text
stringlengths 1
2.15M
| meta
dict |
|---|---|
Q:
How do I use the "Barbara, Celarent, … etc." mnemonic?
Medieval logicians memorized this most famous logic mnemonic:
Barbara, Celarent, Darii, Ferio ← direct first figure
Baralipton, Celantes, Dabitis, Fapesmo, Frisesomorum ← indirect first figure
Cesare, Camestres, Festino, Baroco ← second figure
Darapti, Felapton, Disamis, Datisi, Bocardo, Ferison ← third figure
The 3 vowels of each name tell what the major, minor, and conclusion are; each vowel corresponds to one of 4 possibilities from the square of opposition:
So Barbara is an AAA syllogism, e.g.:
Every man is an animal.
Every animal is a creature.
∴ Every man is a creature.
There is more to the mnemonic than this. Apparently the consonants in the names allow one to reduce the corresponding syllogism to that of a simpler figure.
Are there any references that overview how to fully use all that is packed into this very elaborate, well-thought-out mnemonic?
A:
A good introduction is the second volume of Gabbay & Woods (2008), Handbook of the History of Logic, where you'll find the mnemonics explained on pp 331ff. The mnemonics themselves seems to have originated in 13th century textbooks. For the original, see: de Rijk (1967), Logica Modernorum, vol 2, pp 362ff. I would also recommend Kretzmann, Kenny & Pinborg's Cambridge History of Later Medieval Philosophy: Together with Gabbay this will give you a couple of hundred pages on the development of mediaeval logic, but it will also show you that it was rather more sophisticated than just an mnemonic which you could apply blindly. For even more detail see: Parry & Hacker (1991), Aristotelian Logic, which seems to give a very comprehensive exposition (I have only skimmed this, though).
Unlike @jobermark, I find classical logic an endlessly fascinating topic (I am in no way an expert, though). The value in studying it? Partly seeing the development of an extremly sophisticated system over hundreds of years, partly experiencing the strain between the formal system and that which it is trying to formalize. I would not, however, recommend it as an alternative to modern logic; much less as a guide on how to think. For a very readable comparison with modern logic, see Jan Lukasiewicz (1957), Aristotle's Syllogistic from the Standpoint of Modern Formal Logic. And while you will often find a very polemical stance in 19th and 20th century philosophy, Karl Menger, »The New Logic« (in Sarkar (1996): Logical Empirism at its Peak) presents a rather nuanced motivation for modern logic.
A:
Explanation of the Mnemonic
Brody, Boruch A. "Logical Terms, Glossary of." Encyclopedia of Philosophy. Ed. Donald M. Borchert. 2nd ed. Vol. 5. Detroit: Macmillan Reference USA, 2006. 533-560. Gale Virtual Reference Library. Web. 19 May 2016.:
mnemonic terms
The names that the medieval logicians introduced for the valid syllogisms. One such term is "Barbara." The key for these mnemonics is as follows: The three vowels respectively indicate the three constituent propositions of the syllogism as A, E, I, or O. For first-figure syllogisms the initial consonants are arbitrarily the first four consonants; for the other figures the initial consonants indicate to which of the first-figure syllogisms the syllogism in question may be reduced. Other consonants occurring in second-, third-, and fourth-figure mnemonics indicate the operation that must be performed on the proposition indicated by the preceding vowel in order to reduce the syllogism to a first-figure syllogism. The key for this is as follows: "s" indicates simple conversion, "p" indicates conversion per accidens, "m" indicates metathesis (interchanging of the premises), "k" indicates obversion, and "c" indicates convertio syllogism (that is, the syllogism is to be reduced indirectly). In mnemonic terms the only meaningless letters are "r," "t," "l," "n," and noninitial "b" and "d." More elaborate mnemonics have been devised for syllogisms in which two or more of the premises exhibit modality. See entry "Logic, Traditional."
Mnemonic Terms
Name Figure Major Minor Conclusion
premise premise
Barbara first A A A
Baroco second A O O
Bocardo third O A O
Bramantip fourth A A I
Camenes fourth A E E
Camestres second A E E
Celarent first E A E
Cesare second E A E
Darapti third A A I
Darii first A I I
Datisi third A I I
Dimaris fourth I A I
Disamis third I A I
Felapton third E A O
Ferio first E I O
Ferison third E I O
Fesapo fourth E A O
Festino second E I O
Fresison fourth E I O
Reduction
So, what are the different types of reduction mentioned above?
simple conversion
conversion per accidens
metathesis (interchanging the premises)
obversion
convertio syllogism (indirect conversion)
reduction of syllogisms
The process whereby syllogisms in imperfect figures are expressed in the first figure. Reduction is direct when the original conclusion follows from premises in the first figure derived by conversion, obversion, etc., from premises in an imperfect figure. Reduction is indirect when a new syllogism is formed which establishes the validity of the original conclusion by showing the illegitimacy of its contradictory. See entry "Logic, Traditional."
conversion
In traditional logic, a type of immediate inference in which from a given proposition another proposition is inferred that has as its subject the predicate of the original proposition and as its predicate the subject of the original proposition (the quality of the proposition being retained). The process of conversion yields an equivalent proposition only when the original proposition is an E- or I-proposition; when it is an A-proposition traditional logicians allowed for conversion per accidens (or by limitation)—that is, conversion plus a change in the quantity of the proposition from universal to particular. Thus, the E-proposition "No men are immortal" yields "No immortals are men," but the A-proposition "All men are mortal" can be converted only by limitation, yielding "Some mortals are men." The process of conversion yields no equivalent proposition if the original proposition is an O-proposition. See entry "Logic, Traditional."
obversion
In traditional logic, a type of immediate inference in which from a given proposition another proposition is inferred whose subject is the same as the original subject, whose predicate is the contradictory of the original predicate, and whose quality is affirmative if the original proposition's quality was negative and vice versa. Obversion of a proposition yields an equivalent proposition when applied to all four types (A, E, I, and O) of propositions that traditional logicians considered. See entry "Logic, Traditional."
|
{
"pile_set_name": "StackExchange"
}
|
Welcome to QPR REPORT - A completely unofficial and unaffiliated fan site focusing on G-d's Chosen Team, Queen's Park Rangers (QPR) FC. (Visit also QPR Report Messageboard and Follow on Twitter.) QPR Report accepts no sponsorship, advertising or financial contributions. In 2008, QPR Report was named as one of the top two blogs in the Football League
QPR Report Twitter Feed
Thursday, February 25, 2010
QPR Report Snippets Thursday
- For comprehensive and latest QPR news-related pieces and discussion, visit the football-only, somewhat-different QPR Report Messageboard. All QPR Perspectives genuinely welcomed! Or comment on any of the articles posted below
WARNOCK POST ASTON-VILLA GAME COMMENTSWarnock coy over Palace futurePublished: Wednesday, 24 February 2010, 11:33PMCrystal Palace manager Neil Warnock again made little comment about his future after the 3-1 FA Cup defeat at Aston Villa amid speculation he is bound for QPR. Warnock did confirm that he will be in charge of Palace for Saturday's game at Doncaster but the former Sheffield United boss was giving very little away. He said: "This could have been my last game - but it won't be and we'll now get ready for Doncaster. "Can I deny speculation about going to QPR? No." ITV
Crystal Palace manager Neil Warnock insists the FA Cup defeat to Aston Villa will not be his last game in charge.
The financially-stricken Eagles went down 3-1 at Villa Park, although they put in a spirited display and equalised in the second half thanks to a Darren Ambrose penalty.
With Warnock continually linked with a move to Queens Park Rangers, it had been rumoured that the fifth-round replay would be his last as Palace boss.
However, while not denying the Rangers link, he says he will still be at the helm for the Doncaster clash at the weekend.- "This could have been my last game, but it won't be and we'll now get ready for Doncaster," he said.- "Can I deny speculation about going to QPR? No."...."Skysports
BBC/Steve Claridge re Neil Warnock, Crystal Palace and QPR - Ask Steve Claridge Crystal Palace have slipped into the Championship relegation zone since going into administration and being docked 10 points at the end of January and their manager Neil Warnock is being heavily linked with a move to QPR. This week I examine the Eagles' prospects, as well as those of Warnock should he decide to leave Selhurst Park to take the reins at Loftus Road....
- Do you think Crystal Palace can hold on to manager Neil Warnock and can they stay in the Championship?Steve Bidwell, England
There is lots of speculation at the moment that Warnock will be taking charge at QPR next week, which is ironic considering he could have been sacked by Palace earlier on in the season because he had an absolute nightmare start. The reason he kept his job was that he has a very good relationship with Simon Jordan, Palace's former owner, but that tie is no longer there.
I understand the appeal of changing jobs. Palace are in a precarious state after going into administration while, at QPR, they finally look like they are getting back to some sort of sanity.
So I can see Warnock going to QPR but I think it will only be under his own terms. I don't know how long he is planning to stay in the game so it might be his last hurrah if they were to give him some dough and let him make a real go of it.
If Warnock does go to Loftus Road, and it looks like he will, then Palace are in trouble. Whoever replaces him will face a difficult job to keep them up and, in the longer term, a lot will depend on where they are when they come out of administration and who owns them.Warnock is being linked with the manager's job at QPR But the biggest problem Palace have is their ground. They need to agree a decent lease or acquire Selhurst Park themselves because, if the situation continues where they are told how much they have to pay for the rent of their ground, then it will hold them back forever. Whoever takes over the club will have to resolve that as quickly as possible. BBC
QPR Official Site - AMIT Q&A ON QPR PLAYER!From season ticket prices to why he isn't the new Chairman, from improving communication with the fans to dealing with poor attendances, QPR Holdings Ltd Vice Chairman Amit Bhatia has spoken exclusively to QPR PLAYER regarding the issues which are most important to YOU!
Amit on new Chairman Ishan Saksena...- "The biggest change since the restructuring is that Ishan is now the Chairman of QPR.- "I believe he has a set of instructions and a vision for how decisions are made and how the Club should be, as well as the stability and security that should come with running a Football Club."About the new man in control...- "Ishan is somebody that I have known for a very long time, and who I have an awful amount of trust in.- "I believe that QPR needs someone who is full-time, aware to its needs and has 100 per cent commitment. It was the best decision therefore to appoint Ishan."- On taking the Club forward...- "Our vision as a family is to reintroduce stability into the Football Club. It's of great importance. An organisation cannot succeed if there's no stability at the top.- "By empowering the right people and by doing the right things we will achieve great success." To hear much more from Amit, tune into QPR Player later today where you will find the first of our three-part exclusive interview with the QPR Vice Chairman. Not registered to QPR Player? Click here to join for less than 10p a day! - QPR
|
{
"pile_set_name": "Pile-CC"
}
|
How have Stan Lee's ideas about superpowers changed as he's gotten older? In this sketch from Key & Peele, the Marvel Comics creator pitches several new characters based on his more recent frustrations and desires. »11/15/14 11:00am 11/15/14 11:00am
What do you get as a present for Stan Lee, the man who has a cameo in every Marvel movie? How about a sculpture of his face fashioned into a cameo jewel? Someone commissioned this Stan Lee cameo as a gift for Lee and you can buy one for yourself. »10/28/14 7:00pm 10/28/14 7:00pm
There's a rumor going around that Stan Lee, who has managed to cameo in almost every Marvel movie including those made by Sony and Fox, is not just playing random characters but is instead Uatu, the cosmic alien known as The Watcher. This rumor is dumb, and this compilation of Lee's cameos proves why. »10/03/14 1:20pm 10/03/14 1:20pm
Updated! Apparently Disney didn't forbid the scene, because they never saw it. Director James Gunn took to Instagram to clear up the story. It boils down to this: He shot it with a double (seen in the pic below) but before the real Stan could film it, decided it was too similar to Star-Lord's finger gag. Good call! »9/02/14 6:42am 9/02/14 6:42am
In 1963, George R. Martin (who, at that age, had yet to earn his second "R") wrote to Stan Lee and Jack Kirby in feigned praise of Fantastic Four #17, an issue he refers to, dryly, as "greater than great... absolutely stupendous, the ultimate, utmost!" Proving that even as a boy, GRRM was an acerbic, 65-year-old man. »6/15/14 3:00pm 6/15/14 3:00pm
We've seen numerous western superheroes drawn in the styles of Japanese manga artists, but what if famous Japanese characters had been designed by American artists? Jack Kirby's take on Akira might have been an American version worth looking at. »3/28/14 11:40am 3/28/14 11:40am
Three new clips from Amazing Spider-Man 2 have just dropped, complete with narration by Stan Lee. They're also complete with a pretty major spoiler for the movie if you're interested (it's in the last video below). »3/07/14 11:40am 3/07/14 11:40am
If the world seems a little grayer today, if children seem to laugh less, or if puppies and kittens look a little less cute, please don't be confused. This is merely the consequence of the devastating news that Stan Lee will somehow not have a cameo in Marvel's upcoming Guardians of the Galaxy film. »1/22/14 9:45am 1/22/14 9:45am
Playing "spot the Stan Lee cameo" is a tradition when watching Marvel movies, but in an upcoming episode of Agents of S.H.I.E.L.D., he'll be getting more than a brief shot and a quippy line. »1/07/14 10:39am 1/07/14 10:39am
Could Stephen King's The Stand become a movie at last? Stan Lee's working on a movie for Sony, details have emerged about the in-development Agent Carter series, and someone we know well is getting shot by Oliver on Arrow. Plus, there's a rumor CBS is working on two Star Trek series — but what are they about? Spoilers… »11/28/13 6:00am 11/28/13 6:00am
No one likes to think about it but there will be a day when Stan Lee’s cameos will end. He may be an indefatigable 90-year-old but the co-creator of The Fantastic Four, Hulk and Spider-Man is still only human. But, in the upcoming Lego Marvel Super-Heroes video game, Stan Lee is pretty much omnipotent. »9/10/13 4:02pm 9/10/13 4:02pm
This week in the world of cartoons, Bender is robo-jacked on Futurama, Stan Lee voices a janitor on Ultimate Spider-Man, and we are treated to the spectacular Gravity Falls season finale. »8/03/13 7:00am 8/03/13 7:00am
JADS international, makers of fine colognes inspired by the Avengers, has lost their fucking minds is releasing a cologne based on Stan Lee. The scent is called 'Nuff Said. I am not making this up. »6/12/13 3:00pm 6/12/13 3:00pm
Stan Lee has done plenty in his 90 years on this planet Earth, but now you can add "parkour master" to his titles of "creator of some of the greatest comics characters of all time" and "movie cameo star." Watch Stan jump, roll and climb his way through L.A. with skills that would even inpress Spider-Man. »3/14/13 10:30am 3/14/13 10:30am
The folks at How It Should Have Ended are pros at cooking up better, hilarious endings to blockbuster films, and Stan Lee has a tendency to show up in every Marvel movie. So what happens when the two team up to insert Stan Lee in non-Marvel movies? Let's just say there would be fewer Star Wars films in the world—and… »2/16/13 7:30am 2/16/13 7:30am
Some people get annoyed at Stan Lee's cameos in all the Marvel movies, but not me. Because I know that when Lee is filming those appearances, he's prevented from making the irrelevant, depressing, terrible, generic superhero-based projects with which he's filled the last 20 or so years of his life. Like his latest,… »11/30/12 9:00am 11/30/12 9:00am
There are many types of superhero movies: campy, dark-and-gritty, kid-friendly, gonzo, etc. But really, there are just two kinds: movies that actually have something to say about heroism and sacrifice, and ones that don't. On that basis alone, Amazing Spider-Man is a win. »7/03/12 9:00am 7/03/12 9:00am
|
{
"pile_set_name": "Pile-CC"
}
|
Clean Look from Rubbermaid
Clean Look is the range of air, surface and skin care systems launched by Rubbermaid. The range is said to feature the same coordinated look and contemporary styling for the modern washroom.
Clean Look comprises different products drawn from the Air Care, Surface Care, and newly launched Skin Care system ranges. Each dispenser is available in black, white or chrome finishes, and users can select the particular match or line-up of fittings that best suits their washroom.
The range is also said to promote good hygiene. For example, Clean Look Surface Care solutions systematically ensure both visible surfaces and out-of-view areas - such as drains and pipes, on and around toilets and urinals - are consistently clean, eliminating germs and tackling the source of bad odours. And with the Skin Care fittings, there is touch-free operation and antimicrobial technology incorporated.
|
{
"pile_set_name": "Pile-CC"
}
|
LAHORE: Principle decision of restoration of Muttahida Majlis-e-Amal (MMA) has been made in a meeting of heads of the political parties. It was informed by Jamiat Ulema Islam (JUI-F) chief Maulana Fazl-ur-Rehman in a joint press conference after a six parties meeting held at Jamat-e-Islami Headquarters, Mansoora, here on Thursday. He said the MMA will...
It was informed by Jamiat Ulema Islam (JUI-F) chief Maulana Fazl-ur-Rehman in a joint press conference after a six parties meeting held at Jamat-e-Islami Headquarters, Mansoora, here on Thursday.
He said the MMA will be restored on the previous manifesto which will be finalized by the steering committee of the religious parties and its formal announcement will be made in December meeting to be held at Karachi.
He said democratic stability in the country is important and Pakistan is unable to bear any new political mishap.
Jamat-e-Islami Ameer Sirajul Haq while addressing the media said supremacy of the law and constitution is the only way and the solution of the issues of the country.
He said elections should be held on time and delay in the election will not be acceptable. He demanded the government to restore oath regarding the Khatm-e-Nabuwwat in its real form.
Siraj said Pakistan is facing social and financial crises, adding that all issues can only be resolved through the rule of law and merit.
He said other religious parties will also be contacted.
Earlier, all recommendations given by the steering committee of the six parties were accepted by the all parties in the meeting.
It was decided that the last and final meeting will be held at Karachi which will be presided over by Shah Owais Norani and final announcement of the restoration of the MMA will be made in that meeting. - APP
|
{
"pile_set_name": "OpenWebText2"
}
|
Type of music generally:
Status:
See also:
Comparisons:
Covers/own material:
Own, occasional cover
General comments:
She's cool in a poet-with-crunchy-guitar way sort of like Ani DiFranco.
With Erin, the whole is definitely more than the sum of the parts. She's a really good musician (plays guitar and banjo, among other things), and a very clever songwriter. Not much of a voice, but it doesn't matter. Her music goes from swing to country to jazz to rock and back again, sometimes in the course of one song. She's also a very engaging performer. She's just so damned cute, you can't help but like her—but the music will be enough to get you there on its own. (meth@smoe.org)
if you have not seen her, you really really need to!! she's a brilliant musician who i think is on the brink of some serious success. amazing guitarist and ingenious songwriter. she has lately been heading in a more jazz/swing direction from her folk roots. Susan Werner calls her "post-modern swing." (Jess913@blackfoot.net)
Comments about live performance:
I have to say I was quite pleasantly surprised. Vocally she sounds a lot like Beth Orton, and her music is acoustic/electric thoughtful folk-pop. I picked up a copy of her tape, which I'm just listening to now. I'll definitely see her play again. (c. 1/99)
I'd seen her once before and she was pretty good. Her first set was songs that really don't do all that much for me, but her second set was much, much better. I think she's got a long career ahead of her, and I hope she develops into the vast potential she's showing. She really is a
good guitar player, too. (3/99)
Last night Erin McKeown played the longest, and best set I've seen her do. She played both acoustic and electric guitar, and the sound was great. She told some really amusing stories in between songs, too, including one that has forever altered the way I will hear "Blackbirds". :} It's amazing how quickly she has gone from someone I wouldn't mind missing as an opening act to someone I will drive a number of miles to see. Her command of so many different musical styles and her exceptional ability on the guitar is truly scary for someone who just turned 23. She's not to be missed if she comes to your area. (11/00)
if you get the chance to see Erin McKeown with her band, don't pass it up for ANY reason. She's great solo, but with the band...oh my god. They keep getting exponentially better every time we see them, and it's starting to get rather scary. (7/02)
What a way to begin! Erin was also accompanied by Dave Chalfant and Lorne Entress, who have been her band on those occasions when she's been able to have one. She rocks in so many different ways...and it was great to see how many people were going apeshit over her too. Thinking about how Ani DiFranco was scheduled to come onstage to end the day, I thought to myself, "Erin's the little folksinger now". She just keeps getting better and better. Her new songs are all incredible. (7/02, meth@smoe.org)
I have heard "Blackbird" before and just sort of threw it away but now I want to go back and listen to everything...she's so much fun live and has a great stage prescence that you can't help but fall in love with her and her music. Definitely worth seeing! (RocketsTail@aol.com)
I just got back from a late night at Café du Nord where I caught Erin McKeown for the first time. Erin was great. She is very dynamic, subtley playful, and short. Her promotional material: "...a guitar style somewhere between Django and G. Love." I think Django is right on the money. If you can make any of these shows, you should. At a recent live Erin McKeown show (9-Jun-2K at Rose Street in Berkeley) Erin told the audience that she tours during her breaks from college. Someone in the audience asked her what she was majoring in and she reluctantly told us, early American music. Simultaneously, everyone in the room uttered "Ohhhhhhhhhh." Obviously a primary influence in her music. (6/00, drewh@bitwise.com)
Erin lived up to some of the raves she's gotten. (12/01, mcurry@io.com)
I saw Erin McKeown last night in Santa Monica. First time seeing her full show and I enjoyed the heck out of it. Reminded me of Leslie Feist and Sarah Harmer.
Erin's got some nice guitar chops. Not flashy, but solid. However, she was running one of her guitars through various effects and a volume pedal into the soundboard and either she or the sound guy had the bass eq pumped up big time. Every time she hit the low strings, the subs in front of the stage kicked so hard that I could feel the punch throughout my body and in the
walls. The bass was so physical, I thought I was at a rock concert and it obscured whatever intricate work she was doing in the upper registers on the guitar. Her other guitar, a semi-hollow body electric, was plugged into a little amp which was mic-ed and that didn't present any low-end problems. (1/03)
I also saw Erin McKeown again this month, and came away a bit disappointed. She was only with a drummer this time, and the lack of other backing players made for a less energetic show, I thought. Her set with the full band last year was THE best concert of the year for me, and her previous solo shows had a certain intimate intensity, but this one fell well short of both experiences. Part of the problem, I think, was the audience, which didn't seem to be giving enough energy for her to feed back on. There wasn't even an encore set because the final applause petered out too quickly. Ah well. (5/04, Paul2k@aol.com)
i'm also a huge, devoted, besotted fan.
i'll admit, before the show i wasn't so sure about Sing You Sinners based on the samples. `cou cou' was a bit painful, and the rest didn't do a lot for me—i'm not usually fond of cover albums. i absolutely adore her other three major releases, having bought `grand' at the first concert when it was new, then gone back to `distillation', and having finally bought `we will become like birds' a few months ago and immediately fallen head over heels for it as always. but after the show i immediately bought my copy of SYS as well—it is fabulous! she really makes the songs intensely her own—no real surprise there.
and her new drummer is amazing. (3/07, damon)
Availability:
Ecto priority:
Group members:
Guest artists:
Comments:
I don't think it fairly compares at all, really—it's very early and unpolished. I have a cassette copy of this and I hardly ever listened to it. It's in the "better live than in the studio" category. (meth@smoe.org)
This album is subtitled Demos and Live Material 97-99 on the back, so people should know what they're getting. It's not a bad album, just a bit rough. There are some good songs, and Erin's unique sensibility is already quite developed. It's an interesting look at the early stages of a unique artist. (JoAnn Whetsell)
Produced by:
Dave Chalfant
Comments:
Years from now, when connoisseurs of fine, non-genre-specific music steeped in the various traditions of Americana look back on where it all began for Erin McKeown, they will put on this album and smile. This young woman has a stellar career ahead of her. From the whimsical "Queen of Quiet" into the driving, funky-bass-laden "Blackbirds" and on, Erin leads us through cowboy tunes to brooding singer/songwriter goodness, with stops at swing and jazz along the way. Dave Chalfant's production perfectly enhances the songs, so a listen through headphones is always a rewarding experience. I have no idea where I would file this album in a record store sorted by genre. I guess I'd just be forced to label a new bin "Brilliant" and display it prominently there. (meth@smoe.org)
it is an amazing collection of songs, a true work of art. unlike any cd you have yet heard. and of course produced by mr. dave chalfant, and with harmonies by such lovely and talented people as ms. katryna nields and ms. beth amsel. (Jess913@blackfoot.net)
If anyone hasn't been lucky enough to pick up a copy of her new album, Distillation at one of her recent shows, make a point of getting it. Outstanding stuff, and she isn't to be missed live. (cmont@rci.rutgers.edu)
Produced by:
Dave Chalfant
Comments:
I've been eagerly anticipating this one for a long time, made longer by the fact that just when Erin was finishing up recording, some new songs came to her that she just had to put on the CD, so that pushed everything back a couple months. Wouldn't you know it, two of those latecomers are the best tracks on the disc: the album-opening "Slung-Lo" and the best single song released so far this year, "Cosmopolitans."
Once again, Dave Chalfant (formerly of The Nields) is the producer, and he knows just what to do to make Erin's music shine. Like Distillation, there is a variety of styles represented on the album, from Tin Pan Alley-like ditties to power pop to all-out rockers. And of course there's a Judy Garland cover ("Lucky Day"). Judy shows up all over the album, as a matter of fact: she's mentioned by name in "Cinematic", and while she's not named in the dark, groovy "Cosmopolitans" I knew instantly that the song is about her ("advice, agents, and taped late night whiskey/tiny cups for a tiny lady/opera heels are swiftly growing indecent/and a lady in descent/falling forward towards the cosmopolitans and ladies/looking for pills in draperies").
It was clear from the first listen that this disc is going to be in my top 3 for the year, easily. It kicks every imaginable kind of ass, and was every bit worth the wait. (meth@smoe.org)
I know she has her fans here, she's one of the people I've been meaning to check out for some time, now. But...well, it's pleasant enough, I guess, but there's nothing here that really grabs me. I've listened to it several times hoping that something will leap out at me but, apart from the Go-Go-esque "Cinematic," I can't think of it as anything other than...pleasant. (adamk@zoom.co.uk)
Erin has such a unique sensibility and such varied influences, and they're all on display here on Grand. While not all of it is for everyone, there's probably something here for everyone. From the power pop to straight folk to old-fashioned blues and swing. While not all of it works for me, what does I enjoy a lot. (JoAnn Whetsell)
Release info:
Availability:
Wide
Ecto priority:
Highly recommended
Group members:
Erin McKeown—vocals, all guitars, bass on "Air", synthesizer on "We Are More", Wurlitzer on "The Golden Dream"
Guest artists:
Matt Chamberlain—drums
Sebastian Steinberg—bass
Steve Moore—piano, Wurlitzer, beautiful little sounds
David Berger—drums on "You Were Right About Everything" and "Bells and Bombs"
Juana Molina—vocals on "The Golden Dream", inimitable electronic self on "Air" and "We Are More"Peter Mulvey—vocals on "Delicate December"
Tucker Martine—drums on "Life on the Moon", all tambourines
Produced by:
Tucker Martine and Erin McKeown
Comments:
I am officially obsessed with We Will Become Like Birds. I think it has already achieved Desert Island Disc status. (meth@smoe.org)
This is far and away my favorite of Erin's albums. It has all the things I like about her music and, to put it bluntly, none of the things that annoy me. (JoAnn Whetsell)
Produced by:
Erin McKeown
Comments:
wonderful live recording of an incredible show at Joe's Pub in NYC,
which woj and I attended...does a great job capturing the experience of seeing one of the best live performers of our generation in concert (meth@smoe.org)
Love it, love it, love it. This live recording captures Erin's spirit, energy, and personality. Her studio recordings are sampled equally but so differently with the band treatments. There are also 2 new songs. Essential listening for fans. (JoAnn Whetsell)
Produced by:
Erin McKeown
Comments:
This has really grown on me. I think at first I found the songs too stylistically varied to hang together as an album. But it doesn't feel that way to me now, even though there is a lot of variety, from Monday Morning Cold-type spoken word to New Orleans jazz.
Although often billed as a political album, there are also songs about love and family. But it is Erin's most political album to date, with a number of songs ("The Politican," "The Jailer," and "Baghdad to the Bayou" most obviously) consciously addressing social and environmental justice issues. I pre-ordered and got the bonus acoustic version of the album, which I also really like, so that's worth checking out if you can find it. (JoAnn Whetsell)
DISCLAIMER: Comments and reviews in the Ectophiles' Guide are excerpted from the ecto mailing list or volunteered by members of the list. They are the opinions of music enthusiasts, not professional music critics.
Entry last updated 2017-11-28 00:18:00.
Please request permission if you wish to
reproduce any of the comments in the
Ectophiles' Guide in any context.
|
{
"pile_set_name": "Pile-CC"
}
|
I Use GitHub.app and You Should Too - bbaumgar
http://bbaumgar.svbtle.com/githubapp
======
bradleyland
I too find Git to be the kind of tool that works well through a GUI. However,
I went one step further and bought Tower [1]. In addition to the many things
that GitHub.app does, Tower takes things one step further. If you tried using
GitHub.app, but ran up against a Git activity that isn't exposed through the
app, then you should take a serious look at Tower.
One specific example is partial commits within a single file. Tower shows a
diff view of edited files that breaks edits from different regions of a single
file in to chunks. You can stage/un-stage these chunks right through the GUI.
This is very similar to `git add -p filename.ext`, but with a very nice GUI.
1: [http://www.git-tower.com](http://www.git-tower.com)
------
tiquorsj
It still has major issues. But, for many things it is absolutely better to
have a GUI.
------
mcmillion
I use SourceTree for most of these same reasons.
|
{
"pile_set_name": "HackerNews"
}
|
*To the Editor:*
To date, coronavirus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected 2.2 million people and has killed more than 150,000.[@bib1] The population groups most susceptible to severe and fatal coronavirus disease-2019 (COVID-19) are older adults and those with chronic underlying chronic medical disorders. The residents of long-term care facilities (LTCFs) typically combine those 2 features and are, thus, particularly at risk. In France, 9.4% of the population is over age 75 years and nearly 600,000 people currently reside in LTCFs for older dependent individuals. To date, more than 60% of the French LTCFs have reported at least 1 case of COVID-19 among their residents.
Estimated overall mortality among patients with COVID-19 is 10% in France but reaches up to 30% in LTCFs. There are, however, substantial differences in mortality rates between the different LTCFs. [@bib2] What explains these differences?
We intervened in 1 LTCF located in the Southern Île-de-France region that had registered more than 24 deaths related to COVID-19 among the 140 residents in 5 days. No acute respiratory distress syndrome was observed, and mortality was mainly due to hypovolemic shock. Most of the victims had been left alone in their rooms for confinement settings for many days without help because of the lack of protective masks and the work overload for caregivers affected by a 40% staff absenteeism rate. The dependent infected residents were confined and no longer received the usual assistance for drinking and eating. In addition, general practitioners stopped their physical examination visits, limiting their interventions to telemedicine, which proved unsuitable whenever feasible at all.
With appropriate resources lacking, the "disease linked to confinement" thus proved more fatal than COVID-19 itself. We did not observe this phenomenon in other LCTFs where healthcare staff and physicians were physically present in full force.
A task force team intervened as soon as the fifth death was reported. Adapted infusion to restore hydroelectrolytic balance as well as oxygen therapy per World Health Organization guidelines led to a rapid improvement of this high mortality trend.[@bib3] ^,^ [@bib4]
Disproportionate mortality because of COVID-19 in LTCFs is not a fatality. Continuous provision of pragmatic medicine and wellness care will limit the devastating impact of this infection in dependent older people.
|
{
"pile_set_name": "PubMed Central"
}
|
Grid Solutions
Grid Solutions, a division of GE, is a major solutions provider and thought leader in the effort to modernize and optimize how we generate, move and consume energy. They provide products and services that modernize the electrical grid. iST has been a partner of GE Digital Energy for more than 15 years.
|
{
"pile_set_name": "Pile-CC"
}
|
Wales + Family holidays | The Guardianhttp://www.theguardian.com/travel/wales+familyholidays
Indexen-gbGuardian News and Media Limited or its affiliated companies. All rights reserved. 2015Tue, 03 Mar 2015 19:45:45 GMT2015-03-03T19:45:45Zen-gbGuardian News and Media Limited or its affiliated companies. All rights reserved. 2015The Guardianhttp://assets.guim.co.uk/images/guardian-logo-rss.c45beb1bafa34b347ac333af2e6fe23f.pnghttp://www.theguardian.com
Mountain biking in Wales … it's time to get bold and bravehttp://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-wales
<p>How would a pair of physical cowards get on at a dedicated mountain bike park in Wales? After a two-hour private lesson, one of them became completely fearless – and it wasn’t mum</p><p>I love rain, Wales, bikes and mini-breaks. I don’t mind long drives and I haven’t spent two nights on my own with my son, Thurston, since the night he was born, and the night after, seven years ago. He hates rain, doesn’t know much about Wales, loves hotels (“I definitely think this is the best place we’ve ever been,” he said, as we arrived at the reception of Nant Ddu Lodge and someone smiled at us), is OK on a bike, and was really pleased to have a weekend away with me until he found out that there was no Wi-Fi.</p><p>We were perfect for BikePark Wales, a £1.8m mountain bike park that opened in Merthyr Tydfil in 2013 – except that we’re pathetic physical cowards, both of us. We’re like relay-jellyfish: the minute one of us gets up the courage to do anything, the other freaks out. Which is why we’re trying out the private lessons the park now offers, to see how they cope with scaredy-cat mountain biking novices.</p> <a href="http://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-wales">Continue reading...</a>Cycling holidaysWalesFamily holidaysShort breaksDay tripsTravelFri, 09 Jan 2015 06:00:10 GMThttp://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-walesPhotograph: Andrew LloydTackling a steep run in BikePark Wales. Photograph: Andrew LloydPhotograph: Andrew LloydTackling a steep run in BikePark Wales. Photograph: Andrew LloydZoe Williams2015-01-09T06:00:10ZThe Bunkhouse, near Hay-on-Wye, Powys: accommodation reviewhttp://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-review
<p>This poshed-up dormitory is full of stylish touches – and on the River Wye near the beautiful Black Mountains – but the scene-stealer is its indoor slide</p><p>Woodburner? Check. Rain showers? Yep, three of ’em. Tubular slide that hurtles you down to the ground floor like a fireman in two seconds flat? You bet!</p><p>A stainless steel chute – built to order in Germany – would not be on many people’s wishlist for a weekend retreat, but it’s bloody good fun, and for half our party of three kids and three adults (you can guess which half) <em>the</em> best thing about The Bunkhouse. It is the wackiest of many bespoke touches that make it such an original and enjoyable place.</p><p>The slide is the wackiest of the many bespoke touches that make this such a fun place</p> <a href="http://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-review">Continue reading...</a>WalesSelf-cateringHotelsGroup tripsTravelShort breaksFamily holidaysFood and drinkCottagesSat, 20 Sep 2014 06:00:10 GMThttp://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-reviewPhotograph: PRPhotograph: PRPhotograph: Michael Sinclair/PRThe lounge at the Bunkhouse – stylish, but short on privacy. Photograph: Michael SinclairPhotograph: Michael Sinclair/PRThe lounge at the Bunkhouse – stylish, but short on privacy. Photograph: Michael SinclairGavin McOwan2014-09-20T06:00:10ZThe best of the UK’s national parkshttp://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parks
To mark National Parks Week, we’ve rounded up the best ways to enjoy some of the country’s most celebrated landscapes, with expert’s tips, favourite campsites, activity guides – and our national parks picture quiz<p>Today is the start of <a href="http://www.nationalparks.gov.uk/visiting/national-parks-week-2014">National Parks Week</a>, which is celebrating the UK’s 15 national parks with hundreds of events, from rangers’ walks and wildlife watching to river rafting and pony rides. You can go <a href="http://lakedistrict.gov.uk/visiting/events">rafting or pony trekking in the Lake District</a>, have a <a href="http://www.northyorkmoors.org.uk/visiting/what-to-see-and-do/events/nym-events/teddy-bears-picnic2">teddy bears’ picnic in the North York Moors</a> or <a href="http://www.nationalparks.gov.uk/visiting/national-parks-week-2014/2014-national-parks-week-events/2014-national-parks-week-events/brecon-beacons-npw-events/dark-skies-evening">study the stars with an astronomer in the Brecon Beacons</a>.</p><p>Who better to show you around the parks than the people who live, work and play in them? We’ve asked <a href="http://www.theguardian.com/travel/series/uk-national-parks-rangers-guides">rangers from seven national parks to share their favourite beauty spots, places to eat, drink and stay</a> – and in our <a href="http://www.theguardian.com/travel/2009/jul/28/uk-national-parks-activity-guide">local experts’ guides</a>, kayakers, climbers, hikers and fishing enthusiasts recommend the best ways to get active in Britain’s great outdoors.</p> <a href="http://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parks">Continue reading...</a>United KingdomNational parksFamily holidaysDay tripsEnglandScotlandSummer holidaysWalesEnvironmentTravelEuropeMon, 28 Jul 2014 14:11:42 GMThttp://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parksPhotograph: /AlamyHope Valley below The Great Ridge, Peak District national park, Derbyshire. Photograph: AlamyPhotograph: /AlamyHope Valley below The Great Ridge, Peak District national park, Derbyshire. Photograph: AlamyGeorgia Brown2014-07-28T14:11:42ZMotorway breaks near the M3 and M4http://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidays
Heading to or from south Wales or the West Country this summer? We pick 10 places to refuel, stretch your legs and exercise fractious kids just off the M3 and M4<p></p> <a href="http://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidays">Continue reading...</a>Road tripsFamily holidaysSummer holidaysDay tripsEnglandWalesTravelTop 10sUnited KingdomSat, 05 Jul 2014 06:00:00 GMThttp://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidaysPRPRPRPRAlamyPhotograph: AlamyAlamyPhotograph: AlamyGetty ImagesPhotograph: Getty ImagesPRAlamyPhotograph: AlamyJohn Millar/National Trust ImagesVisitors at Aberdulais Falls, south Wales Photograph: John Millar/National Trust ImagesJohn Millar/National Trust ImagesVisitors at Aberdulais Falls, south Wales Photograph: John Millar/National Trust ImagesSarah Smith2014-07-05T06:00:00Z10 of the UK's best hidden beaches for the weekendhttp://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beaches
Perfect little coves, cooling plunge pools and tasty seaside caffs – Daniel Start, author of Hidden Beaches, reveals some of Britain's lesser-known coastal spots for family fun<p><strong>Good for families, food and sunsets</strong><br />Just on the outskirts of Woolacombe, this sandy cove, perfect for sunsets, has an island lookout and a beach cafe that serves up Sri Lankan curry (bring your own drinks). There are low ledges from which the older children jump, and sand made from crushed shells that seems as if it was washed in from the Caribbean. Grunta Beach is just beyond, or carry on around Morte Head to wild Rockham Bay, set just below <a href="http://www.northmortefarm.co.uk" title="">North Morte Farm campsite</a>.<br />• <em>From main Woolacombe beach, head north along the Esplanade for 300m. The cove is opposite Devon Beach Court. Barricane Beach Cafe is open May–Sept, except if raining (07969 189304). Bring a rug. Three mins walk</em></p> <a href="http://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beaches">Continue reading...</a>Beach holidaysFamily holidaysEnglandScotlandWalesTravelTop 10sThu, 22 May 2014 05:00:00 GMThttp://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beachesdanielstart.comdanielstart.comdanielstart.comdanielstart.comdanielstart.comWendy Kirkwood/PRPhotograph: Wendy Kirkwooddanielstart.comBarricane Beach, Woolacombe, North Devon Photograph: danielstart.comDaniel Start2014-05-22T05:00:00ZHalf-term days out: family ideas for the holidayshttp://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-october
With the first holiday of the school year upon us, <strong>Joanne O'Connor</strong> picks events and activities to keep the kids happy next week – and no, they're not all Halloween themed<p>The newly revamped <strong>London Dungeons</strong> is going big on Halloween, with live shows, special effects and an abundance of pumpkins until 9 November (online tickets from £19.60 adult, £14.95 under-16s , <a href="http://www.thedungeons.com/london/en/" title="">thedungeons.com</a>). But when it comes to the chill factor, an evening narrowboat trip along the <strong>Regents Canal </strong>and into the pitch-black Islington Tunnel might just have the edge, especially when you discover a "witch" on board (26-27 Oct, booking essential, adults £10, children £8, 020-7713 0836, <a href="http://www.canalmuseum.org.uk/" title="">canalmuseum.org.uk</a>). On a less-scary note, the <strong>British Library</strong> is bringing its Children's Illustrated Classics exhibition to life with Peter Pan-themed installations and a live storyteller (29-30 Oct, free, <a href="http://www.bl.uk/whatson/events/event153629.html" title="">bl.uk</a>), while the <strong>Museum of Childhood</strong> in Bethnal Green will encourage children to channel their inner super-hero with mask-making, dressing up, and the chance to test their powers at the Superhero Skills Station (28 Oct-1 Nov, free, <a href="http://www.museumofchildhood.org.uk/" title="">museumofchildhood.org.uk</a>).</p> <a href="http://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-october">Continue reading...</a>Family holidaysDay tripsSchool holidaysMuseumsHalloweenEnglandWalesTravelThu, 24 Oct 2013 05:00:00 GMThttp://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-octoberPRNational Wetland CentrePRBewilderwood Halloween activitiesPRHalloween at the Royal ArmouriesPRBrownsea Island inDorset, where one of last red squirrel colonies can be foundPatrick MulvaneyThe Black Country Living Museum. Photograph: Patrick MulvaneyPRHalloween at the London DungeonPRHalloween at the London DungeonJoanne O'Connor2013-10-24T05:00:00ZSearching for the perfect beach – in Pembrokeshirehttp://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshire
Forget the Caribbean or Thailand, Pembrokeshire has the world's best beaches, says Kevin Rushby, who sets out with his daughter and a vintage VW campervan to find the ultimate stretch of shore<p>I must go down to the seas again, to the lonely sea and the sky, and all I need is a neoprene wetsuit, an inflatable kayak, a telescopic fishing rod, a body board, a power kite, a slimline collapsible barbecue, two moon chairs, a windbreak, and several large dry bags jammed with other essential gadgets. How did I ever manage in the past? When I was 10 years old I went to Pembrokeshire and had a fabulous time on those miraculous beaches with no more than a pair of swimming trunks. Now I was taking my daughter Maddy, also 10, and we had a classic VW campervan filled with everything the outdoor sports megastore can offer. We were on the hunt for the perfect beach, and we had the modern armoury to enjoy that spot to the utmost.</p><p>Now, I don't know if you have ever considered what makes the perfect beach, but clearly it is not sand so hot it burns your feet, disease-laden tropical sandflies, shark attacks and head-splitting falling coconuts. No. Any search for sandy coastal perfection should be contained within the limits of Tenby in the south and Cardigan in the north – the Pembrokeshire coast. It's <a href="http://www.guardian.co.uk/travel/2013/jul/18/top-10-secret-secluded-beaches-wales">a stretch that has at least 243 beaches of unparalleled beauty</a>, and the kind of limpid aquamarine saltwater that has sent poets into raptures.</p> <a href="http://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshire">Continue reading...</a>PembrokeshireBeach holidaysRoad tripsWalesUnited KingdomTravelFamily holidaysFri, 19 Jul 2013 20:00:00 GMThttp://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshireKevin Rushby for the GuardianMaddy on the cliff path to Marloes beach, awarded a 10 after a blissful day. Photograph: Kevin Rushby for the GuardianKevin Rushby for the GuardianMaddy on the cliff path to Marloes beach, awarded a 10 after a blissful day. Photograph: Kevin Rushby for the GuardianAlamyNewgale beach is big, fun and popular with surfers. Photograph: AlamyKevin Rushby2013-07-19T20:00:00ZBank holiday and half-term events for families around the UKhttp://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-events
Street art in Bristol, a Neverland theme park opening in Plymouth and raft racing in Portrush are just some of the family-friendly events taking place around the country over the bank holiday and half term<p>Head over to Hampton Court Palace over the long weekend, but don't forget your sandwiches and scotch eggs, as all ticket holders are invited to join a mass picnic in the grounds. Admittedly, the agenda doesn't sound particularly appetising – offering picnickers the chance to meet a blood-sucking leech and have a "smallpox makeover". But plenty of gruesome tales over lunch means kids will enjoy it far more than the usual riverside picnic. For those with more refined tastes, there's a Pimm's bar and cream teas, as well as a barbecue for those who forget their hampers. <br /><em>• 0844 482 7777, </em><a href="http://www.hrp.org.uk/HamptonCourtPalace/WhatsOn/Thebigpicnic" title=""><em>hrp.org.uk</em></a><em>, adults £16.50, children free</em></p> <a href="http://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-events">Continue reading...</a>Family holidaysFamilyTravelUnited KingdomEuropeEnglandWalesNorthern IrelandScotlandLondonLeedsSchool holidaysCornwallBristolFri, 24 May 2013 13:46:00 GMThttp://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-eventsDavid Lindsay/PRLeeds Loves Food festival. Photograph: David LindsayAlamyAn artist at work at last year's Upfest, Bristol's urban art festival. Photograph: AlamyC&J Willis PhotographyArundel Castle will be under siege this bank holiday. Photograph: C&J Willis PhotographyPRRomans at Hadrian's WallRNLIPortrush raft race, Northern Ireland Photograph: RNLINick Wilkinson/NTILast year's picnic at Hampton Court Palace had a Jubilee theme. Photograph: Nick Wilkinson/NTIVicky Baker2013-05-24T13:46:00ZLate Easter breaks in the UKhttp://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-uk
From feeding lambs on a Welsh farm, to Horrible Histories at Warwick castle or guided glamping gypsy-style, there are plenty of late Easter trips for those who prefer to stay closer to home<p>Among the hills and rivers of the Upper Wye Valley, just north of Rhayader, sits Nannerth Fawr Farm, a 200-acre working farm that ticks every box as far as family spring breaks are concerned. There are river and woodland walks, purpose-built cycle routes (borrow bikes by arrangement or bring your own), an outdoor play area with castle and playhouse, games room with pool and table tennis, falconry sessions (book in advance), a hide above a badger sett and lambing, which is timed to coincide with the Easter holidays so children can help with feeding. And that's just the farm itself. The farm's two self-catering cottages are fully booked over Easter but there is still availabilty in the Loft, a top-floor apartment which sleeps two but a cot bed can be booked, so would be perfect for a couple with a toddler. Plus the gypsy caravan and showman's trailer. Or, if you're feeling brave, there's the campsite. Real fires are allowed on site and you can hire camping equipment if you don't have your own. <br />•<em> The Loft costs £251 for a week at Easter, camping costs £5pp per night (£6pp if you want a hot shower and loo). The caravan and trailer cost from £202 for a two-night stay. </em><a href="http://www.nannerth.co.uk/nf/" title=""><em>nannerth.co.uk</em></a><em>, 01597 811121 </em></p> <a href="http://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-uk">Continue reading...</a>Family holidaysEnglandTravelTop 10sCampingWalking holidaysBed and breakfastsHotelsUnited KingdomScotlandWalesLate offersWed, 13 Mar 2013 14:07:21 GMThttp://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-ukPRPRJohn Bradshaw/AlamyGoring Lock on the Thames. Photograph: John Bradshaw/AlamyPRPRPRThe pass of the cattle road near Cruinn Leum Round HousePRPRPRPREaster breaks ... spring lambing at Nannerth Fawr Farm in WalesPRLambing at Easter at Nannerth Farm, WalesIsabel Choat and Georgia Brown2013-03-13T14:07:21ZFamily Halloween and half-term eventshttp://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-uk
Haunted castles, eerie woodland walks, hair-raising ghost rides and spooky activities for all the family in our round-up of Halloween events around the UK<p>Kids will be able to roam through the grounds of Puzzlewood, hunt for bats and discover Halloween sculptures in the trees between until 31 October. This ancient woodland in the Forest of Dean is a perfect setting for an eerie game of hide and seek – the trees drip with moss and lichen and twist above spooky caves and strange rock formations. If the weather's bad there are two indoor mazes and a new push-and-pedal bike racing track for under 5s. <br />• <a href="http://www.puzzlewood.net" title=""><em>puzzlewood.net</em></a><em>, 01594 833187; adults £6.00, children £4.50, family £20, open 10am-4.30pm (last entry 3.30pm)</em></p> <a href="http://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-uk">Continue reading...</a>Family holidaysTravelFamilyHalloweenLife and styleDay tripsUnited KingdomEuropeScotlandWalesSchool holidaysWed, 24 Oct 2012 12:56:44 GMThttp://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-ukDave Willis/AlamyA past Halloween light show at Muncaster Castle. Photograph: Dave Willis/AlamyJohn Wheeler/AlamyKentwell Hall, Suffolk becomes the setting for Scaresville. Photograph: John Wheeler/AlamyPRBugs galore at the Insect Circus, Jacksons LaneMic Walker/AlamyCastle Fraser, Aberdeenshire. Photograph: Mic Walker/AlamyPhotolibrary Wales/AlamyChepstow Castle in Wales. Photograph: Photolibrary Wales/AlamyAllan Bell/AlamyBodelwyddan Castle, Wales Photograph: Allan Bell/AlamyPauline Moon/AlamyHunt for bats in the magical setting of Puzzlewood in the Forest of Dean. Photograph: Pauline Moon/AlamyPauline Moon/AlamyPuzzlewood in the Forest of Dean, Gloucestershire Photograph: Pauline Moon/AlamyGwen Pew2012-10-24T12:56:44ZOld-fashioned fun: 10 traditional UK seaside breakshttp://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resorts
Not all British seaside resorts have to go the way of Brighton and Whitstable … here are 10 of the most gloriously traditional, with all the fun of the fair<p>As the sailing venue for the Olympics, <a href="http://www.guardian.co.uk/travel/2012/jun/08/weymouth-dorset-sailing-olympics?INTCMP=SRCH" title="">Weymouth has made a sterling effort to move upmarket</a>: boat-shaped cafes on the beach, uplighters on the seafront, upgraded deckchairs. But underneath the gloss, it's the same old Weymouth, thank goodness. For a panoramic view, take an airlift up the shiny new Sea Life Tower – which opened in June (The Quay, 0871 423 2110, <a href="http://www.weymouth-tower.com/" title="">weymouth-tower.com</a>, from £6.50) – and look across a curve of Regency terraces to the Purbeck Hills, across the harbour to the gardens of Nothe Fort (01305 766626, <a href="http://www.nothefort.org.uk/" title="">nothefort.org.uk</a>) to the Isle of Portland. On the beach, there are donkey rides, Professor Mark Poulton's classic Punch and Judy show (<a href="http://www.weymouthpunch.co.uk" title="">weymouthpunch.co.uk</a>) and, according to the town's Sand World (Preston Beach Road, 07411 387529, <a href="http://www.sandworld.co.uk/" title="">sandworld.co.uk</a>, adult £6.50, child £4.50) the perfect sand for castles and sculptures. At Rossi's retro parlour on the seafront, the ice-cream has been made on the premises since 1937 (01305 785557). The Stables Pizza and Cider House (Custom House Quay, <a href="http://thestabledorset.co.uk/" title="">thestabledorset.co.uk)</a> is one of the new breed of restaurants that have popped up in the light of the Olympics. Cafe Oasis (01305 833054, <a href="http://www.cafeoasis.co.uk/" title="">cafeoasis.co.uk</a>), on the beach at Bowleaze Cove, is a old favourite.</p> <a href="http://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resorts">Continue reading...</a>United KingdomBeach holidaysShort breaksFamily holidaysDay tripsTravelDorsetEuropeWalesSussexYorkshireLancashireIsle of WightHotelsRestaurantsFri, 03 Aug 2012 21:44:00 GMThttp://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resortsPatrick Ingrand/Getty ImagesBeachy Head, East Sussex. Photograph: Patrick Ingrand/Getty ImagesVisitBritain/Daniel Bosworth/Getty ImagesRossi's, Southend-on-Sea. Photograph: VisitBritain/Daniel Bosworth/Getty ImagesRichard Watson/Getty ImagesThe Land Train, Bridlington. Photograph: Richard Watson/Getty ImagesTony C French/Getty ImagesJabba the Hut artwork, Mablethorpe. Photograph: Tony C French/Getty ImagesAlamyThe Great Orme Tramway, Llandudno. Photograph: AlamyAlamyPunch and Judy on the beach at Weymouth, Dorset. Photograph: AlamyAlamyPunch and Judy on the beach at Weymouth, Dorset. Photograph: AlamyLesley Gillilan2012-08-03T21:44:00ZPembrokeshire holiday guide: hotels, walks, days out, cheap eats and morehttp://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive
Gorgeous sandy beaches, back-to-nature family attractions, characterful pubs steeped in history, and world-class wildlife viewing – Pembrokeshire has all the ingredients for a brilliant holiday. Browse our expert tips to plan the perfect trip. If you're on a mobile device, the guide will open in a new window, customised to fit your screen. Click below to start exploring <a href="http://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive">Continue reading...</a>TravelWalesPembrokeshirePubsHotelsFamily holidaysBudget travelRestaurantsWalking holidaysWed, 11 Jul 2012 11:23:00 GMThttp://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive/Andy DaviesPuffin with sandeels in bill, Fratercula arctica, The Wick, Skomer Island, Pembrokeshire, Wales, UK, Europe Photograph: /Andy DaviesIsabel Choat, Gavin McOwan, Georgia Brown and Guardian Interactive team2012-07-11T11:23:00ZTop 10 family days out in Pembrokeshirehttp://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshire
Meet a Madagascan fossa, watch sheepdogs herding geese, ride a 'rollercoaster' mountain bike trail or head for a spectacular beach … Pembrokeshire has some great family days out<br /><br /><strong><a href="http://www.guardian.co.uk/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive">• As featured in our Pembrokeshire holiday guide</a></strong><br /><strong>• What's your favourite Pembrokeshire day out? Add your tip to the comments below</strong><p>Pembrokeshire is renowned for its beaches, 26 of which have Blue Flag or Green Coast awards for their water quality and clean environments. Surfers, rockpoolers and dog walkers all have their favourites, but if you crave soft sand, sheltered swimming and the blissful absence of cafes and car parks, Barafundle bay is worth a special journey. This golden horseshoe backed by gorse-flecked dunes and woodland is accessible only via steep steps in the limestone cliffs on either side. It feels idyllically remote, but the National Trust car park and tea room at Stackpole Quay are just a 10-minute walk away – perfectly manageable with a bucket, spade and swimming cozzie in hand. For information on amenities and access at all Pembrokeshire beaches see <a href="http://www.pembrokeshirecoast.org.uk/default.asp?PID=4" title="">pembrokeshirecoast.org.uk</a>. <br /> • <em>Stackpole Quay, </em><a href="http://www.nationaltrust.org.uk/stackpole/" title=""><em>nationaltrust.org.uk</em></a></p> <a href="http://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshire">Continue reading...</a>PembrokeshireFamily holidaysWalesTravelBeach holidaysShort breaksUnited KingdomTop 10sAdventure travelDay tripsWed, 11 Jul 2012 09:30:00 GMThttp://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshireAlamyPhotograph: AlamyPRPRAlamyPhotograph: AlamyDimitris Legakis/D Legakis Photography/AthenaPhotograph: Dimitris Legakis/AthenaAlamyPhotograph: AlamyPRThe Photolibrary Wales/AlamyPhotograph: The Photolibrary Wales/AlamyKevin Rushby/GuardianPhotograph: Kevin Rushby for the GuardianCW Images / Alamy/AlamyBarafundle bay feels idyllically remote. Photograph: CW Images/AlamyCW Images / Alamy/AlamyBarafundle Bay Pembroke Photograph: CW Images / Alamy/AlamyRachael Oakden2012-07-11T09:30:00ZUK cottages: Wales and Scotlandhttp://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-catering
Self-catering in Wales and Scotland is all about spectacular settings amid dramatic landscapes. In the third part of our guide, we round up companies offering cottages in the two regions<br /><br /><a href="http://www.guardian.co.uk/travel/2012/jan/17/uk-cottages-rental-properties-companies-guide?intcmp=239">UK cottages: a guide to leading rental companies</a><p></p> <a href="http://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-catering">Continue reading...</a>CottagesSelf-cateringTravelFamily holidaysScotlandWalesShort breaksUnited KingdomThu, 19 Jan 2012 16:39:00 GMThttp://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-cateringprSwallow Cottage, near Fort WilliamprDalcross Castle, near InvernessprTy Glan Afon, DolgellauPRPen-yr-Heol, Brecon BeaconsPrCider House, a Sheepskin cottage, near AbergavennyPrCider House, near AbergavennyCatherine Nelson2012-01-19T16:39:00ZFree bank holiday days outhttp://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holiday
You don't have to spend a fortune on bank holiday family fun – there's lots you can do for free, from cycle trails in the Forest of Dean to an alternative village fete at the National Theatre<p>The National Theatre is bringing a country fair with an urban twist to London's South Bank this weekend. Artists and theatrical performers will reinterpret the traditional British village fete, with contemporary barn dancing, craftmaking, alternative folk music and story-telling sessions. And of course, no village fete would be complete without tea and cake stalls. <br />• <em>1pm-5.30pm Sunday 28 August and 1pm-4pm Monday 29 August, National Theatre Square, </em><a href="http://www.facebook.com/watchthispace" title="Watch This Space"><em>facebook.com/watchthispace</em></a><em>, </em><a href="http://homeliveart.com/current-projects/145--alternative-village-fete" title="Alternative Village Fete"><em>homeliveart.com</em></a></p> <a href="http://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holiday">Continue reading...</a>Summer holidaysFamily holidaysDay tripsTravelDevonCornwallLondonWalesGlasgowEssexYorkshireThu, 25 Aug 2011 12:22:00 GMThttp://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holidayAlamyPhotograph: AlamyMurdo Macleod/Murdo MacleodPhotograph: Murdo MacleodDavid Kjaer/RSPB ImagesPhotograph: David Kjaer/RSPB ImagesPRTwist of fete … enjoy craftmaking and story-telling sessions at the Alternative Village Fete, LondonAlamyChildren on day out. Photograph: AlamyJoanne O'Connor2011-08-25T12:22:00ZFamily days out in Augusthttp://www.theguardian.com/travel/2011/aug/19/summer-days-out-family
There's plenty of family fun to be had at the tail end of the summer holidays, from a traditional steam fair to a graffiti workshop for your budding Banksy<p>If the prospect of roller coasters or new-fangled activities (canyoning, anyone?) leaves you cold, introduce the family to some more traditional fun. Among the events on offer at the 161-year-old Grasmere games are wrestling, sheep dog displays and a family tug of war. Proper, wholesome fun! There's also a beer tent, so dads can drink a manly pint of ale while watching the terrier dog show.<br /><em>• Adult £8.50, child 5-14 £2.50. The Showfield, Stock Lane, Grasmere, </em><a href="http://grasmeresportsandshow.co.u" title=""><em>grasmeresportsandshow.co.uk</em></a><em>, 26 August, 10am-5pm</em></p> <a href="http://www.theguardian.com/travel/2011/aug/19/summer-days-out-family">Continue reading...</a>Family holidaysDay tripsTravelIsle of WightKentLondonWalesManchesterAdventure travelShort breaksUnited KingdomFri, 19 Aug 2011 15:54:00 GMThttp://www.theguardian.com/travel/2011/aug/19/summer-days-out-familyPRPRAlamyPhotograph: AlamyPRAlamyPhotograph: AlamyAlamyWholesome fun … Grasmere Sports day in Cumbria. Photograph: AlamyAlamyGrasmere Sports. Photograph: AlamyIsabel Choat and Charley McKenzie2011-08-19T15:54:00Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidays
Pirates and Vikings, mini beasts and gothic horrors – plus the chance to paint a horse (yes, really). Here is our latest pick of exciting kids' activities for the summer holidays<p>If you are looking to tire out the little ones, look no further than a fun-packed day at Willows Farm Village. Back by popular demand is the farm's A-maize-ing Maze, open all day for the whole family to get lost in. New activities this summer include the JCB Young Drivers Zone for Bob the Builder wannabes, with mini-JCB diggers and tractors available for children to ride around a miniature track. There are also nine different shows daily and sports day races as well as unlimited access to bouncy haystacks, funfair rides, and an agility play trail.<br /><em>• Adult £12.50, child £13.50, under-twos free. Coursers Road, London Colney, 0870 129 9718, </em><a href="http://www.willowsfarmvillage.com/" title=""></a><a href="http://www.willowsfarmvillage.com/" title=""><em>willowsfarmvillage.com</em></a><em>. Until 4 September</em></p> <a href="http://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidays">Continue reading...</a>Family holidaysDay tripsUnited KingdomBournemouthKentWildlife holidaysAdventure travelWalesCampingTravelSummer holidaysTop 10sFri, 12 Aug 2011 12:50:43 GMThttp://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidaysPRPRPRPRPRLose yourself in Willows Farm maize mazeHalima Ali and Kamilla Baiden2011-08-12T12:50:43Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidays
Here's our latest roundup of (mostly free) ways of keeping the kids happy over the school holidays, from pottery classes in the Potteries to playing Sherlock in Shropshire<p>Read the book? Seen the movie? Time now to take the kids to the live show of Fantastic Mr Fox. Following their successful production of James and the Giant Peach last year, the open-air touring group Illyria Theatre Company is staging a creative, interactive stage version of the Roald Dahl classic at various outdoor locations around the country, from gardens to castles to farms, throughout August. Will Mr Fox outwit the cruel farmers? <br />• <em>Prices vary according to location. For a full listing and booking information visit </em><a href="http://www.illyria.uk.com" title=""><em>illyria.uk.com</em></a></p> <a href="http://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidays">Continue reading...</a>TravelFamily holidaysDay tripsKentUnited KingdomWalesNorthern IrelandGlasgowNewcastleSussexFri, 05 Aug 2011 15:31:00 GMThttp://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidaysPRPRFestival of Fools, BelfastPRChild's play ... Fantastic Mr Fox is playing across the country this summerPRSherlock Holmes weekend, Blists HillKamilla Baiden and Jen McPherson2011-08-05T15:31:00Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/jul/27/familyholidays-day-trips
The school holidays are well under way, and if the kids are driving you mad, check out our latest events and activities for children, from enchanted princesses to electric guitars<p>From 2 August, the normally hushed rooms of Manchester Art Gallery will be disrupted by the squeals of children as they discover a fantasy world of princesses and knights. Set over the two top floors of the gallery, the transformed space will include three tents where kids under 12 can create costumes and make films of their stories to project on to the gallery walls. Artists will also be on hand to organise art activities, and there will be sensory play areas for babies and toddlers. <br /><em>• </em><a href="http://www.manchestergalleries.org" title=""><em>manchestergalleries.org</em></a><em>. Free, 2-28 August, Tuesdays to Sundays, 1-3pm</em></p> <a href="http://www.theguardian.com/travel/2011/jul/27/familyholidays-day-trips">Continue reading...</a>Family holidaysDay tripsUnited KingdomLearning holidaysCycling holidaysCultural tripsScotlandManchesterWalesBrightonBristolTravelSummer holidaysWed, 27 Jul 2011 13:39:00 GMThttp://www.theguardian.com/travel/2011/jul/27/familyholidays-day-tripsPRPRPRPRFar, far away at Manchester Art GalleryPRFar, far away at Manchester Art GalleryNalini Sivathasan2011-07-27T13:39:00ZWales on wheelshttp://www.theguardian.com/travel/2011/jun/19/wales-uk-cycling
A four-day ride from Cardigan to Hay-on-Wye gives Robert Penn the chance to savour some of Britain's most beautiful scenery – and convert his son to cycling<p> On top of the Cambrian Mountains, the world stood still. There was no sound or sign of life. The wind had dropped. Ahead, flat treeless moorland covered in tussocks of ochre and umber grasses stretched to the horizon. The singletrack road snaked round the hill and disappeared into blue sky. Behind, the Ystwyth Valley fell away, cutting its serpentine path through serried ranks of hills to the west coast, 20 miles away. I looked round slowly, until I felt sure the view was etched on to my memory. This is Wales, I thought: a perfectly formed realm with the power of a spell.</p> <a href="http://www.theguardian.com/travel/2011/jun/19/wales-uk-cycling">Continue reading...</a>WalesUnited KingdomEuropeTravelCycling holidaysFamily holidaysSat, 18 Jun 2011 23:05:00 GMThttp://www.theguardian.com/travel/2011/jun/19/wales-uk-cyclingRobert PennBorder country … a view across the Wye Valley, between Rhayader and Builth WellsPRDan and Sarah outside Conti's, LampeterRobert Penn"This is massive. Cycling is way better than TV and Xbox combined": near the top of the Ystwyth Valley in the Cambrian Mountains.
Photograph: Robert PennRobert Penn2011-06-18T23:05:00Z
|
{
"pile_set_name": "Pile-CC"
}
|
1. Field of the Invention
The present invention relates to a process for regulating the exposure time of a light sensor. More particularly, the invention relates to a process for regulating the exposure time of a light sensor according to the variation of luminosity in the work environment in which the sensor is located.
2. Discussion of the Prior Art
Throughout the present description and the attached claims, with the term: “light sensor”, it is intended to indicate a light-sensitive optical element capable of converting a light signal, contained in a incident light beam, in an analogic electrical signal proportional to the light intensity of the light itself. In particular, the light sensor transforms the light image of an illuminated object into an electronic image thereof, in order to allow the carrying out of further operations of image processing, such as for example those connected to the reading of an optical code located on the object.
In the following, reference to light sensors of known type will be made, for example CCD or CMOS sensors, both linear and of matrix type.
As is known, a drawback associated with light sensors at present available on the market is correlated to the fact that their operation is strongly influenced by the variations in luminosity of the surface on which the image to be acquired is to be found (such surface can be more or less clear and more or less illuminated). In particular, the resolution of the image acquired by the sensor (that is the richness of details detected in the image acquired by it) considerably varies according to the variation of the luminosity of the surrounding environment and of the surface to be acquired: highly illuminated environments can as such create conditions of strong overexposure or saturation (little contrast) of the image on the sensor, whilst badly illuminated environments can create conditions of strong under-exposure (excessive dark) in the image on the sensor. In both cases, the image acquired by the sensor appears badly exposed and not very clear, therefore making it impossible to detect details having small sizes.
In particular, with reference to the reading of an optical code, the acquisition on the sensor of an image of an optical code having a low resolution is often undesired because it renders the subsequent operations of localization, reading and decoding of the code itself very approximate and rough; this is absolutely unacceptable where it is necessary to carry out a correct decoding of the code in order to unequivocally identify the object having the code thereon.
The drawbacks associated with the acquisition of an image having low resolution can be overcome by suitably regulating the exposure time of the sensor according to the variations of luminosity of the surrounding work environment and of the surface to be acquired. In particular, where an increase in luminosity occurs in the work environment, it would be advisable to set a shorter exposure time on the sensor, in order to avoid the risk of generating conditions of saturation of the acquired image; viceversa, in the case where a decrease in luminosity occurs in the work environment, it would be advisable to set a higher exposure time on the sensor, in order to avoid the risk of generating conditions of under-exposure of the acquired image.
The majority of light sensors at present available on the market allow to set an exposure time by choosing it between a range of values, more or less extensive, each differing the one from the other by descrete amounts; such values are stated by the manufacturers of the sensors.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Plagiarism: using a collaborative approach in an online allied health professions course.
The purpose of the study was to evaluate the effectiveness of interventions to increase the awareness and understanding of plagiarism among undergraduate students enrolled in an online allied health professions course in a community college in the Midwestern United States. The results suggested that the interventions were effective in educating students about how to avoid plagiarism.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The invention relates to a distilling and desalination apparatus comprising an evaporation chamber and a condensing chamber.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Is it possible to change a view from a user view to a node view?
I have a view that has a couple of displays and a lot of complex field definitions. I now realize the view may have been created by cloning the wrong starter view. Something went wrong such that the view is based on user and the base_table = 'user' when it should be based on nodes. Can I change it to be based on nodes? Or is there a quick way to add my display and field definitions to a newly created node view, perhaps by exporting both and copying over bits of the code? I'm using Views 2.
A:
There is no automatic way to convert a user view to a node view or vice versa.
Although you probably could get away with manually combining the fields from the export of your user view with a plain export of a new node view, it would be faster and a lot less problematic to just open the old view and your new view side by side in two browser windows and recreate everything.
Unfortunately a lot of Drupal site building is just checking checkboxes...
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Change admin module title joomla
When I installed the module that I developed and in the module manager screen of the backend I can see the title like this.
Module Manager: Module mod_examplemodule
So I want to change it into something like this. Module Manager: Module Example Module
I have developed few Joomla modules but so far I didn't realize how to do this.
Your help on this would really appreciated.
Thank you.
Im using Joomla 2.5.8. I have just added the screen shot. Perhaps it would be more helpful.
A:
In my modules I use:
<name>Module Title</name>
<description>MOD_MODULE_TITLE_XML_DESCRIPTION</description>
I then add an entry in the language file for the description. This normally covers my needs
|
{
"pile_set_name": "StackExchange"
}
|
Q:
jQuery, button message doesn't change
How do I get the text beside my button to change? Everything else works fine except for these button messages. Thanks for your help.
<!DOCTYPE html PUBLIC "><head>
<script type="text/javascript" src="js/jquery-1.4.min.js"></script>
<script type='text/javascript'>
var fontSizes = [14, 16]
$(function(){
$('#PlusMinus').click(function() {
if($(this).val() == "+") {
$('#OurText').css('fontSize', fontSizes[1] + 'pt');
$(this).val("-");
}else {
$('#OurText').css('fontSize', fontSizes[0]+ 'pt');
$(this).val("+");
}
});
});
<!--NOT WORKING-->
$("button").click(function () {
$("h6").toggle();
});
</script>
</head>
<!--NOT WORKING-->
<h6>
<input type='button' value='+' id='PlusMinus'/>
Larger Text</h6>
<h6 style="display: none">Smaller Text</h6>
<!--TEXT RESIZES-->
<p id="OurText">My Text!!!</p>
</body>
</html>
BUTTON STATE 'Message should toggle between Larger Text and Smaller text'
[+] Larger Text
[-] Smaller Text
A:
This worked for me:
<!DOCTYPE html PUBLIC "><html>
<head>
<script type="text/javascript" src="jquery-1.4.min.js"></script>
<script type="text/javascript">
var fontSizes = [14, 16]
$(function(){
$('#PlusMinus').click(function() {
if($(this).val() == "+") {
$('#OurText').css('fontSize', fontSizes[1] + 'pt');
$(this).val("-");
}else {
$('#OurText').css('fontSize', fontSizes[0]+ 'pt');
$(this).val("+");
}
$("body h6").toggle();
});
});
</script>
</head>
<input type='button' value='+' id='PlusMinus'/>
<h6>Larger Text</h6>
<h6 style="display: none">Smaller Text</h6>
<!--TEXT RESIZES-->
<p id="OurText">My Text!!!</p>
</body>
</html>
The changes I made were:
changed $("h6").toggle(); to $("body h6").toggle(); and moved it up to the $('#PlusMinus').click function
moved the button out of the "Larger Text" h6 element
added < html > tag at the top
removed "Not Working" comments ;)
|
{
"pile_set_name": "StackExchange"
}
|
State treasurer candidate stockpiles $1 million for fall campaign
Republican state treasurer candidate Dan Rutherford, always a prolific fundraiser, today reported raising $687,000 from January through June and has $1 million available for the fall campaign.
Among the contributions was a $200,000 loan Rutherford made, a move aides described as a cash advance on pledges of future donations. Rutherford, a veteran lawmaker from downstate Chenoa who's always been a prolific fundraiser began the year with more than $568,000 in his campaign fund, state elections records show.
|
{
"pile_set_name": "Pile-CC"
}
|
Changes in autobiographical memory specificity following cognitive behavior therapy and pharmacotherapy for major depression.
An important cognitive marker of clinical depression is a reduced ability to be specific in recalling personal memories, a phenomenon coined 'overgeneral memory'. Overgeneral memory is considered as a stable cognitive trait that is intrinsically linked with depression and independent of mood state. Previous studies show that autobiographical memory is modifiable. This study investigated whether autobiographical memory is differentially affected by treatment type. Depressed patients were randomly assigned to receive either cognitive behavior therapy (CBT) for depression or pharmacotherapy (PHT). The proportion of categoric memories decreased and the proportion of specific memories increased following both types of treatments, adding support to the view that overgeneral memory is modifiable. CBT also had a greater impact on reducing extended overgeneral memories compared to PHT. The results from the current study are important in that they show that overgeneral memory can be targeted and modified through brief treatment. The clinical significance of the finding that there was a greater decrease in extended memories in the CBT group is unclear.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Mitosis-specific monoclonal antibodies block cleavage in amphibian embryos.
By microinjecting monoclonal antibodies that bind specifically to mitotic and meiotic cells of a variety of species, we studied the biological activity of antigens recognized by these antibodies. The antibodies recognize a family of phosphoprotein antigens that are found throughout the cytoplasm of mitotic cells and particularly at microtubule organizing centers, including centrosomes and kinetochores. Their binding is dependent on phosphorylation of the polypeptides. Immunoglobulins were introduced into Xenopus laevis and Rana pipiens oocytes or cleaving embryos using glass micropipettes. The ability of the antibody-injected oocytes to undergo mitosis or meiosis was compared with those injected with control mouse immunoglobulins. The antibodies failed to block chromosome condensation and germinal vesicle breakdown in progesterone-treated oocytes. However, functional mitotic spindles were not assembled in cleavage stage frog embryos injected with antibodies. In vitro, the binding of the antibodies to the antigens inhibited the dephosphorylation of the antigens by alkaline phosphatase. The antibody binding to the activated microtubule organizing centers (MTOC) seems to block not only the nucleation of microtubules and the organization of the mitotic spindle, but also the dephosphorylation of proteins associated with the MTOC that normally occurs at the mitosis-G1 transition.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
North Carolina Skating USA
Advertisements
Skating entails substantially work and practise, so one doesn't need t get discouraged from little setbacks like constant falling that may occur at first as these are just temporary huddles. As a learner or a beginner skater, bear in mind that there's a likelihood of falling a couple of occasions prior to being able to glide smoothly; don't give up, but follow every tip given by your trainer. Meanwhile, before going for North Carolina Skating as a beginner, endeavor to get ready safety gears like a helmet, a wrist guard, and elbow and knee pads for protection in case of a crash.
If an individual desires to obtain all the essential information relating to North Carolina Skating, the ideal place to check and get them is the items section of the web page Kayambo. Nevertheless, the teaching of safety strategies really should be paramount as a way of preventing and decreasing possible accidents during the process of finding out to Skate in North Carolina until the learners have mastered correct posture and modus operandi. Ice skating, roller skating, and snow skating are three major forms of skating available to whoever wishes to Skate in North Carolina, with one possessing different approaches, specifications, and gears from the other.
Discover and explore a skating venue, a place that you can have a memorable and cherished Christmas tree lighting in this season, look no further than the North Carolina Ice Rink is your answer for your skating needs and desires.
Main Cities in North Carolina
It's particularly likely that you go through this Main City when you visit North Carolina searching for Place in Greensboro. We are confident that its more than 269.666 inhabitants will take care of you.
|
{
"pile_set_name": "Pile-CC"
}
|
Nehemiah D. Sperry
Nehemiah Day Sperry (July 10, 1827 – November 13, 1911) was a U.S. Representative from Connecticut.
Biography
Born in Woodbridge, Connecticut, Sperry attended the common schools and a private school in New Haven. He engaged in agricultural pursuits and worked in a mill. He taught school for several years, and then became a partner in a building and contracting firm.
He served as a member of the New Haven common council in 1853, and an Alderman in 1854. He served as Secretary of the State of Connecticut in 1855 and 1856.
He served as delegate to the Republican National Conventions in 1856, 1864, and 1888. He served as member and secretary of the national and executive committees. He served as chairman of the Republican State committee for a number of years.
He served as chairman of the recruiting committee of New Haven during the Civil War. He was appointed in 1861 as postmaster of New Haven, and served until removed by President Cleveland in 1886. He was again postmaster from 1890 to 1894.
Sperry was elected as a Republican to the Fifty-fourth and to the seven succeeding Congresses (March 4, 1895 – March 3, 1911). He served as chairman of the Committee on Alcohol Liquor Traffic (Fifty-sixth through Sixty-first Congresses). He was not a candidate for renomination in 1910.
Death and burial
He died in New Haven, Connecticut, on November 13, 1911. He was interred in Evergreen Cemetery.
References
External links
Category:1827 births
Category:1911 deaths
Category:Connecticut city council members
Category:Connecticut Republicans
Category:Members of the United States House of Representatives from Connecticut
Category:Secretaries of the State of Connecticut
Category:Republican Party members of the United States House of Representatives
Category:19th-century American politicians
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Preference Pane
A Preference Pane (often abbreviated as prefpane) is a special dynamically loaded plugin in macOS. Introduced in Mac OS X v10.0, the purpose of a Preference Pane is to allow the user to set preferences for a specific application or the system by means of a graphical user interface. Preference Panes are the macOS replacement for control panels in the classic Mac OS. Prior to Mac OS X v10.4, collections of Preference Panes featured a "Show All" button to show all the panes in the collection and a customizable toolbar to which frequently-used preference panes could be dragged. In Mac OS X v10.3, the currently-active pane would also be highlighted in the toolbar when it was selected. With Mac OS X v10.4, this functionality was dropped in favor of a plain Show All button and back/forward history arrows.
System Preferences is an application whose sole purpose is the loading of various preference panes, for system configuration. Any application can be written to use prefpanes.
Preference panes carry the .prefpane file extension.
External links
Apple Developer Connection – Preference Panes
Category:MacOS
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Possibly simple Routing Error: No route matches {:action
I think something is wrong with my create method.
When I create a new resume from http://localhost:3000/ or http://localhost:3000/resumes/new, I get the routing error shown below.
Routing Error
No route matches {:action=>"show", :controller=>"resumes"}
The app goes to http://localhost:3000/resumes address instead of http://localhost:3000/resumes/1. Not sure why.
Here is my code.
class SubmissionsController < ApplicationController
def create
@resume = Resume.new(params[:resume])
if @resume.save
#UserMailer.created_resume_email(@user).deliver
redirect_to :action => 'show'
format.html { redirect_to(@resume, :notice => 'Resume was successfully created.') }
format.xml { render :xml => @resume, :status => :created, :location => @resume }
else
@title = "Create a new resume"
render 'new'
end
end
def show
@resume = Resume.find(params[:id])
respond_to do |format|
format.html # show.html.erb
format.xml { render :xml => @resume }
end
end
end
Leaflet::Application.routes.draw do
resources :resumes
match '/' => 'resumes#new'
end
A:
I may be missing something, but, I believe you need to alter your redirect_to statement.
redirect_to resume_url(@resume)
or
redirect_to resume_path(@resume)
That should redirect the user to the "show" action in your controller with the required parameter for determining which resume to get and show.
http://guides.rubyonrails.org/layouts_and_rendering.html#using-redirect_to
|
{
"pile_set_name": "StackExchange"
}
|
從評圖到國外專家表揚,作為創作者,為什麼我們總是希望被看見?┃As an Artists or A Photographers, Why We Always Wish to Be Honor?
文/ 汪正翔 TEXT / Sean Wong
翻譯/ 陳仲麟
I remember one time we taked about ‘Portfolio Review’during a dinner with lots of artists. Some people think this kind of event totoally like plenty of professionals exchanging their opinions about artworks. I don’t think it something bad. However, if now we’re talking about “trying make our artworks to be honored”, especially wish to be honored by professionals abroad, make me feel something weird inside, even thought it intends to do good things.
Take photography for example, in the past few decades in this field, the honor of most kinds of awards or competitions, were decided by some few people who own knowledge, secrecy, and elite education. Those people would be responsible for picking something good enough and then present those work for the world, before the rise of art school. If we say the whole field like a wildland, those people are just like the searchlight, searching something good enough which make the classic works we see now.
Facing the globalization and international flow of information, how can artists make their artworks to be saw by the professionals?
In the other side of this issue, is there any possibility for us to think that we lack of making ourselves become the one who own the ‘light’? As we know, there is a lot of activity not onlt in Taiwan but also in Japan, Shanghai, Hong Kong. Most of them do invite some curator, art critic, or even art historian.
Because of the globalization and international flow of information as well as the the diversity of education and creation, now we can see more and more researcher or artists in the Institute of Contemporary Art launching some activity about art by themselves. However, the question we would like to ask about is that, most of the time, we couldn’t find the clear main reason why the host invite them.
For example, I remember one time I went to an art event with my artists friends, and we accidentally find out even the invitee also feel confuse about why he got invitation to this kind of lecture to be the speaker. Thanks to the globalization and international flow of information, it’s easy for people to find some information by internet. In the way, it won’t be so hard for us to find out where any people from or even judge is he or she belong to the main system or not.
We all know that any institute of Contemporary Art from every country including Taiwan do have the power to luach different kind of way to present the idea they figure out. Yet, in other foreign countries, they got more system to form and even organize some comment, for example, independent reviewer, independent curator. Most of all, thse comment won’t be one-way opinon only, it might be multi-direction or even no-limit instead of just “It’s good.”only.
Now in Taiwan, this is not the first time for us to learn that there are so many dissatisfied artists. To some artists, the choice for them to walk in the illumination or not, just like facing the Eye of Soren. As a artists, we should nerver forget to think about how to be the people who DEFINE what is ‘light’ instead of how to be AT the range of the illumination.
One thought on “從評圖到國外專家表揚,作為創作者,為什麼我們總是希望被看見?┃As an Artists or A Photographers, Why We Always Wish to Be Honor?”
好文,但是Taiwan被拼錯兩次….
“As we know, there is a lot of activity not onlt in Taiwna but also in Japan, Shanghai, Hong Kong.”以及
“Now in Taiwna, this is not the first time for us to learn that there are so many dissatisfied artists.”
|
{
"pile_set_name": "Pile-CC"
}
|
Familiarity Increases Processing Speed in the Visual System.
Familiarity with a stimulus leads to an attenuated neural response to the stimulus. Alongside this attenuation, recent studies have also observed a truncation of stimulus-evoked activity for familiar visual input. One proposed function of this truncation is to rapidly put neurons in a state of readiness to respond to new input. Here, we examined this hypothesis by presenting human participants with target stimuli that were embedded in rapid streams of familiar or novel distractor stimuli at different speeds of presentation, while recording brain activity using magnetoencephalography and measuring behavioral performance. We investigated the temporal and spatial dynamics of signal truncation and whether this phenomenon bears relationship to participants' ability to categorize target items within a visual stream. Behaviorally, target categorization performance was markedly better when the target was embedded within familiar distractors, and this benefit became more pronounced with increasing speed of presentation. Familiar distractors showed a truncation of neural activity in the visual system. This truncation was strongest for the fastest presentation speeds and peaked in progressively more anterior cortical regions as presentation speeds became slower. Moreover, the neural response evoked by the target was stronger when this target was preceded by familiar distractors. Taken together, these findings demonstrate that item familiarity results in a truncated neural response, is associated with stronger processing of relevant target information, and leads to superior perceptual performance.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
why does the mv command in bash delete files?
running the following script to rename all .jpg files in the current folder works well sometimes, but it often deletes one or more files it is renaming. How would I write a script to rename files without deleting them in the process? This is running on Mac OSX 10.8 using GNU bash, version 3.2.48
this is an example file listing I would change for illustration:
original files
red.jpg
blue.jpg
green.jpg
renamed files if counter is set to 5
file_5.jpg
file_6.jpg
file_7.jpg
instead I get usually lose one or more files
#!/bin/bash
counter=5
for file in *.jpg; do
echo renaming "$file" to "file_${counter}.jpg";
mv "$file" "file_${counter}.jpg";
let "counter+=1";
done
** UPDATE **
it no longer seems to be deleting files, but the output is still not as expected. for example:
file_3.jpg
file_4.jpg
turns into
file_3.jpg
file_5.jpg
when counter is set to 4, when the expected output is
file_4.jpg
file_5.jpg
-
#!/bin/bash
counter=3
for file in *.jpg; do
if [[ -e file_${counter}.jpg ]] ; then
echo Skipping "$file", file exists.
else
echo renaming "$file" to "file_${counter}.jpg"
mv "$file" "file_${counter}.jpg"
fi
let "counter+=1"
done
A:
The problem is that some of the files already have names corresponding to the target names. For example, if there are files
file_1.jpg
file_7.jpg
and you start with counter=7, you overwrite file_7.jpg with file_1.jpg in the first step, and then rename it to file_8.jpg.
You can use mv -n to prevent clobbering (if supported), or test for existence before running the command
if [[ -e file_${counter}.jpg ]] ; then
echo Skipping "$file", file exists.
else
mv "$file" "file_${counter}.jpg"
fi
|
{
"pile_set_name": "StackExchange"
}
|
Cardinals Trio Gets Set For Arbitration
Submitted by jcovington on Mon, 01/13/2014 - 8:30am
A trio of Cardinals are preparing for the salary arbitration process this week. Outfielders Jon Jay and Peter Bourjos and infielder Daniel Descalso will file their desired salary figures tomorrow. Arbitration cases will be held in early February.
LOCAL WEATHER
ATHLETE OF THE WEEK
The KLPW Radio Athlete of the Week is Gus Kleekamp with the Washington Post 218 Junior American Legion Baseball Team. Gus pitches, plays shortstop and bats third on the Junior Legion team that won the state championship in Blue Springs over the weekend. He posted the save in a 4-3 win over Festus in the title game. His batting average is .400 with 47-rbi and 47 runs scored. As a pitcher, he's 5-0 with an ERA of 1.631 and a WHIP of .961.
SPORTS CORNER
The Washington Seniors came back to life with a 14-2 route of Manchester Post 208 in the loser's bracket of the state tournament in Sedalia Friday afternoon. Matt Miller pitched a complete game for the win, as Washington improved to 35-4. The victory puts Post 218 in the championship game against Fike-Blue Springs today.
|
{
"pile_set_name": "Pile-CC"
}
|
The movie Carol is nearing its premiere at Cannes film festival next month. The movie is based on the erotic novel by Patricia Highsmith called The Price of Salt. The movie is directed by Todd Haynes and is...Read More
Twilight fame Robert Pattinson and his fiancé FKA Twigs are all set for marriage but say that they are at the moment not ready to be parents yet. They do not want kids for some years even by...Read More
Benedict Cumberbatch has to hit the gym for his new role in the Marvel’s upcoming Doctor Strange movie. The 38-year actor who is famous for paying characters who uses more brain than brawn is currently busy preparing for...Read More
|
{
"pile_set_name": "Pile-CC"
}
|
Broadband wireless is expected to be one of the main drivers of the telecommunications industry. There is a substantial increase in demand for broadband connectivity, with personal broadband being the key growth engine for mobile wireless broadband networks.
Communication in such networks is generally divided between access and backhaul. An access network is the air interface network providing traffic communication between mobile terminals (subscribers) and their associated access points (base stations), while a backhaul network is the air interface network providing traffic communication between the various base stations and a core network. The networks may be arranged to transfer data alone, as in Wi-Fi networks, or may be arranged for triple play services video, audio and data), typically WiMax (or other competitive technology, such as 3GPP-LTE). In conventional systems, the access network and the backhaul network each require their own separate transmission equipment, antennas, etc. at great cost to the operator.
One example of a conventional backhaul network is connecting wireless base stations to corresponding core mobile networks (ASN GateWay, AAA servers, etc). The choice of backhaul technology must take into account such parameters as capacity, cost and coverage. Base station backhaul typically is performed via wired infrastructure (e.g., E1/T1 leased lines), or via wireless Point-to-point (PTP) microwave links to each base station, which is expensive to deploy (equipment and installation). In particular, due to the direct, uninterrupted line-of-sight requirements of the wireless backhaul equipment, the backhaul components of conventional base stations require strategic deployment location on high and expensive towers.
Mobile WiMAX, as defined in IEEE Standard 802.16e-2005 Standardization for WiMAX, was originally designed to provide mobile broadband access for mobile devices, i.e., broadband wireless data-optimized technology, providing carrier-grade triple play services using a variety of user devices (such as laptops, PDAs, handheld devices, smart phones, etc.). A complete mobile WiMAX Radio Access Network (RAN) requires deployment of massive infrastructure, including base station sites with high towers, base station equipment, antennas, and a separate backhaul network, as described above.
The traditional approach for mobile WiMAX network infrastructure deployment is similar to that of cellular phone networks. The network is based on macro-cell deployment, that is, the base stations, radios and antennas are installed on top of high towers, transmitting at high power, so as to maximize the base station coverage area. In order to optimize the cost, the goal is to minimize the number of sites. This can be achieved by deploying more powerful base station equipment for increasing the cell range (e.g., high power radios, multiple radios on each sector with smart antenna techniques), resulting in more expensive base station equipment. However, for a broadband wireless network deployment, this approach is adequate mainly for the coverage phase, when a relatively small number of subscribers share the cell capacity. As the cell coverage area is large, covering a large number of potential subscribers, additional subscribers in each area can rapidly be blocked due to limited base-station capacity.
One proposal for increasing the traffic capacity of the base station, while not greatly increasing the interference caused with neighboring cells, is to use several directional antennae on a base station, each pointing in a different direction. In this way, it is possible to “sectorize” the base station so that several different sectors are served from the same location. (In any given direction, only a small number of frequencies are utilized). However, directional antennas are relatively expensive.
There are also known outdoor Wi-Fi networks, deployed mainly according to outdoor Wi-Fi mesh technology. The typical Wi-Fi setup contains one or more Access Points (APs), which is the equivalent terminology to Base Station in WiMax, having relatively limited range, deployed along telephone poles, street poles, electricity poles and rooftops. Due to the access point unit's smaller coverage range, a large number of access point units are required to cover a given area. Conventional outdoor Wi-Fi access point units require costly power amplifiers in each Wi-Fi AP unit to extend the coverage range. In addition, conventional Wi-Fi networks operate only on unlicensed bands and suffer from severe interference and difficult radio-planning issues.
Furthermore, in the micro/pico-cell deployment approach of conventional Wi-Fi-mesh networks, due to multiple access point nodes in the network, backhauling becomes more complicated and costly. Backhauling each node via wired lines (E1/T1 or DSL) is impractical in a dense deployment of nodes. On the other hand, backhauling each node via traditional wireless PTP microwave links is expensive due to costly equipment and installation costs and not feasible to deploy on telephone poles, street poles, electricity poles, etc. In Wi-Fi, like in WiMAX, PTP microwave links require high towers to achieve a clear line-of-sight between nodes. In addition, when the network load is increased, the backhaul network losses drastically degrade the overall network performance (capacity and latency).
In traditional Point-to-Point (PTP) microwave backhaul operating in licensed bands or using unlicensed bands, OFDM (Orthogonal Frequency Division Multiplexing) or single carrier technology (constant power with a fixed modulation scheme) are typically employed. In OFDM, the channel bandwidth is divided into multiple concurrent parallel transmissions on several frequencies. However, during each time slot, there must be transmission over every frequency in the bandwidth. Thus, there is no granulation to permit correction of local interference, and, if there is a problem with transmission on one frequency, the entire transmission can be lost due to lack of frequency diversity, so the Signal to Noise Ratio (SNR) of a link (between two base stations) falls on the entire link.
Consequently, there is a long felt need for a wireless mobile broadband network that is relatively low in cost and provides an in-band backhaul network having interference mitigation. In particular, it would be useful to have such a network with improved PTP communication having high frequency diversity, variable modulation and coding, MIMO and dynamically adapted Beam Forming, according to the instantaneous link conditions.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Can't ping LAN machines while on wired connection
I have weird situation where a single machine on my home network can't access another. The network is provided by TP-Link WR841ND router to following machines:
A - 192.168.1.117 - Win8.1 machine, wired connection,
B - 192.168.1.200 - Ubuntu 12.04 server machine, wired connection,
C - 192.168.1.111 - Macbook, wireless connection,
D - 192.168.1.210 - Raspberry Pi, wireless connection.
The problem is that A and B can't ping each other, both with Destination host unreachable error.
A can ping C and D.
B can ping C and D.
C can ping A, B, D.
D can ping A, B, C.
If I take wireless dongle from D and use it on A, everything suddenly works - it's only when both A and B are connected via wired connection the problems arise.
arp -a on box A doesn't list B:
Interface: 192.168.1.117 --- 0xa
Internet Address Physical Address Type
192.168.1.1 *mac-address* dynamic
192.168.1.111 *mac-address* dynamic
192.168.1.210 *mac-address* dynamic
arp -a on box B lists A, but with <incomplete> where mac addresses of other devices are:
A (192.168.1.117) at <incomplete> on eth0
C (192.168.1.111) at *mac-address* [ether] on eth0
router (192.168.1.1) at *mac-address* [ether] on eth0
D (192.168.1.210) at *mac-address* [ether] on eth0
arp -a on box C lists everything:
router (192.168.1.1) at *mac-address* on en0 ifscope [ethernet]
A (192.168.1.117) at *mac-address* on en0 ifscope [ethernet]
B (192.168.1.200) at *mac-address* on en0 ifscope [ethernet]
D (192.168.1.210) at *mac-address* on en0 ifscope [ethernet]
The router is running DD-WRT v24-sp2 (06/23/14) firmware. Resetting factory settings didn't help, neither did disabling SPI firewall, toggling AP isolation on or off, or poking other buttons in frustration.
Any suggestions?
A:
It turned out to be bug in DD-WRT router firmware. Appears that this old bug is back in builds dated after 29.03.2014
|
{
"pile_set_name": "StackExchange"
}
|
Helicobacter pylori FlhB processing-deficient variants affect flagellar assembly but not flagellar gene expression.
Regulation of the Helicobacter pylori flagellar gene cascade involves the transcription factors sigma(54) (RpoN), employed for expression of genes required midway through flagellar assembly, and sigma(28) (FliA), required for expression of late genes. Previous studies revealed that mutations in genes encoding components of the flagellar protein export apparatus block expression of the H. pylori RpoN and FliA regulons. FlhB is a membrane-bound component of the export apparatus that possesses a large cytoplasmic domain (FlhB(C)). The hook length control protein FliK interacts with FlhB(C) to modulate the substrate specificity of the export apparatus. FlhB(C) undergoes autocleavage as part of the switch in substrate specificity. Consistent with previous reports, deletion of flhB in H. pylori interfered with expression of RpoN-dependent reporter genes, while deletion of fliK stimulated expression of these reporter genes. In the DeltaflhB mutant, disrupting fliK did not restore expression of RpoN-dependent reporter genes, suggesting that the inhibitory effect of the DeltaflhB mutation is not due to the inability to export FliK. Amino acid substitutions (N265A and P266G) at the putative autocleavage site of H. pylori FlhB prevented processing of FlhB and export of filament-type substrates. The FlhB variants supported wild-type expression of RpoN- and FliA-dependent reporter genes. In the strain producing FlhB(N265A), expression of RpoN- and FliA-dependent reporter genes was inhibited when fliK was disrupted. In contrast, expression of these reporter genes was unaffected or slightly stimulated when fliK was disrupted in the strain producing FlhB(P266G). H. pylori HP1575 (FlhX) shares homology with the C-terminal portion of FlhB(C) (FlhB(CC)) and can substitute for FlhB(CC) in flagellar assembly. Disrupting flhX inhibited expression of a flaB reporter gene in the wild-type but not in the DeltafliK mutant or strains producing FlhB variants, suggesting a role for FlhX or FlhB(CC) in normal expression of the RpoN regulon. Taken together, these data indicate that the mechanism by which the flagellar protein export apparatus exerts control over the H. pylori RpoN regulon is complex and involves more than simply switching substrate specificity of the flagellar protein export apparatus.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Do compiled PHP scripts exist?
I am wondering if anyone has used or read about PHP scripts compiled as a .so extension for Apache... Thing is I think I remember reading about it somewhere but dont know if such a thing exists.
This looks promising, but incomplete and abandoned: http://phpcompiler.org/
Im interested because i think it could improve performance... Perhaps someone could point out a framework or apache extension that does this.
Thanks!!
A:
They do exist. There's HipHop Compiler for PHP by Facebook.
I don't know if it works with Apache, though.
You may want to take a look: http://developers.facebook.com/blog/post/358
Github repository: http://github.com/facebook/hiphop-php
A:
If you want to improve the performance of your PHP scripts in this way, you should try something like Zend Accelerator. It keeps the bytecode around so it doesn't have to be recompiled on every request.
A:
Im interested because i think it could improve performance
This is a very loaded question. Yes, if you are handling more than a million hits per hour, then there are very real benefits in compiling PHP (see other answers about HipHop). But if you really meant to ask "how do I improve the performance of my website" then that's probably the last answer anyone should give you.
If you're objective is to make your site go faster, then you first need to establish methods of capturing the time it takes to service a request (preferably seperating network and database time from webserver time), and for capturing page turn times (i.e. the time it takes to load all the content on a page) then look at stuff like:
browser side caching
server side caching
opcode caching
query optimization
HTTP compression
OS and network tuning
etc.
C.
|
{
"pile_set_name": "StackExchange"
}
|
Effect of culture conditions on the resistance of Pseudomonas aeruginosa biofilms to disinfecting agents.
The relationship between the environmental conditions of biofilm formation and resistance to disinfectants was studied. Anti-biofilm assays were performed against biofilms grown at 20, 30 and 37°C on stainless steel and polycarbonate, over 24 and 48 h. A rise in growth temperature increased the resistance of 24 h biofilms to disinfectants containing didecyldimethylammonium chloride and decreased it to a disinfectant containing alkyldimethylbenzylammonium chloride. The increase in growth temperature coupled with an incubation time of 24 h promoted increases in both matrix production and the membrane rigidity of sessile cells. An increase in incubation time also increased both matrix production and the membrane rigidity of sessile cells. Such phenomena resulted in an increased resistance to disinfectants of biofilms grown at 20 and 30°C. The resistance of 48 h biofilms to disinfectants decreased with an increase in growth temperature despite the increase in matrix production and the membrane rigidity of sessile cells.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Importance and relevance of melatonin to human biological rhythms.
The pineal hormone melatonin is a remarkable molecule, with a conserved time-keeping function across species. It is extensively used as a self-administered remedy for sleep disturbance in countries where it is freely available, and to some extent when it is available on prescription, as in the UK. In some circumstances, notably free-running sleep disorder of the blind, it is the treatment of choice. It is also the marker rhythm of choice for the determination of circadian phase and period. This review outlines the current state of knowledge within a physiological perspective with emphasis on human biological rhythms.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Hepatitis B core-related antigen levels are associated with response to entecavir and peginterferon add-on therapy in hepatitis B e antigen-positive chronic hepatitis B patients.
Hepatitis B core-related antigen (HBcrAg), a new serum marker, may be useful in monitoring chronic hepatitis B infection. HBcrAg was measured in 175 hepatitis B e antigen-positive patients treated with entecavir (ETV) with or without peginterferon (PEG-IFN) add-on therapy. Decline in HBcrAg was stronger in patients with vs. without combined response (ETV: -3.22 vs. -1.71 log U/mL, p <0.001; PEG-IFN add-on: -3.16 vs. -1.83 IU/mL, p <0.001) and in patients with vs. without hepatitis B surface antigen (HBsAg) response (ETV: -2.60 vs. -1.74 log U/mL, p <0.001; PEG-IFN add-on: -2.38 vs. -2.15 log U/mL, p = 0.31). HBcrAg was associated with combined response (adjusted odds ratio 0.3, 95% confidence interval 0.2-0.5, p <0.001), but was not superior to quantitative HBsAg (qHBsAg).
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Midnight: A Gangster Love Story
Midnight: A Gangster Love Story originally scheduled to be published October 14, 2008, is a novel by Sister Souljah that was published November 4, 2008, by Atria/Simon and Schuster. It is a prequel of The Coldest Winter Ever (1999), the novel that spawned the contemporary street literature movement. It follows a young Black Sudanese Muslim immigrant in Brooklyn with whom Winter Santiaga associated before she was sent to prison.
Characters
Midnight, the narrator and title character, is a 14-year-old Black Sudanese immigrant. He learns about the struggles that occur in the US. He proceeds to criticize the way that modern African Americans act in contrast to the way he and the men in Sudan behave and, in contrast, they have loose behavior. He also learns to find love and trains in Ninjutsu so that he can protect the people whom he loves and cares for.
Umma, Midnight's and Naja's mother, is content with the way woman act in her country and is trying to make a notable life for her two children since their move to the United States by founding a business through which she designs and sells elaborate traditional garments.
Naja, Umma’s daughter, is Midnight's 7-year-old sister. Midnight and Umma try to protect her from the world at large.
Akemi, a 16-year-old Japanese girl who lives in Queens where she is working for her uncle while in America on an art fellowship from Japan. Akemi speaks Japanese, Mandarin, and Korean, but she is slowly learning English. An art prodigy, she attends college-level classes at Pratt Institute. She and Midnight love each other romantically.
Ameer, described as one of Midnight’s close friends, is a 15-year-old Five Percenter who is mostly interested in girls. Ameer and Midnight fight frequently in a playful way. After a street fight between the two characters ends, Midnight explains his and Akemi's relationship.
Chris, another of Midnight's close friends, plays basketball for money in a hustlers’ league, and lives with his mother and strict, protective father.
Marty Bookbinder, the owner of a bookstore with whom Midnight plays chess and is offered sage advice and life lessons.
Plot
Midnight is born into a prominent Islamic Black Sudanese family in which he enjoys a life of comfort, confidence, and protection. His father provides him with a veil of privilege and deep, devoted love, but he never hides the truth about the fierce challenges of the world outside of his estate. In the mid 1980s, his father abandons the family, disappears, and is never heard from again. Just before his disappearance, he instructs Midnight and his immediate family to move to the United States. Midnight, his mother, and his sister eventually settle in project housing in the borough of Brooklyn in New York City. They are repulsed by American culture and try to live as comfortably as possible without fully engaging with their new home.
In the streets of Brooklyn, a young Midnight uses his Islamic mind-set and African intelligence to protect the ones he loves, build a business, reclaim his wealth and status, and remain true to his beliefs.
Over the course of four years, Midnight eschews traditional school and eventually enrolls into a Japanese martial-arts dojo, where he trains to be as nimble as a Japanese ninja. When a strange man professes his attraction to Umma, Midnight hunts him down and kills him in Prospect Park—a perfect murder that the police never solve. He also learns how to play basketball and is one of the star players in a hustlers’ league, where he meets his two closest friends, Ameer and Chris. He is also obsessed with protecting his family and procures a stash of weapons for protection. He frequents a small bookstore where he plays regular games of chess with its owner. However, he is extremely guarded and no one outside of his immediate family ever finds out whom he really is or even what his real name is.
Later, Midnight meets a young woman named Akemi, who is an art prodigy from Japan who takes advanced-placement classes at Pratt Institute. Eventually, despite neither of them being able to understand each other’s language, Midnight and Akemi fall in love and decide to marry. Midnight tries to manage his life with Akemi and look out for his family and hang out with his friends while managing his family's newly opened business. He comes to terms with struggles that occur from day to day.
Umma and Naja accept Midnight and Akemi’s decision joyously. When Akemi’s father learns of the marriage, however, he does not approve of the union and takes her back to Japan. In the sequel, Midnight travels to Japan to try to take her back home.
References
External links
Simon & Schuster
Category:Novels by Sister Souljah
Category:2008 American novels
Category:Urban fiction
Category:Brooklyn in fiction
Category:Novels set in New York City
|
{
"pile_set_name": "Wikipedia (en)"
}
|
$219,000
FOR SALE206 John Street, Maryborough
Property ID:61817730
Bedrooms:2
Bathrooms:1
Property type:HOUSE
Land size:870 Metres²
Building size:
Garage:1
Listing type:FOR SALE
CHARACTER & CHARM
This delightful award winning home is full of old world charm. The traditional features on offer are from the (Circa 1936) and are second to none. A renovator will appreciate this unique find and enjoy adding their own touches to the home with the minor renovations required.
Some of the many features include ornate plaster ceilings, led lighting, French doors, T & G walls, bay windows, fret work, and air conditioning.
There is a timber garage at the rear of the block and good side access is available.
The property is situated on a fully fenced 870m2 allotment within walking distance to the CBD, schools, park land, and restaurants.
The home is meeting the market and is listed for sale at a figure of $219,000
For further details please contact the office.
Contact
Email To A Friend
Resources
We would like to thank you and Wal for all your efforts in negotiating and seeing the sale through to settlement in such a supportive and professional manner. Kind Regards Rhonda & Alan
- Rhonda & Alan
We are so happy with Wal Pavey Real Estate. When we came to Maryborough over 10 years ago we purchased a property from them and their knowledge and information was great. Wishing to sell our property we contacted these agents again and to our surprise they were able to gain a contract for the home in a couple of days and now the contract is unconditional. Would recommend this firm to any buyer or seller in the area
- Glenda
Cindy Pavey of Wal Pavey Real Estate was engaged to sell a property for Margaret White at 204 Tooley Street in Maryborough in late 2019. In less than 2 weeks she had a contract and after some negotiation and building inspections, the property went unconditional. This was not an easy property to sell and it had been on the market with another agent for over 2 years. Then Cindy managed to find a rental property for Margaret in a very tight rental market for the Maryborough area at this time. I have no hesitation in recommending Cindy Pavey to anyone considering selling or buying. For clarification of the above my phone number is included.
Signed Jim & Margaret
|
{
"pile_set_name": "Pile-CC"
}
|
On Oct. 23, Denise Grady, health writer for The New York Times, wrote an article about a new in-utero surgical technique to correct fetal spina bifida — a condition in which the spinal column does not fuse, leaving the spinal cord exposed. Children born with spina bifida are unable to walk and can suffer a host of other serious disabilities. Surgeons have been operating on gestating children to ameliorate spina bifida for about 20 years, with mixed results. But this new method is fetoscopic; it does not require opening the uterus and removing the developing fetus. Instead, tools are inserted into the uterus through a tiny incision, and surgery is performed guided by a tiny lighted camera and images projected on a video screen.
Grady watches the surgery — which took place last month at a Houston hospital — and tone of her piece is hopeful; even a bit awestruck. Describing the gestating infant being operated on — at only 24 weeks — she writes, "The patient, still inside his mother's womb, came into focus ... Fingers, toes, the soles of his feet — all exquisite, all perfectly formed."
|
{
"pile_set_name": "OpenWebText2"
}
|
Summary: an AU taking place in the ep "Faith" - what these two do on the planet.
warning: this is probably an offshoot of my series, rather than something that takes place in the show over season 1. or maybe it tucks back into the series, I don't know.~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
"Rush, what the hell're you doing?" Young asked, after a dash from the just-now-locked door to the shuttle to the nearest comm room.
"Playing poker, it seems, Colonel," Rush said, sitting in the pilot seat. He had been standing in the corridor, perfectly ready to ask Col. Young if he was really going down to the planet, when Lt James had walked up to him and past him, not even slowing her walking pace when she grabbed him by one shoulder...and half pulled, half led him to the shuttle.
"Do not disengage from Destiny. Do you hear me?"
"Colonel, what's the penalty for insubordination?" Rush asked. "Now compare that to the penalty of starvation."
"What?" Young and Eli both asked.
"I trust things will become clearer," Rush said, and, listening, Eli wondered who he was talking to just now.
~~~PLANETSIDE:
"I thought Colonel Young was coming," Scott says.
"As did I," Rush says. "But, as you can see, plans have changed."
"Why are you here?" TJ asked them.
"Well, we're going to load up the shuttle with food and water. And then we're going to stay here."
"For how long?"
"As long as everyone else does," Rush said. "I'm sure Destiny will be fine without me. After all, what have I ever done to fix her?"
That generated murmurs and sped up everyone converging on this point.
"You can't do that," TJ said.
Vanessa grinned to herself: Tell Rush he can't do something, and he takes it personally.
"Why not?" Rush asked TJ.
Like I knew he would, Vanessa thought to herself.
"This planet is habitable for most of the year. I'm sure I can devise a way for us to survive when this planet's orbit takes it beyond the freezing point of water."
"It won't come to that," said Caine. "By that time, the aliens who built this world, will come back."
"Maybe," Rush said.
"They will. They made this world for us. They can help us get home."
"Aliens made the planet?" Vanessa asked him.
"Yes," he said, a little puzzled - he'd thought everyone had been briefed on that by now.
"And that makes them good guys?"
"An advanced alien civilization has no need to go to war."
2nd Lt James frowned, and she could see a few other similar faces among those assembled. "I'm going to guess you haven't been with the Stargate Program very long."
"Almost a year, actually," Caine said.
"Then you never met the Goa'uld or the Ori," Vanessa said, seeing Greer and Volker nod.
"On the other hand," Vanessa said, "maybe you're right. Maybe we should stay here and see what these aliens want from us in return for the planet or the ride home. All I ask is I get a window seat," and walked to one of the tents.
The shuttle was up and launching, fully stocked with people and food and water, within the hour.
|
{
"pile_set_name": "Pile-CC"
}
|
Jimmy Savo
Jimmy Savo (1895 – September 5, 1960) was an American Vaudeville, Broadway, nightclub, film and television performer, comedian, juggler, and mime artist.
Life
Born in New York City as James Vincent Savo on July 31, 1892, Savo began his career as a juggler in amateur contests and went on to the burlesque circuit and then Broadway. In 1938, he originated the role of "Dromio of Syracuse" in The Boys from Syracuse.
Savo also starred in "Once In A Blue Moon," (1935) written by Ben Hecht and Charles Macarthur. The film was not a success, costing Paramount pictures $350,000.
In 1942 Isidore Herk and the Shubert brothers co-produced a Broadway show called Wine, Women and Song, starring Jimmy Savo and Margie Hart.
The show was advertised as a combination of vaudeville, burlesque and Broadway revue, and ran for seven weeks.
The revue included striptease, which shocked some of the audiences.
Wine, Women and Song was closed by court order in December 1942.
Savo was the author of two books: Little World, Hello! (1947) and I Bow to the Stones; Memories of a New York Childhood (1963).
He died in Terni, Italy in 1960.
References
Further reading
"Jimmy Savo Dead; Comedian was 64" The New York Times September 7, 1960
"Jimmy Savo (New York 31 luglio 1892 - Guardea 3 settembre 1960); sposato con Frances Victoria Browder, divorziato nel 1935, figli: Jimmy Vincent Savo Junior, sposato in seconde nozze con Farina Lina, Italia, Guardea (Terni), senza figli.
"Jimmy Savo; di Famiglia Lucana originaria di Stigliano (Matera) al "secolo" Vincenzo Rocco Sava, abitò con Farina Lina a Guardea (Terni) Italia nel Castello del Poggio e ad Amelia (Terni) Italia in Via Marcheggiani n. 26. Oggi abitazione "Della Rosa" Amelia (Terni). Referenze, fotografie e note in: www.grupporicercafotografica.it/jimmysavo.htm.
Cullen, Frank, Florence Hackman, and Donald McNeilly. Vaudeville, Old & New: An Encyclopedia of Variety Performers in America. New York: Routledge, 2007. Pg. 993
''Schmucks with Underwoods," Max Wilk, (C) 2004 Applause Theatre and Cinema books
External links
Jimmy Savo at American Museum of Vaudeville.com
Jimmy Savo http://www.grupporicercafotografica.it/jimmysavo.htm
Jimmy Savo http://www.jimmysavo.it
Jimmy Savo http://jimmysavo.altervista.org
Category:Vaudeville performers
Category:American mimes
Category:American male film actors
Category:American male silent film actors
Category:American male comedians
Category:American male musical theatre actors
Category:1895 births
Category:1960 deaths
Category:Jugglers
Category:20th-century American male actors
Category:20th-century American comedians
Category:20th-century American singers
Category:20th-century male singers
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Can Adults With Autism Spectrum Disorder Drive?
Autism spectrum disorder (ASD) does not stop adults with the disorder from driving but may make speed and lane management difficult, according to a new study.
Can Adults With Autism Spectrum Disorder Drive?
But licensed drivers with ASD have similar basic driving skills as their TD peers - even under more demanding conditions, according to the study by researchers at Drexel University, Philadelphia. "We hope our findings will help in developing targeted approaches to help teens and young adults with ASD to become safe drivers, helping to promote their independence in many aspects of life," comments lead author Kristina Elise Patrick, PhD, now at Nationwide Children's Hospital, Columbus, Ohio.
‘Drivers with autism spectrum disorder have similar basic driving skills as their peers but have difficulty in speed and lane management.’
Less-Experienced Drivers with ASD Have More Problems with Driving Skills
The study included two matched groups of young drivers, aged 16 to 26 years: 50 with autism spectrum disorder (ASD) and 50 with TD. None of the participants had been diagnosed with intellectual disability; the ASD and TD groups were similar in terms of age, gender, driver's license status, and IQ.
All participants underwent a structured driving assessment using a virtual reality driving simulator. During the simulation, the driving tasks become progressively more challenging, with added distractions and more complex driving conditions. The two groups were compared for basic driving skills, such as speed and lane positioning.
The two groups had similar performance in terms of maintaining the speed limit. However, drivers with ASD showed increased variability in speed and lane management, compared to drivers in the TD group. These differences suggested "difficulty with self-monitoring and regulation of pedal pressure and steering wheel control," Dr. Patrick and coauthors write.
The differences between the drivers with ASD versus TD were more pronounced in more challenging driving environments. This was so not only in more complex driving conditions, such adjusting to a change in speed limit or construction zone; but also when engaging in secondary, potentially distracting tasks, such as tuning the radio or engaging in social conversation.
However, the differences in performance for drivers with ASD depended on driver's license status. Among unlicensed drivers, the ASD group had greater variability in speed and/or lane positioning, compared to the TD group. But among those who had their driver's license, there were no significant differences between the drivers with ASD versus TD. For many tasks, there was also similar performance for drivers with ASD and TD who had their learner's permit.
Affecting approximately 1 in 68 children, ASD is a common neuro-developmental condition. With early recognition and access to effective treatments and support, many young people with ASD have educational, occupational, and social opportunities similar to those of their TD peers. The ability to drive is a developmental milestone in American society, and an important part of independent functioning.
Studies suggest that only about one-third of teens with ASD have their driver's license - perhaps due to concerns about their ability to drive safely. The new driving simulator study is one of the first objective assessments of driving ability in teens and young adults with ASD, compared to young people with TD.
"Our findings suggest that unlicensed young adults with ASD may have more difficulty than their peers developing basic driving skills," Dr. Patrick and coauthors write. "That said, those individuals with ASD who do acquire driver's licenses may demonstrate comparable skills to TD drivers during most tasks."
Dr. Patrick and colleagues are working on further studies of variables that may affect driving performance in young adults with ASD, and whether difficulty with basic driving skills translates to more overt driving errors. The researchers conclude, "Individually tailored driving interventions with a focus on graduated exposure to increasingly complex environments may be beneficial for individuals with ASD, particularly in the early stages of driver training."
The complete study is published in the Journal Developmental & Behavioral Pediatrics, the official journal of the Society for Developmental and Behavioral Pediatrics.
Your comments are automatically posted once they are submitted. All comments are however constantly reviewed for spam and irrelevant material (such as product or personal advertisements, email addresses, telephone numbers and website address). Such insertions do not conform to our policy and 'Terms of Use' and are either deleted or edited and republished.Please keep your comments brief and relevant.This section may also have questions seeking help. If you have the information you are welcome to respond, but please ensure that the information so provided is genuine and not misleading.
Disclaimer - All information and content on this site are for information and educational purposes only. The information should not be used for either diagnosis or treatment or both for any health related problem or disease. Always seek the advice of a qualified physician for medical diagnosis and treatment.Full Disclaimer
|
{
"pile_set_name": "Pile-CC"
}
|
top and tail
top and tail
1. noun The act of quickly washing the head and buttocks of a baby or small child. Primarily heard in UK. We need to remember to start doing top and tail each evening before we put Samantha to bed. The GP said the cradle cap was because she's not getting washed often enough.
2. verb To quickly wash the head and buttocks of a baby or small child. Primarily heard in UK. It's too late for a bath, so just top and tail him after you brush his teeth.
3. verb To cut off the top and bottom ends of a fruit or vegetable as part of its preparation for a meal. Primarily heard in UK. Next, top and tail the cucumbers and slice them into thin spears, removing the seedy flesh from the centre.
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.
|
{
"pile_set_name": "Pile-CC"
}
|
Share this Story
Ward Churchill Case Heads to Colorado Supreme Court
ICTMN Staff
5/29/11
Ward Churchill
Embattled former University of Colorado (CU) professor Ward Churchill’s civil rights case will be reviewed by the Colorado Supreme Court.
High court scrutiny will be afforded to the issue of whether CU’s investigation of Churchill’s scholarship was an “adverse employment action” under federal civil rights law when, after the investigation’s conclusion he was fired for “research misconduct.”
“It’s a very hopeful sign for the First Amendment, for academic freedom, and for tenured professors,” David Lane, Churchill’s attorney, said.
Churchill and a District Court jury—whose verdict was tossed out by the lower court judge—contended he was fired in 2007 in violation of free speech rights after attention was drawn to a post-9/11 essay he wrote in which he referred to some World Trade Center workers as “little Eichmanns” as part of a critique of U.S. foreign policy.
The Colorado Supreme Court will also decide whether granting quasi-judicial immunity to CU regents who fired Churchill, a tenured professor, and the subsequent denial of his reinstatement or other remedies are actions consistent with civil rights law.
Churchill earlier was unsuccessful in an attempt at a reversal of the lower court judge’s decision to dismiss a jury’s retaliatory firing verdict and then to deny him reinstatement to his former faculty position because, the judge determined, CU officials were immune from liability.
Then, last November, the Colorado Court of Appeals ruled that his academic freedom “did not include the right to commit research misconduct that was specifically proscribed” by CU’s policies and enforced by shared CU/faculty governance in what the court determined was not an adverse action.
Churchill, who wrote extensively on Native issues, was fired from CU’s ethnic studies department after his online essay seemed to blame all 9/11 victims personally for federal policies that preceded the 2001 attack and, although he subsequently attempted to clarify what he meant, a political firestorm ensued.
A former Colorado governor and other politicians, CU regents, talk show hosts, and assorted pundits called for him to be fired, and were “falling all over themselves to talk to the national media and calling for his dismissal,” Lane said at the time, vowing to go to the U.S. Supreme Court, if necessary.
CU decided that his post-9/11 essay enjoyed free-speech protections but that simultaneously raised allegations of research misconduct had to be addressed “just as it should address alleged sexual harassment, sanctionable criminal activity, or other wrongdoings within its purview,” CU said, and Churchill was fired after the review.
Churchill, in turn, charged that CU selectively enforced research misconduct policies “in retaliation for his exercise of free speech.”
“As it stands right now, if a university fires a professor for protected speech, the court will turn a deaf ear—hopefully the Colorado Supreme Court will reverse that,” Lane said after the state Supreme Court agreed to review Churchill’s case.
Legal observers felt it was possible the state’s high court might accept Churchill’s request for review because the issue of whether an investigation alone constituted an adverse employment action had not been resolved in the U.S. Supreme Court.
The date for hearing has not been set for the Colorado Supreme Court’s review of the issues presented by Churchill, who was not immediately available for comment.
You need to be logged in in order to post commentsPlease use the log in option at the bottom of this page
|
{
"pile_set_name": "Pile-CC"
}
|
" Mother." " Good morning, darling." "I have a feeling you're trying to tell me something." "Those were in you-know-who's briefcase." " So?" " Well, don't you care if he carries pictures of other women?" "Mother, in the advertising business, other women are merely tools of the trade." " Oh, blind faith is unbecoming to you, Samantha." "Don't you understand?" "I trust Darrin." "You wouldn't turn a child lose in a candy store, would you?" "Darrin is not a child." "Well, he's only human." "Isn't that the excuse they always make for themselves, "I'm only human"?" "They know their limitations better than we do." "Well, I don't think of Darrin as being merely human." "I think of him as being a cut above the ordinary mortal man." "How can a witch of mine be so naive?" "Mother, will you please go away." "Very well, very well, I'm leaving." "But remember, Samantha no mortal pulls the wool over a witch's eyes while I'm around." "What are these doing here?" "Thought I left them in my briefcase." "You better eat your breakfast." "You'll be late." "I've been looking at girls for weeks." "Yes, I suppose that could get tiring after a while." "You're not kidding." "Which one do you like best?" " For what?" " Miss Jasmine, the perfume account." "Oh, yes." "Of course." "Well, let's see, now." "This one has lovely eyes." "And this one has a beautiful mouth." "This one has a great figure." "Gee, I don't know." "Why don't you cut out the best piece of each and paste them together like I used to do." "With paper dolls." "Look, I'm serious, Sam." "The campaign starts tomorrow, and we haven't picked a Miss Jasmine." "Incidentally, we have to forget about having lunch together today." " How about tomorrow?" " Well, all right." "As long as you promise to have lunch alone today and not enjoy it." "I'll do better than that." "I'll have lunch with Larry Tate and really be miserable." "Better get going." "You better get going." "Okay." "But remember, you threw me out." " So, what do you think?" " Marvellous." "Incredible." "Some of the most gorgeous creatures I ever laid eyes on, but I still haven't seen that je ne sais quoi that ethereal quality we need in a Miss Jasmine." "Courage, old friend." "Don't lose faith, we'll find her." "I know that." "I was just thinking about going home to Louise tonight." "I don't know, after a week of looking at these, it seems pointless somehow." " Now, Larry, you've got a lovely wife." " I suppose so." "If you'll excuse me, Darrin, I'm going out to try and wipe out the memory of all this." "I never could stand too much of a good thing." " Yes?" " I hoped you'd say that." " I beg your pardon?" " Aren't you looking for a Miss Jasmine?" "I was." "I mean, we are." " Won't you sit down, Miss...?" " Janine Fleur." "Thank you." "Have you done much modelling, Miss Fleur?" "I'm sure I could be everything you want in a Miss Jasmine, that is." "You might." "Yes, you just might." "Hello, Larry?" "Can you come in here for a minute?" "Good." " Is something wrong?" " Wrong?" "No." "You may solve a very big problem for me, Miss Fleur." " Janine." " Well?" "Well..." "Well." "I'm thinking exactly what you're thinking, Larry." "I won't say anything if you won't." "You've been very quiet tonight." "You have a bad day at the office?" "Oh, it wasn't a bad day." "It wasn't a good day." "As a matter of fact, it wasn't a bad day." "Well, don't commit yourself." "Anything new on Miss Jasmine?" " We found one." " You did?" "Oh, that's marvellous." "What's she look like?" " Attractive." " Attractive?" "You said you needed something gorgeous." "Well, she's sort of gorgeous." " She's blond, I'll bet." " No, not really." "Well, what's she look like?" "Tall, straight nose, experienced." "Well, that could be Abraham Lincoln." "I said she was pretty." "You said she was attractive." "There's a difference." " What's her name?" " Janine Fleur." "Oh, sounds like perfume." " Does she look like she sounds?" " You could say that." "I haven't seen her." "What do you say?" " Yes." " Yes, what?" "She sounds like perfume, she looks like perfume she even smells like perfume." " You smelled her?" "No, of course not." "Not deliberately." "She's exactly what Larry and I have been looking for." "Well, that's wonderful." "Now, how would you like to go to the movies, eat popcorn and smooch?" "I would love to but I've got to work on some exploitation ideas." "He's very evasive." "That shows interest." "He is only interested in that woman because of business." "You'd better make it your business." "Did you notice that he kissed you on your forehead?" "The next thing you know, he'll be patting your hand." ""Notes on Jasmine campaign:" "Janine Fleur, measurements 37-23-37."" ""Adjectives to be used in copy describing her:" "Provocative, dazzling, ethereal." "Personally supervise photographs for campaign." "Get headshots featuring her large, soft, dark eyes." "Get night shots at beach." "Moonlight." "Janine holding perfume bottle in her long, slender fingers." "Should be irresistible in a bikini."" " What happened?" " You were having a nightmare." " Didn't seem like one." " I say it was." "I know a nightmare when I see one." "Go back to sleep, dear." " Well?" " I'd like to change her position a bit." "Figures." "Here, Janine, why don't you try your hand here, stroking the bear's nose." "Thank you." "There you go." "You keep moving her around, we'll be here all day." "I think we've got it now." "Hold it." " Thank you." "Is that lunch?" " Go ahead." "Lunch, Janine." "Oh, wonderful idea." "I'm starving." "Where shall we go?" "We?" "I'm afraid I can't." "I'm meeting my wife." "Well, I wouldn't ask you or interfere, except that it's..." " Well, never mind." " Well, what is it?" "Well, it's probably foolish, but I think you'd better get another Miss Jasmine." "Another Miss Jasmine?" "What for?" "Now, hold it." "I think we better talk about this." " But your lunch." " I'll cancel it." " Please don't do that because of me." " My wife will understand." "She knows that at the moment the most important thing is Jasmine Perfume." " Go and change, and I'll give her a call." " All right, I'll hurry." "Hello?" "Oh, hi, darling." "I was just leaving." "What?" "Oh, no, no." "I understand." "Yes, well, you go ahead." "I'll see you tonight." "Well, well, well." "All dressed up and nowhere to go." " I am going to have lunch with Darrin." " Really?" "One of these days when he's not too busy." " Oh, I understand, dear." " No, you don't." "You think my husband is taking another woman to lunch." " I haven't said a word." " Well, it's business." "Oh, yes, of course." "Well, I was going to suggest that perhaps we could have lunch together." "Oh, certainly." "You know where Darrin is so you're gonna bring me face to face with him to prove your point." " I never suggested it." " I won't." " Very well." " I'll tell you what I'll do." " What?" " I am going to take you there and bring you face to face with Darrin to prove my point." "Wait for me, Samantha." "Oh, isn't this delightful." "We must have a waiter." "Waiter." "Menu." "Thank you." " Mother, are you sure he's here?" " Quite sure." "Oh, they have Coquille St. Jacques." "They make it marvellously here." "Mother." "I don't believe it." "I'm sure I will." "Where is he?" "I know this is upsetting for you, darling but I'm not in the least surprised." "But, Mother, why?" "I thought he was happy with me." "It's the spirit of conquest." "It's a disease of mortal men." "Like chickenpox." "Just a moment." " That girl..." " I know how you feel, Samantha but I do think we ought to leave before they see us." "Now, Samantha!" "You're not going to create a scene!" "All right." "Come off it, Sara." "Dignity, Samantha, dignity." "Well, hello, Samantha." "My, it has been a long time, hasn't it." "Sara Baker." "I should've known." "She's one of us, Mother, although I hate to admit it." "Just what do you think you're doing with my husband?" "Your husband?" "Now, I heard you'd done something foolish but I never thought for a moment..." " You haven't answered my question." "Well, that must be obvious." "I'm Miss Jasmine." "Well, now, I must say I've had enormous respect for Darrin's taste up until now." "Now, just a moment, blithe spirit." "Watch your tone, my girl, you're speaking to my daughter." "Oh, really?" "Well, now, look who's suddenly so concerned." " What does that mean?" " Pay no attention to her." "You seem terribly solicitous for someone so anxious for me to test your mate's mettle." "Mother!" "If there's one thing I cannot abide, it's a stool pigeon." "What did you think you'd prove by siccing this broom rider on Darrin?" "Easy, Samantha." "Be careful what you say." "Well, you haven't proved a thing." "Even Sir Galahad wouldn't be safe with her." "That's better." "Now that this masquerade is over, I trust it won't be necessary to ask you again." "Stay away from Darrin, Sara." "Is that clear?" "Well, she certainly is sensitive, isn't she?" "Pity, I was just starting to enjoy myself." "I appreciate your efforts on my behalf, Sara Baker but now you'll do as my daughter asked." "You know how difficult it is for me to leave something unfinished, Endora." "Force yourself." "All of us at McMann Tate are behind you 100 percent to make you the best Miss Jasmine there ever was." " I want you to believe that." " I do believe you, Darrin and I won't think about leaving again." "You wouldn't want me to start something I couldn't finish?" "Of course not." "I want..." "Where did all the time go?" "We haven't even had our lunch." "We'd better get back." " We'll talk about this some other time." " Oh, yes, indeed." "Some other time." "Waiter." "Hello?" "Oh, hello, darling." "How are you?" "You're not?" "Yes, dear." "Business." "Miss Jasmine." "Oh, I understand." "No, I'm fine." "Yes, sweetheart." "See you later." " She won't give up, eh?" " That home-wrecking harpy." "Professional pride, I suppose." "She's not gonna get away with it." "I'm gonna tell Darrin that she's a witch." "I wouldn't try to convince him he's susceptible to witches, Samantha." "I never used one single spell on Darrin." "You may have a difficult time convincing him of that." "Mother, what am I going to do?" "You have no choice." "I guess not." "I suppose every woman has to face this at one time or another." "Darrin will just have to be on his own with no help from anyone." " Yes, but, darling..." " And so will I." " All finished?" " Almost." "How are things coming with Miss Jasmine?" "I think we're getting some good layouts." "Fine." "Well, I'll see you tomorrow." "Where you going?" " Home." " Do you have to?" " Yes." " Louise is waiting for you, I suppose." "Well, is it urgent that you go home right at this minute?" "Not if you have somewhere else for me to go." " I do have." " Where?" "Janine Fleur's apartment." " Really?" " With me." " Why?" " I've got business to take care of with Janine, and I'd rather not do it alone." "I brought Larry along to approve some of these changes you asked me to come over and make." "Yes, of course." "May I fix you both a drink?" " Yes, thank you." " No, thank you." "Just a little one." "Well, fine." "Larry, these television spots need a little..." "Larry." "Oh, yes." "They certainly do need a little." "Yes." " I was going to say "fixing."" " I'm not arguing with you." "There you are." "Well, here's to your very good health, Miss Fleur." " Of course." " Thank you." " Are they all right?" " Mine's wonderful." "I think I'll lay down and take a nap." "Meantime, I'll take care of Janine." "Isn't it getting crowded in here?" "Sara, I'm going to lay it right on the line with you." "I love my husband, and I also have a great deal of faith in him." "Oh, is that why you're here?" "Looking after him?" "He can take care of himself as long as you don't pull anything fancy." "I don't know what you're talking about." "Oh, of course not." "He was suddenly bitten by a tsetse fly." "Samoan lotus leaf." "Now, at least let him act of his own free will." "I thought you had more pride than that." "Believe me, Samantha, I have no need of help." "If I'm going to lose Darrin to something like you it's better that I find out now." "Remember what I said." "His own free will." "And go over the papers right away." "Is that all right with you, Larry?" " Oh, sure." " Why don't we sit over here." " The light's a bit better." " Oh, fine." "Come on over, Larry." "All right." "Yes, here we are." "Now, in this first set-up..." " Why don't you go on home, Larry." " I'd be glad to." "Two's company and three's a crowd." " Where you going, Larry?" " Home, I think." "Well, what for?" "I don't know, but I don't think it was my idea." " Well, wait for me, will you?" " Sure." "I think I need another drink." "All right, now, I think the dialogue that probably gives you the most trouble is on page three." " You're absolutely right." " It seems to me, if you said:" ""Jasmine introduces a new sensation" rather than "a new essence" that might make it easier." "Wouldn't you say so, Larry?" "Larry?" "That's the strangest thing I've ever seen." "He keeps going to..." " Kiss you." " What did you say?" "I said, I wanna kiss you more than anything else in the world." "Go ahead." "What in...?" "That wasn't funny, Samantha." "Well, I warned you." "Now, if you'll excuse me, I'd just as soon keep my husband alive." "Get out of here, or I'll..." "You'll what?" "You know what I'm capable of doing." "I'd say we were pretty evenly matched." "Sort of reduces this to the human level, doesn't it?" "How would you like a poke in the nose?" " I'm not a brawler." " I didn't think so." "Pardon the intrusion." " What did you do that for?" " I'm sorry, Darrin." "It slipped." "Never mind, I probably had it coming." " What happened to you?" " Nothing, where were you?" "I think I took another nap." " I feel great." " I'll see you tomorrow, Janine." "But, Darrin, we have things to talk about." "I don't mind breaking dinner dates with my wife for something important but there's nothing here that can't be fixed down at the office." " Are you coming, Larry?" " You run along." "You're absolutely right." "Samantha must be concerned about you." "Suit yourself." "All right." "Well, now, Miss Fleur, suppose we talk about your problems." "Now what?" "I realise that this is none of my business, Sara but Louise Tate happens to be a very dear friend." "Some other time." "My wife is waiting for me too." "Oh, yes, if you can't stay, I understand." "Then I wish you'd explain it to me." "Come in." " Hello, darling." " Hi, sweetheart." "This time I didn't take any chances." "I didn't phone, I just came right down." "I've got it written on my calendar in big red letters:" " "Lunch, my wife, urgent."" " Good." " Oh, is that Miss Jasmine?" " Yep, that's her." "Let's go, dear." "Subtitles by SDI Media Group"
|
{
"pile_set_name": "OpenSubtitles"
}
|
Re: [Gnu-arch-users] corrupted binary files
From:
Brian May
Subject:
Re: [Gnu-arch-users] corrupted binary files
Date:
Tue, 06 Apr 2004 08:53:54 +1000
User-agent:
Gnus/5.1006 (Gnus v5.10.6) Emacs/21.3 (gnu/linux)
>>>>> "David" == David Allouche <address@hidden> writes:
David> Are you sure the cvs-keyword configuration for that file is
David> correct?
How do I tell/verify what the config is for a given file?
David> I have a similar problem with the texmacs cvs. The
David> maintainer is just too lazy and ignorant to correctly set
David> the thing up so binary files have keyword expansion
David> enabled.
David> For some reason, that does not cause any problem with "cvs
David> co" or "cvs update", but it breaks with the command used by
David> cscvs.
David> When adding the "-kb" (disable the damn expansion) option
David> to the "cvs update" command in cscvs, things work right.
Hmmm... That works... Not sure if this is good or bad...
I thought everyone knew these days the importance of using -kb for
binary files in CVS :-(.
--
Brian May <address@hidden>
|
{
"pile_set_name": "Pile-CC"
}
|
1995-2020 Hospitality Net™ All rights reservedHospitality Net is powered by Hsyndicate
|
{
"pile_set_name": "OpenWebText2"
}
|
1. Introduction {#s0005}
===============
Immune cells, like macrophages, are major sources of reactive oxygen species (ROS) in the body. Particularly superoxide is produced by NADPH oxidase (NOX), an enzyme family consisting of several isoforms of which NOX2 is the main isoform expressed in macrophages and neutrophils. The superoxide anion is important for effective host defense, immune cell function and is a component of the cellular redox signaling. However, when overproduction of superoxide persists, the normal redox signaling gets disrupted leading to oxidative stress, in which an imbalance develops between ROS and nitric oxide (NO). Oxidative stress represents a major risk factor and cause of both metabolic and cardiovascular diseases [@bib1]. It can be ameliorated either by a decrease in ROS production or an increase in NO bioavailability. In addition to NO production via the classic nitric oxide synthase (NOS) pathway, fueling the alternative nitrate-nitrite-NO pathway with inorganic nitrate and nitrite has shown beneficial effects in many disorders and experimental disease models via restoring NO bioavailability [@bib2], [@bib3], [@bib4]. However, it is still not clear how this effect is mediated and signaling events may occur in a cell-, tissue- and environment-specific manner. In a recent study, we demonstrated that augmented NOX-mediated ROS production in lipopolysaccharide (LPS)-activated mouse macrophages was almost normalized by simultaneous nitrite treatment [@bib5]. This effect of nitrite on superoxide production was abolished by an NO scavenger and also during inhibition of xanthine oxidoreductase (XOR), which suggests that nitrite acts via an NO signaling mechanism that is dependent on functional XOR.
XOR, a molybdoflavin-containing enzyme responsible for the terminal steps of purine catabolism, catalyzes the hydroxylation of hypoxanthine to xanthine and xanthine to uric acid, which is accompanied by ROS production. However, under certain conditions, XOR is able to use inorganic nitrite as a substrate and generate NO [@bib6], [@bib7]. Especially during low oxygen tensions, which occur during ischemia reperfusion injuries, this way of NO production seems important and may compensate for a compromised NOS function since this enzyme is dependent on oxygen. Immune cells like macrophages are present at sites of tissue injury where they may become lytic and therefore a significant source of XOR.
In addition to activating cGMP-dependent signaling pathways NO can mediate protein S-nitrosation by attachment of an NO^+^ moiety to cysteine residues in proteins. This S-nitrosothiol formation may influence protein function and has been widely recognized as a signaling mechanism [@bib8], [@bib9]. There is emerging evidence that protein S-nitrosation may be altered during disease development, and hence play a role in renal and cardiac protection [@bib10] as well as in modulation of the immune system [@bib11]. The reaction is highly regulated and exhibits remarkable specificity occurring only on selected cysteine residues located within a certain amino acid motif and basic surrounding conditions [@bib12].
In the current study we used murine macrophages to investigate if the previously demonstrated effects of inorganic nitrite on oxidative stress are achieved via XOR-dependent NO production and if NO-mediated S-nitrosation of NOX subunits may contribute to the reduced NOX activity following treatment with inorganic nitrite.
2. Material and methods {#s0010}
=======================
2.1. Materials {#s0015}
--------------
Unless otherwise indicated all chemicals were purchased from Sigma-Aldrich (Stockholm, Sweden).
2.2. Cell culture {#s0020}
-----------------
Mouse peritoneal macrophages (IC-21 ATCC TIB-186; American Type Culture Collection, Manassas, VA, USA) were cultured in RPMI 1640 medium complemented with 10% fetal bovine serum, 2 mmol/l [l]{.smallcaps}-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all Thermo Fisher Scientific, Stockholm, Sweden) and in humidified air with 5% CO~2~ at 37 °C. Medium was replaced every other day and cells were passaged using Dulbecco\'s phosphate-buffered saline (DPBS, without Ca^2+^/Mg^2+^) when reaching 80--90% confluency. For experiments, macrophages were seeded in plates at a density of 500000 cells/ml and allowed to attach overnight.
2.3. Pharmacological treatments {#s0025}
-------------------------------
Pharmacological treatments of macrophages were performed in RPMI medium without fetal bovine serum. After the normal growth medium was removed, cells were washed once with DPBS. Macrophages were then incubated with sodium nitrite (NaNO~2~, 10 µmol/l), LPS from *Escherichia coli* endotoxin (0111:B4, 10 ng/ml), diethylenetriamine/NO adduct (DETA-NONOate, 0.5 mmol/l), N~ω~-nitro-[l]{.smallcaps}-arginine methylester hydrochloride ([l]{.smallcaps}-NAME, 1 mmol/l), febuxostat (30 nmol/l) or a combination thereof, for 24 h or the indicated times. [l]{.smallcaps}-NAME and febuxostat were added 30 min before treatment with other substances.
To prepare S-nitrosocysteine (CysNO), 1 vol of 200 mmol/l [l]{.smallcaps}-cysteine (in 1 mol/l HCl) was incubated with 1 vol of 200 mol/l sodium nitrite (in distilled water) for 30 min at room temperature in the dark. The solution was neutralized by the addition of 2 volumes of 1 mol/l K~2~HPO~4~ (pH 7.4) buffer and was stored in aliquots at −80 °C until use. The concentration of formed CysNO was determined from the optical absorbance at 338 nm by using the extinction coefficient 900/(mol\*l\*cm) [@bib13]. After LPS-treatment or incubation in serum-free medium for 24 h, macrophages were washed twice with phosphate buffered saline (PBS, containing Ca^2+^/Mg^2+^) followed by incubation with CysNO in PBS for 15 min at 37 °C. Subsequently, cells were washed with PBS twice and collected for Biotin Switch assay (see below).
2.4. NADPH-dependent superoxide production {#s0030}
------------------------------------------
Lucigenin-dependent chemiluminescence was used to determine NADPH oxidase activity, measured as NADPH-dependent superoxide production, as described previously [@bib5]. After pharmacological treatments, macrophages were washed with DPBS and detached from the culture dish by incubation in DPBS at 37 °C for 15 min. Cell suspensions were transferred to measurement tubes and incubated with dark-adapted lucigenin (5 µmol/l) at 37 °C for 15 min. Superoxide production was started by the injection of the NOX substrate NADPH (100 µmol/l) and the chemiluminescence signal was measured every 3 s for 3 min with an AutoLumat LB953 Multi-Tube Luminometer (Berthold Technologies, Bad Wildbad, Germany). Previous studies have demonstrated that incubation with either tempol to scavenge superoxide or VAS3947 to inhibit NOX reduces the chemiluminescence signal with approximately 90% in both cell culture and tissues [@bib14], [@bib15], suggesting that mainly superoxide from NOX is measured. Moreover, unspecific lucigenin-mediated superoxide generation in the absence of added NADPH was similar to the blank (i.e. PBS only), and should therefore not have any significant impact on the results.
2.5. Biotin Switch assay {#s0035}
------------------------
Protein S-nitrosation levels were determined in macrophage lysates using the Biotin Switch assay with some modifications from the original protocol [@bib16]. All steps before the neutravidin-purification of biotinylated proteins were carried out in the dark. After treatments, macrophages were collected and lysed by scraping in TENT buffer (50 mmol/l Tris-HCl pH 7.2, 150 mmol/l NaCl, 1 mmol/l EDTA, 0.1 mmol/l neocuproine, 1% Triton X-100, protease inhibitor cocktail) and incubation on ice for 15 min. The soluble fraction was obtained by centrifugation at 10000 g and 4 °C for 15 min. Protein concentration was determined using the Bradford protein assay (Bio-Rad) and samples were adjusted to 0.5 mg/ml with TEN buffer (TENT without Triton X-100). Free thiols were blocked in 4 volumes of HENS buffer (250 mmol/l Hepes pH 7.7, 1 mmol/l EDTA, 0.1 mmol/l neocuproine, 1% SDS) containing 20 mmol/l *S*-methyl methanethiosulfonate at 50 °C for 30 min with agitation every 5 min. Proteins were precipitated with cold acetone for at least 30 min at −20 °C to remove excess blocking reagent. To reduce SNO-thiols and label resulting SH-residues, precipitated proteins were resuspended in 300 µl HENS/mg protein containing 5 mmol/l ascorbate and incubated in the presence of 1 mmol/l (N-\[6-(Biotinamido)hexyl\]-3′-(2′-pyridyldithio)propionamide (HPDP-biotin, Thermo Fisher Scientific) for 2 h at room temperature. After aceton precipitation, biotinylated proteins were resuspended in 150 µl HENS/mg protein and purified by incubation with NeutrAvidin Plus Ultra Link Resin (Thermo Fisher Scientific) in 5 volumes neutralization buffer (20 mmol/l Hepes pH 7.7, 100 mmol/l NaCl, 1 mmol/l EDTA, 0.5% Triton X-100) over night at 4 °C. Bound proteins were washed extensively (20 mmol/l Hepes pH 7.7, 600 mmol NaCl, 1 mmol/l EDTA, 0.5% Triton X-100), eluted from the resin at 37 °C for 20 min with 1 mmol/l β-mercaptoethanol in 20 mmol/l Hepes pH 7.7, 100 mmol/l NaCl, 1 mmol/l EDTA, and analyzed using Western Blot.
2.6. Real-time PCR {#s0040}
------------------
The mRNA expression levels of NOX subunits and xanthine oxidase (XOR) were determined by real-time PCR. After treatments, macrophages were collected in β-mercaptoethanol containing RLT buffer and total RNA was isolated using the RNeasy Mini Kit (Qiagen, Sollentuna, Sweden) according to the manufacturer\'s instructions. RNA purity and concentration were assessed spectrophotometrically on the Nanodrop ND-1000 (Thermo Fisher Scientific). Equal amounts of RNA were reverse transcribed to cDNA with the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Real-time PCR was performed in 96-well plates in a total reaction volume of 20 µl on an ABI 7500 Real-Time PCR System using Power SYBR Green Master mix (Thermo Fisher Scientific) and gene specific primers ([Table 1](#t0005){ref-type="table"}). Mean x-fold relative gene expression changes were calculated with the ∆∆Ct-method [@bib17], standardizing the results to the housekeeping gene β-actin.
2.7. Western Blot {#s0045}
-----------------
Protein fractions from the Biotin Switch assay (input and eluted proteins) were denaturated in loading buffer (62.5 mmol/l Tris-HCl pH 6.8, 10% glycerol, 2% sodium dodecyl sulfate (SDS), 0.01% bromophenol blue, 0.8% β-mercaptoethanol) at 95 °C for 5 min. Protein expression of NOX subunits was measured by Western Blot in macrophages. Whole cell lysates were prepared by scraping the cells in lysis buffer (10 mmol/l Tris-HCl pH 8, 150 mmol/l NaCl, 5 mmol/l EDTA, 60 mmol/l N-octyl-glucoside, 1% Triton X-100, protease inhibitor cocktail) followed by centrifugation at 10000 g for 15 min. Protein concentration was determined in the soluble fraction using the Bradford protein assay (Bio-Rad, Solna, Sweden) and equal amounts of protein were denaturated in loading buffer at 95 °C for 5 min. Proteins were separated on 4--20% SDS-polyacrylamide gels (Bio-Rad) using electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked in 5% nonfat dry milk containing TBS-T (20 mmol/l Trizma base pH 7.6, 150 mmol/l NaCl, 0.1% Tween-20), followed by incubation with primary antibodies (gp91phox/Nox2, BD Biosciences, Stockholm, Sweden; p67phox, Cell Signaling/BioNordika, Stockholm, Sweden; p22phox, p47phox and XOR, Santa Cruz, Heidelberg, Germany). Primary antibodies were detected using the respective horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse IgG (Cell Signaling). Protein bands were visualized by Clarity Western ECL Substrate (Bio-Rad) and intensities were quantified using densitometry (Image Lab software, Bio-Rad). To ensure equal protein loading, membranes were stripped using Restore™ PLUS Western Blot Stripping Buffer (Thermo Fisher Scientific) and after blocking re-probed with primary antibody against β-actin (Santa Cruz) and anti-mouse IgG. Mean x-fold relative protein expression changes were calculated by standardizing the results to the housekeeping protein β-actin. For the comparison of S-nitrosated proteins between LPS- and LPS+CysNO treated cells, the relative intensity ratio SNO-protein/input was calculated for Nox2 and p22phox, respectively, and is presented in the text (LPS treated groups=1). Since the LPS-treatment strongly affected the expression of the studied proteins and SNO-signals were often weak, quantification of SNO-protein/input seemed arbitrary and was omitted for other between-group comparisons but representative blots are shown instead.
2.8. Uric acid assay {#s0050}
--------------------
Uric acid is the final oxidation end product of purine nucleotide metabolism catalyzed by XOR from xanthine and hypoxanthine. Uric acid levels were measured in macrophage cell culture medium after 24 h treatments as a measure of XOR activity. Samples were incubated with 80 µmol/l Amplex Ultra Red reagent (Thermo Fisher Scientific), 0.8 U/ml horse radish peroxidase and 2 U/ml uricase in 100 mmol/l Tris-HCl pH 7.5 for 30 min at 37 °C. The fluorescence signal was measured in a microplate reader (excitation 530 nm, emission 590 nm) and the concentration of uric acid was calculated from a standard curve on the same plate. To investigate how much of the uric acid is derived from XOR, uric acid levels in culture medium of febuxostat (30 nmol/l) treated macrophages were measured with the same approach. As a control, 2.5 mU/ml purified XOR enzyme was used in a cell-free approach and incubated for 30 min at 37 °C with 32 µmol/l hypoxanthine (Sigma), 80 µmol/l Amplex Ultra Red reagent (Thermo Fisher Scientific), 0.8 U/ml horse radish peroxidase in 100 mmol/l Tris-HCl pH 7.5 with or without 2 U/ml uricase and in the presence of different febuxostat concentrations (3, 30, 300, 3000 nmol/l). The fluorescence signal was measured in a microplate reader (excitation 530 nm, emission 590 nm) and the signal without uricase (representing H~2~O~2~ production) was subtracted from the signal with uricase (resulting in only uric acid-derived fluorescence signal). Results are presented as % inhibition with febuxostat vs. no febuxostat.
2.9. DAF-FM fluorescence {#s0055}
------------------------
The cell-permeable fluorescent NO indicator 4,5-diaminofluorescein-FM diacetate (DAF-FM DA) was used to detect NO production in macrophages. The cells were plated and treated in 96-well plates as described above. After 24 h, the cells were loaded with DAF-FM DA (10 µM) for 45 min at 37 °C. Cells were then washed with DPBS and transferred to a black 96-well plate. The fluorescence signal was measured in a microplate reader (excitation 495 nm, emission 515 nm) and is expressed as the percentage change of the [l]{.smallcaps}-NAME treated cells.
2.10. Statistical analysis {#s0060}
--------------------------
Results are expressed as means±SEM. Statistical analyses were performed using one-way ANOVA followed by Bonferroni\'s multiple comparison test (GraphPad Prism version 5.04, San Diego, CA, USA). A p-value\<0.05 was considered statistically significant.
3. Results {#s0065}
==========
3.1. Nitrite reduces superoxide generation in LPS-activated macrophage {#s0070}
----------------------------------------------------------------------
As has been shown recently [@bib5], 24 h activation of macrophages with LPS resulted in increased NADPH-dependent superoxide production and this was attenuated by simultaneous incubation with nitrite. To mimic a more therapeutic situation with administration of nitrite during ongoing inflammation, macrophages were incubated with LPS for 21 h, then nitrite was added and the cells were incubated for another 3 h. This short time was sufficient for a significant reduction of the superoxide generation even though LPS was still present ([Fig. 1](#f0005){ref-type="fig"}). In control cells, nitrite had no effect on superoxide production independently of the incubation time.
3.2. Nitrite does not alter the gene expression of NOX2 subunits {#s0075}
----------------------------------------------------------------
One possible mechanism how nitrite might mediate this attenuation of NOX-derived superoxide formation is through changes in enzyme expression. Therefore, we investigated gene expression levels of the NOX2 subunits in activated and nonactivated macrophages. Treatment with LPS resulted in a strong induction of Nox2, however p47phox was unchanged and levels of p22phox and p67phox were even decreased. Nitrite had no effect in nonactivated cells and did not alter the expression levels of any of the analyzed subunits when administered together with LPS compared to LPS alone ([Fig. 2](#f0010){ref-type="fig"}A--D).
3.3. Nitrite modulates protein expression of NOX2 subunits in LPS-activated macrophages {#s0080}
---------------------------------------------------------------------------------------
Since mRNA levels do not always reflect the abundance of protein in the cells, we also analyzed the protein expression of NOX2 subunits in activated and nonactivated macrophages. Stimulation of the cells with LPS led to a significant increase of Nox2, p22phox, p47phox and p67phox. Whereas the levels of the membrane bound subunits Nox2 and p22phox were not influenced by the presence of nitrite ([Fig. 3](#f0015){ref-type="fig"}A,B), the expression of the cytosolic subunits p47phox and p67phox was significantly reduced in cells treated with LPS plus nitrite compared with LPS alone ([Fig. 3](#f0015){ref-type="fig"}C,D).
3.4. Nitrite does not mediate S-nitrosation of NOX2 subunits {#s0085}
------------------------------------------------------------
S-nitrosation of cysteine residues has been described as a posttranslational modification which impacts on the activity of many proteins. We therefore investigated if nitrite-derived NO mediates S-nitrosation of the membrane bound NOX2 subunits and thereby contributes to the reduced activity of NOX in LPS-activated macrophages. In cells treated with LPS, a proportion of both Nox2 and p22phox underwent S-nitrosation (relative intensity ratio SNO-protein/input 1 for NOX2 and 1 for p22phox; see methods for details); however, simultaneous incubation with nitrite for 24 h did not increase this proportion (relative intensity ratio SNO-protein/input 0.9 for Nox2 and 0.9 for p22phox). In contrast, a short incubation (15 min) with the NO-donor CysNO resulted in clear S-nitrosation of both Nox2 and p22phox (relative intensity ratio SNO-protein/input 3.3 for Nox2 and 6.5 for p22phox), which demonstrates that these proteins are able to undergo S-nitrosation under certain conditions ([Fig. 4](#f0020){ref-type="fig"}A). The mechanisms and kinetics of the release of NO and other reactive nitrogen species vary between different types of NO-donors depending on their decomposition and the requirement of specific conditions or catalysts [@bib18]. Therefore, macrophages were incubated with the slow-releasing NO-donor DETA-NONOate for 24 h in the presence of LPS, which resulted in a similar level of S-nitrosation of Nox2 compared to nitrite, whereas p22hox was not S-nitrosated ([Fig. 4](#f0020){ref-type="fig"}B). Especially the inducible form of endogenous NO synthases (iNOS) produces high amounts of NO in response to LPS-activation of macrophages. To exclude the possibility that this large amount of iNOS-derived NO would mask an effect of nitrite in the detection of S-nitrosation levels, macrophages were treated with [l]{.smallcaps}-NAME to block all NOS isoforms. However, even during NOS inhibition there were no differences between cells treated with LPS alone and LPS plus nitrite ([Fig. 4](#f0020){ref-type="fig"}C). Taken together, these results indicate that the ability of nitrite to reduce superoxide production during LPS-activation of macrophages is not mediated by S-nitrosation of Nox2 or p22phox.
3.5. The effects of nitrite are dependent on XOR {#s0090}
------------------------------------------------
We have previously demonstrated that inhibition of XOR abolished the effect of nitrite on NOX-mediated superoxide production in LPS-activated macrophages [@bib5]. Since there is evidence implicating XOR in the reduction of nitrite to NO and other bioactive nitrogen species [@bib7], [@bib19], we investigated the role of this enzyme further by measuring its gene and protein expression as well as its activity in macrophages. While mRNA levels of XOR were reduced both upon LPS activation and LPS plus nitrite treatment, the protein expression was not influenced by any of the treatments ([Fig. 5](#f0025){ref-type="fig"}A,B). The levels of uric acid were analyzed in the cell culture medium after 24 h treatment of macrophages as a measure of XOR activity. As a control, uric acid production was measured in the presence of febuxostat and resulted in 50--70% inhibition both in culture medium of febuxostat treated macrophages and using purified XOR enzyme ([Supplemental Figure 1](#s0110){ref-type="sec"}). LPS-activation resulted in an increase in uric acid production compared to nonactivated cells. Simultaneous treatment with nitrite increased uric acid levels even further in activated macrophages, which indicates an induction of XOR activity under these conditions ([Fig. 5](#f0025){ref-type="fig"}C). To examine if this change in XOR activity is relevant for nitrite-derived NO production, we measured DAF-FM fluorescence, after 24 h treatment of the macrophages. As shown previously [@bib5], the increased NO production upon treatment with LPS plus nitrite could not be blocked by NOS-inhibition with [l]{.smallcaps}-NAME. However, additional simultaneous inhibition of XOR with febuxostat significantly reduced the NO production, resulting in control levels and was similar in all other groups ([Fig. 5](#f0025){ref-type="fig"}D). These results strongly suggest that XOR, not through changes in its expression but its activity, is involved in the reduction of nitrite to NO and the subsequent inhibition of NOX-derived superoxide production in activated macrophages.
4. Discussion {#s0095}
=============
We demonstrate here that nitrite-mediated attenuation of NOX-derived superoxide production in LPS-activated macrophages is associated with XOR-dependent NO production. Furthermore, we found that nitrite-mediated reduction of superoxide production does not involve S-nitrosation of the membrane-bound NOX subunits Nox2 and p22phox, but can partially be attributed to changes in protein expression of the cytosolic subunits p47phox and p67phox.
According to current knowledge, phagocytic NADPH oxidase NOX2, which is the main isoform expressed in macrophages, consists of two membrane bound subunits Nox2 (or gp91phox) and p22phox, the cytosolic subunits p47phox, p67phox, p40phox and a small GTPase Rac. The assembly process of the active enzyme complex has been described in detail [@bib20]. Briefly, upon stimulation, p47phox is phosphorylated and translocates, in complex with p67phox and p40phox, to the cell membrane where the active enzyme complex is formed. This results in a burst of superoxide production. Looking at the gene expression of NOX subunits we found a strong induction only of Nox2 mRNA in LPS-activated macrophages. In contrast, the protein levels of all four investigated subunits were significantly increased after LPS stimulation. Interestingly, the simultaneous treatment with nitrite only showed an effect on protein expression and reduced levels of p47phox and p67phox, but not Nox2 and p22phox. If this extent of protein reduction has sufficient impact on the enzyme activity to explain the reduced superoxide production seen with nitrite in LPS-activated macrophages is unclear. In addition to expression levels, also the intracellular distribution of these subunits plays an important role for NOX activity and might be altered by nitrite. However, it has been shown in human neutrophils that only 10--15% of p47phox (in complex with p67phox) translocates to the membrane upon cell activation [@bib21], [@bib22]. Future studies are warranted to investigate if nitrite may influence these translocation processes, and hence contribute to the reduced NOX activity.
Supplementation with both inorganic nitrate and nitrite have shown beneficial effects in various diseases and experimental models, e.g. reduced blood pressure in healthy volunteers [@bib23] and in hypertensive patients [@bib24], [@bib25] and rats [@bib26], reversed features of metabolic syndrome [@bib27] and improved glucose and insulin homeostasis in type 2 diabetes and its complications [@bib28], [@bib29]. In many cases, the protective effects of nitrate and nitrite could be linked to reduced NOX-derived oxidative stress [@bib29], [@bib30], [@bib31]. In the current study, we show a therapeutic effect with nitrite, i.e. administration after 21 h LPS challenge resulted in reduced NOX activity and prevention of oxidative stress. Also in vivo nitrite has shown protective effects not only against LPS- but also against tumor necrosis factor-induced shock in mice [@bib32], however, the effects on NOX were not addressed in that study.
Since nitrite abolished superoxide production by NOX in an NO-dependent manner [@bib5], signaling via NO became of particular interest. There are three principal pathways of physiological NO signaling [@bib33] including the reaction of NO with thiyl radicals to form S-nitrosothiols. S-nitrosation has gained increased recognition as a functionally important posttranslational modification and might provide protection by preventing irreversible oxidative thiol-modifications by ROS or peroxynitrite [@bib34]. This action suggests a potential for nitrite-derived NO to S-nitrosate NOX subunits. Most studies of proteins that have been identified as substrates for S-nitrosation used greatly simplified in vitro preparations and/or relied on exogenous NO donors rather than physiological NO produced by endogenous enzymes. We support here the discrepancy between such conditions since we found that in our experimental conditions nitrite-derived NO did not mediate S-nitrosation of Nox2 and p22phox to a greater extent than incubation of macrophages with LPS alone. However, the presence of the NO donor CysNO resulted in strong S-nitrosation of both proteins. These results indicate that nitrite does not reduce LPS-induced superoxide production in these cells via functional NO-mediated modulation of the membrane-bound NOX subunits. However, non-physiologically high NO concentrations resulted in S-nitrosation of both Nox2 and p22phox. There are studies suggesting S-nitrosation of NOX isoforms and subunits, but in these studies purified proteins and/or NO donors were used [@bib35], [@bib36] and the physiological relevance remains to be proven. The activity of Nox5, an isoform only expressed in humans, has been shown to be reduced via NO-mediated S-nitrosation in transfected COS-7 cells and four cysteine residues have been identified as targets for S-nitrosation [@bib37]. This could be of particular interest for the favorable effects observed with nitrite in humans and future studies investigating the signaling mechanism in humans are warranted.
XOR has been described as damaging during disease conditions like ischemia reperfusion injury or atherosclerotic plaques due to its enhanced affinity for oxygen and concomitant ROS production when performing its generally accepted role in purine catabolism [@bib38], [@bib39]. In addition, the detailed mechanism has been elucidated how XOR can also catalyze the reduction of nitrite to NO using either NADH or xanthine as reducing substrate [@bib40], [@bib41]. Especially during conditions with low oxygen tension, XOR-mediated NO production is fairly high and can compensate for impaired NOS-derived, oxygen-dependent NO synthesis [@bib4]. Also in normoxia XOR has been found to produce NO when nitrite is present as substrate [@bib5], [@bib7], [@bib42]. Nitrite-mediated attenuation of superoxide production in LPS-activated macrophages has been described as XOR-dependent since the effect was abolished in the presence of the XOR inhibitor febuxostat [@bib5]. In this study, we demonstrate that also the NO production in LPS-activated macrophages was dependent on XOR and could be blocked by febuxostat whereas this effect was independent of NOS. We found increased uric acid levels in the cell culture medium, which reflect increased XOR activity and are in agreement with previous findings showing increased XOR activity in human macrophages upon LPS-stimulation [@bib43]. In contrast to other tissue and cell types [@bib44], [@bib45] gene expression of XOR was not increased upon inflammatory stimulation. In the current study we show that protein levels of XOR were not influenced by any of the treatments and the gene expression was even decreased during treatment with LPS and LPS plus nitrite, compared to the observed induction of NOX expression. Therefore we conclude that the elevated XOR activity does not contribute to the observed superoxide levels, but rather that NOX is the main source. On the contrary, the increased uric acid formation might reflect increased nitrite reductase activity of XOR, which leads to increased NO bioavailability and subsequently reduced NOX-derived superoxide. Still, it is unclear how nitrite-derived NO and the reduced NOX activity are connected. Direct scavenging of ROS by NO [@bib5] as well as enzyme modification via S-nitrosation, as shown here, seem unlikely.
In conclusion, we show in LPS-activated macrophages that XOR plays an important role in nitrite reduction to NO, leading to decreased NOX-derived superoxide generation. Reduced NOX activity is however not mediated by any significant NO-dependent S-nitrosation of the membrane-bound NOX subunits Nox2 or p22phox. Instead, our findings suggest that a reduced protein expression of the cytosolic NOX subunits may contribute to the favorable effect of nitrite. These mechanistic details are important to further characterize inorganic nitrate and nitrite as potential therapeutics in ROS-mediated cardiovascular and metabolic diseases.
Conflict of interests {#s0100}
=====================
Lundberg and Weitzberg are co-inventors on patent applications related to the therapeutic use of inorganic nitrate.
Appendix A. Supplementary material {#s0110}
==================================
Supplementary material.
We thank Annika Olsson, Carina Nihlen and Annette Ebberyd (Dept of Physiology and Pharmacology, Karolinska Institutet) for their excellent technical contribution. This work was supported by grants from the Swedish Research Council (M.C., E.W. & J.O.L) (Dnr 521-2011-2639), the Swedish Heart and Lung Foundation (M.C. & J.O.L) (Dnr: 20110589 & 20140448), Stockholm City Council (ALF, Dnr 2014-2015) and by KID-funding from the Karolinska Institutet (M.C) (Dnr 2415/2012-225 and Dnr 2-3707/2013).
Supplementary data associated with this article can be found in the online version at [doi:10.1016/j.redox.2016.09.015](http://dx.doi.org/10.1016/j.redox.2016.09.015){#ir0005}.
{#f0005}
{#f0010}
{#f0015}
{#f0020}
![Role of XOR in the effects mediated by nitrite. Relative mRNA (A) and protein levels (B) of XOR are presented as fold change of nonactivated control macrophages. Uric acid concentration in macrophage culture medium as a measure of XOR activity is given in µmol/l (C). NO production was measured as DAF-FM fluorescence and is presented as % of the [l]{.smallcaps}-NAME treated macrophages. Data are shown as mean±SEM, n=6/group (A,C), n=4/group (B), n=8/group (D), \* p\<0.05 between indicated groups.](gr5){#f0025}
######
Nucleotide-sequences of primers used in real-time PCR.
Table 1
Gene Forward primer (5′−3′) Reverse primer (5′−3′)
------------- --------------------------- ---------------------------
*Nox2* GCACCTGCAGCCTGCCTGAATT TTGTGTGGATGGCGGTGTGCA
*p22phox* CTGGCGTCTGGCCTGATTCTCATC CCGAAAAGCTTCACCACAGAGGTCA
*p47phox* CAGCCATGGGGGACACCTTCATT GCCTCAATGGGGAACATCTCCTTCA
*p67phox* AAGACCTTAAAGAGGCCTTGACGCA TCGGACTTCATGTTGGTTGCCAA
*XOR* CAGCATCCCCATTGAGTTCA GCATAGATGGCCCTCTTGTTG
*β*-*actin* GCTCCTCCTGAGCGCAAT GTGGACAGTGAGGCCAGGAT
|
{
"pile_set_name": "PubMed Central"
}
|
J-J-J-Jaded… In all it’s misery.
There’s nothing like a quick looksie through facebook to help me appreciate how lucky I am to be in such a cooperative and successful co-parenting relationship like I am.
Four years ago I don’t think that sentence would have ever even crossed my mind.
I was stuck.
Resentful of The Dad and his ability to just walk away without so much as a glance back. His ability to write me off as a liar and a whore.
His suggestion that neither of us were required to be “stuck” in our situation.
I remember being 26 weeks pregnant, scared, unsure of what the fuck I was doing and just needing someone that understood.
You’d think that he would be that person and that although we didn’t want to be together we could, at the very least, work through it together.
Instead there was name calling, and hurt feelings.
Things were said that could never be taken back.
Instead he chose to live in denial and wait almost 2 years to confront the issue, and start to deal with it.
Never did I ever think I would come to be as close to peace with the situation as I feel today.
————-
I joke with my friend K that I’m really bad at one night stands.The first one I ever had ended up being a prince charming in disguise. I never would have guessed that 6 years later I would be in a long term relationship with him – or living with him.
The second was a little better. Although it still wasn’t really, technically, a one night stand.After JME left, way back when we first met and weren’t dating at all, there was a guy in my program at the college that I hung out with and after a short discussion on the pros and cons, and a lot of flirting, we just went for it. It lasted longer than a night – even in a casual,friends with benefits, relationship I’m monogamous. I feel like that should be some kind of flaw or something.Class, beer, Southpark, sex, crashing for the night and back to class in the morning.That was how it worked and it worked for us.When we were dating someone exclusively or sleeping with someone else all activities ceased with no hard feelings. We’re still on civil terms today.
The third.The third was The Dad.As you can see, that didn’t exactly turn out as a “one night stand” although I’m certain that was our intention.It almost worked. Until we slept together again 8 months later and 42 weeks later I was blessed with the beautiful little dude asleep in the other room.
K thinks it’s funny. She can’t even count how many men she’s banged and here I am with 3, sort of, one night stands and 2 relationships.My magic number is 5. I can literally count all of them on one hand – and she finds that funny.
————-
He made me feel worthless.
Worst of all – he made me feel angry.
He sucked a lot of the joy out of my pregnancy.
Any time I felt like I was happy, or excited, I felt like I should be ashamed of it.
That being so young, single and unprepared meant that I wasn’t “allowed” to enjoy my pregnancy or my impending motherhood.
Anytime I got excited about something I quickly put myself in check.
The only time I would sit and enjoy feeling him rolling around and kicking was when I was absolutely alone.
I’m still angry at him for making me feel that way and taking that away from me.
Especially now under the circumstances life has presented me with again.
If I could go back I would relish every second of my pregnancy.
Appreciate it all.
Make the most of it. Make the best of it.
I wouldn’t let him ruin it.
But putting all of that aside, I don’t resent him like I did. I don’t feel as angry as I used to.
I don’t hate him.
Even after days like today, when he calls to tell me that A: he didn’t pay his child support last week (I already knew that) and that B: He’s coming to pick the little dude up and take him for a week (not going to lie, that one makes me a little mad. I expect to have a little more notice for things like this .)
So even now, after four and a half years of a whole lot of bullshit I don’t feel angry.
Just content.
At least most days.
So when I see these young girls so jaded and angry with life, love and baby daddy drama I feel for them.
I want to reach out to them and tell them it gets better.
That these feelings don’t last forever.
That one day there is a mostly happily ever after.
You’ll move on.
You’ll fall in love.
You’ll feel happy.
Content.
It doesn’t have to be this way – so full of hate and frustration.
Four years ago I would be telling myself this but it wouldn’t have been with the same conviction I feel now.
I wouldn’t feel so sure about it.
I don’t feel it in a altruistic-happy-happy-everything-works-out-in-the-end-I’m-happy-because-I’ve-found-somebody-that-I-want-to-be-with kind of way. Fuck that shit.
I feel sure about it because I finally feel like I’ve come to a place where I’ve finally found me.
It’s made a world of difference in the way I see my life and my future.
A relationship isn’t an integral part of my happiness but I feel incredibly lucky knowing that I am open to sharing my life with a man that I love.
Even partner-less I am still able to face the world and feel the way I do.
I would be able to go day to day with a smile on my face and love in my heart.
What prompted this realization?
To be honest, I’m not sure.
I think it’s partly having my newsfeed filled with so much stress and anxiety from other single moms and single dads who seem so focused on finding someone that they’re losing themselves in the search.
I see brokenhearted women and lonely men and I just want to reach out to them.
Tell them it’s not as bad as it seems and that as cliche as it sounds, everything happens for a reason.
Everything is meant to be just as it is.
But you can’t wallow it. Make your relationship status the basis for your happiness in life.
It isn’t fair – not to themselves or their children.
Why are we so focused on the “single” part of single parenting?
I know it’s hard and it’s frustrating but it isn’t the be all and end all of your state of mind (as much as it may seem so some days!)
You can be happy.
Yeah, it’s hard work, and yes you can’t be happy every single day but who is?
Just keep your chin up.
Don’t let yourself live in misery.
The first guy you fall in love with after you decide to open your heart back up to the prospect of it might not work out.
You may get your heart broken again – but at least you know that if you try, again, it’s possible to find somebody.
Post navigation
3 thoughts on “J-J-J-Jaded… In all it’s misery.”
Awesome pics! You tell a great story. I kind of feel like you should be an inspirational speaker to those young girls. One day they’re going to wake up and realize that life wouldn’t be nearly as great without their baby…
I love this and can totally relate – but on a different level. I am going through a divorce and most people are shocked at how civil RAB and I are with each other. We talk less and less but because of our agreement to not list our house until September – we do still need to keep in touch with each other. The way I see it – being angry, pissed off and bitter takes a lot more energy than just accepting the situation and learning how to live with it as best you can. It’s like how they say it takes a lot more muscles to frown than to smile – once you learn how to live your life without the anger you can move on and actually enjoy your life.
|
{
"pile_set_name": "Pile-CC"
}
|
Detection of fentanyl and its analogs by enzyme-linked immunosorbent assay.
A prototype enzyme-linked immunosorbent assay (ELISA) for fentanyl, a potent synthetic narcotic analgesic, was used to detect the presence of fentanyl and its analogs in human urine. Human drug-free urine was spiked with 0.02 to 100 ng/mL of fentanyl or with 0.1 to 500 ng/mL of each analog and used as a sample in the ELISA. Sensitivity and precision of the assay were analyzed specifically for detection of fentanyl. Cross-reactivities of fentanyl and nine analogs, acetylfentanyl, p-methylfentanyl, p-fluorofentanyl, butyrylfentanyl, (+/-)trans-3-methylfentanyl, (+/-)cis-3-methylfentanyl, alpha-methylfentanyl, benzylfentanyl, and alfentanil for this assay were also determined. The results indicate that the ELISA was capable of detecting urinary fentanyl with a limit of detection of 0.25 ng/mL and a reasonable "working cutoff" of 0.5 ng/mL. The assay was moderately precise with within-run precision, determined at fentanyl concentrations of 10.0 and 2.5 ng/mL, showing coefficients of variation from 7.7 to 10.4% and between-run precision, determined at concentrations of 10.0 and 2.5 ng/mL, showing coefficients of variation from 14.2 to 23.7%. Acetylfentanyl, p-fluorofentanyl, p-methylfentanyl, and butyrylfentanyl show good cross-reactivity in the assay relative to fentanyl. The cross-reactivities equivalent to 2 ng/mL of fentanyl for acetylfentanyl, p-fluorofentanyl, p-methylfentanyl, and butyrylfentanyl were 111, 93, 87, and 77%, respectively. The (+/-)trans-3-methylfentanyl, alpha-methylfentanyl, and (+/-)cis-3-methylfentanyl show less cross-reactivity; their percent cross-reactivities equivalent to 2 ng/mL of fentanyl were 50, 19, and 3%, respectively. Benzylfentanyl and alfentanil, however, do not show any cross-reactivity.(ABSTRACT TRUNCATED AT 250 WORDS)
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Building agents with GuiAgent class
I want to create Multi Agent application with GUI and I supposed to use GuiAgent class, but I didn't find any documentation to start developing it, my application consist to create a chat room between two agents and communicate by using the interface, so plz help me
A:
You can find an example in this link:
http://jade.tilab.com/documentation/chat-demo/
If you want more information about JADE, there is a good book which covers differents topics of it:
https://www.mit.bme.hu/system/files/oktatas/targyak/8671/Developing-Multi-Agent-Systems-with-JADE.pdf
|
{
"pile_set_name": "StackExchange"
}
|
<?xml version="1.0" encoding="utf-8"?>
<selector xmlns:android="http://schemas.android.com/apk/res/android">
<item
android:state_pressed="true"
android:drawable="@drawable/common_signin_btn_icon_pressed_light" />
<item
android:state_enabled="false"
android:state_focused="true"
android:drawable="@drawable/common_signin_btn_icon_disabled_focus_light" />
<item
android:state_focused="true"
android:drawable="@drawable/common_signin_btn_icon_focus_light" />
<item
android:state_enabled="false"
android:drawable="@drawable/common_signin_btn_icon_disabled_light" />
<item
android:drawable="@drawable/common_signin_btn_icon_normal_light" />
</selector>
|
{
"pile_set_name": "Github"
}
|
City Councillor Theresa Kavanagh says people know how demeaning the word that was spray painted is, and it's clear there was no respect shown for gender.
The City of Ottawa Liaison for Women and Gender Equity says the obscenity scrawled across the window of Catherine McKenna's office makes her feel sick to her stomach.
Theresa Kavanagh is calling on the Ottawa Police to investigate this incident of vandalism as a hate crime.
"Someone put this out, knowing full well how insulting and demeaning it is," Kavanagh said. "It should be treated as a hate crime because they were obviously showing no respect for gender."
The city councillor noted that when there is hatred of this level, it needs to be called out.
While she feels respected in her role at city hall, Kavanagh points out that female politicians tend to be tested more than their male counterparts.
"There are sometimes subtle ways that we get tested more, and sometimes not so subtle. This is an example of not so subtle," she explained. "We probably don't even notice it [normally], because we just get so used to it."
The Bay ward representative had a message for Catherine McKenna on Thursday:
"She shouldn't have to put up with this -- no one should," said Kavanagh. "We all feel for her. Other women politicians feel for her."
|
{
"pile_set_name": "OpenWebText2"
}
|
State of New York
Supreme Court, Appellate Division
Third Judicial Department
Decided and Entered: September 17, 2015 520391
________________________________
In the Matter of the Claim of
TAMMY A. POULIN,
Appellant. MEMORANDUM AND ORDER
COMMISSIONER OF LABOR,
Respondent.
________________________________
Calendar Date: August 10, 2015
Before: Lahtinen, J.P., Egan Jr., Lynch and Clark, JJ.
__________
Tammy A. Poulin, New York City, appellant pro se.
Eric T. Schneiderman, Attorney General, New York City
(Linda D. Joseph of counsel), for respondent.
__________
Appeal from a decision of the Unemployment Insurance Appeal
Board, filed April 8, 2014, which ruled that claimant was
disqualified from receiving unemployment insurance benefits
because she voluntarily left her employment without good cause.
Claimant worked as a service technician at a motorcycle
sales and repair shop for approximately five months. After her
supervisor told her that she would not be getting a raise,
claimant became upset and asked to leave early and to take the
following day off from work, which requests were granted.
Claimant later changed her mind about taking the next day off and
called and texted her supervisor that evening, but he did not
respond to her messages. Claimant appeared at the shop the
following day with a U-Haul truck and proceeded to take all of
her tools and equipment without speaking to her supervisor,
except to inform him that she was leaving. Claimant subsequently
applied for unemployment insurance benefits, but was disqualified
-2- 520391
from receiving them upon the basis that she voluntarily left her
employment without good cause. That determination was upheld by
an Administrative Law Judge following a hearing and, thereafter,
by the Unemployment Insurance Appeal Board. Claimant now
appeals.
We affirm. Initially, it is well established that
dissatisfaction with one's salary does not constitute good cause
for leaving employment (see Matter of Kelly [A-1 Tech.,
Inc.–Commissioner of Labor], 65 AD3d 1405, 1406 [2009]; Matter of
Hayes [Commissioner of Labor], 64 AD3d 1116, 1116-1117 [2009]).
Here, claimant testified that, after changing her mind about
taking the next day off and unsuccessfully attempting to reach
her supervisor, she assumed that her job was no longer available
and, consequently, she returned to the shop the next day to load
up her tools and equipment. Claimant conceded that she did not
ask her supervisor about the status of her job or speak to his
superior prior to loading her tools, and she admitted that her
supervisor never told her that she was fired. Under these
circumstances, and given that claimant did not take reasonable
measures to protect her employment, substantial evidence supports
the Board's finding that she voluntarily left her employment
without good cause (see Matter of Goldner [Commissioner of
Labor], 59 AD3d 756, 757 [2009]; Matter of Williams [Commissioner
of Labor], 54 AD3d 1119, 1120 [2008]; Matter of Puchalski
[Commissioner of Labor], 48 AD3d 868, 869 [2008]).
Lahtinen, J.P., Egan Jr., Lynch and Clark, JJ., concur.
-3- 520391
ORDERED that the decision is affirmed, without costs.
ENTER:
Robert D. Mayberger
Clerk of the Court
|
{
"pile_set_name": "FreeLaw"
}
|
Ballymaguigan GAC
Saint Trea's Ballymaguigan GFC () is a Gaelic Athletic Association club based in Ballymaguigan, County Londonderry, Northern Ireland. It plays in Derry league and championships. It currently caters for both Gaelic football and Ladies' Gaelic football.
The club was founded in 1944 and has won the Derry Senior Football Championship once. Ballymaguigan fields Gaelic football teams at U-8, U-10, U-12, U-14, U-16, Minor, Reserve and Senior levels. Teams up to U-12 level compete in South Derry league and championships and U-14 level teams and upwards compete in All-Derry competitions.
History
Gaelic games had been organised on the western shores of Lough Neagh for over 50 years before St Trea's GFC was formed. Before 1944 one team (Newbridge GAC) catered for the Ballymaguigan and Newbridge areas. Both areas are part of Ardtrea North parish. The American Army built Toome airfield during World War II. This effectively split the parish in two, making it very difficult for the Ballymaguigan-based players to travel to the pitch.
Paddy Bateson suggested a ball be bought so the Ballymaguigan players could train among themselves. Soon friendlies were arranged against established clubs. The first of these was against Castledawson. The first home fixture was against Greenlough. St Trea's GFC was soon formed on 23 April 1944. The name was in honour of Saint Trea who has many traditional associations with the area. The first chairman was John McCartney, with Paddy Bateson as vice-chairman.
Ballymaguigan is a very small rural community, consisting approximately of in area. Establishing a Gaelic Football Club in such a small area was quite an achievement.
In 1950 the club built a small meeting hall. The erection of "the hut" was never seen as anything other than a temporary measure and plans proceeded for more permanent premises. In December 1954 Miss Susan Hinfey's farm came on the market and the club committee decided to purchase. Billy McKee was delegated to do the bidding. The farm of approximately eight acres was acquired for £1,230. The task of converting this property into a playing area began immediately. Apart from hiring a bulldozer to level the ground, this work was carried out completely by voluntary labour.
The all-enclosed pitch, considered to be one of the best in the county, was officially opened in 1957 by the then GAA President Séamus McFerran. Thus St Trea's were back playing on the grounds where the club had its beginnings in 1944.
In 1967 steel was purchased for building a hall and during the July holidays the foundations were laid. The hall was completed, again by voluntary labour, in 1969 and hall was officially opened at a variety concert, by GAA past President Alf Murray.
Three playing members of St Trea's, John Bateson (aged 19), James Sheridan (20) and Martin Lee (18), all members of the South Derry Brigade of the Provisional Irish Republican Army (PIRA) died when the bomb they were carrying exploded prematurely in Magherafelt on 18 December 1971. The trophy for the Derry Intermediate Football Championship is named after the three.
Well known players
Eamonn Coleman - former Derry manager and footballer.
Gary Coleman – All Star winning Derry footballer. Son of Eamonn Coleman.
Jim McKeever – 1958 Footballer of the Year.
Paddy Crozier – former Derry manager.
Honours
Senior
Derry Senior Football Championship: 1
1962
Derry Senior Football League: 1
1962
South Derry Senior Football Championship: 1
1957
South Derry Senior Football League: 1
1949
Derry Intermediate Football Championship: 5
1971, 1993, 2001, 2003, 2009
Derry Intermediate Football League: 3
1993, 1998, 2006
Derry Junior Football Championship: 2
1951, 1970
Derry Junior Football League: 1
1951
South Derry Junior Football Championship: 2
1969, 1970
Seán Larkin Cup: 2
1958, 1959
Graham Cup: 2
1970, 1971
McGlinchey Cup: 1
2011
Reserves
Derry Intermediate Reserve Football Championship: 2
2003, 2004
Minor
Tommy O'Neill Cup: 2
1997, 2003
South Derry Minor 'B' Football Championship: 2
1997, 2003
South Derry Minor 'B' Football League: 2
1997, 2003
Under-16
Derry Under-16 11 a Side Shield
2008
South Derry Under-16 'C' Football League: 1
1998
Under-14
South Derry Under-14 'B' Football Championship: 1
1999
South Derry Under-14 'B' Football League: 1
1999
Derry Under-14 'C' Football League: 1
2009
Ladies' football
Senior Ladies Derry Intermediate League: 1
2006
Under-16 Ladies 'B' Championship 1
Under-16 Ladies ‘A’ Championship 5
Under-16 Ladies League 5
2004
Under-14 Ladies Féile na nÓg
2004 2013 2014 2015 2016
Under-14 South Derry League: 5
2003
Under-14 Derry Championship: 5
2003
Under-13 'B' Derry Championship: 1
2011
Note: The above lists may be incomplete. Please add any other honours you know of.
See also
Derry Senior Football Championship
List of Gaelic games clubs in Derry
References
External links
St. Trea's GFC website
Category:Gaelic Athletic Association clubs in County Londonderry
Category:Gaelic football clubs in County Londonderry
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Check out our new site Makeup Addiction
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
Buys new grinder Completely broke and dry
|
{
"pile_set_name": "OpenWebText2"
}
|
Ambulances are able to carry only a very small number of patients (generally only one or two), making it extremely complex to transport all the victims or patients that have treatment or evacuation needs when a mass casualty event or disaster occurs. Currently, when such an event occurs, many ambulances are called to transport the victims, and, given the limited number of ambulances generally available within a given geographic area, the total number of patients that can be transported is also greatly limited. Furthermore, with so many victims needing transportation from one mass casualty event, if all conventional ambulances are used for transport, people in other coverage areas might suffer because ambulances are not available to handle other emergencies.
A similar problem is encountered when an evacuation of a large number of patients is required. For example, the ability to relocate the patients from a hospital or a nursing home that may be in the path of an approaching hurricane also would be limited by the availability and number of ambulances available.
Similarly, if there is a need to treat a large number of victims at a given location, the only option available now is to transport the victims to a remote site for treatment, and movement of the large number of victims is similarly impacted by the limited number of ambulances. Alternatively, a tent-like treatment facility might be set up, but the suitability of such a system would depend on the disaster conditions (e.g., a tent would not hold up well during windy conditions; climate extremes might be difficult to control; once patients are stabilized in the tent-like structure, they would still need to be transported to a hospital or other facility for extended care).
Other ambulance-type vehicles, such as those used in the military, use J-type hooks or loop-type straps for holding stretchers, and loading a stretcher onto such a J-hook type holder or loop-type straps requires up to six people to maneuver the stretcher into storage position.
Furthermore, if there is a need to transport a large number of casualties, multiple ambulances or hearses would be needed.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Robert Pattinson and Kristen Stewert halt “Twilight” filming due to tsunami
Summit entertainment has announced that the filming of the current “Twilight” movie in Vancouver has been halted due to the tsunami warning.
In a statement Friday, they said : “Due to the tsunami advisory, filming of The ‘Twilight’ Saga: ‘Breaking Dawn’ has been delayed. All cast and crew were evacuated to base camp. Everyone is safe and sound.”
As a result of the 8.9 earthquake and 23-foot tsunami that struck Japan’s northeastern coastline, warnings have been issued along the west coast of North America.
“Taylor Lautner and the wolf pack are the only stars that were evacuated,” a source told HollywoodLife.com.
Rob and Kristen are in Vancouver, where warnings advisories have been issued.
|
{
"pile_set_name": "Pile-CC"
}
|
In a recent study Soon et al. ([@B16]) predicted abstract intentions from fMRI BOLD activities in localized areas of the brain. Activities in a spherical cluster of voxels served as input to a multivariate pattern classifier (linear SVM). The accuracy for predicting the intention to add or subtract two numbers was determined for clusters centered on different voxels. A prediction accuracy of 60% averaged across participants and based on 10-fold cross-validation was achieved for patterns of voxel activities in the *medial frontopolar cortex* and *precuneus* up to 4 s *before* participants reported being consciously aware of their decision. The prediction accuracy in this study was similar to studies on predicting spontaneous left or right motor decisions (Soon et al., [@B15]; Bode et al., [@B1]). Since the task demands placed on the participants create similar methodological issues as in previous studies (Lages and Jaworska, [@B10]), it seems possible that the multivariate classifier picked up sequential information processing between trials (Bode et al., [@B2]).
Although the average prediction accuracy of 60% returned to chance level for patterns of voxel activity in the two brain areas shortly after the onset of a new trial and remained at 50% between trials, this observation is neither necessary nor sufficient for the *absence* of sequential information processing. In order to investigate sequential dependencies the outcome of at least one preceding trial and the current trial needs to be taken into account. Depending on task and response, sequential information processing between trials may emerge in distributed form within the default mode network (DMN) at variable time points (Guggisberg and Mottaz, [@B6]). In the following we illustrate the issue and suggest how the data may be analyzed.
To illustrate sequential effects consider the following inconspicuous sequence of ten responses (S, A, A, A, S, A, S, A, S, S) where A and S stand for freely choosing addition and subtraction, respectively. There are five As and five Ss suggesting a binomial process with rate parameter *p* = 0.5. However, if we consider the nine subsequent pairs of responses {(S,A), (A,A), ..., (S,S)} then we obtain unequal transition probabilities. A trained classifier that predicts the next response from the preceding response would be 3 out of 5 times or 60% correct if the preceding response is A and 3 out of 4 times or 75% correct if the response is S. Starting with a random guess in the first trial, this gives an average prediction accuracy of 65%. In two behavioral studies replicating two different choice tasks (Haynes et al., [@B7]; Soon et al., [@B15]) we used subsequent response pairs to train a linear classifier (SVM) and obtained an average prediction accuracy of 61.6 and 64.1%, respectively (Lages and Jaworska, [@B10]).
When asked to generate a random sequence, people typically alternate between binary responses with a probability of about 0.6 (Lopes, [@B14]). This response pattern appears to be relevant in Soon et al.\'s study ([@B16]) since the only behavioral evidence for memory-less choice in the 17 (out of 34) selected participants is a histogram plotting average frequencies for different lengths of response sequences fitted by an exponential distribution (Figure S1). The authors take the excellent fit as evidence for random performance. Recently Allefeld et al. ([@B1a]) released a detailed account of the behavioral data but there are no further details how the data were compiled and fit. Nevertheless, it is discernable from their Figure S1 that the fit represents an *exponential function* with two parameters rather than an *exponential distribution* with a single parameter and that observed frequencies do not add up to probability 1.0. In addition, an exponential distribution would only provide a meaningful approximation of the geometrically distributed phase lengths if choosing addition and subtraction were equally probable \[*p* = (1−p) = 0.5\]. However, even with a best-fitting rate parameter of 1-exp(−0.826) ≈0.56 the exponential distribution underestimates the relative frequency of alternations (A,S) and (S,A) with phase length 1 as well as repetitions (A,A,S) and (S,S,A) with phase length 2 (see Figure [1](#F1){ref-type="fig"}). Increased frequencies for short phase lengths are a hallmark of non-random human choice behavior (Wagenaar, [@B21]; Lopes, [@B14]; Treisman and Faulkner, [@B19]; Falk and Konold, [@B4]) and these characteristics are not only present in the behavioral data of Soon et al. ([@B16]) but also in Soon et al. ([@B15]); Bode et al. ([@B1]), and Haynes et al. ([@B7]) suggesting that free or spontaneous choice tasks result in non-random behavior.
![**Histogram for length of response sequences (phase length or runs) re-plotted as relative frequencies (adapted from Figure S1 in Soon et al., [@B16]).** The data points are fitted by an exponential function with two parameters (red curve) and an exponential distribution with a single parameter (blue curve). The red curve provides an excellent fit (*R*^2^ = 0.99) whereas the blue curve underestimates phase length 1 and 2 (*R*^2^ = 0.77). See text for explanation.](fpsyg-04-00925-g0001){#F1}
A related concern arises from the searchlight analyses. If patterns of voxel activities are analyzed within a moving spherical cluster to predict behavioral responses then pre-processing of the data and definition of the searchlight are important (Etzel et al., [@B3]; Todd et al., [@B18]). The implementation of regions of interest, temporal constraints (hemodynamic delay), pre-processing (covariates), and data selection can invalidate the results of a searchlight analysis (Kriegeskorte et al., [@B8]; Lindquist et al., [@B13]). In Soon et al. ([@B16]) trials were selected (undersampled) in order to balance the mean response rate. It is therefore possible that the searchlight found a cluster of voxels that was predictive of the next response in the context of the preceding response, simply because transitions between successive responses remained unbalanced. A repeated choice task with self-monitoring of the decision process invites sequential dependencies because the observer has to remember goals, constraints, and execution of the task. If, for example, participants shift a decision criterion following each response (Lages and Treisman, [@B12], [@B9]; Lages and Paul, [@B11]; Treisman and Lages, [@B20]) or engage in metacognition by recalling the last response before making the next then neural correlates of these response-dependent processes introduce a confound that would be picked up by a searchlight analysis as soon as transitions between response categories are unbalanced.
We recommend that rather than postulating a 50% chance level, prediction accuracy should be tested with a permutation test (Stelzer et al., [@B17]) and/or separate multivariate classification analyses conditional on the previous response. Only if individual prediction accuracies reliably exceed observable benchmarks such as response bias and transition probabilities can we rest assured that results are not confounded. The interested reader is invited to test predictability of their own free choice behavior by downloading the demo program in the Appendix.
Martin Lages was supported by a research grant from The Leverhulme Trust F00-179/BG (UK). Stephanie Boyle and Katarzyna Jaworska were both funded by BBSRC WestBio DTP studentships.
*After the game is before the game---*Josef "Sepp" Herberger (1897-1977, football player and manager)
The demo program can be downloaded from <http://www.psy.gla.ac.uk/~martinl/Assets/Software/Predictatron.txt>
Please save the text file as Predictatron.m before running it under MatLab (MathWorks Inc., Natick MA). The program illustrates the difficulty for a human decision maker to generate a truly random sequence in a free choice task. Different choice tasks may be simulated by freely choosing between addition/subtraction (Haynes et al., [@B7]; Soon et al., [@B16]), left/right (Soon et al., [@B15]; Bode et al., [@B1]), or delay/non-delay (Filevich et al., [@B5]) before pressing the corresponding left or right arrow key on the keyboard. The program records 100 binary responses before it computes the rate of left/right key presses, number of left/right alternations, and left/right repetitions. Then the program determines the prediction accuracy of a linear support vector machine (SVM) using one preceding response to predict the next response (1-back SVM) for 10-fold cross-validation. If the algorithm does not exceed 60% prediction accuracy then two preceding responses are used to predict the next response (2-back SVM). If both prediction accuracies stay below 60% then the participant is considered "unpredictable" and wins against the "Predict-a-tron". Results of the non-parametric Wald-Wolfowitz `runstest()` and parametric Lilliefors `lillietest()` as implemented in MatLab are also reported.
[^1]: This article was submitted to Decision Neuroscience, a section of the journal Frontiers in Psychology.
[^2]: Edited by: Björn Brembs, University of Regensburg, Germany
[^3]: Reviewed by: Allen Neuringer, Reed College, USA; Alexander Maye, University Medical Center Hamburg-Eppendorf, Germany
|
{
"pile_set_name": "PubMed Central"
}
|
Follow KPCC
Fifty years later, Off-Ramp's Marc Haefele remembers the 'March on Washington for Jobs and Freedom'
Dr. Martin Luther King, Jr., waves to supporters from the steps of the Lincoln Memorial August 28, 1963. Off-Ramp commentator Marc Haefele had traveled from New York for the March on Washington, and watched the speech from a half-mile away.AFP/Getty Images
Share
What an odd lot we were, the Lower Eastsiders who boarded a chartered train for Washington on August 28, 1963 … fifty years ago next Wednesday.
First, there were the grandmothers with the food: Fay Lucia, a blonded Italian lady in her 50s from the projects, who brought a huge lasagna; and Nicolasa Benitez, the Puerto Rican firebrand of Hester Street, with a cargo of empanadas. There was Nicolasa’s gorgeous granddaughter, Aura, whose presence perhaps determined mine, except of course she spoke no English and I no Spanish.
There was a conservative rabbi from the big shul on East Broadway who wore a small straw fedora on the back of his head. There was our token black Republican, (who voted for Eisenhower, but not Nixon), and New Englander Peter Stanford and his Italian-American wife. There was someone who had a portrait of the man who invented Esperanto on her living room wall. Then there was me, a college junior. We all lived in the Five Points barrio under the Manhattan Bridge that was once turf to the old Gangs of New York.
We called ourselves Reform Democrats. To the Democratic regulars, we were outsiders trying to steal patronage. Actually we were discontents out to make America a fairer place. And so somehow we, a majority non-black liberal group, found ourselves rattling off to Washington to march for civil rights fifty years ago … simply because going seemed the right thing to do.
It was the 100th anniversary of the Emancipation Proclamation. But Jim Crow still reigned. Non-violent protest had been met by violence, arson, fire hoses, incarceration and murder all over the South. The Kennedy administration had broken its promises to move the Civil Rights agenda. The Democratic Party was shackled by its deeply racist Dixie caucus and its sympathizers throughout White America. It was a time when one prominent LA jurist proclaimed that blacks weren’t ready for the rights they’d been denied since the Declaration of Independence, when conservative Republicans marched in ideological lockstep with the Klan.
And when major newspapers editorialized that blacks could only wait patiently for the justice that would never come in their lifetimes. It was a time, in short, for a mass affirmation of justice that America could not ignore.
Civil Rights pioneers A. Philip Randolph and Bayard Rustin had been planning the march since December. It’s important to remember now that this was a march for both jobs and freedom. Many activists wanted civil disobedience, mass arrests, perhaps, to show the desperation faced by America’s black population. But the leaders declared for peace. Malcolm X called it the Farce on Washington. Many predicted a city-wide riot.
Some wanted an all-black march. But in the end, blacks and whites -- and some browns, who weren’t counted then -- marched together, in harmonic accord with Dr. King’s most famous speech. The organization was rigorous but unobtrusive. A 1963 state of the art sound system brought us King’s “I have a dream” in perfect clarity from the distant memorial, as we sat perhaps half a mile away. Marian Anderson and Mahalia Jackson sang, and so did Bob Dylan and Joan Baez. Young firebrand John Lewis forthrightly demanded overdue action, but most of the words were peaceful.
A quarter of a million of us sat down there by the reflecting pool that day, and heard the words of justice, many of us not noticing that no women were speaking from the Freedom platform. Then we got up and walked to the station and went home. I’m not sure if any of us noticed that our lives had changed, but they had. So had America.
The next year, following the torment of a presidential assassination, Congress passed the Civil Rights Act of 1964 … Whose voting rights provisions, thanks to our Supreme Court, we find ourselves fighting for once again, 49 years later.
Recently on Off-Ramp
About Off-Ramp
Off-Ramp is a lively weekly look at Southern California through the eyes and ears of radio veteran John Rabe. News, arts, home, life... covering everything that makes life here exciting, enjoyable, and interesting.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
First page request on website very slow
The first page I load from my site after not visiting it for 20+ mins is very slow. Subsequent page loads are 10-20x faster. What are the common causes of this symptom? Could my server be sleeping or something when it's not receiving http requests?
A:
I will answer this question generally because I'm sure it's something that confuses a lot of newcomers.
The really short answer is: caching.
Just about every program in your computer uses some form of caching to remember data that has already been loaded/processed recently, so it doesn't have to do the work again.
The size of the cache is invariably limited, so stuff has to be thrown out. And 99% of the time the main criteria for expiring cache entries is, how long ago was this last used?
Your operating system caches file data that is read from disk
PHP caches pages and keeps them compiled in memory
The CPU caches memory in its own special faster memory (although this may be less obvious to most users)
And some things that are not actually a cache, work in the same way as cache:
virtual memory aka swap. When there not enough memory available for certain programs, the operating system has to make room for them by moving chunks of memory onto disk. On more recent operating systems the OS will do this just so it can make the disk cache bigger.
Some web servers like to run multiple copies of themselves, and share the workload of requests between them. The copies individually cache stuff too, depending on the setup. When the workload is low enough the server can terminate some of these processes to free up memory and be nice to the rest of the computer. Later on if the workload increases, new processes have to be started, and their memory loaded with various data.
(Note, the wikipedia links above go into a LOT of detail. I'm not expecting everyone to read them, but they're there if you really want to know more)
A:
It's probably not sleeping. It's just not visited for a while and releases it's resources. It takes time to get it started again.
If the site is visited frequently by many users it should response quickly every time.
|
{
"pile_set_name": "StackExchange"
}
|
<div id="login">
<p><img src="img/rabbitmqlogo.svg" alt="RabbitMQ logo" width="204" height="37"/></p>
<div id="login-status"></div>
</div>
|
{
"pile_set_name": "Github"
}
|
It’s been a while since I updated, but I think I summarised it best to someone I met at Leeds this weekend: “I only want to update when I have something to say”.
The second issue of my comic is done, and made it’s debut at Thoughtbubble to some very positive comments and even a decent number of sales. Thanks to anyone who bought it or took a card with the promise to check it out. These words shame you if you don’t, however, as you would have had to type in the address off the card to see them… you’re alright.
From now towards the end of the year I’ll be writing the third issue so that I may start working on it in the new year when it’s really cold outside and I’ll have no distractions. Art wise I’ll probably be doing some more fun drawings as I feel like I want to try something different.
Since I’ll be giving out the address to this site at Leeds Thought Bubble I thought it’d be a good idea to actually update!
The last five or so months have been interesting. I’m currently working in a London publishing company which is great so far and has taught me a lot about the process and standard expected from a publication, skills I’m planning to take forward with my personal work!
I proof read and updated my comic’s first chapter. I’m starting to get a buzz about doing it again and I printed off fifty to take to Thought Bubble in Leeds this weekend. Barring a few oversights (I mercifully managed to work around) I’m pretty confident in it. Seeing it in my hands and printed makes it feel much more special.
Starting next week, I’m going to push on with the mini chapter whilst furthering work on Chapter 2. Assuming this week goes well and I garner a few followers I’ll feel obligated to get the chapters out at a much faster rate and with less long standing mistakes.
Because there were, and probably still are, a few mistakes that I just didn’t see. I think there’s a certain allowance in a first time indie comic though. I’ll be signing and numbering the 50 I’m taking to Thought Bubble, warts and all.
The idea here is show off more lighting and VFX orientated stuff. The only real new shot is the dark church and the previously shown UE3/2 stuff. My next project is to create an animation reel, but I might just download some pre-made characters to do that with since rigging is not my strong point and I might get caught up in the modelling and texture work. I’m just the sort of person that likes everything on the reel to be my own work. Then again, I didn’t build Oxford Cicus or the London Underground… not that field the ship lands in.
So I heard they’re making a new Unreal Tournament (4) and the news prompted me to download the (free) Unreal Development Kit and play around with it. This is the old Unreal Engine which was release in 2006 or so and which so many games are based off. I was playing around with the lighting so I made a quick internal scene to try and make something pretty. Since I don’t have Unreal Tournament 3 installed, I was very limited when it came to the art assets available. I do however own Chivalry which runs on the Unreal Engine, so I’m busy making a pretty medieval map on that which will be released some day once I’ve got the KISMET working flawlessly (right now the points awarding is a bit sporadic). I’d like to play with UE4 but it’s $19/mo, great value if you’re a serious developer but not so much for someone like me who just wants to mess around.
Also for fun I made a similar sized scene in Unreal Engine 2 (which is now 12 years old!). You can still get some really pretty lighting in it though:
The end goal for all this is that I’m creating a lighting reel (since people said I had a knack for it) and since Unreal Engine is used in so many games and it was something new to challenge myself with learning (since I’d only previously toyed with the UT2004 editor). I also learnt a bit of the gameplay flow system (Kismet) but that’s just gameplay flowcharts and stuff so it’s not too interesting to show on what is essentially an art blog.
Chapter 2 begins somewhat with a bit of backstory. I really want each period of history in my comic to have a distinct look (if only to help add a visual cue as to when we’re jumping back and forth) so here is something to that end.
I started something and then I finished it. There’s maybe some touches I’m going to do to it, possibly making the background a little more defined and maybe adding some details to the sword hilt. I mostly just did this as proof to myself that I can paint!
So I’m going to try and update this more often, if nothing else I’m sure it will provide good evidence of my content writing ability. Anyway…
CREATIVITY AND THE SEARCH FOR MONEY FOR DOING IT
I sometimes feel some degrees will only prepare you for the very specific job of teaching said degree to the next lot. Creating a sort of Machiavellian level of plotting and backstabbing amidst the students to see who will become the Lecturer once the current one gets enough traction on their Comment is Free articles to pursue a real career in journalism. I imagine the end of term resembles the final scene in Harold Pinter’s “The Homecoming”, with the most manipulative alumni perched atop the throne.
Anyway, I am no longer “unemployed”, I am a “qualified hobbyist”. Which means I sit in my room doing creative stuff in between bouts of frantic application sending and states of heavy existential crisis. I think it sounds good and the lovely people I met at a recent creative gathering agreed. Though most of them had jobs so I think there was an air of humour in their agreement.
But, the comic is nearly done! A mere three pages and I’ll have finally completed my first issue. I don’t know why it’s taken so long but I’m excited to get it out there into the world. I think it’s going to be a strong indicator of my desire to be a creative sort that I can show to potential employers at Wetherspoons.
See, what that was was a bit of comedic satire mixed in with some truth. I don’t believe any degree is inherently worthless since the discipline learned through the pursuit of knowledge moulds people into something interesting. Too many people these days don’t care for learning what is important and we’re swamped by an inordinate amount of noise and junk information it’s hard to tell what is worth archiving in our tiny minds and what is worth putting in the “stuff to forget should I need space for skydiving instructions” drawer.
So… with that in mind. Here’s…
MORE MEDIA I HAVE CONSUMED
I’ve been doing more and more of the consumption that drives our lives, though I have not yet managed to see a West End show. The jury is still out on whether this is a good or a bad thing. Here’s some of the things I’ve been into lately and what I think:
TOP 10
In an effort to enjoy more of Alan Moore’s lesser known work, largely done with Avatar and ABC (America’s Best Comics). I’ve been tracking down trade paperbacks of some of the more obscure (though still fairly known among comic fans) titles. Tom Strong Book 2 eludes me, but I saw Top 10 Volume 1 for £6 at the London Super Comic Con (thanks Orbital Comics!), so I had to get it.
The premise is a seemingly obvious one and I’m shocked that it’s a concept that hasn’t been explored before: Neopolis is a city where everyone has super powers. From the office worker to the sex worker, everyone has a unique and distinctive power. It’s largely played for laughs but there’s a pretty fun and interesting set of stories to be found here about the cases of the Neopolis police. It has the clever layouts and believable characters people have come to expect from Moore, though people looking for a deeply affecting and philosophical tale might want to look elsewhere. Alan Moore has made no secret of his disdain for the juvenile super hero character, so it’s interesting that in Top 10 (as well as Tom Strong) he creates a series of characters that almost seem to be re-constructive of the more light hearted and campy super hero fare, yet injected with a certain self awareness and cleverness largely absent from the funny books of yore (and even today). Still, regardless of the more simple stories and tongue in cheek attitude, Moore is a damn good writer and it’s this that shines through in pretty much everything he’s written. I’ll be picking up more of these titles as and when I can. I always recommend Promethea to those looking for a Moore series that carries as bit more weight and explores some extremely surreal and metaphysical ideas. Except no-one ever asks me for comic recommendations because they know I’ll usually just give them a reading list consisting of 80% Vertigo titles from the 90’s.
FARSCAPE
I don’t know if I’d have watched this show had it not cropped up on Netflix and curiosity had gotten the better of me. I don’t sit very comfortably with science fiction shows involving rubbery aliens and slapstick comedy, which Farscape has in abundance; however thanks in part to the work of the Jim Henson company and the Australian humour (which grows on you) I’ve been enjoying Farscape a lot. Wisely, it opts to go for a more mystical and strange version of the universe as opposed to hard science fiction; to such a degree that it’s certainly more space fantasy than science fiction. The story is fairly simple, John Crichton is a US astronaut who, on a test flight, is sucked into a wormhole and taken to a distant part of the universe. There he becomes involved in a prison ship (which is alive), the prisoners who’ve overtaken it, and their escape from a despotic military commander into the uncharted regions of space.
It took a while for me to get into the groove of the show, having previously experienced both more hard science fiction (Stargate Universe) and more comforting fare (Firefly) but rarely something that sits in between the two. Tonally the show explodes with a sort of creative glee and despite how great this sounds it can be slightly tiring trying to keep up with all the madness the show throws at you. However around the start point of Season 2, something clicked in the show for me; largely thanks to the addition of Scorpius as a major antagonist.
It’s common knowledge that every great adventure story needs a great villain, and Scorpius fits that bill completely. Taking over “being-a-dick” duties from the major antagonist of season one, Commander Crais, Scorpius is immediately a cruel, formidable and yet strangely compelling and charismatic villain. Talking in a eloquent and reasonable manner, he is the perfect counter to Crichton (who by the middle of the second series has pretty much gone a bit loopy) and the almost cartoonish game of cat and mouse they play makes the show instantly compelling. There’s a whole range of reasons to like Farscape, from it’s diverse characters, imaginative creature and set design, and quirky humour; to it’s deftly handled moments of emotion and suspense.
THE GRAND BUDAPEST HOTEL
I went to see this around two weeks ago and it was a sheer delight from start to finish. I’ll probably need to watch it again before I can fully write up what I thought about it but rest assured it would be nothing but praise. I don’t have the film or critical chops to tackle a film as lovingly crafted and effortlessly paced as The Grand Budapest Hotel but I can honestly say it’s been a while since I left a film feeling so refreshed and happy.
THE OCEAN AT THE END OF THE LANE
I really enjoyed the book, short as it was. Neil Gaiman has a habit of using similar elements across his fiction, almost to a point where one could argue they’re all set in the same fictional world (as he hinted in American Gods at least). The Ocean at the End of the Lane is no exception to this. However the book is approached from a more child like and innocent angle than the knowing cynicism of American Gods or the rompy irreverence of Stardust or Anansi Boys. As such it manages to play very successfully on the childlike sense of wonder, fear, and injustice. The triumverate of magical ladies makes an appearance as they have done in almost everything of Gaiman’s I’ve read. In this aspect they are three gentle and kind women living on a farm and guarding the world against things from beyond using lovely knitting techniques and asking nicely for the universe to do as they say. The whimsy of Gaiman’s stories is often used to create a brilliant contrast when things get dark and scary and it’s this fairytale aspect that is a core reason I keep coming back to him. The book is great, and it reminded me of what it was like to be a kid and filled with imagination.
It’s about time for my monthly update. I’m settled into London (almost too much!) and I’m beginning to look to integrate and ingratiate myself here; roughly translated as “I’m sending off a load of job applications and working hard on my comic and creative stuff.”
I finally made it down to London, where I shall be living for a definite three months on a trial basis. I’ll be looking for work whilst focusing on improving my portfolio and C.V and I hope very much that I can stay here.
In terms of updates, I only have this big one. The pages for my comic are slowly trickling out and, with my new location being fairly tranquil and free of distraction, I’m hoping that the production will speed up a little bit.
|
{
"pile_set_name": "Pile-CC"
}
|
Selangor FM
Selangor FM is a regional Malay language-radio station operated by Radio Televisyen Malaysia out of the Selangor state capital Shah Alam in Malaysia. Broadcasts are daily from 06:00 until 00:00 featuring local news as well as Malay music. It transmits on FM 100.9 MHz from the Gunung Ulu Kali transmitter site and can be heard in Selangor, Kuala Lumpur, the northern part of Negeri Sembilan, the southern part of Perak and the western part of Pahang.
Etymology
The station was formerly known as Radio Malaysia Selangor (RMS) and before that as Radio 3 Shah Alam.
Controversy
Forced to move out from present location
On 12 April 2008, the new Menteri Besar of Selangor, Tan Sri Khalid Ibrahim, warned the radio station to come up with a weekly one-hour slot to deliver the information about the programmes held by the State Government, or move out from the Sultan Abdul Aziz Shah Building which also houses the State Government's administration centre. The radio station was given a one-week deadline to perform the State Government's request. However, the radio station refused to allocate the weekly one-hour slot as requested. As a result, the Information Minister of Malaysia, Datuk Ahmad Shabery Chik urged the radio station to move out and operate at the Angkasapuri instead, stating that RTM is not afraid of such warning.
References
External links
Category:Radio stations in Malaysia
Category:Media in Shah Alam
|
{
"pile_set_name": "Wikipedia (en)"
}
|
This survey was carried out as a follow-up to a 1994 survey carried out by this laboratory (1) in order to determine the background levels of explosives traces in public places. The first survey concentrated on transport areas and police stations in and around London. This second study examines levels in four of the United Kingdom's major cities: Birmingham, Cardiff, Glasgow, and Manchester. Samples were taken at various transport sites and from hotels, private houses, private vehicles, and clothing. The survey showed that traces of the high explosives nitroglycerine (NG), trinitrotoluene (TNT), pentaerythritol tetranitrate (PETN), and cyclotrimethylene trinitramine (RDX) are rare within the general public environment. Only one low-level trace of RDX was detected. NG, possibly associated with the use of firearms, was detected at low levels in two samples and 2, 4-DNT was detected in a separate sample. No PETN was detected in any of the samples. The results of the survey indicate that it is unlikely that persons visiting public areas could become significantly contaminated with explosives. The analytical procedures employed would also have detected ethylene glycol dinitrate (EGDN) if present at levels greater than 2 ng, nitrobenzene (NB) if present at levels greater than 50 ng, mononitrotoluenes if present at levels greater than 50 ng, and the other common isomers of dinitrotoluene if these had been present at levels in excess of 10 ng. None of these were detected. The relatively high volatility of EGDN, NB, and the mononitrotoluenes would, however, cause traces of these compounds to disperse rapidly. A proportion of the samples (approximately 7%) were analyzed for the presence of HMX. No HMX was detected.
|
{
"pile_set_name": "Pile-CC"
}
|
1. Background {#sec1}
=============
The eight Millennium Development Goals (MDGs), established during the Millennium Summit of the United Nations in 2000, marked a pledge by 189 nations to foster international relations with shared values of freedom, equality, solidarity, tolerance, respect for nature, and shared responsibility \[[@B1]\]. As global citizens determined to accelerate progress towards MDGs, nurse clinicians have been sharing knowledge and partnering with colleagues in low- and middle-income countries to identify effective ways of working within the context of their healthcare systems. The practice-based process and strategies applied to improve individuals\', organizations\', or communities\' ability to address health issues is referred to as capacity building \[[@B2], [@B3]\]. Historically, this process was characterized by knowledge transfer from "north to south" or from "developed to developing countries" or "colonizer to colonized" and was framed as "transporting" of knowledge to build capacity \[[@B4], [@B5]\] in different parts of the globe; it is now passé. Recently, global health orientations that seek to address these enduring approaches to north-south collaborations have challenged the unidirectional flow of knowledge and skills \[[@B7]\] and follow more equitable partnership models \[[@B2]\]. We urge the nursing community to embrace a new ideology that is not based on or concerned with distinctions---north and south, low- and middle-income countries and high-income countries, and developing and developed countries--- but is rather concerned with One World, One Health. This opinion paper explains the concept One World, One Health and takes a historical and reflective approach that invites consideration of concepts that can inform the way nursing responds to the challenges in global health engagement. We examine terms such as capacity building and explicate how they have been reframed and advanced in the global health and nursing literature including the transformative nature of concepts such as reverse innovation and two-way learning. We conclude by examining implications for nursing, and policy to instill a new perspective---One World, One Health.
2. One World, One Health {#sec2}
========================
Beyond the expiry of the MDGs, it is argued that "the health of people in all countries" must be an overarching goal of a post-2015 framework \[[@B6]\]. Emerging trends, for instance, majority (70%) of the world\'s poor now reside in middle-income countries \[[@B6]\], and associated challenges necessitate applying post-2015 goals to all countries, with modification of targets and indicators depending on country context \[[@B6]\]. The sentiment of our shared health concerns and coming together of experts and disciplines to address global challenges is implied in the term "One World, One Health." One World, One Health was coined in 2008 in reference to a consultation document reviewed at the Sixth International Ministerial Conference on Avian and Pandemic Influenza in Egypt \[[@B7]\]. One World, One Health typifies our interconnectedness, between not only humans but nonhumans (i.e., animals) and our ecosystem and emphasizes coequal collaborations and partnerships \[[@B7]\], providing a privileged intersection in which the capacity of healthcare providers, regardless of geographical boundaries, is enhanced for society\'s well-being \[[@B8]\].
One World, One Health is a relatively new frame of reference in nursing, despite nurses\' unique position to address disparities in healthcare to attain health for all people around the world. There are 13 million nurses worldwide who are front-line healthcare providers and, by virtue of their roles and responsibilities, have prolonged encounters with patients and their families \[[@B9]\]. Nurse clinicians require an inquiry approach situated within a cultural-competency framework that promotes behaviors, attitudes, and practices to come together in interpersonal and interprofessional relationships that (a) acknowledge and view cultural differences as strength, (b) promote self-reflection to develop an understanding of their own culture, attitudes, and prejudices, (c) avoid assumptions and stereotypes, and (d) facilitate empathy, despite language or communication barriers \[[@B10], [@B11]\]. Moreover, knowledge, skills, attitudes, and core values of nurses are fluid \[[@B5]\]---borderless. We assert that for the nursing profession to occupy a forceful role in promoting the aspirations of the Sustainable Development Goals we must see ourselves as partners with our international colleagues, cocreating knowledge and sharing ideas and best practices with a view to seeking innovative solutions to shared health challenges.
3. Transformative Nature of Knowledge Transfer, Reverse Innovation, and Two-Way Learning {#sec3}
========================================================================================
The term capacity building, dominant in the development literature since the 1970s, has a historical trajectory informed by colonial perspectives and unequal power relationships. Capacity building has been reframed to include notions such as working collaboratively to enhance people\'s leadership and commitment (i.e., dynamic capabilities) to effect change in the conditions of their communities through action (e.g., discovering new ways of doing things) or responsiveness to the changing environment \[[@B3], [@B12]--[@B14]\]. Moving beyond the colonial perspective to a more ethical, equitable approach leads to framing this process in terms of the quality of the relationships that are nurtured between nurses. This spirit and approach are best characterized by the concept of knowledge transfer \[[@B4]\]. Knowledge transfer promotes access to new knowledge, generally created through research, to those who will use this knowledge. The use of this knowledge is intended to improve outcomes of health and ensure effective use of resources and time \[[@B4], [@B15]\]. Knowledge transfer entails a social process in which a knowledge manager or broker seeks out existing evidence or seeks to bring research activities more in line with users of knowledge \[[@B4], [@B15]\]. Nurses need to participate in new ways within this social process, developing competencies to promote social, economic, and political action that not only exposes the health inequalities (e.g., social determinants of health) \[[@B16]\] but identifies innovative approaches to reform healthcare delivery. The knowledge transfer experience should be transformative to all individuals engaged in the experience: creator of knowledge, broker of knowledge, and user of knowledge.
With growing awareness of the transformative nature of international activities, concepts such as reverse innovation and two-way or shared learning have also been advanced in the literature. Reverse innovation is a term that appeared in 2009 and is more prominent in the business literature. It entails applying successful innovative approaches originating from low- and middle-income countries (driven by limited resources) to high-income countries in order to transform healthcare systems and improve health outcomes of patients and communities \[[@B17]--[@B19]\]. For example, North Wales implemented a Brazilian family health strategy---universal primary care services---in which primary care teams comprising a doctor, nurse, nurse auxiliary, and four community health workers delivered primary care services to households within their defined geographic area, whether or not the household express a need for service \[[@B20]\]. A number of barriers, however, influence reverse innovation, including weak flow infrastructure, narrow-mindedness, and early failures \[[@B17]\]. Overcoming these barriers is important to realize that the goal of reverse innovation is "to contribute to the countless health challenges faced by populations across the world" \[[@B17], p. 2\]. The 13 million nurses worldwide can promote a "global innovation flow" that is bidirectional, sharing knowledge, skills, ideas, and lessons learned around the world in order to cocreate clinical practice solutions for the world \[[@B17], [@B21]\]. Moreover, this global innovation flow should be linked to the Sustainable Development Goals (e.g., "ensure healthy lives and promote well-being for all at all ages") in a way that seeks to achieve economic, social, and environmental development with hopes of eliminating all forms of poverty \[[@B17], [@B22]\]. As such, nurses need to embrace new ways of doing, a paradigm shift, which entails examining problems across situations or contexts, being inclusive of other disciplines to explore the complex nature of the problem, and finding alternate and creative solutions. At the forefront of these solutions should be the principles of dignity, prosperity, justice, partnership, planet, and people \[[@B6]\].
Similarly, two-way learning is synonymous with reverse capacity development, which refers to the altered perception, particularly awareness and understanding, of these perspectives or worldviews that can be "translated" into action that can potentially inform practice "at home" \[[@B14]\]. Only one article in the policing literature precisely referred to the concept of reverse capacity development \[[@B14]\]. The authors reflected on Australian police officers\' experiences related to peace keeping and capacity building in Solomon Islands, Timor-Lester, and Papua New Guinea. Harris and Goldsmith \[[@B14]\] refer to a "positive effect" of these reverse capacity building experiences, such as enhanced repertoire of skills to improve structures or processes in their workplace, that go beyond enhancing one\'s own clinical and cultural-competency skills.
Cross-cultural competencies are one strategy to improve patient outcomes and eliminate racial and ethnic disparities in health outcomes \[[@B10]\]. Health inequities, however, are also rooted in social determinants of health (e.g., social status, income, gender, disability, or sexual orientation) \[[@B23]\]. Nursing involvement in the global innovation flow offers an opportunity to support learning in utilizing the social determinants of health framework "at home" to increase access to not only quality care but health resources thereby reducing health inequities \[[@B23], [@B24]\]. Indirectly, it increases nursing workforce diversity, which has been identified as an important strategy to overcome health inequities \[[@B23], [@B24]\]. Nursing engagement in the "global innovation flow" is an innovative strategy to reduce inequality within countries---nursing\'s contribution to moving towards Sustainable Development Goal (e.g., Goal 10 "reducing inequality within and among countries") \[[@B1]\]. To ensure an effective healthcare system that is accessible, safe, effective, and affordable around the world, nurses also need to change the conversion to influence policy (health and social) \[[@B25]\].
4. Nursing: Engagement in Changing Conversation {#sec4}
===============================================
Nurses have the potential and often the interest to participate in addressing many of the global health issues (e.g., noncommunicable disease) \[[@B9]\] through engagement in areas of healthcare reform that are common across all countries, despite contextual differences \[[@B26], [@B27]\]. They are uniquely positioned to facilitate shared learning globally and engage in reverse innovation and reverse capacity development (i.e., two-way learning). Reports and studies \[[@B9], [@B26]--[@B28]\] suggest that nurses are viewed as trusted professionals who have the ability to influence elements of healthcare reform. Though there is an appreciation that nurses will need to increase their visibility in shaping international practice and policy decisions (e.g., international agencies, national capitals) \[[@B9], [@B26]--[@B28]\]. The International Council of Nurses realizes that nurses will need to better understand the global health discourse and shape and reshape the conversations at multiple levels (i.e., intrapersonal, interpersonal, organizational, and sociocultural) to inform world views and promote behavior change, that is, involvement in healthcare reform that will lead to health for all \[[@B27]\]. The Global Advisory Panel for the Future of Nursing convened by Sigma Theta Tau International has created a platform for these conversations to increase nurses\' contribution to global health \[[@B29]\].
Reverse innovation and two-way learning create an openness to "change the conversation" \[[@B30]\], that is, engage in discourse to promote change in thinking and behavior (i.e., taking action in global healthcare reform). Reverse innovation and two-way learning can promote respect for intellectual partnerships and shared exchange of knowledge, ideas, skills, and innovation across borders \[[@B19]\]. It does not, however, dispel the power dynamics or the view of them and the "other." Moreover, reverse innovation and capacity development although helpful concepts are not sufficient and must be complemented by an understanding that embodies the complex interrelationship between community engagement and core values of social responsibility, justice, and equity.
5. Implications for Nursing and Health Policy {#sec5}
=============================================
Access to high-quality and high-value care should be a fundamental right of every patient, regardless of the country in which they are receiving healthcare services. The post-2015 United Nations Sustainable Development Goals aspire to this agenda in ways that differ from the "donor-recipient" paradigm of the MDG as it empowers every individual to action \[[@B6], [@B31]\]. Participation of nurses, a key principle of the Sustainable Development Goals, at every level (see [Table 1](#tab1){ref-type="table"}) will be imperative to reform healthcare to move towards this agenda (i.e., improving access and quality while making healthcare affordable) \[[@B32]\].
Nursing academic and professional institutions are integral to creating an enabling environment for nurses to develop the skills and competencies to participate in addressing inequities in health and healthcare delivery. Professional nursing education programs must help nurses develop competencies (e.g., political leadership, team work) and attributes (e.g., influence, professional credibility) that are fundamental for nursing engagement in global health and health reform \[[@B32]--[@B34]\]. To improve health system performance, leadership, critical reasoning, and data management skills are required to generate and use data to inform decisions regarding clinical, research, and education practice and policy \[[@B25], [@B33]\]. Nurses are apt at adopting and implementing policy but appear to be peripheral in informing and shaping policy \[[@B35]\]. Interprofessional education to promote networking, collaboration, nonhierarchical relationships, and common goals will resolve issues related to professional silos and exclusion of nurses at the policy table \[[@B32], [@B33]\]. Emotional intelligence (i.e., self-awareness and social astuteness) will enable nurses to manage social and cultural factors that impede their involvement in promoting changes in practice, education, and policy \[[@B32]\]. Professional institutions maintain the responsibility of (a) ensuring nursing presence during policy decision-making, (b) preserving a united front, and (c) guiding nurses to remain proactive in lobbying government and stakeholder to address social determinants of health, which influence health, and access to healthcare \[[@B32]\]. Nurses will need to hold governments, nongovernmental organizations, private sectors, and academic and professional institutions, among others, accountable to the commitments made in delivering priorities in the Post-2015 Development Agenda \[[@B36]\].
6. Conclusion {#sec6}
=============
This paper intends to begin conversation among nurses about their engagement in global health and identify actions to participate in health reform required to promote health for all. Grounding nursing conversation in the concepts articulated above will guide change \[[@B30]\], in that it will enable nurses to be accountable to both patient care and healthcare leadership \[[@B27]\]. In so doing, nurses can influence organizational and political context of care, cocreate global solution for care through "global innovation flow," and emphasize primary care to promote well-being of populations \[[@B27]\]. Disengagement, on the other hand, will result in preserving the status quo and increase healthcare spending without improvement in patient and population well-being.
Competing Interests
===================
The authors declare that there are no competing interests regarding the publication of this paper.
######
Key recommendations for nursing engagement in global health.
Stakeholder group Recommendation
----------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------
Nurses Need to participate in the conversation at every level (e.g., academic, association, and policy) and develop emotional intelligence
Professional nursing education programs Help nurses develop competencies and attributes for engagement in global health reform
Interprofessional education programs Promote networking, collaboration, nonhierarchical relationships, and common goals
Nurse clinicians Need inquiry approach situated within a cultural-competency framework
Nursing community Embrace One World, One Health
[^1]: Academic Editor: Sten H. Vermund
|
{
"pile_set_name": "PubMed Central"
}
|
black on black looks real sporty like 3 series should look like, my shadowline black window trim wrap should be in next week. 3 series arent really luxurious so idk why ppl have so much chrome and all on them
For me when you have black car, wheels and tyres it makes the wheels look small. That is with gloss black as all the examples are. Go for anthracite or satin black and they will be a bit sort of grey an look awsome imo.
|
{
"pile_set_name": "Pile-CC"
}
|
Digest: Does sexual conflict complicate a trade-off between fecundity and survival?
Why do some species exhibit apparently suboptimal combinations of life history traits? In a comparative study of lizard species, Reedy et al. test the idea that variation in the trade-off between fecundity and survival can be explained by sexual conflict. Their results show that degree of sexual conflict alone cannot explain this variation, and they found a positive correlation between trade-off optimality and the size of males relative to females. These findings suggest a more complicated picture of the fecundity-survival trade-off, possibly involving a third, unknown source of selective pressure.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
LOS ANGELES — California took some of the most aggressive steps yet to counter the effects of climate change as legislators voted Tuesday to require that 100 percent of the state’s electricity come from carbon-free sources.
The bill gives the state until 2045 to meet the goal. California had already imposed a mandate to generate 50 percent of its electricity from renewable sources by 2030; the bill increased the amount to 60 percent.
The move highlights California’s determination to be a leader on climate issues. In May, state regulators revised the building code to require newly built homes to be equipped for solar power.
The state’s aggressiveness comes as the Trump administration is moving to loosen or abandon environmental regulations and promoting a revival of the coal industry. And it follows a year in which catastrophic wildfires that many attribute to climate change have been responsible for dozens of deaths in the state, destroyed homes and businesses and cost billions of dollars.
|
{
"pile_set_name": "OpenWebText2"
}
|
1. Field of the Invention
The present invention relates to semiconductor memory devices. More particularly, the present invention relates to a repair circuit and a method of repairing defects in a semiconductor memory device.
This application claims priority under 35 USC § 119 to Korean Patent Application No. 2005-117258, filed on Dec. 3, 2005, the subject matter of which is incorporated herein in its entirety by reference.
2. Description of the Related Art
A semiconductor memory device generally includes a main memory array having a plurality of memory cells, and a redundant memory array having redundant memory cells adapted for use in the repair of defective memory cells in the main array. It is preferable that all memory cells of the main memory array operate normally. However, defective memory cells are often formed within the main memory array due to variations in the manufacturing processes used to fabricate the memory cells as well as variations in electrical performance characteristics across a large number of memory cells. When a defective memory cell is identified in the main memory array, it may be replaced (or substituted) with one of the redundant memory cells. This capability ensures uniformly acceptable memory cell performance across the entire main memory array.
In general, at various stages during the lengthy sequence of fabrication processes used to manufacture a semiconductor memory device, tests are performed to determine whether or not the memory cells are operating normally. After each test, a memory cell identified as defective may be replaced with a redundant memory cell. This test, identification, and replacement procedure is typically performed while the semiconductor memory device is still in its “wafer state”, i.e., before individual dies are cut from the fabrication wafer and packaged into individual device form.
There are many different types of memory cell defects, including row related defects and/or column related defects. That is, while some memory cell defects are identified in relation to a particular memory cell, memory cell defects are more commonly identified as a defective row or column. As a result, semiconductor memory devices require both a row repair circuit and a column repair circuit in order to remedy row defects and column defects, respectively.
Conventional repair techniques may be divided into before-package repair (BPR) techniques—adapted to repair identified defects in wafer state devices, and post-package repair (PPR) techniques—adapted to repair defects in a packaged devices. PPR techniques are commonly used to repair defective memory cells which remained unidentified in the wafer state, but which were subsequently identified during package level testing. Both PPR and BPR techniques require row repair and column repair circuits.
Some PPR techniques use electrical fuse circuits (e-fuses) instead of laser fuse circuits to repair defective memory cells and improve package yield for the semiconductor memory devices. E-fuse circuits offer several performance advantages, but tend to be more complicated in their layout relative to laser fuse circuits. Thus, conventional PPR techniques incorporating both the row and column repair circuits using e-fuse circuits occupy an unacceptably large layout area within the overall semiconductor memory device. This quality is at odds with continuing pressure to increase the fabrication density of memory devices.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
To navigate through the Ribbon, use standard browser navigation keys. To skip between groups, use Ctrl+LEFT or Ctrl+RIGHT. To jump to the first Ribbon tab use Ctrl+[. To jump to the last selected command use Ctrl+]. To activate a command, use Enter.
Tomorrow will initiate the 2012 – 13 law school recruiting season, in the form of the LSAC’s Washington, D.C., forum. True, we remain knee-deep in waitlist activity for the 2011 – 12 season, but as the robin is the harbinger of spring, so the D.C. forum is the harbinger of law school recruiting season.
The cyclical nature of admissions is one of its many charms as a job; right when you’re feeling worn out by one recurring task, it’s time to move to the next. So I’m pretty excited about the prospect of talking to a whole new slew of strangers tomorrow. I have met many people at these events who went on to become students—I vividly remember, for example, a great conversation at last year’s Boston forum with one of our brand-new summer starters—and so I love the promise of the future the forums offer.
For the admissions folks, attendance means standing on one side of a table and fielding questions from passers-by on the other side. (Well—if you’re lucky. LSAC forums are always well-attended and lively, but when such events are held at individual colleges, attendance sometimes can be sparse. Then, the principal challenge for a recruiter is to resist the urge to leap over the table and tackle the lone attendee in order to have someone to talk to.) Easy enough, although the challenge comes in the necessarily repetitive and workmanlike nature of the questions. Sure, hearing the same questions means you can be assured you will always know the answers, but there is not a lot of latitude for appearing at one’s perky, shiny best when responding to, “What is your median LSAT?”
Which is not to complain. Having recently been on the consumer end of the higher ed selection, I am completely sympathetic to the need to ask pedestrian questions. My sole foray into standing on The Other Side Of The Table came when I was shepherding my daughter through a college fair at the local high school. I went into it with a certain swagger—after all, I had had many opportunities to think about what are good questions, and I already knew a lot of basics about tons of colleges. Surely I would be able to suggest to my daughter some riveting questions. Alas, no. I found myself wanting to categorize all the schools and put them in neat little boxes, and doing that requires apples-to-apples data. Next thing you know, I’m telling my daughter to ask prosaic questions about average ACT scores and acceptance rates. Urgh.
Gathering such information all at one time and in one setting is certainly useful for the exercise of forming comparisons. But it is even more useful if you can bring yourself to move beyond those sorts of questions into something that has the potential to lead to an actual conversation. That allows you to learn a lot about a school’s culture, both at the implicit and explicit level. If you can engage in a dialogue, you can get a sense of the school’s identity and, for want of a better word, personality. Of course, the person a school sends to recruit isn’t always going to be an accurate reflection of the school as a whole, but it’s not for nothing, either. And if you can elicit answers that go beyond data, you’re more likely to learn information that isn’t printed in the viewbook or captured on a website.
Some of the best questions I’ve gotten over the years are framed from the students’ point of view: “How did your students react to XYZ event?” “What is a typical day like for a student?” “Who are the most popular professors? Why?” At the most fundamental level, these questions allow you to quickly suss out whether the recruiter knows anything about what students think. If they don’t, you might want to listen to representations about the school with heightened skepticism. If they’re not interested in their current students, chances are pretty good they’re not going to be interested in their future students, either.
No need, though, to try to wow the person on the other side of the table. One great beauty of this setting, from the applicant’s point of view, is your relative anonymity. You are in complete information-gathering mode; it’s not an interview, and you don’t have to worry about getting a grade. (I’m not recommending that you ask aggressive questions, mind you; at least one person at these events is guaranteed to lob, “Sell me on why I should be interested in your school,” to which I think the appropriate response is, “I’m pretty sure you shouldn’t be.” Such questions won’t do you harm—again, these events are volume operations, and you can pass through fairly anonymously—but think about karma.) Go ahead and ask the prosaic questions, but if your table-hopping leads to even one particularly positive conversation, you’re likely to feel the effort of attending has been merited.
-Dean Z.Senior Assistant Dean for Admissions,Financial Aid, and Career Planning
We encourage your comments and hope you will join the conversation! Although we require all commenters to log in, your post may remain anonymous if you choose, and your login information will not be shared with Admissions Office staff or used for any other purpose. We review comments before they're posted, and advertisements, repeat comments, and language that is profane/abusive/threatening/etc. won’t make the cut. Thanks.
Comments
A worthwhile forum
Dean Z.,
It was such a pleasure meeting you at the D.C. forum. My dialogue with you certainly did make me feel that my trip from New York was worthwhile. Thank you for suggesting your blog – it is uncanny how similar some of the points in our conversation were to your latest blog post. If part of the goal on your side of the table was to get students excited about Michigan Law, I can tell you that you succeeded in at least one case. While I was a little familiar with Michigan Law beforehand, after our conversation I made the effort to research more about it. I have since become much more enthusiastic about the prospect of earning a legal education there. Thank you for taking the time to personally attend the D.C. forum and for truly exuding the personality of Michigan Law!
-Steve
on 6/19/2012 5:05 PM
really?
To quote a question that you claim you receive at least every event, and your response: “Sell me on why I should be interested in your school,” to which I think the appropriate response is, “I’m pretty sure you shouldn’t be.”
If you are willing to judge a potential prospect so harshly, based upon one question, I think the University of Michigan should seriously reconsider your placement in the office of admissions. Unfortunately however, many public institutions like U of M have gone very far astray in pursuing a thinly veiled need to compete with the likes of Ivy League schools. And your post, dripping with snobbery and elitism is a fine example of just how institutionally ingrained this attitude has become.
on 6/20/2012 11:07 AM
Dean Z. responds--
I’m glad you let me know your take on my comment—I think I’ve been a bit sloppy and created a misimpression. Let me expand! My negative reaction to the sort of question I describe comes not at all from a place of snobbery and elitism; I do not think the choice of Michigan (or any other law school for that matter) is so evident that I shouldn’t have to explain it to someone who is considering applying. Frankly, I very much enjoy having the opportunity to talk with prospective students about Michigan’s strengths, and to counsel them about their considerations as they weigh law schools—having these face-to-face conversations is one of my favorite parts of my job, which is what I was trying to convey generally in this post. What I object to is simply discourtesy from the questioner—I like to engage in a dialogue, not to be commanded to “sell” an applicant. But I can see where the brevity created a very different sense, and made me appear pretty discourteous myself. All that said: I’m very proud to be representing one of the nation’s great public universities, and I think the education here is second to none—Ivy designations included. Harvard is, after all, the Michigan of the East (http://www.jfklibrary.org/Research/Ready-Reference/JFK-Speeches/Remarks-of-Senator-John-F-Kennedy-at-the-University-of-Michigan.aspx). And I’m happy to report that not one of the many people I spoke to at the DC forum was anything other than pleasant in their interactions!
|
{
"pile_set_name": "Pile-CC"
}
|
#import "EXPMatchers+beNil.h"
EXPMatcherImplementationBegin(beNil, (void)) {
match(^BOOL{
return actual == nil;
});
failureMessageForTo(^NSString *{
return [NSString stringWithFormat:@"expected: nil/null, got: %@", EXPDescribeObject(actual)];
});
failureMessageForNotTo(^NSString *{
return [NSString stringWithFormat:@"expected: not nil/null, got: %@", EXPDescribeObject(actual)];
});
}
EXPMatcherImplementationEnd
EXPMatcherAliasImplementation(beNull, beNil, (void));
|
{
"pile_set_name": "Github"
}
|
Q:
Invalidate pointer values inside a QMap
I'm having what seems to be a weird issue, but it could be a quirk of how QMap's work and I just don't understand it. It's tough to summarize the problem, but I'll do my best.
I have a class A, with a QMap<QString, someType*> mySomeTypeMap;. When I load a new file in my program, I want to delete all the contents of this QMap so I can repopulate it with new data. I do that by doing the following:
foreach (QString key, mySomeTypeMap.keys())
{
someType* toDelete = mySomeTypeMap.take(key);
//Show me the original address of the pointer
qDebug() << "toDelete: " << toDelete;
delete toDelete;
//Set the pointer to 0x0
toDelete = NULL;
}
The qDebug() statement prints out the correct address of the value I want to delete, and when I look at toDelete in the debugger after it gets set to NULL, it says 0x0, which is what I want.
Then later, in a different class B, I have the following code...
void B::setSomeType(someType* blah)
{
if (Blah != NULL)
{
//Calls a bunch of disconnect()'s
disconnectAllSignals();
Blah = blah;
//Calls a bunch of connect()'s
connectAllSignals();
}
}
Now, what's really confusing is my program crashes when it gets to the disconnectAllSignals(); line. The reason being it's trying to call disconnect() on Blah which was deleted and should have been set to 0x0 when I set it to NULL. However, if it was actually set to NULL it never would have entered that if-block to begin with. In a debugger, I see that the address of Blah is exactly the same as what I get when I print out qDebug() << "toDelete: " << toDelete; right before setting toDelete = NULL;.
TLDR; I don't know how my program is getting the orignal address of a pointer back after I delete the pointer and set the same pointer to NULL. Since the pointer isn't set to NULL later in the execution it leads to a crash.
A:
Values in the map are stored by value even if in these case it means that the pointer (address which it points) is stored by value.
For example:
someType* toDelete1 = mySomeTypeMap.take(key);
someType* toDelete2 = mySomeTypeMap.take(key);
someType* toDelete3 = toDelete1;
toDelete1 = NULL;
toDelete2 & toDelete3 will still point to the original object
Instead of making the pointer null after delete you should either remove it from the map or set the value for that key to NULL.
|
{
"pile_set_name": "StackExchange"
}
|
Q:
AngularJS change scope variable on ng-click
I try to set a scope variable within a template on ng-click and later read it in the controller. Example:
HTML:
<section id="editCtrl" data-ng-controller="EditCtrl as edit">
{{ edit.myVar = []; "" }}
Click the following buttons:<br>
<span data-ng-click="edit.myVar['entry'] = 'test'">Click me</span>
<span data-ng-click="edit.showMyVar();">Show MyVar in console</span>
</section>
JS:
// This controller is just for the example - I would never add a controller variable within the template
var app = angular.module("app", []);
app.controller("EditCtrl", function(){
var edit = this;
edit.showMyVar = function(){
console.log(edit.myVar);
};
});
However the variable "edit.myVar" keeps beeing an empty array. What am I doing wrong? In my interpretation this is a valid ng-click expression.
Live example: JSFiddle
A:
There are couple of changes you have to do --
You can not keep an assignment code in {{ }} since this code renders
frequently . so you will not get the actual value.
Working plunker..
<!DOCTYPE html>
<html >
<head>
<meta charset="utf-8" />
<title>AngularJS Plunker</title>
<script>document.write('<base href="' + document.location + '" />');</script>
<link rel="stylesheet" href="style.css" />
<script data-require="angular.js@1.4.x" src="https://code.angularjs.org/1.4.3/angular.js" data-semver="1.4.3"></script>
<script src="app.js"></script>
<style>span:nth-of-type(1){background:yellow;}
span:nth-of-type(2){background:red;}</style>
</head>
<body>
<section id="editCtrl" ng-controller="EditCtrl as edit">
Click the following buttons:<br>
<button ng-click="edit.myVar['entry']='test'">Click me</button>
<button ng-click="edit.showMyVar()">Show MyVar in console</button>
</section>
<script>angular.bootstrap(document, ['app'])</script>
</body>
</html>
Js file
// This controller is just for the example - I would never add a controller variable within the template
var app = angular.module("app", []);
app.controller("EditCtrl", function(){
var edit = this;
edit.showMyVar = function(){
alert(JSON.stringify(edit.myVar));
};
});
Problems with your code :
You can not keep an assignment code in {{ }} since this code renders frequently . so you will not get the actual value.
one more problem at my end before loading document app was bootstraping.
|
{
"pile_set_name": "StackExchange"
}
|
SEATTLE -- The Seattle Seahawks had a three-point lead and four-and-a-half minutes on the clock Sunday night when their offense, with the NFL’s most committed and prolific rushing attack, took over with the game on the line.
It seemed almost certain that they would try to grind out a victory on the ground, and in the process, clinch a playoff berth.
Instead, the Seahawks left it up to Russell Wilson and his receivers to seal their win over the Kansas City Chiefs.
With the way they had played, why not? That was the thinking coach Pete Carroll expressed to offensive coordinator Brian Schottenheimer when Seattle regained possession following a Chiefs field goal that cut the Seahawks’ lead to 31-28.
ESPN
To that point, Wilson had matched MVP front-runner Patrick Mahomes with three touchdown passes and had answered every punch from the NFL’s highest-scoring offense.
“I was talking to Schotty, ‘Let’s keep going for it. You can throw as much as you need to here. Don’t hold back,’” Carroll said. “Russ was on fire. We could ride him.”
So they did.
After a first-down run and an incompletion, Wilson converted a third-and-6 to David Moore, who muscled his way past the line to gain. He hooked up with Tyler Lockett on a perfectly placed over-the-shoulder deep ball for 45 yards then with Doug Baldwin, who made a one-handed grab for 29 yards to get Seattle to Kansas City’s 1. Chris Carson punched it in from there to give the Seahawks another two-score lead.
The eight-play drive included 5 drop-backs, 3 Wilson completions for 81 yards and 3 Carson rushes.
When the Seahawks held Kansas City to a field goal on the ensuing possession and then withstood an unsuccessful onside kick attempt, they had escaped with a 38-31 win that punched their ticket to the playoffs.
Wilson (18-of-29 for 271 yards, no turnovers) has had more prolific games. Considering what was at stake, who was on the other side and the plays he made down the stretch, this could rank among the best games of Wilson's career.
According to ESPN Stats & Information, he was 8-of-11 for 197 yards and a touchdown on passes 15-plus yards downfield. It was his second-most completions on such throws in his career.
He also torched Kansas City when it blitzed, finishing 9-of-15 for 123 yards and 2 touchdowns when the Chiefs brought an extra pass-rusher. That gives him an NFL-high 15 touchdowns to only one interception against the blitz this season. Wilson was also 7-of-11 for 71 yards and 2 touchdowns when under duress and he scrambled 4 times for 61 yards, including a pair of first downs.
“The times he took off and ran and created first downs for us, he looked like he was done and gone," Carroll said. "He was doing the stuff that I think a lot of people came to watch this game because of Patrick and Russ. They’re magnificent ballplayers.”
Kansas City tied the game at 17 in the third quarter when Mahomes (23 of 40, 273 yards) made one of the jaw-dropping, physics-defying plays he’s becoming known for. While running to his left, he delivered a side-arm throw back across his body to Charcandrick West for his second touchdown of the night.
Wilson showed plenty of off-script magic of his own, including a touchdown throw to tight end Ed Dickson while rolling left. Dickson’s diving catch was one of his two big plays. He also converted a third-and-15 with a tackle-breaking 18-yard catch in the third quarter. That extended a drive that ended with a Baldwin touchdown.
NFL scores, standings and more Everything you need this week:
• 2018 playoffs coverage »
• Full schedule » | Full standings »
• 2019 draft order: Every first-round pick »
More NFL coverage »
“It was a great catch for the touchdown, but his run after the catch was one of the moments in the game where you know, ‘OK, we have a shot to win this frickin' game,’” Carroll said. “And you can tell because the plays are being made and the guys are coming through.”
Carroll said there’s “no doubt” Wilson fed off of having to go back and forth with an MVP candidate during the second half.
“He knows who he’s playing against and he knows all that,” Carroll said before mentioning how Wilson was left off the NFC Pro Bowl roster. “I guess it’s just a statement that we didn’t throw the ball enough and everybody’s enamored with that. But he’s thrown the ball great. Look at his rating (112.7, third behind Drew Brees and Mahomes). I don’t know who has a better rating than him, but he’s been phenomenal all year long. I hope he doesn’t say anything about it because he won’t. But yeah, when you’re competing against guys like that, you want to do well. He came through and did a great job.”
|
{
"pile_set_name": "OpenWebText2"
}
|
---
abstract: 'We prove that generically, both in a topological and measure-theoretical sense, an invariant Lagrangian Diophantine torus of a Hamiltonian system is doubly exponentially stable in the sense that nearby solutions remain close to the torus for an interval of time which is doubly exponentially large with respect to the inverse of the distance to the torus. We also prove that for an arbitrary small perturbation of a generic integrable Hamiltonian system, there is a set of almost full positive Lebesgue measure of KAM tori which are doubly exponentially stable. Our results hold true for real-analytic but more generally for Gevrey smooth systems.'
author:
- 'Abed Bounemoura[^1] and Bassam Fayad[^2] and Laurent Niederman[^3]'
bibliography:
- 'DoubleExpTore10.bib'
---
[N]{} [C]{} [Q]{} [R]{} [Z]{}
Introduction and results
========================
Introduction
------------
The goal of this paper is to prove that invariant Lagrangian Diophantine tori in Hamiltonian systems are generically doubly exponentially stable. We will consider two settings.
In a first setting, we consider a Lagrangian Diophantine torus invariant by a Hamiltonian flow on an arbitrary symplectic manifold. It is well-known that by a symplectic change of coordinates, one can consider a Hamiltonian $$\label{H1}\tag{H}
H(\theta,I)=\omega\cdot I + O\left(||I||^2\right), \quad (\theta,I)\in \T^n \times B,$$ where $\,\cdot\,$ denotes the Euclidean scalar product, $||\,\cdot\,||$ is the associated norm, $n \geq 1$ is an integer, $\T^n:={\mathbb{R}}^n / {\mathbb{Z}}^n$, $B$ is some open bounded neighborhood of the origin in ${\mathbb{R}}^n$ and $\omega\in {\mathbb{R}}^n$ is a vector which is assumed to be Diophantine: there exist constants $0<\gamma \leq 1$ and $\tau \geq n-1$ such that for any $k=(k_1,\dots,k_n) \in {\mathbb{Z}}^n\setminus \{0\}$, $$\label{dio}\tag{Dio$_{\gamma,\tau}$}
|k\cdot\omega|\geq \gamma|k|^{-\tau}, \quad |k|:=|k_1|+\cdots+|k_n|.$$ The torus $\mathcal{T}_\omega:=\T^n \times \{0\}$ is then invariant by the Hamiltonian flow of $H$, and the flow restricted on $\mathcal{T}_\omega$ is quasi-periodic with frequency $\omega$. There are several questions one can ask about the stability or instability properties of such an invariant torus, for instance:
- Is $\mathcal{T}_\omega$ accumulated by a large set of Lagrangian invariant tori?
- Is $\mathcal{T}_\omega$ topologically unstable? Recall that the invariant torus $\mathcal{T}_\omega$ is said to be topologically stable if it admits a basis of neighborhoods which are positively invariant by the Hamiltonian flow, and that it is topologically unstable if it is not topologically stable.
- Given an arbitrary $r>0$ small enough and an arbitrary solution starting in the $r$-neighborhood of $\mathcal{T}_\omega$, how large is the “stability" time $T(r)$ during which the solution remains in the $2r$-neighborhood of $\mathcal{T}_\omega$?
These questions are related to, respectively, KAM theory, Arnold diffusion and Nekhoroshev theory. Concerning $(1)$, it is well-known that if $H$ is sufficiently smooth, under a generic condition, $\mathcal{T}_\omega$ is accumulated by a set of Lagrangian invariant tori of positive Lebesgue measure, which has Lebesgue density one at $\mathcal{T}_\omega$. Assuming $H$ to be real-analytic, without further assumption it is conjectured (see [@Her98]) that $\mathcal{T}_\omega$ is accumulated by a set of Lagrangian invariant tori of positive Lebesgue measure (see [@EFK15] for some partial results). Concerning $(2)$, almost nothing is known in the real-analytic category : for instance, it is still not known if there exists a real-analytic torus $\mathcal{T}_\omega$ which is topologically unstable. In the smooth category, Douady ([@Dou88]) gave examples of topologically unstable invariant tori with any given Birkhoff normal form at the invariant torus. Degenerate examples having almost all orbits oscillating between the neighborhood of the invariant Diophantine torus and infinity were constructed in [@EFK15]. As for the generic behavior, even in the smooth category this is still an open problem (see [@GK14] for some partial result in the case $n=3$).
Finally, concerning $(3)$, it is well-known that for real-analytic systems, $T(r)$ is always at least exponentially large, more precisely it is of order $\exp\left(r^{-a}\right)$ with the exponent $a=(1+\tau)^{-1}$. A similar result holds true for Gevrey smooth systems (with the exponent $\alpha^{-1}a$ instead of $a$, where $\alpha\geq 1$ is the Gevrey exponent). Moreover, in the real-analytic case and under some convexity assumption (which is non-generic), it was proved in [@MG95a] that $T(r)$ is at least doubly exponentially large, that is, it is of order $\exp\exp\left(r^{-a}\right)$. Our first theorem extends this last result: for real-analytic Hamiltonians, or more generally Gevrey smooth Hamiltonians, under a generic condition, $T(r)$ is at least doubly exponentially large; see Theorem \[Th1\] below and its corollary for precise statements. This result is the counterpart to a result we previously obtained in the context of elliptic equilibrium points (see [@BFN15]).
In a second setting, we consider a small $\varepsilon$-perturbation of an integrable Hamiltonian system in action-angle coordinates, namely $$\label{H2}\tag{H$_\varepsilon$}
H_\varepsilon(\theta,I)=h(I)+\varepsilon f(\theta,I), \quad (\theta,I)\in \T^n \times \bar{D},$$ where $\bar{D}$ is the closure of some open bounded domain $D \subseteq {\mathbb{R}}^n$, and $\varepsilon\geq 0$ is a small parameter. When $\varepsilon=0$, letting $\omega_*=\nabla h(I_*) \in {\mathbb{R}}^n$ for $I_* \in D$, the Lagrangian tori $\mathcal{T}_{\omega_*}:=\{I=I_*\}$ are obviously invariant by the Hamiltonian flow of $H_0=h$, and they are quasi-periodic with frequency $\omega_*$. Assuming that $H_\varepsilon$ is sufficiently smooth and $\varepsilon$ sufficiently small, under the Kolmogorov non degeneracy condition (a generic condition on $h$, see Definition \[defK\] below) the classical KAM theorem asserts that most of the invariant tori of the integrable system persist under perturbation. More precisely, let $\Omega$ be the image by $\nabla h$ of $\bar{D}$ and, fixing $0<\gamma \leq 1$, $\tau > n-1$, let $$\label{def.Omega}
\Omega_{\gamma,\tau}:= \left\{ \omega \in \Omega \, | \, d(\omega,\partial \Omega) \geq \gamma, \; \omega \in {\rm Dio}_{\gamma,\tau} \right\}.$$ Observe that since $\tau>n-1$, the complement of $\Omega_{\gamma,\tau}$ in $\Omega$ has a measure of order $\gamma$. The KAM theorem asserts that if one assumes that $\varepsilon \leq c \gamma^2$ where $c$ is some positive constant that depends on $h$ and $f$, then there exists a set $$\mathcal{K}=\bigcup_{\omega_* \in \Omega_{\gamma,\tau}}\mathcal{T}_{\omega_*}^\varepsilon \subseteq \T^n \times D$$ whose complement has a Lebesgue measure of order at most $\gamma$, and which consists of Lagrangian Diophantine tori $\mathcal{T}_{\omega_*}^\varepsilon$ invariant by $H_\varepsilon$ that converge to $\mathcal{T}_{\omega_*}$ as $\varepsilon$ goes to zero. For real-analytic systems, this is a classical result (see [@Pos01] and references therein) and for Gevrey smooth systems, this result is due to Popov ([@Pop04]). Our second theorem states that for real-analytic or Gevrey smooth systems, under a further generic condition on $h$ and a further smallness assumption on $\varepsilon$, a sub-family $\mathcal{K}'$ of this family $\mathcal{K}$ of KAM tori (with a complementary still having measure of order at most $\gamma$) is doubly exponentially stable. We refer to Theorem \[Th2\] below and its corollary for precise statements. This result extends a previous result obtained in [@MG95b], [@GM97] in the real-analytic case, under the stronger (and non-generic) condition that $h$ is quasi-convex.
Results
-------
Let us now state more precisely our results. Given some bounded domain $U \subseteq {\mathbb{R}}^n$, and real numbers $\alpha \geq 1$, $\beta\geq 1$, $L_1>0$ and $L_2>0$, we define $G^{\alpha,\beta}_{L_1,L_2}(\T^n \times U)$ to be the space of smooth functions $H$ on $\T^n \times U$ such that $$||H||_{\alpha,\beta,L_1,L_2,U}:=\sup_{(k,l)\in {\mathbb{N}}^{2n}}\sup_{(\theta,I)\in \T^n \times U}\left(|\partial_\theta^k\partial_I^lH(\theta,I)|L_1^{-|k|}L_2^{-|l|}k!^{-\alpha}l!^{-\beta}\right)<\infty.$$ We shall always assume that $L_1 \geq 1$ and $L_2 \geq 1$. This space $G^{\alpha,\beta}_{L_1,L_2}(\T^n \times U)$, equipped with the above norm, is a Banach space. When $\alpha=\beta$ and $L_1=L_2=L$, we simply write $G^{\alpha}_{L}(\T^n \times U)$ and when $\alpha=1$, then $G^{1}_{L}(\T^n \times U)$ is the space of real-analytic functions which can be extended as a holomorphic function on a complex $s$-neighborhood of $\T^n \times U$ in ${\mathbb{C}}^n/{\mathbb{Z}}^n \times {\mathbb{C}}^n$, with $s<L^{-1}$. For simplicity, we shall also say that a function is $(\alpha,\beta)$-Gevrey (respectively $\alpha$-Gevrey) if it belongs to $G^{\alpha,\beta}_{L_1,L_2}(\T^n \times U)$ (respectively to $G^{\alpha}_{L}(\T^n \times U)$).
Let us introduce the following notations: given some $\rho>0$, some domain $U \subseteq {\mathbb{R}}^n$ and some subset $S \subset \T^n \times U$, we denote by $$V_\rho U:=\{I \in {\mathbb{R}}^n \; | \; ||I-U||<\rho \}, \quad V_\rho S:=\{(\theta,I) \in \T^n \times {\mathbb{R}}^n \; | \; ||(\theta,I)-S||<\rho \}$$ the open $\rho$-neighborhood of $U$ in ${\mathbb{R}}^n$ and of $S$ in $\T^n \times {\mathbb{R}}^n$.
An invariant quasi-periodic Lagrangian torus $\mathcal{T}$ embedded in $\T^n \times U$ is [*doubly exponentially stable with exponent $u>0$*]{} if there exist positive constants $r_*$ and $C$ such that for any $r\leq r_*$ and any solution $(\theta(t),I(t))$ of the Hamiltonian system associated to $H$ with $(\theta(0),I(0)) \in V_r\mathcal{T}$, we have $$(\theta(0),I(0)) \in V_{2r}\mathcal{T}, \quad \forall |t| \leq \exp\left(\exp \left(C r^{-u}\right)\right).$$
Now let us come back to our first setting, that is we consider a Hamiltonian as in , with $\omega$ satisfying . In this setting, the torus $\mathcal{T}_\omega$ is doubly exponentially stable with exponent $u>0$ if there exist positive constants $r_*$ and $C$ such that for any $r\leq r_*$ and any solution $(\theta(t),I(t))$ of the Hamiltonian system associated to $H$ with $||I(0)||\leq r$, we have $$||I(t)||\leq 2r, \quad \forall |t| \leq \exp\left(\exp \left(C r^{-u}\right)\right).$$
If $H$ is smooth, given any integer $m \geq 2$, there exists a symplectic transformation $\Phi_m$ defined on a neighborhood of $\T^n \times \{0\}$ which is close to the identity and such that $$\label{BNFe}\tag{BNF} H \circ \Phi_m(\theta,I)=\omega\cdot I+H_m(I)+O\left(||I||^{m+1}\right)$$ where $H_m$ is a polynomial in $n$ variables of degree $m$ without constant or linear terms (see, for instance, [@Dou88]). One also have a formal symplectic transformation $\Phi_\infty$ and a formal series $H_\infty$ such that $H \circ \Phi_\infty(\theta,I)=H_\infty(I)$. The polynomials $H_m$ (respectively the formal series $H_\infty$) are uniquely defined and they are called the Birkhoff polynomials (respectively Birkhoff formal series).
Next we need to recall the following definition from [@BFN15], which was inspired by the work of Nekhoroshev ([@Nek73]). Let $P(n,m)$ be the space of polynomials with real coefficients of degree $m$ in $n$ variables, and $P_2(n,m)\subset P(n,m)$ the subspace of polynomials without constant or linear terms.
\[stabsteep\] Given positive constants $\rho$, $C$ and $\delta$, a polynomial $P_0 \in P_2(n,m)$ is called $(\rho,C,\delta)$-stably steep if for any integer $l\in [1,n-1]$, any $P \in P_2(n,m)$ such that $||P-P_0||<\rho$ and any vector subspace $\Lambda \subseteq {\mathbb{R}}^n$ of dimension $l$, letting $P_\Lambda$ be the restriction of $P$ to $\Lambda$, the inequality $$\max_{0 \leq \eta \leq \xi}\;\min_{||x||=\eta, \; x \in \Lambda}||\nabla P_\Lambda(x)||>C\xi^{m-1}$$ holds true for all $0 < \xi \leq\delta$. A polynomial $P_0 \in P_2(n,m)$ is called stably steep if there exist positive constants $\rho$, $C$ and $\delta$ such that $P_0$ is $(\rho,C,\delta)$-stably steep.
The set of stably steep polynomials in $P_2(n,m)$ will be denoted by $SS(n,m)$.
For a fixed $\omega \in {\mathbb{R}}^n$, we let $\mathcal{H}^\alpha_L(\omega)$ be the space of Hamiltonians $H \in G^\alpha_L(\T^n \times B)$ as in . We can now state our first main result.
\[Th1\] Let $H \in \mathcal{H}^\alpha_L(\omega)$ with $\omega$ satisfying . Assume that for $m_0:=[n^2/2+2]$, we have $$\label{condG}\tag{G}
H_{m_0} \in SS(n,m_0).$$ Then ${\mathcal T}_{{\omega}}$ is doubly exponentially stable with exponent $\frac{1}{\alpha(1+\tau)}$.
The positive constants $r_*$ and $C$ of the double exponential stability depend only on $n$, $\gamma$ $\tau$, $\alpha$, $L$, $||H||_{\alpha,L,B}$ and on some constants characterizing the condition .
It remains to explain in which sense is generic. As we proved in [@BFN15] (this will be recalled in §\[s3\], Proposition \[propNekho2\]), $SS(n,m_0)$ is an open set of full Lebesgue measure (and hence dense) in $P_2(n,m_0)$ (more precisely, its complement is a semi-algebraic subset of $P_2(n,m_0)$ of positive codimension). Using this, we proved in [@BFN15] that the Birkhoff normal form of order $m_0$ of a Hamiltonian system at a non resonant elliptic fixed point is in general stably steep ([@BFN15], Theorem C). In a similar fashion, we have here that [*for any $H \in \mathcal{H}^\alpha_L(\omega)$ with $\omega$ satisfying , for an open set of full Lebesgue measure of $Q \in P_2(n,m_0)$, the condition holds true for the modified Hamiltonian $H_Q \in \mathcal{H}^\alpha_L(\omega)$ defined by $H_Q(\theta,I):=H(\theta,I)+Q(I)$.*]{} Indeed, the Diophantine condition on ${\omega}$ is necessary just to be able to perform the Birkhoff normal form reduction up to order $m_0$ since we are dealing here with an invariant torus while in [@BFN15] we were interested with fixed points. Apart from this, the proof that the condition holds for $H_Q$ for an open set of full Lebesgue measure of $Q \in P_2(n,m_0)$ follows exactly the same steps as in the fixed point case (see [@BFN15] Section §2.2). Hence we get the following corollary of Theorem \[Th1\].
\[coro1\] In the space of Hamiltonians $\mathcal{H}^\alpha_L(\omega)$ with $\omega$ satisfying , the set of Hamiltonians for which ${\mathcal T}_{{\omega}}$ is doubly exponentially stable with exponent $\frac{1}{\alpha(1+\tau)}$ contains an open dense and prevalent subset.
It follows directly from Theorem \[Th1\] and the fact that the subspace of $\mathcal{H}^\alpha_L(\omega)$ for which holds is open, dense and prevalent. Indeed, prevalence follows form the fact that holds for $H_Q$ for a set of full Lebesgue measure of $Q \in P_2(n,m_0)$ (see [@HK10] for a survey on the notion of prevalence). Openness follows from the fact that is an open condition, and density then follows from prevalence.
Now let us consider our second setting, that is we consider a Hamiltonian as in .
We say that a completely integrable Hamiltonian $h\in G^\alpha_L(\bar{D})$ is [*KAM doubly exponentially stable with exponent $u$*]{} if for any $f \in G^\alpha_L(\T^n \times \bar{D})$, and for any $\gamma>0$, the following holds: there exists $\varepsilon_*>0$ such that for any $\varepsilon\leq \varepsilon_*$, there exists, for the Hamiltonian flow of $H_\varepsilon$ as in , a set of invariant Lagrangian Diophantine tori $\mathcal{K}' \subseteq \T^n \times \bar{D}$ whose complement in $\T^n \times \bar{D}$ has a measure of order $\gamma$, and such that every torus in $\mathcal{K}' $ is doubly exponentially stable with exponent $u$.
Given a smooth function $h$ defined on the closure $\bar{D}$ of some open bounded domain $D \subseteq {\mathbb{R}}^n$, for any $I\in \bar{D}$ and any integer $m\geq 2$, we define the Taylor polynomial $T_I^m h \in P_2(n,m)$ (starting at order 2) by $$T_I^m h(X)=\sum_{l=2}^{m}(l!)^{-1}\nabla^l h(I).(X)^l, \quad X \in {\mathbb{R}}^n$$ and recall the following definition.
\[defK\] Let us define by $N(n,2)$ the subset of $P_2(n,2)$ consisting of non-degenerate quadratic forms. A smooth function $h : \bar{D} \rightarrow {\mathbb{R}}$ is said to be Kolmogorov non-degenerate if for all $I \in \bar{D}$, $T_I^2h \in N(n,2)$. Upon restricting $\bar{D}$ if necessary, we may always assume that its gradient $\nabla h: \bar{D} \rightarrow \bar{\Omega}$ is a diffeomorphism onto its image.
Our second main result is then as follows.
\[Th2\] Let $h \in G^\alpha_L(\bar{D})$ such that for all $I \in \bar{D}$, $$\label{condK}\tag{K}
T_I^{2} h \in N(n,2)$$ and $$\label{condS}\tag{S}
T_I^{m_0} h \in SS(n,m_0).$$ Then $h$ is KAM doubly exponentially stable with exponent $u$, for any $u<\frac{1}{{\alpha}n}$.
As mentioned in the introduction, under the Kolmogorov non-degeneracy condition on $h$, invariant tori with frequency in $\Omega_{\gamma,\tau}$ (see ) are preserved, being only slightly deformed, by an arbitrary $\varepsilon$-perturbation, provided $\varepsilon$ is sufficiently small. For Gevrey systems, this was proved by Popov in [@Pop04]. It is only the second part of the statement (double exponential stability of the set of invariant tori) which is new, and the condition is only required for this part of the statement. Under this condition, we will see in the proof of Theorem \[Th2\] that for any fixed $\tau>n-1$, for any $\gamma>0$ and for $\varepsilon$ sufficiently small, the tori in the set of KAM invariant tori $$\label{def.tOmega} \mathcal K'=\bigcup_{\omega_{*} \in \Omega_{\gamma,\tau}'}\mathcal{T}_{\omega_{*}}^\varepsilon$$ are doubly exponentially stable with exponent $\frac{1}{{\alpha}(\tau+1)}$. Since $\tau$ can be chosen to be any number strictly smaller than $n-1$, we can reach any exponent $u$ with $u<\frac{1}{{\alpha}n}$. Here, we restricted, following [@Pop04], the frequencies to the subset $\Omega_{\gamma,\tau}'$ of vectors in $\Omega_{\gamma,\tau}$ which have positive Lebesgue density in $\Omega_{\gamma,\tau}$; that is $\omega \in \Omega_{\gamma,\tau}'$ if for any neighborhood $O$ of $\omega$ in $\Omega$, the Lebesgue measure of $O \cap \Omega_{\gamma,\tau}$ is positive. No measure is lost due to this restriction since the sets $\Omega_{\gamma,\tau}$ and $\Omega_{\gamma,\tau}'$ have the same Lebesgue measure.
For every fixed couple $(\gamma,\tau)$, the positive constants $\varepsilon_*$, $r_*$ and $C$, characterizing the smallness of the perturbation as well as the constants that appear in the double exponential stability of the tori in $\mathcal K'$ of , depend only on $n$, $\gamma$, $\tau$, $\alpha$, $L$, $||h||_{\alpha,L,\bar{D}}$, $||f||_{\alpha,L,\bar{D}}$ and on some uniform constants characterizing the conditions and . The latter uniform constants can be obtained using the compactness of $\bar{D}$ and the fact that $N(n,2)$ and $SS(n,m_0)$ are open.
As before, it remains to explain in which sense the conditions and are generic. In fact we have the following lemma.
\[lemma.fub\] Fix $\gamma>0$. Given any $h \in G^\alpha_L(\bar{D})$, for an open set of full Lebesgue measure of $Q \in P_2(n,m_0)$, the modified integrable Hamiltonian $h_Q \in G^\alpha_L(\bar{D})$ defined by $h_Q(I):=h(I)+Q(I)$ satisfies and on a compact subset of $\bar{D}$ whose complement in $\bar{D}$ has a measure less than $\gamma$.
It immediately follows that the set of $Q \in P_2(n,m_0)$ such that for any $\gamma>0$, $h_Q$ satisfies and (with constants that depend of course on $\gamma$) on a compact subset of $\bar{D}$ whose complement in $\bar{D}$ has measure less than $\gamma$, contains a residual and prevalent set. Hence we get the following corollary of Theorem \[Th2\] and Lemma \[lemma.fub\].
\[coro2\] For a residual and prevalent set of integrable Hamiltonians $h\in G^\alpha_L(\bar{D})$, $h$ is [*KAM doubly exponentially stable with exponent $u$*]{} for any $u<\frac{1}{{\alpha}n}$.
Let us now give the proof of Lemma \[lemma.fub\].
Let us denote by $G_\gamma$ the set of $Q \in P_2(n,m_0)$ such that $h_Q$ satisfies both conditions and on a compact subset of $\bar{D}$ whose complement in $\bar{D}$ has a measure less than $\gamma$. What we need to prove is that $G_\gamma$ is both open and has full Lebesgue measure.
Since the sets $N(n,2)$ and $SS(n,m_0)$ are open, by a compactness argument the set $G_\gamma$ is open, so it remains to prove that $G_\gamma$ has full Lebesgue measure.
Let us define the subset $KS \subset \bar{D} \times P_2(n,m_0)$ consisting of couples $(I,Q)$ for which the modified Hamiltonian $h_Q$ satisfies both conditions and at the point $I$. Let us also define the sections $$KS(I):=\{Q \in P_2(n,m_0) \; | \; (I,Q) \in KS \}, \quad KS(Q):=\{I \in \bar{D} \; | \; (I,Q) \in KS\} .$$ For any $I \in \bar{D}$, we claim that the set $KS(I)$ has full Lebesgue measure. Indeed, it is obvious that the set of $Q \in P_2(n,m_0)$ for which condition is satisfied at $I$ has full Lebesgue measure while the fact that the set of $Q \in P_2(n,m_0)$ for which condition is satisfied at $I$ has full Lebesgue measure follows from [@BFN15]. By Fubini’s theorem, there exists a subset $G \subset P_2(n,m_0)$ of full Lebesgue measure such that for any $Q \in G$, the set $KS(Q)$ has full Lebesgue measure, that is $h_Q$ satisfies both conditions and at almost all points $I \in \bar{D}$. In particular, for any $Q \in G$ and for any $\gamma>0$, $h_Q$ satisfies both conditions and on a compact subset of $\bar{D}$ whose complement in $\bar{D}$ has a measure less than $\gamma$. This shows that $G$ is contained in $G_\gamma$ (in fact, $G$ is contained in the intersection of the $G_\gamma$ over $\gamma>0$), and therefore $G_\gamma$ has full Lebesgue measure.
Plan of the proofs
------------------
The proofs of Theorem \[Th1\] and Theorem \[Th2\], although independent from each other, will follow the same path, which was the one also taken in [@BFN15]. Let us first start with the case of a single Lagrangian invariant Diophantine torus.
The first step consists of constructing a Birkhoff normal form with an exponentially small remainder. In the analytic case, even though the Birkhoff formal series is expected to be divergent in general, its coefficients have a moderate growth of Gevrey type, so that on a ball of radius $r$, if one truncates the series at a large order $m \sim r^{-a}$, the non-integrable part in the normal form becomes exponentially small with respect to $m \sim r^{-a}$. In the case of an elliptic fixed point, these estimates have been proved but the calculations do not apply directly to the case of invariant tori. However a more general result (valid for Gevrey smooth systems) in the case of an invariant torus has been obtained by Mitev and Popov in [@MP09]. Indeed, by Borel’s theorem the formal Birkhoff series $h_{\infty}$ can be realized as the Taylor series at $I=0$ of some smooth function $H_*(I)$; it is proved in [@MP09] that one can choose such a function $H_*$ in a Gevrey class, and this gives immediately the desired growth on the coefficients of $h_{\infty}$. More precisely, if $H$ is $\alpha$-Gevrey and $\omega$ satisfies , then setting $\beta=\alpha(1+\tau)+1$, one can find a symplectic transformation $\Phi$ which is $(\alpha,\beta)$-Gevrey, such that $H \circ \Phi(\theta,I)=H_*(I)+R_*(\theta,I)$, where $H_*$ is $\beta$-Gevrey, $R_*$ is $(\alpha,\beta)$-Gevrey and flat at $I=0$. It follows that on a $r$-neighborhood of $I=0$, $R_*$ is exponentially small with respect to $r^{-(\beta-1)^{-1}}=r^{-\alpha^{-1}a}$. Now, if in addition, the Birkhoff polynomial $H_{m_0}$ is assumed to be stably steep, one can prove as in [@BFN15] that any sufficiently smooth function, whose Taylor expansion at some point coincides with $H_{m_0}$, is steep in a neighborhood of this point. By unicity of the Birkhoff polynomials, we then get that $H_*$ is steep in a neighborhood of the origin. So on a small $r$-neighborhood of $I=0$, $H \circ \Phi$ is an exponentially small (in $r$) perturbation of a steep integrable Hamiltonian: the double exponential stability follows by applying a version of Nekhoroshev’s theorem in Gevrey classes.
Now in the case of a family of KAM tori, under the Kolmogorov non-degeneracy condition , Popov constructed in [@Pop04] a simultaneous Birkhoff normal form for invariant tori with frequencies $\omega_* \in \Omega_{\gamma,\tau}'$: for $H_\varepsilon=h+\varepsilon f$, assuming that both $h$ and $f$ are $\alpha$-Gevrey, there exists a symplectic transformation $\Psi$ which is $(\alpha,\beta)$-Gevrey, such that $H_\varepsilon \circ \Psi(\theta,I)=h_*(I)+f_*(\theta,I)$, where $h_*$ is $\beta$-Gevrey, $f_*$ is $(\alpha,\beta)$-Gevrey, and $f_*$ is flat at every point $I \in (\nabla h_*)^{-1}(\Omega_{\gamma,\tau}')$. This immediately implies the persistence of invariant tori with frequencies in $\Omega_{\gamma,\tau}'$. Moreover, the derivatives of $h_*$ are close (with respect to $\varepsilon$) to the derivatives of $h$, hence the condition also holds true with $h$ replaced by $h_*$, provided $\varepsilon$ is sufficiently small. This implies that $h_*$ is steep, while $f_*$ is exponentially small on a neighborhood of $\T^n \times (\nabla h_*)^{-1}(\Omega_{\gamma,\tau}')$: as before, the double exponential stability follows from Nekhoroshev theorem.
The plan of the article is as follows. In §\[s2\], we recall the results concerning the Birkhoff normal form for a Hamiltonian as in and the simultaneous Birkhoff normal form for a Hamiltonian as in , following [@MP09] and [@Pop04]. In §\[s3\], we recall some results concerning stably steep polynomials, following [@Nek73] and [@BFN15]. The proof of Theorem \[Th1\] and Theorem \[Th2\] will be given in §\[s4\], using the results of §\[s2\] and §\[s3\], and a version of Nekhoroshev estimates for perturbation of steep integrable Hamiltonians in Gevrey classes, that we state in Appendix \[app\].
Birkhoff normal forms {#s2}
=====================
In the sequel, given some $\rho>0$ and some point $I_* \in {\mathbb{R}}^n$, we define $B_\rho(I_*)=V_\rho \{I_*\}$ the open ball of radius $\rho$ around $I_*$ in ${\mathbb{R}}^n$, and for $I_*=0\in {\mathbb{R}}^n$, we let $B_\rho=B_\rho(0)$.
\[thmMP\] Let $H \in \mathcal{H}^\alpha_L(\omega)$ with $\omega$ satisfying , and define $\beta:=\alpha(1+\tau)+1$. Then there exist positive constants $\bar{r}$, $L_1$, $L_2$ and $A$, which depend only on $n$, $\gamma$, $\tau$, $\alpha$, $L$ and $||H||_{\alpha,L,B}$ and a symplectic transformation $$\Phi : \T^n \times B_{\bar{r}} \rightarrow \T^n \times B$$ whose components belong to $G^{\alpha,\beta}_{L_1,L_2}(\T^n \times B_{\bar{r}})$, such that $$H \circ \Phi(\theta,I)=H_*(I)+R_*(\theta,I), \quad H_* \in G^{\beta}_{L_2}(B_{\bar{r}}), \quad R_* \in G^{\alpha,\beta}_{L_1,L_2}(\T^n \times B_{\bar{r}})$$ and with the following properties:
- for any $(\theta,I) \in \T^n \times B_{\bar{r}}$ (resp. for any $(\theta',I') \in \Phi(\T^n \times B_{\bar{r}})$), we have $\Pi_I\Phi(\theta,I)=\mathrm{Id}+O\left(||I||^2\right)$ (resp. $\Pi_{I'}\Phi(\theta',I')=\mathrm{Id}+O\left(||I'||^2\right)$), where $\Pi_I$ (resp. $\Pi_{I'}$) denotes projection onto action space;
- the Taylor series of $H_*$ at $I=0$ is given by the Birkhoff formal series $H_{\infty}$;
- $\partial_I^l R_*(\theta,0)=0$ for all $\theta \in \T^n$ and all $l\in {\mathbb{N}}^n$: hence for any $r$ such that $0<2r < \bar{r}$, $$||R_*||_{\alpha,\beta,L_1,L_2,B_{2r}} \leq A\exp\left(-(2L_2r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$
This statement is a direct consequence of Theorem 2 in [@MP09], to which we refer for a proof. The statement $(2)$ follows by construction of $H_*$, whereas $(3)$ follows from Stirling’s formula. Indeed, the assumption that $R_*$ is $(\alpha,\beta)$-Gevrey and flat at $I=0$, implies, by Taylor’s formula, that for any $m\in{\mathbb{N}}$: $$|\partial_\theta^k\partial_I^lR_*(\theta,I)|\leq ||R_*||_{\alpha,\beta,L_1,L_2,\bar{B}_{\bar{r}}}L_1^{|k|}L_2^{|l|}k!^\alpha l!^\beta m!^{\beta-1}(L_2||I||)^m.$$ Choosing $$m\sim (L_2||I||)^{-\frac{1}{\beta-1}}=(L_2||I||)^{-\frac{1}{\alpha(1+\tau)}},$$ by Stirling’s formula we eventually obtain $$|\partial_\theta^k\partial_I^lR_*(\theta,I)|\leq AL_1^{|k|}L_2^{|l|}k!^\alpha l!^\beta \exp\left(-(L_2\||I||)^{-\frac{1}{\alpha(1+\tau)}}\right)$$ where $A$ depends only on $||R_*||_{\alpha,\beta,L_1,L_2,\bar{B}_{\bar{r}}}$ and $n$. For $||I||<2r$, this proves $(3)$.
Les us now give an analogous statement for a Hamiltonian as in .
\[thmP\] Let $H_\varepsilon$ be as in , with $h \in G^\alpha_L(\bar{D})$ and $f \in G^\alpha_L(\T^n \times \bar{D})$, and fix $\gamma>0$. Assume that is satisfied. Then there exist positive constants $\bar{\varepsilon}$, $L_1'$, $L_2'$, $A'$ and $E$, which depend only on $n$, $\sigma$, $\gamma$, $\tau$, $\alpha$, $L$, $||h||_{\alpha,L,\bar{D}}$, $||f||_{\alpha,L,\bar{D}}$ and on the condition , such that for $\varepsilon \leq \bar{\varepsilon}$, there exists a symplectic transformation $$\Psi : \T^n \times D \rightarrow \T^n \times D$$ whose components belong to $G^{\alpha,\beta}_{L_1',L_2'}(\T^n \times D)$, with $\beta=\alpha(1+\tau)+1$, such that $$H \circ \Psi(\theta,I)=h_*(I)+f_*(\theta,I), \quad h_* \in G^{\beta}_{L_2'}(D), \quad f_* \in G^{\alpha,\beta}_{L_1',L_2'}(\T^n \times D)$$ and a diffeomorphism $\omega : D \rightarrow \Omega$ whose components belong to $G^{\beta}_{L_2'}(D)$, with the following properties:
- $||\Psi-\mathrm{Id}||_{C^1(\T^n \times D)}\leq E\sqrt{\varepsilon}$ and $||\Psi^{-1}-\mathrm{Id}||_{C^1(\T^n \times D)}\leq E\sqrt{\varepsilon}$, where $||\,\cdot\,||_{C^1(\T^n \times D)}$ denotes the $C^1$-norm on $\T^n \times D$;
- $||\partial_I^l\omega(I)-\partial_I^l\nabla h(I)||\leq EL_2'^{|l|}l!^\beta \sqrt{\varepsilon}$ for all $I \in D$ and $l \in {\mathbb{N}}^n$;
- setting $J_{\gamma,\tau}':=\omega^{-1}(\Omega_{\gamma,\tau}')$, we have $\partial_I^l\omega(I)=\partial_I^l\nabla h_*(I)$ for all $I \in J_{\gamma,\tau}'$ and $l \in {\mathbb{N}}^n$;
- we have $\partial_I^l f_*(\theta,I)=0$ for all $(\theta,I)\in \T^n \times J_{\gamma,\tau}'$ and all $l\in {\mathbb{N}}^n$: hence for any $r>0$ sufficiently small so that $V_{2r}J_{\gamma,\tau}' \subseteq D$, $$||f_*||_{\alpha,\beta,L_1',L_2',V_{2r}J_{\gamma,\tau}'} \leq A'\exp\left(-(2L_2'r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$
This is exactly the content of Theorem 1.1 and Corollary 1.2 of [@Pop04], to which we refer for a proof.
Stably steep polynomials {#s3}
========================
In this section, we recall some results concerning stably steep polynomials, which were defined in Definition \[stabsteep\]. The first one states that stably steep polynomials of sufficiently high degree are generic, and was used in the justification of Corollary \[coro1\] and Corollary \[coro2\].
\[propNekho2\] The complement of $SS(n,m_0)$ in $P_2(n,m_0)$ is contained in a closed semi-algebraic subset of codimension at least one. In particular, $SS(n,m_0)$ is an open dense set of full Lebesgue measure.
For a proof, we refer to Proposition A.2 and Proposition A.3 in [@BFN15]. In order to state the next results, we first recall the definition of steep functions.
\[funcsteep\] A differentiable function $h : G \rightarrow {\mathbb{R}}$ is steep on a domain $G' \subseteq G$ if there exist positive constants $C,\delta,p_l$, for any integer $l\in [1,n-1]$, and $\kappa$ such that for all $I \in G'$, we have $||\nabla h(I)|| \geq \kappa$ and, for all integer $l\in [1,n-1]$, for all vector space $\Lambda \in {\mathbb{R}}^n$ of dimension $l$, letting $\lambda=I+\Lambda$ the associated affine subspace passing through $I$ and $h_\lambda$ the restriction of $h$ to $\lambda$, the inequality $$\max_{0 \leq \eta \leq \xi}\;\min_{||I'-I||=\eta, \; I' \in \lambda}||\nabla h_\lambda(I')-\nabla h_\lambda(I)||>C\xi^{p_l}$$ holds true for all $0 < \xi \leq\delta$. We say that $h$ is $(\kappa,C,\delta,(p_l)_{l=1,\ldots,n-1})$-steep on $G'$ and, if all the $p_i=p$, we say that $h$ is $(\kappa,C,\delta,p)$-steep on $G'$.
We have the following proposition, which states that if a smooth function has a stably steep Taylor polynomial at some point, then the function is steep on a neighborhood of this point.
\[propsteep1\] Let $h : B_{\bar{r}} \rightarrow {\mathbb{R}}$ be a function of class $C^{m_0+1}$ such that $||\nabla h(0)||\geq\varpi>0$ and such that $T_0^{m_0}h$ is $(\rho',C',\delta')$-stably steep. Then for $r>0$ sufficiently small with respect to $\bar{r}, ||h||_{C^{m_0+1}(B_{\bar{r}})}, \rho', \varpi, m_0, C'$ and $\delta'$, the function $h$ is $(\kappa,C,\delta,m_0-1)$-steep on $B_{2r}$ with $$\kappa=\varpi/2, \quad C=C'/2, \quad \delta=r.$$
This proposition is analogous to Theorem 2.2 of [@BFN15]; however, the setting being slightly different we give the details.
We let $M=||h||_{C^{m_0+1}(B_{\bar{r}})}$, and we assume $3r<\bar{r}$. Then observe that for $r$ sufficiently small with respect to $M$ and $\varpi$, we have $$||\nabla h(I)||\geq \kappa=\varpi/2, \quad I \in B_{2r}.$$ Since $P_0:=T_0^{m_0}h$ is $(\rho',C',\delta')$-stably steep, for $r$ sufficiently small with respect to $M$ and $\rho'$, $P_I:=T_I^{m_0}h$ is $(\rho'/2,C',\delta')$-stably steep for any $I \in B_{2r}$. By definition, for any vector subspace $\Lambda \subseteq {\mathbb{R}}^n$ of dimension $1 \leq l \leq n-1$, letting $P_{I,\Lambda}$ be the restriction of $P_I$ to $\Lambda$, the inequality $$\label{bout1}
\max_{0 \leq \eta \leq \xi}\;\min_{||x||=\eta, \; x \in \Lambda}||\nabla P_{I,\Lambda}(x)||>C'\xi^{m_0-1}$$ holds true for all $0 < \xi \leq\delta'$. Assume $r\leq \delta'$, then for $x \in \Lambda$ such that $||x||\leq \xi \leq \delta=r$ and for any $I \in B_{2r}$, we have $I+x\in B_{3r} \subseteq B_{\bar{r}}$ hence by Taylor’s formula (applied to $\nabla h$ at order $m_0$) we obtain $$||\nabla h(I+x)-\nabla h(I)-\nabla P_I(x)||\leq Mm_0!||x||^{m_0}.$$ Therefore, if we assume $r$ sufficiently small with respect to $M$, $m_0$ and $C'$, we get $$||\nabla h(I+x)-\nabla h(I)-\nabla P_I(x)||\leq (C'/2)||x||^{m_0-1}\leq (C'/2)\xi^{m_0-1}$$ and hence, projecting the above vector onto $\Lambda$, we have $$\label{bout2}
||\nabla h_{\lambda}(I+x)-\nabla h_{\lambda}(I)-\nabla P_{I,\Lambda}(x)||\leq (C'/2)\xi^{m_0-1}$$ where $\lambda=I+\Lambda$. Letting $I'=I+x$, the inequalities and yield, for any $I \in B_{2r}$, the inequality $$\max_{0 \leq \eta \leq \xi}\;\min_{||I-I'||=\eta, \; I' \in \lambda}||\nabla h_{\lambda}(I')-\nabla h_{\lambda}(I)||> (C'/2)\xi^{m_0-1}=C\xi^{m_0-1}$$ for all $0 < \xi\leq \delta=r$. This concludes the proof.
We will also need a version of Proposition \[propsteep1\], in which $I=0 \in {\mathbb{R}}^n$ is replaced by a compact set $K \subseteq {\mathbb{R}}^n$.
\[propsteep2\] Let $K \subseteq {\mathbb{R}}^n$ be a compact set, $h : V_{\bar{r}}K \rightarrow {\mathbb{R}}$ be a function of class $C^{m_0+1}$ such that $||\nabla h(I)||\geq\varpi>0$ and $T_I^{m_0}h$ is $(\rho',C',\delta')$-stably steep for any $I \in K$. Then for $r>0$ sufficiently small with respect to $\bar{r}, ||h||_{C^{m_0+1}(V_{\bar{r}}K)}, \rho', \varpi, m_0, C'$ and $\delta'$, the function $h$ is $(\kappa,C,\delta,m_0-1)$-steep on $V_{2r}K$ with $$\kappa=\varpi/2, \quad C=C'/2, \quad \delta=r.$$
The proof is completely analogous to the proof of Proposition \[propsteep1\], so we do not repeat the argument.
Proof of the main results {#s4}
=========================
In this section, we give the proofs of Theorem \[Th1\] and Theorem \[Th2\]. Theorem \[Th1\] follows from Theorem \[thmMP\], Proposition \[propsteep1\] and a version of Nekhoroshev estimates for perturbations of steep integrable Hamiltonians in Gevrey classes, which is stated as Theorem \[thmNek\] in Appendix \[app\]. Theorem \[Th2\] follows from Theorem \[thmP\], Proposition \[propsteep2\] and Theorem \[thmNek\].
Recall that we are considering $H \in \mathcal{H}^\alpha_L(\omega)$, with $\omega$ satisfying , and that we are assuming that $H_{m_0} \in SS(n,m_0)$, for $m_0:=[n^2/2+2]$. We can apply Theorem \[thmMP\]: setting $\beta=\alpha(1+\tau)+1$, there exist positive constants $\bar{r},L_1,L_2,A$, which depend only on $n$, $\gamma$, $\tau$, $\alpha$, $L$ and $||H||_{\alpha,L,B}$ and a symplectic transformation $$\Phi : \T^n \times B_{\bar{r}} \rightarrow \T^n \times B$$ whose components belong to $G^{\alpha,\beta}_{L_1,L_2}(\T^n \times B_{\bar{r}})$, such that $$H \circ \Phi(\theta,I)=H_*(I)+R_*(\theta,I), \quad H_* \in G^{\beta}_{L_2}(B_{\bar{r}}), \quad R_* \in G^{\alpha,\beta}_{L_1,L_2}(\T^n \times B_{\bar{r}})$$ and with the following properties:
- for any $(\theta,I) \in \T^n \times B_{\bar{r}})$ (resp. for any $(\theta',I') \in \Phi(\T^n \times B_{\bar{r}})$), we have $\Pi_I\Phi(\theta,I)=\mathrm{Id}+O\left(||I||^2\right)$ (resp. $\Pi_{I'}\Phi(\theta',I')=\mathrm{Id}+O\left(||I'||^2\right)$), where $\Pi_I$ (resp. $\Pi_{I'}$) denotes projection onto action space;
- the Taylor series of $H_*$ at $I=0$ is given by the Birkhoff formal series $H_{\infty}$;
- $\partial_I^l R_*(\theta,0)=0$ for all $\theta \in \T^n$ and all $l\in {\mathbb{N}}^n$: hence for any $r$ such that $0<2r < \bar{r}$, $$||R_*||_{\alpha,\beta,L_1,L_2,\bar{B}_{2r}} \leq A\exp\left(-(2L_2r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$
Let us choose $L_3 \geq \max\{L_1,L_2\}$. Then since $H_* \in G^{\beta}_{L_2}(B_{\bar{r}}) \subseteq G^{\beta}_{L_2}(B_{2r}) \subseteq G^{\beta}_{L_3}(B_{2r})$, we have $$||H_*||_{\beta,L_3,B_{2r}}\leq F$$ for some positive constant $F$. Since $\beta>\alpha$, using $(3)$, we also have $$||R_*||_{\beta,L_3,\bar{B}_{2r}} \leq A\exp\left(-(2L_2r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$ Then, using $(2)$, we have $T^{m_0}_0H_*=H_{m_0}$, hence $T^{m_0}_0H_*\in SS(n,m_0)$ from our condition . Together with the fact that $\nabla H_*(0)=\omega \neq 0$ this implies, by Proposition \[propsteep1\], that for $r$ sufficiently small, the function $H_*$ is $(\kappa,C,r,m_0-1)$-steep on $B_{2r}$, for some positive constants $\kappa$ and $C$. We can therefore apply Theorem \[thmNek\] to the Hamiltonian $H \circ \Phi$, with $$\mu=A\exp\left(-(2L_2r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$ Assuming $r>0$ sufficiently small, the threshold of Theorem \[thmNek\] is satisfied, and we find that for any solution $(\tilde{\theta}(t),\tilde{I}(t))$ of the Hamiltonian system associated to $H \circ \Phi$ with $\tilde{I}(0) \in B_{5r/4}$, then $$\tilde{I}(t)\in B_{3r/2}, \quad |t|\leq \exp\left(c''\mu^{-\frac{1}{2n\beta a}}\right).$$ Now observe that by choosing some positive constant $C$ sufficiently large, and requiring $r$ to be sufficiently small, we obtain $$c''\mu^{-\frac{1}{2n\beta a}}=c''A^{-\frac{1}{2n\beta a}}\exp\left((2n\beta a)^{-1}(2L_2r)^{-\frac{1}{\alpha(1+\tau)}}\right) \geq \exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)$$ and thus we have in particular $$\label{estimf}
\tilde{I}(t)\in B_{3r/2}, \quad |t|\leq \exp\left(\exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)\right).$$ To conclude the proof, consider an arbitrary solution $(\theta(t),I(t))$ of the Hamiltonian system associated to $H$, with $I(0) \in B_r$. Then $(\tilde{\theta}(t),\tilde{I}(t))=\Phi^{-1}(\theta(t),I(t))$ is a well-defined solution of $H \circ \Phi$, and using the property $(1)$ above, we can ensure that $\tilde{I}(0) \in B_{5/4r}$. Hence holds true, and using $(1)$ again, this implies in particular that $$I(t)\in B_{2r}, \quad |t|\leq \exp\left(\exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)\right)$$ which concludes the proof.
Recall that we are considering $H_\varepsilon$ as in , with $h \in G^\alpha_L(\bar{D})$ and $f \in G^\alpha_L(\T^n \times \bar{D})$, and that we are assuming that and are satisfied and that $\gamma>0$ is fixed. We can apply Theorem \[thmP\]: there exist positive constants $\bar{\varepsilon}$, $L_1'$, $L_2'$, $A'$, $E$, which depend only on $n$, $\sigma$, $\gamma$, $\tau$, $\alpha$, $L$, $||h||_{\alpha,L,\bar{D}}$, $||f||_{\alpha,L,\bar{D}}$ and on the condition , such that for $\varepsilon \leq \bar{\varepsilon}$, there exists a symplectic transformation $$\Psi : \T^n \times D \rightarrow \T^n \times D$$ whose components belong to $G^{\alpha,\beta}_{L_1',L_2'}(\T^n \times D)$, with $\beta=\alpha(1+\tau)+1$, such that $$H \circ \Psi(\theta,I)=h_*(I)+f_*(\theta,I), \quad h_* \in G^{\beta}_{L_2'}(D), \quad f_* \in G^{\alpha,\beta}_{L_1',L_2'}(\T^n \times D)$$ and a diffeomorphism $\omega : D \rightarrow \Omega$ whose components belong to $G^{\beta}_{L_2'}(D)$, with the following properties:
- $||\Psi-\mathrm{Id}||_{C^1(\T^n \times D)}\leq E\sqrt{\varepsilon}$ and $||\Psi^{-1}-\mathrm{Id}||_{C^1(\T^n \times D)}\leq E\sqrt{\varepsilon}$, where $||\,\cdot\,||_{C^1(\T^n \times D)}$ denotes the $C^1$-norm on $\T^n \times D$;
- $||\partial_I^l\omega(I)-\partial_I^l\nabla h(I)||\leq EL_2'^{|l|}l!^\beta \sqrt{\varepsilon}$ for all $I \in D$ and $l \in {\mathbb{N}}^n$;
- setting $J_{\gamma,\tau}'=\omega^{-1}(\Omega_{\gamma,\tau}')$, we have $\partial_I^l\omega(I)=\partial_I^l\nabla h_*(I)$ for all $I \in J_{\gamma,\tau}'$ and $l \in {\mathbb{N}}^n$;
- we have $\partial_I^l f_*(\theta,I)=0$ for all $(\theta,I)\in \T^n \times J_{\gamma,\tau}'$ and all $l\in {\mathbb{N}}^n$: hence for any $r>0$ sufficiently small so that $V_{2r}J_{\gamma,\tau}' \subseteq D$, $$||f_*||_{\alpha,\beta,L_1',L_2',V_{2r}J_{\gamma,\tau}'} \leq A'\exp\left(-(2L_2'r)^{-\frac{1}{\alpha(1+\tau)}}\right).$$
Then observe that since $SS(n,m_0)$ is open in $P_2(n,m_0)$, by compactness of $\bar{D}$ we can find positive constants $\rho'$, $C'$ and $\delta'$ so that for all $I \in \bar{D}$, $T_I^{m_0} h$ is $(\rho',C',\delta')$-stably steep. From $(2)$ and $(3)$ and for $\varepsilon$ small enough, we have that for $I \in J_{\gamma,\tau}'$, $T_I^{m_0} h_*$ is $(\rho'/2,C',\delta')$-stably steep. Using $(3)$ again, we have $\omega(I)=\nabla h_*(I)$ for all $I \in J_{\gamma,\tau}'$, therefore $\nabla h_*(J_{\gamma,\tau}')=\omega(J_{\gamma,\tau}')=\Omega_{\gamma,\tau}'$ is a compact subset of non-zero vectors and hence we can find $\varpi>0$ so that $||\nabla h_*(I)||\geq\varpi$ for any $I \in J_{\gamma,\tau}'$. We can apply Proposition \[propsteep2\] to $h_*$, with $K=J_{\gamma,\tau}'$, and for $r$ sufficiently small, the function $h_*$ is $(\kappa,C,r,m_0-1)$-steep on $V_{2r}J_{\gamma,\tau}'$, for some positive constants $\kappa$ and $C$. Then, since $$V_{2r}J_{\gamma,\tau}'=\bigcup_{I^* \in J_{\gamma,\tau}'}V_{2r}(\{I^*\})=\bigcup_{I^* \in J_{\gamma,\tau}'}B_{2r}(I^*),$$ by using $(4)$ we can apply Theorem \[thmNek\] exactly as in the proof of Theorem \[Th1\], to arrive at the following statement: if $r>0$ is sufficiently small, for any $I^* \in J_{\gamma,\tau}'$ and any solution $(\tilde{\theta}(t),\tilde{I}(t))$ of the Hamiltonian system associated to $H \circ \Psi$, with $||\tilde{I}(0)-I^*|| \leq 5r/4$, we have $$\label{est}
||\tilde{I}(t)-I^*|| \leq 3r/2, \quad |t|\leq \exp\left(\exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)\right)$$ for some positive constant $C$. Now, for $I_* \in J_{\gamma,\tau}'$, let $\omega_*=\omega(I_*)=\nabla h_*(I_*) \in \Omega_{\gamma,\tau}'$, and let us define $$\tilde{\mathcal{T}}_{\omega_*}^\varepsilon=\T^n \times {I^*}, \quad \tilde{\mathcal{K}}':=\T^n \times J_{\gamma,\tau}'=\bigcup_{\omega_* \in \Omega_{\gamma,\tau}'}\tilde{\mathcal{T}}_{\omega_*}^\varepsilon \subseteq \T^n \times D.$$ Then it follows easily from $(4)$ that $\tilde{\mathcal{K}}'$ is a set of Lagrangian Diophantine tori which is invariant by the Hamiltonian flow of $H \circ \Psi$, and whose complement in $\T^n \times D$ has a measure of order $\gamma$. Moreover, from , given any invariant torus $\tilde{\mathcal{T}}_{\omega_*}^\varepsilon$, any solution $(\tilde{\theta}(t),\tilde{I}(t))$ of the Hamiltonian system associated to $H \circ \Psi$, with $(\tilde{\theta}(0),\tilde{I}(0)) \in V_{5r/4}\tilde{\mathcal{T}}_{\omega_*}^\varepsilon$, satisfy $$\label{est2}
(\tilde{\theta}(t),\tilde{I}(t))\in V_{3r/2}\tilde{\mathcal{T}}_{\omega_*}^\varepsilon, \quad |t|\leq \exp\left(\exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)\right).$$ Coming back to the original Hamiltonian $H$, we define $$\mathcal{T}_{\omega_*}^\varepsilon=\Psi(\tilde{\mathcal{T}}_{\omega_*}^\varepsilon), \quad \mathcal{K}':=\Psi(\tilde{\mathcal{K}}')=\bigcup_{\omega_* \in \Omega_{\gamma,\tau}'}\mathcal{T}_{\omega_*}^\varepsilon \subseteq \T^n \times D.$$ Since $\Psi$ is symplectic, $\mathcal{K}'$ is a set of Lagrangian Diophantine tori which is invariant by the Hamiltonian flow of $H$, and since $\Psi$ (as well as its inverse $\Psi^{-1}$) is close to the identity as expressed in $(1)$, the complement of $\mathcal{K}'$ in $\T^n \times D$ has also a measure of order $\gamma$. To conclude, using the estimate $(1)$ again and for $\varepsilon>0$ sufficiently small, $\Psi$ (as well as its inverse $\Psi^{-1}$) is Lipschitz with a Lipschitz constant sufficiently close to $1$, and so the inequality implies the following statement: given any invariant torus $\mathcal{T}_{\omega_*}^\varepsilon$, any solution $(\theta(t),I(t))$ of the Hamiltonian system associated to $H \circ \Psi$, with $(\theta(0),I(0)) \in V_{r}\mathcal{T}_{\omega_*}^\varepsilon$, satisfy $$(\theta(t),I(t))\in V_{2r}\mathcal{\mathcal{T}_{\omega_*}^\varepsilon}, \quad |t|\leq \exp\left(\exp\left((Cr)^{-\frac{1}{\alpha(1+\tau)}}\right)\right).$$ Since we can choose any $\tau>n-1$, for any $u<\frac{1}{{\alpha}n}$ we have that each tori in the family $\mathcal{K}'$ is doubly-exponentially stable with exponent $u$, hence $h$ is KAM doubly exponentially stable with exponent $u$. This concludes the proof.
Nekhoroshev estimates for Gevrey steep Hamiltonian systems {#app}
==========================================================
The aim of this Appendix is to give a version of Nekhoroshev estimates for perturbations of steep integrable Hamiltonians in Gevrey classes. For real-analytic Hamiltonians, they were obtained by Nekhoroshev in his seminal works ([@Nek77], [@Nek79]); here, for Gevrey smooth Hamiltonians we will follow the method of [@Bou11cmp] and [@BFN15].
Given $r>0$, let us denote by $B_{2r}(I_*)$ the ball of radius $2r$ around $I_*$ in ${\mathbb{R}}^n$ and consider a Hamiltonian as follows: $$\label{HamN}
\begin{cases}
H(\theta,I)=h(I)+f(\theta,I), \quad h : B_{2r}(I_*) \rightarrow {\mathbb{R}}, \quad f: \T^n \times B_{2r}(I_*) \rightarrow {\mathbb{R}}\\
||h||_{\beta,L,B_{2r}(I_*)} \leq F, \quad ||f||_{\beta,L,B_{2r}(I_*)} \leq \mu.
\end{cases}$$ Then we have the following result.
\[thmNek\] Let $H$ be as in , and assume that $h$ is $(\kappa,C,r,p)$-steep on $B_{2r}(I_*)$. Then there exist positive constants $\mu_0$, $c$ $c'$ and $c''$, which depend only on $n$, $\beta$, $L$, $F$, $\kappa$, $C$ and $p$, such that if $$\label{seuil}
\mu \leq \min\{\mu_0,cr^{2na}\},$$ then for any solution $(\theta(t),I(t))$ of the Hamiltonian system associated to $H$ with $I(0) \in B_{5r/4}(I_*)$, we have $$||I(t)-I(0)||\leq c'\mu^{\frac{1}{2na}}, \quad |t|\leq \exp\left(c''\mu^{-\frac{1}{2n \beta a}}\right)$$ where $$a=1+p+p^2+\cdots+p^{n-1}.$$ In particular, we have $$I(t)\in B_{3r/2}(I_*), \quad |t|\leq \exp\left(c''\mu^{-\frac{1}{2n\beta a}}\right).$$
In the situations we are interested in, $r$ is a small parameter, and $\mu$ is exponentially small with respect to some power of $r^{-1}$ so that is automatically satisfied.
The second part of the above statement is obviously a direct consequence of the first part. We will not prove the first part of Theorem \[thmNek\], but we claim that it follows from the method of proof of [@Bou11cmp], Theorem 2.4 and [@BFN15], Theorem D. Indeed, the analytical part (the construction of resonant normal forms on suitable domains) can be taken from Theorem 2.4 of [@Bou11cmp], and combined with geometric part (the confinement argument) of Theorem D in [@BFN15] to give a proof of Theorem \[thmNek\]. Let us recall that [@BFN15] deals with elliptic fixed points in real-analytic systems; yet the geometric part is not sensible to the regularity of the system, and is the same in Cartesian or action-angle coordinates. Alternatively, one can only uses [@Bou11cmp], but at the expense of a worst exponent $a$ (which is, however, not important for our purpose here).
[^1]: CNRS - CEREMADE - IMCCE/ASD, abedbou@gmail.com
[^2]: CNRS - IMJ-PRG and Centro Ennio De Giorgi, bassam.fayad@imj-prg.fr
[^3]: Laboratoire Mathématiques d’Orsay & IMCCE/ASD, Laurent.Niederman@math.u-psud.fr
|
{
"pile_set_name": "ArXiv"
}
|
Testo UltraZ
TestoUltra works by enhancing and propelling circulatory system expanding a man's size, bigness and giving you the essentialness you need. Joined with physical exercises, the results achieved are extraordinarily enhanced as you remain fit reliably. In addition, it ensures that your hormones are balanced guaranteeing that none is practically than the other that can achieve a low sex drive.
The TestoUltra has the going with fixings
Goat Weed (horny)
The Ali Root
Vex root
The Saw Palmetto
The Advantages of TestoUltra
The enhancer elevates one's ability to be invigorated for longer period and the power. This infers you can hold for a more drawn out without missing the mark expanding the level of the show to your desired levels.
The TestoUltra builds your moxy and sex drive with the true objective that you feel charming again and you feel required and required. This goes far to upgrading a man's assurance and eagerness levels.
Competent/genuine Finish or peaks are typical while using this thing
The supporter enhances your sexual relationship with your accessory guaranteeing that you both welcome the exhibit and you are left satisfied at the specific end.
It helps the level of essentialness an individual has in the midst of sex guaranteeing that the drive and power is kept up all through the required period with no mistake.
It enhances your virility with the ultimate objective that you can recognize and feel like a man and benefit as much as possible from your manliness continually.
The Cons of TestoUltra
The components of theTestoUltra are not totally unveiled to know their effects on the body when ingested.
Conclusion
Male virility is a condition that various men are engaging with reliably. Having a way to deal with supplement and certification your sex drive is perfect always is an impeccable game plan. Regardless, make sure of the thing and some other suitable information beforehand using it.
One must pick a supplement that has a place with a genuine association, contains deductively attempted fixings, offers a couple of focal points, goes with a direct cost and moreover prepared for giving speedy and convincing results. The accompanying are our best testosterone supporters that have been situated in view of these essential factors. Each thing has been asked about totally with respect to its practicality and security.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Accessing particular instances in a DRF ListSerializer
I currently have this Django models I want to serialize:
class Result(models.Model):
...
routes = models.ManyToManyField(Route)
...
class Route(models.Model):
...
class Feature(models.Model):
result = models.ForeignKey(Result)
route = models.ForeignKey(Route)
description = models.TextField()
And the DRF serializers looks like:
class ResultSerializer(serializers.ModelSerializer):
...
route = RouteSerializer(many=True, required=False)
...
class Meta:
model = Result
fields = '__all__'
class FeatureField(serializers.CharField):
"""
Accepts text in the writes and looks up the correct feature for the reads.
"""
def get_attribute(self, obj):
# We pass the object instance onto `to_representation`, not just the field attribute.
return obj
def to_representation(self, obj):
try:
search_result = self.root.child.instance
# FIXME: this is the problem.
feature = Feature.objects.get(route=obj.id, search_result=search_result)
feature = feature.description
except Feature.DoesNotExist:
feature = None
return feature
class RouteSerializer(serializers.ModelSerializer):
description = FeatureField(required=False)
class Meta:
model = Route
fields = '__all__'
The problem I mean in the code is that this works when I'm using a ResultSerializer with just one instance, but if I want to serialize several instances in a list view for example, and I pass a queryset to the serializer, DRF applies a ListSerializer on top of it and now the self.root.instance is a list of the records, and I can't access the individual Results that call the nested RouteSerializer so I can't retrieve the correct Feature.
A:
I jumped into DRF code and finally understood what was going on:
If you serialize just one instance with serializer = ResultSerializer(result), the serializer.instance contains only this single, particular result instance, and the nested serializers and fields can access it without problem using self.root.instance.
Now, if you serialize several instances, like the default list action does, what really happens is the following:
a call like serializer = ResultSerializer(queryset, many=True) is performed
having many=True in the arguments triggers the many_init() method from BaseSerializer, and this creates a single ResultSerializer with the queryset as instance, so serializer.instance is the queryset.
next it creates a single ListSerializer extending ResultSerializer and its instance again is the queryset.
What I got wrong is thinking that the ListSerializer would create separated ResultSerializers for each element in the queryset.
How I finally solved this is overriding the ResultSerializer.to_representation() method:
class ResultSerializer(serializers.ModelSerializer):
def to_representation(self, instance):
# When we call Results with many=True, the serializer.instance is a list with several records,
# we can't know which particular instance is spawning the nested serializers so we add it here.
self._instance = instance
return super(ResultSerializer, self).to_representation(instance)
and finally consume it in the FeatureField like this:
class FeatureField(serializers.CharField):
"""
Accepts text in the writes and looks up the correct feature for the reads.
"""
def get_attribute(self, obj):
# We pass the object instance onto `to_representation`, not just the field attribute.
return obj
def to_representation(self, obj):
# If the root is a ListSerializer, retrieve the right Result instance using the `_instance` attribute.
try:
if isinstance(self.root, serializers.ListSerializer):
search_result = self.root.child._instance
else:
search_result = self.root.instance
feature = Feature.objects.get(route=obj.id, search_result=search_result)
feature = feature.pickup_instructions
except Feature.DoesNotExist:
feature = None
return feature
|
{
"pile_set_name": "StackExchange"
}
|
Acanthamoeba keratitis is a painful and debilitating infection of the eye caused by an opportunistic amoeba that occurs ubiquitously in nature. From the discovery of this disease in 1973 until 1984, there were only 11 published cases. At present, an estimated 20 new cases are confirmed per month and the majority are associated with contact lens wear. Both awareness and incidence of the disease are thought to be increasing. The success of medical treatment is inconsistent and repeated surgical intervention often is required. There is considerable confusion over identification of clinical isolates. Cell morphology and affinity for specific antisera are the criteria used for identification, but these approaches often give ambiguous results. There is an urgent need for methods to detect small numbers of amebas and to identify the infectious organisms reliably. This project proposes the use of small subunit ribosomal RNA genes (18S rDNA) as a basis for development of genus-, species-, and strain- specific oligonucleotide probes suitable for laboratory and clinical identification of isolates. This one-year pilot project will focus on sequencing of 18S rDNA isolated from amoeba strains associated with human eye infections. Nuclear rDNA will be amplified by the polymerase chain reaction and then sequenced. Sequences will be determined using oligonucleotide primers, primer extension, and dideoxynucleotide chain termination. rDNA sequences then will be analyzed to determine the extent of sequence variability among strains and searched for subsets of sequences that would be suitable targets for probes with different levels of specificity (i.e. genus, species, or strain). Development of clinical probes would occur in subsequent projects if suitable sequence variability is discovered in this study.
|
{
"pile_set_name": "NIH ExPorter"
}
|
Login
Airbnb Channel ManagerSYNCHRONIZE AVAILABILITY AND BOOKINGS
WHAT YOU CAN DO
With this Channel Manager integration will let you manage your Hotel/Property and perform the following actions
Download new bookings
Upload new Hotel bookings
Use the connectivity service you know and trust via E4J with the Airbnb.com platform.
Earn money as an Airbnb host
Founded in August of 2008 and based in San Francisco, California, Airbnb is a trusted community marketplace for people to list, discover, and book unique accommodations around the world — online or from a mobile phone or tablet.
Whether an apartment for a night, a castle for a week, or a villa for a month, Airbnb connects people to unique travel experiences, at any price point, in more than 34,000 cities and 191 countries. And with world-class customer service and a growing community of users, Airbnb is the easiest way for people to monetize their extra space and showcase it to an audience of millions.
Airbnb plans ahead to protect you and your home:
$1,000,000 Host Guarantee
The Host Guarantee protects your home and your stuff from accidental damage. Every host with a listing on Airbnb is eligible for coverage at no additional cost. You don’t have to do anything to sign up.
Host Protection Insurance
Host Protection Insurance is designed to protect you from liability in case your guests get hurt or cause property damage. It’s automatically included as part of your Airbnb account.
Airbnb is built on trust
We require verified information from both hosts and guests, including phone numbers. After a trip, everyone gets a chance to write a review. Reviews keep guests accountable for treating hosts and their homes with respect.
So much more than money
Besides the extra income, hosts join a supportive worldwide community. There are always opportunities to learn from Airbnb and other hosts.
Earnings and fees
Listing your space on Airbnb is free. Airbnb takes a 3% host service fee on each reservation.
Services
e4jConnect
e4j Network
Follow Us
e4jConnect.com and e4j - Extensionforjoomla.com are not affiliated with or endorsed by the Joomla! Project or Open Source Matters. The Joomla! name and logo is used under a limited license granted by Open Source Matters the trademark holder in the United States and other countries. E4J s.r.l. - VAT N. 06794860483
|
{
"pile_set_name": "Pile-CC"
}
|
Your festival ticket gets you the best view — just feet from the action — from start to finish as 100+ pro cyclists speed through RiNo Art District in thrilling circuit races.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Behavior of "round" function in Python
Could anyone explain me this pice of code:
>>> round(0.45, 1)
0.5
>>> round(1.45, 1)
1.4
>>> round(2.45, 1)
2.5
>>> round(3.45, 1)
3.5
>>> round(4.45, 1)
4.5
>>> round(5.45, 1)
5.5
>>> round(6.45, 1)
6.5
>>> round(7.45, 1)
7.5
>>> round(8.45, 1)
8.4
>>> round(9.45, 1)
9.4
Updated
I guess it is because of floating representation. Am I right?
A:
You are right. None of the numbers can be represented exactly. In some cases the fractional part is strictly greater than 0.45 and in some it is strictly less:
In [4]: ['%.20f' % val for val in (0.45, 1.45, 2.45, 3.45, 4.45, 5.45, 6.45, 7.45, 8.45, 9.45)]
Out[4]:
['0.45000000000000001110',
'1.44999999999999995559',
'2.45000000000000017764',
'3.45000000000000017764',
'4.45000000000000017764',
'5.45000000000000017764',
'6.45000000000000017764',
'7.45000000000000017764',
'8.44999999999999928946',
'9.44999999999999928946']
This explains the seemingly inconsistent rounding.
|
{
"pile_set_name": "StackExchange"
}
|
717 F.Supp. 157 (1989)
MOTHER BERTHA MUSIC, INC., Plaintiff,
v.
TRIO MUSIC CO., INC., Defendant.
No. 88 Civ. 8577 (JMW).
United States District Court, S.D. New York.
July 7, 1989.
Donald S. Zakarin and Tina C. Kremenezky, Pryor, Cashman, Sherman & Flynn, New York City, for plaintiff.
Leonard M. Marks and Jane G. Stevens, Gold, Farrell & Marks, New York City, for defendant.
MEMORANDUM ORDER
WALKER, District Judge:
I. Introduction
This dispute concerns control over the rights to twenty-five classic songs written in the 1960s, including such favorites as "Chapel of Love" and "Da Do Run Run." Plaintiff Mother Bertha Music, Inc., a recently formed California corporation owned by songwriter and producer Phil Spector ("Spector"), has brought suit against defendant Trio Music Co. ("Trio"), a New York-based music publishing concern owned by Jerry Leiber ("Leiber") and Mike Stoller ("Stoller"). Plaintiff claims that *158 Trio withheld royalty payments owed to Mother Bertha Music, Inc. under a 1972 co-publishing agreement between the two companies; plaintiff seeks a declaratory judgment terminating the 1972 Agreement as well as actual and punitive damages. Defendant has moved for dismissal under Fed.R.Civ.P. 12(b)(6) or 12(b)(1) on the grounds that plaintiff was not actually a party to the 1972 Agreement but was created solely to establish federal diversity jurisdiction; alternatively, defendant asks for summary judgment in its favor under Fed.R.Civ.P. 56. Both parties seek sanctions under Fed.R.Civ.P. 11. For the reasons discussed below, defendant's motions for dismissal and judgment on the pleadings are denied; both parties motions for sanctions under Rule 11 are also denied.
II. Background
In contrast to the title of Spector's song "There's No Other (Like My Baby)," there has been more than one "Mother Bertha Music, Inc." over the past twenty-five years. The name "Mother Bertha Music, Inc." has been used in connection with two distinct corporations at different times; in addition, the name has been used loosely and sporadically by Spector in his business dealings. Understandably, this has spawned considerable confusion as to the identity and interests of the plaintiff Mother Bertha Music, Inc., as explained below.
In or about 1960, Stoller and Leiber formed Trio to engage in music publishing. Around the same time, they began to work with Spector, who was then beginning a career in song-writing and publishing. In 1963, Spector formed Mother Bertha Music, Inc. ("Mother Bertha (N.Y.)"), as a New York corporation. During the early 1960s, Spector and Mother Bertha (N.Y.) cooperated with Trio to produce a number of songs together; some of these songs, such as "Why Don't They Let Us Fall In Love" and "Da Do Run Run," have, to some extent, retained their popularity over the years and continue to generate significant copyright royalties.
In December 1968, effective May 1969, Spector dissolved Mother Bertha (N.Y.) as a New York corporation. Under law, its assets became vested in its sole shareholder, Spector, a California citizen. Early in 1970, Spector conveyed his rights to these assets to a California Short-Term Trust ("1970 Trust"), established under the law of that state. See Gore Aff., Exh. A.[1] Until recently, Trio was not aware of the dissolution of Mother Bertha (N.Y.). D.Mem. at 9.
During the early 1970s, Spector, whether intentionally or inadvertently, continued to do business occasionally under the name of Mother Bertha Music, Inc.a company which had been formally dissolved several years earlier. By 1972, a dispute had arisen between Spector's businesses and Trio concerning the interests of the two parties in twenty-five compositions co-written by Spector, Ellie Greenwich, and Jeff Barry. Stoller and Leiber continued to believe that they were dealing with Mother Bertha Music, Inc., the New York corporation. In December 1972, Trio, Spector, and an entity known as Mother Bertha Music, Inc.[2] entered into an agreement (the "1972 Agreement"). This agreement provided that the disputed copyrights would be registered in the joint names of Trio and Mother Bertha; that Trio would administer these copyrights; and that Trio would pay Mother Bertha certain royalties on the different songs. The 1972 Agreement referred in a number of places to "Spector and Mother Bertha Music, Inc.," and was signed by three different partiesTrio, Spector, and "Mother Bertha"; Spector signed on behalf of Mother Bertha as well as for himself. D.Exh., App. at 6. A year later, in November 1973, Spector and "Mother Bertha" entered with Trio into another agreement (the "1973 Agreement") which ratified and confirmed the 1972 Agreement. Again, Spector signed for *159 both himself and Mother Bertha.[3] The arrangement established by the two agreements worked for over a decade. Around 1985, however, both parties began to suspect that the other was not accurately accounting for its share of the royalties.
Meanwhile, back in California, the 1970 Trust, limited by California law to ten years, expired in 1980. The rights were transferred to a successor short-term trust ("1980 Trust"). See Gore Aff., Exh. B. According to plaintiff, in mid-1988, Spector and his advisors began to explore "how Mr. Spector's business structure could be reorganized to more efficiently deal with his entertainment industry activities" especially in light of changes in the tax laws. Gore Aff., ¶ 9. The 1980 Trust would expire in 1990 and, under the 1986 Tax Code, could not be renewed. Id.
This reorganization of Spector's business structure led to the formation of Mother Bertha Music, Inc., a California corporation ("Mother Bertha (Cal.)") on November 30, 1988. On December 1, the 1980 Trust beneficiaries renounced their rights, and the Trust dissolved. These rights again vested in Spector. The next day, Spector assigned all his rights in musical compositions, including the twenty-five songs covered by the 1972 Agreement, to Mother Bertha (Cal.). That same day, December 2, 1988, Mother Bertha (Cal.) filed this suit against Trio.
In its complaint, Mother Bertha (Cal.) claims that Trio has withheld royalties owed to Mother Bertha (Cal.) under the 1972 Agreement as well as violated other provisions of that agreement. Mother Bertha (Cal.) asks for declaratory judgment terminating the Agreementeffectively giving Mother Bertha (Cal.) greater control over the rights to the twenty-five songs along with actual damages of about $250,000 and punitive damages of two million dollars. Defendant now seeks dismissal under Fed.R.Civ.P. 12(b)(6) and 12(b)(1) or summary judgment under Fed.R.Civ.P. 56.
III. Discussion
A. Defendant's Substantive Motions
Defendant's motions under Fed.R.Civ.P. 12(b)(6) and 12(b)(1) essentially rest upon two related arguments: first, that Mother Bertha (Cal.) was created at the eleventh hour solely to create otherwise absent federal diversity jurisdiction; and, second, that Mother Bertha (Cal.) has no right to sue since it was not a party, third party beneficiary, or even successor-in-interest to a party to the 1972 Agreement.
1. Subject Matter Jurisdiction
The creation of a diverse plaintiff shortly before a suit is filed may create a suspicion of collusiveness, in violation of 28 U.S.C. § 1359. This section provides:
A district court shall not have jurisdiction of a civil action in which any party, by assignment or otherwise, has been improperly or collusively made or joined to involve the jurisdiction of such court.
See, e.g., Prudential Oil Corp. v. Phillips Petroleum Co., 546 F.2d 469, 476 (2d Cir. 1976); and Drexel Burnham Lambert Group Inc. v. Galadari, 610 F.Supp 114, 117 (S.D.N.Y.1985).
As discussed further below, defendant argues that the song rights at issue in this suit continued to reside in a New York entity even after the 1969 dissolution. Therefore, defendant maintains that Mother Bertha (Cal.) was created in 1988 only to create a diverse plaintiff. In Prudential Oil Corp v. Phillips Petroleum Co., the Second Circuit explained that:
we hold that where it is shown that a non-diverse parent corporation has assigned a claim to its wholly owned diverse subsidiary engaged in no business other than the prosecution of that claim, the assignment must be treated as presumptively improper and as having been undertaken for the purpose of attempting to manufacture diversity jurisdiction. Thereupon, the assignee-plaintiff may rebut or meet the presumption by offering *160 evidence that the transfer was made for a legitimate business purpose unconnected with the creation of diversity jurisdiction. See Federal Rules of Evidence, § 301.
546 F.2d at 476 (footnote omitted). While Prudential dealt with an assignment, analogous reasoning can be applied to the incorporation of a diverse plaintiff.
Here, plaintiff has asserted some facially valid reasons for incorporating Mother Bertha (Cal.). Gore Aff. ¶¶ 9-12. According to Spector's accountant, Mother Bertha (Cal.) was established "as part of Mr. Spector's overall business reorganization and tax planning that had been under discussion for the previous six months." Gore Aff., ¶ 13. Upon review of the present record, the Court finds plaintiff's actions to be prompted by business reasons other than the creation of diversity jurisdiction.
Moreover, as discussed further below, the available evidence lends support to plaintiff's contention that "[a]ll of the rights at issue in this lawsuit have belonged to California persons and/or entities continuously since 1969." P. 3(g), ¶ 13. When Mother Bertha (N.Y.) was formally dissolved in 1969, its rights and assets passed by law to Spector, its sole shareholder and a citizen of California. These rights were subsequently assigned to the two California trusts and then to Mother Bertha (Cal.). Thus, diversity jurisdiction would presumably have been available had either the 1980 Trustor, had that Trust been dissolved, Spector himselfbrought suit against Trio. See Gore Aff. ¶ 14; and P. 3(g) ¶ 13.
During discovery, facts may come to light suggesting that Mother Bertha (Cal.) was created solely to fabricate diversity jurisdiction. If so, with or without motion by defendant, this Court would dismiss plaintiff's claim under 28 U.S.C. § 1359 for lack of subject matter jurisdiction. See, e.g., Hughes v. Patrolmen's Benevolent Association of the City of New York, Inc., 850 F.2d 876, 881 (2d Cir.1988); Fed.R. Civ.P. 12(h)(3). And at that point, the Court would entertain appropriate motions for sanctions. As in all cases, this Court will not tolerate collusive behavior. At the present time, however, the Court cannot find that plaintiff's behavior comes within the scope of 28 U.S.C. § 1359.
2. Fed.R.Civ.P. 12(b)(6)
Relatedly, defendant maintains that Mother Bertha (N.Y.) has continued as a de facto New York corporation since the 1969 dissolution and that it was this corporation which was a party to the 1972 and 1973 Agreements. Since Mother Bertha (N.Y.) has not assigned its rights to Mother Bertha (Cal.), defendant reasons, the California corporation is in no way a party to the 1972 Agreement and therefore cannot bring suit on it.
In support of this argument, defendant points to several factors. First and perhaps foremost, the signatory to the 1972 and 1973 agreements was "Mother Bertha Music, Inc.," with a New York address, even though Mother Bertha (N.Y.) had, unknown to Trio, been formally dissolved in 1969. Second, the corporate form of Mother Bertha continued to be used in other ways after 1969. For example, sheet music published during the 1970s and 1980s continued to bear the names of both Trio and "Mother Bertha Music, Inc.," even though the latter company presumably no longer existed. Second Stoller Aff., Exh. E.
Defendant claims that, "Both prior to and after executing the 1972 Agreement, MB New York [Mother Bertha (N.Y.)] continued to function and hold itself out to Trio and the world as being a New York corporation." D. Mem. at 12. Defendant points to Garzo v. Maid of the Mist Steamboat Co., which held that where "a corporation carries on its affairs and exercises corporate powers as before, it is a de facto corporation ... and ordinarily no one but the state may question its corporate existence." 303 N.Y. 516, 524, 104 N.E.2d 882 (1952). Garzo, however, was quite different, for there "the corporation inadvertently neglected to provide for the extension of its charter during its fifty-year term. There was no thought in anyone's mind of permitting the company to expire or come *161 to an end." Id. at 523, 104 N.E.2d 882. Here, Spector intentionally dissolved the company, though he continued to use the corporate name occasionally.
The record in this case does indicate that Spector and his advisors were careless in their use of the name "Mother Bertha Music, Inc." Plaintiff admits that Spector's New York lawyers inadvertently used the Mother Bertha name in the 1972 Agreement. Plaintiff attempts to explain that in 1972,
Spector and the "Phil Spector 1970 Short-Term Trust," improperly identified as Mother Bertha Music, Inc., entered into an agreement with Trio Music, Co., Inc. with respect to the exploitation of a specified group of 25 musical compositions.... The real party in interest to the 1972 Agreement was not the improperly identified defunct New York Corporation, Mother Bertha Music, Inc. but instead, was the Phil Spector 1970 Short-Term Trust.
P. 3(g), ¶¶ 4, 5. While this ignores the fact that Spector himself signed both the 1968 certificate of dissolution for Mother Bertha (N.Y.) and the 1972 and 1973 agreements on behalf of both himself and Mother Bertha Music, Inc., the appearance of Mother Bertha on the agreements is, in itself, hardly conclusive. Other factors which might indicate corporate existenceincluding, but not limited to, bank records, company minutes, letterheadare all absent here. Compare D & W Central Station Alarm Co., Inc. v. Copymasters, Inc., 122 Misc.2d 453, 471 N.Y.S.2d 464, 466 (Civ.Ct. Queens Co. 1983); In re Gold Depository Unlimited of America, 106 Misc.2d 992, 436 N.Y. S.2d 794 (Sup.Ct.N.Y.Co.1980).
Upon review of the present record, the Court finds that there is insufficient evidence to establish that Mother Bertha (N.Y.) continued to exist as a de facto corporation after 1969.[4] Moreover, at no time has this corporate confusion operated to the disadvantage of Trio. The de facto corporation doctrine is a creation of equity aimed at preventing prejudice to a party's substantive rights. See, e.g., A.A. Sutain, Ltd. v. Montgomery Ward & Company, 22 A.D.2d 607, 257 N.Y.S.2d 724, 727, aff'd 17 N.Y.2d 776, 270 N.Y.S.2d 626, 217 N.E.2d 674 (1st Dept.1965); Bowditch v. 57 Laight Street. Corp., 111 Misc.2d 255, 443 N.Y. S.2d 785, 788 (Sup. Ct. Special Term, N.Y. Co. 1981). Since Spector has apparently acted as if the 1970 and 1980 Trusts were parties to the 1972 Agreement, there is no need to invoke this equitable doctrine when defendant has not suffered by the appearance of a dissolved corporation as a signatory to the 1972 Agreement. See Bowditch, 443 N.Y.S.2d at 788.
The present facts, viewed in favor of the non-moving party, indicate that Mother Bertha (N.Y.) did not continue as a de facto corporation after 1969. Hence, the rights at issue passed to Spector at the 1969 dissolution, and the 1970 Trust (and its successors-in-interest) can be treated as the party to the 1972 Agreement. Mother Bertha (Cal.), then, may bring suit on that agreement. At this stage, plaintiff's suit should not be dismissed under Fed.R.Civ.P. 12(b)(6).[5]
3. Rule 11 Sanctions
Both parties have asked for their attorneys' fees as sanctions under Fed.R. Civ.P. 11. Rule 11, as amended, states:
The signature of an attorney or party constitutes a certificate by the signer that the signer has read the pleading, or other paper; that to the best of the signer's knowledge, information, and belief formed after reasonable inquiry it is well grounded in fact and is warranted by existent law or a good faith argument *162 for extension, modification, or reversal of existing law, and that it is not interposed for any improper purpose, such as to harass or to cause any unnecessary delay or needless increase in the cost of litigation.
Fed.R.Civ.P. 11. "[W]here the scriptures of the rule have been transgressed, it is incumbent upon the district court to fashion proper sanctions." Eastway Construction Corp. v. City of New York, 762 F.2d 243, 254 n. 7 (2d Cir.1985), modified on other grounds, 821 F.2d 121 (2d Cir), cert. denied, 484 U.S. 918, 108 S.Ct. 269, 98 L.Ed.2d 226 (1987).
Of course, Rule 11 is "not intend[ed] to stifle the enthusiasm or chill the creativity that is the very lifeblood of the law," and a court should impose sanctions only when "it is patently clear that a claim has absolutely no chance of success under the existing precedents," or was interposed for an improper purpose. Id. at 254. See also Oliveri v. Thompson, 803 F.2d 1265, 1274 (2d Cir.1986); Nakash v. U.S. Department of Justice, 708 F.Supp. 1354, 1368 (S.D.N. Y.1988).
Under the standard set by Eastway and its progeny, the Court finds that sanctions are unwarranted at this point against either party in the present case. The organizational history of what is now Mother Bertha (Cal.) is more than a little confusing. Until recently, defendant apparently had no reason to believe Mother Bertha (N.Y.) no longer existed. Hence defendant's assertion that Mother Bertha (Cal.) was incorporated simply to create diversity cannot be dismissed as frivolous. Indeed, if additional evidence comes to light in support of their argument, defendants may file another motion to dismiss.
At the same time, plaintiff's pleadings do not merit sanctions. While plaintiff in its complaint misidentified itself as an immediate party to the 1972 Agreement, plaintiff does appear to be a successor-in-interest to parties which, for all intents and purposes, were bound by the 1972 Agreement. As this Court is unconvinced that plaintiff brought this suit for an improper purpose or that defendant's motion to dismiss was unwarranted, sanctions are not appropriate.
IV. Conclusion
For the reasons set forth above, defendant's motion to dismiss is denied. Both parties' motions for sanctions under Rule 11 are denied.
SO ORDERED.
NOTES
[1] References throughout are as follows: Affidavit ("Aff."); Defendant's Memorandum in Support of Motion to Dismiss ("D.Mem."); Plaintiff's Memorandum in Opposition to Motion to Dismiss ("P.Mem."); Exhibit ("Exh."); Plaintiff's 3(g) Statement ("P. 3(g)"); Complaint ("Comp.").
[2] The 1972 Agreement listed Mother Bertha's address as in care of its attorneys in New York.
[3] Again, the 1973 Agreement listed Mother Bertha's address as in care of its attorneys in New York.
[4] There is as yet no more extensive evidence of the continuing corporate existence of Mother Bertha (N.Y.) during the past twenty years than that mentioned in the text. See P. 3(g), ¶ 6. Defendant points to evidence such as recent royalty statements issued to "Phil Spector 1980 Short Term Trust," which also list "Mother Bertha Music." See Stoller Aff., Exh. F. Since these statements are addressed to the 1980 Trust in Los Angeles, defendant's contention that they indicate the continuing existence of a New York corporation is unpersuasive.
[5] Similarly, since material issues of fact exist as to the merits of plaintiff's claim, this Court cannot now grant summary judgment.
|
{
"pile_set_name": "FreeLaw"
}
|
Tag Like Me Corp (OTC: TAGG) followed through on its down day yesterday with what can only be described as a selloff in the stock today. TAGG is currently lower by 41% on $4 million traded in the first 2 hours of trading today. We will be keeping a close on eye on the stock to see if it has the ability to trade back to the levels it was at last week.
Warp 9, Inc. (OTC: WNYN) was another recent high flying name getting sold off in the OTCQB market today. WNYN had a massive couple of up trading days, one being north of 100%. Today however shares are pulling back, WNYN is trading lower by 34% on $1.2 million traded. This could turn out to be a one day sell off for the stock, we will keep you updated.
Amarantus Biosciences (OTC: AMBS) was back on the watch list today after a few days off and was trading higher on Wall Street. AMBS was higher by 20% on $2.7 million in early trading. The shares were much higher around the open and have pulled back a little from that price.
Fannie Mae's (OTC: FNMFM) preferred stock was having a serious run today gapping up 400% but on fairly light volume at the same time. FNMA regular stock was higher by 2% on the trading day.
Pristine Solutions (OTC: PRTN) was another name back on the volume watch list for the wrong reasons. PRTN was lower by 23% on 240k traded after the first couple of hours on the OTC market this morning.
We continue to bring you coverage regardless of the election. We hope you have enjoyed our coverage over the last week, uninterrupted through the hurricane. We will be back to you on Wednesday with the latest news and volume movers in the OTC Markets.
If you are looking to know what's going on with these companies on the OTCQB and in addition receive weekly picks on stocks that we feature….simply sign up at our website for free.
We are making sure you are right in touch with all the top volume leaders in the penny stock world, and the lists of penny stocks. We will show you the movers and shakers and the companies making the headlines in our trading world.
We track the volume and keep in touch with any increasing trends to the upside or downside. We also cover the top stocks on the OTCQB, OTCQX, and the Pink Sheet markets.
As our subscribers know, timing is absolutely critical when buying stocks. The stocks you buy are not as important as when you buy.
Disclosure: Clubpennystocks is not a registered investment advisor and nothing contained in any materials should be construed as a recommendation to buy or sell securities. Investors should always conduct their own due diligence with any potential investment. Clubpennystocks is a wholly owned entity of a financial public relations firm. We have not been compensated by any of the companies listed in this news release.
|
{
"pile_set_name": "Pile-CC"
}
|
Bandicam Crack 2014 plus Serial Key Full Download
Bandicam Crack 2014 plus Serial Key Full Obtain
Bandicam Crack 2014 plus Serial Key Full Obtain is a sort of custom-made software program, which is developed for the assistance of the customers. It’s software program which helps customers for recording of various sorts. Mainly, Bandicam is used for display screen photographs. It’s used to file the particular place of the image or display screen on the system or various kinds of gadgets which supplies knowledge on to the system.
Bandicam Crack 2014 plus Serial can be used to document movies in excessive definition high quality. The video which is created from bandicam seems like an authentic work. Bandicam newest variations efficiency and work is an excessive amount of related with earlier model of the software program. Additionally features are just like the earlier variations.
Options of Bandicam Crack 2014 plus Serial Key:
Bandicam can also be used for sport recording software program.
Bandicam file saved file dimension an excessive amount of small from different.
It additionally compresses photos of movies to scale back the dimensions.
Bandicam have a robust characteristic to add your file on YouTube immediately.
It’s used to report full HD photos with excessive decision.
Bandicam working options are an excessive amount of sooner than others.
It will probably work greater than 24 hours.
Screenshots:
Totally different features of Bandicam Crack 2014:
PC Blackbox
The black field is often utilized in airways and the heavy autos to report the actions earlier than accident/crash. The principle perform of black field is to report your methods entire actions. It data all varieties of operate performing by pilot or drivers. There several types of Bandicam variations that are used as a goal of black field however Bandicam model 2.zero or its newest model assist to document your computer systems actions and might seize as a video. These variations of Bandicam have a function of auto Beginning and Auto Completion when a plan or car will begin.
Bandicut
Black field is recording your methods actions, if someday you wish to take away some movies which you don’t like than there’s a characteristic to take away bandicut means to take away undesirable movies. It provides to save lots of simply these a part of movies which you want that and having prime quality.
Black Display Downside
The primary purpose of black display screen is that the movies having overlapping with one another. There are completely different options of this drawback.
On Bandicam earlier than recording
Earlier than recording, you should on Bandicam for recording in any other case it would overlap movies.
|
{
"pile_set_name": "Pile-CC"
}
|
FROM balenalib/armv7hf-alpine:3.12-run
LABEL io.balena.device-type="generic-armv7ahf"
RUN apk add --update \
less \
nano \
net-tools \
ifupdown \
usbutils \
gnupg \
&& rm -rf /var/cache/apk/*
RUN [ ! -d /.balena/messages ] && mkdir -p /.balena/messages; echo $'Here are a few details about this Docker image (For more information please visit https://www.balena.io/docs/reference/base-images/base-images/): \nArchitecture: ARM v7 \nOS: Alpine Linux 3.12 \nVariant: run variant \nDefault variable(s): UDEV=off \nExtra features: \n- Easy way to install packages with `install_packages <package-name>` command \n- Run anywhere with cross-build feature (for ARM only) \n- Keep the container idling with `balena-idle` command \n- Show base image details with `balena-info` command' > /.balena/messages/image-info
RUN echo $'#!/bin/bash\nbalena-info\nbusybox ln -sf /bin/busybox /bin/sh\n/bin/sh "$@"' > /bin/sh-shim \
&& chmod +x /bin/sh-shim \
&& ln -f /bin/sh /bin/sh.real \
&& ln -f /bin/sh-shim /bin/sh
|
{
"pile_set_name": "Github"
}
|
The Palaszczuk Government has vowed to continue to raise awareness around asbestos safety.
Industrial Relations Minister Grace Grace said Asbestos Awareness Week (24 November – 30 November) was a chance to highlight the risks of working with asbestos.
“As it’s Asbestos Awareness Week it’s timely to reinforce the importance of safety, especially for people cleaning up from the recent bushfires,” she said.
“There is no cure for mesothelioma, asbestosis, lung cancer and other horrible conditions that can be contracted from exposure to asbestos.
“So we need to warn everyone about the very real dangers – starting with students and apprentices, right through to experienced tradies and foremen.”
More than 700 new cases of mesothelioma were reported to the Australian Mesothelioma Registry with a diagnosis date in 2017 – almost two a day. In 2018, 699 people died of mesothelioma.
Ms Grace said the Government was determined to continue to call out builders who were doing the wrong thing.
“Ignoring asbestos laws and putting people at risk can result in stiff penalties, including on-the-spot fines, with clean-up costs exceeding $100,000,” she said.
“Over the past two years, Workplace Health and Safety Queensland had conducted 47 investigations into high-risk asbestos activities.
“In the past 18 months alone, WHSQ has cancelled five asbestos removal licences and suspended four others over unsafe and incompetent asbestos removal.”
A recent Queensland Building and Construction Commission survey found that a staggering 66 per cent of the state’s 11,000 owner builders will have to remove asbestos when renovating their homes, and owner builders could easily underestimate the risks.
Minister for Housing and Public Works Mick de Brenni said that anyone performing work on older buildings should get expert advice before dealing with asbestos, with DIY home renovations a high risk area.
“A QBCC survey found that 72 per cent of owner-builders had done some sort of renovation work to a home built between 1940 and 1990, with 81 per cent potentially having been exposed to risk had asbestos been present.
“It’s very important that anyone either performing or arranging their own renovations understand the very real danger of diseases caused by the handling of asbestos.
“Asbestos is a horrendous building product that can be found in old switchboards, external and internal cladding, vent pipes, vinyl and carpet underlay, behind wall tiles as well as in fencing, sheds and splashbacks in wet areas,” he said.
“In fact, there is a whole range of other unexpected places around older homes that asbestos could be lurking, and the assumption should be that it is in fact present in buildings that age.”
“It’s on all of us to reduce needless exposure to harmful products and making sure you use an appropriately licenced removalist is the first step.”
|
{
"pile_set_name": "OpenWebText2"
}
|
Nineteenth and Twentieth Years of the War - Revolt of Ionia - Intervention of Persia - The War in Ionia[edit]
1When the news was brought to Athens, for a long while they disbelieved even the most respectable of the soldiers who had themselves escaped from the scene of action and clearly reported the matter, a destruction so complete not being thought credible. When the conviction was forced upon them, they were angry with the orators who had joined in promoting the expedition, just as if they had not themselves voted it, and were enraged also with the reciters of oracles and soothsayers, and all other omen-mongers of the time who had encouraged them to hope that they should conquer Sicily. Already distressed at all points and in all quarters, after what had now happened, they were seized by a fear and consternation quite without example. It was grievous enough for the state and for every man in his proper person to lose so many heavy infantry, cavalry, and able-bodied troops, and to see none left to replace them; but when they saw, also, that they had not sufficient ships in their docks, or money in the treasury, or crews for the ships, they began to despair of salvation. They thought that their enemies in Sicily would immediately sail with their fleet against Piraeus, inflamed by so signal a victory; while their adversaries at home, redoubling all their preparations, would vigorously attack them by sea and land at once, aided by their own revolted confederates. Nevertheless, with such means as they had, it was determined to resist to the last, and to provide timber and money, and to equip a fleet as they best could, to take steps to secure their confederates and above all Euboea, to reform things in the city upon a more economical footing, and to elect a board of elders to advise upon the state of affairs as occasion should arise. In short, as is the way of a democracy, in the panic of the moment they were ready to be as prudent as possible.
These resolves were at once carried into effect. Summer was now over. 2The winter ensuing saw all Hellas stirring under the impression of the great Athenian disaster in Sicily. Neutrals now felt that even if uninvited they ought no longer to stand aloof from the war, but should volunteer to march against the Athenians, who, as they severally reflected, would probably have come against them if the Sicilian campaign had succeeded. Besides, they considered that the war would now be short, and that it would be creditable for them to take part in it. Meanwhile the allies of the Lacedaemonians felt all more anxious than ever to see a speedy end to their heavy labours. But above all, the subjects of the Athenians showed a readiness to revolt even beyond their ability, judging the circumstances with passion, and refusing even to hear of the Athenians being able to last out the coming summer. Beyond all this, Lacedaemon was encouraged by the near prospect of being joined in great force in the spring by her allies in Sicily, lately forced by events to acquire their navy. With these reasons for confidence in every quarter, the Lacedaemonians now resolved to throw themselves without reserve into the war, considering that, once it was happily terminated, they would be finally delivered from such dangers as that which would have threatened them from Athens, if she had become mistress of Sicily, and that the overthrow of the Athenians would leave them in quiet enjoyment of the supremacy over all Hellas.
3Their king, Agis, accordingly set out at once during this winter with some troops from Decelea, and levied from the allies contributions for the fleet, and turning towards the Malian Gulf exacted a sum of money from the Oetaeans by carrying off most of their cattle in reprisal for their old hostility, and, in spite of the protests and opposition of the Thessalians, forced the Achaeans of Phthiotis and the other subjects of the Thessalians in those parts to give him money and hostages, and deposited the hostages at Corinth, and tried to bring their countrymen into the confederacy. The Lacedaemonians now issued a requisition to the cities for building a hundred ships, fixing their own quota and that of the Boeotians at twenty-five each; that of the Phocians and Locrians together at fifteen; that of the Corinthians at fifteen; that of the Arcadians, Pellenians, and Sicyonians together at ten; and that of the Megarians, Troezenians, Epidaurians, and Hermionians together at ten also; and meanwhile made every other preparation for commencing hostilities by the spring.
4In the meantime the Athenians were not idle. During this same winter, as they had determined, they contributed timber and pushed on their ship-building, and fortified Sunium to enable their corn-ships to round it in safety, and evacuated the fort in Laconia which they had built on their way to Sicily; while they also, for economy, cut down any other expenses that seemed unnecessary, and above all kept a careful look-out against the revolt of their confederates.
5While both parties were thus engaged, and were as intent upon preparing for the war as they had been at the outset, the Euboeans first of all sent envoys during this winter to Agis to treat of their revolting from Athens. Agis accepted their proposals, and sent for Alcamenes, son of Sthenelaidas, and Melanthus from Lacedaemon, to take the command in Euboea. These accordingly arrived with some three hundred Neodamodes, and Agis began to arrange for their crossing over. But in the meanwhile arrived some Lesbians, who also wished to revolt; and these being supported by the Boeotians, Agis was persuaded to defer acting in the matter of Euboea, and made arrangements for the revolt of the Lesbians, giving them Alcamenes, who was to have sailed to Euboea, as governor, and himself promising them ten ships, and the Boeotians the same number. All this was done without instructions from home, as Agis while at Decelea with the army that he commanded had power to send troops to whatever quarter he pleased, and to levy men and money. During this period, one might say, the allies obeyed him much more than they did the Lacedaemonians in the city, as the force he had with him made him feared at once wherever he went. While Agis was engaged with the Lesbians, the Chians and Erythraeans, who were also ready to revolt, applied, not to him but at Lacedaemon; where they arrived accompanied by an ambassador from Tissaphernes, the commander of King Darius, son of Artaxerxes, in the maritime districts, who invited the Peloponnesians to come over, and promised to maintain their army. The King had lately called upon him for the tribute from his government, for which he was in arrears, being unable to raise it from the Hellenic towns by reason of the Athenians; and he therefore calculated that by weakening the Athenians he should get the tribute better paid, and should also draw the Lacedaemonians into alliance with the King; and by this means, as the King had commanded him, take alive or dead Amorges, the bastard son of Pissuthnes, who was in rebellion on the coast of Caria.
6While the Chians and Tissaphernes thus joined to effect the same object, about the same time Calligeitus, son of Laophon, a Megarian, and Timagoras, son of Athenagoras, a Cyzicene, both of them exiles from their country and living at the court of Pharnabazus, son of Pharnaces, arrived at Lacedaemon upon a mission from Pharnabazus, to procure a fleet for the Hellespont; by means of which, if possible, he might himself effect the object of Tissaphernes' ambition and cause the cities in his government to revolt from the Athenians, and so get the tribute, and by his own agency obtain for the King the alliance of the Lacedaemonians.
The emissaries of Pharnabazus and Tissaphernes treating apart, a keen competition now ensued at Lacedaemon as to whether a fleet and army should be sent first to Ionia and Chios, or to the Hellespont. The Lacedaemonians, however, decidedly favoured the Chians and Tissaphernes, who were seconded by Alcibiades, the family friend of Endius, one of the ephors for that year. Indeed, this is how their house got its Laconic name, Alcibiades being the family name of Endius. Nevertheless the Lacedaemonians first sent to Chios Phrynis, one of the Perioeci, to see whether they had as many ships as they said, and whether their city generally was as great as was reported; and upon his bringing word that they had been told the truth, immediately entered into alliance with the Chians and Erythraeans, and voted to send them forty ships, there being already, according to the statement of the Chians, not less than sixty in the island. At first the Lacedaemonians meant to send ten of these forty themselves, with Melanchridas their admiral; but afterwards, an earthquake having occurred, they sent Chalcideus instead of Melanchridas, and instead of the ten ships equipped only five in Laconia. And the winter ended, and with it ended also the nineteenth year of this war of which Thucydides is the historian.
7At the beginning of the next summer the Chians were urging that the fleet should be sent off, being afraid that the Athenians, from whom all these embassies were kept a secret, might find out what was going on, and the Lacedaemonians at once sent three Spartans to Corinth to haul the ships as quickly as possible across the Isthmus from the other sea to that on the side of Athens, and to order them all to sail to Chios, those which Agis was equipping for Lesbos not excepted. The number of ships from the allied states was thirty-nine in all.
8Meanwhile Calligeitus and Timagoras did not join on behalf of Pharnabazus in the expedition to Chios or give the money--twenty-five talents--which they had brought with them to help in dispatching a force, but determined to sail afterwards with another force by themselves. Agis, on the other hand, seeing the Lacedaemonians bent upon going to Chios first, himself came in to their views; and the allies assembled at Corinth and held a council, in which they decided to sail first to Chios under the command of Chalcideus, who was equipping the five vessels in Laconia, then to Lesbos, under the command of Alcamenes, the same whom Agis had fixed upon, and lastly to go to the Hellespont, where the command was given to Clearchus, son of Ramphias. Meanwhile they would take only half the ships across the Isthmus first, and let those sail off at once, in order that the Athenians might attend less to the departing squadron than to those to be taken across afterwards, as no care had been taken to keep this voyage secret through contempt of the impotence of the Athenians, who had as yet no fleet of any account upon the sea. Agreeably to this determination, twenty-one vessels were at once conveyed across the Isthmus.
9They were now impatient to set sail, but the Corinthians were not willing to accompany them until they had celebrated the Isthmian festival, which fell at that time. Upon this Agis proposed to them to save their scruples about breaking the Isthmian truce by taking the expedition upon himself. The Corinthians not consenting to this, a delay ensued, during which the Athenians conceived suspicions of what was preparing at Chios, and sent Aristocrates, one of their generals, and charged them with the fact, and, upon the denial of the Chians, ordered them to send with them a contingent of ships, as faithful confederates. Seven were sent accordingly. The reason of the dispatch of the ships lay in the fact that the mass of the Chians were not privy to the negotiations, while the few who were in the secret did not wish to break with the multitude until they had something positive to lean upon, and no longer expected the Peloponnesians to arrive by reason of their delay.
10In the meantime the Isthmian games took place, and the Athenians, who had been also invited, went to attend them, and now seeing more clearly into the designs of the Chians, as soon as they returned to Athens took measures to prevent the fleet putting out from Cenchreae without their knowledge. After the festival the Peloponnesians set sail with twenty-one ships for Chios, under the command of Alcamenes. The Athenians first sailed against them with an equal number, drawing off towards the open sea. The enemy, however, turning back before he had followed them far, the Athenians returned also, not trusting the seven Chian ships which formed part of their number, and afterwards manned thirty-seven vessels in all and chased him on his passage alongshore into Spiraeum, a desert Corinthian port on the edge of the Epidaurian frontier. After losing one ship out at sea, the Peloponnesians got the rest together and brought them to anchor. The Athenians now attacked not only from the sea with their fleet, but also disembarked upon the coast; and a melee ensued of the most confused and violent kind, in which the Athenians disabled most of the enemy's vessels and killed Alcamenes their commander, losing also a few of their own men.
11After this they separated, and the Athenians, detaching a sufficient number of ships to blockade those of the enemy, anchored with the rest at the islet adjacent, upon which they proceeded to encamp, and sent to Athens for reinforcements; the Peloponnesians having been joined on the day after the battle by the Corinthians, who came to help the ships, and by the other inhabitants in the vicinity not long afterwards. These saw the difficulty of keeping guard in a desert place, and in their perplexity at first thought of burning the ships, but finally resolved to haul them up on shore and sit down and guard them with their land forces until a convenient opportunity for escaping should present itself. Agis also, on being informed of the disaster, sent them a Spartan of the name of Thermon. The Lacedaemonians first received the news of the fleet having put out from the Isthmus, Alcamenes having been ordered by the ephors to send off a horseman when this took place, and immediately resolved to dispatch their own five vessels under Chalcideus, and Alcibiades with him. But while they were full of this resolution came the second news of the fleet having taken refuge in Spiraeum; and disheartened at their first step in the Ionian war proving a failure, they laid aside the idea of sending the ships from their own country, and even wished to recall some that had already sailed.
12Perceiving this, Alcibiades again persuaded Endius and the other ephors to persevere in the expedition, saying that the voyage would be made before the Chians heard of the fleet's misfortune, and that as soon as he set foot in Ionia, he should, by assuring them of the weakness of the Athenians and the zeal of Lacedaemon, have no difficulty in persuading the cities to revolt, as they would readily believe his testimony. He also represented to Endius himself in private that it would be glorious for him to be the means of making Ionia revolt and the King become the ally of Lacedaemon, instead of that honour being left to Agis (Agis, it must be remembered, was the enemy of Alcibiades); and Endius and his colleagues thus persuaded, he put to sea with the five ships and the Lacedaemonian Chalcideus, and made all haste upon the voyage.
13About this time the sixteen Peloponnesian ships from Sicily, which had served through the war with Gylippus, were caught on their return off Leucadia and roughly handled by the twenty-seven Athenian vessels under Hippocles, son of Menippus, on the lookout for the ships from Sicily. After losing one of their number, the rest escaped from the Athenians and sailed into Corinth.
14Meanwhile Chalcideus and Alcibiades seized all they met with on their voyage, to prevent news of their coming, and let them go at Corycus, the first point which they touched at in the continent. Here they were visited by some of their Chian correspondents and, being urged by them to sail up to the town without announcing their coming, arrived suddenly before Chios. The many were amazed and confounded, while the few had so arranged that the council should be sitting at the time; and after speeches from Chalcideus and Alcibiades stating that many more ships were sailing up, but saying nothing of the fleet being blockaded in Spiraeum, the Chians revolted from the Athenians, and the Erythraeans immediately afterwards. After this three vessels sailed over to Clazomenae, and made that city revolt also; and the Clazomenians immediately crossed over to the mainland and began to fortify Polichna, in order to retreat there, in case of necessity, from the island where they dwelt.
15While the revolted places were all engaged in fortifying and preparing for the war, news of Chios speedily reached Athens. The Athenians thought the danger by which they were now menaced great and unmistakable, and that the rest of their allies would not consent to keep quiet after the secession of the greatest of their number. In the consternation of the moment they at once took off the penalty attaching to whoever proposed or put to the vote a proposal for using the thousand talents which they had jealously avoided touching throughout the whole war, and voted to employ them to man a large number of ships, and to send off at once under Strombichides, son of Diotimus, the eight vessels, forming part of the blockading fleet at Spiraeum, which had left the blockade and had returned after pursuing and failing to overtake the vessels with Chalcideus. These were to be followed shortly afterwards by twelve more under Thrasycles, also taken from the blockade. They also recalled the seven Chian vessels, forming part of their squadron blockading the fleet in Spiraeum, and giving the slaves on board their liberty, put the freemen in confinement, and speedily manned and sent out ten fresh ships to blockade the Peloponnesians in the place of all those that had departed, and decided to man thirty more. Zeal was not wanting, and no effort was spared to send relief to Chios.
16In the meantime Strombichides with his eight ships arrived at Samos, and, taking one Samian vessel, sailed to Teos and required them to remain quiet. Chalcideus also set sail with twenty-three ships for Teos from Chios, the land forces of the Clazomenians and Erythraeans moving alongshore to support him. Informed of this in time, Strombichides put out from Teos before their arrival, and while out at sea, seeing the number of the ships from Chios, fled towards Samos, chased by the enemy. The Teians at first would not receive the land forces, but upon the flight of the Athenians took them into the town. There they waited for some time for Chalcideus to return from the pursuit, and as time went on without his appearing, began themselves to demolish the wall which the Athenians had built on the land side of the city of the Teians, being assisted by a few of the barbarians who had come up under the command of Stages, the lieutenant of Tissaphernes.
17Meanwhile Chalcideus and Alcibiades, after chasing Strombichides into Samos, armed the crews of the ships from Peloponnese and left them at Chios, and filling their places with substitutes from Chios and manning twenty others, sailed off to effect the revolt of Miletus. The wish of Alcibiades, who had friends among the leading men of the Milesians, was to bring over the town before the arrival of the ships from Peloponnese, and thus, by causing the revolt of as many cities as possible with the help of the Chian power and of Chalcideus, to secure the honour for the Chians and himself and Chalcideus, and, as he had promised, for Endius who had sent them out. Not discovered until their voyage was nearly completed, they arrived a little before Strombichides and Thrasycles (who had just come with twelve ships from Athens, and had joined Strombichides in pursuing them), and occasioned the revolt of Miletus. The Athenians sailing up close on their heels with nineteen ships found Miletus closed against them, and took up their station at the adjacent island of Lade. The first alliance between the King and the Lacedaemonians was now concluded immediately upon the revolt of the Milesians, by Tissaphernes and Chalcideus, and was as follows:
18The Lacedaemonians and their allies made a treaty with the King and Tissaphernes upon the terms following:
1. Whatever country or cities the King has, or the King's ancestors had, shall be the king's: and whatever came in to the Athenians from these cities, either money or any other thing, the King and the Lacedaemonians and their allies shall jointly hinder the Athenians from receiving either money or any other thing.
2. The war with the Athenians shall be carried on jointly by the King and by the Lacedaemonians and their allies: and it shall not be lawful to make peace with the Athenians except both agree, the King on his side and the Lacedaemonians and their allies on theirs.
3. If any revolt from the King, they shall be the enemies of the Lacedaemonians and their allies. And if any revolt from the Lacedaemonians and their allies, they shall be the enemies of the King in like manner.
19This was the alliance. After this the Chians immediately manned ten more vessels and sailed for Anaia, in order to gain intelligence of those in Miletus, and also to make the cities revolt. A message, however, reaching them from Chalcideus to tell them to go back again, and that Amorges was at hand with an army by land, they sailed to the temple of Zeus, and there sighting ten more ships sailing up with which Diomedon had started from Athens after Thrasycles, fled, one ship to Ephesus, the rest to Teos. The Athenians took four of their ships empty, the men finding time to escape ashore; the rest took refuge in the city of the Teians; after which the Athenians sailed off to Samos, while the Chians put to sea with their remaining vessels, accompanied by the land forces, and caused Lebedos to revolt, and after it Erae. After this they both returned home, the fleet and the army.
20About the same time the twenty ships of the Peloponnesians in Spiraeum, which we left chased to land and blockaded by an equal number of Athenians, suddenly sallied out and defeated the blockading squadron, took four of their ships, and, sailing back to Cenchreae, prepared again for the voyage to Chios and Ionia. Here they were joined by Astyochus as high admiral from Lacedaemon, henceforth invested with the supreme command at sea. The land forces now withdrawing from Teos, Tissaphernes repaired thither in person with an army and completed the demolition of anything that was left of the wall, and so departed. Not long after his departure Diomedon arrived with ten Athenian ships, and, having made a convention by which the Teians admitted him as they had the enemy, coasted along to Erae, and, failing in an attempt upon the town, sailed back again.
21About this time took place the rising of the commons at Samos against the upper classes, in concert with some Athenians, who were there in three vessels. The Samian commons put to death some two hundred in all of the upper classes, and banished four hundred more, and themselves took their land and houses; after which the Athenians decreed their independence, being now sure of their fidelity, and the commons henceforth governed the city, excluding the landholders from all share in affairs, and forbidding any of the commons to give his daughter in marriage to them or to take a wife from them in future.
22After this, during the same summer, the Chians, whose zeal continued as active as ever, and who even without the Peloponnesians found themselves in sufficient force to effect the revolt of the cities and also wished to have as many companions in peril as possible, made an expedition with thirteen ships of their own to Lesbos; the instructions from Lacedaemon being to go to that island next, and from thence to the Hellespont. Meanwhile the land forces of the Peloponnesians who were with the Chians and of the allies on the spot, moved alongshore for Clazomenae and Cuma, under the command of Eualas, a Spartan; while the fleet under Diniadas, one of the Perioeci, first sailed up to Methymna and caused it to revolt, and, leaving four ships there, with the rest procured the revolt of Mitylene.
23In the meantime Astyochus, the Lacedaemonian admiral, set sail from Cenchreae with four ships, as he had intended, and arrived at Chios. On the third day after his arrival, the Athenian ships, twenty-five in number, sailed to Lesbos under Diomedon and Leon, who had lately arrived with a reinforcement of ten ships from Athens. Late in the same day Astyochus put to sea, and taking one Chian vessel with him sailed to Lesbos to render what assistance he could. Arrived at Pyrrha, and from thence the next day at Eresus, he there learned that Mitylene had been taken, almost without a blow, by the Athenians, who had sailed up and unexpectedly put into the harbour, had beaten the Chian ships, and landing and defeating the troops opposed to them had become masters of the city. Informed of this by the Eresians and the Chian ships, which had been left with Eubulus at Methymna, and had fled upon the capture of Mitylene, and three of which he now fell in with, one having been taken by the Athenians, Astyochus did not go on to Mitylene, but raised and armed Eresus, and, sending the heavy infantry from his own ships by land under Eteonicus to Antissa and Methymna, himself proceeded alongshore thither with the ships which he had with him and with the three Chians, in the hope that the Methymnians upon seeing them would be encouraged to persevere in their revolt. As, however, everything went against him in Lesbos, he took up his own force and sailed back to Chios; the land forces on board, which were to have gone to the Hellespont, being also conveyed back to their different cities. After this six of the allied Peloponnesian ships at Cenchreae joined the forces at Chios. The Athenians, after restoring matters to their old state in Lesbos, set sail from thence and took Polichna, the place that the Clazomenians were fortifying on the continent, and carried the inhabitants back to their town upon the island, except the authors of the revolt, who withdrew to Daphnus; and thus Clazomenae became once more Athenian.
24The same summer the Athenians in the twenty ships at Lade, blockading Miletus, made a descent at Panormus in the Milesian territory, and killed Chalcideus the Lacedaemonian commander, who had come with a few men against them, and the third day after sailed over and set up a trophy, which, as they were not masters of the country, was however pulled down by the Milesians. Meanwhile Leon and Diomedon with the Athenian fleet from Lesbos issuing from the Oenussae, the isles off Chios, and from their forts of Sidussa and Pteleum in the Erythraeid, and from Lesbos, carried on the war against the Chians from the ships, having on board heavy infantry from the rolls pressed to serve as marines. Landing in Cardamyle and in Bolissus they defeated with heavy loss the Chians that took the field against them and, laying desolate the places in that neighbourhood, defeated the Chians again in another battle at Phanae, and in a third at Leuconium. After this the Chians ceased to meet them in the field, while the Athenians devastated the country, which was beautifully stocked and had remained uninjured ever since the Median wars. Indeed, after the Lacedaemonians, the Chians are the only people that I have known who knew how to be wise in prosperity, and who ordered their city the more securely the greater it grew. Nor was this revolt, in which they might seem to have erred on the side of rashness, ventured upon until they had numerous and gallant allies to share the danger with them, and until they perceived the Athenians after the Sicilian disaster themselves no longer denying the thoroughly desperate state of their affairs. And if they were thrown out by one of the surprises which upset human calculations, they found out their mistake in company with many others who believed, like them, in the speedy collapse of the Athenian power. While they were thus blockaded from the sea and plundered by land, some of the citizens undertook to bring the city over to the Athenians. Apprised of this the authorities took no action themselves, but brought Astyochus, the admiral, from Erythrae, with four ships that he had with him, and considered how they could most quietly, either by taking hostages or by some other means, put an end to the conspiracy.
25While the Chians were thus engaged, a thousand Athenian heavy infantry and fifteen hundred Argives (five hundred of whom were light troops furnished with armour by the Athenians), and one thousand of the allies, towards the close of the same summer sailed from Athens in forty-eight ships, some of which were transports, under the command of Phrynichus, Onomacles, and Scironides, and putting into Samos crossed over and encamped at Miletus. Upon this the Milesians came out to the number of eight hundred heavy infantry, with the Peloponnesians who had come with Chalcideus, and some foreign mercenaries of Tissaphernes, Tissaphernes himself and his cavalry, and engaged the Athenians and their allies. While the Argives rushed forward on their own wing with the careless disdain of men advancing against Ionians who would never stand their charge, and were defeated by the Milesians with a loss little short of three hundred men, the Athenians first defeated the Peloponnesians, and driving before them the barbarians and the ruck of the army, without engaging the Milesians, who after the rout of the Argives retreated into the town upon seeing their comrades worsted, crowned their victory by grounding their arms under the very walls of Miletus. Thus, in this battle, the Ionians on both sides overcame the Dorians, the Athenians defeating the Peloponnesians opposed to them, and the Milesians the Argives. After setting up a trophy, the Athenians prepared to draw a wall round the place, which stood upon an isthmus; thinking that, if they could gain Miletus, the other towns also would easily come over to them.
26Meanwhile about dusk tidings reached them that the fifty-five ships from Peloponnese and Sicily might be instantly expected. Of these the Siceliots, urged principally by the Syracusan Hermocrates to join in giving the finishing blow to the power of Athens, furnished twenty-two--twenty from Syracuse, and two from Silenus; and the ships that we left preparing in Peloponnese being now ready, both squadrons had been entrusted to Therimenes, a Lacedaemonian, to take to Astyochus, the admiral. They now put in first at Leros the island off Miletus, and from thence, discovering that the Athenians were before the town, sailed into the Iasic Gulf, in order to learn how matters stood at Miletus. Meanwhile Alcibiades came on horseback to Teichiussa in the Milesian territory, the point of the gulf at which they had put in for the night, and told them of the battle in which he had fought in person by the side of the Milesians and Tissaphernes, and advised them, if they did not wish to sacrifice Ionia and their cause, to fly to the relief of Miletus and hinder its investment.
27Accordingly they resolved to relieve it the next morning. Meanwhile Phrynichus, the Athenian commander, had received precise intelligence of the fleet from Leros, and when his colleagues expressed a wish to keep the sea and fight it out, flatly refused either to stay himself or to let them or any one else do so if he could help it. Where they could hereafter contend, after full and undisturbed preparation, with an exact knowledge of the number of the enemy's fleet and of the force which they could oppose to him, he would never allow the reproach of disgrace to drive him into a risk that was unreasonable. It was no disgrace for an Athenian fleet to retreat when it suited them: put it as they would, it would be more disgraceful to be beaten, and to expose the city not only to disgrace, but to the most serious danger. After its late misfortunes it could hardly be justified in voluntarily taking the offensive even with the strongest force, except in a case of absolute necessity: much less then without compulsion could it rush upon peril of its own seeking. He told them to take up their wounded as quickly as they could and the troops and stores which they had brought with them, and leaving behind what they had taken from the enemy's country, in order to lighten the ships, to sail off to Samos, and there concentrating all their ships to attack as opportunity served. As he spoke so he acted; and thus not now more than afterwards, nor in this alone but in all that he had to do with, did Phrynichus show himself a man of sense. In this way that very evening the Athenians broke up from before Miletus, leaving their victory unfinished, and the Argives, mortified at their disaster, promptly sailed off home from Samos.
28As soon as it was morning the Peloponnesians weighed from Teichiussa and put into Miletus after the departure of the Athenians; they stayed one day, and on the next took with them the Chian vessels originally chased into port with Chalcideus, and resolved to sail back for the tackle which they had put on shore at Teichiussa. Upon their arrival Tissaphernes came to them with his land forces and induced them to sail to Iasus, which was held by his enemy Amorges. Accordingly they suddenly attacked and took Iasus, whose inhabitants never imagined that the ships could be other than Athenian. The Syracusans distinguished themselves most in the action. Amorges, a bastard of Pissuthnes and a rebel from the King, was taken alive and handed over to Tissaphernes, to carry to the King, if he chose, according to his orders: Iasus was sacked by the army, who found a very great booty there, the place being wealthy from ancient date. The mercenaries serving with Amorges the Peloponnesians received and enrolled in their army without doing them any harm, since most of them came from Peloponnese, and handed over the town to Tissaphernes with all the captives, bond or free, at the stipulated price of one Doric stater a head; after which they returned to Miletus. Pedaritus, son of Leon, who had been sent by the Lacedaemonians to take the command at Chios, they dispatched by land as far as Erythrae with the mercenaries taken from Amorges; appointing Philip to remain as governor of Miletus.
Summer was now over. 29The winter following, Tissaphernes put Iasus in a state of defence, and passing on to Miletus distributed a month's pay to all the ships as he had promised at Lacedaemon, at the rate of an Attic drachma a day for each man. In future, however, he was resolved not to give more than three obols, until he had consulted the King; when if the King should so order he would give, he said, the full drachma. However, upon the protest of the Syracusan general Hermocrates (for as Therimenes was not admiral, but only accompanied them in order to hand over the ships to Astyochus, he made little difficulty about the pay), it was agreed that the amount of five ships' pay should be given over and above the three obols a day for each man; Tissaphernes paying thirty talents a month for fifty-five ships, and to the rest, for as many ships as they had beyond that number, at the same rate.
30The same winter the Athenians in Samos, having been joined by thirty-five more vessels from home under Charminus, Strombichides, and Euctemon, called in their squadron at Chios and all the rest, intending to blockade Miletus with their navy, and to send a fleet and an army against Chios; drawing lots for the respective services. This intention they carried into effect; Strombichides, Onamacles, and Euctemon sailing against Chios, which fell to their lot, with thirty ships and a part of the thousand heavy infantry, who had been to Miletus, in transports; while the rest remained masters of the sea with seventy-four ships at Samos, and advanced upon Miletus.
31Meanwhile Astyochus, whom we left at Chios collecting the hostages required in consequence of the conspiracy, stopped upon learning that the fleet with Therimenes had arrived, and that the affairs of the league were in a more flourishing condition, and putting out to sea with ten Peloponnesian and as many Chian vessels, after a futile attack upon Pteleum, coasted on to Clazomenae, and ordered the Athenian party to remove inland to Daphnus, and to join the Peloponnesians, an order in which also joined Tamos the king's lieutenant in Ionia. This order being disregarded, Astyochus made an attack upon the town, which was unwalled, and having failed to take it was himself carried off by a strong gale to Phocaea and Cuma, while the rest of the ships put in at the islands adjacent to Clazomenae--Marathussa, Pele, and Drymussa. Here they were detained eight days by the winds, and, plundering and consuming all the property of the Clazomenians there deposited, put the rest on shipboard and sailed off to Phocaea and Cuma to join Astyochus.
32While he was there, envoys arrived from the Lesbians who wished to revolt again. With Astyochus they were successful; but the Corinthians and the other allies being averse to it by reason of their former failure, he weighed anchor and set sail for Chios, where they eventually arrived from different quarters, the fleet having been scattered by a storm. After this Pedaritus, whom we left marching along the coast from Miletus, arrived at Erythrae, and thence crossed over with his army to Chios, where he found also about five hundred soldiers who had been left there by Chalcideus from the five ships with their arms. Meanwhile some Lesbians making offers to revolt, Astyochus urged upon Pedaritus and the Chians that they ought to go with their ships and effect the revolt of Lesbos, and so increase the number of their allies, or, if not successful, at all events harm the Athenians. The Chians, however, turned a deaf ear to this, and Pedaritus flatly refused to give up to him the Chian vessels.
33Upon this Astyochus took five Corinthian and one Megarian vessel, with another from Hermione, and the ships which had come with him from Laconia, and set sail for Miletus to assume his command as admiral; after telling the Chians with many threats that he would certainly not come and help them if they should be in need. At Corycus in the Erythraeid he brought to for the night; the Athenian armament sailing from Samos against Chios being only separated from him by a hill, upon the other side of which it brought to; so that neither perceived the other. But a letter arriving in the night from Pedaritus to say that some liberated Erythraean prisoners had come from Samos to betray Erythrae, Astyochus at once put back to Erythrae, and so just escaped falling in with the Athenians. Here Pedaritus sailed over to join him; and after inquiry into the pretended treachery, finding that the whole story had been made up to procure the escape of the men from Samos, they acquitted them of the charge, and sailed away, Pedaritus to Chios and Astyochus to Miletus as he had intended.
34Meanwhile the Athenian armament sailing round Corycus fell in with three Chian men-of-war off Arginus, and gave immediate chase. A great storm coming on, the Chians with difficulty took refuge in the harbour; the three Athenian vessels most forward in the pursuit being wrecked and thrown up near the city of Chios, and the crews slain or taken prisoners. The rest of the Athenian fleet took refuge in the harbour called Phoenicus, under Mount Mimas, and from thence afterwards put into Lesbos and prepared for the work of fortification.
35The same winter the Lacedaemonian Hippocrates sailed out from Peloponnese with ten Thurian ships under the command of Dorieus, son of Diagoras, and two colleagues, one Laconian and one Syracusan vessel, and arrived at Cnidus, which had already revolted at the instigation of Tissaphernes. When their arrival was known at Miletus, orders came to them to leave half their squadron to guard Cnidus, and with the rest to cruise round Triopium and seize all the merchantmen arriving from Egypt. Triopium is a promontory of Cnidus and sacred to Apollo. This coming to the knowledge of the Athenians, they sailed from Samos and captured the six ships on the watch at Triopium, the crews escaping out of them. After this the Athenians sailed into Cnidus and made an assault upon the town, which was unfortified, and all but took it; and the next day assaulted it again, but with less effect, as the inhabitants had improved their defences during the night, and had been reinforced by the crews escaped from the ships at Triopium. The Athenians now withdrew, and after plundering the Cnidian territory sailed back to Samos.
36About the same time Astyochus came to the fleet at Miletus. The Peloponnesian camp was still plentifully supplied, being in receipt of sufficient pay, and the soldiers having still in hand the large booty taken at Iasus. The Milesians also showed great ardour for the war. Nevertheless the Peloponnesians thought the first convention with Tissaphernes, made with Chalcideus, defective, and more advantageous to him than to them, and consequently while Therimenes was still there concluded another, which was as follows:
37The convention of the Lacedaemonians and the allies with King Darius and the sons of the King, and with Tissaphernes for a treaty and friendship, as follows:
1. Neither the Lacedaemonians nor the allies of the Lacedaemonians shall make war against or otherwise injure any country or cities that belong to King Darius or did belong to his father or to his ancestors; neither shall the Lacedaemonians nor the allies of the Lacedaemonians exact tribute from such cities. Neither shall King Darius nor any of the subjects of the King make war against or otherwise injure the Lacedaemonians or their allies.
2. If the Lacedaemonians or their allies should require any assistance from the King, or the King from the Lacedaemonians or their allies, whatever they both agree upon they shall be right in doing.
3. Both shall carry on jointly the war against the Athenians and their allies: and if they make peace, both shall do so jointly.
4. The expense of all troops in the King's country, sent for by the King, shall be borne by the King.
5. If any of the states comprised in this convention with the King attack the King's country, the rest shall stop them and aid the King to the best of their power. And if any in the King's country or in the countries under the King's rule attack the country of the Lacedaemonians or their allies, the King shall stop it and help them to the best of his power.
38After this convention Therimenes handed over the fleet to Astyochus, sailed off in a small boat, and was lost. The Athenian armament had now crossed over from Lesbos to Chios, and being master by sea and land began to fortify Delphinium, a place naturally strong on the land side, provided with more than one harbour, and also not far from the city of Chios. Meanwhile the Chians remained inactive. Already defeated in so many battles, they were now also at discord among themselves; the execution of the party of Tydeus, son of Ion, by Pedaritus upon the charge of Atticism, followed by the forcible imposition of an oligarchy upon the rest of the city, having made them suspicious of one another; and they therefore thought neither themselves not the mercenaries under Pedaritus a match for the enemy. They sent, however, to Miletus to beg Astyochus to assist them, which he refused to do, and was accordingly denounced at Lacedaemon by Pedaritus as a traitor. 39Such was the state of the Athenian affairs at Chios; while their fleet at Samos kept sailing out against the enemy in Miletus, until they found that he would not accept their challenge, and then retired again to Samos and remained quiet.
In the same winter the twenty-seven ships equipped by the Lacedaemonians for Pharnabazus through the agency of the Megarian Calligeitus, and the Cyzicene Timagoras, put out from Peloponnese and sailed for Ionia about the time of the solstice, under the command of Antisthenes, a Spartan. With them the Lacedaemonians also sent eleven Spartans as advisers to Astyochus; Lichas, son of Arcesilaus, being among the number. Arrived at Miletus, their orders were to aid in generally superintending the good conduct of the war; to send off the above ships or a greater or less number to the Hellespont to Pharnabazus, if they thought proper, appointing Clearchus, son of Ramphias, who sailed with them, to the command; and further, if they thought proper, to make Antisthenes admiral, dismissing Astyochus, whom the letters of Pedaritus had caused to be regarded with suspicion. Sailing accordingly from Malea across the open sea, the squadron touched at Melos and there fell in with ten Athenian ships, three of which they took empty and burned. After this, being afraid that the Athenian vessels escaped from Melos might, as they in fact did, give information of their approach to the Athenians at Samos, they sailed to Crete, and having lengthened their voyage by way of precaution made land at Caunus in Asia, from whence considering themselves in safety they sent a message to the fleet at Miletus for a convoy along the coast.
40Meanwhile the Chians and Pedaritus, undeterred by the backwardness of Astyochus, went on sending messengers pressing him to come with all the fleet to assist them against their besiegers, and not to leave the greatest of the allied states in Ionia to be shut up by sea and overrun and pillaged by land. There were more slaves at Chios than in any one other city except Lacedaemon, and being also by reason of their numbers punished more rigorously when they offended, most of them, when they saw the Athenian armament firmly established in the island with a fortified position, immediately deserted to the enemy, and through their knowledge of the country did the greatest mischief. The Chians therefore urged upon Astyochus that it was his duty to assist them, while there was still a hope and a possibility of stopping the enemy's progress, while Delphinium was still in process of fortification and unfinished, and before the completion of a higher rampart which was being added to protect the camp and fleet of their besiegers. Astyochus now saw that the allies also wished it and prepared to go, in spite of his intention to the contrary owing to the threat already referred to.
41In the meantime news came from Caunus of the arrival of the twenty-seven ships with the Lacedaemonian commissioners; and Astyochus, postponing everything to the duty of convoying a fleet of that importance, in order to be more able to command the sea, and to the safe conduct of the Lacedaemonians sent as spies over his behaviour, at once gave up going to Chios and set sail for Caunus. As he coasted along he landed at the Meropid Cos and sacked the city, which was unfortified and had been lately laid in ruins by an earthquake, by far the greatest in living memory, and, as the inhabitants had fled to the mountains, overran the country and made booty of all it contained, letting go, however, the free men. From Cos arriving in the night at Cnidus he was constrained by the representations of the Cnidians not to disembark the sailors, but to sail as he was straight against the twenty Athenian vessels, which with Charminus, one of the commanders at Samos, were on the watch for the very twenty-seven ships from Peloponnese which Astyochus was himself sailing to join; the Athenians in Samos having heard from Melos of their approach, and Charminus being on the look-out off Syme, Chalce, Rhodes, and Lycia, as he now heard that they were at Caunus.
42Astyochus accordingly sailed as he was to Syme, before he was heard of, in the hope of catching the enemy somewhere out at sea. Rain, however, and foggy weather encountered him, and caused his ships to straggle and get into disorder in the dark. In the morning his fleet had parted company and was most of it still straggling round the island, and the left wing only in sight of Charminus and the Athenians, who took it for the squadron which they were watching for from Caunus, and hastily put out against it with part only of their twenty vessels, and attacking immediately sank three ships and disabled others, and had the advantage in the action until the main body of the fleet unexpectedly hove in sight, when they were surrounded on every side. Upon this they took to flight, and after losing six ships with the rest escaped to Teutlussa or Beet Island, and from thence to Halicarnassus. After this the Peloponnesians put into Cnidus and, being joined by the twenty-seven ships from Caunus, sailed all together and set up a trophy in Syme, and then returned to anchor at Cnidus.
43As soon as the Athenians knew of the sea-fight, they sailed with all the ships at Samos to Syme, and, without attacking or being attacked by the fleet at Cnidus, took the ships' tackle left at Syme, and touching at Lorymi on the mainland sailed back to Samos. Meanwhile the Peloponnesian ships, being now all at Cnidus, underwent such repairs as were needed; while the eleven Lacedaemonian commissioners conferred with Tissaphernes, who had come to meet them, upon the points which did not satisfy them in the past transactions, and upon the best and mutually most advantageous manner of conducting the war in future. The severest critic of the present proceedings was Lichas, who said that neither of the treaties could stand, neither that of Chalcideus, nor that of Therimenes; it being monstrous that the King should at this date pretend to the possession of all the country formerly ruled by himself or by his ancestors--a pretension which implicitly put back under the yoke all the islands--Thessaly, Locris, and everything as far as Boeotia--and made the Lacedaemonians give to the Hellenes instead of liberty a Median master. He therefore invited Tissaphernes to conclude another and a better treaty, as they certainly would not recognize those existing and did not want any of his pay upon such conditions. This offended Tissaphernes so much that he went away in a rage without settling anything.
Twentieth and Twenty-first Years of the War - Intrigues of Alcibiades - Withdrawal of the Persian Subsidies - Oligarchical Coup d'Etat at Athens - Patriotism of the Army at Samos[edit]
44The Peloponnesians now determined to sail to Rhodes, upon the invitation of some of the principal men there, hoping to gain an island powerful by the number of its seamen and by its land forces, and also thinking that they would be able to maintain their fleet from their own confederacy, without having to ask for money from Tissaphernes. They accordingly at once set sail that same winter from Cnidus, and first put in with ninety-four ships at Camirus in the Rhodian country, to the great alarm of the mass of the inhabitants, who were not privy to the intrigue, and who consequently fled, especially as the town was unfortified. They were afterwards, however, assembled by the Lacedaemonians together with the inhabitants of the two other towns of Lindus and Ialysus; and the Rhodians were persuaded to revolt from the Athenians and the island went over to the Peloponnesians. Meanwhile the Athenians had received the alarm and set sail with the fleet from Samos to forestall them, and came within sight of the island, but being a little too late sailed off for the moment to Chalce, and from thence to Samos, and subsequently waged war against Rhodes, issuing from Chalce, Cos, and Samos.
The Peloponnesians now levied a contribution of thirty-two talents from the Rhodians, after which they hauled their ships ashore and for eighty days remained inactive. 45During this time, and even earlier, before they removed to Rhodes, the following intrigues took place. After the death of Chalcideus and the battle at Miletus, Alcibiades began to be suspected by the Peloponnesians; and Astyochus received from Lacedaemon an order from them to put him to death, he being the personal enemy of Agis, and in other respects thought unworthy of confidence. Alcibiades in his alarm first withdrew to Tissaphernes, and immediately began to do all he could with him to injure the Peloponnesian cause. Henceforth becoming his adviser in everything, he cut down the pay from an Attic drachma to three obols a day, and even this not paid too regularly; and told Tissaphernes to say to the Peloponnesians that the Athenians, whose maritime experience was of an older date than their own, only gave their men three obols, not so much from poverty as to prevent their seamen being corrupted by being too well off, and injuring their condition by spending money upon enervating indulgences, and also paid their crews irregularly in order to have a security against their deserting in the arrears which they would leave behind them. He also told Tissaphernes to bribe the captains and generals of the cities, and so to obtain their connivance--an expedient which succeeded with all except the Syracusans, Hermocrates alone opposing him on behalf of the whole confederacy. Meanwhile the cities asking for money Alcibiades sent off, by roundly telling them in the name of Tissaphernes that it was great impudence in the Chians, the richest people in Hellas, not content with being defended by a foreign force, to expect others to risk not only their lives but their money as well in behalf of their freedom; while the other cities, he said, had had to pay largely to Athens before their rebellion, and could not justly refuse to contribute as much or even more now for their own selves. He also pointed out that Tissaphernes was at present carrying on the war at his own charges, and had good cause for economy, but that as soon as he received remittances from the king he would give them their pay in full and do what was reasonable for the cities.
46Alcibiades further advised Tissaphernes not to be in too great a hurry to end the war, or to let himself be persuaded to bring up the Phoenician fleet which he was equipping, or to provide pay for more Hellenes, and thus put the power by land and sea into the same hands; but to leave each of the contending parties in possession of one element, thus enabling the king when he found one troublesome to call in the other. For if the command of the sea and land were united in one hand, he would not know where to turn for help to overthrow the dominant power; unless he at last chose to stand up himself, and go through with the struggle at great expense and hazard. The cheapest plan was to let the Hellenes wear each other out, at a small share of the expense and without risk to himself. Besides, he would find the Athenians the most convenient partners in empire as they did not aim at conquests on shore, and carried on the war upon principles and with a practice most advantageous to the King; being prepared to combine to conquer the sea for Athens, and for the King all the Hellenes inhabiting his country, whom the Peloponnesians, on the contrary, had come to liberate. Now it was not likely that the Lacedaemonians would free the Hellenes from the Hellenic Athenians, without freeing them also from the barbarian Mede, unless overthrown by him in the meanwhile. Alcibiades therefore urged him to wear them both out at first, and, after docking the Athenian power as much as he could, forthwith to rid the country of the Peloponnesians. In the main Tissaphernes approved of this policy, so far at least as could be conjectured from his behaviour; since he now gave his confidence to Alcibiades in recognition of his good advice, and kept the Peloponnesians short of money, and would not let them fight at sea, but ruined their cause by pretending that the Phoenician fleet would arrive, and that they would thus be enabled to contend with the odds in their favour, and so made their navy lose its efficiency, which had been very remarkable, and generally betrayed a coolness in the war that was too plain to be mistaken.
47Alcibiades gave this advice to Tissaphernes and the King, with whom he then was, not merely because he thought it really the best, but because he was studying means to effect his restoration to his country, well knowing that if he did not destroy it he might one day hope to persuade the Athenians to recall him, and thinking that his best chance of persuading them lay in letting them see that he possessed the favour of Tissaphernes. The event proved him to be right. When the Athenians at Samos found that he had influence with Tissaphernes, principally of their own motion (though partly also through Alcibiades himself sending word to their chief men to tell the best men in the army that, if there were only an oligarchy in the place of the rascally democracy that had banished him, he would be glad to return to his country and to make Tissaphernes their friend), the captains and chief men in the armament at once embraced the idea of subverting the democracy.
48The design was first mooted in the camp, and afterwards from thence reached the city. Some persons crossed over from Samos and had an interview with Alcibiades, who immediately offered to make first Tissaphernes, and afterwards the King, their friend, if they would give up the democracy and make it possible for the King to trust them. The higher class, who also suffered most severely from the war, now conceived great hopes of getting the government into their own hands, and of triumphing over the enemy. Upon their return to Samos the emissaries formed their partisans into a club, and openly told the mass of the armament that the King would be their friend, and would provide them with money, if Alcibiades were restored and the democracy abolished. The multitude, if at first irritated by these intrigues, were nevertheless kept quiet by the advantageous prospect of the pay from the King; and the oligarchical conspirators, after making this communication to the people, now re-examined the proposals of Alcibiades among themselves, with most of their associates. Unlike the rest, who thought them advantageous and trustworthy, Phrynichus, who was still general, by no means approved of the proposals. Alcibiades, he rightly thought, cared no more for an oligarchy than for a democracy, and only sought to change the institutions of his country in order to get himself recalled by his associates; while for themselves their one object should be to avoid civil discord. It was not the King's interest, when the Peloponnesians were now their equals at sea, and in possession of some of the chief cities in his empire, to go out of his way to side with the Athenians whom he did not trust, when he might make friends of the Peloponnesians who had never injured him. And as for the allied states to whom oligarchy was now offered, because the democracy was to be put down at Athens, he well knew that this would not make the rebels come in any the sooner, or confirm the loyal in their allegiance; as the allies would never prefer servitude with an oligarchy or democracy to freedom with the constitution which they actually enjoyed, to whichever type it belonged. Besides, the cities thought that the so-called better classes would prove just as oppressive as the commons, as being those who originated, proposed, and for the most part benefited from the acts of the commons injurious to the confederates. Indeed, if it depended on the better classes, the confederates would be put to death without trial and with violence; while the commons were their refuge and the chastiser of these men. This he positively knew that the cities had learned by experience, and that such was their opinion. The propositions of Alcibiades, and the intrigues now in progress, could therefore never meet with his approval.
49However, the members of the club assembled, agreeably to their original determination, accepted what was proposed, and prepared to send Pisander and others on an embassy to Athens to treat for the restoration of Alcibiades and the abolition of the democracy in the city, and thus to make Tissaphernes the friend of the Athenians.
50Phrynichus now saw that there would be a proposal to restore Alcibiades, and that the Athenians would consent to it; and fearing after what he had said against it that Alcibiades, if restored, would revenge himself upon him for his opposition, had recourse to the following expedient. He sent a secret letter to the Lacedaemonian admiral Astyochus, who was still in the neighbourhood of Miletus, to tell him that Alcibiades was ruining their cause by making Tissaphernes the friend of the Athenians, and containing an express revelation of the rest of the intrigue, desiring to be excused if he sought to harm his enemy even at the expense of the interests of his country. However, Astyochus, instead of thinking of punishing Alcibiades, who, besides, no longer ventured within his reach as formerly, went up to him and Tissaphernes at Magnesia, communicated to them the letter from Samos, and turned informer, and, if report may be trusted, became the paid creature of Tissaphernes, undertaking to inform him as to this and all other matters; which was also the reason why he did not remonstrate more strongly against the pay not being given in full. Upon this Alcibiades instantly sent to the authorities at Samos a letter against Phrynichus, stating what he had done, and requiring that he should be put to death. Phrynichus distracted, and placed in the utmost peril by the denunciation, sent again to Astyochus, reproaching him with having so ill kept the secret of his previous letter, and saying that he was now prepared to give them an opportunity of destroying the whole Athenian armament at Samos; giving a detailed account of the means which he should employ, Samos being unfortified, and pleading that, being in danger of his life on their account, he could not now be blamed for doing this or anything else to escape being destroyed by his mortal enemies. This also Astyochus revealed to Alcibiades.
51Meanwhile Phrynichus having had timely notice that he was playing him false, and that a letter on the subject was on the point of arriving from Alcibiades, himself anticipated the news, and told the army that the enemy, seeing that Samos was unfortified and the fleet not all stationed within the harbour, meant to attack the camp, that he could be certain of this intelligence, and that they must fortify Samos as quickly as possible, and generally look to their defences. It will be remembered that he was general, and had himself authority to carry out these measures. Accordingly they addressed themselves to the work of fortification, and Samos was thus fortified sooner than it would otherwise have been. Not long afterwards came the letter from Alcibiades, saying that the army was betrayed by Phrynichus, and the enemy about to attack it. Alcibiades, however, gained no credit, it being thought that he was in the secret of the enemy's designs, and had tried to fasten them upon Phrynichus, and to make out that he was their accomplice, out of hatred; and consequently far from hurting him he rather bore witness to what he had said by this intelligence.
52After this Alcibiades set to work to persuade Tissaphernes to become the friend of the Athenians. Tissaphernes, although afraid of the Peloponnesians because they had more ships in Asia than the Athenians, was yet disposed to be persuaded if he could, especially after his quarrel with the Peloponnesians at Cnidus about the treaty of Therimenes. The quarrel had already taken place, as the Peloponnesians were by this time actually at Rhodes; and in it the original argument of Alcibiades touching the liberation of all the towns by the Lacedaemonians had been verified by the declaration of Lichas that it was impossible to submit to a convention which made the King master of all the states at any former time ruled by himself or by his fathers.
While Alcibiades was besieging the favour of Tissaphernes with an earnestness proportioned to the greatness of the issue, 53the Athenian envoys who had been dispatched from Samos with Pisander arrived at Athens, and made a speech before the people, giving a brief summary of their views, and particularly insisting that, if Alcibiades were recalled and the democratic constitution changed, they could have the King as their ally, and would be able to overcome the Peloponnesians. A number of speakers opposed them on the question of the democracy, the enemies of Alcibiades cried out against the scandal of a restoration to be effected by a violation of the constitution, and the Eumolpidae and Ceryces protested in behalf of the mysteries, the cause of his banishment, and called upon the gods to avert his recall; when Pisander, in the midst of much opposition and abuse, came forward, and taking each of his opponents aside asked him the following question: In the face of the fact that the Peloponnesians had as many ships as their own confronting them at sea, more cities in alliance with them, and the King and Tissaphernes to supply them with money, of which the Athenians had none left, had he any hope of saving the state, unless someone could induce the King to come over to their side? Upon their replying that they had not, he then plainly said to them: "This we cannot have unless we have a more moderate form of government, and put the offices into fewer hands, and so gain the King's confidence, and forthwith restore Alcibiades, who is the only man living that can bring this about. The safety of the state, not the form of its government, is for the moment the most pressing question, as we can always change afterwards whatever we do not like."
54The people were at first highly irritated at the mention of an oligarchy, but upon understanding clearly from Pisander that this was the only resource left, they took counsel of their fears, and promised themselves some day to change the government again, and gave way. They accordingly voted that Pisander should sail with ten others and make the best arrangement that they could with Tissaphernes and Alcibiades. At the same time the people, upon a false accusation of Pisander, dismissed Phrynichus from his post together with his colleague Scironides, sending Diomedon and Leon to replace them in the command of the fleet. The accusation was that Phrynichus had betrayed Iasus and Amorges; and Pisander brought it because he thought him a man unfit for the business now in hand with Alcibiades. Pisander also went the round of all the clubs already existing in the city for help in lawsuits and elections, and urged them to draw together and to unite their efforts for the overthrow of the democracy; and after taking all other measures required by the circumstances, so that no time might be lost, set off with his ten companions on his voyage to Tissaphernes.
55In the same winter Leon and Diomedon, who had by this time joined the fleet, made an attack upon Rhodes. The ships of the Peloponnesians they found hauled up on shore, and, after making a descent upon the coast and defeating the Rhodians who appeared in the field against them, withdrew to Chalce and made that place their base of operations instead of Cos, as they could better observe from thence if the Peloponnesian fleet put out to sea. Meanwhile Xenophantes, a Laconian, came to Rhodes from Pedaritus at Chios, with the news that the fortification of the Athenians was now finished, and that, unless the whole Peloponnesian fleet came to the rescue, the cause in Chios must be lost. Upon this they resolved to go to his relief. In the meantime Pedaritus, with the mercenaries that he had with him and the whole force of the Chians, made an assault upon the work round the Athenian ships and took a portion of it, and got possession of some vessels that were hauled up on shore, when the Athenians sallied out to the rescue, and first routing the Chians, next defeated the remainder of the force round Pedaritus, who was himself killed, with many of the Chians, a great number of arms being also taken.
56After this the Chians were besieged even more straitly than before by land and sea, and the famine in the place was great. Meanwhile the Athenian envoys with Pisander arrived at the court of Tissaphernes, and conferred with him about the proposed agreement. However, Alcibiades, not being altogether sure of Tissaphernes (who feared the Peloponnesians more than the Athenians, and besides wished to wear out both parties, as Alcibiades himself had recommended), had recourse to the following stratagem to make the treaty between the Athenians and Tissaphernes miscarry by reason of the magnitude of his demands. In my opinion Tissaphernes desired this result, fear being his motive; while Alcibiades, who now saw that Tissaphernes was determined not to treat on any terms, wished the Athenians to think, not that he was unable to persuade Tissaphernes, but that after the latter had been persuaded and was willing to join them, they had not conceded enough to him. For the demands of Alcibiades, speaking for Tissaphernes, who was present, were so extravagant that the Athenians, although for a long while they agreed to whatever he asked, yet had to bear the blame of failure: he required the cession of the whole of Ionia, next of the islands adjacent, besides other concessions, and these passed without opposition; at last, in the third interview, Alcibiades, who now feared a complete discovery of his inability, required them to allow the King to build ships and sail along his own coast wherever and with as many as he pleased. Upon this the Athenians would yield no further, and concluding that there was nothing to be done, but that they had been deceived by Alcibiades, went away in a passion and proceeded to Samos.
57Tissaphernes immediately after this, in the same winter, proceeded along shore to Caunus, desiring to bring the Peloponnesian fleet back to Miletus, and to supply them with pay, making a fresh convention upon such terms as he could get, in order not to bring matters to an absolute breach between them. He was afraid that if many of their ships were left without pay they would be compelled to engage and be defeated, or that their vessels being left without hands the Athenians would attain their objects without his assistance. Still more he feared that the Peloponnesians might ravage the continent in search of supplies. Having calculated and considered all this, agreeably to his plan of keeping the two sides equal, he now sent for the Peloponnesians and gave them pay, and concluded with them a third treaty in words following:
58In the thirteenth year of the reign of Darius, while Alexippidas was ephor at Lacedaemon, a convention was concluded in the plain of the Maeander by the Lacedaemonians and their allies with Tissaphernes, Hieramenes, and the sons of Pharnaces, concerning the affairs of the King and of the Lacedaemonians and their allies.
1. The country of the King in Asia shall be the King's, and the King shall treat his own country as he pleases.
2. The Lacedaemonians and their allies shall not invade or injure the King's country: neither shall the King invade or injure that of the Lacedaemonians or of their allies. If any of the Lacedaemonians or of their allies invade or injure the King's country, the Lacedaemonians and their allies shall prevent it: and if any from the King's country invade or injure the country of the Lacedaemonians or of their allies, the King shall prevent it.
3. Tissaphernes shall provide pay for the ships now present, according to the agreement, until the arrival of the King's vessels: but after the arrival of the King's vessels the Lacedaemonians and their allies may pay their own ships if they wish it. If, however, they choose to receive the pay from Tissaphernes, Tissaphernes shall furnish it: and the Lacedaemonians and their allies shall repay him at the end of the war such moneys as they shall have received.
4. After the vessels have arrived, the ships of the Lacedaemonians and of their allies and those of the King shall carry on the war jointly, according as Tissaphernes and the Lacedaemonians and their allies shall think best. If they wish to make peace with the Athenians, they shall make peace also jointly.
59This was the treaty. After this Tissaphernes prepared to bring up the Phoenician fleet according to agreement, and to make good his other promises, or at all events wished to make it appear that he was so preparing.
60Winter was now drawing towards its close, when the Boeotians took Oropus by treachery, though held by an Athenian garrison. Their accomplices in this were some of the Eretrians and of the Oropians themselves, who were plotting the revolt of Euboea, as the place was exactly opposite Eretria, and while in Athenian hands was necessarily a source of great annoyance to Eretria and the rest of Euboea. Oropus being in their hands, the Eretrians now came to Rhodes to invite the Peloponnesians into Euboea. The latter, however, were rather bent on the relief of the distressed Chians, and accordingly put out to sea and sailed with all their ships from Rhodes. Off Triopium they sighted the Athenian fleet out at sea sailing from Chalce, and, neither attacking the other, arrived, the latter at Samos, the Peloponnesians at Miletus, seeing that it was no longer possible to relieve Chios without a battle. And this winter ended, and with it ended the twentieth year of this war of which Thucydides is the historian.
Earl61y in the spring of the summer following, Dercyllidas, a Spartan, was sent with a small force by land to the Hellespont to effect the revolt of Abydos, which is a Milesian colony; and the Chians, while Astyochus was at a loss how to help them, were compelled to fight at sea by the pressure of the siege. While Astyochus was still at Rhodes they had received from Miletus, as their commander after the death of Pedaritus, a Spartan named Leon, who had come out with Antisthenes, and twelve vessels which had been on guard at Miletus, five of which were Thurian, four Syracusans, one from Anaia, one Milesian, and one Leon's own. Accordingly the Chians marched out in mass and took up a strong position, while thirty-six of their ships put out and engaged thirty-two of the Athenians; and after a tough fight, in which the Chians and their allies had rather the best of it, as it was now late, retired to their city.
62Immediately after this Dercyllidas arrived by land from Miletus; and Abydos in the Hellespont revolted to him and Pharnabazus, and Lampsacus two days later. Upon receipt of this news Strombichides hastily sailed from Chios with twenty-four Athenian ships, some transports carrying heavy infantry being of the number, and defeating the Lampsacenes who came out against him, took Lampsacus, which was unfortified, at the first assault, and making prize of the slaves and goods restored the freemen to their homes, and went on to Abydos. The inhabitants, however, refusing to capitulate, and his assaults failing to take the place, he sailed over to the coast opposite, and appointed Sestos, the town in the Chersonese held by the Medes at a former period in this history, as the centre for the defence of the whole Hellespont.
63In the meantime the Chians commanded the sea more than before; and the Peloponnesians at Miletus and Astyochus, hearing of the sea-fight and of the departure of the squadron with Strombichides, took fresh courage. Coasting along with two vessels to Chios, Astyochus took the ships from that place, and now moved with the whole fleet upon Samos, from whence, however, he sailed back to Miletus, as the Athenians did not put out against him, owing to their suspicions of one another. For it was about this time, or even before, that the democracy was put down at Athens. When Pisander and the envoys returned from Tissaphernes to Samos they at once strengthened still further their interest in the army itself, and instigated the upper class in Samos to join them in establishing an oligarchy, the very form of government which a party of them had lately risen to avoid. At the same time the Athenians at Samos, after a consultation among themselves, determined to let Alcibiades alone, since he refused to join them, and besides was not the man for an oligarchy; and now that they were once embarked, to see for themselves how they could best prevent the ruin of their cause, and meanwhile to sustain the war, and to contribute without stint money and all else that might be required from their own private estates, as they would henceforth labour for themselves alone.
64After encouraging each other in these resolutions, they now at once sent off half the envoys and Pisander to do what was necessary at Athens (with instructions to establish oligarchies on their way in all the subject cities which they might touch at), and dispatched the other half in different directions to the other dependencies. Diitrephes also, who was in the neighbourhood of Chios, and had been elected to the command of the Thracian towns, was sent off to his government, and arriving at Thasos abolished the democracy there. Two months, however, had not elapsed after his departure before the Thasians began to fortify their town, being already tired of an aristocracy with Athens, and in daily expectation of freedom from Lacedaemon. Indeed there was a party of them (whom the Athenians had banished), with the Peloponnesians, who with their friends in the town were already making every exertion to bring a squadron, and to effect the revolt of Thasos; and this party thus saw exactly what they most wanted done, that is to say, the reformation of the government without risk, and the abolition of the democracy which would have opposed them. Things at Thasos thus turned out just the contrary to what the oligarchical conspirators at Athens expected; and the same in my opinion was the case in many of the other dependencies; as the cities no sooner got a moderate government and liberty of action, than they went on to absolute freedom without being at all seduced by the show of reform offered by the Athenians.
65Pisander and his colleagues on their voyage alongshore abolished, as had been determined, the democracies in the cities, and also took some heavy infantry from certain places as their allies, and so came to Athens. Here they found most of the work already done by their associates. Some of the younger men had banded together, and secretly assassinated one Androcles, the chief leader of the commons, and mainly responsible for the banishment of Alcibiades; Androcles being singled out both because he was a popular leader and because they sought by his death to recommend themselves to Alcibiades, who was, as they supposed, to be recalled, and to make Tissaphernes their friend. There were also some other obnoxious persons whom they secretly did away with in the same manner. Meanwhile their cry in public was that no pay should be given except to persons serving in the war, and that not more than five thousand should share in the government, and those such as were most able to serve the state in person and in purse.
66But this was a mere catchword for the multitude, as the authors of the revolution were really to govern. However, the Assembly and the Council of the Bean still met notwithstanding, although they discussed nothing that was not approved of by the conspirators, who both supplied the speakers and reviewed in advance what they were to say. Fear, and the sight of the numbers of the conspirators, closed the mouths of the rest; or if any ventured to rise in opposition, he was presently put to death in some convenient way, and there was neither search for the murderers nor justice to be had against them if suspected; but the people remained motionless, being so thoroughly cowed that men thought themselves lucky to escape violence, even when they held their tongues. An exaggerated belief in the numbers of the conspirators also demoralized the people, rendered helpless by the magnitude of the city, and by their want of intelligence with each other, and being without means of finding out what those numbers really were. For the same reason it was impossible for any one to open his grief to a neighbour and to concert measures to defend himself, as he would have had to speak either to one whom he did not know, or whom he knew but did not trust. Indeed all the popular party approached each other with suspicion, each thinking his neighbour concerned in what was going on, the conspirators having in their ranks persons whom no one could ever have believed capable of joining an oligarchy; and these it was who made the many so suspicious, and so helped to procure impunity for the few, by confirming the commons in their mistrust of one another.
67At this juncture arrived Pisander and his colleagues, who lost no time in doing the rest. First they assembled the people, and moved to elect ten commissioners with full powers to frame a constitution, and that when this was done they should on an appointed day lay before the people their opinion as to the best mode of governing the city. Afterwards, when the day arrived, the conspirators enclosed the assembly in Colonus, a temple of Poseidon, a little more than a mile outside the city; when the commissioners simply brought forward this single motion, that any Athenian might propose with impunity whatever measure he pleased, heavy penalties being imposed upon any who should indict for illegality, or otherwise molest him for so doing. The way thus cleared, it was now plainly declared that all tenure of office and receipt of pay under the existing institutions were at an end, and that five men must be elected as presidents, who should in their turn elect one hundred, and each of the hundred three apiece; and that this body thus made up to four hundred should enter the council chamber with full powers and govern as they judged best, and should convene the five thousand whenever they pleased.
68The man who moved this resolution was Pisander, who was throughout the chief ostensible agent in putting down the democracy. But he who concerted the whole affair, and prepared the way for the catastrophe, and who had given the greatest thought to the matter, was Antiphon, one of the best men of his day in Athens; who, with a head to contrive measures and a tongue to recommend them, did not willingly come forward in the assembly or upon any public scene, being ill looked upon by the multitude owing to his reputation for talent; and who yet was the one man best able to aid in the courts, or before the assembly, the suitors who required his opinion. Indeed, when he was afterwards himself tried for his life on the charge of having been concerned in setting up this very government, when the Four Hundred were overthrown and hardly dealt with by the commons, he made what would seem to be the best defence of any known up to my time. Phrynichus also went beyond all others in his zeal for the oligarchy. Afraid of Alcibiades, and assured that he was no stranger to his intrigues with Astyochus at Samos, he held that no oligarchy was ever likely to restore him, and once embarked in the enterprise, proved, where danger was to be faced, by far the staunchest of them all. Theramenes, son of Hagnon, was also one of the foremost of the subverters of the democracy--a man as able in council as in debate. Conducted by so many and by such sagacious heads, the enterprise, great as it was, not unnaturally went forward; although it was no light matter to deprive the Athenian people of its freedom, almost a hundred years after the deposition of the tyrants, when it had been not only not subject to any during the whole of that period, but accustomed during more than half of it to rule over subjects of its own.
69The assembly ratified the proposed constitution, without a single opposing voice, and was then dissolved; after which the Four Hundred were brought into the council chamber in the following way. On account of the enemy at Decelea, all the Athenians were constantly on the wall or in the ranks at the various military posts. On that day the persons not in the secret were allowed to go home as usual, while orders were given to the accomplices of the conspirators to hang about, without making any demonstration, at some little distance from the posts, and in case of any opposition to what was being done, to seize the arms and put it down. There were also some Andrians and Tenians, three hundred Carystians, and some of the settlers in Aegina come with their own arms for this very purpose, who had received similar instructions. These dispositions completed, the Four Hundred went, each with a dagger concealed about his person, accompanied by one hundred and twenty Hellenic youths, whom they employed wherever violence was needed, and appeared before the Councillors of the Bean in the council chamber, and told them to take their pay and be gone; themselves bringing it for the whole of the residue of their term of office, and giving it to them as they went out.
70Upon the Council withdrawing in this way without venturing any objection, and the rest of the citizens making no movement, the Four Hundred entered the council chamber, and for the present contented themselves with drawing lots for their Prytanes, and making their prayers and sacrifices to the gods upon entering office, but afterwards departed widely from the democratic system of government, and except that on account of Alcibiades they did not recall the exiles, ruled the city by force; putting to death some men, though not many, whom they thought it convenient to remove, and imprisoning and banishing others. They also sent to Agis, the Lacedaemonian king, at Decelea, to say that they desired to make peace, and that he might reasonably be more disposed to treat now that he had them to deal with instead of the inconstant commons.
71Agis, however, did not believe in the tranquillity of the city, or that the commons would thus in a moment give up their ancient liberty, but thought that the sight of a large Lacedaemonian force would be sufficient to excite them if they were not already in commotion, of which he was by no means certain. He accordingly gave to the envoys of the Four Hundred an answer which held out no hopes of an accommodation, and sending for large reinforcements from Peloponnese, not long afterwards, with these and his garrison from Decelea, descended to the very walls of Athens; hoping either that civil disturbances might help to subdue them to his terms, or that, in the confusion to be expected within and without the city, they might even surrender without a blow being struck; at all events he thought he would succeed in seizing the Long Walls, bared of their defenders. However, the Athenians saw him come close up, without making the least disturbance within the city; and sending out their cavalry, and a number of their heavy infantry, light troops, and archers, shot down some of his soldiers who approached too near, and got possession of some arms and dead. Upon this Agis, at last convinced, led his army back again and, remaining with his own troops in the old position at Decelea, sent the reinforcement back home, after a few days' stay in Attica. After this the Four Hundred persevering sent another embassy to Agis, and now meeting with a better reception, at his suggestion dispatched envoys to Lacedaemon to negotiate a treaty, being desirous of making peace.
72They also sent ten men to Samos to reassure the army, and to explain that the oligarchy was not established for the hurt of the city or the citizens, but for the salvation of the country at large; and that there were five thousand, not four hundred only, concerned; although, what with their expeditions and employments abroad, the Athenians had never yet assembled to discuss a question important enough to bring five thousand of them together. The emissaries were also told what to say upon all other points, and were so sent off immediately after the establishment of the new government, which feared, as it turned out justly, that the mass of seamen would not be willing to remain under the oligarchical constitution, and, the evil beginning there, might be the means of their overthrow.
73Indeed at Samos the question of the oligarchy had already entered upon a new phase, the following events having taken place just at the time that the Four Hundred were conspiring. That part of the Samian population which has been mentioned as rising against the upper class, and as being the democratic party, had now turned round, and yielding to the solicitations of Pisander during his visit, and of the Athenians in the conspiracy at Samos, had bound themselves by oaths to the number of three hundred, and were about to fall upon the rest of their fellow citizens, whom they now in their turn regarded as the democratic party. Meanwhile they put to death one Hyperbolus, an Athenian, a pestilent fellow that had been ostracized, not from fear of his influence or position, but because he was a rascal and a disgrace to the city; being aided in this by Charminus, one of the generals, and by some of the Athenians with them, to whom they had sworn friendship, and with whom they perpetrated other acts of the kind, and now determined to attack the people. The latter got wind of what was coming, and told two of the generals, Leon and Diomedon, who, on account of the credit which they enjoyed with the commons, were unwilling supporters of the oligarchy; and also Thrasybulus and Thrasyllus, the former a captain of a galley, the latter serving with the heavy infantry, besides certain others who had ever been thought most opposed to the conspirators, entreating them not to look on and see them destroyed, and Samos, the sole remaining stay of their empire, lost to the Athenians. Upon hearing this, the persons whom they addressed now went round the soldiers one by one, and urged them to resist, especially the crew of the Paralus, which was made up entirely of Athenians and freemen, and had from time out of mind been enemies of oligarchy, even when there was no such thing existing; and Leon and Diomedon left behind some ships for their protection in case of their sailing away anywhere themselves. Accordingly, when the Three Hundred attacked the people, all these came to the rescue, and foremost of all the crew of the Paralus; and the Samian commons gained the victory, and putting to death some thirty of the Three Hundred, and banishing three others of the ringleaders, accorded an amnesty to the rest, and lived together under a democratic government for the future.
74The ship Paralus, with Chaereas, son of Archestratus, on board, an Athenian who had taken an active part in the revolution, was now without loss of time sent off by the Samians and the army to Athens to report what had occurred; the fact that the Four Hundred were in power not being yet known. When they sailed into harbour the Four Hundred immediately arrested two or three of the Parali and, taking the vessel from the rest, shifted them into a troopship and set them to keep guard round Euboea. Chaereas, however, managed to secrete himself as soon as he saw how things stood, and returning to Samos, drew a picture to the soldiers of the horrors enacting at Athens, in which everything was exaggerated; saying that all were punished with stripes, that no one could say a word against the holders of power, that the soldiers' wives and children were outraged, and that it was intended to seize and shut up the relatives of all in the army at Samos who were not of the government's way of thinking, to be put to death in case of their disobedience; besides a host of other injurious inventions.
75On hearing this the first thought of the army was to fall upon the chief authors of the oligarchy and upon all the rest concerned. Eventually, however, they desisted from this idea upon the men of moderate views opposing it and warning them against ruining their cause, with the enemy close at hand and ready for battle. After this, Thrasybulus, son of Lycus, and Thrasyllus, the chief leaders in the revolution, now wishing in the most public manner to change the government at Samos to a democracy, bound all the soldiers by the most tremendous oaths, and those of the oligarchical party more than any, to accept a democratic government, to be united, to prosecute actively the war with the Peloponnesians, and to be enemies of the Four Hundred, and to hold no communication with them. The same oath was also taken by all the Samians of full age; and the soldiers associated the Samians in all their affairs and in the fruits of their dangers, having the conviction that there was no way of escape for themselves or for them, but that the success of the Four Hundred or of the enemy at Miletus must be their ruin.
76The struggle now was between the army trying to force a democracy upon the city, and the Four Hundred an oligarchy upon the camp. Meanwhile the soldiers forthwith held an assembly, in which they deposed the former generals and any of the captains whom they suspected, and chose new captains and generals to replace them, besides Thrasybulus and Thrasyllus, whom they had already. They also stood up and encouraged one another, and among other things urged that they ought not to lose heart because the city had revolted from them, as the party seceding was smaller and in every way poorer in resources than themselves. They had the whole fleet with which to compel the other cities in their empire to give them money just as if they had their base in the capital, having a city in Samos which, so far from wanting strength, had when at war been within an ace of depriving the Athenians of the command of the sea, while as far as the enemy was concerned they had the same base of operations as before. Indeed, with the fleet in their hands, they were better able to provide themselves with supplies than the government at home. It was their advanced position at Samos which had throughout enabled the home authorities to command the entrance into Piraeus; and if they refused to give them back the constitution, they would now find that the army was more in a position to exclude them from the sea than they were to exclude the army. Besides, the city was of little or no use towards enabling them to overcome the enemy; and they had lost nothing in losing those who had no longer either money to send them (the soldiers having to find this for themselves), or good counsel, which entitles cities to direct armies. On the contrary, even in this the home government had done wrong in abolishing the institutions of their ancestors, while the army maintained the said institutions, and would try to force the home government to do so likewise. So that even in point of good counsel the camp had as good counsellors as the city. Moreover, they had but to grant him security for his person and his recall, and Alcibiades would be only too glad to procure them the alliance of the King. And above all if they failed altogether, with the navy which they possessed, they had numbers of places to retire to in which they would find cities and lands.
77Debating together and comforting themselves after this manner, they pushed on their war measures as actively as ever; and the ten envoys sent to Samos by the Four Hundred, learning how matters stood while they were still at Delos, stayed quiet there. 78About this time a cry arose among the soldiers in the Peloponnesian fleet at Miletus that Astyochus and Tissaphernes were ruining their cause. Astyochus had not been willing to fight at sea--either before, while they were still in full vigour and the fleet of the Athenians small, or now, when the enemy was, as they were informed, in a state of sedition and his ships not yet united--but kept them waiting for the Phoenician fleet from Tissaphernes, which had only a nominal existence, at the risk of wasting away in inactivity. While Tissaphernes not only did not bring up the fleet in question, but was ruining their navy by payments made irregularly, and even then not made in full. They must therefore, they insisted, delay no longer, but fight a decisive naval engagement. The Syracusans were the most urgent of any.
79The confederates and Astyochus, aware of these murmurs, had already decided in council to fight a decisive battle; and when the news reached them of the disturbance at Samos, they put to sea with all their ships, one hundred and ten in number, and, ordering the Milesians to move by land upon Mycale, set sail thither. The Athenians with the eighty-two ships from Samos were at the moment lying at Glauce in Mycale, a point where Samos approaches near to the continent; and, seeing the Peloponnesian fleet sailing against them, retired into Samos, not thinking themselves numerically strong enough to stake their all upon a battle. Besides, they had notice from Miletus of the wish of the enemy to engage, and were expecting to be joined from the Hellespont by Strombichides, to whom a messenger had been already dispatched, with the ships that had gone from Chios to Abydos. The Athenians accordingly withdrew to Samos, and the Peloponnesians put in at Mycale, and encamped with the land forces of the Milesians and the people of the neighbourhood. The next day they were about to sail against Samos, when tidings reached them of the arrival of Strombichides with the squadron from the Hellespont, upon which they immediately sailed back to Miletus. The Athenians, thus reinforced, now in their turn sailed against Miletus with a hundred and eight ships, wishing to fight a decisive battle, but, as no one put out to meet them, sailed back to Samos.
Twenty-first Year of the War - Recall of Alcibiades to Samos - Revolt of Euboea and Downfall of the Four Hundred - Battle of Cynossema[edit]
80In the same summer, immediately after this, the Peloponnesians having refused to fight with their fleet united, through not thinking themselves a match for the enemy, and being at a loss where to look for money for such a number of ships, especially as Tissaphernes proved so bad a paymaster, sent off Clearchus, son of Ramphias, with forty ships to Pharnabazus, agreeably to the original instructions from Peloponnese; Pharnabazus inviting them and being prepared to furnish pay, and Byzantium besides sending offers to revolt to them. These Peloponnesian ships accordingly put out into the open sea, in order to escape the observation of the Athenians, and being overtaken by a storm, the majority with Clearchus got into Delos, and afterwards returned to Miletus, whence Clearchus proceeded by land to the Hellespont to take the command: ten, however, of their number, under the Megarian Helixus, made good their passage to the Hellespont, and effected the revolt of Byzantium. After this, the commanders at Samos were informed of it, and sent a squadron against them to guard the Hellespont; and an encounter took place before Byzantium between eight vessels on either side.
81Meanwhile the chiefs at Samos, and especially Thrasybulus, who from the moment that he had changed the government had remained firmly resolved to recall Alcibiades, at last in an assembly brought over the mass of the soldiery, and upon their voting for his recall and amnesty, sailed over to Tissaphernes and brought Alcibiades to Samos, being convinced that their only chance of salvation lay in his bringing over Tissaphernes from the Peloponnesians to themselves. An assembly was then held in which Alcibiades complained of and deplored his private misfortune in having been banished, and speaking at great length upon public affairs, highly incited their hopes for the future, and extravagantly magnified his own influence with Tissaphernes. His object in this was to make the oligarchical government at Athens afraid of him, to hasten the dissolution of the clubs, to increase his credit with the army at Samos and heighten their own confidence, and lastly to prejudice the enemy as strongly as possible against Tissaphernes, and blast the hopes which they entertained. Alcibiades accordingly held out to the army such extravagant promises as the following: that Tissaphernes had solemnly assured him that if he could only trust the Athenians they should never want for supplies while he had anything left, no, not even if he should have to coin his own silver couch, and that he would bring the Phoenician fleet now at Aspendus to the Athenians instead of to the Peloponnesians; but that he could only trust the Athenians if Alcibiades were recalled to be his security for them.
82Upon hearing this and much more besides, the Athenians at once elected him general together with the former ones, and put all their affairs into his hands. There was now not a man in the army who would have exchanged his present hopes of safety and vengeance upon the Four Hundred for any consideration whatever; and after what they had been told they were now inclined to disdain the enemy before them, and to sail at once for Piraeus. To the plan of sailing for Piraeus, leaving their more immediate enemies behind them, Alcibiades opposed the most positive refusal, in spite of the numbers that insisted upon it, saying that now that he had been elected general he would first sail to Tissaphernes and concert with him measures for carrying on the war. Accordingly, upon leaving this assembly, he immediately took his departure in order to have it thought that there was an entire confidence between them, and also wishing to increase his consideration with Tissaphernes, and to show that he had now been elected general and was in a position to do him good or evil as he chose; thus managing to frighten the Athenians with Tissaphernes and Tissaphernes with the Athenians.
83Meanwhile the Peloponnesians at Miletus heard of the recall of Alcibiades and, already distrustful of Tissaphernes, now became far more disgusted with him than ever. Indeed after their refusal to go out and give battle to the Athenians when they appeared before Miletus, Tissaphernes had grown slacker than ever in his payments; and even before this, on account of Alcibiades, his unpopularity had been on the increase. Gathering together, just as before, the soldiers and some persons of consideration besides the soldiery began to reckon up how they had never yet received their pay in full; that what they did receive was small in quantity, and even that paid irregularly, and that unless they fought a decisive battle or removed to some station where they could get supplies, the ships' crews would desert; and that it was all the fault of Astyochus, who humoured Tissaphernes for his own private advantage.
84The army was engaged in these reflections, when the following disturbance took place about the person of Astyochus. Most of the Syracusan and Thurian sailors were freemen, and these the freest crews in the armament were likewise the boldest in setting upon Astyochus and demanding their pay. The latter answered somewhat stiffly and threatened them, and when Dorieus spoke up for his own sailors even went so far as to lift his baton against him; upon seeing which the mass of men, in sailor fashion, rushed in a fury to strike Astyochus. He, however, saw them in time and fled for refuge to an altar; and they were thus parted without his being struck. Meanwhile the fort built by Tissaphernes in Miletus was surprised and taken by the Milesians, and the garrison in it turned out--an act which met with the approval of the rest of the allies, and in particular of the Syracusans, but which found no favour with Lichas, who said moreover that the Milesians and the rest in the King's country ought to show a reasonable submission to Tissaphernes and to pay him court, until the war should be happily settled. The Milesians were angry with him for this and for other things of the kind, and upon his afterwards dying of sickness, would not allow him to be buried where the Lacedaemonians with the army desired.
85The discontent of the army with Astyochus and Tissaphernes had reached this pitch, when Mindarus arrived from Lacedaemon to succeed Astyochus as admiral, and assumed the command. Astyochus now set sail for home; and Tissaphernes sent with him one of his confidants, Gaulites, a Carian, who spoke the two languages, to complain of the Milesians for the affair of the fort, and at the same time to defend himself against the Milesians, who were, as he was aware, on their way to Sparta chiefly to denounce his conduct, and had with them Hermocrates, who was to accuse Tissaphernes of joining with Alcibiades to ruin the Peloponnesian cause and of playing a double game. Indeed Hermocrates had always been at enmity with him about the pay not being restored in full; and eventually when he was banished from Syracuse, and new commanders--Potamis, Myscon, and Demarchus--had come out to Miletus to the ships of the Syracusans, Tissaphernes, pressed harder than ever upon him in his exile, and among other charges against him accused him of having once asked him for money, and then given himself out as his enemy because he failed to obtain it.
While Astyochus and the Milesians and Hermocrates made sail for Lacedaemon, Alcibiades had now crossed back from Tissaphernes to Samos. 86After his return the envoys of the Four Hundred sent, as has been mentioned above, to pacify and explain matters to the forces at Samos, arrived from Delos; and an assembly was held in which they attempted to speak. The soldiers at first would not hear them, and cried out to put to death the subverters of the democracy, but at last, after some difficulty, calmed down and gave them a hearing. Upon this the envoys proceeded to inform them that the recent change had been made to save the city, and not to ruin it or to deliver it over to the enemy, for they had already had an opportunity of doing this when he invaded the country during their government; that all the Five Thousand would have their proper share in the government; and that their hearers' relatives had neither outrage, as Chaereas had slanderously reported, nor other ill treatment to complain of, but were all in undisturbed enjoyment of their property just as they had left them. Besides these they made a number of other statements which had no better success with their angry auditors; and amid a host of different opinions the one which found most favour was that of sailing to Piraeus. Now it was that Alcibiades for the first time did the state a service, and one of the most signal kind. For when the Athenians at Samos were bent upon sailing against their countrymen, in which case Ionia and the Hellespont would most certainly at once have passed into possession of the enemy, Alcibiades it was who prevented them. At that moment, when no other man would have been able to hold back the multitude, he put a stop to the intended expedition, and rebuked and turned aside the resentment felt, on personal grounds, against the envoys; he dismissed them with an answer from himself, to the effect that he did not object to the government of the Five Thousand, but insisted that the Four Hundred should be deposed and the Council of Five Hundred reinstated in power: meanwhile any retrenchments for economy, by which pay might be better found for the armament, met with his entire approval. Generally, he bade them hold out and show a bold face to the enemy, since if the city were saved there was good hope that the two parties might some day be reconciled, whereas if either were once destroyed, that at Samos, or that at Athens, there would no longer be any one to be reconciled to. Meanwhile arrived envoys from the Argives, with offers of support to the Athenian commons at Samos: these were thanked by Alcibiades, and dismissed with a request to come when called upon. The Argives were accompanied by the crew of the Paralus, whom we left placed in a troopship by the Four Hundred with orders to cruise round Euboea, and who being employed to carry to Lacedaemon some Athenian envoys sent by the Four Hundred--Laespodias, Aristophon, and Melesias--as they sailed by Argos laid hands upon the envoys, and delivering them over to the Argives as the chief subverters of the democracy, themselves, instead of returning to Athens, took the Argive envoys on board, and came to Samos in the galley which had been confided to them.
87The same summer at the time that the return of Alcibiades coupled with the general conduct of Tissaphernes had carried to its height the discontent of the Peloponnesians, who no longer entertained any doubt of his having joined the Athenians, Tissaphernes wishing, it would seem, to clear himself to them of these charges, prepared to go after the Phoenician fleet to Aspendus, and invited Lichas to go with him; saying that he would appoint Tamos as his lieutenant to provide pay for the armament during his own absence. Accounts differ, and it is not easy to ascertain with what intention he went to Aspendus, and did not bring the fleet after all. That one hundred and forty-seven Phoenician ships came as far as Aspendus is certain; but why they did not come on has been variously accounted for. Some think that he went away in pursuance of his plan of wasting the Peloponnesian resources, since at any rate Tamos, his lieutenant, far from being any better, proved a worse paymaster than himself: others that he brought the Phoenicians to Aspendus to exact money from them for their discharge, having never intended to employ them: others again that it was in view of the outcry against him at Lacedaemon, in order that it might be said that he was not in fault, but that the ships were really manned and that he had certainly gone to fetch them. To myself it seems only too evident that he did not bring up the fleet because he wished to wear out and paralyse the Hellenic forces, that is, to waste their strength by the time lost during his journey to Aspendus, and to keep them evenly balanced by not throwing his weight into either scale. Had he wished to finish the war, he could have done so, assuming of course that he made his appearance in a way which left no room for doubt; as by bringing up the fleet he would in all probability have given the victory to the Lacedaemonians, whose navy, even as it was, faced the Athenian more as an equal than as an inferior. But what convicts him most clearly, is the excuse which he put forward for not bringing the ships. He said that the number assembled was less than the King had ordered; but surely it would only have enhanced his credit if he spent little of the King's money and effected the same end at less cost. In any case, whatever was his intention, Tissaphernes went to Aspendus and saw the Phoenicians; and the Peloponnesians at his desire sent a Lacedaemonian called Philip with two galleys to fetch the fleet.
88Alcibiades finding that Tissaphernes had gone to Aspendus, himself sailed thither with thirteen ships, promising to do a great and certain service to the Athenians at Samos, as he would either bring the Phoenician fleet to the Athenians, or at all events prevent its joining the Peloponnesians. In all probability he had long known that Tissaphernes never meant to bring the fleet at all, and wished to compromise him as much as possible in the eyes of the Peloponnesians through his apparent friendship for himself and the Athenians, and thus in a manner to oblige him to join their side.
89While Alcibiades weighed anchor and sailed eastward straight for Phaselis and Caunus, the envoys sent by the Four Hundred to Samos arrived at Athens. Upon their delivering the message from Alcibiades, telling them to hold out and to show a firm front to the enemy, and saying that he had great hopes of reconciling them with the army and of overcoming the Peloponnesians, the majority of the members of the oligarchy, who were already discontented and only too much inclined to be quit of the business in any safe way that they could, were at once greatly strengthened in their resolve. These now banded together and strongly criticized the administration, their leaders being some of the principal generals and men in office under the oligarchy, such as Theramenes, son of Hagnon, Aristocrates, son of Scellias, and others; who, although among the most prominent members of the government (being afraid, as they said, of the army at Samos, and most especially of Alcibiades, and also lest the envoys whom they had sent to Lacedaemon might do the state some harm without the authority of the people), without insisting on objections to the excessive concentration of power in a few hands, yet urged that the Five Thousand must be shown to exist not merely in name but in reality, and the constitution placed upon a fairer basis. But this was merely their political cry; most of them being driven by private ambition into the line of conduct so surely fatal to oligarchies that arise out of democracies. For all at once pretend to be not only equals but each the chief and master of his fellows; while under a democracy a disappointed candidate accepts his defeat more easily, because he has not the humiliation of being beaten by his equals. But what most clearly encouraged the malcontents was the power of Alcibiades at Samos, and their own disbelief in the stability of the oligarchy; and it was now a race between them as to which should first become the leader of the commons.
90Meanwhile the leaders and members of the Four Hundred most opposed to a democratic form of government--Phrynichus who had had the quarrel with Alcibiades during his command at Samos, Aristarchus the bitter and inveterate enemy of the commons, and Pisander and Antiphon and others of the chiefs who already as soon as they entered upon power, and again when the army at Samos seceded from them and declared for a democracy, had sent envoys from their own body to Lacedaemon and made every effort for peace, and had built the wall in Eetionia--now redoubled their exertions when their envoys returned from Samos, and they saw not only the people but their own most trusted associates turning against them. Alarmed at the state of things at Athens as at Samos, they now sent off in haste Antiphon and Phrynichus and ten others with injunctions to make peace with Lacedaemon upon any terms, no matter what, that should be at all tolerable. Meanwhile they pushed on more actively than ever with the wall in Eetionia. Now the meaning of this wall, according to Theramenes and his supporters, was not so much to keep out the army of Samos, in case of its trying to force its way into Piraeus, as to be able to let in, at pleasure, the fleet and army of the enemy. For Eetionia is a mole of Piraeus, close alongside of the entrance of the harbour, and was now fortified in connection with the wall already existing on the land side, so that a few men placed in it might be able to command the entrance; the old wall on the land side and the new one now being built within on the side of the sea, both ending in one of the two towers standing at the narrow mouth of the harbour. They also walled off the largest porch in Piraeus which was in immediate connection with this wall, and kept it in their own hands, compelling all to unload there the corn that came into the harbour, and what they had in stock, and to take it out from thence when they sold it.
91These measures had long provoked the murmurs of Theramenes, and when the envoys returned from Lacedaemon without having effected any general pacification, he affirmed that this wall was like to prove the ruin of the state. At this moment forty-two ships from Peloponnese, including some Siceliot and Italiot vessels from Locri and Tarentum, had been invited over by the Euboeans and were already riding off Las in Laconia preparing for the voyage to Euboea, under the command of Agesandridas, son of Agesander, a Spartan. Theramenes now affirmed that this squadron was destined not so much to aid Euboea as the party fortifying Eetionia, and that unless precautions were speedily taken the city would be surprised and lost. This was no mere calumny, there being really some such plan entertained by the accused. Their first wish was to have the oligarchy without giving up the empire; failing this to keep their ships and walls and be independent; while, if this also were denied them, sooner than be the first victims of the restored democracy, they were resolved to call in the enemy and make peace, give up their walls and ships, and at all costs retain possession of the government, if their lives were only assured to them.
92For this reason they pushed forward the construction of their work with posterns and entrances and means of introducing the enemy, being eager to have it finished in time. Meanwhile the murmurs against them were at first confined to a few persons and went on in secret, until Phrynichus, after his return from the embassy to Lacedaemon, was laid wait for and stabbed in full market by one of the Peripoli, falling down dead before he had gone far from the council chamber. The assassin escaped; but his accomplice, an Argive, was taken and put to the torture by the Four Hundred, without their being able to extract from him the name of his employer, or anything further than that he knew of many men who used to assemble at the house of the commander of the Peripoli and at other houses. Here the matter was allowed to drop. This so emboldened Theramenes and Aristocrates and the rest of their partisans in the Four Hundred and out of doors, that they now resolved to act. For by this time the ships had sailed round from Las, and anchoring at Epidaurus had overrun Aegina; and Theramenes asserted that, being bound for Euboea, they would never have sailed in to Aegina and come back to anchor at Epidaurus, unless they had been invited to come to aid in the designs of which he had always accused the government. Further inaction had therefore now become impossible. In the end, after a great many seditious harangues and suspicions, they set to work in real earnest. The heavy infantry in Piraeus building the wall in Eetionia, among whom was Aristocrates, a colonel, with his own tribe, laid hands upon Alexicles, a general under the oligarchy and the devoted adherent of the cabal, and took him into a house and confined him there. In this they were assisted by one Hermon, commander of the Peripoli in Munychia, and others, and above all had with them the great bulk of the heavy infantry. As soon as the news reached the Four Hundred, who happened to be sitting in the council chamber, all except the disaffected wished at once to go to the posts where the arms were, and menaced Theramenes and his party. Theramenes defended himself, and said that he was ready immediately to go and help to rescue Alexicles; and taking with him one of the generals belonging to his party, went down to Piraeus, followed by Aristarchus and some young men of the cavalry. All was now panic and confusion. Those in the city imagined that Piraeus was already taken and the prisoner put to death, while those in Piraeus expected every moment to be attacked by the party in the city. The older men, however, stopped the persons running up and down the town and making for the stands of arms; and Thucydides the Pharsalian, proxenus of the city, came forward and threw himself in the way of the rival factions, and appealed to them not to ruin the state, while the enemy was still at hand waiting for his opportunity, and so at length succeeded in quieting them and in keeping their hands off each other. Meanwhile Theramenes came down to Piraeus, being himself one of the generals, and raged and stormed against the heavy infantry, while Aristarchus and the adversaries of the people were angry in right earnest. Most of the heavy infantry, however, went on with the business without faltering, and asked Theramenes if he thought the wall had been constructed for any good purpose, and whether it would not be better that it should be pulled down. To this he answered that if they thought it best to pull it down, he for his part agreed with them. Upon this the heavy infantry and a number of the people in Piraeus immediately got up on the fortification and began to demolish it. Now their cry to the multitude was that all should join in the work who wished the Five Thousand to govern instead of the Four Hundred. For instead of saying in so many words "all who wished the commons to govern," they still disguised themselves under the name of the Five Thousand; being afraid that these might really exist, and that they might be speaking to one of their number and get into trouble through ignorance. Indeed this was why the Four Hundred neither wished the Five Thousand to exist, nor to have it known that they did not exist; being of opinion that to give themselves so many partners in empire would be downright democracy, while the mystery in question would make the people afraid of one another.
93The next day the Four Hundred, although alarmed, nevertheless assembled in the council chamber, while the heavy infantry in Piraeus, after having released their prisoner Alexicles and pulled down the fortification, went with their arms to the theatre of Dionysus, close to Munychia, and there held an assembly in which they decided to march into the city, and setting forth accordingly halted in the Anaceum. Here they were joined by some delegates from the Four Hundred, who reasoned with them one by one, and persuaded those whom they saw to be the most moderate to remain quiet themselves, and to keep in the rest; saying that they would make known the Five Thousand, and have the Four Hundred chosen from them in rotation, as should be decided by the Five Thousand, and meanwhile entreated them not to ruin the state or drive it into the arms of the enemy. After a great many had spoken and had been spoken to, the whole body of heavy infantry became calmer than before, absorbed by their fears for the country at large, and now agreed to hold upon an appointed day an assembly in the theatre of Dionysus for the restoration of concord.
94When the day came for the assembly in the theatre, and they were upon the point of assembling, news arrived that the forty-two ships under Agesandridas were sailing from Megara along the coast of Salamis. The people to a man now thought that it was just what Theramenes and his party had so often said, that the ships were sailing to the fortification, and concluded that they had done well to demolish it. But though it may possibly have been by appointment that Agesandridas hovered about Epidaurus and the neighbourhood, he would also naturally be kept there by the hope of an opportunity arising out of the troubles in the town. In any case the Athenians, on receipt of the news immediately ran down in mass to Piraeus, seeing themselves threatened by the enemy with a worse war than their war among themselves, not at a distance, but close to the harbour of Athens. Some went on board the ships already afloat, while others launched fresh vessels, or ran to defend the walls and the mouth of the harbour.
95Meanwhile the Peloponnesian vessels sailed by, and rounding Sunium anchored between Thoricus and Prasiae, and afterwards arrived at Oropus. The Athenians, with revolution in the city, and unwilling to lose a moment in going to the relief of their most important possession (for Euboea was everything to them now that they were shut out from Attica), were compelled to put to sea in haste and with untrained crews, and sent Thymochares with some vessels to Eretria. These upon their arrival, with the ships already in Euboea, made up a total of thirty-six vessels, and were immediately forced to engage. For Agesandridas, after his crews had dined, put out from Oropus, which is about seven miles from Eretria by sea; and the Athenians, seeing him sailing up, immediately began to man their vessels. The sailors, however, instead of being by their ships, as they supposed, were gone away to purchase provisions for their dinner in the houses in the outskirts of the town; the Eretrians having so arranged that there should be nothing on sale in the marketplace, in order that the Athenians might be a long time in manning their ships, and, the enemy's attack taking them by surprise, might be compelled to put to sea just as they were. A signal also was raised in Eretria to give them notice in Oropus when to put to sea. The Athenians, forced to put out so poorly prepared, engaged off the harbour of Eretria, and after holding their own for some little while notwithstanding, were at length put to flight and chased to the shore. Such of their number as took refuge in Eretria, which they presumed to be friendly to them, found their fate in that city, being butchered by the inhabitants; while those who fled to the Athenian fort in the Eretrian territory, and the vessels which got to Chalcis, were saved. The Peloponnesians, after taking twenty-two Athenian ships, and killing or making prisoners of the crews, set up a trophy, and not long afterwards effected the revolt of the whole of Euboea (except Oreus, which was held by the Athenians themselves), and made a general settlement of the affairs of the island.
96When the news of what had happened in Euboea reached Athens, a panic ensued such as they had never before known. Neither the disaster in Sicily, great as it seemed at the time, nor any other had ever so much alarmed them. The camp at Samos was in revolt; they had no more ships or men to man them; they were at discord among themselves and might at any moment come to blows; and a disaster of this magnitude coming on the top of all, by which they lost their fleet, and worst of all Euboea, which was of more value to them than Attica, could not occur without throwing them into the deepest despondency. Meanwhile their greatest and most immediate trouble was the possibility that the enemy, emboldened by his victory, might make straight for them and sail against Piraeus, which they had no longer ships to defend; and every moment they expected him to arrive. This, with a little more courage, he might easily have done, in which case he would either have increased the dissensions of the city by his presence, or, if he had stayed to besiege it, have compelled the fleet from Ionia, although the enemy of the oligarchy, to come to the rescue of their country and of their relatives, and in the meantime would have become master of the Hellespont, Ionia, the islands, and of everything as far as Euboea, or, to speak roundly, of the whole Athenian empire. But here, as on so many other occasions, the Lacedaemonians proved the most convenient people in the world for the Athenians to be at war with. The wide difference between the two characters, the slowness and want of energy of the Lacedaemonians as contrasted with the dash and enterprise of their opponents, proved of the greatest service, especially to a maritime empire like Athens. Indeed this was shown by the Syracusans, who were most like the Athenians in character, and also most successful in combating them.
97Nevertheless, upon receipt of the news, the Athenians manned twenty ships and called immediately a first assembly in the Pnyx, where they had been used to meet formerly, and deposed the Four Hundred and voted to hand over the government to the Five Thousand, of which body all who furnished a suit of armour were to be members, decreeing also that no one should receive pay for the discharge of any office, or if he did should be held accursed. Many other assemblies were held afterwards, in which law-makers were elected and all other measures taken to form a constitution. It was during the first period of this constitution that the Athenians appear to have enjoyed the best government that they ever did, at least in my time. For the fusion of the high and the low was effected with judgment, and this was what first enabled the state to raise up her head after her manifold disasters. They also voted for the recall of Alcibiades and of other exiles, and sent to him and to the camp at Samos, and urged them to devote themselves vigorously to the war.
98Upon this revolution taking place, the party of Pisander and Alexicles and the chiefs of the oligarchs immediately withdrew to Decelea, with the single exception of Aristarchus, one of the generals, who hastily took some of the most barbarian of the archers and marched to Oenoe. This was a fort of the Athenians upon the Boeotian border, at that moment besieged by the Corinthians, irritated by the loss of a party returning from Decelea, who had been cut off by the garrison. The Corinthians had volunteered for this service, and had called upon the Boeotians to assist them. After communicating with them, Aristarchus deceived the garrison in Oenoe by telling them that their countrymen in the city had compounded with the Lacedaemonians, and that one of the terms of the capitulation was that they must surrender the place to the Boeotians. The garrison believed him as he was general, and besides knew nothing of what had occurred owing to the siege, and so evacuated the fort under truce. In this way the Boeotians gained possession of Oenoe, and the oligarchy and the troubles at Athens ended.
99To return to the Peloponnesians in Miletus. No pay was forthcoming from any of the agents deputed by Tissaphernes for that purpose upon his departure for Aspendus; neither the Phoenician fleet nor Tissaphernes showed any signs of appearing, and Philip, who had been sent with him, and another Spartan, Hippocrates, who was at Phaselis, wrote word to Mindarus, the admiral, that the ships were not coming at all, and that they were being grossly abused by Tissaphernes. Meanwhile Pharnabazus was inviting them to come, and making every effort to get the fleet and, like Tissaphernes, to cause the revolt of the cities in his government still subject to Athens, founding great hopes on his success; until at length, at about the period of the summer which we have now reached, Mindarus yielded to his importunities, and, with great order and at a moment's notice, in order to elude the enemy at Samos, weighed anchor with seventy-three ships from Miletus and set sail for the Hellespont. Thither sixteen vessels had already preceded him in the same summer, and had overrun part of the Chersonese. Being caught in a storm, Mindarus was compelled to run in to Icarus and, after being detained five or six days there by stress of weather, arrived at Chios.
100Meanwhile Thrasyllus had heard of his having put out from Miletus, and immediately set sail with fifty-five ships from Samos, in haste to arrive before him in the Hellespont. But learning that he was at Chios, and expecting that he would stay there, he posted scouts in Lesbos and on the continent opposite to prevent the fleet moving without his knowing it, and himself coasted along to Methymna, and gave orders to prepare meal and other necessaries, in order to attack them from Lesbos in the event of their remaining for any length of time at Chios. Meanwhile he resolved to sail against Eresus, a town in Lesbos which had revolted, and, if he could, to take it. For some of the principal Methymnian exiles had carried over about fifty heavy infantry, their sworn associates, from Cuma, and hiring others from the continent, so as to make up three hundred in all, chose Anaxander, a Theban, to command them, on account of the community of blood existing between the Thebans and the Lesbians, and first attacked Methymna. Balked in this attempt by the advance of the Athenian guards from Mitylene, and repulsed a second time in a battle outside the city, they then crossed the mountain and effected the revolt of Eresus. Thrasyllus accordingly determined to go there with all his ships and to attack the place. Meanwhile Thrasybulus had preceded him thither with five ships from Samos, as soon as he heard that the exiles had crossed over, and coming too late to save Eresus, went on and anchored before the town. Here they were joined also by two vessels on their way home from the Hellespont, and by the ships of the Methymnians, making a grand total of sixty-seven vessels; and the forces on board now made ready with engines and every other means available to do their utmost to storm Eresus.
101In the meantime Mindarus and the Peloponnesian fleet at Chios, after taking provisions for two days and receiving three Chian pieces of money for each man from the Chians, on the third day put out in haste from the island; in order to avoid falling in with the ships at Eresus, they did not make for the open sea, but keeping Lesbos on their left, sailed for the continent. After touching at the port of Carteria, in the Phocaeid, and dining, they went on along the Cumaean coast and supped at Arginusae, on the continent over against Mitylene. From thence they continued their voyage along the coast, although it was late in the night, and arriving at Harmatus on the continent opposite Methymna, dined there; and swiftly passing Lectum, Larisa, Hamaxitus, and the neighbouring towns, arrived a little before midnight at Rhoeteum. Here they were now in the Hellespont. Some of the ships also put in at Sigeum and at other places in the neighbourhood.
102Meanwhile the warnings of the fire signals and the sudden increase in the number of fires on the enemy's shore informed the eighteen Athenian ships at Sestos of the approach of the Peloponnesian fleet. That very night they set sail in haste just as they were, and, hugging the shore of the Chersonese, coasted along to Elaeus, in order to sail out into the open sea away from the fleet of the enemy.
After passing unobserved the sixteen ships at Abydos, which had nevertheless been warned by their approaching friends to be on the alert to prevent their sailing out, at dawn they sighted the fleet of Mindarus, which immediately gave chase. All had not time to get away; the greater number however escaped to Imbros and Lemnos, while four of the hindmost were overtaken off Elaeus. One of these was stranded opposite to the temple of Protesilaus and taken with its crew, two others without their crews; the fourth was abandoned on the shore of Imbros and burned by the enemy.
103After this the Peloponnesians were joined by the squadron from Abydos, which made up their fleet to a grand total of eighty-six vessels; they spent the day in unsuccessfully besieging Elaeus, and then sailed back to Abydos. Meanwhile the Athenians, deceived by their scouts, and never dreaming of the enemy's fleet getting by undetected, were tranquilly besieging Eresus. As soon as they heard the news they instantly abandoned Eresus, and made with all speed for the Hellespont, and after taking two of the Peloponnesian ships which had been carried out too far into the open sea in the ardour of the pursuit and now fell in their way, the next day dropped anchor at Elaeus, and, bringing back the ships that had taken refuge at Imbros, during five days prepared for the coming engagement.
104After this they engaged in the following way. The Athenians formed in column and sailed close alongshore to Sestos; upon perceiving which the Peloponnesians put out from Abydos to meet them. Realizing that a battle was now imminent, both combatants extended their flank; the Athenians along the Chersonese from Idacus to Arrhiani with seventy-six ships; the Peloponnesians from Abydos to Dardanus with eighty-six. The Peloponnesian right wing was occupied by the Syracusans, their left by Mindarus in person with the best sailers in the navy; the Athenian left by Thrasyllus, their right by Thrasybulus, the other commanders being in different parts of the fleet. The Peloponnesians hastened to engage first, and outflanking with their left the Athenian right sought to cut them off, if possible, from sailing out of the straits, and to drive their centre upon the shore, which was not far off. The Athenians perceiving their intention extended their own wing and outsailed them, while their left had by this time passed the point of Cynossema. This, however, obliged them to thin and weaken their centre, especially as they had fewer ships than the enemy, and as the coast round Point Cynossema formed a sharp angle which prevented their seeing what was going on on the other side of it.
105The Peloponnesians now attacked their centre and drove ashore the ships of the Athenians, and disembarked to follow up their victory. No help could be given to the centre either by the squadron of Thrasybulus on the right, on account of the number of ships attacking him, or by that of Thrasyllus on the left, from whom the point of Cynossema hid what was going on, and who was also hindered by his Syracusan and other opponents, whose numbers were fully equal to his own. At length, however, the Peloponnesians in the confidence of victory began to scatter in pursuit of the ships of the enemy, and allowed a considerable part of their fleet to get into disorder. On seeing this the squadron of Thrasybulus discontinued their lateral movement and, facing about, attacked and routed the ships opposed to them, and next fell roughly upon the scattered vessels of the victorious Peloponnesian division, and put most of them to flight without a blow. The Syracusans also had by this time given way before the squadron of Thrasyllus, and now openly took to flight upon seeing the flight of their comrades.
106The rout was now complete. Most of the Peloponnesians fled for refuge first to the river Midius, and afterwards to Abydos. Only a few ships were taken by the Athenians; as owing to the narrowness of the Hellespont the enemy had not far to go to be in safety. Nevertheless nothing could have been more opportune for them than this victory. Up to this time they had feared the Peloponnesian fleet, owing to a number of petty losses and to the disaster in Sicily; but they now ceased to mistrust themselves or any longer to think their enemies good for anything at sea. Meanwhile they took from the enemy eight Chian vessels, five Corinthian, two Ambraciot, two Boeotian, one Leucadian, Lacedaemonian, Syracusan, and Pellenian, losing fifteen of their own. After setting up a trophy upon Point Cynossema, securing the wrecks, and restoring to the enemy his dead under truce, they sent off a galley to Athens with the news of their victory. The arrival of this vessel with its unhoped-for good news, after the recent disasters of Euboea, and in the revolution at Athens, gave fresh courage to the Athenians, and caused them to believe that if they put their shoulders to the wheel their cause might yet prevail.
107On the fourth day after the sea-fight the Athenians in Sestos having hastily refitted their ships sailed against Cyzicus, which had revolted. Off Harpagium and Priapus they sighted at anchor the eight vessels from Byzantium, and, sailing up and routing the troops on shore, took the ships, and then went on and recovered the town of Cyzicus, which was unfortified, and levied money from the citizens. In the meantime the Peloponnesians sailed from Abydos to Elaeus, and recovered such of their captured galleys as were still uninjured, the rest having been burned by the Elaeusians, and sent Hippocrates and Epicles to Euboea to fetch the squadron from that island.
108About the same time Alcibiades returned with his thirteen ships from Caunus and Phaselis to Samos, bringing word that he had prevented the Phoenician fleet from joining the Peloponnesians, and had made Tissaphernes more friendly to the Athenians than before. Alcibiades now manned nine more ships, and levied large sums of money from the Halicarnassians, and fortified Cos. After doing this and placing a governor in Cos, he sailed back to Samos, autumn being now at hand. Meanwhile Tissaphernes, upon hearing that the Peloponnesian fleet had sailed from Miletus to the Hellespont, set off again back from Aspendus, and made all sail for Ionia. While the Peloponnesians were in the Hellespont, the Antandrians, a people of Aeolic extraction, conveyed by land across Mount Ida some heavy infantry from Abydos, and introduced them into the town; having been ill-treated by Arsaces, the Persian lieutenant of Tissaphernes. This same Arsaces had, upon pretence of a secret quarrel, invited the chief men of the Delians to undertake military service (these were Delians who had settled at Atramyttium after having been driven from their homes by the Athenians for the sake of purifying Delos); and after drawing them out from their town as his friends and allies, had laid wait for them at dinner, and surrounded them and caused them to be shot down by his soldiers. This deed made the Antandrians fear that he might some day do them some mischief; and as he also laid upon them burdens too heavy for them to bear, they expelled his garrison from their citadel.
109Tissaphernes, upon hearing of this act of the Peloponnesians in addition to what had occurred at Miletus and Cnidus, where his garrisons had been also expelled, now saw that the breach between them was serious; and fearing further injury from them, and being also vexed to think that Pharnabazus should receive them, and in less time and at less cost perhaps succeed better against Athens than he had done, determined to rejoin them in the Hellespont, in order to complain of the events at Antandros and excuse himself as best he could in the matter of the Phoenician fleet and of the other charges against him. Accordingly he went first to Ephesus and offered sacrifice to Artemis. . . .
[When the winter after this summer is over the twenty-first year of this war will be completed. ]
|
{
"pile_set_name": "Pile-CC"
}
|
Chang Yu-lung
Chang Yu-lung is a Taiwanese pool player, and winner of the 2015 World Cup of Pool alongside Ko Pin-yi. Yu-Lung won the 2015 Steinway Classic defeating Ko Ping-chung in the final.
Accolades
References
External links
Chang Yu-Lung at AZBilliards.com
Category:Year of birth missing (living people)
Category:Taiwanese pool players
Category:Place of birth missing (living people)
Category:Living people
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Jean-Talon Market
Jean-Talon Market (French: Marché Jean-Talon) is a farmer's market in Montreal. Located in the Little Italy district, the market is bordered by Jean-Talon Street to the north, Mozart Ave. to the south, Casgrain Ave. to the west and Henri-Julien Ave. to the east. It contains two city-maintained streets both called Place du Marché du Nord. The market is located between the Jean-Talon and De Castelnau metro stations.
It is the largest market in Montreal and the largest open-air market in North America.
History
The market was opened to the public in 1933 while Camillien Houde was the city mayor. Before that, the space the market now occupies was a lacrosse field for the "Shamrock Lacrosse Grounds" club.
The market's single building (the chalet) quickly became the focal point for development of the area around it. From the opening until 1961, the chalet was used as a terminal for buses heading to the neighbouring city of Laval. Between 1961 and 1970 a municipal library and a social services centre replaced the bus station. Since then, the space was occupied by administrative offices.
Major renovations were undertaken in 2004 to handle the crowds that populate the market during the summer months. An underground parking lot was constructed, and an above ground structure was built over the underground parking area, to host 20 specialty boutiques.
Activities
The market is open year-round, even during Montreal's severe winters, although during this time walls are placed around the central section of the market while outdoor areas remain vacant. During the peak summer period, between May and October, its open-air arcades are occupied by about 300 vendors, mostly farmers from the countryside around Montreal.
The open air market is surrounded by other food businesses: meat, fish and cheese stores, bulk food emporia, dealers in spices and imported goods, bakeries, restaurants and a branch of the SAQ, among others.
Stores surrounding the open-air market include:
La Fromagerie Hamel
William J. Walter boucherie
Les Touilleurs kitchenware
Since July 15, 2006 vehicles are banned from circulating inside the market's streets during the summer weekends.
See also
Atwater Market
References
External links
Marchés Publics de Montréal, the agency that runs Montreal-area farmer's markets
Category:Buildings and structures in Montreal
Category:Farmers' markets in Canada
Marché Jean-Talon
Category:Montreal cuisine
Category:Rosemont–La Petite-Patrie
Category:Tourist attractions in Montreal
|
{
"pile_set_name": "Wikipedia (en)"
}
|
About This Game
Released
Released
Released
Released
Key Features:
Theatrical Drama: Fully voiced dialogue, music, and sound effects
Fully voiced dialogue, music, and sound effects Be a Hacker: Use the terminal-based LupOS system and hacking techniques like Man-in-the-Middle Attack, Brute Force Attack, Network Jamming and more
Use the terminal-based LupOS system and hacking techniques like Man-in-the-Middle Attack, Brute Force Attack, Network Jamming and more Power of Words: Beware what you answer and the choices you make, they will determine the course of the last episode
What would you do if you found yourself trapped on an eerie space station with nothing but a computer? Play as the hacker Alex and save the world from your keyboard as a sinister A.I. rises from the corner of the universe... but you are not the only one who acts from the shadows. Monsters lurk in the dark and soon humanity itself is in danger. When analog and digital worlds collide, only a master of both can survive.Code 7 is a hacking thriller in which your imagination is the stage. The things unseen are the most terrifying ones... travel the network, gather information from e-mails, documents, and logs, hack protected computers, and navigate your partner through dangerous situations. Work together, gain their trust and make the right choices. The outcome of the story is determined by how you act and what you say.Episode 0:Episode 1:Episode 2:Episode 3:Episode 4: In DevelopmentThe game includes a mode for visually impaired players.
|
{
"pile_set_name": "OpenWebText2"
}
|
The hit sci-fi anime Space Dandy returns on its second season in July 2014.
According to reports from Anime news Network, FUNimation Entertainment announced last Thursday that they will air Space Dandy season 2 on Adult's Swim Toonami block on July 5 Saturday at 12:30 a.m. while the show will premier in Japan on July 6.
There is also a new trailer for season 2 featuring some new faces joining the anime courtesy of the staff members of Space Dandy. Here take a look.
Space Dandy is a Japanese anime series created by Bones and directed by Shingo Natsume. The anime follows the misadventures of Dandy, an alien hunter who is dubbed " a dandy guy in space" as he searches for aliens with his robot assistant QT and a alien cat named Meow.
Season 2 follows the crew of the Aloha Oe as they continue their adventures across space while seeking their fortunes hunting for unregistered aliens. Details on the second season's episode count are yet to be confirmed.
Space Dandy has been licensed by FUNimation in North America, Madman Entertainment in Australia and Anime Limited in United Kingdom. The first season contained 13 episodes and was aird last January to March 2014.
|
{
"pile_set_name": "OpenWebText2"
}
|
Copper Center, Alaska
Copper Center (Tl’aticae’e in Ahtna) is a census-designated place (CDP) on the Copper River in Valdez-Cordova Census Area, Alaska, United States. It is two hundred miles northeast of Anchorage. At the 2010 census the population was 328, down from 362 in 2000.
Geography
Copper Center has a dry-summer subarctic climate (Köppen climate classification: Dsc).
Copper Center is located at (61.965305, -145.318280).
Copper Center is located on the Richardson Highway 4 south on the west bank of the Copper River at the confluence with the Klutina River. It is about 16 miles southeast of Glennallen on the Glenn Highway 1 and about 100 miles north of Valdez.
According to the United States Census Bureau, the CDP has a total area of , all of it land.
|Jan rain inch = 0.69
|Feb rain inch = 0.57
|Mar rain inch = 0.46
|Apr rain inch = 0.19
|May rain inch = 0.63
|Jun rain inch = 1.68
|Jul rain inch = 2
|Aug rain inch = 1.45
|Sep rain inch = 0.89
|Oct rain inch = 0.89
|Nov rain inch = 1.34
|Dec rain inch = 1.61
|Jan snow inch = 9.9
|Feb snow inch = 3.8
|Mar snow inch = 4.2
|Apr snow inch = 1
|May snow inch = 0
|Jun snow inch = 0
|Jul snow inch = 0
|Aug snow inch = 0
|Sep snow inch = 0
|Oct snow inch = 2.6
|Nov snow inch = 10
|Dec snow inch = 8
|Jan record high F = 45
|Feb record high F = 48
|Mar record high F = 58
|Apr record high F = 70
|May record high F = 78
|Jun record high F = 92
|Jul record high F = 89
|Aug record high F = 94
|Sep record high F = 84
|Oct record high F = 60
|Nov record high F = 49
|Dec record high F = 44
|Jan record low F = -60
|Feb record low F = -57
|Mar record low F = -43
|Apr record low F = -30
|May record low F = 12
|Jun record low F = 24
|Jul record low F = 32
|Aug record low F = 21
|Sep record low F = 6
|Oct record low F = -23
|Nov record low F = -32
|Dec record low F = -57
|Jan precipitation days = 3
|Feb precipitation days = 2
|Mar precipitation days = 3
|Apr precipitation days = 1
|May precipitation days = 4
|Jun precipitation days = 7
|Jul precipitation days = 9
|Aug precipitation days = 6
|Sep precipitation days = 5
|Oct precipitation days = 5
|Nov precipitation days = 5
|Dec precipitation days = 5
|source 1 = WRCC
}}
History
Copper Center developed where the Valdez Glacier trail reached the Copper River. Andrew Holman was its first resident, establishing a temporary roadhouse near the site in July 1898 to provide shelter for prospectors on their way to the Klondike. He initially erected two tents: one served as Hotel Holman and the other as a makeshift post office. By winter 1899, Holman had replaced his tents with a substantial cabin. Leaving Dick Worthman to run the roadhouse, Holman pioneered the first mail route from Valdez to Eagle.
During the height of the Klondike stampede prospectors set up tent camps along both the Copper and Klutina rivers, but the first cabins were built on a site one half mile west of the Copper. Another camp sprang up at what was called Copper Ferry, where a ferry crossed the river. The area got a boost as a goldfield service center in June 1898, when B. F. Millard brushed a trail from there to the mouth of the Slana River via the foothills of Mt. Drum.
The east bank site of Old Copper Center apparently was settled in 1901 1902 by prospectors intent on investigating mineral prospects on that side of the river. Its days as a mining center were short lived, but it did draw a Native population and existed for many years as a village.
Copper Center rapidly became the primary supply center for prospectors and travelers in the Copper River basin. A telegraph station and the trail's first official post office opened in 1901, with Ringwald Blix serving as the community's first postmaster. The next year, John McCrary staked a homestead about a mile north of the Klutina River crossing. Before long, McCrary opened a hotel as well, the first frame roadhouse between Valdez and Fairbanks. Much of McCrary's property remains in the family's hands.
By 1910 American settlers had established over fifty homesteads in the vicinity. The community now received tri-weekly mail delivery in the winter and weekly service in the summer. It also contained the only telegraph station between Valdez and Fairbanks where money could be sent or received by wire.
Florence "Ma" Barnes acquired Hotel Holman in 1922, and renamed it the Copper Center Roadhouse and Trading Post. The original building burned in 1932 and was replaced by the southernmost portion of the current one. When Barnes died in 1948, she left her entire estate to a Valdez orphanage. Later that year, it sold George Ashby the property. Although Ashby died in 1979, his family continued to operate the roadhouse. The replacement roadhouse itself burned on May 20, 2012. The family says they intend to rebuild.
Demographics
Copper Center first appeared on the 1910 U.S. Census as an unincorporated village. In 1980 it was made a census-designated place (CDP).
As of the census of 2000, there were 362 people, 132 households, and 88 families residing in the CDP. The population density was 26.4 people per square mile (10.2/km²). There were 163 housing units at an average density of 11.9/sq mi (4.6/km²). The racial makeup of the CDP was 48.07% White, 0.28% Black or African American, 46.69% Native American, and 4.97% from two or more races. 0.83% of the population were Hispanic or Latino of any race.
Of the 132 households 40.2% had children under the age of 18 living with them, 37.1% were married couples living together, 19.7% had a female householder with no husband present, and 33.3% were non-families. 28.8% of all households were made up of individuals and 7.6% had someone living alone who was 65 years of age or older. The average household size was 2.74 and the average family size was 3.39.
In the CDP, the population was spread out with 38.7% under the age of 18, 7.2% from 18 to 24, 22.7% from 25 to 44, 23.2% from 45 to 64, and 8.3% who were 65 years of age or older. The median age was 31 years. For every 100 females, there were 106.9 males. For every 100 females age 18 and over, there were 109.4 males.
The median income for a household in the CDP was $32,188, and the median income for a family was $42,500. Males had a median income of $46,250 versus $22,083 for females. The per capita income for the CDP was $15,152. About 18.5% of families and 18.8% of the population were below the poverty line, including 23.1% of those under age 18 and 6.9% of those age 65 or over.
Education
Public education in the area is provided by Kenny Lake School of the Copper River School District.
References
Category:Census-designated places in Alaska
Category:Census-designated places in Unorganized Borough, Alaska
Category:Census-designated places in Valdez–Cordova Census Area, Alaska
Category:Mining communities in Alaska
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Pontechianale
Pontechianale is a comune (municipality) in the Province of Cuneo in the Italian region Piedmont, located about southwest of Turin and about northwest of Cuneo, on the border with France.
Pontechianale borders the following municipalities: Bellino, Casteldelfino, Crissolo, Oncino (Italy), Molines-en-Queyras, Ristolas, Saint-Paul-sur-Ubaye, and Saint-Véran (France).
References
External links
Category:Cities and towns in Piedmont
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Scala returning a list with certain elements filtered out
I'm trying to take an existing list, run a function on each element, and if that function returns false, filter it out from the list.
I don't quite understand functional programming obviously because I tried the below:
for (elem <- myList) {
if(is_legal(elem) == false) {
myList.filter(_ != elem)
}
}
Any help would be appreciated.
A:
You have the right idea in using filter; all you have to do is pass in the is_legal predicate:
val filteredList = myList.filter(is_legal)
|
{
"pile_set_name": "StackExchange"
}
|
# Translation of Odoo Server.
# This file contains the translation of the following modules:
# * stock_sms
#
# Translators:
# Martin Trigaux, 2019
# Dorin Hongu <dhongu@gmail.com>, 2020
# Foldi Robert <foldirobert@nexterp.ro>, 2020
# Hongu Cosmin <cosmin513@gmail.com>, 2020
#
msgid ""
msgstr ""
"Project-Id-Version: Odoo Server 13.0\n"
"Report-Msgid-Bugs-To: \n"
"POT-Creation-Date: 2019-10-07 07:13+0000\n"
"PO-Revision-Date: 2019-08-26 09:14+0000\n"
"Last-Translator: Hongu Cosmin <cosmin513@gmail.com>, 2020\n"
"Language-Team: Romanian (https://www.transifex.com/odoo/teams/41243/ro/)\n"
"MIME-Version: 1.0\n"
"Content-Type: text/plain; charset=UTF-8\n"
"Content-Transfer-Encoding: \n"
"Language: ro\n"
"Plural-Forms: nplurals=3; plural=(n==1?0:(((n%100>19)||((n%100==0)&&(n!=0)))?2:1));\n"
#. module: stock_sms
#: model:sms.template,body:stock_sms.sms_template_data_stock_delivery
msgid ""
"\n"
" %if object.origin:\n"
" ${object.company_id.name}: We are glad to inform you that your order n° ${object.origin} has been shipped.\n"
" %else:\n"
" ${object.company_id.name}: We are glad to inform you that your order has been shipped.\n"
" %endif\n"
" %if object.carrier_tracking_ref:\n"
" Your tracking reference is ${object.carrier_tracking_ref}.\n"
" %endif\n"
" "
msgstr ""
"\n"
" %if object.origin:\n"
" ${object.company_id.name}: Ne bucurăm să vă informăm că comanda dvs. nr ${object.origin} a fost expediată. \n"
" %else:\n"
" ${object.company_id.name}: Ne bucurăm să vă informăm că comanda dvs. a fost expediată.\n"
" %endif\n"
" %if object.carrier_tracking_ref:\n"
" Referința dvs. de urmărire este ${object.carrier_tracking_ref}.\n"
" %endif\n"
" "
#. module: stock_sms
#: model_terms:ir.ui.view,arch_db:stock_sms.view_confirm_stock_sms
msgid "Cancel"
msgstr "Anulează"
#. module: stock_sms
#: model:ir.model,name:stock_sms.model_res_company
msgid "Companies"
msgstr "Companii"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__company_id
msgid "Company"
msgstr "Companie"
#. module: stock_sms
#: model:ir.model,name:stock_sms.model_res_config_settings
msgid "Config Settings"
msgstr "Setări de configurare"
#. module: stock_sms
#: model_terms:ir.ui.view,arch_db:stock_sms.view_confirm_stock_sms
msgid "Confirm"
msgstr "Confirmă"
#. module: stock_sms
#: model:ir.model,name:stock_sms.model_confirm_stock_sms
msgid "Confirm Stock SMS"
msgstr "Confirmați SMS-urile de stoc"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__create_uid
msgid "Created by"
msgstr "Creat de"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__create_date
msgid "Created on"
msgstr "Creat în"
#. module: stock_sms
#: model:sms.template,name:stock_sms.sms_template_data_stock_delivery
msgid "Delivery: Send by SMS Text Message"
msgstr ""
#. module: stock_sms
#: model_terms:ir.ui.view,arch_db:stock_sms.view_confirm_stock_sms
msgid "Disable SMS"
msgstr "Dezactivați SMS-urile"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__display_name
msgid "Display Name"
msgstr "Nume afișat"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_res_company__has_received_warning_stock_sms
msgid "Has Received Warning Stock Sms"
msgstr ""
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__id
msgid "ID"
msgstr "ID"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms____last_update
msgid "Last Modified on"
msgstr "Ultima modificare la"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__write_uid
msgid "Last Updated by"
msgstr "Ultima actualizare făcută de"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__write_date
msgid "Last Updated on"
msgstr "Ultima actualizare pe"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_confirm_stock_sms__picking_id
msgid "Picking"
msgstr "Ridicare"
#. module: stock_sms
#: code:addons/stock_sms/models/stock_picking.py:0
#: model_terms:ir.ui.view,arch_db:stock_sms.view_confirm_stock_sms
#, python-format
msgid "SMS"
msgstr "SMS"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_res_company__stock_move_sms_validation
msgid "SMS Confirmation"
msgstr "Confirmare SMS"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_res_company__stock_sms_confirmation_template_id
#: model:ir.model.fields,field_description:stock_sms.field_res_config_settings__stock_sms_confirmation_template_id
#: model_terms:ir.ui.view,arch_db:stock_sms.res_config_settings_view_form_stock
msgid "SMS Template"
msgstr "Șablon SMS"
#. module: stock_sms
#: model:ir.model.fields,field_description:stock_sms.field_res_config_settings__stock_move_sms_validation
msgid "SMS Validation with stock move"
msgstr "Validare SMS cu mutare stoc"
#. module: stock_sms
#: model:ir.model.fields,help:stock_sms.field_res_company__stock_sms_confirmation_template_id
#: model:ir.model.fields,help:stock_sms.field_res_config_settings__stock_sms_confirmation_template_id
msgid "SMS sent to the customer once the order is done."
msgstr "SMS trimis clientului odată ce comanda este făcută."
#. module: stock_sms
#: model:ir.model,name:stock_sms.model_stock_picking
msgid "Transfer"
msgstr "Transfer"
#. module: stock_sms
#: model_terms:ir.ui.view,arch_db:stock_sms.view_confirm_stock_sms
msgid ""
"You are about to confirm this Delivery Order by SMS Text Message.<br/>\n"
" This feature can easily be disabled from the Settings of Inventory or by clicking on \"Disable SMS\".<br/>"
msgstr ""
|
{
"pile_set_name": "Github"
}
|
Hawaii Holiday Packages
A destination in itself, this impressive property is nestled inside sixty two oceanfront acres, offering breathtaking tropical gardens and abundant wildlife. Swim with native marine life, together with turtles, dolphins and tropical fish, at among the state’s most iconic beaches. Be the primary to learn about unique provides and deals from Air Canada Holidays and its companions. From the situation and accommodations, to the resort employees, the meals… certainly a 5-star service. has handpicked the most effective trip packages to Hawaii.
Countless turquoise seashores – each with its own lovely uniqueness, majestic sculpted emerald mountains, tropical rainforests, waterfalls, the stunning remote Tahiti-like northeast coast, the lunar-like area drive on eastern Oahu, the world well-known north shore surfing beaches and eating places featuring both international and local cuisines make Oahu a spot that’s unforgettable, and one that you’ll lengthy to return to!
Property presents above-average accommodations, service, consolation, services and grounds. These vacation packages include air, car rental, and hotel stay for six to eight days on a number of of the Hawaiian Islands. The largest island within the United States is a tropical paradise where you possibly can swim , hike and discover volcanoes. The quaint Kapaa and Lihue area is on Kauai’s lower east shore and gives peaceful tropical charm.
The primary city of Honolulu affords high-rise lodging, wonderful beach resorts, luxurious-brand purchasing, a lively Chinatown and thrilling nightlife. Browse our Hawaii trip packages and get started on planning your journey! These custom design packages can embrace your breakfast and dinners as well as all your transportation. Maui affords golfers and sunbathers true paradise.
Maui has among the best luxurious beach resort accommodations and activities within the islands, particularly along Kaanapali Seashore. This island additionally options pretty black sand beaches, rocky lava coastlines, a gorgeous tropical rainforest and the spectacular waterfalls: Rainbow Falls and Akaka Falls. We booked final minute and out travel package was promptly made obtainable.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
How can I add windows controls to a C++ desktop application in Visual Studio 2017?
I've started a new Visual C++ desktop application in Visual Studio 2017 and I'm having trouble getting started with the UI / View. I normally do Windows development in C# with WPF, but I've had to go with C++ for various reasons on this one.
This seems like a rookie question, but I can't see any obvious way to add basic controls, like a TextBox, Label, Button, or Canvas. Several hours of searching online hasn't yielded any concrete results either - only added confusion.
There's definitely a blank form there when I compile and run. It even has a Menu -> Exit.
Is there a specific framework I should be using, like Windows Forms or MFC? Are those even still supported? Do all the UI elements have to be added in C++ code? Did I choose the wrong type of Visual Studio solution?
More Info, by Request:
What I'm working on is a 3D modeling program, similar to something like Blender, but greatly simplified. I'll need to use the FBX SDK, which Autodesk publishes, but it only supports C++.
I've already started one version which uses C# / WPF for the front-end. The goal is to incorporate the SDK later with either some sort of multi-project solution or a dll that I've compiled separately. I haven't attempted something like this before.
The all-C++ version is my idea of trying to simplify everything by consolidating into one language, one project, and one solution. I think if I do a really basic alpha version each way, it will help me choose the best answer and be doubly-educational.
A:
1)Is there a specific framework I should be using, like Windows Forms or MFC?
Using MFC in VC++ 2017, one can quickly using drag-n-drop, insert a number of window controls including ActiveX/COM components directly over dialog box. Thereafter a suitable class, interface events can be generated through in-built wizard. A variety of application choices SDI(Single-Document-interface)/MDI/Dialog based are available to start with.
2)Are those even still supported ?
MFC still works very well on VS 2017 and very user friendly, requires minimal coding IMHO.
3)Do all the UI elements have to be added in C++ code?
No. Let say you added some static text, accelerators, buttons on a dialog and generate a class with a single line of coding. You just insert the appropriate control events and invoke window messages suitably.
4) Did I choose the wrong type of Visual Studio solution?
Don't arise. Worked with MFC in 2010,2012,2015 and 2017, most of the MFC codes remains same. But some conversions are required when one have to switch from multibyte to unicode style.
Hope it helps a bit to clear your doubt. The window controls can be skinned pretty easily.
|
{
"pile_set_name": "StackExchange"
}
|
長い夢から、ようやく覚めたような瞬間だった。時計の針が0時を過ぎ、日本時間27日を迎えた頃。横浜の松永成立GKコーチ(53)は、沖縄県内の宿舎の自室でまどろんでいた。
船をこぐ寝顔が、揺れるテレビの光に照らされる。画面にはU-23(23歳以下)日本代表が、リオデジャネイロ五輪の出場権を懸け、イラク代表と戦う様子が映し出されていた。
合宿中のチームは連日2部練習。松永コーチは誰よりも早くピッチに現れ、若手GKの居残り練習まで付き合い、最後にピッチを後にする。
9年前の就任当時から、変わらぬ熱血指導。その疲労に勝てず、テレビ観戦しながら、いつしか眠りに落ちていた。
その瞬間は、唐突に訪れた。大歓声とアナウンサーの絶叫で、松永コーチは目を覚ました。画面を見やると、ゴールを決めた原川が、チームメートにもみくちゃにされていた。
解説の中山雅史が、ドーハの悲劇を回顧し、感極まっている。そうか、後半ロスタイムというのも、あの時と同じか-。松永もひとり、感慨にふけった。
◇ ◇
翌朝。チームの午前練習のピッチに、やはり最後まで残っていた松永コーチは、宿舎に戻る乗用車の前で取材に応じた。
「五輪に出ないといけないという重圧に、反骨心が勝ったように見えた。世界大会に出られずに来た世代だと言われ続けて、なにくそと頑張ったのではないか。毎試合見ていたけど、勝ち続けたのは勢いじゃなく、チームの成長があってこそ。世間の評価を覆すような結果を出せたのは、日本サッカーにとっても大きなことだし、素晴らしいことだと心を打たれた」。
世間の評価との戦い。あの時は逆の立場だったと、松永はドーハの悲劇当時を振り返りだした。
「ちょっと前まで観客もほとんどいないような日本リーグ時代だったのに、急に日本代表がアジア杯で優勝して、W杯もいけるぞという雰囲気になった。サッカーの見られ方が深まるスピードが追いつかないくらいに、サッカーを見るファン層が爆発的に広がった。立ち上がったばかりのJリーグの成功のためにも、結果が必要だった。実情を超えて高まる期待に、どうにかして応えるしかない状況になっていた」。
期待が重圧に変わり、選手たちをさいなんでいたと、松永コーチは言う。
「肉体的にはボロボロ。それでも何とか最終戦まで出場の可能性を残して、あと1歩でW杯というところまでいった。今考えても、よくあそこまでいったと思う。必死で走るフィールドプレーヤーの背中を見ながら、GKとして何とか失点を食い止めたいと考えていました」。
イラク戦は1点リードで終盤へ。このまま勝てば、初のW杯出場だ。しかし、悪夢の瞬間はやってきた。
後半ロスタイム。ショートコーナーで揺さぶってきたイラク代表に、同点を許した。再開直後、試合終了の笛が鳴った。W杯出場の夢は絶たれた。
「張り詰めていた糸が切れるとは、まさにあのようなことを言うのだと思う。目の前で世界への扉を閉じられた。過酷な道のりを超えて、目の前までたどり着いていたからこそ、ダメージは大きかった」。
それでも松永は、求められれば取材に応じ、悪夢の瞬間について語ってきた。向き合わなければ、前に進めない。そう自分に言い聞かせていた。
だが本当は、「その年は悪夢を振り返るだけではなく、サッカー自体もやりたくないと思っていた」のだという。
少しずつ、記憶と自然に向き合えるようになったのは、日本サッカーが着実な歩みを始めたと実感できるようになってからだ。
「ラモスさんは『神様がまだ早いと言っている』とコメントしていたけど、確かにそうだった。日本は数段飛ばしでW杯に迫っていったけど、ドーハの悲劇をきっかけに、やはり若手の育成からきちんとやらないといけないという機運が高まった。きちんとした育成組織。指導者ライセンス制度。いろんなものが整備されて、日本は本当の意味で強くなることができた」。
◇ ◇
「黄金世代」「プラチナ世代」など、有望株がまとめて育つ年代も現れだした。欧州でプレーする選手も珍しくなくなった。今や日本代表は、W杯本大会の常連になった。
だから「世界を知らない世代」として、手倉森ジャパンが逆の意味で目立つことにもなった。その世代が無敗のまま五輪出場を決めた。松永コーチは「これは大きいこと」と強調する。
松永コーチらの無念をムダにせず、日本サッカーは真の「底上げ」を果たした。それがくしくも、あの悲劇の舞台だったドーハで証明された。しかも同じロスタイムに、93年生まれの原川が決勝点を挙げた。
「何かの縁は感じますよね。1人のプロアスリートとして、あの日負けたからよかったとは、やっぱり言えない。でも、日本が強くなるための1つのステップだったのかなとは思う」。
23年がたった。あの夜、まどろむ松永コーチを揺り起こしたのは、悲劇の記憶ではなかった。テレビから聞こえる歓喜の声に、少しだけ報われた気がした。
◆ドーハの悲劇 93年10月28日、日本はカタール・ドーハで、94年W杯米国大会最終予選の最終戦イラク戦に臨んだ。勝てば初のW杯出場が決まる一戦は、日本がFWカズと中山の得点で2-1とリードし終盤へ。日本がイラクにCKを与えた直後、後半ロスタイムに突入した。
イラクはショートコーナーからのクロスに、オムラムが頭を合わせた。ボールはGK松永の頭上を越えて、日本のゴールに吸い込また。試合はそのまま2-2で終了。日本は韓国と2勝2分け1敗で並んだが、得失点差で3位となり、2位以上に与えられるW杯切符を逃した。
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
JSF page ends in a redirect loop
My browser is always returning a redirect loop and I have no idea why, it looks like when I access login.html it is calling some of my methods.
Here is the login.html file:
<ui:composition
template="/templates/master.xhtml"
xmlns="http://www.w3.org/1999/xhtml"
xmlns:ui="http://java.sun.com/jsf/facelets"
xmlns:h="http://java.sun.com/jsf/html">
<ui:define name="body">
<div class="container-fluid">
<div class="row-fluid">
<div class="span12">
<h:form class="form-horizontal">
<fieldset>
<legend>Bem vindo a Sergio's</legend>
<br/>
<p>Preencha os campos abaixo para entrar no sistema.</p>
<div class="control-group">
<label class="control-label" for="user">Usuário</label>
<div class="controls">
<h:inputText required="true" id="user" value="#{loginController.username}" class="input-medium" />
<h:message for="user" />
</div>
</div>
<div class="control-group">
<label class="control-label" for="password">Senha</label>
<div class="controls">
<h:inputSecret required="true" id="password" value="#{loginController.password}" class="input-medium"/>
<h:message for="password" />
</div>
</div>
<div class="form-actions">
<h:commandButton action="#{loginController.login()}" class="btn btn-primary" value="Entrar"/>
</div>
</fieldset>
</h:form>
<h:messages/>
</div>
</div>
</div>
</ui:define>
</ui:composition>
And here is the LoginController:
package com.erp3.gui.controllers;
import java.io.IOException;
import javax.faces.application.FacesMessage;
import javax.faces.bean.ManagedBean;
import javax.faces.context.ExternalContext;
import javax.faces.context.FacesContext;
@ManagedBean
public class LoginController {
public Boolean isLoggedIn = false;
private String username;
private String password;
private FacesMessage facesMessage;
public ExternalContext externalContent;
public String getPassword() {
return password;
}
public void setPassword(String password) {
this.password = password;
}
public String getUsername() {
return username;
}
public void setUsername(String username) {
this.username = username;
}
public Boolean getIsLoggedIn() {
return isLoggedIn;
}
public void setIsLoggedIn(Boolean isLoggedIn) {
this.isLoggedIn = isLoggedIn;
}
public void login() throws IOException {
if (this.getUsername().equals("daniel") && this.getPassword().equals("123")) {
this.isLoggedIn = true;
externalContent = FacesContext.getCurrentInstance().getExternalContext();
externalContent.getSessionMap().put("loginController", this);
externalContent.redirect(externalContent.getRequestContextPath() + "/views/home.html");
} else {
this.isLoggedIn = false;
facesMessage = new FacesMessage(FacesMessage.SEVERITY_ERROR, "Usuário ou senha inválida.", username);
FacesContext.getCurrentInstance().addMessage(null, facesMessage);
externalContent.redirect(externalContent.getRequestContextPath() + "/views/login.htm");
}
}
public void logOut() throws IOException {
externalContent = FacesContext.getCurrentInstance().getExternalContext();
externalContent.getSessionMap().remove("loginController");
externalContent.redirect(externalContent.getRequestContextPath() + "/views/login.html");
}
}
I have a master.html that is my template and it is calling a top.html with this content:
<ui:composition
xmlns="http://www.w3.org/1999/xhtml"
xmlns:h="http://java.sun.com/jsf/html"
xmlns:ui="http://java.sun.com/jsf/facelets">
<div class="navbar navbar-fixed-top">
<div class="navbar-inner">
<div class="container-fluid">
<a class="btn btn-navbar" data-toggle="collapse" data-target=".nav-collapse">
<span class="icon-bar"></span>
<span class="icon-bar"></span>
<span class="icon-bar"></span>
</a>
<a class="brand" href="#">Project name</a>
<div class="btn-group pull-right">
<a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
<i class="icon-user"></i>
<span class="caret"></span>
</a>
<ul class="dropdown-menu">
<li><a href="#">Conta</a></li>
<li class="divider"></li>
<li><a href="#{loginController.logout}">Sair</a></li>
</ul>
</div>
<div class="nav-collapse">
<ul class="nav">
<li class="active"><a href="#">Home</a></li>
<li><a href="#about">About</a></li>
<li><a href="#contact">Contact</a></li>
</ul>
</div>
</div>
</div>
</div>
</ui:composition>
A:
EL expressions in template text are immediately evaluated during render response and treated as value expressions. I.e. their return value is been printed as part of HTML output. "Plain vanilla" HTML is also template text. So the following
<li><a href="#{loginController.logOut()}">Sair</a></li>
will basically invoke the method, print its returned value as href URL during render response. The resulting HTML is then:
<li><a href="">Sair</a></li>
(yes, the href is empty because you actually returned void instead of a valid String)
But inside that method you're telling JSF to redirect to the login page and hence it ends up in an infinite loop.
This is not what you actually want. You intend to invoke it as a backing bean action method. You should be using fullworthy JSF UICommand component for this, such as <h:commandLink>.
<li><h:form><h:commandLink value="Sair" action="#{loginController.logOut()}" /></h:form></li>
This way you can also change your logOut() method to return a fullworthy navigation outcome:
public String logOut() {
FacesContext.getCurrentInstance().getExternalContext().invalidateSession();
return "/views/login.html?faces-redirect=true";
}
The ExternalContext#redirect() is supposed to be used only when you want to redirect to a non-JSF URL, or when you're actually not inside an action method.
|
{
"pile_set_name": "StackExchange"
}
|
On 10/31/05, Kelton Graham wrote:
> @yitzhak:
>> Let me ask you something, giving the munah, one cannot translate
> this as "God, is your throne for ever and ever."
>> In otherwords the subject/predicate can't flip flop.
The Massoretic marks can't provide that. There are only two possibilities
from the Massoretic marks: either "ksak )lhm" is a unified block or it is
divided into two. If it was divided into two, the verse would read:
[ Your throne ] { [ God ] [ eternal ] }
Translated meaning, "Your throne, God is eternal"? I am not sure what
that means. I guess this means that the division of this verse portion is
rather straightforward.
> And which do you think is stronger translation?
>> Your throne, O God...
> vs
> Your throne is God...
Like I said, I understand that vs 3 reads "God blesses you forever" and
starting with vs 4 reads the blessing to his king. So God can't be speaking
to Himself. God is speaking to His king, blessing him, saying He is the
foundation for his throne/reign.
> In regards to Isaiah 8:11, if this is a piel this would mean that bible works
> is in error, for they mark this as a qal imperfect 3 masculine singular. I
> usually don't go against bible works, but in this case I can't see how they
> got there morphology.
Perhaps by using a variant that I listed. None of the variants that I
pointed out
had a dagesh in the Samekh. Do they claim to follow the Ben Asher Codex?
The dagesh is clear at http://www.aleppocodex.org/aleppocodex.html
Yitzhak Sapir
|
{
"pile_set_name": "Pile-CC"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.