document_id
stringlengths
2
11
passage_offset
uint32
0
909k
passage_text
stringlengths
3
257k
section_type
stringclasses
19 values
passage_type
stringclasses
27 values
annotation_ids
listlengths
1
4.93k
annotation_texts
listlengths
1
4.93k
annotation_offsets
listlengths
1
4.93k
annotation_lengths
listlengths
1
4.93k
annotation_groundings
listlengths
1
4.93k
annotation_types
listlengths
1
4.93k
1990070
47
The 8534 nucleotide sequence of the genome of the carlavirus, potato virus M (PVM), has been determined. The sequence contains six large open reading frames (ORFs) and non-coding regions consisting of 75 nucleotides at the 5' end, 70 nucleotides followed by a poly(A) tail at the 3' end and 38 and 21 nucleotides between three large blocks of coding sequences. The ORF beginning at the first initiation codon at nucleotide 76 encodes a polypeptide of 223K which, according to its primary sequence analysis, seems to be a virus RNA replicase. The next coding block consists of three ORFs encoding polypeptides of 25K, 12K and 7K. The third block consists of two ORFs encoding polypeptides of 34K (PVM coat protein) and 11K. The 11K polypeptide contains a pattern resembling the consensus for a metal-binding nucleic acid-binding 'finger'.
null
abstract
[ 9, 10, 11, 12, 13, 14, 15 ]
[ "carlavirus", "potato virus M", "PVM", "poly(A)", "initiation codon at nucleotide 76", "PVM coat protein", "metal" ]
[ 97, 109, 125, 307, 439, 743, 840 ]
[ 10, 14, 3, 7, 33, 16, 5 ]
[ "12163", "12167", "12167", "MESH:D011061", "tmVar:|Allele|INITIATION|76;VariantGroup:0", null, "MESH:D008670" ]
[ "Species", "Species", "Species", "Chemical", "ProteinMutation", "Gene", "Chemical" ]
1990292
172
We isolated clonal sublines of the established mouse marrow stromal cell line, H-1. These clonal sublines underwent differentiation into adipocytes in various degrees. One subline, H-1/A, underwent adipocyte differentiation after confluence, while another subline, H-1/D, did not differentiate. In H-1/A cells, the 4.5- and 2.5-kb major mRNA species of colony-stimulating factor 1 (CSF-1) were expressed before differentiation and were down-regulated at a posttranscriptional level during the differentiation of H-1/A cells. The down-regulation of the CSF-1 gene was not a result of arrested cellular growth, because no down-regulation was detected in the nondifferentiating sister line, H-1/D. This down-regulation appeared to be an early event in differentiation. Cachectin/tumor necrosis factor transiently induced the expression of CSF-1 and inhibited the differentiation of H-1/A cells into adipocytes. This induced expression of CSF-1 was due to an increased rate of transcription.
null
abstract
[ 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 ]
[ "mouse", "H-1", "H-1/A", "H-1", "H-1/A", "colony-stimulating factor 1", "CSF-1", "H-1/A", "CSF-1", "H-1/D.", "Cachectin", "tumor necrosis factor", "CSF-1", "H-1/A", "CSF-1" ]
[ 219, 251, 353, 437, 470, 525, 554, 684, 724, 860, 938, 948, 1008, 1051, 1107 ]
[ 5, 3, 5, 3, 5, 27, 5, 5, 5, 6, 9, 21, 5, 5, 5 ]
[ "10090", "CVCL:HA53", "tmVar:c|Allele|H,A|-1;VariantGroup:0;OriginalGene:12977;CorrespondingGene:1435;CorrespondingSpecies:10090", "CVCL:HA53", "CVCL:HA53", "12977", "12977", "CVCL:HA53", "12977", "CVCL:B4ZW", "21926", "21926", "12977", "CVCL:HA53", "12977" ]
[ "Species", "CellLine", "DNAMutation", "CellLine", "CellLine", "Gene", "Gene", "CellLine", "Gene", "CellLine", "Gene", "Gene", "Gene", "CellLine", "Gene" ]
1990431
94
Rhodopsin and the visual pigments are a distinct group within the family of G-protein-linked receptors in that they have a covalently bound ligand, the 11-cis-retinal chromophore, whereas all of the other receptors bind their agonists through noncovalent interactions. The retinal chromophore in rhodopsin is bound by means of a protonated Schiff base linkage to the epsilon-amino group of Lys-296. Two rhodopsin mutants have been constructed, K296G and K296A, in which the covalent linkage to the chromophore is removed. Both mutants form a pigment with an absorption spectrum close to that of the wild type when reconstituted with the Schiff base of an n-alkylamine and 11-cis-retinal. In addition, the pigment formed from K296G and the n-propylamine Schiff base of 11-cis-retinal was found to activate transducin in a light-dependent manner, with 30 to 40% of the specific activity measured for the wild-type protein. It appears that the covalent bond is not essential for binding of the chromophore or for catalytic activation of transducin.
null
abstract
[ 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 ]
[ "Rhodopsin", "11-cis-retinal", "retinal", "rhodopsin", "Schiff base", "rhodopsin", "K296G", "K296A", "Schiff base", "n-alkylamine", "11-cis-retinal", "K296G", "n-propylamine", "Schiff base", "11-cis-retinal" ]
[ 94, 246, 367, 390, 434, 497, 538, 548, 731, 749, 766, 819, 833, 847, 862 ]
[ 9, 14, 7, 9, 11, 9, 5, 5, 11, 12, 14, 5, 13, 11, 14 ]
[ "6010", "MESH:D012172", "MESH:D012172", "6010", "MESH:D012545", "6010", "tmVar:p|SUB|K|296|G;HGVS:p.K296G;VariantGroup:0;CorrespondingGene:6010;CorrespondingSpecies:9606", "tmVar:p|SUB|K|296|A;HGVS:p.K296A;VariantGroup:0;CorrespondingGene:6010;CorrespondingSpecies:9606", "MESH:D012545", "-", "ME...
[ "Gene", "Chemical", "Chemical", "Gene", "Chemical", "Gene", "ProteinMutation", "ProteinMutation", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Chemical", "Chemical", "Chemical" ]
38363132
2,991
Unfortunately, the emergence and spread of artemisinin resistance in P. falciparum and the declining efficacy of ACTs, first reported in the Greater Mekong sub-region in 2009 and more recently in Papua New Guinea, Guyana, and sub-Saharan Africa (Rwanda, Uganda, Ethiopia, and Eritrea), are a major concern. A better understanding of the mechanisms of action and resistance to ACTs is urgently needed, not only to manage current clinical use but also to rationally design new strategies. ART-R is defined as a delayed clearance of circulating asexual blood-stage parasites following 3 days of ACT treatment or artemisinin monotherapy (half-life >5.5 h). In vitro, ART-R manifests as increased survival of early ring blood-stage parasites (0-3 h post-invasion [hpi]) exposed to a pulse of 700 nM dihydroartemisinin (DHA, the active metabolite of all clinically used ARTs) for 6 h as measured by the ring-stage survival assay (RSA). Subsequently, mutations in the beta-propeller domain of the P. falciparum kelch gene (Pfkelch13) were shown to confer ART-R in vivo and in vitro. Currently, the most common Pfkelch13 mutation associated with delayed clearance in the eastern part of the Greater Mekong sub-region is C580Y. Recent reports suggest that Pfkelch13 mutations result in lower levels of the kelch13 protein, which is involved in the endocytosis and digestion of hemoglobin in the early ring-stage parasite. Therefore, it has been postulated that the mutations result in reduced endocytosis and degradation of hemoglobin in early ring-stage parasites, resulting in reduced levels of Fe2+-heme available to activate ART. In addition, like other organisms, P. falciparum can mount protective responses to sudden changes in its environment such as temporary cell cycle arrest of a fraction of the ring-stage population (also called quiescence or dormancy) to increase survival under unfavorable conditions. This has been demonstrated for some metabolic conditions (variations in sugars, amino acids, lipids, and micronutrients) and exposure to febrile temperatures and also for drugs such as ART that have been shown to induce this phenotype in vitro and in vivo.
INTRO
paragraph
[ 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 ]
[ "kelch", "Pfkelch13", "Pfkelch13", "Pfkelch13", "kelch13", "hemoglobin", "hemoglobin", "ART-R", "ART-R", "ART-R", "artemisinin", "artemisinin", "dihydroartemisinin", "DHA", "ARTs", "Fe2+", "heme", "ART", "sugars", "amino acids", "lipids", "ART", "C580Y", "P. falciparum"...
[ 3995, 4007, 4094, 4238, 4288, 4359, 4506, 3478, 3654, 4039, 3034, 3600, 3785, 3805, 3855, 4579, 4584, 4611, 4972, 4980, 4993, 5085, 4203, 3060, 3981, 4651 ]
[ 5, 9, 9, 9, 7, 10, 10, 5, 5, 5, 11, 11, 18, 3, 4, 4, 4, 3, 6, 11, 6, 3, 5, 13, 13, 13 ]
[ "11275", null, null, null, null, null, null, "MESH:C580424", "MESH:C580424", "MESH:C580424", "MESH:C031327", "MESH:C031327", "MESH:C039060", "MESH:C039060", "-", "-", "MESH:D006418", "-", "MESH:D000073893", "MESH:D000596", "MESH:D008055", "-", "tmVar:p|SUB|C|580|Y;HGVS:p....
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Species", "Spec...
38363132
5,159
Here, we investigated whether the early ring parasites can sense a stressful environment and induce a fraction of the parasites to undergo a temporary growth arrest that can survive DHA exposure. Using the NF54WT, 3D7WT, 3D7C580Y, and Cambodian P. falciparum kelch13 wild-type (WT) and mutant (C580Y) parasite lines, we show that the culture medium prepared from chloroquine (CQ)-killed NF54WT parasites (mimicking a stressful environment) can induce a temporary growth arrest of P. falciparum early ring-stage parasites. The temporary growth arrest was dependent on the genetic background of the parasite lines but independent of the Pfkech13 genotype. We confirmed that the proportion of ring stages capable of entering a growth arrest increased, resulting in an increased proportion of parasites that were able to survive a 700 nM pulse of DHA for 6 h. Reduced susceptibility to DHA was shown to be threshold-dependent, with the proportion of viable parasites decreasing significantly as the concentration of the stressful environment decreased. We also provide evidence that the signal is potentially mediated by several molecules of small molecular weights (<3 kDa), which would rule out a role for extracellular vesicles (EVs). Finally, we show that DHA-exposed susceptible mature stages of P. falciparum may release these molecules as they die. These potential signaling molecules could, thus, act as danger signals of environmental stress and influence ring-stage growth to optimize population survival, irrespective of the Pfkelch13 genotype. This suggests that Pfkelch13 mutations that confer artemisinin partial resistance and the ring-stage stress-sensing pathway may be two complementary survival mechanisms.
INTRO
paragraph
[ 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 ]
[ "Pfkech13", "Pfkelch13", "Pfkelch13", "DHA", "chloroquine", "CQ", "DHA", "DHA", "DHA", "artemisinin", "C580Y", "P. falciparum kelch13", "P. falciparum", "P. falciparum" ]
[ 5794, 6691, 6730, 5341, 5522, 5535, 6002, 6041, 6415, 6762, 5453, 5404, 5639, 6456 ]
[ 8, 9, 9, 3, 11, 2, 3, 3, 3, 11, 5, 21, 13, 13 ]
[ null, null, null, "MESH:C039060", "MESH:D002738", "MESH:D002738", "MESH:C039060", "MESH:C039060", "MESH:C039060", "MESH:C031327", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", null, "5833", "5833" ]
[ "Gene", "Gene", "Gene", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Species", "Species", "Species" ]
38363132
8,126
We observed that ring-stage parasites exposed to complete RPMI medium (control) had a normal, but heterogeneous, intraerythrocytic developmental cycle progression from ring to trophozoite stages at H24 (i.e., average 24% for ring stages and 76% for trophozoite stages) and from trophozoite stages to schizonts at H48 (i.e., average 26% for trophozoite stages and 74% for schizonts). However, a significant growth delay was observed for all the Cambodian CQ-R P. falciparum parasite lines exposed to the M_NF54_CQ20h medium. A clear shift toward younger forms was observed at H24 (i.e., average 70% for ring stages and 30% for trophozoite stages, P < 10-4, chi-squared test) and H48 (i.e., average 8% for ring stages, 62% for trophozoite stages, and 30% for schizonts, P < 10-4, chi-squared test) (Fig. 1). Although the intraerythrocytic developmental cycle progression was similar between the three Cambodian parasite lines at H24 in both conditions (M_NF54_CQ20h and RPMI complete medium), we observed a higher proportion of ring stages for the Cambodian Pfkelch13 wild-type parasite line (PL3WT) compared to the other two Cambodian Pfkelch13 C580Y parasite lines (PL1C580Y and PL2C580Y), at H48 in the M_NF54_CQ20h-treated condition (forPL3WT: 21% ring stages, 63% trophozoite stages, and 17% schizonts; for PL1C580Y: 0% ring stages, 58% trophozoite stages, and 42% schizonts; and for PL2C580Y: 2% ring stages, 65% trophozoite stages, and 33% schizonts, P < 10-4, chi-squared test).
RESULTS
paragraph
[ 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 ]
[ "RPMI medium", "CQ-R", "M_NF54_CQ20h", "M_NF54_CQ20h", "RPMI", "M_NF54_CQ20h", "C580Y", "C580Y", "P. falciparum", "Pfkelch13", "Pfkelch13" ]
[ 8184, 8580, 8629, 9077, 9094, 9330, 9516, 9439, 8585, 9182, 9260 ]
[ 11, 4, 12, 12, 4, 12, 5, 5, 13, 9, 9 ]
[ "-", "-", "-", "-", "-", "-", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "5833", null, null ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "Species", "Species", "Species" ]
38363132
11,090
We next investigated whether the in vitro DHA susceptibility of P. falciparum parasite lines, as expressed by the ring-stage survival assay (RSA0-3h), is affected by the delayed growth progression induced by M_NF54_CQ20h treatment. Early 0-3 hpi ring-stage parasites of 3D7C580Yand the parasite lines PL1C580Y and PL2C580Y were prepared (Fig. S3) and exposed to four different culture media for 30 min (RPMI complete medium used as control, M_NF54_CQ20h medium prepared as previously described, M_NF54 culture medium prepared from asynchronous NF54 parasites, and M_RBC_CQ20h culture medium prepared from uninfected RBCs exposed to 200 nM CQ for 20 h). The 3D7C580Y, PL1C580Y, and PL2C580Y parasite lines were then exposed to 700 nM DHA or 0.1% dimethylsulfoxide (DMSO, used as a vehicle control) for 6 h, washed three times with incomplete RPMI medium to remove the drug, transferred to 6-well plates, and cultured in complete RPMI medium for a further 66 h. Parasitemia was measured by microscopy at 72 h. Parasite survival was expressed as the ratio of viable parasites in DHA to DMSO-treated samples, as previously described. All experiments were performed in triplicate.
RESULTS
paragraph
[ 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143 ]
[ "DHA", "M_NF54", "CQ20h", "RPMI", "M_NF54", "CQ20h", "M_NF54", "CQ20h", "CQ", "DHA", "dimethylsulfoxide", "DMSO", "RPMI", "RPMI", "DHA", "DMSO", "C580Y", "P. falciparum" ]
[ 11132, 11298, 11305, 11493, 11531, 11538, 11585, 11660, 11729, 11823, 11835, 11854, 11931, 12018, 12166, 12173, 11774, 11154 ]
[ 3, 6, 5, 4, 6, 5, 6, 5, 2, 3, 17, 4, 4, 4, 3, 4, 5, 13 ]
[ "MESH:C039060", "-", "-", "-", "-", "-", "-", "-", "MESH:D002738", "MESH:C039060", "MESH:D004121", "MESH:D004121", "-", "-", "MESH:C039060", "MESH:D004121", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "5833" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Species" ]
38363132
12,270
We found that the proportions of viable parasites of the parasite lines treated with complete RPMI medium were 10.6%, 17.3%, and 18.3% for 3D7C580Y, PL1C580Y, and PL2C580Y, respectively (Fig. 2). Similar proportions of viable parasites were found for parasite lines treated with culture medium prepared from asynchronous NF54 parasites (M_NF54) (10.6% for 3D7C580Y, P = 0.8; 25.5% for PL1C580Y, P = 0.1;and 21.3% for PL2C580Y, P = 0.1, t-test) and parasites treated with culture medium prepared from uninfected RBCs exposed to 200nM CQ for 20 h (M_RBC_CQ20h) (10.2% for the 3D7C580Y, P = 0.7; 18.1% for PL1C580Y, P = 0.1;and 19.9% for PL2C580Y, P = 0.7, t-test). These data showed that (i) a culture medium containing 200nM CQ (M_RBC_CQ20h condition) did not alter the in vitro susceptibility of the tested parasite lines to DHA, consistent with the mode of action of the 4-aminoquinoline derivatives, which act mainly on mature stages by inhibiting the conversion of heme to hemozoin, and (ii) culture medium prepared from an asynchronous NF54 parasite line (M_NF54 condition) did not result in medium depletion or release of signals that could affect the growth progression of the ring-stages. However, we clearly observed that the proportion of viable parasites in the parasite lines treated with M_NF54_CQ20h medium was significantly increased (~2-fold) compared to the tested parasite lines exposed to the complete RPMI medium. Parasite survival changed from 10.6% to 23.4%, P = 0.01 for 3D7C580Y, 17.3% to 32.5% for PL1C580Y, P = 0.02, and 18.3% to 32.4% for PL2C580Y, P = 0.02, t-test. These data may indicate that CQ-killed parasites release a signal in the culture medium that delays the growth of CQ-R ring stages and increases the proportion of ring stages that survive a 700 nM pulse of DHA.
RESULTS
paragraph
[ 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163 ]
[ "RPMI medium", "CQ", "CQ20h", "CQ", "CQ20h", "DHA", "4-aminoquinoline", "heme", "M_NF54_CQ20h medium", "RPMI medium", "CQ", "CQ-R", "DHA", "C580Y", "C580Y", "C580Y", "C580Y", "C580Y", "C580Y", "C580Y" ]
[ 12364, 12803, 12822, 12994, 13004, 13095, 13142, 13238, 13570, 13690, 13892, 13977, 14069, 13838, 13795, 13766, 12908, 12876, 12847, 12690 ]
[ 11, 2, 5, 2, 5, 3, 16, 4, 19, 11, 2, 4, 3, 5, 5, 5, 5, 5, 5, 5 ]
[ "-", "MESH:D002738", "-", "MESH:D002738", "-", "MESH:C039060", "MESH:C001920", "MESH:D006418", "-", "-", "MESH:D002738", "-", "MESH:C039060", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGrou...
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Protein...
38363132
14,074
In vitro susceptibility to DHA is reduced in early ring-stage parasites (0-3 hpi) exposed to stress-induced medium. The graphs show the proportion of viable parasites (%) as measured by the RSA0-3h for the parasite lines 3D7C580Y, PL1C580Y, and PL2C580Y in the four environmental conditions: 30 min 0-3 hpi ring stages pre-treatment with complete RPMI medium (RPMI), culture medium prepared from an asynchronous NF54 CQ-S parasite line exposed to 200 nM CQ for 20 h (M_NF54_CQ20h), culture medium prepared from asynchronous NF54 parasites (M_NF54), and culture medium prepared from uninfected RBCs exposed to 200 nM CQ for 20 h (M_RBC_CQ20h). The number of RBCs counted in each RSA0-3h assay was 20,000. All experiments were performed in triplicate. For each parasite line, no statistical difference was found between M_NF54 or M_RBC_CQ20h and RPMI conditions (indicated by "ns"), while survival rates in the M_NF54_CQ20h condition were significantly higher (~2-fold increase) compared to the RPMI condition (indicated by "*"). One-way ANOVA: 3D7C580Y: F-value =4.455, df = 3; PL1C580Y: F-value =6.268, df = 3; PL2C580Y: F-value =6.489, df = 3.
FIG
fig_caption
[ 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177 ]
[ "DHA", "RPMI medium", "RPMI", "CQ", "CQ", "CQ20h", "CQ", "CQ20h", "CQ20h", "RPMI", "CQ20h", "RPMI", "C580Y", "C580Y" ]
[ 14101, 14421, 14434, 14491, 14528, 14548, 14690, 14709, 14908, 14918, 14990, 15067, 15188, 15154 ]
[ 3, 11, 4, 2, 2, 5, 2, 5, 5, 4, 5, 4, 5, 5 ]
[ "MESH:C039060", "-", "-", "MESH:D002738", "MESH:D002738", "-", "MESH:D002738", "-", "-", "-", "-", "-", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;Correspondin...
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation" ]
38363132
15,348
To confirm whether a signal released by CQ-killed parasites in the culture medium could affect the growth of CQ-R ring-stage parasite lines, we treated 0-3 hpi ring-stage 3D7C580Y, PL1C580Y, and PL2C580Y parasites with dilutions of the M_NF54_CQ20h medium (1/2 and 1/4 dilutions) before assessing their in vitro susceptibility to DHA using the RSA0-3h (Fig. S4). RPMI medium and the pure M_NF54_CQ20h medium were used as negative and positive controls, respectively. All assays were performed in triplicate.
RESULTS
paragraph
[ 180, 181, 182, 183, 184, 185, 186 ]
[ "CQ", "CQ-R", "M_NF54_CQ20h medium", "DHA", "RPMI medium", "M_NF54_CQ20h medium", "C580Y" ]
[ 15388, 15457, 15584, 15678, 15711, 15736, 15546 ]
[ 2, 4, 19, 3, 11, 19, 5 ]
[ "MESH:D002738", "-", "-", "MESH:C039060", "-", "-", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation" ]
38363132
15,860
As previously observed, we confirmed that the proportions of viable parasites of the parasite lines treated with the M_NF54_CQ20h medium were significantly increased compared to the tested parasite lines exposed to complete RPMI medium. We observed that the parasite survival changed from 10.7% to 29.2%, P = 0.002 for 3D7C580Y; from 11.8% to 46.7% for PL1C580Y, P = 0.0003; and from 18.8% to 60.2% for PL2C580Y, P = 0.002, t-test (Fig. 3). We detected significant differences in the proportions of viable parasites in the lines that were treated with the pure M_NF54_CQ20h medium compared to the diluted M_NF54_CQ20h media. These data suggest that a signal released by CQ-killed parasites may diffuse into the culture medium and affect the ability of the ring stages to survive DHA exposure in a threshold-dependent manner. This raises the question of what molecule(s) might be responsible for such a phenotype.
RESULTS
paragraph
[ 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197 ]
[ "M_NF54", "CQ20h", "RPMI medium", "M_NF54", "CQ20h", "M_NF54", "CQ20h", "CQ", "DHA", "C580Y", "C580Y" ]
[ 15977, 15984, 16084, 16421, 16428, 16465, 16472, 16530, 16639, 16266, 16216 ]
[ 6, 5, 11, 6, 5, 6, 5, 2, 3, 5, 5 ]
[ "-", "-", "-", "-", "-", "-", "-", "MESH:D002738", "MESH:C039060", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation" ]
38363132
16,773
In vitro susceptibility of P. falciparum parasite lines to DHA is restored by dilutions of stress-induced medium. The graphs show the proportion of viable parasites (%) as expressed by the RSA0-3h for the parasite lines 3D7C580Y, PL1C580Y, and PL2C580Y in the four experimental conditions: 30 min 0-3 hpi ring stages pre-treated with complete RPMI medium (negative control), pure M_NF54_CQ20h medium, 1/2 dilution of M_NF54_CQ20h medium in complete RPMI medium, and 1/4 dilution of M_NF54_CQ20h medium in complete RPMI medium. The number of RBCs counted in each RSA0-3h assay was ~20,000. All experiments were performed in triplicate. For each parasite line, no statistical difference was found between RPMI and 1/2 and 1/4 M_NF54_CQ20h (indicated by "ns"), while survival rates in the pure M_NF54_CQ20h condition were significantly higher compared to the RPMI condition (indicated by "*"). One-way ANOVA: 3D7C580Y: F-value =9.031, df = 3; PL1C580Y: F-value =84.42, df = 3; PL2C580Y: F-value =26.86, df = 3.
FIG
fig_caption
[ 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214 ]
[ "DHA", "RPMI medium", "M_NF54", "CQ20h", "M_NF54", "CQ20h", "RPMI medium", "M_NF54", "CQ20h", "RPMI medium", "M_NF54", "CQ20h", "M_NF54", "CQ20h", "C580Y", "C580Y", "P. falciparum" ]
[ 16832, 17116, 17153, 17160, 17190, 17197, 17222, 17255, 17262, 17287, 17497, 17504, 17564, 17571, 17750, 17716, 16800 ]
[ 3, 11, 6, 5, 6, 5, 11, 6, 5, 11, 6, 5, 6, 5, 5, 5, 13 ]
[ "MESH:C039060", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "...
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "Species" ]
38363132
34,676
P. falciparum asexual blood-stage parasites were propagated in T50 flasks (Falcon) at 4% hematocrit and parasitemia <1% in 10 mL RPMI-1640 medium (Gibco) supplemented with 10% Albumax (Gibco), 0.2 mM hypoxanthine, 2% AB human serum (heat-inactivated at 56 C), and 4 microg/mL gentamicin (complete RPMI medium). Parasites were maintained at 37 C in 90% N2, 5% O2, and 5% CO2. AB+ human sera and fresh O+ blood from healthy donors were provided by the Etablissement Francais du Sang at Strasbourg. We used several parasite lines including the laboratory strains 3D7 and NF54, 3D7C580Y (a CRISPR/Cas9 edited line, and three culture-adapted isolates from Pailin (western Cambodia). These include PL1C580Y and PL2C580Y (two Pfkelch13 580Y mutant parasite lines) and PL3WT (a Pfkelch13 wild-type parasite line). The genotypes of the parasite lines in the P. falciparum chloroquine resistance transporter gene (pfcrt), the Plasmodium falciparum multidrug-resistant protein gene (pfmdr-1), and the Plasmodium falciparum kelch gene located on chromosome 13 (Pfkelch13) were determined by whole-genome sequencing. Details are presented in Table S1.
METHODS
paragraph
[ 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371 ]
[ "Pfkelch13", "Pfkelch13", "chloroquine resistance transporter", "pfcrt", "multidrug-resistant protein", "pfmdr-1", "kelch", "Pfkelch13", "RPMI-1640 medium", "Albumax", "hypoxanthine", "gentamicin", "RPMI medium", "N2", "O2", "CO2", "C580Y", "580Y", "P. falciparum", "human", "...
[ 35395, 35446, 35539, 35580, 35614, 35648, 35688, 35725, 34805, 34852, 34876, 34952, 34973, 35028, 35035, 35046, 35384, 35405, 34676, 34896, 35055, 35525, 35592, 35666 ]
[ 9, 9, 34, 5, 27, 7, 5, 9, 16, 7, 12, 10, 11, 2, 2, 3, 5, 4, 13, 5, 5, 13, 21, 21 ]
[ null, null, null, null, null, null, "11275", null, "-", "-", "MESH:D019271", "MESH:D005839", "-", "MESH:D009584", "-", "MESH:D002245", "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606", "tmVar:p|Allele|Y|580;VariantGroup:0;Correspon...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "Species", "Species", "Species", "Species", "Species", "Species" ]
38363132
40,476
Local emergence in Amazonia of Plasmodium falciparum k13 C580Y mutants associated with in vitro artemisinin resistance
REF
ref
[ 418 ]
[ "C580Y" ]
[ 40533 ]
[ 5 ]
[ "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606" ]
[ "ProteinMutation" ]
38363132
40,664
Emergence of artemisinin-resistant Plasmodium falciparum with kelch13 C580Y mutations on the island of New Guinea
REF
ref
[ 419 ]
[ "C580Y" ]
[ 40734 ]
[ 5 ]
[ "tmVar:p|SUB|C|580|Y;HGVS:p.C580Y;VariantGroup:0;CorrespondingGene:11275;CorrespondingSpecies:9606" ]
[ "ProteinMutation" ]
38363132
41,046
Emergence and clonal expansion of in vitro artemisinin-resistant Plasmodium falciparum kelch13 R561H mutant parasites in Rwanda
REF
ref
[ 420 ]
[ "R561H" ]
[ 41141 ]
[ 5 ]
[ "tmVar:p|SUB|R|561|H;HGVS:p.R561H;VariantGroup:1;CorrespondingGene:11275;CorrespondingSpecies:9606" ]
[ "ProteinMutation" ]
39872575
16,448
Absence of V599E BRAF mutations in desmoplastic melanomas
REF
ref
[ 139, 140 ]
[ "BRAF", "V599E" ]
[ 16465, 16459 ]
[ 4, 5 ]
[ "673", "tmVar:p|SUB|V|599|E;HGVS:p.V599E;VariantGroup:0;CorrespondingGene:673;CorrespondingSpecies:9606" ]
[ "Gene", "ProteinMutation" ]
38931793
23,550
Figure 5a,b depict the methodology and setup of the study. The experiment used a stainless-steel water pipeline with an outer diameter of 114.4 mm and a thickness of 6 mm to simulate pipeline leakages. R15I-AST sensors from Mistras Group, Inc. (New Jersey, NJ, USA) were fixed on the pipeline to detect AE signals, which were then captured at a sampling rate of 1 MHz using a National Instruments NI-9223 data acquisition system connected to a PC in Austin, TX, USA. To create leaks of different sizes, holes were drilled into the pipeline with an electric drill. A fluid control valve was attached at the hole's location to regulate fluid flow. Water was used for testing due to its non-hazardous nature, facilitating the development of secure and controlled leak scenarios.
METHODS
paragraph
[ 31, 32, 33, 34, 35 ]
[ "leaks", "stainless-steel", "water", "Water", "R15I" ]
[ 24027, 23631, 23647, 24196, 23752 ]
[ 5, 15, 5, 5, 4 ]
[ "MESH:D019559", "MESH:D013193", "MESH:D014867", "MESH:D014867", "tmVar:p|SUB|R|15|I;HGVS:p.R15I;VariantGroup:0" ]
[ "Disease", "Chemical", "Chemical", "Chemical", "ProteinMutation" ]
38931793
27,211
This study utilizes the HSU-Nielsen test as an active AE source to evaluate the attenuation characteristics of the AE sensor. The HSU-Nielsen test involves conducting a pencil lead break test, where a 0.5 mm diameter lead is applied to the pipeline's surface to generate an acoustic emission event. The AE signals detected in this test are similar to those from natural AE sources, like leaks. Figure 10 shows the attenuation characteristics of a fluid-filled industrial pipeline with an outer diameter of 114.3 mm. The proposed method classified normal and HSU-Nielsen test activities with over 95% accuracy when attenuation in the AE signals collected by the R15I-AST AE sensor was below 25 dB. Figure 9 shows this attenuation level at 10.9 m. Thus, the method can provide surveillance for up to 10.9 m.
METHODS
paragraph
[ 40 ]
[ "R15I" ]
[ 27872 ]
[ 4 ]
[ "tmVar:p|SUB|R|15|I;HGVS:p.R15I;VariantGroup:0" ]
[ "ProteinMutation" ]
37274236
102
Kaposiform hemangioendothelioma (KHE) is an extremely rare, locally aggressive vascular neoplasm. The etiopathogenesis of KHE is still poorly understood. In the present study, we found a new mutation in KHE (c.685delA, p.Thr229fs). The KHE patient with the PIK3CA mutation showed complete regression after sirolimus treatment. We propose that the presence of the PIK3CA mutation in KHE may correlate with good response to sirolimus.
ABSTRACT
abstract
[ 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 ]
[ "PIK3CA", "PIK3CA", "Kaposiform hemangioendothelioma", "KHE", "vascular neoplasm", "KHE", "KHE", "KHE", "KHE", "sirolimus", "sirolimus", "c.685delA", "p.Thr229fs", "patient" ]
[ 359, 465, 102, 135, 181, 224, 305, 338, 484, 408, 524, 310, 321, 342 ]
[ 6, 6, 31, 3, 17, 3, 3, 3, 3, 9, 9, 9, 10, 7 ]
[ "5290", "5290", "MESH:C537007", "MESH:C537007", "MESH:D019043", "MESH:C537007", "MESH:C537007", "MESH:C537007", "MESH:C537007", "MESH:D020123", "MESH:D020123", "tmVar:c|DEL|685|A;HGVS:c.685delA;VariantGroup:3;CorrespondingGene:5290;CorrespondingSpecies:9606", "tmVar:p|FS|T|229||;HGVS:p.T229f...
[ "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Chemical", "Chemical", "DNAMutation", "ProteinMutation", "Species" ]
37274236
548
Kaposiform hemangioendothelioma (KHE) is an extremely rare, locally aggressive vascular neoplasm resulting from abnormal angiogenesis and lymphangiogenesis during infancy or early childhood. It is commonly complicated by the occurrence of the Kasabach-Merritt phenomenon, which is characterized by the association of a rapidly growing vascular tumor, thrombocytopenia and consumptive coagulopathy. Recently, Carli et al. reported a patient with KHE with a phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) mutation (c.323G > A, p.Arg108His) and suggested that KHE may be a subtype of PIK3CA-related overgrowth spectrum (PROS). PROS is defined as a phenotypic spectrum of developmental disorders caused by activating variants of the PIK3CA gene. In the present study, we found a different PIK3CA mutation in KHE (c.685delA, p.Thr229fs), which provides new evidence that KHE may belongs to PROS.
INTRO
paragraph
[ 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ]
[ "phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha", "PIK3CA", "PIK3CA", "PIK3CA", "Kaposiform hemangioendothelioma", "KHE", "vascular neoplasm", "vascular tumor", "thrombocytopenia", "coagulopathy", "KHE", "KHE", "PIK3CA-related overgrowth spectrum", "PROS", "PROS",...
[ 1004, 1076, 1310, 1366, 548, 581, 627, 883, 899, 932, 993, 1138, 1162, 1198, 1205, 1249, 1385, 1447, 1466, 1094, 1106, 1390, 1401, 980 ]
[ 70, 6, 6, 6, 31, 3, 17, 14, 16, 12, 3, 3, 34, 4, 4, 23, 3, 3, 4, 10, 11, 9, 10, 7 ]
[ "5290", "5290", "5290", "5290", "MESH:C537007", "MESH:C537007", "MESH:D019043", "MESH:D009369", "MESH:D013921", "MESH:D001778", "MESH:C537007", "MESH:C537007", "MESH:C537340", "MESH:C537340", "MESH:C537340", "MESH:D002658", "MESH:C537007", "MESH:C537007", "MESH:C537340", "tmVar...
[ "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "DNAMutation", "ProteinMutation", "DNAMutation", "ProteinMutation", "Spec...
37274236
3,179
The patient underwent biopsy that confirmed the pathological diagnosis of KHE. Hematoxylin and eosin staining showed typical glomeruloid areas with spindle shaped cells. Immunohistochemical staining was positive for D2-40, PROX-1, LYVE-1, CD31 and CD34 ( Figure 3 ). We also detected the extracted DNA in tumor tissue samples from biopsy by next generation sequencing and bioinformatics analysis. We focused on hot-spot mutation regions of 42 genes ( Table 1 ) related to tumorigenesis and vascular diseases and found that the patient harbored PIK3CA mosaic pathogenic variants (c.685delA and p.Thr229fs).
CASE
paragraph
[ 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 ]
[ "PROX-1", "LYVE-1", "CD31", "CD34", "PIK3CA", "KHE", "tumor", "vascular diseases", "c.685delA", "p.Thr229fs", "patient", "patient" ]
[ 3402, 3410, 3418, 3427, 3723, 3253, 3484, 3669, 3758, 3772, 3183, 3706 ]
[ 6, 6, 4, 4, 6, 3, 5, 17, 9, 10, 7, 7 ]
[ "5629", "10894", "5175", "947", "5290", "MESH:C537007", "MESH:D009369", "MESH:D014652", "tmVar:c|DEL|685|A;HGVS:c.685delA;VariantGroup:3;CorrespondingGene:5290;CorrespondingSpecies:9606", "tmVar:p|FS|T|229||;HGVS:p.T229fsX;VariantGroup:2;CorrespondingGene:5290;CorrespondingSpecies:9606", "9606",...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "DNAMutation", "ProteinMutation", "Species", "Species" ]
37274236
5,429
A few mutations and genes had been found to be related to the development of KHE. Zhou et al. demonstrated a somatic translocation between chromosomes 13 and 16 at the bands of 13q14 and 16p13.3 in 10% of cells with KHE nodules; normal cells were also present in the karyotype. Lim et al. identified a single heterozygous somatic single nucleotide variation, c.614A>T (p.Gln205Leu), in GNA14 (G-protein subunit alpha 14) in one of three KHE patients. They subsequently confirmed that somatic activation of the GNA14 mutation caused changes in cellular morphology and rendered cells growth-factor independent by upregulating the mitogen-activated protein kinase (MAPK) pathway. A recent study also revealed that PIK3CA mutations correlated with mammalian target of rapamycin (mTOR) pathway expression, but not with clinical or pathological features, in patients with fibro-adipose vascular anomaly, indicating that sirolimus may still be effective in patients without PIK3CA mutations. Sirolimus inhibits the mTOR pathway, with subsequent effects on angiogenesis and lymphangiogenesis. Maruani et al. reported that inhibiting mTOR may help shrink lesions and improve clinical symptoms associated with lymphatic anomalies, even with no evidence of PIK3CA variants. We analyzed the expression of mTOR-related proteins in KHE and found that the absence of tuberous sclerosis complex 2 and phosphatase and tensin homolog caused abnormal activation of the mTOR signaling pathway and may account for the pathogenesis of KHE. In our study, the patient with a new PIK3CA mutation showed complete response to sirolimus therapy. The PIK3CA mutation may have abnormally activated the mTOR pathway, although the pathogenicity of this mutation has not been confirmed. In our next study, we will construct the mutant gene in zebrafish to observe the phenotype of the PIK3CA mutation.
DISCUSS
paragraph
[ 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 ]
[ "GNA14", "G-protein subunit alpha 14", "GNA14", "PIK3CA", "mammalian target of rapamycin", "mTOR", "PIK3CA", "mTOR", "mTOR", "PIK3CA", "mTOR", "phosphatase and tensin homolog", "mTOR", "PIK3CA", "PIK3CA", "mTOR", "PIK3CA", "KHE", "KHE", "KHE", "fibro-adipose vascular anomaly"...
[ 5815, 5822, 5939, 6140, 6173, 6204, 6396, 6437, 6554, 6675, 6722, 6814, 6879, 6984, 7051, 7101, 7281, 5506, 5645, 5866, 6295, 6629, 6747, 6942, 6343, 6414, 7028, 5788, 5798, 5870, 6281, 6379, 6965, 7239 ]
[ 5, 26, 5, 6, 29, 4, 6, 4, 4, 6, 4, 30, 4, 6, 6, 4, 6, 3, 3, 3, 30, 19, 3, 3, 9, 9, 9, 8, 11, 8, 8, 8, 7, 9 ]
[ "9630", "9630", "9630", "5290", "2475", "2475", "5290", "2475", "2475", "5290", "2475", "5728", "2475", "5290", "5290", "2475", "5290", "MESH:C537007", "MESH:C537007", "MESH:C537007", "MESH:D009810", "MESH:D044148", "MESH:C537007", "MESH:C537007", "MESH:D020123", "M...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "DNAMutation"...
37274236
7,999
In conclusion, we have presented a new PIK3CA mutation (c.685delA, p.Thr229fs) in KHE. KHE with this PIK3CA mutation may be correlated with a good response to sirolimus. However, more cases are required to validate our findings.
DISCUSS
paragraph
[ 142, 143, 144, 145, 146, 147 ]
[ "PIK3CA", "PIK3CA", "KHE", "sirolimus", "c.685delA", "p.Thr229fs" ]
[ 8038, 8100, 8086, 8158, 8055, 8066 ]
[ 6, 6, 3, 9, 9, 10 ]
[ "5290", "5290", "MESH:C537007", "MESH:D020123", "tmVar:c|DEL|685|A;HGVS:c.685delA;VariantGroup:3;CorrespondingGene:5290;CorrespondingSpecies:9606", "tmVar:p|FS|T|229||;HGVS:p.T229fsX;VariantGroup:2;CorrespondingGene:5290;CorrespondingSpecies:9606" ]
[ "Gene", "Gene", "Disease", "Chemical", "DNAMutation", "ProteinMutation" ]
37443729
7,244
Bacterial and baculovirus expression constructs. pCI-skNAC was a generous gift from Dr. Rene St-Arnaud (Genetics Unit, Shriners Hospital, Montreal, QC, Canada). pCI-skNAC(BamHI) was a modified construct of pCI-skNAC with an insertion of BamHI and SalI restriction sites at the 5' of skNAC via QuikChange Site-Directed Mutagenesis (Stratagene). pFast-Bac-SMYD1B was constructed by PCR using the 5'-primer (GCTCTAGAGCA CCATGGACGTGGAGGTCTTC) and the 3'-primer (CTCGAGCTGCTTCTTATGGAA CAG) with pBK-CMV-SMYD1B serving as a template. The PCR product was subcloned into pGEMT-easy, digested with Xba I/Xho I and then subcloned into pTP17 (a kind gift from the laboratory of Dr. Tanya Paull, University of Texas at Austin, Austin, Texas) after cutting with XhoI/Spe I. pFast-Bac-SMYD1B-(Y234F) was generated by QuikChange Site-Directed Mutagenesis (Stratagene) using pFast-Bac-SMYD1B as a template. pFast-Bac-HTb-skNAC was made by digesting pCI-skNAC with BamHI) to isolate the entire skNAC ORF. This fragment was then subcloned into pFast-Bac-Tb cut with BamHI. pGEX6P1-skNAC(1857-2187) was constructed by PCR with 5'-primer (5'-GGATCCCTTGTTAGCCCGCAAAAGGC-3') and 3'-primer (5'-GCGGCCGCTTACATTG TTAATTCCAT-3') using pCMV-Tag2b-SKNAC(1857-2187) as the template. The PCR product was subcloned into pGEMTeasy and digested with BamHI/Not I and then subcloned into pGEX-6P1 after cutting with BamH1I/Not I. pGEX6P1-skNAC(1857-2187) (L1952A) and pGEX6P1-SKNAC(1857-2187) (K-R) were generated by QuikChange Site-Directed Mutagenesis (Stratagene) using pGEX6P1-SKNAC(1857-2187) as templates. pGEX6P1-skNAC truncations were generated by PCR using pCI-skNAC as the template. The PCR products were digested with BamHI/Not I and subcloned into pGEX-6P1 after cutting with BamHI/Not I.
METHODS
paragraph
[ 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126 ]
[ "SMYD1B", "SMYD1B", "SMYD1B", "SMYD1B", "skNAC", "skNAC", "SKNAC", "SKNAC", "skNAC", "SKNAC", "skNAC", "skNAC", "skNAC", "skNAC", "skNAC", "skNAC", "skNAC", "skNAC", "pCI", "pCI", "pCI", "pCI", "pCI", "Y234F", "L1952A" ]
[ 7598, 7742, 8015, 8113, 8879, 8829, 8790, 8685, 8647, 8464, 8307, 8221, 8181, 8149, 7527, 7454, 7409, 7297, 7293, 7405, 7450, 8177, 8875, 8023, 8665 ]
[ 6, 6, 6, 6, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 3, 3, 3, 3, 3, 5, 6 ]
[ "569027", "569027", "569027", "569027", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "17938", "CVCL:UI80", "CVCL:UI80", "CVCL:UI80", "CVCL:UI80", "CVCL:UI80", "tmVar:p|SUB|Y|234|F;HGVS:p.Y234F;Varia...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "CellLine", "CellLine", "CellLine", "CellLine", "CellLine", "ProteinMutation", "ProteinMutation" ]
37443729
18,738
To determine whether the SET domain was required for skNAC methylation, the catalytically conserved Y234 was replaced with phenylalanine (indicated by the asterisk in Figure 2A). This SET domain mutant failed to methylate skNAC (Figure 2C). This result further indicated that SMYD1 has intrinsic methyltransferase activity, and that the SET domain of SMYD1 is required for this activity.
RESULTS
paragraph
[ 300, 301, 302, 303, 304 ]
[ "skNAC", "skNAC", "SMYD1", "SMYD1", "Y234" ]
[ 18791, 18960, 19014, 19089, 18838 ]
[ 5, 5, 5, 5, 4 ]
[ "4666", "4666", "150572", "150572", "tmVar:p|Allele|Y|234;VariantGroup:0;OriginalGene:569027;CorrespondingGene:150572;CorrespondingSpecies:7955" ]
[ "Gene", "Gene", "Gene", "Gene", "ProteinMutation" ]
37443729
39,459
The SET domain of SMYD1 and the interaction of SMYD1 and skNAC are required for skNAC methylation. (A) Comparison of the C-terminal regions of the SET domains present in SMYD1 and other HMTases. The highly conserved NHxCxPN and GEELxxxY motifs of SET domains, which are strictly essential for KMTase activity, are shown in purple. In the SET domain mutant of SMYD1, the highly conserved tyrosine (Y234) (*), which is essential for SET MTase activity, was mutated. (B) Comparison of the MYND domain of mouse SMYD1 with other MYND domain-containing proteins (upper panel) was performed. In the MYND domain mutant of SMYD1, the highly conserved Cys residues, that are required for zinc binding, were mutated to S (lower panel). (C) The SET and MYND domains of SMYD1 are required for skNAC methylation. FLAG-tagged SMYD1b WT, SMYD1b-MYNDmut or SMYD1b-SETmut(Y234F) were immunoprecipitated with anti-FLAG Ab from transiently transfected 293T cells and used for in vitro KMTase assays. Purified GST-skNAC(1857-2187) was used as a substrate. Equal amounts of skNAC (top panel) were used in the KMTase assay. The middle panel shows an autoradiograph of GST-skNAC from the methylation reaction. Western blot analysis (bottom panel) was performed with anti-FLAG Ab using 10% of the immunoprecipitated SMYD1b as the input. (D) skNAC PXLXP mutant (L1952A) in which the L of PXLXP motif was replaced by A. This mutant was previously shown to abolish skNAC binding to SMYD1 in immunoprecipitation assays. (E) KMTase assay was performed with purified his-tagged SMYD1b as enzyme. As substrates, 2 ug of GST-skNAC(1857-2187) WT or GST-skNAC(1857-2187) (L1952A) were used.
FIG
fig_caption
[ 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635 ]
[ "SMYD1", "SMYD1", "skNAC", "skNAC", "SMYD1", "SMYD1", "SMYD1", "SMYD1", "SMYD1", "skNAC", "SMYD1b", "SMYD1b", "SMYD1b", "skNAC", "SMYD1b", "skNAC", "skNAC", "SMYD1", "SMYD1b", "HMTases", "Cys", "zinc", "S", "293T", "Y234F", "L1952A", "L1952A", "Y234", "mouse" ...
[ 39477, 39506, 39516, 39539, 39629, 39818, 39966, 40073, 40216, 40239, 40270, 40281, 40299, 40511, 40750, 40775, 40896, 40913, 41006, 39645, 40101, 40137, 40167, 40391, 40313, 41096, 40795, 39856, 39960 ]
[ 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 6, 6, 6, 5, 6, 5, 5, 5, 6, 7, 3, 4, 1, 4, 5, 6, 6, 4, 5 ]
[ "150572", "150572", "4666", "4666", "150572", "150572", "150572", "150572", "150572", "4666", "569027", "569027", "569027", "4666", "569027", "4666", "4666", "150572", "569027", null, "MESH:D003545", "MESH:D015032", "MESH:D013455", "CVCL:0063", "tmVar:p|SUB|Y|234|F;HG...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Chemical", "Chemical", "Chemical", "CellLine", "ProteinMutation", "ProteinMutation", "ProteinMutatio...
39772163
302
Dual therapies (DT) combining integrase strand transfer inhibitors (INSTIs) with second-generation non-nucleoside reverse transcriptase inhibitors (2nd-Gen-NNRTIs) offer new possibilities for HIV treatment to improve adherence. However, drug resistance associated mutations (RAMs) to prior antiretrovirals may jeopardize the efficacy of DT. We herein describe the predicted efficacy of DT combining INSTIs + 2nd-Gen-NNRTI following treatment failure among Cameroonian patients. We genotyped the HIV-1 pol gene using Sanger sequencing and assessed acquired RAMs to NNRTIs and INSTIs in patients failing treatment from March 2019 to December 2023. Drug susceptibility was interpreted using Stanford HIVdb v9.5, and statistical analyses were performed using SPSS v22. Of 130 successfully genotyped participants (median age (IQR): 38 (27-46) years; 59.2% female), 92.3% had RAMs to NNRTIs and 1.5% to INSTIs. Prevailing RAMs were Y181C (32.3%) among NNRTIs and R263K (0.7%) among INSTIs. Among 2nd-Gen-NNRTIs, etravirine, doravirine and rilpivirine had 43.85%, 41.54% and 38.46% genotypic sensitivity, respectively. Among INSTIs, we found 97.69% efficacy for dolutegravir/bictegravir, 96.15% for cabotegravir and 92.31% for elvitegravir/raltegravir. The overall predictive efficacy of DT was lower among participants who failed 1st-Gen-NNRTI (p < 0.001); with etravirine + dolutegravir/bictegravir combination showing the highest score (43.8%). Conclusively, DT combining INSTIs + 2nd-Gen-NNRTIs might be suboptimal in the context of previous ART failure, especially with NNRTI-based treatment in low- and middle-income countries. The general data clearly indicate that without resistance testing, it is nearly impossible to use long-acting dual therapies in previously failing patients.
ABSTRACT
abstract
[ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 ]
[ "pol", "ART failure", "non-nucleoside reverse transcriptase inhibitors", "2nd", "Gen", "NNRTIs", "2nd", "Gen", "NNRTI", "NNRTIs", "NNRTIs", "NNRTIs", "2nd", "Gen", "NNRTIs", "etravirine", "doravirine", "rilpivirine", "dolutegravir", "bictegravir", "cabotegravir", "elvitegra...
[ 803, 1841, 401, 450, 454, 458, 710, 714, 718, 866, 1180, 1248, 1292, 1296, 1300, 1308, 1320, 1335, 1457, 1470, 1494, 1522, 1535, 1630, 1634, 1658, 1671, 1684, 1779, 1783, 1787, 1870, 1228, 1259, 494, 770, 797, 887, 2076 ]
[ 3, 11, 47, 3, 3, 6, 3, 3, 5, 6, 6, 6, 3, 3, 6, 10, 10, 11, 12, 11, 12, 12, 11, 3, 5, 10, 12, 11, 3, 3, 6, 5, 5, 5, 3, 8, 5, 8, 8 ]
[ "155348", "MESH:D051437", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "MESH:C451734", "MESH:C000592662", "MESH:D000068696", "MESH:C562325", "MESH:C000620396", "MESH:C584914", "MESH:C509700", "MESH:D000068898", "-", "-", "MESH:C451734", "MESH:C...
[ "Gene", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", ...
39772163
10,938
A total of 130 participants were included in this study. Participants were predominantly female (59.2%), and the median (interquartile range IQR) age was 38 (27-46) years. The median (IQR) ART duration was 84 (42-144) months; 52 (40.0%) participants were failing regimens based on 2 NRTIs + 1 NNRTI, 66 (50.8%) based on 2 NRTIs + 1 ritonavir-boosted protease inhibitor (PI/r) and 12 (9.2%) based on 2 NRTIs + 1 INSTI. Overall, 123 participants (94.6%) had a current/previous exposure to NNRTI-containing regimens, versus only 9.2% exposure to INSTI-based regimens.
RESULTS
paragraph
[ 154, 155, 156, 157, 158, 159, 160 ]
[ "NRTIs", "NNRTI", "NRTIs", "ritonavir-boosted protease inhibitor", "NRTIs", "NNRTI", "1 INSTI" ]
[ 11221, 11231, 11260, 11270, 11339, 11425, 11347 ]
[ 5, 5, 5, 36, 5, 5, 7 ]
[ "-", "-", "-", "-", "-", "-", "tmVar:|Allele|INSTI|1;VariantGroup:6;CorrespondingGene:5241;CorrespondingSpecies:9606" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "DNAMutation" ]
39772163
12,337
Concerning NNRTIs and specifically 2nd-Gen-NNRTIs (i.e., DOR, ETR and RPV), prevailing RAMs were Y181C (32.3%), V179L (13.8%), K101PE (10.7%) and H221Y (6.9%) (Table 2). Drug susceptibility assessment revealed that 58.5% (76/130) of patients had intermediate to high-level resistance to DOR, 56.2% (73/130) to ETR and 61.5% (80/130) to RPV (see Table 3). Among participants who switched to NNRTI-based regimens (N = 78), only 7.7% (6/78) had no NNRTI-RAMs. The median ART duration (IQR; years) after switching was not significant between patients with NNRTI-RAMs and patients without NNRTI-RAMS (3.5 (2.0-6.0) vs. 6 (5.0-7.5), respectively; p = 0.1).
RESULTS
paragraph
[ 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195 ]
[ "RAMS", "NNRTIs", "NNRTIs", "DOR", "ETR", "RPV", "DOR", "ETR", "RPV", "NNRTI", "NNRTI", "NNRTI", "NNRTI", "Y181C", "V179L", "H221Y", "patients", "patients", "patients" ]
[ 12927, 12348, 12380, 12394, 12399, 12407, 12624, 12647, 12673, 12727, 12782, 12889, 12921, 12434, 12449, 12483, 12570, 12875, 12904 ]
[ 4, 6, 6, 3, 3, 3, 3, 3, 3, 5, 5, 5, 5, 5, 5, 5, 8, 8, 8 ]
[ null, "-", "-", "MESH:C000592662", "MESH:C451734", "MESH:D000068696", "MESH:C000592662", "MESH:C451734", "MESH:D000068696", "-", "-", "-", "-", "tmVar:p|SUB|Y|181|C;HGVS:p.Y181C;VariantGroup:9;CorrespondingGene:155348;CorrespondingSpecies:11676", "tmVar:p|SUB|V|179|L;HGVS:p.V179L;Variant...
[ "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Species", "Species", "Species" ]
39772163
12,992
Regarding RAMs to INSTI, two (1.54%) participants harboured INSTI-RAMs. Both cases were found in INSTI-exposed patients (2/12 (16.6%)), and no resistance was observed in the INSTI-non-exposed group. Among participants harbouring major RAMs to INSTIs, we found specifically E138K (1/130), G140A (1/130), Q148R (1/130), R263K (1/130), and S147G (1/130) (Table 2). Some participants harboured a polymorphic INSTI-selected mutation such as T97A (18.5%) and L74I (22.3%).
RESULTS
paragraph
[ 196, 197, 198, 199, 200, 201, 202, 203, 204 ]
[ "INSTIs", "E138K", "G140A", "Q148R", "R263K", "S147G", "L74I", "T97A", "patients" ]
[ 13235, 13265, 13280, 13295, 13310, 13329, 13445, 13428, 13103 ]
[ 6, 5, 5, 5, 5, 5, 4, 4, 8 ]
[ "MESH:D054179", "tmVar:p|SUB|E|138|K;HGVS:p.E138K;VariantGroup:8;CorrespondingGene:5241;CorrespondingSpecies:9606", "tmVar:c|SUB|G|140|A;HGVS:c.140G>A;VariantGroup:14;CorrespondingGene:155348;CorrespondingSpecies:11676", "tmVar:p|SUB|Q|148|R;HGVS:p.Q148R;VariantGroup:11;CorrespondingGene:155348;CorrespondingS...
[ "Disease", "ProteinMutation", "DNAMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "DNAMutation", "Species" ]
39772163
15,282
In the reverse transcriptase (RT) region of HIV-1 pol, analysis showed a high prevalence of NNRTI-RAMs, including Y181C, Y188C and K101PE, which significantly reduce the efficacy of 2nd-Gen-NNRTIs. This high rate of NNRTI-RAMs can be explained by the fact that about 95% had failed first-generation NNRTIs (EFV and NVP) due to their low genetic barrier to resistance.
DISCUSS
paragraph
[ 225, 226, 227, 228, 229, 230, 231, 232, 233, 234 ]
[ "pol", "NNRTI", "NNRTIs", "NNRTI", "NNRTIs", "EFV", "NVP", "Y181C", "Y188C", "HIV-1" ]
[ 15332, 15374, 15472, 15498, 15581, 15589, 15597, 15396, 15403, 15326 ]
[ 3, 5, 6, 5, 6, 3, 3, 5, 5, 5 ]
[ "155348", "-", "-", "-", "-", "MESH:C098320", "MESH:D019829", "tmVar:p|SUB|Y|181|C;HGVS:p.Y181C;VariantGroup:9;CorrespondingGene:155348;CorrespondingSpecies:11676", "tmVar:p|SUB|Y|188|C;HGVS:p.Y188C;VariantGroup:15;CorrespondingGene:155348;CorrespondingSpecies:11676", "11676" ]
[ "Gene", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "Species" ]
39772163
15,650
However, 43.85%, 41.54% and 38.46% of the study population remained susceptible to etravirine, doravirine and rilpivirine, respectively. In fact, the previous reported mutations, although frequent, do not necessarily affect the efficacy of 2nd-Gen-NNRTIs at the same levels. For example, Y181C does not affect DOR.
DISCUSS
paragraph
[ 235, 236, 237, 238, 239, 240 ]
[ "DOR", "etravirine", "doravirine", "rilpivirine", "NNRTIs", "Y181C" ]
[ 15960, 15733, 15745, 15760, 15898, 15938 ]
[ 3, 10, 10, 11, 6, 5 ]
[ null, "MESH:C451734", "MESH:C000592662", "MESH:D000068696", "-", "tmVar:p|SUB|Y|181|C;HGVS:p.Y181C;VariantGroup:9;CorrespondingGene:155348;CorrespondingSpecies:11676" ]
[ "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation" ]
39772163
15,965
Concerning integrase inhibitors, major INSTI-RAMs, such as R263K, S147G, G140A and Q148R, were very rare (<2%). Our study differs from that of Ndashimye et al. (2020) in Uganda, who observed a higher rate of INSTI-RAMs in 47% of patients. This disparity could be explained by variations in patient selection and inclusion criteria. In fact, this Ugandan study was carried out in 52 patients failing a RAL-based regimen. Most samples contained minor mutations such as L74I (29/130), which can modulate susceptibility without causing complete resistance. One factor that appeared initially to be associated with virologic failure to long-acting CAB + RPV was the L74I integrase polymorphism; however, its role in virologic outcome was unclear. According to the Stanford HIVdb algorithm, the predictive efficacy (96.2%) of CAB was lower than that of BIC and DTG (97.7%). This is because DTG and BIC are second-generation INSTIs with a higher genetic barrier to resistance than cabotegravir. Despite the small proportion of patients exposed to INSTIs, these results suggest that INSTIs such as dolutegravir remain a viable option for the management of HIV infection in our context.
DISCUSS
paragraph
[ 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261 ]
[ "HIV infection", "RAL", "CAB", "RPV", "CAB", "BIC", "DTG", "DTG", "BIC", "cabotegravir", "dolutegravir", "R263K", "S147G", "G140A", "Q148R", "L74I", "L74I", "patients", "patient", "patients", "patients" ]
[ 17113, 16366, 16608, 16614, 16785, 16812, 16820, 16849, 16857, 16939, 17055, 16024, 16031, 16038, 16048, 16626, 16432, 16194, 16255, 16347, 16985 ]
[ 13, 3, 3, 3, 3, 3, 3, 3, 3, 12, 12, 5, 5, 5, 5, 4, 4, 8, 7, 8, 8 ]
[ "MESH:D015658", "MESH:D000068898", "MESH:C584914", "MESH:D000068696", "MESH:C584914", "MESH:C000620396", "MESH:C562325", "MESH:C562325", "MESH:C000620396", "MESH:C584914", "MESH:C562325", "tmVar:p|SUB|R|263|K;HGVS:p.R263K;VariantGroup:10;CorrespondingGene:155348;CorrespondingSpecies:11676", ...
[ "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "DNAMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Species", "Species", "Species", "S...
39772163
17,143
Depending on certain factors, this relatively favourable genotypic resistance profile justifies the use of this DT combining INSTIs/2nd-Gen-NNRTIs in the context of virological failure. Overall, the different combinations of INSTIs/2nd-Gen-NNRTIs proved effective, regardless of age, duration of treatment or viral subtype. However, participants who have failed on first-generation NNRTI-based regimens (EFV or NVP) were less sensitive to DT INSTI/NNRTI-based DT compared to those who have failed on PI/r or INSTIs. In fact, virological failure under EFV/NVP-based regimens is often accompanied by the accumulation of NNRTI-RAMs in the HIV genome, which confer cross-resistance to 2nd-Gen-NNRTIs (ETR, DOR, RPV). Indeed, NNRTIs are known to have a low genetic barrier (a single mutation such as M230L is enough to cause resistance to all drugs in the class). On the other hand, participants in virological failure without mutations to any of the NNRTIs or INSTIs all (100%) showed total efficacy with DT INSTI/2nd-Gen-NNRTIs, underlining the importance of genotypic resistance testing to aid the selection of potential candidates for DT despite exposure to previous ART regimens.
DISCUSS
paragraph
[ 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291 ]
[ "virological failure", "virological failure", "virological failure", "DT", "Gen", "NNRTIs", "Gen", "NNRTIs", "NNRTI", "EFV", "NVP", "DT", "NNRTI", "DT", "EFV", "NVP", "NNRTI", "Gen", "NNRTIs", "ETR", "DOR", "RPV", "NNRTIs", "NNRTIs", "DT", "Gen", "NNRTIs", "DT",...
[ 17308, 17668, 18037, 17255, 17279, 17283, 17379, 17383, 17525, 17547, 17554, 17582, 17591, 17603, 17694, 17698, 17761, 17828, 17832, 17840, 17845, 17850, 17864, 18089, 18144, 18157, 18161, 18277, 17938, 17779 ]
[ 19, 19, 19, 2, 3, 6, 3, 6, 5, 3, 3, 2, 5, 2, 3, 3, 5, 3, 6, 3, 3, 3, 6, 6, 2, 3, 6, 2, 5, 3 ]
[ "MESH:D051437", "MESH:D051437", "MESH:D051437", "-", "-", "-", "-", "-", "-", "MESH:C098320", "MESH:D019829", "-", "-", "-", "MESH:C098320", "MESH:D019829", "-", "-", "-", "MESH:C451734", "MESH:C000592662", "MESH:D000068696", "-", "-", "-", "-", "-", "-", "tmV...
[ "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical",...
39772163
26,730
Lack of Impact of Pre-Existing T97A HIV-1 Integrase Mutation on Integrase Strand Transfer Inhibitor Resistance and Treatment Outcome
REF
ref
[ 336 ]
[ "T97A" ]
[ 26761 ]
[ 4 ]
[ "tmVar:c|SUB|T|97|A;HGVS:c.97T>A;VariantGroup:2;CorrespondingGene:5241;CorrespondingSpecies:9606" ]
[ "DNAMutation" ]
39772163
26,863
High Prevalence of Integrase Mutation L74I in West African HIV-1 Subtypes Prior to Integrase Inhibitor Treatment
REF
ref
[ 337 ]
[ "L74I" ]
[ 26901 ]
[ 4 ]
[ "tmVar:p|SUB|L|74|I;HGVS:p.L74I;VariantGroup:3;CorrespondingGene:155348;CorrespondingSpecies:11676" ]
[ "ProteinMutation" ]
39772163
30,319
Drug Class Mutations Prevalence n (%) INSTIs * E138K 1 (0.7) G140A 1 (0.7) Q148R 1 (0.7) R263K 1 (0.7) S147G 1 (0.7) 2nd-Gen-NNRTIs A98G 20 (15.3) E138AGKQ 12 (9.2) G190ASE 23 (17.6) L234I 1 (0.7) L100I 4 (3.0) K101PE 14 (10.7) V179L 18 (13.8) Y181C 42 (32.3) Y188CL 5 (3.8) H221Y 9 (6.9) F227FL 8 (6.1) M230L 4 (3.0)
TABLE
table
[ 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383 ]
[ "R263K", "L234I", "V179L", "H221Y", "M230L", "Q148R", "E138K", "S147G", "L100I", "Y181C", "G140A", "A98G" ]
[ 30416, 30520, 30571, 30624, 30657, 30400, 30368, 30432, 30536, 30589, 30384, 30463 ]
[ 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 4 ]
[ "tmVar:p|SUB|R|263|K;HGVS:p.R263K;VariantGroup:10;CorrespondingGene:155348;CorrespondingSpecies:11676", "tmVar:p|SUB|L|234|I;HGVS:p.L234I;VariantGroup:12;CorrespondingGene:5241;CorrespondingSpecies:9606", "tmVar:p|SUB|V|179|L;HGVS:p.V179L;VariantGroup:13;CorrespondingGene:5241;CorrespondingSpecies:9606", "tmV...
[ "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "DNAMutation", "DNAMutation" ]
39258142
12,439
Pre-RT (n = 19) Post-RT (n = 19) 6-month F/U (n = 18) P value* LVEDD/BSA 2.6 +- 0.3 2.6 +- 0.3 2.7 +- 0.2 .818 LV mass index 74.7 +- 13.1 67.0 +- 15.4 68.3 +- 12.3 .213 LA volume index 25.3 +- 5.8 21.4 +- 6.6 22.2 +- 7.3 .200 LVEF (%) .493 Median (IQR) 61 (58.5, 65.5) 62 (59.5, 65) 63 (61, 65) Range 54-69 55-72 53-68 Mean +- SD 61.8 +- 4.4 62.2 +- 4.3 62.7 +- 3.8 Global longitudinal strain (%) -19.3 +- 2.2 -19.2 +- 1.8 -19.6 +- 1.8 .627 A3C -18.9 +- 2.4 -19.6 +- 1.8 -19.7 +- 2.6 A4C -19.3 +- 2.5 -19.2 +- 2.1 -19.4 +- 2.0 A2C -19.7 +- 2.3 -19.2 +- 2.4 -19.8 +- 2.0 Global circumferential strain (%) -16.6 +- 3.6 -17.0 +- 2.7 -16.2 +- 3.5 .986 Global radial strain (%) 45.8 +- 23.9 44.9 +- 10.4 43.3 +- 15.7 .958 Diastolic parameters Mitral E velocity (cm/s) 77.3 +- 17.5 74.8 +- 15.7 77.2 +- 20.4 .775 Mitral A velocity (cm/s) 60.5 +- 16.3 61.7 +- 11.8 62.9 +- 13.8 .648 Mitral E/A ratio 1.3 +- 0.4 1.3 +- 0.4 1.3 +- 0.4 .417 Septal e' (cm/s) 10.3 +- 2.55 9.7 +- 3.0 10.0 +- 2.9 .669 Lateral e' (cm/s) 13.0 +- 3.2 11.7 +- 2.9 12.1 +- 3.6 .323 Septal E/e' ratio 7.6 +- 1.9 8.0 +- 2.3 8.0 +- 1.5 .274 Lateral E/e' ratio 6.2 +- 1.7 6.5 +- 1.5 6.6 +- 1.2 .191
TABLE
table
[ 51, 52, 53 ]
[ "A2C", "A3C", "A4C" ]
[ 13003, 12909, 12956 ]
[ 3, 3, 3 ]
[ "tmVar:c|SUB|A|2|C;HGVS:c.2A>C;VariantGroup:1;CorrespondingGene:2064;CorrespondingSpecies:9606", "tmVar:c|SUB|A|3|C;HGVS:c.3A>C;VariantGroup:0;CorrespondingGene:2064;CorrespondingSpecies:9606", "tmVar:c|SUB|A|4|C;HGVS:c.4A>C;VariantGroup:2;CorrespondingGene:2064;CorrespondingSpecies:9606" ]
[ "DNAMutation", "DNAMutation", "DNAMutation" ]
39258142
13,723
Abbreviations: A2C = apical 2-chamber; A3C = apical 3-chamber; A4C = apical 4-chamber; BSA = body surface area; IQR = interquartile range; LA = left atrial; LV = left ventricular; LVEDD = left ventricular end diastolic diameter; LVEF = Left ventricular ejection fraction; RT = radiation therapy.
TABLE
table_footnote
[ 54, 55, 56 ]
[ "A3C", "A4C", "A2C" ]
[ 13762, 13786, 13738 ]
[ 3, 3, 3 ]
[ "tmVar:c|SUB|A|3|C;HGVS:c.3A>C;VariantGroup:0;CorrespondingGene:2064;CorrespondingSpecies:9606", "tmVar:c|SUB|A|4|C;HGVS:c.4A>C;VariantGroup:2;CorrespondingGene:2064;CorrespondingSpecies:9606", "tmVar:c|SUB|A|2|C;HGVS:c.2A>C;VariantGroup:1;CorrespondingGene:2064;CorrespondingSpecies:9606" ]
[ "DNAMutation", "DNAMutation", "DNAMutation" ]
40495926
29,351
Mean breadth and depth of coverage when mapping enriched sequences to the Schistosoma mansoni reference genome (V10).
FIG
fig_title_caption
[ 115, 116 ]
[ "V10", "Schistosoma mansoni" ]
[ 29463, 29425 ]
[ 3, 19 ]
[ "tmVar:p|Allele|V|10;VariantGroup:0", "6183" ]
[ "ProteinMutation", "Species" ]
40495926
29,469
Twelve individual miracidia samples extracted from FTA cards, either washed (green [1-6 vertically]) or unwashed (orange [7-12 vertically]) were sequenced and mapped to the S. mansoni reference genome (V10). Mean breadth of coverage per 25kb bin is plotted for each nuclear chromosome and 2kb bins for mitochondrial chromosome on the y axis (green or orange), the smoothed mean is indicated in red. The secondary y axis indicates the depth of coverage and is in purple.
FIG
fig_caption
[ 117, 118 ]
[ "V10", "S. mansoni" ]
[ 29671, 29642 ]
[ 3, 10 ]
[ "tmVar:p|Allele|V|10;VariantGroup:0", null ]
[ "ProteinMutation", "Species" ]
40034091
23,558
As described previously (Gao et al.; Wang et al.), stereotaxic injections were performed using glass pipettes (Cat# 5-000-1001-X10, Drummond) pulled with a micropipette puller (RRID: SCR_021042; P1000, Sutter, USA) to achieve outer diameters of 30-50 microm. Glass pipettes were polished at the tips (Micro Forge MF-830, Narishige, Japan) and mounted on a microinjection pump (Nanoliter 2010 Injector, WPI). AAV-EF1a-DIO-hChR2(H134R)-EYFP (UNC Vector Core; RRID: SCR_023280) was injected bilaterally at a rate of 50-100 nL min-1, with a volume of 300 nL and a titer of 1 x 1012 vg mL-1. Injection sites were determined using the following coordinates: mPFC [anterior-posterior (AP) = +2.10 mm, medial-lateral (ML) = +-0.25 mm, and dorsal-ventral (DV) = from -1.40 mm retracted to -1.20 mm during viral infusion].
METHODS
paragraph
[ 73, 74 ]
[ "EF1a", "H134R" ]
[ 23970, 23985 ]
[ 4, 5 ]
[ "22608", "tmVar:p|SUB|H|134|R;HGVS:p.H134R;VariantGroup:0;OriginalGene:22608;CorrespondingGene:4904;CorrespondingSpecies:10090" ]
[ "Gene", "ProteinMutation" ]
40034091
48,442
To address the inhibitory output from L1INs to deeper layer neurons, we conducted optogenetic activation combined with whole-cell recordings in acute brain slices to examine the inhibitory effects of mPFC L1INs on neurons in Layers 2-6. To specifically activate L1INs in the mPFC, we utilized neuron-derived neurotrophic factor (NDNF)-IRES-Cre knock-in mice (Jackson Laboratory, # 030757), which express Cre in over two-thirds of L1INs in the neocortex (Schuman et al.). Three weeks after injecting AAV-EF1a-DIO-hChR2(H134R)-EYFP (UNC Vector Core) into the mPFC of NDNF-Cre mice, we recorded light-evoked activation of NDNF+ L1 cells (Figure 5a). Confocal microscopy confirmed that ChR2-expressing cells were predominantly localized within L1 of the mPFC (Figure 5b), verifying that NDNF serves as a genetic marker largely restricted to L1 in adult mice.
RESULTS
paragraph
[ 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 ]
[ "neuron-derived neurotrophic factor", "NDNF", "EF1a", "NDNF", "NDNF", "NDNF", "H134R", "mice", "mice", "mice" ]
[ 48735, 48771, 48945, 49007, 49061, 49225, 48960, 48795, 49016, 49291 ]
[ 34, 4, 4, 4, 4, 4, 5, 4, 4, 4 ]
[ "68169", "68169", "22608", "68169", "68169", "68169", "tmVar:p|SUB|H|134|R;HGVS:p.H134R;VariantGroup:0;OriginalGene:22608;CorrespondingGene:4904;CorrespondingSpecies:10090", "10090", "10090", "10090" ]
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "ProteinMutation", "Species", "Species", "Species" ]
40034091
52,435
To validate the optogenetic activation of L1INs, we measured light-evoked (5 ms, 473 nm) responses of mPFC L1INs using whole-cell patch-clamp recordings (Figure 5a-d). All recorded L1INs (seven out of seven cells) reliably initiated action potentials in response to light stimulation. Previous studies have shown that the physiological firing rate of neocortical L1INs in vivo ranges from 1 to 12 Hz (Fan et al.). To assess how fast L1INs can fire action potentials, we tested their spike fidelity in vitro brain slices using various stimulation frequencies. We found that spike fidelity decreased as the stimulation frequency exceeded 20 Hz (Figure 5c,d). The reduced spike fidelity at 40 Hz stimulation could be attributed to a depolarization block, as the membrane voltage accumulates during repeated stimulation (Figure 5c). For stimulation frequencies above 40 Hz, the reduced spike fidelity might result from the off-kinetics limitation of ChR2(H134R) (Yizhar et al.).
RESULTS
paragraph
[ 163 ]
[ "H134R" ]
[ 53386 ]
[ 5 ]
[ "tmVar:p|SUB|H|134|R;HGVS:p.H134R;VariantGroup:0;OriginalGene:22608;CorrespondingGene:4904;CorrespondingSpecies:10090" ]
[ "ProteinMutation" ]
37324171
41,901
International A (2016) D2166/D2166M-16 standard test method for unconfined compressive strength of cohesive soil
REF
ref
[ 371 ]
[ "D2166M" ]
[ 41930 ]
[ 6 ]
[ "tmVar:p|SUB|D|2166|M;HGVS:p.D2166M;VariantGroup:0" ]
[ "ProteinMutation" ]
37728561
25,298
Furthermore, MV altered the abundance of proteins involved in chloroplast protein import in WT and fsd1 mutants, while different proteins were affected in these lines (Fig. 2). In WT, MV altered the abundance of OUTER PLASTID ENVELOPE PROTEIN 16-1 and CHLOROPLAST SIGNAL RECOGNITION PARTICLE 54 kDa SUBUNIT, which were detected only in mock and MV-treated WT plants, respectively. In mutants, TRANSLOCON AT THE OUTER ENVELOPE MEMBRANE OF CHLOROPLAST 159 (found only in MV-treated fsd1-2), chloroplast HEAT SHOCK PROTEIN (HSP) 70-1 (0.38-fold down-regulated in fsd1-2) and chloroplast HSP 70-2 (2.65-fold up-regulated in fsd1-1) were affected. Thus, FSD1 deficiency conferred the alteration of chloroplast HSP70 isoforms in response to short-term MV treatment. Notably, fsd1 mutants exhibited higher alterations in abundances of proteins involved in chloroplast protein folding (Fig. 2), including CHAPERONIN-60 ALPHA (0.55-fold down-regulated in fsd1-1), CYCLIN DELTA-3, and CASEIN LYTIC PROTEINASE B3 (both found uniquely in MV-treated fsd1-2). Plastid FtsH extracellular protease family protein ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 2 (VAR2), involved in the chloroplastic protein degradation pathway, was 0.31-fold down-regulated in WT. Similarly, fsd1-1 exhibited down-regulation of ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 5 (VAR1), found only in mock-treated fsd1-1 plants.
RESULTS
paragraph
[ 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 310, 311, 312, 313, 314, 315, 316, 317, 318 ]
[ "fsd1", "HSP 70-2", "FSD1", "fsd1", "-3", "CASEIN LYTIC PROTEINASE B3", "VAR2", "VAR1", "CHLOROPLAST SIGNAL RECOGNITION PARTICLE 54", "OUTER PLASTID ENVELOPE PROTEIN 16-1", "HSP70", "CHLOROPLAST", "MV", "MV", "MV", "MV", "MV", "MV", "CHAPERONIN-60", "DELTA" ]
[ 25397, 25882, 25947, 26067, 26265, 26273, 26438, 26630, 25550, 25510, 26003, 25736, 25311, 25482, 25643, 25767, 26044, 26324, 26195, 26260 ]
[ 4, 8, 4, 4, 2, 26, 4, 4, 42, 35, 5, 11, 2, 2, 2, 2, 2, 2, 13, 5 ]
[ "79187", "831856", "79187", "79187", "829555", "831398", "817646", "834232", "830273", "817439", "820438", null, "MESH:D010269", "MESH:D010269", "MESH:D010269", "MESH:D010269", "MESH:D010269", "MESH:D010269", "CVCL:C917", "tmVar:|Allele|DELTA|;VariantGroup:0;CorrespondingGene:8...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "CellLine", "DNAMutation" ]
37728561
44,975
Remarkably, the abundances of chloroplastic chaperones, such as CASEIN LYTIC PROTEINASE B3, CYCLIN DELTA-3, CHAPERONIN-60 ALPHA, and chloroplastic HSP70, were changed only in fsd1 mutants. CYCLIN DELTA-3 functions downstream of CHAPERONIN-60 in the assembly of chloroplast ATP SYNTHASE COUPLING FACTOR 1. These results suggest that modulations in abundance of chloroplastic chaperones represent an early response to MV-induced oxidative stress in the mutant hypersensitive lines.
DISCUSS
paragraph
[ 565, 566, 567, 568, 569, 570, 571, 572 ]
[ "CASEIN LYTIC PROTEINASE B3", "-3", "HSP70", "fsd1", "-3", "MV", "DELTA", "DELTA" ]
[ 45039, 45079, 45122, 45150, 45176, 45391, 45171, 45074 ]
[ 26, 2, 5, 4, 2, 2, 5, 5 ]
[ "831398", "829555", "820438", "79187", "829555", "MESH:D010269", "tmVar:|Allele|DELTA|;VariantGroup:0;CorrespondingGene:831398;CorrespondingSpecies:3702", "tmVar:|Allele|DELTA|;VariantGroup:0;CorrespondingGene:831398;CorrespondingSpecies:3702" ]
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Chemical", "DNAMutation", "DNAMutation" ]
37426241
6,960
The structural behavior of the ZnO@beta-SiC composites as well as pure ZnO and beta-SiC was examined by XRD (Bruker, D8-Discover) in the coupled theta-2theta mode over a 2theta range of 20-80 with Cu-Kalpha radiation (lambda = 0.154 nm). The microstructural study was conducted by TEM using a probe-corrected Jeol (JEM ARM 200F) system operated with an accelerating voltage of 200 kV, where the elemental analysis was carried out by attached energy-dispersive X-ray spectroscopy (EDX). The XPS measurements were also performed with Al Kalpha radiation (1486.6 eV) from a monochromatic source, where the photoelectrons were analyzed by a hemispherical electron analyzer fitted with a 128-channel detector in a Thermo Scientific K-Alpha+ XPS spectrometer. The sample surfaces were sputter-cleaned in situ by 1 keV Ar+ ions before data acquisition. All of the spectra were collected in normal emission geometry, where the binding energy (B.E.) scale of the measured kinetic energy was calibrated from the Fermi edge (EF) of a gold foil, while a charge neutralizer gun was employed during data acquisition. The functional groups were further monitored by FTIR in diamond attenuated-total reflection mode in a Thermo Fisher Scientific Nicolet iS5 FTIR spectrometer. The photocatalytic activities were finally examined by following the degradation of the mixture of a 4 ppm MB aqueous solution with ~0.18 g of the ZnO@beta-SiC composite under UV exposure. Before the photocatalytic decomposition experiment, the suspension of MB and the photocatalyst was magnetically stirred in the dark for 30 min to achieve adsorption/desorption equilibrium. A 125 W medium-pressure mercury lamp (spectral range of 250-400 nm) was used as a UV source, where the mixed solution was irradiated at regular intervals. After that, a 4 mL solution was collected from this mixture and centrifuged at a speed of 3000 rpm for 10 min each. The supernatant was then collected by a micropipette and analyzed by UV-visible (UV-vis) spectroscopy (Shimadzu SolidSpec-3700) to monitor the changes in the absorbance of the obtained MB solution.
METHODS
paragraph
[ 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 ]
[ "ZnO@beta-SiC", "ZnO", "beta-SiC", "Cu", "Al", "Ar+", "gold", "MB", "ZnO@beta-SiC", "MB", "mercury", "MB", "A 125 W" ]
[ 6991, 7031, 7039, 7158, 7493, 7773, 7984, 8329, 8369, 8481, 8624, 9056, 8600 ]
[ 12, 3, 8, 2, 2, 3, 4, 2, 12, 2, 7, 2, 7 ]
[ "-", "MESH:D015034", "-", "MESH:D003300", "MESH:D000535", "MESH:D001128", "MESH:D006046", "MESH:D008751", "-", "MESH:D008751", "MESH:D008628", "MESH:D008751", "tmVar:p|SUB|A|125|W;HGVS:p.A125W;VariantGroup:0" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation" ]
39916508
5,135
A loss-of-function mutation (H54R) in the ZnT-2 zinc transporter (SLC30A2) of mammary epithelial cells will result in a reduction in zinc secretion into the tubular lumen and consequently a decrease in zinc concentration in breast milk. Reports in four cases confirm the development of transient zinc deficiency in exclusively breastfed infants from mothers with low breast-milk zinc concentrations but normal maternal serum zinc levels. Maternal zinc supplementation cannot correct this condition, confirming the genetic background of this disorder.
DISCUSS
paragraph
[ 46, 47, 48, 49, 50, 51, 52, 53 ]
[ "SLC30A2", "zinc deficiency", "zinc", "zinc", "zinc", "zinc", "zinc", "H54R" ]
[ 5201, 5431, 5268, 5337, 5514, 5560, 5582, 5164 ]
[ 7, 15, 4, 4, 4, 4, 4, 4 ]
[ "7780", "MESH:C564286", "MESH:D015032", "MESH:D015032", "MESH:D015032", "MESH:D015032", "MESH:D015032", "tmVar:p|SUB|H|54|R;HGVS:p.H54R;VariantGroup:0;CorrespondingGene:7780;RS#:587776926(Expired);CorrespondingSpecies:9606;CA#:6481" ]
[ "Gene", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation" ]
39916508
11,294
A dominant negative heterozygous G87R mutation in the zinc transporter, ZnT-2 (SLC30A2), results in transient neonatal zinc deficiency
REF
ref
[ 133, 134 ]
[ "SLC30A2", "G87R" ]
[ 11373, 11327 ]
[ 7, 4 ]
[ "7780", "tmVar:p|SUB|G|87|R;HGVS:p.G87R;VariantGroup:1;CorrespondingGene:7780;RS#:185398527;CorrespondingSpecies:9606;CA#:699349" ]
[ "Gene", "ProteinMutation" ]
39833238
34,965
31. Toraya, H., Yoshimura, M. & Somiya, S. Calibration curve for quantitative analysis of the monoclinic-tetragonal ZrO2 system by X-ray diffraction. J. Am. Ceram. Soc. 67, C-119-C-121 (1984).
REF
ref
[ 438 ]
[ "C-119-C" ]
[ 35138 ]
[ 7 ]
[ "tmVar:c|Allele|C|-119;VariantGroup:0;CorrespondingGene:10313;CorrespondingSpecies:9606" ]
[ "DNAMutation" ]
40216980
17,357
UV-RIP experiment was performed in TNF-alpha stimulated condition and YEATS2 associated MYC-490 eRNA was checked by RT-PCR in (A) MIAPaCa-2, data are presented as mean +- SD from three independent experiments (n = 3). Statistical significance was determined using an unpaired two-tailed t test: ****P = 0.0001 for Input, ***P = 0.0002 for IP and (B) AsPC-1 cells, data are presented as mean +- SD from three independent experiments (n = 3). Unpaired two-tailed t test: **P = 0.0012 for Input and **P = 0.002 for IP. Western blot was performed to check the successful pulldown of YEATS2 protein. GAPDH served as loading control. (C) A similar UV-RIP experiment with YEATS2 antibody was performed for HPNE cells. (D) Immunoblot analysis showing YEATS2 protein level in MIAPaCa-2 and HPNE cells. GAPDH served as loading control. (E) YEATS2 protein was knocked down by four different shYEATS2 molecules and cMYC expression was checked by RT-PCR. Data are presented as mean +- SD from three independent experiments (n = 3). Unpaired two-tailed t test: *P = 0.0129, **P = 0.0068, **P = 0.009, **P = 0.0016 for YEATS2 and **P = 0.0017, ****P = < 0.0001, *P = 0.0109, ***P = 0.0004 for cMYC. YEATS2 knockdown was further checked by WB (right panel). GAPDH served as a loading control. (F-H) The phospho-tyrosine level of YEATS2 protein was checked by immunoprecipitating YEATS2 from TNF-alpha stimulated MIAPaCa-2 (F), AsPC-1 (G) and HPNE cells (H) followed by western blotting for 4G10 and YEATS2 antibody. GAPDH served as a loading control. (I) In vitro phosphatase assay was performed where YEATS domain was pulled down from HEK293T cells and incubated with MIAPaCa-2 cell lysate treated with TNF-alpha for 0 and 24 h. Phosphorylation levels were assessed via Western blot analysis using 4G10 antibody. (J) A similar approach was taken for an in vitro MYC eRNA binding assay to investigate the correlation between tyrosine phosphorylation and MYC eRNA binding affinity for the YEATS domain. Data are presented as mean +- SD from three independent experiments (n = 3). Unpaired two-tailed t test: **P = 0.0026 for Input, *P = 0.027 for IP (K) An in vitro phosphatase assay was performed, followed by Western blot analysis to evaluate the phosphorylation level of the Y313 and Y313F mutant of YD domain. (L) Same experiment as (J) was done to investigate the correlation between MYC eRNA binding with Y313 or Y313F mutant. Data are presented as mean +- SD from three independent experiments (n = 3). Unpaired two-tailed t test: *P = 0.0219 for Input, *P = 0.0177 for IP. Source data are available online for this figure.
FIG
fig_caption
[ 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337 ]
[ "TNF-alpha", "YEATS2", "MYC", "YEATS2", "GAPDH", "YEATS2", "YEATS2", "GAPDH", "YEATS2", "cMYC", "YEATS2", "cMYC", "YEATS2", "GAPDH", "YEATS2", "YEATS2", "TNF-alpha", "YEATS2", "GAPDH", "TNF-alpha", "MYC", "MYC", "MYC", "IP", "IP", "IP", "tyrosine", "tyrosine", ...
[ 17392, 17427, 17445, 17936, 17952, 18022, 18100, 18150, 18187, 18260, 18461, 18535, 18541, 18599, 18670, 18720, 18732, 18840, 18857, 19045, 19204, 19295, 19729, 17696, 17869, 19917, 18652, 19266, 19487, 17487, 17707, 18056, 18124, 18138, 18753, 1...
[ 9, 6, 3, 6, 5, 6, 6, 5, 6, 4, 6, 4, 6, 5, 6, 6, 9, 6, 5, 9, 3, 3, 3, 2, 2, 2, 8, 8, 2, 9, 6, 4, 9, 4, 9, 6, 4, 7, 9, 5, 5, 4, 4 ]
[ "7124", "55689", "4609", "55689", "2597", "55689", "55689", "2597", "55689", "4609", "55689", "4609", "55689", "2597", "55689", "55689", "7124", "55689", "2597", "7124", "4609", "4609", "4609", "MESH:D007184", "MESH:D007184", "MESH:D007184", "MESH:D014443", "MES...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Cell...
40216980
21,512
YEATS2 has 21 Tyr amino acid residues in the whole protein (EV3E,F), out of which 4 Tyr amino acids are within the YEATS domain and one of the Tyr (Y313) residues is in the 1st RNA binding region (EV3E,F). It has already been reported that Tyr phosphorylation of Argonaut2 protein could interfere with miRNA binding during pro-inflammatory immune response (Mazumder et al,). So, we checked the overall Tyr phosphorylation level in YEATS2 protein with TNF stimulation in MIAPaCa-2, AsPC-1 and HPNE cells. Interestingly, we observed a decrease in Tyr phosphorylation of YEATS2 protein with TNF stimulation in MIAPaCa-2 and AsPC-1 cells (Fig. 3F,G). In the absence of Tyr phosphorylation, the propensity of RNA binding to YEATS2 protein will be more due to less charge-charge repulsion between the phosphate group of Tyr and the 5'-Phosphate group of RNA, correlating our previous observation of UV-RIP experiment (Fig. 3A) that TNF induced more MYC eRNA association with YEATS2. However, this dynamic change in Tyr phosphorylation was not observed for HPNE cells (Fig. 3H), again pointing out a cancer cell-specific post-translational modification for YEATS2 that regulates MYC eRNA binding. Next, we performed in vitro phosphatase assay by overexpressing Flag-tagged YEATS domain (YD) in HEK293T cells, pulled down by Flag bead and incubated the YD-bound bead with TNF-treated or untreated MIAPaCa-2 cell lysate and measured the phospho-tyrosine level by western blotting. This data showed a decrease in phospho-tyrosine level in the Flag-YD (Fig. 3I). Then, we did in vitro RNA binding assay for the Flag-tagged YD and observed higher binding of MYC-490-kb eRNA when incubated with TNF-treated MIAPaCa-2 cell lysate (Fig. 3J). To further validate our claim, site-directed mutagenesis was performed to investigate the functional impact of specific amino acid substitutions at position 313 in the YEATS domain. By introducing the Y313F mutations, we aimed to mimic a non-phosphorylated state to elucidate the role of tyrosine 313 phosphorylation in the domain's activity and its overall functional significance. In the in vitro phosphatase assay, no changes in phosphorylation levels were observed for the Y313F mutant (Fig. 3K). Similarly, in the in vitro RNA binding assay, we observed higher binding of the enhancer RNA to the wild-type protein compared to that of mutant protein with TNF stimulation (Fig. 3L). These results suggest that tyrosine 313 in the YEATS domain is pivotal in regulating the phosphorylation-dephosphorylation cycle and is critical for the subsequent binding to MYC enhancer RNA, which again confirms our claims.
RESULTS
paragraph
[ 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416 ]
[ "YEATS2", "YEATS2", "TNF", "YEATS2", "TNF", "YEATS2", "TNF", "MYC", "YEATS2", "YEATS2", "MYC", "TNF", "MYC", "TNF", "TNF", "MYC", "inflammatory", "cancer", "Tyr", "Tyr", "Tyr", "Tyr", "Tyr", "Tyr", "Tyr", "Tyr", "Tyr", "tyrosine", "tyrosine", "MIAPaCa-2", ...
[ 21512, 21943, 21963, 22080, 22100, 22231, 22438, 22455, 22481, 22662, 22684, 22876, 23158, 23194, 23898, 24100, 21839, 22605, 21526, 21596, 21655, 21752, 21914, 22057, 22177, 22326, 22521, 22948, 23023, 21982, 21993, 22004, 22119, 22133, 22562, 2...
[ 6, 6, 3, 6, 3, 6, 3, 3, 6, 6, 3, 3, 3, 3, 3, 3, 12, 6, 3, 3, 3, 3, 3, 3, 3, 3, 3, 8, 8, 9, 6, 4, 9, 6, 4, 7, 9, 9, 5, 5, 12, 4, 12 ]
[ "55689", "55689", "7124", "55689", "7124", "55689", "7124", "4609", "55689", "55689", "4609", "7124", "4609", "7124", "7124", "4609", "MESH:D007249", "MESH:D009369", "MESH:D014443", "MESH:D014443", "MESH:D014443", "MESH:D014443", "MESH:D014443", "MESH:D014443", "MESH:...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Che...
40216980
32,339
Reagent/resource Reference or source Identifier or catalog number Experimental models MIAPaCa-2 Kind gift from Dr. Shantibhusan Senapati, BRIC Institute of Life Sciences, Bhubaneswar. N/A AsPC-1 Kind gift from Dr. Shantibhusan Senapati, BRIC Institute of Life Sciences, Bhubaneswar. N/A HPNE ATCC CRL-4023 HCT-116 ATCC CCL-247 Recombinant DNA pcDNA3.1 Addgene pIRES-neo Addgene pLKO.1-TRC Addgene shMYC-490 eRNA #1 This Study N/A shMYC-490 eRNA #2 This Study N/A shMYC-490 eRNA#3 This Study N/A shMYC-490 eRNA #4 This Study N/A shYEATS2 #1 This Study N/A shYEATS2 #2 This Study N/A shYEATS2 #3 This Study N/A shYEATS2 #4 This Study N/A Antibodies Anti-YEATS2 ProteinTech 24717-1-AP GAPDH Cell Signaling Technology 14C10 Anti-beta-Actin Cell Signaling Technology 12620S Anti-Lamin Cell Signaling Technology 2032S Anti-Histone H3 Abcam ab1791 4G10 EMD Millipore corp 05-321 Anti-BRD4 Novus Biological NBP1-18874 Anti-PanKcr PTM BioLab PTM-501 Anti-ZZZ3 SIGMA SAB4501106 Anti-H3K27cr PTM BioLab PTM-545RM Anti-H3K27ac PTM BioLab PTM-116 Anti-cMYC Cell Signaling Technology 9402S Anti-rabbit-IgG ABclonal AC005 Anti-FLAG SIGMA F1804-200UG Anti-mouse-IgG CST 7076S Oligonucleotides Cloning Primers Name Sequence (5'-3') NheI_MYC-490 F CTAGCTAGCTCTGCTCCCTTCTCTTCTCTCA EcoRI_MYC-490 R CGCGAATTCATAATCATAATCATACTGTTCA NheI_MYC-425 F CGGCTAGCAGTGAGATGAACCCGGTA XbaI_MYC-425 R TGCTCTAGATATCAATTATACCTCAATAAATAGGAA ChIP primers MYC-490-kb enhancer F TCTGCTCCCTTCTCTTCTCT MYC-490-kb enhancer R ACCACCACACTCCATCTTTC MYC-425-kb enhancer F GAACTGAGGTCGCAAGACAA MYC-425-kb enhancer R GTAGACCGGAGCTGTTCCTA MYC Promoter F CAGACACATCTCAGGGCTAAAC MYC Promoter R TTGGATACCTTCCACCCAGA MYC gene body F GGGCCTCACACCGAATAAC MYC gene body R CACCAGACTAGGAAGCAACAA shRNA targeting sequences shscramble F CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG shscramble R AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG shMYC-490eRNA_F #1 CCGGAAGGTCAAGTTACTGGAAAGACTGCAGTCTTTCCAGTAACTTGACC TTTTTTTG shMYC-490eRNA_R #1 AATTCAAAAAAAGGTCAAGTTACTGGAAAGACTGCAGTCTTTCCAGTAAC TTGACCTT shMYC-490eRNA_F #2 CCGGTGGTGGTTAATAAAGTGAAACTCGAGTTTCACTTTATTAACCACCATTTTTTG shMYC-490eRNA_R #2 AATTCAAAAATGGTGGTTAATAAAGTGAAACTCGAGTTTCACTTTATTAACCACCAT shMYC-490eRNA_F #3 CCGGGATGGAGTGTGGTGGTTAATACTCGAGTATTAACCACCACACTCCATCTTTTTG shMYC-490eRNA_R #3 AATTCAAAAAGATGGAGTGTGGTGGTTAATACTCGAGTATTAACCACCACACTCCATC shMYC-490eRNA_F #4 CCGGCTTCTCTTCTCTCAGTGAAATCTCGAGATTTCACTGAGAGAAGAGAAGTTTTTG shMYC-490eRNA_R #4 AATTCAAAAACTTCTCTTCTCTCAGTGAAATCTCGAGATTTCACTGAGAGAAGAGAAG shYEATS2_F #1 CCGG TTCCTTCATCCTAGCTATAAA CTCGAG TTTATAGCTAGGATGAAGGAA TTTTTG shYEATS2_R #1 AATTCAAAAA TTCCTTCATCCTAGCTATAAA CTCGAG TTTATAGCTAGGATGAAGGAA shYEATS2_F #2 CCGG ATAACAGCAATATGGATATAG CTCGAG CTATATCCATATTGCTGTTATTTTTTG shYEATS2_R #2 AATTCAAAAA ATAACAGCAATATGGATATAG CTCGAG CTATATCCATATTGCTGTTAT shYEATS2_F #3 CCGG CGTCAGAGTTCAAGTTCATTT CTCGAG AAATGAACTTGAACTCTGACG TTTTTG shYEATS2_R #3 AATTCAAAAA CGTCAGAGTTCAAGTTCATTT CTCGAGAAATGAACTTGAACTCTGACG shYEATS2_F #4 CCGG AGTACAGGAAGTCCTACAAAC CTCGAG GTTTGTAGGACTTCCTGTACT TTTTTG shYEATS2_R #4 AATTCAAAAA AGTACAGGAAGTCCTACAAAC CTCGAGGTTTGTAGGACTTCCTGTACT RT-PCR Primers IL-6 F CCAGGAGAAGATTCCAAAGATGTA IL-6 R CGTCGAGGATGTACCGAATTT IL-1beta F CTCTCACCTCTCCTACTCACTT IL-1beta R TCAGAATGTGGGAGCGAATG MYC-490-kb eRNA F TCTGCTCCCTTCTCTTCTCT MYC-490-kb eRNA R ACCACCACACTCCATCTTTC MYC-425-kb eRNA F GAACTGAGGTCGCAAGACAA MYC-425-kb eRNA R GTAGACCGGAGCTGTTCCTA MYC mRNA F CCCTCCTACGTTGCGGTCAC MYC mRNA R GTCCGGGTCGCAGATGAAACT GAPDH F CAGCCTAGGATCATCAGCAAT GAPDH R GGTCATGAGTCCTTCCACGA PMM1 F CGCCAGAAAATTGACCCTGAG PMM1 R TTACAGTAGTCAGAGCCGCC MYC Intronic primer F CCGCATATCGCCTGTGTGAG MYC Intronic primer R AGTGTCCGTCTCCGGCTGTC Chemicals, enzymes, and other reagents DMEM High Glucose Gibco 11965118 DMEM low Glucose Invitrogen 11885084 FBS Gibco 16000044 Pen/Strep Gibco 15140122 puromycin Invitrogen A1113803 EGF Gibco PHG0311L recombinant TNF-alpha Abclonal 30021400 TRIzol reagent Ambion, Life Technologies 15596026 Verso cDNA Synthesis Kit Thermo Fisher Scientific AB1453B HEPES Gibco 15630080 KCL SIGMA P4504 EDTA SRL 43272 Protease Inhibitor Cocktail Invitrogen 87786 PMSF SIGMA 539132 Glycerol SIGMA 49767 DTT Millipore 1114740005 MgCl2 SIGMA 208337 PowerUP SYBR Green PCR Master Mix Applied Biosystems A25742 RNasin Thermo Fisher Scientific N8080119 NaCl SIGMA S9625 Dynabeads Protein A Invitrogen 10001D Dynabeads Protein G Invitrogen 10004D NP-40 MERCK STS0002 DSG SIGMA 80424-50MG-F Glycine SIGMA 4840-5KG Triton X-100 Merck 112298 Sodium Butyrate SIGMA B5887-5G SDS SIGMA L6026 Trizma base SIGMA T4661 HCl RANKEM H0070 Sodium deoxycholate SIGMA 30970 Paraformaldehyde (PFA) SIGMA P6148 PBS Gibco 10010049 lithium chloride (LiCl) SIGMA 213233 Bromophenol blue SIGMA 114391 Sodium orthovanadate SIGMA 450243 M2 Flag beads SIGMA M8823 MTT reagent Sigma Aldrich M5655 Q5 Site-Directed Mutagenesis Kit New England Biolabs E0552S Lipofectamine 3000 Invitrogen L3000015 NheI NEB R313S EcoRI NEB R3101S XbaI NEB R0145S AgeI NEB R3552L NcoI NEB R3193S Software UCSC genome browser https://genome.ucsc.edu/ Adobe Photoshop 7.0 HDOCK http://hdock.phys.hust.edu.cn/ GraphPad Prism 9.1 BioRender www.biorender.com ImageJ National Institutes of Health RPIseq http://pridb.gdcb.iastate.edu/RPISeq FastQC v0.11.7 https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Bowtie2 https://bowtie-bio.sourceforge.net/bowtie2/index.shtml Homer http://homer.ucsd.edu/homer/ Trim Galore v0.6.10 https://github.com/FelixKrueger/TrimGalore
TABLE
table
[ 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576 ]
[ "ZZZ3", "GAPDH", "GAPDH", "GAPDH", "IL-1beta", "IL-1beta", "EGF", "BRD4", "cMYC", "TNF-alpha", "Lamin", "YEATS2", "beta-Actin", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", "MYC", ...
[ 33342, 36079, 36046, 33064, 35772, 35735, 36461, 33269, 33441, 36494, 33160, 33032, 33109, 36220, 36174, 36010, 35975, 35933, 35891, 35849, 35807, 34151, 34112, 34073, 34032, 33986, 33940, 33894, 33848, 33783, 33738, 33688, 33637, 35703, 35668, 3...
[ 4, 5, 5, 5, 8, 8, 3, 4, 4, 9, 5, 6, 10, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 4, 4, 6, 5, 6, 6, 6, 6 ]
[ "26009", "2597", "2597", "2597", "3553", "3553", "1950", "23476", "4609", "7124", "4000", "55689", "728378", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "4609", "...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene"...
40216980
52,741
The cross-linking reaction was subsequently halted by the addition of 125 mM glycine for 5 min. The cells were then rinsed once with phosphate-buffered saline (PBS).
METHODS
paragraph
[ 735, 736, 737 ]
[ "phosphate-buffered saline", "PBS", "glycine for 5" ]
[ 52874, 52901, 52818 ]
[ 25, 3, 13 ]
[ "-", "-", "tmVar:p|Allele|G|5;VariantGroup:6;CorrespondingGene:4609;CorrespondingSpecies:9606" ]
[ "Chemical", "Chemical", "ProteinMutation" ]
39299780
32,359
Funding: This study was supported by the Taipei Veterans General Hospital (no. V105C-201, V107C-153, V109C-136, V110C-119, V113C-146, VTA106-V1-6-1, VTA107-V1-9-1, VTA109-V1-5-1); and the Ministry of Science and Technology, Taiwan (MOST 104-2314-B-075-040, MOST 111-2221-E-075-006). The funding sources did not have any role in processing of our manuscript.
CONCL
footnote
[ 261, 262, 263, 264, 265 ]
[ "V105C", "V107C", "V109C", "V110C", "V113C" ]
[ 32438, 32449, 32460, 32471, 32482 ]
[ 5, 5, 5, 5, 5 ]
[ "tmVar:p|SUB|V|105|C;HGVS:p.V105C;VariantGroup:2", "tmVar:p|SUB|V|107|C;HGVS:p.V107C;VariantGroup:1", "tmVar:p|SUB|V|109|C;HGVS:p.V109C;VariantGroup:0", "tmVar:p|SUB|V|110|C;HGVS:p.V110C;VariantGroup:4", "tmVar:p|SUB|V|113|C;HGVS:p.V113C;VariantGroup:3" ]
[ "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation", "ProteinMutation" ]
40002883
4,705
Tyrosine Kinase Inhibitor Therapeutic Target Reference Gefitinib EGFR (Exon 19 deletions, L858R mutations) Erlotinib EGFR (Exon 19 deletions, L858R mutations) Afatinib EGFR (Exon 19 deletions, L858R mutations, uncommon mutations like G719X, L861Q, S768I) Osimertinib EGFR (Exon 19 deletions, L858R mutations, T790M) Lazertinib EGFR (Exon 19 deletions, L858R mutations, T790M) Dacomitinib EGFR Alectinib ALK Ceritinib ALK, ROS1 Brigatinib ALK Lorlatinib ALK, ROS1 Crizotinib ALK, ROS1, MET Capmatinib MET exon 14 skipping mutations Tepotinib MET exon 14 skipping mutations Selpercatinib RET Pralsetinib RET Amivantamab EGFR, MET Mobocertinib EGFR exon 20 insertion mutations Dabrafenib + Trametinib BRAF V600E Encorafenib + Binimetinib BRAF V600E
TABLE
table
[ 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 ]
[ "Tyrosine Kinase", "RET", "RET", "ALK", "ALK", "ALK", "ALK", "ALK", "ROS1", "ROS1", "ROS1", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "BRAF", "BRAF", "MET", "MET", "MET", "MET", "L858R", "L858R", "L858R", "G719X", "L861Q", "S768I", ...
[ 4705, 5351, 5332, 5211, 5187, 5169, 5145, 5128, 5216, 5192, 5150, 5396, 5370, 5110, 5046, 4983, 4881, 4827, 4772, 5496, 5456, 5376, 5284, 5240, 5222, 5071, 5008, 4906, 4947, 4954, 4961, 4852, 5088, 4797, 5025, 5501, 5461 ]
[ 15, 3, 3, 3, 3, 3, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5 ]
[ "7294", "5979", "5979", "238", "238", "238", "238", "238", "19886", "19886", "19886", "1956", "1956", "1956", "1956", "1956", "1956", "1956", "1956", "673", "673", "79811", "79811", "79811", "79811", "tmVar:p|SUB|L|858|R;HGVS:p.L858R;VariantGroup:1;OriginalGene:1364...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Pr...
40002883
5,511
Abbreviations: EGFR, epidermal growth factor receptor; ALK, anaplastic lymphoma kinase; ROS1, c-ros oncogene 1; MET, mesenchymal-epithelial transition factor; RET, rearranged during transfection; BRAF, v-Raf murine sarcoma viral oncogene homolog B; V600E, valine-to-glutamate substitution at codon 600.
TABLE
table_footnote
[ 102, 103, 104, 105, 106, 107, 108, 109, 110, 111 ]
[ "EGFR", "epidermal growth factor receptor", "ALK", "anaplastic lymphoma kinase", "ROS1", "MET", "RET", "BRAF", "V600E", "valine-to-glutamate substitution at codon 600" ]
[ 5526, 5532, 5566, 5571, 5599, 5623, 5670, 5707, 5760, 5767 ]
[ 4, 32, 3, 26, 4, 3, 3, 4, 5, 45 ]
[ "13649", "13649", "11682", "11682", "19886", "79811", "19713", "109880", "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;CorrespondingGene:673;RS#:113488022;CorrespondingSpecies:10090;CA#:123643", "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;Correspondi...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "ProteinMutation", "ProteinMutation" ]
40002883
5,867
The emergence of resistance to EGFR TKIs poses a significant challenge in the treatment of EGFR-mutant NSCLC. EGFR mutations play a critical role in the pathogenesis of NSCLC by driving aberrant activation of tyrosine kinase signaling pathways. These mutations lead to the constitutive activation of the receptor's intrinsic tyrosine kinase domain, independent of ligand binding. The sustained activation leads to the activation of the MAPK, AKT, STAT3, and other downstream oncogenic signaling pathways, promoting processes such as uncontrolled cell proliferation, inhibition of apoptosis, angiogenesis, and metastasis. EGFR-TKI resistance can be categorized into two types, i.e., primary and secondary (acquired) resistance. Primary resistance occurs in patients who do not respond to EGFR-TKIs during frontline treatment or experience early relapse within 6 months. This can be further divided into intrinsic and late primary resistance. The mechanisms underlying primary resistance are not fully understood but may involve pre-existing genomic alterations, including de novo T790M and TP53 mutations, and MET amplification.
INTRO
paragraph
[ 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128 ]
[ "EGFR", "EGFR", "EGFR", "AKT", "STAT3", "EGFR", "EGFR", "TP53", "MET", "tyrosine kinase", "tyrosine kinase", "NSCLC", "NSCLC", "metastasis", "T790M", "patients" ]
[ 5898, 5958, 5977, 6309, 6314, 6488, 6654, 6956, 6976, 6192, 6076, 5970, 6036, 6476, 6946, 6623 ]
[ 4, 4, 4, 3, 5, 4, 4, 4, 3, 15, 15, 5, 5, 10, 5, 8 ]
[ "1956", "1956", "1956", "207", "6774", "1956", "1956", "7157", "79811", "7294", "7294", "MESH:D002289", "MESH:D002289", "MESH:D009362", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928", "9606"...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "ProteinMutation", "Species" ]
40002883
6,997
Secondary or acquired resistance typically develops after an initial response to EGFR-TKIs. This type of resistance develops via either on-target or off-target mechanisms. On-target resistance mechanisms include alterations in the target enzyme, typically the TKI-binding tyrosine kinase, which results in a reduction in the binding affinity of TKIs, making them less capable of inhibiting kinase activity. The most frequent form of on-target resistance is the acquisition of secondary mutations in the gene encoding the target kinase, e.g., the T790M or C797X mutations. For example, T790M mutations alter the configuration of the ATP-binding site of the tyrosine kinase domain, reducing the binding affinity of TKIs and accounting for approximately 50% of the acquired resistance after first- and second-generation EGFR-TKI treatment.
INTRO
paragraph
[ 129, 130, 131, 132, 133, 134, 135, 136 ]
[ "EGFR", "tyrosine kinase", "tyrosine kinase", "EGFR", "ATP", "T790M", "C797X", "T790M" ]
[ 7078, 7269, 7653, 7814, 7629, 7582, 7552, 7543 ]
[ 4, 15, 15, 4, 3, 5, 5, 5 ]
[ "1956", "7294", "7294", "1956", "MESH:D000255", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928", "tmVar:p|SUB|C|797|X;HGVS:p.C797X;VariantGroup:3;CorrespondingGene:1956;CorrespondingSpecies:9606", "tmVar:p|S...
[ "Gene", "Gene", "Gene", "Gene", "Chemical", "ProteinMutation", "ProteinMutation", "ProteinMutation" ]
40002883
8,559
C797X mutation
METHODS
paragraph
[ 145 ]
[ "C797X" ]
[ 8559 ]
[ 5 ]
[ "tmVar:p|SUB|C|797|X;HGVS:p.C797X;VariantGroup:3;CorrespondingGene:1956;CorrespondingSpecies:9606" ]
[ "ProteinMutation" ]
40002883
9,017
Upon progression on osimertinib, approximately 15% of tumors develop on-target mutations, with EGFR C797X in exon 20 being the most prevalent. This mutation hampers the covalent binding of osimertinib to the EGFR kinase domain. Other notable acquired mutations include L718Q/V, G719A, and G724S in exon 18. Fourth-generation EGFR TKIs like BLU-94573 and BBT-17674 have been developed, showing promising initial data. However, further investment in BLU-945 for EGFR-mutant NSCLC has been discontinued, and new treatments are awaited. Additionally, preclinical studies suggest that cancer cells with the acquired C797S mutation after osimertinib therapy remain sensitive to 1G or 2G EGFR TKIs. A multicenter, open-label, phase 1/2 trial (NCT05394831) is investigating JIN-A02, a fourth-generation EGFR-TKI. The results may provide insights into its potential as a treatment option for advanced NSCLC patients with C797S and/or T790M mutations. Another fourth-generation TKI, BDTX-1535, showed promising outcomes in patients with refractory or relapsed EGFR-mutant NSCLC in a phase 2 trial (NCT05256290).
METHODS
paragraph
[ 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178 ]
[ "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "tumors", "NSCLC", "cancer", "NSCLC", "NSCLC", "osimertinib", "osimertinib", "BLU-94573", "BBT-17674", "BLU-945", "osimertinib", "JIN", "BDTX-1535", "C797X", "L718Q/V", "G719A", "G724S", "C797S", "C797S", "T7...
[ 9112, 9225, 9342, 9477, 9698, 9812, 10067, 9071, 9489, 9597, 9909, 10079, 9037, 9206, 9357, 9371, 9465, 9649, 9783, 9990, 9117, 9286, 9295, 9306, 9929, 9628, 9942, 9915, 10030 ]
[ 4, 4, 4, 4, 4, 4, 4, 6, 5, 6, 5, 5, 11, 11, 9, 9, 7, 11, 3, 9, 5, 7, 5, 5, 5, 5, 5, 8, 8 ]
[ "1956", "1956", "1956", "1956", "1956", "1956", "1956", "MESH:D009369", "MESH:D002289", "MESH:D009369", "MESH:D002289", "MESH:D002289", "MESH:C000596361", "MESH:C000596361", "-", "-", "-", "MESH:C000596361", "-", "-", "tmVar:p|SUB|C|797|X;HGVS:p.C797X;VariantGroup:3;Correspon...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Prote...
40002883
14,456
RET fusions are also reported as acquired resistance mechanism after EGFR TKI treatment. When compared to primary RET fusions, the proportion of CCDC6-RET in patients with acquired resistance to EGFR TKIs was higher. Additionally, RET fusions were more frequently linked to acquired resistance to third-generation EGFR-TKIs compared to earlier generations. Fourteen patients who showed acquired RET fusions after osimertinib treatment underwent osimertinib and selpercatinib, showing modest response rate, disease control rate, and median treatment duration, were recorded at 50% (95% CI: 25-75%, n = 12), 83% (95% CI: 55-95%), and 7.9 months, respectively. For BRAF V600E-mediated osimertinib resistance, combinations such as dabrafenib and trametinib with osimertinib, as well as vemurafenib with osimertinib, have been reported in case studies involving patients resistant to osimertinib.
METHODS
paragraph
[ 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301 ]
[ "RET", "EGFR", "RET", "CCDC6", "RET", "EGFR", "RET", "EGFR", "RET", "BRAF", "osimertinib", "osimertinib", "selpercatinib", "osimertinib", "dabrafenib", "trametinib", "osimertinib", "vemurafenib", "osimertinib", "osimertinib", "V600E", "patients", "patients", "patients" ...
[ 14456, 14525, 14570, 14601, 14607, 14651, 14687, 14770, 14851, 15118, 14869, 14901, 14917, 15138, 15183, 15198, 15214, 15238, 15255, 15335, 15123, 14614, 14822, 15313 ]
[ 3, 4, 3, 5, 3, 4, 3, 4, 3, 4, 11, 11, 13, 11, 10, 10, 11, 11, 11, 11, 5, 8, 8, 8 ]
[ "5979", "1956", "5979", "8030", "5979", "1956", "5979", "1956", "5979", "673", "MESH:C000596361", "MESH:C000596361", "MESH:C000656166", "MESH:C000596361", "MESH:C561627", "MESH:C560077", "MESH:C000596361", "MESH:D000077484", "MESH:C000596361", "MESH:C000596361", "tmVar:p|SUB|...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Species", "Species", "Species" ]
40002883
38,001
In a study on 138 patients with EGFR mutation who underwent re-biopsy after progression following EGFR-TKI failure, the proportion of patients with >=50% PD-L1 expression increased significantly from baseline (14%) to 28%. Similar results have been reported in other studies. Various mechanisms have been suggested for PD-L1 expression elevation in EGFR TKI resistance. A study using TCGA database and paired NSCLC samples suggested that HGF, c-MET amplification, and the T790M mutation are involved in the upregulation of PD-L1 in NSCLC. An in vitro study reported that continuous TKI treatment resulted in PD-L1 overexpression, which correlated with T-cell proliferation suppression and STAT3 and ERK1/2 pathway activation. Another study using next-generation sequencing showed that mutations in the PI3K signaling pathway may lead to initial resistance to EGFR-TKIs with elevated PD-L1 levels. Additionally, AKT-mammalian targeting of rapamycin pathway activation and increased BIM expression have been suggested as possible mechanisms for increased PD-L1 expression in EGFR-mutant NSCLC.
METHODS
paragraph
[ 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730 ]
[ "EGFR", "EGFR", "PD-L1", "PD-L1", "EGFR", "HGF", "c-MET", "PD-L1", "PD-L1", "STAT3", "PI3K", "EGFR", "PD-L1", "AKT", "BIM", "PD-L1", "EGFR", "NSCLC", "NSCLC", "NSCLC", "T790M", "patients", "patients" ]
[ 38033, 38099, 38155, 38320, 38350, 38439, 38444, 38524, 38609, 38690, 38803, 38860, 38884, 38912, 38982, 39054, 39074, 38410, 38533, 39086, 38473, 38019, 38135 ]
[ 4, 4, 5, 5, 4, 3, 5, 5, 5, 5, 4, 4, 5, 3, 3, 5, 4, 5, 5, 5, 5, 8, 8 ]
[ "1956", "1956", "29126", "29126", "1956", "3082", "4233", "29126", "29126", "6774", "5291", "1956", "29126", "207", "10018", "29126", "1956", "MESH:D002289", "MESH:D002289", "MESH:D002289", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "ProteinMutation", "Species", "Species" ]
40002883
40,208
Recent studies have highlighted the critical role of the adenosine pathway in immune suppression, particularly in regulating lymphocyte activity. Within the TME, adenosine is a key modulator of immune responses. Its accumulation is facilitated by ectonucleotidase CD73, which promotes adenosine production and subsequently activates immunosuppressive pathways in tumor-infiltrating immune cells. Signaling through the adenosine A2A receptor has been shown to impair the cytotoxic function of CD8+ T cells and natural killer cells while promoting the differentiation of CD4+ T cells into regulatory T cells. Additionally, innate immune cells within the TME express adenosine receptors, and activation of these receptors enhances the immunosuppressive functions of M2 macrophages and amplifies the effects of myeloid-derived suppressor cells.
METHODS
paragraph
[ 750, 751, 752, 753, 754, 755, 756, 757, 758 ]
[ "CD73", " receptor", "CD8", "CD4", "tumor", "adenosine", "adenosine", "adenosine", "A2A" ]
[ 40472, 40639, 40700, 40777, 40571, 40265, 40370, 40493, 40636 ]
[ 4, 9, 3, 3, 5, 9, 9, 9, 3 ]
[ "23959", "135", "925", "920", "MESH:D009369", "MESH:D000241", "MESH:D000241", "MESH:D000241", "tmVar:c|SUB|A|2|A;HGVS:c.2A>A;VariantGroup:8;CorrespondingGene:925;RS#:1256344587;CorrespondingSpecies:9606" ]
[ "Gene", "Gene", "Gene", "Gene", "Disease", "Chemical", "Chemical", "Chemical", "DNAMutation" ]
40002883
45,351
Reversal of the M2 phenotype to M1 is effective at overcoming gefitinib resistance. Methionine sulfoxide reductase A (MsrA) helps protect the T790M-mutant EGFR protein. When macrophages switch from the M2 to M1 phenotype, the production of reactive oxygen species (ROS) increases, lowering MsrA levels and accelerating EGFR breakdown. Peng et al. developed a trastuzumab-modified liposome carrying gefitinib and vorinostat. Trastuzumab targets HER2-positive NSCLC cells, whereas vorinostat reverses the polarization of tumor-promoting M2 macrophages. Similarly, Yin et al. created PD-L1-modified liposomes that delivered gefitinib and simvastatin, specifically targeting TAMs. These two studies utilizing liposomes to target TAMs showed that converting macrophages from M2 to M1 increased ROS levels, inhibited angiogenesis, and boosted the release of immune-stimulating factors such as TGF-beta. Trastuzumab-modified mannosylated liposomes and PD-L1-modified liposomes, both designed to deliver gefitinib, demonstrated strong anti-tumor effects and good safety profiles in NSCLC mouse models with T790M mutation. The results of these two studies indicated that targeting TAMs and modifying the TME could represent potential therapeutic strategies.
METHODS
paragraph
[ 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851 ]
[ "Methionine sulfoxide reductase A", "MsrA", "EGFR", "MsrA", "EGFR", "HER2", "PD-L1", "TGF-beta", "PD-L1", "NSCLC", "tumor", "tumor", "NSCLC", "gefitinib", "reactive oxygen species", "ROS", "trastuzumab", "gefitinib", "vorinostat", "Trastuzumab", "vorinostat", "gefitinib", ...
[ 45435, 45469, 45506, 45641, 45670, 45795, 45932, 46238, 46296, 45809, 45870, 46383, 46425, 45413, 45591, 45616, 45710, 45749, 45763, 45775, 45830, 45972, 45986, 46140, 46248, 46347, 46449, 45493, 46431 ]
[ 32, 4, 4, 4, 4, 4, 5, 8, 5, 5, 5, 5, 5, 9, 23, 3, 11, 9, 10, 11, 10, 9, 11, 3, 11, 9, 5, 5, 5 ]
[ "110265", "110265", "13649", "110265", "13649", "13866", "60533", "21803", "60533", "MESH:D002289", "MESH:D009369", "MESH:D009369", "MESH:D002289", "MESH:D000077156", "MESH:D017382", "MESH:D017382", "MESH:D000068878", "MESH:D000077156", "MESH:D000077337", "MESH:D000068878", "...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemi...
40002883
48,474
The KEYNOTE-789 trial is a randomized, double-blind, phase III study evaluating the efficacy of pembrolizumab in combination with pemetrexed and platinum-based chemotherapy in patients with TKI-resistant, EGFR-mutant, and metastatic non-squamous NSCLC (NCT03515837). Patients with stage IV non-squamous NSCLC, confirmed DEL19 or L858R EGFR mutations, and progression after EGFR-TKI therapy were randomized 1:1 to receive pembrolizumab (200 mg every three weeks for up to 35 cycles) or placebo along with four cycles of pemetrexed and carboplatin or cisplatin, followed by pemetrexed maintenance therapy. In total, 492 patients were enrolled, and at the second interim analysis, the median PFS for pembrolizumab and chemotherapy and placebo and chemotherapy arms were 5.6 and 5.5 months, respectively (hazard ratio [HR] 0.80; 95% confidence interval [CI], 0.65-0.97; p = 0.0122). At the final analysis, the median overall survival (OS) in the pembrolizumab and placebo arms was 15.9 and 14.7 months, respectively (HR 0.84; 95% CI, 0.69-1.02; p = 0.0362). Treatment-related adverse events (TRAEs) of grade >= 3 occurred in 43.7% of patients receiving pembrolizumab plus chemotherapy, compared to 38.6% in patients receiving placebo plus chemotherapy. However, the addition of pembrolizumab to chemotherapy did not significantly improve PFS or OS. The ongoing benefits of immunotherapy-based treatments for EGFR-mutant NSCLC following failure of EGFR-TKIs remain uncertain.
METHODS
paragraph
[ 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903 ]
[ "EGFR", "EGFR", "EGFR", "EGFR", "EGFR", "NSCLC", "IV", "NSCLC", "NSCLC", "pembrolizumab", "pemetrexed", "platinum", "pembrolizumab", "pemetrexed", "carboplatin", "cisplatin", "pemetrexed", "pembrolizumab", "pembrolizumab", "pembrolizumab", "pembrolizumab", "L858R", "patie...
[ 48679, 48809, 48847, 49878, 49917, 48720, 48761, 48777, 49890, 48570, 48604, 48619, 48895, 48993, 49008, 49023, 49046, 49171, 49416, 49623, 49748, 48803, 48650, 48741, 49092, 49604, 49677 ]
[ 4, 4, 4, 4, 4, 5, 2, 5, 5, 13, 10, 8, 13, 10, 11, 9, 10, 13, 13, 13, 13, 5, 8, 8, 8, 8, 8 ]
[ "1956", "1956", "1956", "1956", "1956", "MESH:D002289", "MESH:D006011", "MESH:D002289", "MESH:D002289", "MESH:C582435", "MESH:D000068437", "MESH:D010984", "MESH:C582435", "MESH:D000068437", "MESH:D016190", "MESH:D002945", "MESH:D000068437", "MESH:C582435", "MESH:C582435", "MESH...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutation", "Species", "Species", ...
40002883
51,992
Owing to the relatively small number of patients enrolled in studies assessing the efficacy of immunotherapy in patients with EGFR mutations, no definite subgroups that would benefit from immunotherapy have been established. A retrospective study indicated that patients with prior TKI treatment and PFS < 10 months exhibited excellent response to subsequent anti-PD-1/PD-L1 immunotherapy. The type of EGFR mutation and the presence of the T790M mutation were significantly associated with PFS in immunotherapy-based treatments. An indirect comparative meta-analysis showed that patients with the L858R mutation (HR 0.52; 95% CI, 0.37-0.72) and those lacking the T790M mutation (HR 0.50; 95% CI, 0.35-0.71) demonstrated significantly greater benefits from immunotherapy regimens than their counterparts. High PD-L1 expression may not predict a strong response to immunotherapy, as >=50% patients with PD-L1 expression also showed limited efficacy in a phase II trial (NCT02879994) of pembrolizumab in TKI-naive patients.
METHODS
paragraph
[ 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949 ]
[ "EGFR", "PD-L1", "EGFR", "PD-L1", "PD-L1", "pembrolizumab", "T790M", "L858R", "T790M", "patients", "patients", "patients", "patients", "patients", "patients" ]
[ 52118, 52361, 52394, 52801, 52893, 52976, 52655, 52589, 52432, 52032, 52104, 52254, 52571, 52879, 53003 ]
[ 4, 5, 4, 5, 5, 13, 5, 5, 5, 8, 8, 8, 8, 8, 8 ]
[ "1956", "29126", "1956", "29126", "29126", "MESH:C582435", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928", "tmVar:p|SUB|L|858|R;HGVS:p.L858R;VariantGroup:1;OriginalGene:13649;CorrespondingGene:1956;RS#:1214...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Chemical", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Species", "Species", "Species", "Species", "Species", "Species" ]
40002883
55,706
These clinical benefits may be associated with the role of VEGFR-2 in TKI resistance. A study by Osude et al. demonstrated that in EGFR-TKI-resistant NSCLC cell lines:specifically those harboring EGFR double mutations (L858R and T790M):the expression of VEGF, VEGFR-2, and its co-receptor neuropilin-1 (NP-1) was significantly more elevated than that in parental or single-mutant cells. Immunofluorescence and flow cytometry confirmed increased expression of VEGFR-2 and NP-1 in TKI-resistant cells. Functional assays further revealed that combining a VEGFR-2 inhibitor with erlotinib reduced the viability of EGFR double-mutant NSCLC cells (9%) significantly more than erlotinib alone (72%).
METHODS
paragraph
[ 994, 995, 996, 997, 998, 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010 ]
[ "VEGFR-2", "EGFR", "EGFR", "VEGF", "VEGFR-2", "neuropilin-1", "NP-1", "VEGFR-2", "NP-1", "VEGFR-2", "EGFR", "NSCLC", "NSCLC", "erlotinib", "erlotinib", "L858R", "T790M" ]
[ 55765, 55837, 55902, 55960, 55966, 55995, 56009, 56165, 56177, 56258, 56316, 55856, 56335, 56281, 56376, 55925, 55935 ]
[ 7, 4, 4, 4, 7, 12, 4, 7, 4, 7, 4, 5, 5, 9, 9, 5, 5 ]
[ "3791", "1956", "1956", "7422", "3791", "8829", "8829", "3791", "8829", "3791", "1956", "MESH:D002289", "MESH:D002289", "MESH:D000069347", "MESH:D000069347", "tmVar:p|SUB|L|858|R;HGVS:p.L858R;VariantGroup:1;OriginalGene:13649;CorrespondingGene:1956;RS#:121434568;CorrespondingSpecies:10...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Chemical", "Chemical", "ProteinMutation", "ProteinMutation" ]
40002883
57,200
The IMpower150 trial showed significant improvements in PFS and OS with atezolizumab plus bevacizumab plus carboplatin plus paclitaxel (ABCP) versus standard-of-care bevacizumab plus carboplatin plus paclitaxel in chemotherapy-naive patients with non-squamous NSCLC. In the final analysis for the subgroup with EGFR mutations, the ABCP regimen improved OS in both the overall (HR 0.60; 95% CI, 0.31-1.14) and TKI-treated (HR 0.74; 95% CI: 0.38-1.46) populations. Building on the dual-targeting approach of the PD-L1 and VEGF pathways, the HARMONi-A trial evaluated ivonescimab, a bispecific antibody against PD-1 and VEGF, combined with chemotherapy, and demonstrated that dual inhibition can significantly improve PFS in EGFR-mutant NSCLC after prior TKI therapy. The trial found that the ivonescimab combination notably increased median PFS (7.1 months; 95% CI, 5.9-8.7) more than the placebo (4.8 months; 95% CI, 4.2-5.6; difference of 2.3 months; HR, 0.46 [95% CI, 0.34-0.62]; p < 0.001). The ORR was 50.6% (95% CI, 42.6-58.6%) for ivonescimab versus 35.4% (95% CI, 28.0-43.3%) for the placebo. Another notable finding was the pronounced PFS benefit in the T790M-positive group (HR 0.22; 95% CI, 0.09-0.54). Regarding the safety profile, >=grade 3 adverse events were reported in 61.5% and 49.1% of patients treated with ivonescimab and placebo, primarily related to chemotherapy. Considering the limitations of monotherapy in EGFR-mutant NSCLC, the addition of VEGF inhibition to immunotherapy may be a potential treatment option for patients who have progressed on EGFR-TKIs.
METHODS
paragraph
[ 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052 ]
[ "EGFR", "PD-L1", "VEGF", "VEGF", "EGFR", "EGFR", "VEGF", "EGFR", "NSCLC", "NSCLC", "NSCLC", "atezolizumab", "bevacizumab", "carboplatin", "paclitaxel", "ABCP", "bevacizumab", "carboplatin", "paclitaxel", "ABCP", "ivonescimab", "ivonescimab", "ivonescimab", "ivonescimab"...
[ 57511, 57710, 57720, 57817, 57922, 58631, 58666, 58771, 57460, 57934, 58643, 57272, 57290, 57307, 57324, 57336, 57366, 57383, 57400, 57531, 57765, 57990, 58236, 58525, 58361, 57433, 58503, 58739 ]
[ 4, 5, 4, 4, 4, 4, 4, 4, 5, 5, 5, 12, 11, 11, 10, 4, 11, 11, 10, 4, 11, 11, 11, 11, 5, 8, 8, 8 ]
[ "1956", "29126", "7422", "7422", "1956", "1956", "7422", "1956", "MESH:D002289", "MESH:D002289", "MESH:D002289", "MESH:C000594389", "MESH:D000068258", "MESH:D016190", "MESH:D017239", "-", "MESH:D000068258", "MESH:D016190", "MESH:D017239", "-", "-", "-", "-", "-", "tmV...
[ "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "Chemical", "ProteinMutatio...
40002883
69,011
Phase 2 Study of Dabrafenib Plus Trametinib in Patients with BRAF V600E-Mutant Metastatic NSCLC: Updated 5-Year Survival Rates and Genomic Analysis
REF
ref
[ 1129, 1130 ]
[ "BRAF", "V600E" ]
[ 69072, 69077 ]
[ 4, 5 ]
[ "673", "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;CorrespondingGene:673;RS#:113488022;CorrespondingSpecies:10090;CA#:123643" ]
[ "Gene", "ProteinMutation" ]
40002883
69,159
Encorafenib and Binimetinib: A New Treatment Option for BRAFV600E-Mutant Non-Small-Cell Lung Cancer
REF
ref
[ 1131 ]
[ "BRAFV600E" ]
[ 69215 ]
[ 9 ]
[ "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;CorrespondingGene:673;RS#:113488022;CorrespondingSpecies:10090;CA#:123643" ]
[ "ProteinMutation" ]
40002883
69,896
HER2 amplification: A potential mechanism of acquired resistance to EGFR inhibition in EGFR-mutant lung cancers that lack the second-site EGFR T790M mutation
REF
ref
[ 1139, 1140, 1141, 1142, 1143 ]
[ "HER2", "EGFR", "EGFR", "EGFR", "T790M" ]
[ 69896, 70034, 69983, 69964, 70039 ]
[ 4, 4, 4, 4, 5 ]
[ "13866", "1956", "1956", "1956", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "Gene", "Gene", "Gene", "ProteinMutation" ]
40002883
70,589
Overcoming EGFR(G724S)-mediated osimertinib resistance through unique binding characteristics of second-generation EGFR inhibitors
REF
ref
[ 1148, 1149, 1150 ]
[ "EGFR", "EGFR", "G724S" ]
[ 70704, 70600, 70605 ]
[ 4, 4, 5 ]
[ "1956", "1956", "tmVar:p|SUB|G|724|S;HGVS:p.G724S;VariantGroup:7;OriginalGene:13649;CorrespondingGene:1956;RS#:748011710;CorrespondingSpecies:10090;CA#:4266230" ]
[ "Gene", "Gene", "ProteinMutation" ]
40002883
71,109
MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib
REF
ref
[ 1156, 1157, 1158 ]
[ "EGFR", "MET", "T790M" ]
[ 71169, 71109, 71150 ]
[ 4, 3, 5 ]
[ "1956", "79811", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "Gene", "ProteinMutation" ]
40002883
71,244
Analysis of resistance mechanisms to osimertinib in patients with EGFR T790M advanced NSCLC from the AURA3 study
REF
ref
[ 1159, 1160 ]
[ "EGFR", "T790M" ]
[ 71310, 71315 ]
[ 4, 5 ]
[ "1956", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "ProteinMutation" ]
40002883
75,508
Lung Adenocarcinoma Harboring Concomitant EGFR Mutations and BRAF V600E Responds to a Combination of Osimertinib and Vemurafenib to Overcome Osimertinib Resistance
REF
ref
[ 1205, 1206, 1207 ]
[ "EGFR", "BRAF", "V600E" ]
[ 75550, 75569, 75574 ]
[ 4, 4, 5 ]
[ "1956", "673", "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;CorrespondingGene:673;RS#:113488022;CorrespondingSpecies:10090;CA#:123643" ]
[ "Gene", "Gene", "ProteinMutation" ]
40002883
75,672
Combined osimertinib, dabrafenib and trametinib treatment for advanced non-small-cell lung cancer patients with an osimertinib-induced BRAF V600E mutation
REF
ref
[ 1208, 1209 ]
[ "BRAF", "V600E" ]
[ 75807, 75812 ]
[ 4, 5 ]
[ "673", "tmVar:p|SUB|V|600|E;HGVS:p.V600E;VariantGroup:5;OriginalGene:109880;CorrespondingGene:673;RS#:113488022;CorrespondingSpecies:10090;CA#:123643" ]
[ "Gene", "ProteinMutation" ]
40002883
79,645
Reprogramming Tumor-Associated Macrophages To Reverse EGFR(T790M) Resistance by Dual-Targeting Codelivery of Gefitinib/Vorinostat
REF
ref
[ 1254, 1255 ]
[ "EGFR", "T790M" ]
[ 79699, 79704 ]
[ 4, 5 ]
[ "1956", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "ProteinMutation" ]
40002883
81,674
Exosomes transmit T790M mutation-induced resistance in EGFR-mutant NSCLC by activating PI3K/AKT signalling pathway
REF
ref
[ 1272, 1273, 1274, 1275 ]
[ "AKT", "EGFR", "PI3K", "T790M" ]
[ 81766, 81729, 81761, 81692 ]
[ 3, 4, 4, 5 ]
[ "207", "1956", "5291", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "Gene", "Gene", "ProteinMutation" ]
40002883
89,962
Remodeling Tumor-Associated Macrophages and Neovascularization Overcomes EGFRT790M-Associated Drug Resistance by PD-L1 Nanobody-Mediated Codelivery
REF
ref
[ 1362, 1363 ]
[ "PD-L1", "EGFRT790M" ]
[ 90075, 90035 ]
[ 5, 9 ]
[ "29126", "tmVar:p|SUB|T|790|M;HGVS:p.T790M;VariantGroup:0;OriginalGene:13649;CorrespondingGene:1956;RS#:121434569;CorrespondingSpecies:10090;CA#:90928" ]
[ "Gene", "ProteinMutation" ]
20338449
202
Johne's disease is a chronic enteritis caused by Mycobacterium avium ssp. paratuberculosis (MAP) that causes substantial financial losses for the cattle industry. Susceptibility to MAP infection is reported to be determined in part by genetic factors, so marker-assisted selection could help to obtain bovine populations that are increasingly resistant to MAP infection. Solute carrier family 11 member 1 (SLC11A1) was adjudged to be a potential candidate gene because of its role in innate immunity, its involvement in susceptibility to numerous intracellular infections, and its previous association with bovine MAP infection. The objectives of this study were to carry out an exhaustive process of discovery and compilation of polymorphisms in SLC11A1 gene, and to perform a population-based genetic association study to test its implication in susceptibility to MAP infection in cattle. In all, 57 single nucleotide polymorphisms (SNP) were detected, 25 of which are newly described in Bos taurus. Twenty-four SNP and two 3'-untranslated region polymorphisms, previously analyzed, were selected for a subsequent association study in 558 European Holstein-Friesian animals. The SNP c.1067C>G and c.1157-91A>T and a haplotype formed by these 2 SNP yielded significant association with susceptibility to MAP infection. The c.1067C>G is a nonsynonymous SNP that causes an amino acid change in codon 356 from proline to alanine (P356A) that could alter SLC11A1 protein function. This association study supports the involvement of SLC11A1 gene in susceptibility to MAP infection in cattle. Our results suggest that SNP c.1067C>G may be a potential causal variant, although functional studies are needed to assure this point.
null
abstract
[ 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 ]
[ "Johne's disease", "enteritis", "Mycobacterium avium ssp", "paratuberculosis", "MAP", "cattle", "MAP infection", "bovine", "MAP infection", "Solute carrier family 11 member 1", "SLC11A1", "intracellular infections", "bovine", "MAP infection", "SLC11A1", "MAP infection", "cattle", "...
[ 202, 231, 251, 276, 294, 348, 383, 504, 558, 573, 608, 749, 809, 816, 949, 1068, 1085, 1192, 1387, 1401, 1507, 1526, 1601, 1630, 1654, 1731, 1765, 1782, 1819 ]
[ 15, 9, 23, 16, 3, 6, 13, 6, 13, 33, 7, 24, 6, 13, 7, 13, 6, 10, 9, 12, 13, 9, 27, 5, 7, 7, 13, 6, 9 ]
[ "MESH:D010283", "MESH:D004751", null, "MESH:D010283", "MESH:D010283", "9913", "MESH:D015270", "9913", "MESH:D015270", "282470", "282470", "MESH:D015270", "9913", "MESH:D015270", "282470", "MESH:D015270", "9913", "9913", "tmVar:c|SUB|C|1067|G;HGVS:c.1067C>G;VariantGroup:0;Original...
[ "Disease", "Disease", "Species", "Disease", "Disease", "Species", "Disease", "Species", "Disease", "Gene", "Gene", "Disease", "Species", "Disease", "Gene", "Disease", "Species", "Species", "DNAMutation", "DNAMutation", "Disease", "DNAMutation", "ProteinMutation", "Prote...
20338454
105
The main goal of the current work was to identify single nucleotide polymorphisms (SNP) that might create or disrupt microRNA (miRNA) target sites in the caprine casein genes. The 3' untranslated regions of the goat alpha(S1)-, alpha(S2)-, beta-, and kappa-casein genes (CSN1S1, CSN1S2, CSN2, and CSN3, respectively) were resequenced in 25 individuals of the Murciano-Granadina, Cashmere, Canarian, Saanen, and Sahelian breeds. Five SNP were identified through this strategy: c.175C>T at CSN1S1; c.109T>C, c.139G>C, and c.160T>C at CSN1S2; and c.216C>T at CSN2. Analysis with the Patrocles Finder tool predicted that all of these SNP are located within regions complementary to the seed of diverse miRNA sequences. These in silico results suggest that polymorphism at miRNA target sites might have some effect on casein expression. We explored this issue by genotyping the c.175C>T SNP (CSN1S1) in 85 Murciano-Granadina goats with records for milk CSN1S1 concentrations. This substitution destroys a putative target site for miR-101, a miRNA known to be expressed in the bovine mammary gland. Although TT goats had higher levels (6.25 g/L) of CSN1S1 than their CT (6.05 g/L) and CC (6.04 g/L) counterparts, these differences were not significant. Experimental confirmation of the miRNA target sites predicted in the current work and performance of additional association analyses in other goat populations will be an essential step to find out if polymorphic miRNA target sites constitute an important source of variation in casein expression.
null
abstract
[ 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 ]
[ "caprine", "goat", "CSN1S1", "CSN1S2", "CSN2", "CSN3", "c.175C>T", "CSN1S1", "c.109T>C", "c.139G>C", "c.160T>C", "CSN1S2", "c.216C>T", "CSN2", "c.175C>T", "CSN1S1", "goats", "CSN1S1", "miR-101", "bovine", "goats", "CSN1S1", "goat" ]
[ 259, 316, 376, 384, 392, 402, 581, 593, 601, 611, 625, 637, 649, 661, 978, 992, 1025, 1053, 1130, 1176, 1210, 1248, 1494 ]
[ 7, 4, 6, 6, 4, 4, 8, 6, 8, 8, 8, 6, 8, 4, 8, 6, 5, 6, 7, 6, 5, 6, 4 ]
[ null, null, "100750242", "100750241", "100860784", "100861231", "tmVar:c|SUB|C|175|T;HGVS:c.175C>T;VariantGroup:1;OriginalGene:100750242;CorrespondingGene:1446;CorrespondingSpecies:9925", "100750242", "tmVar:c|SUB|T|109|C;HGVS:c.109T>C;VariantGroup:2;OriginalGene:100750242;CorrespondingGene:1446;Cor...
[ "Species", "Species", "Gene", "Gene", "Gene", "Gene", "DNAMutation", "Gene", "DNAMutation", "DNAMutation", "DNAMutation", "Gene", "DNAMutation", "Gene", "DNAMutation", "Gene", "Species", "Gene", "Gene", "Species", "Species", "Gene", "Species" ]
20338477
80
PURPOSE: To investigate the influence of demethylation with 5-aza-cytidine (AZA) on radiation sensitivity and to define the intrinsic radiation sensitivity of methylation deficient colorectal carcinoma cells. METHODS AND MATERIALS: Radiation sensitizing effects of AZA were investigated in four colorectal carcinoma cell lines (HCT116, SW480, L174 T, Co115), defining influence of AZA on proliferation, clonogenic survival, and cell cycling with or without ionizing radiation. The methylation status for cancer or DNA damage response-related genes silenced by promoter methylation was determined. The effect of deletion of the potential target genes (DNMT1, DNMT3b, and double mutants) on radiation sensitivity was analyzed. RESULTS: AZA showed radiation sensitizing properties at >or=1 micromol/l, a concentration that does not interfere with the cell cycle by itself, in all four tested cell lines with a sensitivity-enhancing ratio (SER) of 1.6 to 2.1 (confidence interval [CI] 0.9-3.3). AZA successfully demethylated promoters of p16 and hMLH1, genes associated with ionizing radiation response. Prolonged exposure to low-dose AZA resulted in sustained radiosensitivity if associated with persistent genomic hypomethylation after recovery from AZA. Compared with maternal HCT116 cells, DNMT3b-defcient deficient cells were more sensitive to radiation with a SER of 2.0 (CI 0.9-2.1; p = 0.03), and DNMT3b/DNMT1-/- double-deficient cells showed a SER of 1.6 (CI 0.5-2.7; p = 0.09). CONCLUSIONS: AZA-induced genomic hypomethylation results in enhanced radiation sensitivity in colorectal carcinoma. The mediators leading to sensitization remain unknown. Defining the specific factors associated with radiation sensitization after genomic demethylation may open the way to better targeting for the purpose of radiation sensitization.
null
abstract
[ 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 ]
[ "5-aza-cytidine", "AZA", "colorectal carcinoma", "AZA", "colorectal carcinoma", "HCT116", "SW480", "L174 T", "Co115", "AZA", "cancer", "DNMT1", "DNMT3b", "AZA", "(SER) of 1", "AZA", "p16", "hMLH1", "AZA", "AZA", "HCT116", "DNMT3b", "SER of 2", "DNMT3b", "DNMT1", "SE...
[ 140, 156, 261, 345, 375, 408, 416, 423, 431, 461, 584, 731, 738, 814, 1015, 1071, 1114, 1122, 1211, 1328, 1356, 1370, 1442, 1481, 1488, 1529, 1577, 1658 ]
[ 14, 3, 20, 3, 20, 6, 5, 6, 5, 3, 6, 5, 6, 3, 10, 3, 3, 5, 3, 3, 6, 6, 8, 6, 5, 8, 3, 20 ]
[ "MESH:D001374", "MESH:D001374", "MESH:D015179", "MESH:D001374", "MESH:D015179", "CVCL:0291", "CVCL:0546", "tmVar:p|SUB|L|174|T;HGVS:p.L174T;VariantGroup:2", "CVCL:D102", "MESH:D001374", "MESH:D009369", "1786", "1789", "MESH:D001374", "tmVar:p|Allele|S|1;VariantGroup:0;CorrespondingGene:1...
[ "Chemical", "Chemical", "Disease", "Chemical", "Disease", "CellLine", "CellLine", "ProteinMutation", "CellLine", "Chemical", "Disease", "Gene", "Gene", "Chemical", "ProteinMutation", "Chemical", "Gene", "Gene", "Chemical", "Chemical", "CellLine", "Gene", "ProteinMutation"...
20338844
89
Expression of the Na(+)/glucose cotransporter SGLT1 in Xenopus oocytes is characterized by a phlorizin-sensitive leak current (in the absence of glucose) that was originally called a "Na(+) leak" and represents some 5-10% of the maximal Na(+)/glucose cotransport current. We analyzed the ionic nature of the leak current using a human SGLT1 mutant (C292A) displaying a threefold larger leak current while keeping a reversal potential (V(R)) of approximately -15 mV as observed for wt SGLT1. V(R) showed only a modest negative shift when extracellular Na(+) concentration ([Na(+)](o)) was lowered and it was completely insensitive to changes in extracellular Cl(-). When extracellular pH (pH(o)) was decreased from 7.5 to 6.5 and 5.5, V(R) shifted by +15 and +40 mV, respectively, indicating that protons may be the main charge carrier at low pH(o) but other ions must be involved at pH(o) 7.5. In the presence of 15 mM [Na(+)](o) (pH(o) = 7.5), addition of 75 mM of either Na(+), Li(+), Cs(+), or K(+) generated similar increases in the leak current amplitude. This observation, which was confirmed with wt SGLT1, indicates a separate pathway for the leak current with respect to the cotransport current. This means that, contrary to previous beliefs, the leak current cannot be accounted for by the translocation of the Na-loaded and glucose-free cotransporter. Using chemical modification and different SGLT1 mutants, a relationship was found between the cationic leak current and the passive water permeability suggesting that water and cations may share a common pathway through the cotransporter.
null
abstract
[ 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ]
[ "SGLT1", "Xenopus", "phlorizin", "glucose", "glucose", "human", "SGLT1", "C292A", "SGLT1", "Cs(+)", "SGLT1", "SGLT1", "water", "water" ]
[ 135, 144, 182, 234, 332, 418, 424, 438, 573, 1076, 1196, 1494, 1584, 1619 ]
[ 5, 7, 9, 7, 7, 5, 5, 5, 5, 5, 5, 5, 5, 5 ]
[ "6523", "8355", "MESH:D010695", "MESH:D005947", "MESH:D005947", "9606", "6523", "tmVar:c|SUB|C|292|A;HGVS:c.292C>A;VariantGroup:0;CorrespondingGene:6523;CorrespondingSpecies:9606", "6523", "MESH:D002586", "6523", "6523", "MESH:D014867", "MESH:D014867" ]
[ "Gene", "Species", "Chemical", "Chemical", "Chemical", "Species", "Gene", "DNAMutation", "Gene", "Chemical", "Gene", "Gene", "Chemical", "Chemical" ]
20338850
0
Association thermodynamics and conformational stability of beta-sheet amyloid beta(17-42) oligomers: effects of E22Q (Dutch) mutation and charge neutralization.
null
title
[ 1 ]
[ "E22Q" ]
[ 112 ]
[ 4 ]
[ "tmVar:p|SUB|E|22|Q;HGVS:p.E22Q;VariantGroup:0;CorrespondingGene:351;CorrespondingSpecies:9606" ]
[ "ProteinMutation" ]
20338850
161
Amyloid fibrils are associated with many neurodegenerative diseases. It was found that amyloidogenic oligomers, not mature fibrils, are neurotoxic agents related to these diseases. Molecular mechanisms of infectivity, pathways of aggregation, and molecular structure of these oligomers remain elusive. Here, we use all-atom molecular dynamics, molecular mechanics combined with solvation analysis by statistical-mechanical, three-dimensional molecular theory of solvation (also known as 3D-RISM-KH) in a new MM-3D-RISM-KH method to study conformational stability, and association thermodynamics of small wild-type Abeta(17-42) oligomers with different protonation states of Glu(22), as well the E22Q (Dutch) mutants. The association free energy of small beta-sheet oligomers shows near-linear trend with the dimers being thermodynamically more stable relative to the larger constructs. The linear (within statistical uncertainty) dependence of the association free energy on complex size is a consequence of the unilateral stacking of monomers in the beta-sheet oligomers. The charge reduction of the wild-type Abeta(17-42) oligomers upon protonation of the solvent-exposed Glu(22) at acidic conditions results in lowering the association free energy compared to the wild-type oligomers at neutral pH and the E22Q mutants. The neutralization of the peptides because of the E22Q mutation only marginally affects the association free energy, with the reduction of the direct electrostatic interactions mostly compensated by the unfavorable electrostatic solvation effects. For the wild-type oligomers at acidic conditions such compensation is not complete, and the electrostatic interactions, along with the gas-phase nonpolar energetic and the overall entropic effects, contribute to the lowering of the association free energy. The differences in the association thermodynamics between the wild-type Abeta(17-42) oligomers at neutral pH and the Dutch mutants, on the one hand, and the Abeta(17-42) oligomers with protonated Glu(22), on the other, may be explained by destabilization of the inter- and intrapeptide salt bridges between Asp(23) and Lys(28). Peculiarities in the conformational stability and the association thermodynamics for the different models of the Abeta(17-42) oligomers are rationalized based on the analysis of the local physical interactions and the microscopic solvation structure.
null
abstract
[ 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 ]
[ "Amyloid", "neurodegenerative diseases", "neurotoxic", "Abeta(17-42)", "Glu(22)", "E22Q", "Abeta(17-42)", "Glu(22)", "E22Q", "E22Q", "Abeta(17-42)", "Abeta(17-42)", "Glu(22)", "Asp", "Lys", "Abeta(17-42)" ]
[ 161, 202, 297, 775, 835, 856, 1272, 1335, 1470, 1534, 2061, 2146, 2185, 2296, 2308, 2430 ]
[ 7, 26, 10, 12, 7, 4, 12, 7, 4, 4, 12, 12, 7, 3, 3, 12 ]
[ "MESH:C000718787", "MESH:D019636", "MESH:D020258", "351", "-", "tmVar:p|SUB|E|22|Q;HGVS:p.E22Q;VariantGroup:0;CorrespondingGene:351;CorrespondingSpecies:9606", "351", "-", "tmVar:p|SUB|E|22|Q;HGVS:p.E22Q;VariantGroup:0;CorrespondingGene:351;CorrespondingSpecies:9606", "tmVar:p|SUB|E|22|Q;HGVS:p.E2...
[ "Disease", "Disease", "Disease", "Gene", "Chemical", "ProteinMutation", "Gene", "Chemical", "ProteinMutation", "ProteinMutation", "Gene", "Gene", "Chemical", "Chemical", "Chemical", "Gene" ]
20338887
0
Non-synonymous variant (Gly307Ser) in CD226 is associated with susceptibility to multiple autoimmune diseases.
null
title
[ 3, 4, 5 ]
[ "Gly307Ser", "CD226", "multiple autoimmune diseases" ]
[ 24, 38, 81 ]
[ 9, 5, 28 ]
[ "tmVar:p|SUB|G|307|S;HGVS:p.G307S;VariantGroup:0;CorrespondingGene:10666;RS#:763361;CorrespondingSpecies:9606;CA#:8994312", "10666", "MESH:D001327" ]
[ "ProteinMutation", "Gene", "Disease" ]
20338887
111
OBJECTIVES: Recently, a non-synonymous (Gly307Ser) variant, rs763361, in the CD226 gene was shown to be associated with multiple autoimmune diseases (ADs) in European Caucasian populations. However, shared autoimmunity with CD226 has not been evaluated in non-European populations. The aim of the present study is to assess the association of this single nucleotide polymorphism (SNP) with ADs in non-European populations. METHODS: To replicate this association in non-European populations, we evaluated case-control association between rs763361 and coeliac disease (CED) samples from Argentina; SLE, RA, type-1 diabetes (T1D) and primary SS (pSS) from Colombia; and SLE samples from China and Japan. We genotyped rs763361 and evaluated its genetic association with multiple ADs, using chi(2)-test. For each association, odds ratio (OR) and 95% CI were calculated. RESULTS: We show that rs763361 is significantly associated with Argentinean CED (P = 0.0009, OR = 1.60). We also observed a trend of possible association with Chinese SLE (P = 0.01, OR = 1.19), RA (P = 0.047, OR = 1.25), SLE (P = 0.0899, OR = 1.24) and pSS (P = 0.09, OR = 1.33) in Colombians. Meta-analyses for SLE (using our three populations) and T1D (our population and three published populations) yielded significant association with rs763361, P = 0.009 (OR = 1.16) and P = 1.1.46 x 10(-9) (OR = 1.14), respectively. CONCLUSIONS: Our results demonstrate that the coding variant rs763361 in CD226 gene is associated with multiple ADs in non-European populations.
null
abstract
[ 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 ]
[ "Gly307Ser", "rs763361", "CD226", "multiple autoimmune diseases", "ADs", "CD226", "ADs", "rs763361", "coeliac disease", "CED", "SLE", "RA", "type-1 diabetes", "T1D", "primary SS", "pSS", "SLE", "rs763361", "ADs", "rs763361", "CED", "SLE", "RA", "SLE", "pSS", "SLE", ...
[ 151, 171, 188, 231, 261, 335, 501, 648, 661, 678, 707, 712, 716, 733, 742, 754, 778, 825, 886, 998, 1052, 1143, 1170, 1197, 1229, 1288, 1326, 1416, 1560, 1572, 1611 ]
[ 9, 8, 5, 28, 3, 5, 3, 8, 15, 3, 3, 2, 15, 3, 10, 3, 3, 8, 3, 8, 3, 3, 2, 3, 3, 3, 3, 8, 8, 5, 3 ]
[ "tmVar:p|SUB|G|307|S;HGVS:p.G307S;VariantGroup:0;CorrespondingGene:10666;RS#:763361;CorrespondingSpecies:9606;CA#:8994312", "tmVar:rs763361;VariantGroup:0;CorrespondingGene:10666;RS#:763361;CorrespondingSpecies:9606", "10666", "MESH:D001327", "MESH:D001327", "10666", "MESH:D001327", "tmVar:rs763361;Va...
[ "ProteinMutation", "SNP", "Gene", "Disease", "Disease", "Gene", "Disease", "SNP", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "Disease", "SNP", "Disease", "SNP", "Disease", "Disease", "Disease", "Disease", "Disease", "Dise...
20340133
79
Increasing the conformational stability of proteins is an important goal for both basic research and industrial applications. In vitro selection has been used successfully to increase protein stability, but more often site-directed mutagenesis is used to optimize the various forces that contribute to protein stability. In previous studies, we showed that improving electrostatic interactions on the protein surface and improving the beta-turn sequences were good general strategies for increasing protein stability, and used them to increase the stability of RNase Sa. By incorporating seven of these mutations in RNase Sa, we increased the stability by 5.3 kcal/mol. Adding one more mutation, D79F, gave a total increase in stability of 7.7 kcal/mol, and a melting temperature 28 degrees C higher than the wild-type enzyme. Surprisingly, the D79F mutation lowers the change in heat capacity for folding, DeltaC(p), by 0.6 kcal/mol/K. This suggests that this mutation stabilizes structure in the denatured state ensemble. We made other mutants that give some insight into the structure present in the denatured state. Finally, the thermodynamics of folding of these stabilized variants of RNase Sa are compared with those observed for proteins from thermophiles.
null
abstract
[ 2, 3 ]
[ "D79F", "D79F" ]
[ 775, 924 ]
[ 4, 4 ]
[ "tmVar:p|SUB|D|79|F;HGVS:p.D79F;VariantGroup:0", "tmVar:p|SUB|D|79|F;HGVS:p.D79F;VariantGroup:0" ]
[ "ProteinMutation", "ProteinMutation" ]
20340137
0
Allelic imbalance of expression and epigenetic regulation within the alpha-synuclein wild-type and p.Ala53Thr alleles in Parkinson disease.
null
title
[ 3, 4, 5 ]
[ "alpha-synuclein", "p.Ala53Thr", "Parkinson disease" ]
[ 69, 99, 121 ]
[ 15, 10, 17 ]
[ "6622", "tmVar:p|SUB|A|53|T;HGVS:p.A53T;VariantGroup:0;CorrespondingGene:6622;RS#:104893877;CorrespondingSpecies:9606;CA#:257068", "MESH:D010300" ]
[ "Gene", "ProteinMutation", "Disease" ]
20340137
140
Genetic alterations in the alpha-synuclein (SNCA) gene have been implicated in Parkinson Disease (PD), including point mutations, gene multiplications, and sequence variations within the promoter. Such alterations may be involved in pathology through structural changes or overexpression of the protein leading to protein aggregation, as well as through impaired gene expression. It is, therefore, of importance to specify the parameters that regulate SNCA expression in its normal and mutated state. We studied the expression of SNCA alleles in a lymphoblastoid cell line and in the blood cells of a patient heterozygous for p.Ala53Thr, the first mutation to be implicated in PD pathogenesis. Here, we provide evidence that: (1) SNCA shows monoallelic expression in this patient, (2) epigenetic silencing of the mutated allele involves histone modifications but not DNA methylation, and (3) steady-state mRNA levels deriving from the normal SNCA allele in this patient exceed those of the two normal SNCA alleles combined, in matching, control individuals. An imbalanced SNCA expression in this patient is thus documented, with silencing of the p.Ala53Thr allele and upregulation of the wild-type-allele. This phenomenon is demonstrated for a first time in the SNCA gene, and may have important implications for PD pathogenesis.
null
abstract
[ 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 ]
[ "alpha-synuclein", "SNCA", "Parkinson Disease", "PD", "SNCA", "SNCA", "patient", "p.Ala53Thr", "PD", "SNCA", "patient", "SNCA", "patient", "SNCA", "SNCA", "patient", "p.Ala53Thr", "SNCA", "PD" ]
[ 167, 184, 219, 238, 592, 670, 741, 766, 817, 870, 912, 1082, 1102, 1141, 1212, 1236, 1286, 1402, 1453 ]
[ 15, 4, 17, 2, 4, 4, 7, 10, 2, 4, 7, 4, 7, 4, 4, 7, 10, 4, 2 ]
[ "6622", "6622", "MESH:D010300", "MESH:D010300", "6622", "6622", "9606", "tmVar:p|SUB|A|53|T;HGVS:p.A53T;VariantGroup:0;CorrespondingGene:6622;RS#:104893877;CorrespondingSpecies:9606;CA#:257068", "MESH:D010300", "6622", "9606", "6622", "9606", "6622", "6622", "9606", "tmVar:p|SUB|A|53...
[ "Gene", "Gene", "Disease", "Disease", "Gene", "Gene", "Species", "ProteinMutation", "Disease", "Gene", "Species", "Gene", "Species", "Gene", "Gene", "Species", "ProteinMutation", "Gene", "Disease" ]
20340139
106
There are 35 missense mutations among 68 different mutations in the TPP1 gene, which encodes tripeptidyl peptidase I (TPPI), a lysosomal aminopeptidase associated with classic late-infantile neuronal ceroid lipofuscinosis (CLN2 disease). To elucidate the molecular mechanisms underlying TPPI deficiency in patients carrying missense mutations and to test the amenability of mutant proteins to chemical chaperones and permissive temperature treatment, we introduced individually 14 disease-associated missense mutations into human TPP1 cDNA and analyzed the cell biology of these TPPI variants expressed in Chinese hamster ovary cells. Most TPPI variants displayed obstructed transport to the lysosomes, prolonged half-life of the proenzyme, and residual or no enzymatic activity, indicating folding abnormalities. Protein misfolding was produced by mutations located in both the prosegment (p.Gly77Arg) and throughout the length of the mature enzyme. However, the routes of removal of misfolded proteins by the cells varied, ranging from their efficient degradation by the ubiquitin/proteasome system to abundant secretion. Two TPPI variants demonstrated enhanced processing in response to folding improvement treatment, and the activity of one of them, p.Arg447His, showed a fivefold increase under permissive temperature conditions, which suggests that folding improvement strategies may ameliorate the function of some misfolding TPPI mutant proteins.
null
abstract
[ 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 ]
[ "TPP1", "tripeptidyl peptidase I", "TPPI", "late-infantile neuronal ceroid lipofuscinosis", "CLN2 disease", "TPPI deficiency", "patients", "human", "TPP1", "TPPI", "Chinese hamster ovary", "TPPI", "p.Gly77Arg", "TPPI", "p.Arg447His", "TPPI" ]
[ 174, 199, 224, 282, 329, 393, 412, 630, 636, 685, 712, 746, 997, 1234, 1360, 1539 ]
[ 4, 23, 4, 45, 12, 15, 8, 5, 4, 4, 21, 4, 10, 4, 11, 4 ]
[ "1200", "1200", "1200", "MESH:D009472", "MESH:C566857", "MESH:D006969", "9606", "9606", "1200", "1200", "CVCL:0213", "1200", "tmVar:p|SUB|G|77|R;HGVS:p.G77R;VariantGroup:0;CorrespondingGene:1200;RS#:121908195;CorrespondingSpecies:9606;CA#:266187", "1200", "tmVar:p|SUB|R|447|H;HGVS:p.R447...
[ "Gene", "Gene", "Gene", "Disease", "Disease", "Disease", "Species", "Species", "Gene", "Gene", "CellLine", "Gene", "ProteinMutation", "Gene", "ProteinMutation", "Gene" ]
20349493
82
The two homologous proteins ribonuclease A and onconase fold through conserved initial contacts but differ significantly in their thermodynamic stability. A disulfide bond is located in the folding initiation site of onconase (the C-terminal part of the protein molecule) that is missing in ribonuclease A, whereas the other three disulfide bonds of onconase are conserved in ribonuclease A. Consequently, the deletion of this C-terminal disulfide bond (C87-C104) allows the impact of the contacts in this region on the folding of onconase to be studied. We found the C87A/C104A-onconase variant to be less active and less stable than the wild-type protein, whereas the tertiary structure, which was determined by both X-ray crystallography and NMR spectroscopy, was only marginally affected. The folding kinetics of the variant, however, were found to be changed considerably in comparison to wild-type onconase. Proton exchange experiments in combination with two-dimensional NMR spectroscopy revealed differences in the native-state dynamics of the two proteins in the folding initiation site, which are held responsible for the changed folding mechanism. Likewise, the molecular dynamics simulation of the unfolding reaction indicated disparities for both proteins. Our results show that the high stability of onconase is based on the efficient stabilization of the folding initiation site by the C-terminal disulfide bond. The formation of the on-pathway intermediate, which is detectable during the folding of the wild-type protein and promotes the fast and efficient refolding reaction, requires the presence of this covalent bond.
null
abstract
[ 9, 10, 11, 12, 13, 14, 15 ]
[ "disulfide", "disulfide", "disulfide", "C104", "C87A", "C104A", "disulfide" ]
[ 239, 413, 520, 540, 650, 655, 1494 ]
[ 9, 9, 9, 4, 4, 5, 9 ]
[ "MESH:D004220", "MESH:D004220", "MESH:D004220", "tmVar:c|Allele|C|104;VariantGroup:0", "tmVar:c|SUB|C|87|A;HGVS:c.87C>A;VariantGroup:1", "tmVar:c|SUB|C|104|A;HGVS:c.104C>A;VariantGroup:0", "MESH:D004220" ]
[ "Chemical", "Chemical", "Chemical", "DNAMutation", "DNAMutation", "DNAMutation", "Chemical" ]
20349607
111
CD52 is a small glycopeptide leukocyte antigen present on selected subpopulations of human cells. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. Recently, two variants of CD52--rs1071849 (A119G; Asn40Ser) and rs17645 (A123G; I1e41Met)--were discovered. We now report on the distribution of these variants in kidney graft recipients and controls. Our bioinformatics findings suggest that CD52 polymorphism may affect the efficiency of GPI anchor formation and thus may indirectly alter the response to anti-CD52 agents.
null
abstract
[ 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 ]
[ "CD52", "human", "hematological malignancies", "CD52", "rs1071849", "A119G", "Asn40Ser", "rs17645", "A123G", "CD52", "CD52" ]
[ 111, 196, 339, 431, 437, 448, 455, 469, 478, 647, 766 ]
[ 4, 5, 26, 4, 9, 5, 8, 7, 5, 4, 4 ]
[ "1043", "9606", "MESH:D019337", "1043", "tmVar:rs1071849;VariantGroup:0;CorrespondingGene:1043;RS#:1071849;CorrespondingSpecies:9606", "tmVar:c|SUB|A|119|G;HGVS:c.119A>G;VariantGroup:0;CorrespondingGene:1043;RS#:1071849;CorrespondingSpecies:9606;CA#:703354", "tmVar:p|SUB|N|40|S;HGVS:p.N40S;VariantGroup:...
[ "Gene", "Species", "Disease", "Gene", "SNP", "DNAMutation", "ProteinMutation", "SNP", "DNAMutation", "Gene", "Gene" ]
20349940
89
In addition to the four known stylissamides, A (1), B (2), C, and D, two new cyclic heptapeptides, stylissamides E (3) and F (4), were isolated from the Caribbean sponge Stylissa caribica. The structures of 3 and 4 were elucidated from a combination of mass spectrometric and NMR spectroscopic data as cyclo-(cis-Pro(1)-Tyr(2)-trans-Pro(3)-Ala(4)-Ile(5)-Gln(6)-Ile(7)) for stylissamide E (3) and cyclo-(trans-Pro(1)-cis-Pro(2)-Phe(3)-Asp(4)-trans-Pro(5)-Arg(6)-Phe(7)) for stylissamide F (4).
null
abstract
[ 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 ]
[ "stylissamides", "A (1), B (2), C, and D", "cyclic heptapeptides", "stylissamides E (3) and F (4)", "sponge", "Stylissa caribica", "Pro(1)-Tyr", "Pro(3)-Ala", "Ile(5)-Gln", "stylissamide E", "Pro(2)-Phe", "Pro(5)-Arg", "stylissamide F (4)" ]
[ 119, 134, 166, 188, 252, 259, 402, 422, 436, 462, 509, 536, 562 ]
[ 13, 22, 20, 29, 6, 17, 10, 10, 10, 14, 10, 10, 18 ]
[ "-", "-", "-", "-", null, null, "tmVar:p|SUB|P||Y;VariantGroup:4", "tmVar:p|SUB|P||A;VariantGroup:2", "tmVar:p|SUB|I||Q;VariantGroup:1", "MESH:C549728", "tmVar:p|SUB|P|2|F;HGVS:p.P2F;VariantGroup:0", "tmVar:p|SUB|P||R;VariantGroup:3", "-" ]
[ "Chemical", "Chemical", "Chemical", "Chemical", "Species", "Species", "ProteinMutation", "ProteinMutation", "ProteinMutation", "Chemical", "ProteinMutation", "ProteinMutation", "Chemical" ]
20349984
150
The molecular pathway of enrofloxacin, a fluoroquinolone antibiotic, through the outer membrane channel OmpF of Escherichia coli is investigated. High-resolution ion current fluctuation analysis reveals a strong affinity for enrofloxacin to OmpF, the highest value ever recorded for an antibiotic-channel interaction. A single point mutation in the constriction zone of OmpF, replacing aspartic acid at the 113 position with asparagine (D113N), lowers the affinity to a level comparable to other antibiotics. All-atom molecular dynamics simulations allow rationalizing the translocation pathways: wild-type OmpF has two symmetric binding sites for enrofloxacin located at each channel entry separated by a large energy barrier in the center, which inhibits antibiotic translocation. In this particular case, our simulations suggest that the ion current blockages are caused by molecules occupying either one of these peripheral binding sites. Removal of the negative charge on position 113 removes the central barrier and shifts the two peripheral binding sites to a unique central site, which facilitates translocation. Fluorescence steady-state measurements agree with the different location of binding sites for wild-type OmpF and the mutant. Our results demonstrate how a single-point mutation of the porin, and the resulting intrachannel shift of the affinity site, may substantially modify translocation.
null
abstract
[ 11, 12, 13, 14, 15, 16, 17 ]
[ "enrofloxacin", "fluoroquinolone", "Escherichia coli", "enrofloxacin", "aspartic acid at the 113 position", "D113N", "enrofloxacin" ]
[ 175, 191, 262, 375, 536, 587, 798 ]
[ 12, 15, 16, 12, 33, 5, 12 ]
[ "MESH:D000077422", "MESH:D024841", "562", "MESH:D000077422", "tmVar:p|Allele|D|113;VariantGroup:0", "tmVar:p|SUB|D|113|N;HGVS:p.D113N;VariantGroup:0", "MESH:D000077422" ]
[ "Chemical", "Chemical", "Species", "Chemical", "ProteinMutation", "ProteinMutation", "Chemical" ]
20350135
98
AIMS: Genetic contributions to nicotine dependence have been demonstrated repeatedly, but the relevance of individual polymorphisms for smoking cessation remains controversial. MATERIALS & METHODS: We examined genotypes at two dopamine-related loci, DRD2/ANKK1 (rs1800497) and DBH (rs77905), in 577 heavy smokers participating in a prospective study of smoking cessation in general care in Germany. RESULTS: Smoking status after 1 year was significantly associated with DRD2/ANKK1, odds of abstinence being 4.4-fold (95% CI: 1.5-12.9) increased in TT- versus CC-homozygous subjects (p = 0.008). No effect was observed for the DBH genotype. The smoking cessation drug bupropion appeared to be particularly effective in CC-homozygotes (among CC subjects there was a 28% higher cessation probability among those taking buproprion; among T carrier subjects there was an increase only by 12%). CONCLUSION: The large effects observed for DRD2/ANKK1 might be related to our study design, in which individual therapy was decided by the physician. Further studies are needed to clarify the genetic effects of DRD2/ANKK1 especially in 'real-life' settings outside clinical trials.
null
abstract
[ 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 ]
[ "nicotine dependence", "dopamine", "DRD2", "ANKK1", "rs1800497", "DBH", "rs77905", "DRD2", "ANKK1", "DBH", "bupropion", "buproprion", "DRD2", "ANKK1", "DRD2", "ANKK1" ]
[ 129, 325, 348, 353, 360, 375, 380, 568, 573, 724, 765, 914, 1030, 1035, 1198, 1203 ]
[ 19, 8, 4, 5, 9, 3, 7, 4, 5, 3, 9, 10, 4, 5, 4, 5 ]
[ "MESH:D014029", "MESH:D004298", "1813", "255239", "tmVar:rs1800497;VariantGroup:1;CorrespondingGene:255239;RS#:1800497;CorrespondingSpecies:9606", "1621", "tmVar:rs77905;VariantGroup:0;CorrespondingGene:1621;RS#:77905;CorrespondingSpecies:9606", "1813", "255239", "1621", "MESH:D016642", "-", ...
[ "Disease", "Chemical", "Gene", "Gene", "SNP", "Gene", "SNP", "Gene", "Gene", "Gene", "Chemical", "Chemical", "Gene", "Gene", "Gene", "Gene" ]
20350212
137
AIM: The t(14;18)(q32;q21) chromosomal translocation induces BCL2 protein expression in most follicular lymphomas. However, a small number of cases lack BCL2 expression despite carrying the t(14;18)(q32;q21) translocation. This study aims to explore the mechanism accounting for the lack of BCL2 protein expression when the t(14;18) translocation is present. METHODS: BCL2 expression in the t(14;18) positive cell lines FL18, Karpas-422, SU-DHL-4 and SU-DHL-6, was analysed by Western blotting and by immunohistochemistry using two different antibodies. FISH analysis was performed to confirm the cytogenetic changes in the cell lines and real time quantitative PCR was used to evaluate the BCL2 mRNA level. Sequence analysis of translocated BCL2 was performed on FL18, Karpas-422, SU-DHL-4 and SU-DHL-6 cell lines. RESULTS: In FL18, Karpas-422, and SU-DHL-4, the BCL2 mRNA level correlated with the BCL2 protein expression. In contrast, BCL2 protein was not detected in SU-DHL-6 line using standard anti-BCL2 antibody (BCL2/124), despite the presence of the t(14;18) translocation and high level of mRNA. cDNA sequencing of translocated BCL2 showed three mutations in the SU-DHL-6 cell line, one of which resulted in an amino acid substitution (I48F) in the region recognised by the standard BCL2 antibody, whereas the other two were silent mutations at aa71 and aa72. Interestingly, when BCL2 expression was tested with an alternative antibody, E17, the protein was detected in SU-DHL-6, suggesting that the 'negativity' of SU-DHL-6 line for BCL2 using the standard antibody is spurious. Amino acid changes were found in Karpas-422 (G47D, P59L) and SU-DHL-4 (P59T, S117R) but these did not affect BCL2 detection. CONCLUSIONS: This study suggests that some somatic mutations of the translocated BCL2 gene may prevent epitope recognition by BCL2 antibodies, and hence cause false negative expression using the standard antibody. It is recommended that in practice all BCL2 negative cases should routinely be stained with an alternative antibody to prevent false negativity.
null
abstract
[ 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 ]
[ "BCL2", "follicular lymphomas", "BCL2", "BCL2", "BCL2", "FL18", "Karpas-422", "SU-DHL-4", "SU-DHL-6", "BCL2", "BCL2", "FL18", "Karpas-422", "SU-DHL-4", "SU-DHL-6", "FL18", "Karpas-422", "SU-DHL-4", "BCL2", "BCL2", "BCL2", "SU-DHL-6", "BCL2", "BCL2", "BCL2", "SU-DHL-...
[ 198, 230, 290, 428, 505, 557, 563, 575, 588, 828, 879, 901, 907, 919, 932, 965, 971, 987, 1001, 1037, 1075, 1108, 1142, 1157, 1275, 1310, 1383, 1430, 1527, 1617, 1663, 1681, 1772, 1778, 1798, 1804, 1836, 1933, 1978, 2105 ]
[ 4, 20, 4, 4, 4, 4, 10, 8, 8, 4, 4, 4, 10, 8, 8, 4, 10, 8, 4, 4, 4, 8, 4, 4, 4, 8, 4, 4, 4, 8, 8, 4, 4, 4, 4, 5, 4, 4, 4, 4 ]
[ "596", "MESH:D008224", "596", "596", "596", "CVCL:8093", "CVCL:1325", "CVCL:0539", "CVCL:2206", "596", "596", "CVCL:8093", "CVCL:1325", "CVCL:0539", "CVCL:2206", "CVCL:8093", "CVCL:1325", "CVCL:0539", "596", "596", "596", "CVCL:2206", "596", "596", "596", "CVCL:2206...
[ "Gene", "Disease", "Gene", "Gene", "Gene", "CellLine", "CellLine", "CellLine", "CellLine", "Gene", "Gene", "CellLine", "CellLine", "CellLine", "CellLine", "CellLine", "CellLine", "CellLine", "Gene", "Gene", "Gene", "CellLine", "Gene", "Gene", "Gene", "CellLine", "...