, coagulate and emulsify the same as an egg. Also blood contains less calories than eggs.  The egg industry is a big part of the animal industry. By starting to use animal blood as a daily life ingredient the egg industry will shrink. Animals are slaughtered every day, there is a flood of blood anyway. Why use two types of industries while you can only use one, or at least shrink one down enormously.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.94990211725235}", 'metadata': "{'Content-Length': '408085', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:HHH7ML42C3COIJECJEZIL5CHFYQD22HS', 'WARC-Concurrent-To': '<urn:uuid:026fce68-7b0a-4944-b7f6-1b940d2d5bd3>', 'WARC-Date': datetime.datetime(2021, 9, 26, 14, 0, 36), 'WARC-IP-Address': '185.230.60.102', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DOGZ63BOGDUGIHO2X7CU625AIFSE3YMY', 'WARC-Record-ID': '<urn:uuid:09b4ee18-e648-4393-87bb-fb1a3372d7d7>', 'WARC-Target-URI': 'https://www.sandrajanssen.com/the-blood-cookbook', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d8c0bedb-613c-405c-ab87-c2c2d89dc19e>', 'WARC-Truncated': None}", 'previous_word_count': '146', 'url': 'https://www.sandrajanssen.com/the-blood-cookbook', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-142\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9551208019256592', 'original_id': 'b33952ab24cc83dd55a86c79770b06f917e27142450f453f50042f300ba29629'}
{% extends 'base.html' %} {% load staticfiles %} {% load widget_tweaks %} {% load crispy_forms_tags %} {% load accounts_tags %} {% block title %} Company List | {{ block.super }} {% endblock %} {% block breadcrumb %} {% endblock %} {% block content %} <!-- Headers Start --> <div id="headers"> <!-- Light header --> <header id="header-style-1"> <div class="container"> <div class="header-caption"> <div class="row"> <div class="col-12 header-content"> <h3 class="header-title animated fadeInDown"><span class="text-primary">Companies</span> - Best Companies are listed here </h3> <a class="btn btn-lg btn-border animated fadeInUp" href='{% url "company:new" %}'>add your company here</a> <form method="get"> <div class="col-md-8 col-sm-12"> <div class="row"> <div class="col-md-5 col-sm-12 p-0"> {{ filter.form.name.label_tag }} {% render_field filter.form.name class="form-control" %} </div> <div class="col-md-6 col-sm-12 p-0"> {{ filter.form.description.label_tag }} {% render_field filter.form.description class="form-control" %} </div> <div class="mb-0 mt-2 col-md-1 col-sm-12 p-0"> <button class="btn btn-primary" type="submit"> <i class="fas fa-search"></i> Search </button> </div> </div> </div> </form> </div> </div> </div> </div> </header> </div> <!-- Headers End --> <div class="mb-60"></div> <!--simple card--> <div class="container"> <div class="row"> <div class=" clearfix col-md-4 mb-2 pull-left"> <div class="card-body"> <div class="filters panel-group" id="accordion"> <div class="panel panel-default"> <div class="card"> <h6 class=" card-body panel-title"> <a data-toggle="collapse" data-parent="#accordion" href="#collapseGenres"> Filter by Cateogry </a> </h6> </div> <div id="collapseGenres" class="panel-collapse collapse in"> <div class="panel-body"> <div class="list-group"> <a class="list-group-item{% if not facets.selected.cateory %} active{% endif %}" href="{{ modify_query }}">All</a> {% for cat in facets.catego.category %} <a class="list-group-item{% if facets.selected.category == cat %} active{% endif %}" href="{{ modify_query }}">{{ cat }}</a> {% endfor %} </div> </div> </div> </div> <div class="panel panel-default"> <div class="card"> <h6 class="card-body panel-title"> <a data-toggle="collapse" data-parent="#accordion" href="#collapseDirectors"> Filter by Location </a> </h6> </div> <div id="collapseDirectors" class="panel-collapse collapse"> <div class="panel-body"> <div class="list-group"> <a class="list-group-item{% if not facets.selected.location %} active{% endif %}" href="{{ modify_query }}">All</a> {% for cat in facets.catego.location %} <a class="list-group-item{% if facets.selected.director == cat %} active{% endif %}" href="{{ modify_query }}">{{ cat }}</a> {% endfor %} </div> </div> </div> </div> </div> </div> </div> <div class="col-md-8 pull-right "> {% if filter.qs %} {% for obj in filter.qs %} <div class="card mb-2"> <div class="card-body "> <div class="row"> <div class="col-md-3 col-sm-12"> {% if obj.logo %} <a href="{{ obj.get_absolute_url }}"> <img class="d-block w-100" src='{{ obj.logo.url }}'/> </a> {% else %} <a href="{{ obj.get_absolute_url }}"> <img class="d-block w-100" src='{% static "img/avatar.svg" %}'> </a>s {% endif %} </div> <div class="pull-right col-md-9 col-sm-12"> <div class="col-md-12 post-header-line"> <h4 class="card-title"> <a href="{{ obj.get_absolute_url }}"> {{ obj.name }} </a> <span class="badge badge-primary">{{ obj.category.name }}</span> </h4>{% if obj.website %} <h6 class="card-subtitle mb-2 text-muted"><a href="{{ obj.website}}"> Website </a></h6> {% endif %} <p class="card-text">{{ obj.description|truncatechars:100 }}...</p> <hr/> <span><i class="fas fa-star"></i>{{ obj.average_rating | floatformat }} rating </span> | <span><i class="fas fa-comments"></i>{{ obj.review_set.count }} reviews</span> | {% if obj.location %} <span><i class="fas fa-map-marker-alt"></i>{{ obj.location.name }} | {{ obj.location.country.name }}</span> {% endif %} <div class="pull-right"> <a class="card-link" href="{{ obj.get_absolute_url }}"> <button type="button" class="btn btn-primary">Details</button> </a> </div> </div> </div> </div> </div> </div> {% endfor %} {% else %} <div class="modal-dialog" role="document"> <div class="modal-content"> <div class="modal-header"> <h5 class="modal-title">currently no Company</h5> </div> <div class="modal-body"> <a href="{% url 'company:new' %}" class="btn btn-success btn-lg" role="button">Add Your Company </a> </div> </div> </div> {% endif %} </div> </div> </div> <!--end of simple card--> <div class="mb-60"></div> {% endblock content %}
the_stack
{'hexsha': 'd3cc8a3164888a4fc6b1d7b5e3182d0531403339', 'size': '6522', 'ext': 'html', 'lang': 'HTML', 'max_stars_repo_path': 'templates/company/list.html', 'max_stars_repo_name': 'WillieIlus/jobscorner', 'max_stars_repo_head_hexsha': 'ed3734468ea0e88a306a1d29bc876562e940f4fb', 'max_stars_repo_licenses': "['bzip2-1.0.6']", 'max_stars_count': '2', 'max_stars_repo_stars_event_min_datetime': '2020-04-12T13:18:35.000Z', 'max_stars_repo_stars_event_max_datetime': '2021-04-02T04:18:17.000Z', 'max_issues_repo_path': 'templates/company/list.html', 'max_issues_repo_name': 'WillieIlus/jobscorner', 'max_issues_repo_head_hexsha': 'ed3734468ea0e88a306a1d29bc876562e940f4fb', 'max_issues_repo_licenses': "['bzip2-1.0.6']", 'max_issues_count': '3', 'max_issues_repo_issues_event_min_datetime': '2020-02-11T23:58:53.000Z', 'max_issues_repo_issues_event_max_datetime': '2020-09-06T18:46:17.000Z', 'max_forks_repo_path': 'templates/company/list.html', 'max_forks_repo_name': 'WillieIlus/jobscorner', 'max_forks_repo_head_hexsha': 'ed3734468ea0e88a306a1d29bc876562e940f4fb', 'max_forks_repo_licenses': "['bzip2-1.0.6']", 'max_forks_count': '1', 'max_forks_repo_forks_event_min_datetime': '2020-08-17T08:29:41.000Z', 'max_forks_repo_forks_event_max_datetime': '2020-08-17T08:29:41.000Z', 'avg_line_length': '35.8351648352', 'max_line_length': '122', 'alphanum_fraction': '0.4520085863', 'original_id': '7b12ef7022695b31d2d58ffde27e334a7ee3736cb742552886622d5e92aa4b5b'}
How Food52 successfully combines content and commerce While many publishers are trying to find new content streams within the retail sector, few have managed to marry the two worlds of content and commerce like Food52. First launched in 2009 as a small online food community, Food52 now has an average of 11m monthly visitors across various platforms, including an impressive 1.7m followers on Instagram. Meanwhile, it generates two-thirds of its revenue from sales in its online shop.
mini_pile
{'original_id': 'ebe2f4bbaaf7cd4d5e001605fed74d1b6267a2d20580096bd6347d222dcde857'}
Backpage Escorts Pennfield Ridge NB, What Happend To Backpage Escorts New Brunswick I didn't inquire about his plans to return to Chicago right away I allowed him to steer the dialogue because he saw fit. I was convinced he didn't have things all figured out anyhow. He started by backpage escorts massage Pennfield Ridge me all the roadblocks that which made him decide he had to go back to Chicago to regroup and he was met with on his business trip rather than staying in California. Second area of the Night This is the time. I discover that if you are having the time of your life and you are the heart and soul of the party the women will come to you. As soon as you find a woman andyou're having a great time teasing, laughing and being sexual you want to find out some information about her. Where Did Escorts Go To Find People After Backpage Closed He walked into his table with a massive smile on his face. Quiet giggles could be heard by you in the room full of humored people. She grabbed her stuff, got up and walked out to the rising giggles and jeers of the room. When she got to the doorway one man sat at a table on the other side of the room shouted across the room, " Hey love! Don't leave. I have breath mints! " The room's jeers tuned into full- blown, open wake. That is so wrong on each level and there are men that do this. They destroy their chances. By playing it cool It's possible to jump. While I certainly have had success by prodding someone with another message, you have to abandon it. Not hours. And one message is all it requires. If you do not get a reply on the message then forget her and move on. She could well message you. Ive had a response a week later. But proceed. It certainly looks like you don't have anything else going on in your life if you Pennfield Ridge are backpage escorts legit pestering somebody! You have to consider the view, this person isn't known by you, and they don't know you. Nothing is lost or gained here by waiting even if at the end you still don't get a reply. Pennfield Ridge NB Get Where Do Escorts Advertise After Backpage Was Shut Down? You can instantly tell that this person is insecure. Life lives depending on people's opinions. If folks say something about him, instead of brushing the comment off and continuing being his normal self, he lets that comment affect his disposition and he becomes angry. Negative remarks doesn't affected A person. You're risking your friendship once you tell her" I'm interested in you sexually. " You're risking whatever you have constructed over time when you tell her that you would like a romantic relationship with her and come right out. So what? Is she'll be out of your life. Where Do Escorts Post Since Backpage Is Gone In Wa State But once we got amorous he retained his socks on, even though it was a hot summer's day, the for me personally was on a single occasion- - for it was a real turn- off. Invest at least a Pennfield Ridge NB backpage escorts legal to work through your past, if you are divorced and determine your motivation for picking your own ex- spouse before you try dating someone. When there are lots of books on this issue, please consider getting outside help, also. Divorce recovery workshops, and twelve- step applications or therapists, counselors are fantastic resources. Why Did All Escorts Stop Writing A Profile On Backpage Pennfield Ridge NB Backpage Escorts Bareback If we can get four, you should be able to acquire exactly the same amount! Remember, you do not need to have this life- changing experience. Sex Dating Apps Free Others judge Folks such as this from the way they talk in their work. If you where is the new backpage escorts Pennfield Ridge NB me you hate the job, the first question I'd ask you is: " Ok, well, why do you keep doing your job if you hate it? " There is no way to answer this. How Late Red Light District Windows Open Nearby Pennfield Ridge Regardless of what made you hold back from doing these things today is as good a day as any to begin flirting. The best part is that when you start communication and feeling only a little bit of energy you will see an immediate positive difference in the answers you get. Remember that it's not about looking or looking a certain way, but instead, it only comes from responding to them and holding space for the moment's feelings. Sites Like Backpage Escorts Pennfield RidgeFallingfor A Fuck Buddy This is particularly true in online dating, where guys get it that one girl in particular on the site or appis'intended' for them. Wow! She's hot and likes the same band should be the one! Within this delusion that is wild, an attachment to his elevated picture of the woman develops, and so it hurts to not get the result that is desired. You can't put yourself in the position, where you have attachments to girls on the internet, and anticipate this to be sustainable in the long term. She does not owe you anything. Nor would you owe anything. This is not to mention to become an asshole toward anyone, but when she doesn't message you back, it is not a major thing. So, don't treat it. There will be a great deal of women who will not respond, or where the Pennfield Ridge backpage escorts creampied peeters out. That is something whenever it really does to be taken as a life crisis. There is zero attachment to this woman or the results of the conversation. Once you get the date, there's no attachment to the outcome. Just let it go, and move on to another opportunity, if things go south. As she shows herself if things go well, you're able to slowly invest more. What Interests A Girl Online Dating Backpage Escorts Near Me Pennfield RidgeCasual Sex Project Waitress Pennfield Ridge Last Thoughts on Dating a Game Player I've never been someone who plays with games in relationships and have always been extremely straightforward. Because in regards to players of this approach, I've noticed a hypocrisy in men. I have heard my whole life how men just can't handle girls who" cause drama" or" play games. " As soon as they get together with somebody who has better things to do with her period, suddenly they don't know how to behave. They start playing their games to the point in the relationship. Then, months later, you will see them hooked up that for a psychopath is called by everyone in city. Pennfield Ridge Backpage Escorts Gang Bangs Account function WeChat lets you stay signed into two accounts with one phone. It's better to get another account for your life and a dedicated account for dating. Basically, create two WeChat accounts( you will need two telephone numbers) . How Much Casual Sex Are People Having Pennfield Ridge NB Where Is The New Backpage EscortsOnline Dating Intro God loves us and wants us to have powerful unions. He knows what evil and good lurk in the hearts of men and women. If we sincerely ask Him to guide us on a path leading to a spouse He believes is the ideal game for us, He Pennfield Ridge fat online dating honor that request. But be warned: We will expect the road to be direct and short. Me: attempts to resuscitate this dialog with attractive lady and Logs into my Bumble account. ( one of the smiley emojis and also the prayer emoji) That was just something I wanted to check out. It's corny as hell but serves the purpose. Completely about praying since the same message was Pennfield Ridge NB backpage escorts xxx by me into another girl on she answers with the emojis joking. How To Avoid Being Scamed On Dating Sites So what makes good body language? Japanese escorts backpage McIntosh Springs ON today read your own body language, frequently and without believing. Our poses and position are a fantastic source of information. These reflect your degree of confidence in addition to your disposition. Walk or people tend to stand yet another way when they're nervous and a particular way when they're confident. People can read your body language ifyou're apprehensive or outgoing, competitive or relaxed. With just a little practice, we could learn so we constantly seem confident, capable and prepared, the suggestions to show confidence through body language. This doesn't mean that men's main focus is gender. Men do enjoy sex but so do girls. Because it makes them look like sluts in societies eyes it isn't socially acceptable for women to showcase their sexual desires. Dating When Time For Sex He proceeded to brush off my efforts at conversation topics for the remainder of our time at the vineyard. I was extremely annoyed by this, since when he chose the subject, it was silly little things and also normally the details he' d spew was completely incorrect. It was perplexing at best. John Gottman Casual Sex Pennfield RidgeRich Prostitutes Pennfield Ridge The larger and higher profile sites have more features, but are geared to relationship personals generally. They have memberships that are global so ifyou're looking for someone in your area, you could have a difficulty. Pennfield Ridge NB Ftee Fuck Buddy First Contact: Mastering The Art of Opening Assessing the art of beginning conversation with somebody new( a. k. a Opening) is essential to your relationship success. An inability to initiate dialogue limits the diversity of your social circle and your pulling new escorts backpage Pennfield Ridge NB. As long as you want to be successful on the scene, you're going to need to be efficient on the dialogue front. Would you be interested in meeting at the Rose Garden for a top furry dating apps walk? We take a look at their choice and can go to Orchard Nursery, if we're inspired. I have a location for three bushes that are brand new, plus it's just fun to look at a what happend to backpage escorts Pennfield Ridge New Brunswick in full summer splendor. How To Search For Escorts On Backpage Close To Pennfield Ridge New Brunswick This is fundamental, but you shouldn't be flirting with men other than the one. Dance with the person who brung ya. People will believe you've got something to hide- - While there are some perfectly innocent reasons it's also normal for many reasons to be innocent. For example, individuals who are married or in a relationship turn into the Internet in order to find people to cheat with. Putting a picture up shows you have nothing to hide. Where Have All The Escorts On Backpage Gone To Being too" touchy feely" could be a major turn off to a people. On that might create your date or individual of attention uncomfortable, Everybody needs their distance and encroaching. It's not that they don't like you, they don't enjoy howyou're just too touchy feely, so do yourselves a favor and maintain the touching to a minimum or be observant of your spouse's body language, he or she might just happen to be waiting for that little touch. Where Are Escorts Advertising After Backpage Shut Down Located In Pennfield Ridge Backpage Escorts Getting Pounded Pennfield Ridge Dating websites are attempting to attract you and also, like all salespeople, it is just the promise of the glorious experience that is presented on their home pages and advertising and backpage escorts materials. Ultimately, you be proactive on a dating website and need to cause your experience. By placing up a profile that is careless, then waiting for their search engines to perform of the work Don't take a passive stance. It's what you bring to the party that will establish the grade of your experience, although the capacities of the search engines of the site can Pennfield Ridge NB backpage bare escorts. What Do People Use Instead Of Backpage For Escorts Near Pennfield Ridge New Brunswick The hot partner is the one where your independent escorts backpage La Hune NL look hotter than you. Notice Isay'look' as at this stage we're judging only appearance and not character. The purpose is if all of yourmates'seem' hotter than you, what? There's few things worse than seeing that sexy woman gets back- she's asked about your partner in the birthday celebration pic and can she's his or her number. So pick on those group photographs. It's all about you.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '728', 'language_id_whole_page_fasttext': "{'en': 0.9602194428443908}", 'metadata': "{'Content-Length': '21639', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:U32TGUIDDAZ364FDOAASVQ24GZUUIG5V', 'WARC-Concurrent-To': '<urn:uuid:aad458ea-46d3-4c4b-a9d6-ce732e5a0267>', 'WARC-Date': datetime.datetime(2020, 5, 29, 10, 7, 5), 'WARC-IP-Address': '172.67.205.127', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:IT76NXAMB6FNIXEQWY5X5JAHHXRLOK2L', 'WARC-Record-ID': '<urn:uuid:15703558-360e-4827-8959-fb8b68557e65>', 'WARC-Target-URI': 'https://bbpbat.net/backpage-escorts-new-brunswick/pennfield-ridge-nb', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f93574de-f927-4af2-9039-535f4937c0af>', 'WARC-Truncated': None}", 'previous_word_count': '2138', 'url': 'https://bbpbat.net/backpage-escorts-new-brunswick/pennfield-ridge-nb', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-84.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.053276240825653076', 'original_id': '702e2b5745ae0a85f826019814fbbcfdf092551182d688f5717f6a84de972025'}
5 Lessons Learned: Options Everything You Need to Know About Liquidation If you part of the business industry, there is no doubt that you have encountered the name Phillip Cochineas in one of your readings as being linked to the liquidation of his company and is now building it back. What is basically the whole deal with liquidation and its real meaning? As any business entity or company comes to an end, it is crucial for it to have to go through the legal process called liquidation. Once a business is liquidated, all of its assets will be sold to other people and companies and the proceeds will immediately go straight to the creditors to pay them. The process of liquidation is also referred as business dissolution or winding up. Usually, liquidation is thought of as the choice that business owners make when they can no longer pay for their accumulating debts. Liquidation is thus done so that the control of the assets of the company will go to the creditor. All these assets will then be sold by the creditor to interested buyers so that they can make as much money out of them. Creditors are the first ones in line who will get the profit of the assets that are sold by the business. It will be the shareholders of the company next who will be getting the remaining proceeds from the assets sold and left off by the creditors. And then, even among shareholders, the ones that get more say about the remaining profit of the assets will be the preferred shareholders with only the common shareholders being next in line. If you talk about liquidation, it can go in two directions. The two major types are called compulsory liquidation as well as voluntary liquidation. You call it compulsory liquidation when it is the court that will decide that a company must liquidate its assets and pay their creditors. Meanwhile, if you talk about voluntary liquidation, there is a filing of petition for liquidation in the court of law either done by the creditors, the contributors, or even the companies themselves. This becomes a result if the company has debts that will wind up the company or cannot pay for the debts anymore. Typically, shareholders of the business entity get to have a say in voluntary liquidation for the company to be dissolved.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '290', 'language_id_whole_page_fasttext': "{'en': 0.9744612574577332}", 'metadata': "{'Content-Length': '19291', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KZFXYBZCWTD72CXGOMYZJHRGTHNUVZHP', 'WARC-Concurrent-To': '<urn:uuid:4d99aca8-0866-4fd8-84a2-cbbbd8800a48>', 'WARC-Date': datetime.datetime(2018, 9, 23, 7, 26, 47), 'WARC-IP-Address': '198.252.99.67', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:6V6HXWKLGIVI63GJMOVC2NBW2C7IAWYN', 'WARC-Record-ID': '<urn:uuid:8cb8a690-c252-4297-9ae0-7933547098ee>', 'WARC-Target-URI': 'http://doska-net.info/2018/05/10/5-lessons-learned-options/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8ee5a58a-b1e2-47f0-8cc2-57cffc8dc6c2>', 'WARC-Truncated': None}", 'previous_word_count': '488', 'url': 'http://doska-net.info/2018/05/10/5-lessons-learned-options/', 'warcinfo': 'isPartOf: CC-MAIN-2018-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-95-180-234.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.061565935611724854', 'original_id': '8d610c917339c2b504a46ac2d4553577671e9835a186f2a704ca32aec5812515'}
Effects of Late or Non-payments/The 3 "C's" (International) From WikiEducator Jump to:navigation, search Unit 3.3- Effects of Late or Non-payments  Introduction | Tenets of Risk Assessment | Risk and Reward | "Eight C's" | 5 "C's" | 3 "C's" | Applying the "C's" | Impact of Nonpayment | Identifying Costs | Bad Debt Value | Interest | Cost and Capital | Administrative | Summary | Resources | Activities | Assessment The 3 “C’s (International) In international credit management, country, currency and culture risks are inextricably linked to assessing a buyer’s risk. They must be evaluated together for the assessment of one will depend on that of all others. Country Risk Globalization is not just a cliché. It is happening all around, as businesses increasingly look at the world as if it has no national boundaries. Governments, on the other hand, still tend to make policy in what they perceive to be their country's national interests. With globalization, competition sharpens worldwide, but nationalistic laws frequently make for a highly uneven playing field. There are three important principles in country risk assessment: 1. Countries are interdependent. 2. Country conditions affect customers. 3. The assessment must be systematic, objective and relevant. a. Systematic means it must be proactive, looking ahead rather than being merely reactive. There must be specially assigned people charged with the task of country evaluation who can be held accountable. The process of assessment must be continuous for markets in which the company has an interest, not just a task undertaken when a new order comes in. The process requires regular, reliable, assured flows of information, both into the company and within the company, for instance, from international credit managers to sales people. The evaluation of country information must also be structured so that important signals are not overlooked and key questions are being asked. b. Objective means that the evaluation should be free of all personal bias. Countries can and do change, both from good to bad and from bad to good, all too often within very short periods of time. External conditions also can change, as they did for Argentina when Brazil devalued its currency; so countries should be assessed not in isolation, but in the context of what goes on around them. c. Relevance relates to how practical and pertinent the evaluation of the country risk elements fit with the needs of a seller. For example, if a seller is considering the risk factors of selling to Italy and Italy has a change in government, this change might not be enough of an impact for a seller to find it relevant to if or when he/she will be paid. A global credit manager may question the value and significance of examining the cultures that exist in countries where export business is projected. The pro-active company and international credit manager will recognize that personal and company relationships still are critical, both in the development of new markets and in ensuring that payment obligations are processed in a timely manner. Currency Risk Currency risk in international credit management arises from an export invoice (a receivable, an asset) that remains unpaid either because an importer's country has imposed exchange controls, making it impossible to convert the funds to the agreed upon currency or because a devaluation has taken place that raises the local currency cost of paying the invoice so much that an importer is unable to pay. The result can be nonpayment in convertible currency (even if local currency payment has been deposited with a local bank) or delayed payment in convertible currency. Culture Risk Even though an international credit manager may question the value and significance of examining the cultures that exist in countries where export business is projected, the mores and culture of a business located in an offshore country impact risk. In evaluating "culture" as a risk element, it is appropriate to consider examples of cultures in the world and the way they may impact how business is conducted. For example, in Japan, “WA” or “Inner Harmony” is a concept that many Westerners fail to grasp. When it may appear Japanese will have eyes closed at meetings, they are gathering their thoughts, not sleeping! Management in Japan is known to be very participative and team-oriented. In India, the caste system still exists, with underlying cultural variables that structure the life of a person from India. Managers in India generally make most decisions; employees follow rules. In Latin America, the family is of central importance, and loyalty often determines career paths and promotions. In each of these examples, an international manager would be wise to try and understand the “cultural” elements of the business transaction which could impact the process of risk evaluation. Create a book Bookmark and Share
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '9', 'language_id_whole_page_fasttext': "{'en': 0.94415020942688}", 'metadata': '{\'Content-Length\': \'27344\', \'Content-Type\': \'application/http; msgtype=response\', \'WARC-Block-Digest\': \'sha1:IOQGEU7CKEN7N5N5YQGYEWY76MQJAJF7\', \'WARC-Concurrent-To\': \'<urn:uuid:04788a79-48ff-4ae5-863d-f0e8434e156f>\', \'WARC-Date\': datetime.datetime(2014, 4, 19, 9, 24, 11), \'WARC-IP-Address\': \'54.245.92.232\', \'WARC-Identified-Payload-Type\': None, \'WARC-Payload-Digest\': \'sha1:YTATZVDSQ7JMPXG2LJAEVKCVN4XHNKPU\', \'WARC-Record-ID\': \'<urn:uuid:f6824cbd-85d2-4566-8048-2e52836e05f9>\', \'WARC-Target-URI\': "http://wikieducator.org/Effects_of_Late_or_Non-payments/The_3_%22C\'s%22_(International)", \'WARC-Type\': \'response\', \'WARC-Warcinfo-ID\': \'<urn:uuid:bea6524f-6f12-44d3-b955-a271a8b63c78>\', \'WARC-Truncated\': \'length\'}', 'previous_word_count': '763', 'url': "http://wikieducator.org/Effects_of_Late_or_Non-payments/The_3_%22C's%22_(International)", 'warcinfo': 'robots: classic\r\nhostname: ip-10-147-4-33.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-15\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for April 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2676042318344116', 'original_id': '8a5a4624b684cd8b8e25b72b30075e78ca4f9bd68c9db4cc9f583fff61e8f407'}
About the Author Opinion Archives E-mail Scott Scott's Links Why is Donald Trump so popular? By Scott Tibbs, July 13, 2015 I have made no secret of my disdain for Donald Trump, but it is undeniable that he has captured the attention and admiration of a large segment of the Republican base. The guy who donated thousands of dollars to Hillary Clinton and is a fervent opponent of private property rights nonetheless has a lot of Republicans hoping he is our nominee. I think the reason is that Trump, for all of his silly antics, has been an extremely aggressive critic of President Obama, especially with the "birther" issue. At a time when many in the Republican base are fed up with the Washington establishment's moves on amnesty for illegal immigrants, Trump was aggressive to the point of being obnoxious in his criticism of illegal aliens. Granted, his criticisms were the racist, uninformed rantings of a know-nothing, but he is taking an aggressive stance that is a breath of fresh air to many in the Republican base. Hopefully, Republicans will see through Trump's bluff and bluster to see why he would be a terrible choice for the Republican Party. Trump would be a disaster in terms of his electability, his ideology and his personal character. But Trump strikes the same chord that Sarah Palin has since 2008: Someone who is uncompromising, aggressive, fearless and uninhibited in his attacks on the Democrats, President Obama and the Left generally. Trump is basically a less serious, less intelligent and more clownish version of Palin. (Think about that for a minute.) But what Trump's popularity with the Republican base shows is that Republican voters are longing for a top-tier candidate who will aggressively take it to the Democrats generally, and to Obama and Hillary Clinton specifically. (Whether Trump will aggressively attack Clinton, given his many donations to her, remains to be seen.) The content of Trump's blather is less important than the posture he is taking while delivering that blather. If Republicans are to win the White House in 2016, they are going to need an excited Republican base to do it. Neither Mitt Romney nor John McCain were particularly exciting to the base. Republicans do not need to be (and should not be) obnoxious clowns, but Trump's popularity shows one thing that the Republican Party has been lacking: The courage to aggressively take it to the Democrats.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9751810431480408}", 'metadata': "{'Content-Length': '4225', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4LJCEWKX6VLDS2VP4CYNYR255C22BTV3', 'WARC-Concurrent-To': '<urn:uuid:fdada37f-dbfc-4286-b745-9ce1340ce948>', 'WARC-Date': datetime.datetime(2019, 2, 16, 16, 25, 45), 'WARC-IP-Address': '50.63.127.1', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:ZJCDSDJPEMPUAPAEXONJEPDWAZPZON4E', 'WARC-Record-ID': '<urn:uuid:82372a29-96d2-422c-b92f-28d1ca68bbf8>', 'WARC-Target-URI': 'http://www.sstibbs.com/scott/2015_archives/blog_2015_088.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:559ce47d-905e-472b-8fb4-b2136ac48958>', 'WARC-Truncated': None}", 'previous_word_count': '402', 'url': 'http://www.sstibbs.com/scott/2015_archives/blog_2015_088.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-159-135-91.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2317327857017517', 'original_id': '2ff981d93598539fe95773637b7a63b599a9ecab8a0a1fdd4008d2719b2e4b8b'}
1997 Atlantic Championship The 1997 Toyota Atlantic Championship season was contested over 12 rounds. All teams had to utilize Toyota engines. The KOOL Toyota Atlantic Championship Drivers' Champion was Alex Barron driving for Lynx Racing. In C2-class 14 different drivers competed, but none of them for the whole season. Calendar Note: Race 1 held on the road course. Race 10 stopped earlier due to rain, originally scheduled over 17 laps. Final points standings Driver Main championship For every race the points were awarded: 20 points to the winner, 16 for runner-up, 14 for third place, 12 for fourth place, 11 for fifth place, winding down to 1 point for 15th place. Lower placed drivers did not award points. Additional points were awarded to the pole winner (1 point) and to the driver leading the most laps (1 point). C2-class drivers were also able to score points in the main class. C2-Class championship Points system see above. But additional points only awarded for the fastest qualifier. No additional point awarded to the driver leading the most laps. Note: No more competitors in C2-class. See also 1997 CART season 1997 Indy Lights season 1996–1997 Indy Racing League season External links ChampCarStats.com References "The Atlantic championship" , of John Zimmermann Atlantic Atlantic Season, 1997 Category:Atlantic Championship seasons
mini_pile
{'original_id': '45ac496421fbfa637eef396d9e7d1b54f1cff3b259c8dc9fdba82cf1e0a9ebba'}
Army of Norway (Wehrmacht) The Army of Norway, also simply Army Norway (), was a German army operating in the far north of Norway and Finland during World War II. The Army of Norway was under Armeeoberkommando Norwegen (Army High Command Norway), abbreviated AOK Norwegen, which was one of the two army echelon headquarters controlling German troops in the far north. Armeeoberkommando Norwegen was directly subordinate to OKH, the high command headquarters of the Wehrmacht. It was created from Army Group XXI in December 1940, itself a successor of the XXI Army Corps, and disbanded in December 1944, with its assets taken over by the 20th Mountain Army. Operations The Army of Norway took part in Operation Barbarossa in 1941. In talks between Finnish and German staffs in Helsinki in June 1941, the Germans were given military responsibility over northern Finland; Army Norway was to take Murmansk and the Murmansk railway. The plan was codenamed Operation Silberfuchs (Silver Fox). The Army was evacuated from Norway in 1945 as part of the Operation Uberbirkhahn. Assets German Army of Norway (Falkenhorst) From January 1941: XXXIII Corps XXXVI Corps Gebirgskorps Norwegen From July 1941: (during Operation Silberfuchs) XXXIII Corps XXXVI Corps LXX Corps Gebirgskorps Norwegen From September 1941: XXXIII Corps XXXVI Corps LXX Corps Gebirgskorps Norwegen Finnish III Corps From March 1942: (after creation of German Twentieth Mountain Army) XXXIII Corps LXX Corps LXXI Corps See also 20th Mountain Army References A N Category:Norway in World War II Category:Military units and formations established in 1940 Category:Military units and formations disestablished in 1944
mini_pile
{'original_id': '5d7a5be32be6f0743f0d057138ccf6c065624a5085dc8c067be9f7b39a4e649d'}
1500 Meter’s Water-Resist-Breitling Superocean 42 Collections Breitling Superocean 42 has a variety of colors, such as blue, yellow, red and silver. It is the most colorful one and offer the most choices for the fundamental users. Before that, we has introduced the orange bezel and now we could focus on a pure blue one which has a limited number of 2000. Comparing to the orange bezel, it seems darker and deep, but the ocean-theme blue appearing on it seems quite fashion. What a contrast. As a functional watch, it has big time scales to provide a good reading. Taking a careful look at the dial, all the time indexes are dimensional. But only number 6, 9, 12 and grid on the dial are covered with luminous materials. What’s more, we could see a delicate ultra-thin logo whose surface is processed with polishing techniques. In order to improve the touching feel, the outside of the bezel are processed with indention patterns, with a blue-coated and the time indexes are obvious by contrast Screw-in crown can improve the performance on resisting water and the protection on two sides are the basic requirement for the sport watches. The crown on the lug has a naturally graceful arc. Steel and case connects and integrates in a unity. At 10’oclock, we could see a hidden button. That is the helium valve which only appears on the deep diver watches. The crown is the most fragile part which is also interactive with human, so professional watch would has a protection to protect crown from being damaged. In order to achieve the deep water-resist, the case back is made of screw-in case button and has certain marks, such as place of production, water-resist info, certificates, serial number and case serial number, etc. Anyway, Breiling Superocean 42 is a good choice for those who wants to learn and become a Breitling hard fan.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9474086761474608}", 'metadata': "{'Content-Length': '57589', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WNGPATYUZPFI5LBJWB4ZKUFU5X3SHLBK', 'WARC-Concurrent-To': '<urn:uuid:fdc8862a-09ce-49a1-a873-61f8d974c8df>', 'WARC-Date': datetime.datetime(2019, 6, 18, 6, 35, 16), 'WARC-IP-Address': '104.18.53.153', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2HL56N4J7KKIPOBDQ7FPRMOGJSJOGCNN', 'WARC-Record-ID': '<urn:uuid:4e12f4d1-df66-4480-906a-f75e2b33aa38>', 'WARC-Target-URI': 'http://www.granacast.com/tag/collections/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:41802a70-7c45-4f40-9366-2fafefa13aed>', 'WARC-Truncated': None}", 'previous_word_count': '315', 'url': 'http://www.granacast.com/tag/collections/', 'warcinfo': 'isPartOf: CC-MAIN-2019-26\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-187-26-184.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.056231677532196045', 'original_id': 'ff37e2b88d121c74e4198c855315e3863a7d42a50a8c79ecea6154abee33ca66'}
STAN BURNS, Magical Ventriloquist, Versatile Ventrilo-Wit and historian of the art of throwing one's voice, died five years ago. He was 79. He left behind his wife, Sylvia, a trove of memorabilia and six dummies: Bruce, Cecil, Susie, Lulu, Uncle Sam and Dr. Lichi, as in the nut. It is fitting that Stan used an unconventional spelling of litchi, given that he dedicated his life to the whimsical violation of rules &#0151; particularly the one holding that inanimate objects cannot talk. He was a boy with a stutter when he saw his first "vent" act, at a Harlem dime museum back in the 1920's. And when he tried the illusion himself, words poured forth uninterrupted, as if by magic. His first professional dummy was a smart-alecky boy named Willie. But Willie was stolen from a car's back seat one night, an abduction that taught Stan to keep his puppets always in sight. But for years afterward, Sylvia said, "Stan kept looking for him." Although he was no Edgar Bergen, Stan's ability in extracting vaudevillian banter from dressed-up pieces of wood served him well. There was the occasional bit on television or in a movie, but most of the time he lugged his suitcases around the world, going from Catskill resort to Caribbean cruise to children's birthday party, drinking water or smoking a cigarette while the dummy on his lap cracked wise or cute. Those cruise gigs were a grind. On Saturday mornings, the ship would dock on the West Side, Sylvia would hand Stan his mail, they'd have a quick cup of coffee, and then he'd be gone for another week. He diligently sent letters from his various ports of call, but he never signed his own name; it was always Bruce, or Cecil, or "the Kids." Sylvia could never forget Stan in his absence, even if she wanted to. Their Manhattan apartment was a veritable "vent" exhibit, with Charlie McCarthy memorabilia on display, rare ventriloquism books on the shelves, and movie and vaudeville posters adorning the walls: all material for the exhaustive history of ventriloquism that he would someday write. For 30 years Stan talked about his book project, so much so that others in the "vent" fold thought that one of his strings had snapped. "It almost became a joke," recalled Todd Stockman, a former professional ventriloquist who was a friend of Stan's. " `Oh, Stan Burns &#0151; still working on that book?' " He finished his manuscript, called "Other Voices: Ventriloquism from B.C. to TV," in 1996, but publishers said it wasn't for them. Then, when his health began to fail, Sylvia took charge. By the time she got 1,500 copies of the handsome coffee-table book published, at a personal cost of $50,000, Stan was four months dead. Still, what a tribute. Vents everywhere &#0151; from Paul Winchell and his dummy, Jerry Mahoney, to Jimmy Nelson and his puppet dog, Farfel &#0151; applauded Stan and Sylvia. WITH Stan dead, Sylvia was alone in an apartment awash in vent ephemera. This was Stan's stuff, after all; she had been a nurse. When no museum could promise a permanent exhibit, she slowly began to sell the items. Most of the wall art, from a movie poster for "Charlie McCarthy, Detective" to that advertisement for a long-gone French ventriloquist ("L'homme qui parle du ventre"), sold at auction. But there was still the matter of the kids. Bruce, the redhead, and Cecil, his small sidekick, went to relatives of Stan's. Dr. Lichi, who moved by remote control, and sexy Lulu &#0151; "she had a lot of husbands, none of whom were her own," Sylvia said, repeating Stan's old line &#0151; were sold to a collector in the Midwest. Uncle Sam, though, sits in a chair in the living room. And stored in the cluttered hall closet, next to cardboard boxes marked "vent stuff" and "various vent heads," is Susie, tucked safe in her case. "She's got dimples and blue eyes," Sylvia explained, and suddenly Stan's old Susie routine came to life, from the water that Susie used to pour into Stan's ear to the flowers that would sprout if the children said the magic word. "What's the magic word?" he'd ask; "Abracadabra," they'd shout. "No, that was last week's word," he'd say, and the kids would laugh and laugh. Sylvia plans to keep a few things, of course. How could she not? They were introduced many years ago at a dinner party given by mutual friends. One guest that night was a funny storyteller, and Stan and Sylvia laughed so hard that they grasped each other's hands under the table. After that, Sylvia became his living doll. "Stan was a good vent," said the ventriloquist's wife.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9872952699661256}", 'metadata': "{'Content-Length': '47265', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7LYOTYMBNTKJOSAZAH5NE2FDAXQ2AHJS', 'WARC-Concurrent-To': '<urn:uuid:e0c01fbc-3f60-49e0-acec-d8450b0adb90>', 'WARC-Date': datetime.datetime(2015, 3, 2, 12, 27, 16), 'WARC-IP-Address': '170.149.168.130', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:XRBJ4E5MRJKCMZ5QGVOFRSA3TI75NLNW', 'WARC-Record-ID': '<urn:uuid:1d8f7e72-c81d-48c2-8442-d0dd85b6f226>', 'WARC-Target-URI': 'http://www.nytimes.com/2003/10/01/nyregion/01ABOU.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ad067da6-b900-4c6c-b5e5-7315b6fd7889>', 'WARC-Truncated': None}", 'previous_word_count': '758', 'url': 'http://www.nytimes.com/2003/10/01/nyregion/01ABOU.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.26205146312713623', 'original_id': '482bb38888e29ec45758f1a36562a9fcef0aad43742c41364590de77db7ba282'}
The Nigerian Economy: Trials And Triumphs The point is often tossed about, that the Buhari Administration is frail on the economic front. Myth or reality, this perception is widespread. On the other hand, Buhari’s achievements in tackling corruption, and addressing the insurgency are acknowledged almost by acclamation. However, Buhari’s proponents insist that an economy, which for sixteen years had been undermined by the predatory waywardness of the previous administration, meant that Buhari inherited it, dead on arrival. The Jonathan years had clearly drained the life-blood from the Nigerian economy, leaving the incoming government with a public service challenge of spectacular proportions. Buhari’s own early slow-motion disposition, along with   his inclination to trawl for saints, may not have helped matters. Yet the challenge before him was dire and undeniable. It was a troubled economy in every sense. 70% of the population lived in poverty; economic growth stood at 5.5%, while foreign reserve declined to 31billion dollars. Even though loose money seemed to be showered like confetti upon a tiny indulgent elite, unemployment rose to 28% while the misery index, at 51%, announced to the world, that all was not well with the nation. Buhari’s emergence in the circumstance in 2015, was the response of providence to the private and public yearnings of millions of Nigerians. The demand for change and the optimism in the air were truly epic. In some sense therefore, Buhari, may himself have been destined to become the undeserved victim, of the people’s hysterical quest for a new dawn. Given this hysteria and given the nature of the problems Buhari inherited, it was always likely that they would be a lacuna. At the economic front, the Buhari government soon found its feet and was able to tackle some of the problems head-on. However, some of our people, led by a section of our elites, often made the point that the Buhari government had no economic team. This attitude was wrongheaded and mostly primed by needless cynicism. There was indeed an economic team headed by the Vice President. The other part of this cynicism flowed from a lack of proper acknowledgement of the professional fitness of Nigeria’s Finance Minister, Mrs Kemi ADEOSUN. In the early days, with her exceedingly young looks, she seemed to compare rather unfavorably with Mrs Ngozi Okonjo Iweala. Now, nearly three years down the line, the Nigerian economy is stirring back to vitality, and those who once jeered at its managers, now stand and applaud. They perhaps now remember that Kemi Adeosun has had a grooming in economics and before taking the Nigerian job, she had had a sterling career in international accounting entities. The implementation of the National Economic Recovery and Growth Plan ERGP has taken Nigeria out of her worst recession in 29 years. And this has been in spite of a downturn in oil prices. In a nation known for its miserly concessions to the capital subhead, the Buhari Government has disbursed 2 trillion naira to capital/ infrastructure projects, a record in the history of Nigeria’s public finance.  A number of other initiatives have been introduced, and have either raised public revenue or increased transparency in the conduct of public policy. These include the TSA, the implementation of the BVN and the signing into law of the Secured Transaction in Movable Assets Act 2017, t he Credit Reporting Act 2017  and the institutionalization of E-Governance which sets the foundation for the creation of a truly digital economy. The Buhari government has also assisted in bailing out out cash-strapped states, 27 in all. The anti graft fight is continuing and the old climate of promiscuous disbursement which fueled public theft belongs to yesterday. The Nigerian economy still faces many challenges. Unemployment is a growing danger and even though initiatives such as the Voluntary Asset Income Asset Declaration Schème VAIDS  attempt to raise revenue, new income streams will remain an abiding necessity. Poverty alleviation imposes enduring responsibilities on our government in relation to its citizens. The economy has been dragged out of recession. While we congratulate ourselves and the managers of our economy, it is helpful to remind everyone that it is not yet uhuru. Hands on the plough please! Related posts Leave a Reply
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.965930700302124}", 'metadata': "{'Content-Length': '93845', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:TOIKDNKTPGRS3TX623FBHP33VSUCYZE3', 'WARC-Concurrent-To': '<urn:uuid:6102df97-51d0-40f7-b785-ffb25e0318fb>', 'WARC-Date': datetime.datetime(2019, 5, 21, 9, 34, 1), 'WARC-IP-Address': '173.208.173.98', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:Y7KWPVFOLZK762YOQMXATGDN7MKKABQW', 'WARC-Record-ID': '<urn:uuid:bc402a07-463e-49c5-a199-9d3d4fffdaf5>', 'WARC-Target-URI': 'https://voiceoflibertyng.com/the-nigerian-economy-trials-and-triumphs/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2bcf9ead-8d81-4b62-b0dd-cb92fe4b94ba>', 'WARC-Truncated': None}", 'previous_word_count': '695', 'url': 'https://voiceoflibertyng.com/the-nigerian-economy-trials-and-triumphs/', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-146-226-231.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.027779102325439453', 'original_id': 'ed614649f0ce5852eeebca80630a240bd593d6aecf0af71b93fe01e6d9b8e617'}
Bacon-wrapped Cod with Creamed Spinach Bacon-wrapped Cod with Creamed Spinach Greenfield Bacon FEATURED | Greenfield Bacon Bacon-wrapped Cod with Creamed Spinach Serves 4 Total Time 35 min Total Time 35 min Bacon-wrapped Cod 1. 4 portions fresh cod (5 oz. each) 2. Sea salt 3. Freshly ground black pepper 4. 1 package Greenfield bacon 5. 1½ tbsp (22 ml) extra-virgin olive oil Creamed Spinach 1. 1 tbsp (15 ml) butter 2. 1 shallot, minced 3. 1 garlic clove, minced 4. 1 cup (250 ml) 35% cream 5. 3 cups (750 ml) baby spinach, washed 6. Pinch of nutmeg 7. Salt and pepper, to taste 2. Lightly season the cod all over with salt and pepper. Place the bacon on a cutting board and wrap two pieces of bacon around each piece of cod, securing the bacon with a skewer or toothpick. The cod should be completely covered with the bacon except for the corners. 3. In a heavy-bottomed ovenproof skillet, heat olive oil over medium heat. When the oil is hot, add the fish and brown it on all sides, about 4 minutes per side. Place the pan into the oven and cook for 6 to 8 minutes. Remove from heat. 4. Creamed Spinach: In a heavy-bottom pot on medium-low heat, add butter, shallots and garlic and cook for 2 minutes. Add the cream, and cook for 5 minutes or until it has reduced by half. Add the spinach and stir. Cook for 3-5 minutes or until wilted. Season with nutmeg, salt and pepper. 5. Serve with bacon-wrapped cod. Greenfield Natural Meat Co. Related Recipes © 2017-2018 Maple Leaf Foods Inc. All Rights Reserved.  •  Contact Us  •  Privacy Policy  •  Terms of Use
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.801645040512085}", 'metadata': "{'Content-Length': '71589', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:C6URO67ENTVM4JI62VNCBPZFVFCMLJZ2', 'WARC-Concurrent-To': '<urn:uuid:1852b968-c772-4586-8f5d-d02d0b9935a0>', 'WARC-Date': datetime.datetime(2020, 1, 18, 3, 41, 14), 'WARC-IP-Address': '192.124.249.53', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:HMMSXF7EQROSN4QANOBWPL3IOMHCBEZ2', 'WARC-Record-ID': '<urn:uuid:7d30e9fc-a9bc-4d0e-a0b3-fb7396c4046f>', 'WARC-Target-URI': 'https://greenfieldmeat.com/recipes/bacon-wrapped-cod-with-creamed-spinach/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6cd7b348-2a88-4762-84ad-798bd43e31af>', 'WARC-Truncated': None}", 'previous_word_count': '278', 'url': 'https://greenfieldmeat.com/recipes/bacon-wrapped-cod-with-creamed-spinach/', 'warcinfo': 'isPartOf: CC-MAIN-2020-05\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-30.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.10534542798995972', 'original_id': 'd12b346b9f1d022b0ed827a8fe345e7e83369bac8ceefec539183b185175680b'}
Article body copy A common virus that plagues Atlantic salmon in fish farms around the world also causes disease in farmed Pacific chinook salmon, a new finding that reignites the debate about infectious disease migrating from farmed fish to wild fish. For the past decade, one strain of Piscine orthoreovirus, PRV-1, has infected farmed Atlantic salmon on Canada’s West Coast at high levels—around 70 percent of the fish at most farms. Last year, scientists definitively linked PRV-1 to heart and skeletal muscle inflammation (HSMI) in the farmed fish. The disease causes inflammation that affects the fish’s ability to swim and feed. Kristi Miller-Saunders, a molecular biologist with Fisheries and Oceans Canada, has now found that PRV-1 also infects farmed chinook, though it causes different symptoms. Miller-Saunders knew that a different strain of Piscine orthoreovirus, PRV-2, causes a disease in farmed Japanese coho salmon that appears much the same as the jaundice and anemia that afflicts farmed chinook salmon in British Columbia. That gave her the idea that PRV may be responsible for the chinook’s disease as well. So, she and her colleagues used a sensitive molecular test that they had recently developed, along with thorough microscopic analysis, to track the spread of the virus in chinook tissue at every stage of the disease’s development. “We were able to … show the intimate relationship with PRV in chinook,” Miller-Saunders says. But when Miller-Saunders and her team sequenced the genes of the virus that was making the chinook sick, they found something unexpected—it was PRV-1. Chinook and Atlantic salmon, when infected with the same strain of the virus, get different diseases. That’s not unheard of, says Frederick Kibenge, an aquaculture virologist at the University of Prince Edward Island. “If one host is more used to the virus, it might respond differently,” he says. That’s what Miller-Saunders thinks is happening—the chinook’s reaction to PRV-1 is extreme because the virus is new to the fish. “It could be that Atlantic salmon are the normal host, so the virus is more tolerated,” she says. “They have coevolved to coexist.” As she tracked the disease’s progression in chinook and Atlantic salmon, she saw important differences. In both species, the virus first infects the red blood cells, where it replicates. Fish are symptom free until the viral load grows so high that the fish react—and this is when the effects diverge. In Atlantic salmon, PRV-1 trickles out of the red blood cells and infects the heart and muscles, causing inflammation. In chinook salmon, the blood cells burst, releasing the virus as well as the cells’ hemoglobin, which is toxic to the liver and kidneys. In aquaculture, both HSMI in Atlantic salmon and jaundice and anemia in chinook are chronic infections that cause few deaths. Since farmed fish have time and space to recover, PRV is mainly an economic nuisance, causing the fish to grow more slowly. But in wild fish, even mild infections can be harmful, says Kibenge. “They have to forage for food, avoid predators, and migrate to spawn. Physical activities demand physical health,” he says. Chronically diseased farmed Atlantic salmon could be a major source of infection for the wild fish that pass by, Miller-Saunders says. If a chronic infection slows down wild fish, they can be left behind by their school and become easy prey. “They are dead fish swimming as soon as they are physically compromised,” she says. Miller-Saunders and her team’s next goal is to determine how often that kind of transmission might occur. But it’s difficult to spot the disease in wild fish because those that are infected will likely die and be eaten before they can be studied. Now, however, the team’s new molecular test can identify PRV-1 even in healthy wild fish before symptoms surface. “Now we know what to look for in wild fish,” she says.
mini_pile
{'original_id': '9fbf00a98689dc829cf002ab78bdae683b8dfc194e9ce3eb96e479627b93ffca'}
Trachoma (truh-KOH-muh) is a bacterial infection that affects your eyes. The bacterium that causes trachoma spreads through direct contact with the eyes, eyelids, and nose or throat secretions of infected people. Trachoma is very contagious and almost always affects both eyes. Signs and symptoms of trachoma begin with mild itching and irritation of your eyes and eyelids and lead to blurred vision and eye pain. Untreated trachoma can lead to blindness. Trachoma is the leading preventable cause of blindness worldwide. The World Health Organization (WHO) estimates that 8 million people worldwide have been visually impaired by trachoma. WHO estimates more than 84 million people need treatment for trachoma, primarily in poor areas of developing countries. In some of the poorest countries in Africa, prevalence among children can reach 40 percent. If trachoma is treated early, it often may prevent further trachoma complications. Oct. 03, 2012
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9299689531326294}", 'metadata': "{'Content-Length': '40638', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:B53MCXX4WPKKVTVJWZQVBBKE4AWRACOZ', 'WARC-Concurrent-To': '<urn:uuid:94720710-eec7-4874-ae33-9f3450b9b708>', 'WARC-Date': datetime.datetime(2014, 3, 11, 22, 6, 59), 'WARC-IP-Address': '129.176.217.220', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:GTLM4JEL5XL2YYTBRC4Y3VIQI2BKAFZP', 'WARC-Record-ID': '<urn:uuid:cfe050b4-185e-4e4a-b406-64d85dfd21c6>', 'WARC-Target-URI': 'http://www.mayoclinic.org/diseases-conditions/trachoma/basics/definition/con-20025935', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:75205a73-085f-46f1-8469-5fe59ddb2ed2>', 'WARC-Truncated': None}", 'previous_word_count': '143', 'url': 'http://www.mayoclinic.org/diseases-conditions/trachoma/basics/definition/con-20025935', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02389991283416748', 'original_id': '1260bfd677ffaf6e05998114f19386a533a60d25f5b78a50b302d9dbbe7913ec'}
Tired Of Replacing Cracked Rain Gauges? If you are fed up with your rain gauge becoming unreadable or breaking in a matter of months, read this! The reason many rain gauges crack and break or become unreadable is because of the material they are made out of. Plastic rain gauges come in many grades quality of plastic, and the main reason a rain gauge may be cheap is because of the quality of the materials used. So if you are wanting a rain gauge that lasts the distance, won't go yellow or crack in the sun or frost conditions you need to be paying attention to the quality of materials used in the product. Polystyrene plastics are more commonly associated with the cheaper end of the rain gauge range. The plastic is easy to use and print on, however it is brittle. At the other end of the plastic spectrum you have Polycarbonate plastic rain gauges. With more expensive material costs and to manufacture, they have the unrivalled advantage of being tough and durable in extreme climatic conditions. In harsh sunlight this plastic rain gauge does not yellow or go cloudy, so it remains easy to read and manage. Able to withstand frost conditions, however it may crack with snow freezing in it. Rain gauges manufactured from this type of plastic are usually chosen by weather bureaus and commercial enterprise because of it's durability. For the very serious weather watcher metal rain gauges and automatic tipping bucket rain gauges could be appropriate. These definetely fall into the very pricey category! For the backyard gardener or keen weather watcher the polystyrene or polycarbonate manual rain gauges are popular choices. If you are a gadget freak, then a electronic rain gauge or weather station may be a perfect fit.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9250539541244508}", 'metadata': "{'Content-Length': '47653', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:IG6UXNGMWSSYOTNNVNUQPDVSSGTY2RWZ', 'WARC-Concurrent-To': '<urn:uuid:1581d987-1b5f-489b-b1db-e4f930fb7a78>', 'WARC-Date': datetime.datetime(2021, 2, 27, 6, 39, 27), 'WARC-IP-Address': '74.124.210.251', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OEU7Q5OLJG67JAX2IDHE23HPYHNM74GQ', 'WARC-Record-ID': '<urn:uuid:e3dfcbf7-57ac-4de9-91d8-f47fd27c9961>', 'WARC-Target-URI': 'https://outbackblue.com/tag/buy-rain-gauge/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:212eac30-62d2-4dd7-9d10-868dd5235877>', 'WARC-Truncated': None}", 'previous_word_count': '298', 'url': 'https://outbackblue.com/tag/buy-rain-gauge/', 'warcinfo': 'isPartOf: CC-MAIN-2021-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February/March 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-210.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.11464130878448486', 'original_id': '8ec68594626da32b1aa4cc5891c900822f4ca0654def275069470651e099dd52'}
Electronic Seismologist logo March/April 2004 Thomas J. Owens E-mail: owens@sc.edu Department of Geological Sciences University of South Carolina Columbia, SC 29208 Phone: +1-803-777-4530 Fax: +1-803-777-0906 Practical Problem-solving in Seismology This column concludes the second year of the Second ES's tenure as seismology's gatekeeper for all that is going on in "information technology." The Original ES set a high standard in this role, so a little analysis of his successor seems appropriate. What was the most common topic for the ES in the last two years? Nothing! Yup, there was no ES column for five of the last twelve SRL issues. Oops. Definitely need to work on that. OK, when the ES did manage to show up for work, what were the topics? Well, four of the discussions were on the future of IT in seismology, and only three (counting this one) were on practical topics. In other words, only 25% of the available ES columns dealt with something that actually works now! That seems a little light on the practical stuff. One thing the ES has learned over the last couple of years is that writing about the future is fun. The ES likes doing it, other people like doing it, and a lot out there on the horizon is exciting to think about. Plus, readers compliment the ES on these articles! Getting people to write about stuff that actually works has been harder than expected. The thing about practical topics is that readers complain a lot more when those are published. The Original ES never let on that there could be disgruntled readers! Groupies, yes, thousands of groupies. But it never occurred to this ES that the job involved hate mail! OK, "hate mail" may be a bit melodramatic. Mostly, caring readers clearly and firmly inform the ES that their favorite, similar, application or approach was not represented in the column. If one seismologist writes an ES column, then a half-dozen complain to the ES that better things are out there and why was the ES so biased (or grossly uninformed) that good stuff was left out. Assuming roughly 10% of the population who think something is missing are irritated enough at the ES to write, that means there are several dozen seismologists working on most problems! That's a lot of potential ES contributors who are suffering in silence. Given that there is room to double the number of ES columns published over the last two years, the ES encourages his loyal reader base to lift their pens and tell the ES (in fact, The World) what you are doing. Just remember, the ES doesn't know everything that is going on or everybody who is doing something interesting! Ouch. Enough whining ... it's time to present ES readers with an interesting article about a practical problem. Integration of GIS concepts and tools into solving seismological problems (rather than just displaying data) is a hot topic and one that a number of groups are working on. Uh-oh ... a practical problem that lots of people are working on ... the ES will now duck! Actually, this is good stuff and the ES thanks the authors for making the effort to write up their project to share with the community. The ES looks forward to more contributions on solutions to practical problems. Seriously. SAFE-Tools: A Web-based Application for Identification of Active Faults B. Moreno1,2, K. Atakan1, K. A. Furulokken1, S. Temel3, and O. J. Berland1 1. Department of Earth Science, University of Bergen. Allegt. 41, 5007 Bergen, Norway; atakan@geo.uib.no 2. Centro Nacional de Investigaciones Sismológicas, Calle 17 No. 61 e/ 4 y 6 Vista Alegre, Santiago de Cuba, Cuba 3. Bea Systems, Inc., 140 Allen Road, Liberty Corner, NJ 07938 Recognition of active faults, particularly in low-seismicity regions such as Western Europe, has been a challenging task for Earth scientists for many years. These regions are generally characterized by low hazard but high risk due to the concentration of population and structures with high vulnerability. Detection of tectonic deformation that may lead to destructive earthquakes in such areas requires innovative research strategies appropriate to the climate, slow deformation rates, and heavy human modification. The variety and amount of information involved in the characterization of slowly deforming faults, which we call slow active faults, are in general distributed between different research institutions and can be difficult to access. This information, which includes earthquake data, paleoseismic trenches, geophysical cross-sections, etc., should be gathered, parameterized, and stored in a way that makes it more accessible for use in seismic hazard studies. Within the framework of the European project SAFE (Slow Active Faults in Europe), software (SAFE-T) for identifying slow active faults is being developed. The system is a Web-based application with data visualization and user interaction through the Internet. The information relevant to fault identification by nature consists of geospatial data with several parameters or properties attached. Geographical information systems (GIS) are commonly used for the management and visualization of spatially referenced data. Commercially available GIS software is usually expensive, operating mainly as stand-alone (client-side) applications. An effort to integrate GIS into client-server architecture is being carried out by the Open GIS Consortium (http://www.opengis.org/index.htm). This consortium is an association of companies, government agencies, and universities that are developing open-interface, standard protocols and specifications to make geospatial data accessible to the public. For example, Web Map Service is one of the well established achievements of the Open GIS Consortium. CubeServ, Cadcorp SIS, and DEMIS (URL references in Table 1) are examples of server interfaces based on this technology. URL References of Web Map Servers and Interactive Map Tools CubeServhttp://www.cubewerx.com/World Web map server Cadcorp SIShttp://www.cadcorp.com/World Web map server DEMIShttp://www.demis.nl/DEMIS_UK/World Web map server FAUSThttp://www.ingv.it/~roma/banche/catalogo_europeo/Database of potential sources for earthquakes larger than M 5.5 in Europe Faults of Southern Californiahttp://www.scecdc.scec.org/faultmap.htmlFaults of Southern California Geodehttp://dss1.er.usgs.gov/Geo-data Explorer (USGS) IMAhttp://atlas.geo.cornell.edu/ima.htmlInteractive mapping and data analysis J.V. Voyagerhttp://jules.unavco.ucar.edu/VoyagerJr/EarthJules Verne Voyager, Jr. Interactive map tool NASA Web Map Viewerhttp://viewer.digitalearth.gov/Interactive map tool Several Internet-based applications have been developed using Web Map Service interfaces, for example, NASA Web Map Viewer, Geode, and IMA (Table 1). Maps are dynamically generated on the server side and transmitted as images to the client. Other Web-based tools (e.g., Faults of Southern California, J. V. Voyager, FAUST) use static map images that have been created in advance and stored on the server side. In SAFE-T we use the facilities of the Web Map Service interface to generate maps dynamically with background information and then plot our geospatial data on them. The data consist of geological and geomorphic maps; paleoseismological, historical, or instrumental earthquake data; geophysical anomalies; faults; etc., which have been interpreted, parameterized, and stored in a relational database. In this paper we focus on a description of the database structure and the graphical user interface (GUI) implementation. In addition, some technical aspects of the system are presented. Since we use some technical terminology that may be unfamiliar to readers, a list of technical terms with a brief explanation is included in the glossary. Basic Design SAFE-T is based on a client-server architecture, with data communication and visualization occurring through the Web (Figure 1A). The processing module on the server side interacts with a relational database, while clients access the server through the Internet. A distinctive feature of the system in comparison to existing GIS software, which stores raw data (e.g., grid data such as a digital elevation model), is that the database contains mainly interpreted data. On the client side, as part of the GUI, three interfaces are operating: editing, query, and visualization. The editing interface allows data entry and maintenance of the database. The query interface gives the user the possibility to request data and launch the processing. The visualization interface displays requested data and processing results. The relevant data may be distributed in several database servers, which are connected on the Internet (Figure 1B). Once the user (client) connects to the SAFE-T system, he has access to several databases located at different institutions. To ensure portability, by which we mean a system independent of different computer platforms, the Java programming language was used for developing the system. Figure 1 Figure 1. Basic design of the SAFE-Tools. (A) Client-server architecture. (B) Communication between database servers. Application Architecture The application architecture is based on a three-tier architecture (Birnam, 2001; Mukhar et al., 2001). The application is divided into three layers: the presentation, which is the graphical user interface (GUI); the processing logic; and the database (Figure 2A). These three layers may be seen as the view, the controller, and the model. The view (GUI) has access to the model (database) only through the controller (processing logic). This model-view-controller framework makes the application flexible in terms of extensibility and reusability, which means that additional functionality can easily be added to the application and the processing logic can be generalized and reused in other applications. Figure 2 Figure 2. (A) Model-view-controller framework. The view (GUI) has access to the model (database) only through the controller (processing logic). (B) Interaction between components. On the client side the GUI, which comprises HTML forms and a Java applet, is interacting with the server through a servlet or Java server page (JSP). Normally, to deploy the system components involved in the model-view-controller framework, additional applications are needed, which we call here "Containers" (Figure 2A). For example, the relational database management system (RDBMS) provides the basic functions to access the database. An application server is needed to deploy the EJB/JSP/Servlet (Hall, 2002; Monson-Haefel, 2002) on the server side, and on the client side a browser is needed to show the HTML documents (Powell, 2000). SAFE-T uses MySQL (http://www.mysql.com/) as a RDBMS and WebLogic (Girdley et al., 2002) as an application server. Figure 2B shows the communication framework between components. On the client side the GUI, which comprises HTML forms and a Java applet, interacts with the server through a servlet or Java server page (JSP) (see Glossary). The servlet receives the information through the Enterprise Java Beans (EJB) (see Glossary), which map the database and send it back to the GUI either as an HTML document or directly to the Java applet. The Database Relational Database: Basic Concepts The first step in designing a relational database (RDB) is the classification of the information to be stored. The information is classified as different types of entities or objects according to the processing logic and the nature of the data. Each entity has a set of attributes or properties that describe its nature. Classes of entities are collected in a table where each column is associated with one of the attributes. A relational database is a set of tables connected to each other by logical relationships. The relationship between tables can be one-to-one, when one row of a table is related with one row of another table; one-to-many, when one row of a table is related with many rows of another table; and many-to-many. Preservation of the data integrity is a basic guiding principle during the database design process. The attributes of the entities have to be organized in a way such that each piece of data is stored once and in the correct place. To design entities with data integrity a technique known as a normalization process is used. This technique consists of applying several rules to the tables to make sure that there is no redundancy of information or failure in their logical relationships. In general, the data normalization can be summarized in three basic steps (Mukhar et al., 2001): eliminating redundant attributes and/or redundant rows, removing derived data, and making certain that each table represents only one single logical entity. RDB Tables In SAFE-T, broad types of information have to be considered for diagnosing slow active faults. Such information can be categorized into six main groups: seismological, paleoseismic, geophysical, geological, geochemical, and geomorphic. These data are stored in tables with appropriate logical relationships (Figure 3). Four main tables are identified: earthquakes, maps, faults, and cross-sections. These tables are considered as "parent" tables with a set of subtables describing particular cases within the corresponding type of data. The data are geographically referenced either as points (e.g., earthquakes), polylines (e.g., fault segments), lines (e.g., cross-sections), or polygons (e.g., fault zones, geological units). Maps are stored as individual images and cannot be used by the processing module. The components of the maps can be parameterized and stored in the RDB to be used in a meaningful way, however. For example, in the case of "map of stress field", we stored in the database the region (polygon) in which the stress field is applicable and the corresponding parameters describing the principal stresses. FIgure 3 Figure 3. Information included in the database. It is categorized into six main groups: seismologic, paleoseismic, geophysical, geological, geochemical, and geomorphic. Some types of information, such as geophysical anomalies and geological units, are represented both on the surface as a map and in vertical projections (cross-sections). For example, maps of geophysical anomalies or geological units are parameterized as a set of polygons enclosing the area corresponding to the extent of the anomaly or geological unit. On the other hand, cross-sections are geographically referenced as lines and the associated anomalies have relative locations (distance and depth) to the first point of the coordinates of the cross-section. In either case, each anomaly or geological unit represents a row in the table. Four examples of the data parameterization (tables) are listed below. Two examples, MAP and CROSS-SECTION, are parent tables, whereas the other two are daughter tables (see examples below), which include the specified information. The description of the complete list of tables used in the system can be found at http://www.geo.uib.no/seismo/safe-t/tables.html. MAP (parent table for grouping different types of maps) MapGeophyAnomaly (map of geophysical anomaly) CROSS-SECTION (parent table for grouping different types of cross-sections) CrossGeophyAnomaly (cross-section of geophysical anomaly) In addition, all of the tables include three more properties: the user who entered the information, an access level, and a time stamp. These properties are designed for internal use. Open Geosciences Data Retrieval One of the objectives of SAFE-T design is to create data formats and protocols that allow interoperability between Web-based applications that retrieve geosciences data. Toward this end, we are developing server-side applications (URL-based commands) to retrieve different types of data (objects) through the Internet. These objects can be used for other Web-based applications by calling a URL address (a server-side application) followed by several input variables. The information should be retrieved in a well defined structured format. The Extensible Markup Language (XML) (Laurent and Cerami, 1999; White et al., 2001) provides a sophisticated text format that is easily read and manipulated by both people and computers. For example, to get a list of earthquakes located in a specific region within a given magnitude range, the following URL-based command could be called: where "getEarthquakes" is a servlet (see Glossary) that can receive different variables such as the bounding box of the area selected (bbox=minLong,minLat,maxLong,maxLat). The command will return a list of earthquakes in XML format. For example: Here, we propose specifications and data formats that could become the standard way to exchange geosciences-related data associated with active faulting and earthquakes through the Internet. Examples of XML files for different types of information used in the system can be seen at http://www.geo.uib.no/seismo/safe-t/XMLfiles.html. The Graphical User Interface The graphical user interface consists of HTML forms and a "Navigation Map" which is a Java applet (Figure 4). HTML forms are used for the main layout of the system and specific functions such as adding new objects into the database, removing and visualizing parametric information of a particular object, launching the "Diagnostics Wizard" (see "Processing Module" section), etc. Only an authorized user can add and remove objects from the database. The identification of users is achieved through a login and password using a secure Internet connection. The database can also be populated with XML files containing one or several objects. In this sense, authorized users submit XML files to the server side. The server-side application validates the information and indicates to the user whether the transaction succeeded or not. FIgure 4 Figure 4. Main layout of the system is based on an HTML document, which has the "Navigation Map" (Java applet) embedded. HTML forms are used for specific functions such as adding new objects into the database, removing and visualizing parametric information of a particular object, etc. The Navigation Map allows the user to select an area on the map by a zoom-in/zoom-out action, choose type of objects to be plotted in the selected area, pick a particular object to see detailed information about, and filter the data by different properties. Earthquakes from the International Seismological Centre (ISC) are shown as an example (M > 5.5 for the period 1964-1999). The Navigation Map (Figure 5) allows the user to perform four main functions: select an area on the map by a zoom-in/zoom-out action, choose type of objects to be plotted in the selected area, pick a particular object to see detailed information about it, and filter the data by different properties. The objects plotted on the map are also shown in a list (Figure 6). There is a direct link between the list and the map. Picking an object in the map will highlight the corresponding item in the list and vice versa. The background maps in which objects are plotted are transmitted as images to the client side. The user has the choice to select several background maps, which are generated by different Web map servers over the Internet. Most of these Web map servers belong to the Open GIS Consortium, which dynamically generate images with different layers of information (e.g., country boundaries, topography, etc.). In this case there is no limit for zooming, and the quality of the map depends on the resolution of the raw data stored. FIgure 5 Figure 5. Examples of some object types are shown on the map. Red dots represent earthquake epicenters from the ISC database (M > 5.5 for the period 1964-1999). Objects with beachball symbols indicate focal mechanisms based on various data sources (e.g., national observatories, CMT-Harvard solutions, etc.). FIgure 6 Figure 6. The data are visualized through four categories of symbols, which are geographically referenced either as points (e.g., earthquakes), lines (e.g., cross-sections), polylines (e.g., fault segments), or polygons (e.g., fault zones, maps, etc.). Red rectangles are the identified fault zones, whereas black rectangles correspond to objects of various types of maps. Similarly, red lines are fault segments, whereas black lines indicate locations of objects with various types of cross-sections. Processing Module The criteria for diagnosing slow active faults are being defined by a multidisciplinary group of scientists (Sebrier and Siame, 2001). In the first version of the system we implemented a "Diagnostics Wizard", or a quiz, to highlight the most important factors involved in the identification of slow active faults. Through the Diagnostics Wizard the users follow a logical sequence of questions. The main objective is to search for evidence or types of information relevant to deciding if the fault is active or not. This process is performed at regional, local, and site scales considering space, time, and dynamic properties of the data. At the end of the quiz the user receives an indication of whether the fault is active or not. The present implementation of the Diagnostics Wizard is an interactive tool aimed at assisting the scientist in evaluating the relevant data for identifying active faults. The user is guided through a set of questions which systematically search for diagnostic criteria in the existing data. In order to assess the reliability and the importance of the information, a multistep weighting procedure is applied. In future implementations the diagnostic criteria will be automatically applied to the data stored in the database. The algorithm for automatic processing is similar to the Diagnostics Wizard. The only difference is that the evidence used to decide if the fault is active is obtained directly from the database. Concluding Remarks We have presented a software tool for recognizing active faults, designed especially for slowly deforming areas such as Europe. This effort is the first attempt to classify and gather a wide range of geospatial data for the European area into a distributed relational database which can be accessed directly by a Web-based application. Furthermore, we have investigated the possibility of implementing a processing module that will help seismologists and earthquake geologists identify active faults in a given area. The flexible design of the system and the large variety of information considered in the database structure provide the opportunity to add other types of processing modules associated with active faulting and earthquakes, such as seismic hazard analysis, orientation of regional principal stress, etc. The use of distributed database technology reduces the amount of work required to maintain a large database, which can be a problem for a single institution. With the development of information technologies, Web-based applications can also easily be moved to other communication devices such as mobile phones, increasing both the usability and public interest. How to Use the System The system can be accessed at the Web site http://www.safe-tools.net/ at the Department of Earth Science, University of Bergen. This work was conducted within the framework of the project "Slow Active Faults in Europe" SAFE (EVG1-CT-2000-00023), supported by the European Commission Research Directorate General. A number of people from the SAFE-Project team have contributed to the development of the concepts used in this study. We thank BEA Systems, Inc., which provided the WebLogic server software used in this Web-based application. Trond Karl Pettersen and Hector Manera helped with the HTML files and the help functions. We thank Jens Havskov and Susan Hough for their comments and suggestions, which improved the overall quality of the manuscript. Application Server: Software for deploying Java components of the Web application on the server side, which includes EJB, JSP, servlet, etc. Class: Type of data with properties and methods/operators. Enterprise Java Beans (EJB): Network-aware Java classes mapping the database. They provide services (session beans) and hold information (entity beans). Entity/Object: Instance of the class. Extensible Markup Language (XML): Document holding information in text format (i.e., data from the database). Standard way to exchange structured textual data between computer programs. Java Applet: Java program running in an Internet browser. The applet, which is stored on the server side, is downloaded and executed on the client side when the HTML document is downloaded. Java Server Page (JSP): HyperText Markup Language (HTML) document embedding Java code, which is running on the server side. Relational Database: Set of tables related each to other where one row represents an entity and the columns are the properties. Relational Database Management System (RDMS): Software providing basic functions to access a relational database. Servlet: Java program running on the server side and interacting with the client. Birnam, S. (2001). Distributed Java Platform Database Development, Java Series, Sun Microsystems Press. Girdley, M., R. Woollen, and S. L. Emerson (2002). J2EE Applications and BEA WebLogic Server, USA: Prentice Hall PTR. Hall, M. (2002). More Servlets and JavaServer Pages, Java(TM) 2 Platform, Enterprise Edition Series, Sun Microsystems Press. Monson-Haefel, R. (2002). Enterprise JavaBeans(TM), Second Edition, O'Reilly & Associates, Inc. Mukhar, K., D. Shanes, J. De Carli, T. Lauinger, R. Phillips, J. Carnell, M. Mamone, J. Peach, S. Youness, N. Nanda, and D. Payne (2001). Beginning Java Databases, Wrox Press. Powell, T. A. (2000). HTML: The Complete Reference, Third Edition, Osborne McGraw-Hill. Sebrier, M. and L. Siame (2001). Criteria for Characterizing Slow Active Faults and Standardization of Paleoseismological Analyses: Determination of a Basic Set of Diagnostic Criteria, SAFE-Project Internal Report Deliverable.9.1, CNRS, Paris VI, France, 18 pp. St. Laurent, S. and E. Cerami (1999). Building XML Applications, McGraw-Hill. White, C., L. Quin, and L. Burman (2001). Mastering XML(TM), Premium Edition, Sybex. Posted: 23 July 2005
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '75', 'language_id_whole_page_fasttext': "{'en': 0.8733105063438416}", 'metadata': "{'Content-Length': '35233', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QNOINOHHFBJ4JGCTYFIAMDNIRJEQLNYJ', 'WARC-Concurrent-To': '<urn:uuid:33594be5-a2cf-40a8-903c-e7f401e251b7>', 'WARC-Date': datetime.datetime(2015, 3, 1, 6, 51, 59), 'WARC-IP-Address': '208.184.217.146', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:N5E4FWHRHVK62XAOLC23YCJIF4ABFD7K', 'WARC-Record-ID': '<urn:uuid:7deb0103-2b4b-4faf-95df-074aaea3e420>', 'WARC-Target-URI': 'http://www.seismosoc.org/publications/SRL/SRL_75/srl_75-2_es.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3c9fd5ef-38eb-4eee-bf2e-001bc8e966df>', 'WARC-Truncated': None}", 'previous_word_count': '3881', 'url': 'http://www.seismosoc.org/publications/SRL/SRL_75/srl_75-2_es.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.032059550285339355', 'original_id': 'c013b5f82ba8a9fcc9cfc6adc5faff74b6541eeecca7cc0da2b9da1a6f465094'}
A note on fatness. I made the mistake today of watching a really awful video that was essentially this person rambling on about how terrible fat people are. I don’t know why I kept watching it after realizing seconds into it that it was really just several minutes of this person telling me I’m a sorry existence for a human because I am fat but I did. In the video (which I’m not going to link to or even attempt to find ever again), the person essentially ranted about their deep seeded hatred for fat people and the body positivity movement (which by the way, isn’t just for fat people but not the point right now). This video honestly reminded me of so many of the people that are in my life and of all the terrible things I think about myself on a regular basis. It made me feel ill and reminded me of the obsessive nature of my weight loss goals from a few months ago. The nature where I couldn’t stop obsessing, the one that led me to occasionally throw up after eating and could barely function outside of doing anything that didn’t help me to lose weight. My desire to lose weight over the past year has seemed to be more toxic than the fat I have around my stomach and thighs. I was obsessive and destructive and not healthy in anyway.  I was lucky enough to realize all on my own the destructive tendency that had been concealed as a desire to be healthy and stopped. But right now I want to acknowledge the fact the prevalent and toxic nature of assuming you know what’s best for someone else. This is to all those out there that think you know what’s best for me because you’re thin and I’m not and to all those that think you get a say in a stranger’s life: Fuck. You. Just straight up fuck you to the moon and back. Also, why are you so obsessed with me? But in case you’re not won over by just that, let’s look into some things. Did you know that the BMI scale isn’t that great (and apparently total bogus)? Time, NPR, and FoxNews (weird) all have articles about how the BMI scale isn’t that great and isn’t an accurate indicator of health. This Is Thin Privilege and others wrote about the beginning of the BMI scale, the history behind it, and about how the person who started it had a low sample rate in one specific location in a Tumblr post (which has sources attached). ALSO let’s talk about fat shaming and size discrimination. It’s not just the fashion industry or that fat people have trouble finding clothes because there are so many other things about society that shames people about their size. Did you know that weight is a factor in grad school admissions? Or that there’s an increased likelihood of conviction, a lack of medical services and legal rights, among other things? There are so many myths and assumptions about fat people and just fatness in general. Some take downs include: It is possible to exercise while fat and do it for plenty of different reasons other than weight loss. I walk because I like it and it makes me feel better. And there was a point in my life where I was doing cross country, soccer, and horseback riding all within a span of several months but I was still considered fat. People don’t have to exercise to lose weight or change their shape nor do they have to fit into the societal definitions of what fit people should be like. I wrote a poem several months ago about how I felt regarding a family member’s comments about my then weight loss. Looking at my life and how I feel and how I take care of myself, it just seems so apparent to me that it’s more likely that I’ll die from other reasons not related to my fatness. Someone’s inherent worth should not be determined by a stranger’s standards. Fat people do not exist so you can tell them how to lose weight, that they should lose weight. We exist for ourselves, not for your misplaced and unnecessary concern.
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.971815824508667}", 'metadata': "{'Content-Length': '89908', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:35TD2MQ6YO63NIXFOCSZ6RYPP5CG5YG4', 'WARC-Concurrent-To': '<urn:uuid:64977d30-6306-4675-9637-b0e026e8e217>', 'WARC-Date': datetime.datetime(2020, 3, 30, 5, 1, 49), 'WARC-IP-Address': '192.0.78.24', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:IUDCQYV7M4F4ZWMKY4U35FV4E7TX2BUE', 'WARC-Record-ID': '<urn:uuid:5c4aa134-397d-4823-a9e9-746a92af1276>', 'WARC-Target-URI': 'https://contagiousqueer.com/2015/09/06/a-note-on-fatness/?shared=email&msg=fail', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3225fec2-d61e-4d1d-ac54-ce0bb94b7bde>', 'WARC-Truncated': None}", 'previous_word_count': '703', 'url': 'https://contagiousqueer.com/2015/09/06/a-note-on-fatness/?shared=email&msg=fail', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-150.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.027338862419128418', 'original_id': '086f19292db90bbbd0d0582e8dce54837d23aa290306342a57603048c8ec3348'}
Open main menu Development Cooperation Handbook/The video resources linked to this handbook/The Documentary Story/The real project challenges < Development Cooperation Handbook‎ | The video resources linked to this handbook‎ | The Documentary Story The real project challenges Besides finding an innovative approach of talking of cooperation and aids, the other challenge was the audience "size". Since the Millennium Development Goals are a global effort, our target was to reach a global audience. This immediately created a big "size" problem, which however could be easily tackled by using a internet based system of communication. We used the Internet not merely as a big broadcaster and distributor, but also as a platform where written and audiovisual media could integrate and reinforce each other. We used extensively the Internet for getting feedback on the ongoing production. From the comment we received we understood better our target audience, which was not the general public, but the communication professionals and the teachers interested to know more about the MDGs. In our intention these communication professionals and teachers, who were our direct target, would have eventually spoken about the MDGs to their own specific public. Which was our final but indirect target. If were directly trying to talk of the MDGs to the public, we, who received a public grant to talk about them, would have been less credible ("They say what they have been paid to say"). But if the media professionals and teachers talk about the MDGs, then their communication would have been much more authoritative and effective. So, technologically speaking, the "global audience" is reachable with Internet and physical distance was no longer a barrier. But the global audience does not have uniform expectations, on the contrary pre-conceptions and stereotypes are diverse and often reciprocally exclusives. So how to the cultural barriers? What can we say that equally appeals to the different stakeholders? In order to answer to that problem we changed the question and we asked "is there a basic issue that is equally challenging in all the different cultural contexts? We thought that there was one: how can we built a healthy communication and cooperation climate amongst different nations and different cultures? Gradually, following this thread, we went to ask what are the issues at stake in intercultural dialogue. And what are the difficulties of framing common goals in the international development agenda. This seemed to us an inspiring tread to follow, as it was leading us to a different communication ground, where pleasing the audience by conforming to its pre-conceived expectations was not the priority. We were instead proceeding into territories for which there were no existing maps, no prepared customer expectations surveys. We were moving in the unknown and then we were asking the audience to come on board for an unknown destination. We of course did not know if such an approach would have worked. But surely we were well in line with Vincenzo's instructions of not repeating the rhetorical mistakes of the past. To me it was clear that, in order to avoid the rhetorical swamp, we needed to cast aside any effort to "convince" and take up the challenge of "sharing". I knew that this approach potentially had many wider implications and was taking us right into the big issues of philosophy and the general failure of contemporary communication science to conceptualize the difference between rhetoric and dialectics. I wanted to touch the philosophical nots in our documentary, and bring in it some learning from the old master of aesthetics (like Croce, Leonardo, Abhinavagupta, Bhartṛhari, etc). But I did not want that what to load the video product with academic discussions that the public would have found too "abstract". I wanted to remain grounded upon a practical problem: why there has been a global failure in communicating the global program of the MDGs? That would have taken us to the hearth of ethics and aesthetics. Why is it easier to generate consensus by spreading fears and suspects amongst civilizations than by promoting dialogue and cooperation? Are opinion makers really leading the opinions of the people or are just driving upon the most widespread superstitions? Does it exist an ethical "grammar" for communication? Is there a conflict between artistic creativity and social responsibility? While coping with the vastness of the "big" philosophical issues, one intuition was helping my steps. The fact that United Nations had framed its programs exclusively in a "technical" grammar fashion that had made everything sounding too frigid and aloof. That kind of economic language was needed at an earlier stage to frame a consensus amongst the different world leaders. But then that economic-social grammar was not sufficient for raising the emotions of the people and therefore was not really communicable to the public. If we wanted to communicate the MDGs we needed to move from rationality to passions, from statistics to music, from prose to poetry. Then how to put "poetry" into the bureaucratic language of the UN declarations? Probably the first step is to move out of the "formula" idea. Yearning of poetry cannot be grounded into lists of ingredients and processes. We had to be open with our own passion animating our own search. We were going to propose to the professional media development stories about the MDGs that were not pre-cooked in the usual media stereotypes. We would have exposed our difficulties and our attempts to overcome them. We would have recorded our story as it happens, like the researchers write the notes of their experiments. And as it is with all researchers, we could fail in getting the right solutions. But in case we would have been far away of the toxic modality of "trying to convince". Would we also been inspiring and entertaining the public? Well, that's remain to be seen. Now we go for this path. Next Script.pngSearching for the questions to ask See in the handbookEdit Stefano explains the target and the approach of our documentary Stefano asks for suggestions on how to improve the documentary Stefano asks to Jean Drèze suggestions on how to cover the good news
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.9720478653907776}", 'metadata': "{'Content-Length': '42028', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4RD6FQHDPY3WRR2RZXV7LX7GECB4QC3W', 'WARC-Concurrent-To': '<urn:uuid:3f6e162b-c920-4aa3-8f0d-9e7055218d92>', 'WARC-Date': datetime.datetime(2019, 5, 23, 17, 47, 22), 'WARC-IP-Address': '208.80.154.224', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:HPRSAXV23JWVAWKNF4HUEKDEXU66EIYQ', 'WARC-Record-ID': '<urn:uuid:bd33e1e6-f2a6-4fe6-b300-2be2afeb104e>', 'WARC-Target-URI': 'https://en.m.wikibooks.org/wiki/Development_Cooperation_Handbook/The_video_resources_linked_to_this_handbook/The_Documentary_Story/The_real_project_challenges', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8f2b71a6-0850-40de-aec2-7367789f879b>', 'WARC-Truncated': None}", 'previous_word_count': '997', 'url': 'https://en.m.wikibooks.org/wiki/Development_Cooperation_Handbook/The_video_resources_linked_to_this_handbook/The_Documentary_Story/The_real_project_challenges', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-146-95-138.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05080324411392212', 'original_id': 'c509ec3368d37bffedab8de7249156abf850ec6960efa309517c430fcd686209'}
Make handsome money being a pornstar Over the last few years, adult modeling has turned into a well-known choice for girls, who have attained the age of 18 years or older than this. These girls aspire to turn pornstars because of the money which they can make with this process. This is a fact that models can manage to earn lots of money minus being above 5’10” and having a weight of 110 pounds. However, for turning into an aspiring model, a person must know the kind of modeling it is. To put in simple words, adult modeling comprises posing in, at times, in a lingerie, but most of the time it involves posing full nude or topless and you can witness it on sis loves me. Though topless modeling is capable of paying the bills with an adequate set of physical girls, yet it generally takes willingness for posing entirely nude for a model to notice some optimistic influences on her bank account. Hardcoremodeling has become more prominent in the entertainment and adult modeling industry. Different models who do perform in hardcore productions and recognized as porn stars, produce the most money. They derive their income from film work and pornography besides signings, guest appearances, adult entertainment events and obviously, through their personal membership sites. You can see the numerous models on The overview of pornography The majority of the pornographic movies are directed towards a heterosexual male viewer. In this, the subject of primary focus becomes the women present in them. Pornographic films try to show a sexual fantasy and the actresses are chosen based on their ability to fit or create that fantasy. Numerous times, this fantasy turns out to be the appearances or physical features of the actresses, like breast size, figure, ethnicity, hairstyle, etc. It also includes the actresses’ expertise and willingness to perform specific sex acts. Additionally, actresses are needed to show an optimistic attitude on the screen while performing sexual performance with all the sexual acts that are being presented as joyful and enjoyable. Generally, actresses are presented as available and ready to get engaged in many sexual acts with their on-screen partner. Based on the genre of a movie, the physical features and on-screen appearance of the chief actors and their capability to develop the sexual mood of the movie holds critical significance. The majority of the actors do specialize in specific genres, like bondage, lesbian sex, double penetration, strap-on sex, anal sex, teenage women, semen swallowing, MILFs or interracial. Regardless of the genre, the majority of the actors are needed to appear completely nude in the pornographic movies. However, the on-screen appearance of the female actors holds high importance. The pornographic actresses come in their 20s or 30s only. Actually, there is a huge preference for the large breasted actresses in this industry and some studios do encourage their actresses to go for breast implants and propose to pay the actresses for the process. Based on the version of Jonathan Morgan, an actor-turned-director, girls can be graded into A, B, or C. The A girls are considered the chick and they possess the power. This is the reason;they would turn out late or never. The lesser successful actresses become more prone to performing more extreme acts, like ‘double-anal’. Now, if an actress does perform more extreme acts willingly, then she will receive more proposals of work. The less attractive of older actress do perform these acts for getting more work. According to Morgan, a few girls get used up in 9 months or in a year. An 18-year-old, young woman gets signed up with an agency and she ends up making five films in her very first week only. Then, she works with five directors and five actors and then she makes a hundred movies in four months and then, she no longer remains a fresh face. Recommended For You About the Author: admin
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9633534550666808}", 'metadata': "{'Content-Length': '57387', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:RU66D36NGP3X7F5VF7Z25LV2NF3X5HUI', 'WARC-Concurrent-To': '<urn:uuid:12153998-8d74-49c2-b7f0-273b6a3891a2>', 'WARC-Date': datetime.datetime(2019, 4, 24, 5, 52, 33), 'WARC-IP-Address': '216.221.185.120', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JBQIJ3AZY2YFDNGFBF7FPQQVSD5R5YAX', 'WARC-Record-ID': '<urn:uuid:86a807e9-6d6e-4168-8fce-d9adc4286326>', 'WARC-Target-URI': 'http://www.forever-pretty.com/make-handsome-money-being-a-pornstar/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:49f441ae-c169-464d-b52c-53d88ba0cabe>', 'WARC-Truncated': None}", 'previous_word_count': '652', 'url': 'http://www.forever-pretty.com/make-handsome-money-being-a-pornstar/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-141-34-30.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.35663580894470215', 'original_id': '44efe447862c77611bb5f78936dd67f7ad02fbc14d81a8ad37fda96267868800'}
Potentiation of clopidogrel active metabolite formation by rifampicin leads to greater P2Y12 receptor blockade and inhibition of platelet aggregation after clopidogrel. The thienopyridine P2Y(12) receptor antagonist clopidogrel reduces the risk of arterial thrombosis and individual pharmacodynamic responses to clopidogrel are believed to reflect the levels of active metabolite (AM) generated. Rifampicin increases the inhibitory effect of clopidogrel on platelet aggregation (PA). We studied the response to clopidogrel before and during administration of rifampicin in order to study the relationship between individual AM levels and P2Y(12) blockade. Healthy volunteers received a 600-mg loading dose of clopidogrel followed by 75 mg daily for 7 days and, after a washout period and treatment with rifampicin [300 mg twice a day (b.i.d.)], received the same regimen of clopidogrel. Clopidogrel AM levels were determined over 4 h after the clopidogrel loading dose and unblocked P2Y(12) receptor number was assessed using a (33) P-2MeSADP binding assay. PA was measured by optical aggregometry with ADP and TRAP. Rifampicin enhanced clopidogrel AM production [area-under-the-curve (AUC): clopidogrel 89±22 ng h mL(-1) , clopidogrel+rifampicin 335±86 ng h mL(-1) , P<0.0001], and P2Y(12) blockade (unblocked receptors: clopidogrel 48±24, clopidogrel+rifampicin 4±2, P<0.0001) and reduced PA (5 μmol L(-1) ADP: clopidogrel 20±4, clopidogrel+rifampicin 5±2, P<0.01). Increasing numbers of unblocked receptors were required for an aggregation response with a decreasing concentration of ADP. PA induced by ADP 2 μmol L(-1) was particularly sensitive to low levels of receptor blockade. Potentiation of clopidogrel AM production by rifampicin leads to greater P2Y(12) blockade and consequently greater inhibition of PA. PA responses to low concentrations of ADP are more sensitive to P2Y(12) blockade.
mini_pile
{'original_id': '4a92333abeb12a5ee322a619df70249862803bd3119ccb2c2e279530357a3b62'}
Shakespeare Was an Ethnic Minority Claims Ukip Historian ESSEX - England - Ukip historian, Lee Carver, has revealed that William Shakespeare was an illegal immigrant from an ethnic minority. “He had a beard, talked funny with some weird sort of lingo, not really English is it, a bit like a Muslim and he also knew about other countries in the world? That’s proof enough for me, could’ve been a dego, or something,” the Ukip historian said at a recent Ukip rally. The historian also claims that William Shakespeare’s family settled in Stratford Upon Avon only after dodging Tudor immigration officers and that his father, John, (real name: Zoltan Petrescu) was a Romanian gypsy thatched roofer who worked nights in a chicken farm in Surrey. There are also some clues, the historian claims, in a few Shakespeare drafts which have never been published and are purported to show the turmoil Shakespeare went through as an illegal immigrant. Illustration credit: Mattias Kronstrand Illustration: Mattias Kronstrand “To be English, or not to be English: that is the question: Whether ’tis nobler in the mind to suffer The slings and arrows of outrageous fortune or to be stuffed in the back of a hay cart bound for immigration, Or to take arms against a sea of Polski Skleps, And by opposing end them. To dine: to eat; Romanian cabbage soup; and gristled meat, The heart-ache, and the thousand natural shocks of being discovered O how we weep To dine, to eat; chips and bacon butties: perchance some brown sauce: aye, there’s the pub”
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '12', 'language_id_whole_page_fasttext': "{'en': 0.9502584338188172}", 'metadata': "{'Content-Length': '161717', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GYFWYLUOLIP3A6KOONX6ZKXRNMNTERKT', 'WARC-Concurrent-To': '<urn:uuid:c524aeb5-0afd-4787-b32f-3066192f3286>', 'WARC-Date': datetime.datetime(2018, 7, 17, 9, 52, 44), 'WARC-IP-Address': '104.28.15.84', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:CWYSSZCOHL2JR6254V6TF7AI2DIZM3HR', 'WARC-Record-ID': '<urn:uuid:a29a22ae-fc21-42df-a9f3-c289f7b84ae6>', 'WARC-Target-URI': 'https://www.dailysquib.co.uk/world/7600-shakespeare-ethnic-minority-claims-ukip-historian.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d89b0817-18b5-4643-9328-842017544281>', 'WARC-Truncated': None}", 'previous_word_count': '253', 'url': 'https://www.dailysquib.co.uk/world/7600-shakespeare-ethnic-minority-claims-ukip-historian.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-37-226-241.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-30\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for July 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2624478340148926', 'original_id': 'e76b57d3d299c747c481da7e2c4e0d07bb3594354d4af9f004defd062b0bc9c5'}
Fast screening tests for the simultaneous detection of 11 drugs of abuse in urine specimens. A forensic epidemiology study of 28,298 cases in Tunisia. Forensic investigation performed on people suspected to be drug abusers covering all Tunisian cities was conducted by monitoring an epidemiological study of human urine samples surveying positive rates of consumption for drugs of abuse. The forensic investigations were conducted on a total of 28,298 arrested individuals suspected to be drug addicts during five years (January 2010-December 2015). An immunoassay screening tests to detect elevated levels of drugs classes in urine samples was performed. These screening assays provide a preliminary qualitative test result. Only positives urine specimens were analyzed with GC-MS for confirmation. Except for cannabis, the results showed insignificant number of positive cases for cocaine, ecstasy (MDMA) and amphetamine consumptions (<1%).
mini_pile
{'original_id': '123a2c624dd8befe5de2d2416f6f8b686a0ca6e5bb803a9a99a555c26a6a8376'}
Starfire Shell For Ghosts who are bright stars in the night sky. Nuclear fusion, the source of energy for stars • Nuclear reaction in which atomic nuclei of low atomic number fuse to form a heavier nucleus with the release of energy • The Sun is an example of nuclear fusion • Fusion powers stars and produces virtually all elements in a process called nucleosynthesis • These reactions cause visible light Expanded info:
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '8', 'language_id_whole_page_fasttext': "{'en': 0.8210378885269165}", 'metadata': "{'Content-Length': '52544', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4YGXQMWPRNDT5BJ76XB4EJFZMNGCOKOP', 'WARC-Concurrent-To': '<urn:uuid:50b9efc7-944c-4398-bfb9-b63555a8726c>', 'WARC-Date': datetime.datetime(2021, 9, 24, 11, 25, 20), 'WARC-IP-Address': '192.0.78.150', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:22LXEPTW24FN22OCPG77QRNC66CASKTR', 'WARC-Record-ID': '<urn:uuid:954b5b20-e7a5-4cc4-a461-c34cad5c51f4>', 'WARC-Target-URI': 'https://destinyarmorydefined.com/starfire-shell/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:22ecfb03-959f-43f9-9069-81e649db5fa2>', 'WARC-Truncated': None}", 'previous_word_count': '71', 'url': 'https://destinyarmorydefined.com/starfire-shell/', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-28\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.28458863496780396', 'original_id': '9ba4412135e40662962f2af3cde53f5120a3a79d4cb59b4efeff476c45e0a8aa'}
Define a local printer using the same user that starts concurrent manager. This printer must be printing to a file with the name Default and must be the default printer for the concurrent manager defined user. Kyalo
mini_pile
{'original_id': '6b89b3d22ce75a9adf8fb34a1552ff2b6f467fcf50efbc3c2c37953dd07ef511'}
Tax Games and Redistributing Income Upward Monday, 04 February 2013 10:12 By Dean Baker, Truthout | News Analysis • Print • Email Governor Bobby Jindal of Louisiana speaking at the Republican Leadership Conference in New Orleans, Louisiana, June 17, 2011.Governor Bobby Jindal of Louisiana speaking at the Republican Leadership Conference in New Orleans, Louisiana, June 17, 2011. (Photo: Gage Skidmore)The corporate profit share of national income is near a post-World War II high. The share of income going to the richest 1 percent is almost at its pre-Depression peak. These would seem like impressive accomplishments, but the process of upward redistribution, from Joe Sixpack to Joe Six Houses, is a never-ending struggle. Toward this end, Louisiana Governor and Republican wunderkind Bobby Jindal, has just proposed replacing the state's income tax with a sales tax. Sales taxes will generally be more regressive than income taxes for the simple reason that low- and moderate-income people will spend a larger share of their income than upper income people. That means that the portion of income that wealthy Louisianans save will escape taxation, imposing a larger burden on low- and middle-income families in any revenue-neutral shift. However, saving is only part of the story in this picture. Wealthy Louisianans are likely to spend more time and money outside of the state than less affluent residents. Insofar as wealthy Louisianans spend money at out-of-state vacation homes or Parisian shopping trips, they will be creating a tax gap for the less affluent and less well traveled to fill. In fact, fans of economics will likely point to the problem of Louisianans stepping over the border (less than an hour away from the state's major cities) to escape the sales tax on purchases of big-ticket items like televisions and refrigerators. This will leave an even larger burden for the sales tax to cover, which will fall especially hard on those who may not have access to a car or who for other reasons might not find it as easy to take advantage of such tax-evading tourism. So, this shift from an income tax to a sales tax looks like a big step forward in the process of upward redistribution. It's easy to see why Jindal is considered a leading contender for the 2016 Republican nomination. Needless to say, the wealthy dislike state income taxes every bit as much as they dislike federal ones. Insofar as they gain complete control of state governments, they will take the opportunity to shift the tax burden lower down the income ladder. They may get help in this process from one of the widely talked about tax reforms at the federal level: limiting the total amount of tax deductions that can be taken. While this may sound like a progressive measure - requiring that everyone pay their fair share of taxes - this limit could put pressure on state governments to reduce taxes on the wealthy. With the restoration of the Clinton-era tax rates, the highest-income taxpayers are facing a marginal tax rate of almost 40 percent. This means that almost 40 percent of the state income tax paid by the wealthiest taxpayers is, in effect, paid by the federal government, since it comes directly off their taxes. However, if there was a cap on deductions which most of the wealthiest taxpayers actually hit, then the burden of state income taxes would fall fully on the wealthy people in the state. Needless to say, the wealthy in New York, California and other relatively high tax states will raise much more objection to state income taxes when they are paying 100 cents on every dollar rather than 60 cents on every dollar of the tax. A likely outcome will be lower state taxes on the wealthy and higher taxes and/or reduced services for everyone else. The picture looks even less appealing when we consider that contributions to charity are likely to be excluded from the cap. This means that if a wealthy person feels bad about homelessness so that she contributes $100,000 to a charity to shelter the homeless, the federal government will pick up $40,000 of this tab. However, if she and others in the state consider sheltering the homeless to be an obligation of government that should not depend on the kindness of the wealthy, the taxes to cover the cost will be fully borne out of their own pocket. It's hard to see the rationale for this asymmetry, but wait: it gets worse. Suppose our rich person gives $100,000 to an opera that he and his rich friends patronize. The federal government will pick up $40,000 of that contribution, but zero for the state government's efforts to shelter the homeless. Suppose that our rich person decides that his friend should get a $1 million annual salary to run the opera. Well, the feds are on the hook for 40 percent of his friend's salary, but still not contributing to the state's efforts to shelter the homeless. The point here should be clear. The effort to cap deductions is not actually about making the rich pay higher taxes; it is about putting pressure on state governments to cut back their services. President Obama proposed limiting deductions to a 28 percent rate regardless of individuals' tax rate. This policy makes sense as a way of getting more tax revenue from those who can most afford to pay it. Capping the deduction does not. There is a reason that Republicans support it. Dean Baker Hide Comments blog comments powered by Disqus
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '56', 'language_id_whole_page_fasttext': "{'en': 0.9589568972587584}", 'metadata': "{'Content-Length': '68517', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QE7GB3PBBKV3UVB24A6W44J5BMCJ5QZD', 'WARC-Concurrent-To': '<urn:uuid:65538da7-51f9-418a-862c-630f79c26a2a>', 'WARC-Date': datetime.datetime(2014, 8, 1, 15, 54, 7), 'WARC-IP-Address': '199.116.78.77', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:OVAJIURGO75FTBGH4JJ3OA4SF6ZAC3CB', 'WARC-Record-ID': '<urn:uuid:e8cc5a59-24db-421e-b639-b3375bf4f84e>', 'WARC-Target-URI': 'http://www.truth-out.org/index.php?option=com_k2&view=item&id=14325&Itemid=228', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:91e8b40c-8be6-4c45-83db-54427d7a1169>', 'WARC-Truncated': 'length'}", 'previous_word_count': '983', 'url': 'http://www.truth-out.org/index.php?option=com_k2&view=item&id=14325&Itemid=228', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.16387939453125', 'original_id': '664747c1dbdcb35abc29c6bab776d344a4f59f82ba9f6875d6f8b9b36af0b039'}
Peel th6n condescended to hear what I had to oifer r^'^j[>eD^g the anonymous letter, and a donversafion i^^ued on the subject of the aUU, in, the course of i'^ich, he mentioned the aSdavifc of Mrs. Cliff, as conclusive against the genuineness of that defence, o 9» and, ill condltision^ said^ that twelve imn lifill^ deeMkd dnthecase^ in the fiirst instance ; that gfeat pains kttd been subsequently taken to investigate it; and that, as ail>the facts had been laid before hisMajMsty and the Privy Connioil, when the Recorder made his repovt^ he conld not think of interfering with their decision. It wais, therefore, not until near tvirelre o'd^ok, Otf Mon^ dity night, that I relinquished my exertions aild my hbpes^ and obtained the decisive answer vrhi<fh con-^ vincdd me that the fate of my vnfetched client Was irrevocably fixed. ' ' ' I ttave, perhaps, been more minute than interesting in the latter part of my narrative; but'inskiuafldns having been thrown out that I had neglected to exeA myself f6r the man while alive, in order to have an op- portunity of exciting sympatiiy for liim, and casting odium on his prosecutors after his death, I have thought it necessary to show the measures and steps I took ; and the candid reader will, I trust, readily acquit me of the illiberal and unfounded imputation. 'I ^all now proceed to show that the conduct of Harris, while in prison, and in his lastmdments, strongly indicated bis innocence. From the day of his conviction, the 29th of October, until the morning ef bis executiaii, on the 23rd of February, he had been c<»ifined im the i>ells>; and to the clergyn^n^ the sheriffs, the keepers, and every one about him> he had uniformly and con^ sistenlSy asserted bis innocence, and many of his Mlow '{Prisoners, who have been ^questioned ^ to their bidief M the subject, have declared; that ^ they ^firmly In^eved htm to be so. f Late in the evening bdfbre he suffered, my cleric, Mr. Butler, went to him by my desire, to m^e some in- quiries, and waS' w|th' him for neariy an houi^, du^ng .which time he (tpi^MlxiAy protested that he was not v^ a g0i< enM^ffAeA'^in^ iftor *iA' any mnqmr coniwqiadtvitii,) o^; ptity to thfk stealing of the sUk, nor to the fll^mage of Sarah Drew ; .and> ma, previous intervif^wy he went on has iuiee8yaiidlixi4a,8oleBUi and. deyoat manlier called Go() to wkneiis that he was entirely innocent. Th^ night before he suiFered, the following letters wore written lor Harris by Henry Durham, an intelli- g#otan4 iAtprfiStinj; youtb> who was to undergo the same awfiil aentmce with him : — . Ne»wg«te Ceodemiied Celb, Feb, 21, 1325... My nsAB. Wvn, xhj> Ckildrsn axx, , . .. l;ta)Ei^.^w t)ie Appo^^Uwiity^^ lyith an aofaing heiurt^ to bid you a h^ ^yf»h^ ,UM QOt^i^ iiijjMlf Igiieve, it is tl^ I lea^ire yon. drstitute to. a. inerGiless worid^with the shame .upon yourselycya; of my infiuny ai^ jgiymjifflpiw.: (i^atfi* Yet it^jj^ct your husband and your fiither died on Gon^vidjioii o^a crime that he never committed: and th»fc reflec4o|\ will, .in a litde measure, relieve your distressed minds, although I am well aware it will not relieve the ensuing dis- tresses* The only consolation you can receive is by a true and sted&st trust in God. He, alone, can be a Father, — He, alone, can be a Husband, — H^, edone, can relieve your present distressed minds, and your future wants. Look not. for happiness in the things of this worU, the only method to attain that is by strictly walking k^ the paths of righteousness. Trusting you will ever recollect thot.dus is the advice and last injunctions of a dying husband, of a dying ftAer. Vfkdu writing tliia, yon havfi.tiie pleasing knowledge that I am ^ hmjffpj in mind as anyperson canbe^ ; — ^whether I derive sndi from the kiioi^e<%B sf . innqo^ce, or firpm the hope and stedfest faith in Qft^. Iluiew.m^l initbe alone l^isthftcan support us under all^jafpiclio^ ai^ ,trofib^/^-and I tnijit he vrill me in the trying hour of death. Keep yonr hearts and minds in the knowledge and {iffe <f^\^.fad. yoi^r reward will boi the eigoyment of etwnal y«|M> W 4fW.:cWf(/»>?ii ,:Bdvw4* Elizabeth, and Nancy, whose youthful ai4 weaJpsBo^ afe.^f)!^^^^ (^trapped in the snares of this wicked world, you dp I more particulariy vnim of the dan- gw of had ^mapm^i'bf'k09pmf^'vMBk yon invjr iM<wdliko guittj^. If '^ Always tntaik ymir tmnpiny weU, ' .* By keefiiBg BAB four FoMtr Ml ' You^ my dear wife^ I can but thank for all the cares you have shown me^ more so since my confinement^ and t trust you will be rewarded hereafter. And although you may not be able to pro- tect our dear children through this wide woild^ you can advise Hiem lor the best^ and instruct them in the paths of rectifode. I cannot say more, than that I most earnestly recommend you ALii to (lia care and protection of that Almighty Being into whose phresenee f am about to appear. With the sine^re hoptaad liust t^faei^ iide you tiirough fife, and m the last hoartdk^ y<m ttf hhtti^.'^ OS is the htot pMfyer oP .1 .. Your affi^oMe, bat- imfektiiaale HuiAand and Flstfaer, EDWAR1> HARRIS. Condemned Cells, Newgate, Feb. 21, 1835. My dear Mother^ I cannot, considering the filial duty I owe, res^ my last breath,' without first bidding you an eternal farewel. I am called to ano* dier world ; and however innocent of that charge which T am con- victed of, I am bound to bend to the strong carm of the law; and therefore can only say — the Lord's will be done. That yon have ever done a mother's part and a mother's duty, I gladly arid aififec- tionately acknowledge; and for that'paif of more paftlcdhLr atten- tion which I have experienced from yoti, idnce ihcatrcerMed' *wlthm diese gloomy walls, I have to exptess 'my 'ilncere' gratttdd^. ' T conjure ybu/ by the hV 6f 'iHendshtp and r^tionihip that dioeriEnd ever ex&ted between uj^,' ii6t to (tfittress ydtir mindV>n myttiittittti nate account; tor believing that I shaA b6 htippy; it is a sufficient recompense fbt my loss.' I am well Mm h is not in yofilr fUbwt^ to assist my family in a pecuniary way ; but to impart iliid -impress 6od*s precepts t6 thete, is wliat I more particulaily requeM. I ittv€i "wrote io them* and expiessed my last sentiments, aikd given fa » » t Am tftftt advke wfaidil thonihtim^t <idviiiMb^-t<M Ji^fWlH Mlow k, ancl whatevevyou may .wkl> is my jneBt4i]iG«i9,wi9i|. B»coimnftM*i»g yQi<> tfaf wij^ mwi ly dew.wife^ to 0i^cmofth9.lOiiiiii: potent Being ,who ru]^ all thijpgf^ I bid yon an eternal fajrewel ii^ this worlds and in the fiill hope, we may meet in the next^ where you may eiyoy etemal felicity, is the sincere .wish of. Your affectionate but unfortima.te Son, EDWARD HARRIS. I eonaidev.tluiA noinaa who ooald dictate^ or allow siicft leltevs to. be^writtaaJn faisitaam^ atMchra^tfy* hig and awl'ot period^ could be- gailtj of "the offence whioh he tiMSiEeiA bo solemnly denies. There is eJed this additienal test: of Hie troth of bi» deolaraiidnsj^ Durham had been a considerable :liuie c<m&ied in the cells wilh Hairis^ and .fiK>m: the close ' friendship and sympathy whidi attaches die partnens in misery to each otfter^ their secrets^ at least so far as regajpded the cases for whichthdy weie to snffer, Were doubtless mntually imparted. Durhain was exceedingly contrite and well conducted^ and unless he had be^n convinced of the innocedce of his ifeUow-sufferer^ he would not^ when so near his end, have allowed himself to be witti"» drawn from his own rdiigious devotions,' to write sueh letters as these. .On the mornii^ of the ekecution/ when the ^erifiB^ ai^rived, Harris exclaimed, ^^ I am aa innocent man j^ I kup w Codling about it;: |f. I did^ I'd tell, Muvdert Musder !"*«-he then went up to Mr. Sheriff Brown a&fd BfiM^ *^ Indeed; Sas,. you are: going to hang a man thai IS' entirely iimocetttr what bad laws ours are, to hang an iimocent man :'r*^^4hea turning tO' sereral gentlemen pf thotpiess, who were prtesent, he said, ^' Oh, gto- tlemen, tell them. (meaning the puUic) that I die in- nocent ; (I am murdered ! I am, so help me €rod, as I am a dyihg man. I know I have been^ a wicked man, nocent. Is it net a Bhnne to kenp a ndia^ ftr« omniA^ in gaol, and tlien to bring liiteo«t/«ndliaiig*HtfV' He then dropped on his knees before Mr. « Sheriff Bm^mf and others, who were around him, and, Iffting tip his bands, and looking upwards, said, ** Of this I am innocent, and may I endure everlasting torments, if what I am saying is not true ;'' and he again appealed to the Almighty. While the executioaei^ .was f^riMa^ ing his. duty on his wretfcbed oompanidnsf Hiurm oe«^ tinned to address those arotu&d hiln^ still pfOtaetHi«^ hie^ inneoence, and deeiamg that it was m, pimki of siUnS' wioked wre^h, beoau» he was a bad duaaicttei;. and^ iqp to liie last moment of his eststenoe, he kqp« es^ta^ ittg Murder ! Mmrder ! I am mudend! I::jiiaijnutderad i « » ' Some people are of opinion, Hiat 4Ue dj^i^ dertara^ fiesta ^^'ianoocnee^ made by a crinmnl, ought to Imi entirely disregarded;^.!' think otherwise; aad^altlMMi^ I fdni^notv disposed to giye implicit oredit to the'assfer- ftem of <eiieify eiOM, when on the fallows, I have^midom' |e«9sdthe most, depraved and bardraied ruffians »da«e» tlis vengeance o£ the Almighty in Hmt last momenti^ byr calling 'OO, his holy name to bear witness -to a false«^ hood. Offwders, who have all their lives shown aai Qf^er. disregard io all religious and* moral duties, tmve beopme penitent as their end appuMcfaed, and weald not|On any considemdoa, quit thas'WotU uttering aiiei Hants was a man of this descriptwi ; hie fixedly ci^n- fessed, Ihat he had led a sinful life, .add' that. The condnct <^ tiiis unfortunate man^ in his last molnentS) produced^ as well it mighty a strongs sensatian in the public mindy and to counteract its effects maity ingenions artifices^ were resorted to. In order to affml ft teady answer to those who questioned the pvopiiety ofitfae eonviolion^ confesrimis and cif cumstanoes weie iftTittitedy wfaioh) if true, would hatre r^moired all doubt of the prisKmor^ •guik y aaad, to intinlidi^ any- one ffom adiFOc&ting'hasiCase^ it.was said, th»t none but the •patrons ofvpagilism and^ blad^^ards^ or thos6>wfao had^badimd MisQhforousinteiitioAs/wttuld attempt to dBq^ote Ae yvstiee of bis senieiice. > ' It w9i^, amongst' other ^things^ said^ '^ that the ^ri*- sonef had confessed himself guilty whM <first taken 46 tlie» office/'* Ontracisig this sporty the asserlien i;ms qiitiified-by saytitg, ''he had o^ good as c<ml^sed/' and jt was thns^explained : that the magistrate^ hating beenne^ly appointed^ and therefore not well awstre'of his^dttty^ Imd propoi^edto discharge Harris if he would s^nd ^r any part of hid family to provche vf as at home on' the preceding afternoon. That Harris refused tbis offidf^^nd'must^ theitdforej have bcfen coiiscious that no siidi'proof couM honestly be givien: I did not believe a word^oftfails story; atid; on inquiry; P found ttierewas not Mie^ slightest foundaition for the report, no sudi prepositien haA^ver bebn^ made by the magistrate ; and so te fi^otn tile prisotter denning to call, his children, he had atixiou^ i^ished them ta'be produced, thinking their evidtoee would prewnt his* committal for trial 1«4. U wa^ Abo assertfd^ tbat whew talwnto New^rrt*, be. kad used wpreasioM |o Watef«i tbe oftcet, wbix^b, if they did not (uuQimttaa ceofesaomiicMld JieaTe WTy Kttie doubt ef bis guilt.. Tbe»e exprefl8ioa»I haye b^a told^ were' to tbe «ffei^ '' ttmt he knew be wfMs as dead as a hoase; that be/^oald have to come out at Mght in the mornings and aboold .not open his menth.'' If Ihis is.theaab0ta»ce of tbe^woid^ M^icb ftie^pfi^iNldT is, aaid to bailee ottei:ed, I^Uilnk they arc^ emUy fm- fiained* It. could uot be master of ^urpvi^ tb^ the priltoner, bayiugjoath^rdiJthe maiioey iii'^pibieh 4>« l^ffoeecittcix bad beea .swearing a^ainM hii^. and ^alvo haidng tbeen t^ hy me.tbe danger .of. On. his entrauQe into tha^ gm4i.he umf<uw% persisted in mufci^g tbe ^aipe 4MaiiMtipna;.^iaii4 M; wvuddhe eisl^- ^r^inary iudecjdi if to tbi# wan; €wly> fhe ah0ri^4PM»|g Qije /sbort period h^ wm in.b}S;Cwpj¥ttW» have aBiader#ii acknowledgeiae^,> iAfOWiatey^ .iMMl^.siramiiKe^v^ evory ott^rpiMTlof his oondufit 4wwg the i^HPie^thwe of hia imprisonnent ; md the more especially as tbis man was a polpLoe ofioer., m^ was.ou bad tcim^ wMb hiBfty thej bayiBg not many months preyiously, ad I am informed, had a quarrel ; surely, then, he was the last man in the world to whom Harris would have made anj disdosare, which placed his life in jeopardy ; I ,do not believe he did ; I never recollect a case, in which greater anxiety was manifested to succeed than in this, all the strength of the office was ^ployed, or at l^ast six of the principal officers were engaged in it^ namely, Chirian, Hanky, Atifield, Vann, Armstrong, and Ol^ed ; and if the Gaoler could have proved any material fact against Harris, would he not have been called on the trial ? If Harris had said any thing from which a fair inference of his guilt could be drawUi Waters neglected his duty if he omitted immediately to communicate the fact to the Magistrate, and the clerk who was conducting the prosecution, because by keeping it secret till after the trial, jastice might have been defeated; and, is it likely, that Waters would have been culpably remiss to htw Harris^ I know his shrewdness and his zeal too well, to believe the affirmative^ and I cannot for a moment think, that the prosecutors would have omitted to call Waters, if he bad told them he could prove any fact against the accused. The whole, therefore, appears to me to be an afterthought, for the purpose of reconciling and sustaining the evidence of the prosecutrix, and, if pos- sible, stifling the inquiries/ and answering the obser- v^ons pn behalf of Harris. -Another report industriously circulated by those who. felt .an^inteiest in supporting the conviction, .was, " tiiat Yardley had confessed he was suborned, ,and paid seven gnineas, for perjuring himself." .This )is so palpable and improbable a fa,lshood, as lN:aicel|r to. deserve a word in refutation, and I m Hhovld thitok it. would be difficult to determine which deierved the most contempt — those who invented^ or tiiose who could believe such an assertion. I knew th^Ynrdley received no. compensation even for his lost time; stilly however^ I thought it my daty to see and question this man, to ascertain if he had in any conver- sation affijrded the slightest ground for this supposed confession, and he solemnly assures me that it is entirely a. fabrication ; that so far from having received or con- fessed to have received, seven guineas, be never received seven pence, and that, while attending as a witness, he paid for his own refreshment of bread and cheese, and porter. It was industriously propagated, that all the prisoner's family had been clearly detected of fW shood, in assert- faig that they had seen him at home, and the circum- stance of Elissa being with Mrs. Cliff, was urged as most conclusive against the -girl's story. When I first beard of Mrs. Cliff's deposition (on Saturday^ the 19th iPebruary,) I still asserted my firm belief that the girVs Mstimdny was true, and that Mrs. Cliff, notwithstand- ing hejr respectability, might easily be mistaken in the 4ay, ocnsidering that her attention did not seem to have been caHed to the subject till long after, and that the statement of Mrs. Cliff, whose recollection from tiie lapse of time might not foe accurate, ought not to bear down the positive deposition of t)ie prisoner^ daughter, whose mind had been directed to the fact, thievery morning* after she had seen her father at his iHndow.^I cannot now, however, express the asto- irishniieiit and indignation I felt, when;k few days after the deadi of Harris, I learnt, that this most t€q>$cta!ih Uul^,' Mrs. Cliff, is an intimate acquaintance of some of the Worship-street police officers, that her husband 107 Is considered as a candidate for a «itliation on that establishment^ that he is often seen patroling the streets with them, and that she, Mrs. fCliff, on meeting the officers in the street, has gone tp a pnblic-'haase, and drank with them ; and, as a proof of her veracity, she once introduced Eliza Harris to two of these officer^, as being her sister. Now, as it was watt known long be- fore the trial, (bat Eliza wa^ to prove seeing her father at bis window, and as Cliff and bis wife were )on sfauck intimate terms with the officers, that they cotild bordlf avoid hearing the fact ; why was not Mrs*. Cliff pro^ duced at the trial, where she might have uBdfirgo«e cross examination? Supposing, however, MrSi Cliff made no communication until after the trial, wo«N it not have been more satisfactory for sonle person,' oil behalf of the prisoner, ^o have heard her statement, and been allowed to question her as to the accuracy df her recdlectioui when it might perhaps have tturhed out, as I have no doubt is the truth, that Mrs. Whatever may hav« been said or deposed to» by Mm. GUff to contradict Eliza, I thiiA, no 4ottbt eanbe ^telertained, that the Utter is^ correct, when it is stated ^ tliat Mts« MarskaU has on her oath sAserted that she • eaW SUisit em ^undajr, . Oue ^d q£ Ootober, ^me* tei ' 4iet hoim^ to^ ^ovt^Msa Hkt f^ples^-shd was juat 'going ' iMt (0 tea at the time^ m^ niat jiKiali as slio wf a 108 efiteriog. The fact, sUso^ of Eliza being out tli«t^ afternoon^ can be established by other i/ntnessen^ BO as to prove^ b^ond doubt or question^ that she ooiitd not have been at Mrs. Cliff's. It was mentioned to the prisoner's mother^ that If rs^ Cliff was going to make some affidavit agsunst her son, whereupon^ the poor old woman, in her natural anxiety ibr his isafety, went to Mrs. Cliff, to ask if there was imy truth in the report, and if so, what it was she could have |o*say in the business ? when Mrs. Cliff (as I aminformed) said [it was all a mistake, and that she might make lierself easy, for that she knew nothing against her «on, and, if she did^ she would not mention it. ' ~ Another report was, ''that the prisoner's moth^t had declared she was at home with him throughout the afternoon: when it could be satisfactorily proved that she was over in the Borough all the dfity." lu ord^ to lay any basis or foundation for this reiK>ft, Hshotdd be shown, that the elder Mrs. Harris had made tbe declaration asoibed to her. It is most true thut she was at a friend's, in the Borough, and if ^^she.had either before the Magistrate, or on the trial, or, indided, on any one occasion, said, that she was at hot* own house with her son, on the day in question, she must have uttef ed a gross and palpable falshood ; 1>ut, -fhe poor old woman has never oiice made such an asser- tion ; on the contrary, she has uniformly stated where she was, and her regret at being unfortunately on a visit, so as not to be able to give evidence to dear her son. Thus, it appears, that falsehoods were assiimed to have been asserted, which never were thought of, m order to excite a prejudice by contradicting them. It was reported and inserted in the newspapers, that a pocket-book bad been found near the spot whete Saiah 1^ Drtw WHS ilt-asetf, «4iich proved to be Harris's, front ilAiFUigMii it reeeifyto" for r^nt which he had paid. This tale/ like the others^ had not the sligfhtest foandation in tnith ; he never carried a pocket-book, nor had he any receipts fof irent, consequently, none belonging to him could have been foand. , . It was stated that a barber, opposite Shoreditcb clnifcb^ coirid prove that Harris Ivas from home jin tha«ftetiMMHi in quesstion/ because he bad shaved him; <aiid' I QiidetislaAd that some foolish barber had circu- Ittledsach a report. It so happened, however, that its fabhood ooilld be proved by the man who had actually shaved Harris, onthe Bfltmday morning, shortly before he ^ivas taken ^into oustody,*^d who could have sworn, thftt, from the lengA of his beprd, faie could not have besa* sdittved the {^receding afternoon, f he Shoreditch batber, I am trid, was requested to make an affidavit to ; the sme effect ^'the report he had propagated; butcheariBf , pethaps, that he could be contradicted, he pnidenily deigned, and said he believed he was mis- taken' in flie Sunday. In order, however, to have all the efflct of this taian^s declaration, it was currently repotted, that he had told the truth in fiie&st instance, but had been subsequently bought off by the prisoner*s friends, and therefore evaded making the affidavit. In Ibe couiw of my experience, I have found that loqnaeieos pedpdie sometimes intermeddle wifii sub- jecto of public^ intereiit, and invent some trifling inci- dent dot connect fliemSelves with it, and substantiate that side x>f the question which they' advocate or espj6QS^i> ia the case of Harris, which excited great intereal< m Spitalfields, there was a contrariety of opi»oa>«aDd<ccHttiideiraMe alehouse discussion, as I am UMiiWktaAiiti guilt or innocenee ; those, therefore, who U0 of the argavient^ by disposing ^t oiic«.4»f .t]ie mii^^hpRl only to say, that he had bc^ii ii^ea M tt^ Hlitikney- tieiq on the day in^qn^itifm, toA .sw^l^fffff ftms originated and pirevalendy ;^ent/<^irtb | M ouMfi^OfWh ever I while the man was aliyej^ Yentmf^t0COtai»Jw^ wi^rd and swear itA.altbpiv)i^ ap Iain ^Mfim^^ts were spared to o|)tain such proof; it wm0 hfi^ftw^p stated by the prpji^qfpr^j, that It ww ii.nwH ismmu fact that Harris w^s neaf th^ sp^t ; tlwM; JiO';lMid bwi seen tbere by scpres of people, but tliQy wore all tfvaM « » " ' ' f of telling the truths le$t they s^qpLd b^ ti|ill4et»d./. i ■ tn a few dayp after Qarns .wm f»epfited» i ited .the first part of my obseryi^t^ns app(9fi]re4>iti<h0:WaA&Juar tlispATGH Sw^d^ Newspaper! * ipwa«iwi*i wasia- serited i^,T^ who were ta:i:in|; np his c^eifl:^^^ ^,, aMe«t«ig'^tbat '' &e friends to thi^ supposed m^Ttyi^ aUbonsbagmH ing as to ijis jinnQ(^<p^c^, tpqif, diferentjmaf 9.0C ^.siib«- jecf^ some i^sil^vely $ifl|nning th^t the asf aiilt im} robb^r^ never tpo^ placei a,nd9- th^^th/^^ acQOtntr fjht&a hj the.pi;ofi^()^tri(x nf 93 a fftbric^tiqii ; oftexa boUly e«N gaginp; to produce), the iqa^ wk^ yrm the p^p^teatait. of thecrime in as){Q^ttipi^r'^. ♦. < * • -'- * -' Th^^ pars^grap ji thfii^ Yf fiirt^ on Uj^ 3ay» that disifttiflirested |^ersongj|.i9?ho, ^crf abayg §uspioian^ had. .seep Ha^rjis andthe ctther ipan Co^^ y<i93^.yrq^wip|^ X^ndpn-field, on th^ H^e^gSwcfi ^Moopt mititedi t|iat pfje pf , Jlj^i^, , h^ atC^qaUy ^a^i^..^ B[arrisj^^,^^^i^^^ thfy ^ija^ftuppjr^^.tbe disclpqf^iiai,,^^ joijspientipu^ scjij^les^Mte tfep nwalJeg^ ^way the life pf a fel^ow-crf ^tp^.; and, Jba* it^^i easq^^bec^ reomtflicjp^ff ^arri^'s ferocious f(sspciat^^ .might have piodbaeed' A^ Ill w same reMlt; biit aa the man was dead^ these people hatf HDiade, ot were atieilt to make^ depositions ^r the fitMretary of l^te. ' "".The fntenttod and objecft of the writer o( this para^ gftaph bafiffot'be mistaken. In conclusion, I beg to observe, that, however lament- 118 abliB the fate of Harris may be consiilered^ in, hating suffered ike cnreatest of hmnan mmisbments; far ' an offence hd did not commit ; still, the result; I hope, will produce some beneficiiil effect, from: the striking exam- ple it holds forth of the slight tenure by which men, who have once placed Uiemselves in the power of the police, hold their lives, and of the security winch honest and industrious pursuits afford against false accusations. Jifo man of good character would have been selected as the object of such a chai'ge; and against no one, but a reputed thief, could it have beoa successfuL FINIS. Bowe, PriBler, 139, Fleet Street. APAHEURe iiw 0M9 Of BonMra nwni 3 6105 044 148 216 .» • N.
common_corpus
{'identifier': 'caseedwardharri00harmgoog_5', 'collection': 'US-PD-Books', 'open_type': 'Open Culture', 'license': 'Public Domain', 'date': '1825.0', 'title': 'The case of Edward Harris, who was executed at Newgate for robbing and ill-treating Sarah Drew : investigated, and facts and arguments adduced, to prove his innocence', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '4062', 'token_count': '7461', '__index_level_0__': '20684', 'original_id': 'c74133970761e642558080c69d543986dcb31c02294dc8f9397ab5d976dbe796'}
Ethercat control device and factory automation system having the same ABSTRACT An EtherCAT control device and a factory automation system having the same are provided. The EtherCAT control device includes a master including a dummy EtherCAT slave controller (ESC) and a first slave configured to communicate data with the master according to an EtherCAT protocol, such that the master synchronizes a timing with the first slave according to a precision time protocol (PTP) method using the dummy ESC. CROSS-REFERENCE TO RELATED APPLICATION This application claims priority under 35 U.S.C. §119 to Korean PatentApplication No. 10-2014-0025150 filed on Mar. 3, 2014, the entirecontents of which are incorporated herein by reference in theirentirety. BACKGROUND 1. Field Exemplary embodiments relate to an EtherCAT control device, and moreparticularly, to an EtherCAT control device that may synchronize thetiming between a master and a slave and a factory automation systemhaving the same. 2. Description of Related Art Owing to a development of communication technology, a convenience ofinstallment and a cost reduction, a plurality of devices may beconnected with each other through a network. An Ethernet for Control Automation Technology (EtherCAT) network is akind of industrial Ethernet. The EtherCAT network has an updatingfunction with respect to high speed data and controls the timingsynchronization among the devices. Generally, the EtherCAT networkconsists of a master and a plurality of slaves. SUMMARY Embodiments of the inventive concept provide an EtherCAT control devicecapable of synchronizing the timing between a master and a slave. Exemplary embodiments also provide a factory automation system includingthe EtherCAT control device. The technical objectives of the exemplary embodiments are not limited tothe above disclosure; other objectives may become apparent to those ofordinary skill in the art based on the following descriptions. In accordance with an aspect of an exemplary embodiment, an EtherCATcontrol device includes a master configured to include a dummy EtherCATSlave Controller (ESC) and a first slave configured to perform datacommunication with the master according to an EtherCAT protocol, whereinthe master synchronizes a timing with the first slave according to aprecision time protocol (PTP) method using the dummy ESC. According to one exemplary embodiment, the EtherCAT control device mayfurther include a second slave configured to communicate data with themaster according to the EtherCAT protocol, where the first slave and thesecond slave include an ESC, and each of the first slave and secondslave synchronize the timing with each other using each thecorresponding ESC according to the PTP method. In another exemplary embodiment, the first slave operates as a timemaster and each of the master and the second slave operates as a timeslave. In still another exemplary embodiment, the first slave controls a firstmotor corresponding to a first axis of a robot and the second slavecontrols a second motor corresponding to a second axis of the robot. In yet another exemplary embodiment, the dummy ESC performs a drivepreparation operation by itself, and the drive preparation operation mayinclude an initializing operation, a safety operating operation, apre-operating operation, and an operating operation. In yet another exemplary embodiment, the master may further include adigital signal processor (DSP) configured to execute the drivepreparation operation of the dummy ESC. In yet another exemplary embodiment, the master may further include acentral processing unit (CPU) operated according to an operation system,and the operation system does not include a Real-Time Operation System. In yet another exemplary embodiment, the PTP method observes a protocolprescribed by Institute of Electrical and Electronics Engineers (IEEE)1588. In yet another exemplary embodiment, the master further including amaster clock generator configured to generate a master clock, where themaster transfers an operational command in synchronization with themaster clock to the first slave or the second slave. In accordance with another aspect of an exemplary embodiment, a factoryautomation system may include a robot having first motor mounted to afirst axis and a second motor mounted to a second axis and an EtherCATcontrol device configured to control the robot, where the EtherCATcontrol device includes a master configured to include a dummy EtherCATSlave Controller (ESC) and a first slave configured to perform datacommunication with the master according to an EtherCAT protocol, wherethe master synchronizes a timing with the first slave according to a PTPmethod using the dummy ESC. In an exemplary embodiment, a factory automation system may furtherinclude a second slave configured to communicate data with the masteraccording to the EtherCAT protocol, where each of the first slave andthe second slave may include an ESC, wherein each of the first slave andthe second slave synchronize the timing with each other using thecorresponding ESC according to the PTP method. In another exemplary embodiment, the first slave controls the firstmotor in response to a first operational command from the master and thesecond slave controls the second motor in response to a secondoperational command from the master. In still another exemplary embodiment, the first slave operates as atime master and each of the master and the second slave operates as atime slave. In yet another exemplary embodiment, the master may further include aCPU operated according to an operation system, and the operation systemdoes not include a Real-Time Operation System. In yet another exemplary embodiment, the dummy ESC performs a drivepreparation operation, where the drive preparation operation may includean initializing operation, a safety operating operation, a pre-operatingoperation, and an operating operation. According to another exemplary embodiment, there is provided a method ofcontrolling an EtherCAT control device, the method includingcommunicating data from a master, which includes a dummy EtherCAT slavecontroller (ESC), with a first slave, and synchronizing a timing withthe first slave according to a precision time protocol (PTP) methodusing the dummy ESC. The communicating may include communicating data from the master to asecond slave, and the synchronizing may include synchronizing the timingbetween the first slave and the second slave through corresponding ESCaccording to the PTP method. The method may further include performing a drive preparation operationby the dummy ESC, wherein the drive preparation operation may include aninitializing operation, a safety operating operation, a pre-operatingoperation, and an operating operation. The method may further include generating a master clock by the master,and transferring an operational command by the master from the firstslave to the second slave in synchronization with the master clock. BRIEF DESCRIPTION OF THE DRAWINGS The foregoing and other features and advantages of the inventiveconcepts will be apparent from the more particular description ofexemplary embodiments, as illustrated in the accompanying drawings inwhich like reference characters refer to the same parts throughout thedifferent views. The drawings are not necessarily to scale, emphasisinstead being placed upon illustrating the principles of the exemplaryembodiments. In the drawings: FIG. 1 is a block diagram illustrating a related art EtherCAT controldevice; FIG. 2 is a timing diagram for describing a method of synchronizing thetiming between a master and a slave in the EtherCAT control device 10shown in FIG. 1; FIG. 3 is a conceptual diagram for describing the problem shown in FIG.2; FIG. 4 shows a factory automation system according to an exemplaryembodiment; FIG. 5 is a block diagram illustrating an EtherCAT control device shownin FIG. 4; FIG. 6 is a conceptual diagram for explaining a synchronization processbetween the first to fourth slaves; FIG. 7 is a block diagram illustrating an EtherCAT control deviceaccording to another exemplary embodiment; FIG. 8 is a block diagram showing an EtherCAT control device accordingto another exemplary embodiment; FIG. 9A is a graph showing synchronization jitter by a related artEtherCAT control device; FIG. 9B is a graph showing synchronization jitter by the EtherCATcontrol device according to an exemplary embodiment; and FIG. 10 shows an EtherCAT control device according to another exemplaryembodiment. DETAILED DESCRIPTION Exemplary embodiments are described below in sufficient detail to enablethose of ordinary skill in the art to embody and practice the presentinvention. It is important to understand that the present invention maybe embodied in many alternate forms and should not be construed aslimited to the exemplary embodiments set forth herein. It will be understood that, although the terms “first”, “second”, “A”,“B”, etc. may be used herein in reference to elements of the invention,such elements should not be construed as limited by these terms. Forexample, a first element could be termed a second element, and a secondelement could be termed a first element, without departing from thescope of the exemplary embodiments. Herein, the term “and/or” includesany and all combinations of one or more referents. It will be understood that when an element is referred to as being“connected” or “coupled” to another element, it can be directlyconnected or coupled to the other element or intervening elements may bepresent. In contrast, when an element is referred to as being “directlyconnected” or “directly coupled” to another element, there are nointervening elements. Other words used to describe relationships betweenelements should be interpreted in a like fashion (i.e., “between” versus“directly between,” “adjacent” versus “directly adjacent,” etc.). The terminology used herein to describe the exemplary embodiments is notintended to limit the scope of the invention. The articles “a,” “an,”and “the” are singular in that they have a single referent, however theuse of the singular form in describing the exemplary embodiments shouldnot preclude the presence of more than one referent. In other words,elements of the invention referred to as singular may number one ormore, unless the context clearly indicates otherwise. It will be furtherunderstood that the terms “comprises,” “comprising,” “includes,” and/or“including,” when used herein, specify the presence of stated features,items, steps, operations, elements, and/or components, but do notpreclude the presence or addition of one or more other features, items,steps, operations, elements, components, and/or groups thereof. Unless otherwise defined, all terms (including technical and scientificterms) used herein are to be interpreted as is customary in the art towhich this invention belongs. It will be further understood that termsin common usage should also be interpreted as is customary in therelevant art and not in an idealized or overly formal sense unlessexpressly so defined herein. Meanwhile, when it is possible to implement any exemplary embodiment inany other way, a function or an operation specified in a specific blockmay be performed differently from a flow specified in a flowchart. Forexample, two consecutive blocks may actually perform the function or theoperation simultaneously, and the two blocks may perform the function orthe operation conversely according to a related operation or function. Exemplary embodiments will be described below with reference to attacheddrawings. FIG. 1 is a block diagram illustrating a related art EtherCAT controldevice. Referring to FIG. 1, an EtherCAT control device 10 includes a master 11and first to fourth slaves 21 to 24, respectively. The master 11 maytransfer data according to an EtherCAT protocol to each of the first tofourth slaves 21 to 24. Further, the master 11 may receive dataaccording to the EtherCAT protocol from each of the first to fourthslaves 21 to 24. The first to fourth slaves 21 to 24 may control fouraxes of a robot, respectively. According to the exemplary embodiment,the first to fourth slaves 21 to 24 are illustrated, but the number ofslaves is not limited thereto. The master 11 includes a communication device 11 a capable oftransferring or receiving data according to the EtherCAT protocol, acentral processing unit (CPU) 11 b including an operating system (OS)for operating the EtherCAT control device 10, a master clock circuit 11c configured to generate a master clock M_CLK used when transferring anoperational command CMD to the first to fourth slaves 21 to 24 and alogic circuit 11 d configured to execute an interrupt to the CPU 11 b insynchronization with the master clock M_CLK. According to the exemplary embodiment, the communication device 11 a maybe implemented as a local area network (LAN). The master clock circuit11 c may be implemented by ATMEGA AVR. The logic circuit 11 d may beimplemented by PCI9030. An industrial robot may be operated throughcontrolling a motor installed in each of the axes of the industrialrobot. Each of the first to fourth slaves 21 to 24 includes a motor driveconfigured to operate a motor connected to an axis, a digital signalprocessor (DSP) configured to control the motor drive, and an EtherCATSlave Controller (ESC) configured to transfer and receive data accordingto the EtherCAT protocol. A method of synchronizing the timing between amaster and a slave will be described through FIG. 2. FIG. 2 is a timing diagram for describing a method of synchronizing thetiming between a master and a slave in the EtherCAT control device 10shown in FIG. 1. Referring to FIGS. 1 and 2, the master clock circuit 11 c may generate amaster clock M_CLK having a period of 500 μsec. The CPU 11 b may correctthe period of the master clock M_CLK to synchronize the timing with thefirst to fourth slaves 21 to 24. Specifically, the master 11 transfers an operational command to one ofthe first to fourth slaves 21 to 24 in synchronization with an evennumbered rising edge in the master clock M_CLK. For example, in t1 time, the master 11 may transfer an operationalcommand N to one of the first to fourth slaves 21 to 24 insynchronization with an even numbered rising edge in the master clockM_CLK. In t2 time, the first slave 21 receives the operational command N. Butthe operational command N may have a delay (i.e. t2−t1) from an evennumbered rising edge to t2 time by jitter. At this moment, the firstslave 21 stores time information (i.e. t2) received the operationalcommand N and time difference (i.e. t3−t2) information between the t2time and the next slave synchronization time (i.e. t3). The first slave 21 may generate an ESC clock signal ESC_CLK having a 1msec period using an ESC. The first slave 21 transfers the timedifference (i.e. t3−t2) information to the master 11 when a nextoperational command N+1 is transferred. In order to constantly maintain the time difference (i.e. t3−t2) as 500μsec, the period of the master clock M_CLK may be extended or beshortened by the master 11. Accordingly, the master 11 may synchronizethe timing between the master clock M_CLK and the ESC clock ESC_CLK as areference time for the first slave 21. Further, the EtherCAT controldevice 10 may remove the jitter effect. FIG. 3 is a conceptual diagram for describing the problem shown in FIG.2. Referring to FIGS. 1 to 3, a related art method of synchronizing thetiming between the master 11 and the first slave 21 may have a timingjitter of about ±600 μsec. In this case, there is no problem incommunication between a master and a slave that have a 16 msec period.On the contrary, recently, a communication period between a master and aslave is reduced to 1 msec for high-speed and precise control. To solvethis problem, the method shown in FIG. 2 may not be used. For example, when the first slave 21 receives an operational command Nfrom the master 11, if a transmission of the operational command N bythe master 11 is late, a problem occurs in the motor operation of arobot. This is because the first slave 21 does not receive theoperational command N before the first slave 21 executes an operation. FIG. 4 shows a factory automation system according to an exemplaryembodiment. Referring to FIG. 4, the factory automation system 1000 according to theexemplary embodiment includes an EtherCAT control device 100 and anindustrial robot 101. The industrial robot 101 may operate through an operation of a motorinstalled in each axis. The EtherCAT control device 100 may control themotor installed in each axis. In the exemplary embodiment, the EtherCATcontrol device 100 may control the motor of the industrial robot 101according to the EtherCAT protocol. The EtherCAT control device 100 willbe described through FIG. 5 in detail. FIG. 5 is a block diagram illustrating an EtherCAT control device shownin FIG. 4. Referring to FIGS. 4 and 5, the EtherCAT control device 100 includes amaster 110 and first to fourth slaves 121 to 124. The master 110 maytransfer data according to the EtherCAT protocol to each of the first tofourth slaves 121 to 124. Further, the master 110 may receive data fromeach of the first and fourth slaves 121 to 124 according to the EtherCATprotocol. In the exemplary embodiment, the first to fourth slaves 121 to124 are shown, but the number of slaves is not limited thereto. The master 110 includes a dummy ESC 111, a CPU 112, and a communicationdevice 113. The dummy ESC 111 may be implemented using the same ESC asan ESC included in each of the first to fourth slaves 121 to 124. Inaddition, the ESC has a clock function. Generally, each of the first to fourth slaves 121 to 124 may synchronizetiming according to a precision time protocol (PTP) method through thefirst to fourth salves 121 to 124 respective ESC. For example, when theslave 121 operates as a time master, each of the second to fourth slaves122 to 124 operates as a time slave. The PTP method will be describedthrough FIG. 6 in detail. To synchronize the timing between the master 110 and the first to fourthslaves 121 to 124, the master 110 operates as the time slave. That is,the time master 110 may synchronize the timing with the time masteraccording to the PTP method. A method of synchronizing the timingbetween the time master and a plurality of the time slaves is performedusing the PTP method. Generally, an ESC may perform a drive preparation operation to perform anormal operation. The drive preparation operation may include aninitialization operation for initialization, a communication operationfor preparation of safe operational operation, a pre-operationaloperation for confirming a read operation, and an operational operationfor confirming a write operation. The dummy ESC 111 may perform thedrive preparation operation by itself. Further, to perform the drive preparation operation, the EtherCATcontrol device 100 may further include another chip, that is, a DSP.This exemplary embodiment will be described through FIG. 7. The CPU 112 may communicate data with the first to fourth slaves 121 to124 through the communication device 113. In one exemplary embodiment,the communication device 113 may include a LAN. The CPU 112 and thecommunication device 113 may be connected through a peripheral componentinterconnect (PCI) bus. The dummy ESC 111 and the communication device113 may be connected through an EtherCAT. Each of the first to fourthslaves 121 to 124 further includes a motor drive configured to drive amotor operating the industrial robot 101 and a digital signal processor(DSP) configured to control the motor drive. Generally, a masteroperated by real-time operating system (RTOS) has a precise clockfunction. Accordingly, the master may synchronize timing with aplurality of slaves. However, when the master 110 includes an OS without guaranteeingreal-time, the EtherCAT control device 100 may synchronize the timebetween the master 110 and the first to fourth slaves 121 to 124 usingthe method shown in FIG. 2. Here, a clock period for data communicationbetween the master 110 and the first to fourth slaves 121 to 124 is 1msec, the data communication between the master 110 and the first tofourth slaves 121 to 124 can be affected by jitter because of low timingmargin. To solve this problem, the master 110 may synchronize the timing withthe first slave 121 operating as a time master through the dummy ESC111. Accordingly, the timing between an ESC clock ESC_CLK of the dummyESC 111 and an ESC clock ESC_CLK of the first slave 121 may besynchronized. The master 110 may transfer an operational command to oneof the first to fourth 121 to 124 in synchronization with the ESC clockESC_CLK. FIG. 6 is a conceptual diagram for explaining a synchronization processbetween the first to fourth slaves. Referring to FIGS. 5 and 6, in a synchronization process among the firstto fourth slaves 121 to 124, the first slave 21 operates as a timemaster and each of the second to fourth slaves 22 to 24 operates as atime slave. In the exemplary embodiment, the synchronization processamong the first to fourth slaves 121 to 124 may include a precision timeprotocol (PTP) method. The PTP method includes a protocol prescribed byInstitute of Electrical and Electronics Engineers (IEEE) 1588. For example, the first slave 121 operates as a time master, the secondslave 122 operates as a time slave. Each of the first and second slaves121 and 122 has an inherent clock because they both include an ESC. Master time is time of the time master (e.g. the first slave 121). Slavetime is time of the slave master (e.g. the second slave 122). At master time 50, the time master transfers a synchronization messageto the time slave. At slave time 32, the time slave receives thesynchronization message. When a communication overhead time is 0, thetime slave may be determined that time difference between time masterand the slave is 18 (i.e. 50−32). To increase the accuracy of the determination of the time difference,the time master transfers a follow-up message having one master timedifference from the synchronization message to the time slave. The timeslave corrects the time difference. Specifically, the time slave changesslave time 50 into slave time 32 At slave time 51, the time slavereceives the follow-up message. To measure a communication overhead time, the time slave transfers adelay request message to the time master at slave time 54. The timemaster receives the delay request message and transfers a delay responsemessage promptly to the time slave. The time slave receives the delayresponse message at slave time 58. When the time master does not count the time from receiving the delayrequest message to transferring the delay response message promptly, thecommunication overhead time is 4 (i.e. 58−54). When the communicationoverhead time is divided in half, the communication overhead time is aone-way communication overhead time. Accordingly, the time slave adds 2being the one-way communication overhead time to slave time. That is,the time slave changes slave time 60 into slave time 62. A method of synchronizing the timing among slaves is using an ESCincluded in each of the slaves. According to an exemplary embodiment, aRTOS and an ESC have similar functions. Accordingly, a master includinga RTOS performs a similar function such as an ESC. However, when the master shown in FIG. 5 guarantees a real-timeoperation, the method of synchronizing the timing among the slaves maynot be used. To solve this problem, the master 110 may include a dummyESC 111. That is, the EtherCAT control device 100 according to the exemplaryembodiment may apply the PTP method used among slaves to the master 110to synchronize the timing between the master 110 and the first to fourthslaves 121 to 124. During synchronizing the timing among the first to fourth slaves 121 to124, the master 110 may operate as a time slave using the dummy ESC 111.That is, when the first slave 121 operates as the time master, each ofthe second to fourth slaves 122 to 124 and the master 110 operates as atime slave. Through the PTP method, the master 110 may synchronize thetiming among the first to fourth slaves 121 to 124. FIG. 7 is a block diagram illustrating an EtherCAT control deviceaccording to another exemplary embodiment. Referring FIG. 7, an EtherCAT control device 200 has a similar structureto the EtherCAT control device 100 shown in FIG. 5 except a DSP 212.Therefore, the description thereof will not be repeated. In another exemplary embodiment, the master 210 may further include aDSP 212 configured to perform a drive preparation operation of a dummyESC 211. The DSP 212 may perform the drive preparation operation. Specifically,the DSP 212 may perform at least one from among an initializationoperation for initialization, a communication operation for preparationof safe operational operation, a pre-operational operation forconfirming a read operation, and an operational operation for confirminga write operation. FIG. 8 is a block diagram showing an EtherCAT control device accordingto another embodiment of the inventive concept. Referring to FIG. 8, an EtherCAT control device 300 has a similarstructure to the EtherCAT control device 100 shown in FIG. 5, exceptthat the control device 300 includes a master clock generator 312.Therefore, the description thereof will not be repeated. In another exemplary embodiment, the master clock generator 312configured to generate a master clock M_CLK is included in the master310. FIG. 9A is a graph showing synchronization jitter by a related artEtherCAT control device. Referring to FIGS. 1, 2, and 9A, the abscissa is time and the ordinateis time difference. The time difference (i.e. t3−t2) is shown in FIG. 2. Jitter by an EtherCAT control device 10, as shown in FIG. 1, may begenerated by adding jitter from a synchronization clock (i.e. t2−t1)(0.5 μsec), jitter from an OS (about 150 μsec), and jitter by thecommunication device 11 a (about 15 μsec). Jitter from the EtherCATcontrol device 10 shown in FIG. 1 is about 300 μsec. The jitter from thesynchronization clock in a total amount of jitter is very small. FIG. 9B is a graph showing synchronization jitter by the EtherCATcontrol device according to an exemplary embodiment. Referring to FIGS. 5 and 9A, the abscissa is time and the ordinate is atime difference. The time difference denotes (t3−t2) shown in FIG. 2. Jitter by an EtherCAT control device 100 shown in FIG. 5 may begenerated by adding jitter from a synchronization clock (0.5 μsec),jitter from OS (about 25 μsec), and jitter from the communication device11 a (about 2 μsec). Jitter by the EtherCAT control device 100 accordingto the exemplary embodiment is about 50 μsec. The total amount of jitteris reduced through a PTP method between a master and a slave. FIG. 10 shows an EtherCAT control device according to another exemplaryembodiment. Referring to FIGS. 5 and 10, the EtherCAT control device 400 may includea master device 410, a first slave group 420, and a second slave group430. In another exemplary embodiment, the EtherCAT control device 400 asillustrated includes two slave groups, but it is not limited thereto. Each of the first and second slave groups 420 and 430 may include aplurality of slaves. For example, the first slave group 420 may includethe first to fourth slaves 121 to 124 shown in FIG. 5. The master device 410 and the first slave group 420 may be connected viathe Ethernet cable. Likewise, the first slave group 420 and the secondslave group 430 may be connected via the Ethernet cable. The master device 410 may transfer an operational command to the firstor second slave groups 420 or 430 through the Ethernet cable. In theexemplary embodiment, the master device 410 may be implemented as themaster 110 shown in FIG. 5. The exemplary embodiments may be applied to an EtherCAT control deviceand a factory automation system having the same. The EtherCAT control device according to the exemplary embodimentincludes a dummy EtherCAT slave controller and synchronizes the timingbetween a master and a slave through the dummy EtherCAT slavecontroller. Accordingly, the EtherCAT control device may prevent anerror due to jitter in 1 ms operation. The EtherCAT control device according to the exemplary embodimentincludes a dummy EtherCAT slave controller (ESC) and synchronizes thetiming between a master and a slave through the dummy ESC. Accordingly,the EtherCAT control device may prevent an error due to an effect ofjitter in 1 ms operations. The foregoing is illustrative of exemplary embodiments and is not to beconstrued as limiting thereof. Although a few exemplary embodiments havebeen described, those skilled in the art will readily appreciate thatmany modifications are possible without materially departing from thenovel teachings and advantages. Accordingly, all such modifications areintended to be included within the scope of this inventive concept asdefined in the claims. In the claims, means-plus-function clauses areintended to cover the structures described herein as performing therecited function, and not only structural equivalents but alsoequivalent structures. What is claimed is: 1. An EtherCAT control device, comprising: a masterincluding a dummy EtherCAT slave controller (ESC); and a first slaveconfigured to communicate data with the master according to an EtherCATprotocol, wherein the master synchronizes a timing with the first slaveaccording to a precision time protocol (PTP) method using the dummy ESC.2. The EtherCAT control device according to claim 1, further comprising:a second slave configured to communicate data with the master accordingto the EtherCAT protocol, wherein each of the first slave and the secondslave includes an ESC, and each of the first slave and the second slavesynchronizes the timing with each other through the corresponding ESCaccording to the PTP method. 3. The EtherCAT control device according toclaim 2, wherein the first slave operates as a time master and each ofthe master and the second slave operates as a time slave. 4. TheEtherCAT control device according to claim 2, wherein the first slavecontrols a first motor corresponding to a first axis of a robot and thesecond slave controls a second motor corresponding to a second axis ofthe robot. 5. The EtherCAT control device according to claim 1, whereinthe dummy ESC performs a drive preparation operation by itself, whereinthe drive preparation operation includes an initializing operation, asafety operating operation, a pre-operating operation, and an operatingoperation. 6. The EtherCAT control device according to claim 5, whereinthe master further comprises a digital signal processor (DSP) configuredto execute the drive preparation operation of the dummy ESC. 7. TheEtherCAT control device according to claim 1, wherein the master furthercomprises a central processing unit (CPU) operated according to anoperating system, wherein the operating system does not include aReal-Time Operation System. 8. The EtherCAT control device according toclaim 1, wherein the PTP method observes a protocol prescribed byInstitute of Electrical and Electronics Engineers (IEEE) 1588. 9. TheEtherCAT control device according to claim 1, wherein the master furtherincludes a master clock generator configured to generate a master clock,and the master transfers an operational command in synchronization withthe master clock to the first slave or the second slave. 10. A factoryautomation system, comprising: a robot having a first motor mounted on afirst axis and a second motor mounted on a second axis; and an EtherCATcontrol device configured to control the robot, wherein the EtherCATcontrol device comprises: a master including a dummy ESC; and a firstslave configured to communicate data with the master according to anEtherCAT protocol, wherein the master synchronizes a timing with thefirst slave according to a PTP method using the dummy ESC. 11. Thefactory automation system according to claim 10, further comprising asecond slave configured to communicate data with the master according tothe EtherCAT protocol, wherein each of the first slave and the secondslave includes an ESC, and each of the first slave and the second slavesynchronizes the timing with each other through the corresponding ESCaccording to the PTP method. 12. The factory automation system accordingto claim 11, wherein the first slave controls the first motor inresponse to a first operational command from the master and the secondslave controls the second motor in response to a second operationalcommand from the master 13. The factory automation system according toclaim 11, wherein the first slave operates as a time master and each ofthe master and the second slave operates as a time slave. 14. Thefactory automation system according to claim 11, wherein the masterfurther comprises: a CPU operated according to an operating system,wherein the operating system does not include a real-time operatingsystem. 15. The factory automation system according to claim 10, whereinthe dummy ESC performs a drive preparation operation, and the drivepreparation operation includes an initializing operation, a safetyoperating operation, a pre-operating operation, and an operatingoperation. 16. A method of controlling an EtherCAT control device, themethod comprising: communicating data from a master, which includes adummy EtherCAT slave controller (ESC), with a first slave; andsynchronizing a timing with the first slave according to a precisiontime protocol (PTP) method using the dummy ESC. 17. The method accordingto claim 16, wherein the communicating includes communicating data fromthe master to a second slave, and the synchronizing includessynchronizing the timing between the first slave and the second slavethrough corresponding ESC according to the PTP method. 18. The methodaccording to claim 16, further comprising: performing a drivepreparation operation by the dummy ESC, wherein the drive preparationoperation includes an initializing operation, a safety operatingoperation, a pre-operating operation, and an operating operation. 19.The method according to claim 16, further comprising: generating amaster clock by the master, and transferring an operational command bythe master from the first slave to the second slave in synchronizationwith the master clock..
common_corpus
{'identifier': 'US-201414528633-A_1', 'collection': 'USPTO', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '2014.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '5293', 'token_count': '7152', '__index_level_0__': '298', 'original_id': 'd09641f961599c9ab412cdb91a98fe3a8acb51f454055c890c8660c9731011cf'}
Q: Is it possible to initialize a window resize callback function in R (or similar)? In base R, I am attempting to perform a specific command (i.e. re-render display with re-computed fonts) when the window/device is resized. Moreover, a user is most likely to resize the window during an active input query (as the program is waiting for input/confirmation to proceed). In most programs, I would expect to create a resize callback function, like in GLFW, but I would not be surprised if R does not have such a feature. I was curious if anybody knew any solutions for handling window resizes in R. I have looked around and could not find any obvious way to do it. A: Is this Linux or Windows? If you use base R in Linux and get there using ssh, the command tput cols report the number of columns (i.e. the width) of your terminal. It probably works also directly in a Linux machine without ssh. If you run R in the command line and then run system("tput cols"), it will report you the size of the window. You could always check for the size every few functions and, in the case it changes, do something. Even though this is definitely a dirty solution and probably not portable, it might point you to the right direction. Good luck.
mini_pile
{'original_id': 'e796ea69edefaf93f3b6ca036ef792ff513e4c3a45ea8dee7572bb90e3c49697'}
Main menu Post navigation Security Blanket Sometimes it’s best to pull people into a false sense of security, to assure them that you’re okay, and that it’s okay, and that there’s no need to worry. Sometimes it’s safer, and it’s easier, and saves hassle and questions. But if that person really knows you, they’ll never truly believe it. Perhaps for a while, in a wasted attempt to be free, they’ll try to trust you, and allow you to cover them with the security blanket, too. They will allow themselves to believe that you are okay, because they don’t want to fear for your life every day. But when that person has the revelation once more that it’s not true, it’s a shock. If that person knows and loves you, it won’t be long before they realise the lies. Actually, you’re not okay. And I should have been worrying about you. It’s then, when that person realises that they’ve been missing the truth, that they are crushed. It’s when they notice that things aren’t right. It’s when they hate themselves for believing the lies, and allowing the security blanket to envelop them. It’s only then that the person feels guilt. When the blanket is ripped away, they scream from the pain. It’s when they feel like a hot dagger has torn through them. They stopped helping. They thought it was okay. It’s then that they become emotionless, fearful, and afraid. It’s then that they realise that they should have predicted it all along. It’s only now that I realise how stupid I’ve been. I let her pull the blanket over my eyes, and now the reality has hit me with one big THWACK. Once more, my fear for her is deep in my chest, and even if it may be one thing too much right now, nothing can make the ache go away. I love her, I can’t be blind anymore. Even if she wants to be blind, I won’t. Because I fear for her life.
mini_pile
{'original_id': 'fb137a9f8b689034b0fe73220812c17057dee25c07754e673aa1039f8dd3fbb4'}
Q: Induction proof, help please? I have a problem that I need to prove using induction. Prove that a surjective function has at least as many members in its domain as it does in its codomain. Do I begin by using the axiom of choice? Thanks. A: If you need to use induction then it is probably that your function is between finite sets. In that case you don't need the axiom of choice. For the general case, you do need the axiom of choice. But you can't really use induction either. Since there seem to be a dispute on why induction is not a valid method for the infinite case, let me spell out the reason. The reason you can't use induction is that in order to pass from a set of cardinality $\kappa$ to a set of cardinality $\kappa^+$, and in order to use the induction hypothesis (and that's where induction really works, otherwise using the word induction won't make it a proof by induction), you will have to start with a set of cardinality $\kappa^+$ and remove some part of it. Removing a part of cardinality less than $\kappa^+$ won't change the cardinality and therefore you cannot use the induction hypothesis; removing a part of cardinality $\kappa^+$ doesn't guarantee that you end up with a set of cardinality less than $\kappa^+$ in order to use the induction hypothesis; and if you do remove almost the entire set, then in order to deduce from the induction hypothesis on $\kappa$ to the case of $\kappa^+$ you have to actually assume that the case of $\kappa^+$ was correct to begin with -- thus begging the question. Moreover, if you are not intending to use the axiom of choice then the claim is consistently false; that is to say it is perfectly possible that there is a set which can be mapped onto a strictly larger set than itself when the axiom of choice fails. So you have to use the axiom of choice in order to prove this claim, and if you do -- then you might as well use it directly. As in Peter's answer on this page. In any case, for the issue of finite sets, here is some elaborated hint: Suppose $f\colon A\to B$ is a surjection, we prove by induction that if $A$ has $n$ members then $B$ has no more than $n$ members. For $n=1$ this is trivial because $A$ is a singleton, so $B$ must be a singleton as well. Suppose this is true for $n$, and let $A$ be a set of size $n+1$. Pick some $a\in A$, and consider $A'=A\setminus\{a\}$. If $f\upharpoonright A'$ is still a surjection onto $B$, then we can use the induction hypothesis to conclude that $B$ has at most $n$ members and we are done. In the other case, $f\upharpoonright A'$ is not surjective. Conclude that there is some $b\in B$ such that $f\upharpoonright A'\colon A'\to B\setminus\{b\}$ is a surjection, therefore $B\setminus\{b\}$ has at most $n$ members and therefore $B$ has at most $n+1$ members as wanted.
mini_pile
{'original_id': '6333086bf7632e6661e202ae9598dbd3fa10068bd91cdb4776776e33f9e1a787'}
Aleksandar Cvetković (footballer) Aleksandar Cvetković (; born 4 June 1995) is a Serbian football defender who plays for Grasshopper Club Zürich. References External links Aleksandar Cvetković stats at utakmica.rs Category:1995 births Category:Living people Category:People from Prokuplje Category:Association football defenders Category:Serbian footballers Category:Serbian expatriate footballers Category:FK BSK Borča players Category:FK Jagodina players Category:FC Wohlen players Category:Grasshopper Club Zürich players Category:Serbian First League players Category:Serbian SuperLiga players Category:Swiss Super League players Category:Swiss Challenge League players Category:Expatriate footballers in Switzerland
mini_pile
{'original_id': 'fd3e2f9f6c8cee314cbe3532e33729b6c0c244c7270d271b7d99d243dbd3bd56'}
Oral lichen planus and diabetes mellitus. A clinico-pathological study. A study was made of 72 patients with oral lichen planus associated (n = 28) or not with diabetes mellitus (n = 44). No significant differences were observed between both groups in terms of the location of the lichen planus lesions on the buccal mucosa, palate, gums or floor of the mouth. On the other hand, the diabetics exhibited a greater frequency of oral lichen planus on the tongue. Atrophic-erosive lesions were more common in patients with lichen planus associated with diabetes. Finally, no differences were observed between the two groups in terms of absolute inflammatory infiltrate in the connective tissue of the oral lichen planus lesions.
mini_pile
{'original_id': 'e75a09cae0b7abdf0066718d4cd2b86c99a6c25843b79bbc33c8e77af68bbe5e'}
Entrepreneur Mindset-Success Club Tee Looking for tee to keep your motivation to be an entrepreneur keep burning? It's all mindset and when you're on your journey of being an entrepreneur or making career moves, you have to keep yourself motivated. There is something so powerful about wearing this tee. Spread the motivation! Related Items
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9257147908210754}", 'metadata': "{'Content-Length': '57541', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZD5ZX2RDXYYBBCU4T2RNP4HFJHZEO7KR', 'WARC-Concurrent-To': '<urn:uuid:cdc56365-82ed-4f67-95fc-29691d2d9765>', 'WARC-Date': datetime.datetime(2019, 5, 21, 9, 16, 28), 'WARC-IP-Address': '23.227.38.32', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:P4XIHJM3VRLREHNREN6NLRFTSR5DI452', 'WARC-Record-ID': '<urn:uuid:88475685-b5a0-4578-83b4-14dff8007502>', 'WARC-Target-URI': 'https://springandfifth.com/products/entrepreneur-mindset-success-club-tee', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:47a1409f-a537-4ff5-b923-b5856cb51f6a>', 'WARC-Truncated': None}", 'previous_word_count': '53', 'url': 'https://springandfifth.com/products/entrepreneur-mindset-success-club-tee', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-7-214-88.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.033060550689697266', 'original_id': '22a0dadc8de10ee7799fb1626b182bbf03e454c27517430cbae63042ec773872'}
Nowadays, "people" is almost always the right choice when you are talking about more than one person. Some dictionaries don't even include "persons" as the plural of "person" anymore, and the few dictionaries that do include "persons" note that it is uncommon, archaic, or going out of style. Traditionally, "people" was proper when referring to a mass of people: John couldn't believe how many people were at the wrestling match. "Persons" was proper when referring to a distinct number of individuals: John noted that eight persons showed up for the book club meeting. Grammar Girl Category: | edit post 3 Responses 1. Sugar Says: LOL. i thought persons is a wrong grammar-ed word ..=) thanks for the info . =) 2. amiable amy Says: good job teacher...hehehe...what about this: PEOPLES BANK ...yep, a big signage of a bank here in MS... 3. Sera Melinda Says: Peoples - the human beings of a particular nation or community or ethnic group. Funny cartoon of the day Funny cartoon of the day
dclm_baseline
{'bff_contained_ngram_count_before_dedupe': '40', 'language_id_whole_page_fasttext': "{'en': 0.9483467936515808}", 'metadata': "{'Content-Length': '85779', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4FDISKHU3MKCCD6J6PDCZPSLDPXXMHIZ', 'WARC-Concurrent-To': '<urn:uuid:c1ca89ab-f447-47ee-8f11-ae259a83f8ad>', 'WARC-Date': datetime.datetime(2017, 8, 19, 14, 46, 16), 'WARC-IP-Address': '172.217.7.161', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:J2ZPHRNUYZXWPP5VCBT4HPP5PRJNLCYL', 'WARC-Record-ID': '<urn:uuid:508dc19c-7bac-4411-afc1-b843ccc10807>', 'WARC-Target-URI': 'http://yelltale.blogspot.com/2009/04/people-vs-persons.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:52a8cf0f-dea3-4bd3-bdb3-f630b4741b43>', 'WARC-Truncated': None}", 'previous_word_count': '159', 'url': 'http://yelltale.blogspot.com/2009/04/people-vs-persons.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-233-154-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-34\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for August 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.33248746395111084', 'original_id': '95df74f09fb9da5a0e810f464cbbce759600d5063ab49de41b83e0f6e0b36f8b'}
if(GetRealmName() == "Remulos")then WP_Database = { ["Grif"] = "LT:759/96%SB:846/99%LM:962/98%", ["Corswain"] = "ET:664/88%SB:848/99%SM:1048/99%", ["Vaylor"] = "ST:791/99%SB:857/99%SM:1064/99%", ["Corad"] = "ST:829/99%SB:838/99%LM:986/98%", ["Elegan"] = "ET:712/92%SB:826/99%LM:974/98%", ["Woyier"] = "ST:809/99%SB:794/99%LM:969/98%", ["Deluxe"] = "ST:816/99%SB:838/99%SM:1039/99%", ["Sivaji"] = "ST:833/99%SB:837/99%SM:1099/99%", ["Wheresgank"] = "ST:867/99%SB:821/99%SM:1102/99%", ["Positron"] = "ST:806/99%SB:822/99%SM:1027/99%", ["Vigilance"] = "ST:813/99%SB:840/99%LM:973/98%", ["Dmo"] = "LT:786/98%SB:776/99%LM:991/98%", ["Honeypork"] = "LT:789/98%LB:789/98%LM:951/97%", ["Vociferant"] = "ST:849/99%SB:851/99%SM:1066/99%", ["Nevil"] = "LT:757/96%SB:826/99%SM:1004/99%", ["Knowl"] = "LT:768/97%SB:811/99%SM:1036/99%", ["Cato"] = "ST:846/99%SB:840/99%SM:1059/99%", ["Pantykaty"] = "ST:796/99%SB:802/99%SM:1043/99%", ["Caprice"] = "ST:824/99%SB:823/99%SM:1001/99%", ["Gabê"] = "ST:851/99%SB:827/99%SM:1022/99%", ["Ozoops"] = "ST:857/99%SB:833/99%SM:1044/99%", ["Msstabyoback"] = "LT:782/98%SB:781/99%SM:1001/99%", ["Kikay"] = "ET:719/93%LB:789/98%EM:904/94%", ["Megaladon"] = "LT:764/97%SB:808/99%SM:1019/99%", ["Lorraine"] = "ET:732/93%SB:796/99%SM:1019/99%", ["Luai"] = "ST:808/99%SB:812/99%SM:1044/99%", ["Meetshield"] = "ST:799/99%SB:810/99%SM:989/99%", ["Papahav"] = "LT:752/95%SB:795/99%LM:960/97%", ["Jbwarrior"] = "LT:787/98%SB:816/99%SM:1014/99%", ["Lvs"] = "ST:809/99%SB:816/99%SM:1106/99%", ["Tsuyuri"] = "LT:773/97%SB:815/99%LM:981/98%", ["Dagrim"] = "ET:735/94%SB:802/99%EM:752/80%", ["Ktey"] = "ST:799/99%LB:794/98%SM:1021/99%", ["Mux"] = "ST:810/99%SB:813/99%SM:999/99%", ["Chammy"] = "ST:802/99%SB:822/99%LM:969/98%", ["Razokur"] = "ET:701/90%LB:785/98%LM:958/98%", ["Kruel"] = "LT:787/98%SB:810/99%SM:1009/99%", ["Potate"] = "LT:771/97%LB:780/98%LM:972/98%", ["Ribbly"] = "ET:741/94%LB:788/98%SM:1021/99%", ["Pinaka"] = "LT:770/97%SB:803/99%LM:981/98%", ["Porkflute"] = "ET:682/89%LB:788/98%LM:962/97%", ["Junnyw"] = "ET:733/94%LB:781/98%LM:988/98%", ["Momosauce"] = "ET:581/78%SB:822/99%SM:1027/99%", ["Jy"] = "LT:774/97%LB:782/98%LM:920/95%", ["Clunkers"] = "ET:724/93%SB:808/99%SM:1035/99%", ["Winstaford"] = "ST:804/99%SB:801/99%LM:982/98%", ["Pslim"] = "ST:803/99%SB:808/99%SM:991/99%", ["Insomniak"] = "ST:793/99%SB:805/99%SM:1026/99%", ["Shamwa"] = "ET:733/94%LB:792/98%LM:981/98%", ["Aglerion"] = "LT:791/98%SB:797/99%LM:972/98%", ["Boadofbivia"] = "LT:777/97%SB:797/99%SM:1003/99%", ["Lecundra"] = "LT:750/95%LB:775/97%LM:938/95%", ["Boomboomroom"] = "LT:459/95%LB:789/98%LM:944/95%", ["Hodor"] = "ET:331/89%LB:773/97%LM:952/96%", ["Devchaos"] = "LT:752/95%LB:783/98%LM:939/96%", ["Nitram"] = "ET:726/93%SB:809/99%SM:1003/99%", ["Baelan"] = "LT:756/96%LB:774/97%LM:955/97%", ["Alurian"] = "LT:763/96%LB:779/97%LM:932/96%", ["Cliftonius"] = "RT:404/55%SB:802/99%SM:1058/99%", ["Bixw"] = "LT:759/96%LB:778/97%EM:883/92%", ["Izgard"] = "LT:743/95%LB:771/97%LM:957/97%", ["Kyreen"] = "LT:760/96%LB:791/98%SM:1013/99%", ["Dodgem"] = "LT:759/96%LB:797/98%SM:989/99%", ["Arktick"] = "ET:659/86%LB:773/97%LM:969/98%", ["Octomore"] = "ET:699/90%SB:800/99%SM:1011/99%", ["Ahx"] = "ET:676/88%LB:786/98%LM:980/98%", ["Bottas"] = "ET:588/78%LB:787/98%LM:956/97%", ["Unrivalled"] = "ST:800/99%SB:846/99%SM:1077/99%", ["Thekhemistau"] = "ET:651/85%LB:767/96%LM:939/95%", ["Mouthbreathr"] = "ET:618/83%LB:768/97%LM:916/95%", ["Invaderz"] = "ST:830/99%SB:874/99%SM:1031/99%", ["Materia"] = "LT:768/97%SB:923/99%SM:1019/99%", ["Emiren"] = "LT:770/97%LB:770/97%LM:944/96%", ["Hawkington"] = "ET:737/94%LB:792/98%LM:963/97%", ["Klarra"] = "LT:757/96%LB:789/98%LM:974/98%", ["Gooberbear"] = "LT:746/95%LB:775/97%EM:903/93%", ["Hackmebro"] = "CT:87/10%LB:774/97%LM:950/96%", ["Syulain"] = "LT:746/95%SB:777/99%SM:1019/99%", ["Spookss"] = "ET:420/93%LB:791/98%EM:810/84%", ["Shinsapper"] = "ET:710/91%LB:782/98%LM:995/98%", ["Kurenai"] = "ET:726/93%LB:787/98%EM:877/91%", ["Ditty"] = "ST:796/99%SB:800/99%LM:969/97%", ["Gabé"] = "LT:748/95%LB:777/97%LM:923/95%", ["Guire"] = "ET:416/94%LB:785/98%LM:931/96%", ["Victra"] = "ET:633/82%LB:780/98%EM:889/91%", ["Wayn"] = "ET:380/93%EB:747/94%LM:960/98%", ["Andor"] = "ET:700/90%SB:813/99%SM:1023/99%", ["Furyz"] = "ET:745/94%LB:786/98%LM:934/96%", ["Pounding"] = "ET:706/91%LB:783/98%LM:946/97%", ["Hicki"] = "ET:719/93%LB:783/98%LM:982/98%", ["Dismas"] = "ST:798/99%SB:801/99%SM:1057/99%", ["Roguebro"] = "ET:735/94%SB:801/99%LM:965/97%", ["Shadow"] = "ET:659/85%LB:725/98%EM:922/94%", ["Orctopus"] = "LT:778/97%SB:803/99%SM:1000/99%", ["Crad"] = "ET:665/92%SB:967/99%SM:1164/99%", ["Meropenem"] = "ST:730/99%LB:771/97%LM:963/97%", ["Gyumao"] = "ET:689/89%LB:766/96%LM:936/95%", ["Duma"] = "LT:615/98%LB:779/97%LM:952/96%", ["Steelbots"] = "ET:389/94%LB:759/96%LM:968/97%", ["Kaythik"] = "ET:647/86%LB:773/97%LM:969/98%", ["Zu"] = "RT:517/69%SB:835/99%SM:1069/99%", ["Nyamelia"] = "LT:869/98%SB:957/99%SM:1015/99%", ["Mesa"] = "LT:813/95%SB:833/99%LM:958/97%", ["Soulcapter"] = "ET:774/93%SB:844/99%LM:952/98%", ["Hammersmith"] = "ET:731/90%SB:810/99%SM:985/99%", ["Embulance"] = "ST:893/99%SB:811/99%LM:945/98%", ["Elarandria"] = "ST:740/99%SB:776/99%LM:966/98%", ["Dixie"] = "LT:873/98%SB:810/99%SM:1029/99%", ["Frizy"] = "ET:791/94%LB:753/97%EM:604/89%", ["Hãmmy"] = "LB:751/98%EM:855/91%", ["Vinct"] = "ST:896/99%SB:835/99%SM:985/99%", ["Freycinet"] = "LT:810/95%SB:775/99%LM:957/98%", ["Croaks"] = "LT:876/98%SB:827/99%LM:964/98%", ["Rular"] = "LT:853/98%LB:760/98%LM:953/98%", ["Dummydummy"] = "ST:942/99%SB:863/99%SM:1062/99%", ["Underhill"] = "ET:750/91%SB:797/99%SM:996/99%", ["Crafte"] = "LT:869/98%SB:824/99%SM:962/99%", ["Hâmmy"] = "ST:891/99%SB:806/99%SM:1001/99%", ["Darny"] = "LT:806/95%SB:805/99%SM:998/99%", ["Vallien"] = "LT:857/98%SB:813/99%SM:1018/99%", ["Lucabella"] = "LT:857/98%SB:826/99%SM:1036/99%", ["Muse"] = "ST:803/99%SB:762/99%SM:901/99%", ["Onyachin"] = "LT:806/95%SB:820/99%LM:963/98%", ["Jock"] = "LT:845/97%LB:735/97%LM:947/97%", ["Flummoxed"] = "LT:829/96%LB:764/98%SM:1014/99%", ["Mishil"] = "ST:878/99%SB:804/99%SM:1045/99%", ["Themapples"] = "ST:731/99%SB:783/99%LM:938/98%", ["Daddytriton"] = "LT:853/98%SB:771/99%SM:1054/99%", ["Pivit"] = "LT:535/96%LB:718/96%EM:699/94%", ["Arinaomi"] = "ST:910/99%SB:791/99%SM:991/99%", ["Krysinello"] = "LB:740/97%LM:947/97%", ["Orthae"] = "ET:743/90%LB:736/97%LM:944/97%", ["Echoless"] = "ST:878/99%SB:798/99%LM:951/98%", ["Beradws"] = "ST:883/99%SB:791/99%SM:969/99%", ["Illusory"] = "RT:569/72%LB:719/96%EM:835/90%", ["Evangelus"] = "ET:677/84%SB:771/99%SM:1027/99%", ["Fatherino"] = "ET:340/84%EB:691/94%EM:830/89%", ["Inamorata"] = "LT:864/98%SB:788/99%SM:995/99%", ["Iheartbeard"] = "RT:496/62%SB:773/99%EM:888/94%", ["Lightspell"] = "ET:788/94%SB:772/99%EM:860/92%", ["Shieldhearth"] = "ET:375/89%EB:702/94%LM:918/95%", ["Meowzers"] = "LT:849/97%SB:805/99%LM:974/98%", ["Dear"] = "ST:877/99%SB:796/99%LM:909/96%", ["Zaheer"] = "ET:790/94%LB:753/98%LM:933/97%", ["Gooberduck"] = "LT:869/98%SB:773/99%LM:899/96%", ["Garet"] = "ET:760/92%LB:729/96%LM:935/97%", ["Pandaheals"] = "LT:862/98%SB:817/99%SM:1009/99%", ["Nivag"] = "ET:726/89%LB:725/96%LM:931/97%", ["Kasshealz"] = "LT:854/98%SB:779/99%SM:988/99%", ["Thôrkell"] = "LT:815/96%LB:727/96%LM:911/95%", ["Hexenkin"] = "ET:765/92%LB:774/98%LM:940/97%", ["Hydrostasis"] = "LT:811/95%SB:782/99%SM:1018/99%", ["Panadoll"] = "UT:354/43%LB:589/96%LM:945/97%", ["Healwench"] = "ET:685/85%LB:743/97%RM:674/73%", ["Keefette"] = "ET:775/93%LB:761/98%EM:907/94%", ["Dog"] = "LB:751/98%SM:1000/99%", ["Incognito"] = "LT:814/96%LB:765/98%LM:945/98%", ["Pandorè"] = "ST:895/99%SB:816/99%SM:1076/99%", ["Healman"] = "UT:261/31%EB:703/93%EM:880/92%", ["Vestal"] = "ET:684/85%LB:770/98%SM:992/99%", ["Dawie"] = "LT:678/98%SB:692/99%EM:880/93%", ["Fintyowl"] = "ET:773/93%SB:776/99%LM:963/98%", ["Eclipsie"] = "ST:744/99%LB:744/97%LM:966/98%", ["Thundereye"] = "ET:778/93%LB:766/98%LM:921/95%", ["Dvsevo"] = "LT:539/96%LB:757/97%EM:851/90%", ["Merille"] = "LT:793/95%LB:755/98%SM:992/99%", ["Locklear"] = "ET:769/93%LB:767/98%SM:1000/99%", ["Cornwall"] = "ET:445/92%LB:610/97%LM:910/96%", ["Kaliannah"] = "ET:648/82%SB:829/99%SM:1072/99%", ["Broad"] = "ET:722/89%LB:729/96%LM:914/95%", ["Bbqshapes"] = "RT:251/73%LB:754/97%SM:983/99%", ["Karlowaty"] = "LT:825/96%SB:800/99%LM:957/98%", ["Crayolas"] = "ET:776/93%LB:621/97%SM:980/99%", ["Aemy"] = "ET:697/86%EB:637/89%EM:846/93%", ["Aleetosus"] = "ET:384/87%LB:743/96%EM:912/94%", ["Bloodash"] = "LT:825/96%SB:773/99%SM:1015/99%", ["Peggy"] = "LT:838/97%LB:768/98%LM:936/98%", ["Ibuprophene"] = "LT:558/97%LB:742/97%EM:583/88%", ["Jaszmine"] = "RT:502/64%LB:718/95%EM:740/80%", ["Orad"] = "ET:783/93%LB:776/98%SM:993/99%", ["Otherguy"] = "ET:749/91%LB:716/96%LM:928/97%", ["Morphíne"] = "ST:769/99%LB:763/97%EM:871/93%", ["Reasonabull"] = "LT:645/98%LB:756/98%LM:877/98%", ["Sharma"] = "LT:571/96%LB:774/98%LM:921/95%", ["Jezreel"] = "ST:768/99%LB:731/97%LM:928/96%", ["Talm"] = "ET:684/85%LB:768/98%LM:940/98%", ["Gililib"] = "RT:234/70%LB:748/97%EM:816/87%", ["Dorrgh"] = "UT:313/38%LB:711/95%SM:1032/99%", ["Pellinore"] = "ET:785/94%LB:754/98%EM:898/94%", ["Asunaa"] = "LT:666/98%LB:749/97%LM:929/97%", ["Hammerpleb"] = "RT:202/63%LB:714/95%RM:634/72%", ["Healstomp"] = "ET:758/92%SB:737/99%LM:936/98%", ["Dankbeard"] = "ET:769/93%LB:759/98%LM:934/96%", ["Grentirus"] = "UT:358/44%LB:711/95%LM:903/95%", ["Foobar"] = "ST:886/99%SB:869/99%LM:932/97%", ["Jasmìne"] = "LT:481/95%LB:738/97%LM:910/96%", ["Jawara"] = "LT:808/95%LB:773/98%LM:962/98%", ["Duckwaffle"] = "RT:253/74%EB:682/92%RM:604/69%", ["Ducia"] = "LT:867/98%LB:749/97%LM:946/98%", ["Chelsea"] = "ST:810/99%SB:838/99%SM:1030/99%", ["Katyhanpen"] = "ST:814/99%SB:835/99%SM:1033/99%", ["Gnomana"] = "ST:817/99%SB:852/99%SM:1055/99%", ["Awer"] = "LT:762/96%SB:797/99%LM:944/96%", ["Viviwarrior"] = "LT:782/98%LB:790/98%LM:975/98%", ["Kaeylie"] = "ST:798/99%SB:833/99%SM:1055/99%", ["Starbuk"] = "ST:718/99%LB:763/96%LM:968/97%", ["Vaymage"] = "LT:761/96%LB:732/96%EM:908/94%", ["Rahj"] = "LT:754/96%SB:801/99%SM:1028/99%", ["Coldkillae"] = "ST:810/99%SB:824/99%SM:1062/99%", ["Fooze"] = "LT:786/98%SB:849/99%SM:1117/99%", ["Eldon"] = "LT:788/98%SB:836/99%SM:1004/99%", ["Butter"] = "ST:844/99%SB:830/99%LM:973/98%", ["Sohmagical"] = "LT:787/98%LB:789/98%SM:1000/99%", ["Manstar"] = "LT:778/97%SB:811/99%SM:1008/99%", ["Sawcery"] = "ET:737/94%LB:770/97%LM:932/96%", ["Vivimage"] = "LT:787/98%SB:827/99%SM:1077/99%", ["Zurias"] = "ET:670/88%LB:756/95%LM:948/98%", ["Corks"] = "LT:785/98%SB:896/99%SM:1070/99%", ["Neglectful"] = "ST:805/99%SB:806/99%LM:991/98%", ["Inverted"] = "LT:761/96%SB:857/99%LM:974/98%", ["Kryptic"] = "ST:715/99%LB:760/96%LM:964/97%", ["Battousaii"] = "LT:785/98%SB:750/99%LM:951/97%", ["Manatwar"] = "LT:599/98%EB:740/93%LM:947/96%", ["Noxxe"] = "ET:609/81%LB:789/98%SM:1007/99%", ["Dummylock"] = "ST:791/99%SB:840/99%SM:1052/99%", ["Chckenwing"] = "LT:776/98%SB:854/99%SM:1046/99%", ["Wizandir"] = "LT:765/97%SB:802/99%SM:1053/99%", ["Sneekypete"] = "LT:763/96%LB:774/97%LM:920/98%", ["Thewaterboy"] = "LT:782/98%SB:812/99%SM:1036/99%", ["Lkj"] = "LT:755/95%LB:776/97%LM:978/98%", ["Gandhalf"] = "LT:759/96%SB:847/99%SM:1095/99%", ["Papabaz"] = "ET:721/92%LB:768/96%LM:946/96%", ["Otisgabe"] = "ET:667/86%LB:768/96%LM:976/98%", ["Melga"] = "LT:501/96%LB:770/97%EM:656/89%", ["Moonts"] = "LT:776/98%LB:679/98%LM:966/97%", ["Alcowarrior"] = "ET:650/85%EB:747/94%EM:858/89%", ["Googley"] = "ET:699/90%LB:757/95%EM:913/93%", ["Stevlin"] = "LT:492/96%LB:765/96%EM:752/93%", ["Seirax"] = "LT:756/96%EB:714/94%EM:725/84%", ["Flippers"] = "ET:690/89%EB:747/94%LM:932/96%", ["Benjameen"] = "ST:795/99%SB:842/99%SM:1067/99%", ["Bwian"] = "LT:489/96%EB:722/91%EM:847/89%", ["Xalion"] = "LT:647/98%LB:769/97%LM:949/96%", ["Evilkid"] = "LT:752/96%LB:792/98%EM:914/94%", ["Wine"] = "LT:819/96%LB:629/97%EM:887/94%", ["Lilou"] = "LT:802/95%LB:740/97%LM:910/95%", ["Doktor"] = "ET:651/82%EB:668/91%RM:597/66%", ["Junny"] = "LT:854/98%LB:771/98%LM:940/98%", ["Skeno"] = "ET:421/91%LB:743/97%LM:928/96%", ["Rewa"] = "LT:860/98%LB:774/98%SM:1016/99%", ["Apprentices"] = "LT:794/95%EB:687/92%EM:905/94%", ["Kalthana"] = "ET:758/92%SB:781/99%SM:1016/99%", ["Mootillda"] = "LT:842/97%LB:763/98%LM:977/98%", ["Syldrassil"] = "ST:885/99%SB:790/99%SM:1000/99%", ["Holytrimble"] = "ET:729/90%LB:763/98%LM:930/96%", ["Casais"] = "ET:417/92%EB:679/91%LM:926/96%", ["Kittens"] = "ET:791/94%EB:693/94%EM:844/93%", ["Auntyner"] = "ET:789/94%SB:778/99%LM:956/98%", ["Ozpops"] = "RT:256/72%EB:676/92%LM:933/98%", ["Myles"] = "ET:780/93%SB:783/99%SM:998/99%", ["Invaderheals"] = "ET:740/90%EB:682/93%LM:887/95%", ["Jaely"] = "ET:406/91%EB:672/92%EM:857/91%", ["Grudgebearer"] = "ET:711/88%EB:501/90%LM:911/95%", ["Shleeb"] = "ET:700/87%EB:467/88%EM:413/77%", ["Sharise"] = "LT:815/96%LB:756/98%EM:902/94%", ["Fathershamus"] = "ET:463/93%EB:674/93%EM:841/90%", ["Rosaline"] = "RT:492/62%EB:545/76%EM:737/81%", ["Grigori"] = "ST:880/99%LB:724/96%EM:863/92%", ["Freiberg"] = "ET:353/87%LB:732/96%LM:941/97%", ["Mikansu"] = "ET:659/83%SB:827/99%SM:1058/99%", ["Salvitas"] = "ET:687/85%RB:512/71%EM:762/86%", ["Taríc"] = "ET:439/93%LB:767/98%EM:849/92%", ["Shamza"] = "LT:687/98%LB:781/98%EM:888/92%", ["Toughguy"] = "ET:663/84%LB:742/97%LM:973/98%", ["Valandar"] = "LT:689/98%LB:736/96%LM:734/95%", ["Bano"] = "RT:521/69%EB:648/91%LM:878/95%", ["Thormon"] = "ET:652/83%EB:591/83%LM:896/95%", ["Ruzsche"] = "ET:417/91%EB:651/91%LM:907/96%", ["Osca"] = "ET:775/93%LB:772/98%LM:929/97%", ["Constellus"] = "LT:832/97%LB:741/97%LM:939/97%", ["Satit"] = "ET:788/94%LB:766/98%SM:999/99%", ["Neladin"] = "ET:724/89%EB:684/93%EM:859/92%", ["Popi"] = "LT:800/95%EB:698/94%LM:960/98%", ["Seelon"] = "ST:885/99%LB:775/98%SM:991/99%", ["Lorenlight"] = "LT:833/97%EB:644/89%EM:790/87%", ["Fransis"] = "ET:711/88%LB:715/95%LM:934/97%", ["Blackthorn"] = "LT:553/97%EB:699/94%EM:871/93%", ["Nazoren"] = "ET:722/89%EB:655/90%EM:852/92%", ["Mellaris"] = "ET:406/91%EB:665/91%EM:832/91%", ["Andy"] = "ET:642/83%LB:726/96%LM:911/95%", ["Alleksa"] = "ET:389/90%LB:718/95%EM:901/94%", ["Myndflay"] = "ET:793/94%SB:781/99%SM:1006/99%", ["Doubleyousee"] = "ET:769/92%EB:663/92%EM:744/84%", ["Chodina"] = "ET:671/86%LB:736/96%EM:862/91%", ["Plumbus"] = "ET:671/84%EB:690/93%LM:928/96%", ["Katsuko"] = "LT:846/97%LB:742/97%LM:964/98%", ["Eatdapewpew"] = "ET:723/89%EB:681/93%LM:914/97%", ["Gwenevive"] = "ET:433/93%EB:702/94%EM:854/91%", ["Madnezz"] = "ET:383/89%EB:665/91%EM:884/93%", ["Thelin"] = "LT:748/95%LB:777/97%LM:983/98%", ["Lawntoy"] = "LT:748/95%LB:778/97%SM:983/99%", ["Amfred"] = "ET:742/94%LB:781/98%LM:989/98%", ["Morlour"] = "ET:694/90%LB:783/98%LM:965/98%", ["Xoodles"] = "ET:682/88%LB:772/97%EM:885/91%", ["Shadewind"] = "ET:621/82%LB:774/97%LM:933/96%", ["Rayek"] = "ET:686/92%LB:760/95%LM:966/97%", ["Vanhelfsing"] = "RT:482/63%LB:777/97%LM:921/95%", ["Warrkie"] = "ET:332/89%LB:762/96%LM:913/95%", ["Leks"] = "ET:691/89%LB:780/98%LM:949/97%", ["Bobberino"] = "ET:674/87%LB:779/98%LM:974/98%", ["Sarco"] = "SB:816/99%SM:1039/99%", ["Chargy"] = "LT:757/96%SB:811/99%LM:957/97%", ["Johndickson"] = "ET:674/88%EB:747/94%EM:896/92%", ["Pheran"] = "ET:314/87%LB:756/95%LM:961/96%", ["Sharra"] = "RT:167/60%EB:744/94%EM:906/93%", ["Låmp"] = "ET:670/91%LB:703/97%EM:893/93%", ["Thiss"] = "ET:728/93%LB:783/98%LM:957/96%", ["Seighart"] = "ET:338/90%LB:753/95%EM:801/86%", ["Kutisú"] = "LT:778/98%LB:761/96%EM:806/86%", ["Meatstick"] = "ET:591/79%EB:746/94%LM:960/98%", ["Scenesence"] = "RT:215/72%EB:744/94%EM:818/87%", ["Boxi"] = "ET:665/87%LB:773/97%LM:944/97%", ["Kirari"] = "ET:683/89%LB:752/95%EM:816/87%", ["Chennie"] = "ET:395/94%EB:727/92%EM:817/85%", ["Norvik"] = "ET:739/94%LB:778/97%LM:970/98%", ["Lidry"] = "ET:726/93%LB:762/96%LM:958/97%", ["Nalyd"] = "ET:677/88%LB:757/95%LM:959/98%", ["Maiisher"] = "LT:759/96%SB:822/99%SM:1065/99%", ["Zeneth"] = "ET:648/86%LB:753/95%EM:905/94%", ["Mafe"] = "LT:755/95%LB:691/97%LM:977/98%", ["Wipealot"] = "ET:735/93%LB:778/97%SM:987/99%", ["Romoleus"] = "ET:659/86%LB:766/96%LM:942/97%", ["Sohless"] = "LT:786/98%SB:866/99%SM:1013/99%", ["Buibuichiobu"] = "LT:754/96%SB:846/99%LM:975/98%", ["Ahlianchiobu"] = "EB:749/94%LM:954/97%", ["Redkingramen"] = "ET:589/79%EB:735/93%EM:638/90%", ["Bankwhotank"] = "ET:618/82%EB:737/93%EM:816/87%", ["Detua"] = "ET:734/94%LB:768/96%EM:868/91%", ["Kimasu"] = "LT:751/95%LB:779/97%SM:997/99%", ["Equal"] = "LT:750/95%LB:779/97%LM:987/98%", ["Qyn"] = "ET:732/93%LB:758/95%LM:992/98%", ["Dantherogue"] = "ET:697/89%LB:762/96%LM:937/95%", ["Ceverian"] = "ET:258/80%EB:734/93%EM:879/90%", ["Hodgey"] = "ET:658/86%LB:762/96%EM:888/93%", ["Alcarin"] = "ET:422/94%LB:757/95%RM:653/72%", ["Rtz"] = "ET:594/79%LB:743/98%EM:868/89%", ["Azmedaj"] = "LT:748/95%LB:784/98%SM:998/99%", ["Jovacs"] = "LT:753/95%SB:801/99%SM:988/99%", ["Coté"] = "ET:376/93%LB:765/96%LM:968/97%", ["Cheez"] = "LT:761/96%LB:771/97%EM:884/90%", ["Bazzaniceday"] = "ET:716/92%LB:758/95%EM:793/89%", ["Thesanga"] = "LT:504/96%SB:796/99%LM:909/98%", ["Sneakylife"] = "ET:589/77%EB:747/94%EM:917/93%", ["Skibzilla"] = "ET:677/87%LB:769/97%EM:924/94%", ["Gale"] = "ET:713/91%LB:766/96%LM:936/96%", ["Necrolic"] = "ET:734/93%LB:786/98%LM:972/98%", ["Kelistra"] = "LT:760/96%LB:771/97%LM:977/98%", ["Valerina"] = "LT:747/95%LB:757/95%LM:961/97%", ["Notorious"] = "LT:563/97%LB:780/97%EM:923/94%", ["Revtankalt"] = "ET:629/83%LB:775/97%LM:930/95%", ["Gannacus"] = "ET:649/86%EB:742/94%EM:876/90%", ["Gbaited"] = "EB:740/93%EM:888/91%", ["Goals"] = "UT:335/44%LB:755/95%EM:916/94%", ["Kidagakash"] = "ST:814/99%SB:873/99%LM:975/98%", ["Jimmyhànd"] = "ET:332/88%LB:776/97%LM:934/95%", ["Vanilagorila"] = "ET:374/93%LB:760/96%LM:947/96%", ["Fogey"] = "ET:310/87%EB:734/93%EM:873/90%", ["Borg"] = "ET:665/86%LB:755/95%LM:952/96%", ["Kamzi"] = "LB:757/95%EM:707/75%", ["Mavericx"] = "ET:679/88%LB:757/96%EM:902/92%", ["Hoomanmage"] = "ET:728/93%EB:742/94%EM:808/84%", ["Voiceless"] = "LT:543/97%SB:797/99%SM:999/99%", ["Tybius"] = "ET:678/88%LB:769/97%EM:866/91%", ["Trissvort"] = "ET:575/83%EB:741/93%EM:789/89%", ["Simolian"] = "ET:381/92%LB:787/98%LM:985/98%", ["Meztif"] = "LT:773/97%LB:781/98%LM:973/98%", ["Hannibal"] = "ET:627/83%LB:651/95%EM:884/91%", ["Velict"] = "LT:749/95%LB:761/96%EM:755/94%", ["Lej"] = "RT:423/59%EB:725/92%EM:851/88%", ["Gadris"] = "ET:570/76%EB:743/94%EM:595/88%", ["Valimore"] = "ET:741/94%LB:772/97%EM:915/94%", ["Klean"] = "RT:372/54%LB:764/96%LM:965/98%", ["Radon"] = "LT:782/98%SB:835/99%LM:885/95%", ["Brutisimus"] = "RT:366/50%EB:714/90%RM:629/67%", ["Lmaoturtle"] = "LB:777/97%LM:956/97%", ["Patience"] = "ET:626/83%LB:636/95%EM:874/90%", ["Camino"] = "ET:670/87%LB:749/95%EM:843/87%", ["Joannes"] = "ET:691/86%LB:701/95%LM:887/95%", ["Oberious"] = "LT:532/96%SB:778/99%EM:879/93%", ["Picard"] = "ST:771/99%LB:721/96%SM:981/99%", ["Eigaarz"] = "ET:740/91%SB:790/99%LM:951/97%", ["Fåther"] = "LT:817/96%LB:765/98%LM:934/98%", ["Snackie"] = "UT:228/28%LB:722/96%EM:718/79%", ["Tickleback"] = "RT:154/52%LB:724/96%EM:847/90%", ["Ashleyx"] = "ET:727/90%LB:635/97%EM:870/92%", ["Thanatis"] = "ET:357/87%LB:736/96%EM:811/89%", ["Mooncross"] = "ET:388/89%LB:629/97%EM:739/84%", ["Shemaster"] = "ET:326/82%EB:698/94%EM:832/90%", ["Hammerowan"] = "ET:685/85%EB:697/94%LM:881/95%", ["Nickwindfury"] = "LT:530/95%LB:744/96%LM:793/97%", ["Nix"] = "RT:487/64%EB:689/94%LM:910/95%", ["Pathee"] = "RT:577/74%EB:689/92%LM:936/96%", ["Owningg"] = "EB:624/88%RM:624/69%", ["Takhisis"] = "ET:349/85%LB:759/98%EM:770/87%", ["Brutalicious"] = "LT:839/97%LB:750/98%EM:836/91%", ["Beev"] = "ET:343/85%LB:709/95%EM:800/90%", ["Ðarkangel"] = "UT:326/42%LB:702/95%LM:900/95%", ["Blubie"] = "ET:725/89%LB:743/97%LM:972/98%", ["Roushan"] = "ET:784/93%LB:757/98%LM:896/95%", ["Tyrosus"] = "RT:485/65%EB:657/91%EM:686/78%", ["Shameman"] = "ET:802/94%LB:640/97%LM:897/95%", ["Omiihastotem"] = "CT:133/14%EB:689/92%EM:909/94%", ["Eborica"] = "ET:697/86%EB:695/94%UM:412/44%", ["Sarcodeine"] = "EB:650/89%LM:902/95%", ["Witless"] = "CT:187/22%EB:608/84%RM:539/59%", ["Epa"] = "LT:842/97%SB:806/99%LM:947/97%", ["Cyark"] = "ET:294/77%EB:490/90%EM:744/81%", ["Korush"] = "LT:646/98%LB:682/98%EM:877/93%", ["Karathor"] = "ET:713/87%EB:708/94%LM:925/95%", ["Derean"] = "LT:556/96%EB:709/94%EM:826/88%", ["Bigfellor"] = "ET:590/76%LB:712/95%RM:637/70%", ["Ihavesinned"] = "ET:680/85%LB:714/96%EM:398/75%", ["Aripriest"] = "CT:76/22%EB:593/84%EM:690/79%", ["Tryyst"] = "ET:320/80%LB:747/96%EM:704/94%", ["Gawjus"] = "LT:662/98%LB:734/97%EM:854/92%", ["Farli"] = "ET:329/82%LB:747/97%RM:668/74%", ["Mathwin"] = "ET:723/89%LB:734/97%LM:910/97%", ["Wiired"] = "ET:711/88%EB:611/84%EM:875/93%", ["Jeskia"] = "ET:599/75%EB:679/92%EM:870/93%", ["Akkhan"] = "LT:859/98%LB:752/97%EM:888/94%", ["Sidious"] = "LT:669/98%LB:742/96%EM:608/90%", ["Shintzy"] = "ET:453/93%LB:765/98%EM:836/89%", ["Immunisation"] = "ET:698/87%SB:795/99%SM:994/99%", ["Docwho"] = "ET:344/86%LB:729/96%EM:801/88%", ["Fisto"] = "RT:558/70%EB:679/92%EM:822/91%", ["Timbott"] = "ET:765/92%LB:737/96%LM:921/95%", ["Tayssiras"] = "RT:560/71%EB:683/93%EM:745/82%", ["Holynoodle"] = "UT:321/41%EB:632/89%EM:663/93%", ["Jumbothai"] = "ET:340/86%LB:718/95%LM:957/98%", ["Passeve"] = "ET:368/87%LB:716/96%EM:858/92%", ["Arcann"] = "ET:738/91%LB:758/98%SM:986/99%", ["Karsi"] = "UT:227/28%EB:646/91%EM:845/91%", ["Evelynn"] = "LT:831/96%LB:747/97%EM:848/90%", ["Elethia"] = "RT:578/74%EB:681/92%EM:617/91%", ["Virginiam"] = "LT:661/98%EB:678/93%LM:899/95%", ["Aurelle"] = "UT:238/28%LB:710/95%LM:905/95%", ["Moondark"] = "LT:841/97%LB:777/98%LM:943/97%", ["Hokosal"] = "ET:734/89%LB:748/96%LM:765/96%", ["Snowy"] = "CT:29/4%EB:474/90%EM:552/87%", ["Akahotz"] = "LT:861/98%LB:725/95%LM:920/95%", ["Sylaurias"] = "ET:420/91%LB:732/97%LM:896/96%", ["Drluthien"] = "LT:547/96%EB:605/85%EM:709/94%", ["Rightybadeye"] = "ET:468/94%EB:532/93%EM:495/83%", ["Chikenibbles"] = "ET:409/90%EB:652/91%EM:467/80%", ["Cutesham"] = "UT:82/25%EB:605/84%EM:833/88%", ["Selix"] = "ET:349/86%EB:671/91%EM:701/94%", ["Calinba"] = "UT:317/39%LB:708/95%EM:777/86%", ["Powerprince"] = "LT:860/98%SB:780/99%SM:981/99%", ["Kwawkah"] = "LT:632/98%EB:708/94%EM:858/92%", ["Somy"] = "ET:767/92%EB:700/92%EM:866/91%", ["Hantukama"] = "ET:309/82%LB:600/96%LM:886/95%", ["Samadi"] = "EB:544/78%EM:709/81%", ["Vindiction"] = "EB:594/83%", ["Khaylar"] = "ET:395/89%SB:681/99%EM:689/94%", ["Katherine"] = "ET:660/84%EB:674/92%EM:711/78%", ["Emmalouise"] = "LT:760/96%SB:788/99%LM:962/97%", ["Treadz"] = "ET:366/92%EB:734/93%LM:951/97%", ["Frostrag"] = "ET:707/91%LB:768/96%LM:934/95%", ["Uncleboomer"] = "LT:772/97%SB:834/99%LM:960/97%", ["Corro"] = "LT:754/96%EB:744/94%LM:925/95%", ["Sossig"] = "ET:700/91%SB:823/99%LM:934/95%", ["Timdog"] = "LT:789/98%LB:781/98%LM:925/97%", ["Dnutz"] = "LT:742/95%SB:794/99%SM:957/99%", ["Ninjadan"] = "LT:459/95%LB:773/97%EM:888/92%", ["Hughman"] = "ET:365/92%EB:564/91%EM:840/89%", ["Brendoodle"] = "ET:704/91%EB:742/94%EM:848/88%", ["Kullan"] = "LT:745/95%LB:795/98%LM:983/98%", ["Papy"] = "ET:722/93%LB:765/98%LM:942/96%", ["Zelestiara"] = "ET:727/93%EB:699/89%EM:782/84%", ["Ishri"] = "LT:789/98%SB:819/99%SM:985/99%", ["Reni"] = "ST:822/99%LB:775/97%LM:944/97%", ["Volcaner"] = "ET:696/90%LB:787/98%LM:969/98%", ["Corrosive"] = "ST:843/99%SB:886/99%SM:1077/99%", ["Pieck"] = "ET:370/92%SB:786/99%LM:982/98%", ["Fengxian"] = "ET:307/87%EB:723/91%EM:900/94%", ["Keldon"] = "ET:717/92%LB:762/96%LM:953/97%", ["Tryptamine"] = "LT:770/97%SB:841/99%SM:1025/99%", ["Bartle"] = "LT:745/95%SB:791/99%SM:1070/99%", ["Rallys"] = "ET:725/93%LB:781/98%LM:924/95%", ["Halibel"] = "ET:734/94%LB:780/97%EM:869/91%", ["Gutz"] = "ET:390/93%EB:683/87%EM:804/86%", ["Takius"] = "ET:719/92%EB:734/93%LM:878/95%", ["Bragzilla"] = "ET:375/91%EB:697/89%EM:834/86%", ["Keidie"] = "LT:768/97%SB:809/99%LM:983/98%", ["Dandalor"] = "LT:775/97%SB:822/99%SM:1025/99%", ["Fabgp"] = "LT:531/97%LB:778/97%LM:949/96%", ["Tripod"] = "ET:341/89%LB:749/95%EM:854/90%", ["Xayvier"] = "ST:809/99%SB:844/99%LM:982/98%", ["Angerproblem"] = "ST:793/99%LB:780/98%SM:985/99%", ["Blaknight"] = "ST:727/99%LB:770/96%LM:957/97%", ["Pinabow"] = "LT:788/98%SB:807/99%LM:963/97%", ["Jbhunter"] = "LT:780/98%SB:836/99%SM:1045/99%", ["Chasen"] = "ET:726/93%LB:765/96%EM:849/88%", ["Cokebaron"] = "LT:792/98%SB:835/99%LM:976/98%", ["Catostrophix"] = "ET:684/89%LB:733/95%EM:866/90%", ["Iceme"] = "LT:757/96%SB:819/99%SM:986/99%", ["Suncore"] = "LT:747/95%EB:728/93%EM:684/75%", ["Xiaolongnv"] = "ET:677/88%LB:768/97%LM:945/97%", ["Deathslock"] = "LT:775/98%LB:768/96%LM:823/97%", ["Frelancedion"] = "ET:338/90%LB:771/97%SM:984/99%", ["Ramaki"] = "ST:801/99%SB:813/99%SM:985/99%", ["Sneakyhoe"] = "LT:761/96%LB:762/96%LM:839/96%", ["Fategg"] = "ET:699/91%SB:799/99%LM:987/98%", ["Reps"] = "ST:689/99%LB:759/95%LM:951/96%", ["Izzybell"] = "ET:674/88%LB:764/96%EM:856/90%", ["Zoee"] = "ET:326/82%EB:610/86%EM:845/91%", ["Soultrain"] = "ET:632/80%LB:726/96%LM:947/97%", ["Doolakk"] = "ET:790/94%LB:713/95%LM:919/96%", ["Katzukii"] = "ET:631/79%EB:535/77%RM:636/70%", ["Sakos"] = "ET:374/88%EB:700/94%LM:917/96%", ["Fanny"] = "ET:704/87%LB:736/97%EM:521/84%", ["Subaru"] = "ET:309/83%EB:630/87%EM:671/92%", ["Lateral"] = "ET:740/90%LB:725/96%LM:866/98%", ["Illfixit"] = "ET:339/86%EB:642/89%EM:716/78%", ["Lueko"] = "ET:710/88%EB:648/90%LM:934/97%", ["Geno"] = "UT:352/44%EB:688/92%LM:924/96%", ["Gavski"] = "ET:767/93%LB:758/98%LM:917/95%", ["Aerr"] = "ET:658/82%EB:633/89%EM:766/86%", ["Beki"] = "ET:647/81%LB:564/95%EM:789/89%", ["Healinghoney"] = "ET:292/78%EB:629/88%EM:814/88%", ["Elfete"] = "ET:446/93%LB:704/95%EM:732/83%", ["Madkins"] = "ET:621/78%LB:749/98%EM:780/85%", ["Dixiewrekt"] = "ET:700/87%EB:702/94%LM:931/97%", ["Popoki"] = "ET:710/88%EB:696/93%LM:967/98%", ["Saucery"] = "LT:805/95%SB:731/99%LM:965/98%", ["Whisperrae"] = "LT:826/96%LB:759/98%EM:807/89%", ["Peo"] = "ET:473/94%EB:381/79%RM:603/67%", ["Midknite"] = "ET:730/90%LB:728/96%LM:920/95%", ["Pianoforte"] = "RT:500/63%EB:582/81%EM:737/81%", ["Whiterose"] = "ET:659/83%RB:273/63%RM:626/73%", ["Bellow"] = "ET:759/92%LB:744/97%LM:927/97%", ["Gingin"] = "ET:391/89%EB:662/90%EM:787/86%", ["Elegies"] = "RT:567/72%EB:691/94%EM:662/79%", ["Baelor"] = "ET:730/89%LB:754/98%EM:836/90%", ["Awara"] = "LT:836/97%LB:740/97%EM:870/92%", ["Shostfrock"] = "ET:437/92%EB:618/86%EM:771/85%", ["Raimer"] = "ET:393/89%EB:707/94%EM:820/87%", ["Gravels"] = "RT:473/59%RB:419/70%EM:554/75%", ["Pseudoku"] = "ET:688/86%EB:682/92%EM:897/94%", ["Kamrynn"] = "RT:565/72%EB:582/81%EM:845/91%", ["Kaldorn"] = "ET:583/75%LB:749/97%EM:903/94%", ["Manaaki"] = "ET:729/90%LB:758/98%EM:867/91%", ["Amelliane"] = "RT:564/72%EB:623/86%EM:788/86%", ["Ehlysium"] = "UT:146/46%EB:685/93%LM:943/97%", ["Dotless"] = "ET:717/88%LB:756/98%LM:944/97%", ["Healingangel"] = "ET:619/78%EB:651/90%EM:690/76%", ["Kandal"] = "ET:632/80%EB:592/83%EM:697/79%", ["Palpette"] = "ET:691/86%LB:708/95%EM:826/91%", ["Typhos"] = "LT:829/96%EB:698/93%EM:822/88%", ["Shaggydaggy"] = "ET:768/92%SB:797/99%LM:964/98%", ["Abernathy"] = "ET:376/89%EB:626/87%RM:676/74%", ["Papaherb"] = "ET:609/77%EB:574/82%LM:925/97%", ["Mvp"] = "ET:308/82%EB:704/94%EM:774/84%", ["Syneira"] = "RT:570/72%EB:696/94%EM:753/85%", ["Eliel"] = "UT:370/46%EB:661/90%EM:862/93%", ["Heleos"] = "RT:162/50%EB:542/75%EM:736/81%", ["Elivast"] = "ET:659/81%LB:764/97%LM:918/95%", ["Kotoria"] = "ET:385/89%LB:700/95%EM:848/93%", ["Alaxiest"] = "RT:442/55%EB:579/80%EM:782/85%", ["Candrine"] = "ET:647/81%EB:684/93%LM:888/95%", ["Fenixx"] = "RT:557/72%EB:664/90%EM:893/94%", ["Silentsound"] = "ET:665/83%EB:545/76%RM:654/72%", ["Buzzard"] = "RT:247/72%EB:710/94%LM:959/98%", ["Grimmreaper"] = "RT:178/55%RB:416/57%RM:548/60%", ["Lognar"] = "UT:225/26%LB:773/98%LM:972/98%", ["Phrostyy"] = "RT:245/73%EB:594/83%RM:675/74%", ["Elementicks"] = "ET:419/90%EB:691/92%EM:892/93%", ["Ryv"] = "LT:817/95%SB:803/99%SM:1020/99%", ["Bluntforce"] = "ET:402/89%LB:736/96%EM:817/90%", ["Souffrance"] = "UT:303/37%EB:560/79%LM:904/96%", ["Nezzabar"] = "ET:639/92%LB:760/97%EM:851/93%", ["Demealz"] = "LT:524/95%LB:587/95%EM:758/84%", ["Mitchellg"] = "RT:445/57%EB:698/93%EM:842/90%", ["Mearis"] = "ET:628/80%EB:638/88%EM:778/86%", ["Oenaprime"] = "ET:643/82%EB:673/92%EM:777/86%", ["Wererumgone"] = "RT:452/57%EB:650/88%EM:812/87%", ["Klarg"] = "RT:554/73%LB:752/95%LM:920/95%", ["Jiajiabone"] = "ET:729/93%LB:759/95%SM:1017/99%", ["Dunce"] = "RT:457/63%EB:736/93%EM:744/78%", ["Meatbicycle"] = "LT:512/97%EB:741/93%EM:758/94%", ["Dqr"] = "LB:772/97%LM:985/98%", ["Punty"] = "ET:570/75%EB:737/93%EM:717/77%", ["Otisoldman"] = "RT:449/70%EB:740/93%LM:944/97%", ["Pxtatxx"] = "ET:705/91%LB:761/96%SM:1019/99%", ["Friend"] = "ET:293/83%LB:758/95%EM:834/87%", ["Oscca"] = "ET:497/75%EB:719/91%LM:965/98%", ["Krako"] = "LT:768/97%SB:806/99%SM:1018/99%", ["Flattyz"] = "ET:618/82%EB:731/92%EM:863/91%", ["Zennon"] = "ET:648/85%SB:864/99%SM:1023/99%", ["Razettokur"] = "ET:653/85%EB:745/94%EM:642/90%", ["Msbeanus"] = "ET:257/78%EB:727/92%LM:936/95%", ["Craig"] = "LT:533/97%LB:793/98%SM:1047/99%", ["Blockblock"] = "RT:481/66%EB:719/91%EM:788/84%", ["Larina"] = "RT:450/59%EB:741/94%EM:898/93%", ["Illjustww"] = "ET:322/88%LB:755/95%EM:904/93%", ["Worminator"] = "ET:584/77%EB:743/94%EM:727/78%", ["Quickkill"] = "ET:336/88%LB:765/96%LM:942/95%", ["Pauliceman"] = "ET:598/80%EB:718/91%EM:745/87%", ["Malfos"] = "RT:403/55%EB:746/94%EM:830/88%", ["Footette"] = "LT:476/95%LB:760/96%LM:956/96%", ["Lazyknives"] = "UT:113/41%LB:780/97%LM:962/97%", ["Pcakes"] = "ET:298/84%EB:745/94%LM:939/96%", ["Shinkra"] = "ET:702/90%LB:661/96%EM:739/80%", ["Zarigg"] = "ET:361/90%LB:759/95%EM:842/88%", ["Stababy"] = "ET:667/86%EB:749/94%EM:788/82%", ["Seanosnachos"] = "ET:364/90%LB:756/95%LM:957/97%", ["Zielx"] = "LT:762/96%LB:782/98%EM:923/94%", ["Junae"] = "ET:664/86%LB:753/95%LM:971/97%", ["Executie"] = "UT:275/41%EB:728/91%EM:860/89%", ["Sunflare"] = "UT:236/36%EB:705/90%UM:410/48%", ["Wofole"] = "ET:279/81%LB:754/95%LM:948/96%", ["Grifiana"] = "LT:749/95%LB:754/95%LM:947/97%", ["Kamiree"] = "ET:303/86%EB:724/91%EM:825/88%", ["Orcrogue"] = "RT:537/70%EB:742/94%LM:939/95%", ["Ipawnkidneys"] = "ET:331/89%EB:732/93%LM:919/95%", ["Faldric"] = "ET:238/77%LB:725/98%SM:912/99%", ["Redbid"] = "LT:733/98%SB:801/99%SM:990/99%", ["Llethlin"] = "ET:603/81%SB:831/99%LM:975/98%", ["Fridgekeys"] = "LT:490/96%EB:574/92%LM:993/98%", ["Tzuyuri"] = "ET:714/92%EB:704/89%EM:890/93%", ["Dealsheals"] = "LT:747/98%SB:823/99%LM:909/96%", ["Cutnrun"] = "ET:612/80%EB:747/94%LM:809/95%", ["Kosmo"] = "ET:617/80%LB:685/97%LM:946/96%", ["Muss"] = "RT:535/70%EB:726/92%EM:866/90%", ["Dubinn"] = "ET:301/86%EB:724/92%EM:855/88%", ["Kelsie"] = "ET:339/88%EB:746/94%EM:907/93%", ["Katelittle"] = "ET:272/80%LB:751/95%EM:920/93%", ["Taranne"] = "ST:763/99%SB:857/99%SM:1018/99%", ["Gawbinz"] = "LB:768/96%EM:895/92%", ["Grifiano"] = "ST:806/99%SB:813/99%SM:1095/99%", ["Charaine"] = "ET:292/83%LB:774/97%EM:868/89%", ["Alexelder"] = "ET:681/89%EB:744/93%EM:798/83%", ["Nóx"] = "ET:362/90%LB:760/96%EM:827/85%", ["Tricksy"] = "ET:302/84%EB:721/91%LM:933/95%", ["Magne"] = "LT:529/97%LB:693/97%LM:852/97%", ["Duskrage"] = "RT:415/57%EB:724/92%EM:889/91%", ["Barael"] = "ET:655/86%EB:738/93%EM:793/83%", ["Ice"] = "ET:723/93%SB:830/99%SM:1064/99%", ["Tyronë"] = "LT:744/95%EB:719/91%LM:985/98%", ["Zeroix"] = "RT:501/70%EB:734/93%EM:918/94%", ["Dobbyrogue"] = "ET:672/86%LB:783/98%LM:994/98%", ["Bnk"] = "ET:707/91%EB:710/90%LM:948/95%", ["Labuschagne"] = "LT:787/98%SB:849/99%SM:1001/99%", ["Inforce"] = "ET:557/75%EB:737/93%EM:770/82%", ["Daves"] = "RT:414/56%LB:760/95%EM:897/93%", ["Galant"] = "UT:194/26%EB:558/92%EM:757/94%", ["Reacharound"] = "ET:581/77%EB:734/93%EM:884/90%", ["Tinyexor"] = "ET:320/87%EB:727/92%EM:874/89%", ["Chapstick"] = "UT:324/46%LB:758/95%LM:931/95%", ["Grossballbag"] = "EB:693/88%EM:790/82%", ["Gorethon"] = "ET:399/92%LB:782/98%LM:944/96%", ["Wethands"] = "ET:657/86%SB:813/99%LM:989/98%", ["Skux"] = "ET:353/91%EB:729/92%LM:945/96%", ["Xavierbane"] = "LT:782/98%SB:797/99%SM:1026/99%", ["Lockstomp"] = "ET:667/87%LB:788/98%LM:980/98%", ["Smashbros"] = "LT:746/95%LB:767/96%EM:884/91%", ["Kaeylor"] = "LB:713/95%LM:918/96%", ["Ribbs"] = "UT:356/48%SB:806/99%LM:971/98%", ["Shambalamb"] = "EB:529/93%RM:594/69%", ["Gandonor"] = "UT:300/38%LB:740/97%LM:921/95%", ["Shammwow"] = "UT:235/29%EB:635/88%EM:698/79%", ["Sentellen"] = "RT:225/65%LB:574/95%EM:801/89%", ["Antioch"] = "UT:130/41%LB:757/98%LM:970/98%", ["Selini"] = "ET:461/94%EB:637/88%LM:722/95%", ["Frankdetank"] = "RT:547/70%EB:668/91%EM:742/81%", ["Zirael"] = "LT:817/95%LB:761/98%LM:908/96%", ["Coltrane"] = "ET:758/92%LB:741/97%LM:935/97%", ["Crayonz"] = "EB:652/90%EM:827/89%", ["Hasballs"] = "LT:517/95%LB:719/95%LM:907/96%", ["Midouban"] = "ET:737/90%LB:732/97%LM:907/95%", ["Creyn"] = "UT:249/31%EB:629/89%EM:824/92%", ["Likeasurgeon"] = "RT:476/63%EB:546/79%", ["Jainna"] = "CT:108/10%EB:704/94%EM:789/85%", ["Amandria"] = "RT:500/64%LB:725/96%EM:863/93%", ["Surgeon"] = "ET:357/86%EB:608/86%LM:737/95%", ["Basex"] = "ET:597/76%EB:701/94%EM:871/93%", ["Skullmunchz"] = "ET:285/79%LB:758/98%LM:914/96%", ["Eskim"] = "LT:563/97%SB:801/99%EM:755/83%", ["Stainthorpe"] = "UT:133/46%LB:703/95%EM:904/94%", ["Maeodra"] = "RT:573/74%EB:679/92%RM:659/73%", ["Battiatus"] = "UT:256/32%EB:590/85%EM:575/89%", ["Brondo"] = "ET:581/75%LB:713/95%EM:788/85%", ["Larazi"] = "RT:567/71%EB:649/88%EM:810/88%", ["Elfhorn"] = "RT:250/73%LB:720/95%RM:620/69%", ["Baboo"] = "ET:767/92%LB:743/96%LM:950/97%", ["Viere"] = "ET:775/93%LB:752/98%EM:779/88%", ["Fiddlersfoe"] = "ET:431/92%LB:672/98%LM:935/96%", ["Allilliah"] = "ET:631/80%EB:574/82%EM:721/79%", ["Cadriel"] = "EB:570/81%EM:665/76%", ["Icynight"] = "UT:361/44%EB:579/82%EM:676/78%", ["Oxycontin"] = "ET:366/86%EB:633/88%EM:679/93%", ["Dexin"] = "RT:227/69%EB:675/92%EM:767/83%", ["Lightbeam"] = "CT:205/24%EB:428/84%EM:670/77%", ["Kiia"] = "CT:192/22%EB:684/92%EM:706/77%", ["Azshånnå"] = "RT:520/66%EB:598/85%EM:754/85%", ["Deesha"] = "LT:600/97%EB:663/90%LM:821/97%", ["Ishellheal"] = "LB:713/96%EM:703/81%", ["Gypzie"] = "LT:807/95%LB:719/96%LM:947/98%", ["Yskierka"] = "RT:519/71%EB:711/94%EM:857/93%", ["Badjujub"] = "LT:859/98%SB:791/99%LM:971/98%", ["Hotcoco"] = "ET:289/78%EB:643/87%EM:778/84%", ["Bettymae"] = "UT:131/42%EB:582/84%EM:830/89%", ["Absorbs"] = "RT:235/67%EB:644/90%EM:865/92%", ["Mitankdin"] = "ET:658/84%LB:672/98%LM:933/97%", ["Dharuma"] = "RT:409/51%LB:581/96%EM:712/81%", ["Ithilias"] = "UT:393/49%EB:382/79%EM:807/87%", ["Joekiwi"] = "ET:651/82%EB:714/94%EM:797/86%", ["Cantbepel"] = "ET:638/81%EB:587/82%RM:602/66%", ["Nerdone"] = "UT:296/36%EB:671/92%EM:757/86%", ["Magelingz"] = "ET:596/76%EB:691/93%EM:713/80%", ["Darthanon"] = "ET:745/90%LB:742/96%LM:946/97%", ["Fiyero"] = "ET:586/75%EB:635/88%EM:746/83%", ["Kruppe"] = "LT:626/98%LB:739/96%LM:960/97%", ["Liadrana"] = "ET:747/91%LB:721/96%LM:956/98%", ["Allosterics"] = "LT:815/95%SB:786/99%SM:1000/99%", ["Ramsraine"] = "ET:673/83%EB:636/87%EM:814/89%", ["Annperkins"] = "ET:335/85%EB:644/89%EM:810/89%", ["Sidon"] = "UT:156/49%RB:451/65%CM:173/16%", ["Spade"] = "ST:806/99%SB:843/99%SM:1048/99%", ["Amosi"] = "ET:710/91%LB:769/97%LM:962/97%", ["Drucila"] = "ET:731/94%SB:807/99%LM:945/96%", ["Krey"] = "ET:737/94%EB:747/94%EM:913/92%", ["Cosine"] = "ET:638/84%SB:789/99%LM:965/97%", ["Eloiys"] = "ET:733/94%LB:775/97%EM:722/77%", ["Psorrf"] = "ET:360/90%EB:747/94%LM:937/95%", ["Knixers"] = "LT:773/97%LB:779/98%LM:935/96%", ["Gladrimm"] = "LT:788/98%SB:827/99%SM:1003/99%", ["Magicpuppet"] = "LT:599/98%EB:737/93%LM:953/97%", ["Neutron"] = "ST:776/99%LB:771/98%LM:942/98%", ["Wezex"] = "ET:588/78%LB:739/96%LM:943/96%", ["Shanenec"] = "LT:778/98%SB:889/99%SM:987/99%", ["Brollis"] = "ET:668/87%EB:734/93%EM:902/93%", ["Ticklez"] = "LT:752/96%LB:775/97%EM:910/93%", ["Remulos"] = "LT:741/95%SB:823/99%SM:1001/99%", ["Twoinches"] = "ST:794/99%LB:788/98%LM:917/95%", ["Yay"] = "ET:408/94%EB:655/84%EM:872/93%", ["Choralone"] = "ET:715/92%SB:799/99%LM:986/98%", ["Deley"] = "LT:789/98%SB:841/99%SM:993/99%", ["Reistlin"] = "ET:655/86%EB:729/93%EM:886/92%", ["Fondue"] = "ET:741/94%LB:774/97%LM:921/95%", ["Dagan"] = "LT:765/97%SB:828/99%SM:998/99%", ["Kulrulk"] = "LT:631/98%LB:759/95%LM:945/96%", ["Adra"] = "LT:758/96%LB:783/98%LM:969/98%", ["Khangy"] = "ET:720/93%LB:569/95%LM:727/96%", ["Cheny"] = "ET:633/82%EB:712/90%EM:923/94%", ["Safecracker"] = "RT:500/66%RB:554/74%EM:761/81%", ["Lugnuts"] = "ET:677/88%LB:774/97%LM:957/97%", ["Scuffles"] = "ET:357/91%LB:779/97%LM:953/97%", ["Threatkey"] = "LT:768/97%LB:716/95%EM:757/81%", ["Mccool"] = "ET:417/94%LB:637/97%LM:938/98%", ["Perry"] = "ET:651/85%EB:743/94%EM:807/86%", ["Apnc"] = "ET:382/92%EB:689/89%EM:916/94%", ["Vizi"] = "ET:558/75%RB:371/51%RM:497/62%", ["Shleb"] = "ET:730/94%LB:763/96%EM:904/93%", ["Dirtsanchezz"] = "ET:680/89%SB:800/99%LM:890/95%", ["Obiray"] = "ET:728/93%EB:729/91%EM:842/87%", ["Murdertrain"] = "ET:687/89%EB:744/93%EM:825/88%", ["Hitlock"] = "ET:739/94%LB:769/97%LM:952/97%", ["Kontraband"] = "ET:600/80%EB:743/94%EM:713/85%", ["Brickwallbob"] = "ET:555/75%LB:737/95%LM:733/97%", ["Ellaira"] = "RT:492/66%EB:706/94%EM:775/88%", ["Lizsche"] = "ET:345/89%SB:792/99%EM:695/81%", ["Bilbsy"] = "LT:770/97%EB:744/94%EM:864/89%", ["Rajneesh"] = "LT:753/96%SB:803/99%SM:1035/99%", ["Taymar"] = "ET:680/89%LB:775/97%EM:850/89%", ["Monky"] = "ET:710/91%EB:749/94%EM:779/94%", ["Derothan"] = "ET:653/86%EB:705/90%RM:655/70%", ["Necruccia"] = "ET:715/92%LB:753/95%EM:772/82%", ["Aggroman"] = "ET:357/92%SB:768/99%LM:953/98%", ["Èvil"] = "ET:622/81%EB:716/90%EM:834/86%", ["Syrion"] = "ET:585/78%EB:665/90%EM:861/90%", ["Cobalt"] = "ET:273/82%LB:767/97%EM:916/94%", ["Flamingskull"] = "ET:603/80%LB:766/98%LM:938/96%", ["Silentogre"] = "ET:704/90%EB:749/94%LM:972/97%", ["Classgannon"] = "ET:674/88%LB:733/96%LM:936/96%", ["Sparcrypt"] = "ET:698/89%EB:744/93%EM:907/92%", ["Blink"] = "ET:636/87%LB:736/95%LM:935/95%", ["Jockeggs"] = "ET:629/83%LB:754/95%EM:898/93%", ["Owning"] = "LT:783/98%LB:776/97%EM:898/93%", ["Nocent"] = "ET:335/88%EB:576/94%EM:821/91%", ["Lochstra"] = "LT:789/98%SB:841/99%SM:1054/99%", ["Exiled"] = "ET:606/80%EB:732/92%RM:696/74%", ["Docnina"] = "RT:564/71%RB:467/67%EM:844/93%", ["Aninakia"] = "ET:653/83%EB:655/90%EM:823/90%", ["Klarice"] = "ET:666/84%EB:687/93%EM:843/90%", ["Lørrde"] = "RT:469/60%EB:652/90%EM:906/94%", ["Muddygut"] = "RT:553/70%EB:687/93%EM:779/85%", ["Charaznable"] = "ET:603/77%EB:683/92%EM:780/84%", ["Riversong"] = "RT:232/67%EB:648/89%LM:927/96%", ["Willba"] = "RT:579/74%LB:718/95%LM:923/97%", ["Holydiver"] = "CT:158/18%RB:318/70%RM:579/64%", ["Monandis"] = "UT:312/39%EB:568/81%RM:602/70%", ["Dil"] = "CT:126/13%EB:583/81%EM:817/88%", ["Bettyboom"] = "ET:303/81%EB:598/82%EM:707/78%", ["Treesrus"] = "ET:693/87%UB:285/37%RM:590/66%", ["Netherspark"] = "ET:285/79%EB:530/75%RM:252/60%", ["Blessingbot"] = "RT:560/72%EB:657/89%EM:787/89%", ["Druidiot"] = "ET:390/89%EB:696/93%LM:916/95%", ["Khamard"] = "UT:147/49%EB:610/84%EM:732/80%", ["Herrb"] = "ET:350/84%EB:548/76%EM:744/81%", ["Kyre"] = "ET:458/93%LB:733/95%EM:885/92%", ["Bensoclenso"] = "RT:502/64%EB:574/81%RM:470/51%", ["Puddinn"] = "RT:526/68%EB:654/90%EM:867/93%", ["Hatoki"] = "LT:549/96%EB:630/86%EM:730/80%", ["Friarbeard"] = "UT:27/29%RB:397/54%UM:73/37%", ["Torra"] = "RT:250/70%EB:704/93%RM:625/72%", ["Zef"] = "ET:292/79%EB:518/92%EM:537/87%", ["Cyrogen"] = "ET:319/80%EB:572/79%EM:882/92%", ["Holynahman"] = "UT:102/32%RB:403/55%RM:622/69%", ["Atromidus"] = "RT:255/74%EB:641/89%EM:819/88%", ["Ladrin"] = "CT:86/8%CB:18/0%UM:245/29%", ["Djosha"] = "ET:615/76%EB:696/93%EM:562/87%", ["Adelaide"] = "UT:132/44%EB:612/84%EM:780/84%", ["Avadiator"] = "LT:819/96%LB:721/95%EM:855/92%", ["Marty"] = "RT:142/64%RB:331/67%EM:719/85%", ["Darlarna"] = "ET:598/77%EB:648/89%EM:835/91%", ["Zardie"] = "ET:371/88%EB:642/87%EM:862/91%", ["Axxori"] = "UT:312/38%EB:547/77%EM:747/83%", ["Torgal"] = "RT:215/66%EB:619/86%EM:660/76%", ["Havokk"] = "RT:574/74%EB:588/83%RM:400/69%", ["Mercuccia"] = "CT:54/4%UB:344/46%RM:446/53%", ["Munks"] = "LT:553/96%EB:441/86%EM:746/81%", ["Sayraphim"] = "UT:244/29%EB:401/81%EM:711/78%", ["Mizmoo"] = "ET:458/93%EB:576/80%EM:705/78%", ["Mishamina"] = "ET:315/80%EB:680/91%RM:669/74%", ["Nks"] = "ET:367/90%EB:709/94%EM:869/94%", ["Thingfish"] = "ET:611/76%EB:654/89%LM:898/95%", ["Gyeph"] = "ET:329/84%EB:612/88%LM:884/95%", ["Tenteñ"] = "UT:80/26%RB:383/52%RM:464/50%", ["Pranque"] = "RT:75/57%EB:641/90%EM:797/93%", ["Dukagos"] = "ET:533/87%LB:721/95%LM:918/96%", ["Kauri"] = "ET:608/93%LB:735/97%EM:755/90%", ["Delitescent"] = "UT:101/34%EB:592/83%EM:861/93%", ["Chodi"] = "CT:149/20%LB:744/96%LM:911/96%", ["Emerahl"] = "CT:59/15%UB:283/38%UM:119/49%", ["Chanel"] = "RT:462/58%EB:643/88%EM:890/94%", ["Aylar"] = "CT:148/16%RB:467/64%EM:787/86%", ["Vicious"] = "ET:624/92%LB:726/95%EM:876/94%", ["Iliandra"] = "ET:649/92%LB:755/97%EM:834/92%", ["Arsy"] = "ET:524/84%LB:733/95%EM:860/93%", ["Weasley"] = "ET:301/83%LB:749/95%EM:840/89%", ["Smiteicus"] = "ET:657/92%EB:683/92%EM:866/94%", ["Orschat"] = "ET:437/81%EB:443/85%EM:849/93%", ["Bashnek"] = "LT:700/96%LB:729/96%EM:855/93%", ["Snakebro"] = "ET:641/91%LB:765/98%LM:925/97%", ["Azheal"] = "LT:723/96%LB:758/97%LM:936/97%", ["Siuleilodau"] = "ET:436/93%EB:656/90%EM:819/91%", ["Zeromuth"] = "LT:764/97%LB:790/98%EM:901/91%", ["Larial"] = "ET:593/89%EB:643/89%EM:755/88%", ["Mcspicy"] = "LT:572/97%EB:740/94%EM:840/87%", ["Hirsh"] = "ET:702/94%LB:758/98%SM:998/99%", ["Elenriel"] = "LT:728/96%SB:788/99%SM:987/99%", ["Polemos"] = "ET:734/94%LB:764/96%EM:895/93%", ["Kindread"] = "LT:727/96%EB:703/94%LM:943/98%", ["Messana"] = "ET:598/85%LB:743/96%EM:777/92%", ["Tedosaur"] = "ET:734/94%LB:780/98%LM:979/98%", ["Heskal"] = "CT:80/10%EB:744/94%EM:895/92%", ["Phunkymunky"] = "EB:741/93%LM:924/95%", ["Erzá"] = "ET:358/91%EB:727/92%EM:832/86%", ["Negatron"] = "ET:741/94%EB:747/94%EM:629/89%", ["Olmo"] = "ET:638/83%LB:751/95%LM:983/98%", ["Iamfoe"] = "ET:394/93%LB:768/96%LM:911/98%", ["Spanck"] = "ET:271/80%EB:732/92%EM:820/86%", ["Feq"] = "ET:321/88%LB:768/96%SM:987/99%", ["Touch"] = "UT:208/26%EB:725/92%LM:941/95%", ["Yamice"] = "ST:735/99%LB:782/98%LM:846/97%", ["Pancåkes"] = "LT:520/97%EB:732/92%EM:612/88%", ["Primordialxn"] = "ET:673/88%EB:705/89%EM:720/78%", ["Sabene"] = "RT:209/68%EB:735/93%EM:836/87%", ["Rybius"] = "ET:345/89%LB:751/95%EM:839/86%", ["Karrakaz"] = "LT:698/97%SB:787/99%LM:916/97%", ["Storytime"] = "ET:304/86%EB:715/90%EM:863/91%", ["Esra"] = "ET:688/88%EB:712/90%EM:805/84%", ["Raj"] = "EB:709/90%EM:883/91%", ["Aliisza"] = "EB:644/83%LM:978/98%", ["Rok"] = "LT:766/97%SB:809/99%SM:1021/99%", ["Blorgon"] = "RT:183/64%EB:685/87%RM:672/74%", ["Riplash"] = "LT:469/96%EB:675/86%EM:853/88%", ["Melslock"] = "LT:760/96%SB:831/99%EM:917/94%", ["Terngaceng"] = "ET:645/85%LB:755/95%EM:860/90%", ["Yurnéro"] = "ET:617/87%EB:732/92%EM:801/91%", ["Arok"] = "LT:762/97%LB:792/98%LM:976/98%", ["Systerjay"] = "ET:422/94%LB:649/95%EM:623/89%", ["Violatte"] = "ET:663/87%SB:809/99%LM:972/98%", ["Graznar"] = "LT:434/95%EB:742/93%LM:940/95%", ["Tirra"] = "ET:700/90%EB:721/91%EM:906/94%", ["Depth"] = "ET:306/86%EB:710/90%EM:913/93%", ["Powderpuff"] = "ET:576/77%EB:718/91%EM:921/94%", ["Zuuphi"] = "LT:781/98%SB:828/99%LM:970/98%", ["Triggle"] = "ET:337/89%EB:698/89%EM:769/81%", ["Astemir"] = "ET:266/81%EB:717/91%EM:703/77%", ["Delthree"] = "ET:718/92%SB:803/99%LM:900/96%", ["Iamdps"] = "ET:294/85%EB:748/94%LM:967/97%", ["Rekd"] = "CT:63/21%EB:715/91%RM:677/72%", ["Plebtank"] = "ET:557/81%EB:710/90%EM:743/94%", ["Zyro"] = "ET:286/82%EB:743/94%LM:819/96%", ["Mathillas"] = "RT:167/58%EB:724/92%EM:902/93%", ["Lillya"] = "ET:244/75%EB:746/94%LM:981/98%", ["Deciphel"] = "ET:248/78%EB:723/91%EM:579/87%", ["Haniel"] = "ET:398/92%LB:760/95%LM:960/97%", ["Vanguarrd"] = "ET:693/90%EB:720/94%EM:735/88%", ["Inumbra"] = "EB:700/89%LM:951/96%", ["Snook"] = "EB:699/89%EM:889/91%", ["Azzinoth"] = "EB:730/92%LM:939/95%", ["Pandamarna"] = "ET:345/90%EB:722/91%EM:827/86%", ["Dubdub"] = "ET:707/90%EB:746/94%EM:884/90%", ["Dakka"] = "ET:601/80%EB:726/91%EM:892/91%", ["Meshuga"] = "ET:272/82%EB:719/91%EM:844/89%", ["Saptapstab"] = "ET:369/91%EB:747/94%EM:665/90%", ["Rothanna"] = "RT:516/68%EB:704/89%EM:882/91%", ["Kornsaratar"] = "UT:270/34%EB:702/89%LM:958/97%", ["Epis"] = "ET:336/88%EB:717/91%EM:786/82%", ["Rosslyon"] = "ET:291/85%EB:686/86%LM:951/96%", ["Psychopathy"] = "CT:86/10%EB:738/93%EM:904/93%", ["Mertarg"] = "EB:682/87%EM:812/85%", ["Kailos"] = "EB:703/88%EM:918/94%", ["Deãthshív"] = "LT:631/98%EB:720/91%EM:902/93%", ["Asmodaios"] = "RT:521/69%EB:695/89%RM:619/66%", ["Saurfangg"] = "ET:562/75%EB:703/89%EM:789/84%", ["Skilled"] = "RT:465/61%EB:697/89%EM:824/85%", ["Koruk"] = "ET:404/94%EB:690/88%LM:935/95%", ["Frootloops"] = "LB:762/96%EM:897/91%", ["Then"] = "RT:471/62%LB:791/98%SM:1059/99%", ["Tetswho"] = "LT:747/95%EB:707/90%LM:924/95%", ["Arbertor"] = "UT:351/49%EB:660/85%RM:503/57%", ["Caintwo"] = "ET:697/89%EB:724/92%EM:746/93%", ["Juunee"] = "LT:597/97%LB:789/98%LM:970/98%", ["Tyrvig"] = "RT:187/70%LB:758/95%EM:915/94%", ["Monara"] = "RT:556/73%EB:747/94%EM:900/92%", ["Coldfingies"] = "ET:611/81%LB:743/95%EM:779/89%", ["Adellenn"] = "UT:279/36%EB:734/93%EM:711/75%", ["Boota"] = "SB:808/99%LM:971/98%", ["Joels"] = "EB:699/88%EM:762/88%", ["Cofidis"] = "ET:665/86%EB:732/93%EM:773/94%", ["Punishor"] = "ET:625/82%EB:700/89%EM:835/87%", ["Baruchan"] = "ET:653/83%EB:664/90%LM:919/95%", ["Velsandra"] = "ET:466/94%EB:526/92%EM:791/86%", ["Elpadre"] = "LT:531/96%EB:638/88%EM:565/87%", ["Denga"] = "ET:753/91%LB:744/97%EM:882/94%", ["Saxons"] = "ET:789/94%EB:705/94%LM:958/98%", ["Eastwig"] = "EB:561/94%EM:836/91%", ["Umbro"] = "EB:543/78%RM:561/62%", ["Frostsheng"] = "RT:254/74%EB:580/82%RM:348/71%", ["Cohex"] = "RT:242/72%LB:596/96%EM:702/80%", ["Zoadofzivia"] = "UT:231/31%EB:689/93%LM:917/95%", ["Sanctius"] = "EB:682/92%EM:812/87%", ["Midnité"] = "RT:404/50%EB:630/88%EM:737/81%", ["Bertolli"] = "UT:258/30%LB:711/95%EM:821/88%", ["Azdraice"] = "ET:718/88%EB:678/93%EM:656/92%", ["Alchohealic"] = "RT:479/61%EB:607/85%EM:861/91%", ["Noviq"] = "ET:737/90%EB:638/89%LM:903/96%", ["Benedictus"] = "RT:252/71%EB:561/80%LM:922/96%", ["Rathon"] = "RT:569/72%EB:669/91%EM:573/88%", ["Drefyus"] = "RT:462/59%EB:656/90%EM:815/89%", ["Naija"] = "UT:104/33%EB:572/82%EM:721/79%", ["Mythixy"] = "RT:184/56%EB:575/82%EM:829/92%", ["Preistboi"] = "UT:261/33%EB:644/90%EM:745/82%", ["Zurkolta"] = "RT:200/61%EB:645/89%EM:749/81%", ["Dunni"] = "ET:309/82%LB:617/97%LM:919/95%", ["Arei"] = "EB:602/86%EM:700/81%", ["Lara"] = "RT:398/52%EB:704/93%EM:874/91%", ["Isam"] = "ET:639/81%LB:731/96%EM:887/93%", ["Erikka"] = "ST:742/99%LB:600/96%EM:560/87%", ["Saynt"] = "ET:318/81%EB:695/94%EM:862/92%", ["Britney"] = "ET:462/93%RB:496/71%EM:850/91%", ["Jimini"] = "ET:459/94%EB:700/94%LM:779/96%", ["Shaderac"] = "LT:494/95%LB:720/95%EM:875/94%", ["Spooff"] = "RB:473/68%RM:676/74%", ["Unholymoly"] = "ET:595/75%EB:628/87%EM:792/86%", ["Teana"] = "LB:714/95%LM:934/96%", ["Gudjujub"] = "LT:521/96%LB:578/95%EM:905/94%", ["Gnomiesomie"] = "LT:548/97%EB:634/88%RM:627/72%", ["Arrgsoo"] = "ET:386/88%EB:585/81%LM:794/97%", ["Hadd"] = "ET:316/83%EB:691/93%EM:804/89%", ["Fatherlionel"] = "RT:231/70%EB:535/76%CM:36/2%", ["Nkd"] = "RT:538/70%LB:748/97%LM:929/96%", ["Devilink"] = "EB:585/81%EM:776/87%", ["Nailyon"] = "ST:798/99%LB:586/95%LM:810/97%", ["Mikyo"] = "LT:553/96%EB:724/94%LM:959/97%", ["Sabzi"] = "RT:511/66%EB:616/86%EM:792/88%", ["Maktown"] = "LT:487/95%EB:696/93%LM:961/98%", ["Alzangel"] = "UT:344/42%EB:620/85%EM:758/82%", ["Unbound"] = "RT:222/66%RB:310/69%RM:562/63%", ["Matutu"] = "UT:93/29%EB:583/83%RM:618/72%", ["Chocky"] = "EB:530/76%RM:498/55%", ["Arranum"] = "LT:607/97%LB:720/95%EM:827/88%", ["Monnrai"] = "UT:155/48%EB:611/86%EM:750/82%", ["Arrudd"] = "UT:249/30%EB:624/85%EM:797/86%", ["Adolin"] = "ET:377/89%EB:539/93%EM:740/83%", ["Medikmoo"] = "ET:398/91%EB:511/92%RM:618/72%", ["Ayahuasca"] = "ET:286/76%EB:622/86%EM:777/84%", ["Purusha"] = "ET:731/89%EB:669/91%EM:829/90%", ["Lilpoppet"] = "ET:389/90%LB:709/95%LM:787/97%", ["Zoya"] = "UT:292/36%EB:687/91%EM:767/83%", ["Caitlin"] = "EB:696/93%EM:844/90%", ["Carebears"] = "UT:362/45%EB:540/77%EM:718/79%", ["Ocarii"] = "LB:745/97%LM:925/96%", ["Xabbu"] = "ET:283/76%EB:604/85%EM:764/86%", ["Jarius"] = "RT:526/68%EB:668/91%EM:854/90%", ["Toven"] = "ET:655/82%LB:721/95%EM:859/93%", ["Paldust"] = "RT:203/64%EB:642/89%EM:499/84%", ["Admetre"] = "UT:315/39%LB:698/95%EM:813/88%", ["Yanice"] = "EB:569/79%RM:597/66%", ["Galene"] = "ET:316/81%EB:640/86%LM:919/95%", ["Azrianya"] = "RT:379/50%EB:660/90%EM:764/83%", ["Sheepyure"] = "RT:547/69%LB:705/95%LM:929/97%", ["Taima"] = "UT:236/28%RB:409/59%EM:701/76%", ["Drbob"] = "RT:162/50%EB:400/81%EM:414/76%", ["Timdogtwo"] = "EB:615/86%EM:665/93%", ["Shaithis"] = "LT:869/98%LB:752/97%LM:934/97%", ["Landard"] = "RT:236/74%EB:669/84%RM:615/66%", ["Powerhunt"] = "ST:833/99%SB:803/99%LM:955/97%", ["Banksey"] = "ET:617/82%LB:751/96%EM:798/85%", ["Dalo"] = "LT:760/97%LB:766/97%LM:957/97%", ["Tathar"] = "ST:800/99%SB:821/99%SM:996/99%", ["Enduin"] = "ET:572/76%EB:640/87%EM:764/86%", ["Moonsong"] = "LT:762/96%SB:793/99%SM:999/99%", ["Pzyche"] = "ET:602/80%LB:780/98%SM:1008/99%", ["Mil"] = "ET:733/94%EB:712/90%EM:892/92%", ["Snacksized"] = "ET:691/90%LB:783/98%LM:945/96%", ["Bavaroo"] = "ET:691/90%LB:749/96%EM:862/93%", ["Fnarr"] = "ET:312/86%EB:717/92%EM:888/92%", ["Hemorrhage"] = "LT:627/98%EB:723/91%LM:948/96%", ["Epicgamor"] = "ST:834/99%LB:788/98%EM:924/94%", ["Therm"] = "LT:573/97%EB:701/90%EM:891/92%", ["Deadspell"] = "ET:645/85%LB:784/98%EM:655/78%", ["Vivs"] = "ET:712/92%LB:796/98%LM:951/96%", ["Lennethvalky"] = "RT:211/71%EB:667/84%EM:822/85%", ["Imarkon"] = "LT:747/95%EB:747/94%LM:763/95%", ["Reapervirus"] = "ET:718/92%EB:692/89%EM:806/86%", ["Kitianna"] = "LT:790/98%LB:778/98%LM:948/97%", ["Dashi"] = "LT:772/97%LB:792/98%EM:871/91%", ["Lagarde"] = "ET:644/84%EB:721/91%EM:592/87%", ["Nerdknight"] = "ST:743/99%SB:792/99%LM:980/98%", ["Zolt"] = "LT:765/96%LB:784/98%LM:964/97%", ["Elag"] = "ET:684/89%EB:730/92%EM:861/89%", ["Nefala"] = "ET:686/89%EB:569/79%RM:662/72%", ["Westinghouse"] = "ET:714/92%EB:708/94%EM:769/83%", ["Hellfirespam"] = "ET:738/94%EB:721/91%EM:477/80%", ["Cult"] = "RT:191/66%EB:734/93%EM:861/90%", ["Yuimetal"] = "ET:728/93%SB:800/99%LM:946/96%", ["Imhoturnot"] = "ET:629/83%SB:792/99%LM:982/98%", ["Jmack"] = "LT:779/98%SB:827/99%SM:985/99%", ["Zaara"] = "RT:471/62%RB:477/69%RM:603/73%", ["Gringleblast"] = "ET:302/85%EB:690/92%EM:647/75%", ["Lamanheru"] = "ET:705/91%LB:770/97%EM:903/93%", ["Sléèpy"] = "ET:576/77%LB:730/95%EM:768/82%", ["Fahrenheit"] = "ET:738/94%EB:738/93%LM:933/96%", ["Xixixi"] = "ET:658/86%EB:710/90%EM:857/88%", ["Smidgey"] = "ET:339/89%LB:770/97%LM:927/95%", ["Gnomygosh"] = "ET:307/86%EB:538/77%RM:628/66%", ["Manwithbeard"] = "ST:815/99%SB:807/99%SM:997/99%", ["Armaggedon"] = "ET:679/88%SB:807/99%LM:974/98%", ["Gribalo"] = "ET:658/86%LB:761/98%EM:867/94%", ["Kaleal"] = "ET:267/81%EB:693/92%EM:865/94%", ["Whiplash"] = "ET:694/90%EB:674/87%EM:855/90%", ["Amonett"] = "ET:731/93%LB:789/98%SM:996/99%", ["Alessandro"] = "ET:707/91%LB:741/96%LM:946/96%", ["Sèrax"] = "ET:678/88%LB:767/96%EM:893/93%", ["Psyconaut"] = "ET:679/88%EB:742/94%EM:890/91%", ["Squeegle"] = "ET:733/93%EB:739/93%EM:910/93%", ["Kneerwar"] = "ET:626/82%EB:745/94%EM:816/87%", ["Atrocity"] = "ET:732/94%LB:753/95%EM:911/93%", ["Snedit"] = "ET:699/90%LB:681/97%LM:939/95%", ["Riflemate"] = "ET:705/91%LB:764/96%EM:889/92%", ["Blueraven"] = "LT:754/95%LB:773/97%LM:939/95%", ["Phreaque"] = "LT:454/95%LB:653/96%LM:922/95%", ["Arttemisia"] = "ET:281/83%EB:473/88%EM:834/88%", ["Lilpumpkin"] = "ET:731/93%LB:790/98%LM:980/98%", ["Istian"] = "ET:711/91%EB:742/94%EM:897/94%", ["Onos"] = "LT:762/98%LB:724/95%LM:892/95%", ["Nøme"] = "LT:762/97%LB:763/97%LM:937/96%", ["Pretzellent"] = "LT:736/95%LB:777/98%LM:939/98%", ["Arioch"] = "ET:249/75%EB:740/93%EM:850/88%", ["Gloisa"] = "ET:600/79%EB:733/93%EM:747/78%", ["Lotus"] = "LT:783/98%SB:817/99%SM:986/99%", ["Vikki"] = "ET:570/75%EB:711/90%EM:817/85%", ["Krovak"] = "ET:542/91%LB:755/97%LM:885/95%", ["Kwatz"] = "ET:523/90%LB:765/98%EM:755/90%", ["Tinkz"] = "ET:315/86%EB:546/91%EM:763/88%", ["Claze"] = "LT:553/98%LB:659/98%LM:943/98%", ["Imtokanti"] = "ET:725/94%LB:775/98%LM:933/96%", ["Yunero"] = "LT:780/98%LB:780/98%SM:987/99%", ["Mikebison"] = "LT:584/98%LB:756/96%LM:953/97%", ["Yuuko"] = "ET:604/80%LB:792/98%LM:939/96%", ["Babnelma"] = "RT:523/69%EB:694/88%EM:761/79%", ["Warrstomp"] = "ET:688/92%EB:730/94%EM:876/93%", ["Mickeys"] = "ET:644/90%LB:736/96%EM:817/91%", ["Jazby"] = "ET:230/75%EB:580/93%EM:729/94%", ["Moochi"] = "ET:676/87%EB:562/91%EM:860/89%", ["Garree"] = "ET:279/83%EB:729/91%EM:897/92%", ["Emilia"] = "CT:108/18%EB:729/92%EM:908/94%", ["Jelarazz"] = "ET:359/91%EB:733/92%EM:908/93%", ["Thrillhouse"] = "RT:525/71%EB:696/88%EM:612/79%", ["Spacebar"] = "EB:667/85%EM:700/77%", ["Orangebox"] = "RT:149/55%EB:668/86%EM:754/82%", ["Onlyone"] = "LT:653/98%EB:711/90%EM:904/92%", ["Pirate"] = "ET:605/80%EB:698/89%EM:811/84%", ["Yungsandwich"] = "ET:376/92%EB:722/91%EM:852/90%", ["Willuz"] = "RT:505/69%EB:707/90%EM:763/82%", ["Polyaretos"] = "LT:731/95%EB:722/94%EM:835/93%", ["Despressod"] = "EB:697/92%EM:915/93%", ["Skyeden"] = "RT:215/69%EB:712/89%EM:886/90%", ["Rivendare"] = "UT:108/25%EB:704/88%EM:886/91%", ["Alamak"] = "EB:734/92%EM:897/91%", ["Dingleberri"] = "ET:716/92%LB:778/98%LM:967/97%", ["Devwar"] = "EB:666/85%EM:803/86%", ["Sôx"] = "ET:270/80%EB:603/93%EM:721/92%", ["Antarktick"] = "CT:112/14%SB:802/99%SM:1003/99%", ["Neminas"] = "ET:341/89%EB:708/90%EM:923/94%", ["Asspocalypse"] = "CT:138/22%EB:662/85%EM:721/93%", ["Mavroula"] = "ET:408/94%LB:663/96%LM:923/95%", ["Gawaain"] = "ET:425/94%EB:690/88%EM:741/78%", ["Mcbrute"] = "EB:665/85%EM:860/89%", ["Rokbottom"] = "EB:665/85%EM:885/93%", ["Ruwyn"] = "ET:680/88%LB:768/97%EM:923/94%", ["Sinsteel"] = "LT:762/97%SB:790/99%SM:987/99%", ["Azomi"] = "ET:438/94%LB:764/96%LM:944/95%", ["Balakay"] = "ET:580/76%EB:702/89%EM:886/90%", ["Thing"] = "ET:343/88%EB:712/90%EM:860/89%", ["Arminius"] = "RT:453/63%EB:689/88%EM:872/90%", ["Dankrogue"] = "RT:474/62%EB:676/87%EM:828/85%", ["Sweetmonz"] = "ET:647/89%EB:691/92%EM:669/85%", ["Adria"] = "EB:656/84%UM:334/39%", ["Fuzzyduck"] = "UT:339/44%EB:665/85%EM:890/91%", ["Coralflame"] = "RT:424/58%EB:667/85%EM:742/78%", ["Jackguiness"] = "UT:321/42%EB:692/88%EM:861/88%", ["Stabbygumby"] = "ET:321/86%EB:733/93%EM:495/79%", ["Kattara"] = "CT:78/9%EB:727/92%EM:776/82%", ["Moondranah"] = "LT:650/95%LB:760/98%LM:967/98%", ["Tango"] = "LB:787/98%LM:981/98%", ["Shoemeister"] = "CT:97/12%LB:796/98%SM:1024/99%", ["Grookk"] = "RT:458/60%EB:511/88%EM:820/85%", ["Cowl"] = "ET:606/79%EB:710/89%EM:867/89%", ["Riggered"] = "RT:496/69%EB:715/91%RM:559/64%", ["Kratos"] = "RT:162/59%EB:692/87%EM:918/94%", ["Enishi"] = "LT:532/96%EB:600/93%LM:933/96%", ["Addinix"] = "RT:463/62%EB:680/87%EM:874/89%", ["Habicht"] = "ET:689/89%EB:714/90%LM:925/95%", ["Vandana"] = "ET:596/78%EB:692/88%LM:971/98%", ["Darks"] = "EB:706/89%EM:854/88%", ["Archies"] = "ET:384/92%SB:801/99%SM:1014/99%", ["Roguedobird"] = "UT:99/36%EB:702/89%EM:821/85%", ["Benjorik"] = "RT:168/60%EB:617/80%RM:596/67%", ["Crooze"] = "EB:621/81%LM:964/98%", ["Kasais"] = "ET:669/87%LB:754/95%EM:862/91%", ["Åzorak"] = "ET:421/94%EB:585/92%EM:742/94%", ["Caoliu"] = "RT:472/62%EB:678/87%EM:856/88%", ["Magnarr"] = "ET:713/92%LB:768/97%EM:616/92%", ["Copie"] = "SB:846/99%LM:989/98%", ["Bomski"] = "LT:728/98%LB:763/98%LM:954/98%", ["Nalber"] = "CT:58/19%EB:511/88%RM:694/74%", ["Alesandero"] = "EB:519/75%RM:364/73%", ["Daalvan"] = "RB:483/70%EM:738/81%", ["Athwen"] = "LT:556/97%EB:630/88%EM:471/81%", ["Spurius"] = "ET:782/93%LB:748/97%LM:920/96%", ["Elefury"] = "CT:147/16%EB:583/82%EM:686/78%", ["Winona"] = "UT:350/46%RB:483/70%RM:437/52%", ["Virgilcain"] = "CT:62/16%EB:474/89%EM:829/92%", ["Sarise"] = "UB:336/47%RM:602/66%", ["Forannath"] = "LT:631/98%EB:723/94%EM:812/86%", ["Ironfaith"] = "ET:318/81%EB:636/87%EM:794/86%", ["Dwarffo"] = "CT:68/6%EB:562/78%EM:686/76%", ["Enishini"] = "RB:437/63%EM:783/85%", ["Vornak"] = "ET:393/89%EB:480/89%RM:638/70%", ["Umbradin"] = "RT:217/66%EB:682/92%LM:768/96%", ["Surtr"] = "ET:679/86%EB:613/86%EM:705/80%", ["Swiftheals"] = "CT:74/6%EB:379/80%RM:638/70%", ["Polyâretos"] = "CT:2/0%EB:523/76%RM:480/70%", ["Zoltan"] = "ET:361/87%LB:731/96%LM:929/96%", ["Desklamp"] = "EB:408/82%EM:710/81%", ["Goldelocks"] = "RT:413/53%EB:583/82%RM:360/72%", ["Milisabella"] = "CT:123/13%RB:465/67%RM:629/73%", ["Rodentia"] = "EB:617/86%UM:257/26%", ["Croaker"] = "UT:77/26%LB:768/98%EM:898/94%", ["Vtecc"] = "ET:593/76%EB:559/94%SM:975/99%", ["Nathri"] = "LT:853/98%LB:724/96%EM:797/88%", ["Misielle"] = "UT:344/43%LB:747/97%LM:924/96%", ["Farodin"] = "ET:467/94%LB:713/95%EM:743/83%", ["Vivere"] = "EB:667/90%EM:891/93%", ["Bixsham"] = "ET:469/93%EB:653/89%EM:875/91%", ["Elunous"] = "CT:126/14%RB:511/73%EM:662/77%", ["Florencnight"] = "ET:343/85%EB:535/77%EM:746/85%", ["Swirly"] = "ET:341/75%EB:524/94%EM:705/92%", ["Mends"] = "RT:430/55%RB:500/72%EM:662/93%", ["Mátildá"] = "UT:329/41%EB:591/81%EM:692/76%", ["Letsudiealot"] = "RB:498/72%EM:756/83%", ["Emeralda"] = "ET:683/86%LB:741/96%EM:891/93%", ["Andisa"] = "ST:688/99%EB:521/92%EM:585/89%", ["Woohoo"] = "CT:119/13%EB:557/80%UM:262/26%", ["Irae"] = "ET:368/88%EB:587/82%RM:362/73%", ["Snaareesha"] = "UT:262/32%EB:635/89%RM:608/67%", ["Lifesend"] = "RB:507/73%CM:203/24%", ["Obicorn"] = "CT:126/14%RB:494/71%RM:432/51%", ["Papatoa"] = "CT:80/24%CB:73/17%EM:779/84%", ["Zedoth"] = "ET:423/91%EB:724/94%LM:954/97%", ["Narlen"] = "CT:28/5%RB:505/72%EM:443/80%", ["Holyfaith"] = "UT:308/37%EB:585/83%EM:414/76%", ["Tuppin"] = "ET:286/76%EB:606/84%RM:579/67%", ["Cowzwithwind"] = "EB:539/93%EM:670/76%", ["Naimara"] = "ET:318/83%LB:719/95%EM:888/93%", ["Drazak"] = "ET:345/85%EB:676/93%EM:793/86%", ["Isaburu"] = "UT:360/44%EB:623/86%EM:684/75%", ["Vaara"] = "UT:331/43%EB:625/87%EM:815/89%", ["Riak"] = "RB:355/50%EM:710/81%", ["Misted"] = "ET:596/93%LB:754/97%LM:930/97%", ["Dissonance"] = "EB:559/79%RM:589/67%", ["Mengoo"] = "RT:175/54%EB:589/82%EM:793/86%", ["Elastoplast"] = "RT:188/57%EB:431/84%EM:838/92%", ["Ringo"] = "RB:505/70%RM:650/72%", ["Cjdjman"] = "ET:782/93%EB:700/94%LM:953/98%", ["Grogmug"] = "ET:734/89%EB:683/92%EM:690/93%", ["Schtaussen"] = "ET:336/85%EB:681/92%RM:618/71%", ["Hygieia"] = "RT:222/65%EB:520/75%EM:673/78%", ["Rouge"] = "RT:561/72%EB:670/91%RM:629/70%", ["Nali"] = "CT:52/4%EB:636/89%EM:432/78%", ["Elysius"] = "ET:262/76%RB:494/70%RM:598/68%", ["Divinea"] = "ET:305/82%LB:578/95%EM:828/91%", ["Flethginn"] = "ET:265/75%LB:641/98%EM:870/93%", ["Andop"] = "RB:452/65%RM:570/67%", ["Dwarfageddon"] = "RT:212/63%EB:559/80%RM:604/67%", ["Threnode"] = "RT:166/52%RB:435/59%CM:207/20%", ["Smegs"] = "EB:583/82%EM:829/91%", ["Priestlypose"] = "RT:227/66%RB:335/73%RM:457/54%", ["Taxman"] = "ET:406/91%EB:664/91%EM:736/82%", ["Magnuus"] = "RB:265/61%RM:466/55%", ["Blest"] = "RT:152/50%EB:492/90%EM:602/90%", ["Klassix"] = "EB:524/75%EM:678/77%", ["Supermodel"] = "CT:45/10%RB:432/62%EM:793/89%", ["Missclick"] = "CT:136/15%EB:671/91%EM:805/87%", ["Diamut"] = "ET:715/89%LB:752/97%EM:886/93%", ["Soulseraph"] = "RT:158/52%EB:531/75%EM:670/76%", ["Gixser"] = "EB:574/79%RM:547/61%", ["Noelshunter"] = "ET:732/94%LB:771/97%LM:936/95%", ["Fenix"] = "RT:533/73%EB:658/83%EM:825/86%", ["Moorden"] = "ET:251/77%EB:730/92%EM:537/82%", ["Magwar"] = "ET:672/91%EB:697/92%EM:872/93%", ["Tyroneda"] = "ET:654/85%EB:733/93%EM:821/87%", ["Bloodwyn"] = "ET:713/92%LB:775/97%LM:961/97%", ["Roadhouse"] = "RT:177/62%EB:675/87%EM:833/88%", ["Litchith"] = "LT:768/97%LB:771/97%EM:928/94%", ["Flamestarter"] = "ET:631/83%EB:650/89%EM:802/89%", ["Thedund"] = "LT:746/95%LB:770/97%EM:905/92%", ["Ra"] = "RT:539/72%RB:559/74%RM:604/66%", ["Ghraku"] = "ET:329/88%EB:611/94%EM:647/90%", ["Brondozer"] = "LT:760/96%LB:792/98%SM:986/99%", ["Hobsy"] = "RT:511/68%LB:741/96%EM:542/87%", ["Hasina"] = "ET:737/94%EB:741/93%EM:888/91%", ["Freexp"] = "CT:164/21%UB:225/30%RM:529/58%", ["Maomaomao"] = "LT:751/95%LB:782/98%LM:945/96%", ["Warshak"] = "LT:449/95%EB:679/86%EM:909/93%", ["Mooven"] = "LT:585/97%EB:665/85%EM:849/87%", ["Ðeathdealer"] = "ET:688/88%LB:758/95%LM:930/95%", ["Zoxx"] = "ET:641/85%LB:757/95%EM:893/92%", ["Nymo"] = "LT:764/97%LB:703/98%LM:964/98%", ["Rathpex"] = "ET:671/87%EB:747/94%RM:709/74%", ["Karyah"] = "ET:320/87%EB:696/93%EM:842/93%", ["Scarfaceclaw"] = "RT:490/65%EB:374/80%EM:531/89%", ["Skrra"] = "LT:768/97%LB:771/97%EM:932/94%", ["Llayne"] = "RT:547/73%EB:644/88%EM:481/86%", ["Brag"] = "ET:690/90%EB:733/92%EM:908/91%", ["Goodluck"] = "ET:603/79%EB:730/92%EM:864/89%", ["Nihilius"] = "ET:397/93%EB:537/92%LM:985/98%", ["Stanharris"] = "ET:332/89%EB:490/86%LM:937/96%", ["Fungmeat"] = "RT:511/69%EB:496/87%EM:829/86%", ["Galaxea"] = "ET:475/88%LB:771/98%EM:799/91%", ["Beastblade"] = "ET:667/87%LB:763/96%EM:912/93%", ["Jinbe"] = "ET:728/93%LB:762/96%LM:938/96%", ["Tmmingtan"] = "LT:730/96%LB:764/97%EM:768/86%", ["Anatalia"] = "RT:549/73%EB:680/91%EM:813/90%", ["Frozenpea"] = "UT:296/38%EB:546/76%RM:613/71%", ["Abagaia"] = "RT:516/70%EB:639/82%EM:682/83%", ["Sionell"] = "ET:268/81%EB:708/94%EM:887/92%", ["Moundmongrel"] = "ET:336/87%EB:747/94%LM:806/96%", ["Bbibbi"] = "ET:272/80%EB:745/94%LM:939/96%", ["Aristedes"] = "ET:280/87%LB:760/96%EM:913/94%", ["Zãc"] = "UT:112/40%RB:528/68%RM:585/63%", ["Ioll"] = "ET:655/86%EB:737/93%EM:920/93%", ["Speedysloth"] = "ET:703/91%LB:770/97%EM:909/93%", ["Protoast"] = "ET:635/84%EB:734/93%EM:873/91%", ["Brewed"] = "LT:736/95%LB:769/97%LM:923/96%", ["Syiren"] = "ET:728/93%LB:779/98%LM:931/96%", ["Dentzal"] = "ET:303/84%EB:736/93%EM:876/90%", ["Unfallén"] = "RT:471/73%LB:749/96%EM:854/94%", ["Lazarus"] = "ET:259/79%EB:691/89%EM:862/90%", ["Dorasan"] = "RT:394/52%EB:656/85%EM:779/82%", ["Harley"] = "LT:753/95%SB:809/99%LM:955/96%", ["Ranka"] = "LT:759/97%LB:772/98%SM:973/99%", ["Qetesh"] = "ET:246/77%EB:428/85%EM:744/84%", ["Mella"] = "ET:322/85%EB:745/94%EM:908/93%", ["Therwinnia"] = "ET:732/93%LB:778/97%LM:981/98%", ["Excession"] = "RT:217/69%EB:645/84%EM:863/89%", ["Suavebugga"] = "LT:760/96%SB:807/99%LM:955/96%", ["Taylorswift"] = "ET:605/80%LB:756/95%EM:858/90%", ["Muzza"] = "UT:300/40%LB:754/95%EM:898/92%", ["Fridge"] = "ET:259/79%EB:626/82%LM:938/96%", ["Jerkogist"] = "ET:608/81%EB:730/92%EM:810/85%", ["Astonmartyn"] = "ET:692/90%LB:768/97%LM:938/96%", ["Silentwinter"] = "ET:699/90%LB:756/95%LM:946/96%", ["Mizi"] = "ET:594/79%EB:727/91%EM:874/90%", ["Sorbs"] = "LT:762/96%LB:767/97%EM:904/94%", ["Kinigos"] = "LT:753/95%LB:780/98%LM:956/97%", ["Anika"] = "UT:183/28%EB:584/81%RM:168/52%", ["Stuka"] = "LT:652/98%EB:708/90%EM:857/88%", ["Clone"] = "ET:263/84%EB:686/94%EM:679/86%", ["Ujie"] = "RT:555/73%EB:653/84%EM:555/85%", ["Desdinova"] = "RT:440/69%EB:509/88%RM:644/69%", ["Sleepo"] = "ET:526/86%EB:705/94%LM:931/96%", ["Zebadtouch"] = "UT:179/37%EB:614/78%EM:718/76%", ["Lock"] = "ET:607/80%EB:705/90%EM:795/85%", ["Devz"] = "ET:685/92%EB:714/93%LM:950/97%", ["Zoglock"] = "ET:653/85%EB:739/93%EM:909/93%", ["Buffel"] = "ET:679/91%LB:774/98%LM:942/97%", ["Quetzl"] = "ET:700/93%EB:571/94%EM:881/93%", ["Kerravon"] = "LT:397/97%EB:681/94%EM:509/91%", ["Knockedloose"] = "ET:722/94%LB:756/96%EM:894/94%", ["Agen"] = "ET:540/87%EB:698/93%LM:941/97%", ["Valtaur"] = "ET:360/83%LB:703/95%LM:874/97%", ["Elata"] = "ET:549/91%EB:702/94%EM:809/92%", ["Gnomepoopy"] = "RT:446/61%RB:549/73%EM:854/90%", ["Yindao"] = "RT:370/51%EB:599/78%EM:770/81%", ["Putracide"] = "ET:372/90%LB:632/95%EM:925/94%", ["Wing"] = "LT:731/95%LB:787/98%LM:980/98%", ["Knee"] = "RT:144/51%EB:737/93%LM:945/96%", ["Joemuma"] = "EB:623/81%EM:764/80%", ["Dancerr"] = "ET:296/83%EB:718/90%LM:947/96%", ["Dahkness"] = "ET:590/77%EB:713/90%LM:974/98%", ["Sneakyphuk"] = "RT:230/72%EB:741/93%LM:837/96%", ["Carn"] = "ET:378/92%EB:525/89%LM:936/95%", ["Surly"] = "ET:350/89%LB:633/95%EM:764/94%", ["Qiaobiluo"] = "RT:486/67%EB:688/88%EM:793/83%", ["Littlechaoz"] = "UT:81/29%SB:804/99%LM:933/95%", ["Argwyne"] = "ET:637/84%EB:668/85%EM:833/88%", ["Ogkush"] = "RT:230/73%LB:753/95%EM:898/93%", ["Krypt"] = "LT:463/96%EB:659/84%EM:823/86%", ["Ahmeow"] = "ET:691/89%EB:711/90%RM:525/60%", ["Zerkot"] = "ET:396/92%EB:714/90%LM:889/98%", ["Blaid"] = "RT:397/54%EB:718/91%EM:766/81%", ["Ezree"] = "RT:437/58%EB:667/86%EM:830/86%", ["Junnym"] = "ET:352/91%SB:746/99%LM:915/96%", ["Elayniah"] = "LB:781/98%SM:1007/99%", ["Dreadcrest"] = "CT:35/13%EB:581/77%EM:706/75%", ["Omii"] = "ET:401/93%EB:699/89%EM:882/90%", ["Lionette"] = "EB:630/82%LM:910/95%", ["Scanktank"] = "RT:218/73%EB:728/91%EM:909/93%", ["Raim"] = "ET:365/91%EB:663/85%EM:832/86%", ["Kannaai"] = "EB:719/90%EM:913/93%", ["Nutteh"] = "LB:763/96%EM:918/94%", ["Trashboàt"] = "RT:229/72%EB:721/91%EM:887/92%", ["Shoxx"] = "RT:221/74%EB:697/88%LM:972/98%", ["Dixy"] = "ET:384/93%EB:705/89%LM:830/97%", ["Æyes"] = "LT:730/98%LB:774/98%LM:919/97%", ["Tazosin"] = "ST:757/99%LB:760/96%LM:974/98%", ["Convic"] = "UT:126/48%EB:462/84%RM:379/67%", ["Areius"] = "EB:732/92%LM:954/97%", ["Sneakysneak"] = "RT:504/66%EB:694/87%EM:906/92%", ["Adegal"] = "UT:78/28%EB:695/89%EM:609/87%", ["Gamrgirl"] = "EB:637/83%EM:912/93%", ["Seta"] = "RT:500/67%LB:760/96%EM:905/93%", ["Dotinatrix"] = "LT:666/98%LB:783/98%SM:1004/99%", ["Bakus"] = "LB:785/98%LM:961/97%", ["Stabii"] = "ET:672/86%EB:695/89%LM:933/95%", ["Sergis"] = "UT:77/30%EB:661/85%EM:618/79%", ["Carpoolcinno"] = "RT:389/57%LB:771/98%LM:953/97%", ["Darogue"] = "RT:559/73%EB:721/91%EM:557/84%", ["Deynari"] = "ET:636/84%EB:675/85%EM:871/90%", ["Whitegive"] = "RT:400/64%EB:644/88%EM:792/89%", ["Eo"] = "LT:454/95%LB:776/98%LM:982/98%", ["Morgiee"] = "UT:128/49%EB:660/85%RM:649/69%", ["Nata"] = "CT:64/7%EB:469/84%EM:706/92%", ["Blazing"] = "LT:743/96%SB:789/99%LM:910/96%", ["Whitewõlf"] = "RT:153/54%EB:591/78%RM:486/52%", ["Bacot"] = "CT:113/19%EB:700/88%EM:883/94%", ["Mandert"] = "RT:207/70%EB:671/86%EM:738/78%", ["Midñïght"] = "ET:332/88%LB:758/97%LM:960/97%", ["Selira"] = "EB:575/76%UM:441/46%", ["Mccxi"] = "ST:691/99%SB:794/99%SM:989/99%", ["Icarrythots"] = "EB:597/78%EM:677/92%", ["Ceeate"] = "RT:483/64%EB:688/87%EM:753/79%", ["Khulgan"] = "ST:758/99%LB:685/97%LM:863/98%", ["Ronaldo"] = "UT:378/49%SB:782/99%EM:488/86%", ["Jjtwo"] = "RT:494/67%EB:723/91%EM:767/83%", ["Swiftkill"] = "ET:710/91%LB:760/96%EM:806/84%", ["Huuko"] = "ET:585/78%EB:668/85%EM:537/84%", ["Jeordaeus"] = "ET:425/94%LB:782/98%SM:885/99%", ["Chenny"] = "LT:770/97%EB:712/94%LM:931/95%", ["Lerondo"] = "RT:220/70%EB:688/88%EM:811/85%", ["Meanusbeanus"] = "ET:627/82%LB:758/96%EM:910/93%", ["Booglez"] = "UT:188/29%EB:644/81%EM:784/85%", ["Tardigrade"] = "ET:710/94%LB:779/98%LM:927/96%", ["Jorna"] = "UT:349/45%EB:375/79%RM:545/60%", ["Soltzman"] = "ET:678/85%EB:658/90%LM:841/98%", ["Tayjavu"] = "LT:641/98%EB:631/87%EM:479/84%", ["Bzerkz"] = "EB:532/84%EM:673/84%", ["Beardman"] = "RB:529/73%UM:435/47%", ["Saint"] = "UB:275/37%UM:380/40%", ["Songicefire"] = "ET:283/78%EB:618/85%RM:635/70%", ["Paulgale"] = "LT:655/98%EB:638/88%EM:742/81%", ["Chonbahh"] = "ET:722/88%EB:592/83%EM:551/87%", ["Bodak"] = "RB:432/62%RM:291/64%", ["Valashu"] = "EB:578/80%EM:760/83%", ["Lilylo"] = "ET:593/77%EB:563/81%EM:643/75%", ["Healzwithat"] = "RT:245/69%EB:445/86%RM:614/68%", ["Ashska"] = "EB:625/85%EM:783/85%", ["Nimladris"] = "ET:325/82%LB:623/97%EM:584/88%", ["Droidof"] = "RT:511/68%EB:585/84%EM:604/90%", ["Anthelas"] = "UT:145/48%RB:514/71%RM:663/73%", ["Simplejack"] = "ET:298/78%EB:635/87%EM:836/90%", ["Acidic"] = "EB:572/81%EM:680/78%", ["Rooinella"] = "UT:140/44%EB:399/81%RM:591/69%", ["Scoben"] = "CT:181/21%UB:340/45%RM:634/70%", ["Kelvan"] = "UT:367/47%EB:541/78%EM:714/78%", ["Packardbell"] = "ET:328/82%EB:621/86%EM:853/92%", ["Erevon"] = "SB:820/99%LM:974/98%", ["Sona"] = "RB:505/73%EM:804/87%", ["Mels"] = "RT:486/62%EB:654/90%EM:679/77%", ["Rillien"] = "RT:458/58%EB:604/83%EM:452/80%", ["Wingliss"] = "EB:611/84%EM:856/91%", ["Elivra"] = "UT:132/42%EB:465/89%RM:565/66%", ["Piellia"] = "ET:365/88%EB:695/94%EM:861/91%", ["Florondra"] = "ET:649/81%EB:698/94%EM:739/84%", ["Rahvin"] = "ET:399/89%EB:530/93%EM:716/79%", ["Nodeath"] = "CT:65/5%EB:661/91%EM:756/84%", ["Dobbypriest"] = "EB:372/79%EM:701/81%", ["Jubïlee"] = "ET:459/93%EB:449/86%EM:851/91%", ["Orpheus"] = "UT:256/32%EB:581/81%RM:594/66%", ["Isopod"] = "ET:610/77%EB:561/80%EM:861/92%", ["Brunnilla"] = "UT:159/49%RB:412/58%RM:465/55%", ["Saintpheo"] = "UT:235/28%EB:543/75%EM:768/84%", ["Sneakytrksta"] = "RT:182/56%EB:404/82%RM:581/64%", ["Hicky"] = "RB:516/74%RM:578/62%", ["Darkowen"] = "RT:241/72%RB:470/68%EM:442/81%", ["Arcdruid"] = "LT:528/96%EB:633/88%EM:672/88%", ["Dapally"] = "CT:82/7%RB:362/50%RM:498/54%", ["Jockp"] = "RB:437/63%LM:871/95%", ["Zestra"] = "RT:217/64%RB:333/73%EM:698/77%", ["Vellarax"] = "RT:195/59%EB:659/90%EM:884/94%", ["Desudesudesu"] = "ET:632/79%RB:509/73%EM:598/89%", ["Luciancorian"] = "CT:45/12%RB:460/65%RM:638/70%", ["Sieera"] = "UT:332/41%RB:419/60%EM:817/91%", ["Fuktheccp"] = "UT:122/41%RB:476/67%EM:447/82%", ["Golden"] = "UT:146/46%EB:587/81%RM:550/65%", ["Bem"] = "CT:173/23%LB:763/98%EM:841/89%", ["Flippyowl"] = "RT:432/54%EB:632/88%EM:816/91%", ["Diffiehelman"] = "UT:107/38%RB:518/72%RM:558/61%", ["Psbb"] = "RT:478/62%EB:536/76%EM:685/88%", ["Eíra"] = "UT:89/31%EB:397/81%RM:523/60%", ["Rustyom"] = "CT:135/15%RB:508/70%EM:682/79%", ["Wildesa"] = "RT:397/52%EB:629/87%EM:837/90%", ["Zypholy"] = "RT:186/56%EB:600/85%EM:404/75%", ["Shamology"] = "ET:333/82%EB:629/87%RM:300/65%", ["Fishwife"] = "EB:585/81%RM:642/71%", ["Hoddz"] = "UB:306/42%RM:486/57%", ["Wildknight"] = "RT:249/73%EB:471/88%RM:303/66%", ["Florayla"] = "UT:210/28%EB:685/93%EM:834/91%", ["Maraina"] = "EB:472/90%EM:810/87%", ["Yvie"] = "CT:122/13%RB:253/59%EM:732/80%", ["Eii"] = "ET:367/87%EB:386/79%EM:850/91%", ["Arnemetia"] = "ET:333/82%RB:481/69%EM:656/75%", ["Lolikoko"] = "RB:489/70%RM:646/71%", ["Meld"] = "ET:605/76%EB:561/80%EM:783/85%", ["Healaton"] = "CT:137/15%RB:505/70%EM:728/80%", ["Fezzaa"] = "RT:495/64%EB:617/86%EM:748/82%", ["Angal"] = "UT:323/40%EB:541/77%RM:639/74%", ["Static"] = "RB:512/71%EM:711/78%", ["Redsdwarf"] = "ET:664/87%EB:726/92%EM:844/87%", ["Lare"] = "ET:725/93%LB:780/98%SM:996/99%", ["Kazami"] = "ET:252/78%EB:694/89%EM:817/86%", ["Toiletbrush"] = "ET:271/79%EB:713/90%EM:847/87%", ["Chadsmells"] = "ET:708/91%LB:795/98%LM:942/95%", ["Smallperson"] = "ET:289/82%EB:666/86%RM:613/66%", ["Lolikondashu"] = "RT:157/57%EB:654/84%LM:933/96%", ["Hoansblast"] = "RT:166/60%UB:256/35%UM:241/30%", ["Orangmaen"] = "RT:212/69%EB:632/82%EM:853/89%", ["Jerol"] = "RT:149/55%UB:309/40%UM:155/45%", ["Zzfer"] = "RT:161/65%EB:665/90%EM:674/78%", ["Anromeda"] = "ET:666/87%LB:760/96%EM:915/94%", ["Fluffles"] = "RT:486/66%EB:604/79%RM:677/73%", ["Splendour"] = "ET:688/93%LB:767/97%LM:916/96%", ["Cyza"] = "RT:423/56%EB:642/88%EM:712/77%", ["Yusoo"] = "RT:437/60%EB:625/81%RM:307/65%", ["Iamgnome"] = "ET:240/76%RB:322/73%RM:605/67%", ["Hillslock"] = "ET:662/86%LB:750/95%EM:727/93%", ["Rc"] = "RT:458/63%RB:367/74%EM:844/89%", ["Honoresa"] = "ET:706/91%EB:749/94%EM:832/83%", ["Dujek"] = "LT:753/96%LB:737/95%LM:641/95%", ["Quingstarr"] = "ET:638/84%EB:694/89%RM:362/71%", ["Moonstride"] = "RT:460/72%EB:714/93%LM:917/95%", ["Adnewton"] = "LT:745/96%LB:767/97%LM:912/95%", ["Philomena"] = "UT:272/35%RB:518/69%RM:592/65%", ["Oorlov"] = "ET:615/82%LB:766/96%LM:950/97%", ["Hons"] = "ET:657/86%LB:762/96%EM:904/92%", ["Tiggrazulka"] = "ET:678/88%LB:762/96%EM:740/79%", ["Wulu"] = "ET:675/88%EB:745/94%EM:914/94%", ["Brion"] = "ET:253/78%EB:729/92%EM:895/93%", ["Schala"] = "RT:205/69%EB:688/89%EM:797/85%", ["Poria"] = "ET:575/79%EB:703/89%RM:658/70%", ["Theghar"] = "ET:271/80%EB:664/85%EM:891/92%", ["Junata"] = "RT:189/66%EB:615/81%RM:373/74%", ["Brat"] = "ET:631/83%LB:635/95%EM:814/84%", ["Applebandit"] = "LT:563/98%LB:747/97%SM:1064/99%", ["Avicii"] = "RT:190/66%EB:556/75%CM:72/6%", ["Erkalmiester"] = "UT:117/45%RB:557/71%EM:828/86%", ["Monikacheng"] = "RT:434/57%EB:535/76%UM:115/37%", ["Swiffty"] = "ET:626/83%EB:519/89%EM:857/89%", ["Cloud"] = "ET:275/84%EB:707/93%LM:953/97%", ["Sinacle"] = "CT:188/24%EB:631/82%RM:691/74%", ["Darkzhunter"] = "LT:466/95%EB:743/94%EM:882/91%", ["Caedailitri"] = "UT:321/43%EB:706/90%EM:805/85%", ["Pandahunts"] = "UT:335/45%EB:709/90%EM:772/81%", ["Dreamlost"] = "ET:342/90%EB:478/85%EM:902/94%", ["Jazzy"] = "ET:715/94%LB:756/96%EM:868/93%", ["Kamazii"] = "LT:743/96%LB:708/98%LM:926/96%", ["Oldbuster"] = "UT:299/38%RB:480/64%RM:486/55%", ["Tazlar"] = "UT:269/34%EB:652/82%EM:713/75%", ["Danite"] = "ET:636/88%EB:707/92%EM:852/92%", ["Coldie"] = "ET:729/93%LB:657/98%LM:941/96%", ["Smokehoof"] = "LT:706/96%LB:745/97%EM:793/90%", ["Subjugator"] = "LT:762/97%EB:723/94%LM:884/95%", ["Corin"] = "RT:416/54%RB:513/72%RM:655/72%", ["Isaack"] = "ET:721/94%LB:770/97%LM:923/96%", ["Rethilgore"] = "LT:713/97%LB:772/98%SM:940/99%", ["Lyni"] = "UT:83/32%EB:677/91%EM:708/81%", ["Throbulator"] = "RT:196/64%EB:423/80%RM:607/65%", ["Amumu"] = "RT:392/53%EB:699/89%EM:833/86%", ["Bowgar"] = "ET:630/88%EB:531/92%EM:896/94%", ["Armbeyance"] = "ET:672/91%EB:615/86%EM:806/90%", ["Shira"] = "ET:307/89%EB:533/85%EM:630/83%", ["Bradman"] = "ET:578/83%EB:630/87%EM:785/89%", ["Nachtmystium"] = "ET:305/83%EB:543/90%EM:873/90%", ["Stümpy"] = "ET:717/94%LB:775/98%LM:924/96%", ["Eddiez"] = "ET:716/94%EB:713/93%EM:510/91%", ["Kuldan"] = "ET:674/88%EB:714/91%EM:853/88%", ["Oldtime"] = "UT:119/46%RB:311/66%UM:342/39%", ["Oorage"] = "RT:393/54%EB:451/83%EM:781/89%", ["Flush"] = "UT:69/28%RB:563/72%EM:782/82%", ["Omegahealzzs"] = "ET:699/94%LB:736/97%LM:880/97%", ["Omegamoo"] = "ET:623/82%EB:700/88%LM:928/95%", ["Oldmanmatt"] = "EB:639/83%RM:506/57%", ["Macdanife"] = "RT:206/67%EB:652/84%EM:828/85%", ["Fivewarriors"] = "CT:0/7%RB:563/74%EM:763/82%", ["Amberrior"] = "ET:260/80%EB:573/92%EM:818/87%", ["Robbostab"] = "RT:152/53%EB:472/84%EM:500/80%", ["Ellin"] = "ET:590/78%EB:702/89%LM:916/95%", ["Chadgnome"] = "RT:152/56%EB:664/85%EM:753/79%", ["Handrindezar"] = "UT:105/41%EB:676/86%EM:726/77%", ["Question"] = "ET:502/76%EB:615/80%RM:322/62%", ["Hogey"] = "ET:382/92%EB:722/91%EM:893/91%", ["Fandetta"] = "EB:621/81%EM:722/76%", ["Wyetta"] = "LT:511/97%EB:697/88%EM:824/86%", ["Featherwind"] = "LT:787/98%SB:847/99%SM:1007/99%", ["Elektron"] = "RT:221/73%EB:648/83%EM:785/84%", ["Emkay"] = "RT:534/70%EB:640/83%EM:708/76%", ["Messer"] = "EB:631/82%EM:884/91%", ["Hanma"] = "RT:545/73%EB:672/86%LM:939/96%", ["Mordaxt"] = "LT:770/97%SB:819/99%SM:972/99%", ["Chunkmeat"] = "RT:461/63%EB:661/85%RM:662/73%", ["Slinks"] = "ET:244/75%EB:739/93%LM:959/97%", ["Thornix"] = "ET:317/86%EB:676/86%EM:499/80%", ["Manaan"] = "ET:293/83%EB:576/92%EM:891/91%", ["Gonfar"] = "EB:665/85%EM:485/81%", ["Phocks"] = "LT:745/95%SB:795/99%LM:964/97%", ["Magizima"] = "LT:431/97%LB:746/96%LM:899/95%", ["Bigbadbaldy"] = "RT:232/73%RB:558/74%RM:530/57%", ["Hoplite"] = "CT:30/11%EB:641/83%EM:629/80%", ["Vegemate"] = "ET:593/77%EB:681/87%EM:902/93%", ["Muffinman"] = "ET:402/93%LB:789/98%SM:960/99%", ["Tarragona"] = "EB:535/89%EM:615/88%", ["Twoinch"] = "ET:251/75%EB:716/91%EM:863/91%", ["Missbrandy"] = "RT:200/66%EB:672/85%EM:902/92%", ["Ulrica"] = "UT:109/40%EB:627/80%EM:823/85%", ["Helmira"] = "ET:345/88%LB:754/95%LM:951/96%", ["Lolii"] = "EB:636/81%EM:793/82%", ["Hugglebug"] = "RT:506/67%LB:770/97%LM:698/95%", ["Vraelan"] = "RT:543/73%EB:649/83%RM:291/60%", ["Ketick"] = "ET:302/86%LB:755/95%EM:864/91%", ["Armsgay"] = "RT:474/64%EB:687/87%RM:449/51%", ["Lesanto"] = "RT:160/56%EB:646/83%RM:606/65%", ["Serenah"] = "RT:170/58%EB:670/85%EM:922/94%", ["Dingléberry"] = "ET:400/93%EB:656/84%EM:729/79%", ["Sleya"] = "RB:506/64%EM:898/89%", ["Syxe"] = "LT:769/97%EB:724/92%LM:964/98%", ["Mankrikerino"] = "EB:730/92%EM:897/92%", ["Vi"] = "LT:774/97%SB:815/99%EM:833/86%", ["Zarienne"] = "ET:322/85%LB:756/95%EM:919/94%", ["Arther"] = "RT:165/57%EB:688/88%EM:913/93%", ["Lysergicius"] = "RT:503/66%EB:686/88%EM:821/85%", ["Eternalglory"] = "RT:200/68%EB:678/86%EM:833/86%", ["Evonid"] = "RT:390/53%EB:707/90%EM:862/89%", ["Whissin"] = "LT:756/96%SB:802/99%SM:1008/99%", ["Solohan"] = "LB:790/98%LM:985/98%", ["Okamio"] = "ET:568/76%SB:816/99%SM:989/99%", ["Hugyou"] = "UT:261/33%EB:621/81%EM:858/89%", ["Arcani"] = "ET:344/89%LB:764/98%LM:889/95%", ["Thaxor"] = "LT:454/95%LB:781/98%LM:897/98%", ["Dragal"] = "LB:767/96%LM:936/95%", ["Twiztid"] = "LT:537/96%LB:764/96%EM:893/93%", ["Silencium"] = "LT:687/95%SB:786/99%SM:1076/99%", ["Dixiethedead"] = "ET:608/79%EB:685/87%EM:906/92%", ["Neoncircuit"] = "LT:781/98%SB:804/99%SM:983/99%", ["Handho"] = "UT:237/34%EB:660/83%EM:783/82%", ["Axxarrior"] = "CT:34/13%EB:649/82%EM:827/86%", ["Bloodlust"] = "ET:364/86%EB:681/91%EM:825/88%", ["Classichealz"] = "UB:318/43%RM:466/51%", ["Karoz"] = "RT:231/69%RB:333/71%RM:553/63%", ["Futon"] = "CT:131/14%UB:346/48%UM:270/27%", ["Sethdru"] = "EB:458/87%EM:802/88%", ["Chanowan"] = "UT:231/31%EB:670/90%EM:903/94%", ["Druidlord"] = "ET:351/86%EB:618/85%EM:897/94%", ["Shinkicker"] = "LB:722/96%LM:898/95%", ["Shacow"] = "ET:707/86%EB:673/91%EM:822/87%", ["Capri"] = "RT:227/66%RB:522/72%EM:772/84%", ["Aubrey"] = "EB:537/76%EM:799/86%", ["Dankshifter"] = "LT:814/95%EB:644/89%LM:896/95%", ["Alvyna"] = "UB:160/39%UM:280/33%", ["Styxie"] = "ET:263/75%EB:442/85%RM:585/67%", ["Holypaladin"] = "RT:530/68%EB:657/90%EM:749/84%", ["Auzfury"] = "ET:324/83%LB:582/95%EM:887/93%", ["Thalyra"] = "UT:150/46%UB:277/37%UM:100/44%", ["Bilbssy"] = "CT:59/5%EB:628/87%EM:813/88%", ["Hem"] = "EB:560/94%EM:819/90%", ["Shamfu"] = "CT:212/24%EB:528/75%RM:329/69%", ["Hollyice"] = "RT:172/56%EB:549/78%EM:706/77%", ["Shamaholic"] = "RT:180/54%EB:626/85%EM:777/84%", ["Deathslight"] = "UT:295/35%RB:476/67%RM:665/73%", ["Hymon"] = "CT:67/19%EB:340/75%UM:430/46%", ["Oparawinfury"] = "UT:116/36%UB:156/40%UM:314/32%", ["Paella"] = "CT:15/2%RB:426/60%UM:324/37%", ["Mantii"] = "LT:560/97%RB:423/60%RM:163/54%", ["Vannilla"] = "UT:93/32%RB:486/69%RM:619/68%", ["Gandua"] = "EB:583/80%EM:810/87%", ["Ono"] = "EB:608/85%EM:729/82%", ["Chastitha"] = "RB:442/63%RM:297/66%", ["Onrack"] = "UT:83/25%RB:324/71%RM:485/57%", ["Missjade"] = "EB:684/92%EM:883/93%", ["Bart"] = "UT:370/46%RB:471/67%RM:607/69%", ["Jezzabelle"] = "ET:748/91%LB:589/96%EM:817/89%", ["Ticond"] = "ET:517/85%EB:649/90%EM:746/86%", ["Karlowcaty"] = "ET:666/91%EB:591/89%EM:777/93%", ["Diabeatus"] = "UB:189/46%UM:303/36%", ["Lilystar"] = "RT:433/55%EB:656/89%EM:809/87%", ["Altharin"] = "RT:210/65%UB:343/47%UM:427/46%", ["Healtome"] = "UT:137/43%RB:463/66%EM:685/79%", ["Falco"] = "RB:399/57%EM:599/80%", ["Randgrio"] = "EB:566/80%RM:587/67%", ["Truxnell"] = "RT:249/72%UB:325/46%UM:375/40%", ["Aziralel"] = "ET:287/79%EB:602/84%EM:412/79%", ["Blessarella"] = "RT:169/57%EB:353/76%EM:445/80%", ["Allsia"] = "UB:316/43%RM:574/63%", ["Grommet"] = "RT:552/71%EB:613/85%EM:707/77%", ["Nasikangkang"] = "RB:420/60%RM:309/65%", ["Solafide"] = "CT:162/19%UB:226/29%RM:329/69%", ["Falka"] = "RT:215/63%RB:509/73%RM:370/72%", ["Mieliey"] = "RT:495/63%EB:360/76%EM:656/76%", ["Winnieblues"] = "RB:283/65%CM:108/14%", ["Filthyanimal"] = "CT:80/24%RB:493/71%EM:497/83%", ["Sureya"] = "RT:524/68%EB:634/88%RM:651/72%", ["Sinno"] = "EB:712/94%EM:879/94%", ["Strogganoff"] = "UT:335/46%EB:386/82%EM:685/79%", ["Abstains"] = "UB:311/43%CM:131/14%", ["Elorane"] = "ET:357/88%EB:560/77%EM:440/79%", ["Ajbluey"] = "UT:367/48%RB:405/59%RM:594/70%", ["Frakus"] = "RT:264/73%EB:531/76%RM:580/64%", ["Anomanderake"] = "CT:63/5%RB:475/69%UM:309/35%", ["Voel"] = "UT:225/27%RB:464/67%EM:858/93%", ["Caedmon"] = "LT:505/95%EB:678/91%EM:890/93%", ["Ishkajarah"] = "CT:145/16%RB:297/67%EM:656/76%", ["Carat"] = "ET:376/88%EB:567/81%EM:487/82%", ["Arsie"] = "RB:449/65%RM:632/69%", ["Anjingburuk"] = "CT:79/23%EB:570/82%EM:451/80%", ["Meltzer"] = "UT:84/27%EB:610/83%RM:623/69%", ["Shmooze"] = "UT:159/49%UB:350/49%UM:122/39%", ["Balzac"] = "EB:352/76%RM:407/65%", ["Mhilly"] = "RT:242/72%EB:505/91%RM:541/59%", ["Kyr"] = "UT:258/34%EB:619/86%EM:741/83%", ["Mazguroth"] = "RB:452/67%RM:645/74%", ["Booff"] = "ET:261/75%LB:711/95%EM:818/88%", ["Bearshock"] = "ET:366/86%RB:432/62%UM:151/44%", ["Njorz"] = "UB:266/35%UM:275/28%", ["Terluna"] = "EB:539/78%UM:406/44%", ["Xek"] = "ET:666/82%EB:703/93%EM:868/91%", ["Midz"] = "CT:155/17%EB:529/76%EM:727/80%", ["Aggrovator"] = "RT:235/70%EB:397/80%EM:775/86%", ["Zhenia"] = "RB:485/70%RM:378/73%", ["Euthanize"] = "CT:204/24%RB:479/69%UM:133/36%", ["Thanarin"] = "UT:32/30%RB:511/71%EM:855/91%", ["Khooey"] = "UT:118/40%RB:392/54%RM:469/51%", ["Torsten"] = "ET:558/75%EB:711/91%EM:899/93%", ["Tks"] = "RT:404/66%EB:609/86%EM:683/86%", ["Honeyjoy"] = "RT:190/63%EB:659/85%EM:733/78%", ["Bretech"] = "ET:674/87%EB:702/89%EM:705/76%", ["Matrias"] = "ET:680/91%EB:704/92%EM:803/91%", ["Metafizzicks"] = "ET:663/86%LB:772/97%EM:924/94%", ["Tryliard"] = "ET:598/80%EB:700/89%EM:882/90%", ["Narcia"] = "RT:205/66%EB:681/87%EM:804/83%", ["Zakin"] = "ET:303/85%EB:532/90%EM:884/92%", ["Sting"] = "UT:112/41%RB:450/60%EM:782/81%", ["Boow"] = "ET:712/93%EB:710/93%EM:627/80%", ["Margo"] = "RT:222/73%EB:659/86%EM:799/84%", ["Deezbonez"] = "ET:253/76%EB:558/91%EM:840/87%", ["Grimgarth"] = "ET:692/92%EB:667/90%EM:783/90%", ["Izefia"] = "UT:221/32%EB:567/75%EM:746/79%", ["Esende"] = "LT:751/97%SB:787/99%SM:1001/99%", ["Gundur"] = "RT:147/54%RB:271/61%RM:685/73%", ["Meera"] = "ET:615/81%EB:658/85%RM:595/64%", ["Milkmate"] = "ET:520/84%EB:593/85%EM:755/88%", ["Dhrazar"] = "ET:469/88%EB:514/85%EM:665/87%", ["Minideath"] = "RT:452/60%EB:741/94%EM:790/82%", ["Rezped"] = "RT:391/55%EB:590/77%RM:316/67%", ["Rickwell"] = "ET:620/87%LB:747/96%EM:887/94%", ["Ufourian"] = "RT:141/53%LB:758/95%LM:932/96%", ["Shaddyguy"] = "ET:578/76%EB:620/81%RM:524/57%", ["Avadiàtor"] = "ET:556/75%EB:472/86%RM:597/66%", ["Aureon"] = "ET:689/92%EB:662/90%EM:758/88%", ["Qidiao"] = "ET:240/89%EB:605/90%EM:681/86%", ["Milkabull"] = "ET:583/84%LB:714/96%EM:843/93%", ["Rakshatiz"] = "CT:65/22%RB:407/55%CM:72/22%", ["Fodargh"] = "RT:403/54%EB:728/92%EM:776/81%", ["Shadowpower"] = "CT:74/9%UB:297/39%UM:319/37%", ["Mayme"] = "ET:316/89%EB:490/75%EM:584/81%", ["Nncha"] = "RT:568/74%EB:403/78%EM:868/90%", ["Darni"] = "RT:161/59%RB:503/67%EM:678/75%", ["Biozou"] = "ET:678/91%LB:587/95%EM:841/92%", ["Withaq"] = "ET:454/82%EB:581/94%EM:882/94%", ["Celador"] = "ET:703/94%LB:759/98%LM:960/98%", ["Pikelets"] = "ET:611/91%LB:740/96%EM:825/91%", ["Jupiter"] = "ET:592/85%EB:645/88%EM:809/90%", ["Valliance"] = "ET:251/81%EB:727/94%EM:870/93%", ["Tearess"] = "ET:589/84%EB:589/84%EM:727/86%", ["Theurgen"] = "UT:127/45%RB:239/55%UM:312/37%", ["Husosheep"] = "LT:728/96%EB:635/91%LM:913/97%", ["Skywarlock"] = "CT:85/11%CB:151/20%UM:126/39%", ["Moopies"] = "ET:692/92%EB:609/86%EM:680/85%", ["Xrita"] = "RT:261/68%EB:447/76%EM:597/76%", ["Bighots"] = "ET:569/92%EB:565/88%RM:413/71%", ["Tranimal"] = "ET:562/82%EB:651/93%LM:930/98%", ["Alpharaven"] = "RT:153/61%EB:497/76%EM:575/76%", ["Shootyqt"] = "SB:847/99%SM:1071/99%", ["Lionella"] = "UT:94/38%EB:531/77%EM:688/84%", ["Beliz"] = "LT:481/96%LB:770/97%EM:884/91%", ["Meltdown"] = "ET:670/87%LB:768/97%SM:980/99%", ["Outofbounds"] = "ET:288/84%EB:638/82%EM:689/76%", ["Warrstain"] = "ST:685/99%EB:708/93%EM:600/82%", ["Macmeg"] = "ET:256/79%EB:592/77%EM:468/80%", ["Thebigbull"] = "ET:700/94%SB:796/99%SM:988/99%", ["Koromak"] = "ET:599/78%EB:651/84%EM:888/92%", ["Stinkydee"] = "ET:237/76%EB:628/81%EM:493/81%", ["Protroast"] = "ST:665/99%SB:788/99%SM:1033/99%", ["Confuscious"] = "ET:286/93%LB:781/98%SM:1047/99%", ["Sometime"] = "EB:588/77%", ["Pacci"] = "ET:339/88%EB:468/84%RM:648/69%", ["Ragranos"] = "ET:258/79%LB:755/95%LM:980/98%", ["Rtan"] = "EB:622/79%EM:903/92%", ["Lestibournes"] = "RT:491/65%EB:642/83%RM:691/74%", ["Unclecreepy"] = "RT:219/70%EB:665/84%RM:653/70%", ["Malevolencia"] = "LT:475/96%SB:787/99%SM:930/99%", ["Rexxer"] = "ET:682/88%EB:726/92%EM:792/83%", ["Mooshine"] = "ET:673/88%LB:782/98%SM:993/99%", ["Iampcyn"] = "RT:228/74%EB:642/83%EM:797/83%", ["Dalawere"] = "CT:114/14%EB:605/79%EM:897/91%", ["Aegan"] = "EB:680/86%EM:921/94%", ["Shortjoke"] = "RT:149/54%SB:759/99%SM:983/99%", ["Vreenak"] = "ET:369/91%LB:762/97%LM:934/95%", ["Azzielliea"] = "ET:338/89%LB:737/95%EM:868/91%", ["Rosyath"] = "RT:161/59%EB:650/82%EM:813/85%", ["Shakul"] = "LT:544/97%LB:775/97%LM:870/98%", ["Vampiria"] = "UT:330/43%EB:691/88%EM:864/88%", ["Gasillus"] = "ET:719/92%LB:755/95%EM:887/93%", ["Kaldira"] = "RT:149/55%EB:640/82%EM:733/78%", ["Kythe"] = "RT:226/74%EB:606/79%EM:496/82%", ["Faranoch"] = "ST:745/99%LB:770/97%LM:983/98%", ["Verlexia"] = "LT:770/97%SB:781/99%EM:918/94%", ["Voe"] = "EB:704/89%EM:752/80%", ["Banzai"] = "RT:200/73%EB:719/90%LM:948/96%", ["Uraith"] = "ET:413/94%LB:758/95%LM:932/96%", ["Saiya"] = "RT:219/70%EB:680/86%EM:891/91%", ["Delarix"] = "RT:206/68%RB:551/73%UM:189/46%", ["Bogdanoff"] = "ET:718/92%EB:746/94%LM:955/97%", ["Wii"] = "ET:413/94%EB:668/85%EM:820/85%", ["Cashfan"] = "ET:328/86%LB:752/95%EM:897/94%", ["Balor"] = "RT:212/71%EB:621/80%EM:840/87%", ["Chocobunny"] = "UT:351/45%EB:678/87%EM:707/76%", ["Hurtstone"] = "LT:611/97%LB:755/95%LM:944/96%", ["Sheoldred"] = "ET:640/84%SB:801/99%EM:868/91%", ["Spikes"] = "RB:532/71%RM:505/56%", ["Hideinbush"] = "RT:211/69%EB:624/81%EM:721/77%", ["Danzigg"] = "CT:54/10%EB:625/79%EM:862/89%", ["Deathrow"] = "EB:613/80%EM:905/93%", ["Giggityguu"] = "EB:734/92%EM:895/91%", ["Khalexus"] = "CT:42/17%EB:605/79%EM:820/91%", ["Swamptank"] = "UT:231/34%RB:537/71%EM:522/84%", ["Silverhawk"] = "LT:752/95%LB:789/98%SM:1010/99%", ["Shurrik"] = "RT:560/74%EB:632/80%EM:880/90%", ["Karlo"] = "ET:337/89%EB:694/87%EM:895/92%", ["Port"] = "ET:716/92%LB:772/98%EM:612/92%", ["Op"] = "RB:544/72%RM:505/53%", ["Raxigar"] = "ET:370/92%EB:716/91%EM:893/92%", ["Waran"] = "RT:155/52%LB:731/96%EM:754/82%", ["Seraphblade"] = "RB:295/65%RM:458/50%", ["Bens"] = "EB:629/86%LM:947/97%", ["Animale"] = "RT:236/67%EB:394/80%EM:610/90%", ["Daerr"] = "ET:488/94%EB:572/79%EM:734/80%", ["Gnorth"] = "RB:475/68%RM:663/73%", ["Flange"] = "UT:370/46%RB:431/59%EM:624/77%", ["Pumpa"] = "CT:63/17%EB:592/83%EM:731/82%", ["Taranthis"] = "UT:361/47%EB:479/89%EM:679/78%", ["Kiandara"] = "ET:433/80%EB:577/85%EM:788/89%", ["Dilson"] = "EB:576/81%RM:572/63%", ["Heavenstouch"] = "UT:145/45%EB:556/94%EM:711/81%", ["Whiteboipaly"] = "UT:73/25%EB:612/84%EM:816/87%", ["Blodht"] = "CT:185/21%RB:475/68%RM:643/73%", ["Saiyi"] = "RT:434/56%RB:432/62%EM:642/75%", ["Ragan"] = "RT:182/58%EB:674/91%EM:837/89%", ["Maleficént"] = "CT:204/24%RB:477/68%EM:604/90%", ["Deadduck"] = "UT:108/34%UB:352/49%RM:303/65%", ["Driftwood"] = "CT:36/15%EB:518/85%EM:586/82%", ["Buzhel"] = "RT:538/68%EB:598/85%RM:599/70%", ["Robboslam"] = "RB:458/65%RM:645/71%", ["Turborandom"] = "LB:715/95%EM:865/92%", ["Arthouu"] = "UT:97/33%EB:393/79%RM:604/69%", ["Shamer"] = "UT:380/48%RB:337/74%RM:518/57%", ["Dumphuk"] = "ET:312/79%EB:573/81%EM:837/88%", ["Holiestpepeg"] = "RB:230/55%RM:562/66%", ["Teaz"] = "UT:265/32%RB:310/69%RM:257/58%", ["Pickmepickme"] = "RB:435/63%EM:387/77%", ["Lyekka"] = "RB:488/71%EM:699/80%", ["Evilcreature"] = "RB:374/50%UM:158/45%", ["Periculo"] = "CT:85/8%UB:139/47%RM:202/51%", ["Ewenn"] = "UB:331/46%RM:607/71%", ["Lyriss"] = "ET:422/92%EB:487/90%EM:731/80%", ["Zeina"] = "LT:668/98%EB:562/80%EM:677/93%", ["Merise"] = "RT:211/65%EB:541/77%EM:402/76%", ["Fitzem"] = "EB:545/75%EM:749/81%", ["Boxpuncher"] = "ET:418/93%EB:618/85%EM:831/89%", ["Mosesrob"] = "RB:265/60%UM:423/46%", ["Fatherdead"] = "RT:400/50%RB:526/73%EM:755/82%", ["Bushwookie"] = "CT:57/18%RB:421/60%RM:634/72%", ["Adoreme"] = "RT:401/50%EB:615/85%EM:720/79%", ["Akromas"] = "UT:310/37%EB:549/76%RM:611/67%", ["Serabi"] = "EB:714/94%LM:930/96%", ["Heavensgrace"] = "UB:149/36%", ["Mudeye"] = "CT:153/16%EB:611/84%EM:749/81%", ["Benetictus"] = "RT:175/54%UB:301/41%UM:405/43%", ["Remedee"] = "RT:430/55%EB:685/93%EM:868/92%", ["Bigjay"] = "UB:263/35%UM:419/49%", ["Cocoelf"] = "UB:316/44%RM:539/60%", ["Xilra"] = "EB:396/82%RM:297/68%", ["Thanierena"] = "ST:709/99%EB:636/88%RM:231/57%", ["Bluster"] = "CT:113/15%EB:559/80%EM:716/81%", ["Payforheal"] = "UB:231/29%RM:487/53%", ["Kbear"] = "CT:185/21%RB:454/65%EM:657/75%", ["Garen"] = "RB:456/63%RM:649/71%", ["Shamanelia"] = "RB:399/58%UM:295/33%", ["Zatas"] = "RT:319/73%EB:341/88%LM:719/95%", ["Keylith"] = "EB:368/79%RM:570/63%", ["Maxxi"] = "CT:86/8%UB:342/46%UM:272/27%", ["Külgän"] = "EB:621/87%EM:873/94%", ["Potatounited"] = "LB:620/97%EM:775/87%", ["Belisarius"] = "ET:337/86%EB:606/83%EM:836/89%", ["Rankaa"] = "RB:386/52%EM:679/75%", ["Bigbìrd"] = "RB:229/56%EM:687/85%", ["Crystalmth"] = "UT:285/37%RB:433/62%EM:775/86%", ["Barcindes"] = "ET:623/78%EB:434/85%RM:419/50%", ["Rawfish"] = "UT:268/32%EB:574/79%EM:786/85%", ["Bullheals"] = "ET:784/93%LB:584/95%EM:820/88%", ["Datuimao"] = "CT:60/16%UB:327/46%RM:575/63%", ["Ningbb"] = "EB:591/82%LM:905/95%", ["Desudesu"] = "CT:55/14%EB:564/78%RM:587/65%", ["Teach"] = "CT:80/7%UB:255/33%UM:359/42%", ["Eviljelly"] = "RB:444/64%EM:737/81%", ["Stunnerdin"] = "ET:289/80%CB:194/23%EM:664/75%", ["Vanraven"] = "RT:208/66%UB:253/32%CM:64/5%", ["Angellucifer"] = "RT:210/63%EB:553/77%EM:684/75%", ["Kitkatzippy"] = "RB:199/50%RM:535/59%", ["Babyhodor"] = "RT:496/64%EB:573/81%LM:903/96%", ["Lanad"] = "EB:358/75%EM:712/80%", ["Sucrée"] = "CT:56/4%RB:389/56%RM:527/62%", ["Thundatheyes"] = "CT:171/20%EB:563/78%EM:685/75%", ["Yamatoreaver"] = "ET:685/92%EB:708/93%EM:739/88%", ["Thad"] = "RT:337/58%RB:582/74%RM:637/68%", ["Ounbreakable"] = "ET:541/80%EB:619/85%EM:690/84%", ["Ursidae"] = "RT:86/61%EB:650/93%LM:878/95%", ["Kwayver"] = "ET:663/94%EB:695/93%LM:938/97%", ["Feon"] = "ET:541/80%EB:675/86%EM:715/87%", ["Endsliced"] = "LB:764/96%LM:979/98%", ["Pokey"] = "ET:257/78%EB:675/85%RM:661/70%", ["Khaladrius"] = "ET:672/88%LB:753/96%EM:857/93%", ["Ayoong"] = "EB:613/78%EM:787/82%", ["Diocletian"] = "ST:696/99%LB:750/96%LM:937/96%", ["Lythel"] = "RT:471/66%EB:579/93%RM:386/74%", ["Nighthell"] = "RT:385/50%EB:700/89%EM:551/83%", ["Vallidium"] = "ET:643/84%EB:571/92%EM:900/94%", ["Steadfast"] = "CT:77/16%EB:692/91%EM:785/82%", ["Maldrake"] = "RT:440/58%EB:718/94%EM:814/86%", ["Leelass"] = "ET:724/93%SB:796/99%LM:919/96%", ["Michelle"] = "RT:466/63%SB:792/99%LM:945/96%", ["Mitfries"] = "LB:773/97%LM:962/97%", ["Cuzz"] = "LT:755/96%LB:795/98%LM:955/97%", ["Talonkarde"] = "ET:302/84%EB:605/79%RM:643/70%", ["Valora"] = "ET:713/93%EB:727/94%EM:853/93%", ["Roughneck"] = "RB:544/72%EM:832/86%", ["Lazylawyer"] = "ET:739/94%LB:752/95%LM:941/96%", ["Ero"] = "UT:246/36%EB:713/94%LM:920/96%", ["Jacqulyn"] = "ET:673/88%LB:764/96%LM:938/95%", ["Sedia"] = "ET:678/88%LB:759/96%EM:886/92%", ["Steel"] = "SB:786/99%LM:934/97%", ["Playa"] = "CT:39/4%RB:528/71%RM:497/53%", ["Junek"] = "RB:560/74%RM:236/57%", ["Raymer"] = "RT:378/52%EB:623/81%RM:665/71%", ["Nefrata"] = "LT:482/96%SB:826/99%SM:1020/99%", ["Andà"] = "EB:736/93%EM:877/90%", ["Thaladaan"] = "CT:141/18%EB:673/85%EM:925/94%", ["Wargishi"] = "ET:299/86%EB:694/87%EM:893/92%", ["Richiebenaud"] = "ET:302/86%EB:687/87%EM:888/91%", ["Daario"] = "LT:550/98%LB:777/98%LM:946/98%", ["Amethylia"] = "EB:712/90%UM:399/45%", ["Kenroach"] = "ET:286/84%EB:638/82%RM:544/74%", ["Isedso"] = "ET:282/83%EB:658/83%EM:568/86%", ["Gonf"] = "ET:717/92%EB:739/94%LM:800/96%", ["Wakaboo"] = "UT:123/44%EB:510/88%EM:800/84%", ["Azaliea"] = "CT:49/8%RB:543/72%RM:613/69%", ["Hyhy"] = "LT:754/96%LB:774/97%SM:1007/99%", ["Volcanor"] = "EB:750/94%EM:825/86%", ["Hodgen"] = "EB:687/94%EM:793/92%", ["Stabmonster"] = "UT:194/25%RB:556/74%UM:412/43%", ["Ulala"] = "ST:791/99%LB:775/98%LM:939/98%", ["Jordor"] = "ET:736/94%LB:778/98%EM:908/94%", ["Poothunter"] = "ET:377/92%LB:781/98%SM:981/99%", ["Alarana"] = "RT:373/52%EB:622/81%RM:607/65%", ["Chorclemagne"] = "UT:177/27%EB:672/86%EM:816/85%", ["Atc"] = "RT:207/68%EB:396/77%RM:621/66%", ["Toukyou"] = "EB:613/78%RM:437/50%", ["Smeggy"] = "ET:437/94%LB:757/97%EM:855/87%", ["Erny"] = "UT:115/45%EB:455/83%EM:697/76%", ["Timi"] = "ET:298/83%LB:755/95%LM:948/96%", ["Korlok"] = "LT:481/96%LB:768/97%LM:915/95%", ["Elinsar"] = "LB:761/96%EM:490/82%", ["Revenga"] = "ET:682/89%LB:742/96%EM:813/86%", ["Alatra"] = "CT:142/16%RB:365/51%RM:639/74%", ["Phillthy"] = "UT:314/39%RB:385/55%RM:563/66%", ["Holytaker"] = "UT:323/40%RB:418/59%RM:210/54%", ["Wallace"] = "ET:719/88%EB:628/91%EM:687/87%", ["Swamptrollop"] = "UT:142/45%EB:551/81%EM:800/89%", ["Dunbas"] = "UT:131/41%RB:451/64%EM:779/85%", ["Elevenujin"] = "ET:265/76%EB:548/78%EM:724/79%", ["Thunderbaby"] = "CB:137/15%RM:217/55%", ["Grubbynz"] = "RT:172/53%RB:436/63%RM:519/61%", ["Dtripper"] = "UT:296/35%EB:579/79%EM:689/76%", ["Grasshòpper"] = "UT:110/40%RB:302/69%RM:297/68%", ["Sage"] = "RB:424/61%RM:515/61%", ["Leucetios"] = "UT:133/46%RB:405/58%UM:147/47%", ["Garakith"] = "ET:593/77%EB:577/80%EM:798/86%", ["Hemeras"] = "RB:355/50%RM:503/60%", ["Darthan"] = "CT:156/21%RB:459/66%UM:251/29%", ["Arumai"] = "RT:193/59%EB:573/82%EM:843/92%", ["Ghraka"] = "RT:424/52%EB:547/78%EM:772/85%", ["Priesto"] = "CB:170/19%UM:217/25%", ["Serum"] = "UT:260/32%EB:688/93%EM:866/92%", ["Toosouth"] = "CT:36/2%UB:273/36%UM:408/48%", ["Freecandies"] = "CT:17/21%EB:589/82%EM:722/79%", ["Thundershock"] = "CT:191/22%RB:378/54%EM:723/81%", ["Pennylane"] = "UT:270/36%EB:580/82%RM:570/63%", ["Classpal"] = "ET:310/82%RB:507/72%EM:803/88%", ["Gimoney"] = "CT:77/7%UB:326/43%EM:802/87%", ["Denathal"] = "RB:382/51%RM:536/58%", ["Shokaku"] = "UB:287/39%CM:182/17%", ["Pret"] = "RT:521/67%EB:558/79%RM:653/74%", ["Medíumrare"] = "RB:434/63%RM:466/73%", ["Shagalot"] = "UT:90/31%RB:429/61%UM:314/32%", ["Demolay"] = "RB:242/55%UM:313/32%", ["Maëlys"] = "CT:72/21%RB:393/55%RM:606/71%", ["Ragivagi"] = "CT:31/3%CB:181/21%UM:194/49%", ["Beardweiser"] = "CB:159/18%RM:498/55%", ["Teckynate"] = "UT:119/40%CB:159/17%RM:647/71%", ["Slanachaidh"] = "CT:4/0%CB:197/24%UM:318/37%", ["Griffxlol"] = "CB:108/10%UM:295/30%", ["Flasher"] = "UT:292/36%EB:565/78%EM:817/87%", ["Arlandria"] = "UB:336/47%UM:140/48%", ["Dayne"] = "RT:159/53%EB:571/81%EM:805/89%", ["Syanas"] = "CT:114/16%LB:739/96%EM:690/86%", ["Bekw"] = "CB:158/17%UM:259/29%", ["Txish"] = "CT:93/9%UB:253/33%RM:458/50%", ["Hellabeefy"] = "RT:248/73%EB:615/84%EM:700/88%", ["Dendrelite"] = "RB:329/73%EM:718/81%", ["Blackwolf"] = "CT:37/6%RB:267/62%RM:582/65%", ["Khaleesi"] = "CT:9/1%RB:399/57%RM:187/50%", ["Altered"] = "RT:217/67%UB:350/49%RM:674/71%", ["Arkeyteor"] = "UB:232/29%UM:248/28%", ["Bellmoo"] = "UT:155/48%EB:487/90%EM:747/85%", ["Hamishh"] = "CT:25/0%UB:227/29%UM:103/34%", ["Lengzai"] = "CT:136/14%RB:243/58%RM:622/71%", ["Fofunzies"] = "UB:169/43%CM:57/21%", ["Mchamma"] = "ET:476/82%EB:601/87%EM:794/89%", ["Sayra"] = "RT:427/53%RB:479/69%CM:118/13%", ["Daelvin"] = "UT:294/35%UB:349/48%RM:557/61%", ["Bethany"] = "CT:133/14%RB:358/50%RM:535/61%", ["Evantor"] = "RT:198/59%RB:356/50%RM:506/60%", ["Rodimus"] = "UB:258/34%UM:354/42%", ["Loulou"] = "UT:105/38%EB:611/85%EM:488/84%", ["Morraki"] = "UB:119/31%RM:384/65%", ["Thickchungus"] = "UT:378/47%EB:673/92%RM:529/61%", ["Aimlee"] = "UB:323/44%RM:529/61%", ["Gorsky"] = "UB:99/25%UM:364/42%", ["Pulsavr"] = "CB:181/21%RM:361/62%", ["Kamilia"] = "UT:390/49%RB:513/73%EM:837/89%", ["Zzpriest"] = "CT:98/10%CB:81/7%CM:71/21%", ["Panzerwagon"] = "ET:413/94%EB:543/82%EM:574/88%", ["Puppy"] = "CB:168/19%UM:149/40%", ["Fishslap"] = "CB:173/19%UM:332/38%", ["Ghostbusters"] = "UT:109/37%RB:380/51%RM:210/54%", ["Lilcum"] = "CB:166/18%RM:506/71%", ["Hubblestorm"] = "EB:374/79%RM:191/51%", ["Paulette"] = "UT:243/29%RB:497/71%EM:485/82%", ["Lolinir"] = "UT:82/25%RB:274/63%RM:459/54%", ["Rumy"] = "RB:505/70%RM:539/60%", ["Mondeo"] = "CT:164/22%RB:320/72%RM:640/71%", ["Tailbebop"] = "ET:655/82%RB:516/74%EM:664/76%", ["Sollaris"] = "CT:157/17%RB:518/74%EM:754/84%", ["Noodles"] = "RB:346/63%RM:524/73%", ["Aurovia"] = "UB:146/33%UM:390/45%", ["Mashedpotato"] = "UB:353/47%UM:68/44%", ["Zoa"] = "EB:673/92%EM:866/93%", ["Silverstrike"] = "ET:504/86%EB:689/92%EM:723/86%", ["Avaicus"] = "RT:487/64%EB:657/91%EM:682/85%", ["Yakadin"] = "CT:203/23%UB:234/29%RM:496/54%", ["Kaepora"] = "CT:63/5%CB:57/4%RM:494/58%", ["Silverhax"] = "ET:377/90%EB:741/93%LM:976/98%", ["Tankenwing"] = "LB:752/95%EM:815/87%", ["Tsuchie"] = "LT:765/96%LB:792/98%SM:946/99%", ["Haldir"] = "RT:479/63%EB:614/78%EM:779/81%", ["Sadahara"] = "CT:177/23%EB:626/79%RM:632/68%", ["Imapriest"] = "ET:413/93%LB:769/97%LM:927/95%", ["Gellan"] = "UT:234/34%EB:610/79%RM:688/73%", ["Rufeo"] = "ET:269/81%LB:769/97%EM:554/86%", ["Armsdray"] = "UT:74/30%EB:477/85%EM:783/84%", ["Aaequin"] = "RT:383/50%LB:771/97%EM:859/89%", ["Communities"] = "LT:775/97%LB:771/97%LM:973/98%", ["Kohana"] = "RB:573/73%EM:807/84%", ["Forehead"] = "RB:475/64%UM:421/48%", ["Azzee"] = "ET:633/93%SB:796/99%SM:970/99%", ["Taynedrek"] = "RT:512/70%EB:697/88%EM:858/90%", ["Yakasha"] = "ET:377/92%LB:759/96%LM:965/97%", ["Turbointer"] = "EB:750/94%SM:999/99%", ["Millbear"] = "UT:113/44%LB:792/98%SM:1017/99%", ["Gingo"] = "CT:183/24%EB:744/94%LM:971/98%", ["Addicted"] = "UT:130/28%EB:662/83%EM:888/91%", ["Jumbo"] = "EB:733/92%EM:872/89%", ["Tankforsale"] = "RB:546/69%EM:836/81%", ["Alliessa"] = "UT:115/41%RB:540/72%RM:690/74%", ["Millember"] = "UT:124/47%EB:656/83%EM:919/94%", ["Stabzalot"] = "UT:251/32%RB:553/73%EM:752/79%", ["Bronzebots"] = "CT:43/4%LB:784/98%SM:995/99%", ["Exutyph"] = "ET:283/84%EB:443/82%EM:786/84%", ["Hklock"] = "LT:764/97%LB:756/95%LM:966/98%", ["Irontitan"] = "RT:175/62%EB:584/77%RM:559/60%", ["Sholland"] = "ET:286/84%RB:457/60%CM:74/9%", ["Pharah"] = "ET:301/83%EB:718/91%EM:887/93%", ["Daniella"] = "RT:200/69%LB:767/96%EM:820/85%", ["Keiara"] = "ET:555/75%LB:768/96%LM:984/98%", ["Nerber"] = "LT:405/96%LB:733/95%EM:566/91%", ["Fole"] = "RT:188/66%LB:716/95%EM:847/93%", ["Sligathor"] = "LB:782/98%LM:963/97%", ["Bumjab"] = "RB:541/72%EM:903/92%", ["Winch"] = "ET:698/90%LB:756/95%LM:975/98%", ["Kirä"] = "UT:129/46%RB:542/72%RM:543/60%", ["Grognak"] = "CT:33/8%EB:613/78%EM:741/78%", ["Mzee"] = "LT:606/97%LB:778/97%LM:975/98%", ["Shentj"] = "EB:676/85%EM:908/92%", ["Guerriero"] = "UT:100/45%EB:613/78%EM:610/88%", ["Dítty"] = "ET:669/87%EB:669/85%EM:896/92%", ["Shagamuffin"] = "RT:517/69%EB:745/94%LM:913/95%", ["Grimtalon"] = "EB:606/79%RM:344/67%", ["Congo"] = "RB:439/60%RM:542/60%", ["Lokbox"] = "RT:498/67%EB:742/94%EM:882/93%", ["Drew"] = "RT:472/64%RB:364/74%RM:342/69%", ["Lantlos"] = "EB:730/93%EM:761/81%", ["Erfan"] = "ET:310/86%LB:752/95%LM:961/97%", ["Moogienights"] = "ET:562/75%EB:704/89%RM:637/71%", ["Mojomo"] = "ET:282/83%LB:780/97%SM:998/99%", ["Starzs"] = "ET:672/91%EB:606/79%EM:786/90%", ["Boundless"] = "EB:670/85%EM:710/75%", ["Relíc"] = "RB:557/74%RM:284/64%", ["Demonichaos"] = "LB:773/97%LM:928/95%", ["Klx"] = "EB:680/94%", ["Frostsabers"] = "ST:735/99%LB:751/95%EM:906/92%", ["Lochael"] = "ET:468/94%LB:757/96%LM:861/97%", ["Jalidora"] = "ET:357/91%EB:503/87%EM:776/81%", ["Doublebarrel"] = "RT:454/64%RB:544/72%RM:640/72%", ["Braticus"] = "CT:66/5%CB:94/8%UM:326/34%", ["Lotti"] = "RT:498/63%RB:437/62%UM:351/42%", ["Mochaa"] = "UT:277/38%CB:165/19%UM:398/43%", ["Cowheal"] = "CT:151/20%RB:420/60%RM:461/55%", ["Elwynnie"] = "RT:197/59%RB:513/74%EM:490/82%", ["Cryto"] = "CT:83/8%CB:201/24%RM:490/53%", ["Lawlbringer"] = "RB:503/72%EM:736/83%", ["Palaemon"] = "RB:457/65%UM:391/45%", ["Faash"] = "UT:100/32%RB:271/63%RM:511/56%", ["Saintx"] = "RB:384/55%RM:674/74%", ["Xandithas"] = "UB:314/43%UM:257/26%", ["Vellybelle"] = "UT:104/32%UB:355/49%RM:437/52%", ["Randdy"] = "RT:218/67%RB:377/52%RM:587/67%", ["Sephronia"] = "UB:172/42%RM:496/58%", ["Nightbabe"] = "RT:201/62%RB:466/64%RM:301/58%", ["Meche"] = "UB:175/45%", ["Tankoneday"] = "CB:130/13%UM:183/49%", ["Ceashell"] = "UT:132/47%RB:237/58%RM:296/68%", ["Ebolvar"] = "EB:464/75%EM:691/83%", ["Dregs"] = "RB:389/55%EM:420/79%", ["Arianarose"] = "RB:418/57%RM:462/51%", ["Dougupp"] = "CT:61/16%CB:169/19%RM:212/52%", ["Telvendris"] = "CT:116/16%UB:260/34%EM:665/76%", ["Sangy"] = "ET:385/88%RB:507/70%RM:650/72%", ["Wasai"] = "RT:473/62%EB:538/77%EM:694/79%", ["Gremz"] = "UB:231/29%RM:606/67%", ["Eliena"] = "UT:89/28%RB:460/66%EM:406/76%", ["Londomolari"] = "ET:471/81%EB:628/88%EM:711/85%", ["Rayov"] = "CB:79/6%RM:466/50%", ["Moirain"] = "CT:70/20%", ["Divinefaith"] = "CT:37/2%UB:171/39%UM:248/25%", ["Darkblood"] = "RT:168/52%UB:209/26%RM:676/74%", ["Berto"] = "CT:3/0%UB:166/43%UM:85/30%", ["Kakadu"] = "RT:211/66%RB:329/73%RM:591/66%", ["Anronn"] = "CT:49/15%RB:426/62%UM:355/38%", ["Venzen"] = "UT:155/49%RB:444/61%RM:545/60%", ["Kellso"] = "CB:163/18%UM:359/38%", ["Lazykitty"] = "UB:360/48%RM:452/53%", ["Rentodd"] = "UT:127/43%EB:557/79%RM:435/50%", ["Balakey"] = "CB:62/14%UM:123/39%", ["Valorious"] = "CT:179/24%EB:578/82%EM:840/91%", ["Frankanmoon"] = "CT:88/8%CB:101/9%UM:301/31%", ["Tigermoth"] = "CB:109/11%RM:149/59%", ["Heftyjustice"] = "CT:14/16%CB:88/7%UM:356/37%", ["Zardessa"] = "RB:415/70%EM:647/85%", ["Shantilly"] = "RT:394/50%UB:180/46%RM:238/57%", ["Vikkie"] = "CB:75/7%UM:291/33%", ["Moonpig"] = "UT:23/26%EB:393/88%EM:527/76%", ["Shiftymcgee"] = "RB:248/67%UM:178/48%", ["Paindanar"] = "CT:12/1%CB:68/5%UM:357/41%", ["Mcdoove"] = "CB:116/11%UM:324/34%", ["Crossorc"] = "UT:29/37%RB:376/53%RM:245/65%", ["Holymilkman"] = "UB:107/28%CM:98/8%", ["Kromandus"] = "UB:120/27%CM:44/16%", ["Strongârm"] = "CT:86/8%RB:375/52%RM:547/60%", ["Rmp"] = "UB:52/37%CM:11/16%", ["Healich"] = "CT:89/8%CB:135/14%CM:183/17%", ["Willempfish"] = "CT:71/24%RB:462/63%RM:587/64%", ["Maxitan"] = "EB:560/79%RM:324/69%", ["Thuner"] = "UT:123/41%RB:344/72%RM:524/60%", ["Brunnhilda"] = "CT:78/23%RB:222/53%RM:514/72%", ["Grous"] = "EB:611/84%EM:842/90%", ["Othniel"] = "ET:339/89%EB:642/89%EM:757/87%", ["Dominic"] = "CT:107/14%EB:584/81%EM:831/89%", ["Cassindi"] = "CB:114/11%UM:364/39%", ["Merleen"] = "CB:63/12%", ["Jooniee"] = "UT:249/34%RB:207/52%RM:567/67%", ["Leinad"] = "UB:280/36%RM:279/63%", ["Seldomstatic"] = "CT:109/10%EB:619/85%EM:785/85%", ["Australia"] = "CB:103/10%RM:165/50%", ["Zos"] = "ET:397/76%EB:659/90%EM:833/92%", ["Route"] = "RT:101/67%RB:329/70%RM:547/61%", ["Theq"] = "CT:28/0%CB:202/24%CM:165/16%", ["Spudlee"] = "CB:85/7%CM:174/16%", ["Uglyheals"] = "RB:452/73%RM:544/74%", ["Boomtilloom"] = "RB:419/57%EM:826/90%", ["Practitioner"] = "CB:78/17%EM:758/87%", ["Figaro"] = "CB:47/9%RM:238/57%", ["Foreverheal"] = "CB:33/1%", ["Rb"] = "CB:31/1%UM:56/42%", ["Aumra"] = "CB:29/0%", ["Lolakitty"] = "CB:126/13%RM:182/52%", ["Nefertiri"] = "CB:86/18%UM:74/37%", ["Windeye"] = "CB:78/21%RM:250/65%", ["Feiyun"] = "ET:637/91%EB:584/84%EM:866/94%", ["Mokiyah"] = "ET:305/81%EB:383/80%EM:437/81%", ["Madammim"] = "CB:60/15%UM:209/25%", ["Nlcky"] = "CB:174/20%CM:62/23%", ["Nevvyn"] = "UM:93/29%", ["Hillswar"] = "RT:140/52%RB:554/73%EM:787/82%", ["Winnieblue"] = "ET:262/80%EB:708/93%LM:735/96%", ["Fadez"] = "LT:543/97%LB:780/97%LM:951/96%", ["Darkstrong"] = "CT:29/6%RB:559/74%RM:504/71%", ["Greentiger"] = "ET:706/93%LB:761/96%LM:930/96%", ["Littlestab"] = "EB:728/91%EM:826/85%", ["Willus"] = "CT:87/11%EB:684/92%LM:953/96%", ["Jfly"] = "ET:596/79%EB:718/91%EM:572/86%", ["Alencit"] = "EB:736/92%LM:948/96%", ["Condemned"] = "ET:731/93%EB:740/94%EM:841/89%", ["Llamagoat"] = "ET:721/92%LB:767/96%EM:900/94%", ["Daknar"] = "ET:716/92%LB:756/95%EM:808/86%", ["Genos"] = "LT:666/98%LB:682/97%EM:709/93%", ["Vanylla"] = "RT:539/72%EB:711/93%LM:921/95%", ["Ducko"] = "EB:608/94%EM:723/75%", ["Partytime"] = "EB:701/88%LM:952/96%", ["Hatazee"] = "RT:542/73%LB:765/96%LM:938/95%", ["Stregobor"] = "ET:317/87%LB:742/96%EM:809/90%", ["Walter"] = "ET:430/94%EB:455/83%EM:749/80%", ["Quudomi"] = "RB:464/61%EM:727/79%", ["Lunarïs"] = "RB:444/59%RM:600/64%", ["Drunkguy"] = "RB:401/51%", ["Tity"] = "UT:87/32%RB:564/72%EM:455/76%", ["Hodz"] = "ET:345/89%LB:744/96%LM:829/98%", ["Snodrog"] = "CT:98/17%RB:536/71%EM:892/91%", ["Azyria"] = "ET:304/83%EB:725/92%EM:742/94%", ["Slidersmage"] = "UT:270/34%LB:731/95%EM:831/91%", ["Shiftymkii"] = "CT:0/0%RB:531/68%RM:591/63%", ["Olinth"] = "ET:704/91%EB:744/94%LM:843/97%", ["Omiihasmagic"] = "EB:703/93%LM:783/97%", ["Woakley"] = "ET:296/89%LB:760/97%RM:536/59%", ["Zuggums"] = "CT:41/13%EB:713/91%EM:800/85%", ["Sheepy"] = "LT:763/96%LB:767/96%EM:915/94%", ["Sarumarn"] = "ET:593/79%LB:749/96%LM:820/98%", ["Opsox"] = "ET:245/78%EB:504/87%RM:680/72%", ["Incomplete"] = "CT:137/22%EB:751/94%EM:902/92%", ["Nimblechunk"] = "ET:397/93%LB:780/98%LM:950/96%", ["Mbetty"] = "ET:513/77%LB:744/95%LM:909/95%", ["Thunkd"] = "RT:197/68%RB:449/59%UM:445/46%", ["Metaldragon"] = "LB:755/95%EM:805/84%", ["Wormhole"] = "UT:102/46%LB:742/96%LM:852/98%", ["Abaobao"] = "ET:424/94%LB:739/95%LM:781/97%", ["Cenedra"] = "ET:676/88%LB:762/96%EM:913/94%", ["Aliki"] = "RT:206/69%EB:664/89%EM:749/85%", ["Icariom"] = "RB:341/71%RM:664/73%", ["Nocsyn"] = "ET:593/79%EB:694/92%LM:947/98%", ["Rhana"] = "RT:517/68%EB:681/86%EM:913/93%", ["Rajaya"] = "LT:565/97%LB:773/97%LM:907/98%", ["Leerrooyy"] = "UT:114/44%RB:498/66%EM:690/76%", ["Grumpyone"] = "RT:188/70%EB:682/86%EM:856/88%", ["Yatdou"] = "ET:366/90%EB:601/79%EM:559/84%", ["Wilferral"] = "ET:318/94%LB:719/96%EM:819/93%", ["Calys"] = "LT:478/96%LB:767/96%EM:882/90%", ["Kalana"] = "UB:385/49%RM:481/55%", ["Dorfhuntard"] = "ET:672/88%LB:780/98%LM:922/95%", ["Calin"] = "ET:347/88%EB:728/92%EM:573/86%", ["Bhoy"] = "LT:528/97%LB:737/95%LM:796/97%", ["Flain"] = "ET:674/88%LB:754/95%LM:959/97%", ["Deadfrost"] = "ET:640/84%EB:679/91%LM:936/96%", ["Methis"] = "EB:722/94%EM:789/84%", ["Lyndon"] = "RT:174/60%EB:567/75%RM:628/68%", ["Cyllair"] = "RT:198/68%EB:710/93%LM:933/95%", ["Muddyspudd"] = "ET:377/90%EB:554/90%EM:894/93%", ["Elfslayerx"] = "UT:79/32%RB:560/74%RM:607/68%", ["Cirella"] = "RT:214/71%EB:687/91%EM:815/90%", ["Vladamorte"] = "ET:310/86%EB:699/92%EM:472/85%", ["Dingers"] = "LB:773/97%LM:960/97%", ["Goreth"] = "RT:450/70%EB:731/94%SM:993/99%", ["Gromkar"] = "LT:749/96%LB:734/95%LM:947/97%", ["Chungah"] = "ET:355/90%EB:707/91%LM:923/95%", ["Alcifer"] = "ET:584/78%EB:734/93%EM:567/91%", ["Exium"] = "ET:581/77%EB:735/93%EM:883/91%", ["Flokie"] = "ET:412/77%EB:601/86%EM:748/87%", ["Terrafear"] = "CT:48/3%", ["Balain"] = "CT:22/22%RB:157/55%RM:524/69%", ["Precursor"] = "CT:26/0%CB:158/18%RM:301/66%", ["Tehnaiping"] = "UB:231/29%UM:321/33%", ["Castergal"] = "CT:167/23%UB:119/31%UM:104/38%", ["Pondscum"] = "CT:24/20%RB:397/68%RM:537/73%", ["Octora"] = "RT:76/53%RB:328/62%RM:326/59%", ["Ahalalel"] = "ET:216/81%EB:362/89%EM:560/90%", ["Momos"] = "LB:764/98%LM:968/98%", ["Koramin"] = "RT:115/56%RB:413/70%EM:701/84%", ["Meadowmist"] = "CT:49/15%UB:116/30%RM:550/61%", ["Shaftesbury"] = "ET:458/80%EB:655/90%EM:711/85%", ["Gazzar"] = "CT:31/2%CB:26/0%", ["Puddinnz"] = "RB:307/61%EM:628/80%", ["Mcree"] = "RB:231/54%RM:304/58%", ["Decadence"] = "ET:409/77%EB:469/76%EM:670/82%", ["Silentseeker"] = "CT:32/6%CB:25/0%UM:109/35%", ["Jabiru"] = "RB:263/56%EM:558/75%", ["Valryx"] = "RT:141/59%RB:426/71%RM:499/71%", ["Elioenai"] = "RB:236/54%RM:318/59%", ["Durra"] = "RB:206/52%RM:398/64%", ["Bonesey"] = "ET:514/84%EB:621/87%EM:813/91%", ["Xanied"] = "ET:410/93%RB:312/73%EM:657/81%", ["Magrita"] = "EB:493/78%EM:769/89%", ["Jackiepaper"] = "CB:65/5%CM:62/6%", ["Eydis"] = "ET:235/77%EB:420/83%EM:457/82%", ["Melinoe"] = "CT:57/6%RB:267/60%RM:539/58%", ["Kamazy"] = "RB:273/58%EM:726/86%", ["Mechie"] = "RT:222/63%RB:428/72%EM:665/82%", ["Ancksunamun"] = "ET:434/93%EB:595/93%EM:525/83%", ["Souli"] = "ST:773/99%LB:782/98%LM:944/97%", ["Shamtank"] = "RB:370/66%RM:366/55%", ["Holycaustx"] = "ET:581/89%EB:660/91%EM:832/91%", ["Oxo"] = "CT:69/8%RB:232/54%UM:105/35%", ["Sillypotato"] = "RT:261/74%EB:543/83%EM:744/87%", ["Shadowninja"] = "CB:38/2%", ["Røx"] = "LB:758/97%SM:1000/99%", ["Alberon"] = "ET:291/82%EB:671/86%EM:882/91%", ["Saliver"] = "ET:676/88%EB:721/91%EM:754/94%", ["Alok"] = "UB:194/25%UM:434/48%", ["Rekali"] = "EB:687/89%UM:374/40%", ["Crayônz"] = "RT:134/58%RB:347/65%EM:600/78%", ["Theagente"] = "ET:406/92%EB:712/90%EM:758/79%", ["Fruitcake"] = "UT:99/45%EB:610/77%RM:685/73%", ["Svirfneblin"] = "RB:428/57%RM:588/63%", ["Keett"] = "CT:125/21%EB:695/92%RM:666/73%", ["Noventix"] = "LT:585/97%LB:764/96%SM:991/99%", ["Fourx"] = "LT:742/96%LB:737/96%LM:914/95%", ["Scion"] = "LB:756/95%LM:942/96%", ["Insignia"] = "UT:364/49%EB:699/89%EM:768/82%", ["Allesa"] = "LT:473/95%EB:736/93%LM:981/98%", ["Fody"] = "RB:462/61%RM:442/50%", ["Xalor"] = "CT:30/6%RB:527/70%EM:556/85%", ["Lugo"] = "ET:383/93%EB:630/81%EM:670/91%", ["Beloloo"] = "UT:106/42%RB:431/56%RM:404/62%", ["Vandrick"] = "EB:572/75%RM:669/74%", ["Ziggyy"] = "ET:690/92%LB:748/96%SM:967/99%", ["Starian"] = "UT:341/44%EB:591/78%RM:574/63%", ["Centura"] = "UT:93/37%EB:380/76%EM:774/83%", ["Scrotesque"] = "EB:719/92%EM:824/87%", ["Hodush"] = "RT:220/72%EB:672/89%RM:509/71%", ["Sabine"] = "RB:446/60%RM:587/65%", ["Varenn"] = "UT:341/44%EB:692/92%EM:798/85%", ["Ethanum"] = "RT:224/73%EB:472/85%RM:581/65%", ["Anatherian"] = "LT:447/95%LB:756/96%LM:936/96%", ["Passmeabeer"] = "CT:57/19%EB:603/77%RM:558/60%", ["Eigzstabby"] = "ET:670/86%EB:585/92%EM:848/88%", ["Warpride"] = "CT:97/17%RB:490/64%EM:855/88%", ["Lybius"] = "ET:735/94%LB:784/98%EM:836/86%", ["Broodle"] = "RB:428/55%UM:427/49%", ["Sunblast"] = "ET:361/91%EB:723/94%EM:881/92%", ["Silvershards"] = "LT:441/97%LB:623/97%EM:823/90%", ["Tiifa"] = "CT:83/10%EB:619/81%EM:733/78%", ["Krankz"] = "RT:467/61%RB:317/67%EM:535/82%", ["Emdeekay"] = "RT:186/63%EB:680/86%LM:956/96%", ["Grain"] = "EB:738/92%EM:916/94%", ["Vestige"] = "ET:331/86%EB:731/93%EM:700/92%", ["Mandrais"] = "UT:106/41%LB:732/95%EM:716/81%", ["Tituspullo"] = "ET:441/94%LB:778/98%LM:975/98%", ["Ruan"] = "ET:244/75%EB:695/87%EM:877/90%", ["Chillerz"] = "ET:420/94%EB:743/94%EM:808/86%", ["Veganhunter"] = "LB:757/95%LM:934/95%", ["Auxi"] = "EB:730/93%LM:948/96%", ["Alfgeirr"] = "ET:399/93%LB:742/98%EM:905/92%", ["Ishar"] = "ET:651/90%EB:671/93%EM:844/93%", ["Lekss"] = "RB:426/55%UM:376/43%", ["Tavias"] = "EB:733/93%LM:984/98%", ["Xtravaganza"] = "CT:52/21%EB:628/81%EM:545/85%", ["Grimward"] = "ET:630/94%LB:703/95%EM:803/92%", ["Daggerz"] = "UT:114/41%EB:590/78%EM:621/88%", ["Zzappy"] = "ET:631/83%EB:722/94%LM:978/98%", ["Consolelog"] = "RT:545/72%EB:711/90%EM:800/85%", ["Venomz"] = "CT:175/22%RB:277/61%RM:468/53%", ["Ozzyiceburn"] = "ET:679/89%LB:752/95%EM:820/87%", ["Stonecoldz"] = "ET:626/81%EB:491/86%EM:872/91%", ["Emzy"] = "LT:627/98%EB:742/94%EM:879/90%", ["Loralee"] = "ET:353/90%EB:530/89%EM:785/82%", ["Vivilock"] = "ET:446/94%EB:728/92%EM:870/90%", ["Stãlker"] = "RB:418/56%RM:575/63%", ["Skwurt"] = "ET:680/88%LB:759/96%LM:917/95%", ["Bloodbath"] = "RT:223/74%RB:364/74%RM:521/59%", ["Riki"] = "UT:277/36%UB:320/42%UM:436/46%", ["Prassy"] = "UT:94/38%RB:439/57%RM:486/69%", ["Whosthedps"] = "CT:179/23%EB:748/94%EM:920/93%", ["Krytic"] = "RB:426/57%EM:715/76%", ["Mortimer"] = "RT:176/60%EB:632/82%EM:778/81%", ["Galumira"] = "ET:395/93%LB:762/96%EM:885/90%", ["Proven"] = "UB:197/26%RM:527/58%", ["Dragonspite"] = "RT:132/59%EB:496/75%EM:709/83%", ["Minotan"] = "LT:745/96%LB:762/97%SM:857/99%", ["Aurola"] = "RB:337/70%EM:605/80%", ["Lenkaxx"] = "ET:626/82%EB:720/91%EM:805/83%", ["Phøenix"] = "ET:541/80%EB:717/93%EM:821/92%", ["Husonapf"] = "ET:414/81%LB:742/97%SM:990/99%", ["Luciente"] = "LT:489/96%LB:741/96%LM:889/95%", ["Nefertiti"] = "CM:73/10%", ["Serephinion"] = "ST:659/99%EB:543/93%EM:877/93%", ["Matildia"] = "EB:638/89%EM:758/87%", ["Hoodini"] = "ET:354/89%EB:713/91%EM:797/85%", ["Reg"] = "ET:255/82%EB:609/86%EM:890/94%", ["Wannaberogue"] = "ET:280/87%EB:664/94%EM:817/93%", ["Gnomerpile"] = "EB:576/81%EM:731/86%", ["Folus"] = "LT:476/95%EB:730/93%EM:794/85%", ["Jamms"] = "ET:339/87%EB:738/93%LM:941/96%", ["Gotabliz"] = "UB:197/26%EM:584/91%", ["Shandrith"] = "CT:144/23%RB:551/70%RM:642/71%", ["Brutimus"] = "LT:735/95%LB:752/96%LM:915/95%", ["Azali"] = "ET:215/78%EB:667/90%EM:834/91%", ["Bilbsyy"] = "ET:230/89%LB:707/95%EM:815/93%", ["Sparxo"] = "UT:276/36%EB:640/83%EM:660/91%", ["Halfmast"] = "CT:41/14%EB:583/81%EM:693/80%", ["Pilsner"] = "ET:676/91%EB:687/87%EM:668/85%", ["Silvercliff"] = "RT:197/65%RB:535/71%RM:675/72%", ["Torwarr"] = "RT:186/65%EB:638/82%EM:730/77%", ["Tawl"] = "LT:748/96%LB:622/96%LM:943/98%", ["Morque"] = "ET:588/78%EB:710/90%EM:730/76%", ["Cairnal"] = "ET:360/90%EB:681/87%EM:860/88%", ["Bigger"] = "RT:379/52%LB:759/95%EM:860/89%", ["Stabsta"] = "EB:682/86%EM:857/88%", ["Eavy"] = "ET:234/75%LB:575/95%EM:782/88%", ["Derter"] = "UT:300/40%EB:752/94%LM:771/95%", ["Glimmerorc"] = "CT:136/17%RB:396/53%RM:495/53%", ["Romro"] = "RT:321/56%RB:545/69%EM:734/78%", ["Sweetypie"] = "CT:29/6%RB:556/71%UM:452/48%", ["Cloxis"] = "RT:526/70%EB:709/90%EM:802/85%", ["Darktankie"] = "RT:287/51%RB:292/63%UM:421/48%", ["Kangaxx"] = "RT:468/63%EB:723/92%EM:844/87%", ["Foreverdirt"] = "ET:680/92%LB:781/98%EM:808/89%", ["Artamisa"] = "ET:390/93%LB:750/95%EM:914/93%", ["Panthere"] = "RT:186/63%EB:452/83%RM:640/70%", ["Bigbuoyz"] = "CT:167/22%EB:727/92%EM:868/89%", ["Tibben"] = "LT:441/95%EB:731/92%RM:571/64%", ["Tittania"] = "RT:173/66%EB:676/91%EM:871/90%", ["Homicide"] = "RT:543/71%EB:649/84%EM:800/83%", ["Brutalistic"] = "ET:616/81%EB:702/89%EM:863/91%", ["Carnelian"] = "RT:551/74%LB:758/95%LM:970/98%", ["Titania"] = "ET:699/92%LB:761/96%LM:950/97%", ["Shadowmike"] = "LT:547/96%LB:750/95%LM:787/95%", ["Frisky"] = "LT:756/96%LB:761/96%LM:960/98%", ["Mispentyouth"] = "LB:784/98%LM:981/98%", ["Punted"] = "EB:633/80%EM:782/82%", ["Hootymcbooty"] = "ET:610/79%EB:737/93%LM:939/96%", ["Zarred"] = "LT:590/97%EB:700/90%EM:858/90%", ["Azzmage"] = "LT:493/96%LB:719/95%EM:851/89%", ["Lio"] = "EB:707/90%EM:881/90%", ["Toastedsambo"] = "ET:346/89%EB:739/94%EM:902/93%", ["Lynchen"] = "ET:568/75%EB:680/87%EM:787/82%", ["Lucinder"] = "CT:187/24%EB:690/92%EM:848/92%", ["Thermalpaste"] = "RT:140/50%EB:534/89%EM:553/83%", ["Glorion"] = "EB:374/76%EM:769/81%", ["Predatorr"] = "CT:30/6%RB:396/54%CM:92/11%", ["Deleyndre"] = "CT:50/16%LB:763/96%EM:781/82%", ["Jenova"] = "UT:194/25%EB:747/94%LM:918/95%", ["Floranim"] = "RT:513/70%EB:652/88%EM:839/92%", ["Keithflint"] = "EB:716/94%EM:917/94%", ["Esurientes"] = "EB:644/81%EM:716/76%", ["Mortaxton"] = "ET:300/83%EB:703/89%EM:876/90%", ["Pumpernickel"] = "EB:672/86%EM:855/88%", ["Mëd"] = "ET:396/94%EB:589/77%EM:738/87%", ["Darkmantis"] = "ET:334/88%LB:726/95%LM:995/98%", ["Smudgemuffin"] = "UT:309/42%EB:644/84%", ["Urm"] = "RB:548/70%RM:581/62%", ["Maarsh"] = "ET:285/83%EB:676/91%LM:945/97%", ["Trustworthy"] = "RB:541/72%EM:749/79%", ["Smallbells"] = "UT:85/35%EB:577/76%RM:629/70%", ["Gauge"] = "UT:331/46%EB:694/89%EM:917/93%", ["Gothgnomegf"] = "EB:694/93%EM:715/83%", ["Suffocation"] = "ET:626/82%EB:646/84%EM:862/88%", ["Supermonkey"] = "ET:553/75%EB:563/91%LM:928/95%", ["Dontcry"] = "UT:122/44%EB:667/86%RM:465/52%", ["Ayaria"] = "UB:336/45%RM:655/71%", ["Cerebulon"] = "ET:317/85%EB:704/90%UM:399/45%", ["Airetamstomp"] = "EB:719/94%EM:853/92%", ["Rotbone"] = "ET:320/87%LB:770/97%SM:1004/99%", ["Gammakai"] = "EB:427/80%EM:797/85%", ["Retz"] = "RB:361/73%RM:542/56%", ["Drast"] = "CT:111/14%UB:322/43%RM:514/53%", ["Liandree"] = "UT:226/29%EB:644/83%RM:639/69%", ["Brurn"] = "LT:616/98%LB:756/95%RM:686/74%", ["Squishyfaz"] = "ET:378/92%EB:638/87%EM:756/81%", ["Rsi"] = "RB:506/72%RM:506/60%", ["Jalarand"] = "ET:519/78%EB:674/90%EM:711/85%", ["Muxwar"] = "ET:491/75%EB:665/89%LM:908/95%", ["Smish"] = "RB:136/61%RM:153/70%", ["Vargram"] = "ET:575/83%LB:575/95%EM:897/94%", ["Wimo"] = "RT:358/53%EB:635/87%EM:788/84%", ["Xandaar"] = "EB:596/85%EM:867/94%", ["Sivart"] = "UB:155/47%RM:202/50%", ["Mangletooth"] = "EB:726/94%LM:980/98%", ["Radu"] = "UT:228/33%UB:384/49%RM:525/60%", ["Valla"] = "RT:418/57%EB:629/86%EM:862/90%", ["Buffy"] = "UT:94/34%EB:646/84%UM:427/47%", ["Cainwho"] = "CT:40/4%EB:578/76%EM:784/81%", ["Tarki"] = "LT:444/95%EB:731/94%LM:949/97%", ["Silentseek"] = "RT:517/73%RB:501/70%UM:133/45%", ["Coldwind"] = "EB:567/75%EM:554/90%", ["Cretinlyfe"] = "RB:493/69%LM:901/95%", ["Cifr"] = "ET:624/87%LB:738/95%EM:858/92%", ["Nkm"] = "CB:53/6%CM:88/7%", ["Comeondown"] = "EB:579/77%EM:743/80%", ["Aax"] = "UT:266/34%EB:568/75%RM:478/54%", ["Ivor"] = "ET:425/94%EB:385/76%EM:444/78%", ["Trollbender"] = "UT:165/25%RB:484/64%EM:820/87%", ["Detha"] = "RT:192/67%EB:472/85%RM:570/64%", ["Nukedukem"] = "RT:180/64%EB:693/87%EM:917/94%", ["Frizzy"] = "EB:666/86%EM:827/87%", ["Mestoka"] = "CT:93/16%EB:706/93%EM:854/90%", ["Thearatan"] = "UT:88/36%RB:507/64%RM:670/71%", ["Tukan"] = "LT:750/95%LB:798/98%SM:1004/99%", ["Ishura"] = "ET:243/77%RB:515/68%EM:488/81%", ["Parry"] = "ET:408/94%EB:679/85%EM:864/89%", ["Daaer"] = "EB:652/82%RM:496/70%", ["Broodlord"] = "RT:555/73%EB:649/84%EM:743/79%", ["Tobibowdachi"] = "EB:668/86%LM:939/95%", ["Izstalker"] = "ET:347/90%EB:721/91%EM:898/92%", ["Sneakytard"] = "EB:714/91%RM:372/74%", ["Snowbutt"] = "RT:154/63%EB:625/82%EM:771/78%", ["Tirilas"] = "CT:164/21%RB:545/72%RM:255/56%", ["Stabho"] = "RT:208/71%EB:591/75%RM:667/71%", ["Thestorm"] = "UT:164/25%EB:609/77%EM:777/82%", ["Rafeki"] = "EB:729/92%EM:820/85%", ["Wrayth"] = "RB:458/58%RM:587/63%", ["Viserion"] = "RT:468/64%EB:718/91%LM:968/97%", ["Contagious"] = "RT:377/51%EB:679/87%EM:882/91%", ["Shlort"] = "UB:255/34%UM:408/46%", ["Spartacys"] = "UT:102/40%RB:332/71%EM:406/76%", ["Wishling"] = "ET:433/94%EB:736/93%EM:698/92%", ["Gândalf"] = "ET:270/81%LB:594/96%LM:689/95%", ["Robiji"] = "ET:328/89%EB:636/80%EM:805/84%", ["Lexeene"] = "CT:41/9%RB:484/65%UM:346/35%", ["Ricardo"] = "RT:194/67%EB:665/90%EM:803/89%", ["Kutisu"] = "CT:139/22%LB:761/96%EM:858/90%", ["Nex"] = "ET:576/75%EB:591/75%EM:822/85%", ["Gnomezilla"] = "EB:713/90%EM:881/91%", ["Ambrai"] = "RT:547/72%EB:716/91%EM:897/92%", ["Ryathdagreat"] = "RT:534/71%EB:718/91%EM:869/90%", ["Muffel"] = "CT:29/1%UB:280/37%UM:406/46%", ["Ecofascist"] = "LT:729/97%SB:811/99%LM:942/98%", ["Aru"] = "LT:465/95%RB:493/66%EM:607/87%", ["Dicso"] = "EB:734/92%EM:887/91%", ["Ugakuga"] = "RT:391/54%EB:703/89%EM:600/88%", ["Eradan"] = "ET:614/82%LB:670/96%RM:638/71%", ["Taleon"] = "ET:239/76%EB:716/91%EM:912/93%", ["Slayersheng"] = "RB:417/55%RM:257/56%", ["Scrazy"] = "ET:432/93%EB:546/90%EM:856/88%", ["Clemfandango"] = "ET:262/80%EB:720/91%EM:902/92%", ["Suttulti"] = "ET:398/93%LB:640/95%EM:428/78%", ["Endgame"] = "ET:235/76%EB:394/77%RM:516/55%", ["Baskett"] = "CT:29/5%RB:477/60%EM:459/80%", ["Faelwen"] = "CT:65/24%EB:735/93%EM:844/88%", ["Dragen"] = "CT:81/15%RB:430/58%CM:169/21%", ["Isarn"] = "RT:190/73%EB:641/87%EM:718/82%", ["Yourdeddy"] = "RT:212/68%EB:685/88%EM:889/91%", ["Oaen"] = "UB:341/44%EM:798/86%", ["Issz"] = "ET:259/78%EB:679/87%EM:635/90%", ["Merk"] = "ET:603/78%RB:558/74%RM:587/63%", ["Kaelus"] = "ET:285/81%EB:709/90%EM:892/92%", ["Bakteria"] = "ET:315/87%EB:644/88%EM:770/83%", ["Itherael"] = "ET:294/88%EB:683/94%EM:810/93%", ["Unexis"] = "RT:168/57%LB:754/95%LM:940/96%", ["Kooka"] = "ET:368/90%EB:504/87%EM:617/89%", ["Ravahana"] = "EB:538/75%RM:591/69%", ["Dentz"] = "CT:52/5%EB:743/94%EM:902/93%", ["Guttz"] = "ET:690/92%EB:661/89%EM:383/85%", ["Nighthawk"] = "RT:482/66%EB:722/92%EM:878/90%", ["Gnogue"] = "UB:311/42%RM:688/74%", ["Khanny"] = "RT:552/74%EB:685/87%UM:337/33%", ["Thuraya"] = "ET:277/84%EB:585/84%EM:836/87%", ["Ary"] = "CT:66/22%RB:378/51%UM:338/39%", ["Liuko"] = "ET:624/82%EB:694/89%EM:785/84%", ["Dilraba"] = "ET:712/92%EB:564/80%RM:582/71%", ["Rydolomo"] = "CT:40/18%RB:542/72%RM:460/50%", ["Magdevil"] = "RB:555/74%UM:429/43%", ["Løki"] = "UT:78/29%UB:222/30%RM:326/74%", ["Elonil"] = "EB:712/93%EM:891/94%", ["Isa"] = "RB:485/66%RM:584/63%", ["Deborah"] = "EB:598/86%EM:627/80%", ["Shmilly"] = "UT:301/44%EB:563/78%RM:634/74%", ["Sydney"] = "RB:377/53%RM:491/54%", ["Crita"] = "RT:543/72%EB:713/94%EM:814/91%", ["Hamada"] = "RB:545/71%EM:523/84%", ["Noelo"] = "CB:180/24%", ["Emhyr"] = "ET:587/78%EB:358/76%RM:260/62%", ["Dämon"] = "ET:424/78%EB:634/88%EM:713/85%", ["Huntbert"] = "UT:73/28%UB:174/43%CM:55/20%", ["Ironwill"] = "CT:78/9%EB:605/80%EM:727/79%", ["Sepotank"] = "RT:209/74%EB:581/76%RM:382/67%", ["Ki"] = "EB:584/84%RM:269/57%", ["Faelemere"] = "UT:309/45%EB:700/93%EM:813/90%", ["Faro"] = "RT:349/51%EB:675/90%EM:782/84%", ["Uglybum"] = "UT:155/25%RB:413/54%RM:391/74%", ["Defrost"] = "CT:46/8%RB:449/63%EM:555/90%", ["Cmoo"] = "ET:516/77%EB:662/89%EM:833/91%", ["Tanglebeard"] = "ET:661/90%EB:656/89%EM:798/90%", ["Fanie"] = "RB:440/64%UM:406/43%", ["Frankcastle"] = "UT:99/40%EB:597/78%RM:231/56%", ["Bleedingcrow"] = "UT:320/41%RB:504/71%RM:528/62%", ["Rdballpotato"] = "CT:156/20%UB:311/44%RM:582/68%", ["Dayjavu"] = "RB:297/71%EM:656/81%", ["Nosepick"] = "ET:294/87%EB:620/80%EM:341/82%", ["Steppinrazor"] = "CT:170/21%UB:318/39%UM:444/47%", ["Spartacuse"] = "RT:150/55%RB:540/69%RM:557/59%", ["Trele"] = "ET:384/92%EB:746/94%EM:905/93%", ["Màdara"] = "UT:267/39%LB:726/95%EM:749/85%", ["Makingbank"] = "UT:249/46%EB:650/89%EM:722/87%", ["Joshkirby"] = "RT:172/62%EB:725/92%EM:906/92%", ["Karta"] = "ET:334/87%EB:695/89%RM:689/72%", ["Mekajiki"] = "EB:660/85%RM:325/63%", ["Cupidme"] = "EB:653/89%LM:934/95%", ["Brutale"] = "RT:162/56%LB:761/96%EM:823/85%", ["Nekrotect"] = "RB:537/68%RM:694/74%", ["Oddsockz"] = "RT:446/60%EB:575/76%", ["Zomble"] = "RT:206/70%EB:665/90%EM:813/90%", ["Cyberrage"] = "ET:458/88%EB:492/92%EM:683/88%", ["Malooka"] = "UT:88/35%EB:593/78%EM:590/87%", ["Channyboi"] = "EB:610/84%EM:620/93%", ["Deathstrikes"] = "UB:304/40%RM:399/72%", ["Enemydown"] = "EB:719/91%EM:893/91%", ["Mayn"] = "UT:118/46%EB:602/76%EM:721/76%", ["Dexterityx"] = "ET:593/80%EB:674/87%EM:843/88%", ["Longcarabine"] = "LT:520/96%EB:746/94%LM:841/97%", ["Kittii"] = "RB:550/73%EM:785/83%", ["Gyoong"] = "EB:686/88%EM:752/81%", ["Mudskipper"] = "ET:325/86%EB:701/89%EM:752/78%", ["Versed"] = "EB:509/92%LM:761/96%", ["Garn"] = "CT:103/13%EB:654/85%EM:809/85%", ["Saleadari"] = "ET:247/78%EB:732/92%EM:888/91%", ["Poppycocks"] = "CT:25/0%RB:373/50%CM:191/23%", ["Munzta"] = "CT:139/22%RB:474/63%UM:359/41%", ["Xunair"] = "RT:162/59%RB:506/64%EM:483/81%", ["Anko"] = "EB:743/94%LM:975/98%", ["Spiritshift"] = "ST:566/99%LB:733/96%LM:955/98%", ["Felianni"] = "UB:333/44%RM:231/53%", ["Dreamhunt"] = "ET:348/90%EB:607/94%EM:689/92%", ["Kuroyukihime"] = "UT:322/42%EB:707/94%UM:290/30%", ["Faralda"] = "CT:145/18%EB:589/82%EM:791/84%", ["Warz"] = "RT:540/73%EB:613/80%EM:785/82%", ["Knash"] = "LT:759/98%SB:794/99%SM:1023/99%", ["Kagaru"] = "CT:88/11%RB:385/52%EM:804/83%", ["Bragamuffin"] = "RB:421/59%RM:307/72%", ["Greenfury"] = "LT:458/96%LB:743/95%LM:810/98%", ["Lidrymage"] = "UT:235/30%EB:590/83%RM:554/68%", ["Neptunus"] = "EB:626/82%EM:713/76%", ["Nukêz"] = "LT:511/96%EB:697/92%EM:527/86%", ["Darrainn"] = "RT:169/61%EB:589/77%RM:180/66%", ["Kaytoo"] = "RT:178/61%EB:600/79%EM:493/79%", ["Andrewdx"] = "UT:306/40%EB:650/84%EM:731/76%", ["Apokalyptik"] = "CT:139/22%EB:553/94%EM:860/93%", ["Azzuri"] = "ET:369/91%EB:643/84%EM:544/89%", ["Hexist"] = "CT:187/24%EB:608/80%RM:675/72%", ["Mengbb"] = "RB:458/65%RM:582/64%", ["Honkie"] = "ET:675/92%LB:725/96%LM:901/97%", ["Punkrockgyrl"] = "CT:117/15%RB:288/68%RM:593/69%", ["Shapemaster"] = "LT:530/98%EB:490/82%EM:564/79%", ["Hatchepsut"] = "CT:59/7%CB:69/18%", ["Lolowow"] = "CB:59/15%RM:177/53%", ["Myaa"] = "RT:134/50%EB:355/78%RM:608/71%", ["Eky"] = "EB:661/85%EM:887/91%", ["Tinytinatap"] = "CB:87/11%UM:232/29%", ["Izab"] = "CT:112/14%RB:463/63%CM:110/11%", ["Kieranagus"] = "ET:358/75%EB:655/91%EM:798/89%", ["Squad"] = "UT:282/40%LB:574/95%EM:819/92%", ["Mercury"] = "RB:387/53%EM:694/76%", ["Cherry"] = "ET:641/85%EB:721/92%EM:758/85%", ["Darkfyre"] = "CT:53/9%CB:114/15%UM:299/31%", ["Soulguard"] = "RT:509/68%RB:478/69%EM:615/91%", ["Icychillzz"] = "RT:225/74%RB:393/55%RM:515/61%", ["Tayshank"] = "ET:581/78%EB:561/80%RM:575/67%", ["Hugme"] = "ET:610/81%LB:750/95%EM:901/93%", ["Varenon"] = "RB:431/53%RM:622/67%", ["Sameth"] = "CB:66/17%RM:502/59%", ["Magrata"] = "UB:261/33%RM:278/68%", ["Goochie"] = "RB:381/53%RM:331/74%", ["Atarangiahi"] = "UT:195/25%EB:662/85%RM:605/65%", ["Zigfus"] = "ET:425/94%EB:712/93%LM:779/97%", ["Sphincs"] = "ET:565/75%EB:694/88%EM:778/81%", ["Anoctris"] = "CT:181/23%RB:453/58%RM:545/61%", ["Dilligaf"] = "ET:599/80%EB:599/93%LM:949/97%", ["Reatrei"] = "CT:18/3%EB:685/88%EM:860/89%", ["Joshie"] = "EB:669/90%EM:712/81%", ["Hopscotch"] = "ET:249/78%EB:704/90%EM:856/90%", ["Cavil"] = "ET:396/93%LB:758/96%EM:920/94%", ["Deiren"] = "UB:327/41%RM:532/61%", ["Torched"] = "RT:515/69%EB:645/88%EM:544/89%", ["Illusionary"] = "ET:284/88%EB:709/93%EM:853/92%", ["Margerlena"] = "RT:137/51%RB:285/62%RM:247/55%", ["Psychonutz"] = "UT:111/40%UB:249/32%UM:187/46%", ["Emoni"] = "ET:325/88%EB:504/88%EM:408/76%", ["Zuikaku"] = "ET:660/86%EB:715/90%EM:901/94%", ["Medistab"] = "EB:608/77%EM:903/92%", ["Gole"] = "ET:348/90%EB:682/88%EM:571/91%", ["Akumage"] = "ET:267/86%LB:682/98%EM:875/94%", ["Skifr"] = "UT:118/43%RB:260/58%RM:476/54%", ["Manaholic"] = "EB:577/80%EM:781/84%", ["Slicedice"] = "CT:59/20%UB:346/46%CM:202/20%", ["Miriella"] = "ET:382/91%EB:705/90%LM:771/95%", ["Rubi"] = "ET:670/87%EB:692/92%EM:876/94%", ["Vero"] = "ET:606/90%EB:698/93%LM:903/95%", ["Surgical"] = "RT:158/55%RB:322/68%RM:519/58%", ["Bladebear"] = "ET:418/94%EB:608/84%EM:612/92%", ["Woainibaka"] = "RB:437/59%RM:228/52%", ["Bigdyl"] = "UB:316/39%CM:221/22%", ["Zuupi"] = "RB:472/67%EM:671/78%", ["Rookstar"] = "EB:578/76%RM:695/72%", ["Woahyak"] = "RT:114/66%EB:616/90%EM:779/93%", ["Rosabella"] = "LT:726/97%LB:760/98%LM:937/97%", ["Fy"] = "UB:300/39%UM:90/28%", ["Ruok"] = "EB:681/88%EM:849/87%", ["Suci"] = "ET:407/93%EB:679/91%EM:735/79%", ["Shelane"] = "ET:198/75%EB:640/87%EM:818/90%", ["Woadkill"] = "EB:613/85%EM:726/84%", ["Amayas"] = "UT:71/25%EB:562/75%UM:348/35%", ["Snowyconan"] = "RT:167/60%EB:577/76%RM:514/58%", ["Zirac"] = "CB:186/24%UM:258/26%", ["Gladrina"] = "EB:723/94%LM:890/95%", ["Mododamage"] = "ET:243/82%EB:503/91%EM:707/77%", ["Elinne"] = "ET:559/75%EB:731/92%EM:892/91%", ["Bogchic"] = "UT:238/32%EB:652/85%EM:810/84%", ["Looze"] = "LB:754/95%LM:962/98%", ["Fannindreal"] = "CT:38/3%LB:676/97%EM:842/87%", ["Thatgugubear"] = "CT:35/9%UB:348/47%RM:549/61%", ["Casualbob"] = "CT:50/20%RB:467/62%RM:286/63%", ["Arlenze"] = "UT:67/25%LB:736/96%EM:820/90%", ["Lockmysocks"] = "EB:715/91%EM:900/92%", ["Candylink"] = "ET:657/90%EB:673/90%EM:881/94%", ["Tabbouleh"] = "UT:221/33%EB:633/87%EM:765/86%", ["Anaemic"] = "CT:34/8%UB:366/46%RM:500/53%", ["Zahxia"] = "EB:740/93%UM:448/45%", ["Efah"] = "RT:497/66%EB:705/90%EM:602/88%", ["Fandy"] = "ET:259/79%EB:586/77%EM:854/88%", ["Manlikebale"] = "ET:241/77%UB:379/49%CM:56/19%", ["Rykan"] = "ET:595/83%LB:681/98%LM:956/98%", ["Immortelle"] = "EB:634/87%RM:639/70%", ["Majikthise"] = "RT:172/61%EB:637/87%EM:627/93%", ["Lunarrings"] = "RT:135/50%EB:633/86%LM:889/95%", ["Lorpo"] = "ET:300/90%EB:651/89%RM:337/70%", ["Shellie"] = "ET:291/83%EB:606/79%RM:599/66%", ["Deezydeathc"] = "EB:730/92%RM:716/74%", ["Itmb"] = "LT:400/95%LB:613/97%EM:739/90%", ["Frostysoulz"] = "EB:491/91%EM:827/91%", ["Flaine"] = "EB:612/84%", ["Dudemanguy"] = "UB:162/39%RM:449/51%", ["Fistophile"] = "UT:338/45%RB:562/73%UM:429/43%", ["Fearghail"] = "UT:112/49%EB:321/75%RM:278/62%", ["Mergi"] = "UT:91/36%EB:662/85%EM:801/84%", ["Bropeen"] = "RT:508/69%RB:545/72%EM:751/79%", ["Revengette"] = "CT:41/12%UB:300/36%UM:390/45%", ["Koora"] = "RB:457/64%RM:254/65%", ["Locha"] = "RB:517/68%RM:587/62%", ["Ragehelm"] = "RB:270/60%RM:613/69%", ["Darkblôod"] = "UT:131/49%EB:564/75%EM:822/87%", ["Conjuror"] = "CT:36/16%RB:526/74%EM:475/86%", ["Dazismash"] = "UT:65/26%RB:465/58%UM:451/47%", ["Jalnis"] = "RT:169/73%LB:729/95%SM:970/99%", ["Pryzm"] = "ET:357/90%EB:734/93%LM:933/95%", ["Babu"] = "RT:388/51%EB:683/87%EM:706/93%", ["Coldreaver"] = "LB:660/98%LM:872/98%", ["Britta"] = "RT:118/52%EB:622/85%EM:825/91%", ["Zarinne"] = "ET:294/93%EB:605/90%EM:805/93%", ["Thyartismrdr"] = "UB:309/38%RM:660/70%", ["Jedimaster"] = "CT:57/19%RB:315/67%RM:619/68%", ["Protgonewild"] = "UT:235/34%EB:629/81%RM:556/63%", ["Loliveriadin"] = "RT:224/73%EB:591/83%EM:783/87%", ["Aurienne"] = "ET:279/82%EB:747/94%EM:931/94%", ["Trivaik"] = "RT:165/57%UB:343/45%RM:525/58%", ["Grawr"] = "RT:123/67%EB:506/84%RM:410/64%", ["Vicende"] = "ET:552/81%EB:713/93%EM:454/88%", ["Sampengeo"] = "RT:223/73%EB:606/80%EM:748/81%", ["Nosmas"] = "RT:230/74%LB:764/96%LM:960/97%", ["For"] = "EB:627/86%EM:884/94%", ["Xiaolongxia"] = "EB:694/88%EM:890/91%", ["Keefi"] = "CT:45/10%UB:359/45%EM:756/88%", ["Yellowdart"] = "ET:421/94%LB:752/95%EM:875/91%", ["Wheresmage"] = "EB:735/93%EM:888/92%", ["Schneider"] = "EB:652/85%EM:785/84%", ["Misspalmer"] = "LT:504/96%EB:676/87%EM:789/84%", ["Afinity"] = "ET:662/86%EB:581/76%EM:753/81%", ["Crazywhale"] = "EB:690/88%EM:916/93%", ["Varix"] = "LT:447/95%LB:604/96%LM:674/96%", ["Chromosome"] = "ET:706/91%EB:622/86%CM:110/17%", ["Teracious"] = "ET:549/77%EB:489/90%EM:701/76%", ["Ashenshrugar"] = "UT:88/36%EB:496/87%EM:784/84%", ["Thorazydia"] = "EB:652/85%EM:829/88%", ["Xiaoxiaoyang"] = "RB:539/70%RM:285/63%", ["Insideousvex"] = "EB:593/75%EM:835/87%", ["Khyral"] = "RT:401/54%EB:694/89%LM:940/96%", ["Belthazor"] = "EB:714/90%RM:593/61%", ["Calithia"] = "RT:206/67%EB:701/89%EM:851/88%", ["Nashi"] = "ET:392/93%EB:675/91%EM:728/84%", ["Mellisander"] = "UT:335/43%EB:596/79%EM:731/79%", ["Guyvus"] = "RT:175/59%EB:649/83%EM:763/79%", ["Slique"] = "RB:427/57%RM:633/69%", ["Meowzchaser"] = "EB:700/89%EM:881/90%", ["Sherbert"] = "CT:38/17%CB:84/23%RM:676/74%", ["Jorudessa"] = "LT:573/97%EB:681/88%EM:789/88%", ["Gnomepowah"] = "EB:615/81%EM:907/93%", ["Bassfish"] = "CT:126/21%RB:528/67%RM:592/63%", ["Warlf"] = "UT:125/47%EB:633/86%EM:759/85%", ["Enishiya"] = "ET:403/93%EB:550/91%LM:922/95%", ["Duramboros"] = "ET:231/89%EB:510/93%EM:785/92%", ["Darkvanake"] = "ET:287/81%EB:668/86%EM:833/86%", ["Zappa"] = "LT:480/96%EB:740/94%EM:921/94%", ["Shteve"] = "LB:629/95%LM:930/95%", ["Flee"] = "RT:154/56%EB:690/89%EM:853/89%", ["Fizion"] = "EB:698/93%EM:851/89%", ["Balerian"] = "ET:496/76%RB:408/50%UM:234/26%", ["Criisys"] = "RT:403/53%EB:642/83%RM:664/72%", ["Col"] = "ET:296/84%LB:743/97%EM:744/85%", ["Belaid"] = "ET:316/87%EB:731/93%EM:779/81%", ["Sucitank"] = "LT:522/97%LB:770/98%LM:977/98%", ["Ballzingski"] = "ET:430/93%EB:680/87%EM:724/75%", ["Nepôs"] = "UT:331/43%RB:559/74%RM:583/68%", ["Ikit"] = "EB:585/85%EM:813/90%", ["Toolmage"] = "RT:458/60%EB:569/80%EM:799/89%", ["Wagyuprime"] = "ST:820/99%SB:815/99%SM:972/99%", ["Dalaross"] = "UT:238/45%RB:366/62%EM:565/80%", ["Artonsha"] = "ET:251/86%EB:624/89%EM:702/86%", ["Oâtz"] = "ET:420/94%EB:654/85%EM:825/87%", ["Summonshards"] = "UT:91/33%EB:573/76%EM:696/75%", ["Blinkinator"] = "CT:140/23%EB:562/78%RM:533/58%", ["Philmccrackn"] = "ET:293/84%EB:628/86%EM:571/91%", ["Noi"] = "LT:722/95%EB:688/92%EM:883/94%", ["Ferran"] = "RB:551/70%RM:568/61%", ["Secretvermin"] = "RT:569/74%RB:544/72%RM:291/61%", ["Chococo"] = "LT:459/95%EB:668/90%EM:738/85%", ["Imlividmate"] = "RT:372/51%RB:549/72%UM:149/42%", ["Portalopen"] = "UT:193/30%EB:623/85%EM:818/90%", ["Iqthinxii"] = "UT:376/49%EB:696/89%EM:851/88%", ["Amaraki"] = "UB:322/39%EM:844/87%", ["Dusseldorf"] = "UT:295/39%EB:599/80%EM:737/78%", ["Dilemmia"] = "RT:412/56%RB:574/73%RM:580/62%", ["Doubleoseven"] = "UB:361/48%RM:539/58%", ["Sowon"] = "LB:759/96%LM:926/96%", ["Sprokett"] = "ET:280/83%EB:596/78%RM:552/62%", ["Winkle"] = "RT:206/67%EB:689/88%EM:848/90%", ["Grimwood"] = "ET:372/93%EB:624/91%SM:979/99%", ["Bonepile"] = "ET:370/91%EB:728/93%SM:1004/99%", ["Kriscoco"] = "RT:484/66%EB:684/88%EM:790/84%", ["Fudy"] = "RT:200/69%RB:459/57%EM:558/86%", ["Mybubbles"] = "UT:343/45%EB:642/84%EM:766/82%", ["Shadevar"] = "UB:269/32%RM:470/50%", ["Ivianna"] = "EB:486/86%EM:772/82%", ["Aegnor"] = "RT:482/66%EB:691/89%EM:834/86%", ["Delia"] = "UB:196/25%RM:577/64%", ["Crushing"] = "CB:187/20%", ["Ricksanchez"] = "LT:544/96%LB:751/96%LM:859/98%", ["Valtiell"] = "CB:50/5%RM:485/51%", ["Lovetap"] = "RB:519/70%EM:658/91%", ["Ssjfury"] = "EB:630/83%EM:734/79%", ["Saintswins"] = "ET:251/78%EB:658/85%EM:868/90%", ["Elulu"] = "ET:657/86%EB:643/83%EM:552/85%", ["Bide"] = "LB:742/95%EM:870/93%", ["Evelynne"] = "EB:476/85%UM:342/34%", ["Johnmcclain"] = "RB:537/72%EM:856/88%", ["Vivivi"] = "EB:615/81%EM:800/83%", ["Chch"] = "ET:285/84%RB:425/55%EM:575/76%", ["Leningrad"] = "RT:418/57%EB:681/88%EM:738/78%", ["Salphine"] = "RT:157/57%RB:520/74%EM:849/89%", ["Rosekrans"] = "LT:627/98%RB:491/71%RM:533/62%", ["Mindless"] = "ET:240/77%EB:637/83%EM:756/79%", ["Rustyhook"] = "RT:486/67%EB:645/84%EM:821/85%", ["Peachpanther"] = "EB:424/89%EM:625/84%", ["Drugal"] = "EB:375/76%RM:684/73%", ["Quarthalf"] = "UB:345/43%CM:177/22%", ["Puddingpants"] = "RB:380/50%RM:279/58%", ["Trisk"] = "RB:512/69%EM:694/75%", ["Ariala"] = "ET:282/80%EB:712/90%EM:878/90%", ["Excruciate"] = "EB:670/86%RM:714/74%", ["Xls"] = "UT:103/41%UB:300/36%RM:481/55%", ["Jonosan"] = "CT:117/20%RB:386/50%RM:503/57%", ["Avocado"] = "LT:516/96%EB:625/82%LM:727/96%", ["Helmetcrab"] = "ET:238/77%RB:426/57%UM:389/45%", ["Diigi"] = "RT:552/74%EB:610/79%RM:524/59%", ["Thørin"] = "EB:704/90%EM:886/92%", ["Larha"] = "CT:191/24%UB:312/41%UM:173/44%", ["Moneyshotss"] = "UT:295/41%EB:710/90%EM:849/85%", ["Jutz"] = "CT:65/7%EB:628/87%RM:673/74%", ["Chuky"] = "CT:37/9%CB:38/3%", ["Tsarchasm"] = "EB:689/92%EM:360/84%", ["Hitwar"] = "EB:651/84%RM:666/74%", ["Wafflehaus"] = "RT:132/50%UB:133/33%RM:224/55%", ["Ist"] = "ET:614/80%EB:660/85%UM:83/26%", ["Oohlala"] = "ET:647/89%EB:644/88%EM:766/89%", ["Feron"] = "ET:259/77%EB:643/83%EM:806/86%", ["Inv"] = "UM:459/48%", ["Luffles"] = "EB:592/82%EM:855/93%", ["Pïety"] = "ET:357/91%EB:721/93%LM:914/95%", ["Talyna"] = "ET:320/91%EB:427/85%RM:564/62%", ["Turducken"] = "EB:408/90%EM:556/81%", ["Rallaz"] = "RB:389/54%EM:415/82%", ["Telmeri"] = "EB:674/87%LM:944/96%", ["Destructicon"] = "CT:165/22%RB:400/55%RM:613/63%", ["Vampyre"] = "RT:363/73%RB:437/73%EM:527/86%", ["Nightswifter"] = "UB:254/35%RM:520/62%", ["Coolfridge"] = "CB:82/9%CM:181/23%", ["Eladrial"] = "CM:73/10%", ["Icycold"] = "UB:320/45%UM:329/34%", ["Kratoz"] = "EB:536/80%EM:529/78%", ["Slimpikkens"] = "CT:133/17%UB:211/27%RM:459/52%", ["Soklin"] = "RT:555/73%LB:753/95%RM:665/71%", ["Facetank"] = "EB:601/76%EM:785/82%", ["Stabbus"] = "CT:36/9%UB:357/44%UM:419/44%", ["Shueys"] = "UT:329/44%EB:613/80%EM:846/90%", ["Qixshots"] = "ET:274/82%EB:731/92%EM:865/89%", ["Cellesta"] = "CT:52/5%EB:599/78%RM:632/67%", ["Klyde"] = "RB:485/65%RM:667/71%", ["Frankenmoon"] = "LT:497/97%EB:617/86%EM:793/89%", ["Calis"] = "CT:69/8%EB:638/83%RM:691/73%", ["Sturatty"] = "LB:768/96%LM:964/97%", ["Shacklebolt"] = "EB:633/82%EM:727/94%", ["Farmerbob"] = "UT:120/46%LB:737/95%SM:982/99%", ["Sanabalis"] = "UT:177/28%EB:596/79%EM:816/87%", ["Snowyy"] = "EB:654/88%RM:243/63%", ["Wildhuntress"] = "ET:258/79%EB:672/87%EM:689/92%", ["Cüpid"] = "ET:301/85%EB:698/89%EM:914/93%", ["Smoothbrain"] = "EB:683/88%EM:784/82%", ["Kyt"] = "RB:531/72%RM:536/59%", ["Áeðrîel"] = "RT:395/54%RB:493/65%EM:708/77%", ["Raiko"] = "UB:395/48%UM:425/44%", ["Ravinoff"] = "UT:323/45%RB:529/70%RM:277/62%", ["Itachî"] = "UB:201/25%RM:595/64%", ["Gingèr"] = "EB:647/83%EM:817/85%", ["Outrage"] = "CT:49/20%UB:369/46%UM:366/42%", ["Rampo"] = "RB:564/72%EM:914/91%", ["Brualan"] = "ET:554/81%EB:684/91%EM:868/93%", ["Eq"] = "RT:133/50%EB:676/86%EM:776/81%", ["Swiftard"] = "EB:558/75%RM:693/73%", ["Sheepoopi"] = "CT:19/9%RB:417/58%RM:542/60%", ["Bundyrumbear"] = "RT:382/50%LB:767/96%EM:845/87%", ["Azurelights"] = "ET:604/81%EB:715/91%EM:797/83%", ["Odmalice"] = "RT:237/74%EB:585/75%EM:714/75%", ["Dazann"] = "ET:425/79%EB:689/93%EM:864/93%", ["Dazarann"] = "UT:322/44%RB:498/73%EM:573/76%", ["Deadmeowse"] = "RB:283/62%UM:417/47%", ["Magiko"] = "CT:132/16%EB:669/90%EM:651/75%", ["Me"] = "RT:388/51%EB:552/77%RM:655/72%", ["Ancy"] = "ET:663/86%EB:651/84%EM:778/83%", ["Thorrinn"] = "UT:302/40%RB:553/74%RM:536/57%", ["Cactusrose"] = "LT:443/95%EB:668/86%EM:667/91%", ["Grandpawaru"] = "EB:737/93%EM:905/93%", ["Moonrazer"] = "ET:626/88%EB:613/90%EM:725/89%", ["Beldenox"] = "UT:312/45%EB:619/81%EM:685/75%", ["Grantaurino"] = "ET:415/94%LB:742/95%EM:893/94%", ["Southy"] = "ET:442/94%LB:785/98%LM:806/97%", ["Missbox"] = "ET:260/79%EB:684/92%EM:531/89%", ["Blackvein"] = "EB:359/78%RM:250/64%", ["Deirdre"] = "RT:154/71%EB:639/90%LM:676/96%", ["Velmagus"] = "ET:271/81%LB:747/96%LM:962/97%", ["Tameimpala"] = "ET:298/85%EB:678/87%RM:685/73%", ["Oilyfart"] = "LT:562/97%EB:665/85%EM:560/86%", ["Sayakai"] = "UT:218/32%RB:429/53%UM:319/32%", ["Frozendun"] = "CT:47/21%RB:433/60%EM:456/85%", ["Asterixx"] = "RT:524/70%EB:631/86%RM:543/64%", ["Bobbob"] = "EB:460/84%EM:733/79%", ["Frostbites"] = "RB:528/70%RM:620/68%", ["Aldwin"] = "RB:385/50%RM:537/59%", ["Andybro"] = "CB:219/24%UM:306/35%", ["Swipengrowl"] = "ET:207/76%EB:680/94%EM:845/94%", ["Chabiba"] = "RB:351/64%RM:387/58%", ["Wizzywiz"] = "UB:304/41%RM:455/53%", ["Phrosty"] = "ET:367/91%EB:560/79%EM:784/84%", ["Selanya"] = "UT:130/46%RB:267/60%RM:289/63%", ["Kellamity"] = "RB:534/72%EM:713/77%", ["Sparrowhawkk"] = "UT:85/33%EB:623/85%EM:809/89%", ["Bearson"] = "CT:71/14%UB:175/36%UM:416/47%", ["Treeboy"] = "RT:181/71%EB:599/87%EM:869/94%", ["Who"] = "EB:452/81%EM:634/84%", ["Darkwonder"] = "ET:254/76%EB:615/80%EM:487/81%", ["Huntzha"] = "RT:180/64%EB:623/82%RM:647/69%", ["Denzie"] = "EB:523/85%EM:562/80%", ["Jj"] = "CT:29/2%CM:24/4%", ["Lenik"] = "ET:619/82%EB:394/82%EM:786/84%", ["Gnocke"] = "ET:646/84%EB:729/92%EM:886/91%", ["Malison"] = "RB:397/53%EM:726/75%", ["Jiajiahunt"] = "RB:490/67%EM:802/85%", ["Elirra"] = "RT:535/73%EB:727/92%RM:555/59%", ["Yuuna"] = "ET:695/90%LB:752/95%EM:882/91%", ["Bowjõb"] = "ET:239/76%EB:644/84%EM:823/85%", ["Amroth"] = "ET:232/78%RB:454/72%EM:709/85%", ["Annarawr"] = "RT:462/63%EB:660/85%EM:790/82%", ["Quorpse"] = "ET:604/80%EB:541/90%EM:917/94%", ["Braw"] = "UB:204/47%RM:435/50%", ["Spekk"] = "RT:191/63%EB:595/78%RM:705/73%", ["Venir"] = "RT:491/67%EB:702/90%RM:641/68%", ["Friday"] = "UT:285/38%RB:514/70%EM:792/83%", ["Thunderdrunk"] = "ET:314/86%EB:526/89%EM:741/79%", ["Oodles"] = "UT:80/31%EB:743/94%EM:875/91%", ["Thorny"] = "RT:407/65%EB:397/78%EM:697/76%", ["Feedback"] = "ET:247/83%EB:632/86%EM:684/75%", ["Riecan"] = "RT:210/71%RB:521/71%RM:633/67%", ["Degen"] = "LB:763/96%LM:957/96%", ["Porque"] = "CT:104/13%RB:518/70%EM:757/81%", ["Bawllsdeep"] = "ET:248/77%EB:548/77%EM:767/86%", ["Zestor"] = "EB:649/84%RM:571/63%", ["Profpyro"] = "RB:423/60%EM:684/79%", ["Queek"] = "UT:358/48%EB:749/94%EM:852/88%", ["Fluffkins"] = "CT:48/5%EB:639/84%EM:822/85%", ["Lunarific"] = "CT:49/17%EB:437/86%RM:680/74%", ["Tolir"] = "EB:571/77%RM:549/58%", ["Windsire"] = "EB:749/94%EM:857/88%", ["Fizzgig"] = "EB:720/92%EM:825/87%", ["Epsil"] = "EB:697/92%EM:648/93%", ["Mercuccio"] = "ET:198/75%EB:512/84%EM:749/90%", ["Flossan"] = "EB:454/81%RM:214/53%", ["Jornathon"] = "EB:681/87%EM:930/94%", ["Zou"] = "RB:373/50%UM:359/36%", ["Aeme"] = "UT:122/47%RB:280/61%RM:299/65%", ["Gnomerissa"] = "RT:505/67%RB:507/68%RM:660/71%", ["Chaammy"] = "UB:282/38%UM:355/37%", ["Skippe"] = "ET:361/91%EB:648/84%LM:713/95%", ["Kurdo"] = "ET:556/88%EB:647/89%EM:770/88%", ["Telarr"] = "ET:349/90%EB:459/84%EM:722/76%", ["Hornes"] = "CT:72/8%EB:670/86%EM:881/90%", ["Cyberas"] = "UT:324/43%EB:607/80%RM:580/64%", ["Acxa"] = "CT:39/4%RB:344/72%EM:476/81%", ["Gudrun"] = "CT:61/20%RB:478/61%RM:586/63%", ["Therodin"] = "ET:343/89%EB:604/80%EM:442/79%", ["Xelzenov"] = "RT:194/74%EB:402/83%RM:654/72%", ["Gotashot"] = "ET:627/83%EB:487/87%EM:875/91%", ["Biigmac"] = "UB:386/49%RM:555/59%", ["Lakisha"] = "ET:656/90%EB:693/92%EM:822/91%", ["Tinyproblem"] = "ET:242/76%EB:552/77%RM:464/50%", ["Thorgar"] = "ET:553/75%EB:703/89%EM:885/90%", ["Cliftoniuss"] = "UB:216/26%RM:626/67%", ["Catlady"] = "UT:367/49%EB:617/81%EM:695/75%", ["Mitchda"] = "UT:198/25%EB:567/76%RM:660/72%", ["Antimessiah"] = "CT:27/5%UB:359/45%RM:330/68%", ["Blanka"] = "CB:214/23%CM:118/13%", ["Adagh"] = "LT:427/95%EB:728/94%LM:908/95%", ["Ghrim"] = "RT:554/74%EB:585/77%EM:816/85%", ["Leonart"] = "ET:251/75%EB:657/85%EM:766/80%", ["Vizerii"] = "ET:622/82%EB:690/92%LM:938/96%", ["Arakasi"] = "UT:237/30%UB:374/49%UM:124/35%", ["Kyriakos"] = "ET:436/80%EB:589/85%LM:838/97%", ["Andalite"] = "CB:47/10%CM:31/2%", ["Rorysmalls"] = "UT:107/41%CB:105/12%UM:308/32%", ["Razmo"] = "UB:113/30%UM:398/45%", ["Bearskin"] = "RT:139/59%RB:360/69%RM:301/62%", ["Gorebag"] = "RT:121/60%RB:401/66%EM:705/82%", ["Urgh"] = "RT:292/51%EB:600/83%EM:845/92%", ["Ly"] = "RB:495/66%UM:376/40%", ["Holyshaid"] = "RB:293/60%RM:436/67%", ["Farcough"] = "UM:104/35%", ["Garlis"] = "RT:218/67%RB:453/74%EM:845/92%", ["Davex"] = "CB:189/20%RM:700/74%", ["Hercules"] = "ET:708/93%EB:687/91%EM:853/92%", ["Jazzi"] = "CT:30/8%EB:667/86%EM:817/87%", ["Fluffyhuggs"] = "CB:25/3%CM:37/11%", ["Incandescent"] = "ET:657/86%EB:576/81%EM:723/78%", ["Iskion"] = "ET:489/75%EB:674/90%EM:822/91%", ["Arfarm"] = "RB:403/56%EM:655/76%", ["Salar"] = "CT:106/18%CB:44/9%CM:87/14%", ["Ryyl"] = "CM:144/20%", ["Ragyo"] = "LT:443/95%EB:521/92%LM:917/95%", ["Anatherias"] = "CT:55/6%UB:312/40%RM:508/56%", ["Ceiling"] = "ET:289/84%RB:529/70%UM:348/37%", ["Orphic"] = "ET:595/79%EB:654/89%EM:677/80%", ["Grundar"] = "LT:458/95%EB:747/94%EM:748/94%", ["Drassil"] = "EB:588/78%RM:622/66%", ["Voidy"] = "CT:44/14%RB:411/55%", ["Biker"] = "UB:359/48%UM:196/25%", ["Preadd"] = "EB:454/84%EM:911/93%", ["Magenum"] = "EB:621/81%EM:864/90%", ["Tinkdawn"] = "ET:632/88%EB:693/91%EM:827/91%", ["Cenwrath"] = "LT:578/98%EB:716/93%LM:933/96%", ["Razzledazzle"] = "CT:143/18%EB:601/83%LM:713/95%", ["Nightcatto"] = "UT:228/43%EB:397/77%EM:679/75%", ["Peppin"] = "UT:88/35%RB:468/61%RM:661/73%", ["Katlock"] = "CT:64/22%RB:513/69%RM:208/53%", ["Grashak"] = "UB:195/45%RM:575/61%", ["Goomba"] = "RT:142/50%CB:51/5%RM:443/50%", ["Kryptik"] = "ET:462/80%EB:536/80%EM:682/83%", ["Extrabonus"] = "CT:100/17%RB:417/54%RM:548/62%", ["Ironballs"] = "RT:422/57%RB:544/74%RM:687/73%", ["Nemi"] = "RT:463/61%EB:615/85%EM:795/88%", ["Lockbahh"] = "LT:753/96%LB:752/95%LM:938/96%", ["Carnifexus"] = "RT:163/59%EB:407/83%UM:400/43%", ["Kullunter"] = "RT:421/57%EB:664/86%EM:847/88%", ["Wargear"] = "CT:182/23%RB:491/67%RM:647/70%", ["Whysodry"] = "UT:77/28%EB:641/83%RM:531/54%", ["Hotshoot"] = "RB:561/74%EM:881/90%", ["Starsonra"] = "EB:666/86%RM:473/53%", ["Ascentt"] = "ET:334/88%EB:367/77%EM:713/81%", ["Tommytooth"] = "RT:492/67%RB:562/71%EM:852/88%", ["Dm"] = "EB:717/91%LM:950/96%", ["Dafydd"] = "LT:477/96%EB:499/91%EM:843/92%", ["Bommski"] = "RT:427/56%RB:519/73%RM:642/70%", ["Froufrou"] = "RB:487/66%EM:721/77%", ["Maebeline"] = "UT:127/48%EB:626/82%RM:540/59%", ["Julez"] = "RT:189/66%EB:586/81%EM:791/84%", ["Denzy"] = "UT:190/38%RB:426/69%EM:710/78%", ["Grimmvar"] = "EB:637/83%LM:957/97%", ["Ithmala"] = "UT:97/38%EB:725/92%EM:750/79%", ["Moriarty"] = "UT:98/36%RB:483/63%RM:675/70%", ["Armida"] = "ET:294/84%EB:387/81%EM:726/82%", ["Scattertraps"] = "UT:75/28%EB:589/79%EM:778/81%", ["Kaleb"] = "RT:548/73%EB:581/77%RM:567/56%", ["Phesta"] = "ET:382/92%EB:657/85%EM:801/85%", ["Hvitsek"] = "RB:412/59%RM:466/55%", ["Nický"] = "RB:535/71%EM:713/77%", ["Meunick"] = "CT:132/21%EB:722/91%RM:611/68%", ["Vericawraith"] = "UT:277/35%RB:557/74%RM:667/72%", ["Cotwo"] = "EB:430/86%EM:686/75%", ["Shubbz"] = "EB:671/86%EM:813/84%", ["Shadybits"] = "RT:239/73%EB:403/78%RM:558/60%", ["Lariantian"] = "EB:597/79%RM:665/71%", ["Greasybone"] = "UT:230/35%UB:166/36%RM:450/66%", ["Dobbyhunter"] = "ET:618/82%EB:736/93%EM:892/89%", ["Cheezus"] = "LT:759/96%LB:663/96%EM:914/94%", ["Rhumba"] = "CT:149/24%UB:270/36%RM:500/59%", ["Ovette"] = "CT:131/17%RB:521/70%EM:706/76%", ["Cryidis"] = "UT:68/27%UB:306/36%RM:507/54%", ["Chillgrave"] = "LT:466/95%EB:653/85%EM:891/92%", ["Bacondux"] = "CB:223/24%UM:269/27%", ["Metamoo"] = "RT:172/73%EB:539/84%LM:873/95%", ["Tehguns"] = "RT:215/64%UB:159/45%RM:308/50%", ["Exill"] = "RB:548/70%UM:337/34%", ["Badjoojoo"] = "ET:365/91%EB:563/80%RM:354/72%", ["Sinphear"] = "ET:274/84%EB:488/90%EM:416/87%", ["Smashana"] = "UB:250/29%UM:340/39%", ["Avoid"] = "CT:32/8%RB:530/69%RM:657/68%", ["Nrec"] = "CB:134/17%RM:541/63%", ["Tythazerus"] = "CT:7/8%UB:104/25%CM:121/16%", ["Kommando"] = "EB:514/79%EM:650/80%", ["Lifelock"] = "RB:392/54%RM:566/61%", ["Morrak"] = "ET:682/91%LB:591/95%EM:896/94%", ["Agarthor"] = "RB:495/70%CM:67/9%", ["Holdthedoor"] = "LT:424/95%EB:554/81%EM:664/82%", ["Storic"] = "ET:293/88%EB:500/83%EM:720/89%", ["Hazuki"] = "EB:421/78%RM:483/72%", ["Serrendipity"] = "CT:38/12%RB:534/71%EM:717/78%", ["Byorr"] = "CB:31/3%EM:573/81%", ["Douge"] = "CT:54/19%RB:321/73%EM:335/75%", ["Zolimon"] = "ET:448/81%EB:566/82%EM:712/94%", ["Chanson"] = "LT:746/95%EB:712/91%RM:669/73%", ["Kaylora"] = "EB:663/85%EM:896/91%", ["Fellvoice"] = "RT:172/58%RB:336/70%RM:482/53%", ["Demonblade"] = "RB:510/68%RM:616/64%", ["Whysteria"] = "RT:226/71%EB:596/78%EM:514/83%", ["Crasy"] = "EB:720/91%EM:888/91%", ["Tygar"] = "ET:349/90%EB:671/87%EM:651/91%", ["Tarahu"] = "ET:275/79%EB:603/79%RM:533/55%", ["Carsina"] = "RB:547/73%RM:652/70%", ["Morisu"] = "UT:79/36%EB:340/76%UM:430/46%", ["Wyldor"] = "UT:257/49%EB:608/86%EM:740/88%", ["Stabinu"] = "CB:52/5%UM:387/40%", ["Tinylock"] = "EB:453/83%EM:725/78%", ["Lavinia"] = "RB:306/67%UM:446/45%", ["Kamireyn"] = "CT:84/11%EB:406/79%EM:717/75%", ["Shortcircuit"] = "UT:314/41%EB:632/82%RM:450/50%", ["Trix"] = "CB:27/1%UM:264/27%", ["Fragglepop"] = "RT:216/71%RB:431/62%RM:474/59%", ["Angrycrispyz"] = "CT:60/24%UB:252/29%UM:224/27%", ["Reco"] = "RT:534/71%EB:633/82%RM:237/57%", ["Zurajita"] = "UT:89/36%UB:170/40%UM:363/37%", ["Shelmette"] = "UT:108/43%RB:529/70%RM:464/68%", ["Chilywalaby"] = "RT:222/73%RB:504/67%RM:607/67%", ["Venathar"] = "RT:479/63%RB:504/72%", ["Mcoz"] = "CB:156/17%CM:69/9%", ["Pyro"] = "RB:518/73%EM:805/89%", ["Zingerworks"] = "RB:454/61%UM:158/45%", ["Magikmaster"] = "RB:427/60%EM:678/78%", ["Zamiel"] = "UT:295/39%EB:647/83%EM:759/80%", ["Toblerone"] = "RT:441/70%EB:682/91%EM:807/90%", ["Adcknight"] = "UT:66/27%CB:139/15%CM:198/20%", ["Bobbyious"] = "RT:513/70%EB:720/91%EM:709/93%", ["Larian"] = "UM:299/35%", ["Hanníbal"] = "EB:645/83%RM:650/67%", ["Volkuhn"] = "CB:63/14%CM:77/10%", ["Teleehey"] = "UB:256/30%UM:398/46%", ["Sagee"] = "CB:68/17%EM:753/79%", ["Yogs"] = "EB:682/88%EM:707/77%", ["Brokyn"] = "RB:267/59%RM:623/68%", ["Foros"] = "ET:377/91%RB:479/65%RM:265/60%", ["Fendog"] = "LT:759/96%LB:759/96%EM:754/82%", ["Miniudge"] = "ET:259/77%RB:528/69%UM:461/47%", ["Seborrheic"] = "UT:73/26%UB:153/37%RM:549/59%", ["Obscuro"] = "RT:386/50%EB:563/91%EM:840/89%", ["Idkhowtoplay"] = "EB:583/78%EM:859/90%", ["Mith"] = "RT:203/66%EB:585/76%UM:471/48%", ["Goldenstar"] = "RT:172/58%EB:592/78%UM:435/48%", ["Gaheris"] = "ET:264/80%EB:687/88%EM:866/89%", ["Kinomon"] = "EB:688/89%EM:918/94%", ["Smellyhippy"] = "ET:216/76%EB:431/80%", ["Vinn"] = "RT:454/62%EB:671/87%EM:783/83%", ["Evolete"] = "ET:394/93%EB:643/87%EM:730/79%", ["Anukys"] = "ET:273/79%EB:594/78%EM:712/76%", ["Meldwar"] = "CB:189/21%EM:703/77%", ["Ransakz"] = "UB:266/36%EM:363/78%", ["Warllyn"] = "UT:130/29%UB:178/34%RM:408/63%", ["Orionsbolt"] = "RT:526/71%EB:690/88%EM:745/80%", ["Stabbydingo"] = "CB:178/22%UM:409/47%", ["Orcestrate"] = "ET:371/90%EB:628/82%RM:663/71%", ["Benington"] = "RB:276/66%EM:825/91%", ["Tapiorigel"] = "CB:82/22%EM:807/85%", ["Late"] = "UT:242/36%EB:585/81%EM:668/77%", ["Joyce"] = "RT:386/55%EB:459/88%EM:684/75%", ["Rageoffor"] = "CT:94/11%RB:393/55%EM:742/80%", ["Verny"] = "UB:93/26%UM:257/31%", ["Hugaard"] = "CT:44/14%RB:449/58%UM:436/44%", ["Krites"] = "ET:319/87%EB:627/88%LM:911/96%", ["Magrate"] = "RT:130/56%EB:560/78%EM:671/77%", ["Esox"] = "RT:382/52%EB:650/84%EM:816/86%", ["Fangorn"] = "ET:592/85%EB:681/94%EM:800/93%", ["Bearknuckles"] = "RT:150/62%EB:583/89%LM:868/95%", ["Zaelio"] = "RB:344/72%EM:787/83%", ["Fellrock"] = "RT:186/69%EB:339/77%RM:362/66%", ["Tarrik"] = "ET:374/92%EB:716/93%LM:939/97%", ["Zenzan"] = "ET:280/80%EB:421/79%EM:513/83%", ["Hiddenflange"] = "UB:282/38%UM:418/49%", ["Ninetynine"] = "RT:176/69%RB:224/57%RM:503/55%", ["Reduce"] = "RT:179/67%EB:354/78%EM:761/88%", ["Neme"] = "RB:278/67%RM:547/60%", ["Juwita"] = "RT:210/67%EB:644/83%EM:765/82%", ["Shadowblade"] = "RB:444/60%RM:570/63%", ["Litymctity"] = "RT:175/63%RB:502/68%RM:476/53%", ["Hardstroke"] = "CB:65/17%RM:589/61%", ["Fionamonic"] = "RT:419/55%EB:604/79%RM:298/64%", ["Sagalo"] = "RT:422/55%RB:490/66%RM:497/56%", ["Playboi"] = "EB:685/93%SM:976/99%", ["Kyrra"] = "RB:458/63%RM:566/63%", ["Fellrion"] = "UT:245/32%RB:548/72%RM:672/71%", ["Nhome"] = "RB:414/57%CM:83/7%", ["Bovinebill"] = "UT:211/27%EB:559/75%EM:724/78%", ["Levil"] = "CT:92/16%RB:442/62%RM:504/59%", ["Redprimus"] = "RT:157/58%EB:630/82%RM:665/71%", ["Tapington"] = "CT:126/16%EB:669/86%EM:912/94%", ["Kirimi"] = "RB:403/56%EM:530/89%", ["Rhodrick"] = "CT:64/12%UB:177/42%RM:467/53%", ["Jory"] = "RB:529/69%EM:794/82%", ["Loree"] = "RB:462/58%UM:181/48%", ["Dingwoot"] = "EB:526/89%EM:802/85%", ["Ebbi"] = "UB:254/29%UM:290/34%", ["Morganlefaye"] = "CT:67/24%EB:619/81%RM:377/72%", ["Àkeno"] = "UT:118/42%UB:321/43%UM:337/34%", ["Frostbolter"] = "EB:631/83%RM:624/69%", ["Sbd"] = "UB:195/25%UM:295/34%", ["Lug"] = "EB:616/81%EM:923/94%", ["Smegoff"] = "RB:315/68%EM:769/81%", ["Forrestghost"] = "EB:358/85%EM:645/85%", ["Aluyiss"] = "CT:40/12%EB:685/88%EM:805/85%", ["Nemessia"] = "RB:470/61%UM:431/44%", ["Gallstone"] = "CT:117/19%RB:432/57%RM:578/65%", ["Seleven"] = "RB:232/54%RM:581/66%", ["Amirantha"] = "RT:170/58%RB:315/67%UM:102/34%", ["Swiftnes"] = "RT:206/70%RB:453/62%UM:390/43%", ["Teromo"] = "RT:176/63%EB:407/79%RM:613/65%", ["Abu"] = "CT:34/3%RB:430/59%RM:486/50%", ["Expirydate"] = "EB:603/78%RM:625/65%", ["Axxen"] = "RT:351/61%EB:711/93%EM:748/87%", ["Iplaywthfire"] = "RB:386/56%RM:448/53%", ["Sóul"] = "RB:416/55%RM:572/63%", ["Rjb"] = "RB:507/72%RM:442/52%", ["ßlindsåp"] = "CT:74/9%CB:132/17%", ["Geoplasmik"] = "ET:657/90%EB:702/92%EM:861/93%", ["Dadade"] = "RT:216/69%EB:450/82%RM:686/71%", ["Arwynne"] = "RT:401/52%RB:476/63%EM:369/78%", ["Fydmie"] = "LT:527/97%EB:684/91%EM:842/92%", ["Zeroace"] = "RB:448/62%RM:477/50%", ["Juggarnautt"] = "EB:566/80%EM:669/83%", ["Thalabaan"] = "LB:763/98%LM:967/98%", ["Shapsix"] = "RB:476/65%RM:563/60%", ["Amend"] = "ET:684/91%EB:517/92%EM:847/92%", ["Kasslock"] = "RB:492/66%RM:613/63%", ["Mimida"] = "RT:438/62%EB:582/81%RM:521/61%", ["Prevent"] = "CB:61/6%CM:37/12%", ["Knickerless"] = "EB:588/76%RM:702/73%", ["Fizzban"] = "EB:644/84%EM:810/86%", ["Jonnymage"] = "UT:333/48%EB:447/87%EM:689/79%", ["Nuro"] = "CT:61/11%CB:41/3%", ["Alinras"] = "UT:84/38%EB:341/76%RM:462/54%", ["Kaldoric"] = "EB:605/85%EM:850/88%", ["Noose"] = "ET:555/81%EB:661/89%EM:841/92%", ["Bokeh"] = "CT:54/21%UB:318/40%UM:75/26%", ["Lolitah"] = "UB:198/26%UM:371/44%", ["Moordotz"] = "CT:135/17%EB:459/83%EM:704/75%", ["Zik"] = "CB:33/2%CM:134/17%", ["Tyrraganks"] = "CB:26/0%RM:499/53%", ["Speakinspell"] = "UT:231/30%UB:255/35%", ["Zoologist"] = "RB:400/56%RM:619/68%", ["Emptyfrank"] = "EB:618/85%EM:757/88%", ["Cablis"] = "UT:82/31%EB:622/82%EM:757/81%", ["Dorachan"] = "UT:295/43%EB:615/85%EM:862/93%", ["Squishybeast"] = "EB:629/81%EM:860/88%", ["Gladdy"] = "EB:573/75%RM:454/73%", ["Guybrush"] = "ET:504/76%EB:693/91%EM:859/92%", ["Serephly"] = "EB:604/78%RM:670/70%", ["Esoon"] = "RT:170/61%UB:340/45%RM:472/53%", ["Felaren"] = "UB:326/45%CM:101/9%", ["Stickymicky"] = "LT:757/98%LB:761/97%LM:821/97%", ["Flosso"] = "ET:668/90%LB:734/95%LM:930/96%", ["Elanna"] = "RB:461/60%EM:855/89%", ["Stevedore"] = "EB:740/93%LM:943/95%", ["Pawfection"] = "ET:116/75%EB:438/80%EM:489/75%", ["Px"] = "EB:605/79%RM:655/70%", ["Addiction"] = "UB:289/40%RM:565/67%", ["Silentnite"] = "UT:246/36%RB:473/66%EM:392/80%", ["Trollin"] = "RT:543/73%EB:600/80%EM:842/88%", ["Coltaine"] = "UB:211/25%CM:64/22%", ["Kyte"] = "RB:538/73%EM:786/82%", ["Zinny"] = "UT:60/28%UB:267/36%EM:683/79%", ["Trinitee"] = "UB:349/45%EM:788/84%", ["Skyelah"] = "RT:157/54%RB:502/67%RM:604/65%", ["Khangz"] = "UT:83/33%EB:592/77%RM:514/58%", ["Apollo"] = "EB:645/83%EM:885/90%", ["Dankestmage"] = "UB:301/41%RM:503/55%", ["Dontoliver"] = "UB:134/33%RM:544/58%", ["Sideshow"] = "UB:282/39%UM:350/39%", ["Shiftyhunter"] = "CT:112/14%RB:526/72%UM:453/47%", ["Geeson"] = "ET:672/91%EB:718/93%EM:895/94%", ["Versey"] = "EB:573/75%UM:360/36%", ["Mikeyp"] = "ET:350/88%EB:673/86%RM:660/71%", ["Zud"] = "UT:249/32%UB:329/43%", ["Mazraghar"] = "CT:55/6%EB:680/87%EM:905/91%", ["Amhras"] = "UB:301/41%EM:514/84%", ["Beks"] = "CT:146/19%RB:398/55%RM:523/55%", ["Rukozar"] = "RB:437/60%EM:755/79%", ["Archbearuid"] = "ET:202/75%EB:600/89%EM:669/86%", ["Tankypea"] = "UB:249/27%UM:236/29%", ["Tropical"] = "RB:366/50%RM:234/56%", ["Beladin"] = "CB:174/23%RM:436/51%", ["Evera"] = "UB:260/35%EM:690/79%", ["Anathibarlin"] = "UT:62/28%UB:234/31%CM:43/15%", ["Shagnasty"] = "CB:44/9%CM:74/24%", ["Digibyte"] = "CT:81/18%EB:394/84%EM:710/85%", ["Gaogaigar"] = "CB:159/21%UM:403/48%", ["Kasari"] = "RT:146/61%UB:364/47%UM:399/43%", ["Saintaya"] = "RT:164/66%UB:175/47%UM:321/33%", ["Lunarz"] = "UT:89/35%CB:96/11%UM:246/30%", ["Wotyourname"] = "EB:389/80%EM:760/82%", ["Lizzilyn"] = "RT:152/62%EB:384/81%RM:582/68%", ["Costica"] = "ET:273/85%EB:570/83%EM:315/80%", ["Rustypipe"] = "RT:159/55%RB:406/55%UM:393/44%", ["Lario"] = "ET:639/88%EB:574/75%RM:216/71%", ["Daerthe"] = "ET:326/89%EB:539/93%EM:691/84%", ["Fyrestorm"] = "CT:64/23%CB:60/16%UM:286/29%", ["Brorc"] = "UB:321/44%RM:573/63%", ["Cmd"] = "CT:40/13%EB:684/91%RM:581/68%", ["Arohk"] = "LT:471/96%EB:654/89%EM:796/90%", ["Coorsice"] = "CT:29/13%CB:150/20%RM:638/70%", ["Luthur"] = "UT:100/37%RB:440/59%RM:594/65%", ["Onyx"] = "UB:160/41%RM:189/50%", ["Rachaelgale"] = "UT:348/45%RB:446/59%EM:536/89%", ["Cheezypeezy"] = "UT:254/33%UB:319/45%RM:406/52%", ["Tygermoon"] = "EB:427/79%EM:738/89%", ["Rubí"] = "CT:36/10%RB:416/57%RM:478/50%", ["Auranii"] = "CT:37/3%RB:386/50%EM:716/76%", ["Donnyville"] = "ET:663/87%RB:502/68%RM:648/69%", ["Spamone"] = "EB:642/84%RM:636/70%", ["Xéna"] = "CB:154/16%UM:395/45%", ["Zow"] = "EB:581/77%EM:797/85%", ["Mageroyal"] = "UT:270/40%EB:532/75%RM:675/74%", ["Sarru"] = "UT:95/37%RB:228/54%UM:80/29%", ["Beandawg"] = "LT:469/96%EB:499/91%EM:871/93%", ["Sandfly"] = "ET:280/80%EB:467/84%RM:591/64%", ["Kyliran"] = "RT:461/63%EB:596/79%EM:866/89%", ["Bobvio"] = "RB:378/52%RM:619/68%", ["Siuleisoubou"] = "CB:102/13%UM:390/44%", ["Travelers"] = "EB:471/82%RM:372/68%", ["Sheldon"] = "EB:569/75%CM:113/16%", ["Cursor"] = "RB:451/58%UM:423/43%", ["Chorbar"] = "UB:319/44%UM:142/41%", ["Cáis"] = "CT:33/8%CB:179/21%CM:214/21%", ["Mídgèt"] = "LT:506/96%RB:421/61%UM:198/29%", ["Ayaseharuka"] = "UB:304/41%RM:475/52%", ["Amarat"] = "UB:315/43%UM:373/42%", ["Nongren"] = "UT:129/49%RB:559/73%RM:343/72%", ["Letterature"] = "CT:25/0%UB:158/41%RM:480/50%", ["Derierii"] = "EB:691/88%EM:852/88%", ["Grishha"] = "UB:164/43%", ["Soulsy"] = "UT:244/32%EB:464/85%EM:760/81%", ["Slugga"] = "ET:585/84%EB:647/88%EM:759/88%", ["Thintridar"] = "EB:567/75%EM:729/79%", ["Pinchpoints"] = "RT:187/55%RB:380/67%", ["Magrid"] = "UB:312/40%UM:420/45%", ["Orsino"] = "UB:322/42%UM:406/48%", ["Darktrix"] = "UT:345/45%EB:499/86%EM:809/86%", ["Goldylokz"] = "RT:244/74%RB:265/59%RM:461/51%", ["Hemical"] = "EB:518/80%UM:49/28%", ["Drivertius"] = "UB:260/35%UM:327/38%", ["Beardface"] = "ET:282/83%RB:536/73%RM:307/67%", ["Expose"] = "UB:116/29%RM:512/55%", ["Strikes"] = "CT:38/10%CB:110/14%RM:221/52%", ["Keita"] = "UB:137/35%RM:650/71%", ["Hailnova"] = "UT:69/25%RB:500/66%RM:560/62%", ["Moonsaber"] = "LB:778/98%SM:996/99%", ["Melelia"] = "RT:404/53%RB:482/69%EM:668/77%", ["Utsukushii"] = "RT:141/50%RB:303/65%RM:468/51%", ["Wapowski"] = "CT:10/8%CB:42/9%CM:65/24%", ["Jadamore"] = "UT:89/35%UB:202/26%UM:144/44%", ["Edillesa"] = "UB:249/32%CM:13/2%", ["Loadfrank"] = "EB:485/76%EM:721/85%", ["Ilaa"] = "RT:338/74%EB:385/81%EM:488/84%", ["Treefiddee"] = "ET:326/91%EB:541/85%EM:608/82%", ["Cancelled"] = "RT:155/61%EB:545/81%RM:473/74%", ["Lohwani"] = "CB:56/6%UM:404/41%", ["Sinnaman"] = "EB:607/79%EM:780/81%", ["Opposed"] = "UT:127/45%RB:423/58%UM:111/35%", ["Cowhead"] = "EB:382/76%RM:487/74%", ["Gaiden"] = "ET:729/93%EB:730/92%RM:691/74%", ["Drave"] = "ET:249/78%EB:473/82%EM:642/85%", ["Wizdomwoman"] = "RB:428/56%UM:342/36%", ["Aphid"] = "EB:623/89%EM:666/84%", ["Pinnaclemagi"] = "CT:56/19%UB:243/33%RM:239/63%", ["Pinkthorn"] = "UB:223/30%UM:270/33%", ["Shienn"] = "RB:393/55%EM:739/78%", ["Amoranth"] = "CT:94/12%RB:309/67%UM:431/48%", ["Beestje"] = "CT:42/13%RB:241/56%RM:273/63%", ["Donteatme"] = "CB:92/10%CM:209/23%", ["Cyro"] = "UT:122/46%RB:280/64%EM:753/79%", ["Hairybeast"] = "RT:181/64%RB:513/70%UM:150/46%", ["Pomkys"] = "CB:157/21%UM:410/44%", ["Trexoc"] = "EB:653/85%RM:666/72%", ["Jumamage"] = "RB:402/53%RM:642/70%", ["Mana"] = "UB:189/25%EM:640/75%", ["Shazam"] = "CB:96/12%RM:179/54%", ["Itzel"] = "ET:257/79%EB:367/75%RM:420/60%", ["Brckshathaus"] = "UB:132/32%RM:532/61%", ["Kavorca"] = "EB:396/77%EM:629/84%", ["Whoosh"] = "ET:205/76%RB:383/53%UM:424/46%", ["Brock"] = "UB:223/30%EM:815/85%", ["Bepo"] = "RB:480/65%UM:440/48%", ["Kortania"] = "UB:260/30%UM:252/30%", ["Nerdhunter"] = "UT:82/32%RB:484/66%EM:801/83%", ["Nigelnomates"] = "CT:134/17%UB:312/41%RM:210/53%", ["Redasarose"] = "ET:216/76%EB:433/80%RM:339/65%", ["Cönan"] = "RT:133/50%UB:198/46%", ["Mazirian"] = "RT:189/66%EB:570/75%CM:25/0%", ["Lyne"] = "UT:236/31%UB:272/37%UM:432/48%", ["Bokken"] = "CB:181/24%UM:442/46%", ["Delt"] = "ET:603/80%EB:679/86%RM:649/72%", ["Polymorphy"] = "CT:55/10%RB:442/57%RM:334/63%", ["Rageryn"] = "RB:400/68%EM:822/92%", ["Kyanu"] = "RT:164/56%RB:481/63%UM:361/36%", ["Beergut"] = "RB:523/71%UM:268/26%", ["Tumscro"] = "UT:230/30%RB:427/58%RM:243/59%", ["Maddok"] = "RT:182/62%EB:489/76%EM:802/90%", ["Zingoraluzza"] = "RM:461/52%", ["Barbra"] = "CB:159/20%", ["Retkon"] = "RT:131/50%RB:550/74%EM:736/79%", ["Balonglong"] = "CB:160/21%EM:411/82%", ["Destrias"] = "CB:79/8%CM:28/6%", ["Katoria"] = "RB:455/62%RM:585/64%", ["Bangers"] = "CT:85/11%RB:476/62%UM:410/41%", ["Dobbymay"] = "RB:474/67%EM:640/76%", ["Killerangus"] = "CT:107/18%UB:362/45%RM:566/64%", ["Notagnome"] = "RT:502/67%RB:459/66%RM:477/60%", ["Trek"] = "CB:150/19%RM:549/58%", ["Hodval"] = "CT:49/16%UB:363/49%UM:400/45%", ["Threekan"] = "CB:121/14%EM:683/75%", ["Draconix"] = "RT:275/50%EB:701/92%EM:883/94%", ["Mimas"] = "RT:195/67%RB:444/64%RM:527/65%", ["Cmixer"] = "UB:101/29%CM:63/4%", ["Duskrunner"] = "CT:65/7%UB:243/32%EM:737/79%", ["Yelanda"] = "UT:187/28%EB:614/86%EM:844/93%", ["Zzchop"] = "UB:264/31%RM:225/55%", ["Magelee"] = "UB:93/26%RM:553/65%", ["Mick"] = "RT:145/51%EB:617/80%EM:756/79%", ["Vidania"] = "RB:199/63%", ["Teeborq"] = "RB:446/58%RM:644/67%", ["Beastism"] = "UB:266/35%CM:34/2%", ["Omegamanlet"] = "UB:360/46%RM:642/68%", ["Gotaform"] = "RT:83/60%EB:609/91%EM:780/90%", ["Carbonfurry"] = "LT:735/96%LB:751/98%LM:826/95%", ["Crankymage"] = "RT:225/73%RB:515/74%RM:314/68%", ["Foxinsox"] = "UT:196/26%LB:708/96%LM:875/96%", ["Sylvloriel"] = "UB:127/33%UM:119/39%", ["Jemwar"] = "RT:287/52%EB:660/89%EM:842/92%", ["Narc"] = "CB:95/10%EM:796/90%", ["Varina"] = "CT:62/23%RB:360/50%UM:314/41%", ["Link"] = "RB:299/66%EM:749/79%", ["Adannik"] = "RB:540/71%EM:781/81%", ["Aak"] = "CT:38/3%UB:203/26%UM:257/29%", ["Trriss"] = "UB:225/28%RM:219/60%", ["Dæmona"] = "RT:174/59%RB:252/57%RM:240/57%", ["Griimm"] = "CT:151/20%UB:319/40%RM:670/69%", ["Shuftii"] = "CT:78/9%EB:369/79%UM:152/49%", ["Afterlee"] = "UB:108/29%UM:317/37%", ["Basc"] = "EB:716/92%EM:870/91%", ["Kanforth"] = "RT:218/69%EB:638/83%EM:802/83%", ["Junmage"] = "UB:292/40%RM:171/52%", ["Yytoil"] = "RT:165/66%EB:626/91%EM:792/92%", ["Naraku"] = "UB:363/47%EM:673/78%", ["Jessania"] = "CB:68/8%CM:96/9%", ["Jackmerius"] = "CT:87/11%RB:472/64%EM:415/76%", ["Ambshoota"] = "CT:66/7%UB:299/40%RM:689/74%", ["Làmp"] = "ET:378/79%EB:503/80%EM:651/81%", ["Arael"] = "RT:171/58%EB:418/79%RM:592/64%", ["Lyebath"] = "CT:40/13%CB:87/9%RM:458/50%", ["Darkdaggers"] = "CT:2/3%UB:217/28%UM:95/28%", ["Yurione"] = "CB:155/20%CM:119/16%", ["Stallis"] = "ET:451/80%EB:570/84%EM:819/91%", ["Beastmood"] = "CT:24/8%UB:291/35%RM:195/51%", ["Fenick"] = "RB:416/70%EM:606/78%", ["Minnuette"] = "RT:155/54%UB:351/47%UM:325/38%", ["Tryst"] = "CT:51/5%RB:435/59%EM:727/77%", ["Xarxiv"] = "UB:104/29%UM:402/47%", ["Ackermann"] = "UB:208/27%CM:128/18%", ["Owi"] = "RB:421/52%RM:266/61%", ["Archeuz"] = "RT:334/73%EB:526/81%RM:431/66%", ["Faustish"] = "CB:160/21%CM:171/22%", ["Downere"] = "CT:32/5%CB:158/21%CM:43/3%", ["Shadzam"] = "CB:116/15%UM:333/39%", ["Sharkbaite"] = "CT:45/16%CB:183/23%UM:378/40%", ["Gilfeather"] = "CT:86/10%RB:394/54%RM:536/59%", ["Zwarrior"] = "UT:69/28%CB:215/24%UM:271/32%", ["Rusha"] = "ET:279/82%EB:618/81%EM:832/88%", ["Cosmicpower"] = "UB:221/29%EM:767/86%", ["Haros"] = "UB:363/49%RM:468/51%", ["Blongo"] = "CB:64/17%UM:304/31%", ["Bahuu"] = "CT:40/13%RB:373/51%RM:225/57%", ["Nessy"] = "CB:96/10%", ["Teralitie"] = "UT:40/42%RB:244/63%EM:400/77%", ["Cardinalgrug"] = "RT:198/67%EB:460/87%EM:705/84%", ["Medivha"] = "EB:738/94%EM:865/90%", ["Thewallmaker"] = "UT:79/30%UB:287/37%RM:461/50%", ["Hatzbefarmin"] = "RB:210/51%UM:155/47%", ["Rounin"] = "EB:689/87%EM:913/93%", ["Thecandymanz"] = "CB:169/18%UM:238/28%", ["Zandeen"] = "RB:501/67%RM:570/67%", ["Beayen"] = "CT:31/2%CB:130/15%CM:47/6%", ["Snowyartemis"] = "UB:347/47%RM:611/67%", ["Windley"] = "RB:413/70%EM:858/94%", ["Zenishrah"] = "CB:177/23%CM:65/5%", ["Brogore"] = "UB:236/31%RM:456/51%", ["Gruktwo"] = "EB:587/75%RM:651/70%", ["Hanlon"] = "EB:588/87%EM:824/92%", ["Ajarluz"] = "CM:28/10%", ["Daelault"] = "CT:52/19%CB:65/8%CM:130/18%", ["Crittens"] = "CT:37/11%RB:223/53%RM:211/55%", ["Branigun"] = "CT:65/24%CB:140/17%RM:496/52%", ["Odinsword"] = "RB:408/69%RM:489/66%", ["Pnutzz"] = "ET:563/75%EB:710/90%UM:416/47%", ["Pinwheel"] = "UB:242/32%RM:200/54%", ["Ambeline"] = "ET:337/77%EB:522/92%EM:618/91%", ["Amelodia"] = "RT:194/64%RB:489/64%RM:514/53%", ["Schemata"] = "ET:707/94%LB:725/96%LM:880/96%", ["Aradael"] = "UT:71/25%CB:82/22%", ["Thanna"] = "CB:110/13%RM:362/73%", ["Collateral"] = "EB:630/86%EM:813/90%", ["Foxymoron"] = "CT:101/17%EB:617/81%EM:796/85%", ["Píxie"] = "UB:230/29%RM:611/67%", ["Motgus"] = "CT:50/16%UB:366/49%CM:164/22%", ["Whitefang"] = "UB:226/29%EM:876/91%", ["Chuckie"] = "CB:164/22%UM:326/33%", ["Devvi"] = "UB:368/47%EM:448/78%", ["Nutbagz"] = "CT:48/5%UB:320/43%RM:628/69%", ["Toeslurper"] = "CB:113/13%EM:723/76%", ["Corint"] = "CB:31/2%CM:61/15%", ["Yag"] = "UT:111/40%CB:63/16%CM:31/2%", ["Grimmagician"] = "RT:396/52%RB:503/67%EM:734/79%", ["Marena"] = "UT:71/25%CB:125/16%CM:226/23%", ["Pol"] = "ET:389/93%EB:523/79%EM:689/84%", ["Voladre"] = "RT:141/58%EB:531/79%RM:301/52%", ["Hopscottch"] = "RT:407/62%EB:441/77%EM:718/89%", ["Alias"] = "EB:680/90%EM:887/94%", ["Portald"] = "UT:227/34%RB:415/58%RM:555/65%", ["Oyteara"] = "UT:88/38%EB:332/76%EM:760/88%", ["Clntbeastwud"] = "CB:52/5%UM:354/40%", ["Beaverwag"] = "CT:50/16%CB:98/24%UM:108/32%", ["Xeraph"] = "UB:128/34%", ["Sarowman"] = "ET:259/79%EB:597/79%EM:754/80%", ["Linaya"] = "CT:106/13%UB:245/30%UM:475/49%", ["Memnoch"] = "CB:109/14%RM:183/54%", ["Madna"] = "UB:249/33%RM:576/61%", ["Vissta"] = "CT:99/17%RB:398/51%RM:334/63%", ["Dulrin"] = "UB:310/41%RM:642/70%", ["Morgaana"] = "UB:221/29%CM:3/1%", ["Belthtank"] = "EB:655/88%EM:833/91%", ["Pwntang"] = "RT:106/61%EB:514/79%EM:730/85%", ["Nitebabe"] = "CB:56/14%CM:69/9%", ["Treads"] = "UT:269/49%EB:629/87%EM:734/86%", ["Ynnej"] = "CT:59/10%UB:90/25%UM:100/37%", ["Alkuris"] = "RT:61/56%EB:601/89%EM:688/87%", ["Colding"] = "RT:98/54%RB:365/66%EM:580/76%", ["Dalari"] = "CT:51/18%UB:302/40%UM:137/42%", ["Enhancedbust"] = "RT:177/63%RB:271/56%RM:235/60%", ["Treeage"] = "ET:287/80%RB:260/68%RM:200/54%", ["Fadyena"] = "CB:63/7%UM:257/31%", ["Shiverrs"] = "UT:293/37%EB:593/78%RM:290/60%", ["Takahirö"] = "CB:155/20%UM:461/47%", ["Bloodyèlf"] = "CM:98/12%", ["Nastyfridge"] = "UT:337/44%EB:667/87%EM:873/91%", ["Bigoldbear"] = "ET:579/83%LB:688/95%EM:738/90%", ["Cowzwithgunz"] = "LT:466/96%EB:692/92%EM:711/85%", ["Insindiary"] = "ET:663/87%EB:477/89%LM:893/95%", ["Blackaddar"] = "RT:373/61%EB:560/80%EM:540/92%", ["Lucyanne"] = "UT:180/28%RB:225/57%RM:488/57%", ["Hine"] = "CT:42/17%UB:104/25%UM:209/40%", ["Locknyadot"] = "UB:191/25%UM:386/44%", ["Rocksta"] = "RB:373/52%EM:668/77%", ["Glorifright"] = "CB:79/9%UM:274/33%", ["Magetastic"] = "CT:178/23%RB:480/64%RM:630/69%", ["Fiend"] = "CT:31/2%CB:57/6%UM:177/48%", ["Instruction"] = "RT:159/72%LB:734/97%EM:603/82%", ["Bearboi"] = "EB:499/79%EM:767/89%", ["Hepha"] = "CB:132/16%CM:123/15%", ["Bukmeyeh"] = "CM:36/10%", ["Aessa"] = "CT:63/22%UB:149/38%RM:504/52%", ["Shootypie"] = "CT:38/4%CB:52/5%UM:214/25%", ["Lazycraze"] = "RT:156/57%CB:142/17%UM:348/37%", ["Grizraz"] = "RT:61/56%EB:363/75%EM:401/85%", ["Bravette"] = "CB:40/8%UM:135/45%", ["Grubbz"] = "RT:219/72%RB:431/57%RM:520/61%", ["Stumbleduck"] = "UT:316/41%RB:339/70%RM:631/68%", ["Kinome"] = "ET:238/76%CB:140/17%", ["Melka"] = "UT:121/27%EB:544/81%EM:573/80%", ["Woftam"] = "EB:565/80%EM:748/87%", ["Zefira"] = "CT:16/4%UB:250/33%RM:182/50%", ["Rhummy"] = "UB:150/38%CM:159/21%", ["Zoltare"] = "CB:56/13%RM:223/56%", ["Obelixx"] = "CT:81/7%EB:522/80%EM:842/92%", ["Fandezaris"] = "CB:164/21%UM:397/40%", ["Exothermic"] = "UT:75/29%UB:203/26%", ["Rhorlaul"] = "RT:539/71%LB:775/97%EM:848/88%", ["Adparsec"] = "CB:57/6%EM:795/82%", ["Greatdiablo"] = "RB:466/64%EM:723/78%", ["Dqh"] = "CB:142/17%CM:162/19%", ["Arkham"] = "ET:364/92%EB:365/80%EM:679/83%", ["Akaname"] = "CT:37/16%UB:111/31%UM:307/36%", ["Nerdtwo"] = "UB:95/27%UM:369/39%", ["Kisim"] = "CT:44/14%CB:104/13%CM:47/18%", ["Gnoyoudont"] = "CT:62/11%RB:205/53%UM:369/43%", ["Decrepitude"] = "UB:381/49%RM:400/74%", ["Ayo"] = "RT:302/53%EB:500/76%EM:528/78%", ["Holyorder"] = "RT:100/61%RB:120/58%RM:369/70%", ["Picnic"] = "EB:621/91%LM:851/95%", ["Dengziqi"] = "UT:201/40%EB:540/78%EM:720/86%", ["Yaknomagi"] = "CB:42/4%CM:182/24%", ["Storminus"] = "UM:105/35%", ["Azliann"] = "CB:32/1%CM:121/15%", ["Yaseiji"] = "ET:297/88%RB:413/74%EM:690/87%", ["Lobshot"] = "CB:110/13%RM:657/71%", ["Gaya"] = "UT:261/37%EB:628/91%EM:781/92%", ["Magiclee"] = "EB:576/88%RM:498/74%", ["Artheur"] = "UT:257/47%RB:423/69%EM:595/78%", ["Genestealer"] = "EB:647/92%EM:766/91%", ["Verz"] = "ET:599/85%LB:719/96%LM:853/95%", ["Lorgren"] = "ET:633/89%EB:659/89%EM:661/87%", ["Aspit"] = "CM:137/12%", ["Mortalwombat"] = "RT:65/54%EB:666/93%EM:804/93%", ["Apsara"] = "UB:284/38%EM:418/82%", ["Xeebank"] = "CB:50/5%CM:169/22%", ["Glorific"] = "CB:140/18%UM:411/48%", ["Slipperysam"] = "CM:230/23%", ["Tessysmage"] = "CT:4/7%CB:44/5%UM:84/32%", ["Plasma"] = "CT:29/1%CB:33/5%UM:132/41%", ["Battleblade"] = "RT:331/56%EB:564/82%EM:693/84%", ["Sqirt"] = "RM:650/71%", ["Sweetclive"] = "UB:98/28%UM:383/45%", ["Marama"] = "RT:363/60%EB:498/76%EM:584/77%", ["Felinea"] = "RT:120/53%RB:271/69%RM:496/73%", ["Malterion"] = "RB:229/66%", ["Axxage"] = "UB:92/26%CM:101/14%", ["Temulan"] = "CB:113/14%CM:122/17%", ["Foxglove"] = "RT:160/65%EB:437/77%EM:633/84%", ["Alphadog"] = "UT:154/32%EB:565/80%EM:769/88%", ["Bullseyebaby"] = "CB:32/1%UM:99/34%", ["Pocketrockit"] = "CT:22/9%CB:36/3%CM:34/3%", ["Peebodie"] = "CB:66/8%UM:81/31%", ["Selki"] = "LB:715/95%EM:811/92%", ["Gorrbag"] = "CB:77/16%UM:187/49%", ["Ducatee"] = "UT:158/33%RB:436/70%EM:622/80%", ["Yodyfroster"] = "CM:119/17%", ["Targragis"] = "UT:67/27%UB:129/44%EM:757/88%", ["Jhe"] = "RB:362/62%EM:725/86%", ["Firidar"] = "RT:492/65%RB:481/65%UM:138/42%", ["Belagorn"] = "RT:155/61%RB:301/73%RM:373/59%", ["Morphandee"] = "CT:25/10%RB:190/50%UM:414/48%", ["Magetogrind"] = "CB:27/0%CM:55/7%", ["Colomius"] = "CB:60/15%CM:77/6%", ["Zogrrior"] = "RB:248/66%EM:853/92%", ["Googleybear"] = "UT:120/43%RB:545/73%RM:609/63%", ["Aquaticnova"] = "RT:182/71%LB:730/96%LM:943/98%", ["Bendalar"] = "RT:129/54%RB:331/58%EM:600/78%", ["Greenfingers"] = "UT:50/46%EB:460/79%EM:737/90%", ["Thorungus"] = "CB:30/1%CM:35/4%", ["Mike"] = "CB:28/1%", ["Kashmir"] = "ET:382/84%EB:400/87%EM:630/83%", ["Torious"] = "ET:568/82%EB:687/91%EM:807/90%", ["Keacilius"] = "CM:29/7%", ["Svens"] = "CB:154/16%RM:333/63%", ["Zuljiin"] = "CB:28/2%", ["Borhammer"] = "CB:27/1%UM:336/34%", ["Beardedwagon"] = "RB:180/62%EM:674/88%", ["Munyshot"] = "CB:36/2%UM:439/45%", ["Goldylockz"] = "RT:246/74%UB:339/45%RM:292/64%", ["Zaco"] = "CB:104/13%CM:125/17%", ["Tirikesh"] = "RB:308/55%EM:602/78%", ["Hocuspokus"] = "RB:549/72%RM:687/71%", ["Stronkwoman"] = "CT:9/7%", ["Kagomesan"] = "CB:49/5%UM:115/38%", ["Floistine"] = "ET:214/75%EB:445/87%EM:583/81%", ["Fruityloops"] = "RT:197/74%EB:422/76%RM:472/74%", ["Wintermute"] = "ET:269/83%EB:336/76%EM:686/84%", ["Hersey"] = "RT:321/55%RB:449/71%EM:716/85%", ["Icyboii"] = "CM:54/7%", ["Rámpáge"] = "UB:241/46%UM:112/32%", ["Tuscani"] = "CB:29/1%UM:141/43%", ["Cabochon"] = "UB:246/31%CM:228/23%", ["Azirale"] = "ET:218/76%RB:426/69%RM:474/74%", ["Betros"] = "CT:34/14%CB:32/2%UM:230/29%", ["Odet"] = "CB:158/19%", ["Moonboy"] = "ET:663/91%EB:672/94%EM:680/86%", ["Shrill"] = "CB:83/16%CM:36/19%", ["Yumimi"] = "CM:120/17%", ["Rubber"] = "CT:48/5%UB:235/31%UM:79/29%", ["Poeperdoeks"] = "CB:25/0%", ["Kintrick"] = "ET:309/88%RB:444/71%EM:584/77%", ["Unblock"] = "CB:155/20%UM:352/40%", ["Ponzah"] = "ET:508/77%EB:624/85%EM:779/89%", ["Bearbum"] = "RT:196/74%EB:493/93%EM:746/91%", ["Hairyroar"] = "CT:156/20%EB:615/90%EM:619/83%", ["Flynnyblues"] = "UB:62/42%EM:601/81%", ["Oldie"] = "RT:423/67%RB:448/71%RM:525/73%", ["Theperkynana"] = "UM:75/27%", ["Mycha"] = "CT:18/4%UB:152/39%CM:43/15%", ["Shiftmyselff"] = "RB:280/62%RM:474/70%", ["Itsakinda"] = "CB:14/0%CM:141/13%", ["Antealis"] = "RT:315/73%RB:341/66%UM:141/40%", ["Lavalon"] = "UT:69/26%CM:55/20%", ["Wileyroo"] = "RB:353/57%EM:647/81%", ["Murad"] = "UT:57/25%RB:196/65%EM:685/87%", ["Enumclaw"] = "CT:7/3%CB:26/0%UM:234/27%", ["Onthekase"] = "UT:162/34%RB:299/54%RM:353/65%", ["Myform"] = "EB:360/85%EM:716/88%", ["Lothamir"] = "CM:12/2%", ["Tardaan"] = "UT:112/25%UB:118/27%UM:92/47%", ["Iceflow"] = "CM:172/23%", ["Cetshwayo"] = "UB:122/42%", ["Qness"] = "RT:114/50%RB:189/56%RM:366/66%", ["Andreb"] = "ET:270/85%EB:517/83%EM:714/88%", ["Dehvi"] = "EB:668/86%EM:809/84%", ["Cirusvaga"] = "CT:49/22%UB:64/28%EM:578/80%", ["Starrysky"] = "CT:4/2%UB:294/49%EM:562/75%", ["Bobsteven"] = "RT:169/70%RB:313/65%RM:357/63%", ["Hammerrun"] = "CB:37/5%RM:223/52%", ["Moomighty"] = "UB:110/45%RM:460/70%", ["Trueshotkity"] = "EB:616/80%EM:846/87%", ["Davina"] = "CT:64/20%RB:150/51%RM:270/52%", ["Bravado"] = "RB:407/63%RM:545/74%", ["Patriot"] = "EB:253/78%EM:460/83%", ["Luno"] = "UT:83/25%RB:409/56%RM:494/58%", ["Lolidest"] = "CB:131/16%RM:668/69%", ["Milfoil"] = "UT:238/30%RB:551/73%RM:561/62%", ["Chronicon"] = "ET:463/93%EB:593/84%EM:835/92%", ["Harkaway"] = "RT:228/74%EB:587/77%RM:654/72%", ["Beaconsfield"] = "CT:8/7%CB:88/11%CM:118/17%", ["Mallen"] = "ET:424/92%EB:636/88%EM:875/94%", ["Maydie"] = "LT:573/97%SB:800/99%LM:908/98%", ["Kommbaxx"] = "CT:73/14%RB:413/53%RM:249/58%", ["Faerie"] = "RT:214/69%RB:526/70%RM:699/74%", ["Zieri"] = "UT:132/47%RB:433/58%RM:249/59%", ["Omi"] = "LT:616/98%EB:616/85%EM:693/94%", ["Márkus"] = "LT:495/96%LB:773/97%LM:861/97%", ["Aliera"] = "ET:367/92%EB:696/88%EM:834/86%", ["Hiionhere"] = "ET:409/91%EB:661/90%LM:915/96%", ["Bunzy"] = "ET:371/91%EB:720/91%EM:858/89%", ["Ironrage"] = "ET:327/91%EB:581/88%EM:454/89%", ["Séréphiná"] = "ET:439/92%EB:578/82%EM:682/78%", ["Florena"] = "ET:340/89%EB:723/94%EM:714/78%", ["Oakendreamer"] = "RT:189/61%EB:574/81%EM:624/91%", ["Gazaus"] = "LT:466/96%EB:680/91%EM:554/92%", ["Bizznizz"] = "ET:196/86%EB:478/82%EM:448/88%", ["Ammar"] = "LT:556/97%EB:691/91%LM:927/96%", ["Alarinde"] = "ET:400/93%LB:783/98%EM:913/94%", ["Armaret"] = "ET:248/80%EB:587/84%EM:520/77%", ["Biwbiw"] = "CT:47/10%UB:368/46%RM:208/53%", ["Ayeverb"] = "LT:442/95%EB:724/92%EM:571/86%", ["Stelesfury"] = "LT:538/97%LB:769/97%LM:837/97%", ["Pins"] = "RT:198/65%EB:585/76%EM:787/82%", ["Bluewaffle"] = "UT:117/42%RB:530/71%EM:770/80%", ["Faladen"] = "LT:382/96%EB:642/92%EM:589/94%", ["Dieriandra"] = "RT:198/62%RB:372/50%EM:467/82%", ["Pepelepewpew"] = "ET:239/76%EB:721/94%LM:684/95%", ["Goodz"] = "ET:248/77%EB:714/94%EM:636/93%", ["Mifivestone"] = "ET:325/84%RB:509/72%EM:448/80%", ["Naughtybaba"] = "LT:496/95%EB:730/93%EM:668/91%", ["Stormcast"] = "ET:235/81%EB:612/84%RM:576/63%", ["Paladinjonty"] = "CT:25/3%CB:68/5%UM:410/44%", ["Auriél"] = "UT:135/42%UB:247/31%RM:594/66%", ["Bunsen"] = "CT:42/14%", ["Idreya"] = "UT:105/42%RB:510/67%EM:757/82%", ["Sausaged"] = "CT:208/24%LB:700/95%EM:755/86%", ["Melissandra"] = "UT:182/37%EB:533/80%RM:450/72%", ["Theodra"] = "RT:550/69%EB:671/92%EM:750/85%", ["Rissole"] = "CT:164/21%UB:338/45%UM:293/33%", ["Cynders"] = "CT:28/1%", ["Mingemaimer"] = "ET:354/91%EB:724/91%EM:685/75%", ["Reyen"] = "UT:323/42%EB:695/88%EM:739/77%", ["Soco"] = "UT:284/37%", ["Alethea"] = "RT:225/74%RB:327/69%RM:458/51%", ["Lee"] = "UT:149/49%EB:527/92%RM:509/59%", ["Baitnswitch"] = "UT:340/44%UB:368/49%RM:487/55%", ["Kinkshame"] = "RT:255/73%RB:380/69%RM:255/58%", ["Vanheusen"] = "UT:321/41%UB:138/36%RM:198/53%", ["Vodle"] = "RT:516/68%EB:625/81%EM:499/82%", ["Pitta"] = "CT:95/10%UB:185/45%RM:279/61%", ["Cludo"] = "RT:409/50%EB:475/88%RM:264/61%", ["Richirichi"] = "ET:734/89%EB:646/88%LM:909/95%", ["Deadshotz"] = "CT:146/19%UB:354/47%RM:449/50%", ["Shazorc"] = "CB:21/15%UM:238/45%", ["Squishybutt"] = "CT:46/5%CB:82/21%UM:76/29%", ["Battlepope"] = "RT:231/64%RB:367/67%RM:490/71%", ["Bearden"] = "CB:137/14%RM:560/64%", ["Sneekychin"] = "UB:286/35%EM:856/88%", ["Hunterremix"] = "UT:94/37%RB:395/53%RM:303/67%", ["Faithgiver"] = "LT:569/97%LB:717/96%SM:918/99%", ["Blowshtup"] = "ET:250/78%EB:721/94%EM:587/91%", ["Uvibus"] = "CT:32/8%EB:559/78%EM:777/87%", ["Floarnes"] = "CT:44/14%UB:350/48%UM:142/44%", ["Mysterybeef"] = "UB:322/45%UM:272/31%", ["Shnaza"] = "ET:298/85%EB:730/92%EM:460/79%", ["Sourdiesel"] = "UM:70/27%", ["Highness"] = "CT:166/19%UB:140/36%CM:18/7%", ["Araya"] = "UT:89/36%EB:619/80%UM:74/25%", ["Mellilpriest"] = "UB:216/27%RM:615/68%", ["Dubbo"] = "CT:85/8%UB:338/47%RM:310/66%", ["Curseling"] = "EB:558/78%LM:913/96%", ["Opalurana"] = "RT:149/55%UB:173/43%UM:231/26%", ["Jynne"] = "RT:173/62%RB:487/66%EM:428/78%", ["Swampyy"] = "ET:241/77%EB:541/81%RM:534/73%", ["Jesanda"] = "ET:324/83%EB:670/90%EM:836/89%", ["Kudasai"] = "CT:0/4%UM:255/45%", ["Icynips"] = "ET:591/79%EB:571/76%RM:505/55%", ["Bloodlusts"] = "EM:607/82%", ["Mellivora"] = "CM:68/21%", ["Fairyland"] = "CT:71/6%UM:369/40%", ["Knerby"] = "CT:31/2%RM:539/64%", ["Inamoreata"] = "RT:477/66%EM:858/90%", ["Calpis"] = "UT:106/48%CB:93/12%RM:621/72%", ["Darden"] = "CT:180/24%UB:282/38%RM:245/61%", ["Azora"] = "CT:0/5%EM:852/87%", ["Felshift"] = "CT:123/16%RB:420/54%RM:650/67%", ["Morolan"] = "ET:323/87%RB:464/59%RM:682/72%", ["Tiax"] = "RT:140/59%CB:76/10%UM:270/33%", ["Belistyx"] = "UT:78/28%CB:119/15%UM:80/29%", ["Thincow"] = "CT:80/8%EB:552/78%EM:826/90%", ["Ihategnomes"] = "CM:97/14%", ["Numa"] = "CT:53/8%UB:132/34%UM:52/32%", ["Pantinho"] = "RT:158/58%UB:296/35%UM:241/28%", ["Norden"] = "CT:184/21%RB:508/73%RM:548/64%", ["Carrotstrips"] = "CT:38/8%CB:77/8%", ["Feralpawz"] = "UT:359/47%RB:241/58%CM:167/20%", ["Chayya"] = "CT:103/11%CB:72/15%CM:33/7%", ["Kyarose"] = "UT:100/46%CB:83/23%RM:221/60%", ["Flametree"] = "ET:669/84%EB:625/87%EM:794/88%", ["Ferrn"] = "UT:58/26%CB:162/21%RM:248/64%", ["Azurine"] = "CT:5/3%CB:28/1%UM:117/38%", ["Asherixie"] = "CT:55/20%RB:265/64%EM:532/89%", ["Mattrix"] = "UT:229/33%EB:380/76%RM:289/63%", ["Rockelber"] = "CT:48/15%CB:79/9%UM:85/27%", ["Soopermodel"] = "UT:331/40%RB:445/63%EM:503/84%", ["Nenshaft"] = "CT:48/16%CB:76/20%RM:254/61%", ["Spankmytank"] = "CM:33/10%", ["Metalhorns"] = "CB:24/10%UM:413/45%", ["Aldrax"] = "UT:105/25%UB:138/31%RM:249/55%", ["Chandal"] = "ET:356/83%EB:350/84%RM:221/70%", ["Ramster"] = "UB:238/29%EM:731/78%", ["Grogflog"] = "CT:53/20%CB:121/13%CM:143/18%", ["Jumawa"] = "EB:541/75%LM:921/96%", ["Xerbus"] = "UM:248/28%", ["Bowry"] = "CB:8/0%UM:83/31%", ["Idzapthat"] = "UB:132/34%UM:328/34%", ["Sheepshager"] = "CM:73/10%", ["Avenus"] = "CM:69/8%", ["Fandi"] = "UB:322/44%CM:53/19%", ["Ayscha"] = "CB:40/3%RM:693/74%", ["Randle"] = "RB:533/71%RM:669/73%", ["Ijave"] = "UM:70/26%", ["Dotitus"] = "CM:64/9%", ["Mutilater"] = "EB:589/77%EM:873/89%", ["Zanazeenja"] = "CB:52/13%CM:175/16%", ["Clevin"] = "UB:104/30%RM:328/74%", ["Cyndri"] = "EM:466/79%", ["Tygorl"] = "ET:192/75%EB:433/77%RM:386/68%", ["Maetor"] = "UT:70/28%UB:305/36%UM:119/36%", ["Leighdots"] = "CB:129/17%RM:677/73%", ["Hottotrot"] = "UT:357/44%EB:545/78%RM:578/68%", ["Mirralee"] = "CB:134/16%RM:688/74%", ["Esstwelle"] = "CB:87/24%UM:110/39%", ["Roosterchook"] = "CB:33/2%", ["Furieosa"] = "RT:182/64%EB:458/84%EM:696/76%", ["Salamence"] = "CB:42/10%UM:222/25%", ["Xarta"] = "EB:439/86%RM:464/54%", ["Rindu"] = "UB:129/36%RM:285/69%", ["Roguefort"] = "UB:217/29%RM:456/51%", ["Dumdums"] = "ET:633/83%LB:780/98%LM:977/98%", ["Holywars"] = "CT:57/4%RB:257/59%UM:315/33%", ["Crustacius"] = "CB:128/17%EM:389/80%", ["Adela"] = "RB:173/68%EM:363/88%", ["Boakley"] = "EB:627/81%EM:539/78%", ["Niven"] = "CB:80/6%UM:264/30%", ["Leofrich"] = "RT:172/56%EB:693/93%EM:835/91%", ["Illidanos"] = "CB:120/12%CM:80/10%", ["Portaldummy"] = "RM:567/67%", ["Greenner"] = "RB:287/66%RM:287/67%", ["Asadpanda"] = "RB:316/72%EM:577/91%", ["Tanemahuta"] = "EB:440/86%EM:442/81%", ["Ivellios"] = "EB:493/91%LM:720/95%", ["Potatosoup"] = "EB:513/92%EM:523/77%", ["Rokstdy"] = "RB:223/60%RM:339/71%", ["Imonit"] = "EB:449/86%RM:565/66%", ["Urgly"] = "CT:27/5%EB:446/82%EM:516/83%", ["Mathi"] = "EB:515/88%EM:563/86%", ["Sebstantial"] = "RB:351/72%RM:679/73%", ["Gongan"] = "UB:110/28%UM:87/30%", ["Xs"] = "RB:359/73%RM:603/65%", ["Merca"] = "LB:599/96%EM:789/85%", ["Tuckarnz"] = "UB:242/31%UM:240/28%", ["Bumblebetuna"] = "RB:319/73%RM:578/73%", ["Menomoo"] = "CB:9/1%", ["Tetsunosuke"] = "RB:294/68%UM:265/30%", ["Salmac"] = "RB:275/62%RM:291/65%", ["Hellpriest"] = "EB:441/86%RM:549/64%", ["Primordial"] = "RB:274/67%EM:400/76%", ["Actchillz"] = "EB:353/78%EM:849/92%", ["Ftpolice"] = "CB:71/8%UM:321/38%", ["Tongpo"] = "UB:192/47%RM:470/52%", ["Sevenshades"] = "EB:448/87%EM:733/83%", ["Shtinkystien"] = "RB:445/71%EM:285/78%", ["Kanika"] = "RT:104/65%EB:383/86%EM:466/89%", ["Kheressa"] = "LB:594/96%RM:358/71%", ["Tronto"] = "RB:231/71%RM:421/69%", ["Barcliffrey"] = "CB:4/0%CM:122/19%", ["Scilla"] = "CB:45/10%CM:28/11%", ["Achílles"] = "EB:409/84%EM:571/93%", ["Spikerama"] = "RB:296/64%RM:272/58%", ["Tealeafer"] = "UB:117/29%RM:228/52%", ["Brokeish"] = "CB:116/15%CM:187/24%", ["Mofubuki"] = "CT:116/14%UB:96/27%CM:61/23%", ["Thunderfart"] = "CB:46/7%CM:79/10%", ["Holyschmoly"] = "CT:151/17%UB:259/34%RM:484/57%", ["Shread"] = "RB:531/73%EM:838/89%", ["Flonne"] = "CB:73/6%EM:395/75%", ["Juliosantana"] = "CT:39/10%CB:113/14%UM:141/38%", ["Gnomoretor"] = "CM:57/21%", ["Wolfblood"] = "CB:117/14%CM:48/19%", ["Ubeernoob"] = "CB:41/4%", ["Meaticanes"] = "ET:599/80%EB:618/80%EM:908/94%", ["Bowgün"] = "CB:132/16%EM:831/86%", ["Barumbado"] = "RB:261/58%RM:525/73%", ["Bowarf"] = "CB:32/2%UM:88/33%", ["Kinanti"] = "RT:384/50%RB:537/72%UM:173/48%", ["Xiuhpilli"] = "CB:29/3%", ["Piscera"] = "EB:487/80%EM:578/84%", ["Caffinez"] = "RB:451/60%RM:450/51%", ["Barpanzer"] = "EB:511/82%EM:765/89%", ["Bekalah"] = "RT:143/60%EB:676/91%EM:496/87%", ["Oricale"] = "EB:694/93%EM:807/90%", ["Idriselbank"] = "RM:506/58%", ["Komori"] = "CT:28/1%RB:431/63%UM:255/35%", ["Dadadarny"] = "RB:389/51%RM:598/66%", ["Hoppybear"] = "RM:460/74%", ["Mythhunter"] = "RM:187/52%", ["Noongg"] = "UB:92/25%RM:376/72%", ["Granso"] = "UB:286/37%RM:638/73%", ["Creepyhoe"] = "RB:486/70%UM:403/48%", ["Gahna"] = "RM:257/62%", ["Xint"] = "UT:260/34%RB:464/66%EM:761/85%", ["Dunsmash"] = "UT:317/44%EB:650/83%RM:531/60%", ["Mageblade"] = "RM:454/53%", ["Lineup"] = "RM:682/72%", ["Ecrae"] = "CB:43/9%RM:169/52%", ["Gotosleep"] = "UT:200/26%EB:574/77%RM:315/68%", ["Masvidal"] = "UM:116/34%", ["Mooky"] = "EM:764/86%", ["Kuru"] = "ET:284/82%EB:627/81%EM:802/84%", ["Manabearpig"] = "UM:406/48%", ["Velho"] = "CM:51/6%", ["Dalacere"] = "UB:246/33%UM:280/38%", ["Shortchamp"] = "CT:30/2%EB:596/83%EM:753/86%", ["Chamheals"] = "CB:77/17%UM:340/40%", ["Matsuri"] = "RM:532/62%", ["Bruceflee"] = "RB:281/56%EM:554/78%", ["Djonk"] = "UB:291/38%RM:224/52%", ["Buttaknife"] = "RM:554/61%", ["Zoggii"] = "EM:461/81%", ["Magnalis"] = "RB:538/71%RM:521/59%", ["Rubì"] = "RM:495/74%", ["Rajquiche"] = "ET:731/93%EB:709/90%LM:979/98%", ["Survival"] = "UB:286/38%EM:863/89%", ["Bullette"] = "CM:173/21%", ["Wujie"] = "CT:38/9%UB:227/25%CM:54/18%", ["Consumable"] = "UB:326/46%UM:172/48%", ["Hunterjim"] = "RT:475/64%EB:692/88%EM:902/92%", ["Frikii"] = "UB:234/30%RM:622/69%", ["Nostun"] = "UM:135/37%", ["Kitoria"] = "CT:42/3%RM:492/54%", ["Adoremetoo"] = "EM:488/75%", ["Destro"] = "CT:23/3%UB:270/35%RM:475/55%", ["Cataclysm"] = "EM:805/89%", ["Gwalchavad"] = "UM:107/34%", ["Abs"] = "RB:504/66%EM:807/86%", ["Onlywar"] = "UB:375/47%RM:332/68%", ["Kandy"] = "UM:72/41%", ["Dazed"] = "UM:88/33%", ["Orion"] = "CB:42/9%RM:536/57%", ["Khava"] = "CM:32/2%", ["Ffiadh"] = "UM:81/29%", ["Enera"] = "RM:528/62%", ["Noosê"] = "ET:415/91%RB:513/74%UM:145/39%", ["Rampagè"] = "UM:140/41%", ["Mavina"] = "RB:521/69%EM:774/82%", ["Azomie"] = "RM:529/56%", ["Nightvolf"] = "ET:511/85%EB:654/90%RM:481/65%", ["Lazykiller"] = "RB:449/59%RM:613/67%", ["Katzooka"] = "CB:88/10%RM:549/58%", ["Johnstipated"] = "UT:56/26%CM:32/2%", ["Daera"] = "CM:131/18%", ["Dontask"] = "RM:532/56%", ["Serindra"] = "CT:35/5%CM:181/21%", ["Ablaze"] = "UB:343/43%RM:629/68%", ["Soba"] = "EM:818/90%", ["Poumage"] = "EM:675/78%", ["Rylaì"] = "RT:535/71%RB:479/69%UM:358/47%", ["Pinadruid"] = "EM:872/94%", ["Hotguysixpac"] = "EM:819/86%", ["Narcoleptik"] = "RT:69/65%EM:837/93%", ["Gnomorals"] = "UB:358/48%EM:715/77%", ["Osquette"] = "UM:235/32%", ["Joker"] = "RM:557/62%", ["Melian"] = "UM:174/25%", ["Oscaa"] = "RM:461/50%", ["Tkxs"] = "CM:14/5%", ["Andom"] = "CB:26/1%CM:163/22%", ["Darkness"] = "CT:54/4%EB:595/83%RM:589/67%", ["Hollygirl"] = "RB:367/51%EM:653/76%", ["Waifu"] = "RB:446/64%EM:412/77%", ["Morygan"] = "RM:474/56%", ["Busdriver"] = "CB:51/12%RM:567/66%", ["Lolcat"] = "UB:236/29%UM:224/26%", ["Stannis"] = "RM:598/66%", ["Firestarta"] = "UB:200/26%UM:320/38%", ["Catsoup"] = "CT:2/3%CM:6/0%", ["Zzmage"] = "RM:424/50%", ["Bealtharzor"] = "CM:173/17%", ["Swolejin"] = "CB:44/11%UM:79/30%", ["Wuhanftw"] = "CM:185/17%", ["Junab"] = "CT:67/19%UB:203/25%EM:735/80%", ["Ermahgerdon"] = "UM:342/40%", ["Revcasts"] = "UM:276/37%", ["Deadstealth"] = "EM:852/87%", ["Carmine"] = "UM:371/48%", ["Rhomb"] = "UM:397/46%", ["Prichu"] = "RM:476/56%", ["Angelus"] = "UM:253/31%", ["Bethelle"] = "CT:80/24%UB:228/29%EM:758/86%", ["Calanthe"] = "EM:604/78%", ["Aquavendor"] = "RM:448/53%", ["Isolator"] = "CT:34/7%RM:593/69%", ["Payout"] = "UM:330/38%", ["Nomadss"] = "CB:167/18%EM:677/77%", ["Dèvîné"] = "RT:135/51%RM:572/65%", ["Ashenpal"] = "CT:98/9%RB:386/54%RM:592/68%", ["Pirko"] = "RB:372/51%RM:556/62%", ["Ahl"] = "EM:485/75%", ["Spindrift"] = "UM:72/27%", ["Cujimmy"] = "RM:587/65%", ["Magicmystery"] = "UB:229/30%RM:258/65%", ["Alyshia"] = "CM:56/6%", ["Desole"] = "RT:221/71%EB:690/88%RM:618/67%", ["Tronagnix"] = "CB:152/16%RM:563/65%", ["Timdoghunts"] = "CT:23/4%RB:511/69%RM:288/65%", ["Gígachad"] = "EB:627/81%EM:477/80%", ["Lorman"] = "UM:108/38%", ["Aditty"] = "RM:608/66%", ["Fartattach"] = "CM:77/24%", ["Daelyxa"] = "CB:18/1%UM:104/34%", ["Junako"] = "RB:263/64%RM:533/62%", ["Unclegumbo"] = "RT:512/68%EB:600/84%RM:271/63%", ["Unholymonk"] = "CT:72/21%CB:76/17%RM:575/67%", ["Treelover"] = "UM:392/46%", ["Tronn"] = "RB:221/52%RM:682/71%", ["Benezor"] = "RB:226/54%RM:620/72%", ["Jemster"] = "UM:148/47%", ["Omguronfire"] = "RM:180/54%", ["Meshkaga"] = "RM:267/59%", ["Gothika"] = "CM:25/10%", ["Grenemathoth"] = "UM:81/31%", ["Ghutghsegiu"] = "UM:97/37%", ["Icecoldbrew"] = "UB:157/43%RM:223/61%", ["Ramius"] = "CT:160/20%RB:495/67%RM:645/70%", ["Thune"] = "CM:44/18%", ["Tanksmun"] = "CT:27/5%EB:329/76%EM:747/87%", ["Firne"] = "UM:194/48%", ["Unholysaphfy"] = "CT:106/11%RB:315/70%EM:741/81%", ["Refrigerata"] = "UM:64/25%", ["Vindraa"] = "CB:18/19%RM:324/51%", ["Cheezburga"] = "UB:89/25%RM:584/62%", ["Fuic"] = "CB:27/3%UM:149/46%", ["Pumpy"] = "CB:203/22%EM:515/77%", ["Dionysùs"] = "RM:335/60%", ["Voron"] = "CB:49/8%UM:181/46%", ["Mori"] = "RT:119/52%RB:280/67%EM:411/82%", ["Darkvision"] = "UM:93/29%", ["Shameltotem"] = "RT:78/55%RB:265/56%RM:538/70%", ["Wînterborn"] = "CB:87/22%RM:557/65%", ["Suraya"] = "CB:141/17%EM:742/78%", ["Hotdogprince"] = "CB:28/1%CM:29/2%", ["Slaughterer"] = "UM:376/38%", ["Eg"] = "RB:514/72%EM:806/89%", ["Poisontipped"] = "UM:240/27%", ["Largore"] = "CB:13/1%RM:225/52%", ["Hakhakin"] = "EB:503/88%EM:761/81%", ["Furies"] = "RB:304/66%EM:831/88%", ["Murdoloch"] = "EB:381/75%RM:637/68%", ["Fuknugly"] = "UB:166/41%RM:215/51%", ["Zqp"] = "EB:548/94%EM:593/89%", ["Mustbreakyou"] = "CB:66/15%RM:318/62%", ["Maracil"] = "CB:46/7%RM:457/50%", ["Bigdaddyemps"] = "RT:294/53%UB:335/43%RM:439/72%", ["Doktorfrost"] = "UM:415/45%", ["Legiondairy"] = "CB:157/17%EM:709/81%", ["Mindarie"] = "CB:54/11%EM:863/85%", ["Tyrliard"] = "EM:656/93%", ["Protogenia"] = "RM:409/70%", ["Fionni"] = "CB:72/9%RM:446/52%", ["Homeros"] = "CM:32/2%", ["Kaeren"] = "RT:144/58%RB:434/73%UM:159/48%", ["Barrann"] = "CM:26/0%", ["Gustáv"] = "CT:6/7%UM:145/47%", ["Squadfam"] = "CM:208/24%", ["Razzuvious"] = "RB:542/72%EM:778/82%", ["Carbonflurry"] = "RM:184/55%", ["Arxiv"] = "UB:111/27%RM:459/50%", ["Shawback"] = "CM:64/7%", ["Karnek"] = "RM:565/67%", ["Rageterror"] = "RT:329/69%RB:214/63%RM:392/62%", ["Bangkayy"] = "CM:151/14%", ["Kaitalar"] = "EM:681/79%", ["Pactx"] = "RM:483/54%", ["Peekolo"] = "EM:861/90%", ["Macrosblack"] = "CB:105/12%UM:360/43%", ["Wezoost"] = "CM:31/10%", ["Feqq"] = "UM:138/38%", ["Vashunini"] = "RM:345/54%", ["Zarjda"] = "CT:40/8%UB:343/49%RM:577/68%", ["Nyssåelly"] = "RB:387/51%UM:306/36%", ["Ffrosty"] = "RM:558/66%", ["Mcknife"] = "RB:527/70%EM:724/76%", ["Jhinwock"] = "CM:49/20%", ["Zephaniah"] = "RT:550/73%EB:594/78%EM:763/81%", ["Caedan"] = "UM:131/45%", ["Loh"] = "CM:108/11%", ["Saggycrits"] = "UT:189/29%UB:229/30%RM:559/61%", ["Reistlïn"] = "CM:29/1%", ["Hornebeast"] = "RM:314/53%", ["Lolimomo"] = "CT:23/4%CB:36/2%UM:338/39%", ["Lolialuneth"] = "CM:20/5%", ["Astra"] = "CB:50/3%UM:371/41%", ["Triplicities"] = "UM:248/25%", ["Kekec"] = "UB:276/36%UM:85/30%", ["Tailburn"] = "CT:67/23%UM:75/27%", ["Sabrene"] = "CB:93/11%CM:175/22%", ["Friartuc"] = "CT:179/21%RB:492/71%EM:535/85%", ["Antipithica"] = "CB:57/6%UM:112/33%", ["Oppopo"] = "CM:133/20%", ["Longarm"] = "CB:44/4%UM:66/26%", ["Sierran"] = "CT:103/14%CB:69/18%RM:323/71%", ["Sibeiyandao"] = "CB:40/4%EM:855/89%", ["Nerdthree"] = "UM:139/47%", ["Clickme"] = "CB:110/14%CM:31/12%", ["Friky"] = "RB:523/73%RM:594/69%", ["Lakeesha"] = "CT:28/4%RM:201/53%", ["Mand"] = "UB:195/25%EM:394/75%", ["Robozha"] = "UM:119/40%", ["Thysakimbo"] = "CT:8/8%CB:112/14%RM:209/59%", ["Schlibs"] = "UM:163/45%", ["Altaboy"] = "UT:352/43%RB:490/70%RM:613/71%", ["Pascal"] = "UT:79/30%UB:217/27%UM:345/38%", ["Wildmage"] = "UM:230/28%", ["Mystiqué"] = "CM:183/21%", ["Yvaki"] = "RM:461/54%", ["Terdferguson"] = "RT:201/60%EB:473/88%EM:827/91%", ["Grimpy"] = "CM:190/18%", ["Ashenkrow"] = "UT:94/42%UB:148/48%RM:461/73%", ["Mymymycorona"] = "ET:312/87%RB:350/72%RM:660/73%", ["Nimlond"] = "CT:81/10%EB:630/82%EM:868/89%", ["Chamfer"] = "RT:500/74%EB:542/86%EM:716/90%", ["Kem"] = "CB:47/8%RM:487/58%", ["Bobdobalina"] = "UM:446/49%", ["Zilana"] = "CB:47/5%RM:299/71%", ["Enceladia"] = "CT:2/4%CM:106/15%", ["Bravehart"] = "UB:291/39%RM:625/71%", ["Skyewalker"] = "CM:89/9%", ["Captn"] = "RM:583/62%", ["Anddie"] = "CB:70/7%RM:557/63%", ["Mcflappay"] = "UM:410/49%", ["Lottahots"] = "RM:430/51%", ["Akhann"] = "CM:82/12%", ["Saradun"] = "UB:261/34%EM:765/81%", ["Kwikemart"] = "UM:214/27%", ["Wahahti"] = "RM:458/54%", ["Varjo"] = "UM:412/47%", ["Waja"] = "EB:493/87%EM:899/93%", ["Snêêk"] = "CB:57/6%UM:278/32%", ["Forvalour"] = "RB:261/62%RM:231/57%", ["Axle"] = "UB:181/43%RM:525/60%", ["Beastv"] = "RM:280/59%", ["Drokar"] = "UM:237/27%", ["Aarrowknee"] = "RM:532/59%", ["Thadril"] = "EM:364/78%", ["Verseiyaan"] = "UB:223/28%RM:615/72%", ["Mazia"] = "CB:59/7%UM:151/49%", ["Therealfreak"] = "UM:76/39%", ["Stiletta"] = "UM:132/36%", ["Alishya"] = "RM:459/51%", ["Oshie"] = "UM:172/45%", ["Jaggakor"] = "RM:583/67%", ["Tridiak"] = "CM:42/24%", ["Pryest"] = "RM:580/68%", ["Icygoddess"] = "RM:467/55%", ["Exitus"] = "UB:289/39%UM:252/31%", ["Spankmepls"] = "CM:59/7%", ["Kaimei"] = "RB:257/56%RM:308/71%", ["Rigatil"] = "CM:169/20%", ["Kenzie"] = "CB:124/15%RM:623/68%", ["Kcuc"] = "EM:713/76%", ["Gotama"] = "RM:308/50%", ["Kalamon"] = "RM:275/68%", ["Embola"] = "RM:638/74%", ["Keefy"] = "RT:432/57%UB:348/48%RM:551/68%", ["Whissaber"] = "UM:141/44%", ["Rapui"] = "CM:32/2%", ["Everdark"] = "RM:239/53%", ["Camacho"] = "RM:404/51%", ["Lolyna"] = "UB:144/33%UM:370/39%", ["Fellrule"] = "UT:244/29%RB:423/60%UM:400/47%", ["Playboí"] = "RM:643/72%", ["Ayelune"] = "RM:549/61%", ["Sinematic"] = "UM:85/46%", ["Ðeadpool"] = "RB:463/60%EM:819/85%", ["Carryme"] = "UM:113/32%", ["Nitefury"] = "RM:181/54%", ["Miera"] = "UM:455/46%", ["Freedum"] = "CB:69/7%UM:253/30%", ["Acyclovir"] = "UB:276/37%RM:277/61%", ["Belaide"] = "RM:593/61%", ["Miekka"] = "RM:285/50%", ["Wirulight"] = "RT:150/50%CB:93/8%CM:201/22%", ["Violete"] = "RM:461/69%", ["Tarius"] = "CT:23/3%RM:457/53%", ["Perily"] = "ET:575/75%EB:737/93%EM:713/76%", ["Cabbagehead"] = "CT:61/11%UM:362/38%", ["Footoomsch"] = "UM:366/43%", ["Tente"] = "CM:74/10%", ["Sillybilly"] = "CB:40/4%CM:62/7%", ["Valbank"] = "UB:287/38%UM:126/39%", ["Nerdfour"] = "CM:35/3%", ["Maxtaur"] = "UM:333/37%", ["Amageballs"] = "CB:58/6%RM:460/54%", ["Stabbenj"] = "RM:678/73%", ["Review"] = "EM:888/92%", ["Kneebernicus"] = "EM:790/84%", ["Achillesheal"] = "CT:27/0%EB:611/84%EM:851/91%", ["Pokendstab"] = "RM:460/52%", ["Gnomedguerre"] = "CB:102/24%RM:420/64%", ["Leakydiaper"] = "CM:26/0%", ["Nomadzke"] = "UB:249/32%UM:367/43%", ["Dayone"] = "UM:310/36%", ["Fincannan"] = "CM:194/23%", ["Grumpimage"] = "UM:402/43%", ["Jumble"] = "RB:238/58%RM:462/73%", ["Tyth"] = "CB:35/3%UM:277/33%", ["Epone"] = "CM:140/19%", ["Athyn"] = "CB:77/21%UM:428/47%", ["Unethical"] = "CB:101/12%UM:277/32%", ["Rectify"] = "UM:133/35%", ["Elivatha"] = "UM:108/42%", ["Waerloga"] = "UM:109/36%", ["Luthras"] = "UB:389/47%EM:751/79%", ["Leann"] = "CM:42/15%", ["Kallista"] = "UT:80/29%EB:621/86%EM:835/91%", ["Barbarosa"] = "UM:235/28%", ["Fem"] = "CM:117/12%", ["Alitis"] = "UM:417/46%", ["Finnia"] = "RM:682/74%", ["Arisada"] = "RM:574/66%", ["Mythcure"] = "CB:32/4%CM:161/22%", ["Dl"] = "UB:352/47%EM:822/87%", ["Dartagnan"] = "CM:60/20%", ["Khemjunior"] = "RB:406/57%EM:769/86%", ["Affection"] = "RB:521/70%RM:508/55%", ["Jorunnah"] = "CM:50/18%", ["Tiberculosis"] = "UB:38/33%RM:335/60%", ["Croatian"] = "CM:106/13%", ["Draph"] = "UM:351/40%", ["Qality"] = "UB:125/30%CM:126/15%", ["Blinknumisme"] = "CM:22/1%", ["Kyzaghan"] = "CB:36/3%CM:160/20%", ["Kamekaze"] = "ET:276/80%EB:668/86%EM:807/84%", ["Amava"] = "CT:27/1%RB:400/53%UM:317/37%", ["Lorbag"] = "RT:100/58%UB:165/43%", ["Jimmyisaknob"] = "UT:180/28%UB:151/36%RM:256/59%", ["Nochill"] = "UB:138/38%RM:439/52%", ["Renwick"] = "EM:661/78%", ["Midazölam"] = "CT:27/1%", ["Lockrobster"] = "CT:33/3%UM:283/29%", ["Flutterbye"] = "RT:63/53%EM:589/81%", ["Enter"] = "CT:141/18%EB:706/89%EM:912/93%", ["Psyphonne"] = "UT:289/38%UB:169/42%UM:433/48%", ["Imarcane"] = "RM:209/59%", ["Nidafjol"] = "CB:108/12%EM:852/83%", ["Healinghoofs"] = "CT:32/3%EB:569/81%LM:921/95%", ["Fingers"] = "CT:46/5%CB:28/1%UM:494/48%", ["Ronnie"] = "CT:45/15%CB:55/13%", ["Spiritfinger"] = "RT:85/61%UM:147/45%", ["Faldur"] = "CB:103/9%UM:425/48%", ["Sknum"] = "CT:46/10%UM:365/42%", ["Leftybadeye"] = "CT:62/9%EB:670/90%EM:762/83%", ["Fallenhope"] = "UT:110/38%UB:113/25%UM:114/36%", ["Tari"] = "RT:222/68%EB:663/90%EM:820/88%", ["Smolchad"] = "CT:32/13%RM:440/50%", ["Reptizzle"] = "CT:177/23%EB:569/76%EM:830/87%", ["Shokken"] = "CM:92/9%", ["Xevrovris"] = "LB:747/95%LM:950/97%", ["Muffdìver"] = "UB:115/32%RM:643/70%", ["Oppie"] = "CT:0/5%RM:304/60%", ["Kaeldia"] = "UT:233/33%UB:372/47%", ["Euphale"] = "CB:2/0%", ["Meshiptwo"] = "RM:208/59%", ["Ieatgnomez"] = "CB:159/20%RM:611/65%", ["Bearhunta"] = "CB:14/0%", ["Jcwc"] = "UB:115/30%EM:721/79%", ["Syntaxx"] = "CB:26/1%UM:154/49%", ["Theconan"] = "CB:28/21%", ["Menchkalt"] = "UB:138/38%CM:212/21%", ["Ripkuna"] = "CB:163/19%UM:448/47%", ["Myrtille"] = "CB:41/4%CM:26/0%", ["Churritos"] = "CB:14/1%UM:183/49%", ["Popsmoke"] = "CT:18/9%", ["Maedros"] = "CB:76/15%", ["Bilgamesh"] = "UT:156/25%RB:246/61%UM:68/26%", ["Hathorr"] = "UB:235/30%UM:262/30%", ["Raah"] = "CB:76/8%UM:441/49%", ["Baall"] = "RB:497/68%UM:412/46%", ["Apophiss"] = "CT:75/9%UB:329/44%RM:628/69%", ["Cyberlight"] = "CB:111/10%RM:270/62%", ["Zappaa"] = "RM:449/57%", ["Kult"] = "RM:598/70%", ["Darity"] = "CM:26/0%", ["Alfourdran"] = "RB:551/72%EM:676/92%", ["Eldwineld"] = "CM:153/14%", ["Deacons"] = "UB:215/39%RM:469/68%", ["Markii"] = "UM:167/43%", ["Deuswrath"] = "CT:31/7%EM:581/81%", ["Erynys"] = "UM:320/33%", ["Magestica"] = "RM:525/61%", ["Walticus"] = "UM:105/35%", ["Addabey"] = "CT:34/9%CB:58/20%RM:312/61%", ["Korelai"] = "RM:191/56%", ["Needapriest"] = "CB:42/6%UM:378/45%", ["Bashere"] = "RM:437/64%", ["Ryllia"] = "UB:75/27%RM:183/67%", ["Torim"] = "CM:60/8%", ["Wingingit"] = "UM:77/40%", ["Maniacal"] = "UM:45/25%", ["Jariuss"] = "CT:118/12%RB:455/64%EM:736/82%", ["Tenebrys"] = "CM:20/8%", ["Tris"] = "UM:153/49%", ["Ilych"] = "RB:342/70%RM:411/73%", ["Tinpot"] = "RM:274/63%", ["Dayn"] = "EB:601/85%EM:290/78%", ["Rs"] = "UM:73/25%", ["Allaidlock"] = "UM:122/38%", ["Vailen"] = "UM:145/43%", ["Caliara"] = "RB:233/59%EM:697/80%", ["Estwell"] = "RB:441/58%RM:658/70%", ["Moiraine"] = "RM:329/74%", ["Nohomegnome"] = "CM:17/6%", ["Stabyahfk"] = "CM:38/4%", ["Dayku"] = "RM:264/57%", ["Zestel"] = "RM:295/68%", ["Sandhurst"] = "CT:36/11%CM:44/16%", ["Kohanim"] = "LB:729/96%EM:762/85%", ["Billjonr"] = "CT:30/2%", ["Arctodus"] = "UM:414/45%", ["Pril"] = "RB:418/51%RM:211/53%", ["Swarovski"] = "CM:61/23%", ["Inamori"] = "CM:91/8%", ["Moloran"] = "CM:54/21%", ["Monsterpizza"] = "EB:573/76%EM:742/79%", ["Lethargica"] = "UB:241/26%", ["Chochocan"] = "RM:511/60%", ["Chikunchompa"] = "UM:108/31%", ["Elastic"] = "UM:242/29%", ["Overture"] = "UM:126/43%", ["Onehunter"] = "UM:167/48%", ["Xenosis"] = "CT:53/10%RB:469/62%RM:104/51%", ["Lostmykeys"] = "CM:2/1%", ["Pocoloco"] = "UM:121/34%", ["Udderlytanky"] = "CM:210/21%", ["Uddered"] = "CM:32/9%", ["Cogen"] = "UM:31/29%", ["Karraket"] = "ET:653/86%EB:743/94%EM:856/89%", ["Titustroll"] = "CM:26/0%", ["Jondala"] = "CM:28/1%", ["Ticklemaster"] = "CB:178/23%RM:451/53%", ["Dernwold"] = "RM:613/70%", ["Zye"] = "RB:188/62%RM:235/55%", ["Ayenshield"] = "UM:156/42%", ["Lian"] = "UM:377/43%", ["Bsdisc"] = "RM:321/59%", ["Oneton"] = "UM:172/48%", ["Horypooter"] = "CM:79/6%", ["Cellaurind"] = "UM:128/40%", ["Ricebucket"] = "CM:30/8%", ["Zieria"] = "CB:46/3%UM:147/47%", ["Kagarun"] = "RM:378/61%", ["Navah"] = "CM:16/7%", ["Heretic"] = "CM:69/6%", ["Kaygen"] = "CB:53/18%UM:223/26%", ["Ripzuz"] = "RM:498/67%", ["Bloodrend"] = "CB:52/4%RM:138/59%", ["Tommywiseau"] = "CB:164/20%UM:423/46%", ["Nimmue"] = "RM:542/64%", ["Dekx"] = "RM:443/51%", ["Hantujanda"] = "UM:363/43%", ["Mujas"] = "UM:423/47%", ["Snickerdoodl"] = "RM:519/59%", ["Grousmouse"] = "CM:220/22%", ["Mclocko"] = "UB:249/33%RM:449/50%", ["Xanders"] = "CB:58/11%RM:484/53%", ["Ayokanako"] = "RM:480/70%", ["Altert"] = "UB:312/42%UM:344/41%", ["Gruumsha"] = "CM:161/19%", ["Junx"] = "RM:363/66%", ["Skeetz"] = "RM:518/58%", ["Berla"] = "UM:138/45%", ["Meretta"] = "CM:123/14%", ["Praecox"] = "CT:67/6%RM:528/62%", ["Tibboh"] = "CB:78/21%UM:94/35%", ["Sneakyblade"] = "RM:230/53%", ["Ait"] = "CB:30/4%UM:120/38%", ["Pynty"] = "RM:472/74%", ["Catmann"] = "RB:185/68%RM:191/66%", ["Kelti"] = "RM:225/57%", ["Berwind"] = "CB:122/15%UM:171/48%", ["Tehsiping"] = "UM:261/26%", ["Woomera"] = "UM:84/30%", ["Frappé"] = "UM:143/47%", ["Baggies"] = "UM:299/35%", ["Xunai"] = "CB:4/0%UM:79/28%", ["Rheavin"] = "RM:556/61%", ["Allessandra"] = "CB:94/22%CM:60/17%", ["Veleni"] = "RM:223/61%", ["Sampenarawn"] = "RM:269/51%", ["Missalot"] = "UM:164/45%", ["Bobski"] = "UM:113/37%", ["Angkor"] = "RM:529/62%", ["Fellrain"] = "UM:421/45%", ["Baconbrains"] = "UM:49/27%", ["Kosui"] = "RM:475/70%", ["Nightmann"] = "CB:107/14%UM:120/42%", ["Eboricus"] = "CM:114/16%", ["Sahiluxcross"] = "CT:0/0%RB:476/63%RM:616/66%", ["Lillían"] = "RM:500/55%", ["Tdpete"] = "UT:28/31%RB:105/53%UM:105/38%", ["Oragil"] = "RM:314/53%", ["Mikelowrey"] = "UM:352/39%", ["Ahsoká"] = "CB:15/0%CM:19/2%", ["Catinhat"] = "EB:570/88%EM:818/92%", ["Lightbring"] = "CT:70/6%CB:29/3%EM:686/78%", ["Nastro"] = "RM:493/55%", ["Drsmall"] = "CM:62/8%", ["Yormajesty"] = "CT:68/6%CB:184/21%EM:474/82%", ["Vegemitee"] = "RM:212/55%", ["Demonightii"] = "CM:47/5%", ["Radsounds"] = "UM:132/40%", ["Onybuff"] = "CB:68/7%CM:159/20%", ["Timewalk"] = "CT:126/16%UB:247/33%RM:186/55%", ["Aphordite"] = "UM:266/31%", ["Plzhealme"] = "UB:122/42%EM:668/85%", ["Inkoa"] = "RB:454/62%RM:592/65%", ["Ragegauge"] = "RM:123/56%", ["Nordreeve"] = "UM:346/40%", ["Wafflelog"] = "UM:74/26%", ["Tassarion"] = "EB:439/78%EM:786/93%", ["Dezzalicious"] = "EM:676/78%", ["Sneekers"] = "CM:90/11%", ["Lunarbear"] = "RM:443/72%", ["Volcaris"] = "CM:42/17%", ["Elbakazam"] = "RM:174/53%", ["Salvinia"] = "UB:105/44%RM:433/70%", ["Stanmarshh"] = "UT:203/30%CB:191/20%UM:227/27%", ["Dixieiamdead"] = "CM:172/21%", ["Conversion"] = "UM:174/45%", ["Mcnabb"] = "UM:291/30%", ["Chunkylucife"] = "RM:456/52%", ["Lidura"] = "CM:32/3%", ["Sleaze"] = "EM:806/89%", ["Shaedeboi"] = "RM:325/59%", ["Edenbeast"] = "RM:476/56%", ["Fightinguy"] = "RM:348/57%", ["Mysterjay"] = "RM:475/74%", ["Kadina"] = "CB:1/0%CM:144/13%", ["Duria"] = "RM:224/56%", ["Sanagdala"] = "CB:95/11%UM:152/45%", ["Iceyfire"] = "CM:216/21%", ["Roran"] = "RM:547/74%", ["Tiedemann"] = "LB:730/96%EM:900/94%", ["Smallproblem"] = "EB:675/86%LM:944/96%", ["Cilk"] = "UB:250/32%RM:593/65%", ["Richan"] = "EB:656/85%EM:820/87%", ["Darktalon"] = "RM:668/71%", ["Iceburn"] = "UM:204/26%", ["Meliyah"] = "UB:301/39%RM:509/56%", ["Chancey"] = "EB:726/92%EM:929/94%", ["Chichan"] = "CM:244/24%", ["Divice"] = "RM:213/59%", ["Painrelief"] = "EM:688/76%", ["Zanas"] = "CM:33/9%", ["Desath"] = "CM:17/2%", ["Morgase"] = "UB:120/42%UM:47/26%", ["Feralblood"] = "CB:12/12%", ["Isotopes"] = "CB:36/3%CM:76/7%", ["Pamelorilia"] = "CB:4/0%CM:5/2%", ["Syngularity"] = "RB:477/63%RM:645/71%", ["Krustophenia"] = "CB:61/4%UM:114/41%", ["Sagah"] = "UB:99/27%UM:401/45%", ["Elocura"] = "LB:723/96%SM:990/99%", ["Aedelas"] = "UM:272/27%", ["Ninjabubble"] = "UM:262/26%", ["Mendicus"] = "EM:788/89%", ["Caveat"] = "UM:98/33%", ["Stevas"] = "UB:103/45%RM:318/58%", ["Seth"] = "RM:264/60%", ["Amel"] = "UB:155/38%RM:273/61%", ["Yourpall"] = "EM:713/81%", ["Bindleton"] = "UT:262/35%UB:294/36%RM:520/55%", ["Dwarfmeat"] = "CM:193/18%", ["Nekobusu"] = "RM:396/63%", ["Kagell"] = "CB:29/0%UM:138/38%", ["Tagaran"] = "UB:133/34%RM:503/58%", ["Draxxe"] = "CB:24/2%UM:142/42%", ["Nutty"] = "EB:733/93%LM:989/98%", ["Meepok"] = "EB:597/87%EM:862/94%", ["Robert"] = "LB:790/98%SM:1013/99%", ["Droody"] = "UT:189/25%EB:396/81%EM:823/90%", ["Bundyblack"] = "UM:68/26%", ["Mcchop"] = "CB:17/10%EM:638/79%", ["Whisperdeath"] = "CB:5/0%CM:24/7%", ["Cornhollio"] = "ET:359/78%RB:311/73%EM:831/93%", ["Birdhouse"] = "CB:33/1%CM:21/1%", ["Stytch"] = "UM:332/38%", ["Morticetwo"] = "CT:73/22%EB:707/93%EM:892/93%", ["Seranai"] = "UM:87/32%", ["Rustychains"] = "CB:195/24%RM:477/52%", ["Aramoo"] = "RM:256/59%", ["Backtrack"] = "CM:150/14%", ["Chivas"] = "UB:320/39%EM:822/85%", ["Druidize"] = "UB:179/47%RM:673/74%", ["Bm"] = "EM:712/75%", ["Taintedflame"] = "CB:62/16%RM:183/55%", ["Gobinz"] = "LB:772/97%LM:970/98%", ["Kyriako"] = "UM:131/39%", ["Licoricetea"] = "RB:336/73%EM:524/85%", ["Evilelf"] = "RM:270/68%", ["Heliotrope"] = "RM:205/52%", ["Whatthefark"] = "UM:84/33%", ["Blakbutt"] = "RM:305/57%", ["Epichealtime"] = "RM:495/51%", ["Glorify"] = "EM:846/87%", ["Whimpy"] = "RM:300/65%", ["Naughtypapa"] = "UM:82/32%", ["Hokanu"] = "EB:605/84%RM:669/73%", ["Divitiacus"] = "UM:91/34%", ["Bodycount"] = "CT:21/3%CB:6/0%CM:31/2%", ["Dreambound"] = "EM:668/77%", ["Tehhealerer"] = "CB:148/17%RM:484/53%", ["Ravendark"] = "CM:47/5%", ["Iroam"] = "CM:105/15%", ["Manslock"] = "UB:277/35%EM:873/90%", ["Pinaporter"] = "EM:657/76%", ["Greyparse"] = "UM:265/31%", ["Aniya"] = "EM:855/90%", ["Snowbunnyy"] = "UM:407/47%", ["Kinetixs"] = "CB:30/1%RM:498/55%", ["Ihavesmolpp"] = "RM:614/63%", ["Laopowansui"] = "CB:112/12%UM:358/42%", ["Embulan"] = "UM:129/42%", ["Tranquirrino"] = "RM:192/52%", ["Darkspells"] = "RM:213/53%", ["Bishibosh"] = "UB:329/43%RM:676/74%", ["Crittykat"] = "EB:500/81%EM:693/86%", ["Riya"] = "UM:328/38%", ["Oska"] = "ET:669/93%LM:949/98%", ["Frostytoppin"] = "CT:122/20%CB:185/23%RM:232/62%", ["Zacflemo"] = "RT:317/73%RB:338/65%RM:375/62%", ["Turrell"] = "CT:43/3%EB:549/76%LM:941/97%", ["Magelings"] = "CT:0/0%", ["Magelingss"] = "CT:0/1%", ["Coconutmilk"] = "CT:131/14%CB:98/10%RM:526/58%", ["Kriegals"] = "CT:51/18%CB:34/3%UM:356/37%", ["Kookadurra"] = "UT:328/47%RB:193/51%UM:446/48%", ["Nocked"] = "UB:284/35%CM:61/24%", ["Crackalackin"] = "CT:98/10%EB:631/89%RM:502/59%", ["Opt"] = "CT:16/2%RM:654/69%", ["Reyg"] = "RB:388/50%RM:564/58%", ["Braeby"] = "LB:770/96%SM:1010/99%", ["Tigorrasil"] = "RT:47/62%RB:300/62%RM:378/63%", ["Imoteph"] = "CB:83/19%RM:490/58%", ["Ancalador"] = "CT:52/9%SB:827/99%SM:1021/99%", ["Tarko"] = "CT:108/13%RB:457/61%EM:799/84%", ["Trollby"] = "CB:63/7%UM:440/45%", ["Gfhk"] = "UB:308/40%RM:472/52%", ["Needahunter"] = "CT:64/23%CM:42/16%", ["Andyjr"] = "RT:157/57%EB:636/82%EM:850/88%", ["Cuhh"] = "UB:200/41%EM:870/90%", ["Lostsoul"] = "CB:32/1%CM:125/10%", ["Nedigal"] = "EB:649/87%EM:852/89%", ["Bindingz"] = "UB:210/26%RM:633/67%", ["Susanxpress"] = "RB:380/53%RM:641/70%", ["Disenchant"] = "CB:50/10%UM:399/43%", ["Belthazar"] = "RB:281/54%RM:526/69%", ["Söül"] = "RT:182/70%RB:442/74%EM:586/79%", ["Magess"] = "CB:42/9%UM:263/32%", ["Aamaging"] = "RM:167/52%", ["Churrochu"] = "CB:121/16%CM:214/21%", ["Nechtan"] = "RM:170/52%", ["Roth"] = "CB:34/5%UM:355/37%", ["Pyatprëë"] = "CB:9/0%UM:92/32%", ["Caiylein"] = "UT:69/26%UB:194/48%RM:560/62%", ["Keyva"] = "CT:50/22%CB:41/8%RM:549/64%", ["Flintlock"] = "UM:76/29%", ["Poitar"] = "CM:67/23%", ["Fartalota"] = "UB:89/39%RM:434/67%", ["Avatank"] = "UB:112/27%RM:639/68%", ["Danyen"] = "UT:275/35%EB:383/80%EM:740/81%", ["Youngwuhan"] = "CM:36/14%", ["Frandelch"] = "UM:107/35%", ["Mykanae"] = "CB:66/12%RM:419/64%", ["Fatstacks"] = "CT:143/16%RB:521/72%RM:565/63%", ["Rummy"] = "RT:438/60%EB:404/84%EM:760/88%", ["Munchy"] = "UT:223/29%RB:403/54%RM:325/67%", ["Hèrmes"] = "CB:60/13%UM:420/44%", ["Jazzytotes"] = "UB:161/47%RM:335/62%", ["Swiftbeam"] = "UM:125/41%", ["Meijin"] = "CB:22/1%RM:526/62%", ["Phoenixia"] = "CB:180/21%CM:197/18%", ["Nyctera"] = "UT:140/49%RB:418/57%CM:57/6%", ["Puckshot"] = "RB:231/54%RM:468/52%", ["Firewall"] = "UM:410/48%", ["Elaenor"] = "CM:173/21%", ["Mekalekahai"] = "CB:64/7%CM:131/12%", ["Dakkaman"] = "UB:129/29%RM:197/69%", ["Meowkitty"] = "CM:25/20%", ["Kasynnar"] = "RM:476/53%", ["Agedone"] = "RB:83/50%RM:488/70%", ["Vivipally"] = "UB:325/44%UM:327/38%", ["Mymagegnome"] = "CB:4/0%CM:35/2%", ["Rangi"] = "CT:41/2%RB:429/58%UM:403/43%", ["Bumpkin"] = "RM:189/56%", ["Occam"] = "UM:389/44%", ["Unknowns"] = "RB:489/67%RM:523/58%", ["Dagônet"] = "CB:46/4%CM:61/8%", ["Jheral"] = "UM:282/32%", ["Lliira"] = "RM:547/74%", ["Tekcor"] = "RM:666/72%", ["Deleyi"] = "UM:299/38%", ["Merrypoppin"] = "RM:666/73%", ["Chonkette"] = "RB:375/69%EM:608/79%", ["Shadowsil"] = "EB:706/94%EM:720/85%", ["Postcode"] = "CB:27/0%RM:489/53%", ["Enishiyon"] = "RM:501/71%", ["Rhew"] = "CM:31/1%", ["Lovefisted"] = "EM:809/90%", ["Philswar"] = "UM:226/28%", ["Randin"] = "UM:141/44%", ["Dån"] = "CB:131/17%RM:510/55%", ["Asmonbaldiin"] = "CB:149/16%RM:448/53%", ["Bonniepark"] = "CM:75/7%", ["Jaxson"] = "CT:103/11%UB:226/28%RM:475/56%", ["Arthurol"] = "CM:202/24%", ["Frostimochi"] = "RM:271/67%", ["Razy"] = "UM:358/41%", ["Swiperight"] = "EB:493/82%RM:461/73%", ["Unnadawg"] = "CM:63/8%", ["Pìnchy"] = "RB:557/73%RM:672/74%", ["Lidrysong"] = "EB:699/93%EM:826/93%", ["Halfmoonsage"] = "EM:677/83%", ["Kashinboner"] = "RB:365/69%EM:579/76%", ["Xil"] = "CM:178/17%", ["Azalie"] = "RM:521/62%", ["Raikó"] = "RB:477/63%EM:768/83%", ["Demellza"] = "UM:408/45%", ["Fluzie"] = "CM:85/10%", ["Tyoong"] = "RB:434/59%EM:772/83%", ["Iceage"] = "RM:211/59%", ["Khaar"] = "CB:134/16%RM:445/50%", ["Balathar"] = "UM:442/49%", ["Jieweitan"] = "EM:563/75%", ["Annebee"] = "EB:465/77%EM:774/89%", ["Holymagik"] = "UM:390/43%", ["Deländra"] = "CM:189/18%", ["Pienthera"] = "UM:378/45%", ["Magiczha"] = "UM:271/33%", ["Tariq"] = "RM:354/61%", ["Urrgg"] = "EB:664/90%EM:651/80%", ["Malinois"] = "UM:409/46%", ["Palygon"] = "RM:636/73%", ["Feralfawcett"] = "RM:220/53%", ["Zippypip"] = "CM:58/22%", ["Losh"] = "CM:46/5%", ["Adelong"] = "CM:24/9%", ["Barasuishou"] = "RT:115/68%RB:244/61%RM:296/60%", ["Jinke"] = "UM:231/27%", ["Madkinx"] = "RT:399/53%CB:181/24%EM:743/77%", ["Obviouslee"] = "CT:25/0%UM:107/32%", ["ßitchfåce"] = "RM:271/55%", ["Hogeylicious"] = "RM:521/72%", ["Velinhide"] = "CB:167/21%RM:568/63%", ["Shotgunz"] = "CM:57/20%", ["Fandyy"] = "CM:75/23%", ["Tinycuts"] = "RM:473/53%", ["Bowhard"] = "UM:85/32%", ["Bowshamy"] = "UM:355/39%", ["Orschatsoul"] = "UM:366/43%", ["Hydra"] = "RM:479/52%", ["Tinkaburr"] = "UB:100/28%RM:157/50%", ["Lanadelrey"] = "UM:85/26%", ["Hatchetman"] = "UM:350/41%", ["Warbow"] = "RM:460/51%", ["Mortiss"] = "UM:339/36%", ["Shadowmist"] = "CT:26/0%EB:614/80%RM:642/68%", ["Bopit"] = "CB:160/17%RM:215/50%", ["Tanea"] = "CB:10/1%CM:56/21%", ["Dubbs"] = "UM:393/40%", ["Slackattack"] = "UM:317/32%", ["Novenstrike"] = "RB:429/53%EM:858/89%", ["Bek"] = "CT:74/7%RB:409/56%UM:447/48%", ["Zombl"] = "RM:226/56%", ["Priestlol"] = "UM:334/39%", ["Rreptar"] = "CM:104/15%", ["Peacemaker"] = "RM:497/70%", ["Rularadin"] = "UM:348/37%", ["Fela"] = "CB:81/10%RM:452/53%", ["Levî"] = "UT:209/32%EM:733/77%", ["Frostivus"] = "LB:779/97%LM:986/98%", ["Lìllý"] = "UM:84/33%", ["Kokos"] = "CT:4/8%UM:72/28%", ["Dubin"] = "UM:199/27%", ["Ruul"] = "RM:610/68%", ["Warriorc"] = "UM:411/42%", ["Jacknife"] = "RM:546/61%", ["Withoutaq"] = "RM:598/66%", ["Fightclub"] = "UM:356/35%", ["Retztank"] = "UB:136/30%RM:338/63%", ["Corvisa"] = "UM:86/31%", ["Frostdeath"] = "CM:41/14%", ["Henroid"] = "UM:255/31%", ["Tubbington"] = "UM:248/28%", ["Sheprotec"] = "RM:379/67%", ["Drchocolate"] = "CM:164/21%", ["Sarlune"] = "CM:44/16%", ["Rosethorna"] = "UM:110/35%", ["Lightswrath"] = "CB:7/4%RM:226/74%", ["Swobble"] = "RB:372/50%EM:700/75%", ["Anniewilks"] = "CM:149/14%", ["Wumpie"] = "UM:364/43%", ["Jeger"] = "UM:165/49%", ["Pandia"] = "UB:315/43%EM:828/89%", ["Quaari"] = "RB:160/59%RM:256/59%", ["Adalia"] = "CM:47/6%", ["Ariellá"] = "UB:161/33%EM:661/85%", ["Noctowl"] = "RM:241/56%", ["Augathella"] = "CM:112/12%", ["Norpo"] = "EB:618/80%EM:752/79%", ["Exon"] = "UB:113/32%RM:420/50%", ["Kolaiidz"] = "UB:41/33%EM:576/76%", ["Sati"] = "UM:55/28%", ["Shadrina"] = "CM:62/14%", ["Landwalker"] = "CM:32/4%", ["Lemans"] = "RM:555/61%", ["Schtauffen"] = "RM:514/54%", ["Shiftytank"] = "RB:140/58%RM:100/59%", ["Bubblèwrap"] = "UM:219/25%", ["Saintfire"] = "EB:623/81%EM:713/75%", ["Morvarnia"] = "RB:394/57%RM:594/65%", ["Nadosemor"] = "CT:34/15%UB:299/38%RM:510/60%", ["Stabitystab"] = "CB:45/5%CM:67/6%", ["Oe"] = "CT:26/5%EB:409/75%EM:660/84%", ["Embushift"] = "UM:58/32%", ["Skyleaf"] = "RT:496/68%LB:751/97%LM:930/96%", ["Amorup"] = "CT:88/16%RB:504/67%RM:439/51%", ["Mindfire"] = "EB:573/79%EM:810/87%", ["Zoggiie"] = "UM:331/39%", ["Rallyz"] = "UM:291/29%", ["Jug"] = "CB:126/13%UM:425/44%", ["Arminthegrey"] = "CM:10/2%", ["Chancelot"] = "EB:701/88%EM:895/91%", ["Maurd"] = "CB:27/3%CM:211/21%", ["Yerena"] = "CT:19/1%CB:69/17%UM:61/26%", ["Doogle"] = "UB:89/26%RM:219/61%", ["Areora"] = "EM:387/75%", ["Acca"] = "UM:20/25%", ["Peggysue"] = "CT:40/4%CB:42/4%UM:128/39%", ["Spudzee"] = "UB:31/27%RM:304/62%", ["Orse"] = "CB:39/3%", ["Muffette"] = "UB:180/44%RM:439/62%", ["Uglyshaman"] = "CM:26/10%", ["Strayarrow"] = "RM:283/65%", ["Whiro"] = "CB:70/7%", ["Blairski"] = "CB:34/2%CM:182/19%", ["Jeba"] = "CB:33/2%UM:131/45%", ["Bridgeport"] = "RM:196/54%", ["Mystee"] = "UM:201/26%", ["Careles"] = "RM:484/53%", ["Shifted"] = "EB:494/83%EM:681/87%", ["Friartuck"] = "CM:3/3%", ["Needapali"] = "RM:266/62%", ["Pickleriick"] = "CM:186/17%", ["Dreamfight"] = "UB:268/31%RM:329/63%", ["Ebowwla"] = "CM:95/14%", ["Wincie"] = "RM:192/51%", ["Articas"] = "UM:143/47%", ["Amillia"] = "LB:788/98%SM:1005/99%", ["Clarakess"] = "CM:72/10%", ["Suzzie"] = "RM:692/71%", ["Mikana"] = "CT:73/7%CM:45/12%", ["Kharvi"] = "UM:358/42%", ["Cindee"] = "UM:256/26%", ["Swisstime"] = "CB:34/5%CM:7/1%", ["Hairysneeks"] = "UM:367/38%", ["Owlo"] = "UM:122/41%", ["Knelly"] = "UT:293/38%CB:134/16%UM:170/48%", ["Illuvia"] = "RM:635/68%", ["Boganbob"] = "UB:215/27%RM:647/67%", ["Kneerdeath"] = "CM:188/17%", ["Sketie"] = "UM:354/37%", ["Arryia"] = "CM:49/18%", ["Endone"] = "UM:43/39%", ["Oomature"] = "UM:40/25%", ["Lastairbendr"] = "RM:120/51%", ["Saurfang"] = "CM:42/23%", ["Drakthos"] = "CM:40/11%", ["Zurek"] = "CB:194/21%RM:645/72%", ["Heafty"] = "RM:494/50%", ["Tinsey"] = "UM:415/49%", ["Rilli"] = "CB:66/17%CM:24/5%", ["Perilous"] = "CB:150/16%RM:568/61%", ["Manix"] = "UM:86/31%", ["Ártëmís"] = "UB:361/49%CM:138/12%", ["Terrybollea"] = "CM:203/20%", ["Zhammoo"] = "UM:156/46%", ["Animasmage"] = "EB:518/92%EM:781/84%", ["Midnightrain"] = "CM:192/23%", ["Locknloud"] = "UM:374/38%", ["Eykan"] = "RM:305/57%", ["Javezim"] = "UM:289/35%", ["Iaso"] = "CT:37/6%CB:112/12%RM:527/58%", ["Mutthound"] = "CM:137/17%", ["Rottinghoes"] = "CM:43/13%", ["Icehole"] = "CM:115/10%", ["Nivunter"] = "RM:515/57%", ["Koutu"] = "EM:714/78%", ["Sandyv"] = "UM:410/44%", ["Ezu"] = "EM:693/80%", ["Slinkymlinki"] = "UM:196/48%", ["Varìx"] = "RM:639/68%", ["Dalamar"] = "UM:259/26%", ["Tyranna"] = "CM:117/13%", ["Sunie"] = "RM:609/67%", ["Ventres"] = "UM:296/35%", ["Adabesi"] = "CB:133/14%RM:442/51%", ["Knix"] = "EM:709/76%", ["Quantix"] = "CM:73/10%", ["Wokstar"] = "UM:124/38%", ["Telstra"] = "CB:175/23%RM:434/51%", ["Dahlinas"] = "UB:267/33%EM:904/92%", ["Frozendead"] = "RM:603/66%", ["Satanikka"] = "CM:112/12%", ["Protspec"] = "UM:149/29%", ["Aoelus"] = "UM:348/41%", ["Sonae"] = "CB:27/1%CM:167/22%", ["Solinvictus"] = "CM:145/17%", ["Valrock"] = "UT:256/31%EB:669/91%EM:861/92%", ["Frezier"] = "CB:33/2%UM:94/36%", ["Truckkun"] = "UM:334/39%", ["Elvendar"] = "RT:268/74%EB:636/88%EM:885/94%", ["Voxett"] = "CM:99/10%", ["Darkcrescent"] = "UM:119/39%", ["Procris"] = "CM:226/21%", ["Philbenzo"] = "CB:161/20%UM:454/46%", ["Warrego"] = "CM:14/2%", ["Dolm"] = "RM:183/54%", ["Zazus"] = "CM:34/3%", ["Ohka"] = "UM:119/39%", ["Nyct"] = "CM:9/1%", ["Mirashal"] = "UM:394/45%", ["Omegawarrior"] = "RT:401/55%RB:491/62%RM:652/72%", ["Paulant"] = "UM:390/39%", ["Shamiee"] = "RM:223/50%", ["Nukez"] = "CM:9/2%", ["Bobtuna"] = "CB:3/0%CM:39/14%", ["Vessarine"] = "EB:599/87%EM:680/85%", ["Kymer"] = "CM:12/0%", ["Shardior"] = "CB:39/12%CM:62/15%", ["Ermahgerddon"] = "RB:209/54%RM:551/65%", ["Spridius"] = "EB:467/79%EM:800/91%", ["Jaci"] = "CB:26/10%RM:205/54%", ["Cariah"] = "UB:100/45%RM:382/60%", ["Dingwing"] = "UM:231/30%", ["Nightstalka"] = "RM:313/66%", ["Mullac"] = "UM:158/43%", ["Silvaa"] = "EB:727/92%EM:898/92%", ["Thruk"] = "UM:165/37%", ["Bobb"] = "CM:147/13%", ["Rathorlis"] = "RM:137/51%", ["Hellangel"] = "UM:280/33%", ["Anhket"] = "UM:392/42%", ["Hemorrhaged"] = "UM:385/43%", ["Cykotic"] = "UB:264/33%UM:276/28%", ["Mcsmiteface"] = "RT:257/70%EB:610/87%LM:940/97%", ["Pwlo"] = "CB:55/4%RM:615/67%", ["Jeran"] = "CM:20/3%", ["Zaraya"] = "CM:164/15%", ["Stubbyholder"] = "UB:324/43%UM:424/47%", ["Tistana"] = "CT:27/0%RM:319/54%", ["Codehmonekey"] = "CT:8/3%", ["Nibbleme"] = "CB:29/1%UM:259/32%", ["Blaqued"] = "UT:194/26%EB:361/77%RM:570/63%", ["Lucii"] = "CB:78/9%EM:799/83%", ["Sumail"] = "CM:127/11%", ["Elodia"] = "EM:842/86%", ["Antixx"] = "UB:282/39%", ["Exploration"] = "UB:247/32%RM:539/58%", ["Minibanked"] = "CB:59/5%CM:140/15%", ["Esaj"] = "UB:104/26%RM:632/67%", ["Rivikk"] = "UM:114/32%", ["Chrisembowel"] = "CB:123/15%UM:375/39%", ["Shahrazad"] = "RM:601/64%", ["Krazybows"] = "CB:1/0%CM:85/7%", ["Deathstorm"] = "EB:649/85%LM:937/96%", ["Silverside"] = "EM:636/75%", ["Warglok"] = "RM:596/62%", ["Actuallydead"] = "CB:8/0%UM:113/32%", ["Fister"] = "CB:11/1%CM:53/2%", ["Vicena"] = "CB:6/0%CM:47/18%", ["Misshobo"] = "CB:27/0%", ["Slander"] = "UM:335/34%", ["Adellee"] = "CM:225/22%", ["Selision"] = "CB:26/0%UM:296/30%", ["Theproven"] = "RB:439/60%EM:767/86%", ["Tahsaya"] = "UM:108/38%", ["Phallux"] = "CM:55/7%", ["Forevertank"] = "LB:740/95%EM:897/94%", ["Aillison"] = "UM:147/42%", ["Shaluk"] = "CM:33/11%", ["Bearing"] = "RM:189/50%", ["Eatmycrît"] = "RM:660/70%", ["Farded"] = "UM:439/45%", ["Withering"] = "CM:127/17%", ["Uglyred"] = "RM:460/50%", ["Smeladin"] = "RM:609/69%", ["Krong"] = "EB:607/83%EM:895/93%", ["Needamage"] = "UM:253/31%", ["Dwarfie"] = "CM:25/0%", ["Reinholdt"] = "RB:490/65%RM:531/60%", ["Tokzik"] = "CM:151/19%", ["Animatank"] = "RM:332/55%", ["Holyshard"] = "CM:78/5%", ["Aaerik"] = "UM:412/44%", ["Rethana"] = "CM:19/1%", ["Tyberiuis"] = "CM:120/17%", ["Sokas"] = "RB:456/63%EM:762/83%", ["Umbraxica"] = "UM:254/30%", ["Suraklin"] = "CM:84/12%", ["Spazzattack"] = "UM:341/35%", ["Yolie"] = "UM:466/48%", ["Lippi"] = "RB:336/60%EM:703/82%", ["Hoges"] = "UB:213/26%UM:269/27%", ["Blizwiz"] = "CM:145/20%", ["Emptymage"] = "UM:77/30%", ["Manataur"] = "UB:161/41%EM:677/75%", ["Davetheorc"] = "CM:61/15%", ["Kassadin"] = "CM:27/0%", ["Garbagegutz"] = "RM:500/53%", ["Skkipp"] = "CM:130/15%", ["Blackthunder"] = "CB:75/9%RM:582/60%", ["Bullrito"] = "EM:860/92%", ["Gnora"] = "CM:65/9%", ["Nzr"] = "UM:140/47%", ["Kalian"] = "RM:674/74%", ["Hance"] = "UM:413/47%", ["Kierna"] = "CM:102/12%", ["Yadaa"] = "UB:33/35%UM:379/40%", ["Ellay"] = "CM:62/4%", ["Caltrice"] = "CB:40/2%CM:75/11%", ["Suffokate"] = "CB:44/9%UM:294/35%", ["Alberr"] = "CM:7/0%", ["Blackazz"] = "RB:402/52%RM:685/73%", ["Enduranceman"] = "CB:116/12%EM:711/78%", ["Sargoth"] = "UM:385/41%", ["Kynâreth"] = "CM:83/11%", ["Qinn"] = "RM:551/65%", ["Manahate"] = "RM:471/56%", ["Opala"] = "CM:107/13%", ["Eledhel"] = "RM:671/71%", ["Toodoo"] = "RM:681/74%", ["Darknstormy"] = "RM:187/55%", ["Yolo"] = "UB:358/48%EM:724/79%", ["Adapt"] = "RM:261/57%", ["Mageulook"] = "UM:392/42%", ["Spàrròw"] = "EM:909/93%", ["Dreadleaf"] = "CM:88/11%", ["Chickybabe"] = "CT:10/13%UB:76/40%RM:198/52%", ["Royston"] = "UB:213/26%RM:286/57%", ["Leakisikbagh"] = "UM:79/30%", ["Mataya"] = "CM:10/4%", ["Zortikai"] = "CM:75/6%", ["Bstdhunter"] = "CM:139/12%", ["Stanperech"] = "RM:611/65%", ["Kneedin"] = "CT:107/10%UM:263/26%", ["Ralle"] = "CM:175/22%", ["Icepop"] = "UM:296/30%", ["Madz"] = "CM:116/16%", ["Phive"] = "RM:233/57%", ["Ashe"] = "UM:338/33%", ["Jimmie"] = "EB:741/94%LM:927/95%", ["Bogdanon"] = "UT:374/48%EB:652/84%EM:930/94%", ["Spiritjujub"] = "CM:59/5%", ["Edreldin"] = "CB:42/3%EM:687/76%", ["Amoonfane"] = "EM:594/77%", ["Clarent"] = "CB:38/3%CM:137/18%", ["Mcguffin"] = "RT:237/70%RB:171/53%RM:315/58%", ["Grizzwald"] = "RB:315/69%EM:513/76%", ["Aurella"] = "CM:13/14%", ["Gnomerson"] = "CM:43/12%", ["Owmylasagna"] = "UM:348/35%", ["Idotcats"] = "CM:100/10%", ["Duskcaller"] = "CT:78/23%UM:389/48%", ["Arphir"] = "CM:41/13%", ["Lyonkíng"] = "CM:23/5%", ["Sup"] = "UM:202/48%", ["Stumpshot"] = "CB:8/0%", ["Amenglowrock"] = "CT:140/18%RB:405/52%EM:780/81%", ["Elinad"] = "CM:83/8%", ["Kasho"] = "CM:96/11%", ["Freischutz"] = "RM:621/66%", ["Lyralia"] = "CB:152/16%UM:291/33%", ["Dolphyaches"] = "EB:663/85%EM:787/82%", ["Illanour"] = "UM:256/29%", ["Athyist"] = "CM:165/17%", ["Derlen"] = "UB:228/29%CM:249/24%", ["Manahar"] = "RB:236/64%RM:544/74%", ["Macleod"] = "CB:29/1%RM:480/69%", ["Thiswillhurt"] = "CB:66/13%UM:336/40%", ["Illidani"] = "RB:192/50%UM:351/37%", ["Frostwyrm"] = "CB:53/12%UM:105/38%", ["Dingowild"] = "CB:19/0%CM:140/12%", ["Bearytanky"] = "RB:340/74%UM:241/40%", ["Rhodendra"] = "CB:33/3%CM:140/16%", ["Winna"] = "UB:229/29%UM:322/33%", ["Nicavus"] = "CB:29/2%RM:337/64%", ["Ameghan"] = "CT:121/13%UB:304/41%UM:295/35%", ["Dysnull"] = "CB:46/11%CM:131/18%", ["Icecoldmilk"] = "EB:420/76%EM:615/84%", ["Michaeas"] = "RT:157/57%EB:666/90%EM:768/86%", ["Purze"] = "RB:304/69%RM:486/57%", ["Rhani"] = "CB:34/1%EM:744/81%", ["Stavrus"] = "CB:11/1%CM:105/22%", ["Dasderivvian"] = "CB:107/13%CM:72/23%", ["Crustynapkin"] = "CB:28/1%RM:558/60%", ["Eichmann"] = "EB:636/81%EM:883/90%", ["Edaranis"] = "CB:89/10%RM:676/72%", ["Jázzy"] = "UM:104/34%", ["Flavapop"] = "UB:221/29%RM:497/51%", ["Isorno"] = "EB:656/85%EM:856/88%", ["Orangemaen"] = "UB:102/29%RM:596/66%", ["Elbaliavanu"] = "CM:72/10%", ["Moredheal"] = "UM:326/34%", ["Firstaidkity"] = "EB:700/93%EM:759/92%", ["Sombremoon"] = "UB:215/27%RM:466/51%", ["Nitelights"] = "UM:213/26%", ["Lolihelly"] = "RM:514/56%", ["Slackin"] = "UM:274/28%", ["Iela"] = "LB:736/96%EM:737/81%", ["Leö"] = "UB:239/30%EM:831/89%", ["Artimys"] = "UM:310/30%", ["Ælvendar"] = "CM:31/2%", ["Bottomburp"] = "RB:97/51%LM:879/95%", ["Sideswipe"] = "CB:25/0%RM:550/50%", ["Choobetta"] = "UM:252/25%", ["Kevinge"] = "UM:274/27%", ["Wildworld"] = "EB:648/84%EM:815/84%", ["Anarsong"] = "EM:357/76%", ["Kooky"] = "CM:39/12%", ["Mincer"] = "UM:57/33%", ["Yukikaze"] = "UM:89/30%", ["Notyou"] = "CM:114/23%", ["Bangkit"] = "UT:199/30%UB:263/35%RM:442/52%", ["Dreadaleon"] = "EM:781/85%", ["Bubblemedic"] = "CT:28/0%CM:65/6%", ["Juuldhazure"] = "UM:350/37%", ["Badjubjub"] = "RM:567/60%", ["Poodanish"] = "RM:218/50%", ["Presario"] = "RM:597/66%", ["Arttemisfel"] = "CM:89/9%", ["Organix"] = "CT:171/19%UB:340/47%RM:475/56%", ["Serialkiller"] = "RM:561/62%", ["Yennéfer"] = "RM:528/58%", ["Critneyfeärs"] = "UB:329/44%EM:750/78%", ["Doobles"] = "LB:754/97%LM:966/98%", ["Saradipity"] = "RM:565/62%", ["Agan"] = "UM:104/40%", ["Tauntable"] = "UB:394/47%RM:548/58%", ["Exeqt"] = "EB:669/91%EM:893/94%", ["Goodgravy"] = "LB:728/95%LM:979/98%", ["Xyla"] = "UM:396/42%", ["Derolt"] = "CB:80/9%UM:74/27%", ["Faethless"] = "CM:31/1%", ["Biffette"] = "CM:206/21%", ["Stoan"] = "CM:16/4%", ["Ripz"] = "CM:38/3%", ["Cambridge"] = "RB:376/52%RM:631/69%", ["Bouba"] = "CM:57/6%", ["Lorpur"] = "CM:53/3%", ["Modopriest"] = "CM:57/3%", ["Duckstabs"] = "UM:252/25%", ["Razíel"] = "SB:886/99%SM:1067/99%", ["Jazbee"] = "RM:493/54%", ["Kreia"] = "CB:117/14%RM:539/59%", ["Juicieg"] = "RM:482/69%", ["Hadassah"] = "EM:762/92%", ["Thure"] = "CB:25/0%RM:501/54%", ["Jasmíne"] = "UM:405/43%", ["Iceflo"] = "UM:249/25%", ["Ducissa"] = "CB:95/9%UM:264/26%", ["Intervene"] = "UM:317/32%", ["Omiihasforms"] = "RB:173/61%RM:231/57%", ["Belthalus"] = "EM:710/78%", ["Auroradragon"] = "RT:87/54%RB:180/50%RM:393/64%", ["Projectile"] = "CB:72/8%UM:304/30%", ["Anenbrielde"] = "UM:253/25%", ["Onelove"] = "EB:686/91%EM:868/91%", ["Sylvanys"] = "EB:663/85%EM:829/86%", ["Osothorny"] = "UB:79/38%RM:246/58%", ["Eilinna"] = "RB:384/67%EM:553/75%", ["Boomboom"] = "CM:119/12%", ["Mewsalot"] = "UB:390/49%RM:609/65%", ["Dantee"] = "CM:133/13%", ["Fistavus"] = "LB:793/98%LM:976/98%", ["Marlan"] = "UM:466/47%", ["Alías"] = "CM:149/13%", ["Meeztiq"] = "RB:397/52%RM:497/54%", ["Blebebs"] = "RB:468/64%RM:609/67%", ["Jhereg"] = "CM:154/15%", ["Tokzikz"] = "RT:571/73%EB:647/89%EM:860/91%", ["Maleficarum"] = "EB:661/84%EM:808/84%", ["Thighhigh"] = "EB:746/94%LM:964/97%", ["Hades"] = "UM:384/41%", ["Davedacat"] = "CM:127/12%", ["Moovurass"] = "RB:489/70%EM:846/90%", ["Minobloom"] = "UM:264/27%", ["Eiddieindica"] = "EB:675/85%EM:926/94%", ["Moistbuns"] = "LB:749/95%LM:946/96%", ["Toesuka"] = "EM:776/81%", ["Ross"] = "EB:623/85%EM:862/90%", ["Cantalingus"] = "RM:553/61%", ["Degraves"] = "RB:525/67%UM:372/39%", ["Alyx"] = "CM:88/7%", ["Tums"] = "RB:417/57%EM:756/82%", ["Itzhakov"] = "EB:712/89%EM:928/94%", ["Letharia"] = "EB:734/93%LM:926/95%", ["Joachim"] = "UM:197/48%", ["Arcx"] = "EB:649/82%EM:853/88%", ["Nostrodamis"] = "CB:93/9%UM:276/28%", ["Billbowigans"] = "RM:349/66%", ["Orbarsin"] = "EB:631/80%EM:796/83%", ["Luckycow"] = "RM:170/51%", ["Wastedwizz"] = "RM:496/54%", ["Ansatsu"] = "CM:5/0%", ["Lgi"] = "UB:254/32%EM:750/82%", ["Beertanky"] = "CB:143/15%RM:532/73%", ["Blamblam"] = "RM:497/52%", ["Tism"] = "CM:34/2%", ["Halfstack"] = "RB:502/66%RM:641/68%", ["Instantdeath"] = "UM:132/49%", ["Jstatikk"] = "CM:67/5%", ["Bellasta"] = "RB:455/62%RM:614/67%", ["Eyeballpaul"] = "RM:244/55%", ["Thumpah"] = "CB:58/5%CM:199/18%", ["Soreya"] = "UM:255/26%", ["Alfodr"] = "EB:719/92%EM:904/93%", ["Nøm"] = "RM:484/53%", ["Alfador"] = "UM:379/38%", ["Joeykarate"] = "UB:245/43%RM:454/67%", ["Lithic"] = "UT:250/32%CB:182/23%EM:776/83%", ["Egoslayer"] = "EB:746/94%EM:878/91%", ["Nitestalka"] = "UM:313/31%", ["Monal"] = "CB:32/2%UM:117/41%", ["Uthorn"] = "CB:191/20%UM:246/25%", ["Zuubji"] = "RB:371/50%LM:524/97%", ["Mydksmall"] = "UM:79/30%", ["Sfk"] = "CT:48/3%CB:106/10%UM:104/30%", ["Peace"] = "RB:201/50%RM:518/72%", ["Slaaneshee"] = "UB:36/29%", ["Bigtotems"] = "EM:651/78%", ["Kyronal"] = "CB:12/1%RM:525/58%", ["Facemask"] = "RM:670/71%", ["Calfurn"] = "RM:316/63%", ["Palithos"] = "EB:702/94%EM:877/92%", ["Reazuna"] = "CB:116/11%CM:127/10%", ["Mickasham"] = "EB:718/94%LM:938/96%", ["Feardarkness"] = "RB:471/63%", ["Garone"] = "EB:732/92%LM:958/97%", ["Wantëd"] = "EB:637/81%EM:853/88%", ["Sallysativa"] = "EB:668/91%LM:946/97%", ["Rookere"] = "EB:596/87%EM:502/75%", ["Grumpygramps"] = "RB:564/74%EM:840/87%", ["Mussy"] = "EB:551/79%EM:768/88%", ["Moshin"] = "CM:28/1%", ["Eviannia"] = "RB:200/58%RM:272/55%", ["Svd"] = "CB:48/5%UM:409/41%", ["Menziez"] = "RM:585/65%", ["Twistnether"] = "UM:246/25%", ["Novuh"] = "UM:131/44%", ["Darqblade"] = "UM:115/33%", ["Fredhollows"] = "RM:643/71%", ["Binchooken"] = "UB:141/39%RM:159/50%", ["Rubidium"] = "CM:58/20%", ["Kydia"] = "EB:363/75%EM:714/80%", ["Shootfirst"] = "UB:214/26%RM:548/58%", ["Vimm"] = "UB:231/29%EM:692/76%", ["Heimerdinger"] = "CB:33/2%CM:204/20%", ["Edmang"] = "CB:17/19%CM:129/11%", ["Alysria"] = "CM:105/9%", ["Donaltrump"] = "RB:290/64%RM:391/63%", ["Naatsu"] = "UM:414/44%", ["Stoneface"] = "RM:566/62%", ["Raedar"] = "RB:488/63%EM:867/89%", ["Relough"] = "EB:614/85%EM:811/88%", ["Lugnut"] = "RM:570/61%", ["Twilbert"] = "CM:164/15%", ["Nyteblade"] = "UB:346/43%EM:770/80%", ["Dirtyoldman"] = "UM:439/47%", ["Mystiques"] = "LB:784/98%SM:997/99%", ["Gigigoode"] = "EB:507/78%RM:485/70%", ["Wielew"] = "EM:564/79%", ["Zyfer"] = "RB:529/70%EM:751/79%", ["Tamisu"] = "UB:57/40%RM:500/72%", ["Bigsbyy"] = "RB:548/70%RM:685/73%", ["Abbiwilliams"] = "RT:520/69%RB:405/52%RM:670/69%", ["Sinazaela"] = "UB:100/28%CM:150/14%", ["Eaturveggies"] = "UM:116/38%", ["Mongorel"] = "RB:413/53%EM:795/83%", ["Sensim"] = "RB:568/74%EM:807/84%", ["Fuglymedic"] = "CB:105/11%CM:62/4%", ["Bigcritties"] = "EB:738/93%LM:952/96%", ["Keegons"] = "LB:737/96%SM:984/99%", ["Dazol"] = "EM:799/83%", ["Faragon"] = "RB:424/74%EM:652/81%", ["Sabrerus"] = "RM:466/68%", ["Ristianna"] = "EB:637/87%EM:810/90%", ["Alìas"] = "EM:865/89%", ["Savempet"] = "EM:738/78%", ["Carana"] = "RB:487/67%RM:555/61%", ["Blase"] = "UB:284/36%UM:353/37%", ["Wudu"] = "UB:321/42%UM:320/37%", ["Needless"] = "UM:68/26%", ["Dashamoitall"] = "RM:141/52%", ["Littleshooty"] = "EB:679/88%EM:794/85%", ["Brolad"] = "CT:41/13%RB:479/63%EM:741/78%", ["Wanted"] = "UB:377/49%EM:742/80%", ["Halfbagharry"] = "EM:821/87%", ["Dvava"] = "CM:194/19%", ["Jatzkraker"] = "CM:37/2%", ["Smackem"] = "UT:66/27%RM:566/60%", ["Bullie"] = "EM:834/89%", ["Hintoki"] = "CT:48/16%CM:159/14%", ["Herbiee"] = "UB:405/49%EM:726/86%", ["Haleyfox"] = "RM:266/54%", ["Nuit"] = "EB:525/80%RM:540/74%", ["Sabren"] = "EB:665/90%RM:669/71%", ["Lorindi"] = "RB:551/73%EM:828/87%", ["Rajak"] = "UB:282/31%RM:656/70%", ["Jellygoo"] = "UM:406/43%", ["Splasher"] = "UB:177/41%EM:786/85%", ["Killstealz"] = "SB:801/99%LM:987/98%", ["Mogu"] = "EB:691/88%RM:636/66%", ["Jugulate"] = "EM:754/89%", ["Protein"] = "SB:814/99%LM:986/98%", ["Reallycold"] = "RB:505/67%EM:866/90%", ["Supre"] = "EB:744/93%LM:933/95%", ["Bruz"] = "LB:787/98%SM:1006/99%", ["Thundathighs"] = "CT:12/21%LB:774/98%SM:996/99%", ["Sve"] = "EB:587/75%EM:809/84%", ["Tirasaru"] = "LB:758/96%LM:916/95%", ["Sana"] = "EB:682/92%LM:944/97%", ["Ceekay"] = "LB:780/97%SM:1081/99%", ["Nakora"] = "EB:748/94%EM:925/94%", ["Thcfury"] = "EB:599/82%EM:744/81%", ["Cinch"] = "EB:700/92%EM:904/94%", ["Piston"] = "CM:224/22%", ["Azoren"] = "EB:594/81%EM:774/83%", ["Klarity"] = "LB:766/96%EM:881/91%", ["Jacked"] = "LB:783/98%EM:917/91%", ["Moniicold"] = "SB:828/99%SM:1030/99%", ["Jaaykay"] = "EB:666/91%EM:886/94%", ["Avalein"] = "RB:501/69%EM:728/80%", ["Akumas"] = "EB:501/91%EM:775/84%", ["Yaminoxi"] = "EB:700/89%EM:908/92%", ["Newlife"] = "EB:703/93%LM:910/95%", ["Magwindsong"] = "UB:287/36%EM:720/76%", ["Aopsjrfpdosa"] = "CT:0/1%RB:465/62%RM:573/63%", ["Deneir"] = "RM:592/65%", ["Kadiyandiyah"] = "CM:211/20%", ["Hammerspace"] = "CT:74/6%UM:434/47%", ["Alxs"] = "RM:493/71%", ["Newives"] = "RB:511/71%EM:681/75%", ["Shakesbeer"] = "RB:440/60%EM:861/92%", ["Tuxman"] = "EB:684/87%EM:706/75%", ["Morticethree"] = "CB:186/22%UM:378/45%", ["Inprimis"] = "RB:550/70%EM:868/89%", ["Tukanti"] = "CT:177/23%UB:153/39%RM:556/61%", ["Honeyboo"] = "CM:40/2%", ["Gahzilla"] = "UM:261/26%", ["Thorion"] = "RM:612/67%", ["Madamwang"] = "CM:208/20%", ["Kerpman"] = "EM:754/79%", ["Skoob"] = "CM:226/23%", ["Shamitan"] = "UM:318/32%", ["Fizz"] = "EB:616/80%EM:748/78%", ["Craz"] = "CB:143/16%RM:534/59%", ["Fireforhire"] = "LB:792/98%SM:1054/99%", ["Dam"] = "RM:256/57%", ["Wirusneak"] = "CB:38/4%UM:249/25%", ["Cailough"] = "RM:361/62%", ["Phaere"] = "UM:421/45%", ["Sita"] = "EB:712/93%EM:857/92%", ["Opaz"] = "EB:602/83%EM:866/92%", ["Scrattie"] = "EB:732/92%EM:898/91%", ["Vendaxi"] = "CM:153/14%", ["Bigmac"] = "EM:712/87%", ["Bstdheals"] = "CB:196/23%CM:25/0%", ["Nimbless"] = "RM:632/67%", ["Belicia"] = "UB:346/47%RM:508/60%", ["Elhuntardo"] = "RB:451/59%RM:624/66%", ["Tabletopd"] = "RM:487/53%", ["Sarg"] = "RM:670/74%", ["Elkie"] = "UM:289/29%", ["Kiyoshi"] = "UB:286/38%RM:570/63%", ["Darak"] = "CM:40/12%", ["Voleris"] = "RM:575/61%", ["Thon"] = "EB:649/82%EM:707/75%", ["Morguemaus"] = "RB:545/70%RM:565/60%", ["Lunami"] = "EM:767/84%", ["Nextin"] = "EB:591/83%EM:745/87%", ["Valkyire"] = "CB:81/9%CM:27/0%", ["Flyre"] = "EB:617/84%EM:834/87%", ["Misstery"] = "CB:83/7%CM:213/20%", ["Shawtye"] = "LB:773/97%LM:932/95%", ["Krosev"] = "EM:740/78%", ["Tinket"] = "CM:99/8%", ["Ðark"] = "RB:335/70%", ["Honeybaby"] = "RB:206/50%RM:260/56%", ["Sauceress"] = "EM:721/75%", ["Opazz"] = "RB:485/72%EM:738/87%", ["Iphias"] = "CB:52/18%RM:285/50%", ["Juiicybox"] = "CB:1/0%UM:72/27%", ["Quazar"] = "RB:405/55%RM:561/62%", ["Anin"] = "LB:722/96%LM:934/97%", ["Zindiyah"] = "EB:639/83%RM:604/64%", ["Streetvendor"] = "UB:318/41%RM:469/51%", ["Vyeagra"] = "UB:309/40%", ["Pellewy"] = "CB:29/2%", ["Bbella"] = "EB:583/77%EM:754/81%", ["Shifts"] = "EB:513/83%RM:436/67%", ["Rumba"] = "CM:131/12%", ["Legendarius"] = "CB:152/17%CM:178/16%", ["Svarlie"] = "RB:436/55%UM:249/25%", ["Nikanoru"] = "UB:270/29%UM:275/49%", ["Kits"] = "EB:521/79%EM:752/87%", ["Madude"] = "EB:750/94%LM:977/98%", ["Loreal"] = "RB:449/56%RM:532/56%", ["Capo"] = "LB:766/96%LM:948/96%", ["Chocmilk"] = "CM:31/1%", ["Grahzet"] = "UM:456/49%", ["Ifd"] = "UM:313/32%", ["Bigseven"] = "UM:305/30%", ["Pleone"] = "UB:292/37%UM:421/43%", ["Noogums"] = "UB:303/40%UM:351/37%", ["Yoo"] = "EB:403/75%EM:525/76%", ["Mewgii"] = "UB:383/49%UM:388/39%", ["Valyrium"] = "CB:77/9%CM:239/24%", ["Nuromol"] = "RB:378/70%RM:373/62%", ["Kennei"] = "EB:647/84%EM:796/85%", ["Hophophop"] = "EB:470/77%RM:428/68%", ["Bigscarypoo"] = "EM:728/80%", ["Gemon"] = "RB:513/67%RM:590/61%", ["Oldfogey"] = "RB:471/65%EM:819/87%", ["Boracay"] = "CM:93/11%", ["Eril"] = "CM:101/8%", ["Jk"] = "RB:489/68%EM:714/78%", ["Malatae"] = "CB:151/18%CM:130/12%", ["Psydel"] = "LB:752/97%LM:980/98%", ["Kalende"] = "EB:620/85%EM:806/87%", ["Smokinbarrel"] = "LB:782/98%LM:964/97%", ["Hurrah"] = "ET:565/75%EB:735/93%EM:840/87%", ["Kennee"] = "EB:605/83%EM:742/81%", ["Momo"] = "RT:292/67%EB:604/86%EM:855/93%", ["Krist"] = "LB:776/97%SM:1004/99%", ["Ghaun"] = "LB:794/98%SM:1040/99%", ["Malonglong"] = "EM:653/82%", ["Moonunit"] = "EB:634/86%EM:870/91%", ["Nohealsfozac"] = "RB:421/57%RM:661/73%", ["Sventrax"] = "EB:718/90%EM:923/94%", ["Gravymage"] = "RB:437/58%EM:729/79%", ["Chelseafan"] = "ET:708/91%LB:795/98%LM:982/98%", ["Snowyanimal"] = "RM:244/74%", ["Celinda"] = "EB:657/90%LM:923/96%", ["Beefpipe"] = "LB:772/97%EM:925/94%", ["Kevlarbruh"] = "UB:221/27%EM:868/89%", ["Arthurs"] = "CM:28/0%", ["Bettee"] = "RB:422/52%RM:646/69%", ["Larafrost"] = "EB:592/78%LM:933/95%", ["Gnometiddies"] = "RB:481/61%EM:898/92%", ["Plush"] = "CM:29/1%", ["Djinn"] = "EB:674/86%LM:948/96%", ["Pukuto"] = "UT:283/35%CB:48/3%CM:189/17%", ["Curklord"] = "EB:565/80%RM:672/74%", ["Vanderwaals"] = "RM:562/60%", ["Stupidlysexc"] = "RM:655/72%", ["Magespec"] = "EM:699/76%", ["Existential"] = "UM:127/33%", ["Idoru"] = "CT:163/21%UB:98/28%UM:149/48%", ["Zoligrave"] = "CM:117/12%", ["Zigler"] = "UM:412/43%", ["Embérs"] = "CM:40/2%", ["Dose"] = "UB:363/46%UM:438/44%", ["Rampagin"] = "RT:438/69%EB:599/83%EM:743/87%", ["Missuzbliss"] = "UM:161/46%", ["Davoss"] = "UB:383/46%UM:405/41%", ["Visitandine"] = "CM:216/21%", ["Cascadian"] = "CM:189/20%", ["Meduse"] = "UB:68/39%UM:429/46%", ["Zaragoth"] = "RB:515/68%EM:797/85%", ["Jimpy"] = "CM:70/5%", ["Fladel"] = "CM:198/19%", ["Callmestab"] = "CM:83/10%", ["Deimona"] = "UM:267/27%", ["Momoz"] = "EB:626/86%EM:774/84%", ["Salvage"] = "UM:273/26%", ["Kish"] = "EM:714/75%", ["Wyrnnlegacy"] = "EM:811/87%", ["Huntmedown"] = "CM:63/5%", ["Rustyzap"] = "RM:605/67%", ["Melgibson"] = "RM:551/60%", ["Calamity"] = "EB:642/83%RM:667/69%", ["Ddevil"] = "RM:609/67%", ["Cèlestia"] = "RM:157/50%", ["Ziku"] = "UB:141/34%EM:770/84%", ["Visionary"] = "UM:347/36%", ["Daggus"] = "RM:528/73%", ["Catrana"] = "UM:297/30%", ["Dryspel"] = "RB:505/67%EM:704/77%", ["Fathrguiness"] = "UM:167/44%", ["Magnetar"] = "LB:715/95%EM:849/92%", ["Myrline"] = "RM:637/68%", ["Punpun"] = "UM:117/34%", ["Gizeh"] = "RB:452/73%EM:608/78%", ["Anthelaz"] = "UM:454/46%", ["Nyxie"] = "UM:318/33%", ["Aethryn"] = "EB:672/85%EM:869/89%", ["Dulgrim"] = "LB:757/95%SM:989/99%", ["Sharting"] = "CB:184/22%EM:692/76%", ["Shadelli"] = "RM:415/70%", ["Silverwind"] = "RB:471/62%RM:648/69%", ["Hemian"] = "UM:436/45%", ["Lilylovely"] = "ET:586/79%RB:539/73%RM:614/67%", ["Labzy"] = "CM:95/8%", ["Thalcore"] = "CB:112/13%EM:775/81%", ["Durelm"] = "RM:599/66%", ["Chammie"] = "CM:129/12%", ["Búbbles"] = "UB:286/31%RM:593/63%", ["Cuteya"] = "CB:114/13%", ["Mystique"] = "CM:28/1%", ["Frostdancer"] = "RB:538/71%EM:710/77%", ["Sylesce"] = "EB:572/75%EM:727/76%", ["Ripstarter"] = "UM:356/36%", ["Crackfox"] = "RB:307/70%EM:830/89%", ["Zarlas"] = "RM:518/53%", ["Berrylicious"] = "EB:642/81%EM:779/82%", ["Xzennon"] = "LB:746/97%LM:979/98%", ["Warforge"] = "RB:511/66%EM:728/77%", ["Sodiq"] = "EB:749/94%LM:968/97%", ["Tedosaurus"] = "EM:688/76%", ["Lichkingg"] = "UB:243/31%RM:640/70%", ["Wallup"] = "RM:626/65%", ["Sevensorrows"] = "CM:25/0%", ["Partuna"] = "CB:139/17%RM:519/57%", ["Mcshooty"] = "CM:55/4%", ["Overthere"] = "EB:671/91%EM:778/85%", ["Frosty"] = "UM:444/48%", ["Saberized"] = "CM:167/16%", ["Lobes"] = "RB:430/53%RM:450/72%", ["Galfour"] = "RB:470/60%RM:546/58%", ["Bonnie"] = "UB:284/37%UM:267/27%", ["Bestever"] = "RB:437/56%RM:506/52%", ["Mixedberry"] = "EM:838/89%", ["Valkyrios"] = "EB:596/76%EM:721/76%", ["Cenuij"] = "EB:647/90%EM:678/86%", ["Allis"] = "EM:768/80%", ["Quickport"] = "CM:27/0%", ["Osko"] = "CB:113/12%UM:407/44%", ["Mordecaii"] = "CM:153/15%", ["Feuerandeis"] = "CM:143/13%", ["Meq"] = "RB:535/74%EM:822/88%", ["Drednaught"] = "UM:468/48%", ["Voidamort"] = "EM:726/75%", ["Ezrafel"] = "RM:188/52%", ["Wallyjenkins"] = "CB:52/5%UM:277/28%", ["Slipshadey"] = "CB:110/13%RM:508/54%", ["Zandan"] = "RM:630/67%", ["Miniwizard"] = "CM:187/18%", ["Xaviuss"] = "CM:126/12%", ["Wubalubadub"] = "EB:639/81%EM:901/94%", ["Galaxyrogue"] = "EB:663/84%EM:860/88%", ["Chemame"] = "RB:539/72%EM:883/92%", ["Magicboy"] = "CB:141/15%CM:132/15%", ["Oldmanshart"] = "CB:26/0%CM:35/2%", ["Modala"] = "CT:135/17%CB:110/13%CM:100/9%", ["Crittical"] = "CB:38/3%UM:416/42%", ["Mina"] = "LB:738/96%LM:937/96%", ["Onemillion"] = "LB:771/97%EM:888/91%", ["Dyluck"] = "UB:233/25%RM:524/55%", ["Thalon"] = "EB:749/94%EM:830/91%", ["Twoofnine"] = "EB:587/81%EM:814/88%", ["Marisabelle"] = "LB:795/98%SM:1023/99%", ["Butterlips"] = "EB:716/92%EM:892/90%", ["Peytonxi"] = "EB:731/93%EM:773/83%", ["Tipitaka"] = "RB:533/74%RM:673/74%", ["Scruffeh"] = "RB:411/50%RM:612/65%", ["Jade"] = "EB:704/94%EM:813/88%", ["Shadowjunkie"] = "CM:113/14%", ["Imperious"] = "EB:739/93%EM:908/92%", ["Seem"] = "LB:743/95%EM:832/91%", ["Protios"] = "EB:712/94%EM:802/89%", ["Mks"] = "LB:767/96%LM:938/95%", ["Oxidottin"] = "RB:549/72%UM:405/41%", ["Inara"] = "CB:186/23%", ["Peaweevil"] = "UB:71/35%EM:556/78%", ["Delwin"] = "CB:159/21%RM:269/67%", ["Meliah"] = "UM:95/36%", ["Trouto"] = "CB:120/14%UM:274/26%", ["Apochlorax"] = "LB:760/95%EM:849/87%", ["Xiaonaonao"] = "RB:178/56%RM:523/57%", ["Freud"] = "CM:110/10%", ["Greentree"] = "RB:308/68%RM:427/66%", ["Lipp"] = "UM:410/44%", ["Isosceles"] = "EB:489/76%EM:618/79%", ["Bloodhide"] = "EB:717/90%EM:901/92%", ["Moji"] = "LB:796/98%SM:998/99%", ["Aude"] = "EB:660/91%EM:786/91%", ["Deadlia"] = "CM:156/14%", ["Swordlord"] = "UM:132/26%", ["Flamingturd"] = "CM:220/22%", ["Hopsngrains"] = "RM:625/65%", ["Lumisan"] = "EB:614/78%LM:949/96%", ["Punchingbag"] = "RM:503/53%", ["Fuscharistic"] = "RB:485/64%RM:524/55%", ["Xtcee"] = "RM:314/63%", ["Charrizard"] = "CM:204/20%", ["Belgash"] = "RM:611/67%", ["Wishbone"] = "UB:364/43%EM:766/80%", ["Hersilia"] = "RM:661/72%", ["Schreibler"] = "CM:200/19%", ["Halcyonn"] = "LB:793/98%LM:972/98%", ["Bacall"] = "EM:759/80%", ["Rattystu"] = "RB:395/53%EM:846/90%", ["Miltonmango"] = "CM:119/14%", ["Leonidas"] = "EB:607/83%LM:957/98%", ["Marenna"] = "CB:93/9%UM:265/27%", ["Nassiriem"] = "CM:217/21%", ["Galnaias"] = "CM:234/23%", ["Grimfiend"] = "EB:639/82%EM:854/88%", ["Choppy"] = "CB:84/10%UM:358/37%", ["Snaffo"] = "UM:391/40%", ["Bastynastard"] = "UM:248/25%", ["Wiiman"] = "RM:313/59%", ["Ltopray"] = "UM:450/46%", ["Backtowork"] = "CB:137/14%RM:649/69%", ["Rathos"] = "UB:380/45%UM:152/30%", ["Randomizer"] = "CB:115/12%EM:794/89%", ["Apu"] = "RB:162/54%EM:555/79%", ["Itchyscrot"] = "CB:139/15%UM:404/41%", ["Cupoftea"] = "RB:520/72%EM:682/75%", ["Sifarish"] = "CM:186/18%", ["Hic"] = "EB:704/88%EM:900/92%", ["Soniasonn"] = "RB:561/73%EM:751/78%", ["Breo"] = "RM:659/72%", ["Sharkie"] = "RB:250/58%RM:341/62%", ["Konjac"] = "EB:644/82%EM:860/88%", ["Ladimus"] = "CB:63/7%", ["Wundah"] = "RB:390/61%RM:540/74%", ["Mononokie"] = "EB:752/94%EM:928/94%", ["Thundertank"] = "EB:611/84%EM:685/84%", ["Sabela"] = "EB:662/90%EM:781/84%", ["Sebbie"] = "UB:335/44%RM:643/71%", ["Kitona"] = "EB:653/83%EM:742/78%", ["Jockw"] = "UM:416/43%", ["Thalonn"] = "UM:317/32%", ["Ellanta"] = "RB:274/65%EM:571/79%", ["Solara"] = "RB:537/70%EM:833/86%", ["Beefshanks"] = "UM:310/32%", ["Kimorijenks"] = "RB:500/66%UM:434/47%", ["Senseless"] = "CT:89/15%RB:565/74%RM:676/74%", ["Stupid"] = "EB:580/76%RM:609/65%", ["Beanella"] = "CM:3/3%", ["Bootataki"] = "EB:702/89%RM:577/61%", ["Tessyshordie"] = "CM:159/14%", ["Zylore"] = "EB:727/92%LM:938/95%", ["Laluna"] = "CB:94/9%EM:700/77%", ["Avalaine"] = "CB:57/6%EM:553/75%", ["Zakalis"] = "UM:438/47%", ["Baragon"] = "CB:41/4%CM:188/19%", ["Daamaste"] = "CM:120/10%", ["Villainy"] = "RM:693/73%", ["Bunko"] = "UM:307/30%", ["Mcmurder"] = "UB:225/27%RM:457/50%", ["Cwackinblock"] = "UB:401/48%RM:535/57%", ["Shanai"] = "RM:503/55%", ["Mintock"] = "CM:72/5%", ["Arcbane"] = "CM:20/21%", ["Lilpixi"] = "EM:686/75%", ["Mindra"] = "UM:387/41%", ["Arenya"] = "RM:602/64%", ["Thetouch"] = "RM:537/59%", ["Mspanda"] = "CB:14/16%RM:175/51%", ["Wildkin"] = "EM:683/85%", ["Spiritstick"] = "CM:185/17%", ["Ryshad"] = "CM:150/16%", ["Balmont"] = "UB:239/30%RM:620/68%", ["Mazguwrath"] = "CM:73/6%", ["Frothies"] = "UM:424/46%", ["Sheepfactory"] = "CM:98/8%", ["Touchyhobo"] = "CB:199/24%EM:780/85%", ["Utterz"] = "UM:46/27%", ["Anoobb"] = "CM:234/23%", ["Fauntleroy"] = "UM:375/40%", ["Prettylights"] = "RM:543/59%", ["Lôthar"] = "UM:260/26%", ["Ellenya"] = "UM:380/40%", ["Lìghtbrìnger"] = "UM:454/49%", ["Bds"] = "EB:718/90%RM:670/71%", ["Neriana"] = "EB:637/82%RM:686/71%", ["Agarim"] = "EB:719/91%EM:740/78%", ["Lunaya"] = "LB:786/98%SM:996/99%", ["Tomski"] = "EB:695/87%EM:783/81%", ["Vyle"] = "UB:312/41%UM:415/45%", ["Bubbletiming"] = "UB:267/34%", ["Weeb"] = "EB:599/76%EM:793/76%", ["Azmedam"] = "UT:231/29%RB:421/58%RM:616/68%", ["Deronima"] = "EB:710/94%EM:879/92%", ["Ranowar"] = "CM:115/23%", ["Æøæ"] = "EB:625/82%RM:573/63%", ["Jastor"] = "CB:131/16%UM:302/29%", ["Kahlanvale"] = "UB:252/32%", ["Morowena"] = "RT:412/52%EB:627/86%LM:919/95%", ["Thickmilk"] = "EB:657/89%EM:828/89%", ["Flambe"] = "UM:246/25%", ["Vauk"] = "RB:425/52%RM:690/73%", ["Weginald"] = "UM:252/25%", ["Juros"] = "RB:500/64%EM:814/84%", ["Frostitue"] = "UB:356/46%RM:532/58%", ["Scabs"] = "CM:217/22%", ["Dupin"] = "RB:439/60%RM:566/62%", ["Tenujin"] = "RM:625/67%", ["Daraand"] = "EB:555/77%EM:772/84%", ["Leone"] = "EM:759/89%", ["Tarosukii"] = "RM:468/50%", ["Ripnroll"] = "EB:580/80%RM:646/72%", ["Natherra"] = "LB:757/95%LM:938/95%", ["Fireytoo"] = "CM:39/2%", ["Daimakimura"] = "CB:192/23%UM:255/26%", ["Wonbebe"] = "EB:707/94%EM:749/87%", ["Faketaxiee"] = "CB:116/12%CM:187/19%", ["Ralan"] = "UB:241/30%UM:394/42%", ["Poxpea"] = "UM:87/29%", ["Skiip"] = "CT:60/24%RB:358/61%UM:228/42%", ["Warmmilk"] = "RM:353/66%", ["Mccaustic"] = "EM:777/81%", ["Herborial"] = "RB:375/50%RM:519/58%", ["Jax"] = "CM:162/14%", ["Xiaoyang"] = "RB:485/67%RM:593/65%", ["Òmni"] = "RB:504/70%RM:631/69%", ["Triselly"] = "CM:230/23%", ["Ishelltameya"] = "EM:759/81%", ["Ransyn"] = "RM:542/58%", ["Eeveelution"] = "CT:71/13%CM:99/8%", ["Lianara"] = "UM:336/33%", ["Rockybearboa"] = "RB:188/57%RM:501/74%", ["Thark"] = "RM:560/66%", ["Zalexane"] = "CM:101/8%", ["Neekø"] = "EB:694/94%EM:863/92%", ["Scarecrow"] = "LB:752/95%LM:940/95%", ["Boomhealedyo"] = "CB:123/13%RM:654/72%", ["Mortress"] = "CM:49/3%", ["Eminence"] = "CB:28/1%EM:794/83%", ["Gurnison"] = "RB:115/52%EM:565/75%", ["Belrond"] = "RB:381/60%EM:809/90%", ["Zerani"] = "UM:339/34%", ["Thotsupreme"] = "RM:466/51%", ["Hancholo"] = "RM:590/65%", ["Rayhuntersky"] = "CM:212/20%", ["Longineus"] = "EB:689/93%LM:938/97%", ["Ards"] = "RM:629/65%", ["Esum"] = "UM:431/47%", ["Darklling"] = "EB:606/79%EM:852/88%", ["Majisto"] = "RB:539/72%RM:573/63%", ["Poisonmilk"] = "RB:424/58%RM:624/69%", ["Klever"] = "CB:190/23%RM:518/53%", ["Toblerowned"] = "UT:314/41%UB:340/43%EM:856/88%", ["Spicshady"] = "CM:95/11%", ["Orschatlite"] = "RM:269/56%", ["Warrhawk"] = "CM:170/18%", ["Wintersheat"] = "CM:37/2%", ["Balthyne"] = "UM:273/27%", ["Ruena"] = "UM:342/36%", ["Onelock"] = "CM:128/13%", ["Ghostdrops"] = "UM:196/38%", ["Grimthor"] = "EM:625/80%", ["Drakeir"] = "UM:406/42%", ["Ravynsclaw"] = "CM:45/20%", ["Itzachu"] = "CM:107/16%", ["Kp"] = "EB:717/92%EM:882/92%", ["Dandrah"] = "RM:560/61%", ["Dorrannus"] = "CM:189/23%", ["Badchemistry"] = "CB:92/24%RM:462/51%", ["Elandir"] = "RM:695/74%", ["Moradahn"] = "CB:177/21%EM:859/88%", ["Sin"] = "RB:357/64%EM:634/80%", ["Bållz"] = "CB:131/16%EM:805/84%", ["Lilindra"] = "CB:75/20%UM:323/32%", ["Nemvy"] = "EB:662/86%EM:742/80%", ["Hadros"] = "EB:672/85%RM:660/70%", ["Muscleup"] = "CM:61/5%", ["Kendoll"] = "RM:90/57%", ["Iceursoxoff"] = "RM:531/58%", ["Lucielaria"] = "CM:163/15%", ["Moopants"] = "RB:517/72%RM:638/71%", ["Wheresholy"] = "EB:699/93%EM:850/90%", ["Warbutz"] = "RB:407/55%EM:838/90%", ["Haplo"] = "EB:701/88%EM:853/88%", ["Aztec"] = "EB:658/85%EM:823/85%", ["Sethoris"] = "EM:679/75%", ["Valexania"] = "RB:538/70%RM:620/64%", ["Farway"] = "RM:491/54%", ["Forgedragon"] = "RM:534/73%", ["Seymonald"] = "UM:378/40%", ["Nastyhunter"] = "UM:432/47%", ["Dagnong"] = "RM:371/67%", ["Sneekea"] = "RB:556/71%RM:699/74%", ["Trelegy"] = "EB:692/87%EM:884/90%", ["Nicochan"] = "CM:75/21%", ["Fourofnine"] = "UM:442/47%", ["Signilde"] = "UM:333/35%", ["Ubes"] = "EM:902/92%", ["Nalaxi"] = "UM:412/43%", ["Sesh"] = "EB:451/78%EM:747/89%", ["Jilad"] = "EB:718/90%LM:949/96%", ["Sleeping"] = "EB:720/90%EM:844/87%", ["Stelle"] = "RB:472/62%EM:828/86%", ["Chandra"] = "RB:463/61%RM:582/64%", ["Fuzznucket"] = "CB:116/12%RM:646/69%", ["Thelandira"] = "UB:315/40%RM:520/55%", ["Za"] = "EB:644/88%RM:566/62%", ["Sleepmaker"] = "CM:162/14%", ["Elenaxii"] = "CB:109/13%RM:665/65%", ["Asa"] = "EB:650/82%EM:823/85%", ["Leeroyjenkii"] = "EB:597/76%RM:614/66%", ["Chancetaker"] = "UB:376/49%RM:499/55%", ["Princsess"] = "LB:733/96%EM:756/82%", ["Elestar"] = "EB:641/89%EM:814/91%", ["Coldtips"] = "EB:734/93%EM:910/94%", ["Lightblinger"] = "CB:185/22%RM:557/61%", ["Bacon"] = "RM:556/59%", ["Anticorona"] = "RB:493/64%EM:814/84%", ["Wizzjab"] = "CM:65/5%", ["Buffero"] = "UM:253/25%", ["Rumtard"] = "CM:26/0%", ["Tartetatin"] = "UM:370/37%", ["Thunderchill"] = "CM:153/14%", ["Thunderbolts"] = "CM:70/7%", ["Niarja"] = "UM:321/34%", ["Hairyportal"] = "RB:448/59%RM:665/73%", ["Mcfrosty"] = "EB:707/91%EM:865/90%", ["Thundercold"] = "CM:204/20%", ["Papisfascist"] = "UB:44/34%UM:340/36%", ["Frostyflakes"] = "UB:250/32%RM:523/57%", ["Tajimabeef"] = "RB:573/73%EM:817/85%", ["Biigdoiinks"] = "UM:451/47%", ["Glugglug"] = "RM:510/52%", ["Coocoopuffs"] = "CM:137/12%", ["Saitama"] = "UB:364/45%EM:719/76%", ["Lycan"] = "RM:579/64%", ["Loknilam"] = "CM:93/9%", ["Aleksandr"] = "CB:93/11%RM:518/55%", ["Dqw"] = "RM:302/52%", ["Iknowaguy"] = "UM:186/36%", ["Deepfried"] = "CM:218/21%", ["Zejia"] = "UM:328/34%", ["Nesquik"] = "RM:398/69%", ["Roast"] = "CT:140/19%RB:442/61%EM:472/79%", ["Squark"] = "RM:525/57%", ["Fetters"] = "UM:361/36%", ["Sho"] = "RB:499/69%EM:779/84%", ["Misakha"] = "CM:29/1%", ["Cursez"] = "RB:529/69%RM:695/72%", ["Pronhuba"] = "EB:660/83%EM:879/90%", ["Lren"] = "RB:562/74%EM:865/89%", ["Dipship"] = "CB:145/15%CM:228/23%", ["Yorkhunt"] = "CB:129/16%UM:445/48%", ["Veganqueef"] = "UM:254/25%", ["Slygrat"] = "UB:299/36%RM:610/65%", ["Apolault"] = "EB:596/83%EM:822/89%", ["Rubyhurts"] = "RB:548/70%EM:863/88%", ["Komage"] = "RB:440/58%EM:742/80%", ["Narcin"] = "RB:447/59%RM:643/71%", ["Wuhanlab"] = "UB:226/28%EM:805/87%", ["Pennypax"] = "CM:1/1%", ["Paullock"] = "RM:583/60%", ["Heartless"] = "CM:153/13%", ["Burntburgers"] = "CM:207/19%", ["Sukablyatt"] = "EM:747/81%", ["Jetsiqi"] = "UM:122/25%", ["Toofrosty"] = "CM:178/17%", ["Yamboss"] = "CM:145/13%", ["Deepinside"] = "CM:26/0%", ["Hordemaiden"] = "UB:395/47%EM:724/77%", ["Gaiseric"] = "UM:352/35%", ["Jasna"] = "UM:255/26%", ["Flowerpots"] = "UB:332/41%CM:206/20%", ["Chequerz"] = "CB:29/1%CM:115/10%", ["Tomten"] = "EM:628/80%", ["Natali"] = "UM:284/27%", ["Meadowmast"] = "CB:61/13%UM:414/43%", ["Tugboat"] = "CB:26/0%RM:482/69%", ["Sapples"] = "CM:104/10%", ["Koukla"] = "EB:743/94%LM:962/97%", ["Grinti"] = "EB:738/92%EM:905/93%", ["Jurodice"] = "EB:708/94%LM:965/98%", ["Morris"] = "CB:112/11%RM:672/74%", ["Slothie"] = "CM:72/16%", ["Chrune"] = "UB:140/28%RM:356/58%", ["Silverhorn"] = "CB:170/20%CM:79/7%", ["Tandy"] = "EB:662/90%LM:930/97%", ["Orczwithgunz"] = "RM:633/67%", ["Deathmagi"] = "UM:370/37%", ["Frenzal"] = "RM:420/66%", ["Dedlikeme"] = "CB:97/11%UM:289/30%", ["Ailment"] = "EB:685/91%EM:777/84%", ["Pinaynes"] = "RT:424/53%EB:539/75%EM:751/82%", ["Apx"] = "UT:329/42%RB:464/61%EM:698/76%", ["Tradewind"] = "UM:373/39%", ["Slinqi"] = "CM:218/20%", ["Heinlarger"] = "RM:555/59%", ["Slashygashy"] = "RB:405/51%RM:688/73%", ["Galain"] = "UB:145/37%UM:275/26%", ["Capybara"] = "RB:565/74%EM:785/82%", ["Lildevil"] = "RM:514/60%", ["Thardrin"] = "EM:867/89%", ["Aaeryn"] = "EM:532/76%", ["Aeryss"] = "UB:126/32%RM:484/53%", ["Gimpyblimp"] = "EB:683/92%LM:910/96%", ["Porblarrus"] = "LM:913/97%", ["Navy"] = "RM:553/58%", ["Novenshock"] = "CM:62/4%", ["Iknowagirl"] = "UB:242/31%UM:331/35%", ["Gelly"] = "EB:705/89%EM:924/94%", ["Icyqueenn"] = "UM:322/33%", ["Needles"] = "UB:313/40%RM:656/72%", ["Purpleowl"] = "RB:386/74%EM:520/77%", ["Atomic"] = "CM:28/0%", ["Bomi"] = "UT:240/30%EB:645/82%EM:763/80%", ["Kalaman"] = "UM:446/48%", ["Neimh"] = "CM:119/10%", ["Icenova"] = "UM:342/36%", ["Balinak"] = "UM:302/30%", ["Pb"] = "CM:110/11%", ["Gungho"] = "UM:253/25%", ["Kerala"] = "UM:377/40%", ["Bugeisha"] = "RM:269/56%", ["Spanckette"] = "UM:255/26%", ["Nessya"] = "CB:66/7%RM:485/53%", ["Nadoe"] = "LB:765/96%LM:970/98%", ["Phillippe"] = "UM:419/44%", ["Maevinna"] = "EB:652/82%EM:828/86%", ["Reginas"] = "EB:388/79%RM:624/71%", ["Scorpionmum"] = "RM:318/63%", ["Gelligan"] = "EB:677/85%LM:945/96%", ["Ikatu"] = "EM:750/79%", ["Allarna"] = "UB:272/30%RM:553/59%", ["Lykacherri"] = "RB:497/64%EM:931/94%", ["Shaker"] = "EB:668/84%EM:871/90%", ["Luciferheals"] = "LB:732/95%EM:867/91%", ["Trixom"] = "RT:460/62%EB:654/85%EM:879/90%", ["Squishyman"] = "EB:738/94%LM:976/98%", ["Valorthorn"] = "UB:299/37%RM:699/74%", ["Tiramisu"] = "UB:252/32%RM:465/51%", ["Lockondeez"] = "EB:723/92%RM:628/65%", ["Dinarth"] = "EM:742/81%", ["Kasshunt"] = "RM:683/72%", ["Bobmortimer"] = "EB:613/84%EM:805/86%", ["Richie"] = "EB:568/78%RM:707/74%", ["Bullrog"] = "UM:302/30%", ["Teanadruid"] = "LB:743/96%EM:793/86%", ["Teia"] = "EB:683/87%EM:873/88%", ["Nado"] = "EB:717/90%LM:948/96%", ["Furpants"] = "EB:481/80%RM:448/72%", ["Vahallah"] = "EB:688/93%EM:802/87%", ["Pukyewtew"] = "RB:496/65%RM:609/60%", ["Annitas"] = "CB:59/6%CM:27/0%", ["Twistz"] = "CB:96/11%CM:184/18%", ["Istarion"] = "RM:471/52%", ["Twardziel"] = "EB:591/75%EM:714/76%", ["Feeanor"] = "CM:46/4%", ["Damog"] = "LB:788/98%SM:1014/99%", ["Mogrann"] = "CM:101/9%", ["Ner"] = "CM:234/23%", ["Amo"] = "CM:246/23%", ["Celinez"] = "RB:402/55%RM:607/67%", ["Nadali"] = "EB:687/92%EM:847/90%", ["Eluner"] = "EM:702/77%", ["Morquiede"] = "CM:217/21%", ["Skarbranded"] = "CM:90/8%", ["Rastan"] = "CT:42/17%CB:86/8%CM:37/4%", ["Xzenith"] = "UM:426/44%", ["Pezy"] = "CM:129/20%", ["Suphomies"] = "EB:640/81%EM:884/90%", ["Hartwinc"] = "UM:257/26%", ["Seeseebee"] = "EM:552/75%", ["Stormpulse"] = "UM:281/28%", ["Kirasa"] = "CB:189/23%RM:631/67%", ["Tantivy"] = "CM:62/5%", ["Cindari"] = "RB:440/58%RM:553/61%", ["Rayzinhel"] = "RM:602/62%", ["Slyther"] = "CB:38/4%RM:555/59%", ["Efefes"] = "RT:384/50%RB:560/74%EM:850/87%", ["Dregi"] = "CT:69/13%EB:602/76%EM:896/92%", ["Moistpoon"] = "EB:656/84%EM:914/93%", ["Appollon"] = "EM:711/78%", ["Kangi"] = "UM:406/42%", ["Crystallize"] = "EB:680/88%EM:869/91%", ["Mashedspudd"] = "EB:704/93%EM:879/92%", ["Apocalypse"] = "CB:86/17%RM:603/65%", ["Ripnot"] = "UM:330/33%", ["Gõdspally"] = "UM:405/43%", ["Giveroflife"] = "CB:28/0%RM:545/60%", ["Rhylriah"] = "RM:481/53%", ["Pozy"] = "RB:380/51%EM:698/77%", ["Yakubyougami"] = "CM:62/6%", ["Sherazi"] = "CM:224/22%", ["Foc"] = "CM:194/19%", ["Quon"] = "EM:556/78%", ["Awhgazmic"] = "UM:291/29%", ["Tiala"] = "UM:357/38%", ["Belthasar"] = "CM:120/11%", ["Radox"] = "EB:611/78%EM:880/90%", ["Adexia"] = "RB:546/70%EM:910/93%", ["Cheekykient"] = "CB:183/19%CM:211/21%", ["Kilswitch"] = "CT:100/10%EB:538/75%EM:702/77%", ["Shrêk"] = "RB:493/62%RM:694/74%", ["Ggmyster"] = "UB:361/46%CM:205/21%", ["Alexpatrique"] = "EB:576/83%EM:789/89%", ["Dirmei"] = "CM:227/22%", ["Sullen"] = "CB:174/21%RM:500/52%", ["Skamos"] = "EB:518/75%EM:728/86%", ["Qosh"] = "RM:517/54%", ["Buksyy"] = "CB:150/16%UM:286/29%", ["Bobhorc"] = "RT:383/62%EB:320/75%RM:464/74%", ["Muntedhead"] = "CT:37/8%UB:245/27%RM:682/73%", ["Aphazel"] = "CT:85/11%UB:286/38%RM:574/59%", ["Alaxandrior"] = "UM:333/33%", ["Kjerstin"] = "LB:762/96%LM:990/98%", ["Meisterlight"] = "UM:306/31%", ["Driad"] = "CB:108/11%UM:407/44%", ["Assaultzero"] = "UB:336/42%RM:599/64%", ["Nuza"] = "RB:511/71%EM:747/82%", ["Kaari"] = "EB:573/76%RM:669/73%", ["Sktfaker"] = "RB:525/69%EM:747/78%", ["Anerion"] = "UB:279/30%RM:527/73%", ["Evessie"] = "RB:250/54%RM:411/65%", ["Arcidas"] = "RB:415/55%RM:479/52%", ["Leuko"] = "EB:545/76%EM:703/77%", ["Roomsie"] = "CB:35/1%CM:172/15%", ["Ogana"] = "EB:671/87%EM:817/87%", ["Chayapat"] = "RB:524/70%EM:748/81%", ["Krulz"] = "CB:123/15%UM:465/47%", ["Killalli"] = "CM:64/8%", ["Imootoo"] = "UT:260/31%RB:291/68%EM:737/80%", ["Hiddenquake"] = "CM:28/1%", ["Bastani"] = "CM:47/16%", ["Naddod"] = "UM:382/41%", ["Filby"] = "UB:218/27%UM:430/44%", ["Piddle"] = "UM:293/47%", ["Recklass"] = "CM:136/12%", ["Barnicus"] = "UM:338/35%", ["Bookarkey"] = "RM:637/68%", ["Creepybanana"] = "RB:511/71%EM:721/79%", ["Butulu"] = "RB:569/72%RM:667/71%", ["Stinkbox"] = "UB:247/31%UM:377/40%", ["Erint"] = "UM:396/42%", ["Kangy"] = "EB:599/79%EM:740/80%", ["Deceiver"] = "CM:79/7%", ["Permadead"] = "UB:349/47%RM:648/71%", ["Meisternil"] = "RB:538/71%EM:740/80%", ["Sinulog"] = "CM:98/10%", ["Valouriel"] = "UM:436/47%", ["Dottymcfear"] = "CM:27/1%", ["Ravenalpha"] = "RB:527/67%EM:704/75%", ["Starna"] = "RM:358/61%", ["Dilraw"] = "RM:421/64%", ["Roland"] = "CM:228/23%", ["Ångel"] = "UB:117/44%RM:377/63%", ["Ryhose"] = "CM:127/11%", ["Shesgotballs"] = "RB:474/61%RM:701/74%", ["Tanque"] = "CB:163/17%UM:462/48%", ["Pandax"] = "LB:707/95%LM:903/95%", ["Members"] = "RM:546/58%", ["Hecks"] = "EM:869/87%", ["Pipschick"] = "UB:249/31%RM:221/61%", ["Joosi"] = "EB:713/93%EM:885/92%", ["Stabsnkisses"] = "UB:305/37%RM:514/55%", ["Zmixer"] = "RB:461/58%RM:522/55%", ["Sinisterman"] = "EB:485/78%RM:293/56%", ["Dancerqueenn"] = "CB:173/20%", ["Ishkode"] = "UB:60/29%EM:632/78%", ["Chiliya"] = "CM:230/21%", ["Orcopalypse"] = "UT:147/31%RB:162/51%", ["Stratcaster"] = "CB:190/24%RM:624/69%", ["Dennzy"] = "RM:298/60%", ["Avarr"] = "CM:226/22%", ["Colloquial"] = "CM:68/5%", ["Radd"] = "CB:21/0%", ["Shawtyee"] = "RM:525/54%", ["Enishisan"] = "CM:161/15%", ["Spudindawat"] = "CM:69/5%", ["Trisa"] = "CB:107/13%UM:404/43%", ["Gotheals"] = "CB:109/11%", ["Nenestar"] = "RB:430/59%RM:645/71%", ["Curbenette"] = "UB:274/35%CM:216/21%", ["Depressing"] = "UB:339/43%UM:339/34%", ["Magerkritz"] = "EB:625/82%EM:791/84%", ["Cruix"] = "LB:741/96%LM:932/96%", ["Reavi"] = "EB:743/93%EM:910/93%", ["Behelit"] = "EB:574/75%EM:925/93%", ["Priceless"] = "UT:21/47%EB:563/78%EM:536/77%", ["Sitrie"] = "CM:150/14%", ["Manganyxx"] = "RB:405/53%EM:716/78%", ["Mythania"] = "UB:204/25%RM:527/58%", ["Megale"] = "UM:311/30%", ["Dragrit"] = "RB:425/71%EM:737/86%", ["Kilgrave"] = "UM:282/28%", ["Nugglivich"] = "UM:263/31%", ["Dimz"] = "CM:44/3%", ["Latchyy"] = "CM:28/1%", ["Madaussie"] = "CM:150/16%", ["Nightfalcon"] = "EB:625/86%EM:769/81%", ["Sayaa"] = "RM:467/64%", ["Morph"] = "CM:146/14%", ["Hardthuglife"] = "CM:34/2%", ["Ravenmad"] = "UM:125/49%", ["Binnet"] = "EB:604/80%EM:687/75%", ["Gumbercules"] = "EM:840/87%", ["Youcube"] = "RB:494/66%EM:796/85%", ["Nahual"] = "RB:212/64%RM:388/68%", ["Mellare"] = "UM:288/28%", ["Baul"] = "UM:309/30%", ["Beastwarr"] = "RM:328/64%", ["Cloudi"] = "EB:691/87%EM:919/93%", ["Bixr"] = "EB:567/85%LM:931/97%", ["Kevry"] = "UM:372/39%", ["Nedali"] = "RM:702/72%", ["Enlighten"] = "EM:817/86%", ["Farmerthen"] = "UB:214/27%RM:489/53%", ["Fugmomo"] = "CB:31/2%RM:488/53%", ["Lunarith"] = "UM:332/34%", ["Breadbasket"] = "UM:297/30%", ["Mclovan"] = "EB:634/87%EM:805/86%", ["Fluffalo"] = "UM:357/36%", ["Rinion"] = "RB:399/50%EM:877/87%", ["Arokh"] = "CB:139/17%CM:223/22%", ["Frostmonster"] = "CB:30/1%CM:220/22%", ["Manganyx"] = "UB:318/41%RM:598/66%", ["Brathorth"] = "CB:28/1%CM:123/15%", ["Scrag"] = "CM:229/23%", ["Niteeyes"] = "RB:447/55%RM:679/72%", ["Bennyrage"] = "UT:68/31%RB:414/57%UM:281/34%", ["Einya"] = "CB:174/20%UM:294/30%", ["Eggyolk"] = "EB:667/86%EM:923/94%", ["Rèflow"] = "RM:526/56%", ["Rhodan"] = "CM:34/1%", ["Sver"] = "UM:302/31%", ["Margus"] = "CM:170/16%", ["Laflamme"] = "RM:208/50%", ["Elfmonz"] = "RM:215/64%", ["Stackedboy"] = "CM:182/17%", ["Amoonia"] = "CM:91/8%", ["Quake"] = "UT:232/34%UB:83/30%RM:438/65%", ["Zargrax"] = "UB:215/27%UM:397/42%", ["Jymreaper"] = "CM:32/13%", ["Rumage"] = "CM:184/18%", ["Pappy"] = "CM:126/11%", ["Neoo"] = "CM:36/3%", ["Hallar"] = "CM:148/13%", ["Mcdroo"] = "RM:454/72%", ["Dods"] = "UM:456/47%", ["Jodyfroster"] = "RB:489/65%RM:660/72%", ["Cosmiccupid"] = "CM:57/4%", ["Márianne"] = "EB:651/85%EM:836/88%", ["Sharktank"] = "CB:150/17%RM:636/70%", ["Viovio"] = "EM:684/76%", ["Beastbites"] = "CB:158/19%CM:82/7%", ["Soundwave"] = "RB:484/67%RM:600/66%", ["Snakez"] = "CM:119/10%", ["Notional"] = "RM:485/53%", ["Bearmace"] = "EB:596/89%EM:872/91%", ["Nundead"] = "EB:500/77%EM:813/91%", ["Nightprowler"] = "CB:50/5%RM:526/55%", ["Nëk"] = "CM:33/2%", ["Elyrisa"] = "UM:338/34%", ["Tanada"] = "CM:27/0%", ["Bulkstorage"] = "UM:278/27%", ["Splinter"] = "RM:243/58%", ["Shifta"] = "CM:72/6%", ["Ris"] = "RM:637/71%", ["Yourahunt"] = "UB:284/35%RM:590/63%", ["Pharque"] = "RB:574/73%RM:704/74%", ["Mypaladin"] = "CT:99/9%CB:154/17%RM:538/59%", ["Zalarielle"] = "UT:111/41%UB:322/42%UM:295/30%", ["Ezekial"] = "RT:359/50%RB:536/71%RM:585/62%", ["Halö"] = "EB:555/77%EM:745/81%", ["Buckrogers"] = "CM:179/16%", ["Metatron"] = "CM:123/10%", ["Shallox"] = "EM:746/81%", ["Kakusu"] = "CM:164/16%", ["Narxian"] = "RB:556/73%EM:853/88%", ["Drpepp"] = "CM:42/3%", ["Hashtagurmom"] = "UB:281/36%UM:396/42%", ["Swing"] = "EB:671/87%LM:922/95%", ["Zwwhunt"] = "UM:296/29%", ["Rathoum"] = "RM:161/50%", ["Mediumheals"] = "UB:307/40%RM:656/72%", ["Maddi"] = "EB:606/80%RM:560/62%", ["Jacein"] = "RB:555/74%EM:732/79%", ["Aleshu"] = "CB:11/12%EM:599/78%", ["Retrø"] = "EB:695/94%LM:907/95%", ["Azoth"] = "EB:711/89%EM:897/91%", ["Wangjangle"] = "CM:242/24%", ["Oatiis"] = "RB:472/65%EM:760/83%", ["Zulgan"] = "CM:63/8%", ["Duckduckouss"] = "EB:637/83%EM:774/83%", ["Finbar"] = "CM:70/9%", ["Dwest"] = "UM:338/35%", ["Yeva"] = "UM:342/35%", ["Maluy"] = "RB:455/58%EM:748/78%", ["Unakrynj"] = "EB:514/75%EM:751/87%", ["Icelancebass"] = "RB:509/68%RM:548/60%", ["Jeffree"] = "UB:329/43%RM:532/58%", ["Zac"] = "RB:395/51%EM:741/78%", ["Yodah"] = "RB:492/65%RM:548/60%", ["Venefica"] = "RB:506/67%EM:762/82%", ["Yamumsamilf"] = "EB:691/88%EM:881/88%", ["Lucyce"] = "RT:144/58%EB:385/80%EM:637/80%", ["Cardano"] = "RB:559/73%RM:527/54%", ["Sc"] = "EB:750/94%SM:1022/99%", ["Eskodas"] = "EB:624/79%EM:900/90%", ["Lockpicks"] = "EB:669/86%EM:764/79%", ["Droo"] = "EB:571/87%EM:821/93%", ["Endorsi"] = "CB:205/24%CM:145/14%", ["Bluwaffe"] = "UM:255/26%", ["Psychoras"] = "CM:27/0%", ["Piscold"] = "CM:88/7%", ["Lexxaa"] = "RM:380/60%", ["Torosito"] = "UM:145/48%", ["Nazdreg"] = "UB:327/44%RM:615/68%", ["Loopy"] = "CM:28/0%", ["Moujin"] = "EB:715/90%LM:986/98%", ["Voluptuous"] = "UM:26/32%", ["Yehbro"] = "UM:280/29%", ["Snippey"] = "CM:179/16%", ["Thehuntard"] = "RM:485/51%", ["Cryptopsy"] = "RM:83/53%", ["Foofoo"] = "CM:176/16%", ["Sbr"] = "EB:698/93%EM:876/92%", ["Gravémind"] = "EB:745/94%LM:960/97%", ["Denham"] = "RB:480/63%RM:715/74%", ["Littleniubi"] = "UB:313/35%UM:353/36%", ["Chenweiting"] = "RB:400/50%UM:387/40%", ["Carcignoma"] = "CB:146/18%UM:426/43%", ["Tumnis"] = "RB:451/62%EM:678/75%", ["Heimdalsgate"] = "EB:642/84%EM:839/88%", ["Nimerya"] = "EM:767/81%", ["Keren"] = "CM:140/15%", ["Valanth"] = "EB:673/86%EM:911/93%", ["Foshizl"] = "UM:445/48%", ["Veltaurus"] = "CT:0/5%RB:315/60%RM:423/61%", ["Savory"] = "EB:669/87%LM:954/97%", ["Auganzar"] = "CM:159/17%", ["Shrowd"] = "RM:648/71%", ["Tsarcastic"] = "RM:602/64%", ["Juggs"] = "UM:307/31%", ["Trueassassin"] = "CM:106/10%", ["Nalthandir"] = "UM:281/27%", ["Renlethe"] = "UM:290/30%", ["Shugoo"] = "RM:475/74%", ["Pvozz"] = "CM:175/17%", ["Holy"] = "EM:691/76%", ["Tanknathal"] = "RM:500/71%", ["Stankfang"] = "UB:206/25%CM:32/2%", ["Cybershots"] = "CM:30/1%", ["Havsome"] = "UB:215/27%EM:792/82%", ["Jockstrap"] = "UM:295/29%", ["Kittycut"] = "EM:716/87%", ["Adganson"] = "UM:248/25%", ["Lovegood"] = "CM:234/24%", ["Oneytuha"] = "UM:260/26%", ["Mojave"] = "RM:581/64%", ["Kreemie"] = "ET:725/90%EB:659/90%EM:826/90%", ["Jerkterk"] = "RM:236/57%", ["Helpmate"] = "RM:503/55%", ["Samai"] = "CM:98/7%", ["Bartimer"] = "RM:478/52%", ["Tendara"] = "UM:313/31%", ["Viktim"] = "UB:332/42%UM:397/40%", ["Trademe"] = "RB:533/71%EM:710/77%", ["Kiirst"] = "UB:300/38%RM:651/71%", ["Pitchy"] = "UB:248/31%RM:564/58%", ["Swiftnight"] = "UB:274/34%RM:506/53%", ["Ada"] = "UB:302/39%UM:72/45%", ["Iceymidgit"] = "CT:174/23%RB:216/69%RM:352/62%", ["Peita"] = "CM:35/1%", ["Zarakem"] = "UM:19/25%", ["Lilsirri"] = "RM:133/51%", ["Lofihiphop"] = "CM:169/17%", ["Borgan"] = "UM:277/28%", ["Niblik"] = "CM:243/24%", ["Slashdmg"] = "CB:225/24%RM:604/65%", ["Gymbrat"] = "EB:641/81%EM:789/83%", ["Killmenow"] = "EB:590/75%EM:845/87%", ["Firepisces"] = "UM:454/46%", ["Shadowind"] = "UT:124/47%EB:645/83%EM:891/91%", ["Eucalyptus"] = "EB:645/88%EM:717/79%", ["Fot"] = "CB:72/6%UM:456/49%", ["Mersadion"] = "EB:530/77%EM:808/90%", ["Xandred"] = "RB:429/59%RM:536/59%", ["Azshura"] = "EB:587/77%RM:673/74%", ["Steezzee"] = "UB:224/28%RM:531/60%", ["Dethonie"] = "EB:621/81%RM:636/70%", ["Ballbags"] = "EB:645/81%EM:895/92%", ["Nitemonq"] = "EB:561/78%UM:64/36%", ["Dust"] = "CB:47/5%RM:555/59%", ["Wifi"] = "CB:73/6%CM:244/24%", ["Florielle"] = "EM:871/86%", ["Obeseik"] = "UM:308/31%", ["Felucianna"] = "RM:637/68%", ["Ultima"] = "EB:610/80%EM:754/81%", ["Reflow"] = "EB:550/76%RM:485/53%", ["Trikia"] = "RB:487/65%RM:471/51%", ["Piccolo"] = "RB:282/54%RM:541/70%", ["Theknowing"] = "RB:401/62%RM:490/70%", ["Vizer"] = "EB:577/80%RM:463/50%", ["Jorlann"] = "ET:384/75%EB:605/86%RM:241/54%", ["Lailian"] = "EB:597/83%RM:364/62%", ["Strongârm"] = "CB:48/3%", ["Vashinda"] = "RM:524/73%", ["Notavendor"] = "RB:462/61%RM:497/55%", ["Jaen"] = "RM:583/64%", ["Cheesetop"] = "CM:117/10%", ["Serratura"] = "EB:625/81%EM:851/88%", ["Xxexcite"] = "EB:699/88%LM:939/95%", ["Indubitably"] = "LB:733/96%EM:890/93%", ["Beregron"] = "UT:215/28%EB:710/91%LM:941/96%", ["Grodney"] = "CM:55/4%", ["Seck"] = "UB:348/43%RM:602/64%", ["Dragonj"] = "UB:402/49%RM:676/72%", ["Hargalaa"] = "UB:403/49%RM:521/72%", ["Boomhoof"] = "RB:418/57%RM:596/66%", ["Nenenene"] = "RM:527/54%", ["Malakina"] = "UB:347/40%RM:634/68%", ["Cortex"] = "CM:70/5%", ["Viessa"] = "CM:161/16%", ["Gibbysan"] = "CM:248/23%", ["Aravei"] = "CM:65/5%", ["Seleris"] = "CM:30/1%", ["Meelka"] = "EB:660/88%EM:780/89%", ["Manox"] = "UM:85/39%", ["Toxxolous"] = "CM:97/12%", ["Mefistofeles"] = "CB:86/10%RM:516/53%", ["Eraden"] = "CB:82/9%CM:171/17%", ["Puwpuw"] = "EB:709/91%EM:744/80%", ["Introduction"] = "UM:308/31%", ["Axemark"] = "EM:844/87%", ["Norah"] = "CB:49/3%CM:119/10%", ["Keken"] = "UM:324/32%", ["Persephome"] = "CM:28/0%", ["Petina"] = "EB:555/77%EM:852/90%", ["Bueller"] = "CB:30/2%CM:147/16%", ["Blackguard"] = "CM:121/14%", ["Frostty"] = "EB:604/77%EM:760/80%", ["Pixietrout"] = "EB:581/76%EM:726/75%", ["Waxypotato"] = "RM:565/60%", ["Shallow"] = "UB:327/41%UM:393/40%", ["Shîttits"] = "CM:26/0%", ["Jockr"] = "EM:803/83%", ["Golactikus"] = "RM:405/69%", ["Lustër"] = "UB:224/28%UM:339/35%", ["Parrinu"] = "CM:90/7%", ["Markymarks"] = "CB:28/1%RM:520/55%", ["Huntforyou"] = "UB:369/47%RM:644/69%", ["Tamm"] = "RM:272/60%", ["Rustysink"] = "UM:434/45%", ["Cabernet"] = "EB:562/78%EM:793/86%", ["Breezey"] = "EB:496/81%EM:571/79%", ["Stankchungus"] = "UB:268/29%UM:324/32%", ["Padd"] = "UB:259/32%UM:432/44%", ["Felcursed"] = "UM:396/40%", ["Boats"] = "RB:558/73%EM:809/84%", ["Darthshadowz"] = "CM:156/15%", ["Altherial"] = "RM:132/51%", ["Finalpam"] = "CM:98/8%", ["Beubonic"] = "CM:136/13%", ["Gayfornature"] = "RM:347/63%", ["Houseparty"] = "CM:95/8%", ["Ragequitz"] = "RB:565/72%EM:756/80%", ["Vizz"] = "EB:605/83%EM:689/76%", ["Niff"] = "RB:369/59%EM:590/77%", ["Timswarrior"] = "UM:246/45%", ["Kneerzero"] = "UM:356/44%", ["Nabber"] = "CM:33/3%", ["Satele"] = "RM:464/68%", ["Memmy"] = "UM:274/28%", ["Lovers"] = "UM:128/26%", ["Baebae"] = "UM:300/30%", ["Shesus"] = "CM:71/5%", ["Shettick"] = "UT:79/30%EB:568/75%EM:844/89%", ["Greganus"] = "CM:165/15%", ["Mooligan"] = "RM:179/65%", ["Magicshow"] = "UM:283/29%", ["Onenightstab"] = "UM:297/30%", ["Saiesha"] = "CM:167/16%", ["Eir"] = "UB:152/37%UM:387/46%", ["Sicilia"] = "CM:9/13%", ["Stayfrosty"] = "CB:57/5%RM:553/61%", ["Farum"] = "UM:344/36%", ["Juggërnaut"] = "UM:464/48%", ["Stergios"] = "RT:169/66%RB:386/71%EM:667/80%", ["Thonatoz"] = "CM:165/16%", ["Ipy"] = "RM:253/55%", ["Hamaka"] = "UB:296/38%UM:426/46%", ["Slowmode"] = "CB:174/22%EM:822/83%", ["Majoop"] = "UB:362/46%RM:652/69%", ["Wardork"] = "EB:671/91%EM:826/88%", ["Erikdarkmoor"] = "UB:355/41%RM:605/65%", ["Rodario"] = "CM:60/9%", ["Hugoballs"] = "UB:363/48%RM:577/64%", ["Melarias"] = "CM:163/17%", ["Catapult"] = "EB:592/77%EM:804/84%", ["Ivywinters"] = "UB:348/40%EM:717/76%", ["Vudul"] = "RM:400/66%", ["Moxee"] = "EB:489/80%EM:848/94%", ["Aika"] = "RB:550/70%UM:402/41%", ["Dairyfarm"] = "EB:539/84%EM:723/87%", ["Raedel"] = "UB:298/33%UM:155/30%", ["Ishamoo"] = "RB:513/71%UM:406/43%", ["Ski"] = "LB:728/96%EM:784/85%", ["Ilsinll"] = "RM:494/52%", ["Niubi"] = "RB:426/54%CM:95/9%", ["Joru"] = "EB:407/75%RM:206/54%", ["Huntingpet"] = "CB:147/18%EM:900/90%", ["Spazmcgee"] = "EB:674/90%EM:816/90%", ["Ironbull"] = "EB:628/85%EM:754/82%", ["Emfourthree"] = "EB:603/79%EM:902/92%", ["Sarlo"] = "UM:430/46%", ["Arragone"] = "RM:301/57%", ["Sebrina"] = "CM:28/1%", ["Fookmefooku"] = "CM:202/20%", ["Malais"] = "RB:434/59%RM:659/73%", ["Fren"] = "CB:60/6%RM:486/53%", ["Tranquilfury"] = "RM:363/55%", ["Bridgebaby"] = "CM:148/14%", ["Pseudonymous"] = "UM:284/27%", ["Zahear"] = "UB:353/47%RM:615/67%", ["Resentful"] = "UB:279/36%RM:662/73%", ["Silman"] = "EB:670/86%EM:811/84%", ["Lennia"] = "CB:56/5%CM:150/13%", ["Cyndane"] = "RM:500/53%", ["Wehaz"] = "UM:135/44%", ["Drgreen"] = "CM:28/0%", ["Aire"] = "CM:217/21%", ["Xsting"] = "CB:33/3%CM:57/7%", ["Stergio"] = "UT:103/40%RB:370/50%UM:332/37%", ["Tyrandra"] = "CM:150/14%", ["Tuppie"] = "CM:34/1%", ["Yüki"] = "RM:350/61%", ["Frostickle"] = "CB:30/1%EM:846/89%", ["Leucas"] = "UB:367/46%RM:620/66%", ["Classicwar"] = "UB:400/48%RM:618/66%", ["Iamcrystal"] = "RB:425/58%RM:561/62%", ["Shortfuse"] = "RM:348/57%", ["Lellen"] = "UM:475/48%", ["Shadów"] = "CM:25/5%", ["Poorjim"] = "EB:667/86%LM:933/95%", ["Redzilla"] = "UB:353/45%RM:675/72%", ["Erkz"] = "UM:437/45%", ["Karo"] = "CM:198/19%", ["Ships"] = "UB:333/38%UM:447/46%", ["Frodoflaggin"] = "CB:43/4%UM:295/30%", ["Nixxy"] = "EB:542/78%EM:657/82%", ["Icymage"] = "RB:460/61%EM:784/84%", ["Viejafea"] = "CB:32/2%RM:482/51%", ["Careful"] = "EM:843/90%", ["Trishy"] = "UB:329/42%UM:333/35%", ["Burnedice"] = "RB:502/67%EM:739/75%", ["Camnomis"] = "EB:659/85%EM:922/94%", ["Tush"] = "CM:30/1%", ["Remulostits"] = "EB:667/90%EM:855/91%", ["Loisgriffin"] = "RB:524/66%EM:731/77%", ["Averetta"] = "CM:28/0%", ["Cummins"] = "CB:111/13%RM:579/62%", ["Spurs"] = "CB:87/10%RM:672/71%", ["Aeon"] = "UB:282/31%UM:491/45%", ["Eito"] = "RB:413/52%RM:484/51%", ["Tooploop"] = "RM:381/60%", ["Spoonzz"] = "RM:661/69%", ["Killnnikk"] = "CM:146/13%", ["Mydnhyt"] = "RB:294/67%RM:410/70%", ["Slurpee"] = "CM:25/0%", ["Dadiao"] = "CB:64/7%CM:41/6%", ["Kaitou"] = "CM:163/16%", ["Fearywarrior"] = "RB:391/61%EM:644/81%", ["Sanchurro"] = "CB:85/10%CM:65/6%", ["Mawaboo"] = "CM:87/7%", ["Daybreyk"] = "RB:290/64%RM:493/70%", ["Dentessa"] = "UM:290/30%", ["Pakpao"] = "UM:276/49%", ["Gritzgore"] = "UB:282/31%UM:471/49%", ["Amarindia"] = "UM:439/47%", ["Impii"] = "CB:142/17%UM:247/25%", ["Chocolats"] = "RB:455/62%RM:662/73%", ["Alàe"] = "RB:222/52%RM:502/71%", ["Keiser"] = "RB:142/51%EM:488/87%", ["Whatsadot"] = "RB:443/57%RM:700/73%", ["Valtori"] = "CM:39/2%", ["Ferrocide"] = "EM:518/79%", ["Ehudd"] = "EM:492/75%", ["Ravenclawed"] = "RB:383/73%RM:384/68%", ["Fear"] = "UM:251/25%", ["Reknaw"] = "EM:647/81%", ["Grahams"] = "EB:639/90%SM:987/99%", ["Oranacus"] = "UB:115/32%CM:175/17%", ["Cliftonios"] = "CB:194/20%UM:345/35%", ["Loneokami"] = "RM:209/69%", ["Clêavage"] = "EM:593/78%", ["Kreemy"] = "EB:492/83%RM:560/62%", ["Vanake"] = "CM:26/0%", ["Sampriest"] = "UB:287/37%RM:559/62%", ["Dustie"] = "UM:348/44%", ["Drefamir"] = "CM:59/7%", ["Necroscope"] = "CM:124/12%", ["Kronicklock"] = "EB:660/85%EM:781/81%", ["Scma"] = "UB:214/27%", ["Kintyre"] = "CM:64/5%", ["Stabbiboi"] = "EB:673/85%EM:886/90%", ["Soulshadows"] = "RB:501/65%RM:553/57%", ["Kyupelix"] = "UB:350/43%UM:441/46%", ["Mhoose"] = "RB:398/54%RM:459/51%", ["ßòó"] = "RB:545/70%EM:871/86%", ["Thranos"] = "CM:39/3%", ["Manadan"] = "EB:621/79%EM:702/75%", ["Rutharsche"] = "RB:578/74%EM:734/77%", ["Valentina"] = "EB:648/85%EM:890/92%", ["Lasui"] = "CM:161/16%", ["Fairyvon"] = "EB:601/83%EM:814/88%", ["Fearyvon"] = "UB:258/33%UM:201/25%", ["Greedyknife"] = "CT:147/18%RB:447/60%RM:513/55%", ["Chunks"] = "CM:149/13%", ["Brotard"] = "RB:454/59%RM:661/70%", ["Grim"] = "CM:61/4%", ["Maxpaua"] = "RM:500/55%", ["Oceania"] = "CM:214/21%", ["Fleet"] = "RM:225/54%", ["Milkshakers"] = "CB:41/2%UM:331/34%", ["Freefall"] = "CM:143/14%", ["Ryoux"] = "RB:274/69%RM:264/65%", ["Drunkeldore"] = "CB:28/2%CM:56/4%", ["Smallchips"] = "RB:390/50%RM:533/56%", ["Dorfie"] = "RB:351/56%RM:384/60%", ["Vonballin"] = "RM:481/53%", ["Delaynomore"] = "CM:74/6%", ["Yaguar"] = "CB:96/11%UM:359/38%", ["Gadz"] = "CM:108/10%", ["Carth"] = "EB:557/82%LM:911/96%", ["Whispering"] = "CM:59/4%", ["Jekobi"] = "CB:56/5%EM:693/76%", ["Thrillpapi"] = "UM:396/40%", ["Aeldor"] = "UM:274/27%", ["Notheface"] = "EB:667/90%EM:906/94%", ["Icetab"] = "RM:670/71%", ["Cascayde"] = "RM:641/68%", ["Urbs"] = "RM:677/70%", ["Kennea"] = "RM:108/60%", ["Club"] = "EM:852/92%", ["Smasha"] = "RM:286/50%", ["Padma"] = "RB:486/67%RM:561/61%", ["Critnyspears"] = "CM:227/23%", ["Miranda"] = "UB:237/29%UM:394/40%", ["Akamage"] = "EB:660/86%EM:858/90%", ["Rastillin"] = "RB:472/63%EM:707/77%", ["Snuzz"] = "EB:541/75%LM:929/96%", ["Msmuddle"] = "CB:45/4%RM:487/53%", ["Girthie"] = "RB:435/54%RM:423/64%", ["Wyldfyre"] = "EB:617/81%EM:824/87%", ["Kisskiss"] = "CB:76/9%EM:720/76%", ["Emeralddream"] = "UM:262/26%", ["Mayle"] = "UM:466/47%", ["Eudne"] = "CM:112/11%", ["Naes"] = "UM:396/40%", ["Lilgobicourt"] = "UM:394/43%", ["Zargrogrind"] = "RM:520/55%", ["Misary"] = "UM:91/47%", ["Nikaja"] = "UM:313/32%", ["Skewwr"] = "CM:164/15%", ["Barelylethal"] = "RB:495/68%UM:202/46%", ["Moovova"] = "CM:214/20%", ["Aesthesis"] = "CM:63/4%", ["Noll"] = "UM:323/33%", ["Trapa"] = "CM:25/0%", ["Koric"] = "EB:548/76%EM:824/87%", ["Idonteatpork"] = "RB:397/51%RM:711/74%", ["Barbaverde"] = "CM:131/13%", ["Merkspally"] = "RM:360/61%", ["Gòku"] = "CM:179/16%", ["Copperhead"] = "CM:202/19%", ["Hik"] = "EB:624/85%EM:790/85%", ["Lugs"] = "CM:217/21%", ["Lucidfear"] = "CM:82/8%", ["Grimsbane"] = "UB:259/28%RM:548/58%", ["Greengorby"] = "RB:403/51%RM:603/65%", ["Grimble"] = "EB:586/77%EM:774/83%", ["Ey"] = "CM:229/23%", ["Gobsham"] = "RB:330/59%EM:613/77%", ["Sectumsempra"] = "UM:115/40%", ["Stabysarus"] = "CB:153/18%RM:648/61%", ["Gimbooze"] = "CB:28/1%UM:318/31%", ["Cris"] = "CB:116/14%UM:430/46%", ["Aelita"] = "UB:194/49%RM:415/65%", ["Missgivings"] = "CB:172/21%CM:148/13%", ["Dwarfrogue"] = "CM:58/4%", ["Drippie"] = "CM:198/18%", ["Highnus"] = "UM:322/33%", ["Motion"] = "UM:271/28%", ["Rudol"] = "EM:748/81%", ["Scharla"] = "EB:725/92%LM:946/95%", ["Ghôst"] = "EB:727/93%LM:975/98%", ["Blondebeard"] = "EM:584/77%", ["Sli"] = "RB:547/72%EM:836/83%", ["Introspect"] = "CB:54/5%RM:559/58%", ["Pompom"] = "UB:261/32%RM:620/66%", ["Kairn"] = "CM:26/0%", ["Octivia"] = "UB:290/35%RM:618/66%", ["Povo"] = "CB:184/22%RM:504/54%", ["Mash"] = "CB:126/13%UM:345/36%", ["Gnomatter"] = "UB:322/41%EM:853/87%", ["Dohp"] = "RB:527/73%RM:647/72%", ["Bazok"] = "RB:387/50%EM:769/80%", ["Darkminista"] = "CB:39/3%CM:26/0%", ["Xar"] = "UB:207/26%UM:358/38%", ["Nixit"] = "EB:591/75%EM:752/79%", ["Cortanä"] = "UB:56/37%", ["Runea"] = "RB:467/70%EM:556/75%", ["Spiritualmoo"] = "UB:104/36%UM:197/40%", ["Redmist"] = "CB:87/10%CM:106/11%", ["Rokstonewall"] = "UB:197/37%RM:466/68%", ["Teejaayy"] = "UB:284/36%RM:604/66%", ["Amista"] = "CM:90/7%", ["Eggwhite"] = "CM:207/20%", ["Frankinmoon"] = "CB:116/14%CM:226/23%", ["Killabeez"] = "CB:157/16%RM:572/61%", ["Beatin"] = "CB:222/23%RM:507/53%", ["Themes"] = "UB:294/33%EM:800/84%", ["Chronus"] = "UM:347/36%", ["Eldaren"] = "CB:49/9%", ["Lional"] = "CM:153/13%", ["Malinche"] = "UM:408/42%", ["Rhio"] = "EM:767/80%", ["Nightmother"] = "UB:186/49%RM:475/69%", ["Endisclose"] = "RB:451/68%EM:615/79%", ["Holywand"] = "UM:44/40%", ["Slèépy"] = "CM:44/3%", ["Ales"] = "RB:384/52%EM:786/85%", ["Moorence"] = "UM:264/47%", ["Fountain"] = "CM:129/12%", ["Gospel"] = "EB:567/79%EM:804/87%", ["Hakon"] = "EB:700/93%EM:779/84%", ["Buttlust"] = "UM:129/33%", ["Ancalasue"] = "UM:302/31%", ["Bettega"] = "RM:124/61%", ["Kcmatt"] = "CM:92/9%", ["Shards"] = "RM:586/64%", ["Akujin"] = "RM:568/60%", ["Shibata"] = "CM:99/21%", ["Schwifty"] = "EB:594/82%EM:860/90%", ["Littlenuke"] = "UM:355/37%", ["Snakejay"] = "EM:539/78%", ["Azlan"] = "RM:530/56%", ["Sylaura"] = "CM:36/2%", ["Sunniesideup"] = "CM:31/1%", ["Famsquad"] = "CM:247/24%", ["Valorina"] = "RB:415/56%RM:616/69%", ["Turdi"] = "CM:166/16%", ["Noom"] = "UM:404/44%", ["Carbyfed"] = "RB:552/70%RM:603/65%", ["Octivian"] = "UB:362/42%UM:466/49%", ["Daargonfel"] = "RM:559/62%", ["Kronick"] = "UM:377/40%", ["Bundari"] = "UB:261/28%CM:119/14%", ["Kneehum"] = "CM:172/23%", ["Placeholdil"] = "CM:70/5%", ["Aspir"] = "CM:114/10%", ["Drilldunbelt"] = "CB:35/4%RM:711/66%", ["Mydogsimba"] = "CB:86/10%UM:279/28%", ["Syrup"] = "CB:82/8%RM:539/59%", ["Driza"] = "CB:37/4%CM:90/11%", ["Leafygreenz"] = "RT:331/50%RB:348/66%EM:615/82%", ["Tixa"] = "CM:31/1%", ["Buerre"] = "CM:53/3%", ["Glorf"] = "EB:706/90%EM:919/93%", ["Alalena"] = "CB:132/16%UM:288/29%", ["Swandog"] = "RB:494/66%RM:527/58%", ["Kalley"] = "CM:132/11%", ["Manky"] = "UM:417/43%", ["Photons"] = "UB:247/31%UM:276/28%", ["Ozymandias"] = "CM:190/20%", ["Garg"] = "UB:269/33%RM:676/72%", ["Okatou"] = "RB:419/58%RM:565/63%", ["Hpdonor"] = "CB:27/0%CM:153/14%", ["Sharde"] = "CB:147/18%CM:115/16%", ["Miharu"] = "CM:82/7%", ["Cesa"] = "LB:750/97%LM:910/95%", ["Kethe"] = "UB:349/40%UM:409/42%", ["Melchan"] = "RB:423/58%RM:633/70%", ["Grogz"] = "UM:417/45%", ["Fenikz"] = "EB:588/77%RM:699/74%", ["Hestia"] = "UM:257/26%", ["Unfallen"] = "RB:415/64%EM:784/89%", ["Nink"] = "RB:414/52%RM:591/63%", ["Scroto"] = "UM:302/29%", ["Cubyatwo"] = "CB:113/12%RM:530/59%", ["Diremaul"] = "EM:596/78%", ["Boneyem"] = "CM:104/9%", ["Fâtâlity"] = "RB:440/67%EM:726/89%", ["Gomad"] = "RM:498/54%", ["Auukward"] = "RT:472/62%EB:582/77%RM:587/61%", ["Ronindex"] = "EB:648/88%EM:857/91%", ["Nacnac"] = "LB:716/96%EM:687/86%", ["Flane"] = "RB:276/63%RM:355/60%", ["Bowsmage"] = "UM:235/32%", ["Kitchna"] = "CM:194/18%", ["Wun"] = "EB:683/86%EM:934/93%", ["Spikeme"] = "CB:115/14%RM:523/57%", ["Legacy"] = "RB:393/68%EM:726/84%", ["Lewstherinn"] = "CB:147/18%RM:448/51%", ["Ozwald"] = "UB:264/33%RM:553/59%", ["Vajra"] = "UB:229/27%RM:494/52%", ["Miak"] = "UM:246/25%", ["Orias"] = "UB:232/29%EM:725/77%", ["Vayl"] = "EB:433/76%RM:465/73%", ["Larace"] = "CM:35/2%", ["Jagernaut"] = "RM:350/60%", ["Nep"] = "CB:46/4%EM:778/76%", ["Sneakysnitch"] = "CB:26/0%UM:302/31%", ["Thoridal"] = "RB:536/71%EM:875/88%", ["Fisttre"] = "RM:641/68%", ["Mcmuffle"] = "EB:578/76%EM:761/77%", ["Bubbleosevn"] = "EM:765/83%", ["Spacemans"] = "RB:428/56%EM:781/82%", ["Beardyboi"] = "CM:43/2%", ["Sabery"] = "CM:30/1%", ["Flooci"] = "CM:82/7%", ["Boundini"] = "UM:227/31%", ["Nelwenie"] =
common_corpus
{'identifier': 'https://github.com/dfbb/iWclPlayerScore/blob/master/Data/5010.lua', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '', 'title': 'iWclPlayerScore', 'creator': 'dfbb', 'language': 'Lua', 'language_type': 'Code', 'word_count': '20000', 'token_count': '139711', '__index_level_0__': '36546', 'original_id': 'b5cdec374522c8baf2249b90cb797c6a9b7b05f6cbd17ba0d0fd2448f8f12b83'}