diff --git a/.gitattributes b/.gitattributes index 1ef325f1b111266a6b26e0196871bd78baa8c2f3..1e0f4db0c11bb4b389dbc84a9cfb73eac6d0e887 100644 --- a/.gitattributes +++ b/.gitattributes @@ -1,59 +1 @@ -*.7z filter=lfs diff=lfs merge=lfs -text -*.arrow filter=lfs diff=lfs merge=lfs -text -*.bin filter=lfs diff=lfs merge=lfs -text -*.bz2 filter=lfs diff=lfs merge=lfs -text -*.ckpt filter=lfs diff=lfs merge=lfs -text -*.ftz filter=lfs diff=lfs merge=lfs -text -*.gz filter=lfs diff=lfs merge=lfs -text -*.h5 filter=lfs diff=lfs merge=lfs -text -*.joblib filter=lfs diff=lfs merge=lfs -text -*.lfs.* filter=lfs diff=lfs merge=lfs -text -*.lz4 filter=lfs diff=lfs merge=lfs -text -*.mds filter=lfs diff=lfs merge=lfs -text -*.mlmodel filter=lfs diff=lfs merge=lfs -text -*.model filter=lfs diff=lfs merge=lfs -text -*.msgpack filter=lfs diff=lfs merge=lfs -text -*.npy filter=lfs diff=lfs merge=lfs -text -*.npz filter=lfs diff=lfs merge=lfs -text -*.onnx filter=lfs diff=lfs merge=lfs -text -*.ot filter=lfs diff=lfs merge=lfs -text -*.parquet filter=lfs diff=lfs merge=lfs -text -*.pb filter=lfs diff=lfs merge=lfs -text -*.pickle filter=lfs diff=lfs merge=lfs -text -*.pkl filter=lfs diff=lfs merge=lfs -text -*.pt filter=lfs diff=lfs merge=lfs -text -*.pth filter=lfs diff=lfs merge=lfs -text -*.rar filter=lfs diff=lfs merge=lfs -text -*.safetensors filter=lfs diff=lfs merge=lfs -text -saved_model/**/* filter=lfs diff=lfs merge=lfs -text -*.tar.* filter=lfs diff=lfs merge=lfs -text -*.tar filter=lfs diff=lfs merge=lfs -text -*.tflite filter=lfs diff=lfs merge=lfs -text -*.tgz filter=lfs diff=lfs merge=lfs -text -*.wasm filter=lfs diff=lfs merge=lfs -text -*.xz filter=lfs diff=lfs merge=lfs -text -*.zip filter=lfs diff=lfs merge=lfs -text -*.zst filter=lfs diff=lfs merge=lfs -text -*tfevents* filter=lfs diff=lfs merge=lfs -text -# Audio files - uncompressed -*.pcm filter=lfs diff=lfs merge=lfs -text -*.sam filter=lfs diff=lfs merge=lfs -text -*.raw filter=lfs diff=lfs merge=lfs -text -# Audio files - compressed -*.aac filter=lfs diff=lfs merge=lfs -text -*.flac filter=lfs diff=lfs merge=lfs -text -*.mp3 filter=lfs diff=lfs merge=lfs -text -*.ogg filter=lfs diff=lfs merge=lfs -text -*.wav filter=lfs diff=lfs merge=lfs -text -# Image files - uncompressed -*.bmp filter=lfs diff=lfs merge=lfs -text -*.gif filter=lfs diff=lfs merge=lfs -text -*.png filter=lfs diff=lfs merge=lfs -text -*.tiff filter=lfs diff=lfs merge=lfs -text -# Image files - compressed -*.jpg filter=lfs diff=lfs merge=lfs -text -*.jpeg filter=lfs diff=lfs merge=lfs -text -*.webp filter=lfs diff=lfs merge=lfs -text -# Video files - compressed -*.mp4 filter=lfs diff=lfs merge=lfs -text -*.webm filter=lfs diff=lfs merge=lfs -text +* filter=lfs diff=lfs merge=lfs -text diff --git a/.gitignore b/.gitignore new file mode 100644 index 0000000000000000000000000000000000000000..d430a05d6b9ebc3c6d52133d585a44d837be1a21 --- /dev/null +++ b/.gitignore @@ -0,0 +1,2 @@ +.vscode +howtopush.txt \ No newline at end of file diff --git a/converter.py b/converter.py new file mode 100644 index 0000000000000000000000000000000000000000..2864677a6b9102a4e39b2ecbc73979b4d421f9d3 --- /dev/null +++ b/converter.py @@ -0,0 +1,50 @@ +import os +import ffmpeg + +def convert_to_mp4(input_dir='./video'): + """ + Convert all .mkv and .webm videos in input_dir to .mp4 using FFmpeg. + Skip files that are already .mp4 or where the target .mp4 already exists. + Originals are kept. + """ + for fname in os.listdir(input_dir): + base, ext = os.path.splitext(fname) + ext = ext.lower() + + # skip anything already .mp4 + if ext == '.mp4': + continue + + # only convert mkv/webm + if ext in {'.mkv', '.webm'}: + in_path = os.path.join(input_dir, fname) + out_path = os.path.join(input_dir, base + '.mp4') + + if os.path.exists(out_path): + print(f"→ Skipping {fname}: {base}.mp4 already exists") + continue + + print(f"→ Converting {fname} → {base}.mp4") + try: + ( + ffmpeg + .input(in_path) + .output( + out_path, + vcodec='libx264', # H.264 video + preset='medium', # speed/quality tradeoff + crf=23, # quality (lower is better) + acodec='aac', # AAC audio + audio_bitrate='128k' + ) + .overwrite_output() + .run(quiet=False) + ) + except ffmpeg.Error as e: + print(f"Error converting {fname}:\n{e.stderr.decode()}") + + else: + print(f"→ Skipping {fname}: unsupported extension {ext}") + +if __name__ == '__main__': + convert_to_mp4('./video') diff --git a/minerva.json b/minerva.json new file mode 100644 index 0000000000000000000000000000000000000000..b1c8de555a819c3b43587d5ff6181480a7446e76 --- /dev/null +++ b/minerva.json @@ -0,0 +1,23570 @@ +[ + { + "key": "--C26cvIFdY:07d644e47f0fb60f7aa738e2e85bc7da406bf48d", + "video_id": "--C26cvIFdY", + "question": "What sequence of events occur to put Hawaii up 24 to 13 against UC Irvine?", + "answer_choice_0": "#4 in white dribbles the ball down court then passes it to #10 in white who dunks the ball.", + "answer_choice_1": "#0 in white inbounds the ball to #4 in white who then makes an immediate fadeaway.", + "answer_choice_2": "#4 in white gets the rebound and passes it to #0 in white who then makes a 3 point shot.", + "answer_choice_3": "#4 in white steals the ball and dribbles down court before making a dunk.", + "answer_choice_4": "#10 in white steals the ball and passes it to #4 in white who makes a layup.", + "answer_id": 2, + "answer": "#4 in white gets the rebound and passes it to #0 in white who then makes a 3 point shot.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I observed the score of the games between Hawaii and UC and Irvine and looked for a moment when the score became 24 to 13. I found this moment when #0 in white makes a 3 point shot at 01:08. Then, I read the scoreboard and added 3 to Hawaii's score of 21, calculating that the bucket puts them up 24 to 13. I then went back to the beginning of the clip at 01:39. I observed #4 in white get the rebound, then pass it to #0 in white, who makes the 3 pointer." + }, + { + "key": "--C26cvIFdY:23c6625af4efac831acd0f7e37a70ab6f811b113", + "video_id": "--C26cvIFdY", + "question": "How many three-pointers are made before the second clip of Hawaii versus UCSB?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "0.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for the first USCB clip, which shows up from 00:04 to 00:08. I knew it to be so because the names \"USCB\" and \"HAWAII\" are written on the bar graphic at the bottom of the screen. Then I notice the second clip against UCSB happens from 00:33 to 00:37 (identified by the same logic as I identified by the first). I then looked at every clip prior to this timeframe and looked for three-pointers. I found 1 at 00:07, another at 00:20, and another at 00:33. Counting these up, I found 3 three-pointers made prior to the second clip of Hawaii vs. USCB." + }, + { + "key": "--C26cvIFdY:35832d1a93041292a5a6a222bcac0a134ff12165", + "video_id": "--C26cvIFdY", + "question": "How many players with black jerseys are inside the three-point arc when the ball bounces off the rim at 03:09 during CS Fullerton versus Hawaii?", + "answer_choice_0": "5.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "6.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "2.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I locate the section of the video featuring CS Fullerton versus Hawaii at 3:09. I locate the ball in question as a player in black throws the ball at the hoop, and she misses the shot. The ball bounces off the rim and is then rebounded by a player in white at 03:11. There are 2 players in black jerseys during this time." + }, + { + "key": "--C26cvIFdY:4100bc592127dc02c191c7aa9500dedfc43c9380", + "video_id": "--C26cvIFdY", + "question": "Where is the fourth game played?", + "answer_choice_0": "Hawaii.", + "answer_choice_1": "UCSB.", + "answer_choice_2": "Texas.", + "answer_choice_3": "UC Riverside.", + "answer_choice_4": "CS Fullerton.", + "answer_id": 4, + "answer": "CS Fullerton.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "First, I watched a clip from a game between 00:04-00:08 between UCSB and Hawaii. I saw that the clips from the next game featured Hawaii and Cal Poly between 00:09-00:33. I observed the next game between Hawaii and UCSB occur between 00:34-00:42. At 00:42, I read on the black banner the words, \"3 pointer against Cal state Fullerton\" And determined that this was the fourth game featuring Hawaii against an opponent. I observed the orange and navy colors of Cal State Fullerton on the basketball court, as well as the name of the school. I determined that the fourth game takes places at CS Fullerton." + }, + { + "key": "--C26cvIFdY:475fe92590230712b6a659fb43f6a147d83c184a", + "video_id": "--C26cvIFdY", + "question": "How many points would Hawaii have if Reier's assist against UC Davis led to a two-pointer instead of a three pointer?", + "answer_choice_0": "20.", + "answer_choice_1": "43.", + "answer_choice_2": "18.", + "answer_choice_3": "26.", + "answer_choice_4": "46.", + "answer_id": 0, + "answer": "20.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "First, I looked for the assist against UC Davis. I found three UC Davis clips from 00:53 to 01:13, but only 00:53 to 00:59 shows Reier offering an assist to her teammate -- \"ASSIST - AGAINST UC DAVIS\" is also written at the bottom right side of the screen here, so I knew it to be the correct clip. I knew Reier to be the one offering the assist since the narrator says, \"Reier jukes a defender out of the way,\" at the same time the girl offering the assist jukes her defender. So I have found Reier offering her assist against UC Davis. I looked for the score and found it in a banner in the bottom middle of the screen. It says that UC Davis has 26 points and Hawai'i has 18 points. Now, I knew that Reier and her teammate play for Hawaii because her teammate's jersey says \"Hawaii,\" and they wear the same jersey, and I knew that when Reier's teammate scores at 00:59, she scores a three-pointer because she stands outside the three-point line when she makes her shot. However, I imagined that if she scored a two-pointer instead, the score would have been UC Davis 26, Hawai'i 20, because 2+18=20. Therefore, if Reier's assist led to a two-pointer against UC Davis, Hawaii would have 20 points." + }, + { + "key": "--C26cvIFdY:7034b483ac7facb91d0d69ff63f026dc19a80864", + "video_id": "--C26cvIFdY", + "question": "How many fouls does Hawaii have against UCSB before a player makes a shot to put Hawaii ahead by 2?", + "answer_choice_0": "1.", + "answer_choice_1": "0.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 1, + "answer": "0.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for a game between Hawaii and UCSB. I found the first clip between 00:04-00:08 and read the names of both teams across the scoreboard. Furthermore, I observed #4 in white make a 3 point shot, but this still put Hawaii behind by 1 point. Then, I observed the next 2 clips of a game between Hawaii and UCSB between 00:33-00:42, but in both cases Hawaii was still losing. Next, I watched a clip from a game between Hawaii and UCSB between 01:20-01-26, but no bucket gets made. Between 01:27-01:33, I observed #4 in black make a 3 point shot. I calculated how this would add to Hawaii's lead by adding 3 to 19. I concluded that the new score was Hawaii 22, UCSB 20. Furthermore, I subtracted 20 from 22 and found that this play put Hawaii up by 2. I read the number of fouls during the play on the scoreboard and saw that it was 0. I did not observe any more clips from a game between Hawaii and UCSB." + }, + { + "key": "--C26cvIFdY:7764790c9eaf523edcebfcc6f58973bd2544762d", + "video_id": "--C26cvIFdY", + "question": "Where is the referee positioned when the ball is flying toward the hoop at 03:09?", + "answer_choice_0": "Standing on the sideline on the left", + "answer_choice_1": "Standing at the center of the court", + "answer_choice_2": "Jogging across the center of the court", + "answer_choice_3": "Walking along the sideline on the right", + "answer_choice_4": "Standing underneath the hoop on the right", + "answer_id": 0, + "answer": "Standing on the sideline on the left", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I found the 03:09 section of the video. I searched for the referee. I found him standing on the sideline on the left while the ball is flying toward the hoop." + }, + { + "key": "--C26cvIFdY:e0bcd021749350d7e536643edd65b76f1f3cae37", + "video_id": "--C26cvIFdY", + "question": "What beverage is advertised when #4 in black makes a 3 point shot to put Hawaii up 64 to 42 against UC Riverside?", + "answer_choice_0": "Dr. Pepper.", + "answer_choice_1": "Sprite.", + "answer_choice_2": "Pepsi.", + "answer_choice_3": "Coca-Cola.", + "answer_choice_4": "Diet Coke.", + "answer_id": 3, + "answer": "Coca-Cola.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for a moment when Hawaii's score increased to 64 to 42 against UC Riverside and found this at 03:33. #4 in black sinks a 3 pointer when the score is Hawaii 61, UC Riverside 42. I added 3 to Hawaii's score and got Hawaii 64, UC Riverside 42. I then looked for a beverage advertisement and read the words \"Coca-Cola\" on a sign behind the goal." + }, + { + "key": "--mHv6CeVbg:228a28b4dba07516a3516b9f1bec68e899472101", + "video_id": "--mHv6CeVbg", + "question": "How many people are shown in the bottom row of the moving graphic from 00:22 to 00:27?", + "answer_choice_0": "9.", + "answer_choice_1": "14.", + "answer_choice_2": "12.", + "answer_choice_3": "7.", + "answer_choice_4": "8.", + "answer_id": 3, + "answer": "7.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the part of the video the question specified, from 00:22 to 00:27. I isolated the bottom row of people in the moving graphic and counted from left to right. I found that there are 7 people." + }, + { + "key": "--mHv6CeVbg:23ad9a39604244fffbaa5c7758ece8ae05cdc5b9", + "video_id": "--mHv6CeVbg", + "question": "At the start of hand 2, what is the difference between the highest and lowest amount of cash held by a contestant?", + "answer_choice_0": "124,000.", + "answer_choice_1": "278,000.", + "answer_choice_2": "154,000.", + "answer_choice_3": "240,000.", + "answer_choice_4": "229,000.", + "answer_id": 3, + "answer": "240,000.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the start of hand 2 at 02:42, and waited for all of the player names and their cash holds to be visible onscreen - this occurred at 02:50, where I was able to read all of the player names and their cash numbers just below their names across the top of the screen. From this, I determined that the highest value onscreen was 278,000, and the lowest value was 38,000. I then did the equation 278,000-38,000=240,000, to determine that this was the difference between the highest and lowest cash amounts shown by players." + }, + { + "key": "--mHv6CeVbg:71f45fb8eaad8adcf3f3f4f87b57814dd2678497", + "video_id": "--mHv6CeVbg", + "question": "What two cards, including their suits, are Hawk Tuah holding as part of her 2-pair hand in hand three?", + "answer_choice_0": "King of Diamonds, Queen of Spades.", + "answer_choice_1": "King of Hearts, Queen of Clubs.", + "answer_choice_2": "King of Hearts, Queen of Spades.", + "answer_choice_3": "King of Diamonds, Queen of Clubs.", + "answer_choice_4": "King of Spades, Queen of Hearts.", + "answer_id": 2, + "answer": "King of Hearts, Queen of Spades.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened to the narrator introduce hand 3 at 04:28. Just after that time, at 04:30, I watched as Hawk Tuah's hand was displayed on the left side of the screen, to show a King of Hearts and Queen of Spades just above her name." + }, + { + "key": "--mHv6CeVbg:7868d4f19bff8b69e60de54de8341b5e267d26da", + "video_id": "--mHv6CeVbg", + "question": "After the winner of the final hand stands up, where is the next person who stands up located in relation to the winner?", + "answer_choice_0": "Across the table to their right.", + "answer_choice_1": "Directly behind them.", + "answer_choice_2": "To their right.", + "answer_choice_3": "To their left.", + "answer_choice_4": "Directly across the table.", + "answer_id": 3, + "answer": "To their left.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the winner of the final poker hand, Vegas Matt, standing at 07:18 while the AI narrator says that he won the hand. I then watched the video for the next person to stand up, which I saw at 07:20 as a woman stood and leaned forward over the table to gather poker chips. I noted this woman's location in relation to Vegas Matt - she was directly to his left at the table." + }, + { + "key": "--mHv6CeVbg:89e593a60bae98773d56bbc5a771db51248d48ea", + "video_id": "--mHv6CeVbg", + "question": "What is written on the shirt of the man sitting on the left of the woman with the blonde ponytail at the poker table?", + "answer_choice_0": "Mortimer.", + "answer_choice_1": "CPT.", + "answer_choice_2": "Richards.", + "answer_choice_3": "Fliff.", + "answer_choice_4": "Shredder.", + "answer_id": 4, + "answer": "Shredder.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "While watching the video, I noted the blonde ponytail woman is first shown at the poker table at 00:11. I then identified the man on her left, who is wearing a black graphic t-shirt with some blue text on it. At 00:11 the text was not fully legible, so I kept watching. At 00:12, however, the text was clear, and reads \"SHREDDER.\"" + }, + { + "key": "--mHv6CeVbg:9f7818d48260a0d998ac506f5c31aca3300c5439", + "video_id": "--mHv6CeVbg", + "question": "What would the final scores of Peterson and Mortimer be if combined?", + "answer_choice_0": "340,000.", + "answer_choice_1": "730,000.", + "answer_choice_2": "430,000.", + "answer_choice_3": "205,000.", + "answer_choice_4": "625,000.", + "answer_id": 0, + "answer": "340,000.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and paid attention to the superimposed graphic at the top of the screen that displayed the player's names and scores. I watched as they updated throughout the game and noted that the last time they did was at 08:24. I then stopped the video, and looked for Peterson and Mortimer's scores, respectively. I noted that Peterson had 50,000, and that Mortimer had 290,000. Combined this would be 340,000." + }, + { + "key": "--mHv6CeVbg:af73a259de499f0370dd96614c7adcec201b94b8", + "video_id": "--mHv6CeVbg", + "question": "When the narrator asks the viewer to let them know their opinion in the comments, how many cards of the heart suit are displayed in the graphics onscreen?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "6.", + "answer_id": 1, + "answer": "4.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened for the AI narrator of the video to ask the viewer to let them know their opinion in the comments, which occurred from 08:06-08:07. During this timespan, I counted how many cards of the heart suit I saw on the onscreen graphics - I noted a Jack of Hearts held by E. Klein based on his onscreen graphic on the left of the screen, and two more hearts, an Ace and a Four, held by Peterson lower down on the left side. I counted a fourth and final heart, a Nine, held by Mortimer in the bottom left corner of the screen, for a total of four hearts shown." + }, + { + "key": "--mHv6CeVbg:cceed22331f57246112b30451ace6a73fc0c5712", + "video_id": "--mHv6CeVbg", + "question": "What is the scenery when the blonde woman asks \"you get me?\"", + "answer_choice_0": "Many pedestrians on a street at night.", + "answer_choice_1": "Many pedestrians on a street at midday.", + "answer_choice_2": "Many cars on a street at midday.", + "answer_choice_3": "One pedestrian on a street at night.", + "answer_choice_4": "One pedestrian on a street at midday.", + "answer_id": 0, + "answer": "Many pedestrians on a street at night.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and waited for the blonde woman to ask \"you get me?\" Which she does, starting at 00:05. I then stopped the video and studied the scene around her. I noted that it was a busy street, full of passersby, and that it was night." + }, + { + "key": "--oWChJdE-o:1356a26f342c3797fea9827902f36611ceaf7bb5", + "video_id": "--oWChJdE-o", + "question": "What is the difference in the score right before the player scores at 00:50 - 00:52?", + "answer_choice_0": "9 points.", + "answer_choice_1": "1 point.", + "answer_choice_2": "5 points.", + "answer_choice_3": "3 points.", + "answer_choice_4": "7 points.", + "answer_id": 4, + "answer": "7 points.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:50 - 00:52, I found the player who scores. Right before that, at 00:49, I saw the scoreboard, with a score of 23-30. Then, I calculated 30-23=7. Therefore, the difference in the score right before the player scoers at 00:50 - 00:52 is 7 points." + }, + { + "key": "--oWChJdE-o:2b7425b171cebfa15ec8bd7f3b5ae648f251c9c3", + "video_id": "--oWChJdE-o", + "question": "What was the player's jersey number who made the last shot of the game?", + "answer_choice_0": "22.", + "answer_choice_1": "10.", + "answer_choice_2": "43.", + "answer_choice_3": "30.", + "answer_choice_4": "23.", + "answer_id": 3, + "answer": "30.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I went to the end of the video to find when the last shot was taken. At 01:15, I heard the announcer share that the game was over. Then, I went back and looked for a shot before that. At 01:11, the last shot was taken. Then, I looked at the jersey number of the player who was responsible for the shot. It was player 30. Therefore, the jersey number of the player who made the last shot in the game is 30." + }, + { + "key": "--oWChJdE-o:7e88803993a21241fd164a0d5995910471fec8f3", + "video_id": "--oWChJdE-o", + "question": "What call does the referee make at 01:03 - 01:04?", + "answer_choice_0": "Travel.", + "answer_choice_1": "Time-out.", + "answer_choice_2": "Block.", + "answer_choice_3": "Foul.", + "answer_choice_4": "Charge.", + "answer_id": 3, + "answer": "Foul.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 01:03, I saw a gray jersey player offensively dribble towards the basket as a defensive white jersey player fouled her in the middle of her shot. At 01:04, I heard the referee blow their whistle and raise a single arm in the air, gesturing a standard defensive player foul on the play. At the same time, I heard the voiceover announcer say that the ref called a foul. Therefore, the referee calls a foul at 01:03 - 01:04." + }, + { + "key": "--oWChJdE-o:a8f253da15be02025718210a1d5ca580267a2f60", + "video_id": "--oWChJdE-o", + "question": "What happens after the ball is passed to Player #22 at 00:27 - 00:28?", + "answer_choice_0": "She scores a 1-point free throw.", + "answer_choice_1": "She scores a 3-point half-court shot.", + "answer_choice_2": "She scores a 2-point layup.", + "answer_choice_3": "She scores a 3-point jump shot.", + "answer_choice_4": "She scores a 2-point jump shot.", + "answer_id": 2, + "answer": "She scores a 2-point layup.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:27, I found Player #22, identified by her gray jersey with the number \"22\". Next, I saw her receive a pass at 00:27 - 00:28. Then, at 00:28 - 00:30, I saw Player #22 dribble toward the basket and score a layup, which is 2 points. Therefore, after the ball is passed to Player #22 at 00:27 - 00:28, she scores a 2-point layup at 00:28 - 00:30." + }, + { + "key": "--oWChJdE-o:a9c6576c3e4b49eacbb29f20d1cfc837f2a7c785", + "video_id": "--oWChJdE-o", + "question": "How many baskets are made during the 00:22 - 01:00?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "0.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "Starting from 00:22, I determined the first basket was made at 00:29. The second basket was made at 00:44. The third basket was made at 00:52. Since no other baskets are made after 01:00, the answer is 3 baskets are made between 00:22 - 01:00." + }, + { + "key": "--oWChJdE-o:ba9dfafcffadf93bb74fcd0f57571689cae992c0", + "video_id": "--oWChJdE-o", + "question": "How does the \"State Champs!\" graphic change throughout the video?", + "answer_choice_0": "It pops away off-screen.", + "answer_choice_1": "It remains on-screen.", + "answer_choice_2": "It descends off-screen.", + "answer_choice_3": "It fades away off-screen.", + "answer_choice_4": "It ascends off-screen.", + "answer_id": 1, + "answer": "It remains on-screen.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:00, I found the \"State Champs!\" graphic in the top left corner. Then, from 00:00 - 01:22, I saw the graphic remain on-screen." + }, + { + "key": "--oWChJdE-o:cd982d769665e5a28ef1ca0e3cc3818eebe90136", + "video_id": "--oWChJdE-o", + "question": "How many words are in the winning team's name?", + "answer_choice_0": "0.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "3.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 01:18, I identified the winning team when I saw the final score of 48-38 between L'Anse Creuse North and St. Clair Shores Lakeview correspondingly. Since the former had the higher score, they were the winning team. Next, at 00:02, I found the team's full name, which read \"L'Anse Creuse North\". Then, I counted the number of words in the winning team's name, calculating a total of 3." + }, + { + "key": "--oWChJdE-o:d02e695c958cbf53f2104ea9af699a366e060ac9", + "video_id": "--oWChJdE-o", + "question": "Where is the basketball in relation to the referee between 1:06-1:07?", + "answer_choice_0": "Behind him and to his left", + "answer_choice_1": "Behind him and to his right", + "answer_choice_2": "In front of him and to his right", + "answer_choice_3": "In front of him and to his left", + "answer_choice_4": "Straight in front of him", + "answer_id": 2, + "answer": "In front of him and to his right", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched the video between 1:06-1:07. I identified the referee behind the player with the basketball and saw that she was in front of him and to his right." + }, + { + "key": "--oWChJdE-o:fd6d1c37b1fbe9b4937e22422880ef199a054590", + "video_id": "--oWChJdE-o", + "question": "What are the hand movements between 00:07-00:09 after the brunette jogs toward the girl standing alone?", + "answer_choice_0": "A threatening slap.", + "answer_choice_1": "A friendly hi-five.", + "answer_choice_2": "A team handshake.", + "answer_choice_3": "A defensive foul.", + "answer_choice_4": "A defensive stance.", + "answer_id": 2, + "answer": "A team handshake.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:07, I watched as the brunette jogged toward the girl standing alone. I noticed they were wearing the same gray uniform and were smiling as they interacted. I determined from their friendly banter, matching uniforms, and smiles that they were teammates. The intricate handshake at 00:07 - 00:09 is a display of camaraderie and unity before the game." + }, + { + "key": "--rEUC2Zwvs:3e5cdc0546611645b25331524fd8f7307f800855", + "video_id": "--rEUC2Zwvs", + "question": "Which rider wins the race?", + "answer_choice_0": "Red and blue helmets tie.", + "answer_choice_1": "Rider with yellow helmet.", + "answer_choice_2": "Rider with blue helmet.", + "answer_choice_3": "Rider with white helmet.", + "answer_choice_4": "Rider with red helmet.", + "answer_id": 3, + "answer": "Rider with white helmet.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "While watching the video, I located the point where the commentator announced it was the final round at the 01:19 mark, as the riders approached the finish line. I then saw the rider with the white helmet cross the finish line first at 01:21, and the commentator announced his name as he did so. The referee then held up the finish flag. Therefore, I concluded that the rider with the white helmet won the race." + }, + { + "key": "--rEUC2Zwvs:404ae84d544325bf04e462fa1bd05e2e3557beba", + "video_id": "--rEUC2Zwvs", + "question": "What place is the rider with the red helmet in at the end of the first turn?", + "answer_choice_0": "Second.", + "answer_choice_1": "Fifth.", + "answer_choice_2": "Third.", + "answer_choice_3": "Fourth.", + "answer_choice_4": "First.", + "answer_id": 3, + "answer": "Fourth.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video and looked for the first turn of the race. I observed this occurring from 00:25 to 00:38. At the end of this turn, I looked for the rider with the red helmet. I observed him to be in fourth place. Therefore, the answer is fourth." + }, + { + "key": "--rEUC2Zwvs:4bebaf04c83174a6431462820a7f03a8c76b3555", + "video_id": "--rEUC2Zwvs", + "question": "How many laps is the race?", + "answer_choice_0": "3 laps.", + "answer_choice_1": "4 laps.", + "answer_choice_2": "1 lap.", + "answer_choice_3": "5 laps.", + "answer_choice_4": "7 laps.", + "answer_id": 1, + "answer": "4 laps.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "While watching the video, I located the start and finish line. At 00:00, I identified it as a white line drawn on the ground, with two ropes stretched horizontally across the track. The riders were preparing for the race at this point. The race began at 00:23. I observed the riders complete the first lap. They crossed the finish line again at 00:39, which I counted as the second lap. At 00:53, they crossed the finish line a third time. I continued watching, and saw that they crossed again at 01:22, marking the fourth lap. Immediately after, a referee raised the finish flag, signaling the end of the race. Therefore, I concluded that the race consisted of 4 laps." + }, + { + "key": "--rEUC2Zwvs:559badb99ab68b0ea23547defe846d50e366653a", + "video_id": "--rEUC2Zwvs", + "question": "What words are written on the white awning above the crowd, pictured behind the starting line from 00:16 to 00:23?", + "answer_choice_0": "Brighton Eyewear.", + "answer_choice_1": "Sunshine Security.", + "answer_choice_2": "Hartford Banking.", + "answer_choice_3": "Bayside Cleaners.", + "answer_choice_4": "Eyewatch Security.", + "answer_id": 4, + "answer": "Eyewatch Security.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video from 00:16 to 00:23 and looked for the white awning over the crowd behind the starting line. When I located it, I read the words \"Eyewatch Security\" in large green letters." + }, + { + "key": "--rEUC2Zwvs:b2a854a92450708eadf040680fc5341a4429624e", + "video_id": "--rEUC2Zwvs", + "question": "After the commentator introduces the riders, in what direction do their images exit the frame?", + "answer_choice_0": "They remain still.", + "answer_choice_1": "Downwards.", + "answer_choice_2": "Rightwards.", + "answer_choice_3": "Leftwards.", + "answer_choice_4": "Upwards.", + "answer_id": 1, + "answer": "Downwards.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "While watching the video, I located the point where the commentator finished introducing the riders at 00:14. I then watched further to determine the direction the images moved. I saw them move and completely exit the frame between 00:14 and 00:15, moving straight down. Therefore, I concluded that the images' direction was downwards as they left the frame." + }, + { + "key": "--rEUC2Zwvs:cef8b298b41b83d3ff1d616ec0613acecce6f6bb", + "video_id": "--rEUC2Zwvs", + "question": "How many points does the second rider introduced by the commentator have before the race starts?", + "answer_choice_0": "4 points.", + "answer_choice_1": "5 points.", + "answer_choice_2": "3 points.", + "answer_choice_3": "2 points.", + "answer_choice_4": "1 point.", + "answer_id": 3, + "answer": "2 points.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "While watching the video, I located the riders' introductions. At 00:00, I saw four images representing each rider. I heard the commentator begin the introductions at 00:02, starting with Tom Brennan. A graphic box on the right side of the screen displayed his picture, name, and pre-race point total. At 0:05, I heard the commentator introduce the second rider, Jake Allen. I read his name beneath his image, along with his pre-race point total: 2 points. Therefore, I concluded that the second rider had 2 points before the race." + }, + { + "key": "--rEUC2Zwvs:e57fdd9916f4e42a7892b36e8f312437bcbe0118", + "video_id": "--rEUC2Zwvs", + "question": "What color is the hat of the leftmost racer pictured from 00:00 to 00:15?", + "answer_choice_0": "Blue.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Red.", + "answer_choice_3": "Yellow.", + "answer_choice_4": "Green.", + "answer_id": 3, + "answer": "Yellow.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video from 00:00 to 00:15 and looked for the leftmost racer pictured on screen. I located him and looked for his hat, which I observed to be yellow." + }, + { + "key": "--rEUC2Zwvs:f4c645013f767f155394b1b08028ceb2d53a6d6d", + "video_id": "--rEUC2Zwvs", + "question": "What does the rider in the white helmet do with the rider in the blue and red helmet after the race and replays are completed?", + "answer_choice_0": "They fist bump.", + "answer_choice_1": "They high-five.", + "answer_choice_2": "They wave.", + "answer_choice_3": "They drive away from each other.", + "answer_choice_4": "They get into a fight.", + "answer_id": 0, + "answer": "They fist bump.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video and specifically looked for the end of the race, which I observed at 01:21. There were then replays of the race until 1:38. From 01:38 to 01:43, I observed the rider with the white helmet and the rider with the red and blue helmet riding side by side after the race. From 01:38 to 01:39, I saw them fist bump." + }, + { + "key": "--w-FuLNttw:323d13bf43d9a3a0bc27a6ed278b15ef802e445d", + "video_id": "--w-FuLNttw", + "question": "When the banner graphic shows the second set of results, how many more points did the winning team have?", + "answer_choice_0": "17.", + "answer_choice_1": "18.", + "answer_choice_2": "15.", + "answer_choice_3": "16.", + "answer_choice_4": "19.", + "answer_id": 1, + "answer": "18.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I found and read the graphic at the bottom center of the screen at 00:02, which had a final score of 52-66 between Dayton and Fordham correspondingly. Since no other final score was listed before this, this was the first final score listed. Then, at 00:07, I saw the graphic change to the second final score listed, which was 63-81 between Xavier and Georgetown respectively. Since Georgetown's score of 81 was higher than Xavier's score of 63, Georgetown was the winning team. Then, I calculated the difference between the two scores, concluding that Georgetown scored 18 more points than Xavier to win the game." + }, + { + "key": "--w-FuLNttw:572085754a6c06b77f1f1c62bc0d94e962acef14", + "video_id": "--w-FuLNttw", + "question": "What is the significance of Aja Wilson's last shot attempt?", + "answer_choice_0": "She missed the shot because she was fouled.", + "answer_choice_1": "The game would have been tied if it went in.", + "answer_choice_2": "The Gamecocks would have won if it went in.", + "answer_choice_3": "She would have scored 10 points total if it went in.", + "answer_choice_4": "She shot from half-court at the last second.", + "answer_id": 1, + "answer": "The game would have been tied if it went in.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:30-00:40, I heard the announcer say that Aja Wilson was dominant all game for the Gamecocks as I saw a player make a shot. At 00:37, the player turned and walked away and I saw the number \"22\" and the word \"Wilson\" written on her back, indicating that Aja Wilson wears the number 22. Then, I watched this player's last shot attempt from 01:47-01:52. The shot was taken close to the basket and inside the 3-point line, so it is a 2-point attempt. At 01:53, I saw the final score, which would've been 62-62 if Aja Wilson had made her last shot. Therefore, the game would have been tied if the shot went in." + }, + { + "key": "--w-FuLNttw:aa42f7c59fca6fe2986fa689879907929b8ee1bb", + "video_id": "--w-FuLNttw", + "question": "During the first highlighted play shown in the video, how many times is the basketball dribbled before a shot is taken?", + "answer_choice_0": "8 times.", + "answer_choice_1": "3 times.", + "answer_choice_2": "2 times.", + "answer_choice_3": "4 times.", + "answer_choice_4": "5 times.", + "answer_id": 3, + "answer": "4 times.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched until I located the first highlighted play of the game, which began at 00:23. I observed a pink player with blonde hair dribble the ball at 00:23, 00:24, and twice at 00:25. Then I watched as the pink player with blonde hair passed the ball to a pink player with brown hair at 00:26. The pink player with brown hair then took a shot and made the basket at 00:28. Therefore, the basketball was dribbled 4 times before a shot was taken." + }, + { + "key": "--w-FuLNttw:fac53d508fd2ef65dfaa1d2311781aef097263a7", + "video_id": "--w-FuLNttw", + "question": "What color is the South Carolina team's uniform?", + "answer_choice_0": "Black.", + "answer_choice_1": "White.", + "answer_choice_2": "Pink.", + "answer_choice_3": "Blue.", + "answer_choice_4": "Teal.", + "answer_id": 1, + "answer": "White.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "First, I had to identify who the South Carolina basketball team was. I learned from the announcer at 00:02-00:17 that South Carolina played against Missouri. At 00:59, the announcer shares that the Missouri team had a scary moment due to one of their players getting hurt. I looked at the injured player's uniform color at 01:02 and noticed that it was pink. So, the Missouri team was in pink uniform. I looked at the other players' uniforms, and they were in white. Therefore, the color of the South Carolina team uniform is white." + }, + { + "key": "-0XB0BWhzNc:24ec4de9b24c77a4cdbe49467eae5d445c5e2895", + "video_id": "-0XB0BWhzNc", + "question": "What is the number on the back of the jersey of the man who makes the first 3 point shot of the video?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "00.", + "answer_choice_3": "27.", + "answer_choice_4": "14.", + "answer_id": 0, + "answer": "5.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched the video and looked for the first instance of a 3 point shot. From 00:01 to 00:03, I observed a man wearing a maroon basketball jersey successfully make a 3 point shot. I looked for the number on his back, and saw that it was 5." + }, + { + "key": "-0XB0BWhzNc:2ed411139af664b5a90a1083338ff366420ad4a3", + "video_id": "-0XB0BWhzNc", + "question": "What is the unique advantage Player 32 from Bristol Central has over the opposing team?", + "answer_choice_0": "He is the most popular player among both teams.", + "answer_choice_1": "He is the smartest player among both teams.", + "answer_choice_2": "He is the tallest player among both teams.", + "answer_choice_3": "He is the player that scores the most points.", + "answer_choice_4": "He is the fastest player among both teams.", + "answer_id": 2, + "answer": "He is the tallest player among both teams.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked at the video in its entirety to locate instances where Player 32 from Bristol Central scored points or blocked the opponents. At 00:21 he makes his first block, at 00:33 he scores his first point, at 00:54 and 01:01 he makes 2 more blocks, and at 01:30 he makes his first dunk. From looking at high angles shots of the basketball court, such as the one at 01:08, it is evident that Player 32 is the tallest player among both teams. This information helped me to conclude that Player 32's unique advantage is his height." + }, + { + "key": "-0XB0BWhzNc:64ffce0eb7aeda44b179fc952575f9eba8326710", + "video_id": "-0XB0BWhzNc", + "question": "During which quarter did Bristol Central take the lead for the first time by more than 3 points?", + "answer_choice_0": "Fourth quarter.", + "answer_choice_1": "Second quarter.", + "answer_choice_2": "First quarter.", + "answer_choice_3": "During Overtime.", + "answer_choice_4": "Third quarter.", + "answer_id": 2, + "answer": "First quarter.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked at the video from the beginning, paying close attention to the score bar at the bottom of the screen. The first instance when Bristol Central took the lead by more than 3 points happened at 00:19, where they had scored 12 points, taking the lead against the East Catholic team who had 7 points. I subtracted 12 minus 7, which equals 5. The quarter that was being played at the 00:19 timestamp was the first quarter." + }, + { + "key": "-0XB0BWhzNc:6b7acad79e042c3bb8e59e1ad84f2c689bcd2929", + "video_id": "-0XB0BWhzNc", + "question": "What play leads to Bristol Central's 46th point?", + "answer_choice_0": "A tip-in.", + "answer_choice_1": "A jump shot.", + "answer_choice_2": "A free throw.", + "answer_choice_3": "A layup.", + "answer_choice_4": "A dunk.", + "answer_id": 4, + "answer": "A dunk.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched the video and paid attention to the scoreboard. At 01:29 - 01:31, I observed their score rise 2 points from 44 to 46. I saw that this was because of a dunk that occurred just before that. Therefore, a dunk led to Bristol Central's 46th point." + }, + { + "key": "-0XB0BWhzNc:bc73119299c2ea9c64e526baa63cee489cadf528", + "video_id": "-0XB0BWhzNc", + "question": "Who scored the last points before the final buzzer on the third quarter?", + "answer_choice_0": "Player 5 from Bristol Central.", + "answer_choice_1": "Player 3 from Bristol Central.", + "answer_choice_2": "Player 17 from Bristol Central.", + "answer_choice_3": "Player 10 from Bristol Central.", + "answer_choice_4": "Player 11 from Bristol Central.", + "answer_id": 0, + "answer": "Player 5 from Bristol Central.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for the end of quarter three in the video which happened at 02:12. I then went back to see who scored the last points, and it was Player 5 from the Bristol Central team, who did a 3-pointer at 02:03." + }, + { + "key": "-0XB0BWhzNc:da1b5afee321da1cf40a6257cc8f8aee77640f39", + "video_id": "-0XB0BWhzNc", + "question": "Why is Bristol Central celebrating from 02:07 to 02:10?", + "answer_choice_0": "They made a 3 point shot.", + "answer_choice_1": "They won the game.", + "answer_choice_2": "They made a freethrow.", + "answer_choice_3": "They made a layup.", + "answer_choice_4": "They stole the ball.", + "answer_id": 0, + "answer": "They made a 3 point shot.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched the video and saw Bristol Central's reaction from 02:07 to 02:10. From 02:02 to 02:06, I observed a player make a 3 point shot at the buzzer. Therefore, they were cheering because they made a 3 point shot." + }, + { + "key": "-0XB0BWhzNc:e350fe6f6a4e87895cb37bc05336edce978879a9", + "video_id": "-0XB0BWhzNc", + "question": "What is the score at the end of the third quarter?", + "answer_choice_0": "55 to 40, Bristol Central leading.", + "answer_choice_1": "52 to 52, tied.", + "answer_choice_2": "55 to 40, East Catholic leading.", + "answer_choice_3": "64 to 32, Bristol Central leading.", + "answer_choice_4": "64 to 32, East Catholic leading.", + "answer_id": 0, + "answer": "55 to 40, Bristol Central leading.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I watched the video and looked for the third quarter buzzer. I observed this occuring from 02:02 to 02:06, when Bristol Central shoots a 3 pointer at the buzzer. At 02:07, I observed the digital scoreboard update to indicate that the score is 55 to 40, Bristol Central leading." + }, + { + "key": "-0ZosUeqDg0:28db5cc56bdd1085677ece0c54a22281d97cd24b", + "video_id": "-0ZosUeqDg0", + "question": "In the second replay of the black team's first scoring shot, what word is the referee skating on?", + "answer_choice_0": "Hues.", + "answer_choice_1": "Hugo's.", + "answer_choice_2": "Yugo's.", + "answer_choice_3": "Rydell.", + "answer_choice_4": "Wegos.", + "answer_id": 1, + "answer": "Hugo's.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I first searched for the black team's scoring shot by finding the time when the score of the black team displayed on the top of the screen changes from 0 to 1. This happens around 2:40 after the word \"GOAL\" is displayed at the top. I then waited for the second replay. The first one starts at 2:53 and the second one starts at 3:06 and is an overhead shot of the rink. Then I looked for the referee who I identified by his black and white striped shirt. I saw the advertisement he was skating over which is the word \"HUGO's\", so I tentatively assumed that answer (3) must be correct. To be sure, I watched further for more goals of the black team. The score another time around 4:10, but in none of the replays is the referee skating over a word. With that I am certain that answer (3) is correct." + }, + { + "key": "-0ZosUeqDg0:2a0a94b4e3f853b7db62cecdd997e0cba57bd7e6", + "video_id": "-0ZosUeqDg0", + "question": "What would the final score be if the player who shot at 4:53 successfully scored?", + "answer_choice_0": "2-1.", + "answer_choice_1": "3-0.", + "answer_choice_2": "2-2.", + "answer_choice_3": "2-0.", + "answer_choice_4": "3-2.", + "answer_id": 2, + "answer": "2-2.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I observed the player at 04:53 and identified him as a member of the red and white team, who currently has zero points to the black team's 2 points, according to the graphic at the top of the screen. If he had scored this goal, his team would have had 1 point. I watched until the end of the video to see if the red team scored a goal. At 05:31, the graphic at the top of the screen displayed a score celebration for the red and white team, showing that they had scored. If the player at 04:53 had scored, this would've made the final score 2-2, since neither team scored again by the end of the video." + }, + { + "key": "-0ZosUeqDg0:7c32e484088ef6d8c9d3103bbb7ba63e3ab51e96", + "video_id": "-0ZosUeqDg0", + "question": "How is the red and white goalkeeper positioned in front of the net at the end of the first period?", + "answer_choice_0": "Lying on the ice after blocking a shot.", + "answer_choice_1": "Kneeling on and blocking with his knees.", + "answer_choice_2": "Sprawled out, face down on the ice.", + "answer_choice_3": "Kneeling on all fours.", + "answer_choice_4": "Crouched and using his hockey stick to block.", + "answer_id": 1, + "answer": "Kneeling on and blocking with his knees.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I identified the black team's first score at 02:35, when the puck entered the net of the red and white team and the graphic at the top displayed \"Goal\" a few seconds later at 02:38. I identified the referee's location at 02:34 from his striped uniform; he stands to the right of the goalkeeper. I watched past the first replay, which is from 02:52 to 03:05, when the second replay begins. While watching the second replay, I searched for the referee, who skates around the word \"Hugo's\" at the top left of the screen from 03:07 to 03:13." + }, + { + "key": "-0ZosUeqDg0:d8330977bde896a74b3e6e2234f5f3b61d881778", + "video_id": "-0ZosUeqDg0", + "question": "After a player falls for the first time, how many times do the other players pass the puck before shooting at the goal?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "From the beginning, I watched the players carefully to see when a player falls unintentionally. I see that at 00:38, a player falls after being pushed. I observe the puck as a player steals it and skates away. He passes it once at 00:41. I continue to observe the puck. This player passes the puck at 00:42 to a player who immediately shoots at the goal. This totals 2 passes." + }, + { + "key": "-0ZosUeqDg0:fa89871b6b1daa7a46ff783419a9b572749656ca", + "video_id": "-0ZosUeqDg0", + "question": "When the announcer says, \"This is clearly a hook,\" why does the player who fell hit the puck again?", + "answer_choice_0": "To pass to his teammate.", + "answer_choice_1": "To hit the puck away from the defenders.", + "answer_choice_2": "To take a shot at the goal.", + "answer_choice_3": "To hit the puck away from the attackers.", + "answer_choice_4": "He hit the puck by accident.", + "answer_id": 0, + "answer": "To pass to his teammate.", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I listened carefully to the announcers until one of them said \"This is clearly a hook.\" This happens at 03:33. I observed the falling player carefully as he hit the puck on his way down. I continued watching the next clip, from 03:37 to 03:41, which shows the event from a higher angle and a slower speed, to determine his intention. As he falls, he swipes at the puck away from the goalkeeper, toward his teammate." + }, + { + "key": "-18ZO2Pda2A:1e6382c7e07ed7cefba8101ecd34f222782241c2", + "video_id": "-18ZO2Pda2A", + "question": "What notable event happens after the game concludes?", + "answer_choice_0": "The players get into a fight.", + "answer_choice_1": "Fans throw objects onto the ice rink.", + "answer_choice_2": "A section of the glass barrier crashes onto the rink.", + "answer_choice_3": "The players stand in a line and shake hands.", + "answer_choice_4": "A player makes a goal right after the buzzer.", + "answer_id": 0, + "answer": "The players get into a fight.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and looked for the conclusion of the game. This occurs at 02:40, when the timer on the scoreboard reads \"0.0\" and the game ends. For a couple of seconds, the players all skate around a bit, not doing anything in particular. At 02:42, in the bottom right corner of the frame, two players (one from each team) start to get into a fight. Other players and the referees all run to the fighting players to try to separate them, but a second fight breaks out between two players at 02:49. These fights continue until 03:01. So, the answer is that the players get into a fight." + }, + { + "key": "-18ZO2Pda2A:54d4345d678c2f3b7da83a91aceca116e0d62865", + "video_id": "-18ZO2Pda2A", + "question": "As the announcer explains that the player named Harper went \"high over Arvanitis\" to score his second goal of the game, what is on-screen?", + "answer_choice_0": "Players getting into a fight", + "answer_choice_1": "Audience members yelling and screaming", + "answer_choice_2": "The next play beginning", + "answer_choice_3": "A player sitting in the penalty box", + "answer_choice_4": "Players hugging and celebrating", + "answer_id": 3, + "answer": "A player sitting in the penalty box", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to find the moment when the announcer is talking about the player named Harper and how he scores his second goal of the game. I found this moment at 00:23, when \"Harper\" is identified as the player who scores \"his second of the game.\" Then, the announcer says that the goal he just scored was \"very similar to the first, he goes high over Arvanitis.\" As this sentence is spoken from 00:27-00:28, a player is shown sitting in the penalty box, where he had been sitting by himself. So, the answer is a player sitting in the penalty box." + }, + { + "key": "-18ZO2Pda2A:6e0560af70254134d232dc60d0e8f1122a19a0f9", + "video_id": "-18ZO2Pda2A", + "question": "What does the player named Skeoch do right after the end of the third period?", + "answer_choice_0": "Attacks a player with his stick.", + "answer_choice_1": "Trips another player.", + "answer_choice_2": "Smashes into the glass wall.", + "answer_choice_3": "Blocks a goal shot.", + "answer_choice_4": "Scores a goal.", + "answer_id": 0, + "answer": "Attacks a player with his stick.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to identify which player is Skeoch. I heard the announcer call his name at 02:46, and noticed that he has a number 44 on his white jersey (it is seen clearly at 02:59). I then went to see what he did at the end of the third period. I find it at 02:40, when the timer by the \"3rd\" text line on the scoreboard graphic counts down to zero. At this point, at 02:42, I see Skeoch at the bottom right side of the screen. He slides up and attacks a player in a green jersey with his stick. Therefore, the answer is that Skeoch attacks a player with his stick." + }, + { + "key": "-18ZO2Pda2A:9654a1fa819654d04119f27bd33b4aa115c7d1b5", + "video_id": "-18ZO2Pda2A", + "question": "For the first goal scored in the video, how many passes are there before player #11 shoots and scores?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "0.", + "answer_choice_4": "3.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to find when the first goal was scored in the video. At 00:00, a scoreboard is shown in the upper left corner. The scoreboard shows a zero for both teams, indicating that no score has occurred yet. As the video plays, player #22 for the team in white dribbles a puck down toward a goal. At 00:03, he passes the puck to his teammate, player #9. A moment later, player #9 passes the puck to another teammate, player #11. Player #11 then shoots and scores at 00:05. So, the answer is 2." + }, + { + "key": "-18ZO2Pda2A:adc65182aef2d97884f460854afba43d866d8466", + "video_id": "-18ZO2Pda2A", + "question": "How many unsuccessful shots are made by the Mariners during the game?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "12.", + "answer_choice_3": "9.", + "answer_choice_4": "11.", + "answer_id": 2, + "answer": "12.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched and listened to discover which team is the Mariners. At 00:03 the announcer mentions the Adirondacks, who are in possession of the puck, and they are in the white jerseys. Therefore, the Mariners must be the other team, which is the green team. I then watched for each time the Mariners took shots on the Adirondack goal. This occurred at 00:41, 00:48, 00:57, 01:10, 01:12, 01:23, 01:30, 01:38, 02:15, 02:23, 02:30, and 02:33. None of these shots scored, and so all 12 of them were saved by the goalie. The answer is (5) 12." + }, + { + "key": "-18ZO2Pda2A:f004264db73f23e1e3064b74a9cabd0eaecd3bfb", + "video_id": "-18ZO2Pda2A", + "question": "If the player in green had made his shot on the goal at 02:22 in the video, what would the score have been?", + "answer_choice_0": "1-0.", + "answer_choice_1": "2-0.", + "answer_choice_2": "3-0.", + "answer_choice_3": "2-1.", + "answer_choice_4": "2-2.", + "answer_id": 3, + "answer": "2-1.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to first understand which team corresponds to each team name on the scoreboard in the upper left corner. At the beginning of the video, the team in white scores at 00:05. Then, at 00:10, the score changes to \"MNE 0 - ADK 1\". From this, I can deduce that the team in white is \"ADK\". At 02:22, a player in green shoots the puck at the goal, which is saved by the goalie. If the shot had gone into the goal, the team in green would have scored. Since the scoreboard at this point in the video says that \"MNE\" has 0 points, this would have given them 1 point. The scoreboard also shows that \"ADK\" has 2 points. So, the score would have been 2-1 if the puck had gone into the net." + }, + { + "key": "-18ZO2Pda2A:f8176ab5b6fb2b6851cb8b0bce05b0ff800044e3", + "video_id": "-18ZO2Pda2A", + "question": "Of the advertisements displayed on the side of the ice rink, which advertisement printed three times in a row shows up most often?", + "answer_choice_0": "Upstate Agency.", + "answer_choice_1": "Starry.", + "answer_choice_2": "Streamlined Graphics.", + "answer_choice_3": "Bean's Country Store.", + "answer_choice_4": "Bud Light.", + "answer_id": 1, + "answer": "Starry.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to find the advertisements displayed on the side of the ice rink. They first become visible at 00:02 in the video. I then looked for the advertisements to become more visible. A triple repeated Starry logo shows up in the top right side of the screen at 00:04, but it becomes clearly visible from 00:52 to roughly 00:58, and also from 01:24 to 01:26. There is one more triple repeating advertisement that shows up briefly from 01:43 to 01:45. It is an advertisement that says \"Phinney.\" However, since this is the last time it is shown and since the Starry logo takes up much more screen time, the answer is Starry." + }, + { + "key": "-1UXq-FzmQA:09641be19f3ede1588c9c024120f4aa8e9f17904", + "video_id": "-1UXq-FzmQA", + "question": "What celebration does player #5 do after making a sack at 00:49?", + "answer_choice_0": "He does a shimmy.", + "answer_choice_1": "He gives a high five.", + "answer_choice_2": "He acts like a mummy.", + "answer_choice_3": "He shakes his hips.", + "answer_choice_4": "He acts like a dog.", + "answer_id": 2, + "answer": "He acts like a mummy.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "While watching the video I noticed that player #5 runs to player #9 in the white jersey at 00:47. At 00:48, player #5 tackles player #9 who is a quarterback, therefore, making a sack. As soon as player #5 gets up, he walks with his arms out in front of him like he is a mummy." + }, + { + "key": "-1UXq-FzmQA:0ef2819c24a800a8bc739f6df8284bfedaa914ae", + "video_id": "-1UXq-FzmQA", + "question": "What occurred immediately after the second intercepted pass by the Villanova quarterback?", + "answer_choice_0": "A sack.", + "answer_choice_1": "Another interception.", + "answer_choice_2": "A fumble.", + "answer_choice_3": "A touchdown.", + "answer_choice_4": "An offensive pass interference", + "answer_id": 0, + "answer": "A sack.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the Villanova quarterback, with the football already in his hands, drop back four yards from a shotgun formation from 1:10-1:12. Simultaneously, I watched the Maine defensive end #9 blow past the Villanova team's right tackle, causing the Villanova quarterback to run in the opposite direction. From 1:14-1:15, the Maine defensive end #9 wrap his arms around the fleeing quarterback, tackling him to the ground." + }, + { + "key": "-1UXq-FzmQA:2aee49394861d1554e31d1371159af6f6fb39774", + "video_id": "-1UXq-FzmQA", + "question": "How does Maine beat Villanova in the final seconds of the game?", + "answer_choice_0": "A safety.", + "answer_choice_1": "An interception.", + "answer_choice_2": "A fumble.", + "answer_choice_3": "A field goal.", + "answer_choice_4": "A touchdown.", + "answer_id": 3, + "answer": "A field goal.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched as the Maine football team lined up for about a 50 yard field goal from 2:05-2:14. At 2:15, the Maine center snaps the football to the holder as he sets the ball down on the field vertically for the place kicker to administer the long attempt. All the while, the Villanova football team leaps into the air at the line of scrimmage, hoping to swat the ball and block it. At 2:16, I watched the place kicker kick the football as it soars through the goal posts at 2:18. From the 2:18-2:14, I watched the entire Maine football field storm the football field in celebration, joyously huddling around the place kicker. I watched the scoreboard change from \"Villanova: 10\" and \"Maine: 10\" to \"Villanova: 10\" and \"Maine: 13\" with \"00:00\" remaining in the fourth quarter, thereby indicating the Maine football team's field goal was the final play of the game." + }, + { + "key": "-1UXq-FzmQA:5d5aa760715fb9b780349f54af28f9b03bd22f79", + "video_id": "-1UXq-FzmQA", + "question": "What is the football broadcast's primary advertiser?", + "answer_choice_0": "New England Savings.", + "answer_choice_1": "FS1.", + "answer_choice_2": "Quality Jewelers Sales & Service.", + "answer_choice_3": "Hammington Lumber Company.", + "answer_choice_4": "Doritos.", + "answer_id": 2, + "answer": "Quality Jewelers Sales & Service.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the football stadium transform into an brodacast advertisement from 1:03-1:04. At 1:03, I watched an advertisement flash from the front of the camera land and fall into view. I watched the advertisement read \"Quality Jewelers Sales & Service\" with a drawing of a shimmering, crystalline diamond at the top of the lettering." + }, + { + "key": "-1UXq-FzmQA:68fa67f7d9d0112646425cabb95827d4cfb68a83", + "video_id": "-1UXq-FzmQA", + "question": "What does player #6 do after he runs over player #3 at 01:24?", + "answer_choice_0": "He catches the ball.", + "answer_choice_1": "He falls down.", + "answer_choice_2": "He sacks #9.", + "answer_choice_3": "He stumbles on a player.", + "answer_choice_4": "He throws the ball.", + "answer_id": 2, + "answer": "He sacks #9.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "While watching the video, I noticed that at 01:20, player #6, in the black jersey, runs right toward player #3, in the white jersey. At 01:20, player #6 runs into player #3. I listened and found out that player #3 is the running back. At 01:24, player #6 runs into the quarterback in the white jersey, player #9, resulting in a sack." + }, + { + "key": "-1UXq-FzmQA:71aa8cc216c595576306de1756e33e2f5c1c8ed5", + "video_id": "-1UXq-FzmQA", + "question": "How many interceptions are depicted in the highlight video?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video from 0:00-0:56. I saw that the Villanova team's quarterback sporting #9 on his jersey uses his right hand to throw the deep ball to his wide receiver #2 running an inside post. However, I watched a miscommunication take place as the football soars over the wide receiver's helmet, the quarterback not expecting #2 to break toward the center of the field. Nonetheless, I saw the Maine cornerback break toward the football and intercept the miscued pass. Subsequently, from 1:05-1:10, I watched the Villanova quarterback bootleg to the right and hurl the football downfield on the run by #20 in the Villanova secondary." + }, + { + "key": "-1UXq-FzmQA:a5c9e18c532982d1eb060127add4c385dd4c53f2", + "video_id": "-1UXq-FzmQA", + "question": "From what yard line does the Villanova quarterback throw his second interception?", + "answer_choice_0": "40.", + "answer_choice_1": "50.", + "answer_choice_2": "45.", + "answer_choice_3": "35.", + "answer_choice_4": "30.", + "answer_id": 3, + "answer": "35.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "From 1:05-1:10, I watched the Villanova quarterback bootleg to the right between the labelled 30 and 40 yard line clearly delineated and labelled. I watched as the quarterback hurled the football downfield on the run, releasing the balls on the white line bisecting the 30 and 40 yard line, establishing that the quarterback's intercepted throw was released at the unlabelled 35 yard line." + }, + { + "key": "-1UXq-FzmQA:ab412156e1107120a0df6992563b727dcdc2ff5a", + "video_id": "-1UXq-FzmQA", + "question": "What would the score be if Maine did not kick the first field goal?", + "answer_choice_0": "7.", + "answer_choice_1": "12.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "6.", + "answer_id": 2, + "answer": "0.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "While watching the video, I saw a player in a black jersey getting ready to kick the football through the goal post at 00:37. I looked at the graphics and noticed that the player was on the Maine team. At that time, they had not scored so the score was Maine 0 points and Villanova 3 points. After the ball was kicked through the goal post at 00:39, Maine's score went from 0 to 3." + }, + { + "key": "-1UXq-FzmQA:c3e0cc8e1028c9b6231f89d39abd83f1b0957a90", + "video_id": "-1UXq-FzmQA", + "question": "On which yard line is Filzpatrick when he breaks a tackle?", + "answer_choice_0": "33.", + "answer_choice_1": "40.", + "answer_choice_2": "44.", + "answer_choice_3": "16.", + "answer_choice_4": "23.", + "answer_id": 2, + "answer": "44.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "While watching the video, I saw player #7 wearing a black jersey with the #7 in white on the back at 00:13 after he jumped up. I went back to see how far he had run. He held the football at the 15 yard line at 00:08. At 00:09, I heard the commentator say \"Now the fake to Fitzpatrick.\" He was talking about the football player who carries the ball, so I knew that the football player's name was Fitzpatrick. He ran and encountered another player who wears a white jersey at 00:19. When he fell, I noticed that he was at the 44 yard line." + }, + { + "key": "-1YjD_Epw9M:0dc38ca240600adf2e850f7e7215832d52a84354", + "video_id": "-1YjD_Epw9M", + "question": "What does the basketball coach do after the interviewer asks his first question?", + "answer_choice_0": "He looks behind him.", + "answer_choice_1": "He looks to the ceiling.", + "answer_choice_2": "He scratches his head.", + "answer_choice_3": "He smiles and bows.", + "answer_choice_4": "He shakes his head.", + "answer_id": 2, + "answer": "He scratches his head.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for the interviewer's first question. This happens at the beginning of the video, from 00:00, and it goes to 00:04. At this point, the interviewer finishes his question and stops talking. At this point, I watch the basketball coach to see his response. As he responds, he raises a hand to the side of his head and scratches." + }, + { + "key": "-1YjD_Epw9M:2b9fe6203c038c0bf90cd3756dae5771348ef307", + "video_id": "-1YjD_Epw9M", + "question": "When the girl in the #12 jersey grabs the ball at 00:14, where is the girl in the #13 jersey?", + "answer_choice_0": "Behind her at the free throw line.", + "answer_choice_1": "In front of her on the three-point line.", + "answer_choice_2": "In front of her at the free throw line.", + "answer_choice_3": "Behind her on the three-point line.", + "answer_choice_4": "The girl in the #13 jersey isn't on-screen.", + "answer_id": 0, + "answer": "Behind her at the free throw line.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I examined the 00:14 time stamp, looking for hints of the girl in the #13 jersey. I notice, just at the time #12 grabs the ball, #13 is passing by immediately behind her by the free throw line. Therefore, #13 is close behind #12 at the free throw line when she grabs the ball." + }, + { + "key": "-1YjD_Epw9M:2eac322357bc52a1c5b972ef7c383f2752ba7943", + "video_id": "-1YjD_Epw9M", + "question": "What letter or letters is printed on the base of the basketball hoops on the court?", + "answer_choice_0": "U and U.", + "answer_choice_1": "M and M.", + "answer_choice_2": "C and U.", + "answer_choice_3": "R and M.", + "answer_choice_4": "A and S.", + "answer_id": 0, + "answer": "U and U.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I examined each clip of the basketball court, looking for a good look at the base of the two basketball hoops. I noticed a clear \"U\" at the base of one of them at 00:17. At 00:58, I noticed another \"U\" on the basketball hoop. Clearly, these two basketball hoops aren't the same because the basketball team sitting on the sideline is different from the people sitting on the sideline at 00:17. Therefore, \"U\" and \"U\" are the two letters printed on the base of the basketball hoops." + }, + { + "key": "-1YjD_Epw9M:39c13112649cd30ecaac63f8d8381abc189a0e5f", + "video_id": "-1YjD_Epw9M", + "question": "How many words were in the video's first text graphic?", + "answer_choice_0": "4.", + "answer_choice_1": "8.", + "answer_choice_2": "7.", + "answer_choice_3": "6.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "6.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I found a text graphic at 00:00. Since no other text graphics preceded this, this was the first one. Next, I read the text graphic, which read \"Ryan Sullivan\" and \"Sheridan Girls Basketball Coach\". Then, I counted the number of words in the text graphic, calculating a total of 6." + }, + { + "key": "-1YjD_Epw9M:6d2ea4b8f50e516a9aac270caccb6e095f0f1d12", + "video_id": "-1YjD_Epw9M", + "question": "Out of all the girls who shot baskets in this video, which girl shot the most?", + "answer_choice_0": "#13.", + "answer_choice_1": "#30.", + "answer_choice_2": "#21.", + "answer_choice_3": "#12.", + "answer_choice_4": "#2.", + "answer_id": 3, + "answer": "#12.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for each clip of the girls shooting baskets. There are nine of them: 00:12 to 00:20, 00:20 to 00:26, 00:33 to 00:39, 00:39 to 00:47, 00:50 to 00:58, 00:58 to 01:05, 01:05 to 01:13, 01:20 to 01:28, and 01:28 to 01:38. In each clip, it is possible to identify the girl shooting by the number on her jersey. I examined each of these and noticed that the girl with the #12 on her white jersey shoots 4 shots -- at 00:21, 00:53, 01:08, and 01:23 -- the most of any other girl. The closest to her is 2 shots from the girl with a number #2 jersey, at 00:16 and 00:43. The girl with the #13 jersey, the girl with the number #30 jersey, and the girl with the #21 jersey each shoot once, at 00:35, 01:01, and 01:33 respectively. Therefore, #12 is the girl who shot the most." + }, + { + "key": "-1YjD_Epw9M:8f6b7aca497937e3f243808be15d4a5dd6dfb74f", + "video_id": "-1YjD_Epw9M", + "question": "What happened after Player #12 gained possession of the ball at 00:13 - 00:14?", + "answer_choice_0": "She passed to Player #2, who scored a 3-pointer.", + "answer_choice_1": "She passed to Player #2, who missed a layup.", + "answer_choice_2": "She dribbled forwards and missed a jump shot.", + "answer_choice_3": "She dribbled to the basket and scored a layup.", + "answer_choice_4": "She dribbled backwards and scored a 3-pointer.", + "answer_id": 0, + "answer": "She passed to Player #2, who scored a 3-pointer.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:13, I identified Player #12 based on her white jersey with the number \"12\". At the same time, I saw her gain possession of the ball at 00:13 - 00:14. Next, at 00:14 - 00:15, I saw Player #12 pass the ball to Player #2, identified by her white jersey number with the number \"2\", who then shot and scored a 3-pointer at 00:15 - 00:17. Therefore, after Player #12 gained possession of the ball at 00:13 - 00:14, she passed to Player #2, who scored a 3-pointer at 00:14 - 00:17." + }, + { + "key": "-1YjD_Epw9M:9893fb7d73eb8d025047a9eab1984f8020bcd970", + "video_id": "-1YjD_Epw9M", + "question": "How many 3-pointers did Player #2 score?", + "answer_choice_0": "2.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "2.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:17, I identified Player #2 based on her white jersey with the number \"2\". At the same time, I saw her score a 3-pointer, since the shot was taken from behind the 3-point line. Then, I saw her score another 3-pointer at 00:44. I counted the number of 3-pointers Player #2, calculating a total of 2." + }, + { + "key": "-1YjD_Epw9M:aba5a491589c22e10e38c05d5d8c84672372f798", + "video_id": "-1YjD_Epw9M", + "question": "What percentage of three-point shots made to white team members via a pass from another white team member makes it through the hoop?", + "answer_choice_0": "16.6%.", + "answer_choice_1": "66.6%.", + "answer_choice_2": "83.3%", + "answer_choice_3": "50%.", + "answer_choice_4": "100%.", + "answer_id": 4, + "answer": "100%.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked over the basketball clips for footage of white team members passing to other white team members. This happens 6 times: 00:15, 00:21, 00:42, 00:52, 01:07, 01:22, and 01:32. I examine each of them to see if they are passing to another member on the three point line and who subsequently take a shot. It turns out that, each time a white team member passes to another, she passes to a person standing by the three-point line, and, each time, that person makes a shot. This means that all 6 shots are three-point shots. Then, I examined each shot they made, to see if they were successful. It turns out once again that all 6 proceeding shots are successful so I calculate 6/6 into a percentage and get 100%." + }, + { + "key": "-1YjD_Epw9M:af75fdeacdadf70a6371f862d19dc8306af08965", + "video_id": "-1YjD_Epw9M", + "question": "What was the result of the game?", + "answer_choice_0": "The game was cancelled.", + "answer_choice_1": "The black team won.", + "answer_choice_2": "The white team won.", + "answer_choice_3": "The two teams tied.", + "answer_choice_4": "The teams were disqualified.", + "answer_id": 2, + "answer": "The white team won.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "At 00:12, I identified the two teams with the different colors of their jerseys: white and black. Throughout the video, the white and black teams competed against each other, until at 01:43 - 01:58, I saw the white team victoriously storm the floor and celebrate together. Then, at 02:11 - 02:21, I saw the white team pose together for a photo with an award plaque before jumping around and celebrating together. All of this behavior indicates that the white team won the game." + }, + { + "key": "-2ADJedUQv0:09bd8dee02144f80eaaeb48071fcaeaaef45f507", + "video_id": "-2ADJedUQv0", + "question": "What is the number of the player that makes the shot to put NC State within a pair of tying the game?", + "answer_choice_0": "#0.", + "answer_choice_1": "#30.", + "answer_choice_2": "#14.", + "answer_choice_3": "#11.", + "answer_choice_4": "#34.", + "answer_id": 1, + "answer": "#30.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I listened to the announcer and heard him say \"State within a pair\" at 00:50 right after a player sinks a basket. I went back to identify the number of the player who made the bucket and read the number #30 on his jersey at 00:46." + }, + { + "key": "-2ADJedUQv0:45dd2ebf64216a034167c9f85ea21c80f226c45b", + "video_id": "-2ADJedUQv0", + "question": "What hangs around coach Kevin Keatts' neck in the beginning of the video?", + "answer_choice_0": "A whistle.", + "answer_choice_1": "Glasses.", + "answer_choice_2": "A badge.", + "answer_choice_3": "A mask.", + "answer_choice_4": "A necklace.", + "answer_id": 3, + "answer": "A mask.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "First, I had to identify who coach Kevin Keatts was. At 01:22, a banner appears on the screen as a man is speaking. The banner reads \"Kevin Keatts\" and below it says, \"NC State head coach.\" After identifying who coach Kevin Keatts was, I went to the beginning of the video and spotted him along the sidelines. I looked around his neck and saw that there was a mask hanging around it from 00:00-00:13." + }, + { + "key": "-2ADJedUQv0:76b57f510ca6e58f44cfe6cc05d4f255277337a3", + "video_id": "-2ADJedUQv0", + "question": "Which player fouled #34 in white in the play directly after the scoreboard read \"final\"?", + "answer_choice_0": "#20 in black.", + "answer_choice_1": "#0 in black.", + "answer_choice_2": "#11 in black.", + "answer_choice_3": "#23 in black.", + "answer_choice_4": "#31 in black.", + "answer_id": 2, + "answer": "#11 in black.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked at the scoreboard, and read \"final\" on it at the 01:12 mark in the video. I then watched further, and heard the announcer refer to a foul at 01:13. I read #11 across the jersey of the player in black who jumps up to try and block the shot of #34 in white between 01:12-01:13. Therefore, I concluded that #11 in black fouls #34 in white during the final period." + }, + { + "key": "-2ADJedUQv0:79d5a72ee8d4b5713d2af2ccd2892375138db288", + "video_id": "-2ADJedUQv0", + "question": "How long is the band displayed on the screen?", + "answer_choice_0": "12 seconds.", + "answer_choice_1": "6 seconds.", + "answer_choice_2": "10 seconds.", + "answer_choice_3": "14 seconds.", + "answer_choice_4": "2 seconds.", + "answer_id": 4, + "answer": "2 seconds.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching, I looked for a shot of the band. I found a shot of the band playing at 01:06. Then I continued watching and noticed that the band was last seen on screen at 01:08. So, I found the difference in timing which was 2 seconds. I watched the rest of the video and that was the only time the band was on the screen. Therefore, the band was only on-screen for 2 seconds in total." + }, + { + "key": "-2ADJedUQv0:7f37821bc23cf500f41dcf23fb4e88b588e5928d", + "video_id": "-2ADJedUQv0", + "question": "How many times does Coach Keatts wear a mask over his face?", + "answer_choice_0": "2 times.", + "answer_choice_1": "4 times.", + "answer_choice_2": "1 time.", + "answer_choice_3": "5 times.", + "answer_choice_4": "3 times.", + "answer_id": 0, + "answer": "2 times.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I identified Coach Keatts between 00:02-00:06 when a man clearly gets tossed out of the game by a referee. During that span, I listened as the narrator identifies this man as Coach Keatts. I then looked for instances of Coach Keatts wearing a facial mask. I found instances of this at 00:30 and 01:22 when a mask clearly covers his face. I counted up that number and arrived at 2." + }, + { + "key": "-2ADJedUQv0:875a6bfe1c23e925d6a9682d0f6c4c095aeb25ca", + "video_id": "-2ADJedUQv0", + "question": "What does the referee do after he signals a technical foul against a coach during the game?", + "answer_choice_0": "Walk behind the coach while raising his arms.", + "answer_choice_1": "Walk to the left away from the coach.", + "answer_choice_2": "Move towards the coach while gesturing.", + "answer_choice_3": "Move towards the coach while shaking his head.", + "answer_choice_4": "Walk to the right away from the coach.", + "answer_id": 1, + "answer": "Walk to the left away from the coach.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I saw the referee signal a foul against a screaming coach between 00:00-00:03. I then observed the referee walk to the left away from the coach between 00:03-00:05. I listened as the announcer said the coach was \"thrown out of the game\" due to technical fouls at 00:06." + }, + { + "key": "-2ADJedUQv0:db38950e1ae6f6c7eab156562d6d83f3fbfe5ddd", + "video_id": "-2ADJedUQv0", + "question": "Which NC State player had a stomach bug during the game?", + "answer_choice_0": "Player 34.", + "answer_choice_1": "Player 30.", + "answer_choice_2": "Player 11.", + "answer_choice_3": "Player 22.", + "answer_choice_4": "Player 14.", + "answer_id": 1, + "answer": "Player 30.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching, I heard the announcer say at 00:41-00:46, \"DJ Burns playing through a stomach bug tonight, still able to work it out.\" Then I looked at the NC State player's jersey for the name Burns. At 00:46, I read the last name \"Burns\" on player number 30 jersey." + }, + { + "key": "-3ab4xjUXNQ:33ae6cb49cf874678ec134efd0ddf4ce2c29347d", + "video_id": "-3ab4xjUXNQ", + "question": "What does the Woking player do to get the first yellow card?", + "answer_choice_0": "He shouts at the referee.", + "answer_choice_1": "He wastes time before a throw-in.", + "answer_choice_2": "He knocks over a Wrexham player.", + "answer_choice_3": "He makes a rude gesture to the Wrexham manager.", + "answer_choice_4": "He dives in the penalty box.", + "answer_id": 2, + "answer": "He knocks over a Wrexham player.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched for the first time that the referee gets a yellow card out of his pocket. At 01:16, the referee pulls a yellow card from his pocket and displays it over his head, facing a Woking player. I went back to see what happened. At 01:12, the Woking player in question slams his body into that of a Wrexham player approaching with the ball, in a move obviously aiming more to stop the player than to regain the ball. The yellow card is given immediately afterwards." + }, + { + "key": "-3ab4xjUXNQ:a8431e7abd2a14d5d02e74737651b8cf9d9e269c", + "video_id": "-3ab4xjUXNQ", + "question": "At what minute of the game does Summerfield score the first goal for Wrexham?", + "answer_choice_0": "15.", + "answer_choice_1": "27.", + "answer_choice_2": "32.", + "answer_choice_3": "12.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "15.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video, looking for a goal to be scored by Wrexham. At 00:49, Summerfield scores for Wrexham, their first. As this is a highlight reel, this was not the actual time of the goal. At 00:58, a graphic flashes up with the new scoreline of 1-0, noting that it was scored by Summerfield at 15'." + }, + { + "key": "-3ab4xjUXNQ:c31b3e7b7d23086cbbcfd62b031749b4c5f9271d", + "video_id": "-3ab4xjUXNQ", + "question": "How many Woking players are already on the ground when the Woking keeper falls trying to save Summerfield's first goal?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "0.", + "answer_id": 1, + "answer": "1.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched for Summerfield's first goal, which occurs at 00:49. As he is kicking, a Woking player falls to the ground in front of him. As the Woking keeper leaps and falls to the ground in an attempt to block the goal, the player is still on the ground. So, one." + }, + { + "key": "-3ab4xjUXNQ:edf03ad67d2d55a01b468259d20660c08990c96f", + "video_id": "-3ab4xjUXNQ", + "question": "In the second half, what is the website on the sign just to the right of Woking's goal?", + "answer_choice_0": "www.wokingtown.com.", + "answer_choice_1": "www.ryanreynolds.com.", + "answer_choice_2": "www.vanarama.com.", + "answer_choice_3": "www.carlsberg.com.", + "answer_choice_4": "www.wrexrent.com.", + "answer_id": 4, + "answer": "www.wrexrent.com.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for the Woking keeper on the pitch, and he is first seen in the goal at the left of the screen at 00:12. I watched until he was in the opposite goal, signifying the second half. He is seen in the opposite goal at 04:41. At 04:44, the camera pans enough to the right of the goal that a sign with a website printed on it can be seen, reading \"www.wrexrent.com.\"" + }, + { + "key": "-45ykBNkhpc:2e19889cdce1876f172798bf1e1c33111a0f49a8", + "video_id": "-45ykBNkhpc", + "question": "How many orange cars are visible in the right lineup at 00:08?", + "answer_choice_0": "0.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I locate the 00:08 timestamp of the video. I notice two lines of cars, one on the left and the other on the right. Also, I notice 1 orange car at the back of the line on the right." + }, + { + "key": "-45ykBNkhpc:3e191b1d920a10098180390069c46b5a1f4c1fa3", + "video_id": "-45ykBNkhpc", + "question": "What is visible in the distance, looming in the background at 00:33?", + "answer_choice_0": "Sky.", + "answer_choice_1": "Mountains.", + "answer_choice_2": "Fencing.", + "answer_choice_3": "Trees.", + "answer_choice_4": "Spectator stands.", + "answer_id": 3, + "answer": "Trees.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I locate the 00:33 timestamp and look towards the background. A large span of dense trees are visible in the distance." + }, + { + "key": "-45ykBNkhpc:5012be4d576ec3add25410778798bc6bf092aa4b", + "video_id": "-45ykBNkhpc", + "question": "What happens after the red race car drives past a black and white checkered flag?", + "answer_choice_0": "Race car drivers line up for a photo on the race track.", + "answer_choice_1": "Race car drivers park their race cars.", + "answer_choice_2": "Race car drivers hug each other.", + "answer_choice_3": "Race car drivers drink water from bottles.", + "answer_choice_4": "Race car drivers get interviewed by reporters.", + "answer_id": 2, + "answer": "Race car drivers hug each other.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 01:25-01:26, I watched the red race car drive past the black and white checkered flag. I continued watching and observed race car drivers hugging each other from 01:27-01:30." + }, + { + "key": "-45ykBNkhpc:5502f7184f2c4d3f2f0c05daa0e9b3382059703c", + "video_id": "-45ykBNkhpc", + "question": "Which color car leads the race during 00:17 - 00:25?", + "answer_choice_0": "Yellow and white car.", + "answer_choice_1": "Blue and black car.", + "answer_choice_2": "Red and black car.", + "answer_choice_3": "Green and white car.", + "answer_choice_4": "Orange and white car.", + "answer_id": 4, + "answer": "Orange and white car.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 00:17 timestamp, I watch the orange and white car slightly speed around the bend at 00:19, with the red and black car on its tail. Starting at 00:24, the orange and white car takes the lead as the first car to turn the corner." + }, + { + "key": "-45ykBNkhpc:62869322677847b1cf8b5d035cd0b64226c66d65", + "video_id": "-45ykBNkhpc", + "question": "What is the sum total of the number of times the individual words \"RAUCH\" and \"ENERGY\" appear clearly on signs above the racetrack?", + "answer_choice_0": "8", + "answer_choice_1": "11", + "answer_choice_2": "14", + "answer_choice_3": "3", + "answer_choice_4": "6", + "answer_id": 4, + "answer": "6", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "First, I watched the video and looked for times when the words \"RAUCH\" and 'ENERGY\" appear on signs. I found the first instance at 00:25-00:26 when the word \"RAUCH\" appears 3 times on a yellow sign above the racetrack. I then saw the word \"ENERGY\" on a sign above the racetrack at 00:35. I saw the word \"ENERGY\" appear again on a sign above the racetrack at 00:48. Another instance of the word \"ENERGY\" appearing occurs at 01:00. The word \"RAUCH\" appears 5 times on a sign at 01:22, but since that sign is not above the racetrack, I did not count it. I then added together the total number of times each word appears, 3+1+1+1=6. Therefore, the answer is 6." + }, + { + "key": "-45ykBNkhpc:666a3b16e2213edf0e0d32d0e6aa9cbf6f5b642f", + "video_id": "-45ykBNkhpc", + "question": "Where is the red car positioned after the announcer says, \u201cthese three would continue to duel\u201d?", + "answer_choice_0": "It drives behind three other race cars", + "answer_choice_1": "It drives ahead of three other race cars", + "answer_choice_2": "It veers off the track on the side", + "answer_choice_3": "It parks on the side of the track", + "answer_choice_4": "It drives in the middle of three other race cars", + "answer_id": 2, + "answer": "It veers off the track on the side", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched and listened specifically for when the announcer says, \"these three would continue to duel\". I found this at 01:16-01:17. I then paid attention to where the red race car was positioned after the announcer said this and I observed that it veers off the track on the left side." + }, + { + "key": "-45ykBNkhpc:6f1afc27089a73876ff5646da1ff3fa48bf56c58", + "video_id": "-45ykBNkhpc", + "question": "Why do the men gather closer together starting at 01:39?", + "answer_choice_0": "To address a reporter.", + "answer_choice_1": "To hear each other over the loud applause.", + "answer_choice_2": "To take a group picture.", + "answer_choice_3": "To congratulate each other.", + "answer_choice_4": "To examine each other's trophies.", + "answer_id": 2, + "answer": "To take a group picture.", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 01:39 timestamp, I notice the men gathering closer together while standing on the winner's platform. They are all holding their trophies while positioning themselves in a standard, frontal pose. I can determine the men are taking a group picture." + }, + { + "key": "-4IduHFnEwg:0dcff7311e6f117499456c68e92fe475ac6577c6", + "video_id": "-4IduHFnEwg", + "question": "At 08:26, what is one half of the run rate?", + "answer_choice_0": "2.85.", + "answer_choice_1": "2.615.", + "answer_choice_2": "2.715.", + "answer_choice_3": "2.65.", + "answer_choice_4": "2.815.", + "answer_id": 4, + "answer": "2.815.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "While watching the match, I first located the 08:26 mark in the video. I observed the run rate displayed on the screen as 5.63. Then, I divided 5.63 by 2, which resulted in the conclusion that the answer is 2.815." + }, + { + "key": "-4IduHFnEwg:17b8c8a963065a1621a4cdaae1318f9c7d18cb6b", + "video_id": "-4IduHFnEwg", + "question": "Which sponsor has a hashtag on their posted advertisement around the field?", + "answer_choice_0": "Wolf 777 News.", + "answer_choice_1": "Visit Trinidad.", + "answer_choice_2": "ITW.", + "answer_choice_3": "KNCB Cricket.", + "answer_choice_4": "Fair Play New.", + "answer_id": 1, + "answer": "Visit Trinidad.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I began watching the cricket match from the beginning of the video. I noticed that there are several sponsor related advertisements around the field. I looked carefully for any that might have a hashtag. At 01:55, I notice a white advertisement with red and black lettering that reads \"#visitTrinidad\". Therefore, the answer is Visit Trinidad." + }, + { + "key": "-4IduHFnEwg:6202ef55d7fd2941df98ea6546850ee27d71b3aa", + "video_id": "-4IduHFnEwg", + "question": "Based on the scores shown at 04:01, what is the difference between Fakhar's and Babar's displayed scores?", + "answer_choice_0": "17.", + "answer_choice_1": "8.", + "answer_choice_2": "15.", + "answer_choice_3": "7.", + "answer_choice_4": "5.", + "answer_id": 0, + "answer": "17.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First, I located the 04:01 timestamp in the video. Then, I found the scores displayed in the center-right of the frame, accompanied by images of both players on the left. I carefully observed the displayed scores. I read \"FAKHAR\" and saw his score as \"59.\" Below that, I read \"BABAR\" and saw his score as \"42.\" After identifying both names and scores, I subtracted 42 from 59, concluding that the difference between the players' scores at the 04:01 timestamp was 17." + }, + { + "key": "-4IduHFnEwg:9e3aab1dde6c8161e6ae48aec472c1d87b277879", + "video_id": "-4IduHFnEwg", + "question": "How many runs did Imam score before being dismissed?", + "answer_choice_0": "14.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "19.", + "answer_choice_4": "21.", + "answer_id": 1, + "answer": "2.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I identified Imam as one of the first batters for Pakistan by reading his name on the scoreboard at 00:00. He was called out at 01:04. When I next saw the scoreboard at 01:08, I could see that Pakistan had 10 runs scored, with 8 credited to Fakhar, and none yet scored for the new batter Babar. I subtracted Fakhar's 8 runs from Pakistan's total of 10 to deduce that Imam must have scored 2 while at bat." + }, + { + "key": "-4IduHFnEwg:aa49600d0a838c6a494e5eae12d162453a72486b", + "video_id": "-4IduHFnEwg", + "question": "How does the Netherlands log their second out?", + "answer_choice_0": "Edwards puts down a wicket.", + "answer_choice_1": "Cushtill makes a catch.", + "answer_choice_2": "Kingma makes a catch.", + "answer_choice_3": "Rizwan is called for a leg before wicket.", + "answer_choice_4": "Cooper makes a catch.", + "answer_id": 4, + "answer": "Cooper makes a catch.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I heard the Netherlands record their first out at 01:04 when the announcer declares it, and it's reflected on the scoreboard at 01:08. I continued watching until I saw another out at 05:43, when Cooper makes a clean catch. It's reflected on the scoreboard as their second out at 05:52." + }, + { + "key": "-4IduHFnEwg:b01f2504c84f21f599b6e6b751cc7268990b59b0", + "video_id": "-4IduHFnEwg", + "question": "Two shots before the second reviewed play, how many times does the spectator wave his flag while a ball lands near him?", + "answer_choice_0": "2 times", + "answer_choice_1": "1 time", + "answer_choice_2": "5 times", + "answer_choice_3": "4 times", + "answer_choice_4": "3 times", + "answer_id": 3, + "answer": "4 times", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to find the second reviewed play. The first review of a play occurs from 00:21-00:56, when footage is slowed down and reviewed several times. I continued watching to find the second review, which occurs from 07:21-07:30 when, again, footage is slowed down and reviewed. I then went back from this time range to find the spectator waving a flag. The first previous shot is from 07:13-07:21, when play occurs. Moving one more back, I found a spectator waving a white and green flag in the stands from 07:10-07:13. He waves his flag 4 times, making that the answer." + }, + { + "key": "-4IduHFnEwg:e00597697cc091a2bc7be9be5bca0e24fc79f380", + "video_id": "-4IduHFnEwg", + "question": "Throughout the video, who is the man in the black flat-brimmed hat?", + "answer_choice_0": "The pitcher.", + "answer_choice_1": "The referee.", + "answer_choice_2": "A fan.", + "answer_choice_3": "The wicket guardian.", + "answer_choice_4": "The coach.", + "answer_id": 1, + "answer": "The referee.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "As I watched the video, I first saw and identified a man in black, wearing a flat-brimmed black hat, standing on the field at 00:02. I continued watching the match and observed his actions. I saw him give warnings and penalties at 01:01-01:03 and again at 03:43. Therefore, I deduced that he was the referee. I continued watching until the end of the video. I found no other man on the field with a flat-brimmed black hat." + }, + { + "key": "-4IduHFnEwg:e2da6bde60e557930aefc28db4e2d9b84f9170a3", + "video_id": "-4IduHFnEwg", + "question": "How does Babar's ball travel when he hits it at 02:06?", + "answer_choice_0": "It flies high over the bowler and over the boundary.", + "answer_choice_1": "It rolls quickly along the ground to a fielder on his left.", + "answer_choice_2": "It bounces slowly to his left and short of the boundary.", + "answer_choice_3": "It rolls quickly along the ground and over the boundary to his right.", + "answer_choice_4": "It pops up high behind him and short of the boundary.", + "answer_id": 3, + "answer": "It rolls quickly along the ground and over the boundary to his right.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "At 02:06 I can read Babar's name on the scoreboard graphic and see an indicator next to it to signal that he's currently at bat. I see him strike the ball with a chopping motion and turn his head to his right. At 02:07, I can see the ball rolling smoothly along the grass and past the fielders. At 02:10, the ball skips over the boundary and stops at the wall behind it." + }, + { + "key": "-4PUD-TNhU4:321f21aa74e52f453d93016afff57a0724176288", + "video_id": "-4PUD-TNhU4", + "question": "At what time does the shot taken by the player named Brancini deflect off the goal crossbar?", + "answer_choice_0": "02:05.", + "answer_choice_1": "01:37.", + "answer_choice_2": "00:18.", + "answer_choice_3": "01:01.", + "answer_choice_4": "00:25.", + "answer_id": 4, + "answer": "00:25.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched and looked for all cases where a shot was taken where the puck deflected off the goal crossbar. This first happens at 00:18, but it is first deflected by the goalie, and the name of the player is neither visible nor mentioned by the announcer. Another shot is taken at 00:25 that deflects off the crossbar, but the player's name is unknown. A replay of that shot begins at 00:27 and at 00:29 the announcer mentions the name Brancini as having taken the shot. No further pucks hit the crossbar. Therefore, the answer is (3) 00:25." + }, + { + "key": "-4PUD-TNhU4:73c8f64b52ea357b3ce40d176abb042974f0a692", + "video_id": "-4PUD-TNhU4", + "question": "If the red team's shots that hit the goal post had successfully scored instead, how many points would the red team have?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "From the beginning of the video, I carefully noted the instances when the red team shot into the white team's goal and hit the post instead. The first time happens at 00:17. The second time happens at 00:28, when the puck hits the crossbar. For the rest of the video, the red team's shots do not hit the goal post. They also did not score against the white team for the entire video. If they had made the two shots that hit the goal post, they would have two points." + }, + { + "key": "-4PUD-TNhU4:7a597231a0e333177be7363e14cb4beed0847752", + "video_id": "-4PUD-TNhU4", + "question": "How many players are below the referee in the frame in the initial faceoff?", + "answer_choice_0": "6.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "8.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched for the start of the first faceoff (00:04). I identified the referee by his striped shirt. I then counted the number of players from both teams who are on the screen below him. The number is 6. So the answer is (5) four." + }, + { + "key": "-4PUD-TNhU4:d4fb1df64d41a4b45f77f8bfb7c5268ecdb62cb9", + "video_id": "-4PUD-TNhU4", + "question": "How many hugs does the player in the red helmet get after the final score of the video?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "7.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "7.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched to see when the last goal was scored. That goal and its replay was 02:13 - 02:18. I then saw a hug at 02:20, but it was not with a player with a red helmet. The red helmet player shows up at 02:22. He was hugged at 02:22, 02:26, 02:29, 02:31, 02:32, 02:34, 02:36. So the total number of hugs for the red helmet team player is 7. So the answer is (2) 7." + }, + { + "key": "-4PUD-TNhU4:eeac7303ed03192c23c8038b1e4565f19944c3b4", + "video_id": "-4PUD-TNhU4", + "question": "How did the puck get past the goal keeper during the final shot of the game?", + "answer_choice_0": "It bounced off of the right post and into the net.", + "answer_choice_1": "It flew at speed and cleanly entered the net.", + "answer_choice_2": "It bounced off of a red player's hockey stick and flew into the net.", + "answer_choice_3": "It bounced off of the crossbar and entered the net.", + "answer_choice_4": "It bounced off of a white player's hockey stick and flew into the net.", + "answer_id": 4, + "answer": "It bounced off of a white player's hockey stick and flew into the net.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I searched the later part of the video for a scoring shot and found one at 02:12. I confirmed that the rest of the video did not have another scoring shot. I watched the segment from 02:14 to 02:18 to determine how the puck entered the net. I observe a white player pass the puck to another white player, who lets the puck bounce off his hockey stick at 02:16, causing it to lift into the air toward the goal keeper, who fails to block the unexpected airborne shot." + }, + { + "key": "-4PUD-TNhU4:f912e8641fa6d0f2ac6dd4d799066a3671af0d19", + "video_id": "-4PUD-TNhU4", + "question": "How many individual instances of shots taken on goal that were saved by the goalie of either team during the game occurred in the highlight reel?", + "answer_choice_0": "9", + "answer_choice_1": "10", + "answer_choice_2": "6", + "answer_choice_3": "4", + "answer_choice_4": "8", + "answer_id": 2, + "answer": "6", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video for all shots taken on a goal. After discarding the shots that scored, the video shows ten shots taken that were saved: 00:16, 00:17, 00:23, 00:25, 00:27, 01:00, 01:37, 01:40, 01:45, 02:05. I noticed that four of these were replays: 00:17, 00:27, 01:40, 01:45. After subtracting replays from shots taken and saved, the answer is (1) Six." + }, + { + "key": "-5Uz0Pz-mI0:2af1efb0da9c9fcf22406e38656ef4d53c0a1755", + "video_id": "-5Uz0Pz-mI0", + "question": "Which team has the first fast break of the game?", + "answer_choice_0": "Marvin Tepper.", + "answer_choice_1": "Yannik Baier.", + "answer_choice_2": "There are no fast breaks.", + "answer_choice_3": "Bulls.", + "answer_choice_4": "Indians.", + "answer_id": 4, + "answer": "Indians.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video up to 00:28. The teams exchanged puck control at the Indians' far side of the rink. Finally, I saw the Indians retain possession, skating at breakneck speed with the puck down the near side of the rink from 00:28-00:34. The Indians player #92 takes possession as he hustles down to the Bulls' restraining area before dumping the puck behind the back of their net 00:33. In doing so, I saw that he has attempted to pass the pick to his crossing teammate #8, but I watched the puck glide by him and an opposing Bulls player." + }, + { + "key": "-5Uz0Pz-mI0:4db7186a4d65bcc4ec2c191d27313e52c7980d4c", + "video_id": "-5Uz0Pz-mI0", + "question": "At what time is there a close up shot in the video that shows a few of the spectators watching the game?", + "answer_choice_0": "02:13.", + "answer_choice_1": "01:58.", + "answer_choice_2": "06:25.", + "answer_choice_3": "06:03.", + "answer_choice_4": "This shot does not occur.", + "answer_id": 3, + "answer": "06:03.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to find the time when there is a close up shot which shows a few of the spectators watching the game. For most of the video, there are no close up shots of the spectators. At 06:03, there is a quick fade cut that occurs between two shots, moving from a shot of the players on the ice rink to a shot of a few spectators standing and watching the action happen. This shot continues until 06:09. So, the answer is 06:03." + }, + { + "key": "-5Uz0Pz-mI0:5a5f8f7fc38bfe87358b188d0d4eaef78f9f717c", + "video_id": "-5Uz0Pz-mI0", + "question": "How much time is left in the game when Marvin scores?", + "answer_choice_0": "5 minutes.", + "answer_choice_1": "15 minutes.", + "answer_choice_2": "1 minute.", + "answer_choice_3": "59 minutes.", + "answer_choice_4": "10 minutes.", + "answer_id": 2, + "answer": "1 minute.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the initial banner at the top of the video display the competing teams: the black and red Bulls logo set against the blue and red Indians logo. I noticed that the team's colors are difficult to discern, so I watched the video from 0:28-0:30, noticing the black letters of \"Bulls\" were scrawled across the white ice. Therefore, I was able to discern that the Bulls were the home team, and as is customary in all sports, the home teams don their color jersey while the visiting team wears white jerseys. I watched up to the final minutes of the game from 00:00-05:56. At 05:57, the Bulls player number passes the puck to his teammate, who delivers a 'one-timer' snapshot at the far side of the hockey rink. I heard the crowd erupt, and the Bulls players throw their hands into the air in celebration, a loud siren resounds, and a strobe light flashes as the puck hits the back of the defending Indians' net. From 05:58 to 06:03, I watched the video display a typeface that reveals the scoring player's name \"Marvin Tepper\" as well as the minute at which the goal is scored. I see the time reads \"59min\". Since there are 60 minutes in a professional and amateur hockey match, one may deduce that there is a minute left in the game's duration; unlike soccer, there is no added injury time." + }, + { + "key": "-5Uz0Pz-mI0:5ac4c46c83194c32726cc196f3613d29d5879479", + "video_id": "-5Uz0Pz-mI0", + "question": "Which player throws the first punch during the fight that breaks out at 3:29?", + "answer_choice_0": "Petermann.", + "answer_choice_1": "Graves.", + "answer_choice_2": "Baier.", + "answer_choice_3": "Bacek.", + "answer_choice_4": "Peleikis.", + "answer_id": 0, + "answer": "Petermann.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "At 3:29, I watched the action of the hockey game cease, and a fight broke out between a player on the Indians and Bulls. I watched a member of the Bulls team #6 deliver the first blow with a right hook, which makes impact with the jaw of the Indians player #87 at 03:32. I watched the Indians player remain on his feet as the two players' arms become entangled, and their bodies rotate on the ice, revealing the last name of the Bulls' player #6. I saw that his name \"Petermann\" rests above the numeral of his jersey." + }, + { + "key": "-5Uz0Pz-mI0:63a89f014e70025bd665989269f054f8c3ca1a57", + "video_id": "-5Uz0Pz-mI0", + "question": "What is the name of the Indians player who scores the first goal of the game?", + "answer_choice_0": "Mario Peleikis.", + "answer_choice_1": "Yannik Baier.", + "answer_choice_2": "Philipp Gunkel.", + "answer_choice_3": "Adam Graves.", + "answer_choice_4": "Igo Bacek.", + "answer_id": 1, + "answer": "Yannik Baier.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the game from 00:00-03:06. Until then, there has been no visible goal scoring on the screen; so in order to verify the score of the game, I checked the banner in the top left corner of the screen that reads, \"2. Dr. MEC 0 : 0 ECH\", suggesting that the game's score is 0 to 0. I watch as the Indians' left wing #92 fires a shot on goal at the far side of the ring, hitting the back of the net from 03:07-03:09. I watched as the video flashes titles at the bottom center of the screen reading, \"32. Min. 0:1\", indicating that the first goal of the game has been scored. Also, the top left banner of the screen's scoreboard has not been numerically adjusted from 0 to 1 in favor of ECH. Also flashing at the bottom of the screen is \"Yannik Baier #92\", thereby indicating that the name of the scoring player who wears the jersey #92 is named Yannik Baier." + }, + { + "key": "-5Uz0Pz-mI0:691c3fa2fb5089971393e086cb1bb239213fecbb", + "video_id": "-5Uz0Pz-mI0", + "question": "At what time does the team in red score their first goal of the game?", + "answer_choice_0": "They never score a goal.", + "answer_choice_1": "04:29.", + "answer_choice_2": "03:07.", + "answer_choice_3": "05:58.", + "answer_choice_4": "05:14.", + "answer_id": 1, + "answer": "04:29.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and looked for the time stamp when the team in red scored their first goal of the game. Goals occur at 03:07, 04:29, 05:14, and 05:58. The goal that occurs at 03:07 was scored by the team in white. All the other goals are scored by the team in red. Since the first of their goals occurs at 04:29, that makes 04:29 the answer." + }, + { + "key": "-5Uz0Pz-mI0:892b483a063102bf2079fe0455f2259f632cb78d", + "video_id": "-5Uz0Pz-mI0", + "question": "Of the advertisements displayed on the far side of the ice rink, which 2 company advertisements are shown twice in a row?", + "answer_choice_0": "Kegler and K\u00f6stritzer.", + "answer_choice_1": "Luhrmann and Weinberg Campus.", + "answer_choice_2": "K\u00f6stritzer and Rheingas.", + "answer_choice_3": "HASTRA and Kegler.", + "answer_choice_4": "Weinberg Campus and HASTRA.", + "answer_id": 0, + "answer": "Kegler and K\u00f6stritzer.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and looked at the advertisements displayed on the side of the ice rink. The advertisements come into view as the game begins at 00:12. I looked specifically for advertisements which are shown twice in a row. Immediately, I see \"K\u00f6stritzer\" (it is located in the top left side of the screen). At 00:32, more of the advertisements come into view near the center of the ice rink as the players move from the left side to the right side. At the top, one of the advertisements is repeated twice: \"Kegler\". Putting these together, I concluded that the answer is Kegler and K\u00f6stritzer." + }, + { + "key": "-5Uz0Pz-mI0:9f4f689a283b54f3dd592b178f78053ece1336c6", + "video_id": "-5Uz0Pz-mI0", + "question": "How many officials stop the punching opponents at the end of the video's first fight?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "0.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the initial banner at the top of the video display the competing teams: the black and red Bulls' logo set against the blue and red Indians logo. I noticed that the team's colors are difficult to discern, so I watched the video from 0:28-0:30, noticing the black letters of \"Bulls\" were scrawled across the white ice. Therefore, I was able to discern that the Bulls were the home team, and as is customary in all sports, the home teams don their color jersey while the visiting team wears white jerseys. I watched the Bulls and the Indians exchange competing shots in each other's restricted zone through 02:06. I witnessed the Bulls player #5 and Indians player #26 named Peleikis grapple each other's arms, tugging at the other's jerseys. I watched them begin exchanging punches at 02:16 in the video, with Peleikis firing the first shot. I watched the larger Bulls player throw the Indians' Pelekis to the ice, gaining the upper hand as he leaps on top of his sparring opponent. At 02:26, I saw the left official hop on top of the felled hockey players, and as the camera pans out at 02:27, another official has entered the frame, peeling the tussling players apart. That's a total of two officials who have attempted to disrupt the fighting hockey opponents." + }, + { + "key": "-5Uz0Pz-mI0:a958c5ee55d32ed5b7beb495052bb524a597af97", + "video_id": "-5Uz0Pz-mI0", + "question": "If the shot on goal at 04:23 had gone into the net, what would the score have been after the goal?", + "answer_choice_0": "2-0.", + "answer_choice_1": "3-1.", + "answer_choice_2": "2-1.", + "answer_choice_3": "1-1.", + "answer_choice_4": "2-2.", + "answer_id": 3, + "answer": "1-1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video to understand what the score would be if the shot on goal was successful at 04:23. Before this time, the score is shown in the scoreboard in the upper left corner as 1-0 in favor of ECH. Watching the rest of the video before this shot, the only successful goal at this point occurred at 03:07, when the team in white scores. So, the team in white must be ECH on the scoreboard, while the team in red must be the other team, Dr. MEC. At 04:23, the team in white is on defense, and the shot originates from someone on the team in red. So, if the team in red had scored this goal, it would have been their first. Thus, the score would be 1-1." + }, + { + "key": "-5Uz0Pz-mI0:e232ce2f879eaf274c69aebf9ec719211bf3b4fb", + "video_id": "-5Uz0Pz-mI0", + "question": "How many fights occur in the video, causing prolonged breaks in the action of the game?", + "answer_choice_0": "0.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and looked for the number of fights that occur during the course of the video. Fights break out at 02:06 and 03:29, both of which cause prolonged stoppages during the course of the game. At 01:55, a fight almost breaks out, but the two players facing each other are immediately separated. So, the answer is 2." + }, + { + "key": "-8Az6UgyLVQ:3358b87668526db488c2ad2e996e709fc5875e3e", + "video_id": "-8Az6UgyLVQ", + "question": "How many flags are waving at 07:00?", + "answer_choice_0": "2.", + "answer_choice_1": "10.", + "answer_choice_2": "9.", + "answer_choice_3": "5.", + "answer_choice_4": "7.", + "answer_id": 4, + "answer": "7.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 07:00, I searched for flags and found them positioned along the top rim of the framework above the starting line. I counted the number of waving flags starting at the left. The total number was 7. Therefore, there are 7 flags waving at 07:00." + }, + { + "key": "-8Az6UgyLVQ:61951f5d3f4ddec6cd8c103cb29b319d72036048", + "video_id": "-8Az6UgyLVQ", + "question": "How many racing cars are on the track at 00:15 - 00:45?", + "answer_choice_0": "1.", + "answer_choice_1": "6.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 00:15, I saw and counted 2 racing cars on the track. Then, from 00:15 - 00:45, I didn't see any other drifting cars. Therefore, there are 2 racing cars on the track at 00:15 - 00:45." + }, + { + "key": "-8Az6UgyLVQ:7868691a3ade7abfd4f73fb175a2e8b1a97bf590", + "video_id": "-8Az6UgyLVQ", + "question": "What happens after the lime green car merges into the lane beside the teal car at 00:18?", + "answer_choice_0": "The lime green car crashes.", + "answer_choice_1": "They drift a series of donuts.", + "answer_choice_2": "The teal car increases speed.", + "answer_choice_3": "They collide into the barrier.", + "answer_choice_4": "They glide together into a drift.", + "answer_id": 4, + "answer": "They glide together into a drift.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 00:18, I noticed the lime green car merging into the same lane beside the teal car. As they approached a curve, I saw them merge together into a drift, with the teal car speeding slightly ahead of the lime green car at 00:19. Therefore, after the lime green car merges into the lane beside the teal car at 00:18, they glide together into a drift." + }, + { + "key": "-8Az6UgyLVQ:ac347c7479606f2aa7c6f7fb517b366a6e764aa8", + "video_id": "-8Az6UgyLVQ", + "question": "What is the shape of the race track at 00:01?", + "answer_choice_0": "Figure-eight.", + "answer_choice_1": "Tri-oval.", + "answer_choice_2": "Oval.", + "answer_choice_3": "S-shaped.", + "answer_choice_4": "Linear.", + "answer_id": 0, + "answer": "Figure-eight.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the race track at 00:01. Then, I noticed the track was shaped with three connected loops to form a figure-eight pattern. Therefore, the shape of the rack track at 00:01 is a figure-eight." + }, + { + "key": "-8Az6UgyLVQ:bdc193b36a37f71a62bd5b1611b3f9e8c288de16", + "video_id": "-8Az6UgyLVQ", + "question": "What does the graphic in the top left corner say at 06:18?", + "answer_choice_0": "2024.", + "answer_choice_1": "Chase.", + "answer_choice_2": "OAA.", + "answer_choice_3": "OIDC.", + "answer_choice_4": "Live.", + "answer_id": 2, + "answer": "OAA.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found a graphic logo in the top left corner of the screen at 06:18. Then, I read the top line of the graphic, closest to the top left corner, which read \"OAA\". Therefore, the graphic in the top left corner of the screen at 06:18 says \"OAA\"." + }, + { + "key": "-8Az6UgyLVQ:bff061f4988f6dd3babd524355648168aad3f6ed", + "video_id": "-8Az6UgyLVQ", + "question": "At 06:08, where is the black car in relation to the yellow car?", + "answer_choice_0": "In front of it.", + "answer_choice_1": "Behind it.", + "answer_choice_2": "To its left.", + "answer_choice_3": "To its right.", + "answer_choice_4": "On top of it.", + "answer_id": 0, + "answer": "In front of it.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 06:08, I found the black car and the yellow car as they were drifting on the track. I then examined their positions relative to each other and noticed that the yellow car was behind the black car. Therefore, the black car is in front of the yellow car at 06:08." + }, + { + "key": "-8Az6UgyLVQ:d57dc523a6ee2d64707b78ae4b2bbf7e9e80fa85", + "video_id": "-8Az6UgyLVQ", + "question": "At 14:48 - 14:53, what happens to the teal drifting car?", + "answer_choice_0": "It bumped into several curbs, then stopped.", + "answer_choice_1": "It sparked and burst into flames, then stopped.", + "answer_choice_2": "It crashed into the nearby car, then stopped.", + "answer_choice_3": "It rotated counterclockwise, then stopped.", + "answer_choice_4": "It flipped over and into the air, then stopped.", + "answer_id": 0, + "answer": "It bumped into several curbs, then stopped.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 14:48, I saw the teal car lose control while driving. Another dark car drifting alongside the teal car blocked its path as the dark car rotated in front, causing the teal car to bump into the curbs to its left. Then, at 14:49, the teal car came to a stop. Then, from 14:49 - 14:53, I saw the teal car remain stationary. Therefore, at 14:48 - 14:53, the teal car bumped into several curbs, then stopped." + }, + { + "key": "-AY84ybskqI:198221005a7705fa73959d93d47c329392676fb7", + "video_id": "-AY84ybskqI", + "question": "How many people are on the tennis court directly behind the woman on the far side of the court when the protagonist says \"I went from being just the flattest, hardest hitter\"?", + "answer_choice_0": "3", + "answer_choice_1": "5", + "answer_choice_2": "1", + "answer_choice_3": "4", + "answer_choice_4": "2", + "answer_id": 3, + "answer": "4", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I listened for the target phrase and heard it from 00:30-00:32. At 00:31, the camera pointed toward the far side of the court and I observed that there was another tennis court behind the woman on the far side. I counted that there were 4 people on the court directly behind the woman. I also noticed someone walking behind that court beyond the fence, but since that person was not on a tennis court, I did not count them in the total. I also noticed a court behind and to the left of the woman, and did not count people on that court because it was not directly behind. Therefore, the total number of people was 4." + }, + { + "key": "-AY84ybskqI:2205fc8cc5a315685a9fe7e881cfc2db620b06a2", + "video_id": "-AY84ybskqI", + "question": "How many people are watching the protagonist and the other player from the sidelines between 00:16 and 00:23?", + "answer_choice_0": "6.", + "answer_choice_1": "5.", + "answer_choice_2": "8.", + "answer_choice_3": "4.", + "answer_choice_4": "7.", + "answer_id": 2, + "answer": "8.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I moved to 00:16 and observed a woman on the far side of the court serving. I kept watching and noticed the camera moving to follow the ball. At 00:16, the camera pointed toward the protagonist and showed people watching from the sidelines in the background. At 00:18, I had a clear view of the people on the sidelines, so I counted everyone who was facing the court. I counted 6 people facing the court with the protagonist and the other player. There was 1 additional person on the sidelines, but he faced a different court, so I did not count him. I continued watching and saw 2 more people at 00:21 on the far end of the sidelines facing the court, so I added 2 to my count. I watched for the remainder of the segment and did not find any additional people. Therefore, I counted 8." + }, + { + "key": "-AY84ybskqI:6766a8eb6f631579deac623ba2f92065fb43598d", + "video_id": "-AY84ybskqI", + "question": "How many times did the tennis ball cross the net between the players from the 00:30-00:40 timestamps in the video?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "6.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "While watching, I located the timestamps 00:30-00:40. As I watched, I counted the times the tennis ball was hit and crossed the net by the tennis players. The first time was at 00:30, the second at 00:32. Then, a third hit occurred at 00:34, crossing the net. Right after the ball crossed the net, it fell, and the other female player receiving it missed it. There were no more times the ball crossed the net before 00:40. Therefore, I concluded the ball crossed the net 3 times in total during the timestamps 00:30-00:40." + }, + { + "key": "-AY84ybskqI:68415e237802b9d8b3e663afa37eefcdc39e6f75", + "video_id": "-AY84ybskqI", + "question": "What other object does the main character hold briefly in the video, besides a tennis ball and racket?", + "answer_choice_0": "A water bottle.", + "answer_choice_1": "A wristband.", + "answer_choice_2": "Sunglasses.", + "answer_choice_3": "A towel.", + "answer_choice_4": "An energy bar.", + "answer_id": 0, + "answer": "A water bottle.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "While watching the video, I looked for parts where the main character holds objects other than a tennis racket or a tennis ball. I found her holding a white water bottle at the 00:58 mark, as she drinks from it. I watched further until the end of the video and only saw her with either a tennis ball or a racket. Therefore, I concluded that the only object she held briefly in the video was a water bottle." + }, + { + "key": "-AY84ybskqI:cf9de84ceaebcf80cf06bee61f64f927e61cb1a0", + "video_id": "-AY84ybskqI", + "question": "Is the ball hit successfully at 01:14?", + "answer_choice_0": "Yes, the protagonist returns the ball successfully.", + "answer_choice_1": "No, it's between points.", + "answer_choice_2": "Yes, the woman in purple returns the ball successfully.", + "answer_choice_3": "No, the protagonist fails to return the ball.", + "answer_choice_4": "No, the woman in purple fails to return the ball.", + "answer_id": 4, + "answer": "No, the woman in purple fails to return the ball.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I went to 01:14 and noticed that the camera was pointed toward the woman in purple. I continued watching and saw a tennis ball bounce toward the woman in purple. At 01:14 I saw the woman swing the racket at the tennis ball and make contact. I saw that the tennis ball flew up. At 01:15 I noticed that the woman in purple got out of a ready stance and looked up above the frame. From 01:16-01:18 I saw the protagonist walk in front of the camera and off the left edge of the court. At 01:17 I saw the protagonist reach out her racket and at 01:18 I saw her stop a tennis ball that was far out of bounds on the left side. Therefore, I determined that at 01:14 the ball was hit by the woman in purple, but she failed to successfully return it." + }, + { + "key": "-AY84ybskqI:f792919bacef87bc676ebcac4b29fc1d6fe34ce1", + "video_id": "-AY84ybskqI", + "question": "When is a school bus visible for the second time?", + "answer_choice_0": "When the protagonist says being on the bench can \"feel a little lonely\".", + "answer_choice_1": "When the narrator says the protagonist became the \"Number one singles player\".", + "answer_choice_2": "When the narrator says that for the protagonist, the tennis court is \"her happy place\".", + "answer_choice_3": "When the protagonist says she appreciates seeing the children she works with \"love it just as much\".", + "answer_choice_4": "When the narrator says the protagonist is probably \"teaching the game\".", + "answer_id": 0, + "answer": "When the protagonist says being on the bench can \"feel a little lonely\".", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched for a school bus and saw it for the first time at 01:18 -- it is barely visible behind a windscreen in the background. Then, I found another at 01:39. This is the second, so I listened to what the protagonist was saying while the school bus was present. At 01:45 I heard her say that being on the bench can \"feel a little lonely\"." + }, + { + "key": "-AY84ybskqI:f85b38b6bf15304a524da59111f36a5af3cd28ea", + "video_id": "-AY84ybskqI", + "question": "What is the ratio of side steps to ball tosses when the woman in gray volunteers with Inner City Tennis?", + "answer_choice_0": "4:1).", + "answer_choice_1": "3:1.", + "answer_choice_2": "1:1.", + "answer_choice_3": "5:1.", + "answer_choice_4": "2:1.", + "answer_id": 1, + "answer": "3:1.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "First, I searched for the section about volunteering with Inner City Tennis. I heard this phrase at 01:54 and saw a sign that read \"Inner City Tennis\" at 01:54. Immediately after, the woman in the gray shirt is opposite a child and doing a training drill. I counted each sidestep by the woman in gray. I saw her take a side step at 01:58, 01:59, 02:00, two at 02:01, and one at 02:02. In total, I counted 6 side steps. Then I counted the number of times the woman in gray tossed the ball. I counted a toss at 01:59 and 02:02. In total, I counted 2 tosses. Since there were 6 sidesteps and 2 tosses, that makes the ratio 3:1." + }, + { + "key": "-Bdlf7Ke5aU:388a71fed8df924ea6e32e8cad3edd48a7cd3c80", + "video_id": "-Bdlf7Ke5aU", + "question": "How many tennis balls does Roger Federer pull out of his pocket from 08:05-09:05?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the span of the video specified in the question, watching for Roger Federer to pull tennis balls out of his pocket, and counting the number of times he did so. The first instance I observed happened at 08:21, and the second visible instance happened at 08:47." + }, + { + "key": "-Bdlf7Ke5aU:687bcff24c7ad8cf089f6cfbc099587a82178062", + "video_id": "-Bdlf7Ke5aU", + "question": "Does Bill Gates hit the ball at 02:51?", + "answer_choice_0": "No, Federer hits the ball into the net.", + "answer_choice_1": "Yes, he successfully returns the ball.", + "answer_choice_2": "No, Federer successfully returns the ball.", + "answer_choice_3": "No, the opponent hits the ball to Gates.", + "answer_choice_4": "Yes, but he hits the ball into the net.", + "answer_id": 1, + "answer": "Yes, he successfully returns the ball.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for the specified time of 02:51. I recognized that Bill Gates was on the far side of the court in the left half (from his perspective). I observed Gates swing his racket at a tennis ball at 02:51. I saw that the tennis ball passed over the net successfully." + }, + { + "key": "-Bdlf7Ke5aU:6ad125d166d5bbcb80b9e2f0cbc3699c01908971", + "video_id": "-Bdlf7Ke5aU", + "question": "Not counting the serve, how many times is the ball hit back and forth in the round that puts Federer up 40-30 in the singles set?", + "answer_choice_0": "26.", + "answer_choice_1": "20.", + "answer_choice_2": "15.", + "answer_choice_3": "24.", + "answer_choice_4": "21.", + "answer_id": 1, + "answer": "20.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the round that put Federer up 40-30 in the singles set, which I was able to identify afterward by the screen showing \"Federer 40, Isner 30\" following the round at 09:50. I then watched the round up to that point, which begins at 09:07. Federer serves the ball at 09:09, which I did not count as part of the total, and I then watched and listened from 09:09 to 09:37 for the number of times the ball was hit in the round. I had to listen for Isner's hits because he was off-screen, but I could see most of Federer's. When the point finished, I counted a total of 20 balls before Isner missed at 09:37." + }, + { + "key": "-Bdlf7Ke5aU:a968f300dce927aca409ae8f15ccf6de7e108ac4", + "video_id": "-Bdlf7Ke5aU", + "question": "When Roger Federer is shown on the square TV screen during his last interview, an advertisement for which company can be seen directly below the TV screen?", + "answer_choice_0": "Alaska Airlines.", + "answer_choice_1": "Hyatt Place.", + "answer_choice_2": "Microsoft.", + "answer_choice_3": "Rolex.", + "answer_choice_4": "Starbucks.", + "answer_id": 1, + "answer": "Hyatt Place.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the portion of the video where Roger Federer's final interview was conducted, and where he could be seen on the square TV screen: an interview on the TV screen first occurs at 07:48, but it isn't the final interview, so I kept watching. At 13:54 Federer does another interview. This turns out to be the last one, since, when it finishes at 17:49, the video ends without any more interviews. So I looked at this interview and found a good shot of the advertisement below the TV screen at 15:40, where I was able to easily identify the advertisement directly beneath the TV screen: it read \"Hyatt Place.\"" + }, + { + "key": "-Bdlf7Ke5aU:b7f6c201ff1fdb44433361761d968413bcc833d3", + "video_id": "-Bdlf7Ke5aU", + "question": "Of the following events that occur from 02:50-03:20, which event occurs fourth: Roger Federer bounces a ball to John Isner, Bill Gates and Roger Federer high five, Bill Gates returns a volley, Roger Federer returns a serve, and Roger Federer addresses the crowd?", + "answer_choice_0": "Roger Federer bounces a ball to John Isner.", + "answer_choice_1": "Roger Federer returns a serve.", + "answer_choice_2": "Roger Federer addresses the crowd.", + "answer_choice_3": "Bill Gates returns a volley.", + "answer_choice_4": "Bill Gates and Roger Federer high five.", + "answer_id": 2, + "answer": "Roger Federer addresses the crowd.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the sequence of the video from 02:50-03:20, taking note of the order in which events occur. I noted that the first event of those listed was Bill Gates returning a volley at 02:52. I noted the second event at 02:53, when Federer took a ball out of his pocket and bounced it across the net to John Isner (who could be seen across from Federer at 02:50). The third event in the sequence occurred at 02:56, when I observed Roger Federer and Bill Gates high five. The fourth event occurred from 03:06-03:10, when I heard Roger Federer address the crowd, loudly saying \"this is where we make our move\" - since this occurred fourth out of the events, it is the correct answer. The fifth event, Roger Federer returning a serve, occurred at 03:13." + }, + { + "key": "-Bdlf7Ke5aU:d29bb328a1f436334ee52918436772fe32c5088e", + "video_id": "-Bdlf7Ke5aU", + "question": "A tech company's logo is fully visible for what percentage of the first five minutes?", + "answer_choice_0": "2.5%.", + "answer_choice_1": "12.5%.", + "answer_choice_2": "7.5%.", + "answer_choice_3": "10%.", + "answer_choice_4": "5%.", + "answer_id": 3, + "answer": "10%.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the video and noted each time a tech company's logo was fully visible in the background during the first five minutes. I first observed the Microsoft logo, a tech company, at 01:42 and saw that it was visible until 01:45. I saw noted the timestamps for every subsequent time I saw the Microsoft logo: 01:50-01:52, 02:08-02:13, 03:11-03:25, 03:48-03:50, 04:06-04:10, 04:18-04:24, 04:28-04:32. I did not observe any other tech company's logo fully visible in the background during the first five minutes. I added the durations of each segment and found that a tech company's logo is fully visible in the first five minutes totalled 30 seconds. To find the percentage of time this logo was present, I calculated that there were 300 seconds in the first five minutes (5x60=300) and divided 30 by 300. This equaled 0.1, or 10%." + }, + { + "key": "-Bdlf7Ke5aU:e13f97e132a51144f8aa3525f9dad5d77d4d3e45", + "video_id": "-Bdlf7Ke5aU", + "question": "In the first game Federer serves in the singles match, how many more times does Federer bounce the ball on his second serve compared to his first?", + "answer_choice_0": "0.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "First, I needed to find out when the singles match began. At 07:51, I heard Federer say \"I'm ready for you, John. I'm coming after you\" while talking to a commentator. I observed that John Isner smiled and walked away at 07:53. I observed that Roger Federer walked away from the commentator and toward the baseline of the court from 07:57-08:03, signaling the beginning of the singles match. I observed Federer on the baseline preparing for his first serve at 08:15. From 08:15-08:17, I counted that he bounced the ball three times before his first serve. After, at 08:21, I saw Federer turn back to the baseline and take a ball from his pocket, preparing for his second serve. From 08:21-08:25, I counted that Federer bounced the ball five times before his second serve. I subtracted 3 from 5 and found that he used 2 more bounces before his second serve in the singles match." + }, + { + "key": "-Bdlf7Ke5aU:f769b4595d9f2407a03e290b954c2b4923775295", + "video_id": "-Bdlf7Ke5aU", + "question": "How many people are seen on Federer's side of the court at exactly 04:09?", + "answer_choice_0": "2.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I went to the specified timestamp and observed 2 people on the court, Federer and Bill Gates. I noticed 2 more people in the background as well, a ball girl and a line judge. I added this together and came to 4 people in total." + }, + { + "key": "-D_S2Ys7m7M:1904c3b0959b18d1d3535f24093b2ef297b95a29", + "video_id": "-D_S2Ys7m7M", + "question": "How long would it take someone to crimp the sides of the pie with a fork if they took 100% more time than the woman in the video?", + "answer_choice_0": "50 seconds", + "answer_choice_1": "44 seconds", + "answer_choice_2": "90 seconds", + "answer_choice_3": "96 seconds", + "answer_choice_4": "30 seconds", + "answer_id": 2, + "answer": "90 seconds", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I first looked for where the woman is crimping the sides of the pie with a fork. She starts at 06:29 and ends at 7:14. Calculating the time between the intervals gives a total of 45 seconds in the video. 100% of 45 is 45, so if someone took 100% more time to crimp the sides, they would finish in 90 seconds." + }, + { + "key": "-D_S2Ys7m7M:3b3a6c03678abff0f0f4fad83cdae681c49f586b", + "video_id": "-D_S2Ys7m7M", + "question": "What does the cook do with her hand after crimping the first pie?", + "answer_choice_0": "She burns it on pie filling.", + "answer_choice_1": "She wipes it on a towel.", + "answer_choice_2": "She covers it in flour.", + "answer_choice_3": "She puts on a latex glove.", + "answer_choice_4": "She takes off her ring.", + "answer_id": 3, + "answer": "She puts on a latex glove.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video until I saw the cook first crimping a pie at 06:29. She finishes crimping it and places it onto a platter from 07:15-07:19. At 07:19 I can see a blue latex glove on her rightmost hand." + }, + { + "key": "-D_S2Ys7m7M:8cd5c9afac6c81a751ebbddf9c4cd3421efb47ac", + "video_id": "-D_S2Ys7m7M", + "question": "What is the cook doing when the music switches back to the first song in the video?", + "answer_choice_0": "Frying a pie.", + "answer_choice_1": "Filling a pie.", + "answer_choice_2": "Crimping a pie.", + "answer_choice_3": "Rolling pie dough.", + "answer_choice_4": "Seasoning pie filling.", + "answer_id": 1, + "answer": "Filling a pie.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I started watching the video and noted the song playing at the start. At 04:05 I heard the song change to a different piece of music. I continued watching until I heard the song change again at 06:07. I identified the song playing as the one from the beginning of the video, and looked on screen to see the cook filling a pie at that time." + }, + { + "key": "-D_S2Ys7m7M:adbbc969f9f5ecd66f4bc55a69e0d8e89aa6acd9", + "video_id": "-D_S2Ys7m7M", + "question": "What's the average time it takes to fold (and not crimp) a pie in the video?", + "answer_choice_0": "10.33 seconds.", + "answer_choice_1": "11.67 seconds.", + "answer_choice_2": "12 seconds.", + "answer_choice_3": "9 seconds.", + "answer_choice_4": "13.5 seconds.", + "answer_id": 1, + "answer": "11.67 seconds.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to see the moments when pies were filled and noted them from 06:10-06:28, 07:19-07:30, and 07:49-07:55. I subtracted the start times from the end times to get totals of 18, 11, and 6 seconds, respectively. I averaged those numbers to get a final time of 11.67 seconds." + }, + { + "key": "-D_S2Ys7m7M:bdc630ecc10db547c61da0537ad3fbe269a16475", + "video_id": "-D_S2Ys7m7M", + "question": "Approximately how long would it take the woman to knead the dough if she was working twice as fast?", + "answer_choice_0": "30 seconds.", + "answer_choice_1": "45 seconds.", + "answer_choice_2": "2 minutes.", + "answer_choice_3": "3 minutes.", + "answer_choice_4": "20 seconds.", + "answer_id": 1, + "answer": "45 seconds.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video and kept track of how long it takes the woman to knead the dough in the video. She begins mixing the dough at 01:11 with a spoon to incorporate the water. Then, at 01:21, she begins mixing and kneading by hand. She continues kneading the dough until 02:40. Therefore, it takes her 1 minute and 29 seconds to knead the dough in the video, or 89 seconds. If she was working twice as fast, it would have taken her approximately 45 seconds." + }, + { + "key": "-D_S2Ys7m7M:c561d0f1235e95563646998b72c81726476112de", + "video_id": "-D_S2Ys7m7M", + "question": "How many crimps (counting raised edges only) does the woman make on average per second when she's crimping the pie?", + "answer_choice_0": "1.32 crimps per second.", + "answer_choice_1": "0.62 crimps per second.", + "answer_choice_2": "1.84 crimps per second.", + "answer_choice_3": "1.04 crimps per second.", + "answer_choice_4": "1.16 crimps per second.", + "answer_id": 2, + "answer": "1.84 crimps per second.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I first looked for where the woman is crimping the pie. She starts at 06:30 and ends at 7:14. The length of time she spends crimping is thus 44 seconds. In that range, she touches the fork to the pastry dough 27 times. The fork has four tines, so when it's pressed into the dough, it results in three raised edges each time. Therefore, the number of crimps is 27*3=81. The number of crimps per second on average is then 81/44 = 1.84." + }, + { + "key": "-D_S2Ys7m7M:fd0a932672d6f9ab09933e4bd8ffad1ce5c59f28", + "video_id": "-D_S2Ys7m7M", + "question": "How many prepared meat pies are on the plate that the woman shows to the camera as opposed to the finished number on the plate after they are fried?", + "answer_choice_0": "Fewer prepped pies than fried pies.", + "answer_choice_1": "Twice the amount of fried pies as prepped pies.", + "answer_choice_2": "Fewer fried pies than prepped pies.", + "answer_choice_3": "Twice the amount of prepped pies as fried pies.", + "answer_choice_4": "The same number of prepped pies as fried pies.", + "answer_id": 2, + "answer": "Fewer fried pies than prepped pies.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video and noticed that there were 8 prepped meat pies on the plate at 08:08-08:10 when the woman shows the plate to the camera. At 08:22, she is seen frying the pies. At the end of the video, the camera shows a plate of fried meat pies, ready to eat. There are 5 pies on the plate shown at 08:38-08:41. So the answer is fewer fried meat pies than prepped meat pies." + }, + { + "key": "-DlsYwroLME:3bf32f4566220a637740359c2ab44289daa11e78", + "video_id": "-DlsYwroLME", + "question": "Who wins the match after the photographer is showcased?", + "answer_choice_0": "The tennis player in blue.", + "answer_choice_1": "The tennis player in white.", + "answer_choice_2": "The tennis player in orange.", + "answer_choice_3": "The tennis player in purple.", + "answer_choice_4": "The tennis player in green.", + "answer_id": 0, + "answer": "The tennis player in blue.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for a moment where a photographer is highlighted and found this occurs at 01:04. I continued watching and listening for the announcer to reference the end of the match. I observed the player in black fail to return the ball to the player in blue at 01:15 and also heard the announcer say that the player in blue wins the match." + }, + { + "key": "-DlsYwroLME:43c4e2a7e69299e6b324e08a79cc18cdb6f836e2", + "video_id": "-DlsYwroLME", + "question": "What happens to the tennis ball after the tennis player in black builds a 5 to 2 lead?", + "answer_choice_0": "It rolls to the right.", + "answer_choice_1": "It bounces up and down.", + "answer_choice_2": "It rolls to the left.", + "answer_choice_3": "It goes into the stands.", + "answer_choice_4": "It rolls towards the net.", + "answer_id": 2, + "answer": "It rolls to the left.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I listened for the announcer to reference a moment when the score became 5 to 2. I found this moment at 00:20. I went back to see who made the play to achieve that score and saw that the tennis player in blue hit the ball out of bounds. I concluded that the tennis player in black's lead is 5 to 2. I then watched what happened to the tennis ball after this play and saw it roll to the left." + }, + { + "key": "-DlsYwroLME:621d96e8f297e15fe3c53b82c88ecb99dd0440b1", + "video_id": "-DlsYwroLME", + "question": "Where is the player in the black shirt located on the tennis court when she plays an overhead shot?", + "answer_choice_0": "The far side of the court on the right.", + "answer_choice_1": "The far side of the court in the middle.", + "answer_choice_2": "The far side of the court in the rear.", + "answer_choice_3": "Situated off the court.", + "answer_choice_4": "The far side of the court on the left.", + "answer_id": 1, + "answer": "The far side of the court in the middle.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 00:32, I listened to the announcer say, \"Nice touch on an overhead shot by Adkins on this play\". I then scrolled back and identified the tennis player Zoe Adkins at 00:04 when the announcer said, \"Maple Grove Senior Zoe Adkins playing in the Class AA Tennis Singles Final\" while a woman with brown hair in a black shirt and yellow visor placed a drink into a cooler. Then, at 00:36, I saw Adkins, in the black shirt, play the overhead shot and observed that she was located on the far side of the court in the middle." + }, + { + "key": "-DlsYwroLME:6460ece7eaf97a05927db782485cb107019d183f", + "video_id": "-DlsYwroLME", + "question": "How many times does a tennis racket hit a ball in the match where the tennis player in blue wins the first set?", + "answer_choice_0": "8.", + "answer_choice_1": "6.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "6.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I listened for the moment where the announcer said that the player in blue won the first set and found this between 00:51-00:53. I then went back to watch that game. I found that it starts at 00:43. I watched the game looking for times that a tennis racket connects with a ball. I found them at 00:43, 00:44, 00:46, 00:48, 00:49, and 00:51. I counted the total number of times a tennis racket hits a ball and arrived at 6." + }, + { + "key": "-DlsYwroLME:73764888a3e98caf9318285e56faa5c15ffd54cf", + "video_id": "-DlsYwroLME", + "question": "What color is the second bottle the tennis player in black drinks from?", + "answer_choice_0": "Red and white.", + "answer_choice_1": "White and gray.", + "answer_choice_2": "Blue and black.", + "answer_choice_3": "Orange and blue.", + "answer_choice_4": "Purple and black.", + "answer_id": 4, + "answer": "Purple and black.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for a moment when the tennis player in black drinks from a bottle. I found the first occurs at 00:03. I looked for a second moment where she drinks from a bottle and found this at 00:09. I observed that the color of the bottle was purple and black." + }, + { + "key": "-DlsYwroLME:8ddc198880eb83a44ea983b5bc646044a0112544", + "video_id": "-DlsYwroLME", + "question": "What happens after the player in a black shirt is fatigued?", + "answer_choice_0": "She takes a sip from her water bottle.", + "answer_choice_1": "A cameraman is shown onscreen.", + "answer_choice_2": "An audience member screams her name.", + "answer_choice_3": "A coach gives her a hug.", + "answer_choice_4": "Her parents rush onto the court.", + "answer_id": 1, + "answer": "A cameraman is shown onscreen.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 00:55-01:02, I listened to the announcer say, \"A nice passing volley by Adkins for a point but after a three-set win in the semi-finals early in the day, she became fatigued.\" I paid attention to what happened after this, and I noticed that a cameraman was shown on-screen at 01:04." + }, + { + "key": "-DlsYwroLME:a769039c70e5f226104cc6218a72f677bf558cea", + "video_id": "-DlsYwroLME", + "question": "How many games are played before the player in blue wins the first set?", + "answer_choice_0": "10.", + "answer_choice_1": "14.", + "answer_choice_2": "13.", + "answer_choice_3": "12.", + "answer_choice_4": "8.", + "answer_id": 2, + "answer": "13.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I listened to the announcer explain that the set was tied after 12 games had been played between 00:42-00:45. I only heard the announcer reference one additional game as a tiebreaker after 12 games have been played. I also heard the announcer say that the player in blue won the set after the tiebreaker between 00:52-00:53. I added 1 to 12 and arrived at 13 total games before the player in blue wins the first set." + }, + { + "key": "-DlsYwroLME:e90f6c4c9945746f8e8c954601502668951450d1", + "video_id": "-DlsYwroLME", + "question": "What happens after the player in the blue shirt is named the Class AA Singles Champion for 2021?", + "answer_choice_0": "She hugs her mom on the court.", + "answer_choice_1": "She high-fives the player in the black shirt by the net.", + "answer_choice_2": "She jumps up and down on the court.", + "answer_choice_3": "She starts to cry on the court.", + "answer_choice_4": "She drinks some water off the court.", + "answer_id": 1, + "answer": "She high-fives the player in the black shirt by the net.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 01:13-01:15, I heard the announcer declare, \"Shahbaz wins the point and the match\". I continued to watch and listened as the announcer said, \"she's the Class AA Singles Champion for 2021\" at 01:17-01:20. I then scrolled back and confirmed that the player in the blue shirt is Sarah Shahbaz at 00:10, when the announcer mentioned her by name. After the match point happened, I watched as the player in the blue shirt approached the player in the black shirt at the net and gave her a high-five from 01:20-01:26." + }, + { + "key": "-DlsYwroLME:ee783a48ba7f56d483d4b223ccf45fe7b9a8f6d0", + "video_id": "-DlsYwroLME", + "question": "How many times is the audience featured during the match?", + "answer_choice_0": "7 times.", + "answer_choice_1": "2 times.", + "answer_choice_2": "0 times.", + "answer_choice_3": "3 times.", + "answer_choice_4": "5 times.", + "answer_id": 3, + "answer": "3 times.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I paid attention to each time the action moved away from the tennis match and focused on the audience. This happened at 00:21, 00:30, and 00:54. So, that is a total of 3 times." + }, + { + "key": "-KpTOB2hoG4:0fd25e043fc32f68e56225f6bb09f67547a3ba5d", + "video_id": "-KpTOB2hoG4", + "question": "How many times does an eagle logo appear as an onscreen graphic transition from one scene to another throughout the video?", + "answer_choice_0": "2", + "answer_choice_1": "4", + "answer_choice_2": "5", + "answer_choice_3": "3", + "answer_choice_4": "1", + "answer_id": 0, + "answer": "2", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video closely and waited for the first on screen graphic transition of the eagle logo. I found it at 04:50. Then, I watched for the second transition of the logo on screen at 12:59. The logo appears exactly 2 times. The eagle logo shows up in the background during scenes on occasion, but these images don't appear as onscreen graphics used to transition the video from one scene to another, so I didn't count them." + }, + { + "key": "-KpTOB2hoG4:77734869b731da8590af001385284326f56b3a4a", + "video_id": "-KpTOB2hoG4", + "question": "At what time does the red boxer's swing miss and hit the ropes in Round 3, if the miss had happened 30 seconds before?", + "answer_choice_0": "06:30.", + "answer_choice_1": "09:43.", + "answer_choice_2": "03:18.", + "answer_choice_3": "07:18.", + "answer_choice_4": "10:13.", + "answer_id": 1, + "answer": "09:43.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watch the start of Round 3, which happens at 09:09 by the ringing of the bell. (Even though on-screen shows a replay of an earlier sequence of punches, this is the start because the boxers are mid-fight by the time we see them at 09:16). I continue watching until 10:12 when the red boxer has moved closer to the ropes. Right at 10:13, his punch misses the blue boxer and hits the ropes. I subtract 10:13 by 30 seconds to get a time of 09:43." + }, + { + "key": "-KpTOB2hoG4:928f2a3f6d4bbd5848a8dc05d193668cbd95a6ab", + "video_id": "-KpTOB2hoG4", + "question": "What percentage of letters on the backs of the boxers' tank tops are vowels?", + "answer_choice_0": "16.6% repeating.", + "answer_choice_1": "83.3% repeating.", + "answer_choice_2": "50%.", + "answer_choice_3": "33.3% repeating.", + "answer_choice_4": "66.6% repeating.", + "answer_id": 3, + "answer": "33.3% repeating.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First, I looked to find the letters on the back of the boxers' tank tops. I noticed clearly that the back of the red boxer's shirt reads \"HUN\" at 00:59. A clear shot at 01:03 of the back of the blue boxer's top reads \"POL\". Having examined these letters, I realize that there are 6 total, with 2 of them being vowels. Putting this into a fraction, I get 2/6 or 1/3. As a percentage, this reads 33.3% repeating." + }, + { + "key": "-KpTOB2hoG4:9b5c3ae304ce1068e0f1ce5aeed3a0cd10e0349d", + "video_id": "-KpTOB2hoG4", + "question": "How many people behind the ring walk past it during Round 1?", + "answer_choice_0": "10.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "6.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for Round 1, finding it from 00:55 by the sound of a bell. I looked in the background and saw a silhouetted man cross the ring from behind from 01:00 to 01:08. He moves from the center left to the right until he is off-screen. Additionally, from 02:46 to 02:53 behind the boxers, I saw 4 silhouettes of people walk behind the ring, from the right to the left. I count these up to get 5 people. No one else moves across by the time the round ends at 04:09." + }, + { + "key": "-KpTOB2hoG4:a692202dfa074867bf90807a51863abeacf07fc9", + "video_id": "-KpTOB2hoG4", + "question": "What is the sum of every number on the scoreboard graphic when there are 35 seconds left in Round 2?", + "answer_choice_0": "83", + "answer_choice_1": "105", + "answer_choice_2": "89", + "answer_choice_3": "53", + "answer_choice_4": "16", + "answer_id": 1, + "answer": "105", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I saw that the graphic for Round 2 appeared at 05:20 and began counting down from 2 minutes and 49 seconds. I watched until the timer on the scoreboard graphic reached 35 seconds, which happened at 07:34. I then looked for every number on the graphic. I find a \"16\" in the top left corner, a \"52\" at the top, a \"2\" from \"Round 2\" at the bottom and a \"0\" and a \"35\" from the timer. I add these up, and I get 16+52+2+0+35=105." + }, + { + "key": "-KpTOB2hoG4:b850122b4205a68133d970f62cf4edde17122f35", + "video_id": "-KpTOB2hoG4", + "question": "What three events follow one another when the on-screen timer counts from 2:04 to 2:00 in Round 2?", + "answer_choice_0": "The red boxer threw punches, the blue boxer dodged, the Round 2 bell rang.", + "answer_choice_1": "The red boxer threw punches, the blue boxer dodged, the blue boxer threw punches.", + "answer_choice_2": "The blue boxer threw punches, the blue boxer kneeled, the blue boxer got his headgear checked.", + "answer_choice_3": "The blue boxer grapples the red boxer, the red boxer escapes, the red boxer threw punches.", + "answer_choice_4": "The red boxer threw punches, the referee paused the fight, the red boxer nods at the blue boxer.", + "answer_id": 4, + "answer": "The red boxer threw punches, the referee paused the fight, the red boxer nods at the blue boxer.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and paid close attention to the timer at the bottom center of the screen. At 06:05, I observed that the scoreboard graphic reads \"Round 2\" and right next to it the timer reads 2:04. I found the right place, so I turned my attention to the events that happened. I first see the red boxer throw punches at the blue boxer. Then I hear the referee yell and pause the fight. Finally, I see the red boxer nod at the blue boxer." + }, + { + "key": "-KpTOB2hoG4:c097b2ad754f48a2c482dc69deb41b8661393551", + "video_id": "-KpTOB2hoG4", + "question": "How many punches would Bernath throw at 2:41-2:40 in Round 1, if the number of his punches were doubled?", + "answer_choice_0": "2", + "answer_choice_1": "0", + "answer_choice_2": "3", + "answer_choice_3": "1", + "answer_choice_4": "4", + "answer_id": 4, + "answer": "4", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video and saw that 2:41 to 2:40 in round 1 happens from 01:15 to 01:17 in the video clip's time, and this is made clear because of a timer and a \"Round 1\" text line in a graphic in the bottom left corner of the screen. At this time, Bernath is in the center of the frame and Krzpiet is in the foreground at the left of the frame. I know Bernath to be Bernath because his name was listed on a graphic at the bottom of the screen at 00:00 when he, a boy in red, is getting his headgear fitted to his head. Bernath and Krzpiet both move toward each other, and Bernath throws 2 quick punches with his left hand. I doubled 2 punches and got 4 punches." + }, + { + "key": "-KpTOB2hoG4:ca6d4236f114e807f58a5fbd82eed8915676dd10", + "video_id": "-KpTOB2hoG4", + "question": "What causes Bernath to hit the ground in Round 1?", + "answer_choice_0": "He trips. (3) His opponent sweeps his legs.", + "answer_choice_1": "He twists an ankle.", + "answer_choice_2": "His opponent knocks him out.", + "answer_choice_3": "He collides with the referee.", + "answer_choice_4": "His opponent shoves him.", + "answer_id": 4, + "answer": "His opponent shoves him.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched Round 1 from when it starts at 00:55 to when Bernath hits the ground. I know Round 1 starts at 00:55 because a bell sounds and the boxers begin to fight after first being at their corners. I kept watching till 02:08, when I noticed Bernath collapses to his arms and knees. I watched just a little bit before this to see what happened, and I noticed that his opponent grappled and shoved him to the ground." + }, + { + "key": "-Ngy_kr1oGQ:16a232444bd66dc3553a149d25ff91f81b25baef", + "video_id": "-Ngy_kr1oGQ", + "question": "How many times does the cook's husband appear in the video?", + "answer_choice_0": "6", + "answer_choice_1": "2", + "answer_choice_2": "1", + "answer_choice_3": "3", + "answer_choice_4": "5", + "answer_id": 1, + "answer": "2", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I saw the cook's husband appear at 00:06 and 07:58, where he remained on-screen until the end of the video. This totals 2 appearances. Therefore, the cook's husband appears 2 times in the video." + }, + { + "key": "-Ngy_kr1oGQ:16d58a88c4636f8fd16efc689afaa55fdef07a39", + "video_id": "-Ngy_kr1oGQ", + "question": "What is sizzling in the skillet after the cook says \"Maybe 10 minutes tops\"?", + "answer_choice_0": "Pinto beans.", + "answer_choice_1": "Jackfruit.", + "answer_choice_2": "Black beans.", + "answer_choice_3": "Peppers.", + "answer_choice_4": "Tofu chunks.", + "answer_id": 1, + "answer": "Jackfruit.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I heard the cook say \"Maybe 10 minutes tops\" at 00:03. This is followed by a clip of 5 ingredients: shredded cheese, beans, tortillas, vegetable slices, and jackfruit at 00:04-00:05. Then, at 00:05, I saw chunks of jackfruit sizzling in the skillet. Therefore, jackfruit is sizzling in the skillet after the cook says \"Maybe 10 minutes tops\"." + }, + { + "key": "-Ngy_kr1oGQ:3ad2f9cd36fd4d975f9bbfa6bef3e74e62e7df8f", + "video_id": "-Ngy_kr1oGQ", + "question": "What is on-screen right before and right after the screen becomes blurry for the first time?", + "answer_choice_0": "Pinto beans and the cook.", + "answer_choice_1": "Tortillas and salsa.", + "answer_choice_2": "Sliced vegetables and the cook.", + "answer_choice_3": "Jackfruit and shreds.", + "answer_choice_4": "The cook and sliced vegetables.", + "answer_id": 0, + "answer": "Pinto beans and the cook.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched to see when the video first went blurry. This happens from 03:26 to 03:29. I then backed up to the shot before it went blurry (03:24) and saw a pot of pinto beans. I then went forward to the shot after the screen corrected its blurriness (03:29) and saw the cook. Therefore, pinto beans are on-screen right before and the cook is on-screen right after the screen becomes blurry for the first time." + }, + { + "key": "-Ngy_kr1oGQ:3ee6c1fa092b19a79ef09a920fbb0556975e39a2", + "video_id": "-Ngy_kr1oGQ", + "question": "Not including the base, which ingredient is second when the woman builds the finished product?", + "answer_choice_0": "Beans.", + "answer_choice_1": "Veggies.", + "answer_choice_2": "Vegan cheese.", + "answer_choice_3": "Vegan sour cream.", + "answer_choice_4": "Jackfruit.", + "answer_id": 0, + "answer": "Beans.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the timestamp at 06:51 where the woman started to build the finished product. I understood from the recipe title shown on screen at 00:01 the woman was making vegan tacos. At 06:50, she laid a plate of tortillas on the counter. That was the dish's base. At 06:57, she topped the tortillas with vegan cheese. Next, were the beans at 07:04, veggies at 07:13, and finally, jackfruit at 07:26. By counting the number of ingredients, not including the tortillas, I concluded that the second ingredient added to the tacos were beans." + }, + { + "key": "-Ngy_kr1oGQ:4b6c12e2d6ec81244002a97ee32c5a55ad3fe444", + "video_id": "-Ngy_kr1oGQ", + "question": "If there were 2 more coffee machines in the kitchen, how many would there be total?", + "answer_choice_0": "2.", + "answer_choice_1": "0.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "4.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 03:10, I found 2 Keurig coffee machines in the kitchen, next to the stove. Since these were the only coffee machines in the kitchen, I counted a total of 2. I then calculated 2+2=4. Therefore, if there were 2 more coffee machines in the kitchen, there would be 4 total." + }, + { + "key": "-Ngy_kr1oGQ:65f30c61950d831b7abdf10ef93242596f9e6c82", + "video_id": "-Ngy_kr1oGQ", + "question": "How long does the meat substitute cook?", + "answer_choice_0": "4 minutes 17 seconds.", + "answer_choice_1": "2 minutes 10 seconds.", + "answer_choice_2": "3 minutes 36 seconds.", + "answer_choice_3": "2 minutes 49 seconds.", + "answer_choice_4": "3 minutes 21 seconds.", + "answer_id": 3, + "answer": "2 minutes 49 seconds.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "The meat substitute's packaging was visible at 00:05, where \"TEX-MEX JACKFRUIT\" was printed in white text across the front at the bottom. The woman mentioned the name of the meat substitute at 01:55, referring to it as jackfruit. Both instances confirmed what the meat substitute was. Next, the woman started to cook the jackfruit at 04:01 when she turned on the stove's burner. She served the meal at 06:50. By subtracting 04:01 from 06:50, this simple math problem led me to conclude that the jackfruit cooked for 2 minutes and 49 seconds." + }, + { + "key": "-Ngy_kr1oGQ:70a0a751ddafabcd5f709f0dbedc9744395b9b9b", + "video_id": "-Ngy_kr1oGQ", + "question": "What surfaces do the tortillas touch after the woman removes them from the package?", + "answer_choice_0": "Counter, plate, microwave.", + "answer_choice_1": "Microwave, parchment paper, counter.", + "answer_choice_2": "Parchment paper, microwave, and plate.", + "answer_choice_3": "Counter, parchment paper, plate.", + "answer_choice_4": "Plate, parchment paper, counter.", + "answer_id": 2, + "answer": "Parchment paper, microwave, and plate.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I searched for the timestamp where the woman removed the tortillas from the package. This occurred at 04:29. I continued to watch the video to determine all the surfaces the tortillas touched after that. I determined, at 05:08, the woman placed the tortillas on a sheet of parchment paper. At 05:19, the woman placed the tortillas in the microwave. Finally, at 06:50, the woman placed the tortillas on a black plate. Overall, the tortillas were placed on 3 surfaces: parchment paper, in the microwave, and on a plate." + }, + { + "key": "-Ngy_kr1oGQ:77d06382cd0b37e3b675ef28ebc0b13a331f6321", + "video_id": "-Ngy_kr1oGQ", + "question": "How many ingredients used in the vegan tacos are non-GMO certified?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I went back and watched for when all the vegan tacos' ingredients were displayed on the screen, from various angles, to read the packaging. These occur at 00:05, 01:47, 02:32, 03:02. In all angles, it is possible to see that the Vegan Gourmet Shreds are non-GMO, the Tex-Mex Jackfruit is non-GMO, the Organic Tortillas are non-GMO, the Pinto Beans are organic, and the sliced vegetables are not labeled. Because \"organic\" does not also mean \"non-GMO\", I can dismiss the Pinto Beans, in addition to the sliced vegetables being unlabeled. I then counted the number of non-GMO food products, calculating a total of 3. Therefore, 3 ingredients that are used in the vegan tacos are non-GMO certified." + }, + { + "key": "-Ngy_kr1oGQ:ddf5151242084f861599da1caa3cf13ffe064c55", + "video_id": "-Ngy_kr1oGQ", + "question": "What does the woman garnish the man's taco with before he takes a bite?", + "answer_choice_0": "Tabasco sauce.", + "answer_choice_1": "More vegan cheese.", + "answer_choice_2": "Fresh squeezed lime.", + "answer_choice_3": "Frank's hot sauce.", + "answer_choice_4": "No garnish.", + "answer_id": 4, + "answer": "No garnish.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I searched for the timestamp where the woman garnishes the finished tacos. This occurred at 08:18 when she added Tabasco sauce to her serving. The man said in reply, \"Not this cowboy\" at 08:21, indicating that he did not want any. He took a bite of the taco at 08:26 without adding any other ingredients. Therefore, the woman never garnished the man's taco with an additional topping before he took a bite." + }, + { + "key": "-Ngy_kr1oGQ:ec80091eb0b4ccd5de947953d7265eb5e2372626", + "video_id": "-Ngy_kr1oGQ", + "question": "Does the woman laugh before or after cooking the veggies?", + "answer_choice_0": "While cooking the veggies.", + "answer_choice_1": "She doesn't laugh.", + "answer_choice_2": "Before cooking the veggies.", + "answer_choice_3": "After cooking the veggies.", + "answer_choice_4": "While cooking the jackfruit.", + "answer_id": 3, + "answer": "After cooking the veggies.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the timestamp where the woman cooked the veggies. She first turned on the burner to cook them at 03:43. She declared they were ready at 06:49. Throughout those timestamps, I had not heard the woman laugh. Next, I continued searching for the timestamp to determine if the woman laughed at all. This finally occurred at 07:33, after she made a joke about jackfruit's pronunciation. I could determine then that the woman laughed after cooking the veggies." + }, + { + "key": "-ODflyuHFr0:2000ddfe05561e9b3abe554eeb63627ead10deb2", + "video_id": "-ODflyuHFr0", + "question": "According to the order it was presented, what is the third ingredient used to make green chutney?", + "answer_choice_0": "Palak.", + "answer_choice_1": "Ginger.", + "answer_choice_2": "Green chillies.", + "answer_choice_3": "Garlic.", + "answer_choice_4": "Mint leaves.", + "answer_id": 1, + "answer": "Ginger.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "While watching, I read a text on the screen at 00:28 that said \"for green chutney,\" and below that was another text that said \"palak\" which introduced the first ingredient to make the chutney. Then at 00:30, I read the text on the screen, and it said \"green chillies.\" That was the second ingredient presented. I continued watching, and at 00:31, I read a text that said \"ginger & garlic.\" Although ginger and garlic are presented at the same time, I noticed that ginger was the first word in the text, so I counted that as the third ingredient. Therefore, ginger is the third ingredient used to make the green chutney." + }, + { + "key": "-ODflyuHFr0:2e84379a00c64aed1bc89ebb49cb5007c9922923", + "video_id": "-ODflyuHFr0", + "question": "What's the difference in the number of silver bowls from the beginning of when the man starts cutting the sandwich diagonally to the end?", + "answer_choice_0": "0.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 02:50, I watched as the man started to cut the sandwich diagonally, based on his actions and the text I read on the screen that said \"cut the sandwich diagonally.\" Then I looked at the bowls on the table. There were a total of 5 bowls. I counted only 1 bowl that was orange and the other 4 bowls were silver. At 03:05, there are 5 silver bowls and no orange bowls. He finishes cutting the sandwich at 03:23 and there are still 5 silver bowls on screen. Therefore, there is 1 more silver bowl than there was when the man started cutting the sandwich diagonally." + }, + { + "key": "-ODflyuHFr0:40510d37b7422f789d29fce29c6bd5e18e8a9a71", + "video_id": "-ODflyuHFr0", + "question": "If the man decided to make more sandwiches, how many more could he make looking at the number of boiled potatoes he has not used?", + "answer_choice_0": "5.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "6.", + "answer_id": 3, + "answer": "4.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 01:48, the man slices a boiled potato onto the sandwiches. Then, I counted how many sandwiches were made with just 1 boiled potato and got 2. After, I looked at the remaining boiled potatoes he had in the bowl at 02:07 and counted 2. Since it takes 1 boiled potato to make 2 sandwiches, and he has 2 boiled potatoes leftover, I added 2 + 2 and got 4. Therefore, if the man decided to make more sandwiches, he could have made 4 more based on the number of boiled potatoes the man has not used." + }, + { + "key": "-ODflyuHFr0:5315e3f107f790978600a7b968c20c4cdb4ea7c1", + "video_id": "-ODflyuHFr0", + "question": "What is sprinkled 2 times on the sandwich?", + "answer_choice_0": "Sandwich masala.", + "answer_choice_1": "Coarse salt.", + "answer_choice_2": "Dried basil.", + "answer_choice_3": "Dried oregano.", + "answer_choice_4": "Black pepper.", + "answer_id": 0, + "answer": "Sandwich masala.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 01:43, I watched the man sprinkle the sandwich masala onto the sandwich. I also read the text on the screen that said \"sprinkle sandwich masala.\" Then, I continued watching and at 02:08, I watched the man sprinkle the sandwich masala onto the sandwich again. I also read the text on the screen that said \"sprinkle again with sandwich masala.\" I continued watching, and there were no other moments where the man sprinkled anything else onto the sandwich. Therefore, the man sprinkled sandwich masala 2 times onto the sandwich." + }, + { + "key": "-ODflyuHFr0:6ff56ea0204ec16d40799946c616fdadee6ad67d", + "video_id": "-ODflyuHFr0", + "question": "How many slices of cucumber are added to the sandwich?", + "answer_choice_0": "18.", + "answer_choice_1": "20.", + "answer_choice_2": "9.", + "answer_choice_3": "16.", + "answer_choice_4": "25.", + "answer_id": 0, + "answer": "18.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for when in the video the slices of cucumber are being added. They are all added to the sandwich from 01:27 to 01:41. I counted them and in total 18 slices are added." + }, + { + "key": "-ODflyuHFr0:c9b8a25a01ffcbd8dd4fdb63f9688dd400d2d52e", + "video_id": "-ODflyuHFr0", + "question": "How many more cucumbers are there on the sandwich compared to tomatoes?", + "answer_choice_0": "3.", + "answer_choice_1": "10.", + "answer_choice_2": "8.", + "answer_choice_3": "5.", + "answer_choice_4": "13.", + "answer_id": 2, + "answer": "8.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 01:41, I counted the cucumbers that were on the sandwich. I got a total of 18 cucumbers. At 02:34, I counted the tomatoes that were on the sandwich. I got a total of 10 tomatoes. Then, I subtracted 10 from 18 and got 8. Therefore, there are 8 more cucumbers on the sandwich compared to the tomatoes." + }, + { + "key": "-ODflyuHFr0:cf9a503aba652371c1ca2ba40fa2c8b85c10fb56", + "video_id": "-ODflyuHFr0", + "question": "If the number of ingredients in bowls were multiplied by the number of wedges in which the sandwich is cut, what would the answer be?", + "answer_choice_0": "60.", + "answer_choice_1": "36.", + "answer_choice_2": "56.", + "answer_choice_3": "9.", + "answer_choice_4": "21.", + "answer_id": 2, + "answer": "56.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I identified which ingredients were placed in bowls. I found this at 00:32 when all of the ingredients in the bowls were shown on the screen, and I counted a total of 7 bowls. I then confirmed this at 00:55 when all 7 of the bowls are shown again. I then looked to see how many wedges the sandwich is cut into. I found this at 02:47-03:42 and the sandwich was cut into 8 wedges. I then multiplied the number of ingredients in bowls, 7, by the total number of sandwich wedges, 8, and I found that 7X8 is 56." + }, + { + "key": "-ODflyuHFr0:d72b0b74f8fb5e337f3cface50db6cb4e455dcc4", + "video_id": "-ODflyuHFr0", + "question": "What is the 1st letter of the 2nd word for the 2nd ingredient to get ground in a mixer?", + "answer_choice_0": "O.", + "answer_choice_1": "L.", + "answer_choice_2": "M.", + "answer_choice_3": "C.", + "answer_choice_4": "E.", + "answer_id": 3, + "answer": "C.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I identified which ingredients needed to be ground in a mixer. I watched until, at 00:34, I found words on the screen that said \"Grind it in a mixer.\" I then scrolled back and observed which specific ingredients were involved in this step. The 1st ingredient listed was \"Palak\" at 00:28. The 2nd ingredient listed was \"Green Chillies\" at 00:30. I then observed that the 1st letter of the 2nd word for the 2nd ingredient to be ground in a mixer was the letter \"C.\"" + }, + { + "key": "-ODflyuHFr0:f0c2bc2d3703bf64bbd586f7a4fa47ca8eef2cbb", + "video_id": "-ODflyuHFr0", + "question": "Once the sandwich starts to get assembled, what is the fifth step?", + "answer_choice_0": "Add sliced onions.", + "answer_choice_1": "Apply chutney.", + "answer_choice_2": "Add sliced potatoes.", + "answer_choice_3": "Sprinkle with sandwich masala.", + "answer_choice_4": "Add sliced tomatoes.", + "answer_id": 2, + "answer": "Add sliced potatoes.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched until the sandwich started to get assembled, which occurred at 00:52 in the video. This was confirmed by the text \"Let's Start\" appearing on the screen. After that, I observed each step of the sandwich making process. At 00:55, I observed the 1st step, when the text on the screen said \"Apply Amul butter on the bread sliced.\" I found the 2nd step at 01:16 when the text on the screen said \"Apply green chutney to the bread.\" I found the 3rd step at 01:28 when the text on the screen said \"Place the sliced cucumber on the bread slice.\" I found the 4th step at 01:43 when the text on the screen said \"Sprinkle sandwich masala.\" Then I located the 5th step in the video at 01:52, which was \"Add sliced potatoes.\" Therefore, once the sandwich starts to get assembled the 5th step is \"Add sliced potatoes.\"" + }, + { + "key": "-PCNlAxHXAE:0bc9e1d11301dd8fe96b97b62e5a4224157757e7", + "video_id": "-PCNlAxHXAE", + "question": "Which decorative element adds to Buttigieg's shorts?", + "answer_choice_0": "A silver chain.", + "answer_choice_1": "Vertical stripes.", + "answer_choice_2": "Fringe.", + "answer_choice_3": "Horizontal stripes.", + "answer_choice_4": "Glitter.", + "answer_id": 2, + "answer": "Fringe.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I determined which boxer was Buttigieg. At 00:42, I noticed that the boxer with the purple, black, and white trunks had the word \"Buttigieg\" embroidered along the back of the waistband. I determined that this boxer was Buttigieg. As he moved side to side and up and down from 00:42-00:50, I noticed that there were fringes along the outer parts of each leg." + }, + { + "key": "-PCNlAxHXAE:16b23cb35397407664549dbfdb4a0af913e1a959", + "video_id": "-PCNlAxHXAE", + "question": "How many rounds of this match did this video show?", + "answer_choice_0": "6.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 0, + "answer": "6.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I began watching the video, and heard the announcer call out \"Round 1\" and a bell rang at 00:22. At 00:26, I noticed that a scoreboard with a clock counting down appeared in the bottom left corner of the screen. I observed that this scoreboard displayed \"1/6\" in the top left section, which I inferred to mean that it was round 1 of 6. Then the announcer called out \"Round 2\" at 03:28 and the bell rang to signify that the round was beginning. Confirming my earlier suspicion, I observed that the scoreboard now displayed \"2/6\" in the top left section at this round's information shortly after the round began at 03:32. I determined the beginnings of the following rounds the same way. The third round begins at the time code 06:33, and the scoreboard is showing 3/6 at the same time. Round 4 begins at 09:47 when the bell rings and the boxers walk towards each other. The scoreboard appears at 09:49 and shows the 4/6 in the upper left corner of the scoreboard. The 5th round begins at time code 12:51 when the bell rings out. The digital scoreboard is displayed at 12:55, and it shows 5/6 in the upper left-hand corner. The 6th round begins at time code 16:12, and the scoreboard is also shown in the lower left corner. The scoreboard is showing 6/6 in the upper left-hand corner. When the sixth round finished, I saw the referee hold each boxer by one hand in the center of the ring at 19:40 before a winner was declared. I watched the remainder of the video and did not see any more rounds. Therefore, the video shows 6 rounds of the boxing match." + }, + { + "key": "-PCNlAxHXAE:1bd6da0b8bd674b1037640d42c5937b7f3b45573", + "video_id": "-PCNlAxHXAE", + "question": "What is the person in the corner behind Buttigieg holding at 2:56?", + "answer_choice_0": "A video camera.", + "answer_choice_1": "A microphone.", + "answer_choice_2": "A bell.", + "answer_choice_3": "A smartphone.", + "answer_choice_4": "A flag.", + "answer_id": 0, + "answer": "A video camera.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I determined which boxer was Buttigieg. At 00:42, I noticed that the boxer with the purple, black, and white trunks had the word \"Buttigieg\" embroidered along the back of the waistband. I determined that this boxer was Buttigieg. Then, I watched the video until 02:56. I observed that Buttigieg was the boxer facing the camera. I looked over Buttigieg's shoulder and saw someone near the corner of the ring. I observed that this person was holding a video camera on their shoulder." + }, + { + "key": "-PCNlAxHXAE:4a5f0a3d9a24e6c802bdb202173a67ca18dbc65f", + "video_id": "-PCNlAxHXAE", + "question": "What kind of contact do Buttigieg and Stryczek make at 06:27?", + "answer_choice_0": "They tap gloves.", + "answer_choice_1": "Buttigieg lands a right hook.", + "answer_choice_2": "They do a one-armed embrace.", + "answer_choice_3": "They each have a glove on the other's shoulder.", + "answer_choice_4": "Stryczek lands a right jab.", + "answer_id": 0, + "answer": "They tap gloves.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I determined which boxer was Buttigieg. At 00:42, I noticed that the boxer with the purple, black, and white trunks had the word \"Buttigieg\" embroidered along the back of the waistband. At 00:42 I also saw that there was a scoreboard graphic in the lower left corner of the screen. I observed that there were two names. The name on top read \"Buttigieg\" and the name on the bottom read \"Stryczek\". Therefore I determined that the other boxer in the ring, the one wearing black shorts, was Stryczek. I moved to 06:27. At 06:27, I observed Buttigieg tap his left glove on Stryczek's left glove as they each walked in opposite directions." + }, + { + "key": "-PCNlAxHXAE:734502aa660e603a264433ec4d286d16247930cc", + "video_id": "-PCNlAxHXAE", + "question": "What's the last punch thrown in the first round?", + "answer_choice_0": "A left uppercut.", + "answer_choice_1": "A right cross.", + "answer_choice_2": "A left cross.", + "answer_choice_3": "A right hook.", + "answer_choice_4": "A right uppercut.", + "answer_id": 1, + "answer": "A right cross.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "As I watched the video, I observed that the two boxers were on opposite corners until a bell rang at 00:23. At the bell, I saw the boxers near the center of the ring and inferred from this that the first round had begun. Then at 00:26, I saw a graphic appear in the bottom left corner with a clock that began to count down from 2:56. I understood from my knowledge of boxing that this clock was counting down the time in the round. I moved forward 2 minutes and 40 seconds, to 03:06, so that I could watch the last 15 seconds of the round. At 03:22, I saw the boxer in the purple shorts throw 3 punches in quick succession. I saw that the last punch of this combo was thrown with his right hand and it crossed over his body to the left. There were no more punches thrown before I heard the bell ring at 03:24, signalling the end of the round. Therefore, I determined that the last punch thrown was a right cross." + }, + { + "key": "-PCNlAxHXAE:78752abbad51c820bf899bb27fbaa42f87de1c47", + "video_id": "-PCNlAxHXAE", + "question": "Relative to the camera, which way does the winner of the match face when toweling off with his support crew?", + "answer_choice_0": "Left.", + "answer_choice_1": "Away from the camera.", + "answer_choice_2": "Towards the camera.", + "answer_choice_3": "He's not shown toweling off.", + "answer_choice_4": "Right.", + "answer_id": 1, + "answer": "Away from the camera.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I went to the last minute to determine who the winner was. At 19:38, I saw both boxers stand in the middle of the ring with the referee. I heard the announcer begin to talk about the match, and heard him announce that Leli Buttigieg is still undefeated and has won the match from 19:47-19:53. I went backwards to the last time I heard a bell, signalling the end of the 6th round, and found it at 19:07. I identified Buttigieg by the embroidered lettering on the back of his waistband at 19:16 as he and the other boxer walked to the left. I watched for Buttigieg to towel off and saw this occur at 19:29. I noticed that there were four people on the other side of the ring, one of which was holding a towel to Buttigieg's face. I noticed that Buttigieg was facing away from the camera as he toweled off." + }, + { + "key": "-PCNlAxHXAE:7dc5dcbd582d2dd15f66c9c87cabcf0a5c8807af", + "video_id": "-PCNlAxHXAE", + "question": "Buttigieg is wearing what color trunks for the match?", + "answer_choice_0": "Green, white, and black.", + "answer_choice_1": "Maroon, black, and white.", + "answer_choice_2": "Purple, black, and white.", + "answer_choice_3": "Red and white.", + "answer_choice_4": "Black and white.", + "answer_id": 2, + "answer": "Purple, black, and white.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the boxing match from the beginning to help identify who Buttigieg is. I noticed at 00:08 that a large monitor is hanging from the ceiling that shows the two boxers. Their names are prominently displayed, as well as their pictures. However, I wanted to make sure I correctly identified the correct boxer. So I continued to watch the video. At 00:22, the announcer makes a comment about the \"Monster Leli Buttigieg\" being in the blue corner. However, I was not able to identify which corner was the blue, so I kept watching. The camera begins to zoom in on the boxers as the match starts. At 00:25, I am pretty sure I see that the boxer on the left has \"Leli\" embroidered on his trunks in the front waistband area. A scoreboard appears in the bottom left corner at 00:26. On the scoreboard, I can read the two boxers' names. Next to Buttigieg, there is a box with purple, white, and black colors. And next to that is a box that reads \"Trunks\". So I am thinking that Leli Buttigieg is wearing the trunks that are purple, white, and black. At 00:32, the camera changes angles and I can noticeably see that it does in fact say \"Leli\" in that area previously mentioned. And to finalize my decision, I saw at 00:41 that the boxer with \"Leli\" embroidered on the front of his shorts also has \"Buttigieg\" embroidered on the back waistband area of his shorts. His trunks are purple, white, and black." + }, + { + "key": "-PCNlAxHXAE:8dc1cb53c8802251d0bc9a4d3271cec9991e7b74", + "video_id": "-PCNlAxHXAE", + "question": "How many punches does Buttigieg throw from 05:00-05:15?", + "answer_choice_0": "13", + "answer_choice_1": "15", + "answer_choice_2": "2", + "answer_choice_3": "9", + "answer_choice_4": "3", + "answer_id": 3, + "answer": "9", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I determined which boxer was Buttigieg. At 00:42, I noticed that the boxer with the purple, black, and white trunks had the word \"Buttigieg\" embroidered along the back of the waistband. I determined that this boxer was Buttigieg. Then, I moved to 05:00 and watched until 05:15, counting the number of punches that Buttigieg threw. I saw the first punch at 05:00. I saw another punch at 05:03. I saw two punches at 05:07. I saw one punch at 05:08. I saw one punch at 05:09. I saw one punch at 05:10. I saw one punch at 05:12. And I saw one punch at 05:15. I counted the observed punches and came to a total of 9 punches between 05:00-05:15 from Buttigieg." + }, + { + "key": "-PCNlAxHXAE:b06288d15ab60e0d38769cebf41e9de8a8194d71", + "video_id": "-PCNlAxHXAE", + "question": "What is the third punch landed in round 1?", + "answer_choice_0": "A left hook.", + "answer_choice_1": "A left jab.", + "answer_choice_2": "A right jab.", + "answer_choice_3": "A right hook.", + "answer_choice_4": "A left uppercut.", + "answer_id": 3, + "answer": "A right hook.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "As I watched the video, I observed that the two boxers were on opposite corners until a bell rang at 00:23. At the bell, I saw the boxers near the center of the ring and inferred from this that the first round had begun. At 00:25 I saw the boxer in purple shorts make a punch. At 00:29, I saw the boxer in purple shorts attempt a punch, but noticed that the other boxer ducked to avoid it. This means the punch wasn't \"landed\", so I did not count this as the second landed punch. At 0:30, I saw the boxer in purple shorts land two punches in quick succession. I noted that the second of these punches was with his right arm and crossed towards the other boxer's face in a hooking motion. I used my boxing knowledge to determine that this is called a right hook." + }, + { + "key": "-PCNlAxHXAE:dea60ef419ef5aa58345aacae21a8f70018fd234", + "video_id": "-PCNlAxHXAE", + "question": "Why does the referee grab Buttigieg's arm in the last round?", + "answer_choice_0": "To pause the match and call for a technical review.", + "answer_choice_1": "To announce him as the winner.", + "answer_choice_2": "To separate him and the other boxer.", + "answer_choice_3": "To help him get up.", + "answer_choice_4": "To stop him from punching the other fighter after the bell rang.", + "answer_id": 2, + "answer": "To separate him and the other boxer.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First I determined which boxer was Buttigieg. At 00:42, I noticed that the boxer with the purple, black, and white trunks had the word \"Buttigieg\" embroidered along the back of the waistband. I determined that this boxer was Buttigieg. Then, I looked for the last round of the fight. At 00:26, I noticed that a scoreboard with a clock counting down appeared in the bottom left corner of the screen. I observed that this scoreboard displayed \"1/6\" in the top left section, which I inferred to mean that it was round 1 of 6. Then the announcer called out \"Round 2\" at 03:28 and the bell rang to signify that the round was beginning. Confirming my earlier suspicion, I observed that the scoreboard now displayed \"2/6\" in the top left section at this round's information shortly after the round began at 03:32. I looked for when the top left section of the scoreboard showed \"6/6\" for the first time, and found it at 16:13. I watched the last round and looked for the referee to grab Buttigieg's arm. This occurred at 16:54. I went backwards a few seconds to 16:50 and observed that at 16:51, the other boxer hooked his left arm underneath Buttigieg's right arm. At 16:52, I observed Buttigieg attempt to punch the other boxer and end up leaning in. At 16:54 when the referee grabbed Buttigieg's arm, I observed him hold onto it as he stepped in between the two boxers until 16:56. Thus, I determined that the reason the referee grabbed Buttigieg's arm was to temporarily halt the round and separate the boxers." + }, + { + "key": "-QACREXoI9w:024b0eaf391df24095385de63f21c312b3fa5f4d", + "video_id": "-QACREXoI9w", + "question": "How many boxes on the chess board are highlighted blue at 11:29?", + "answer_choice_0": "2.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the highlighted boxes on the chess board at 11:29. I then counted all the highlighted boxes, calculating a total of 2 blue and 2 green. Therefore, the number of boxes on the chess board that are highlighted blue at 11:29 is 2." + }, + { + "key": "-QACREXoI9w:1779abb94e1697bc0d48d987ae458eb3592cb6ea", + "video_id": "-QACREXoI9w", + "question": "How many more pawns has white activated compared to black at 12:22?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "1.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I observed the board at 12:22. First, I counted the number of pawns that had been moved by white from their starting position. I counted 4 white pawns outside of their starting positions (f4, e5, d3, and c3). Then I counted the number of pawns black had moved from their starting positions. I counted 3 pawns (e6, d5, and c4). I then calculated 4-3=1. Therefore, white has activated 1 more pawn compared to black at 12:22." + }, + { + "key": "-QACREXoI9w:1dba0883851e049fc405cd8c5a8f5cdcc73dcdfd", + "video_id": "-QACREXoI9w", + "question": "What is happening in the video displayed on the right side of the screen at 11:53 - 12:00?", + "answer_choice_0": "A boy drags a desk back and forth.", + "answer_choice_1": "2 girls are playing a game together.", + "answer_choice_2": "A girl dances in front of a crowd.", + "answer_choice_3": "A classroom of boys is learning math.", + "answer_choice_4": "A girl drums loudly on her desk.", + "answer_id": 0, + "answer": "A boy drags a desk back and forth.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 11:53, I found a video playing on the right side of the screen. In the video, I saw a boy dragging a school desk back and forth across the floor at 11:53 - 12:00. Therefore, a boy drags a desk back and forth in the video displayed on the right side of the screen at 11:53 - 12:00." + }, + { + "key": "-QACREXoI9w:1edfd361e888ac51628bf1fae133fa2c58d65379", + "video_id": "-QACREXoI9w", + "question": "What colors are the 3 chess boards that appear on-screen together?", + "answer_choice_0": "Blue, green, and brown.", + "answer_choice_1": "Red, blue, and green.", + "answer_choice_2": "Yellow, blue, and green.", + "answer_choice_3": "Red, brown, and blue.", + "answer_choice_4": "Brown, blue, and red.", + "answer_id": 0, + "answer": "Blue, green, and brown.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found and counted 3 chess boards that appear on-screen together at 01:30 - 01:36. I then noticed the individual chess boards were blue, green, and brown. Therefore, the colors of the 3 chess boards that appear on-screen together are blue, green, and brown." + }, + { + "key": "-QACREXoI9w:3088e10b016bac8a1a7f45fad533bde77cc8d50f", + "video_id": "-QACREXoI9w", + "question": "In the game that begins at 16:20, what is the fourth new piece that white plays?", + "answer_choice_0": "Knight.", + "answer_choice_1": "Queen.", + "answer_choice_2": "Bishop.", + "answer_choice_3": "Pawn.", + "answer_choice_4": "Rook.", + "answer_id": 2, + "answer": "Bishop.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the game that begins at 16:20, noting and counting the first four pieces that white plays. White's first move was a pawn at 16:20. Their second move was another pawn at 16:37. Their third move was a previously played pawn at 16:43, though still only having played 2 different pieces. Their fourth move was a new pawn at 16:46, played as a third new piece. At 16:51, their fifth move was a fourth new piece: a bishop. Therefore, in the game that begins at 16:20, the fourth new piece that white plays is a bishop." + }, + { + "key": "-QACREXoI9w:6a8713f80824ba36830ed4829322fd422718c269", + "video_id": "-QACREXoI9w", + "question": "When does the first single chess board appear on-screen?", + "answer_choice_0": "00:51.", + "answer_choice_1": "00:19.", + "answer_choice_2": "00:29.", + "answer_choice_3": "00:32.", + "answer_choice_4": "01:00.", + "answer_id": 1, + "answer": "00:19.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:10, I saw various chess boards appear on-screen, but it wasn't a single board. I then saw the first single chess board appear on-screen at 00:19. Therefore, 00:19 is when the first single chess board appears on-screen." + }, + { + "key": "-QACREXoI9w:e6d2a489fea6541c51ceac91d96408beae345ab6", + "video_id": "-QACREXoI9w", + "question": "What would happen if white took black's knight at 10:36?", + "answer_choice_0": "Black would take white's bishop.", + "answer_choice_1": "Black would promote a pawn.", + "answer_choice_2": "Black would exchange knights.", + "answer_choice_3": "Black would take white's rook.", + "answer_choice_4": "Black would deliver a checkmate.", + "answer_id": 3, + "answer": "Black would take white's rook.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I went to 10:36 to observe the board, noting that both black and white had only two non-pawn pieces left in addition to their kings. At the same time, I also noted that black was up by two pawns and that white's king at f4 could take black's knight on e5. However, I also observed that white and black's rooks were in the same file with no pawns or other pieces between them. Therefore, if white took black's knight at 10:36, black would then take white's rook." + }, + { + "key": "-QACREXoI9w:ef531736170c0e50559f419ffa0eaa07cf358705", + "video_id": "-QACREXoI9w", + "question": "What chess piece is highlighted when Bill Cosby shows up on-screen?", + "answer_choice_0": "Pawn.", + "answer_choice_1": "Queen.", + "answer_choice_2": "Rook.", + "answer_choice_3": "Bishop.", + "answer_choice_4": "Knight.", + "answer_id": 0, + "answer": "Pawn.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 12:33, I saw an image of Bill Cosby appear on-screen in the top right corner of the frame. At the same time, I looked at the chess board and noticed a pawn was highlighted. Therefore, the chess piece that is highlighted when Bill Cosby shows up on-screen is a pawn." + }, + { + "key": "-RyqpUcmspo:0afe0326f3795a686471b3e2d97e52f106c20366", + "video_id": "-RyqpUcmspo", + "question": "What is the path the vlogger takes to get from the side of the pool to the poolside restaurant?", + "answer_choice_0": "The vlogger walks along the edge of the pool and then climbs a set of concrete steps to the restaurant.", + "answer_choice_1": "The vlogger walks along the side of the pool to a small wooden bridge, which leads to the top of a large boat, and on the other side of the boat is another wooden bridge that leads to the restaurant.", + "answer_choice_2": "The vlogger walks over a small wooden bridge, gets into the pool and begins swimming towards the poolside restaurant.", + "answer_choice_3": "The vlogger walks along the edge of the pool, opens a metal door, and walks down a hallway to the restaurant.", + "answer_choice_4": "The vlogger walks along the edge of the pool, climbs the concrete steps that lead to the resort's lobby, and on the right is a hall that leads to the restaurant.", + "answer_id": 1, + "answer": "The vlogger walks along the side of the pool to a small wooden bridge, which leads to the top of a large boat, and on the other side of the boat is another wooden bridge that leads to the restaurant.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the vlogger as he walked up to the pool at 00:57. At 01:07, he mentions the poolside restaurant that can be seen in frame. At 01:12, the vlogger started walking from the edge of a pool onto a dark wooden bridge that crossed over part of a pool. When he crossed the bridge, he was standing on the wooden deck of a boat at 01:20. Directly in front of the vlogger was another wooden bridge, which I surmised he crossed to reach the restaurant." + }, + { + "key": "-RyqpUcmspo:25d5b5c60ed7d91a2284a4f369bdb3f84bddc537", + "video_id": "-RyqpUcmspo", + "question": "How many chairs are in the hotel suite the vlogger tours?", + "answer_choice_0": "2.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "6.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "The vlogger toured the hotel suite from 04:35-14:24. In the bedroom area, I could see there was 1 cushioned chair that was pushed up against the black dresser at 05:40. Then the vlogger walked out onto the balcony at 09:20. On the right side of the balcony, there was a small metal table with 2 matching metal chairs at 09:28, bringing the total to 3. At 09:34, I could see there were 2 sunbeds on the left side of the balcony, bringing the total to 5. I continued watching and could see there were no other chairs in the space." + }, + { + "key": "-RyqpUcmspo:29d5088bdbbd653047b6207690c018787078dcad", + "video_id": "-RyqpUcmspo", + "question": "If the vlogger had also mentioned Brazilian cuisine when touring the restaurants, how many types of cuisine would he have mentioned?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the section of the video where the vlogger is touring restaurants at the resort. As he walks into the first restaurant, he mentions that the cuisine is Italian at 02:50. At 03:21, he walks into another restaurant and comments that the cuisine is American, and you can get steak, ribs, and other American fare. In the next restaurant, he says the cuisine is Japanese at 03:38. If he had mentioned Brazilian food as well, he would have mentioned 4 cuisines." + }, + { + "key": "-RyqpUcmspo:32dbecfcdea9915d273444130bfd4489452d5369", + "video_id": "-RyqpUcmspo", + "question": "As the vlogger walks toward Sarah and Julian's room, how many palm trees are visible in the center of the open air corridor?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "7.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and looked for when the vlogger is walking toward Sarah and Julian's room. At 04:05, while the vlogger is showing off the spa, he mentions in a voiceover that he needed to go to Julian and Sarah's room. At 04:13, he says \"let's go.\" Then, an open air corridor is shown, which contains palm trees in the center of it. As he describes the corridor, he shows 2 individual palm trees. So, the answer is 2." + }, + { + "key": "-RyqpUcmspo:576c2fe90daa54664b551638dd574c0b7c44a87d", + "video_id": "-RyqpUcmspo", + "question": "When the vlogger walks past the breakfast stations, what flavor is the middle bottle of syrup in the group of bottles closest to the pancakes?", + "answer_choice_0": "Strawberry.", + "answer_choice_1": "Mixed berry.", + "answer_choice_2": "Peach.", + "answer_choice_3": "Chocolate.", + "answer_choice_4": "Maple.", + "answer_id": 2, + "answer": "Peach.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the until I saw the vlogger tour the breakfast buffet beginning at 01:35. I noticed that there were quite a few bottles of syrup on a counter at 01:40. They were grouped into 3 separate groups. The groups on the left and the center had mostly illegible labels. The third group was on the right and closest to the tray of pancakes. At 01:45, I could see that each of the 3 upside-down bottles had a clear label with a picture indicating the flavor. The one in the center had a peach on the label. Therefore, the flavor was peach." + }, + { + "key": "-RyqpUcmspo:725ca9b251cf7cc7d3a543f35d958627a02820fb", + "video_id": "-RyqpUcmspo", + "question": "If whenever he is shown onscreen in the first 5 minutes and 30 seconds, the speaker made the same number of hand gestures per minute that he does during the first 15 seconds, how many hand gestures would he make?", + "answer_choice_0": "19.", + "answer_choice_1": "35.", + "answer_choice_2": "18.", + "answer_choice_3": "24.", + "answer_choice_4": "55.", + "answer_id": 2, + "answer": "18.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I observed the speaker talk and gesture from a seated position during the first 15 seconds of the video (00:00-00:15). During this time, I counted each hand gesture. The first was an open-handed gesture at 00:00. The second was a point toward the camera at 00:02. The third was a \"number one\" gesture at 00:05. The fourth was a \"number one\" gesture at 00:07. The fifth was an open hand in the center of his chest at 00:10. The sixth was a point toward the camera at 00:11. The sixth was a point toward the camera at 00:15. In the first 15 seconds, I counted a total of 6 gestures. To find the gestures per minute, I multiplied 6*4=24. Then I watched the video and noted the periods where the speaker was onscreen. He was onscreen from 00:00-00:31, in the mirror from 02:27-02:32, in the mirror from 05:05-05:11, in the mirror from 05:19-05:20, and in the mirror from 05:26-05:28. The speaker is not visible in the last 2 seconds of the specified timeframe. I found the duration of each appearance in the first 5 minutes and 30 seconds: 00:31-00:00=31 seconds; 02:32-02:27=5 seconds; 05:11-05:05=6 seconds; 05:20-05:19=1 second; 05:28-05:26=2 seconds. I added the durations to find the total time onscreen in the first 5 minutes and 30 seconds: 31+5+6+1+2=45 seconds. I converted this to a fraction of a minute by dividing 45/60=0.75. Then, I multiplied the average gestures per minute by 0.75 to find the estimated gestures during the total durations if he continued the same rate as the first 15 seconds: 0.75*24=18. Therefore, I concluded the answer is 18." + }, + { + "key": "-RyqpUcmspo:72cb89e98f496b6fbab4bcc6c693c74aaecf054a", + "video_id": "-RyqpUcmspo", + "question": "Rank these items based on how many there are of each: (A) Cups of coffee at the bar; (B) Omelets pans at the buffet; (C) Pillows on Julian and Sara's couch.", + "answer_choice_0": "ABC.", + "answer_choice_1": "CAB.", + "answer_choice_2": "BAC.", + "answer_choice_3": "ACB.", + "answer_choice_4": "CBA.", + "answer_id": 4, + "answer": "CBA.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and looked for the target objects in the question. At 01:52 I heard the speaker say \"This is the main buffet restaurant.\" At 01:52 I also saw 3 small pans with omelets cooking. At 02:20 I heard the speaker say \"A beautiful piano bar.\" I also heard the speaker say you could grab a coffee here at 02:25. At 02:28-02:30, I saw a woman behind the bar step toward the camera with 2 cups of coffee. At 04:40 I heard the speaker ask a woman if she would show him around and she agreed. From 04:43-04:48 I heard the speaker introduce the couple and they introduced themselves as Sara and Julian. I noticed a couch behind them but couldn't count the total number of pillows at that time. I continued watching until 06:32, when I could see that the couch clearly, I counted that the couch had 5 pillows on it. Therefore, the couch (item C) had the most items, followed by the omelet pans (item B), followed by the cups of coffee (Item A). Therefore, the correct order is CBA." + }, + { + "key": "-RyqpUcmspo:d058d378d4a5f6861a0d56327d3c4fdf8fc97c06", + "video_id": "-RyqpUcmspo", + "question": "If one of the pillows were removed from the couch inside Sarah and Julian's room, how many pillows would remain?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to understand how many pillows were inside of Sarah and Julian's room sitting on the couch. I identified Sarah and Julian thanks to the vlogger, who meets them and has them introduce themselves from 04:47-04:48. At this time, the vlogger is inside of their room with them. A couch can be seen right behind them, but it is not yet fully visible. It later becomes more clearly visible at 06:32, when 5 pillows can be seen on top of it. No other couches appear inside of Sarah and Julian's room. So, if 1 were removed, there would be 4." + }, + { + "key": "-RyqpUcmspo:dd87c31c6de665e18b9f288d91a1007e76ce34a5", + "video_id": "-RyqpUcmspo", + "question": "During the second time a portion of the Despacio spa is shown, how many teal tile pillars would there be if there were 2 additional pillars?", + "answer_choice_0": "7", + "answer_choice_1": "6", + "answer_choice_2": "4", + "answer_choice_3": "5", + "answer_choice_4": "8", + "answer_id": 0, + "answer": "7", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to find when the vlogger discusses and shows the spa amenities. I found this at 03:52. The vlogger walks into a spa area and talks about its amenities, also showing a sign that says \"Despacio\" at the same time stamp. This shot ends at 04:00, when it transitions to the second shot of the Despacio spa. In this new shot, since it is the second one, I looked to see how many teal tile pillars are visible in the frame. There are 2 by the window, and 3 in the back. This totals 5. If there were 2 additional pillars, there would be 7 pillars in total." + }, + { + "key": "-RyqpUcmspo:ff13df134be7cde5f88e6b804f8e515a226fb451", + "video_id": "-RyqpUcmspo", + "question": "In the area shown when the speaker mentions someone named \"Sarah\" for the second time after the intro, what unique decorations and containers are at the top of the walls?", + "answer_choice_0": "Wooden shelving with food themed displays.", + "answer_choice_1": "Slatted wooden detailing in circular shapes.", + "answer_choice_2": "Long sheer curtains on thin, hidden rods.", + "answer_choice_3": "Christmas decorations hanging from long, rectangular planters.", + "answer_choice_4": "Ferns and hanging plants within long, rectangular planters.", + "answer_id": 4, + "answer": "Ferns and hanging plants within long, rectangular planters.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video with the intention of isolating the intro. I noted that at 00:31 a graphic/simple animation set to music denoted the website the video made for, and that this must be the intro. Then, I listened to the speaker, anticipating him mentioning Sarah, which he did\u2014for the first time, after the intro, at 01:46, and then again, for the second time, at 02:16. I stopped the video and studied the scene, and saw a bar with a seating area in front of it. I looked at the top of the walls and noted that there were plants by the ceiling. The plants were all ferns and a few other similar leafy green flora. They were hanging from long rectangular planters, that ran along the edges of the ceiling surrounding the bar." + }, + { + "key": "-g1O2PNqDzw:3c689cf160a8b91357b5dbbbf47b93b5d1594f36", + "video_id": "-g1O2PNqDzw", + "question": "In how many shots in which the host is at least partially visible are his tattoos not visible?", + "answer_choice_0": "4", + "answer_choice_1": "2", + "answer_choice_2": "5", + "answer_choice_3": "3", + "answer_choice_4": "1", + "answer_id": 0, + "answer": "4", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 00:00 I identified the host and noticed that he had several tattoos, including on his shoulders, arms, and hand. I watched the video carefully to find shots where the host was at least partially visible but his tattoos were not. The first occurrence was from 00:44-00:46, when his hand was in the shot. The second occurrence was from 02:40-02:48, which was followed by a quick cut. The third occurrence was from 02:49-02:50. The fourth occurrence was from 03:06-03:08. I did not see any additional occurrences in the remainder of the video. Therefore, I counted 4 total shots where the host was at least partially visible but his tattoos weren't." + }, + { + "key": "-g1O2PNqDzw:3cc96a4895296e23c985f158c2229252b009a9c3", + "video_id": "-g1O2PNqDzw", + "question": "How many drones shots occur before the man goes to Flyer's?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked for the time the man goes to Flyer's and find it at 01:08 -- Flyer's is the name of a restaurant at which he eats. Knowing this I looked from 00:00 to 01:08 to find any drone shots. Shots that move without handheld motion while also capturing views high above the ground are good candidates. I looked for these and found my first from 00:11 to 00:17, my second from 00:28 to 00:36, and my third just before the shot of the restaurant, from 01:05 to 01:08. Therefore, I concluded their are 3 drones shots." + }, + { + "key": "-g1O2PNqDzw:5a05909f5ab9820222fbe0139034d7fbf94ff1f7", + "video_id": "-g1O2PNqDzw", + "question": "How many times does the traveler go for a swim during the day?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "0.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "3.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked at the video from the beginning to locate the moments the traveler is seen going swimming. The first instance happens at 00:37, where he swims at the beach. The second time happens at 02:07, where he is seen jumping in a pool. The third and last time happens at 02:36, where he swims at the beach again." + }, + { + "key": "-g1O2PNqDzw:7a02bdd607647c7cdc264b80e6ac8131de677aa6", + "video_id": "-g1O2PNqDzw", + "question": "What is the third food the traveler is seen eating during the day?", + "answer_choice_0": "Watermelon.", + "answer_choice_1": "Banana Pudding.", + "answer_choice_2": "Yogurt.", + "answer_choice_3": "Peach.", + "answer_choice_4": "Apple.", + "answer_id": 0, + "answer": "Watermelon.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked at the video from the beginning to locate the moments where the traveler is seen eating something. The first time he is having something to eat happens at 00:47 (it is an apple), the second time at 01:37 (it is a dinner entr\u00e9e with lots of ingredients), and the third time at 03:51. The third food that the traveler is seen eating during the day is a slice of watermelon." + }, + { + "key": "-g1O2PNqDzw:7dbe973476c154897db73aa38a8ed81a1422e881", + "video_id": "-g1O2PNqDzw", + "question": "When the travelers arrive at the restaurant, which items on the table belong to the restaurant?", + "answer_choice_0": "The condiment caddy.", + "answer_choice_1": "The glass lantern.", + "answer_choice_2": "The water bottle.", + "answer_choice_3": "The white t-shirt.", + "answer_choice_4": "The black bag.", + "answer_id": 0, + "answer": "The condiment caddy.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I searched in the video for the moment the travelers arrived at a restaurant, which happened at 01:08. At 01:23, the travelers are inside the restaurant and one of them pulls a chair to sit on. I looked at the table and noticed the following items: a black bag, a green water bottle, a folded white t-shirt on top of a phone, and a wooden condiment caddy with several white napkins. Only the condiment caddy belongs to the restaurant, since all the other items are not placed on tables by restaurants." + }, + { + "key": "-g1O2PNqDzw:9ea8d33861681f03aa05c96c41c7c82bfdb10922", + "video_id": "-g1O2PNqDzw", + "question": "What is the product of the difference in open hours of the daytime menu compared to the dinner menu times the number of red plates on the restaurant table?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "2.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video looking for the hours of the daytime menu and the dinner menu. At 01:08, the hours are visible, posted by the arch in front of the restaurant. The daytime menu hours are listed as 9:00-17:00, while the dinner menu hours are 17:00-23:00, so 8 hours for the daytime menu and 6 hours for the dinner menu. 8-6=2, meaning that the daytime menu lasts for 2 more hours than the dinner menu. I continued watching until the restaurant table was shown at 01:23. During the scene with the restaurant table in it, there is only ever one red plate on it, shown from 01:32-01:36. So the number of hours (2) x the number of red plates (1) is 2." + }, + { + "key": "-g1O2PNqDzw:df592c87892bf4c18c039bca1f18619b8f6058ba", + "video_id": "-g1O2PNqDzw", + "question": "Does the number of people seen in the first pool we see match the number of floaties we see in the second pool?", + "answer_choice_0": "No, there are 2 more floaties than people.", + "answer_choice_1": "No, there is 1 more person than floaties.", + "answer_choice_2": "Yes, the number of people and floaties match.", + "answer_choice_3": "No, there are 2 more people than floaties.", + "answer_choice_4": "No, there is 1 more floatie than people.", + "answer_id": 2, + "answer": "Yes, the number of people and floaties match.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for the first time a pool appears, finding a good view at 01:53. I counted 3 people, and I looked for the second pool. This shows up at 02:01. Here, I counted 3 floaties: 2 tubes and 1 long rectangular one. I realized that there are 3 pool floaties. I compared the 2 numbers and realized that, yes, the number of people in the first pool match the number of floaties in the second pool." + }, + { + "key": "-hJg2ScKAr4:35e6f2a4c48e78b01409fab9cadf40414ae7135b", + "video_id": "-hJg2ScKAr4", + "question": "What do the two lab techs discover in the bathroom?", + "answer_choice_0": "A bomb.", + "answer_choice_1": "A prisoner.", + "answer_choice_2": "A weapon.", + "answer_choice_3": "A wallet.", + "answer_choice_4": "A hole.", + "answer_id": 4, + "answer": "A hole.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The video shows the two lab techs discovering a large escape hatch-style hole in the floor of the bathroom at 01:54." + }, + { + "key": "-hJg2ScKAr4:4c9506cc885f52299ec0c9ccbdc88082863b56f9", + "video_id": "-hJg2ScKAr4", + "question": "What happens as a result of the brunette woman in a red tank top sparing the life of the man in the wheelchair?", + "answer_choice_0": "The woman in red surrenders.", + "answer_choice_1": "The men in black kill the woman in red.", + "answer_choice_2": "The woman in white kills the men in black.", + "answer_choice_3": "The woman in white surrenders.", + "answer_choice_4": "The woman in white kills the woman in red.", + "answer_id": 1, + "answer": "The men in black kill the woman in red.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a man in a wheelchair. I saw a woman in a red tank top pushing a man in a wheelchair for the first time at 02:35. I continued watching and looked for a moment when his life is in danger. I saw her point a gun at his head at 02:40. I continued to watch and looked for the moment when she changes her mind and spares his life. This happens between 03:05 and 03:09 when she turns the gun from the man in the wheelchair to the woman in white and shoots her. I continued watching and saw the woman in white's bodyguards (who are wearing black) execute the woman in red between 03:16 and 03:19. I thus concluded that the men in black kill the woman in red due to her decision to spare the life of the man in the wheelchair." + }, + { + "key": "-hJg2ScKAr4:ebf00b21d3d32c039bf521ba48cffcb7dd21a511", + "video_id": "-hJg2ScKAr4", + "question": "Why does the woman in red hold a gun to the man in the wheelchair's head?", + "answer_choice_0": "She has lost her mind.", + "answer_choice_1": "She is persuading him.", + "answer_choice_2": "She is defending herself.", + "answer_choice_3": "She is holding him hostage.", + "answer_choice_4": "She wants the secret code.", + "answer_id": 3, + "answer": "She is holding him hostage.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a moment when a woman in red holds a gun to a man in a wheelchair's head. I saw this occur at 02:40. She uses the threat of killing him as leverage over the intellectual property within his body, known as nanocells, as she faces off against rivals." + }, + { + "key": "-hJg2ScKAr4:ecefa9b7d2e54e1ac11b309390049fc0269d2741", + "video_id": "-hJg2ScKAr4", + "question": "How many people appear in the locker room?", + "answer_choice_0": "0.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the locker room, and I observed the locker room appearing onscreen at 00:31. There were a total of two people present. I continued watching until the location changed at 00:38 to ensure no other people appeared onscreen. I then continued watching the rest of the video to ensure the locker room does not appear onscreen again." + }, + { + "key": "-ooQI03JqYM:5935932e0b207a3e40b3e3053e40b9d4424224ca", + "video_id": "-ooQI03JqYM", + "question": "Which comedian tells the viewer, in English, that he is watching them?", + "answer_choice_0": "Patriko Mujuuka.", + "answer_choice_1": "Godi Godi.", + "answer_choice_2": "Teacher Mpamire.", + "answer_choice_3": "Alex Muhangi.", + "answer_choice_4": "Arnold Bubinyo.", + "answer_id": 4, + "answer": "Arnold Bubinyo.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video all the way through to identify whether any of the comedians said that they were watching the viewer in English - from 04:04 to 04:08, the comedian Arnold Bubinyo speaks this line in English. I identified this comedian as Arnold Bubinyo by reading the caption of his name displayed in front of him when his verse begins at 03:48." + }, + { + "key": "-ooQI03JqYM:75dc14e96dd98cec17e6e7b9db12f53ec8efa268", + "video_id": "-ooQI03JqYM", + "question": "At what point does the sixth comedian introduced start to sing?", + "answer_choice_0": "02:21.", + "answer_choice_1": "03:12.", + "answer_choice_2": "03:45.", + "answer_choice_3": "00:56.", + "answer_choice_4": "01:34.", + "answer_id": 0, + "answer": "02:21.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and counted how many comedians were introduced on screen as they were singing. Comedian 1 appears at 00:06. Comedian 2 is introduced at 00:25. At 0:36, comedian 3 is introduced. At 01:11, comedian 4 is introduced. Comedian 5 is introduced at 01:47. At 02:21, the sixth comedian is introduced." + }, + { + "key": "-ooQI03JqYM:f237a4400b2a6e8e38df8735b1f3ec572b769cf6", + "video_id": "-ooQI03JqYM", + "question": "Which comedian has a towel over their left shoulder?", + "answer_choice_0": "Nilo Nilo.", + "answer_choice_1": "Alex Muhangi.", + "answer_choice_2": "Richard Amosii.", + "answer_choice_3": "Bujingo Hannington.", + "answer_choice_4": "Godi Godi.", + "answer_id": 1, + "answer": "Alex Muhangi.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The video shows only one comedian with a towel over his left shoulder at 01:46. He is introduced as Alex Muhangi." + }, + { + "key": "-ooQI03JqYM:fb985b59353391b93b051dd2f519ad47d55f821e", + "video_id": "-ooQI03JqYM", + "question": "In the third graphic of the #EpukaCorona sequence of graphics, where is the coronavirus depicted?", + "answer_choice_0": "At a party.", + "answer_choice_1": "On a couch.", + "answer_choice_2": "On a bus.", + "answer_choice_3": "In a car.", + "answer_choice_4": "At a hair salon.", + "answer_id": 0, + "answer": "At a party.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the sequence in which the poster graphics are quickly flashed across the screen at 00:55, and identified them as the correct ones by reading the phrase #EpukaCorona on them. I observed that these poster graphics all had a personified symbol of the coronavirus on them: a man with a green germ head. I counted to the third of these that flashed across the screen at 00:56 and noted the location of the personified coronavirus man in that poster - he is at a party, amidst a large crowd." + }, + { + "key": "-ywXYEaP8KA:113c27db201ff159237b2f574383544df8056ae5", + "video_id": "-ywXYEaP8KA", + "question": "In the segment when Arizona Bill speaks to a group of people to the end of the video, how many more people are wearing hats than people wearing sunglasses?", + "answer_choice_0": "4", + "answer_choice_1": "6", + "answer_choice_2": "7", + "answer_choice_3": "3", + "answer_choice_4": "5", + "answer_id": 1, + "answer": "6", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and saw that Arizona Bill was identified at 02:23 by a graphic stating his name. At 02:28, the screen shows Arizona Bill standing in front of a group of people. I carefully observed the setting and counted the people wearing hats and the people wearing sunglasses. There are 4 people wearing hats and 4 people wearing sunglasses here. I continued watching and counted anyone wearing sunglasses and hats in the segment from 02:31 to 02:34, which shows 6 people wearing hats and 1 person wearing sunglasses. I continued to watch until I saw more people, who appeared at 02:53 on horseback. I counted 2 people in hats, 1 of which also wore sunglasses. I watched the rest of the video to see if additional people showed up, and there were none. In total, there were 12 people wearing hats and 6 people wearing sunglasses. This means that there were 6 more people who wore hats than people who wore sunglasses." + }, + { + "key": "-ywXYEaP8KA:1ce8e4e6bb55f62cd856983794260755ad36d884", + "video_id": "-ywXYEaP8KA", + "question": "What colors are the letters written in the window of the business which also has an Information door available?", + "answer_choice_0": "Red and white.", + "answer_choice_1": "Cream and gray.", + "answer_choice_2": "Yellow and red.", + "answer_choice_3": "Green and white.", + "answer_choice_4": "Brown and gray.", + "answer_id": 2, + "answer": "Yellow and red.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "To determine this, I watched the video looking for an Information door, which I identified as a red door on the front wall of a gray building at 02:19, which had \"Information\" written across its top. I then rewound the video to spot whether I could see a name on the building, which I did, identifying it as the Old Trapmann Saloon based on the sign on its front roof at 02:15. I then watched the video to determine where a window of the Old Trapmann saloon with letters displayed could be seen - I found this precise thing a little further back in the video, from 02:08-02:10, in which a window with the words \"Old Trapmann Saloon\" is centered in the frame. I then noted the colors that the words were written in, which were yellow with red outlines, making yellow and red the correct answer." + }, + { + "key": "-ywXYEaP8KA:40f53bd0dbc0497f78a282adde14b50205bdba26", + "video_id": "-ywXYEaP8KA", + "question": "In reverse chronological order, what is the order in which the following title cards - Karin Von Wolff, Arizona Bill, Juergen von Wolff, and Tombstone Monument Ranch - are displayed onscreen?", + "answer_choice_0": "Tombstone Monument Ranch, Juergen Von Wolff, Karin Von Wolff, Arizona Bill.", + "answer_choice_1": "Tombstone Monument Ranch, Karin Von Wolff, Juergen Von Wolff, Arizona Bill.", + "answer_choice_2": "Karin Von Wolff, Tombstone Monument Ranch, Arizona Bill, Juergen Von Wolff.", + "answer_choice_3": "Arizona Bill, Juergen Von Wolff, Karin Von Wolff, Tombstone Monument Ranch.", + "answer_choice_4": "Arizona Bill, Karin Von Wolff, Juergen Von Wolff, Tombstone Monument Ranch.", + "answer_id": 3, + "answer": "Arizona Bill, Juergen Von Wolff, Karin Von Wolff, Tombstone Monument Ranch.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video, paying attention to when the title cards specified by the question were displayed onscreen - I first saw the Tombstone Monument Ranch card displayed in the bottom left corner of the screen from 00:00-00:04. The next title card I saw onscreen was the one denoting Karin Von Wolff from 01:21-01:25. I then identified the Juergen Von Wollf title card as appearing onscreen from 01:39-01:43, and finally, saw the Arizona Bill title card appear from 02:23-02:27. To find the correct answer to the question, I then considered these in reverse chronological order, from last to first - thus, the correct display order per the question would be Arizona Bill, Juergen Von Wolff, Karin Von Wolff, Tombstone Monument Ranch." + }, + { + "key": "-ywXYEaP8KA:54f24b4b6a779bf6699a0b0d9cff823c73196fce", + "video_id": "-ywXYEaP8KA", + "question": "In the clip where the German woman is introduced by the narrator, where can the Tombstone monument be intitally seen onscreen?", + "answer_choice_0": "In the middle right midground.", + "answer_choice_1": "In the middle right background.", + "answer_choice_2": "In the lower right foreground.", + "answer_choice_3": "In the upper left background.", + "answer_choice_4": "In the lower left foreground.", + "answer_id": 3, + "answer": "In the upper left background.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video clip where the German woman is introduced by the narrator - she is introduced as Karin during the clip which plays from 01:03-01:07. Having heard this and identified it as the clip where I should look for the Tombstone monument, I searched the frame and located it in the upper left background, off in the distance. I knew with certainty that this was the Tombstone monument because the narrator identifies it as such later in the video, where it is shown and talked about from 02:35-02:42." + }, + { + "key": "-ywXYEaP8KA:9bb29a86c3d1d816b360ef2dc2664b5ba5c46242", + "video_id": "-ywXYEaP8KA", + "question": "What are the antlers being used for when people walk through the swinging doors?", + "answer_choice_0": "A candle holder.", + "answer_choice_1": "A coat rack.", + "answer_choice_2": "A painting frame.", + "answer_choice_3": "A chandelier.", + "answer_choice_4": "Table legs.", + "answer_id": 3, + "answer": "A chandelier.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and noted when people walked through the swinging doors from 00:18 to 00:21. I watched this segment carefully to assess the environment for the location of the antlers. I see that the antlers are crafted together and are hanging from the ceiling in the room behind the swinging doors. There are lightbulbs fixed to the antlers, showing that this is a makeshift chandelier." + }, + { + "key": "-ywXYEaP8KA:b125497a7058cdbabf2b7972001663716262ca95", + "video_id": "-ywXYEaP8KA", + "question": "What is the sum of the year the town's founder died and the year that the narrator used to describe the bedrooms?", + "answer_choice_0": "3775.", + "answer_choice_1": "3777.", + "answer_choice_2": "3769.", + "answer_choice_3": "3762.", + "answer_choice_4": "3773.", + "answer_id": 1, + "answer": "3777.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I found that the bedrooms appeared at 00:57, and listened carefully to the narrator as he described the rooms having an \"1880s flair\" at 00:59. To find the next number, I watched the video and listened to the narrator until he began talking about the founder of the town at 02:42. I continued watching and listening for the year the founder died. At 02:43, the founder's epigraph on his monument is present on screen. I read the engraving and saw that the founder died on May 12, 1897. I then added the two years together. 1880 and 1897 equals 3777." + }, + { + "key": "-ywXYEaP8KA:c656464ca2a807d4d98406b8b5e154093e9d3dc3", + "video_id": "-ywXYEaP8KA", + "question": "In the third shot of the video in which a horse is visible, which building is not visible?", + "answer_choice_0": "Mining office.", + "answer_choice_1": "Grand Hotel.", + "answer_choice_2": "Post office.", + "answer_choice_3": "Wells Fargo.", + "answer_choice_4": "Livery Stable.", + "answer_id": 0, + "answer": "Mining office.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video, paying close attention and counted each of the first 3 shots where a horse was visible. The first shot with a horse is from 00:00-00:06, and the second shot with visible horses can be seen from 00:06-00:12. The third shot in which I saw a horse runs from 00:27-00:29, so I identified this as the shot I was looking for. I then watched the span of 00:27-00:29 to identify building signs, reading the fronts of the buildings, and counted the number of signs I saw in the frame. There is one cut off in the upper left edge of the frame, the visible portion of which reads \"office\". A second sign says \"Wells Fargo\" and can be seen in the upper middle left, and a third that says \"Grand Hotel\" is in the upper middle right. A fourth sign, too far away to be easily readable, can be seen above a shop window in the lower right. I looked for another view of the \"office\" building and found it at 00:08. I knew it was the same building because it was left of the \"Wells Fargo\" building and had the same green color and roof shape. At 00:08, I could clearly read the sign on this building said \"Post Office.\" I looked for another view of the building to the right of the Grand Hotel building and found it at 02:08. At this time, I could clearly read that the sign on the building said \"Livery Stable\". Thus, the only building that was not present during the 3rd shot with horses was the mining office." + }, + { + "key": "0-iiPxDyO68:06261d68d8eb057bb6689be813e1ee35712d1cef", + "video_id": "0-iiPxDyO68", + "question": "What is the movie that was shown at Movies Under the Stars, a week before the couple filmed the video?", + "answer_choice_0": "Tarzan.", + "answer_choice_1": "Luca.", + "answer_choice_2": "Coco.", + "answer_choice_3": "Ratatouille.", + "answer_choice_4": "Tangled.", + "answer_id": 4, + "answer": "Tangled.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While listening to the guy at 03:38, I heard him mention \"Movies Under the Stars.\" Then, I looked at the information board he was pointing at and read the title Movies Under the Stars with the different movie dates listed. I heard the guy say at 03:40 that The Avengers was playing last night. Then, I read the day The Avengers was played and saw it was Saturday. So, that told me that the day the couple filmed the video was Sunday. So, I looked at the movie the previous Sunday and read that it was Tangled. Therefore, Tangled is the movie that was shown at Movies Under the Stars, a week before the couple filmed the video." + }, + { + "key": "0-iiPxDyO68:34019f78ce292f1e162bb223329c148906818e5d", + "video_id": "0-iiPxDyO68", + "question": "When the words \"No Slide at Value Resorts\" appears on the screen, how many Disney characters are in the background?", + "answer_choice_0": "5.", + "answer_choice_1": "2.", + "answer_choice_2": "7.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "2.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched until I noticed the words \"No Slide at Value Resorts\" appear as text at the bottom of the screen at 05:58-06:02. I found that this was when the man was discussing the resort pool area, and he was showing the pool to the vlog viewers. Then, I looked to see which Disney characters could be found in the background. I first identified the Magic Broom from Fantasia positioned behind the pool. Then I identified Sorcerer Mickey from Fantasia in the center of the pool. There were no other Disney characters found while the words \"No Slide at Value Resorts\" were on the screen. Therefore, there were a total of 2 Disney characters in the background." + }, + { + "key": "0-iiPxDyO68:52c845241c3555dbb4f5cb8d3ddfb203c7a0728f", + "video_id": "0-iiPxDyO68", + "question": "If the woman had bought the Bourbon Breeze drink instead at Silver Screen Spirits, how much more money would she have spent?", + "answer_choice_0": "$3.", + "answer_choice_1": "$14.", + "answer_choice_2": "$1.", + "answer_choice_3": "$7.50.", + "answer_choice_4": "$2.50.", + "answer_id": 2, + "answer": "$1.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, at 07:23, I saw a sign reading 'Silver Screen Spirits\", which the woman also mentioned at that time. Then, I noticed the man holding 2 drinks in his hands at 07:25. I rewound to the moment before they ordered the drinks and located it at the 07:05 mark in the video. The woman shared that she got the Frose drink. I looked on the menu and noticed it cost $14. Then, I saw the Bourbon Breeze drink cost $15. So, to find the difference, I subtracted 14 from 15 and got 1. Therefore, if the woman had gotten the Bourbon Breeze drink instead at Silver Screen Spirits, she would have paid $1 more." + }, + { + "key": "0-iiPxDyO68:6f0e3860ec505abb1191914ab09c1028b59ec1f9", + "video_id": "0-iiPxDyO68", + "question": "What is the 1st letter of the 2nd word for the 4th non-alcoholic specialty drink at the resort poolside bar?", + "answer_choice_0": "S.", + "answer_choice_1": "E.", + "answer_choice_2": "M.", + "answer_choice_3": "W.", + "answer_choice_4": "N.", + "answer_id": 3, + "answer": "W.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched until I located the resort poolside bar at 06:56. I continued watching until I found the menu for the \"Non-Alcoholic Specialties\" at 07:10. I also heard the woman say they have \"some non-alcoholic drinks\" at 07:11. I then looked at the 4th drink listed on the menu, which was a \"Dole WHIP Smoothie\". I then looked to see what the 4th letter of this drink was, and I observed that it was a \"W\"." + }, + { + "key": "0-iiPxDyO68:c84f92f52c02e360cbb51c291903b64afa373af7", + "video_id": "0-iiPxDyO68", + "question": "If you were standing in the centermost circle of the Love Bug area facing Fantasia, in what general direction would you need to walk to get to the woman in purple's location when she says, \"The area that we are staying in?\"", + "answer_choice_0": "Forward and to the left", + "answer_choice_1": "Directly right", + "answer_choice_2": "Directly left", + "answer_choice_3": "Straight ahead", + "answer_choice_4": "Forward and to the right", + "answer_id": 4, + "answer": "Forward and to the right", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I listened until I heard the woman in purple say \"The area that we are staying in\" at 13:32-13:34. Just before that, I noticed a map onscreen at 13:31 that details the woman's location. I looked at the centermost circle in the Love Bug area on the left of the map, and pretended I was standing in it facing the Fantasia area on the map. I then looked at the woman's location marked by a black square and a blue text oval that says, \"We are Here!\". I realized I would need to walk forward and to the right to reach her location." + }, + { + "key": "0-iiPxDyO68:cf3ca32e4d0fe0211c85aa11e10d38f46d5408e1", + "video_id": "0-iiPxDyO68", + "question": "What is the difference between the number present on screen when \"Our room is 939\" is spoken and the number present on screen when \"So this is what the splash pad is\" is spoken?", + "answer_choice_0": "1,715.", + "answer_choice_1": "1,061.", + "answer_choice_2": "1,830.", + "answer_choice_3": "1,970.", + "answer_choice_4": "1,812.", + "answer_id": 1, + "answer": "1,061.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched until I heard the woman say \"Our room is 939\" at 00:44-00:46, and I found the number 0939 located on the wall next to the resort room door. Then I watched until I heard the woman say \"So this is what the splash pad is\" at 06:36-06:38, and I found the number 2000 as part of the movie title \"Fantasia 2000\" located on a sign in the background. To find the difference, I then subtraced 0939 from 2000, and I found that 2000-0939 is 1,061." + }, + { + "key": "0-iiPxDyO68:d3978554c62b5c7dd9b73b0c45e357d004e95eb5", + "video_id": "0-iiPxDyO68", + "question": "Assuming the lawn tires are arranged symmetrically, if the woman took 1 tire from the Love Bug area home, how many would still be remaining on the grass?", + "answer_choice_0": "7.", + "answer_choice_1": "15.", + "answer_choice_2": "4.", + "answer_choice_3": "19.", + "answer_choice_4": "17.", + "answer_id": 3, + "answer": "19.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, I heard the woman say that they were in the love bug section from 09:24-09:26. I looked around for tires and noticed that I could see 4 on the grass behind the woman and to her left. Additionally, I saw a large version of a love bug mid-air between the hotel buildings to the woman's left, but did not count those tires because the question specifically asked about tires on the grass. I continued watching and noticed that as the camera moved at 09:27, I could see 1 more tire on the grass behind the woman and to her left. At 09:30, the camera moved a little more and the woman turned and walked forward. I noticed 2 more tires to the woman's left, that appeared to be in the same formation as the tires on the opposite side of the walkway. Therefore I determined that there were actually 5 tires on this side of the grass. From 10:04-10:05, I saw 5 more tires on grass when the woman was sitting on one. I knew these were different tires because these were adjacent to hedges, whereas the previous tires were in the open grass. Since the question assumes they are arranged symmetrically, I figured there were another 5 tires on the opposite side. I added all of the tires together: 5+5+5+5=20. If 1 was removed, 20-1=19. Therefore, if the woman took home one tire, there would still be 19 tires remaining on the grass." + }, + { + "key": "0-iiPxDyO68:d8401da4667414f3cbff1755cebffdcc59d3cab8", + "video_id": "0-iiPxDyO68", + "question": "If someone were to walk from the large blue door of the Toy Story area to the RC car, which statue would be behind them on their left side?", + "answer_choice_0": "Rex", + "answer_choice_1": "Buzz Lightyear", + "answer_choice_2": "Woody", + "answer_choice_3": "Blocks", + "answer_choice_4": "Bo Peep", + "answer_id": 2, + "answer": "Woody", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for the segments when the woman is introducing the Toy Story themed area and found it at 13:44. I continued watching, and at 13:53, I saw the RC car parked on the road that led toward the blue doors in the background. At 14:01, the statues on each side of the door are clearly visible, with Buzz Lightyear on the left and Woody on the right. If someone were to walk from the blue door to the RC car, the statue behind them and to their left would be Woody." + }, + { + "key": "0-iiPxDyO68:eaa1c4259890a32e327fbf33abcaa6e6c9939ac5", + "video_id": "0-iiPxDyO68", + "question": "After the woman says \"Room 939,\" what is the difference between the largest number and the second largest number that appears on the map?", + "answer_choice_0": "107.", + "answer_choice_1": "79.", + "answer_choice_2": "263.", + "answer_choice_3": "348.", + "answer_choice_4": "413.", + "answer_id": 2, + "answer": "263.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched until I heard the woman say, \"Our room is room 939\" at 00:44 while she stands outside of her resort room by the door. I noticed that the room number \"0939\" was also posted next to the door. I continued watching until a map was shown on the screen at 00:47. I noticed that the highest number on the map was 9964 and the second highest number on the map was 9701. I then subtracted 9701 from 9964 and I got a total of 263." + }, + { + "key": "02HpVRfxSF4:2c3c0539d6e900cc8d9a46b1c1f9979c648aa49c", + "video_id": "02HpVRfxSF4", + "question": "What object is not present in the gorilla habitat?", + "answer_choice_0": "Cucumbers.", + "answer_choice_1": "A window.", + "answer_choice_2": "Ropes.", + "answer_choice_3": "A waterfall.", + "answer_choice_4": "Stairs.", + "answer_id": 3, + "answer": "A waterfall.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and specifically looked for the objects that were present in the gorilla habitat. At the beginning of the video, at 00:00, I located cucumbers in the habitat. At 00:33, I located ropes in the habitat. Also at 00:33, I located a window in the habitat. At 03:06, I located stairs in the habitat. I then continued watching until the end of the video, and I looked for a waterfall but there was not one inside the habitat. Therefore, the object that was not present in the habitat is a waterfall." + }, + { + "key": "02HpVRfxSF4:67f28faa73564bebbb3ca8f6a9af9c9bee5b5c3d", + "video_id": "02HpVRfxSF4", + "question": "What happens immediately after the third time the female gorilla blows hot air on the window glass?", + "answer_choice_0": "The female gorilla rolls on her back.", + "answer_choice_1": "The female gorilla drinks some water.", + "answer_choice_2": "The child in a dinosaur jacket beats their chest.", + "answer_choice_3": "The child in a dinosaur jacket laughs.", + "answer_choice_4": "The female gorilla blows on the glass again.", + "answer_id": 4, + "answer": "The female gorilla blows on the glass again.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until I located the section of the video where the first gorilla blows hot air on the window glass for the first time at 04:46. I then observed the first gorilla blow hot air on the window glass for the second time at 04:47, and the third time at 04:48. I watched to see what happened immediately after this, which was that the gorilla blew on the glass for the fourth time at 04:49." + }, + { + "key": "02HpVRfxSF4:6fa1b712c5fdcead7de15fee2d23b13f1f7fbd1a", + "video_id": "02HpVRfxSF4", + "question": "What action does the second gorilla not make in the video?", + "answer_choice_0": "It sits on some stairs.", + "answer_choice_1": "It looks at its fingers.", + "answer_choice_2": "It looks at the camera.", + "answer_choice_3": "It walks to a doorway.", + "answer_choice_4": "It eats a carrot.", + "answer_id": 4, + "answer": "It eats a carrot.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified the first gorilla at the beginning of the video, at 00:00, while it sits and eats cucumbers in the habitat. I then watched until I located the second gorilla appear in the habitat. This happened at 07:02. I then watched to see what actions the second gorilla made in the video. At 07:05, I saw the second gorilla sat on some stairs. At 07:07, I saw the second gorilla make eye contact with the camera. At 07:42, I saw the second gorilla look at its fingers. At 07:57-08:05, I saw the second gorilla walk to a doorway. I then continued watching to the end of the video, and I noticed that the second gorilla never eats a carrot." + }, + { + "key": "02HpVRfxSF4:763169296fc494a0db3c24fadd25a525d2871b9c", + "video_id": "02HpVRfxSF4", + "question": "Who interrupts the communication between the toddler and gorilla while the toddler leans against the second window shown?", + "answer_choice_0": "Silverback gorilla.", + "answer_choice_1": "Toddler's father.", + "answer_choice_2": "Gorilla's baby.", + "answer_choice_3": "Toddler's mother.", + "answer_choice_4": "Toddler's brother.", + "answer_id": 0, + "answer": "Silverback gorilla.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 00:34, I saw the toddler leaning against a window and looking at a female gorilla. But after a cross-fade at 01:45, I saw the same toddler leaning against a window and looking at the same gorilla. I knew this was the second window shown, so I look for an interruption. At 02:18. I witnessed the gorilla back away from the glass partition in submissive fear. I watched the backtracking gorilla bowing to a much larger gorilla with prominent silver streaks spotted along its back. This is the dominant male of the pack, interrupting the communication between toddler and gorilla." + }, + { + "key": "02HpVRfxSF4:8e25cb1e2ad4e7c06a84108e48f3e242b7e22d03", + "video_id": "02HpVRfxSF4", + "question": "How many times does the gorilla blow on the glass of its indoor enclosure from 04:45-05:07?", + "answer_choice_0": "7.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "7.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 04:32 I observed the gorilla in an indoor enclosure, perched up against the zoo's glass window, making direct eye contact with a toddler. I watched as they examined each other's faces between the glass partition from 04:32-04:35. Then, I continued watching and saw the gorilla gently tap the glass with its massive finger as the toddler turned back to his parents, grinning wide from 04:35-04:42. At 04:46, while facing the toddler, the gorilla blew hot condensation onto the glass, repeating this action at 04:47, 04:48, and 04:49. That is a total of 4 instances of the gorilla blowing hot air onto the glass while facing the toddler. From 04:50-04:54, I watched as the toddler, elated, turned back to his parents behind the camera. At 05:01, the gorilla and the toddler returned to face each other across the glass. The gorilla blew hot air onto the foggy glass at 05:02, 05:03, and 05:04. However, during the last blow at 05:04, the toddler turned his face away. Therefore, that makes 2 additional times in a row that the gorilla blows onto the glass, while facing the toddler. Then at 05:07 the toddler turned back to face the gorilla, and at 05:08 the gorilla blow 1 more time. After that, the gorilla stopped blowing. Which makes a total of 7 times the gorilla blew onto the glass while facing the toddler." + }, + { + "key": "02HpVRfxSF4:b44b6f86539df99ac3e8d124a01e3211a1bb39e5", + "video_id": "02HpVRfxSF4", + "question": "After the second gorilla appears in the video, where in the habitat does the first gorilla move?", + "answer_choice_0": "From the rope to the doorway.", + "answer_choice_1": "From the ground to the stairs.", + "answer_choice_2": "From the doorway to the ground.", + "answer_choice_3": "From the ground to the rope.", + "answer_choice_4": "From the rope to another rope.", + "answer_id": 1, + "answer": "From the ground to the stairs.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified the first gorilla at the beginning of the video, at 00:00, while it sits and eats cucumbers in the habitat. I then watched until I located the second gorilla appear in the habitat. This happened at 07:02 when it entered and sat on some stairs. I then watched to see where the first gorilla moved after the second gorilla appeared, and I saw it move from the ground to the stairs at 07:25-07:30." + }, + { + "key": "02HpVRfxSF4:c1efc08cd111331bf0c3fb087b844f3eb44b696b", + "video_id": "02HpVRfxSF4", + "question": "How many steps are in the indoor enclosure?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "0.", + "answer_choice_3": "6.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "6.", + "question_type": "State Changes", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I looked for the indoor enclosure and found a good view of 2 steps at 03:06. But at 07:48, I noticed 2 more steps further on. Finally, at 07:58, I noticed another 2 steps just before the open exit. I counted all these up and found 6 steps total." + }, + { + "key": "02HpVRfxSF4:ca5a860466df3a09fd5f70c67d4262ee349f8b73", + "video_id": "02HpVRfxSF4", + "question": "After the first gorilla sees the child in a dinosaur jacket for the second time, which of the following does not happen within 20 seconds?", + "answer_choice_0": "The gorilla chews on a cucumber", + "answer_choice_1": "The child in a dinosaur jacket steps backward from the window", + "answer_choice_2": "The gorilla leans up to the window", + "answer_choice_3": "The child in a dinosaur jacket places their hands on the window", + "answer_choice_4": "The gorilla takes a seat on the ground", + "answer_id": 1, + "answer": "The child in a dinosaur jacket steps backward from the window", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until the first gorilla saw the child in a dinosaur jacket for the first time. This happened at 00:34 when the first gorilla made eye contact with the child through a window. I then watched to see when the first gorilla saw the child in a dinosaur jacket through the window for the second time at 00:39. Paying attention to the 00:39 timestamp, I looked to see what actions happened within 20 seconds of this occurrence. At 00:40, I saw the first gorilla chew on a cucumber. At 00:42, I watched the first gorilla lean up to the window. At 00:43, I saw the child in a dinosaur jacket place their hands on the window. At 00:50, I saw the first gorilla take a seat on the ground. I continued watching until 00:59, which was 20 seconds after 00:39, and I noticed that the child in a dinosaur jacket never left the window." + }, + { + "key": "02HpVRfxSF4:cfacee64e3995ea8926ac83e3a91a3b8cde8d4ad", + "video_id": "02HpVRfxSF4", + "question": "If the gorilla were to add 2 more cucumbers to her left hand, how many cucumbers would the gorilla be holding in his left hand while he eats an eggplant with his right hand?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "6.", + "answer_id": 4, + "answer": "6.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 00:03, I watched the gorilla munching on an intact cucumber, including its dark green skin. However, the gorilla is holding the cucumber in his right hand. Therefore, I did not consider this cucumber as part of my answer. At 00:13, I saw the gorilla switch a batch of cucumber to his left hand as the gorilla munches on a slice of eggplant in its right hand. In the gorilla's left hand, I saw that the gorilla had a stack of 4 unpeeled cucumbers in his left hand. If one were to add 2 cucumbers to the gorilla's left hand, that would be 2 cucumbers plus the 4 cucumbers the gorilla is currently clutching. Therefore, the gorilla would have a total of 6 cucumbers." + }, + { + "key": "03hFktDJ6zc:30e8e2f07c5aa3d63f9c3d42ae887228d997ce88", + "video_id": "03hFktDJ6zc", + "question": "How many lines are featured in the Albatros Expeditions logo?", + "answer_choice_0": "7.", + "answer_choice_1": "9.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "5.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video all the way through and identified the Albatros Expeditions logo in the top right corner of the video, as well as on the side of ships at 00:39-00:40, 00:50-00:52, and 01:30-01:34. I counted the lines of this logo and saw that there were 5 in total. Therefore, the answer is 5." + }, + { + "key": "03hFktDJ6zc:37ba314af9a2203ce6bae1dba3f9043958fd04af", + "video_id": "03hFktDJ6zc", + "question": "From 0:14 to 0:16, what color hat is the person sitting secondmost to the left wearing?", + "answer_choice_0": "Blue.", + "answer_choice_1": "White.", + "answer_choice_2": "Purple.", + "answer_choice_3": "Pink.", + "answer_choice_4": "Black.", + "answer_id": 3, + "answer": "Pink.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video from 0:14 to 0:16. I saw several people sitting on a raft. I then looked for the leftmost person, who I identified as a man. I then looked for the person sitting to the right of him, as they are secondmost to the left. This person was wearing a pink hat. Therefore, the answer is pink." + }, + { + "key": "03hFktDJ6zc:3b2d7c806dc692b87589aa2c9e078573a2ac4455", + "video_id": "03hFktDJ6zc", + "question": "What is the most likely role of the first person interviewed after a letter is stamped?", + "answer_choice_0": "Tourist", + "answer_choice_1": "Tour Guide", + "answer_choice_2": "Chef", + "answer_choice_3": "Waiter", + "answer_choice_4": "Captain", + "answer_id": 2, + "answer": "Chef", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked for a moment when a letter gets stamped in the video and found that this occurs at 02:36. I heard the next interview begin at 02:49. AT 02:51, I observed the person giving this interview and noticed he was wearing a chef's hat. I determined that his most likely role is that of chef." + }, + { + "key": "03hFktDJ6zc:8f5d0523dc8efbf6e3a88d323668680caa9de966", + "video_id": "03hFktDJ6zc", + "question": "What is the second animal visible, after the orange capped man points with his fingers, at the beginning of the video?", + "answer_choice_0": "Seal.", + "answer_choice_1": "Penguin.", + "answer_choice_2": "Whale.", + "answer_choice_3": "Polar Bear.", + "answer_choice_4": "Walrus.", + "answer_id": 3, + "answer": "Polar Bear.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "From 00:04-00:05, I watched a man in an orange cap point with 2 fingers toward his eyes and turn toward the camera to indicate to his fellow travelers that he had spotted a creature out of the frame. At 00:06, I watched a cavalry of traveling tourists on lifeboats at sea, in the Arctic, snap photographs of a whale. I noticed the whale reached the surface to breathe as a fountain of salt water was expelled from the mammal's blowhole atop the surface of the water. At 00:12, I watched a lifeboat of tourists on the arctic waters, admiring a polar bear at a distance. This is the second wild animal depicted in the video." + }, + { + "key": "03hFktDJ6zc:9070e8beeeb7026e8b696d5cdfddb511356cafc6", + "video_id": "03hFktDJ6zc", + "question": "After a male tourist leaps into the water, what grade does the female tourist give his dive?", + "answer_choice_0": "3.", + "answer_choice_1": "9.", + "answer_choice_2": "1.", + "answer_choice_3": "10.", + "answer_choice_4": "7.", + "answer_id": 3, + "answer": "10.", + "question_type": "Cause and Effect", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "From 03:03-03:06, I watched a shirtless male tourist, with a rope fastened around his waist, leap into the frigid Arctic waters from a makeshift dock at the base of the ocean liner. After witnessing her fellow tourists' jump, I watched a smiling woman side by side with a male photographer lift her oar with the numeral \"10\" emblazoned on its paddle. I deduced that the woman was playfully posing as the jump's judge, imparting a top score for her fellow tourists' cannonball leap into the ice-cold water." + }, + { + "key": "03hFktDJ6zc:a3a88278d23143720589b935630ab91047f9f105", + "video_id": "03hFktDJ6zc", + "question": "What animal do the tourists embark on land to film?", + "answer_choice_0": "Walrus.", + "answer_choice_1": "Lynx.", + "answer_choice_2": "Sea Lion.", + "answer_choice_3": "Puffin.", + "answer_choice_4": "Fox.", + "answer_id": 0, + "answer": "Walrus.", + "question_type": "Cause and Effect", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 01:00, the tour guides dock their inflatable lifeboat carrying tourist passengers ashore. From 01:02-01:05, I watched as the tour guides dock on land, and the tourists walk single file. They carry telephoto lens cameras and telescopes. Subsequently, from 01:05-01:21, the tourists stand at a distance holding their professional lenses and iPhones to snap photos and film videos of a walrus pack lounging along the rocky banks of the Arctic shoreline." + }, + { + "key": "03hFktDJ6zc:b14f46834190b21c20b658f153bdae4dd017f938", + "video_id": "03hFktDJ6zc", + "question": "How many times is a whale's fluke seen emerging from the water?", + "answer_choice_0": "5.", + "answer_choice_1": "11.", + "answer_choice_2": "13.", + "answer_choice_3": "9.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and looked for instances where I saw a whale's fluke emerge from the water. I saw this occur at 00:23-00:24, 00:49-00:51, 03:18-03:19, and 03:22-03:24. Next, I added each of those instances together, which equaled a sum of 4. Therefore, the answer is 4." + }, + { + "key": "03hFktDJ6zc:d11d30c78abe62dc7e218b5c0d9413b04659fe41", + "video_id": "03hFktDJ6zc", + "question": "What creature is the man referring to when he says \"we are very blessed to have them today -- they are not always at this spot\"?", + "answer_choice_0": "Arctic fox.", + "answer_choice_1": "Orca.", + "answer_choice_2": "Walrus.", + "answer_choice_3": "Snow leopard.", + "answer_choice_4": "Polar bear.", + "answer_id": 2, + "answer": "Walrus.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and listened for the man to say \"we are very blessed to have them today -- they are not always at this spot\". I heard this occur from 01:10 to 01:14. On screen, I saw a walrus, indicating that this is the creature he's talking about. Therefore, the answer is walrus." + }, + { + "key": "076Q76G0ptA:00be328a2eff99f621abd862c1a869734f6c744c", + "video_id": "076Q76G0ptA", + "question": "If all of the individuals visible on the top part of the boat from 01:25-01:35 were to visit the beach at 03:40-03:45, how many total people would be there, including the people already there?", + "answer_choice_0": "12.", + "answer_choice_1": "22.", + "answer_choice_2": "20.", + "answer_choice_3": "24.", + "answer_choice_4": "16.", + "answer_id": 4, + "answer": "16.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to first count how many individuals are visible on the top part of the boat from 01:25-01:35. I watched this portion and counted 12 total people. I then went to 03:40-03:45 to see the beach, and count how many people were present there at that time. I found 4 additional people. Adding 12 and 4 equals 16, which makes the answer 16." + }, + { + "key": "076Q76G0ptA:10ddf9ab1cda3edbdd64cf9bfc851d4706219ccc", + "video_id": "076Q76G0ptA", + "question": "At the catamaran dock at Bequia, if you face the signs and walk left, where would you end up?", + "answer_choice_0": "Bank and Tourism Office.", + "answer_choice_1": "Food and Drinks and Model Boat Shop.", + "answer_choice_2": "Belmont Walkway and Food and Drinks.", + "answer_choice_3": "Belmont Walkway and Bank.", + "answer_choice_4": "Tourism Office and Bank.", + "answer_id": 2, + "answer": "Belmont Walkway and Food and Drinks.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I search the video for when they disembark the catamaran, which is at 03:17. There is a sign that shows that Food and Drinks is both right and left, and, at 03:20, there is a sign that shows that Belmont Walkway also points left. The Tourism Office, Bank, and Model Boat Shop are all in the right direction. Hence the answer is Belmont Walkway and Food and Drinks, for if you were to stand and face the signs, both would point left." + }, + { + "key": "076Q76G0ptA:3ac1d8752a7516ae97766bb588955dadc75ed93e", + "video_id": "076Q76G0ptA", + "question": "As the tourists enter the Kingstown Cruise Terminal, how many musicians would there be playing music right outside of it if there were two additional musicians?", + "answer_choice_0": "8.", + "answer_choice_1": "4.", + "answer_choice_2": "7.", + "answer_choice_3": "6.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to find the moment when the tourists are entering the Kingstown Cruise Terminal. I found this moment at 00:21, when a red building became visible next to a tall fence. As the person operating the camera gets closer to the building at 00:23, text can be read on the building which reads: \"KINGSTOWN CRUISE TERMINAL\". To the left of the building's entrance, some musicians are visible. At 00:32, as the person operating the camera gets even closer, 3 separate musicians are seen standing in orange shirts. If there were two additional musicians, there would be 5. So, the answer is 5." + }, + { + "key": "076Q76G0ptA:424294eb0fb543f275819b5360549fe820b4da30", + "video_id": "076Q76G0ptA", + "question": "Which way does the woman in the blue dress walk on the boat?", + "answer_choice_0": "From the aft toward the bow and to the stern side.", + "answer_choice_1": "From stern to port and toward the bow.", + "answer_choice_2": "From stern to port and toward the aft.", + "answer_choice_3": "From port to stern and toward the bow.", + "answer_choice_4": "From port to stern and toward the aft.", + "answer_id": 3, + "answer": "From port to stern and toward the bow.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I searched the video for a woman in a blue dress on a boat. At 03:50 footage onboard the boat resumed and I noticed a woman in a blue dress holding onto a wall. At 04:00 I observed the woman turn to her right and struggle to walk forward as the boat rocked beneath her. At 04:14, I saw that she made it to another wall. She continued walking forward and reached the opposite railing (compared to where she started) at 04:18. She turned to her left and walked a few steps forward, then disappeared from view at 04:23. During this time period of 03:50-04:23, I observed that the water in the background appeared to be getting closer. This meant that the boat was going in the direction that the camera was pointing. This meant that the woman started out on the left, relative to the boat's direction, which is known as the port side. She then crossed to the right, relative to the boat's direction, which is known as the stern side. When she walked a few steps forward, relative to the boat's direction, she was walking toward the bow. I watched the remainder of the video and did not see another woman in a blue dress walk across the boat. Therefore, the woman walked from port to stern and toward the bow." + }, + { + "key": "076Q76G0ptA:48254c07a5ea67ca6a583be901b4b267f4ff2a6a", + "video_id": "076Q76G0ptA", + "question": "How many more people on the top level of the boat are not wearing orange the second time someone is seen hoisting the sail?", + "answer_choice_0": "9.", + "answer_choice_1": "8.", + "answer_choice_2": "12.", + "answer_choice_3": "11.", + "answer_choice_4": "10.", + "answer_id": 1, + "answer": "8.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched for someone to hoist the sail on the boat. At 01:14, I saw a person standing next to the mast on the top level of the boat. From 01:14-01:17, I saw them unwind something and then begin to pull down on some rope. I understood this to be the person hoisting the sail and counted this as the first occurrence. From 01:25-01:35 I saw the person hoisting the sail again and counted this as the second occurrence. I counted the people on the top level of the boat during this section. I counted 12 people, including the person at the mast. Of these people, I saw that only 4 wore orange clothing. I subtracted 12-4=8. Therefore, I determined that 8 more people were not wearing orange on the top level the second time the person was seen hoisting the sail." + }, + { + "key": "076Q76G0ptA:5daa91084419b7bfdb8b0fec91b04a6c294f8fb0", + "video_id": "076Q76G0ptA", + "question": "After disembarking the catamaran, if you walk at approximately 3 miles an hour, how long would it take to reach the bank?", + "answer_choice_0": "Roughly 4 minutes.", + "answer_choice_1": "Roughly 2 minutes.", + "answer_choice_2": "Roughly 5 minutes.", + "answer_choice_3": "Less than a minute.", + "answer_choice_4": "More than 5 minutes.", + "answer_id": 1, + "answer": "Roughly 2 minutes.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I seach the video for when they disembark the catamaran, which is at 03:17. There is a sign that says the bank is 150 m away. Given 1 mile is approximately 1609 meters and 1 hour has 60 minutes, walking at 3 mph would mean walking 3*1609/60 = 80 metres per minute. Hence it would take around 150/80 = 1.87 minutes to reach the bank, which is roughly 2 minutes." + }, + { + "key": "076Q76G0ptA:829cee507965b189fcf9e488b871c644d3105f67", + "video_id": "076Q76G0ptA", + "question": "Toward the end of the video, when the group is traveling back to St. Vincent, how long does it take from the first time the final voyage is shown for someone to be shown holding a rum punch drink?", + "answer_choice_0": "1 minute and 48 seconds.", + "answer_choice_1": "1 minute and 45 seconds.", + "answer_choice_2": "1 minute and 59 seconds.", + "answer_choice_3": "1 minute and 18 seconds.", + "answer_choice_4": "1 minute and 38 seconds.", + "answer_id": 3, + "answer": "1 minute and 18 seconds.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to determine when the group is traveling back to St. Vincent. At 03:51, text appears on the screen, which reads: \"A rocky journey back to St Vincent!\" Before this, the group was shown starting at 03:50. Since this is the journey back, I looked for when a rum punch drink appears on the screen. At 05:09, during the same trip, more text appears in the bottom left corner, which reads: \"Rum punch\" with a tropical drink emoji. The drink is first visible just before this, at 05:08. So, using subtraction, I determined that it took 1 minute and 18 seconds for someone to be shown holding a rum punch drink." + }, + { + "key": "076Q76G0ptA:a259ad8a631fc6822873ef31c8efd2a6206fe3fe", + "video_id": "076Q76G0ptA", + "question": "If a disembarking cruise passenger wanted to take a selfie in front of the mural, what steps should they take?", + "answer_choice_0": "Turn left off the boat, turn right at the building, turn right in front of the mural.", + "answer_choice_1": "Turn right off the boat, turn right at the building, turn right in front of the mural.", + "answer_choice_2": "Walk straight off the boat, turn left at the building, walk straight in front of the mural.", + "answer_choice_3": "Turn left off the boat, turn left at the building, turn left in front of the mural.", + "answer_choice_4": "Turn right off the boat, turn left at the end of the dock, turn right in front of the mural.", + "answer_id": 0, + "answer": "Turn left off the boat, turn right at the building, turn right in front of the mural.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 00:13, I observed that the cruise ship was docked so that its port-side was adjacent to the dock. From 00:13-00:17 I observed that people were walking toward the camera on the dock. From 00:17-00:21, I saw that the camera moved clockwise about 180 degrees to face a building. This means that in order to walk to the building, a disembarking passenger would turn left onto the dock and be facing the building. At 00:27 I observed a mural on the wall to the right of the building (relative to the camera's perspective). This means that if someone wanted to take a selfie (which I understood to mean a photo taken by oneself), they would need to turn right once they got to the entrance of the building, and then right again so that they faced away from the mural. Therefore, I determined that the total moves required would be turning left, turning right, and turning right." + }, + { + "key": "076Q76G0ptA:afed7c7809ebeab9e7984142b528df37c1c6271c", + "video_id": "076Q76G0ptA", + "question": "From the time when the tourists embark on their boat trip to Bequia, how long would it have taken for them to reach Bequia in the video if it took 15 fewer seconds?", + "answer_choice_0": "2 minutes and 1 second.", + "answer_choice_1": "49 seconds.", + "answer_choice_2": "1 minute and 18 seconds.", + "answer_choice_3": "1 minute and 57 seconds.", + "answer_choice_4": "1 minute and 33 seconds.", + "answer_id": 4, + "answer": "1 minute and 33 seconds.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to see how long it takes the tourists to reach Bequia from the time they embark on their boat trip. At 02:47, text in the bottom left corner of the screen appears, which reads: \"Bequia.\" Since this is when they arrived at Bequia, I went earlier in the video to see when their journey begins. At 00:59, the group of tourists is shown in the boat. From 00:59-02:47, the continuous boat ride is shown, which equates to 1 minute and 48 seconds. Subtracting 15 seconds, that gives a total time of 1 minute and 33 seconds." + }, + { + "key": "0BIYhbK6JWA:43a3259df84903e31634df4f1df78ef54c0d3b7a", + "video_id": "0BIYhbK6JWA", + "question": "What is the total duration of the clips in the video that feature a drive through a covered tunnel?", + "answer_choice_0": "14 seconds.", + "answer_choice_1": "10 seconds.", + "answer_choice_2": "13 seconds.", + "answer_choice_3": "19 seconds.", + "answer_choice_4": "16 seconds.", + "answer_id": 4, + "answer": "16 seconds.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to identify clips of a drive through a covered tunnel, and counted the total number. The first such clip shows a drive through a covered tunnel from 00:23-00:33. The second clip which shows a car driving through a tunnel occurs from 00:44-00:50, for a total of 2 clips in the video. I watched the rest of the video to ensure no more drives through covered tunnels are shown after this point. Next, I found the duration for each clip: 00:33-00:23=10 seconds; 00:50-00:44=6 seconds. I added the duration of each of these clips together to find the total duration: 10+6=16 seconds. Therefore, I determined that the total duration of clips that feature driving through a covered tunnel is 16 seconds." + }, + { + "key": "0BIYhbK6JWA:558c1d9eaeb2cf7a215385ecce437efaaf74d293", + "video_id": "0BIYhbK6JWA", + "question": "What number would you get if you divided the number of times the speakers say \"cost\" or \"costs\" by the number of Norwegian flags shown or depicted in the video?", + "answer_choice_0": "2.5", + "answer_choice_1": "2", + "answer_choice_2": "1", + "answer_choice_3": "0.8", + "answer_choice_4": "0.6", + "answer_id": 2, + "answer": "1", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I watched the video and listened to the speakers, anticipating them saying the word \"cost\" or \"costs.\" \"Cost\" is said at 00:07 for the first time, at 01:24 the second time, and at 01:28 for a third time. \"Costs\" was said at 00:45, and again at 01:24. This gives us a total of 5 instances \"cost\" or \"costs\" was said by the speaker. Next, I watched the video again, looking for Norwegian flags. The first one is shown on a sign at 00:35. Then, at 00:59, there are 4 flags shown over a store. This gives us a total of 5 Norwegian flags shown or depicted in the video. I then divided the number of times the speakers said \"cost\" or \"costs\" (5) by the number of Norwegian flags shown or depicted in the video (5). The answer is (1)." + }, + { + "key": "0BIYhbK6JWA:629122f448c03a6bc496d53f419901ac421587e8", + "video_id": "0BIYhbK6JWA", + "question": "If you added the most expensive thing shown from the menu with the metal spine, the fast food menu, and from the prices in the grocery store, what would the sum be in Norwegian Kroner?", + "answer_choice_0": "412.5 kr.", + "answer_choice_1": "407.3 kr.", + "answer_choice_2": "223.5 kr.", + "answer_choice_3": "407.5 kr.", + "answer_choice_4": "412 kr.", + "answer_id": 0, + "answer": "412.5 kr.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, I looked out for the menu with the metal spine, a fast food menu, and grocery store footage. First came the grocery store footage, at 01:01. In the first shoot of the grocery store footage, there are two prices\u201428.50 kr and 27.30 kr. The next shot of the grocery store footage did not include prices, meaning the most expensive thing shown from the grocery store costs 28.50 kr. Next came the menu with the metal spine at 01:11. I read the menu and though blurry, a Whale Burger is listed for 195 kr in restaurant. Finally, the fast food menu was shown at 01:15. It had myriad prices as well, but the most expensive thing shown was 189 kr. I then added the numbers I found together\u201428.50+195+189. The sum is 412.5." + }, + { + "key": "0BIYhbK6JWA:6cb50f6b1d63ea352f088a643725b63f195e4489", + "video_id": "0BIYhbK6JWA", + "question": "What do the jelly jar shown and the second peanut butter jar shown in the video have in common?", + "answer_choice_0": "Their lid color", + "answer_choice_1": "Their shape", + "answer_choice_2": "Their location", + "answer_choice_3": "Their label color", + "answer_choice_4": "Their accompaniments", + "answer_id": 1, + "answer": "Their shape", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I first located the jelly jar in the video - this could be one of any number of identical jelly jars shown in the clip in the grocery store from 01:02-01:06. I noted that it was a glass, cylindrical jar with a red label, located on a grocery store shelf and accompanied by other jelly jars. I then looked for jars of peanut butter. I found the first jar peeking out of a backpack from 01:22-01:24. I identified it as a peanut butter jar because of the word \"Peanut\" on the label and its brown coloring. Then I saw another jar of peanut butter from 01:24-01:28. Since this was the second jar, I noted its characteristics in more detail. I noted that it was a plastic, cylindrical jar with a blue label, located on a patio table and accompanied by apple slices. Of the options listed, the one that the peanut butter jar and jelly jar have in common is their cylindrical shape, making \"shape\" the correct answer to this question." + }, + { + "key": "0BIYhbK6JWA:6d644f3ea999b16a7a9b7fe2f07233d1b6624e1d", + "video_id": "0BIYhbK6JWA", + "question": "What is the mathematical difference between Venezuela's cost of living value, and the cost of an in-store whale burger in dollars?", + "answer_choice_0": "17.80.", + "answer_choice_1": "88.25.", + "answer_choice_2": "62.51.", + "answer_choice_3": "83.49.", + "answer_choice_4": "24.78.", + "answer_id": 1, + "answer": "88.25.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "To determine this value, I looked at the graphic which shows the top 10 countries in cost of living, which is displayed onscreen from 00:02-00:06. Reading this graph, I determined that Venezuela was number 3 on the list, with a cost of living value of 111.51. I then located the cost of a whale burger, which can be seen on the menu shown from 01:11-01:15 - I read the price listed specifically in the \"Eat Here\" column, because this price has a dollar amount listed beneath it, which I identified as $23.26. To find the difference between these two numbers, I did the equation 111.51-23.26=88.25." + }, + { + "key": "0BIYhbK6JWA:81ac698fe7b30594026dff57f0e49f7376e53393", + "video_id": "0BIYhbK6JWA", + "question": "If the speakers still had the total amount of money they spent on both takeout and groceries, then according to the menu in the video, how much money would they have remaining after purchasing a whale burger?", + "answer_choice_0": "$325.14.", + "answer_choice_1": "$78.86.", + "answer_choice_2": "$403.22.", + "answer_choice_3": "$706.74.", + "answer_choice_4": "$526.23.", + "answer_id": 3, + "answer": "$706.74.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 01:25, I heard the speakers say they spent $325 on takeout. Then, at 01:36, I heard them say they spent $405 on groceries. I then calculated $325+$405=$730, which is the total amount of money the speakers spent on both takeout and groceries. Next, I found the menu with the whale burger and its price at 01:13, reading \"$23.26\". I then calculated $730-$23.26=$706.74. Therefore, if the speakers still had the total amount of money they spent on both takeout and groceries, according to the menu in the video, after purchasing a whale burger, they would have $706.74 remaining." + }, + { + "key": "0BIYhbK6JWA:a5453f7f8fa5cd356390b1a2e629b40572cb2ece", + "video_id": "0BIYhbK6JWA", + "question": "How many shots in the final minute of the video feature a body of water?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "To determine this, I watched the video for its final minute - the video is a total of 02:01 minutes long, so I watched from 01:01-02:01. During this time, I identified the unique shots which contained a body of water and counted those shots. I saw shots which contained a body of water from 01:24-01:28 (a river can be seen in the distance at the start of the shot), 01:47-01:50, 01:53-01:54, and 01:54-01:57. I counted up these shots, for a total of 4." + }, + { + "key": "0BIYhbK6JWA:d12a87d78da652401bf0da652b8b12bda5d1c03b", + "video_id": "0BIYhbK6JWA", + "question": "Which item is not shown being held by the man?", + "answer_choice_0": "A spatula.", + "answer_choice_1": "An apple slice.", + "answer_choice_2": "A pair of tongs.", + "answer_choice_3": "A bottle of mustard.", + "answer_choice_4": "A phone.", + "answer_id": 1, + "answer": "An apple slice.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video carefully and identified each time a specified object was shown being held by the man in the video. At 00:56, I saw the man holding a pair of tongs in his right hand and a spatula in his left hand. At 01:23, I saw the man holding a bottle of mustard in his hand. At 01:26, I saw a man holding a phone in his hands. Therefore I determined that the object not shown held by the man is an apple slice." + }, + { + "key": "0BIYhbK6JWA:d539352f7e0aab21808c5514887b9e52172599b5", + "video_id": "0BIYhbK6JWA", + "question": "What is the ratio of hot-dogs on the barbecue to toast shown in the video?", + "answer_choice_0": "3:6.", + "answer_choice_1": "5:2.", + "answer_choice_2": "3:2.", + "answer_choice_3": "2:3.", + "answer_choice_4": "5:6.", + "answer_id": 2, + "answer": "3:2.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and waited for a barbecue to appear on screen, which it did, from 00:54 to 00:57. I stopped the video during this timeframe and counted the hot-dogs. There were 3. I then continued the video, and waited for toast to be shown, which it was, starting at 00:57. There are 2 toasted sandwiches in this shot, and though one is cut in half, there are still only four pieces of toast shown, making 2 sandwiches. This makes the ratio of hot dogs on the barbecue to toast shown in the video 3:2." + }, + { + "key": "0ILGJ9r9BbY:2087f86de57f9c8df6abc4fcceca06324c68469c", + "video_id": "0ILGJ9r9BbY", + "question": "How many figures of the man can be seen painting on the wall from 04:17-04:19?", + "answer_choice_0": "6 figures.", + "answer_choice_1": "3 figures.", + "answer_choice_2": "5 figures.", + "answer_choice_3": "8 figures.", + "answer_choice_4": "2 figures.", + "answer_id": 0, + "answer": "6 figures.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video, I identified the moment with the most figures of the original painter, which occurred at 04:17. I then continued watching until 04:19. Between 04:17-04:19 there were six figures of the man painting the wall." + }, + { + "key": "0ILGJ9r9BbY:420bfe59d358982d3201eb7966a15a6438597733", + "video_id": "0ILGJ9r9BbY", + "question": "What is the cause of the man's frustration from 01:05 to 01:31 in the video?", + "answer_choice_0": "The man lacks the inspiration to make art.", + "answer_choice_1": "The boy is playing, slowing the man down.", + "answer_choice_2": "The boy is in trouble, frustrating the man.", + "answer_choice_3": "The boy is sleeping, making the man late.", + "answer_choice_4": "The man lacks the ability to sell his art.", + "answer_id": 0, + "answer": "The man lacks the inspiration to make art.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from 01:05 to 01:31. I see that the man's frustration is stemmed from the man unable to make art due to being uninspired. At 01:15, I observed him tapping a clean paintbrush against the ground, signifying his anxiety that he has no ideas. This is also determined by listening to the narrator as they say, \"Who told you to start playing?\" As the narrator continues to recite the man's past truamas, the man looks sad, helpless, and unispired." + }, + { + "key": "0ILGJ9r9BbY:a3688d98d8879d4d32269f547f0cfc20bdf1284b", + "video_id": "0ILGJ9r9BbY", + "question": "What word does the narrator use in the video immediately before the third separate shot showing a hug between the man and the boy?", + "answer_choice_0": "Hug", + "answer_choice_1": "Blend", + "answer_choice_2": "Unify", + "answer_choice_3": "Morphed", + "answer_choice_4": "One", + "answer_id": 4, + "answer": "One", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video, I looked for the shots where the man and the boy are shown hugging. The first occurs from 03:13-03:14. The second occurs from 03:15-03:16. The third occurs from 03:18-03:22. Then, I reviewed the moments leading up to the third hug to hear the last word that the narrator uses. I identified the narrator's last word before the third hug which was \"One\"." + }, + { + "key": "0ILGJ9r9BbY:aac034b297e9bc8d4db8b26744c2ac312ec5d8a6", + "video_id": "0ILGJ9r9BbY", + "question": "What word can be read in the painting at 00:51?", + "answer_choice_0": "Stop.", + "answer_choice_1": "Live.", + "answer_choice_2": "Love.", + "answer_choice_3": "Give.", + "answer_choice_4": "Laugh.", + "answer_id": 3, + "answer": "Give.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I forwarded the video to 00:51 and looked for a man painting. Within the painting, I looked for the word, which I identified and read as \"GIVE\". It was located amidst the painting, as a part of it." + }, + { + "key": "0ILGJ9r9BbY:fbc9af363e17477632d778212188f13f1861db66", + "video_id": "0ILGJ9r9BbY", + "question": "What led to the boy rising quickly out of bed?", + "answer_choice_0": "The voice of the narrator says, \"Get up now!\"", + "answer_choice_1": "The voice of the narrator says, \"Get up!\"", + "answer_choice_2": "The voice of the narrator says, \"Get your ass up now!\"", + "answer_choice_3": "The voice of the narrator says, \"Get up, it's time!\"", + "answer_choice_4": "The voice of the narrator says, \"Get your ass up.\"", + "answer_id": 4, + "answer": "The voice of the narrator says, \"Get your ass up.\"", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, searching for a scene with the boy in bed. This occurs at 00:17. I listened to hear if the narrator made any demands of the boy. I heard the narrator say \"Get your ass up\" at 00:29, and as a result, the boy rose out of bed at 00:31." + }, + { + "key": "0JZ5AE0erU0:1aba4fd984c7dd3e6c9d70f7c9cf660cfb1be2cc", + "video_id": "0JZ5AE0erU0", + "question": "What is the main reason one of the brothers opts to take the hippy name \"Mouse?\"", + "answer_choice_0": "He has persistent visions of the future where he has a pet mouse.", + "answer_choice_1": "He named himself after the first creature he saw.", + "answer_choice_2": "He is afraid of mice.", + "answer_choice_3": "He really likes cheese.", + "answer_choice_4": "The hippy girl wants to name him \"Mouse,\" and he goes along with it.", + "answer_id": 3, + "answer": "He really likes cheese.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and noticed the girl asking the brothers what animals they wanted to be named after at 6:14. She points out why each of the other characters might have chosen their names, as it matches their personality or the animals they most relate to. Berry, the first brother, says he relates to the mouse because they both like cheese." + }, + { + "key": "0JZ5AE0erU0:4ba034a8bf29fd34ec729046a4c420d65c959ab5", + "video_id": "0JZ5AE0erU0", + "question": "Why does one of the brothers not want to challenge the guru to a pillow fight?", + "answer_choice_0": "He heard that the guru uses a rock as a pillow.", + "answer_choice_1": "The guru sleeps with a body pillow, and the brother worries it would give him an unfair advantage in a fight.", + "answer_choice_2": "The guru is a pillow fight champion.", + "answer_choice_3": "The guru keeps a gun under his pillow.", + "answer_choice_4": "The brother is a weak pillow fighter.", + "answer_id": 0, + "answer": "He heard that the guru uses a rock as a pillow.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I heard the girl mention what the guru does at bedtime. At 5:02, she says he eats, then goes to bed with a rock to rest his head on. At this point, one of the brothers says to remind him not to challenge the guru to a pillowfight." + }, + { + "key": "0JZ5AE0erU0:5557ff17554f2efbd320821fb096772c2ff03baf", + "video_id": "0JZ5AE0erU0", + "question": "How many colors are there in the ChuckleVision logo at the beginning of the video?", + "answer_choice_0": "5.", + "answer_choice_1": "6.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "5.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the beginning at 00:00 and saw that the logo of the company began to appear on the screen. Originally, the logo was repeateded over and over again in the upper background of the screen. Then it moved to a central location and in a larger font in the lower center of the screen. There are five colors in their logo." + }, + { + "key": "0JZ5AE0erU0:c0eef1bbba675b2ef21008a935664744406550d4", + "video_id": "0JZ5AE0erU0", + "question": "How long did the man say it has been since they last ate?", + "answer_choice_0": "Two minutes.", + "answer_choice_1": "Two seconds.", + "answer_choice_2": "Two weeks.", + "answer_choice_3": "Two hours.", + "answer_choice_4": "Two days.", + "answer_id": 3, + "answer": "Two hours.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video where it begins with the hippie asking the men if they are hungry at 02:09. One of the men responds and says that they are, and that they are starving and haven't eaten in 2 hours." + }, + { + "key": "0WDXJ9g7KAw:140d1fe1132958773ad64cd51820190a6e92b5ca", + "video_id": "0WDXJ9g7KAw", + "question": "During the character's monologue, which runs from 00:18-04:35, how many shot cuts occur in the video?", + "answer_choice_0": "None.", + "answer_choice_1": "Ten.", + "answer_choice_2": "Five.", + "answer_choice_3": "Seven.", + "answer_choice_4": "One.", + "answer_id": 0, + "answer": "None.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video during the specified time frame (00:18-04:35) in order to see how many shot cuts occur during the character's monologue. From the beginning, the camera frame slowly zooms into the character as he speaks. He comes closer into view the entire time. The zoom never stops, eventually reaching the 04:35 time stamp of the video and then cutting to black. So, from 00:18-04:35, as the character speaks his monologue, there are no shot cuts at all." + }, + { + "key": "0WDXJ9g7KAw:24ab48692191a62b30ff96a08caa88218967e8b1", + "video_id": "0WDXJ9g7KAw", + "question": "Where is the bald man in the suit sitting in relation to the black train tanker car and the fire during the first 30 seconds of his monologue where he is also visible on the screen?", + "answer_choice_0": "In front of them.", + "answer_choice_1": "To the right of them.", + "answer_choice_2": "In between them.", + "answer_choice_3": "Above them.", + "answer_choice_4": "To the left of them.", + "answer_id": 2, + "answer": "In between them.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for an image of the bald man in the suit and listened for his monologue. I found the first image of him at 00:18 and heard his monologue begin while he is onscreen at 00:23. I continued watching for 30 seconds until 00:53. From 00:23-00:53, I observed that he was facing the camera to the left of a black tanker and to the right of a fire. I also observed that his position doesn't change during this timespan. I concluded that he is sitting between them." + }, + { + "key": "0WDXJ9g7KAw:62ea390ea71b4084a2c7ef7623de092150ffe222", + "video_id": "0WDXJ9g7KAw", + "question": "What ongoing phenomenon is visible on the left side of the frame from 00:17-02:55?", + "answer_choice_0": "It is completely dark and black.", + "answer_choice_1": "Wind streams in from a window.", + "answer_choice_2": "Flames shroud the room.", + "answer_choice_3": "The room is soaking wet.", + "answer_choice_4": "It is very brightly lit.", + "answer_id": 2, + "answer": "Flames shroud the room.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to understand any ongoing phenomena. From 00:17-02:55, the camera frame slowly zooms into the main character, who sits in the center of the frame, and he speaks. As this occurs, the left side of the frame is filled with flames that stream upward. Thus, the ongoing phenomenon is flames that shroud the room." + }, + { + "key": "0WDXJ9g7KAw:67046ddf25ae1839d4810539d13b517659a32347", + "video_id": "0WDXJ9g7KAw", + "question": "In which direction is the bald man in the suit's right knee pointed when he's talking into the transmitter?", + "answer_choice_0": "Down.", + "answer_choice_1": "Up.", + "answer_choice_2": "Right.", + "answer_choice_3": "Straight.", + "answer_choice_4": "Left.", + "answer_id": 1, + "answer": "Up.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the bald man in the suit. I found him for the first time at 00:18. I continued watching and looking to see when he would begin speaking into the transmitter. I saw this happen for the first time at 00:23, but his knee was obscured at that time by some objects in the foreground. I continued watching and looking for an image of his knee. I made sure his position did not change as I watched and that he continued talking into the transmitter. As the camera moves forward past the objects in the foreground, a clear image of the bald man in the suit's right knee emerges between 01:23-03:02. I observed that his knee was pointing up. I continued to watch the video until the end of the scene to confirm that he talks into the transmitter throughout and that the position of his right knee never changes. I thus concluded that his right knee is pointed up when he is talking into the transmitter." + }, + { + "key": "0WDXJ9g7KAw:81bcc0af73eda88de06891e1620b8969a53aaa10", + "video_id": "0WDXJ9g7KAw", + "question": "What surrounds the spinning circular medallion during the closing credits?", + "answer_choice_0": "Fire.", + "answer_choice_1": "Mountains.", + "answer_choice_2": "Water.", + "answer_choice_3": "Stars.", + "answer_choice_4": "Clouds.", + "answer_id": 0, + "answer": "Fire.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the closing credits. I saw them begin at 04:36. I continued watching and looked for a spinning circular medallion. I saw it for the first time clearly at 05:00. I continued watching to see what surrounds it. I saw at 05:02 that it was surrounded by fire." + }, + { + "key": "0e9Q7n11tvg:05ef42f095155c72d671d984de0abd38c04bb49f", + "video_id": "0e9Q7n11tvg", + "question": "What is the total of the first 2 numbers of the full price listed on the receipt after the meal served by the robot waiter?", + "answer_choice_0": "9.", + "answer_choice_1": "10.", + "answer_choice_2": "6.", + "answer_choice_3": "8.", + "answer_choice_4": "13.", + "answer_id": 4, + "answer": "13.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video looking for the robot waiter. The robot waiter appears onscreen at 02:56, and at 03:00, the narrator states that their dinner was served by a robot waiter. I continued watching and looked for a receipt after the dinner, which is visible on a table at 03:02. The full price given at the bottom of the receipt is 94.96. The first 2 numbers are 9 and 4, which would make a sum total of 13 when added together." + }, + { + "key": "0e9Q7n11tvg:38271f3588559b36159ed4bee570370767909285", + "video_id": "0e9Q7n11tvg", + "question": "If the woman in front of the camera had kept walking past the tax free snacks, walking forward and then turning left, where would she have ended up?", + "answer_choice_0": "Beauty Services.", + "answer_choice_1": "Art Lane.", + "answer_choice_2": "Fashion Level.", + "answer_choice_3": "EX House Store.", + "answer_choice_4": "Food Court.", + "answer_id": 1, + "answer": "Art Lane.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to find the moment where the woman is walking in front of the camera, paying close attention for where I could see tax free snacks. At 00:52, the woman walks in a large shopping center. To her left is a wall of snacks with a sign above it that says \"Tax Free.\" So these are the tax free snacks. I looked at the area around her. The woman keeps walking straight, and at 00:55, a sign for \"Art Lane\" with an arrow pointing to the left is up ahead. So if the woman were to keep walking forward and then turned left, she would have ended up at the Art Lane." + }, + { + "key": "0e9Q7n11tvg:64268445e1e0fe4c366be2a6181e6b4ad7fdfc7d", + "video_id": "0e9Q7n11tvg", + "question": "Where was the narrator before going to the Singapore Botanic Gardens, as seen in the video?", + "answer_choice_0": "At a street market.", + "answer_choice_1": "In an art gallery.", + "answer_choice_2": "On his hotel balcony.", + "answer_choice_3": "At a shopping mall.", + "answer_choice_4": "At a coffee shop.", + "answer_id": 3, + "answer": "At a shopping mall.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, I looked for the part where the narrator began filming the Singapore Botanic Garden. I identified this at 04:21, as I saw the garden's entrance with its name displayed. From this point, I went back in the video to see where he filmed immediately before arriving at the garden. At 04:20, I noticed he filmed in a mall, with retail shopping stores and a cow statue centered in the frame. Therefore, I concluded he was in a shopping mall before going to the Singapore Botanic Garden." + }, + { + "key": "0e9Q7n11tvg:a10a860cb72157b21cd4ff6d0832b29ba4e90e04", + "video_id": "0e9Q7n11tvg", + "question": "How many seconds after the last glimpse of the coffee shop, Apartment, does the narrator actually talk about the coffee shop, Apartment?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "7.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "2.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video looking for signs of the coffee shop called Apartment. At 00:34, I saw the interior of a coffee shop. I continued watching until 00:37, when a card next to a cup of coffee can be seen with the word Apartment on the top. The coffee shop scene ends at 00:38. I listened for the narrator to talk about his visit to the coffee shop, which he does at 00:40. There are 2 seconds between the end of the coffee shop scene and the narrator starting to talk about the visit." + }, + { + "key": "0e9Q7n11tvg:af8ea93ce23fb8ad331e6e8f746000faa4242f20", + "video_id": "0e9Q7n11tvg", + "question": "What was the second animal the narrator filmed in the Singapore Botanic Garden within the video?", + "answer_choice_0": "A turtle.", + "answer_choice_1": "A bird.", + "answer_choice_2": "A crocodile.", + "answer_choice_3": "A snake.", + "answer_choice_4": "An alligator.", + "answer_id": 2, + "answer": "A crocodile.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, I looked for the parts where the narrator was in the Singapore Botanic Garden, first spotting it at 04:21, as he filmed the entrance of the garden. I continued watching, searching for animals the narrator filmed or encountered. At 04:35, I saw him filming a large lizard in the garden. Then, continuing to watch for the second animal, I saw a large crocodile peeking through the water at 04:39. Therefore, the answer is a crocodile." + }, + { + "key": "0e9Q7n11tvg:cfe91b6ebdc92a5b05d8b935a3b87256f15ac537", + "video_id": "0e9Q7n11tvg", + "question": "Which media productions are show on screens during the first 45 seconds of the video?", + "answer_choice_0": "Mad Max: Beyond Thunderdome and Yellow Brick Road and Beyond.", + "answer_choice_1": "Mad Max: Fury Road and The Wizard of Oz.", + "answer_choice_2": "Furiosa: A Mad Max Saga and Wicked.", + "answer_choice_3": "Max Max (1977) and Return to Oz.", + "answer_choice_4": "Mad Max 2: The Road Warrior and Oz the Great and Powerful.", + "answer_id": 2, + "answer": "Furiosa: A Mad Max Saga and Wicked.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the first 45 seconds of the video, looking for screens showing media productions. At 00:08, a black tablet is playing Furiosa: A Mad Max Saga. I kept watching until I saw a large digital billboard on a building. At 00:41, this billboard shows an actor dressed up as Elphaba from Wicked. No more screens are shown after this, making the answer Furiosa and Wicked." + }, + { + "key": "0e9Q7n11tvg:fbeefb3b93fcfa1afd4edf51195138067e229f55", + "video_id": "0e9Q7n11tvg", + "question": "How many times does the word Capitol appear on the building seen just after the tea shop?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "6.", + "answer_choice_4": "0.", + "answer_id": 2, + "answer": "2.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video looking for a tea shop, which was identifiable at 01:34, as there are pictures of tea and the word \"Tea\" on the menu board above the counter. Following the scene in the tea shop is a street scene, beginning at 01:43, and a large corner building is in the middle ground, featuring the word \"Perennial\" over the words \"The Capitol Kempinski Hotel\". The word \"Capitol\" appears again over the door of the building, meaning it appears twice." + }, + { + "key": "0lR8NhqOkGE:7a938491fc25ed39f6a11a0e2bde5bc3bbb10f13", + "video_id": "0lR8NhqOkGE", + "question": "What object does the driver of the red car's passenger give him before they ride together?", + "answer_choice_0": "A driver's racing helmet.", + "answer_choice_1": "A brightly colored scarf.", + "answer_choice_2": "A crumpled map of the city.", + "answer_choice_3": "A well-worn leather journal.", + "answer_choice_4": "A steaming mug of coffee.", + "answer_id": 0, + "answer": "A driver's racing helmet.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and took note of when the driver of the red car was handed things throughout. At 01:22, I saw a passenger hand the driver a racing helmet. Immediately after this happens, the diver gets into the red car. I kept watching and saw that at 01:28, the passenger is in the car with the driver. They then ride together between 01:28-02:16" + }, + { + "key": "0lR8NhqOkGE:a5b5c3912d2eecb3489318e37695bbaa75b3f9fb", + "video_id": "0lR8NhqOkGE", + "question": "What is handed to the main male character by a man in a gray shirt after a masked man gets into his car?", + "answer_choice_0": "A mysterious envelope.", + "answer_choice_1": "A wad of cash.", + "answer_choice_2": "A new suit.", + "answer_choice_3": "A briefcase.", + "answer_choice_4": "Keys to a new car.", + "answer_id": 3, + "answer": "A briefcase.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I carefully watched the video and looked for a moment when a masked man gets into the main male character's car. I found this moment between 2:49-2:52. I continued watching and looking for a moment when the main character is handed something by a man in a gray shirt.. I observed a man in a gray shirt hand him a briefcase between 03:05-03:06." + }, + { + "key": "0lR8NhqOkGE:de4f496bd9cc009dcaf4c23a93f4801e3f8d1622", + "video_id": "0lR8NhqOkGE", + "question": "How does the blonde woman feel after the man in the white jacket walks towards her from the bathroom?", + "answer_choice_0": "Happy.", + "answer_choice_1": "Curious.", + "answer_choice_2": "Skeptical.", + "answer_choice_3": "Envious.", + "answer_choice_4": "Horrified.", + "answer_id": 0, + "answer": "Happy.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a scene where a man in a white jacket is walking away from a bathroom. I found this moment from 02:16-02:17. I then watched the blonde woman's reaction to his presence from 02:18-02:22. I saw her smile and concluded from her demeanor that she is happy." + }, + { + "key": "0lR8NhqOkGE:eae9faa646d9d39be1213435d7fc0f3561670d91", + "video_id": "0lR8NhqOkGE", + "question": "In which direction did the police car go from the perspective of its driver after passing the building behind and to the left of the chainlink fence?", + "answer_choice_0": "Backwards.", + "answer_choice_1": "Right.", + "answer_choice_2": "Left.", + "answer_choice_3": "Straight.", + "answer_choice_4": "Forwards.", + "answer_id": 1, + "answer": "Right.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a moment when a police car passes a building behind and to the left of a chainlink fence. This moment begins at 02:39 when the police car drives beside the building. Between 02:43 - 02:47, I observed the police car turn to the right from the perspective of its driver after passing the building." + }, + { + "key": "0wbPOJ7gG4Q:30f577a351b71deca2bf590376359fe533644ff6", + "video_id": "0wbPOJ7gG4Q", + "question": "What does the top line of the graphic in the bottom right corner say at 00:11?", + "answer_choice_0": "Opponent | 0 - 15.", + "answer_choice_1": "Topspin Forehand.", + "answer_choice_2": "Tom N | 0 - 0.", + "answer_choice_3": "Shots Tracked by.", + "answer_choice_4": "SwingVision.", + "answer_id": 3, + "answer": "Shots Tracked by.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the graphic in the bottom right corner of the screen at 00:11. Then, I read the top line of the graphic, just above \"SwingVision\", which read \"Shots Tracked by\". Therefore, the top line of the graphic in the bottom right corner of the screen at 00:11 says \"Shots Tracked by\"." + }, + { + "key": "0wbPOJ7gG4Q:31d5398c0b3a22a3d6e8ca463de1028f4e5ec582", + "video_id": "0wbPOJ7gG4Q", + "question": "What type of hit did the man with the blue shirt return with after the man with the white shirt's first serve?", + "answer_choice_0": "Flat backhand.", + "answer_choice_1": "Slice forehand.", + "answer_choice_2": "Topspin forehand.", + "answer_choice_3": "Slice backhand.", + "answer_choice_4": "Flat forehand.", + "answer_id": 4, + "answer": "Flat forehand.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the ball in the man with the white shirt's hands at 00:00. Next, at 00:01, I saw the man with the white shirt serve the ball to the man with the blue shirt on the other side of the court. Then, I saw the man with the blue shirt return the ball back to the man with the white shirt on the other side of the court at 00:03. At the same time, I saw a graphic on the right side of the screen, indicating the type of hit that the man with the blue shirt just used, which read \"Flat Forehand\". Therefore, after the man with the white shirt's first serve, the man with the blue shirt returned with a flat forehand hit." + }, + { + "key": "0wbPOJ7gG4Q:37f54bb9053e4dd7f6c50f2fae2e41217780d115", + "video_id": "0wbPOJ7gG4Q", + "question": "What would happen if the man in blue won the point at 08:42?", + "answer_choice_0": "He would be \"vindicated\".", + "answer_choice_1": "He would have won the set.", + "answer_choice_2": "He would have won the match.", + "answer_choice_3": "He would have broken Tom N's serve.", + "answer_choice_4": "He would be up 40-30.", + "answer_id": 3, + "answer": "He would have broken Tom N's serve.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked at 08:42 to examine the point, and I looked at the scoreboard. I noticed that the man in white was serving, and the scoreboard read that \"Tom N\" was tied 4-4 games with his \"Opponent\" and that \"Tom N\" was down 30-40 in this game. Since the little dot by Tom N's name indicated that he was serving, I concluded that the man in white was Tom N and the man in blue was the Opponent. This means that the man in blue was leading 40-30, and with one point could win the game. During this point, the man in blue misses a forehand in the net (08:47), but had he won, he would have won the game and \"broken\" Tom N's serve. This would have allowed him to serve for the set in the next game." + }, + { + "key": "0wbPOJ7gG4Q:883745c3427939bdb501afc03804f618a73e62ec", + "video_id": "0wbPOJ7gG4Q", + "question": "How many total backhands does the man in blue hit in the first game?", + "answer_choice_0": "6.", + "answer_choice_1": "2.", + "answer_choice_2": "5.", + "answer_choice_3": "7.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "5.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for the first game. I noticed that the game starts right away at 00:00, because the man in white serves against the man in blue, and the scoreboard graphic in the top left corner reads \"0-0\" for the first game. Then, I counted how many backhands the man in blue hit. He hits 1 in the first point (00:08), 3 in the second point (00:21, 00:24, and 00:28), 0 in the third point, 1 in the fourth point (00:41), and 0 in the fifth point. I also noted that he hit a backhand at 00:32, but it was after the point was over because the ball had bounced twice. Therefore, I did not factor that hit in the total count. I added the backhand hits up from each of the points in the first game and came to a total of 5 backhands." + }, + { + "key": "0wbPOJ7gG4Q:8c913d8b2dac743c6a86e5dc7ed87b52af86cdfe", + "video_id": "0wbPOJ7gG4Q", + "question": "What happens to the mini-court graphic in the top right corner when the tennis players play out their points?", + "answer_choice_0": "It rotates whenever a player changes sides.", + "answer_choice_1": "It glows whenever a player serves an ace.", + "answer_choice_2": "It turns red when a player hits an unforced error.", + "answer_choice_3": "It tracks the movements of the players.", + "answer_choice_4": "It records the placement of the player's shots.", + "answer_id": 4, + "answer": "It records the placement of the player's shots.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for the mini-court graphic and found it in the top right corner. It remains there as a fixture for the whole match from 00:00-28:18. I watched how it behaved when the tennis players played and noticed that, each time a player hits a ball, and it lands on the court, the position of that ball is recorded on the mini-court. The first serve of the match, for example, becomes a small blue dot in the deuce side service box at 00:01, and the return right after becomes a small green dot in the far court's \"No Man's Land\" area at 00:03. Therefore, I concluded that the mini-court records the placement of the players' shots when they play their points." + }, + { + "key": "0wbPOJ7gG4Q:d46c41df007e16ef9d374081a188a2e7448c13b1", + "video_id": "0wbPOJ7gG4Q", + "question": "How did the man with the blue shirt's position change from 00:15-00:17?", + "answer_choice_0": "He moved from the baseline to the net.", + "answer_choice_1": "He moved from the net to the baseline.", + "answer_choice_2": "He moved from the ad side to the center mark.", + "answer_choice_3": "He moved from the center mark to the deuce side.", + "answer_choice_4": "He moved from the ad side to the deuce side.", + "answer_id": 2, + "answer": "He moved from the ad side to the center mark.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the man with the blue shirt at 00:15. At the same time, I noticed he was standing on the ad side of his half of the court. Then, from 00:15-00:17, I saw the man with the blue shirt move right before stopping to stand by the center mark of his half of the court at 00:17. Therefore, the man with the blue shirt changed his position from 00:15-00:17 by moving from the ad side to the center mark." + }, + { + "key": "0wbPOJ7gG4Q:e44621b11b5eb695a9fa08e7db6afedf6ae8659c", + "video_id": "0wbPOJ7gG4Q", + "question": "What, in order, are the colors of the labelled racquet strokes in the last three strokes of the first set tiebreaker?", + "answer_choice_0": "Orange, Blue, Green.", + "answer_choice_1": "Orange, Green, Blue.", + "answer_choice_2": "Blue, Green, Orange.", + "answer_choice_3": "Blue, Orange, Green.", + "answer_choice_4": "Green, Blue, Orange.", + "answer_id": 3, + "answer": "Blue, Orange, Green.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "First, I looked for labelled racquet strokes. I noticed that, at each stroke the tennis players hit, the name of the stroke is recorded in a colored font just under the mini-court graphic--this starts at 00:01 and continues for the rest of the video. As I watched, I noticed that the records noted the type of stroke, like whether it is forehand, backhand, or a serve, as well as the type of spin used, for example, topspin or flat. I noticed that each stroke is labelled with a color. The first label at 00:01 says, \"Flat serve\" and it is colored blue. The return at 00:02 is labelled as a \"Flat Forehand\" and is colored green. Next, I looked for the first set tiebreaker's last point. At 12:51, I noticed that the scoreboard in the top left corner read 6-6 for set points, left, and 6-7 for the game points, right. I also read that it was the \"set point #2\" just below the scoreboard. This indicated that the current game was a tiebreaker and the current point might determine the set winner. At 12:57, I observed that the man in white won this point and noticed that the scoreboard now showed \"Tom N\" up 7-6 in the set score. I went back to the beginning of the last point at 12:52 and counted that there were only 3 strokes in the point. I then recorded the stroke name and color for each of the three strokes. At 12:52, \"Flat serve\" is written in blue. At 12:54, \"Slice Backhand\" is written in orange. And at 12:55, \"Topspin Forehand\" is written in green. Therefore, I determined that the order of colors was blue, orange, and green." + }, + { + "key": "0wbPOJ7gG4Q:f9d0b57758b1a79d5c057c3245e15abf2dfb4664", + "video_id": "0wbPOJ7gG4Q", + "question": "How many times did the ball bounce on the ground before the very first point was scored?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "6.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "6.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the ball in the man with the white shirt's hands at 00:00. Next, at 00:01, I saw the man with the white shirt serve the ball to the man with the blue shirt on the other side of the court, where it bounced on the ground for the first time at 00:02. Then, I saw the man with the blue shirt return the ball to the man with the white shirt on the other side of the court, where it bounced on the ground for the second time at 00:03. Then, I saw the man with the white shirt return the ball to the man with the blue shirt on the other side of the court, where it bounced on the ground for the third time at 00:05. Then, I saw the man with the blue shirt return the ball to the man with the white shirt on the other side of the court, where it bounced on the ground for the fourth time at 00:06. Then, I saw the man with the white shirt return the ball to the man with the blue shirt on the other side of the court, where it bounced on the ground for the fifth time at 00:08. Then, I saw the man with the blue shirt return the ball to the man with the white shirt on the other side of the court, where it bounced on the ground for the sixth time at 00:09. Then, I saw the man with the white shirt accidentally send the ball into the net, ending the play with the very first point now scored, as further indicated by the scoreboard graphic in the top left corner of the screen. Then, I counted the number of times the ball bounced on the ground during the play, calculating a total of 6. Therefore, the ball bounced on the ground 6 times before the very first point was scored." + }, + { + "key": "0wbPOJ7gG4Q:f9ff10d540179f182ad8be9eb05eccc0739f1afd", + "video_id": "0wbPOJ7gG4Q", + "question": "How much did the ball's speed change between when it was served and when it was returned at 00:01-00:03?", + "answer_choice_0": "decreased by 3 mph.", + "answer_choice_1": "It remained at 53 mph.", + "answer_choice_2": "It increased by 4 mph.", + "answer_choice_3": "It increased by 5 mph.", + "answer_choice_4": "It remained at 49 mph.", + "answer_id": 2, + "answer": "It increased by 4 mph.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the ball in the man with the white shirt's hands at 00:00. Next, at 00:01, I saw the man with the white shirt serve the ball to the man with the blue shirt on the other side of the court. At the same time, I saw a graphic on the right side of the screen, indicating the speed of the ball after it was initially struck by the player, which read \"49 mph\". Then, I saw the man with the blue shirt return the ball back to the man with the white shirt on the other side of the court at 00:03. At the same time, I saw the graphic on the right side of the screen change to \"53 mph\", indicating the new speed of the ball. Then, I calculated 53-49=4. Therefore, the ball's speed increased by 4 mph between when it was served and when it was returned at 00:01-00:03." + }, + { + "key": "12fnJva0ypU:0fa1942bd8fb40466d4cc8dd6af04880e6b17ab9", + "video_id": "12fnJva0ypU", + "question": "How many TikTok followers does the main player have?", + "answer_choice_0": "96,700 followers.", + "answer_choice_1": "400 followers.", + "answer_choice_2": "100,000 folllowers.", + "answer_choice_3": "97,600 followers.", + "answer_choice_4": "97,000 followers.", + "answer_id": 0, + "answer": "96,700 followers.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I searched in the video for the moment the main player speaks about his TikTok following, which happens at 05:46. At 05:47, the player says he has around 100,000 thousand followers on Tiktok, but the camera zooms in on the app at 05:48, and it shows he has 96,700 followers." + }, + { + "key": "12fnJva0ypU:298368b543dd17ccff938ab24dbbd695f7ccf0a0", + "video_id": "12fnJva0ypU", + "question": "What is the pattern on the floor of the poker room?", + "answer_choice_0": "Red plaid carpet.", + "answer_choice_1": "Blue plaid carpet.", + "answer_choice_2": "Dark herringbone.", + "answer_choice_3": "Red and white checkered tile.", + "answer_choice_4": "Black and white checkered tile.", + "answer_id": 0, + "answer": "Red plaid carpet.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for the first time the poker room can be seen in full. I saw this from 00:27 to 00:37. I then looked to see what pattern was on the floor. I saw that the floor of the poker room was covered in red plaid carpet." + }, + { + "key": "12fnJva0ypU:485f7c0d2a9f1f9b273c38a5af4f4c9e2f6c0ab2", + "video_id": "12fnJva0ypU", + "question": "By how much does the pot increase during the first hand of poker played in the video?", + "answer_choice_0": "40.00 dollars.", + "answer_choice_1": "67.00 dollars.", + "answer_choice_2": "7.00 dollars.", + "answer_choice_3": "60.00 dollars.", + "answer_choice_4": "47.00 dollars.", + "answer_id": 3, + "answer": "60.00 dollars.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked for the first hand of poker played in the video, which starts at 01:18. The bottom of the screen shows how much money is in the pot at the beginning of the game, which is 7.00 dollars. I continued to watch until the end of the first hand of poker, which happens at 02:05. The pot is now 67.00 dollars. I subtracted the 67.00 dollars at the end of the first hand from the initial 7.00 dollars, which totaled 60.00 dollars. Therefore, the pot increased 60.00 dollars by the end of the first played hand of poker." + }, + { + "key": "12fnJva0ypU:5771db2e6cf73333d81040102a3bddf8649ac4f1", + "video_id": "12fnJva0ypU", + "question": "What's the message on the front of the dark hoodie the player at the poker table is wearing?", + "answer_choice_0": "Folding is Boring.", + "answer_choice_1": "Folding is my Superpower.", + "answer_choice_2": "Folds under Pressure.", + "answer_choice_3": "Folding is my Talent.", + "answer_choice_4": "Folding is Fun.", + "answer_id": 0, + "answer": "Folding is Boring.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video from the beginning to locate the moment where the main poker player in the video is sitting at the poker table, which happens at 00:38. I located the player with the dark hoodie across the table, in the background, but because this is a fast-motion shot, the image of the player is blurry. I kept watching in order to find a time where the image is more clear. At 00:55, I noticed the player with the dark hoodie is a friend of the main poker player in the video, and they're walking towards the entrance of the Bellagio hotel. I was able to read the words on the hoodie in this same segment, which seemed to read \"FOLDING IS BORING\". I continued to watch until 01:04, where I confirmed the words on the hoodie were indeed \"FOLDING IS BORING\"." + }, + { + "key": "12fnJva0ypU:bec4bed1826846ddac17e0bc4f56d8484c01fef5", + "video_id": "12fnJva0ypU", + "question": "How many people walk behind the man as he says \"make sure you guys like the video, subscribe if you're new\"?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for the moment the man says \"make sure you guys like the video, subscribe if you're new\". I heard this occur from 02:09 to 02:11. I then looked behind him to see how many people are walking. I only saw 1 person. The scene plays again from 08:14 to 08:17 with the same audio and video footage, with still only 1 person visible." + }, + { + "key": "12fnJva0ypU:cf3b572a0f3a03060a9d107c6c69b26c16ea703e", + "video_id": "12fnJva0ypU", + "question": "What animal is depicted in the logo which appears and then disappears at the sound of the lighter flicking?", + "answer_choice_0": "Tiger.", + "answer_choice_1": "Wolf.", + "answer_choice_2": "Lion.", + "answer_choice_3": "Cheetah.", + "answer_choice_4": "Bear.", + "answer_id": 1, + "answer": "Wolf.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for the logo that appears at the sound of a lighter flicking. I both saw and heard this occur from 00:47 to 00:48. I then looked at the logo to identify the animal depicted, and saw that it was a wolf." + }, + { + "key": "12fnJva0ypU:dcf6425338d358d3ff6f3264f495054c8c11ab6f", + "video_id": "12fnJva0ypU", + "question": "What is the third set of cards that the player peeks on the camera from 02:48 to 02:55?", + "answer_choice_0": "Ace of Hearts and Queen of Clubs.", + "answer_choice_1": "Five of Clubs and King of Hearts.", + "answer_choice_2": "Ace of Diamonds and Eight of Diamonds.", + "answer_choice_3": "Ace of Hearts and Queen of Spades.", + "answer_choice_4": "Four of Clubs and Jack of Clubs.", + "answer_id": 3, + "answer": "Ace of Hearts and Queen of Spades.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I searched in the video for the segment referenced in the question, which is 02:48 to 02:55. In this segment, the player lifts the corner of his cards towards the camera several times. The third instance happens at 02:51, where the player slightly bends two cards placed upside down on the poker table cards to reveal an Ace of Hearts and a Queen of Spades." + }, + { + "key": "12fnJva0ypU:e51c1a7e4b6e4b2944f1782d0a347517639bf77e", + "video_id": "12fnJva0ypU", + "question": "What is the sum of the numbered cards on screen when the pot total reaches $232?", + "answer_choice_0": "34.", + "answer_choice_1": "24.", + "answer_choice_2": "15.", + "answer_choice_3": "12.", + "answer_choice_4": "20.", + "answer_id": 1, + "answer": "24.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for the moment the pot total reaches $232. I saw this occur from 02:41 to 02:44. I then looked at the cards pictured on screen and saw that they were an Ace of Clubs, a Jack of Spades, a Queen of Diamonds, a 10 of Hearts, a 5 of Hearts, and a 9 of Spades. As only the last 3 of these cards are numbered, I added 10 + 5 + 9 = 24." + }, + { + "key": "12fnJva0ypU:f4940b268b19b98a5c0584d540bdbf5a994165cc", + "video_id": "12fnJva0ypU", + "question": "What is the single cursive letter engraved over the exterior archway the man with the white hat is walking toward?", + "answer_choice_0": "E.", + "answer_choice_1": "A.", + "answer_choice_2": "C.", + "answer_choice_3": "D.", + "answer_choice_4": "B.", + "answer_id": 4, + "answer": "B.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for an instance where a man in a white hat is walking toward an exterior archway. I saw this occur from 00:03 to 00:05. I then looked to see if there was a single cursive letter engraved somewhere over the archway. I saw an adornment with the letter \"B\" engraved in cursive. I continued watching and saw the same scene repeat from 00:58 to 01:00. I continued watching the video to confirm there were no other archways he walked towards." + }, + { + "key": "1QiiEPNv9wM:1570cd493aa577e1d23468cff7a4b3f1456efdf5", + "video_id": "1QiiEPNv9wM", + "question": "How many of the card players wear glasses throughout the video?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "0.", + "answer_id": 1, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video, and up until 04:31, only the card player in the gray shirt required spectacles. However, at 04:32, I watched the card player in the checkered brown button-down place a set of black rimmed glasses on his head. The pair of glasses remains on his face for the remainder of the video." + }, + { + "key": "1QiiEPNv9wM:2f7408a09df44a4a1eb513ef64808454ff51ff35", + "video_id": "1QiiEPNv9wM", + "question": "What does the host do with his left hand at 07:42?", + "answer_choice_0": "Gives a high five.", + "answer_choice_1": "Reaches across the table.", + "answer_choice_2": "Waves it around.", + "answer_choice_3": "Slaps a card on the table.", + "answer_choice_4": "Snaps his fingers.", + "answer_id": 1, + "answer": "Reaches across the table.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and saw a player tease the host at 05:32. After that, the host played another card, and then he held up his middle finger to the player that was teasing him." + }, + { + "key": "1QiiEPNv9wM:6b324a79648b65cbe76e60e05e37fa8c12be69df", + "video_id": "1QiiEPNv9wM", + "question": "What color is the first hat of the card player with a role on the television series The Flash?", + "answer_choice_0": "Green.", + "answer_choice_1": "Gray.", + "answer_choice_2": "Beige.", + "answer_choice_3": "Brown.", + "answer_choice_4": "Red.", + "answer_id": 1, + "answer": "Gray.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 00:15-00:17, I watched the video display title cards indicating the names of Matt, the card player in the checkered shirt, and Patrick. I saw that Patrick has a fully grown, stubbly beard and dark gray hat. From 00:34-00:36, I watched Matt turn out to the audience, gesturing with his right hand toward his seated neighbor. I also listened to Matt state that Patrick was on the show titled The Flash at 00:35-00:36 state that Patrick was on the show titled The Flash at 00:35-00:36 - thus, the person with the role on The Flash is wearing a gray hat." + }, + { + "key": "1QiiEPNv9wM:7b5403b3e7233f6d80676dba44fe0fcc0ff8614e", + "video_id": "1QiiEPNv9wM", + "question": "On the card that shows writing on the back of the hand, which numbered instruction deals with Reducing Party Interest?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video until 01:48, when the card with writing on the back of the hand was clearly shown. I read the instructions on the back of this card, determining from my reading that the instructions labeled (4) on the list dealt with reducing party interest." + }, + { + "key": "1QiiEPNv9wM:7dd2f1a80db07c4fbcbc3335e941fde225b66183", + "video_id": "1QiiEPNv9wM", + "question": "How many times does the host look at the audience from 12:00-13:00?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "6.", + "answer_id": 1, + "answer": "3.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video during the specified timespan, and counted the number of times I saw the host look out to the audience, which is out of the left of the frame relative to the camera that films the host. I determined this by the responsiveness of the audience when the host looked out in that direction, such as at 12:21. I noted that the host looked out of the left of the frame and received an audience response from 12:20-12:23, the second time he looked out was a quick glance from 12:38-12:39, and the third time from 12:45-12:51, for a total of three times in this span." + }, + { + "key": "1QiiEPNv9wM:911ab9b80de626381ba686b3dca70a2f9ddbc959", + "video_id": "1QiiEPNv9wM", + "question": "What word is written directly below the caricature on the first conversation card played?", + "answer_choice_0": "Awkward.", + "answer_choice_1": "Card.", + "answer_choice_2": "Conversation.", + "answer_choice_3": "Tornado.", + "answer_choice_4": "Weather.", + "answer_id": 4, + "answer": "Weather.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video through the moment the lead host in the striped brown shirt finishes explaining the rules of the game, \"Awkward Party\", from 00:00-03:08. At 03:09, I listened to the card player in the black tee shirt read his card aloud, and I watched him display his chosen card, labeled Conversation Card, on the table. From 03:09-03:10, I watched the card player in the black tee shirt read the card aloud as the Conversation Card is revealed to have a caricature of a spiky haired man grabbing his friend and shouting in a text bubble, \"Oh F***!!!! A Tornado!!!\". Below the caricature reads \"Weather\"." + }, + { + "key": "1QiiEPNv9wM:a2a3d58a4ce00b98a3203454adb4ee73649a1734", + "video_id": "1QiiEPNv9wM", + "question": "What does the card on the left have written on it at 11:49?", + "answer_choice_0": "Teaching wizards how to code.", + "answer_choice_1": "Neville Longbottom, that's who.", + "answer_choice_2": "The entire Gryffindor Quidditch team.", + "answer_choice_3": "is going to Azkaban for.", + "answer_choice_4": "Due to Dementors deserting Azkaban, it will now be guarded by.", + "answer_id": 2, + "answer": "The entire Gryffindor Quidditch team.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and saw the second game they play is Cards Against Muggles. During this game, I saw the cards that were shown at 11:49, and I read the card on the left. It said, \"The entire Gryffindor Quidditch team\"." + }, + { + "key": "1QiiEPNv9wM:ddfb8377db3026f87ac51c808f4a62705a88d556", + "video_id": "1QiiEPNv9wM", + "question": "Besides the maple leaf, what is a prominent feature of the Canadian hat that the first man in the \"Surplus of Popes\" t-shirt wears?", + "answer_choice_0": "A hockey stick design.", + "answer_choice_1": "A pair of moose antlers.", + "answer_choice_2": "A giant bow.", + "answer_choice_3": "A Mountie logo.", + "answer_choice_4": "A beaver tail.", + "answer_id": 1, + "answer": "A pair of moose antlers.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video from 02:17, when the card player in the gray shirt lifts a plastic bag from his lap, extracting a variety of red and white hats. Throughout, I listened to the card player in the brown checkered shirt that explains to the audience that these are \"Canadian hats\". From 02:27-02:37, the quartet of card players don their respective hats, each emblazoned with a logo of Canada's flag and corresponding red maple leaf. At 02:30, I identified that the hat donned by the man wearing the t-shirt which read \"Surplus of Popes\" had prominent red moose antlers on the sides." + }, + { + "key": "1jzROE6EhxM:3009ffb92413128f21ce7d522b6064f49ee8d9fb", + "video_id": "1jzROE6EhxM", + "question": "From 04:30 to 05:30, how many times does the blue symbols for Wi-Fi appear?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "8.", + "answer_choice_3": "2.", + "answer_choice_4": "6.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator discuss \"proof of history\" at 04:33. At 04:38, I saw the first blue Wi-Fi symbol appear at the top left. I identified the symbol as a Wi-Fi symbol because the symbol consists of three curved lines that extend from a single point, plus a dot. From 04:39 to 04:41, I saw two gray Wi-Fi symbols appear. At 05:05, I see one blue and two gray Wi-Fi symbols appear. I counted a total of 6 Wi-Fi symbols, of which only 2 were blue." + }, + { + "key": "1jzROE6EhxM:6b478cf14d5b8c3125a36883e139e8bc602c600c", + "video_id": "1jzROE6EhxM", + "question": "How many green blocks connected with Solana appear in the first 4 minutes of the video?", + "answer_choice_0": "9", + "answer_choice_1": "3", + "answer_choice_2": "4", + "answer_choice_3": "1", + "answer_choice_4": "5", + "answer_id": 2, + "answer": "4", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I saw 1 green block at 01:20, and at the same time heard the narrator talk about Solana's block time, so I decided to count this one. I then saw 5 green blocks at 02:50, but when I listened to the narrator speak at that time, he was only talking about computers trying to figure out the time. At 03:13, I saw some blocks change color, and 3 of them became green. At the same time, I heard the narrator say that \"Solana fixes this\" -- he was referring to the problem that other digital currencies have on agreeing as to what time it is. I decided that these blocks were changing color on account of Solana, so I counted those too. I discounted the 5 green blocks from 02:50, and added up the 1 green block from 01:20 and the 3 green blocks from 03:13 and got a total of 4. Those 4 were all the green blocks I saw in the first 4 minutes in the video." + }, + { + "key": "1jzROE6EhxM:7c2673b70518f9f675a9b4f9254168ed8ae7f102", + "video_id": "1jzROE6EhxM", + "question": "How many envelopes have arrows on them during the \u201cfamous whiteboard crypto story\u201d in total?", + "answer_choice_0": "4", + "answer_choice_1": "2.", + "answer_choice_2": "0.", + "answer_choice_3": "8.", + "answer_choice_4": "6.", + "answer_id": 1, + "answer": "2.", + "question_type": "Event Occurence", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video looking and listening for the narrator to tell the \"famous whiteboard story.\" At 03:32 the narrator begins using one of the \"famous whiteboard crypto stories.\" At 03:37, I see one envelope appear on screen, an arrow appears on the envelope at 03:38. At 03:42-03:43 a second envelope appears with an arrow on it. At 3:45, two envelopes appear, they have no arrow on them. Between 04:22 and 04:25 4 more envelopes appear with no arrow on them. I continue to watch looking for any envelopes with arrows on them until the end of the story at 05:12 and no more envelopes appear. I counted a total of two envelopes with arrows on them." + }, + { + "key": "1jzROE6EhxM:9fa90a8e8afc002a89db7108e6d4489584ac549b", + "video_id": "1jzROE6EhxM", + "question": "What company is mentioned just after a light bulb appears on someone's head?", + "answer_choice_0": "Visa.", + "answer_choice_1": "Coinbase.", + "answer_choice_2": "Nvidia.", + "answer_choice_3": "Solana.", + "answer_choice_4": "Qualcomm.", + "answer_id": 4, + "answer": "Qualcomm.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "At 01:04, I saw the word, Qualcomm appear. Right before that at 01:02, I listened to the narrator describe Anatoly Yakavenko as \"smart.\" At the same time, I saw a yellow lightbulb appear on top of the head. I identified the yellow object as a light bulb due to the presence of the glass bulb, filament, and the electrical contact (foot)." + }, + { + "key": "1jzROE6EhxM:a3022c1ff160241d857275bbb51a18c7abc02a54", + "video_id": "1jzROE6EhxM", + "question": "In the section, \"Anyone can stake\", the number 100,000 appears on screen. What number would be on the other side of the equal sign if 100,000 was replaced with 215,000?", + "answer_choice_0": "100.", + "answer_choice_1": "68.8.", + "answer_choice_2": "47.2", + "answer_choice_3": "215.", + "answer_choice_4": "32.", + "answer_id": 1, + "answer": "68.8.", + "question_type": "Counterfactual", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video looking and listening for the section \"Anyone can stake\" and the number 100,000. At 05:17, I see the words \"Anyone can stake\" appear on the screen and the narrator begins discussing Proof of Stake. At 05:35, I see the number 100,000 appear on the screen as part of the equation, 32 ethereum = $100,000. I then perform calculations to determine how many ethereum there will be when the cost is $215,000. First I find the value of 1 etherum by dividing 100,000 / 32 = $3,125 = 1 ethereum. Next, to find out how many ethereum equal $215,000, I divide 215,000 / 3125 = 68.8 Ethereum." + }, + { + "key": "1jzROE6EhxM:a7b9901067c88d49496626266c584d4541eccd3f", + "video_id": "1jzROE6EhxM", + "question": "At 05:58, when the narrator is discussing SeaLevel, he describes a human performing serial tasks. The human sweeping is wearing the same color shirt as someone when he was telling the \u201cfamous whiteboard crypto story\u201d. Who is wearing the same color shirt as this human?", + "answer_choice_0": "Your aunt.", + "answer_choice_1": "Your cousin.", + "answer_choice_2": "Your grandma.", + "answer_choice_3": "Your uncle.", + "answer_choice_4": "Your grandpa.", + "answer_id": 2, + "answer": "Your grandma.", + "question_type": "Event Occurence", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video at 05:58 looking and listening for the human performing serial tasks. At 06:16, I see a human appear on screen holding a broom and wearing a blue shirt. I then go back earlier in the video to 03:32 when the narrator is telling the famous whiteboard crypto story. At 04:00, the narrator says \"your uncle\" and I see an arrow extending from a human wearing a grey shirt indicating this is your uncle. At 04:03 the narrator says \"your aunt\" and I see an arrow extending from a human wearing a pink shirt indicating this is your Aunt. At 04:05, the narrator says \"your cousin\" and I see an arrow extending from a human-like figure wearing a yellow shirt. At 04:08, I hear the narrator say \"your grandma\" and I see a human-like figure wearing a blue shirt appear on screen." + }, + { + "key": "1jzROE6EhxM:ddeac126a7892058c31856af1a8477f52779a9fa", + "video_id": "1jzROE6EhxM", + "question": "How many transactions does Visa have in one day?", + "answer_choice_0": "2,044,742,400.", + "answer_choice_1": "14,313,196,800.", + "answer_choice_2": "744,286,233,600.", + "answer_choice_3": "85,197,600.", + "answer_choice_4": "23,666.", + "answer_id": 0, + "answer": "2,044,742,400.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "At 1:39, I saw \"23666 transactions/sec\" written underneath the image of the Visa card. I then calculated the number of Visa transactions per day. To find how many seconds are in a day, I started by finding how many seconds are in an hour. I multiplied 60 by 60 to get 3,600 seconds in an hour. I then multiplied 3,600 by 24 to find that there are 86,400 seconds in a day. I then multiplied 23,666 (transactions) by 86,400 (seconds) to find that there are 2,044,742,400 Visa transactions in one day." + }, + { + "key": "1jzROE6EhxM:eafffde64d8769b0e1cdb31d8324a2884c74adb8", + "video_id": "1jzROE6EhxM", + "question": "In the video a visa card appears with a numbers undeneath. If this number were increased by 10000, how much faster would Solana\u2019s transaction speed be than Visa's?", + "answer_choice_0": "2109 times faster.", + "answer_choice_1": "210.9 times faster.", + "answer_choice_2": "21.09 times faster.", + "answer_choice_3": "2.19 times faster.", + "answer_choice_4": "21.90 times faster.", + "answer_id": 2, + "answer": "21.09 times faster.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video looking for a visa card that appears with a number of transactions per second. At 01:35 I hear the narrator say that Solana's transaction speed is up to 710,000 per second around 30 times faster than Visa. At 01:41, I see a visa card appear on screen with 23666 transactions/sec written underneath. I also see a Computer screen with a label for Solana and that Solana's transaction per second is 710,000. I perform the calculations to determine how much faster Solana's transaction speed would be if the number of transactions by visa were increased by 10000. I add 10000 to 23666 to get 33666. I then divide 710,000 by 33,666 and I get 21.09. Solana's transaction speed would be 21.09 times faster." + }, + { + "key": "1jzROE6EhxM:ef9977ae7f3b37521e1686417ce5fa7efb205014", + "video_id": "1jzROE6EhxM", + "question": "When the narrator says \"Proof of history\" for the fourth time in the video, how many yellow blocks appear on screen?", + "answer_choice_0": "4", + "answer_choice_1": "3", + "answer_choice_2": "1", + "answer_choice_3": "2", + "answer_choice_4": "5", + "answer_id": 3, + "answer": "2", + "question_type": "Event Occurence", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I watched the video and listened for instances when the narrator says, \"proof of history.\" At 00:19, the narrator says \"proof of history\" for the first time. At 02:17, the narrator says \"proof of history\" for the second time. At 02:24, I hear the narrator say \"proof of history\" for the third time. At 03:14, I hear the narrator say proof of history for the fourth time. At 03:14, there are several colored blocks on screen, and at the bottom right, there are 2 yellow boxes." + }, + { + "key": "2SdMmx_sLNc:1fee785bfe09ab0d62ab7da14d98c0330db1c53b", + "video_id": "2SdMmx_sLNc", + "question": "If the viewer were to do the seated hamstring stretch for the recommended amount of time with a 10 second rest in between each set, how much time total would they spend on the stretch routine?", + "answer_choice_0": "150 seconds", + "answer_choice_1": "120 seconds", + "answer_choice_2": "140 seconds", + "answer_choice_3": "180 seconds", + "answer_choice_4": "170 seconds", + "answer_id": 4, + "answer": "170 seconds", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video in order to figure out where the seated hamstring stretch was shown at. I found that section at 03:59 when a graphic appeared on the screen that has a title \"Seated Hamstring Stretch\". The trainer then demonstrates that stretch and a graphic pops up at 05:09 that says \"20 seconds hold\" and \"3 sets (each side).\" 3 sets on each side would equal 6 total sets of 20 seconds each. 6 times 20 equals 120 seconds. A 10 second rest between each set means there are 5 total rests for a total of 50 seconds. 120 seconds plus 50 seconds gives a final total of 170 seconds." + }, + { + "key": "2SdMmx_sLNc:9d2079b1d84442707dc44c913cc3297fdeeef470", + "video_id": "2SdMmx_sLNc", + "question": "How many different ways does the instructor stretch when a red triangular graphic appears onscreen?", + "answer_choice_0": "1", + "answer_choice_1": "0", + "answer_choice_2": "4", + "answer_choice_3": "2", + "answer_choice_4": "3", + "answer_id": 2, + "answer": "4", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I saw the instructor perform a stretch while standing with a red triangular graphic over his waist area at 00:29-00:31. During that timeframe, the instructor also performs a stretch while sitting on a mat with a red triangular graphic on top of his waist area. I counted both of these stretches. Then, I saw the instructor perform another type of impromper hamstring stretch while standing with a red triangular graphic at his waist area between 05:51-05:52. I counted this as another type of stretch. Then, I saw the instructor perform another type of stretch, a correct hamstring stretch, while standing with a red triangular graphic at his waist area between 06:06-06:09. I counted this stretch. Since no other red triangles appear in the video, I added up the different stretches the instructor performs when a red triangular graphic appears onscreen and arrived at 4." + }, + { + "key": "2SdMmx_sLNc:9e5271d3df71f6f33e42a13623fb89a1c732abd6", + "video_id": "2SdMmx_sLNc", + "question": "What are all the objects used throughout the video to help with the demonstrations that aren't mentioned by the instructor?", + "answer_choice_0": "Mat and exercise table.", + "answer_choice_1": "Jump rope and foam roller.", + "answer_choice_2": "Stool and ball.", + "answer_choice_3": "Stretch-out strap and mat.", + "answer_choice_4": "Exercise table and foam roller.", + "answer_id": 0, + "answer": "Mat and exercise table.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "While watching, I looked for the different objects that the instructor used to help with the demonstrations. At 01:14, the instructor talks about using a foam roller. At 02:23, the instructor shares that he is using a stretch-out strap for the demonstration. Then, at 05:27, the instructor shares that he is using a stool. There was also a mat used at 00:14 and an exercise table in the video at 02:38, but the instructor did not mention those objects. Therefore, the objects used throughout the video to help with the demonstrations that aren't mentioned are the mat and exercise table." + }, + { + "key": "2SdMmx_sLNc:bf12ffafb61fe645ec7ef5486f82e130f3e6d242", + "video_id": "2SdMmx_sLNc", + "question": "If the instructor wanted to finish the video in the same position as he was in the beginning, where would the instructor have to move to?", + "answer_choice_0": "To the left.", + "answer_choice_1": "To the top.", + "answer_choice_2": "Nowhere, he's in the same position.", + "answer_choice_3": "To the bottom.", + "answer_choice_4": "To the right.", + "answer_id": 4, + "answer": "To the right.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the beginning of the video and noticed that the instructor was standing in the middle of the screen starting at 00:00. Then, I went to the very end of the video at 06:48 and noticed the instructor was standing on the right side of the screen and not in the middle. So, if the instructor wanted to be in the middle again he would have to move more towards the left of the screen. But while looking at the instructor the screen's left is his right, so he would have to move to the right to be positioned more left on the screen. Therefore, if the instructor wanted to finish the video in the same position as he was in the beginning, he would have to move to the right." + }, + { + "key": "2SdMmx_sLNc:d1bacf57ffc7bd0817b3dd4885ee64f28b09e3d0", + "video_id": "2SdMmx_sLNc", + "question": "What is the difference between the amount of single-leg exercises the instructor does with his right leg compared to his left leg?", + "answer_choice_0": "2", + "answer_choice_1": "3", + "answer_choice_2": "0", + "answer_choice_3": "1", + "answer_choice_4": "4", + "answer_id": 2, + "answer": "0", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I saw in the video that he does 4 single leg exercises: Foam Roller Mobilization from 01:07 to 02:00, Supine Hamstring stretch from 02:31 to 03:48, Seated Hamstring stretch from 03:59-05:06, and standing hamstring stretch from 05:31 to 06:28. Of these, he demonstrates the first 2 with only his left leg, while he demonstrates the last 2 with his right leg. Then to find the difference, I subtracted 2 from 2 and got 0. Hence, the answer is 0." + }, + { + "key": "2SdMmx_sLNc:eaffb1713830a5290de40b2cd3cfd2e65c5c4334", + "video_id": "2SdMmx_sLNc", + "question": "In what order do the shapes used to demonstrate the movement of the supine hamstring stretch appear?", + "answer_choice_0": "Arrow, line, triangle, line.", + "answer_choice_1": "Line, arrow, line, triangle.", + "answer_choice_2": "Line, arrow, line, arrow.", + "answer_choice_3": "Arrow, line, arrow, triangle.", + "answer_choice_4": "Triangle, line, arrow, line.", + "answer_id": 1, + "answer": "Line, arrow, line, triangle.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video until a graphic appeared at 02:33 showing the trainer is about to do the \"Supine hamstring stretch\". The trainer picks up the yoga strap and begins to demonstrate, and at 02:45 I can see a line parallel to their leg. At 02:48, an arrow appears and points to the right, mirroring the motion of the trainer's leg. At 02:55, another line appears parallel to the trainer's back. Finally, a triangle appears over the trainer's pelvis at 03:01. Thus the answer is line, arrow, line, triangle." + }, + { + "key": "2SdMmx_sLNc:ed2023110acc42551b84167e552672b8affb29fe", + "video_id": "2SdMmx_sLNc", + "question": "How many shots are of the instructor demonstrating the proper way to stretch without talking?", + "answer_choice_0": "6", + "answer_choice_1": "3", + "answer_choice_2": "7", + "answer_choice_3": "5", + "answer_choice_4": "8", + "answer_id": 3, + "answer": "5", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "While watching, I looked for moments in the video where the instructor was demonstrating a move without talking. These are the following timeframes where this occurs: 01:46 - 01:52, 03:04 - 03:09, 03:27 - 03:30, 05:01 - 05:08 and 06:19 - 06:24. There are no other shots after that where the man is demonstrating the proper way to stretch without talking. There are two shots with the instructor stretching without talking, which occur from 00:13-00:19, and 00:19-00:25, but they are not considered the proper way based on the text that I read that said \"Bad Ideas,\" which appears at 00:26 along with the two previous stretches, so I didn't count them. Then, I counted these moments up and got 5. Therefore, there are 5 shots where the instructor is demonstrating a proper stretch without talking." + }, + { + "key": "2dKCBcRehFY:12cf08c3608f7e008261959616610b2bcb25cf4e", + "video_id": "2dKCBcRehFY", + "question": "Which greyhound passed the other dogs the most during the race?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "6.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the race between 02:58 and 03:26. I saw that greyhound number 6 passed 2 dogs at 03:05, number 2 passed number 1 at 03:01, and number 5 passed dog number 4 at 03:07. I continued watching until the end of the race and did not see any more greyhounds passing another. This makes number 6 the one who passed the most dogs." + }, + { + "key": "2dKCBcRehFY:4ed9e5bdd0edbe466e703558065ff2f70ba82920", + "video_id": "2dKCBcRehFY", + "question": "What was the order by which each greyhound was loaded into the cage before the start of the race?", + "answer_choice_0": "5, 1, 2, 4, 6.", + "answer_choice_1": "5, 2, 1, 4, 6.", + "answer_choice_2": "5, 2, 4, 1, 6.", + "answer_choice_3": "5, 4, 1, 2, 6.", + "answer_choice_4": "5, 1, 4, 2, 6.", + "answer_id": 4, + "answer": "5, 1, 4, 2, 6.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched from 01:35 to 01:51 and noticed that the greyhounds were lined up in front of the cages. The front view of the cages at 01:57 shows the handlers putting a greyhound into cage number 5, which matches the tag of the same greyhound seen at 01:44 with the orange tag. This means that each greyhound was lined up in order, in front of their respective numbers. From 02:17 to 02:25, I saw greyhound #5 was secured into its cage first. Greyhound #1 was secured in its cage from 02:21 to 02:25. Greyhound #4's securement followed from 02:28 to 02:33. Greyhound #2 followed from 02:33 to 02:36. Greyhound #6 was the last to be secured, from 02:36 to 02:41. This means the order of each greyhound's loading in their cages was 5, 1, 4, 2, and 6." + }, + { + "key": "2dKCBcRehFY:5070f8152937882fe4f223a4a4906d276687b7b7", + "video_id": "2dKCBcRehFY", + "question": "If the race had been 50m longer and dog #2 maintained its average speed, what is the sum of dog #2's new winning time when combined with the duration of the tractor driving on the racetrack?", + "answer_choice_0": "58.30 seconds.", + "answer_choice_1": "59.12 seconds.", + "answer_choice_2": "59.06 seconds.", + "answer_choice_3": "59.03 seconds.", + "answer_choice_4": "58.95 seconds.", + "answer_id": 3, + "answer": "59.03 seconds.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 07:13, I saw several orange banners on the screen that displayed the length of the race as 480m and the winning dog, dog #2\u2019s, time as 28.10 seconds. First I had to figure out dog #2\u2019s average speed for each meter which I got by dividing 28.10 by 480. I got approximately .0585 seconds as the average time it takes dog #2 to run a single meter. I then multiplied 50 meters by .0585 and got 2.927 as the total amount of time it would have taken dog #2 to run an additional 50 meters. Finally, I added 2.927 to 28.10 and arrived at 31.03 seconds as the amount of time it would have taken dog #2 to run the race if it had been an additional 50 meters in length. I then identified the tractor from 05:14 to 05:21, which is 7 seconds. The next shot also shows the tractor from 05:21 to 05:42, which is 21 seconds, driving on the racetrack behind the white fence. The tractor does not appear in any other instance of the video, so the tractor drove on the racetrack for 28 seconds in total. When combined with dog #2's new time, this totals 59.03 seconds." + }, + { + "key": "2dKCBcRehFY:8154cf87faa5ed97064a90e6beb2d599b2ddc86c", + "video_id": "2dKCBcRehFY", + "question": "Which number Greyhound was able to keep up the longest throughout the race with the winning Greyhound?", + "answer_choice_0": "Number 1.", + "answer_choice_1": "Number 6.", + "answer_choice_2": "Number 4.", + "answer_choice_3": "Number 5.", + "answer_choice_4": "Number 2.", + "answer_id": 0, + "answer": "Number 1.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I closely observed the race beginning at timestamp 02:57, with Greyhound number 2 taking the lead. Throughout the timestamp leading up to 03:23, Greyhound number 1 remained in close pursuit of Greyhound number 2 for the majority of the race until Greyhound number 6 ultimately overtook Greyhound number 1 to secure second place behind Greyhound number 2 at the race's conclusion.Therefore, Greyhound number 1 keeps up with Greyhound number 2 for the longest duration throughout the race." + }, + { + "key": "2dKCBcRehFY:af67eb85abf68259e3598b2fd609aa71578b2e96", + "video_id": "2dKCBcRehFY", + "question": "What is the difference between the number of people who first entered the blue stage and the number of people shown using their phones after the second replay of the race?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I identified the blue stage at 05:03, when no one had yet stood on it. I began counting at 05:08, when three people stepped on to the stage. I continued to watch and saw that another person entered the stage at 05:13. the clip ends at 05:14. This totals 4 people who first entered the stage. I then looked for the second replay of the video. I found that the first replay, identifiable by the orange icon in the top right corner, began at 03:54 and ended at 04:31. I continued watching and saw that the second replay began at 06:19 and ended at 06:38. For the rest of the video, I observed the people in the setting for anyone using their phones. I spotted one person at 07:11 at the far left using their phone and did not see another person using their phone for the rest of the video. This totals 1 person. The difference between the number of people who first entered the blue stage, 4, and the number of people using their phones after the second replay, 1, is 3." + }, + { + "key": "2dKCBcRehFY:b69e6240c7ec4aebfb5e76cc769abfdd9c436fc4", + "video_id": "2dKCBcRehFY", + "question": "What was the color of the number on the tag of the greyhound that came in second place?", + "answer_choice_0": "White.", + "answer_choice_1": "Red.", + "answer_choice_2": "Orange.", + "answer_choice_3": "Yellow.", + "answer_choice_4": "Black.", + "answer_id": 1, + "answer": "Red.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the race between 02:58 and 03:26. At 03:26, the greyhounds crossed the finish line. I heard the announcer call out the numbers of the first 3 dogs who crossed the finish line, 2, 6 and 1. I went back to right before the beginning of the race, at 02:57, to look at the number 6. The number 6 is on a striped background and is red." + }, + { + "key": "2dKCBcRehFY:c76ba0085c5d848b239468b34f01f43300764637", + "video_id": "2dKCBcRehFY", + "question": "In the crowd shot after the second tractor shot, where is the double decker bus?", + "answer_choice_0": "Parked next to a blue storehouse.", + "answer_choice_1": "Parked next to a sandy building.", + "answer_choice_2": "Parked in the grass.", + "answer_choice_3": "Parked in a lot by a van.", + "answer_choice_4": "Parked next to a blue stand.", + "answer_id": 1, + "answer": "Parked next to a sandy building.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I saw the first shot of the tractor beginning at 05:14. I continued watching and saw that the second shot of the tractor begins at 05:21 and ends at 05:42 as it transitions into the shot of the crowds. I observed the setting carefully and spotted the red double decker bus next to a sandy colored building." + }, + { + "key": "2dKCBcRehFY:c8257f1826bb7744fe56af047a5086a7ab3b7e9e", + "video_id": "2dKCBcRehFY", + "question": "When the symbol of a yellow star first appears on screen, which word has the same number of letters as the total number of scenery shots after the race ended?", + "answer_choice_0": "Derby.", + "answer_choice_1": "Sports.", + "answer_choice_2": "Greyhound.", + "answer_choice_3": "Star.", + "answer_choice_4": "Gain.", + "answer_id": 3, + "answer": "Star.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I scanned the setting carefully for a yellow star symbol and found that it first appeared at 01:56. \"Star\" has 4 letters, \"Sports\" has 6 letters, \"Greyhound\" has 9 letters, \"Derby\" has 5 letters, and \"Gain\" is not on screen. I then found that the race ended at 03:27, when the greyhounds crossed the finish line and the announcer called the winner. For the rest of the video, I looked for scenic shots that showed the setting of the venue with no particular subjects in frame. I counted one shot from 03:31 to 03:53, one from 05:14 to 05:20, one from 05:21 to 05:48, and one from 05:48 to 06:18. This totals 4 shots of scenery and matches the number of letters in the word, \"Star\"." + }, + { + "key": "2tapJf1frt0:033b62d0256695d786219d84b171d3b74051f72b", + "video_id": "2tapJf1frt0", + "question": "After adding up all the millimeter totals on the sheet of paper illustrated at the timestamp 09:58, and then adding the average length of Louisiana Pine Snake hatchlings according to the video, how many total millimeters are there?", + "answer_choice_0": "2,217.41mm-4,130.04mm.", + "answer_choice_1": "1,912.63.41mm-2,217.41mm.", + "answer_choice_2": "693.41mm-1,912.63mm.", + "answer_choice_3": "1,912.63mm-2,217.41mm.", + "answer_choice_4": "4,130.04mm-4,530.04mm.", + "answer_id": 3, + "answer": "1,912.63mm-2,217.41mm.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I went to the 09:58 timestamp in the video. I saw that there were 7 millimeter measurements marked down, each one corresponding to an egg. These 7 millimeter measurements were\u201496.74,93.37,93.45,98.24,99.53,115.67,96.41. When added all together, the sum is 693.41. I marked this number down for later. I then continued watching the video, waiting for any mention of the length of Louisiana Pine Snake hatchlings. From 10:47-10:50, the speaker begins to say, in reference to the hatchlings, \"they usually range from 4 to 5 feet in length.\" Since the length was in feet, I converted 4 feet to millimeters, getting 1219.2mm. I then did the same thing with 5 feet, getting, 1524mm. I then added 1219.22mm to 693.41mm to get 1,912.63 millimeters. Then added 1524 mm to 693.41 to get 2,217.41 millimeters. So the total after adding up all the millimeter totals on the sheet of paper at the 09:58 timestamp, and additionally adding the average length of Louisiana Pine Snake hatchlings is between 1,912.63 millimeters and 2,217.41 millimeters." + }, + { + "key": "2tapJf1frt0:24f9f71dab27e9291e446fc3341bddc91f01ca29", + "video_id": "2tapJf1frt0", + "question": "Directly after the man jokes about how he still has all of his appendages after 25 years of running an alligator business, how many alligators would be visible in the video if 2 of them were removed?", + "answer_choice_0": "4.", + "answer_choice_1": "8.", + "answer_choice_2": "12.", + "answer_choice_3": "10.", + "answer_choice_4": "6.", + "answer_id": 1, + "answer": "8.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video to find the time when a man jokes about how he still has all of his appendages after 25 years of running an alligator business. I found this joke in a voiceover which occurs from 18:51-19:06. The man mentions during this voiceover that he and his brother started an alligator business 25 years ago, and then the joke about his appendages occurs right at 19:06. Directly after this moment, at 19:07, I looked for a group of alligators, and found them to be shown all lined up in a row at that time with 2 men attending to them. I counted the alligators, and there were 10. If 2 of them were removed, there would be 8, which makes that the answer." + }, + { + "key": "2tapJf1frt0:34777268dd5918f6f90b633c47331d4043634fc3", + "video_id": "2tapJf1frt0", + "question": "If you were to combine the first spoken word of the video, with the first animal mentioned, with the last full written word of the video, what nonsensical phrase/word combination would you get?", + "answer_choice_0": "To crocodile Alive.", + "answer_choice_1": "In Bald Eagles Alive.", + "answer_choice_2": "In Bald Eagles of.", + "answer_choice_3": "In crocodile of.", + "answer_choice_4": "To Bald Eagles of.", + "answer_id": 2, + "answer": "In Bald Eagles of.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First I watched the video and listened for the first spoken word. It happens at the very start of the video at 00:02, when the speaker says \"in.\" I then continued watching, waiting for an animal to be mentioned. At 02:18 the speaker mentions \"Bald Eagles,\" the first animal specifically mentioned in the video. I continued watching, paying attention to written words, to see which one would be last. During the last second of the video at 27:02, in a graphic of a production company, the last full word is shown as \"of.\" Combining these words in orders results in the nonsensical phrase \"In Bald Eagles of.\"" + }, + { + "key": "2tapJf1frt0:53f9ac7e047c047e3c337339c2c88e9f3e2be29c", + "video_id": "2tapJf1frt0", + "question": "If you were to subtract the number of states where the United States' national bird was threatened in 1978 from the number of states where that same bird was \"Fully Recovered\" in 2007, what number would you get according to the video?", + "answer_choice_0": "48.", + "answer_choice_1": "42.", + "answer_choice_2": "43.", + "answer_choice_3": "44.", + "answer_choice_4": "49.", + "answer_id": 2, + "answer": "43.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I noted to myself that the United States' national bird is the Bald Eagle. I then watched the video, paying attention to any mention of the Bald Eagle and its endangered or recovered status. At 23:12, a clear map of the continental United States appears with the title \"Bald Eagle Status (1978).\" The map has a key that shows states colored yellow have the \"Threatened\" status for Bald Eagles. Michigan, Wisconsin, Minnesota, Washington, and Oregon are all colored yellow. I noted that this means that in 5 states in 1978 the Bald Eagle was threatened. At 23:15, the map changes. It is still of the continental states, and still depicts Bald Eagle Status, though in 2007. It also has a different key, showing that green denotes states where the Bald Eagle status is \"Fully Recovered.\" All the states shown are colored green, meaning the number of states where the Bald Eagle was fully recovered in 2007 is 48 (as Hawaii and Alaska are not depicted in the map). I then subtracted the number of states where the Bald Eagle was threatened in 1978 (5) from the number of states where the Bald Eagle was fully recovered in 2007 (48), to get 43." + }, + { + "key": "2tapJf1frt0:6ebe83c7e412c5d27f23e56513807f2170d7e683", + "video_id": "2tapJf1frt0", + "question": "If you were to take the number of traffic lights displaying red arrows at 01:14 and multiply by the first number explicitly said in the video, what number would you get?", + "answer_choice_0": "798.", + "answer_choice_1": "1,600.", + "answer_choice_2": "802.", + "answer_choice_3": "640.", + "answer_choice_4": "400.", + "answer_id": 1, + "answer": "1,600.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I went to the 01:14 timestamp and stopped the video. I studied the scene and counted 2 traffic lights displaying red arrows. I then started the video over and listened for explicitly stated numbers. I noted that at 01:21 the narrator says \"...more than 800 animals...\" and that this was the first explicitly stated number. I then multiplied the number of traffic lights displaying red arrows at 01:14 (2) by the first number explicitly said in the video (800) to get 1,600." + }, + { + "key": "2tapJf1frt0:717cb159136a0f25c72d1a62cab9e74b3e3a1915", + "video_id": "2tapJf1frt0", + "question": "How many green alligator skin purses with handles would be visible from 19:00-23:00 if 1 more was added?", + "answer_choice_0": "10.", + "answer_choice_1": "14.", + "answer_choice_2": "11.", + "answer_choice_3": "8.", + "answer_choice_4": "15.", + "answer_id": 0, + "answer": "10.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 19:00-23:00 in order to identify and count how many green alligator skin purses with handles are visible during that time. I found the following green purses with handles visible at least partially in the frame: 1 at 19:16-19:18, 4 at 19:18-19:21, and 4 at 22:10-22:12. I was able to identify them as alligator skin purses because of the voiceover narration, which mentions crocodilian species at 19:15. So, the total number visible is 9. If 1 more was added, there would be 10, making that the answer." + }, + { + "key": "2tapJf1frt0:a6b47e9b70804f2716ff77526147bf539a43ff2a", + "video_id": "2tapJf1frt0", + "question": "Before a named man explains that 6-8% of alligator eggs will survive to become 4-foot alligators, what name had been the most recent one to be shown onscreen?", + "answer_choice_0": "Michael Seymour.", + "answer_choice_1": "Rick Atkinson.", + "answer_choice_2": "Amity Bass.", + "answer_choice_3": "Noel Kinler.", + "answer_choice_4": "Keri Landry.", + "answer_id": 3, + "answer": "Noel Kinler.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video to find when a named man explains that 6-8% of alligator eggs will survive to become 4-foot alligators. I found him at 20:47, when his name appears on screen, which is Ted Falgout. He mentions this fact about alligator eggs from 20:54-21:00. Armed with this knowledge, I then sought to locate which name had been the most recent one to be shown onscreen before Ted Falgout. Looking backward, I found the name of Noel Kinler on the screen from 19:25-19:29. No other names appear between 19:29-20:47. So, the answer must be Noel Kinler." + }, + { + "key": "3X3tKlr5am8:041103c17e13bd80919980e2368c3a933ee23200", + "video_id": "3X3tKlr5am8", + "question": "When does the first segment that has the performers singing begin?", + "answer_choice_0": "4:04.", + "answer_choice_1": "0:58.", + "answer_choice_2": "3:22.", + "answer_choice_3": "0:36.", + "answer_choice_4": "5:30.", + "answer_id": 1, + "answer": "0:58.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While I was watching, I was listening to the music. During the beginning, the performers just danced to a beat. It wasn't until the next performance at 00:58 that I heard lyrics being played along with the music." + }, + { + "key": "3X3tKlr5am8:2bed06913f8c06f78c6c290e594492d8fce9c28a", + "video_id": "3X3tKlr5am8", + "question": "When are the male and female dancers seen together dancing?", + "answer_choice_0": "At the end.", + "answer_choice_1": "Once in the middle and once at the end.", + "answer_choice_2": "Once at the beginning and twice at the end.", + "answer_choice_3": "Once in the middle.", + "answer_choice_4": "Once at the beginning.", + "answer_id": 2, + "answer": "Once at the beginning and twice at the end.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the performances and noticed that the video consisted of different performances. So I searched for performances where both male and female dancers performed together on stage. They performed once at the beginning at 01:00 and then twice at the end at 07:09 and 07:51." + }, + { + "key": "3X3tKlr5am8:6617d8e5c9ef8a14aa087bd5bfa8470c0014ef28", + "video_id": "3X3tKlr5am8", + "question": "What happens after the female soloist performs?", + "answer_choice_0": "A male soloist dances.", + "answer_choice_1": "A troupe of children dance.", + "answer_choice_2": "The band performs on the dancefloor.", + "answer_choice_3": "The performance is complete.", + "answer_choice_4": "Another female soloist joins her.", + "answer_id": 0, + "answer": "A male soloist dances.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the female soloist, who performs at 01:51 - 02:35. Then, at 02:35, I saw the video dissolve to a wide shot of the male soloist, who dances next." + }, + { + "key": "3X3tKlr5am8:9ddafc7cb1a6bcf2d985e30d623cba0fc8d9acbb", + "video_id": "3X3tKlr5am8", + "question": "What two primary colors compose the cloth skirts of the third unique group of dancers seen wearing skirts made primarily from cloth rather than plants?", + "answer_choice_0": "Green and gold", + "answer_choice_1": "Pale blue and yellow", + "answer_choice_2": "Navy and white", + "answer_choice_3": "Red and pale yellow", + "answer_choice_4": "White and tan", + "answer_id": 2, + "answer": "Navy and white", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for unique groups of dancers in the video and found the first appears momentarily at 00:01 and that they wear black cloth skirts. I counted this as the first group. The next few sets of unique groups of dancers wear skirts made primarily from green leaves, so I did not count them. Two solo dancers perform wearing cloth skirts but since they are soloists and not part of a group, I did not count them. The second unique group of dancers wearing cloth skirts begins performing at 03:22. They are followed by the third group of dancers wearing cloth skirts at 04:44. I observed that the cloth skirts of this group of dancers are made up of navy cloth with a white pattern. Therefore, the correct answer is navy and white." + }, + { + "key": "3X3tKlr5am8:ae6e29fde1eeebea8e655703d3c003e9d19eddd2", + "video_id": "3X3tKlr5am8", + "question": "Some of the musicians have large cylindrical pieces of polished wood. What are they doing with them?", + "answer_choice_0": "They are using them as a stand for a set of two small hand drums.", + "answer_choice_1": "They are using them as a percussion instrument by tapping them on the side with a wooden wand.", + "answer_choice_2": "They are using them as a percussion instrument by playing on the top of them with their hands.", + "answer_choice_3": "They are not for music, they are a decorative music stand.", + "answer_choice_4": "The are using them as a percussion instrument by scraping a metal comb over the ridged parts.", + "answer_id": 1, + "answer": "They are using them as a percussion instrument by tapping them on the side with a wooden wand.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the musicians with the wooden cylinders at 05:53. From then until 06:55, I watched them play the cylinders by tapping on them with a wooden hand." + }, + { + "key": "3X3tKlr5am8:bb875211322acf9e214797e20e5167560ab7a4dd", + "video_id": "3X3tKlr5am8", + "question": "What has been placed around the stage at 07:32?", + "answer_choice_0": "There are rows of benches placed around the edges of the stage.", + "answer_choice_1": "There are potted plants placed at wide intervals around the edges of the stage.", + "answer_choice_2": "There are sheets of metallic blue plastic around the edges of the stage.", + "answer_choice_3": "There are regularly placed buckets filled with palm fronds around the edges of the stage.", + "answer_choice_4": "There are large wooden pools filled with water around the edges of the stage.", + "answer_id": 1, + "answer": "There are potted plants placed at wide intervals around the edges of the stage.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the stage at 07:32. At the same time, I then noticed there were potted plants placed at wide intervals around the edges of the stage." + }, + { + "key": "3X3tKlr5am8:edac5a8fdc09b7dd90e74b5d60241ceff48a5952", + "video_id": "3X3tKlr5am8", + "question": "What is the male soloist's crown made of after 02:35?", + "answer_choice_0": "Pearls.", + "answer_choice_1": "Gold.", + "answer_choice_2": "Plants.", + "answer_choice_3": "Bone.", + "answer_choice_4": "Rubies.", + "answer_id": 2, + "answer": "Plants.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "After 02:35, I saw the video dissolve to a wide shot of the male soloist. Then, I noticed his crown was made of plants." + }, + { + "key": "3lxklYVZYEk:6a54ea22f996320f82dce7491e62691a08c26407", + "video_id": "3lxklYVZYEk", + "question": "Who is the first person to speak during the film?", + "answer_choice_0": "Hendrickx Ntela.", + "answer_choice_1": "Beast.", + "answer_choice_2": "Grichka Caruge.", + "answer_choice_3": "Kwame Osei.", + "answer_choice_4": "Sally.", + "answer_id": 3, + "answer": "Kwame Osei.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to the beginning of the film and paused it at 00:58 when the first person appeared on the screen talking. I then read the white text next to his head that read \"KWAME OSEI\"." + }, + { + "key": "3lxklYVZYEk:7b9818ebb598b44982a0d7de6e1343062f993417", + "video_id": "3lxklYVZYEk", + "question": "What is the color of the man's hat between 06:22 and 06:28?", + "answer_choice_0": "Pink.", + "answer_choice_1": "Orange.", + "answer_choice_2": "White.", + "answer_choice_3": "Red.", + "answer_choice_4": "Blue.", + "answer_id": 0, + "answer": "Pink.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the specified section of the video at the 06:22 mark, and I located a man wearing a pink. I continued watching until 06:28 to ensure he did not wear any other colored hats." + }, + { + "key": "3lxklYVZYEk:7da7a35bb0d573ce5d04f8733dcd9ce713df4132", + "video_id": "3lxklYVZYEk", + "question": "What is the primary color of the cap featured in the fifth color shot in the video that shows one or more caps?", + "answer_choice_0": "Yellow", + "answer_choice_1": "Gray", + "answer_choice_2": "Pink", + "answer_choice_3": "Red", + "answer_choice_4": "Black", + "answer_id": 2, + "answer": "Pink", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I saw at least one person wearing a cap in the first minute of the video, but the shots were in black and white so I did not count that instance. The first shot in color that features individuals wearing caps begins at 01:19. I counted this as the first instance. This shot is followed by another shot in color of individuals wearing caps at 01:20. A third shot in color of a person wearing a cap occurs at 01:24. A fourth appears at 01:51. The fifth shot in color of a person wearing a cap occurs at 01:58. I observed the color of this cap and determined it to be pink." + }, + { + "key": "3tisOnOkwzo:5800e49b79392adb1a82d0bbe66b626ef3cb0dfa", + "video_id": "3tisOnOkwzo", + "question": "If there were twice as many golgi apparati in the plant cell diagram, how many more chloroplasts than golgi apparati would there be?", + "answer_choice_0": "2.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "2.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator say, \"plant cell\" at 04:26 while the video showed a cell diagram. It appeared to be a typical cell diagram with only 1 golgi apparatus. At 04:29, the narrator identifies the green oblong shapes as chloroplasts. I went back to the full diagram at 04:26 and counted 4 chloroplasts. Twice as many golgi apparati would be 2, so 4-2=2." + }, + { + "key": "3tisOnOkwzo:813396e66e50654e46735def6aea4e08850624e4", + "video_id": "3tisOnOkwzo", + "question": "How many stop codons are found in the mRNA sequence shown at 07:31 in the video after being decoded?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I looked at 07:32 to find the mRNA sequence mentioned in the question. I see a DNA sequence on the screen, and I hear the narrator say that there is a way to decode the strand of DNA. At 07:34 a chart appears on the screen containing triplets of letters. UAA, UAG and UAA all correspond to stop. I go back and look at the DNA sequence at 07:32, AUGACGUACGUAUGCUAGUUAGCC and I count in triplets, decoding the 3 letters with the corresponding amino acid or action in the chart and adding up the number of stops that are in the RNA sequence. There is only one stop codon in the sequence UAG." + }, + { + "key": "3tisOnOkwzo:8a2d3fd593ec55637a75f0da17e682822c63ba40", + "video_id": "3tisOnOkwzo", + "question": "The narrator tells us how long the DNA in a single cell would be if stretched out; if you were to stretch out the DNA of all the cells on the screen that have a thumbs up beside them at 12:17, about how long would their DNA be all together?", + "answer_choice_0": "24 meters.", + "answer_choice_1": "48 meters.", + "answer_choice_2": "8 meters.", + "answer_choice_3": "4 meters.", + "answer_choice_4": "32 meters.", + "answer_id": 2, + "answer": "8 meters.", + "question_type": "Temporal Reasoning", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video listening for the narrator to say how long the DNA in a single cell would be if stretched out. At 8:03, I hear the narrator say \"if you were to stretch out the DNA of one cell it would be about 2 meters long.\" I go to 12:17 in the video to determine how long the DNA from all the cells present on screen would be if it were stretched out. At 12:17, I see four cells with a thumbs up beside them. I know that each cell's DNA when stretched out is about 2 meters long. I perform the math two times four and get a final answer of 8 meters." + }, + { + "key": "3tisOnOkwzo:a13167b38fcdfeab457cac91e2e88ac283e5b30a", + "video_id": "3tisOnOkwzo", + "question": "In the video directly after the cold emoji appears onscreen, there are some molecules of water on the left side of the cell membrane and then the move, why did water travel across the cell membrane?", + "answer_choice_0": "To balance pH.", + "answer_choice_1": "To maintain homeostasis.", + "answer_choice_2": "To maintain ion balance.", + "answer_choice_3": "To make ATP.", + "answer_choice_4": "To lower the concentration gradient.", + "answer_id": 1, + "answer": "To maintain homeostasis.", + "question_type": "Cause and Effect", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video looking for the cold emoji and molecules of water on screen with a cell membrane. At 02:27, I see the cold emoji appear onscreen. I continue to watch looking for water molecules and a cell membrane to appear. At 02:29, I see molecules of water on the left side of the cell membrane mentioned in the question. In the image, there are 6 molecules on the left side of a cell membrane and 2 molecules of water on the right side of the cell membrane. I hear the narrator say that certain chemicals are being balanced as 2 molecules of water move from the left side of the cell membrane to the right side of the cell membrane. I then go back to the beginning of this section of the video, which begins at 02:18. The narrator then says that every species has one thing in common, \"homeostasis,\" and defines the term at 02:21 as \"keeping certain conditions in check.\" At 02:27 the narrator explains that cells do the same thing by balancing out certain concentrations of certain chemicals. I deduce that the 2 molecules of water are moving across the cell membrane to maintain homeostasis." + }, + { + "key": "3tisOnOkwzo:bf9d510268ed17cdc1d09103755b5f04694297fc", + "video_id": "3tisOnOkwzo", + "question": "How many unique appearances of the golgi apparatus are there in the first 3 minutes?", + "answer_choice_0": "3.", + "answer_choice_1": "6.", + "answer_choice_2": "7.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "4.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I saw a depiction of a eukaryotic cell labeled at 01:37. I then identified the pink structure at the bottom of the cell as a golgi apparatus, due to the stacking of small flat sacs. From 00:00 to 03:00, I saw the golgi apparatus at 01:35, 01:37, 02:27, and 02:42. It is important to note that the same golgi apparatus was on the screen from 01:37 to 01:45. I added the number of times the golgi apparatus appeared and found the total to be 4." + }, + { + "key": "3tisOnOkwzo:cf91ee20b4dfd944c885d11fe12850f16834f29d", + "video_id": "3tisOnOkwzo", + "question": "At 06:37, what would the second line of the DNA sequence be after it is transcribed into mRNA?", + "answer_choice_0": "CUAGCUGAUCGAGGCUA.", + "answer_choice_1": "GATCGACTAGCTCCGAT.", + "answer_choice_2": "GAUCGACUAGCUCCGAU.", + "answer_choice_3": "GTACGTCATGCACCUA.", + "answer_choice_4": "CTAGCTGATCGAGGUA.", + "answer_id": 0, + "answer": "CUAGCUGAUCGAGGCUA.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I looked at 06:37 to find the second line of the DNA sequence referenced in the question. The DNA sequence on the second line reads: GATCGACTAGCTCCGAT. The question is asking for the mRNA strand after transcription. I find the narrator discussing the steps of transcription from 06:17 to 06:32. On the screen, I see that complementary base pairs are as follows: A pairs with U, T pairs with A, C pairs with G, and G pairs with C. Based on this logic, the 2nd line of DNA after being transcribed into mRNA is CUAGCUGAUCGAGGCUA." + }, + { + "key": "3wEth2tcL5k:378f06b0bdbd63ddd6042ae26e7e031fdcc84c78", + "video_id": "3wEth2tcL5k", + "question": "If we add the largest number shown in the video to the smallest number shown in the video and divide them by 100000000000, what is the result rounded to 2 decimal points?", + "answer_choice_0": "4.13 x 10^{76}.", + "answer_choice_1": "4.11 x 10^{73}.", + "answer_choice_2": "3.11 x 10^{71}.", + "answer_choice_3": "2.01 x 10^{70}.", + "answer_choice_4": "6.41 x 10^{78}.", + "answer_id": 1, + "answer": "4.11 x 10^{73}.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed they discussed a bunch of constants. These constants varied. At 00:50, a number of 3.3598856662 was shown. At 01:42, I saw the number 137.5. At 02:51 I was the number -2.89. At 06:03, the number 3263442 was shown. At 11:31, many numbers flash across the frame, with variables attached to them. The smallest number from that page was -12. At 11:54, the number 01101001100101101001011001101001 is shown. At 13:07, the number 1221121221221121122121121 is shown. At 13:40, the number 4113101149215104800030529537915953170486139623539759933135949994882770404074832568499 is shown. At 15:45, the number 10^18 appears, but this is smaller than the number shown at 13:07. This ends up being the largest number in the video and -12 ends up being the smallest number. I added those 2 numbers together and then divided the result by 100000000000 to get 4.11 x 10^{73}. Therefore, if we add the largest number shown in the video to the smallest number shown in the video and divide them by 100000000000, the result rounded to 2 decimal points is 4.11 x 10^{73}." + }, + { + "key": "3wEth2tcL5k:39c238a8c4a748223fdaf24bf821735d9b7e56fd", + "video_id": "3wEth2tcL5k", + "question": "The bottom right corner of the screen shows the number of constants discussed. What is the product of the number of circles that appear between 08:23 and 14:10 and the constant \u201c21?\u201d", + "answer_choice_0": "1.70142.", + "answer_choice_1": "10.87313.", + "answer_choice_2": "4.33480.", + "answer_choice_3": "2.26856.", + "answer_choice_4": "92.56276.", + "answer_id": 3, + "answer": "2.26856.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "At 08:35, a circle is drawn around an ellipse, and the narrator says that a circle is drawn. A smaller circle is formed at 09:02, and the narrator continues to talk about the circle and its properties. At 09:06, another larger circle is shown. The narrator talks about both of these shapes. At 09:15, the circle and ellipse are both transformed into another circle and ellipse, but the narrator doesn\u2019t discuss that change. No more circles appear during that time period. Therefore, there are 4 circles that appear during this time period. At 05:28, the Omega Constant is given as the \u201c21\u201d constant. The value of it is approximately 0.56714. Therefore, the answer is 4*0.56714=2.26856." + }, + { + "key": "3wEth2tcL5k:3ddb0072fa8dd9e99941148d5e68f6d7aa2f3723", + "video_id": "3wEth2tcL5k", + "question": "What is the value of the expression (13th-21st)^(3rd) where the counts refer to constants in the video?", + "answer_choice_0": "1.74513.", + "answer_choice_1": "4.61871.", + "answer_choice_2": "1.53542.", + "answer_choice_3": "4.2249.", + "answer_choice_4": "0.21168.", + "answer_id": 4, + "answer": "0.21168.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "I begin watching the video, looking for the 3rd constant. I see the 3rd constant at 00:20 which is Euler's constant. I see the 13th constant, Viswanath's constant, which is equal to 1.131988, at 02:36. I see the 21st constant, the omega constant, which is equal to 0.56714, at 05:31. Then to perform the calculation I take (1.131988-0.56714)^e which gives 0.21168. Therefore, the value of the expression (13th-21st)^(3rd) where the counts refer to constants in the video is 0.21168." + }, + { + "key": "3wEth2tcL5k:40a1c6ac86809ce9eea265c9ad356ef276aa4960", + "video_id": "3wEth2tcL5k", + "question": "If the value of the continued fraction used to demonstrate Loch's constant when it has 4 terms in its denominator is multiplied by the value of the continued fraction when it has 6 terms in its denominator, what is the resulting value?", + "answer_choice_0": "0.1694.", + "answer_choice_1": "1.5354.", + "answer_choice_2": "0.2116.", + "answer_choice_3": "1.7451.", + "answer_choice_4": "4.6187.", + "answer_id": 0, + "answer": "0.1694.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "I begin watching the video for when Loch's constant comes up, which happens at 03:20. At 03:23, I see the continued fraction has 4 denominators and the value is approximately 0.41162228. At 03:25, I see the continued fraction has six denominators and the value is approximately 0.4116251482. So 0.4116251482 multiplied by 0.411622 is 0.16943408. Therefore, if the value of the continued fraction used to demonstrate Loch's constant when it has 4 terms in its denominator is multiplied by the value of the continued fraction when it has 6 terms in its denominator, the resulting value is 0.1694." + }, + { + "key": "3wEth2tcL5k:46db70e47916ae3e05d449d6bb457fa12e715f3a", + "video_id": "3wEth2tcL5k", + "question": "At what time does the largest number in the video appear on-screen?", + "answer_choice_0": "01:42.", + "answer_choice_1": "00:50.", + "answer_choice_2": "13:40.", + "answer_choice_3": "11:54.", + "answer_choice_4": "13:07.", + "answer_id": 2, + "answer": "13:40.", + "question_type": "Temporal Reasoning", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed several very large numbers. At 01:42, I saw the number 137.5. At 06:03, the number 3263442 was shown, which is larger than 137.5. At 11:54, the number 01101001100101101001011001101001 is shown, which is larger than 3263442. At 13:40, the number 4113101149215104800030529537915953170486139623539759933135949994882770404074832568499 is shown, which is larger than the number shown at 11:54. At 15:45, the number 10^18 appears, but is smaller than the number that appeared at 13:40. This ends up being the largest number given in the video. However, it is not said out loud and is briefly shown in a very small font at the bottom center of the screen when talking about Mill\u2019s constant. Therefore, the largest number in the video appears on-screen at 13:40." + }, + { + "key": "3wEth2tcL5k:50ff4f7b2485581af069aeb15bb2e0fa2c0ca156", + "video_id": "3wEth2tcL5k", + "question": "What is the fifth term in the third sequence mentioned?", + "answer_choice_0": "5.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "0.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "While watching the video, I paid close attention to each sequence. The first sequence I saw was at 00:39. At 01:58 I see the Fibonacci sequence is again. The third sequence I see at 02:04 and its fifth term is 2. Therefore, the fifth term in the third sequence is 2." + }, + { + "key": "3wEth2tcL5k:a95dc0444eea9380585219a2db8b02de1359fab0", + "video_id": "3wEth2tcL5k", + "question": "What is the sum of every constant whose name starts with a C that appears in this video if all the numbers' printed values are in base 10?", + "answer_choice_0": "3.21997", + "answer_choice_1": "3.45568", + "answer_choice_2": "3.34557", + "answer_choice_3": "3.57656", + "answer_choice_4": "3.09866", + "answer_id": 1, + "answer": "3.45568", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "I begin watching the video looking for constants which start with a C. I see Cahen's constant at 06:16 which is approximately equal to 0.64341. At 06:27 I see Catalan's constant with the approximate value 0.91596559. At 11:29 I see Conway's constant with the approximate value 1.303577. At 12:22 I see the video discuss a series of constant called Champernowne constants and show 3 of them with approximate values 0.12345678910, 0.110111001, and 0.12345101112. At 12:30 I see the Copeland-Erdos constant with approximate value 0.2357111317. No other constant whose names begin with a C are shown, and the sum of these is 3.45568. Therefore, the sum of every constant whose name starts with a C that appears in this video if all the numbers' printed values are in base 10 is 3.45568." + }, + { + "key": "3wEth2tcL5k:e7b5452af13343c9df7b01a40f8eec712ecc1c03", + "video_id": "3wEth2tcL5k", + "question": "Excluding 0 and 1, what is the smallest possible value shown when the count of discussed constants displayed in the bottom right corner of the screen reads \"11\"?", + "answer_choice_0": "1.75.", + "answer_choice_1": "2.", + "answer_choice_2": "\\sqrt{2}.", + "answer_choice_3": "\\sqrt{2} - 1.", + "answer_choice_4": "0.46.", + "answer_id": 2, + "answer": "\\sqrt{2}.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed in the bottom right corner of the screen the number corresponding to how many constants had been discussed is shown. This number is not said out loud, but with each constant discussed, it increases by 1. At 01:45, the Magic Angle is discussed. This corresponds to number 11. Number 11 is in the bottom right corner of the screen from 01:45 to 02:13. The smallest number, excluding 0 and 1, is given at 01:54. That number is \\sqrt{2}. Therefore, when the count of discussed constants displayed in the bottom right corner of the screen reads \"11\", the smallest possible value shown, excluding 0 and 1, is \\sqrt{2}." + }, + { + "key": "3wEth2tcL5k:f9d83214a07595401dcf2f29f318478dfd2308e0", + "video_id": "3wEth2tcL5k", + "question": "What is the third term in the third series mentioned?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "1/3.", + "answer_choice_3": "7.", + "answer_choice_4": "1/5.", + "answer_id": 4, + "answer": "1/5.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "While watching the video, I paid close attention to each series. The first series I saw was at 00:49 while discussing the reciprocal Fibonacci constant. The second series I saw was the harmonic series at 04:16. The third series I saw was at 04:28, and it was the sum of the reciprocals of prime numbers, so the third term was 1/5. Therefore, the third term in the third series mentioned is 1/5." + }, + { + "key": "3wEth2tcL5k:fe87b20320e3b8c6ae24ae398765fa34759ff734", + "video_id": "3wEth2tcL5k", + "question": "The bottom right corner of the screen displays the number of constants discussed. What is the quotient when the number of distinct words (hyphenated words count with non-hyphenated words) containing the letter \"f\" (shown on-screen from the beginning of the video to the 9:00 mark) is divided by the 37th constant?", + "answer_choice_0": "5.234", + "answer_choice_1": "1.309", + "answer_choice_2": "2.617", + "answer_choice_3": "3.926", + "answer_choice_4": "6.543", + "answer_id": 4, + "answer": "6.543", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I was watching the video and noticed many words coming onto the screen, but not many containing the letter \u201cf.\u201d At 00:39, the Fibonacci sequence is talked about. The word Fibonacci contains an f. It appears several more times throughout the video, but only counts as 1 distinct word. At 02:55, the Embree-Trefethen constant is discussed. Trefethen contains an f. At 04:40, the word function appears on screen. At 05:35, Gelfond\u2019s constant is discussed, as is Gelfond-Schneider which is not distinct from Gelfond. At 07:59, the word \u201cfor\u201d appears on screen, as part of the phrase \u201cBrun\u2019s constant for prime quadruplets.\u201d Therefore, a total of 5 distinct words that contain the letter f appear on-screen from the beginning of the video to the 9 minute mark. All of these words appear on screen, but are spoken too. However, many more words containing the letter \u201cf\u201d are spoken by the narrator. At 10:56, the Landau-Ramanujan constant is given. It is the 37th constant discussed, with a value of 0.76422\u2026 Therefore, the quotient is 5/0.76422 which is approximately 6.543, when rounded to 3 decimal places." + }, + { + "key": "3zrHa2Qh0I0:5b11d123818cedaa234259606c46f8d648f1b747", + "video_id": "3zrHa2Qh0I0", + "question": "What does the setting look like when the man in the hat is brushing the woman's hair?", + "answer_choice_0": "They are in a bathroom.", + "answer_choice_1": "They are in a bedroom.", + "answer_choice_2": "They are in a gravel pit.", + "answer_choice_3": "They are in the Tardis.", + "answer_choice_4": "They are in a hair salon.", + "answer_id": 2, + "answer": "They are in a gravel pit.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 02:38, when the scene cuts to a desolate gravel pit. The camera pans to show the man in the hat bending over to brush the woman's hair while she sits on the ground." + }, + { + "key": "3zrHa2Qh0I0:5b592be7b079484a499fa1923b2e6befd2a77967", + "video_id": "3zrHa2Qh0I0", + "question": "What does the man in the bowler hat do in response to the woman saying the line \"You sold us out!\"?", + "answer_choice_0": "He shakes his head.", + "answer_choice_1": "He pushes her over.", + "answer_choice_2": "He argues with her.", + "answer_choice_3": "He runs away.", + "answer_choice_4": "He pulls out a gun.", + "answer_id": 1, + "answer": "He pushes her over.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene and listened for the line where the woman says \"You sold us out!\" which occurs at 00:50. I then continued watching the scene for the man in the bowler hat's response from at 00:53-00:54, I watched him push her to the side, and watched her fall over slightly in response." + }, + { + "key": "3zrHa2Qh0I0:c5dcbd18c3a0b54edb9891a938e20264151a60c6", + "video_id": "3zrHa2Qh0I0", + "question": "Who brushes the brunette girl's hair behind the scenes?", + "answer_choice_0": "Acne Kid.", + "answer_choice_1": "Bowler Hat Man.", + "answer_choice_2": "Balding Twentysomething.", + "answer_choice_3": "Blonde actress.", + "answer_choice_4": "Male lead.", + "answer_id": 1, + "answer": "Bowler Hat Man.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the Bowler Hat Man, who has long silky hair, brushing the brunette girl's hair. She is seated on the ground facing away from him as he runs the brush through her hair. They are laughing together and discussing conditioners [2:39-2:51]." + }, + { + "key": "3zrHa2Qh0I0:cec26d9be55357875161983fcfd313625db7fdc2", + "video_id": "3zrHa2Qh0I0", + "question": "Where is the red eraser when the man and the woman are discussing the making of the film?", + "answer_choice_0": "Stuck to the dry erase board behind and between them.", + "answer_choice_1": "On top of the green helmet next to the woman.", + "answer_choice_2": "Sitting on the table in front of them.", + "answer_choice_3": "Held in the man's right hand.", + "answer_choice_4": "Held in the woman's left hand.", + "answer_id": 0, + "answer": "Stuck to the dry erase board behind and between them.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 04:43, when the scene switches to the man and the woman sitting at a table in a small room. On the wall behind them, visible between them, is a dry erase board. A red eraser is stuck to the board." + }, + { + "key": "3zrHa2Qh0I0:eb488850c155f3b30ea13f1f38fc03c4c8fe6c8f", + "video_id": "3zrHa2Qh0I0", + "question": "Why do the four actors begin to perform a haka?", + "answer_choice_0": "To distract from embarrassment after a dropped line.", + "answer_choice_1": "To intimidate other actors.", + "answer_choice_2": "To kick off a rugby match.", + "answer_choice_3": "To celebrate the end of filming.", + "answer_choice_4": "To welcome a new cast member to set.", + "answer_id": 0, + "answer": "To distract from embarrassment after a dropped line.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched a scene that began at 01:22. The four actors are standing together, waiting for someone to say their line. As the silence lengthens, the actors begin to look back and forth at one another with unease. At 01:32, the actor playing the Doctor breaks into a haka, at which point the others join him in relief." + }, + { + "key": "4I36G3B_sPA:22088b3083f3e7f7dfba58fb6f36de23845786f2", + "video_id": "4I36G3B_sPA", + "question": "In what order do the following events occur?", + "answer_choice_0": "Embodiment of Ben Shapiro's voice, Obi-wan Kenobi's ghost, a clown, a void.", + "answer_choice_1": "Embodiment of Ben Shapiro's voice, a clown, a void, Obi-wan Kenobi's ghost.", + "answer_choice_2": "Embodiment of Ben Shapiro's voice, Obi-wan Kenobi's ghost, a void, a clown.", + "answer_choice_3": "Embodiment of Ben Shapiro's voice, a void, Obi-wan Kenobi's ghost, a clown.", + "answer_choice_4": "Embodiment of Ben Shapiro's voice, a void, a clown, Obi-wan Kenobi's ghost.", + "answer_id": 0, + "answer": "Embodiment of Ben Shapiro's voice, Obi-wan Kenobi's ghost, a clown, a void.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched to find the start of the argument between the men. At 00:50, the man in black is visibly irritated. I listened to find the insults. At 02:06, the man in gray says \"embodiment of Ben Shapiro's voice\". At 02:10, the man in black says Obi-wan Kenobi's ghost. At 02:15, the man in gray calls him \"a clown\". At 02:18 the man in black calls him a void." + }, + { + "key": "4I36G3B_sPA:50c25db0c38821448724bed133a118a8739c66ad", + "video_id": "4I36G3B_sPA", + "question": "What is the young man doing at 00:16-00:17 when he walks into the room?", + "answer_choice_0": "Putting on his jacket.", + "answer_choice_1": "Fixing his hair.", + "answer_choice_2": "Buttoning his coat.", + "answer_choice_3": "Tying his tie.", + "answer_choice_4": "Adjusting his cufflinks.", + "answer_id": 3, + "answer": "Tying his tie.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:16-00:17, the young man walks in the room. As he does, his tie hangs around his neck and he starts tying it while talking to the older man." + }, + { + "key": "4I36G3B_sPA:931bf2173a0d558fa2b155ea371e34dbad3fb0ed", + "video_id": "4I36G3B_sPA", + "question": "The second time the phrase \"no offense\" is spoken in the video, what is the speaker doing as he says it?", + "answer_choice_0": "Eating eggs in the kitchen.", + "answer_choice_1": "Walking into the kitchen.", + "answer_choice_2": "Leaning over the table.", + "answer_choice_3": "Standing with arms crossed.", + "answer_choice_4": "Eating cereal at the table.", + "answer_id": 2, + "answer": "Leaning over the table.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the conversation between the two men, listening for each instance of the phrase \"No Offense\" to be spoken. The first happens at 01:20, and the second at 01:34. I identified the speaker during this second instance as the black-haired man, and watched what he was doing while he said it: he was leaning over the table at 01:34." + }, + { + "key": "4I36G3B_sPA:a9bd301169ec56c05b70f592238ad6eca0708679", + "video_id": "4I36G3B_sPA", + "question": "What is in the cabinet behind the old man?", + "answer_choice_0": "Family photos.", + "answer_choice_1": "Porcelain dolls.", + "answer_choice_2": "A tea set.", + "answer_choice_3": "An urn full of ashes.", + "answer_choice_4": "Collectable baseball cards.", + "answer_id": 2, + "answer": "A tea set.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The video shows the cabinet behind the old man at 00:14. I noticed that the cabinet is filled with a tea set." + }, + { + "key": "4I36G3B_sPA:bb9f5a609b6b1849150e24eecbce53a4cc75d4e5", + "video_id": "4I36G3B_sPA", + "question": "What does the younger man do as the video music queues?", + "answer_choice_0": "He tries harder to make his point.", + "answer_choice_1": "He approaches the older man.", + "answer_choice_2": "He just stares at the older man.", + "answer_choice_3": "He complains and walks out of the room.", + "answer_choice_4": "He screams in frustration.", + "answer_id": 3, + "answer": "He complains and walks out of the room.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for when the music first queued at 00:41. I watched the younger man then sigh and walk from the dining room into the kitchen while complaining about the older man not listening from 00:42 to 00:44. Therefore, the younger man left the room." + }, + { + "key": "4I36G3B_sPA:c3044862543a7f7dc19bcaf5ecf0a24a1692557d", + "video_id": "4I36G3B_sPA", + "question": "Who or what is centered in the shot immediately before the man in gray mentions Alex Jones?", + "answer_choice_0": "The man in black.", + "answer_choice_1": "A bouquet of flowers.", + "answer_choice_2": "A plate of eggs.", + "answer_choice_3": "The man in gray.", + "answer_choice_4": "A bowl of cereal.", + "answer_id": 0, + "answer": "The man in black.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for a mention of Alex Jones. This happens at 02:42. I looked at the shot immediately beforehand, at 02:40, and identified the man in black as the central focus of that shot." + }, + { + "key": "4M0lZPaJKto:0fab3d5b57e78df706bfc584ab258b18ee046647", + "video_id": "4M0lZPaJKto", + "question": "Between 17:10-17:20, as the winner gallops around the arena, how many people in the center of the arena would be visible if there were twice as many people there?", + "answer_choice_0": "30.", + "answer_choice_1": "28.", + "answer_choice_2": "26.", + "answer_choice_3": "22.", + "answer_choice_4": "24.", + "answer_id": 1, + "answer": "28.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 17:10-17:20 to see how many people are present in the center of the arena as the winner gallops around. At 17:13, the first people began to appear, each of them standing near the tables and some of them sitting at computers, all located in the center of the arena. From 17:13-17:20, I counted 14 people visible. A few of them toward the end are walking away from the tables, but they are still located in the center of the arena where the winner is galloping around. If there were twice as many people, there would be 28, making that the answer." + }, + { + "key": "4M0lZPaJKto:201d73f411d8b42aed6f5c59435836925d1f5623", + "video_id": "4M0lZPaJKto", + "question": "After the announcer says it's time to \"report to center ring\"--what color is the second horse to be fully visible?", + "answer_choice_0": "Dark brown", + "answer_choice_1": "Light brown", + "answer_choice_2": "Black and white", + "answer_choice_3": "Light gray", + "answer_choice_4": "Black", + "answer_id": 3, + "answer": "Light gray", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and listened for the announcer to say \"report to center ring\". This occurred at 10:45. At 10:45, I saw the first fully visible horse was dark brown. From 10:47-10:48 a horse passed by in the foreground. I could not see the entire horse, so I did not count this. The next horse that was fully visible appeared from 10:50-10:52. This horse was light gray." + }, + { + "key": "4M0lZPaJKto:21cd9a9a43595d7f8b1992a8a22634591811f23e", + "video_id": "4M0lZPaJKto", + "question": "After the announcer tells the riders to \"halt,\" what is the sum of the numbers visible on the riders who are seen two shots after the shot where \"halt\" is heard?", + "answer_choice_0": "721.", + "answer_choice_1": "684.", + "answer_choice_2": "906.", + "answer_choice_3": "823.", + "answer_choice_4": "599.", + "answer_id": 3, + "answer": "823.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video to find the moment when the announcer tells the riders to \"halt.\" I found this moment at 03:30, when the video shows a rider wearing a green coat. I then looked for the subsequent shots, counting to 2. The first subsequent shot begins at 03:33, when a lone rider in a blue-green coat is shown behind two men wearing suits. This shot lasts until 03:36. Then, the next shot begins at 03:36 and goes until 03:40. Since this is the second shot after the shot where \"halt\" is heard, I identified the numbers the riders are wearing (247 and 576) and added them. The total being 823, I determined that this is the answer." + }, + { + "key": "4M0lZPaJKto:49629a4f05e46b81c479f940fadb2a63e114fc8c", + "video_id": "4M0lZPaJKto", + "question": "As the man walks down past the lined up horses from 11:47-12:01, and some of the horses back away from him, how many horses would have backed away from him if 3 fewer horses backed away from him?", + "answer_choice_0": "6.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "7.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video during the 11:47-12:01 time frame in order to first see how many horses back away from the man as he walks down the line of horses. During that time span, 7 total horses back away from the man as he walks past them. If there were 3 fewer horses that backed away from him, that would make the answer 4." + }, + { + "key": "4M0lZPaJKto:853abceb6be8c07a7856970aa9ae6c2a270e4118", + "video_id": "4M0lZPaJKto", + "question": "How many times do brown horses move from right to left while the entirety of the first horse's information is on the chyron at the time the announcer says \"extended trot, please\"?", + "answer_choice_0": "8.", + "answer_choice_1": "2.", + "answer_choice_2": "6.", + "answer_choice_3": "0.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "6.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video listening for the anouncer to say \"extended trot, please\", which occurs at 02:28. I looked at the chyron at the bottom of the screen, and the first horse's information is given as #562 - CH THE CRESCENDO - MIA PROVENZANO. I went back to see at what time the entirety of the information is on the screen, and it is from 02:19-02:28. I watched the segment again to see how many brown horses move from right to left during that time period, and I counted 6." + }, + { + "key": "4M0lZPaJKto:9fa14e051a39889e8cc941361283c551dcede8e8", + "video_id": "4M0lZPaJKto", + "question": "Two shots before the rider mouths \"sorry,\" what kind of accessories is the rider wearing?", + "answer_choice_0": "Earrings and a brooch.", + "answer_choice_1": "Earrings and a monogrammed collar.", + "answer_choice_2": "Earrings and a collar with a chain.", + "answer_choice_3": "Earrings.", + "answer_choice_4": "Earrings and a cameo.", + "answer_id": 0, + "answer": "Earrings and a brooch.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for a rider mouthing the words \"I'm sorry\", which happens at 12:44. I went back two shots before this, to a shot beginning at 12:30. The rider featured in this shot is wearing earrings and a brooch." + }, + { + "key": "4M0lZPaJKto:a40151bdca6aaa45d0515f7be4644bc18d261391", + "video_id": "4M0lZPaJKto", + "question": "Directly after the third time that the words \"FREEDOM HALL\" become visible in their entirety, how many horses would be featured on the screen if there were 5 additional horses?", + "answer_choice_0": "6.", + "answer_choice_1": "7.", + "answer_choice_2": "15.", + "answer_choice_3": "10.", + "answer_choice_4": "11.", + "answer_id": 3, + "answer": "10.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the times when the words \"FREEDOM HALL\" become visible in their entirety. I found the first instance of this from 03:30-03:33, when the words are visible as a large sign on the side of the arena, in the midst of the stands. A second instance occurs from 03:47-03:48. After this, the next instance where the words become visible is from 06:20-06:21. Having found the third instance, I looked to see how many horses are featured on the screen. At 06:22, I counted 5 horses. If there were 5 more, there would be 10 total, making that the answer." + }, + { + "key": "4M0lZPaJKto:a6638dbd9c0ee34a98d47ad4994cc137c6058eb4", + "video_id": "4M0lZPaJKto", + "question": "When the announcer says where the 1st prize rider is from, how many more letters are in the name in red at the top right than the name in red at the lower left?", + "answer_choice_0": "4.", + "answer_choice_1": "7.", + "answer_choice_2": "6.", + "answer_choice_3": "0.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "6.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I listened for the winning horse to be announced, which occurs at 14:25. I continued listening for the 1st prize rider's name at 14:30, and where the rider was from, at 14:32. At that point I looked onscreen for a name in red, of which there are four. The one at the top right is Chief of Spindletop, with 17 letters, and at the lower left is Night Flower, with 11. 17-11=6, making the answer 6." + }, + { + "key": "4M0lZPaJKto:fc4fe0a13e0f1219723e93f738aff049436e7e87", + "video_id": "4M0lZPaJKto", + "question": "When the horse who wins a place two lower than the horse with a male rider is shown facing the camera, how many people onscreen are seen wearing masks?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "1.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for the horse with a male rider to win something, which occurs at 15:36. He is announced as the 5th place winner. I continued watching, waiting for the announcer to announce the 7th place winner, which occurs at 16:00. I then waited for the horse and rider to be facing the camera, which occurs at 16:08. At this time, there is 1 person onscreen wearing a mask." + }, + { + "key": "4n_mRf7j920:71e24a4a8644909d2890bf41d0701375272e96b6", + "video_id": "4n_mRf7j920", + "question": "During Tony's interview, there is a blue longsleeve shirt on the rack behind him. What number is represented on the shirt?", + "answer_choice_0": "95.", + "answer_choice_1": "93.", + "answer_choice_2": "78.", + "answer_choice_3": "98.", + "answer_choice_4": "24.", + "answer_id": 1, + "answer": "93.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video, I analyzed the background elements presented during Tony's interview. I noticed that the number 93 is on a blue long sleeve shirt from 00:38-00:50 that a merchant seems to be selling. The shirt remains on a rack for the duraiton of the interview." + }, + { + "key": "4n_mRf7j920:73066395ce9e683fe4f600e497aee95bc76f351f", + "video_id": "4n_mRf7j920", + "question": "What does the man in the \"KIA\" shirt pretend to do at the end of his performance?", + "answer_choice_0": "Drop a microphone.", + "answer_choice_1": "Shoot a basket.", + "answer_choice_2": "Faint.", + "answer_choice_3": "Shoot a gun.", + "answer_choice_4": "Trip.", + "answer_id": 3, + "answer": "Shoot a gun.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the man in the \"KIA\" shirt. I found this text in large print on the back of a black shirt at 01:36. I continued watching until the end of the segment, which occurred at 01:39. I went backwards and looked for when this person was visible from the front and found them onstage at 01:17. I looked for what happened just before the man in the \"KIA\" shirt walked off stage. At 01:28, I noticed a man behind the man in the \"KIA\" shirt pretended to toss something up in the air. Immediately after, the man in the \"KIA\" shirt lifted both his arms up as if he was holding a rifle. I heard the sound of a gunshot at 01:29 and then saw him put his hands down and walk off stage." + }, + { + "key": "4n_mRf7j920:82fd015cce327bbed3a17218b5e329bc163f00fe", + "video_id": "4n_mRf7j920", + "question": "In what order did the instructors perform?", + "answer_choice_0": "Tony, Kenzo, Ian, and Keone & Mari.", + "answer_choice_1": "Kenzo, Keone & Mari, Ian, and Tony.", + "answer_choice_2": "Kenzo, Ian, Keone & Mari, and Tony.", + "answer_choice_3": "Tony, Ian, Kenzo, and Keone & Mari.", + "answer_choice_4": "Keone & Mari, Ian, Tony, and Kenzo.", + "answer_id": 0, + "answer": "Tony, Kenzo, Ian, and Keone & Mari.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the beginning and started collecting the names of the interviewees. I read their names across the screens that appeared on the left of them. At 00:41, Tony started the interviews and his name was displayed. At 01:45, the next interviewee, Kenzo, was shown with his name across the screen. At 02:51, the interviewee Ian Westwood was shown with his name across the screen. The last interviewees, Keone & Mari, were shown at 05:06 with their names across the screen. I noticed that before each interview the instructors performed. I obsereved they performed in the following order: Tony, Kenzo, Ian, and Keone and Mari." + }, + { + "key": "4n_mRf7j920:8abd017e7a1996139f6eeb4fc616b6869e9e4d46", + "video_id": "4n_mRf7j920", + "question": "What color shirt does the man who taught \"Victory\" wear?", + "answer_choice_0": "Peach.", + "answer_choice_1": "Olive.", + "answer_choice_2": "Charcoal.", + "answer_choice_3": "Teal.", + "answer_choice_4": "Cream.", + "answer_id": 0, + "answer": "Peach.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for anyone to mention teaching \"Victory.\" This occurred at 05:17. I observed that the person who spoke \"Victory\" was a man and was accompanied by a woman. I observed the man's shirt and saw that it was a peach colored t-shirt." + }, + { + "key": "4n_mRf7j920:8ee139b88a237acb229579c5a10242f1aa0a3e98", + "video_id": "4n_mRf7j920", + "question": "How many interviewees had hats on?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "4.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and identified each interviewee, and then counted how many of them had hats on. Tony was an interviewee, but he did not have a hat on. Kenzo had his hat on at 01:43. Ian had his hat on at 02:51. Lastly, Keone & Mari both had their hats on at 05:07. This added up to four interviewees having hats." + }, + { + "key": "4n_mRf7j920:9f5b170b70653af079d0e79005ed4ae0ab5c2c9d", + "video_id": "4n_mRf7j920", + "question": "Where is the location when a crowd of dancers are dancing and the video is in slow motion?", + "answer_choice_0": "The dancers are in a large room dancing with a partner.", + "answer_choice_1": "The dancers are in a large room facing a stage with two screens on both sides.", + "answer_choice_2": "The dancers are in a large room walking in a circle.", + "answer_choice_3": "The dancers are in a large room facing a stage with other dancers on stage.", + "answer_choice_4": "The dancers are in a large room facing each other.", + "answer_id": 1, + "answer": "The dancers are in a large room facing a stage with two screens on both sides.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and from 03:51-03:55, I noticed that the video is in slow motion with the dancers facing the stage. They are in very large room with two large screens on both sides of the stage." + }, + { + "key": "4n_mRf7j920:ec740da594ca234816e3df8b70c1eea8a2850d69", + "video_id": "4n_mRf7j920", + "question": "What happens after the woman in the gold shirt wins the competition?", + "answer_choice_0": "She hugs the judges and leaves the stage.", + "answer_choice_1": "She raises her hands and leaves the stage.", + "answer_choice_2": "She grabs her face and leaves the stage.", + "answer_choice_3": "She jumps in excitment and stays on the stage.", + "answer_choice_4": "She grabs the trophy and stays on the stage.", + "answer_id": 2, + "answer": "She grabs her face and leaves the stage.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scroll to the specified section of the video starting at 06:22, and I observe when the woman in the gold shirt wins her competition. At 06:23, she puts her face in her hands and proceeds to walk off of the stage." + }, + { + "key": "5-otljNyRmQ:0505db5016e87fbfd33545456fd0f02c3c133313", + "video_id": "5-otljNyRmQ", + "question": "How many darts are thrown in the first scene?", + "answer_choice_0": "6.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "8.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the first scene. It begins at 00:03 after the title of the video is shown. At this time, a dart is immediately thrown. Another dart is thrown at 00:06. A third dart is thrown at 00:11 offscreen. We know this because he only has one dart left in his hand and we can hear it. At 00:20, a fourth dart is thrown. The scene ends at 01:06, with no other darts thrown in that time. So, the answer is 4." + }, + { + "key": "5-otljNyRmQ:1705fc2f16ed241fee2f2e3b27b5f29f22657940", + "video_id": "5-otljNyRmQ", + "question": "Which person is accused of being a kidnapper by the man in the light gray jacket?", + "answer_choice_0": "The man with the backwards baseball cap.", + "answer_choice_1": "The man wearing glasses.", + "answer_choice_2": "The man wearing a blonde wig.", + "answer_choice_3": "The man in the orange puff jacket.", + "answer_choice_4": "The man in the plaid shirt.", + "answer_id": 3, + "answer": "The man in the orange puff jacket.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched and listened to the scene where the man in the light gray jacket accuses one of the friends of kidnapping him, and points at that person, from 02:57-02:59. I then watched the next shot, in which it is made clear by his reaction from 03:00-03:02 that the man in the orange puff jacket was the one being pointed at." + }, + { + "key": "5-otljNyRmQ:88ab92be84a75558bbee2a951fb5b1887595ac9b", + "video_id": "5-otljNyRmQ", + "question": "In what direction is the driver looking when he says he just saw Dave walking into the woods?", + "answer_choice_0": "In front of him.", + "answer_choice_1": "To his right.", + "answer_choice_2": "To his left.", + "answer_choice_3": "Down.", + "answer_choice_4": "Behind him.", + "answer_id": 2, + "answer": "To his left.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for when the driver identified someone entering the woods. This occurs at 00:41. I then observed which direction he was looking and identified it as his left, out his driver's side window." + }, + { + "key": "5-otljNyRmQ:9fa06119d7bc632982bb66d0b032f4db6101527a", + "video_id": "5-otljNyRmQ", + "question": "What happens after the friends exit the vehicle in the rain?", + "answer_choice_0": "Someone slams a car door.", + "answer_choice_1": "Someone shoots a gun at the friends standing in front of the car.", + "answer_choice_2": "Someone appears holding a lantern.", + "answer_choice_3": "Someone cocks their rifle.", + "answer_choice_4": "Someone slips and falls on the wet terrain.", + "answer_id": 2, + "answer": "Someone appears holding a lantern.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and scrolled to the 01:52 time stamp. At this time, I see all four of the friends exit their vehicle as rain comes down outside. At 02:02, immediately after the previous scene concludes, a blonde man appears holding a lantern." + }, + { + "key": "5-otljNyRmQ:de7d386c576c68001311c8849d59c86c634061f0", + "video_id": "5-otljNyRmQ", + "question": "What is the man at 00:06 doing?", + "answer_choice_0": "Playing cards.", + "answer_choice_1": "Swilling beer.", + "answer_choice_2": "Tinkering in his garage.", + "answer_choice_3": "Playing ping pong.", + "answer_choice_4": "Playing darts.", + "answer_id": 4, + "answer": "Playing darts.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At the 00:06 mark, I can see the man in a garage looking setting as he throws a dart at a dart board. Clearly, he is playing darts." + }, + { + "key": "5BSjRjAcuL4:3ee9e1fdf9c4063aeeb672cbfe3a3a76587a49f1", + "video_id": "5BSjRjAcuL4", + "question": "Between 08:00-08:45, how many times does the comedian raise both of his hands simultaneously up into the air and completely above his head?", + "answer_choice_0": "2 times", + "answer_choice_1": "3 times", + "answer_choice_2": "5 times", + "answer_choice_3": "4 times", + "answer_choice_4": "1 time", + "answer_id": 0, + "answer": "2 times", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video specifically from 08:00-08:45 in order to see how many times the comedian raises one or both of his hands up into the air and above his head. At 08:10, he began dancing on the stage. At 08:23, I noticed him throw both of his hands up quickly above his head with his back turned to the audience. At 08:29, I noticed his right hand reach above his head while he danced in slow motion. This occurs again at 08:33, but I did not count either of these instances since they only invovle one hand, not both. At 08:40, I noticed both of his hands reach above his head, and this was the last instance before the time reached 08:45. Counting these up, I counted 2 instances, making that the correct answer." + }, + { + "key": "5BSjRjAcuL4:54226cab47790e8bfab0bddb9cc09aefd72a0d7c", + "video_id": "5BSjRjAcuL4", + "question": "What city is written on the signs at the back of the stage?", + "answer_choice_0": "Dublin.", + "answer_choice_1": "Galway.", + "answer_choice_2": "Waterford.", + "answer_choice_3": "Cork.", + "answer_choice_4": "Limerick.", + "answer_id": 1, + "answer": "Galway.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, looking for a moment when the signs at the back of the stage are visible and legible. This occurred first at 00:06, as the camera panned around the room creating an establishing shot for a stand-up comedy show. At the back of the stage, signs could be seen with red and cream-colored text, and at the bottom, they both read \"Galway\" in cursive text." + }, + { + "key": "5BSjRjAcuL4:77b94fe7b5b16d003a16c8bb85d8a36d3d23c118", + "video_id": "5BSjRjAcuL4", + "question": "What does the comedian do when he has his back to the audience?", + "answer_choice_0": "He talks in a low-pitched voice.", + "answer_choice_1": "He whistles to the tune of a song.", + "answer_choice_2": "He counts backwards from 10.", + "answer_choice_3": "He talks with a different accent.", + "answer_choice_4": "He talks in a high-pitched voice.", + "answer_id": 0, + "answer": "He talks in a low-pitched voice.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Watching the whole video, starting at 00:34, there are several instances where the comedian turns his back to the camera and audience and has a conversation with himself in a voice similar to that of a goblin. It's a deep gurgling voice." + }, + { + "key": "5BSjRjAcuL4:8d79dd62f384dbb503d8799480c0cb0269c2df96", + "video_id": "5BSjRjAcuL4", + "question": "What was the comedian pretending to be when he held his mic stand and gave instructions to the audience member?", + "answer_choice_0": "A doctor", + "answer_choice_1": "A shepherd", + "answer_choice_2": "A mailman", + "answer_choice_3": "A ghost", + "answer_choice_4": "A cowboy", + "answer_id": 1, + "answer": "A shepherd", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I saw an audience member walk toward the stage at 00:11. I then saw the comedian respond to this by telling the audience member to \"come through,\" \"come by,\" then \"come back.\" He did this while waving his microphone stand like a staff. I concluded that he was pretending the audience member was a sheep and that he was a shepherd." + }, + { + "key": "5BSjRjAcuL4:afde052c49b07bc42c01a84b5f9e702d3545ecff", + "video_id": "5BSjRjAcuL4", + "question": "What device does the stand-up comedian use to play his music?", + "answer_choice_0": "A TV screen.", + "answer_choice_1": "A laptop.", + "answer_choice_2": "A tablet.", + "answer_choice_3": "A cell phone.", + "answer_choice_4": "A stereo.", + "answer_id": 2, + "answer": "A tablet.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to locate the moment when the stand-up comedian played music. From 01:52-01:53, the stand-up comedian walked over to a pedestal on the left side of the stage and on top of it was a tablet which was propped up on a stand. At 01:55, he hit a button on the tablet and the music began to play." + }, + { + "key": "5BSjRjAcuL4:dab9519dfda25134340417da489ab17ab648182b", + "video_id": "5BSjRjAcuL4", + "question": "What color T-shirt is the comedian wearing when he sings about chopsticks?", + "answer_choice_0": "Peach.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Green", + "answer_choice_3": "Lavender.", + "answer_choice_4": "Yellow.", + "answer_id": 0, + "answer": "Peach.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The comedian sings at three different times in the film. I listened to when he started to sing specifically about chopsticks, which was at 02:31. He is wearing a peach colored T-shirt." + }, + { + "key": "5BSjRjAcuL4:e4a24ceda10b15d78f0a0d6e2e05dab4714d7bc7", + "video_id": "5BSjRjAcuL4", + "question": "How many times does the camera cut to the audience reaction?", + "answer_choice_0": "15.", + "answer_choice_1": "27.", + "answer_choice_2": "20.", + "answer_choice_3": "23.", + "answer_choice_4": "10.", + "answer_id": 3, + "answer": "23.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I had to identify what is considered a cut reaction of the audience. Some shots included the comedian in it as well, but it is not considered a reaction shot. Then I went through the entire video and counted how many times I saw a reaction shot. These were the times: 00:06, 00:34, 00:42, 01:00, 02:18, 02:38, 02:49, 03:53, 04:07, 04:34, 04:41, 05:13, 05:19, 05:52, 05:56, 07:14, 07:22, 08:21, 08:32, 09:04, 09:17, 09:22, 09:25." + }, + { + "key": "5Jrv1h4AztM:237748a1ff0d0517a3480a7121a926ae55f3403b", + "video_id": "5Jrv1h4AztM", + "question": "During the 6th shot of the boat at sea, how many people would be at the stern of the boat if there were an additional person helping the person in a collared striped shirt?", + "answer_choice_0": "4.", + "answer_choice_1": "6.", + "answer_choice_2": "2.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I found that the boat at sea first appears at 02:53. I began counting each shot. The next shot happens at 02:57, then 03:00, 03:14, 03:18, and finally, the sixth shot happens at 03:22. I watched this shot carefully and observed the orientation of the boat and the number of people around the boat. I saw that there were two people at the stern of the boat. I found the man in the striped shirt standing at the side of the boat with two others helping him at 03:26. If an additional person helped the person in the striped shirt, there would still be two people at the stern of the boat." + }, + { + "key": "5Jrv1h4AztM:4d1bfb4b555a66ae30cf6353cf55b31f57769c79", + "video_id": "5Jrv1h4AztM", + "question": "What is the difference between the time it took for the first animal shown in the video to appear again and the duration of the end credits?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "6.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I identified the first animal at 00:11, a bird with a large black and yellow beak. The shot ends at 00:18. I continued watching the video until the bird appeared again. The bird appeared again at 01:06. To find out how long it took for the bird to appear again, I subtracted the duration where it was last seen, 18 seconds, from the duration when the bird reappeared, 01:06. This results in 00:48 seconds. I then found the beginning of the end credits at 16:47. I watched until the credits ended at 17:09. To find the duration of the end credits, I subtracted the duration 16:47 from 17:09. This results in 22 seconds. The difference between 18 seconds and 22 seconds is 4 seconds." + }, + { + "key": "5Jrv1h4AztM:7899e04aa36ee9bc5739b03b2074d668b7fc71a6", + "video_id": "5Jrv1h4AztM", + "question": "There is a man left holding the crab after a rope has been tied around it; how many shots of fish being cut are seen before he is seen again?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "0.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "1.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for a crab being tied up with rope, which begins at 10:54. Another man, wearing a green striped shirt, begins helping him at 11:00, and the crab is passed to this man at 11:05. I continued watching, and the next shot, beginning at 11:10, shows hands cutting fish. The shot after that begins at 11:14, and shows a hand holding chunks of fish. The next shot begins at 11:15, and the man wearing the green striped shirt is seen again. There has been 1 shot of fish being cut since the rope-tying shot." + }, + { + "key": "5Jrv1h4AztM:80667c00ca4be2fab917bc1700e24bdf5ff3d806", + "video_id": "5Jrv1h4AztM", + "question": "After the third insect is shown, how many shots happened until two birds appeared on sticks?", + "answer_choice_0": "3.", + "answer_choice_1": "6.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "7.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I began counting the appearance of insects at 00:43, when I first spotted an insect. I counted the second insect at 00:44. I counted the third insect at 00:46. I then began to count the number of shots that followed. The next shot begins at 00:47, then 00:49, 00:50, and finally, 00:52. I stopped counting at 00:52 because I noticed the two birds at 00:54. This totals 4 shots before the shot of the birds appeared." + }, + { + "key": "5Jrv1h4AztM:bfef0d4a72b8b005ba59b24e0c240fbe04db2f84", + "video_id": "5Jrv1h4AztM", + "question": "From 04:00-05:50 which of the following do we not see fish being placed into?", + "answer_choice_0": "A yellow ice chest.", + "answer_choice_1": "A green laundry basket.", + "answer_choice_2": "A red laundry basket.", + "answer_choice_3": "A halved blue barrel with handles.", + "answer_choice_4": "A white and yellow ice chest.", + "answer_id": 1, + "answer": "A green laundry basket.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 04:00-06:00, looking for all of the times that fish were being placed inside of something. I saw them placed into a halved blue barrel with handles (04:07), a red laundry basket (04:26, 04:49), a yellow ice chest (05:05), and a yellow and white ice chest (05:46). Although green laundry baskets with fish already in them are seen at 04:46 and 05:46, no one is seen putting fish into them." + }, + { + "key": "5Jrv1h4AztM:e044aef5d4e292665862d1584bc24d3714355d3e", + "video_id": "5Jrv1h4AztM", + "question": "From 01:30-02:00, what is the approximate percentage of shots featuring birds?", + "answer_choice_0": "15%.", + "answer_choice_1": "23%.", + "answer_choice_2": "1%.", + "answer_choice_3": "38%.", + "answer_choice_4": "79%.", + "answer_id": 3, + "answer": "38%.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 01:30-02:00. I counted how many shots featured birds (6) and how many did not (10), and thus counted a total of 16 shots in the span. I divided 6 by 16, with an answer of .375, which, rounded up, gives an approximate answer of 38%." + }, + { + "key": "5Jrv1h4AztM:f35e4258504cff237121707897cebcfa65ba09b1", + "video_id": "5Jrv1h4AztM", + "question": "How many fish would need to be added to the bucket on top of the container reading \"SSL\" at the time of the ice packing process to equal the numerical value of the weight of the gift of fishes that the narrator received?", + "answer_choice_0": "3", + "answer_choice_1": "4", + "answer_choice_2": "5", + "answer_choice_3": "1", + "answer_choice_4": "2", + "answer_id": 3, + "answer": "1", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I found that the ice packing process began at 04:55, when the man in the blue shirt used a tool to fill a bucket with ice, according to the audio at the same timestamp. The bucket on top of the container reading \"SSL\" is visible in the background. There is a single fish in the bucket. I continued watching and listening to the video to find out the weight of the gift the narrator received. I found that from 05:54 to 05:59, the narrator said that \"they gifted us a few fishes which was around 2 kilograms.\" To reach the numerical value of the weight, 2 kilograms, and not the weight itself, 1 fish would need to be added to the bucket, since there is 1 fish in the bucket. Therefore, 2 fishes would equal the numerical value of the weight, 2." + }, + { + "key": "5Jrv1h4AztM:fb93f563eab2043ddae031db9df370fca5a6cdda", + "video_id": "5Jrv1h4AztM", + "question": "Of the individual children playing in the water and sand at the beach between 12:42-13:14, how many more are wearing shorts than dresses?", + "answer_choice_0": "5", + "answer_choice_1": "3", + "answer_choice_2": "9", + "answer_choice_3": "2", + "answer_choice_4": "4", + "answer_id": 0, + "answer": "5", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for a beach scene with children, which runs from 12:42-13:14. During that time I counted 9 total children. The first appears alone at 12:42 and is seen wearing shorts at 12:45. 2 more children appear at 12:52 and at that timestamp, 1 is wearing shorts. At 12:53, the other child is seen wearing a dress. 2 more children are seen wearing shorts at 12:54. Another child is seen near them at 12:56 wearing shorts, but this child is the same child that appeared at 12:52, so I did not count him. These same three chlidren appear in a few more shots. Then, at 13:02, 2 older boys wearing shorts can be seen running through the water. At 13:05, an additional child wearing shorts is visible next to two children who have already been seen wearing shorts. At 13:06, the same two children visible at 13:02 appear again, so I did not count them a second time. At 13:10, a child wearing a dress is seen so I counted her as the second child wearing a dress. She is seen once more at 13:13 just before the sequence ends. I then counted up all the children wearing shorts, 1+1+2+2+1=7 and all the children wearing dresses, 1+1=2. I subtracted 2 from 7, and got an answer of 5." + }, + { + "key": "6anotlZtbCg:42701afd93758839325a6b452c15e646d700e751", + "video_id": "6anotlZtbCg", + "question": "What weapon does the co-producer/stunt coordinator pick up and demonstrate at 05:44?", + "answer_choice_0": "A gun.", + "answer_choice_1": "A crossbow.", + "answer_choice_2": "A knife.", + "answer_choice_3": "A sword.", + "answer_choice_4": "A hammer.", + "answer_id": 1, + "answer": "A crossbow.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to the 05:44 time stamp in order to see what weapon the co-producer/stunt coordinator uses. At this time stamp, the co-producer/stunt coordinator is identified by text at the bottom of the frame. He picks up a crossbow, and then walks through an explanation of how to use it from 05:45-06:04." + }, + { + "key": "6anotlZtbCg:563301ee7cd52d2507f812e876567be9d455a6f4", + "video_id": "6anotlZtbCg", + "question": "How long does the first talking head last?", + "answer_choice_0": "24 seconds.", + "answer_choice_1": "28 seconds.", + "answer_choice_2": "32 seconds.", + "answer_choice_3": "41 seconds.", + "answer_choice_4": "36 seconds.", + "answer_id": 0, + "answer": "24 seconds.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the first talking head, which started at 00:29, indicated by a medium shot of the director, with him facing and addressing the camera. I continued watching until this shot ended at 00:53, indicating the end of this first talking head. I subtracted 29 from 53 and found a duration of 24 seconds." + }, + { + "key": "6anotlZtbCg:5d826fcc028adf70b3bc4e491c32ff9a8c51a218", + "video_id": "6anotlZtbCg", + "question": "For the shot that begins at 00:53, how many actors are seated at the table?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to the 00:53 time stamp in order to see how many actors are present in the scene and seated at the table. As the camera tilts down, two actors can be seen seated at the table and talking to each other." + }, + { + "key": "6anotlZtbCg:617d9e51e8a50439ca91bfd18d8f9ab1aff4b063", + "video_id": "6anotlZtbCg", + "question": "How does the director of \"Blade of the Assassin\" position his arms during his first appearance?", + "answer_choice_0": "Both arms are crossed over his chest.", + "answer_choice_1": "One arm is down and the other is bent so his hand is on top of his head.", + "answer_choice_2": "Both arms are bent so his hands are on his hips.", + "answer_choice_3": "Both arms are straight by his side.", + "answer_choice_4": "One arm is down and the other is bent so his hand is under his chin.", + "answer_id": 0, + "answer": "Both arms are crossed over his chest.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched from the beginning and noticed that from 00:25-00:27, a male voice spoke in a voiceover about \"Blade of the Assassin\" and called it an \"all-out action\". I suspected this was the director and confirmed it once the scene was cut at 00:30 when the man who was speaking in the voiceover appeared. At this time, I also noticed a line of text in the bottom right third of the frame that read: \"Writer/Director\". I observed the man's posture and noted that his arms were crossed over his chest. I continued watching the director's first appearance and confirmed that he didn't change position." + }, + { + "key": "6anotlZtbCg:e42ac21ac65a3f277168fd9b4a656df2d03fa2f1", + "video_id": "6anotlZtbCg", + "question": "At what point in the video does the man in a blue sweater talk about how much of the movie is action?", + "answer_choice_0": "02:19-02:25.", + "answer_choice_1": "07:01-07:15.", + "answer_choice_2": "08:42-08:55.", + "answer_choice_3": "06:20-06:42.", + "answer_choice_4": "03:04-03:06.", + "answer_id": 4, + "answer": "03:04-03:06.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and first noticed the man in the blue sweater being interviewed at 00:29, and he is identified by text onscreen as the director of the film. I watched until 03:04 when I heard the man say in a voiceover that \"This film has 80 percent action.\" So, this happened at 03:04-03:06." + }, + { + "key": "6anotlZtbCg:f735de8ba9f4ab86c580e4fbe27145318e31519b", + "video_id": "6anotlZtbCg", + "question": "What happens just before the film described is a \"revenge movie\"?", + "answer_choice_0": "The director reviews footage.", + "answer_choice_1": "A clapboard claps.", + "answer_choice_2": "Women roll under a garage door.", + "answer_choice_3": "Smoke is blown.", + "answer_choice_4": "A fight scene with a bat.", + "answer_id": 3, + "answer": "Smoke is blown.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the words \"revenge movie\" and heard them from 01:51-01:52. I went backwards five seconds to see what happened just before. At 01:46, I noticed a large glow of light shined onto actors. Then at 01:48 I saw two thick plumes of smoke shot toward the actors from behind. The plumes of smoke continued through 01:51, so I concluded that that was the action that immediately preceded the words \"revenge movie.\"" + }, + { + "key": "6jvaV9NJrTo:071e4a1efc7361673317e1229626ee6d1f855764", + "video_id": "6jvaV9NJrTo", + "question": "What is the order in which the woman in the blue shirt prepares to go to the market?", + "answer_choice_0": "Feed the chickens, collect the eggs, and pack chickens into the cage.", + "answer_choice_1": "Feed the chickens, pack chickens into the cage, and collect eggs.", + "answer_choice_2": "Pack chickens into the cage, collect eggs, and feed the chickens.", + "answer_choice_3": "Collect the eggs, feed the chickens, and pack chickens into the cage.", + "answer_choice_4": "Collect eggs, pack chickens into the cage, and feed the chickens.", + "answer_id": 1, + "answer": "Feed the chickens, pack chickens into the cage, and collect eggs.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the woman in the blue shirt feed the chickens at 00:50. Then, the woman packed the chickens into the cage starting at 02:13. After that, the woman collected eggs at 04:01. Then, the woman drove off, heading to the market at 07:40. Therefore, the order of events that the woman in the blue shirt did to prepare for the market was to feed the chickens, pack the chickens into the cage, and collect the eggs." + }, + { + "key": "6jvaV9NJrTo:3cdd245c3885c951e3bb06f373da28f377a0b661", + "video_id": "6jvaV9NJrTo", + "question": "As the woman in blue is eating and waiting for customers at the market, how many motorcycles with people on them would be visible if there were 5 additional motorcycles with people on them?", + "answer_choice_0": "11", + "answer_choice_1": "5", + "answer_choice_2": "8", + "answer_choice_3": "12", + "answer_choice_4": "7", + "answer_id": 2, + "answer": "8", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for when the woman in blue is eating and waiting for customers at the market. This part of the video begins at 12:22. Behind her, there are 2 motorcycles visible with people on them in the scene that ends at 12:31. Another shot showing her eating begins at 12:35. At 12:39, while she eats, another motorcycle with a person on it becomes visible behind her driving down the road. This shot ends at 12:42. After this, she is not shown to be eating. So, the total is 3. If there were 5 additional, there would be 8." + }, + { + "key": "6jvaV9NJrTo:9f4cb5cc81f4bbbf48fc04293f58e6d23a23fd6d", + "video_id": "6jvaV9NJrTo", + "question": "When a \"Photocopy\" sign is on screen for the third time, how many chickens are visible?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until a \"Photocopy\" sign was visible on screen in the background for the first time at 10:54. I then located the second time the \"Photocopy\" sign was visible at 12:22. After that, I located the third time the \"Photocopy\" sign was visible at 12:47. I then looked to see how many chickens were on screen at 12:47, and I found a total of 1 chicken in a cage on the ground. Therefore, 1 chicken is visible when a \"Photocopy\" sign is on screen for the third time." + }, + { + "key": "6jvaV9NJrTo:a2db608b432a77cb67d1fe5342110d8debb35d2d", + "video_id": "6jvaV9NJrTo", + "question": "Which of these fruits and vegetables does not appear in the video?", + "answer_choice_0": "Tomatoes.", + "answer_choice_1": "Cauliflower.", + "answer_choice_2": "Oranges.", + "answer_choice_3": "Lettuce.", + "answer_choice_4": "Pineapple.", + "answer_id": 1, + "answer": "Cauliflower.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I watched until I noticed an array of fruits and vegetables that appeared on the screen. Starting at 08:16, there was a display with various greens, herbs, and cucumbers. At 08:29, I identified tomatoes and heads of lettuce sitting in bowls on the concrete. There was also squash, herbs, cucumbers, and more leafy greens visible in the shot. At 09:40, I identified oranges and other fruit sitting in a square bin. At 09:45, I identified pineapples piled on a tarp on the ground. I continued watching to see if cauliflower ever appeared in the video, and it did not. Therefore, the fruit or vegetable that did not appear in the video is cauliflower." + }, + { + "key": "6jvaV9NJrTo:c0b9eb66cfffe46d7c2efd494da2243f82a49669", + "video_id": "6jvaV9NJrTo", + "question": "If the number of chickens weighed on a scale is multiplied by the number of people who hand the woman in blue money, what would the answer be?", + "answer_choice_0": "4.", + "answer_choice_1": "12.", + "answer_choice_2": "2.", + "answer_choice_3": "16.", + "answer_choice_4": "8.", + "answer_id": 0, + "answer": "4.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until I noticed a chicken getting weighed on a scale, which occurred when the woman in blue placed the 1st chicken on a green scale at 08:57. I then observed as she placed a 2nd chicken on a scale at 09:06. These were the only 2 chickens placed on a scale. Then I located the number of times people handed money to the woman in blue. The 1st time was when a woman in all black handed money to the woman in blue at 10:45. The 2nd time was when a man in an orange hat handed money to the woman in blue at 11:37. These were the only 2 times money was handed to the woman in blue. I then multiplied the number of chickens weighed on a scale, 2, by the total number of people who handed money to the woman in blue, 2, and I found that 2x2 equals 4." + }, + { + "key": "6jvaV9NJrTo:dba812332372d66429edc124d5eba64d86519bd4", + "video_id": "6jvaV9NJrTo", + "question": "How many chickens would have jumped up and landed on the egg laying trough between 04:00-05:00 if one additional chicken jumped and landed on it?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video between 04:00-05:00 and looked for moments when chickens jumped up and landed on the egg laying trough. Immediately, I identified the trough as a long line of baskets all elevated by pieces of wood, and the woman in blue is grabbing eggs from them. I noticed, at 04:11, a chicken jumps up from the ground and lands on the long trough as the woman in blue collects eggs from more of the baskets. I continued watching, and noticed another chicken jumping up and landing at 04:26. I watched until 05:00 and did not notice any other chickens jumping up and landing on the trough. So, since there were 2, I added 1 to that, for a total of 3." + }, + { + "key": "6jvaV9NJrTo:f39a121018c36fa5b09423b56fd06d4ec1c6c980", + "video_id": "6jvaV9NJrTo", + "question": "What is the total number of chickens that get their legs tied together in the video?", + "answer_choice_0": "5.", + "answer_choice_1": "8.", + "answer_choice_2": "10.", + "answer_choice_3": "6.", + "answer_choice_4": "0.", + "answer_id": 0, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until I located the 1st time the woman in blue tied a chicken's legs together, which happened at 08:35. I then watched as a woman in a green helmet tied the 2nd chicken's legs together at 08:40. Then I watched the woman in blue tie a 3rd chicken's legs together at 11:05. Finally, the woman in blue tied 2 different chicken's legs together at 11:33. I continued watching and found that no other chickens got their legs tied together in the video. I then counted the total number of chickens that got their legs tied together and got a total of 5." + }, + { + "key": "7Mn9jqmcD6w:01557a60b31202f5a157963d8a0063c21e3ad687", + "video_id": "7Mn9jqmcD6w", + "question": "What is the closest thing to the camera at 01:01?", + "answer_choice_0": "Flickering candles.", + "answer_choice_1": "A blinking eye.", + "answer_choice_2": "An unmade bed.", + "answer_choice_3": "A tinted window.", + "answer_choice_4": "A magic box.", + "answer_id": 0, + "answer": "Flickering candles.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I go to 01:01 and examine the location. In the midground, a man and the black-haired woman fight with swords. But in the foreground, the place closest to the camera, there are flickering candles on a wooden bench. Therefore, flickering candles are the closest thing to the camera." + }, + { + "key": "7Mn9jqmcD6w:574d5ee83a57f6af57b883b7929ede19450bb6e6", + "video_id": "7Mn9jqmcD6w", + "question": "What genre is \"The Outpost\"?", + "answer_choice_0": "Fantasy.", + "answer_choice_1": "Mystery.", + "answer_choice_2": "Comedy.", + "answer_choice_3": "Drama.", + "answer_choice_4": "Horror.", + "answer_id": 0, + "answer": "Fantasy.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 0:10, I heard the narrator describe \"The Outpost\" as a fantasy series, then again at 1:45, which aligned with my own observations of the medieval fantasy-looking footage from the show at 0:10-1:45." + }, + { + "key": "7Mn9jqmcD6w:911b51edbb3ebeae0fb4038f971e28979a20d7f4", + "video_id": "7Mn9jqmcD6w", + "question": "When a woman says that she's seen a certain box before, in what direction does the woman look as she utters these words?", + "answer_choice_0": "Down and to her left", + "answer_choice_1": "Straight forward", + "answer_choice_2": "She closes her eyes", + "answer_choice_3": "Up and to the ceiling", + "answer_choice_4": "Up and to her right", + "answer_id": 4, + "answer": "Up and to her right", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, listening for a moment when a woman says that she has seen a certain box before. This occurs at 02:15, right after another character talks about a box as it is shown by yet another character from 02:09-02:14. I observed the woman's eye movement as she spoke right afterward at 02:15. I noticed that her eyes darted up and to her right." + }, + { + "key": "7S9q1kAVmc0:42f136e6b804abf0bd09369cc02a05e51dd010f2", + "video_id": "7S9q1kAVmc0", + "question": "When receipts are shown in the video, what does the top line say on each of them?", + "answer_choice_0": "The word \"restaurant.\"", + "answer_choice_1": "A logo.", + "answer_choice_2": "A food item.", + "answer_choice_3": "The time.", + "answer_choice_4": "The table number.", + "answer_id": 0, + "answer": "The word \"restaurant.\"", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to find when receipts become visible in the video. They are shown from close up at 12:00 in the video, with several receipts visible, all lined up in a row. Looking closely at them, the top of each receipt shows the word \"restaurant\", with the time shown directly below it, the table numbers below that, and then the food items below that. So, the answer is the word \"restaurant.\"" + }, + { + "key": "7S9q1kAVmc0:433b3e491d7ffeb96ba57503389d44971cd92f3a", + "video_id": "7S9q1kAVmc0", + "question": "What food does the chef touch after putting the greens back into the drawer the second time?", + "answer_choice_0": "Burgers.", + "answer_choice_1": "Steak.", + "answer_choice_2": "Bok Choy.", + "answer_choice_3": "Leeks.", + "answer_choice_4": "Halibut.", + "answer_id": 0, + "answer": "Burgers.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the section of the video where the chef placed the greens back into the drawer. It happened the first time at 15:53. The second time it happened was at 15:55. The next food the chef touched was burgers after taking them out of the warmer. The chef pressed the top of the buns with their finger at 16:06." + }, + { + "key": "7S9q1kAVmc0:51497b687fe7d24944d9787f540d03cb1d096593", + "video_id": "7S9q1kAVmc0", + "question": "If the total number of whole buns shown were tripled, how many whole buns would have been shown?", + "answer_choice_0": "12", + "answer_choice_1": "6", + "answer_choice_2": "24", + "answer_choice_3": "18", + "answer_choice_4": "16", + "answer_id": 0, + "answer": "12", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the number of times buns were shown in the video. Buns were first shown at 00:11. The total number of buns shown at 00:11 were 2 as 2 halves equal one whole bun. The second time buns were shown was at 16:07, when the chef removed 2 burgers from the warmer. The 2 burgers used 2 whole buns. Next, I added the 2 buns shown in each timestamp. The total number of buns shown so far were 4. No other buns were shown in the video. After that, I multiplied 4 by 3 (triple) to equal 12. That is, 4x3=12. Hence, the total number of buns shown if the chef had tripled the buns would have been 12." + }, + { + "key": "7S9q1kAVmc0:70414f2a6e9cda77b0ae791ea641e19f5fa4d190", + "video_id": "7S9q1kAVmc0", + "question": "How many ingredients would be on the first burger plate if the man applied the last ingredient he used before he said \"burger coming down?\"", + "answer_choice_0": "2", + "answer_choice_1": "5", + "answer_choice_2": "4", + "answer_choice_3": "3", + "answer_choice_4": "1", + "answer_id": 2, + "answer": "4", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to find the first burger plate and count how many ingredients it has on it. I found the first burger plate at 00:51, as the man grabs the plate and pulls it down from where it is resting. The number of ingredients on the plate is 3: a patty, a slice of cheese, and a piece of bacon underneath the cheese. Then, I searched for the time before this when the man said \"burger coming down\" and I found this moment at 00:47. Then, I looked for what ingredient he used just before this. At 00:46, he sprinkles some sort of seasoning into a saucepan of vegetables. So, if this seasoning were added to the burger plate, there would be 4 ingredients in total." + }, + { + "key": "7S9q1kAVmc0:723010109a3fedef9aa0f7d62fb6eeb86bef1dcb", + "video_id": "7S9q1kAVmc0", + "question": "How many times is the orange sauce ladled into a dish during the first 10 minutes?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "0.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 1, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I searched the video to locate the orange sauce used with a ladle. I found it in one of the silver containers on the third row on the right. Next, I had to determine how many times this sauce was used. The first time, the orange sauce was used twice during the 00:59 timestamp. At 3:22, the orange sauce was used only once. I kept watching and could determine that the orange sauce was not used again during the remaining minutes. Adding 2+1, I concluded that the sauce was used a total of 3 times in the first 10 minutes." + }, + { + "key": "7S9q1kAVmc0:95aa2aa0064fa9e4ebe8815ea4039cf910cb7c6d", + "video_id": "7S9q1kAVmc0", + "question": "What is the product of the the number of different sliced bok choy stalks seared with a blowtorch between 04:00 and 09:30 times the number of receipts shown tucked in on the side of the kitchen closest to the fryer between 20:00-21:00?", + "answer_choice_0": "36", + "answer_choice_1": "24", + "answer_choice_2": "12", + "answer_choice_3": "21", + "answer_choice_4": "6", + "answer_id": 4, + "answer": "6", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First I went to 04:00 and watched for the stalks of bok choy. From 04:04-04:08, I saw the chef grab 3 stalks of bok choy from a drawer and add them to the cooktop. From 06:32-06:52, I observed the chef use a blowtorch on these 3 stalks of bok choy. Then from 07:04-07:14 I saw the chef grab 3 more stalks of bok choy from a drawer and add them to the cooktop as well. From 07:36-07:41, I saw the chef use the blowtorch again, but it was on the same original 3 stalks of bok choy. I watched through 08:00 but these additional stalks were not seared with a blowtorch. Therefore, only 3 stalks were seared with a blowtorch during this time. Then I moved to 20:00 and looked for receipts on the same side as the fryers. At 20:03 I noted that there were two fry baskets to the left of the cooktop. At 20:16, I observed the chef turn 180 degrees from the cooktop and the fry baskets, to an island in the middle of the kitchen. From 20:54-20:55 I saw the chef turn toward this island again. This time, I saw 4 receipts tucked into place on the side that was closest to the fryers. There were also additional receipts on the other side of the island and a couple receipts that were not tucked in. Therefore, I multiplied 3*4=12." + }, + { + "key": "7S9q1kAVmc0:cca2bc3b43a57b2c8b8ccbedf787a0cfe27272ec", + "video_id": "7S9q1kAVmc0", + "question": "What action does the chef perform with his right hand immediately after opening the drawer containing greens for the 2nd time?", + "answer_choice_0": "Puts greens on a plate", + "answer_choice_1": "Puts greens in an iron pan", + "answer_choice_2": "Uses a blow torch", + "answer_choice_3": "Shakes a pan of vegetables", + "answer_choice_4": "Puts greens on a silver stove", + "answer_id": 4, + "answer": "Puts greens on a silver stove", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video and looked for the chef to open the drawer containing greens. I found this moment occurs for the first time at 02:03 when the chef opens a drawer below him and to his right to grab some lettuce. I continued watching and found that the chef opens the drawer for the second time at 04:03. Immediately afterwards at 04:05, he takes greens from the drawer and places them on the silver stove." + }, + { + "key": "7S9q1kAVmc0:e05fbe8171d24494f8eec91fb05e595585ccc933", + "video_id": "7S9q1kAVmc0", + "question": "If the line cook had used the blowtorch an additional time from 06:00-07:00, how many times would he have used it?", + "answer_choice_0": "3 times.", + "answer_choice_1": "2 times.", + "answer_choice_2": "6 times.", + "answer_choice_3": "4 times.", + "answer_choice_4": "5 times.", + "answer_id": 2, + "answer": "6 times.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video from 06:00-07:00 to see how many times the line cook used the blowtorch. I first saw him pick up the blowtorch and use it at 06:32 on a few pieces of bok choy. That went until 06:35, when the blowtorch was turned off. Additionally, he used the blowtorch on the bok choy during the following times: 06:37-06:43, 06:43-06:49, 06:49-06:52, and 06:56-06:58 for a total of 5 times. If he were to use the blowtorch an additional time, it would have been 6 times." + }, + { + "key": "7VBalG0IhhI:00a3ff5e22091de36c826b6e36d1911f83befdd3", + "video_id": "7VBalG0IhhI", + "question": "How many times can the sign that says \"Closed\" be seen before a student falls to the ground?", + "answer_choice_0": "2 times.", + "answer_choice_1": "6 times.", + "answer_choice_2": "1 time.", + "answer_choice_3": "3 times.", + "answer_choice_4": "0 times.", + "answer_id": 3, + "answer": "3 times.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched until I located the sign that said \"Closed\" at 01:49, which was positioned in the background behind a snowboarding student in a light gray jacket. Up until this point, no student had fallen to the ground. I then observed the \"Closed\" sign a 2nd time at 01:56 and a 3rd time at 02:02. After that, at 02:03, a student wearing a camouflage jacket fell to the ground. Therefore, the sign that said \"Closed\" could be seen 3 times before a student fell to the ground." + }, + { + "key": "7VBalG0IhhI:3c499f7120e25eb95261c02c4499b063f22d3ab1", + "video_id": "7VBalG0IhhI", + "question": "After the third time the snowboarding instructor touches the students' hands, how many people in the frame can be seen wearing ski goggles?", + "answer_choice_0": "4 people.", + "answer_choice_1": "2 people.", + "answer_choice_2": "3 people.", + "answer_choice_3": "1 person.", + "answer_choice_4": "5 people.", + "answer_id": 3, + "answer": "1 person.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I identified the snowboarding instructor. At 00:12, a man wearing a gray and black jacket said \"This video is about teaching two strangers how to snowboard.\" Then, at 00:15, I noticed the same man in the gray and black jacket giving guidance to two students. After that, I concluded that he was the instructor. Then I watched to see how many times the instructor touched the hands of the students. I observed the instructor touch the student in a light gray jacket's hands for the 1st time at 04:12 and a 2nd time at 04:19. Then I saw the instructor touch the student in a camouflage jacket's hands at 04:41. So that was the 3rd time. After the 3rd time, I then looked to see how many people were wearing ski goggles. I found 1 person wearing ski goggles, which was the instructor himself." + }, + { + "key": "7VBalG0IhhI:467fa4b87fd4b9330ef8e6e68788c412f5cb1b35", + "video_id": "7VBalG0IhhI", + "question": "Immediately after the instructor tells the learner to go back around to the heels, how does the learner rotate the board to reset his stance?", + "answer_choice_0": "Counterclockwise 180 degrees.", + "answer_choice_1": "Clockwise 270 degrees.", + "answer_choice_2": "Counterclockwise 90 degrees.", + "answer_choice_3": "Clockwise 180 degrees.", + "answer_choice_4": "Clockwise 90 degrees.", + "answer_id": 3, + "answer": "Clockwise 180 degrees.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "From 10:48-10:50, I listened to the ski instructor tell the learner in the light gray jacket to go back around to the heels. I then observed the position in which the learner in the light gray jacket was standing - he was facing backward, toward the instructor, in a wide stance, with the board facing perpendicular to the direction of the slope. From 10:51-10:55, I watched him adjust his stance in line with the instructor's direction - he rotated the board in a clockwise direction to face forward down the slope, with the board still perpendicular to the slope's direction, meaning he rotated 180 degrees clockwise." + }, + { + "key": "7VBalG0IhhI:486e27a8a11ad439b75d805bbd6b121ecdab8311", + "video_id": "7VBalG0IhhI", + "question": "During the span of 08:00-10:00, how many times does a snowboarder stumble and fall into the snow?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "1.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the specified span in the question, paying attention and counting the number of times I saw a snowboarder stumble and fall into the snow. During this span, I only watched this happen once, from 09:13-09:16, when one of the learners became top-heavy on his balance and let himself fall gently into the snow, on his knees. I watched the span and saw no other falls, making the total number of falls in this span 1." + }, + { + "key": "7VBalG0IhhI:663b8f867fa5c40cdab758588a631400f523d4b4", + "video_id": "7VBalG0IhhI", + "question": "After the \"heel sliding\" technique is described, where can the word \"Burton\" first be found on the screen?", + "answer_choice_0": "On a sign on a tree.", + "answer_choice_1": "On a building.", + "answer_choice_2": "On the jacket of a student.", + "answer_choice_3": "On a car.", + "answer_choice_4": "On the bottom of a snowboard.", + "answer_id": 4, + "answer": "On the bottom of a snowboard.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I watched until I found the \"heel sliding\" technique being described. This happened at 04:35-04:37 when the snowboarding instructor said \"This is called heel sliding\" to one of the students. After that, I then looked to see where the word \"Burton\" could be found on the screen. I found the word \"Burton\" on the bottom of a snowboard at 04:38, positioned in the background." + }, + { + "key": "7VBalG0IhhI:87e50e54d2d771bb831a564eed9df1230fc1eac9", + "video_id": "7VBalG0IhhI", + "question": "How many of the main snowboarders have a dominant right foot?", + "answer_choice_0": "0.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "2.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "From 00:16 to 00:21 the instructor asks the two students which is their dominant foot and one says left while the other says right. The instructor then tells them to strap in their dominant foot first. At 00:34, we see the instructor has strapped in his right foot. Hence we can infer that his right foot is dominant. This means that 2 of the snowboarders have dominant right feet." + }, + { + "key": "7VBalG0IhhI:dfefb11b8c42a69f55666a6a64ba511da89cc0da", + "video_id": "7VBalG0IhhI", + "question": "If there were 12 fewer words displayed onscreen in captions than what were actually displayed from 12:00-12:30, how many words total would be displayed onscreen in captions in this timespan?", + "answer_choice_0": "31", + "answer_choice_1": "21", + "answer_choice_2": "24", + "answer_choice_3": "12", + "answer_choice_4": "33", + "answer_id": 1, + "answer": "21", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video during the specified timespan, and counted the number of words I read in captions onscreen - some of which were reflected in video speech, some of which were not. I counted 2 words from 11:59-12:01, 9 from 12:07-12:10, 3 from 12:17-12:18, 1 at 12:21, 11 from 12:22-12:27, and 7 from 12:27-12:30, for a total of 33 words displayed in captions onscreen during the span. I then imagined that there were 12 fewer words than the number that were actually displayed, doing the equation 33-12 to find this answer, the solution to which is 21." + }, + { + "key": "7eF4EjdYZ7k:1d6742465e6e3de56b4626da83bc0d54bfbfcf5a", + "video_id": "7eF4EjdYZ7k", + "question": "What are the colors shown on the two items that the man uses during the final process of plugging the hole?", + "answer_choice_0": "Yellow and green.", + "answer_choice_1": "Blue and yellow.", + "answer_choice_2": "Blue and red.", + "answer_choice_3": "Red and yellow.", + "answer_choice_4": "Blue and green.", + "answer_id": 1, + "answer": "Blue and yellow.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to gather the entire process of plugging the hole, also keeping an eye out for the primary colors seen. At 03:50, the man can be seen cleaning some of the glue off of the plug. The towel he uses to clean the glue is blue. He then uses a knife to cut off the excess plug. The handle of the knife has yellow on it. Therefore, the two primary colors seen in the end process of the plug are blue and yellow." + }, + { + "key": "7eF4EjdYZ7k:3642e12be27753157346ca1ffcd6c735cd064152", + "video_id": "7eF4EjdYZ7k", + "question": "What would the total duration be of all of the close up views of the tire being fixed if there were 30 seconds removed from the total time?", + "answer_choice_0": "2 minutes and 56 seconds.", + "answer_choice_1": "1 minute and 59 seconds.", + "answer_choice_2": "2 minutes and 33 seconds.", + "answer_choice_3": "3 minutes and 23 seconds.", + "answer_choice_4": "3 minutes and 4 seconds.", + "answer_id": 0, + "answer": "2 minutes and 56 seconds.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and looked for the close up views of the tire being fixed, preparing to add them up and then subtract 30 seconds. One close up view occurs from 00:25-01:14, for a total of 49 seconds. Another very long and continuous view occurs from 01:28-04:05, for a total of 2 minutes and 37 seconds. After this, the video changes, and a close up view is not seen again. Adding 49 seconds to 2 minutes and 37 seconds gets to a total of 3 minutes and 26 seconds. Subtracting 30 seconds from this means I get a final time of 2 minutes and 56 seconds." + }, + { + "key": "7eF4EjdYZ7k:5fadc2f6e49eb0ebb0d4f9bce0674d090615824c", + "video_id": "7eF4EjdYZ7k", + "question": "How many times in the video would the words on the man's shirt be at least partially visible if they were visible an additional time?", + "answer_choice_0": "10 times.", + "answer_choice_1": "3 times.", + "answer_choice_2": "7 times.", + "answer_choice_3": "5 times.", + "answer_choice_4": "9 times.", + "answer_id": 1, + "answer": "3 times.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to count the number of times the words on the man's shirt are at least partially visible. From the beginning of the video, at 00:00, the words are visible continuously until 00:25. They are not visible again until 04:05, and then they remain continuously visible on the screen until the end of the video at 05:27. If there was an additional time, then the answer would be 3 times." + }, + { + "key": "7eF4EjdYZ7k:65dcac397273d9f04627496492fd414506a225de", + "video_id": "7eF4EjdYZ7k", + "question": "How long is the TIRE PLUGS PVC pipe visible in the video?", + "answer_choice_0": "1 minute and 52 seconds.", + "answer_choice_1": "1 minute and 3 seconds.", + "answer_choice_2": "36 seconds.", + "answer_choice_3": "48 seconds.", + "answer_choice_4": "1 minute and 33 seconds.", + "answer_id": 1, + "answer": "1 minute and 3 seconds.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to determine how long the TIRE PLUGS PVC pipe is visible in the video. I noticed it first at the very beginning of the video, when it is visible as it sits on top of the tire behind the man. It is visible until 00:25, which equates to 25 total seconds. I continued watching the video, and it does not reappear until 04:10. It remains visible until 04:14, for an additional 4 seconds. The man brings it back up into the frame at 04:15, and then it goes down below the frame at 04:18, for an additional 3 seconds. Once again, the man brings it back up into the frame at 04:19, and it remains continuously visible until 04:50. This adds another 31 seconds. The pipe does not become visible again. Adding up 25+4+3+31=63 seconds. This makes the total time 1 minute and 3 seconds." + }, + { + "key": "7eF4EjdYZ7k:8c794216f6e688b1c9a47c2ac861cd0347a3183b", + "video_id": "7eF4EjdYZ7k", + "question": "What is the sum of the numbers shown on the side of the tire?", + "answer_choice_0": "29.", + "answer_choice_1": "25.", + "answer_choice_2": "19.", + "answer_choice_3": "21.", + "answer_choice_4": "23.", + "answer_id": 1, + "answer": "25.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to see when the numbers on the side of the tire were visible. At 00:50, they can be seen. The numbers shown on the tire are 235/80R16. So the numbers on the tire are 2, 3, 5, 8, 0, 1, 6. The sum of these numbers is 25. So the answer is 25." + }, + { + "key": "7eF4EjdYZ7k:943fde63dedba865f4fd57a3f409d7800d844067", + "video_id": "7eF4EjdYZ7k", + "question": "How many times do the words \"TIRE PLUG\" appear in the video?", + "answer_choice_0": "1 time.", + "answer_choice_1": "3 times.", + "answer_choice_2": "5 times.", + "answer_choice_3": "2 times.", + "answer_choice_4": "4 times.", + "answer_id": 3, + "answer": "2 times.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "As soon as the video begins at 00:00, I noticed the white PVC pipe on the top part of the tire. I can read the words \"TIRE PLUGS\" on it. I continued watching the video to see if the words appeared anywhere else. At 04:10, the man holds up the PVC pipe to the camera and I could read the words on it again. They did not appear on anything else in the video." + }, + { + "key": "7eF4EjdYZ7k:979353ca515fb9abd846e9167d42585a9c7e5211", + "video_id": "7eF4EjdYZ7k", + "question": "How many times does the man in the video twist the pliers before the nail comes out of the tire?", + "answer_choice_0": "6 times.", + "answer_choice_1": "4 times.", + "answer_choice_2": "8 times.", + "answer_choice_3": "2 times.", + "answer_choice_4": "10 times.", + "answer_id": 4, + "answer": "10 times.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to find when the man uses pliers to twist the nail out of the tire. The pliers first appear at 02:27, held by the man from outside the frame. He brings the pliers to the nail at 02:28. He twists them once at 02:32. Then, there is a series of twists which happen in pretty rapid succession, and these occur at 02:36, 02:37, 02:39, 02:42, 02:44, 02:46, 02:48, 02:49, and 02:50. Then, on the last twist, the nail is removed from the tire. So, the answer is 10." + }, + { + "key": "7eF4EjdYZ7k:98ae7c4d3a72cbe4eae009ee383eb26eb94151eb", + "video_id": "7eF4EjdYZ7k", + "question": "If an additional $3 is added to the cost of the Slime Tire Repair Kit, what would be the total cost?", + "answer_choice_0": "$3.12.", + "answer_choice_1": "$12.12.", + "answer_choice_2": "$10.12.", + "answer_choice_3": "$15.12.", + "answer_choice_4": "$9.12.", + "answer_id": 4, + "answer": "$9.12.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "While watching the video I noticed that the man mentioned the Amazon store from 01:14 - 01:22. At 01:23, the Slime Tire Repair Kit Deluxe is shown on screen. I noticed that it costs $6.12. I imagined that if $3 is added then that would be $9.12." + }, + { + "key": "7eF4EjdYZ7k:9c910af3af70588ab41c8a57eb53c71a6f3fc3a7", + "video_id": "7eF4EjdYZ7k", + "question": "How many items contain metal shown between 00:50-01:14?", + "answer_choice_0": "7 items", + "answer_choice_1": "6 items", + "answer_choice_2": "2 items", + "answer_choice_3": "4 items", + "answer_choice_4": "1 item", + "answer_id": 0, + "answer": "7 items", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video between 00:50-01:14. Between that time, various items are seen. Resting on the tire are 2 tools that contain metal. The nail in the tire is also metal. The tire rim contains 4 lugnuts. Therefore, the 2 tools, plus the nail, plus 4 lugnuts equals 7 items." + }, + { + "key": "7eF4EjdYZ7k:a72a960e6a4ba462cc1268228c84fde33335e46f", + "video_id": "7eF4EjdYZ7k", + "question": "What would the total cost be of every item containing a price point that is visible from 01:20-01:25 in the video?", + "answer_choice_0": "$175.22.", + "answer_choice_1": "$138.37.", + "answer_choice_2": "$190.01.", + "answer_choice_3": "$157.15.", + "answer_choice_4": "$207.55.", + "answer_id": 2, + "answer": "$190.01.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video from 01:20-01:25 to find every item that is visible in the video which has a price point next to it. From 01:20-01:22, I see five items on the top row of an Amazon page, and the items are priced at $19.82, $11.26, $8.37, $17.41, and $6.12. I continued watching to look for more items and prices. At 01:23, the Slime Tire Repair Kit Deluxe is shown, which is $6.12. At 01:24, more prices become visible, including $94.95 at the top of the page next to the text that reads \"AIR BEAD SEATER 5 Gallon Tire Seating Blaster Inflator ATV Tractor Car Truck 145 PSI YELLOW\". Another is toward the bottom of the page, which has text that reads \"Castrol 03083 Edge 5W-20 Advanced Full Synthetic Motor Oil, 5 Quarts\" which is $25.96 in price. No other items and prices appear. Adding all of these prices together, I reach a total of $190.01." + }, + { + "key": "8FKq6r2rad8:083f092f7c66b95e729f6bf080792ad196e83f4b", + "video_id": "8FKq6r2rad8", + "question": "What does the heavyset brunette woman in the black leotard do after the man in the yellow tights from the opposing team causes her to fall backwards the first time?", + "answer_choice_0": "She kicks him in the shin.", + "answer_choice_1": "She punches him in the face.", + "answer_choice_2": "She kicks at him and misses.", + "answer_choice_3": "She swings at him and misses.", + "answer_choice_4": "She screams at him through her megaphone.", + "answer_id": 3, + "answer": "She swings at him and misses.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 03:13 when the man in the yellow tights from the opposing team bent down behind the unsuspecting heavyset brunette woman in the black leotard. At 03:14 she tripped backwards and fell over him. She charged at him at 03:21 and swung and missed. She fell backwards several times during the fight but this was the first occurrence." + }, + { + "key": "8FKq6r2rad8:98856d107a5b9f9fe8ce092075ebd428e6e44185", + "video_id": "8FKq6r2rad8", + "question": "How many wrestlers use a megaphone to beat their opponent?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I look for wrestlers using the microphone to beat an opposing wrestler. At 07:22, Zizi uses a megaphone to hit one of the boys in the head while the referee looks away. At 07:47, the megaphone is used by Ivy to hit the other guy. Therefore, two wrestlers use a megaphone to beat their opponent." + }, + { + "key": "8FKq6r2rad8:b68a404b1ab5499ba436132384a401e12f8bf76c", + "video_id": "8FKq6r2rad8", + "question": "What is the setting?", + "answer_choice_0": "A fighting arena.", + "answer_choice_1": "A movie theater.", + "answer_choice_2": "An auditorium stage.", + "answer_choice_3": "An amphitheater.", + "answer_choice_4": "A concert hall.", + "answer_id": 0, + "answer": "A fighting arena.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:01, I heard the ambience of a crowd in the background. Then, at 00:10, I heard a voiceover announce a fight. At the same time, I saw a fighting ring in the middle of an arena with a surrounding seating area and illuminated by colorful spotlights, all indicating the atmosphere of a fighting arena." + }, + { + "key": "8FKq6r2rad8:cf6b9487ea1a3d07af755e137836158d3bdb79af", + "video_id": "8FKq6r2rad8", + "question": "How many people have at least one elbow on the floor of the ring when the announcer comments on the female wrestler's young age?", + "answer_choice_0": "0.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for the announcers to comment on the female wrestler's young age. I heard this occur at 06:53. I observed the floor of the ring and saw that the blond man's elbows were clearly on the floor. I suspected the brown haired man's elbow was on the floor, but couldn't see from this angle, so I went backwards one second and was able to confirm that he had one elbow on the ground. I counted no other people with an elbow on the ground, therefore the total number was 2." + }, + { + "key": "8LOFc5FmVbI:2d0297f2937d78dd90b6cb6d8f09132ea6158180", + "video_id": "8LOFc5FmVbI", + "question": "What floats inside of the glass sphere?", + "answer_choice_0": "A hand.", + "answer_choice_1": "An alien plant.", + "answer_choice_2": "An alien creature.", + "answer_choice_3": "A fish.", + "answer_choice_4": "A human.", + "answer_id": 4, + "answer": "A human.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for a glass sphere and found it at 03:39. I saw the pilot peer into the sphere, but there is nothing there yet. I continued watching and at 03:40, there are two screens where the pilot peers into the sphere. The bottom screen shows a floating humanoid figure floating around. At 03:42, a more detailed 3D model confirms that a human floats inside of the sphere." + }, + { + "key": "8LOFc5FmVbI:6232b39a045677a89d68e2b089e2a0a53b14cdb2", + "video_id": "8LOFc5FmVbI", + "question": "How many times in the video does a 3D model of a red haired woman fly into the air?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for all instances in the video showing a 3D model of a red haired woman. A 3D model appears at 03:43, 05:28, 08:47, and 08:52. The model at 08:52 flies into the air at 08:55. No other 3D models of red haired women fly into the air, making the total, 1." + }, + { + "key": "8LOFc5FmVbI:6356e70aa42dadf2859a97a17aa0ea7cf722403e", + "video_id": "8LOFc5FmVbI", + "question": "What is in the globe sphere when the younger spaceship pilot is adjusting things down and to his left?", + "answer_choice_0": "An alien.", + "answer_choice_1": "A planet.", + "answer_choice_2": "A head.", + "answer_choice_3": "A space map.", + "answer_choice_4": "A 3D ship image.", + "answer_id": 2, + "answer": "A head.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The first scene where I saw an actor that seemed to be a spaceship pilot is at 02:09, where the man discusses his preference for a worn-in spaceship. But I have no idea if he is older or younger compared with another pilot.At 02:55, I saw another man who also appeared to be a pilot. This man was visibly younger than the first pilot and was sitting at the controls. I continued watching until I saw the younger pilot looking down and to his left at 03:05. In this shot, I noticed a globe sphere within the frame, and soon a man's head appeared in it." + }, + { + "key": "8LOFc5FmVbI:75ecea8ecaa4a47852cbd459b705a28ab3fcb852", + "video_id": "8LOFc5FmVbI", + "question": "What tool is used to cut the polystyrene for the set pieces?", + "answer_choice_0": "A handsaw.", + "answer_choice_1": "A utility knife.", + "answer_choice_2": "A laser.", + "answer_choice_3": "A putty knife.", + "answer_choice_4": "A jigsaw.", + "answer_id": 4, + "answer": "A jigsaw.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for when the video shared the set build. I found this at 00:34. It was also at this time that an AI narrator stated, \"the team was only able to gather a pile of polystyrene from the studio waste, which pushed set to design a new set with this constraint.\" This led me to understand that polystyrene is being used as a building material. From 0:56-1:02 I see the set being assembled. Then, at 01:07, I see a styrofoam-like material being cut with a jigsaw. We then see dozens of these pieces being attached to the set. At 01:24, we see more of the same material being cut with the jigsaw. Therefore, polystyrene must be this styrofoam-like material and is the only material aside from wood that we see being cut while the set is constructed. Since it was cut with a jigsaw, the answer is jigsaw." + }, + { + "key": "8LOFc5FmVbI:830c94b9d1ab634f3078abd3bd6235b46ee1541b", + "video_id": "8LOFc5FmVbI", + "question": "What happens after the red-haired woman reaches for the green woman's face?", + "answer_choice_0": "The green woman showers off her slime.", + "answer_choice_1": "The green woman punches the redhaired woman.", + "answer_choice_2": "The green woman launches into the sky.", + "answer_choice_3": "The green woman falls to the ground.", + "answer_choice_4": "The green woman kisses the redhaired woman.", + "answer_id": 2, + "answer": "The green woman launches into the sky.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for a moment in the video when a red-haired woman reaches for a green woman's face. This occurs at 10:54, when I see a green woman rise up to face a red-haired woman, who reaches out to the green woman's face. But before the redhaired woman can make contact, the green woman launches vertically into the sky at 10:57." + }, + { + "key": "8LOFc5FmVbI:9322283a2ed9af4eb78723f5ef17c6df2344099b", + "video_id": "8LOFc5FmVbI", + "question": "How many naked gray bodies are lying on the set in the first images with actors?", + "answer_choice_0": "21.", + "answer_choice_1": "25.", + "answer_choice_2": "30.", + "answer_choice_3": "10.", + "answer_choice_4": "15.", + "answer_id": 0, + "answer": "21.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and found the first scene with at least one actor on set, which occurs at 01:53, and there are many characters on set. All but one are naked and also lying on the ground. I next counted the number of bodies, and they equaled 22." + }, + { + "key": "8LOFc5FmVbI:e9f75aa576809691f447d647d3c95cdaa78533ac", + "video_id": "8LOFc5FmVbI", + "question": "In the first shot of the video where words can be seen moving across the screen, how many of those words are orange?", + "answer_choice_0": "4.", + "answer_choice_1": "6.", + "answer_choice_2": "3.", + "answer_choice_3": "7.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the scene where words can first be seen moving across the screen, and identified this point at 00:03. I then watched the words scroll across until all were visible, and noted their color, and the number of words of each color. Three of the words were white in color, and I counted four that were orange." + }, + { + "key": "8LOFc5FmVbI:ebe321b47e7350770c8660c9393223b9befb3c67", + "video_id": "8LOFc5FmVbI", + "question": "How do the walls surrounding the pentagon platform appear at 01:47-01:50?", + "answer_choice_0": "Reds and blacks with intricate pipes.", + "answer_choice_1": "Clear, with complex symbols and patterns.", + "answer_choice_2": "Brown, with futuristic reliefs.", + "answer_choice_3": "Colorful, with industrial textures.", + "answer_choice_4": "Blue tones with smooth surfaces.", + "answer_id": 2, + "answer": "Brown, with futuristic reliefs.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the beginning of the construction of the walls at 00:51. From 00:51 to 01:43, people work on the walls. From 01:47 to 01:50, the video shows the finished result of the walls. The walls of the set are brown and have futuristic reliefs. The walls surround a platform which is shaped like a pentagon. I concluded that the answer is brown, with futuristic reliefs." + }, + { + "key": "8dSWPmf0hnQ:1602c84c6fa4d4dd2a8377592ab75667b8513ae6", + "video_id": "8dSWPmf0hnQ", + "question": "Why does the gravedigger pull a gun on the man in the khaki suit?", + "answer_choice_0": "To save his parents.", + "answer_choice_1": "To save the strangers.", + "answer_choice_2": "To save his children.", + "answer_choice_3": "To save himself.", + "answer_choice_4": "To save his enemies.", + "answer_id": 1, + "answer": "To save the strangers.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video and never saw the gravedigger interact with the two young men or acknowledge them, and therefore determined he did not know them. I watched the video until the 02:58 mark and saw that the man is digging a grave. At 03:02 there's a clear shot of him noticing the two men being held at gunpoint. I continued to 03:38 where it becomes clear the man in the khaki suit plans to kill the young men by covering them in driveway sealant. At 03:51 the gravedigger pulls a gun on the man in the khaki suit and commands him to stop what he's doing to the two young men. Therefore, it became clear that the gravedigger pulls a gun on the man in the khaki suit to save the lives of strangers." + }, + { + "key": "8dSWPmf0hnQ:83bf87fb3eb90f3dbd854e860ed32d5a3c864cae", + "video_id": "8dSWPmf0hnQ", + "question": "What does the man in the black jacket say he aspires to be after the man in the blue jacket asks him about his ambitions?", + "answer_choice_0": "A sketchy lawyer.", + "answer_choice_1": "A famous thief.", + "answer_choice_2": "An addicted gambler.", + "answer_choice_3": "A medical doctor.", + "answer_choice_4": "A drug dealer.", + "answer_id": 4, + "answer": "A drug dealer.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:12 and listened to the dialogue as the man in the blue jacket asks the man in the black jacket if he has any ambitions. I then listened to the man in the black jacket's response after this question at 00:17 and heard him say his goal is to be a big time drug dealer." + }, + { + "key": "8dSWPmf0hnQ:ce1e7ffa21432f25008a3525b3bc480bb1e9fd70", + "video_id": "8dSWPmf0hnQ", + "question": "How does the driver of the red car feel after he sideswipes the old truck?", + "answer_choice_0": "Proud.", + "answer_choice_1": "Ashamed.", + "answer_choice_2": "Scared.", + "answer_choice_3": "Thrilled.", + "answer_choice_4": "Angry.", + "answer_id": 2, + "answer": "Scared.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:43 where the driver of the red car sideswipes the old truck. He tensely looks behind him with a worried expression at 00:46. At 00:51, he's breathing hard and has a scared expression. The combination of these events led me to conclude that he's scared about hitting the old truck." + }, + { + "key": "8dSWPmf0hnQ:dbb8a21997e808bf4c0cda5eb8062461ee624553", + "video_id": "8dSWPmf0hnQ", + "question": "What does the setting look like when Ronnie and his brother are shirtless?", + "answer_choice_0": "Dark with no light.", + "answer_choice_1": "Bright with fluorescent light.", + "answer_choice_2": "Bright and overcast.", + "answer_choice_3": "Dark with red light.", + "answer_choice_4": "Bright with sunshine.", + "answer_id": 3, + "answer": "Dark with red light.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the time that Ronnie and his brother were shirtless and found that they were shirtless from 03:24-04:28. I watched this time again to observe the setting. I noticed that the scene was very dark but flares on the ground were casting a red light." + }, + { + "key": "8epJyi9TjZQ:38c359926f808299d96e89bd06e4daf4fe9d1824", + "video_id": "8epJyi9TjZQ", + "question": "Of the cities first mentioned by the man with the goatee, how many appear onscreen in yellow?", + "answer_choice_0": "0.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, listening for the man with the goatee to list cities, which he does from 00:02 to 00:07. Two of the cities mentioned, Genova and Ljubljana, appear onscreen in yellow. However, Ljubljana is first mentioned by the man with the full beard first, eliminating that option. Therefore, the man with the goatee only mentions 1 city that appears onscreen in yellow first: Genova." + }, + { + "key": "8epJyi9TjZQ:40c701e65939adc19578472a7afb19cd36ea2456", + "video_id": "8epJyi9TjZQ", + "question": "In what city is there a man carrying a golden retriever?", + "answer_choice_0": "Zurich.", + "answer_choice_1": "Genova.", + "answer_choice_2": "Bologna.", + "answer_choice_3": "Ljubljana.", + "answer_choice_4": "Maribor.", + "answer_id": 2, + "answer": "Bologna.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched for a man carrying a golden retriever. One appears at 03:35, walking toward the camera. At 03:29, the comedians had mentioned it was their first time going to Bologna, and started sharing scenes of the city, during which time the man carrying the golden retriever is seen." + }, + { + "key": "8epJyi9TjZQ:564389db3aa18c6be9125133b23550f868ac66ce", + "video_id": "8epJyi9TjZQ", + "question": "According to the logo, when was the Jazz Klub 300 founded?", + "answer_choice_0": "2002.", + "answer_choice_1": "2003.", + "answer_choice_2": "2001.", + "answer_choice_3": "2000.", + "answer_choice_4": "2004.", + "answer_id": 0, + "answer": "2002.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I found the logo for the Jazz Klub 300 at 05:10. The top part of the logo reads \"since 2002,\" indicating that the Jazz Klub 300 was founded in 2002." + }, + { + "key": "8epJyi9TjZQ:78e23c85a1908b7ea53783ca138aa65891b2cce7", + "video_id": "8epJyi9TjZQ", + "question": "As the crowd laughs for the third time in the video, what does the comedian do?", + "answer_choice_0": "He drinks from a bottle.", + "answer_choice_1": "He points at his mom in the crowd.", + "answer_choice_2": "He makes a funny noise into the microphone.", + "answer_choice_3": "He laughs nervously and straightens his shirt.", + "answer_choice_4": "He makes up a song on the spot.", + "answer_id": 0, + "answer": "He drinks from a bottle.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the first time the crowd laughed and found it at 00:32. I focused on the comedian on the stage and waited for the crowd to laugh. The crowd laughs for the second time at 00:35. I waited for the crowd to laugh again. The crowd laughs for the third time at 00:39. While the crowd laughs for the third time, I saw the comedian take a drink from the bottle he holds in his left hand." + }, + { + "key": "8epJyi9TjZQ:9ab9cdeef0ec07e74148e6136d952f16d45e18d3", + "video_id": "8epJyi9TjZQ", + "question": "When the bearded comedian drinks from a white cup, where is the baby?", + "answer_choice_0": "On the table at the left of the screen.", + "answer_choice_1": "On someone's lap in a seat at the right of the screen.", + "answer_choice_2": "In the restaurant behind him, looking through the window.", + "answer_choice_3": "In a carrier on the ground, at the right of the screen.", + "answer_choice_4": "In a stroller at the right of the screen.", + "answer_id": 1, + "answer": "On someone's lap in a seat at the right of the screen.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the bearded comedian on the right, at 00:00. I focused on him throughout the video, and waited until he drank from a white cup. He only drinks once in the video, which I found at 02:16. I observed the scene for the baby, who is partially visible at the edge of the right of the screen, sitting on someone's lap." + }, + { + "key": "8epJyi9TjZQ:9c07b974b61f2cdf7a987712d3c2601d7b3e5771", + "video_id": "8epJyi9TjZQ", + "question": "Before a logo which reads \"Jazz Club 300\" is seen, in what sequence do the colors of each unique and single-color stage backdrop appear?", + "answer_choice_0": "Blue, black, red", + "answer_choice_1": "Blue, black, blue", + "answer_choice_2": "Blue, red, black", + "answer_choice_3": "Blue, red, blue", + "answer_choice_4": "Blue, blue, black", + "answer_id": 2, + "answer": "Blue, red, black", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Every time a stage appeared on-screen that was different from the previous stage, I observed the back of the stage for the color of the backdrop. The first stage appeared at 00:25 with a blue backdrop. The second stage appeared at 00:58, and I waited until 01:07 for a view of the backdrop, which I saw was red. The third stage appeared at 02:46, and I waited until 02:49 for a good view of the backdrop, which I saw was black. The stage at 05:00 did not have a single-color backdrop, so I did not include it in the sequence of colors. The stage with the Jazz Club 300 logo appears at 05:12. This makes the sequence of colors before it appears blue, red, and black." + }, + { + "key": "8epJyi9TjZQ:bb51f243cd2368c3150731d1f767c1220feaea53", + "video_id": "8epJyi9TjZQ", + "question": "What household item in the kitchen changes position during the video?", + "answer_choice_0": "The cutting board.", + "answer_choice_1": "The dish soap.", + "answer_choice_2": "The fire extinguisher.", + "answer_choice_3": "The purple flowers.", + "answer_choice_4": "The electric tea kettle.", + "answer_id": 1, + "answer": "The dish soap.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Watching the video, I noticed the green Fairy dish soap on the counter to the right of the sink, below the window, from 00:00. It remains where it is through several cuts, but at 00:52, I saw that it had been moved forward, closer to the edge of the counter. It remains in this position for the rest of the video." + }, + { + "key": "8rdIuLhEQso:79dc3c87adc669a5345d0ffb14081b1c991043c2", + "video_id": "8rdIuLhEQso", + "question": "What color are the brunette woman's shoes?", + "answer_choice_0": "Grey.", + "answer_choice_1": "Black.", + "answer_choice_2": "White.", + "answer_choice_3": "Green.", + "answer_choice_4": "Red.", + "answer_id": 2, + "answer": "White.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I first identified the brunette woman onscreen at 00:43. I continued watching until there was a wide shot of the brunette woman at 01:01 and her shoes can be seen. They are white." + }, + { + "key": "8rdIuLhEQso:9565485362e4c87aff55db6a29dce54cc8ba6367", + "video_id": "8rdIuLhEQso", + "question": "Between the two women, who has their nails painted, what color, and how many nails?", + "answer_choice_0": "Both women have all ten nails painted bright pink.", + "answer_choice_1": "Both women have all ten nails painted red.", + "answer_choice_2": "The brunette has three nails painted red.", + "answer_choice_3": "The brunette has all ten nails painted red.", + "answer_choice_4": "The blonde has all ten nails painted red.", + "answer_id": 3, + "answer": "The brunette has all ten nails painted red.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At multiple points in the video, for example 02:16 and 03:02, we can see that Mathilde has all her nails painted red and Lea's nails are natural." + }, + { + "key": "8rdIuLhEQso:d39c5d6d38cac782c244d22ef0a5b947c065d6b6", + "video_id": "8rdIuLhEQso", + "question": "Who is the second person to speak in the video?", + "answer_choice_0": "A narrator.", + "answer_choice_1": "The brunette woman.", + "answer_choice_2": "It is a silent film.", + "answer_choice_3": "The blonde woman.", + "answer_choice_4": "The brunette woman's fiancee.", + "answer_id": 3, + "answer": "The blonde woman.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watch the video until I see the brunette woman speak at 00:41. When I see the blonde woman speak at 00:47, then, I know that she is the second woman to speak in the video." + }, + { + "key": "8rdIuLhEQso:ece10b462514e0a12bf86e81973335dc7b0ca59c", + "video_id": "8rdIuLhEQso", + "question": "Why did the blonde send the brunette a text?", + "answer_choice_0": "To stall the brunette's wedding.", + "answer_choice_1": "To rebuke the brunette's unacceptable behavior.", + "answer_choice_2": "To avoid being the brunette's maid of honor.", + "answer_choice_3": "To lure the brunette to the cliffs.", + "answer_choice_4": "To break up with the brunette.", + "answer_id": 3, + "answer": "To lure the brunette to the cliffs.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "During the blonde and the brunette's entire discussion, from 00:40-02:46, the blonde is clearly trying to win the brunette back. She even claims around 02:08 that the brunette doesn't love her fianc\u00e9. Therefore, it is clear that the blonde sent the brunette a text to get her to come to the cliffs and to confront her over their romantic feelings." + }, + { + "key": "9120Php3Kh4:3408f581cc848d007770537778a61e2ca19dfa78", + "video_id": "9120Php3Kh4", + "question": "What is the fifth player name displayed on-screen?", + "answer_choice_0": "Nigel Richards", + "answer_choice_1": "Matt Canik", + "answer_choice_2": "Rajiv Antao", + "answer_choice_3": "Josh Sokol", + "answer_choice_4": "Cesar Del Solar", + "answer_id": 4, + "answer": "Cesar Del Solar", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I read and counted each name that appeared on-screen, starting at the beginning of the video. At 00:00, the first 2 player names appear on-screen, reading \"Nigel Richards\" and \"Rajiv Antao\". Then, at 00:35, the third player name appears on-screen, reading \"Josh Sokol\". At 01:19, the fourth player name appears on-screen, reading \"Matt Canik\". Then, the fifth player name appears on-screen at 01:59, reading \"Cesar Del Solar\". Therefore, the fifth player name displayed on-screen is Cesar Del Solar." + }, + { + "key": "9120Php3Kh4:43e5a1eb1971657dd09166c83214d2d7ce2016fc", + "video_id": "9120Php3Kh4", + "question": "What change of color occurs to the letters added to the word \"ZING\" by Chris Cree?", + "answer_choice_0": "They turn from red to yellow", + "answer_choice_1": "They turn from yellow to red", + "answer_choice_2": "They turn from green to red", + "answer_choice_3": "They turn from yellow to green", + "answer_choice_4": "They turn from red to green", + "answer_id": 3, + "answer": "They turn from yellow to green", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched for the section of video dedicated to Chris Cree and his addition to the word \"ZING\", which I found from 03:06-03:38. Since the letters \"ANNUALI\" are added to the \"ZING,\" \"ANNUALI\" are then the letters whose color I pay attention to. Initially, the letters \"ANNUALI\" are displayed in yellow, but this color changes to green at 03:05 after they are played on the board. Therefore, the letters added to the word \"ZING\" by Chris Cree change color by turning from yellow to green." + }, + { + "key": "9120Php3Kh4:5900b0e8bcc3f352d5cddfc9859a890cc9c94972", + "video_id": "9120Php3Kh4", + "question": "As the word \"Oxyphenbutazone\" is said by the narrator, what letter is slotted into place on the Scrabble board?", + "answer_choice_0": "E.", + "answer_choice_1": "J.", + "answer_choice_2": "N.", + "answer_choice_3": "O.", + "answer_choice_4": "A.", + "answer_id": 0, + "answer": "E.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 00:15 - 00:16, I heard the narrator say the word \"Oxyphenbutazone\". At the same time, I saw the letter \"E\" was placed in the bottom left square of the Scrabble board. Therefore, as the word \"Oxyphenbutazone\" is said by the narrator, the letter \"E\" is slotted into place on the Scrabble board." + }, + { + "key": "9120Php3Kh4:6b4f1cc7ad6638fe8ffae185b664929d59468636", + "video_id": "9120Php3Kh4", + "question": "What happens to the Scrabble letters spelling \"BOASTI_G\" at 05:53?", + "answer_choice_0": "They flash and change color.", + "answer_choice_1": "They move and disappear.", + "answer_choice_2": "They move and change color.", + "answer_choice_3": "They shrink and expand.", + "answer_choice_4": "They bounce and emit music.", + "answer_id": 2, + "answer": "They move and change color.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 05:53, I found a line of vertically stacked orange Scrabble letters on top of the \"G\" in a horizontal \"OLOGY\", spelling \"BOASTI_G\". After, I saw the letters in \"BOASTI_G\" move down to become horizontally aligned with \"OLOGY\" at the front of the word, change to the color green, and then spell out the word \"ASTROBIOLOGY\". Therefore, the Scrabble letters spelling \"BOASTI_G\" at 05:53 move and change color." + }, + { + "key": "9120Php3Kh4:ae1975360106a6a4951dc56ce1ec402feeaca4ce", + "video_id": "9120Php3Kh4", + "question": "When Matt Canik's picture and board are first displayed on-screen, how many times has the letter \"S\" been played on the displayed board?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "5.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 01:19, I found the Scrabble board that was displayed on-screen with Matt Canik's picture and name. I then counted the number of letter \"S\"'s that were on the board after having been played, calculating a total of 5. Therefore, when Matt Canik's picture and board are first displayed on-screen, the letter \"S\" has been played 5 times on the displayed board." + }, + { + "key": "9120Php3Kh4:ba1e194daee0bacda3520835927a2ab3eab18661", + "video_id": "9120Php3Kh4", + "question": "What is the mathematical difference between the green numbers on-screen at 06:25?", + "answer_choice_0": "293.", + "answer_choice_1": "203.", + "answer_choice_2": "459.", + "answer_choice_3": "662.", + "answer_choice_4": "865.", + "answer_id": 2, + "answer": "459.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found 2 green numbers on-screen at 06:25, reading \"662\" and \"203\". I then calculated 662-203=459. Therefore, the mathematical difference between the green numbers on-screen at 06:25 is 459." + }, + { + "key": "9120Php3Kh4:cff71597360c97a63333a8bf99b05aa5cb955c6b", + "video_id": "9120Php3Kh4", + "question": "In what colors do the aliens speak over the course of the video?", + "answer_choice_0": "Red and purple.", + "answer_choice_1": "Purple and yellow.", + "answer_choice_2": "Yellow and green.", + "answer_choice_3": "Green and purple.", + "answer_choice_4": "Green and red.", + "answer_id": 4, + "answer": "Green and red.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found 2 aliens at 06:04 and 1 at 08:29. During those times, I examined the text boxes of each speaking alien. I then noticed that the aliens at 06:04 speak in green font, while the alien at 08:29 speaks in red font. Therefore, the colors in which the aliens speak over the course of the video are green and red." + }, + { + "key": "9120Php3Kh4:dca9d923826197a8d60f64aa3af31588e69f47ea", + "video_id": "9120Php3Kh4", + "question": "In how many profile pictures are men wearing glasses?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "3.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First I looked at each profile picture shown in the video, looking for glasses. I found a profile picture of Nigel Richards wearing glasses at 0:01, a picture of Cesar Del Solar wearing glasses at 02:00, and a picture of Sherwin Rodrigues wearing glasses at 06:32. There is a very small avatar picture of a man, labeled \"You\", appearing at 08:10, but it is too small and blurry to tell if he is wearing glasses. I then counted the number of profile pictures with men wearing glasses, calculating a total of 3. Therefore, there are 3 profile pictures of men wearing glasses." + }, + { + "key": "9120Php3Kh4:e8a618bc21b40275c981eccd2a63ae2351bcb062", + "video_id": "9120Php3Kh4", + "question": "What appears on the graphic of Texas after Matt Canik plays ELECTRI(CITY)?", + "answer_choice_0": "A crown.", + "answer_choice_1": "A star.", + "answer_choice_2": "A scepter.", + "answer_choice_3": "A laurel.", + "answer_choice_4": "A medal.", + "answer_id": 4, + "answer": "A medal.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I searched for Matt Canik's ELECTRI(CITY) play. I found a screen at 01:19 with a virtual Scrabble board and a profile picture of a man in a white coat. The name next to the profile picture says \"Matt Canik\", so I concluded that this is the play I am searching for. Then, at 01:44, the narrator mentions Matt's ELECTRI(CITY) play and Scrabble letters move onto the board to spell out the word. Then, at 01:50, I found the graphic of Texas. At the same time, I noticed it has a medal with a number \"1\" on it. Therefore, a medal appears on the graphic of Texas after Matt Canik plays ELECTRI(CITY)." + }, + { + "key": "91ub3om9Fg0:190d5f923e0a1b5aa90e5a5a0a4fc6d982059b3f", + "video_id": "91ub3om9Fg0", + "question": "What was the purpose of the yellow button on the time machine?", + "answer_choice_0": "It is the start button for the time machine.", + "answer_choice_1": "It allows the time machine to connect to Bluetooth.", + "answer_choice_2": "There was no yellow button on the time machine.", + "answer_choice_3": "It functions as an emergency stop for the time machine.", + "answer_choice_4": "It is a safety mechanism to keep the time travel scientist from being permanently frozen.", + "answer_id": 4, + "answer": "It is a safety mechanism to keep the time travel scientist from being permanently frozen.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "We learn that the yellow button is a safety mechanism when the man in the blue sweatshirt tries to freeze the scientist. When he suddenly unfreezes, he shows them the yellow button and says, \"safety always.\" This occurs at 02:55." + }, + { + "key": "91ub3om9Fg0:40fe04c92fdd987e9b7e24c2dd577dd1eef5c208", + "video_id": "91ub3om9Fg0", + "question": "What happens when the friends argue over control of the machine?", + "answer_choice_0": "It sucks them into it.", + "answer_choice_1": "They freeze themselves.", + "answer_choice_2": "It splits in two.", + "answer_choice_3": "It records their image.", + "answer_choice_4": "They agree to share.", + "answer_id": 1, + "answer": "They freeze themselves.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched until 02:56, where one of the friends said he wanted the machine. A tussle ensued, and the third friend ended up activating the machine at 03:02 \u2014 freezing themselves." + }, + { + "key": "91ub3om9Fg0:906bdca0d52cb4735328b0022b295ee0619c435d", + "video_id": "91ub3om9Fg0", + "question": "How does the physical state of the three friends change over the course of the video?", + "answer_choice_0": "Initially, all three friends are unfrozen, but after freezing each other successfully, the machine is damaged and freezes all three for good.", + "answer_choice_1": "At first, all three friends are unfrozen, but after they argue about the bank robbery, the scientist freezes the other two and leaves.", + "answer_choice_2": "Initially all three are unfrozen, but then the scientist and man in the blue sweatshirt freeze the man in the green hoodie to steal his ice cream.", + "answer_choice_3": "The three friends remain unfrozen throughout the video because the scientist drops the machine and it breaks.", + "answer_choice_4": "At first, all three men are unfrozen, but then the man in the blue shirt grabs the device and freezes the other two.", + "answer_id": 0, + "answer": "Initially, all three friends are unfrozen, but after freezing each other successfully, the machine is damaged and freezes all three for good.", + "question_type": "State Changes", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The freezing happens in stages. First, no one is frozen from 0:00-1:46. Second, the scientist freezes the other two at 01:47. Third, the other two freeze the scientist at 02:38. Last, the machine is broken and freezes all three with no way out of the situation at 03:16." + }, + { + "key": "91ub3om9Fg0:d39956abc8ff4ce755b6d792a4f9a4a089e6e9b6", + "video_id": "91ub3om9Fg0", + "question": "What is the object at the center of this story?", + "answer_choice_0": "A time machine.", + "answer_choice_1": "An audio mixer.", + "answer_choice_2": "A plasma globe.", + "answer_choice_3": "A remote control.", + "answer_choice_4": "An ice cream maker.", + "answer_id": 0, + "answer": "A time machine.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched from the opening title \u2014 where the focus was hinted at \u2014 but it was when the object was officially introduced at 0:56 that this became clear as the character announced he has created a time machine." + }, + { + "key": "91ub3om9Fg0:ddd13fee500caf7ad52ce4455f300f80f657938f", + "video_id": "91ub3om9Fg0", + "question": "What is the primary color of the third poster on the wall?", + "answer_choice_0": "Red.", + "answer_choice_1": "Yellow.", + "answer_choice_2": "Black.", + "answer_choice_3": "Orange.", + "answer_choice_4": "Blue.", + "answer_id": 4, + "answer": "Blue.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:49, when the posters on the wall are visible. From there, I counted from left to right and found the third poster. The primary color of the third poster is blue." + }, + { + "key": "91ub3om9Fg0:e520944f0b0f9c237b0a6cd86750446e6115a1c8", + "video_id": "91ub3om9Fg0", + "question": "How long does it take for the word \"TIME MACHINE\" to be in focus once the man in the blue sweater shows it to the man in the green hoodie?", + "answer_choice_0": "00:01.", + "answer_choice_1": "00:04.", + "answer_choice_2": "00:02.", + "answer_choice_3": "00:07.", + "answer_choice_4": "00:06.", + "answer_id": 1, + "answer": "00:04.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:13, when the man in the blue sweater shows a video of the time machine on his phone to the man in the green hoodie. The word \"TIME MACHINE\" is barely legible along the bottom of the device. I watched until the camera finally focused on the word completely at 00:17. There are 00:04 seconds difference between 00:13 and 00:17." + }, + { + "key": "9hLit9A8gso:0f09d4d8b5ec6ddb5c9fefa185f953d8a704938d", + "video_id": "9hLit9A8gso", + "question": "What color was absent from the ribbons resting on the Alpaca farmer's bed?", + "answer_choice_0": "Blue.", + "answer_choice_1": "White.", + "answer_choice_2": "Red.", + "answer_choice_3": "Purple.", + "answer_choice_4": "Gold.", + "answer_id": 2, + "answer": "Red.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "From 06:16-06:22, I watched the alpaca farmer demonstrate the countless number of ribbons resting on her bed. I saw that there were dark blue and blue ribbons, some of which were adorned with white as well as gold patterning of a rose in the center of the dark blue ribbons. At 06:23, I noticed that there was a gold etching of a golden alpaca in the middle of the dark blue ribbons, displaying the words \"Alpaca Association of Western Washington\". At 06:30, I saw a series of dark blue ribbons with a purple ribbon behind it. At 06:41, I saw a large, navy blue banner resting atop the bed. Next to the banner, I witnessed a navy blue and white ribbon with gold lettering that also features the year \"2018\" on its white fabric. Absent from the ribbons is any semblance of the color red." + }, + { + "key": "9hLit9A8gso:12ccdbb4d3576cdfc59af7a41972c71aedf67c64", + "video_id": "9hLit9A8gso", + "question": "How many alpacas would be visible in the video between 01:00-01:30 if 3 of them were removed?", + "answer_choice_0": "11.", + "answer_choice_1": "13.", + "answer_choice_2": "10.", + "answer_choice_3": "12.", + "answer_choice_4": "14.", + "answer_id": 0, + "answer": "11.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video in between the time stamps of 01:00 and 01:30 in order to count how many alpacas are visible during this time period. I found the following: briefly from 01:00-01:00, there are 5 visible; from 01:00-01:03, one is 1 visible; from 01:03-01:07, 3 are visible; from 01:07-01:13, 3 are visible; from 01:13-01:24, 1 is visible; and from 01:24-01:30, 1 is visible. The sum of these numbers is 14. If 3 of them were removed, there would be 11, making that the answer." + }, + { + "key": "9hLit9A8gso:1b13c542dd618e679974d163cf6cbb29db006921", + "video_id": "9hLit9A8gso", + "question": "During the fourth shot showing at least part of a building on the property's land, in what direction is the alpaca looking at first?", + "answer_choice_0": "Toward the sky", + "answer_choice_1": "Toward his right", + "answer_choice_2": "Toward the ground", + "answer_choice_3": "Toward his left", + "answer_choice_4": "Toward the camera", + "answer_id": 4, + "answer": "Toward the camera", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and counted the number of times when at least part of a building on the property's land appears. The first time is immediately as the video starts, running from 00:00-00:06. There are three buildings visible in this shot. The second time a building is visible is from 00:39-00:44. The third time a building is visible is from 00:55-01:00, when the side of one is seen. The fourth time a building is visible is from 01:24-01:34. As this is the fourth shot, I looked to see where the alpaca is looking at first. He is staring directly at the camera. So, the answer is toward the camera." + }, + { + "key": "9hLit9A8gso:2db7a65a42aee1c7c6f4f83ef7d72b08cb568dbd", + "video_id": "9hLit9A8gso", + "question": "How many price tags are visible attached by plastic fasteners to products from 04:00-04:30 in the video?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "10.", + "answer_choice_3": "7.", + "answer_choice_4": "9.", + "answer_id": 3, + "answer": "7.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 04:00-04:30 in order to see how many price tags are visible which are attached by plastic fasteners to products. Right away, at 04:00, I see 2 products which have price tags attached by plastic fasteners, and both of them are attached to little snowmen. They are visible until 04:01. From 04:22-04:27, there are 2 more price tags visible which are attached by plastic fasteners, one of which is attached to a beanie, and the other is attached to a small black object. From 04:27-04:30, there are 3 additional price tags visible which are attached by plastic fasteners, two of which are only partially visible (on the left at the bottom, and the other toward the center), and the third of which is attached to some gloves. Adding these up, I get a total of 7." + }, + { + "key": "9hLit9A8gso:2e038ccae69101ba11ca6497c900fd957474f39c", + "video_id": "9hLit9A8gso", + "question": "In the bedroom, there is a host of multi-colored ribbons. What other object in the bedroom matches some of her ribbons?", + "answer_choice_0": "Pants.", + "answer_choice_1": "Walls.", + "answer_choice_2": "Glasses.", + "answer_choice_3": "Seat Cushion.", + "answer_choice_4": "Blanket.", + "answer_id": 3, + "answer": "Seat Cushion.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "From 06:11-06:15, I watched the alpaca farmer speak into the camera wearing a navy blue sweater in her bedroom. Subsequently, the alpaca farmer lifted her right hand, indicating a bed that was littered with show ribbons of various colors. At 06:17, I noticed that there was a pile of blue ribbons that mimicked the exact color of the blue sweater the alpaca farmer had on. However, I do not mention the sweater as this would be too obvious. Rather, from 06:15-06:17, behind the alpaca farmer, I noticed a white chair with a blue seat cushion. This is the desired answer." + }, + { + "key": "9hLit9A8gso:66d2e97191c7e63ae2f2ad82370473012612e9e9", + "video_id": "9hLit9A8gso", + "question": "How many fully visible alpacas would be eating the grass from 08:30-09:00 if there were 2 additional fully visible alpacas eating grass?", + "answer_choice_0": "7", + "answer_choice_1": "8", + "answer_choice_2": "10", + "answer_choice_3": "6", + "answer_choice_4": "3", + "answer_id": 4, + "answer": "3", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 08:30-09:00 in order to count how many fully visible alpacas are eating the grass. From 08:35-08:42, there are 3 alpacas shown that are grazing, but none of them are fully visible so I did not count them. From 08:43-08:47, 2 more alpacas are shown to be grazing, but one is partially obscured by an alpaca in the foreground, so I did not count it. The other is fully visible while grazing at 08:47, so I counted it. At 08:49, while the previous 2 alpacas are still visible, another alpaca begins to graze, but is partially obscured by other alpacas so I did not count it. From this point on, there are no more fully visible alpacas which are shown to be grazing. As the total is 1, I added 2, and got 3." + }, + { + "key": "9hLit9A8gso:8e8cc7a3fb499b7e2b06c17086b8c33d2512345d", + "video_id": "9hLit9A8gso", + "question": "If one were to subtract 50 yards of yarn from the total amount of yard contained in the two plastic baggies between 03:37-03:46, how much yarn would remain?", + "answer_choice_0": "350 yards.", + "answer_choice_1": "400 yards.", + "answer_choice_2": "250 yards.", + "answer_choice_3": "450 yards.", + "answer_choice_4": "300 yards.", + "answer_id": 0, + "answer": "350 yards.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the Alpaca farmer display a plastic baggie of yarn with a handwritten Post-It note at 03:37. The handwritten Post-It, composed in black Sharpie marker, has the words \"2ply Worsted, 200yds\". Therefore, I deduced that there were 200 yards of yarns contained in the plastic baggie. Subsequently, I noticed that there was an additional plastic bag of yarn, \"200 yards\" of \"LFWN Alpaca\" yarn. If one were to add 200 yards and 200 yards, that would be the total of 400 yards of yarn. However, if one were to subtract, 50 yards, that would equal, 350 yards of yarn in total between the two plastic bags of yarn." + }, + { + "key": "9hLit9A8gso:a3c8b91136a517b55baf1b50de823408e7866172", + "video_id": "9hLit9A8gso", + "question": "How many alpacas are introduced by name during a shot where other alpacas are also visible?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "5", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the times when the alpacas are introduced by name. I found the following alpacas introduced by name as I watched the video: Glory, who is introduced from 00:06-00:27; Shadow Dancer, who is introduced from 01:18-01:34; Zeus, who is introduced from 01:36-01:46; Leon, who is introduced from 01:46-01:53; and Felina, who is introduced from 01:53-02:08. In each shot, I looked to see if other alpacas were present as they were introduced, and this was the case for Glory, Zeus, and Leon, making the total number 3." + }, + { + "key": "9hLit9A8gso:b4eb4e5b2535bf4935423e788bb078c12f9a0b90", + "video_id": "9hLit9A8gso", + "question": "How many shots of a hand-knit snowman are there between 04:00-05:56?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 0, + "answer": "4.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 04:00, I saw the alpaca farmer was displaying a hand-knit snowman that she had crafted. This is the 1st shot of the snowman. From 05:27-05:31, I watched the snowman recur in a low angle shot that racks focus to the handmade knick-knack. This is the 2nd shot of the snowman. At 05:32, I watched the snowman from another angle, which now has a plastic and cardboard tag attached to the top of its black cap. This is the 3rd shot of the snowman. Lastly, at 05:33, I watched as the snowman is now witnessed up-close and its threaded fibers and stitching are visible from just below the scarf and up. That makes a total of 4 times the snowman was shown between 04:00-05:56." + }, + { + "key": "9jFOIkFIaVg:06b174a575e2b9544ea5cbc1d38f2c1c96b23da0", + "video_id": "9jFOIkFIaVg", + "question": "Where does the author's saliva land after he spits at the agent?", + "answer_choice_0": "On the agent's mustache.", + "answer_choice_1": "On the agent's chest.", + "answer_choice_2": "On the agent's ear.", + "answer_choice_3": "On the agent's chin.", + "answer_choice_4": "On the agent's neck.", + "answer_id": 1, + "answer": "On the agent's chest.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the author at 00:54, when I listened to the man with the fresh shave tell the agent that he \"writes\" while the agent \"sells.\" I focused on the author until he spit at the agent at 03:39. I observed the spit landing on the agent's chest, above his necklace." + }, + { + "key": "9jFOIkFIaVg:1235da080b7eabbcf2838a6761006fe07bb62235", + "video_id": "9jFOIkFIaVg", + "question": "How many blurry lights can be seen in the shot immediately after the one where the agent says the words \"his house was burned down\"?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 1, + "answer": "4.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for when the agent spoke the words \"his house was burned down\" in the video, and noted that he spoke these words from 02:12-02:13. I then watched the shot immediately after the one where the agent said these words, which ran from 02:16-02:25. In this shot, I counted four blurry lights, slightly overlapping one another, in the background." + }, + { + "key": "9jFOIkFIaVg:ffd4f59f0df7539add3306cd59e54c75d4e98231", + "video_id": "9jFOIkFIaVg", + "question": "Who calls the agent after he knocks out the author?", + "answer_choice_0": "His partner.", + "answer_choice_1": "His sister.", + "answer_choice_2": "His brother.", + "answer_choice_3": "His boss.", + "answer_choice_4": "His colleague.", + "answer_id": 0, + "answer": "His partner.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for the moment when the agent punched the author. He punched the author at 07:19. I waited and observed the agent. He takes out his phone at 07:35. His phone displays a caller ID with the name, Jane. To determine who Jane is, I listened and found the first instance where the two men began talking about her at 05:34, when the agent claims at 05:36 that \"She stopped loving me.\" For further evidence, I listened to his phone call with Jane from 07:44 when he happily greeted her with, \"Hey, babe,\" and told her he loved her at 08:07 before hanging up." + }, + { + "key": "9u2I5D55tfU:0a5abc4b0b39bbb023613adf46b1b30d7068dd66", + "video_id": "9u2I5D55tfU", + "question": "Once the building at 00:32 is finished, what are the two characters on the lawn in front of it?", + "answer_choice_0": "A gingerbread couple.", + "answer_choice_1": "Two replica deer.", + "answer_choice_2": "Donald and Daisy duck.", + "answer_choice_3": "The founder and his wife.", + "answer_choice_4": "Mickey Mouse and Pluto.", + "answer_id": 0, + "answer": "A gingerbread couple.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "During the first few segements of the video I noticed that the construction of the project was heavily emphasized. At 00:27 there is a man, who seems to be the founder, holding and showing a few children and parents a photo of one of the projects to be constructed. At 00:32 we can see the skeleton of the building, fully built, without details added. Finally, at 00:35 we can see the building fully realized and created. In front of the building at 00:35 I also noticed two gingerbread people. In total I count two." + }, + { + "key": "9u2I5D55tfU:0ba8efaeed24dfc32d60a49653e4cca85328fd46", + "video_id": "9u2I5D55tfU", + "question": "Which character accompanies a child down a slide?", + "answer_choice_0": "Donald Duck.", + "answer_choice_1": "Daisy.", + "answer_choice_2": "Goofy.", + "answer_choice_3": "Mickey Mouse.", + "answer_choice_4": "Pluto.", + "answer_id": 4, + "answer": "Pluto.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 01:03 when the camera pointed to a slide with a child and a character on it. From 01:03 to 01:04, I observed that the character accompanying the child down the slide was Pluto. I watched the remainder of the video to confirm that this is the only instance of a character going down a slide." + }, + { + "key": "9u2I5D55tfU:2990ebb1aa2575ccf834c03eedb08cb18698593f", + "video_id": "9u2I5D55tfU", + "question": "During the montage, what color was the horse that the boy in yellow is riding?", + "answer_choice_0": "Black with brown spots.", + "answer_choice_1": "Brown with white spots.", + "answer_choice_2": "Black.", + "answer_choice_3": "White.", + "answer_choice_4": "Brown.", + "answer_id": 3, + "answer": "White.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 01:07-01:17, I noticed a few pictures and videos included children riding, playing, or touching horses. I noticed the first picture at 01:07 and the second picture at 01:09 were vintage pictures. I immediately took notice of the second picture with the boy in the top riding the horse at 01:09. I noticed the horse he was riding was white in color." + }, + { + "key": "9u2I5D55tfU:f8cb72bd704d90406969899088d12823c345d4b9", + "video_id": "9u2I5D55tfU", + "question": "At what point does the text \"A dream comes true with Jenna Bush Hager\" appear onscreen?", + "answer_choice_0": "03:31.", + "answer_choice_1": "04:19.", + "answer_choice_2": "02:11.", + "answer_choice_3": "01:16.", + "answer_choice_4": "00:44.", + "answer_id": 0, + "answer": "03:31.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to any time text appeared onscreen. I observed that the text \"A dream comes true with Jenna Bush Hager\" appeared onscreen at 03:31. I continued watching the rest of the video to ensure that no other text appeared onscreen again." + }, + { + "key": "9u2I5D55tfU:fa86d24c2db5921af3a525fb05ee2da50f6fa462", + "video_id": "9u2I5D55tfU", + "question": "What hotel name appears onscreen in the first two minutes of the video?", + "answer_choice_0": "Best Western.", + "answer_choice_1": "Holiday Inn.", + "answer_choice_2": "Courtyard Marriott.", + "answer_choice_3": "Comfort Suites.", + "answer_choice_4": "Hampton Inn.", + "answer_id": 1, + "answer": "Holiday Inn.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the first two minutes of the video and paid attention to any time a hotel name appeared onscreen. I observed the name \"Holiday Inn\" appear as part of the opening titles at the very beginning of the video until 00:04. I observed that no other hotel names appeared onscreen through the 2 minute mark." + }, + { + "key": "AztHIuOAu7E:352dd8340f3a80645fa959c43b4c74a001c134af", + "video_id": "AztHIuOAu7E", + "question": "How many colors are present in the letters of the opening title?", + "answer_choice_0": "6.", + "answer_choice_1": "3.", + "answer_choice_2": "7.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video's opening sequence from 00:00 to 00:08, when the whole opening title, \"ChuckleVision,\" is present on the screen. From there, I observed the different colors present in the letters of \"ChuckleVision,\" which are the following: orange, green, blue, yellow, and purple. That is a total of 5 different colors." + }, + { + "key": "AztHIuOAu7E:4d386b08d01345821e898b6a752c6f9474d616cf", + "video_id": "AztHIuOAu7E", + "question": "In the opening credits, on the top left smaller screen, what number is the shorter man depicted wearing on his first shown outfit?", + "answer_choice_0": "163.", + "answer_choice_1": "155.", + "answer_choice_2": "115.", + "answer_choice_3": "132.", + "answer_choice_4": "151.", + "answer_id": 2, + "answer": "115.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At the beginning of the video, at 00:01, I watched the leftmost of the smaller screens to observe the first clip that took place on that screen. I took note of which man was shorter, identifying it as the man on the left, and then read the number pinned to his chest, which I identified as 115." + }, + { + "key": "AztHIuOAu7E:7b259231677ca36beacd256c2704f0f7be0d4f81", + "video_id": "AztHIuOAu7E", + "question": "What place name is visible onscreen between 00:58-01:03 as a sign on the wall?", + "answer_choice_0": "New Zealand.", + "answer_choice_1": "Wales.", + "answer_choice_2": "Ireland.", + "answer_choice_3": "Scotland.", + "answer_choice_4": "Spain.", + "answer_id": 3, + "answer": "Scotland.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and scrolled to the specified timeframe at 00:58. I observed a sign on the wall that said \"Scotland\" in the middle of the frame next to the man's head. I continued watching until 01:03 to ensure no other signs were visible onscreen." + }, + { + "key": "AztHIuOAu7E:93ea176d97b1a55c42d1eb393729393ee2372780", + "video_id": "AztHIuOAu7E", + "question": "What was the second letter to fall down in the beginning of the opening credits?", + "answer_choice_0": "H.", + "answer_choice_1": "C.", + "answer_choice_2": "V.", + "answer_choice_3": "S.", + "answer_choice_4": "I.", + "answer_id": 3, + "answer": "S.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At the beginning of the video, two men bring in parts of the print title. At 00:10, I noticed that one of the letters fell down after the title was in place. At 00:11, the man in the yellow shirt sees the fallen letter and hurries to put it back in place. The first letter to fall is the letter O. Right after, at 00:13, the second letter falls down. This time it is the letter S." + }, + { + "key": "AztHIuOAu7E:a127c8e1bac62bb0c81eb971a902953a827f1a4d", + "video_id": "AztHIuOAu7E", + "question": "Who answered the door at the cabin?", + "answer_choice_0": "The Scotsman.", + "answer_choice_1": "The Entrepreneur.", + "answer_choice_2": "The Plumber.", + "answer_choice_3": "The Senator.", + "answer_choice_4": "The Musician.", + "answer_id": 0, + "answer": "The Scotsman.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:29, I saw the man in the red jacket knock on the door. After the knock, the Scotsman answers the door at 00:31, which takes the man in the red jacket by surprise. I identified him as the video's depiction of a Scotsman based on his accent at 00:45, and the fact that he was wearing tartan." + }, + { + "key": "AztHIuOAu7E:a2f46f69c617eedc0f6fd5b91c49fbf1f0087c56", + "video_id": "AztHIuOAu7E", + "question": "How many times does the man with the hat with hanging corks play the didgeridoo?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "5.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the whole video and noted that the man with the hat with hanging corks was shown playing the didgeridoo at 02:35 and 08:31. This totals 2 times." + }, + { + "key": "AztHIuOAu7E:ba3b6c259f59dc88823b77b5605461479564b307", + "video_id": "AztHIuOAu7E", + "question": "What opening credit appears on the screen when the man in the red sweater knocks on the red door?", + "answer_choice_0": "Starring.", + "answer_choice_1": "Directed by.", + "answer_choice_2": "Written by.", + "answer_choice_3": "Produced & Directed by.", + "answer_choice_4": "Produced by.", + "answer_id": 2, + "answer": "Written by.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I saw the man in the red sweater appear, which happens at 00:22. From there, I kept watching until this man in the red sweater knocked on a red door at 00:29. At that point, I noted that the opening credit, \"Written by RORY CLARK\", appears on the screen." + }, + { + "key": "AztHIuOAu7E:c6df7cab33ccd33bb8821074f24ebd809daeefa6", + "video_id": "AztHIuOAu7E", + "question": "At what point in the video does the man with long white hair and a white beard disappear into thin air?", + "answer_choice_0": "07:15.", + "answer_choice_1": "02:40.", + "answer_choice_2": "11:13.", + "answer_choice_3": "08:32.", + "answer_choice_4": "12:09.", + "answer_id": 2, + "answer": "11:13.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I located the man with long white hair and a white beard first appear onscreen at 05:09. I continued watching and paid attention to the man's actions until he disappeared into thin air at 11:13. I then watched the rest of the video to ensure this event did not happen again." + }, + { + "key": "AztHIuOAu7E:ec667f784d0fe783f87f67dcc26f16d688099cd9", + "video_id": "AztHIuOAu7E", + "question": "How many times does it rain in the video?", + "answer_choice_0": "1 time", + "answer_choice_1": "2 times", + "answer_choice_2": "0 times", + "answer_choice_3": "3 times", + "answer_choice_4": "4 times", + "answer_id": 1, + "answer": "2 times", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid careful attention to each setting. I observed that it began to rain onscreen at 02:37. I continued watching the rest of the video and found another instance of rain at 08:36. I watched the rest of the video and found no more instances of rain." + }, + { + "key": "CkX3sA-8-hw:0d572ee8a97e67947f70eb6ebadd4151d1ce9781", + "video_id": "CkX3sA-8-hw", + "question": "Saito has a design on the backside of his pants, what is it of?", + "answer_choice_0": "Heart.", + "answer_choice_1": "Star.", + "answer_choice_2": "Fire.", + "answer_choice_3": "Rainbow.", + "answer_choice_4": "Square.", + "answer_id": 3, + "answer": "Rainbow.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I noticed a design on a man's pants at 00:13. The design was of a rainbow. However, I was not sure if it was on Saito's pants. So I continued to watch the video in order to find out who Saito was. At 01:13 a banner appeared on the lower part of the screen. This banner was for Saito, and listed out his stats, as well as a headshot of him. The man I saw at the beginning of the video at 00:13 with the rainbow design on the backside of his pants was Saito." + }, + { + "key": "CkX3sA-8-hw:41954d1dbf7939a911b4e6d03bba1280bb3b2dd6", + "video_id": "CkX3sA-8-hw", + "question": "How old is King Tany?", + "answer_choice_0": "25.", + "answer_choice_1": "35.", + "answer_choice_2": "42.", + "answer_choice_3": "32.", + "answer_choice_4": "45.", + "answer_id": 4, + "answer": "45.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched and listened for the commentator to identify a wrestler as King Tany. I heard him identify King Tany at 02:52. I continued watching and looking for a graphic with King Tany's stats. I found the graphic at 03:00 with King Tany's name and age. I read the number of his age as 45." + }, + { + "key": "CkX3sA-8-hw:7977e9673c0a2a452c103f32861ed7c4db744270", + "video_id": "CkX3sA-8-hw", + "question": "What color are the production lights that are shining upwards along the back wall?", + "answer_choice_0": "Purple.", + "answer_choice_1": "Black.", + "answer_choice_2": "Green.", + "answer_choice_3": "Blue.", + "answer_choice_4": "Pink.", + "answer_id": 2, + "answer": "Green.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked around the screen in order to identify where the production lights were visible. I noticed them after the camera zoomed in at 00:04. I could see the lights shining upwards and they were the color green." + }, + { + "key": "CkX3sA-8-hw:95ea7f9270fde9f1b2f5721fc97eb4a7c7e57e7c", + "video_id": "CkX3sA-8-hw", + "question": "What wrestling moves do Inaba and Aki perform from 05:30 to 05:45?", + "answer_choice_0": "Inaba and Aki tap in partners, and a four-person rumble begins.", + "answer_choice_1": "Inaba dodges a punch, Aki knocks him down with a leg sweep, and when he doesn't get up the referee counts him out.", + "answer_choice_2": "Inaba dodges a punch and throws himself to the mat. He then runs to the ropes and bounces off, repeats, crashing into Aki, where they both fall, and Inaba tags out.", + "answer_choice_3": "Aki grabs Inaba and hits him with a piledriver, knocking him out and disqualifying him.", + "answer_choice_4": "Inaba clotheslines Aki and knocks him down, he then drops an elbow onto him, and Aki rolls away and gets to his feet.", + "answer_id": 2, + "answer": "Inaba dodges a punch and throws himself to the mat. He then runs to the ropes and bounces off, repeats, crashing into Aki, where they both fall, and Inaba tags out.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the specified time from 05:30-05:45. I then observed that these moves are clearly articulated by the wrestlers." + }, + { + "key": "CkX3sA-8-hw:f5d46118d1313aefd5906cc5e90c57351822a3b7", + "video_id": "CkX3sA-8-hw", + "question": "In the first fight, there is a man wearing pants- what color are his pants?", + "answer_choice_0": "Silver.", + "answer_choice_1": "Black.", + "answer_choice_2": "Purple.", + "answer_choice_3": "Green.", + "answer_choice_4": "Gold.", + "answer_id": 0, + "answer": "Silver.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I began watching the video from the very beginning. A bell rang out that signified that the fight had started. There were two men in the center of the stage that were circling each other at 00:04. One of the men was wearing silver pants. The other man was wearing something that looked like a bodysuit with his legs exposed. Therefore, the only man wearing pants in the first match has on silver pants." + }, + { + "key": "DwRpgqbs7bY:3d6a775299b8cfa07b5ea881ef5808e67906a334", + "video_id": "DwRpgqbs7bY", + "question": "Who loses in the fifth fight?", + "answer_choice_0": "The boxer in the purple trunks.", + "answer_choice_1": "The boxer in the black trunks.", + "answer_choice_2": "The boxer in the pink trunks.", + "answer_choice_3": "The boxer in the red trunks.", + "answer_choice_4": "The boxer in the orange trunks.", + "answer_id": 1, + "answer": "The boxer in the black trunks.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I counted 4 fights before 05:58 when I saw the boxer in the flag trunks make the first move to get the fifth fight started. The boxer in the black trucks eventually loses that fight at 06:52." + }, + { + "key": "DwRpgqbs7bY:420193f7b1d834078884cc4e3e9688779f128cee", + "video_id": "DwRpgqbs7bY", + "question": "At the end of the third boxing match, what do the two boxers do?", + "answer_choice_0": "They continue fighting.", + "answer_choice_1": "They shake hands.", + "answer_choice_2": "They yell at each other.", + "answer_choice_3": "They share a hug.", + "answer_choice_4": "They say nothing.", + "answer_id": 3, + "answer": "They share a hug.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 03:55 to 03:58, I observed the boxers. At 03:55, both boxers stopped moving. They shared a hug as the match ends." + }, + { + "key": "DwRpgqbs7bY:5a95ac6338ef136f061f92976d3e1b5f6d11b434", + "video_id": "DwRpgqbs7bY", + "question": "What is the boxer wearing who throws the first punch in round two of the first fight?", + "answer_choice_0": "Gold trunks.", + "answer_choice_1": "Orange trunks.", + "answer_choice_2": "Black trunks.", + "answer_choice_3": "Red trunks.", + "answer_choice_4": "Pink trunks.", + "answer_id": 2, + "answer": "Black trunks.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 1:17, I saw the graphic for round 2. The boxer in the black trunks begins the round with a punch." + }, + { + "key": "DwRpgqbs7bY:b384099c424b3dde364305aa174c99be6f01bc3e", + "video_id": "DwRpgqbs7bY", + "question": "Who lands the first punch in the first fight?", + "answer_choice_0": "The boxer in the red trunks.", + "answer_choice_1": "The boxer in the orange trunks.", + "answer_choice_2": "The boxer in the pink trunks.", + "answer_choice_3": "The boxer in the black trunks.", + "answer_choice_4": "The boxer in the gold trunks.", + "answer_id": 3, + "answer": "The boxer in the black trunks.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching I noticed that the first match started at 00:55. Then I continued to watch and saw that the boxer with black shorts had thrown the first punch at 00:56." + }, + { + "key": "DwRpgqbs7bY:d0fd896bec8f2c51417ceaad123b1370a49ac777", + "video_id": "DwRpgqbs7bY", + "question": "Who makes the first move in the second fight?", + "answer_choice_0": "The boxer in the red trunks.", + "answer_choice_1": "The boxer in the pink trunks.", + "answer_choice_2": "The boxer in the purple trunks.", + "answer_choice_3": "The boxer in the orange trunks.", + "answer_choice_4": "The boxer in the gold and white trunks.", + "answer_id": 4, + "answer": "The boxer in the gold and white trunks.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 2:18 I saw the boxer in the gold and white trunks make the first move to get the fight started." + }, + { + "key": "DwRpgqbs7bY:d951c3d2c710bf34fcf3c45bea0086d91b2682ed", + "video_id": "DwRpgqbs7bY", + "question": "What color are the trunks of the boxer who loses the first match?", + "answer_choice_0": "Black.", + "answer_choice_1": "Red.", + "answer_choice_2": "Orange.", + "answer_choice_3": "Gold.", + "answer_choice_4": "Blue.", + "answer_id": 2, + "answer": "Orange.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 01:43 to 01:52, I observed the end of the first match, where the losing boxer was laying on the ground after being punched. He is wearing orange trunks." + }, + { + "key": "DwRpgqbs7bY:eb6ef54f3eb0f72aea99bb8d1929b872e0eb8388", + "video_id": "DwRpgqbs7bY", + "question": "How many cars can be seen driving by outside while the man in the navy sweater vest first speaks?", + "answer_choice_0": "15.", + "answer_choice_1": "16.", + "answer_choice_2": "13.", + "answer_choice_3": "11.", + "answer_choice_4": "9.", + "answer_id": 3, + "answer": "11.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the time period that the man in the navy sweater vest first speaks, which is 00:05 to 00:48. From there, I focused my attention on the glass balcony door to his right, where the road and the cars using the road are visible. After that, I counted how many cars passed within the timeframe of 00:05 to 00:48, which came to a total of 11 cars." + }, + { + "key": "DwRpgqbs7bY:ef4dfe19f4df02287a5ba852bf406d6d274142bc", + "video_id": "DwRpgqbs7bY", + "question": "How many boxing matches are discussed in the video?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "6.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "6.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Throughout the video, I observed 6 matches being discussed. The first match was presented from 00:45 to 02:00; the second from 2:00 to 3:10; the third from 3:10 to 4:00; the fourth from 4:00 to 5:45; the fifth from 5:45 to 7:05; and the sixth from 7:05 to 11:01." + }, + { + "key": "E4F77emUnqQ:0613fea310d6a7ebb7245f4cbe875349f3a75a70", + "video_id": "E4F77emUnqQ", + "question": "According to the information written on the screen, why should viewers like the video?", + "answer_choice_0": "To encourage the speaker.", + "answer_choice_1": "Their rating is important to the speaker.", + "answer_choice_2": "Their rating will increase views.", + "answer_choice_3": "To make the speaker feel good.", + "answer_choice_4": "To make the video go viral.", + "answer_id": 1, + "answer": "Their rating is important to the speaker.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching, I looked at the different information provided on the screen. At 03:23, I read the text on the right side of the screen that read, \"Hit the like, your rating is important!\" Therefore, the speaker wants viewers to like the video because it's important to him." + }, + { + "key": "E4F77emUnqQ:0fa24fece63479ba209a54eeaf709c1b17597df1", + "video_id": "E4F77emUnqQ", + "question": "How many chess pieces are on the board when the speaker explains the definition of a \"skewer\"?", + "answer_choice_0": "12.", + "answer_choice_1": "8.", + "answer_choice_2": "4.", + "answer_choice_3": "10.", + "answer_choice_4": "6.", + "answer_id": 4, + "answer": "6.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the video until the speaker started to explain the definition of the chess tactic \"skewer\" at 02:14. I also observed the word \"skewer\" on the right side of the screen. I then counted how many chess pieces were positioned on the chess board during this time. I counted a total of 6 chess pieces." + }, + { + "key": "E4F77emUnqQ:1cdfc1276ed2c5bfdfade2caab38e12a4b34146c", + "video_id": "E4F77emUnqQ", + "question": "What are the first pieces the narrator uses to demonstrate a fork technique?", + "answer_choice_0": "A black knight and a white bishop.", + "answer_choice_1": "A white rook and a white king.", + "answer_choice_2": "A white rook and a white bishop.", + "answer_choice_3": "A black rook and a black knight.", + "answer_choice_4": "A black knight and a white king.", + "answer_id": 1, + "answer": "A white rook and a white king.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching the video, I saw the segment where the speaker explains a fork tactic and what it means. At 00:33, the speaker begins to demonstrate the fork tactic. With a white rook and a white king, he demonstrates how to successfully steal one of black's pieces using the fork technique." + }, + { + "key": "E4F77emUnqQ:4531a4a3bcf6b7c0a4bc86df34cd65a2dbc2046c", + "video_id": "E4F77emUnqQ", + "question": "What does the speaker do to show viewers which chess piece he is talking about?", + "answer_choice_0": "Circle the chess piece in yellow.", + "answer_choice_1": "Highlights the chess piece box in red.", + "answer_choice_2": "Point a red arrow to the chess piece.", + "answer_choice_3": "Zooms in on the chess piece.", + "answer_choice_4": "Gray out all the other chess boxes.", + "answer_id": 1, + "answer": "Highlights the chess piece box in red.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching, I listened as the speaker was describing the different chess tactics. As he was talking about the pieces, the screen would highlight the chess piece boxes red, such as at 01:30 when he's talking about the bishop. Sometimes the speaker would use arrows to point at the pieces as well, but the arrows are orange and not red. Therefore, the speaker highlights the chess piece box in red." + }, + { + "key": "E4F77emUnqQ:bd26d992d4046cc20c96c61efb9cea42edfd443c", + "video_id": "E4F77emUnqQ", + "question": "When the word, \"zugzwang\" first appears on the screen, which chess pieces are situated on the board?", + "answer_choice_0": "1 white queen, 1 black king, 1 white king, 2 black rooks.", + "answer_choice_1": "1 white king, 1 black queen, 1 white bishop, 1 black king.", + "answer_choice_2": "1 white king, 1 black king, 2 white bishops, 2 black pawns.", + "answer_choice_3": "1 black king, 1 white knight, 1 black bishop, 3 white pawns, 1 white king", + "answer_choice_4": "1 white king, 1 black bishop, 1 white rook, 1 black king.", + "answer_id": 4, + "answer": "1 white king, 1 black bishop, 1 white rook, 1 black king.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I watched the video and identified the word \"zugzwang\" on the right side of the screen at 08:08. I then turned my attention to identifying which chess pieces were positioned on the chess board at this time. I identified 1 white king, 1 black bishop, 1 white rook, and 1 black king." + }, + { + "key": "E4F77emUnqQ:c6dd826927052ba7779d7f1a0daed1d64df49c86", + "video_id": "E4F77emUnqQ", + "question": "Which space is the white king positioned on the board during the explanation of an \"X-ray attack\"?", + "answer_choice_0": "h1.", + "answer_choice_1": "g3.", + "answer_choice_2": "f4.", + "answer_choice_3": "c6.", + "answer_choice_4": "b2.", + "answer_id": 1, + "answer": "g3.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched until the speaker started to explain the definition of the chess tactic \"X-ray attack\" at 07:14. The words \"X-ray attack\" also appear on the right side of the screen. I then looked for which space the white king was positioned during this explanation. I located the white king in space g3 on the chess board." + }, + { + "key": "E4F77emUnqQ:e0fea9c9e30effe83944bf9ae27e4b3d5b9d0287", + "video_id": "E4F77emUnqQ", + "question": "When the word \"undermining\" appears on the screen, which space on the board is not occupied by a chess piece?", + "answer_choice_0": "a2.", + "answer_choice_1": "f7.", + "answer_choice_2": "b5.", + "answer_choice_3": "g4.", + "answer_choice_4": "h1.", + "answer_id": 2, + "answer": "b5.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched until the word \"undermining\" appeared as a chess tactic on the screen from 09:13-09:40. I then observed which spaces were occupied by chess pieces and which spaces were not during this timeframe. I noticed that b5 was not occupied by a chess piece." + }, + { + "key": "E5dOAWyh3uk:9c900a69e73ef08a0f587396658f958b4765b947", + "video_id": "E5dOAWyh3uk", + "question": "What accessory/accessories is Priyanka Chopra wearing when she discusses being thrown out of a film and replaced?", + "answer_choice_0": "A chunky silver necklace and silver rings.", + "answer_choice_1": "Large, circular, silver earrings.", + "answer_choice_2": "Large, circular, silver earrings and silver rings.", + "answer_choice_3": "A chunky silver necklace.", + "answer_choice_4": "Large, circular gold earrings and a silver ring.", + "answer_id": 2, + "answer": "Large, circular, silver earrings and silver rings.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, waiting for Priyanka Chopra to discuss the time she was thrown out of a film and replaced. This scene begins at 01:51, when a male interviewer asks her if this is something that happened. At 01:53, I saw Priyanka onscreen confirming that it did happen, and she is wearing large, circular, silver earrings. As she continues the discussion, I could see at 01:58 that she is also wearing at least one silver ring." + }, + { + "key": "E5dOAWyh3uk:9ef106cd7eeda4d27d4a27f3fa4460bbb21674a4", + "video_id": "E5dOAWyh3uk", + "question": "What outfit is Priyanka wearing in the clip from 02:32-02:35?", + "answer_choice_0": "A saree.", + "answer_choice_1": "A wedding dress.", + "answer_choice_2": "A red dress.", + "answer_choice_3": "A black dress.", + "answer_choice_4": "A ballgown.", + "answer_id": 2, + "answer": "A red dress.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and the specified clip at 02:32. In the clip, Priyanka is dancing with many dancers behind her. She is in the front wearing a red dress." + }, + { + "key": "E5dOAWyh3uk:d724ce70fb7f98bc4f724e59d92052d74a042ad2", + "video_id": "E5dOAWyh3uk", + "question": "Why is the particular clip of Priyanka at 02:46 shown at that point of her voiceover?", + "answer_choice_0": "The clip is of her running fast as the voiceover is about the hard work she put into her career.", + "answer_choice_1": "The clip is of her posing for photoshoots as she talks about her low self esteem she had.", + "answer_choice_2": "The clip is of her dancing at her wedding as she talks about her love for Nick Jonas.", + "answer_choice_3": "The clip is of her crying as the voiceover is about her dad's illness.", + "answer_choice_4": "The clip is of her laughing as the voiceover about overcoming challenges.", + "answer_id": 3, + "answer": "The clip is of her crying as the voiceover is about her dad's illness.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and noticed that Priyanka's voiceover is from an interview where she talks about the illness and eventual death of her father, whom she was very close to. The clip used at 02:46 is a clip of her crying as her voiceover explains this part of her life and what a struggle it was. So the clip is used to depict the same emotion that Priyanka felt during the event of losing her dad--immense sadness." + }, + { + "key": "E5oMSKck2J8:1abb75f019b3f07dbd00c401a3d57575b5e10127", + "video_id": "E5oMSKck2J8", + "question": "What is the last name of the person whose credit is cut off at 02:16?", + "answer_choice_0": "Burgess.", + "answer_choice_1": "Smith.", + "answer_choice_2": "Degrassi.", + "answer_choice_3": "Bergasse.", + "answer_choice_4": "Kelly.", + "answer_id": 3, + "answer": "Bergasse.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched for an on-screen title that fades in on the left at 02:16, which is visibly cut off. I then read the last name, which is Bergasse." + }, + { + "key": "E5oMSKck2J8:d1304bac84ab674ce5b679ba1cbb0bd3821ee62c", + "video_id": "E5oMSKck2J8", + "question": "When does the man in the glasses begin to speak?", + "answer_choice_0": "01:51.", + "answer_choice_1": "02:59.", + "answer_choice_2": "02:53.", + "answer_choice_3": "01:56.", + "answer_choice_4": "03:04.", + "answer_id": 3, + "answer": "01:56.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched for the man in the glasses to be handed the microphone. I then observed as the man commenced speaking at 01:56." + }, + { + "key": "E5oMSKck2J8:d50049bbf3fc523e52416b6e099fbc6fba415c7c", + "video_id": "E5oMSKck2J8", + "question": "What is the hair color of the woman wearing a metallic colored dress?", + "answer_choice_0": "Black.", + "answer_choice_1": "Gray.", + "answer_choice_2": "Brown.", + "answer_choice_3": "Blonde.", + "answer_choice_4": "Red.", + "answer_id": 3, + "answer": "Blonde.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "There is one woman who is highly visible for most of the video. She is wearing a gold dress with a detailed design. This woman has blonde hair." + }, + { + "key": "E7cAz-bnsqM:5061744ada6afda036f049cadd37cac4708aaf23", + "video_id": "E7cAz-bnsqM", + "question": "Between the chess moves in the main game where the adult moves his knight to E6 and the child moves his pawn to D3, in what direction does the female chess player wearing jeans walk?", + "answer_choice_0": "To the center.", + "answer_choice_1": "To the back.", + "answer_choice_2": "To the front.", + "answer_choice_3": "She does not move.", + "answer_choice_4": "To the left.", + "answer_id": 1, + "answer": "To the back.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I located the play in the main game where the adult chess player moves his knight to E6 and found that this occurs at 05:46. I was able to determine which cell the knight moved to by observing a computer generated image of the board in the center of the top of the screen that mirrors the game play. I then looked for a female chess player walking. I saw her get up from her chair at 06:04 and then walk towards the back of the room. She remains there until the child moves his pawn to D3 at 06:12. I confirmed that the pawn moves to D3 by observing the computer generated image of the board in the center of the top of the screen. Therefore, the female player moves to the back of the room." + }, + { + "key": "E7cAz-bnsqM:5b96174033ec8743c3be54a18af8d144ea5dc6d0", + "video_id": "E7cAz-bnsqM", + "question": "What is the time difference on the clock in the match featuring an adult vs. a child in a black shirt at the end of the play where the first rook is removed from the board?", + "answer_choice_0": "18 seconds.", + "answer_choice_1": "14 seconds.", + "answer_choice_2": "22 seconds.", + "answer_choice_3": "8 seconds.", + "answer_choice_4": "12 seconds.", + "answer_id": 4, + "answer": "12 seconds.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the match for the play when the first rook was removed from the board - this occurred at 08:18, when the child opponent took the adult's rook from C5. The child then clocked out at the end of this play, also during the 08:18 mark. After this, I observed that the clock showed 18 seconds remaining for the adult, and 6 seconds for the child opponent. I did the equation, 18-6=12. Therefore, there is a 12 second difference on the play clock." + }, + { + "key": "E7cAz-bnsqM:5dfa9422bffeef7b3118fe3eae30d65e089cfea9", + "video_id": "E7cAz-bnsqM", + "question": "When the child opponent in the black shirt takes the adult's pawn at B4 and stops the clock, how much time is left on the child opponent's clock?", + "answer_choice_0": "00:13.", + "answer_choice_1": "00:19.", + "answer_choice_2": "00:11.", + "answer_choice_3": "00:16.", + "answer_choice_4": "00:18.", + "answer_id": 4, + "answer": "00:18.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I looked for a moment in the video where a child in a black shirt takes his adult opponent's pawn at B4, and found this occurs at 06:56. As I saw this happen, I also looked at the computer generated image of the game centered at the top of the screen to determine which cell the pawn was in. I clearly saw that the adult opponent's white pawn was in cell B4. Immediately after this happens, the child in a black shirt stops his clock. I then read the clock face to determine that the child opponent has 18 seconds left on his clock after making this move." + }, + { + "key": "E7cAz-bnsqM:6b2a73763597e35d2ff711be9a8d62f9591c26c6", + "video_id": "E7cAz-bnsqM", + "question": "Where is the man in the suit and tie in relation to the long row of chess tables between 02:05 - 02:17?", + "answer_choice_0": "Bent over behind them.", + "answer_choice_1": "Sitting to the right of them.", + "answer_choice_2": "Standing to the right of them.", + "answer_choice_3": "Standing to the left of them.", + "answer_choice_4": "Standing directly behind them.", + "answer_id": 4, + "answer": "Standing directly behind them.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I located the row of chess tables and saw they run in a row away from the main chess match towards the back of the room. Next, I located the 02:05 timestamp and saw the man in a suit and tie standing directly behind the row of tables. He remained standing until 02:17, before bending down to place a handkerchief on the table at 02:19. Therefore, the man in the suit and tie is standing directly behind the long row of chess tables between 02:05-02:17." + }, + { + "key": "E7cAz-bnsqM:6cd23b95c3bddf2e707be2297e8bd67fdc313708", + "video_id": "E7cAz-bnsqM", + "question": "From what square is the first overall piece removed from the game in the adult vs a child opponent in a black shirt match?", + "answer_choice_0": "B6.", + "answer_choice_1": "C6.", + "answer_choice_2": "B4.", + "answer_choice_3": "C4.", + "answer_choice_4": "C8.", + "answer_id": 1, + "answer": "C6.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I located the part of the match where the first overall piece was removed from the board - this occurred at 01:55, when the adult's bishop took the child opponent's knight. I then read the computer generated chessboard displayed at the top and center of the screen which mirrors the game play. I observed that it has the squares labeled with letters and numbers, and saw the knight was taken from square C6." + }, + { + "key": "E7cAz-bnsqM:a650b59b683ccfe2a9ebe0f8acce48891bfe00b5", + "video_id": "E7cAz-bnsqM", + "question": "What chess play follows the fourth instance of the boy in the black shirt touching his forehead with his right hand?", + "answer_choice_0": "White bishop to B5.", + "answer_choice_1": "Black knight to C6.", + "answer_choice_2": "White pawn to D3.", + "answer_choice_3": "Black pawn to D5.", + "answer_choice_4": "White knight to E2.", + "answer_id": 4, + "answer": "White knight to E2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I observed that the adult chess player is playing the white pieces and the boy in the black shirt is playing the black pieces by looking at which section of the board they are sitting behind at 00:00. I then looked for a moment where the boy in the black shirt touches his forehead with his right hand. I found he is already touching his forehead with his right hand at 00:00 and counted this as the first instance. I found this occurs for the second time at 00:46, and for a third time at 00:54. I then observed that the child moves his pawn to D5 at 01:11. Several chess moves occur until the boy puts his forehead in both hands, including his right hand, at 01:59. Immediately following this, the adult player moves his knight to E2. I confirmed on the computer generated image of the board that the cell the knight moves to is E2 at 02:00. Therefore, the chess play that follows the fourth instance of the boy in the black shirt touching his forehead with his right hand is white knight to E2." + }, + { + "key": "E7cAz-bnsqM:cddc8dc0e88499c873c34f8889928428f73ac1d6", + "video_id": "E7cAz-bnsqM", + "question": "How many times is a pawn moved on the most foregrounded chessboard during the first 2 minutes of the video?", + "answer_choice_0": "7.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "8.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "8.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the video from 00:00-02:00, counting the number of times a pawn is moved on the most foregrounded chessboard in the shot, where an adult faces off against a child. The first time a pawn is moved is at 00:27, the second time at 00:29. The third time occurs at 00:32, the fourth time at 00:40, and the fifth time at 01:09. A pawn is moved for the sixth time at 01:51, and the seventh time from 01:53-01:54. A pawn is moved for the eighth and final time in this span at 01:56. I counted up the total number of times a pawn is moved and got 8." + }, + { + "key": "E7cAz-bnsqM:fcd94fae5c030c9053c99d30bb931b02ff5f1fda", + "video_id": "E7cAz-bnsqM", + "question": "From 07:00-08:00, which of the following piece types is moved most frequently in the match featuring an adult vs a child in a black shirt?", + "answer_choice_0": "Queen.", + "answer_choice_1": "Knight.", + "answer_choice_2": "King.", + "answer_choice_3": "Rook.", + "answer_choice_4": "Pawn.", + "answer_id": 1, + "answer": "Knight.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the match from 07:00-08:00, paying attention to when each piece was played, and what that piece was. I observed the child move a knight at 07:06, and the adult moved a knight at 07:18. The adult also moved a pawn at 07:07, but this was not a chess move, only a move to center the piece back into the square. I saw the child move a knight at 07:26, and the adult moved his queen at 07:38 to capture the child's pawn. I then watched the child move his king at 07:42 to capture the adult's queen. I observed the adult move a knight at 07:44 to capture the child's queen, the child move his king at 07:47, the adult move a knight at 07:50 to capture the child's bishop, and the child move a knight at 07:51. I saw the adult move a rook at 07:56, and the child moved a knight at 07:57 to capture the adult's pawn. Finally, I watched the adult move a rook at 07:59. The total tally of piece types moved in chess plays is therefore knight: 8, queen: 1, king: 2, and rook: 2. Therefore, the knight is moved most frequently during 07:00-08:00." + }, + { + "key": "ECMMct_jnEM:242363e81a90355e845485bcd443c5fe48b29042", + "video_id": "ECMMct_jnEM", + "question": "What spaces do the highlighted pawns occupy when the host pumps his arms and says, \"I'm so smart...\"?", + "answer_choice_0": "g2 and h4.", + "answer_choice_1": "b7 and c7.", + "answer_choice_2": "f1 and f3.", + "answer_choice_3": "f2 and f4.", + "answer_choice_4": "a7 and b7.", + "answer_id": 3, + "answer": "f2 and f4.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I located the timestamp starting at 12:27, when the host deepens his voice, pumps his arms, and says jokingly, \"I'm so smart...\" I looked for the locations of the highlighted pawns on the board and found they were positioned above and below a white knight, on f2 and f4." + }, + { + "key": "ECMMct_jnEM:285f2b3077143cfa637e4dc27e0ed3dc9e0447f4", + "video_id": "ECMMct_jnEM", + "question": "What chess piece is highlighted on the board when the host acknowledges Gotham Chess as one of his favorite creators?", + "answer_choice_0": "Queen's pawn.", + "answer_choice_1": "King.", + "answer_choice_2": "Queen.", + "answer_choice_3": "King's pawn.", + "answer_choice_4": "Castle.", + "answer_id": 0, + "answer": "Queen's pawn.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I listened for the mention of \"Gotham Chess\" to be acknowledged as one of his \"favorite creators\" and heard this occurred from 00:58-01:00 when he says \"Shoutout to Gotham Chess, one of my favorite creators.\" I observed the board during this time frame and noticed that two squares were highlighted yellow. One of these squares, d4, had a piece on it, a white pawn. I rewound the video to learn the specific name of the pawn. At 00:41, I heard the speaker call this piece \"the Queen's pawn\" as he moved it from d2 to d4." + }, + { + "key": "ECMMct_jnEM:304af29d45261fd0b303f6537d54de88a7dd8c58", + "video_id": "ECMMct_jnEM", + "question": "In the first demonstration of the London System, which piece does the speaker prefer to mobilize into the middle?", + "answer_choice_0": "The king-side bishop.", + "answer_choice_1": "The king's pawn.", + "answer_choice_2": "The king-side knight.", + "answer_choice_3": "The queen-side knight.", + "answer_choice_4": "The queen-side bishop.", + "answer_id": 2, + "answer": "The king-side knight.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I heard the speaker say \"The London System begins with the Queen's pawn\" at 00:41 and determined that this was the beginning of the first demonstration. I continued watching and listened for the word \"mobilize\" or \"mobilizing\". From 03:21-03:25, I heard the speaker say, \"the central game plan I like to employ is mobilizing directly into the middle.\" While the speaker was saying this, I observed that the white knight on f3 was picked up and moved two squares up and one to the left into e5. To determine which knight this was, I went back to the beginning of the demonstration at 00:41 and paid attention to which piece moved into f3. I observed the king-side knight move from g1 to f3 at 02:06. I confirmed that no other piece moved into this square before 03:21. Therefore, I determined that in this demonstration of the London System, the speaker prefers to mobilize the king-side knight into the middle." + }, + { + "key": "ECMMct_jnEM:32084b18ec3db9950b18af5a082acd0c93942260", + "video_id": "ECMMct_jnEM", + "question": "In game 1, does white ever castle long?", + "answer_choice_0": "Yes, at 16:50.", + "answer_choice_1": "Yes, at 16:15.", + "answer_choice_2": "Yes, at 16:35.", + "answer_choice_3": "No, white castles short.", + "answer_choice_4": "No, white doesn't castle.", + "answer_id": 2, + "answer": "Yes, at 16:35.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I understood that castling is a special move that allows two pieces (the king and a rook) to move at the same time if certain conditions are present. I heard the speaker say \"if the king ever goes short castle\" at 02:40. At this time, I noticed there was also a graphic of an arrow from the black king's starting position to the h8 square, demonstrating the direction of a \"short castle.\" I heard the speaker say \"castle long\" at 13:51. As the speaker said this, I observed that they castled with the queen-side rook. I moved to the beginning of the first game, which occurred with white's opening move at 15:47. I observed that at 16:15 the conditions for a long castle were available to white. And at 16:35 I observed that white castled long by moving the king to c1 and the queen-side rook to d1." + }, + { + "key": "ECMMct_jnEM:57509cf30a0030d62c9f96e1f5e473279f12db22", + "video_id": "ECMMct_jnEM", + "question": "How many pieces are activated when the speaker says \"as we wrap up the theoretical portion\"?", + "answer_choice_0": "2.", + "answer_choice_1": "10.", + "answer_choice_2": "4.", + "answer_choice_3": "8.", + "answer_choice_4": "6.", + "answer_id": 3, + "answer": "8.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I listened for the target phrase and heard it from 13:02-13:04. During this period, I observed that the board was static. I understood that \"activated\" pieces are pieces that have moved from their starting position. Of black's pieces, I observed that the bishop, king pawn, queen pawn, and king-side knight had all moved from their starting positions. Of white's pieces, I observed that the king and queen pawns had moved, in addition to the king-side knight and the queen-side bishop. Thus, I counted a total of eight pieces activated when the target phrase was said." + }, + { + "key": "ECMMct_jnEM:70b05926945b964a6acd7b9dc5ed820ee5938938", + "video_id": "ECMMct_jnEM", + "question": "How many non-light brown or dark brown squares are shown on the board when the word \"pyramid\" is said for the third time?", + "answer_choice_0": "11.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "0.", + "answer_choice_4": "8.", + "answer_id": 4, + "answer": "8.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I listened for the target word and counted each occurrence. The first occurrence was at 01:48. The second occurrence was at 01:51. The third occurrence was at 02:35. I observed the board at this point and saw that there were five squares highlighted in blue (b2, c3, d4, e3, and f2). I also observed a square highlighted in red (d3). Finally, I observed two squares highlighted in yellow (e8 and g8). I counted the total number of squares highlighted a color other than the standard light and dark brown of the chess board, and counted 8 total." + }, + { + "key": "ECMMct_jnEM:79cd68ad7a22cb38859c14f92b02bd252576ce32", + "video_id": "ECMMct_jnEM", + "question": "What movement is the speaker describing when he says \"develop\" for the first time?", + "answer_choice_0": "Bringing the queen into the center of the board.", + "answer_choice_1": "Using a bishop to challenge white's bishop.", + "answer_choice_2": "Using a pawn to mirror white's opening move.", + "answer_choice_3": "Castling the rook and king.", + "answer_choice_4": "Bringing a knight out of its starting position.", + "answer_id": 4, + "answer": "Bringing a knight out of its starting position.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I listened for the target word and heard it at 01:44. I noticed that there were two squares highlighted in yellow: g8 and f6, where a black knight was. I went backwards 3 seconds to confirm that that was the movement that just happened. At 01:41, I noticed that all but one of black's pieces were in their starting positions. Then at 01:42 I observed the black king-side knight move from g8 to f6. There were no more movements before \"develop\" was spoken at 01:44. Therefore, I concluded that when the word \"develop\" is spoken at 01:44. The speaker is referring to bringing the knight out of its starting position." + }, + { + "key": "ECMMct_jnEM:7c792d206a5adf6c680e4ab7b50ac9c41dff66a9", + "video_id": "ECMMct_jnEM", + "question": "After the host introduces the concept of a \"typical position that you are after in the London\", how much time passes before the last side of this position is drawn?", + "answer_choice_0": "25 seconds.", + "answer_choice_1": "22 seconds.", + "answer_choice_2": "21 seconds.", + "answer_choice_3": "20 seconds.", + "answer_choice_4": "23 seconds.", + "answer_id": 4, + "answer": "23 seconds.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "The host introduces the pyramid, a typical London position, starting at 01:28. The first side demonstrated is the right side. While the host was speaking at 01:47, 3 spaces were highlighted in red: f2, e3, and d4. The second side demonstrated was the left. At 01:50, c3 was highlighted and at 01:51, b2 was highlighted. By 01:52, the pyramid was complete with an orange triangular outline. Solving the problem 151-128=23, I determined 23 seconds passed before the last side was drawn." + }, + { + "key": "ECMMct_jnEM:dd1ac5639dc636f05b968fd6263dff2f2668c510", + "video_id": "ECMMct_jnEM", + "question": "What is the next to last chess piece highlighted in yellow before the host switches from a pyramid plan to set up the Queen's Gambit?", + "answer_choice_0": "White bishop", + "answer_choice_1": "White knight", + "answer_choice_2": "Black pawn", + "answer_choice_3": "White pawn", + "answer_choice_4": "Black bishop", + "answer_id": 3, + "answer": "White pawn", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I found the section of video at 09:48 where the host mentions abandoning the pyramid plan. It turns out he abandoned the plan slightly before he talked about it because he mentions a \"Queen's Gambit\" at 09:45, and moves a white pawn from c2 to c4. This begins the Queen's Gambit. I then went back to find the last chess piece highlighted in yellow before the Queen's Gambit begins. This is the black bishop at 09:37. I then went back to find the next to last chess piece highlighted in yellow. At 09:23, the highlight on the white pawn changes from red to yellow, making it the next to last chess piece highlighted in yellow before the host abandons the pyramid plan to set up the Queen's Gambit." + }, + { + "key": "FJlnDef8Qww:1ea041ba593e3d5e097a3d14b4ca528fc620f8d8", + "video_id": "FJlnDef8Qww", + "question": "What tattoo lounge is a sponsor of this event?", + "answer_choice_0": "High Tide Tattoo Shop.", + "answer_choice_1": "Neon Moon Tattoo Shop.", + "answer_choice_2": "Craft & Co Tattoo Lounge.", + "answer_choice_3": "Blue Lagoon Tattoo.", + "answer_choice_4": "Adventus Tattoo Lounge.", + "answer_id": 4, + "answer": "Adventus Tattoo Lounge.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for signs of a tattoo shop sponsor and saw at 00:27 that there was an advertisement being projected onto the screens behind the fight stage. One of the advertisements shows an ad for Adventus Tattoo Lounge. This tattoo shop is a sponsor of this event." + }, + { + "key": "FUJYcbCZFeI:016aa03958545e5699ced7b0ac49cc68ca4f7d1d", + "video_id": "FUJYcbCZFeI", + "question": "How many lightbulbs appear on the screen at 00:13?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "6.", + "answer_choice_3": "1.", + "answer_choice_4": "13.", + "answer_id": 0, + "answer": "8.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I went to 00:13 in the video. Then I identified the lightbulbs on the screen. I counted them and got 8. Therefore, there are 8 lightbulbs on the screen at 00:13." + }, + { + "key": "FUJYcbCZFeI:58be937b25841ac8bf11fe8734f08deb05974548", + "video_id": "FUJYcbCZFeI", + "question": "Which major and minor pieces are vertically stacked from top to bottom on the chess board when the man says, \"it's quite an advanced-level position\" in the last minute of the video?", + "answer_choice_0": "Knight, Bishop, Knight", + "answer_choice_1": "Rook, Bishop, Knight", + "answer_choice_2": "Queen, Bishop, Bishop", + "answer_choice_3": "Queen, Rook, Bishop", + "answer_choice_4": "Bishop, Queen, Knight", + "answer_id": 1, + "answer": "Rook, Bishop, Knight", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I scrolled to the last minute of the video, and I heard the man say \"it's quite an advanced-level position\" at 15:43-15:44. I then observed which spaces have major and minor pieces on the board. From common knowledge of chess, I know that the major pieces are the queen and rook, while minor pieces are the bishop and knight. I noticed that there is only one vertical stack of major and minor pieces, and it is composed entirely of black pieces from A5-A7. The stack at G1-G3 doesn't count, because the king is neither a major piece nor a minor one. From top to bottom, the vertical stack with major and minor pieces consists of the rook, the bishop, and the knight." + }, + { + "key": "FUJYcbCZFeI:a06ad6b783740c81f43c942ca00a92a6542a0eb8", + "video_id": "FUJYcbCZFeI", + "question": "What fraction of logos that remain on-screen for the majority of the video have a \"g\" in them?", + "answer_choice_0": "3/4", + "answer_choice_1": "2/3", + "answer_choice_2": "1/3", + "answer_choice_3": "1/4", + "answer_choice_4": "1/2", + "answer_id": 2, + "answer": "1/3", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "Starting at 00:00, I looked on the right side of the screen, and I noticed 3 logos that remain for the majority of the video, only briefly disappearing when an on-screen graphic covers them. The first, near the top, has an image of a crown surrounded by some red and gold ribbons, placed against a black, circular background with text beside it that reads \"Remote CHESS ACADEMY.\" The second, near the bottom, is a black banner with a red square that has \"GM\" in the red square, and \"IGOR SMIRNOV\" in the black banner. The third, to the right of the second, is a gray banner which contains a small red globe with white lines crossing vertically and horizontally, and a line of text that reads \"CHESS-TEACHER.COM\". I examined each of these logos and realized that only the second contains the letter \"g\". When I put this into a fraction, 1 out of 3, I came up with 1/3." + }, + { + "key": "FUJYcbCZFeI:ca470538b5892b3ce8ba81fdd16d5c2d0840d8c1", + "video_id": "FUJYcbCZFeI", + "question": "What direction is the orange arrow facing when the man says, \"The best way for you to play chess and win is actually to attack\"?", + "answer_choice_0": "Left.", + "answer_choice_1": "Right.", + "answer_choice_2": "Up.", + "answer_choice_3": "Down.", + "answer_choice_4": "Diagonal.", + "answer_id": 2, + "answer": "Up.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching the video, I listened for when the man says, \"The best way for you to play chess and win is actually to attack.\" He says it at 08:00-08:03. Then, I looked at the orange arrow and noticed that it was pointing upwards. Therefore, the orange arrow is pointing up when the man says, \"The best way to for you to play chess and win is actually to attack.\"" + }, + { + "key": "FUJYcbCZFeI:ecbcdd37971088e060f33876c7e902585cdcd7b4", + "video_id": "FUJYcbCZFeI", + "question": "Which chess pieces are highlighted in red on the chess board at 12:12?", + "answer_choice_0": "1 black pawn, 2 black knights, 1 black rook, 1 black bishop.", + "answer_choice_1": "1 black king, 2 black rooks, 1 black knight, 1 black pawn.", + "answer_choice_2": "1 black queen, 1 black rook, 1 black bishop, 2 black pawns.", + "answer_choice_3": "1 black king, 2 black pawns, 1 black knight, 1 black bishop.", + "answer_choice_4": "1 black rook, 2 black knights, 2 black pawns.", + "answer_id": 0, + "answer": "1 black pawn, 2 black knights, 1 black rook, 1 black bishop.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I scrolled to the specified timestamp in the video at 12:12, and I observed 5 spots highlighted in red on the chess board. I then identified the chess pieces that were highlighted, which were 1 black pawn, 2 black knights, 1 black rook, and 1 black bishop." + }, + { + "key": "FUJYcbCZFeI:fef40aa4710124a042870e1645119c0ad9e79a95", + "video_id": "FUJYcbCZFeI", + "question": "Which chess board spaces contain the knight's yellow arrow, while the man says, \"The best way for you to play chess and to win is actually to attack\"?", + "answer_choice_0": "f3, e3, d3, d4.", + "answer_choice_1": "g6, f6, e6, e7.", + "answer_choice_2": "h2, g2, f2, f3.", + "answer_choice_3": "c5, b5, a5, a6.", + "answer_choice_4": "d5, d6, e6, f6.", + "answer_id": 0, + "answer": "f3, e3, d3, d4.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the video until the man said, \"The best way for you to play chess and to win is actually to attack\" at 08:00-08:03. I then observed which spaces on the chess board that contained a yellow arrow coming from the knight, and the answer is f3, e3, d3, and d4." + }, + { + "key": "FadiuRRgvAw:08798b3641046a47714895a935f8445fe302f5f1", + "video_id": "FadiuRRgvAw", + "question": "How does the lighter-haired woman feel as she explains the Narwhal song?", + "answer_choice_0": "Eager.", + "answer_choice_1": "Confused.", + "answer_choice_2": "Embarrassed.", + "answer_choice_3": "Angry.", + "answer_choice_4": "Proud.", + "answer_id": 2, + "answer": "Embarrassed.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the section of the video where the woman explains the Narwhal song re-work that she did in her head: this takes place from 01:10-01:40. I watched her expression closely as she explained it and was quizzed by her co-star - her face was downcast and scrunched with cringe, indicating she was embarrassed." + }, + { + "key": "FadiuRRgvAw:9c49bba960a47e3e3a4260b72e5b870470eea7a0", + "video_id": "FadiuRRgvAw", + "question": "What line from the Doctor Who clip first causes the lighter-haired woman to put her hand over her mouth?", + "answer_choice_0": "\"Do you feel stupid?\"", + "answer_choice_1": "\"Bow ties are cool.\"", + "answer_choice_2": "\"Amy, this is me.\"", + "answer_choice_3": "\"So you're like a space squid.\"", + "answer_choice_4": "\"Maybe you need to change the pump.\"", + "answer_id": 0, + "answer": "\"Do you feel stupid?\"", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the section of the video where the Doctor Who clip plays, from 02:18 to 03:52, to listen to the lines spoken by the characters in the clip. I also watched the woman with the lighter hair to see when she put her hand over her mouth. At 02:49, I listened to the red-haired character in Dr. Who ask \"Do you feel stupid?\" and as a result, watched the lighter-haired woman cover her mouth with her hand. This is the first time in the video she makes this gesture while watching the clip." + }, + { + "key": "FadiuRRgvAw:e2f136372498483f5262392aaf5683568d5b9420", + "video_id": "FadiuRRgvAw", + "question": "How do the two hosts feel when their names are listed below them?", + "answer_choice_0": "Neutral and unamused.", + "answer_choice_1": "Pensive and whimsical.", + "answer_choice_2": "Happy and excited.", + "answer_choice_3": "Flirtatious and sultry.", + "answer_choice_4": "Sad and disappointed.", + "answer_id": 2, + "answer": "Happy and excited.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to when the graphics listed the hosts name, from 00:06 to 00:12. I then watched that section, paying attention to the hosts' body language, and saw they were smiling, and moving excitedly." + }, + { + "key": "FadiuRRgvAw:f01fd8f96165578607586e30e5ba8e8261799a8b", + "video_id": "FadiuRRgvAw", + "question": "How many \"mini episodes\" of Doctor Who do the two hosts watch together in this video?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video all the way through. From 02:15 to 03:52, I observed the hosts as they watched a \"mini episode\" of Doctor Who. This was the only episode the hosts watched throughout; therefore, the answer is one." + }, + { + "key": "FkuqYtE1rw0:0184946251402312bd6218fe99aef8af31229495", + "video_id": "FkuqYtE1rw0", + "question": "What is the sum of all the visible cards when the text \"UNO!\" appears on-screen for the second time?", + "answer_choice_0": "9.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "7.", + "answer_id": 1, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I saw the text \"UNO!\" appear on-screen for the first time at 01:19. Next, I saw the text appear on-screen for the second time at 01:23. At the same time, I saw the only cards that were visible, which were a yellow 5 and a yellow 0. I then calculated 5+0=5. Therefore, the sum of all the visible cards when the text \"UNO!\" appears on-screen for the second time is 5." + }, + { + "key": "FkuqYtE1rw0:169cdc1dd643db3ed5f40db6c1ed61e5819fa38c", + "video_id": "FkuqYtE1rw0", + "question": "After the player plays their wild card, before the wild shuffle hands card is discussed, what color do they change it to?", + "answer_choice_0": "Green Card.", + "answer_choice_1": "Wild shuffle hands Card.", + "answer_choice_2": "Red Card.", + "answer_choice_3": "Blue Card.", + "answer_choice_4": "Yellow Card.", + "answer_id": 4, + "answer": "Yellow Card.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and saw the player play a wild card at 01:53. A few moments later, at 01:59, the narrator talks about the wild shuffle hands card. Then I saw, in between those 2 events, at 01:58, the player plays a yellow \"8\" card and the word \"Yellow\"appears on the screen, indicating they changed the cards to yellow." + }, + { + "key": "FkuqYtE1rw0:3abbe655180a1eb42718a99bbbab584cdf73edbf", + "video_id": "FkuqYtE1rw0", + "question": "How many different wild customizable cards are shown in the last 30 seconds of video?", + "answer_choice_0": "2.", + "answer_choice_1": "6.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I located the last 30 seconds of the video, from 03:29 to 03:59, to determine how many different wild customizable cards were shown. To identify them, I rewound to learn what wild customizable cards are, and heard the narrator introducing them and showing them at 03:10-03:18. I then continued watching the last 30 seconds of the video and identified the first 1 at 03:29. I watched further and found another 1 at 03:52 at the bottom center of the frame, and I didn't see more of them on screen. Therefore, the answer is 2." + }, + { + "key": "FkuqYtE1rw0:5d417643bebb133819888d8f76b36f2d6e0daf56", + "video_id": "FkuqYtE1rw0", + "question": "After the shuffle hands card was played, how many of the players ended up with a red UNO card in their hands?", + "answer_choice_0": "1.", + "answer_choice_1": "6.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "While watching, I noticed a shuffle hands card at 02:00 by reading the card. Then, I watched from 02:02 - 02:18 as the shuffle hands card was played, and then the rest of the cards were reshuffled and passed out. At 02:18, I paused the video and counted how many players there were. Based on the hands I saw in the frame, there are 4 players. Then, I counted how many players had a red card in their hands and noticed all the players had at least 1 red card. Therefore, there are 4 players who ended up with a red UNO card after the shuffle hands card was dealt." + }, + { + "key": "FkuqYtE1rw0:7989810f4d13268a07e351bf44ba0cecbdcec66d", + "video_id": "FkuqYtE1rw0", + "question": "What two cards are pulled immediately after \"Uno!\" appear on the screen for the second time?", + "answer_choice_0": "A yellow 5 and a wild card.", + "answer_choice_1": "A green 6 and a +4.", + "answer_choice_2": "A +4 and a yellow 0.", + "answer_choice_3": "A wild card and a green 6.", + "answer_choice_4": "A yellow 0 and a yellow 5.", + "answer_id": 1, + "answer": "A green 6 and a +4.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and looked for the word \"Uno!\" and found it appear on the screen first at 01:18. I continued watching and read it the second time at 01:24. I kept watching until two cards were drawn, which happened at 01:29. The two cards were a green 6 and a +4." + }, + { + "key": "FkuqYtE1rw0:a8dcbad023d8be06740869d8817878f0f3b3b80e", + "video_id": "FkuqYtE1rw0", + "question": "When the player put down the draw 4 card, what 2 colors did they have in their hands?", + "answer_choice_0": "Green and red.", + "answer_choice_1": "Yellow and blue.", + "answer_choice_2": "Blue and green.", + "answer_choice_3": "Red and blue.", + "answer_choice_4": "Green and yellow.", + "answer_id": 4, + "answer": "Green and yellow.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "While watching, I saw a draw 4 card placed down at 02:27. Then, I looked at the players cards in their hands and noticed that they had 2 green UNO cards and 1 yellow UNO card. Therefore, when the player puts down the draw 4 card, the 2 colors they have left in their hand are green and yellow." + }, + { + "key": "FkuqYtE1rw0:ef0c98f9ef93b49ce9ba4ab1f8b4ba289af71226", + "video_id": "FkuqYtE1rw0", + "question": "What is the total sum of the blue numbered UNO cards presented to the screen in hand, within the first 20 seconds?", + "answer_choice_0": "6.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I watched the first 20 seconds of the video. Then at 00:13, there's an insert on the players cards. I examined the cards and spotted out the blue UNO cards. There are 3 blue UNO cards, but there are only 2 numbered UNO cards. Then, I looked at the 2 numbered blue UNO cards and noticed it was a 1 and a 4. After, I added 1 plus 4 and got 5. Therefore, the total sum of the blue numbered cards presented to the screen within the first 20 seconds is 5." + }, + { + "key": "FkuqYtE1rw0:f233394cde2ce00b3dfa15056935cd7725771845", + "video_id": "FkuqYtE1rw0", + "question": "After the wild shuffle hands card is played, and the narrator mentions players may have more or fewer cards, how many cards does the player on the left receive?", + "answer_choice_0": "6.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and saw the gameplay demonstration. At 02:03, I saw a player put down a card that says \"shuffle hands\". At 02:05-02:11, the narrator explains that after that card is played, all remaining cards are gathered, shuffled, and dealt out again. As a player starts dealing out the cards again to the other players at 02:10, I continued watching, and saw the player on the left received 5 cards at 02:16. Therefore, the answer is 5." + }, + { + "key": "G0oXM9YPLcg:473ded601aff245209d890dd0dcc18a8a0c87291", + "video_id": "G0oXM9YPLcg", + "question": "What colors are the first pill to appear onscreen in the video made up of?", + "answer_choice_0": "White and yellow.", + "answer_choice_1": "Red and yellow.", + "answer_choice_2": "White and blue.", + "answer_choice_3": "Blue and yellow.", + "answer_choice_4": "Red and White.", + "answer_id": 4, + "answer": "Red and White.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video when the blonde woman spoke at the demonstration, holding up the pill - which is the first pill that can clearly be seen, and appears at 00:34. I then noted the colors of the pill, which were red and white." + }, + { + "key": "G0oXM9YPLcg:508289a17764bab66724371f7890f157e6c317f1", + "video_id": "G0oXM9YPLcg", + "question": "How many times is the word 'poison' legible in the first minute of the video?", + "answer_choice_0": "7", + "answer_choice_1": "6", + "answer_choice_2": "3", + "answer_choice_3": "5", + "answer_choice_4": "4", + "answer_id": 1, + "answer": "6", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the first minute of the video, from 00:00-01:00, watching for the word 'poison' and when it appears onscreen. It first appears in a caption at 00:35, followed quickly by a graphic with the word at 00:36. It next appears in caption form at 00:50, and then in a graphic at 00:51. It appears in another caption at 00:55, and in a final graphic at 00:56, for a total of six appearances in the first minute." + }, + { + "key": "G0oXM9YPLcg:581ea2366404d26bef07ecbfb06fcb6682aa7059", + "video_id": "G0oXM9YPLcg", + "question": "Which character continues to ask others if they want to watch funny videos on YouTube?", + "answer_choice_0": "Chef.", + "answer_choice_1": "Janitor.", + "answer_choice_2": "Boss.", + "answer_choice_3": "Inspector.", + "answer_choice_4": "Doctor.", + "answer_id": 4, + "answer": "Doctor.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened carefully to spot the instances where the question \"Do you want to watch a funny video on YouTube?\" was asked in the video. At 00:15 I found the first moment the question was asked, and at 01:40 I found the second and last time the question was asked. In both instances, it was the male lead character named Doctor that asked the question." + }, + { + "key": "G0oXM9YPLcg:6b5946180f03130614bc9d22c21226bd11f6ee78", + "video_id": "G0oXM9YPLcg", + "question": "Why does the Doctor greet the woman in the office?", + "answer_choice_0": "He wants to hear about her day.", + "answer_choice_1": "He wants to avoid talking to his companion.", + "answer_choice_2": "He wants to learn about the source of the pills.", + "answer_choice_3": "He wants to warn her of danger.", + "answer_choice_4": "He wants to show her a funny video.", + "answer_id": 4, + "answer": "He wants to show her a funny video.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene where the Doctor greets the woman in the office, which occurs at 01:13. I then listened to their conversation, where the Doctor quickly asks if he can show her a funny YouTube video." + }, + { + "key": "G0oXM9YPLcg:7b0537d1ac100fe520ee8040e31e07b7af2371db", + "video_id": "G0oXM9YPLcg", + "question": "Where is the Doctor in relation to the man he shows the YouTube video to?", + "answer_choice_0": "Looking over the man's left shoulder.", + "answer_choice_1": "Kneeling directly in front of him.", + "answer_choice_2": "Sitting across from him at the table.", + "answer_choice_3": "Standing in front of him across the room.", + "answer_choice_4": "Looking over the man's right shoulder.", + "answer_id": 3, + "answer": "Standing in front of him across the room.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the event where the Doctor shows a man the YouTube video - this occurs at starting at 01:52. I then watched the scene to learn the position of the Doctor in relation to the man sitting in the chair. The Doctor is pacing back and forth across the room in front of the man watching the YouTube video." + }, + { + "key": "G0oXM9YPLcg:a66a2ea760016b1dc9eb83130312cd2b2b742318", + "video_id": "G0oXM9YPLcg", + "question": "What items are the male and female characters holding in their hands when they pretend they are window cleaners?", + "answer_choice_0": "Glass cleaner and a rag.", + "answer_choice_1": "A window squeegee and a rag.", + "answer_choice_2": "A bucket and a sponge.", + "answer_choice_3": "Two glass cleaner bottles.", + "answer_choice_4": "A window squeegee and a sponge.", + "answer_id": 4, + "answer": "A window squeegee and a sponge.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for the segment where the male and female characters decided to pretend to be window cleaners in order to escape from their angry boss. The segment starts at 04:08. At 04:12 the characters are standing inside a window cleaning gondola, hanging suspended against a building's glass wall. The male character is holding a window squeegee and the female character is holding a yellow sponge at 04:17." + }, + { + "key": "G0oXM9YPLcg:eb7e8cc599b38cbe6ede56450d4821fc7e2d1d4e", + "video_id": "G0oXM9YPLcg", + "question": "How many times during the opening sequence does the first character introduced in the video appear on the screen after his name appears?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I played the video from the beginning to locate the first character introduction. A man with a brown suit, white eyes, and a movable jaw crosses the frame from left to right at 00:03. A name appears behind him in the background that reads \"TENTH DOCTOR\" at 00:05, which is the name of the first character introduced. Between 00:05 and 00:06, the image of the first character appears in the screen three times." + }, + { + "key": "GcOzdAzmtNM:0bb6911506e71bc21c5ea4057e08ed1e23e3f58f", + "video_id": "GcOzdAzmtNM", + "question": "What is the location the second time the instructor says the word \"yarn?\"", + "answer_choice_0": "A white surface with crochet tools.", + "answer_choice_1": "A white surface with a ball of yarn.", + "answer_choice_2": "An empty white surface.", + "answer_choice_3": "A title card reading \"Slip Knot.\"", + "answer_choice_4": "A shot of the instructor in a room.", + "answer_id": 0, + "answer": "A white surface with crochet tools.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video listening for the instructor to say the word 'yarn.' The first time is at 00:29. The second time is at 00:42. I checked the location, and at this time it was a flat white surface with a display of crocheting tools." + }, + { + "key": "GcOzdAzmtNM:27f92c0a3b95f8527c46607743aa53bc63e48545", + "video_id": "GcOzdAzmtNM", + "question": "What is the total when the number of blue social media banners displayed onscreen during the first minute of the video are subtracted from the number of chain stitches completed?", + "answer_choice_0": "5.", + "answer_choice_1": "13.", + "answer_choice_2": "9.", + "answer_choice_3": "11.", + "answer_choice_4": "7.", + "answer_id": 4, + "answer": "7.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video looking for a display of blue social media banners onscreen, which occurs from 00:13-00:17. There are 3 banners. I continued watching the video, looking for the instructor to create chain stitches. A section of the video entitled Chain Stitch begins at 03:10, and at 05:59 she has completed 10 chain stitches, after which she creates no more. I subtracted the number of blue social media banners (3) from the number of chain stitches created (10), for an answer of 7." + }, + { + "key": "GcOzdAzmtNM:603219c74273b52e8d584316eccb1f27450cfe56", + "video_id": "GcOzdAzmtNM", + "question": "Of the crochet hooks that were introduced, which one is used to demonstrate a chain stitch?", + "answer_choice_0": "The aluminum hook with the plastic handle.", + "answer_choice_1": "None of them, she uses her finger.", + "answer_choice_2": "The full aluminum hook.", + "answer_choice_3": "The acrylic hook.", + "answer_choice_4": "The aluminum hook with a soft grip handle.", + "answer_id": 2, + "answer": "The full aluminum hook.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to figure out which of the crochet hooks that were introduced in the video is used to demonstrate a chain stitch. First, I looked for the time period when the hooks are introduced. This occurs from 01:25-01:41. Having found these, I then looked for the period when a chain stitch is demonstrated. This begins at 03:10, when a graphic on the screen says \"CHAIN STITCH\". At 03:13, a crochet hook appears, and I recognize it as the full aluminum hook from earlier. So, the answer is the full aluminum hook." + }, + { + "key": "GcOzdAzmtNM:6f0a28822b3bb82bace0ae66791ede3058635741", + "video_id": "GcOzdAzmtNM", + "question": "Which crochet hook is two below the crochet hook that is the correctly sized hook for the yarn?", + "answer_choice_0": "The plastic.", + "answer_choice_1": "The full aluminum.", + "answer_choice_2": "The aluminum and blue plastic.", + "answer_choice_3": "The bamboo.", + "answer_choice_4": "The aluminum and pink plastic.", + "answer_id": 2, + "answer": "The aluminum and blue plastic.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video, looking to see what size of crochet hook was recommended for the yarn being used. At 00:54, the instructor turns the yarn over so the label shows where the recommended hook sizes are given, and she specifies this at 00:58. At 01:03, she points to where it says 5mm, and states the same. I continued watching until the crochet hooks were in focus again, which occurs at 01:18. I looked at the hooks and the full aluminum hook displays a size of 5mm on the handle, which is the size specified on the label. Therefore, the full aluminum crochet hook is the correct size for the yarn. I looked down to 2 spaces below that crochet hook, which is the aluminum and blue plastic hook." + }, + { + "key": "GcOzdAzmtNM:a95b58618f2aead331ee837947b2eddec2bf8e2f", + "video_id": "GcOzdAzmtNM", + "question": "From 01:18-01:40, as the host introduces the crochet hooks, how many times would the host have touched them if she touched one of them an additional time?", + "answer_choice_0": "9 times.", + "answer_choice_1": "12 times.", + "answer_choice_2": "11 times.", + "answer_choice_3": "8 times.", + "answer_choice_4": "10 times.", + "answer_id": 2, + "answer": "11 times.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video from 01:18-01:40 to see how many times the host touches the crochet hooks as she introduces them. She touches the aluminum hook with a soft grip handle five times, the acrylic hook one time, the full aluminum hook twice, and the aluminum hook with the plastic handle twice before reaching the 01:40 time stamp of the video. This totals 10 touches. If there was an additional touch, that would make 11 touches. So, the answer is 11." + }, + { + "key": "GcOzdAzmtNM:b63257e8cd4b9817d2eeec59b322fa39f92a7714", + "video_id": "GcOzdAzmtNM", + "question": "How many times does the host slip the yarn between her pinky and ring finger after she introduces the chain stitch and before she introduces the knife hold?", + "answer_choice_0": "1 time.", + "answer_choice_1": "0 times.", + "answer_choice_2": "4 times.", + "answer_choice_3": "5 times.", + "answer_choice_4": "2 times.", + "answer_id": 0, + "answer": "1 time.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to find the time when the host introduces the chain stitch. I found this time at 03:09, when the words \"chain stitch\" appear in the center of the screen. I then counted the number of times when she slipped the yarn between her pinky and ring finger. This occurs at 03:19. I watched until she introduced the knife hold, which occurs at 03:35. Since she only slipped the yarn between her pinky and ring finger once, the answer is 1 time." + }, + { + "key": "GcOzdAzmtNM:c6ff1feb4fa8a72ed19239d2bef857edbe214053", + "video_id": "GcOzdAzmtNM", + "question": "How many times does the host pinch a piece of yarn when she is unraveling it from the yarn ball?", + "answer_choice_0": "11 times.", + "answer_choice_1": "13 times.", + "answer_choice_2": "7 times.", + "answer_choice_3": "5 times.", + "answer_choice_4": "9 times.", + "answer_id": 2, + "answer": "7 times.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to find when the host pinches the yarn as she unravels it from the yarn ball. She removes the yarn band from the yarn ball from 02:18-02:21. As she does this, she is holding one end of the yarn ball. At 02:24, she pinches a piece of yarn with her left hand and pulls it away from the yarn ball. She pinches it again at 02:26. More pinches occur at 02:33, 02:35, 02:36, 02:37, and 02:39. Then, at 02:40, the yarn ball and the host's hands disappear. So, the answer is 7." + }, + { + "key": "GcOzdAzmtNM:f0f7c1a2615b3aa9c0ca1296b616af8bb9b81175", + "video_id": "GcOzdAzmtNM", + "question": "What does the instructor do with her right index finger just after she has pinched the yarn, holding it in an x for the slip knot?", + "answer_choice_0": "Wraps the yarn around her left thumb.", + "answer_choice_1": "Circles it around so the yarn wraps around it.", + "answer_choice_2": "Taps the top and bottom of her left thumb.", + "answer_choice_3": "Points to the loop on her left index finger.", + "answer_choice_4": "Taps the ball of yarn.", + "answer_id": 2, + "answer": "Taps the top and bottom of her left thumb.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video, looking and listening for the instructor to make a slip knot. The title card indicates the slip knot section beginning at 02:41. At 02:50, she pinches the yarn after making a slip knot. Directly after this, the instructor taps the top and bottom of her left thumb with her right index finger." + }, + { + "key": "GcOzdAzmtNM:f6b5a5ec4c8dd87c1cf9a279191d3fca1d3abd09", + "video_id": "GcOzdAzmtNM", + "question": "If there was an additional superimposed light blue graphic that appeared somewhere in the video, how many total light blue graphics would there be?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "11.", + "answer_choice_3": "7.", + "answer_choice_4": "9.", + "answer_id": 0, + "answer": "8.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to count the number of superimposed light blue graphics that appear throughout the video. I found the first 3 at 00:13 in the video, when they appear in the video in the lower left corner. They contain social media information for the YouTube channel. An additional graphic appears at 00:44, with text inside of it that says: \"TAKE A LOOK AT THE LINKS IN THE DESCRIPTION BOX\". No other graphics of this kind appear until the very end, when 3 more appear at 06:53 in the lower left corner of the frame. These contain the same social media information for the YouTube channel as before. Since there are 7 total superimposed light blue graphics, if there was an additional graphic, there would be 8." + }, + { + "key": "GlecDUdZdkE:0ffd35b8888f2ee615a0b6b8b52a28386bd73f35", + "video_id": "GlecDUdZdkE", + "question": "In how many times are the\"RFIN'\" letters of the word \"SURFIN\" moved in a specific direction after it is uploaded into Adobe Photoshop?", + "answer_choice_0": "12", + "answer_choice_1": "6", + "answer_choice_2": "10", + "answer_choice_3": "3", + "answer_choice_4": "1", + "answer_id": 1, + "answer": "6", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I searched for the section of the video where the \"DIRT SURFIN'\" sticker was shown on screen. This occurred at 00:51. I went back a bit to 00:50 and heard the narrator mention, \"I like to refine my designs in Photoshop\". I knew from that statement I was in the right place in the video. Next, I looked for any adjustments made to the sticker. At 00:52, part of the word \"SURFIN'\" (the \"RFIN'\" part) was pushed up and to the right. I counted this as the first instance. AT 00:52, the letters are pushed several times to the right. I counted this as the second instance. Also at 00:52, the letters are pushed once to the left and once up. I counted this as the third and fourth instance. At 00:53, the same part was pushed left. Between 00:53-00:55, the same part of the word was angled. I added up the number of times the letters were moved in a particular direction and came up with 6." + }, + { + "key": "GlecDUdZdkE:35b0c45d32bda243076102a04a50a943b1f081d0", + "video_id": "GlecDUdZdkE", + "question": "If someone exits the teal house through the front door, in which direction can they say the camera is located in relation to them?", + "answer_choice_0": "Diagonally and to the right.", + "answer_choice_1": "To the left of the house.", + "answer_choice_2": "Diagonal and to the left.", + "answer_choice_3": "In front of the house.", + "answer_choice_4": "Parallel to the house toward the right.", + "answer_id": 2, + "answer": "Diagonal and to the left.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I located the segment where there are two guys talking in front of a teal house, which happens at 02:29. I observed the teal house and its front door and its position to the camera. The camera is placed at a diagonal angle, giving a three-quarters view of the house that would capture the left side of the person walking through its front door. Therefore, I concluded that someone were to exit the front door and face the street, the camera would be at a diagonal toward their left side." + }, + { + "key": "GlecDUdZdkE:6cef95bc61ef4fd3fef75c50dd596fb79d0c3838", + "video_id": "GlecDUdZdkE", + "question": "What is the fourth country that lights up in yellow on the world map?", + "answer_choice_0": "Canada.", + "answer_choice_1": "Australia.", + "answer_choice_2": "United States.", + "answer_choice_3": "Spain.", + "answer_choice_4": "Brazil.", + "answer_id": 1, + "answer": "Australia.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I located the scene where a world map is presented in the video at 00:18. As the narrator speaks about the countries where he has sold stickers, a list appears on-screen, while some countries on the map in the background glow in yellow light. I counted the times a country would turn yellow until the fourth one did, which happens at 00:19. This country is Australia." + }, + { + "key": "GlecDUdZdkE:6f20d1c1d2bdfce8cc730546a58bda56f113fef6", + "video_id": "GlecDUdZdkE", + "question": "What color is the last physical \"Mahalo my dude\" sticker that appears on-screen?", + "answer_choice_0": "Green", + "answer_choice_1": "Black", + "answer_choice_2": "White", + "answer_choice_3": "Red", + "answer_choice_4": "Yellow", + "answer_id": 2, + "answer": "White", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video from the beginning to locate the instances where a physical \"Mahalo my dude\" sticker appears on-screen. The first time happens at 00:01, and it's a yellow sticker, the second time is at 00:07, and it's white. It appears briefly again at 00:10 (black), 00:12 (white), and 00:14 (white). I watched the video until the end and found no other instance where a physical \"Mahalo my dude\" sticker is visible. For this reason, the last time a physical \"Mahalo my dude\" sticker appears on-screen is at 00:14, where a white version of the sticker is being placed on a car window." + }, + { + "key": "GlecDUdZdkE:6fa71663c3211949118f42a623e9b2de1d75f60d", + "video_id": "GlecDUdZdkE", + "question": "Which of the four total steps listed in an onscreen way is the second to appear after the man presses the \"Load media\" button?", + "answer_choice_0": "Refine Your Design", + "answer_choice_1": "Transfer Tape", + "answer_choice_2": "Cut Your Design", + "answer_choice_3": "Weed the Edges", + "answer_choice_4": "Import Your Design", + "answer_id": 1, + "answer": "Transfer Tape", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I looked for the moment where the man presses the \"Load media\" button and found it at 02:14. Next, I looked for the first of the 4 onscreen steps to appear. This happened at 02:16 when the words, \"STEP 3\" and \"CUT YOUR DESIGN\" appeared onscreen. I then looked for the next onscreen step to appear. This happened at 03:48 when the words, \"STEP 4\" followed by \"TRANSFER TAPE\" appeared onscreen. I counted this as the second of the four steps to appear onscreen after the man presses the \"Load media\" button." + }, + { + "key": "GlecDUdZdkE:7c042eb7bf7d624e7ccc8379b6f5b42a0efada08", + "video_id": "GlecDUdZdkE", + "question": "After the guy uses his smartphone for the last time, what onscreen option is highlighted?", + "answer_choice_0": "\"Decline\".", + "answer_choice_1": "\"Open in Photos\".", + "answer_choice_2": "\"Download\".", + "answer_choice_3": "\"Accept\".", + "answer_choice_4": "\"Open in new window\".", + "answer_id": 3, + "answer": "\"Accept\".", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I searched the video to determine each time the guy was shown using his smartphone. The first time was at 01:13 when he snapped a photo of the \"DIRT SURFIN'\" sticker. He used his smartphone again at 01:15 when he uploaded the sticker to Adobe Photoshop, the app he mentioned at 01:16. This was inferred when the photo was then visible on the screen at 01:16, confirming a successful upload. A message appeared on screen at the top of a black dialog box that read, \"Andrew Santos's iPhone wants to send you a photo\". The \"Accept\" option was highlighted in blue." + }, + { + "key": "GlecDUdZdkE:89a7f44271b8ce18b1643034d012df702f721c86", + "video_id": "GlecDUdZdkE", + "question": "After the image of the text \"Dirt Surfin'\" is uploaded into photoshop, what is the 3rd step in the process of turning the image into a finalized, black and white image?", + "answer_choice_0": "Increase contrast", + "answer_choice_1": "Decrease lightness", + "answer_choice_2": "Crop the image", + "answer_choice_3": "Decrease brightness", + "answer_choice_4": "Lower saturation", + "answer_id": 0, + "answer": "Increase contrast", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I located the section of the video where the image of the text \"Dirt Surfin'\" was uploaded into photoshop. This occurred at 01:15, when the narrator instructs viewers to \"place it in photoshop.\" I continued watching to determine the process of making the image black and white. All of the following actions were shown on screen in order: crop the image (01:18); increase the brightness (01:18); increase the contrast (01:18); decrease the lightness (01:19), and finally, lower the saturation (01:19). After counting all the steps, I determined that increasing the contrast was third in the process." + }, + { + "key": "GlecDUdZdkE:8ee5f9f6a69ddeafaa59e5bf0a92b7087a4c1897", + "video_id": "GlecDUdZdkE", + "question": "How many 2\" wide squares can be cut across the vinyl that the creator uses?", + "answer_choice_0": "4 stickers.", + "answer_choice_1": "6 stickers.", + "answer_choice_2": "10 stickers.", + "answer_choice_3": "5 stickers.", + "answer_choice_4": "7 stickers.", + "answer_id": 1, + "answer": "6 stickers.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "In order to answer the question correctly, I need to find out what the width of the vinyl actually is. First, I looked for the segment where the creator says he can fit 3, 3\" inch wide stickers on the vinyl. This would suggest that the vinyl he uses is 9\" wide. However, when he weeds his printed sticker around 03:04, he places the sticker on a grid of squares. From a glance of the edge of the grid at 03:32, I learn that two squares equals one inch. The weeded sticker is just shy of 8 squares, which would mean that the sticker itself is just shy of 4 inches. This implies that three stickers are actually using borders that add another 3 inches, which means that the vinyl the hobbyist is using is 12\" long. Therefore, if I cut 2\" wide stickers across the vinyl, I should be able to cut 6 of them. For 6, 2\" wide squares add up to 12\" inches." + }, + { + "key": "GlecDUdZdkE:a79c1293139673f671966d28bcf4b3ec7aa92b78", + "video_id": "GlecDUdZdkE", + "question": "What is the 7th, 25th, 35th, and the 2nd from the last country on the scrolling list?", + "answer_choice_0": "Brazil, Serbia, El Salvador, and the United Arab Emirates.", + "answer_choice_1": "United Arab Emirates, Ireland, India, and Serbia.", + "answer_choice_2": "Serbia, Haiti, Greece, and Cyprus.", + "answer_choice_3": "India, Italy, Ukraine, and Sint Maarten.", + "answer_choice_4": "Brazil, Finland, Poland, and Spain.", + "answer_id": 0, + "answer": "Brazil, Serbia, El Salvador, and the United Arab Emirates.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I searched for the scrolling list and found it printed in white text, starting at 00:18 and lasting until 00:24. I went back to count the 7th country and concluded it was Brazil, shown at 00:18. Next, I forwarded ahead to locate the 25th country and after counting, I determined it was Serbia shown at 00:20. I located the 35th country which was El Salvador, shown at 00:21. Finally, I skipped ahead to get to the end of the list. I saw that the United Arab Emirates was positioned as the 2nd from the last country at 00:24. Hence, Brazil, Serbia, El Salvador, and the United Arab Emirates are the correct answers." + }, + { + "key": "GlecDUdZdkE:efcbbb4bbd4eae07ae8f72f1a830fa06df2ed989", + "video_id": "GlecDUdZdkE", + "question": "List the last timestamp where a sticker was peeled from the transfer tape?", + "answer_choice_0": "04:29", + "answer_choice_1": "02:58", + "answer_choice_2": "03:12", + "answer_choice_3": "04:43", + "answer_choice_4": "03:25", + "answer_id": 3, + "answer": "04:43", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I watched the video to understand what transfer tape is. I found an explanation from 03:55-04:00. Then, I located each instance in the video where stickers were shown being peeled from a piece of transfer tape. The first instance occurred with the \"Mahalo my dude\" sticker at 00:01, 00:07, and 00:12. Next, was the square-shaped sticker at 00:17, the \"SKRT\" sticker at 00:25 and 00:26, the \"DIRT SURFIN'\" sticker at 02:58, 04:29, 04:43, and finally, the \"RIDE YOUR DAMN BIKE\" sticker at 03:25. I counted each timestamp and concluded that there were 10 instances of a sticker being peeled from transfer tape. Hence, the 10th and final instance sequentially was at 04:43." + }, + { + "key": "H5tOnBKITXo:1729937b4e6c752ca27efe63673352baaba872dd", + "video_id": "H5tOnBKITXo", + "question": "How did the woman in the black and white dress feel when the woman in the pink dress recalled her experience of not being able to open her eyes?", + "answer_choice_0": "Nervous.", + "answer_choice_1": "Afraid.", + "answer_choice_2": "Happy.", + "answer_choice_3": "Upset.", + "answer_choice_4": "Relieved.", + "answer_id": 1, + "answer": "Afraid.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 12:35 - 12:47, I heard the woman in the pink dress recall her experience of not being able to open her eyes even when she was told to. During that time, at 12:42 - 12:44, I heard the woman in the black and white dress agree, stating that her heart was racing, which therefore implies that she felt afraid." + }, + { + "key": "H5tOnBKITXo:391db85b57981decb1c5c417aa87771c6e9ff901", + "video_id": "H5tOnBKITXo", + "question": "What percentage of people who are standing when the hypnotist begins working are also standing when he says \"I would probably get a dinner\"?", + "answer_choice_0": "100%", + "answer_choice_1": "80%", + "answer_choice_2": "60%", + "answer_choice_3": "20%", + "answer_choice_4": "40%", + "answer_id": 0, + "answer": "100%", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I observed 5 people standing behind a line of chairs at several points before the hypnosis began, including from 00:00-00:08 and 01:21-01:24. From 01:22-01:25, I heard the man in the middle say that they had recruited a hypnotist, Richard Barker. From 01:29-01:34, I saw the man at the end of the line talk about how he was going to enter peoples' subconscious. I also observed a text graphic that read \"Richard Barker\" on the top line and \"hypnotist\" on the bottom while this man was speaking from 01:32-01:38. I determined that this was the hypnotist and waited for him to begin working. This occurred at 02:39, when he walked away from the other 4 people and into the center. At this point, I observed that there were 5 people standing. I then listened for the hypnotist to say \"I would probably get a dinner\". I heard this at 13:40. At this point, I observed that all of the original 5 people were still standing. Therefore, I determined that 100% of the people standing at the beginning were also standing when the target phrase was spoken." + }, + { + "key": "H5tOnBKITXo:630c0b7895e44dade04472b50ed41985be434f63", + "video_id": "H5tOnBKITXo", + "question": "What does the sign behind Al Roker say?", + "answer_choice_0": "Team Today And Everyday.", + "answer_choice_1": "Team Today Goes Under.", + "answer_choice_2": "Team Today Goes Far.", + "answer_choice_3": "Team Today Sometime Forever.", + "answer_choice_4": "Team Today Always.", + "answer_id": 1, + "answer": "Team Today Goes Under.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I noticed that Al Roker remains seated for the whole video. I watched until a good view of the sign is given at 03:15. I read the words on the sign, which said \"Team Today Goes Under.\"" + }, + { + "key": "H5tOnBKITXo:c2e16d615ece763e897b0e8d8f93bbe3fd7be3b6", + "video_id": "H5tOnBKITXo", + "question": "How many total people does the hypnotist attempt to hypnotize?", + "answer_choice_0": "12.", + "answer_choice_1": "8.", + "answer_choice_2": "10.", + "answer_choice_3": "11.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "11.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I noticed a panning shot at 09:42. At this timestamp, it shows everyone who attempts to get hypnotized." + }, + { + "key": "H5tOnBKITXo:de502d2e78cce5685ea94c6829e839f68ca2c885", + "video_id": "H5tOnBKITXo", + "question": "How many volunteers leave their seats when hypnotized into being exotic animals?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "6.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 10:50 the hypnotist prompts the volunteers to act like exotic animals. At 10:55, I can see two of them out of their seats." + }, + { + "key": "I3GWzXRectE:06c481387599218854f5005868102467ff975e53", + "video_id": "I3GWzXRectE", + "question": "What integration by part problem does the professor not work fully and only gives the answer for?", + "answer_choice_0": "(e^x)sin(x).", + "answer_choice_1": "(cos(x))^n.", + "answer_choice_2": "(e^(x^2))sin(x).", + "answer_choice_3": "(x^2)(ln(x)).", + "answer_choice_4": "(t^3)(cos(t)).", + "answer_id": 0, + "answer": "(e^x)sin(x).", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "At around 34:39 the professor writes the integral of (e^x)sin(x) and writes the answer on the whiteboard a few seconds later. However, he does not show any work leading to the answer." + }, + { + "key": "I3GWzXRectE:61d82b239b1205845b27d5cddf6397ee7fbb8caf", + "video_id": "I3GWzXRectE", + "question": "After the professor demonstrates integration by parts with examples at 24:10, if we replace the expression labeled \"f\" in example 2 with the expression labeled \"f\" from example 3 and integrate, what would the final result be?", + "answer_choice_0": "(x^2 - x + 1)log(x^2 + 1) - ((x-2)x) - 2tan^{-1}(x) + C.", + "answer_choice_1": "2e^x(x - 1) + C.", + "answer_choice_2": "e^x(2x - 3) + C.", + "answer_choice_3": "2sin(x) - 2xcos(x) + cos(x) + C.", + "answer_choice_4": "\u00bd e^x(sin(x) - cos(x)) + C.", + "answer_id": 2, + "answer": "e^x(2x - 3) + C.", + "question_type": "Counterfactual", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed the professor discussing integration by parts. At 24:10, he starts to give many different examples of integration by parts, and works through them. When solving an integration by parts problem, one section is labeled \u201cf\u201d and the other is labeled \u201c g\u2019 \u201c and then the formula given at 23:25 can be used. Example 2 is given at 27:15, and the part labeled \u201cf\u201d is given at 28:02. A student in the class identifies which part of the integral is \u201cf,\u201d and the professor confirms it. Here, ln(x^2 + 1) is labeled as \u201cf.\u201d Example 3 begins at 34:35. The section labeled as \u201cf\u201d is given at 35:14. The section e^x is labeled as \u201cf,\u201d but this isn\u2019t said out loud by the professor. If the section labeled \u201cf\u201d on example 2 is replaced with the section labeled \u201cf\u201d from example 3, the resulting integral becomes (2x - 1)(e^x). From there, we apply the formula given by 23:25 and solve. The answer is e^x(2x - 3) + C. Therefore, after the professor demonstrates integration by parts with examples at 24:10, if we replace the expression labeled \"f\" in example 2 with the expression labeled \"f\" from example 3 and integrate, the final result would be e^x(2x - 3) + C." + }, + { + "key": "I3GWzXRectE:75511ac72822c351b04f78f5a2cef6c9952f3fc2", + "video_id": "I3GWzXRectE", + "question": "When solving the integral in Example 2, what would be the result of plugging in x=5 into the function for which the professor integrates by using a u-substitution?", + "answer_choice_0": "1/5.", + "answer_choice_1": "1.", + "answer_choice_2": "5/26.", + "answer_choice_3": "0.", + "answer_choice_4": "1/2.", + "answer_id": 2, + "answer": "5/26.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Maths", + "reasoning": "First, I looked for Example 2 in the video. I found that he starts this example at 27:18. He doesn't verbally say that he's working Example 2 at any point in the video. He only writes it on the whiteboard. I continued to watch to find where he uses a u-substitution in this example. I found this to be at 32:03. I then saw that he was doing this u-substitution to solve the integral of x/(x^2 + 1). I plugged in 5 for x into this function and got 5/26." + }, + { + "key": "I3GWzXRectE:802ac03567040652abf946070815c6a1fb19f380", + "video_id": "I3GWzXRectE", + "question": "Starting from the bottom and moving clockwise, what is the order in which the professor draws the components of an electrical circuit?", + "answer_choice_0": "Capacitor, resistor, battery, then inductor.", + "answer_choice_1": "Battery, capacitor, inductor, then resistor.", + "answer_choice_2": "Capacitor, battery, resistor, then inductor.", + "answer_choice_3": "Battery, capacitor, resistor, then inductor.", + "answer_choice_4": "Capacitor, battery, inductor, then resistor.", + "answer_id": 2, + "answer": "Capacitor, battery, resistor, then inductor.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Maths", + "reasoning": "At 14:20, I saw the professor start drawing an electrical circuit. As he draws, he mentions the components by name, but he doesn't verbally specify their locations within the circuit. At the same time, I saw the order of components, starting from the bottom and moving clockwise, was the capacitor first, then the battery, resistor, and inductor. Therefore, starting from the bottom and moving clockwise, the order in which the professor draws the components of an electrical circuit is capacitor, battery, resistor, then inductor." + }, + { + "key": "I3GWzXRectE:b5edf97061e2d026dfd947cd591af1bec1590b60", + "video_id": "I3GWzXRectE", + "question": "If we take the problem introduced at 24:26, but substitute cos(2x) for sin(x) and apply the formula presented at 23:25, what is the result?", + "answer_choice_0": "\u00bc(2xsin(2x) + cos(2x)) + C.", + "answer_choice_1": "\u00bc((2x^2 - 1)sin(2x) + 2xcos(2x)) + C.", + "answer_choice_2": "\u00bc((1 - 2x^2)cos(2x) + 2xsin(2x)) + C.", + "answer_choice_3": "(x^2 - 2)sin(x) + 2xcos(x) + C.", + "answer_choice_4": "2xsin(x) - (x^2 - 2)cos(x) + C.", + "answer_id": 1, + "answer": "\u00bc((2x^2 - 1)sin(2x) + 2xcos(2x)) + C.", + "question_type": "Listening", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed the professor start to discuss integration by parts. At 23:25, he gives the formula for integration by parts. At 23:49, he gives the formula for integration by parts given a lower limit of a and an upper limit of b. He begins showing examples at 24:12. The example is the integral of x^2 sin(x) dx. If we replace sin(x) with cos(2x), the problem becomes the integral of x^2 cos(2x) dx. When applying the integration by parts formula, we get a final solution of \u00bc((2x^2 - 1)sin(2x) + 2xcos(2x)) + C, where C is a constant. Therefore, if we take the problem introduced at 24:26, but substitute cos(2x) for sin(x) and apply the formula presented at 23:25, the result is \u00bc((2x^2 - 1)sin(2x) + 2xcos(2x)) + C." + }, + { + "key": "I3GWzXRectE:fb8054bf915c100b45a2cdf9a6a094ab5a380b67", + "video_id": "I3GWzXRectE", + "question": "If the second term from the first example about separation of variables is changed to 6y^3(x^4 - 1) dy/dx, what is the solution?", + "answer_choice_0": "y^2/2 + 1/2 log(y^2 - 1) - 1/(12x^2) = C.", + "answer_choice_1": "y^2/2 + 1/2 log(y^2 - 1) + 1/2 log(1 - x^2) = C.", + "answer_choice_2": "y^2/2 + 1/2 log(y^2 - 1) + 1/12 log(x^2 - 1) = C.", + "answer_choice_3": "y^2/2 + 1/2 log(y^2 - 1) + 1/24[log(1 - x^2) - log(x^2 + 1)] = C.", + "answer_choice_4": "y^2/2 + 1/2 log(y^2 - 1) + 1/4[log(1 - x^2) - log(x^2 + 1)] = C.", + "answer_id": 3, + "answer": "y^2/2 + 1/2 log(y^2 - 1) + 1/24[log(1 - x^2) - log(x^2 + 1)] = C.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed the professor giving many different examples. At 44:57, he began to talk about integration through separation of variables, and wrote about it on the white board. At 47:49, he began to show and go through integration examples that could be solved through separation of variables. At 48:33, he finishes writing the problem with the equation x(y^2 - 1) + y(x^2 - 1) dy/dx = 0. He finished solving the problem at 53:44. If we swap out the first term of the equation with 6y^3(x^4 - 1), the problem becomes x(y^2 - 1) + 6y^3(x^4 - 1) dy/dx = 0. This problem can then be solved through separation of variables. Because this is a definite integral, we can solve the integral and then plug in the limits of integration. The final answer ends up being y^2/2 + 1/2 log(y^2 - 1) + 1/24[log(1 - x^2) - log(x^2 + 1)] = C. Therefore, if the second term from the first example about separation of variables is changed to 6y^3(x^4 - 1) dy/dx, the solution is y^2/2 + 1/2 log(y^2 - 1) + 1/24[log(1 - x^2) - log(x^2 + 1)] = C." + }, + { + "key": "IEP7f0uWURs:977de643fe0bebb9499b186d6934c0b3ff617966", + "video_id": "IEP7f0uWURs", + "question": "How many women appear in the first row of the audience?", + "answer_choice_0": "6.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "5.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the times that the camera focuses on the audience. This happens at 01:04, 01:08, 02:18, and 03:39. Each instance features the same shot of the audience. From there, I counted how many women appeared sitting in the first row, which is 5." + }, + { + "key": "IEP7f0uWURs:a54d9e62f1090bbc1bf3283cded853f47a77bc71", + "video_id": "IEP7f0uWURs", + "question": "What word or phrase is written on the comedian's vest?", + "answer_choice_0": "Billabong.", + "answer_choice_1": "He\u02bbenalu.", + "answer_choice_2": "Radical.", + "answer_choice_3": "Surf's Up.", + "answer_choice_4": "Suui' Savo.", + "answer_id": 4, + "answer": "Suui' Savo.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a point where I could clearly see the comedian's vest. At 1:07, there is a point where the camera is directly on the comedian from the front and you can read the phrase on his vest. It says, \"Suui' Savo.\"" + }, + { + "key": "IEP7f0uWURs:c0b3874ed2ee120bd492b7ea7a48e06a94d2d41d", + "video_id": "IEP7f0uWURs", + "question": "How many times does the man with the microphone pretend to whisper into the microphone?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:45, when the man with the microphone first pretends to whisper into it. I continued to watch until 00:49, when he pretends to whisper again. He doesn't do this again for the rest of the video." + }, + { + "key": "IEP7f0uWURs:edfab8ff78b71b02c48c4d4d7e3df1d25699bbd2", + "video_id": "IEP7f0uWURs", + "question": "For how many seconds does the name \"Stuart Laws\" appear on screen?", + "answer_choice_0": "14.", + "answer_choice_1": "3.", + "answer_choice_2": "10.", + "answer_choice_3": "22.", + "answer_choice_4": "18.", + "answer_id": 0, + "answer": "14.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the name, \"Stuart Laws.\" I saw it appear onscreen at 00:04. I continued to watch the video until the name disappears at 00:18. I subtracted 4 from 18 and got the number 14. I watched the rest of the video to make sure the name does not appear again. I therefore concluded that the name \"Stuart Laws\" appears onscreen for 00:14 seconds." + }, + { + "key": "IkalikR-pFs:01d24213dd78af7bdf629d88a8987bd785bc7db0", + "video_id": "IkalikR-pFs", + "question": "How many total egg yolks does the man use for cooking?", + "answer_choice_0": "14.", + "answer_choice_1": "18.", + "answer_choice_2": "4.", + "answer_choice_3": "7.", + "answer_choice_4": "10.", + "answer_id": 0, + "answer": "14.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video until the first sight of egg yolks are seen at 00:09 inside a wooden bowl. I counted exactly 10 egg yolks in the wooden bowl. The next time egg yolks are seen being used is at 05:29. I counted exactly 4 eggs inside a smaller wooden bowl this time. I add 10 + 4 to equal 14 total egg yolks." + }, + { + "key": "IkalikR-pFs:2e0c3ea43474eb1df240d981beb4606c5ae0b00c", + "video_id": "IkalikR-pFs", + "question": "How many ingredients involve chopping with a cleaver?", + "answer_choice_0": "1.", + "answer_choice_1": "6.", + "answer_choice_2": "5.", + "answer_choice_3": "3.", + "answer_choice_4": "8.", + "answer_id": 1, + "answer": "6.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched and looked for any time the man used a cleaver to chop an ingredient. I found that he chopped an onion at 01:05, mushrooms at 01:25, parsley at 02:00, garlic at 02:12, dough at 03:21, and chicken at 06:14. These were the only ingredients in which he used a cleaver to chop. I then counted these ingredients and got a total of 6." + }, + { + "key": "IkalikR-pFs:3bec93dadcebb9061c49489e01bf593ee747eee0", + "video_id": "IkalikR-pFs", + "question": "The dog lays to what side of a rock when the man adds the fourth ingredient for the sauce to the pan?", + "answer_choice_0": "Right.", + "answer_choice_1": "On top.", + "answer_choice_2": "Front side.", + "answer_choice_3": "Left.", + "answer_choice_4": "Back side.", + "answer_id": 4, + "answer": "Back side.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video until I saw what I recognized as sauce in the pan and a man began to make the sauce at 06:28. He adds seasonings to a mixture with pasta water. I went back to 05:51 where I could see the pan was empty before butter was added at 05:52. At 05:54 onions get added to the skillet, followed by garlic at 06:05. At 06:08-06:12, the man adds mushrooms to the skillet as the fourth ingredient. I look for the dog beyond the man cooking and spot him laying near a fairly large rock. The dog lays near the back side of the rock." + }, + { + "key": "IkalikR-pFs:63588acd296e95e6e5ddc596d656076a289a2c23", + "video_id": "IkalikR-pFs", + "question": "What is the second thing that happens to the unpeeled onion after the man tosses it into the air?", + "answer_choice_0": "It falls off the cutting board.", + "answer_choice_1": "It is sliced in half.", + "answer_choice_2": "It is sliced into fours.", + "answer_choice_3": "It is caught in mid-air.", + "answer_choice_4": "It is peeled.", + "answer_id": 1, + "answer": "It is sliced in half.", + "question_type": "Cause and Effect", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watch the video up until 01:04 when the man rolls the unpeeled onion to the side with the knife. At 01:05, the man uses the tip of the knife to toss the onion into the air. The first thing that happens is that the man catches it with the sharp edge of the knife. At 1:06, he then slams the knife down with the onion and slices the onion in half. Therefore, the second thing that happens to the onion is it getting sliced in half." + }, + { + "key": "IkalikR-pFs:8980c4d73de15a09a613389586805e1fecafeb83", + "video_id": "IkalikR-pFs", + "question": "When does he first add the parmesan to the pan?", + "answer_choice_0": "06:36.", + "answer_choice_1": "04:23.", + "answer_choice_2": "02:35.", + "answer_choice_3": "05:45.", + "answer_choice_4": "05:30.", + "answer_id": 0, + "answer": "06:36.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "We never see parmesan being directly added to the pan. However, we first see the parmesan being added to the eggs yolks to form the yolk mixture at 05:30-05:33. This yolk mixture is then added to the pasta sauce in the pan at 06:36. Hence the correct answer is 06:36." + }, + { + "key": "IkalikR-pFs:d26e1d734c0629bd04fb9572b4a036f6ae754797", + "video_id": "IkalikR-pFs", + "question": "If the number of times a dog appears in the video is multiplied by the number of skillets in the video, what would the answer be?", + "answer_choice_0": "10.", + "answer_choice_1": "18.", + "answer_choice_2": "22.", + "answer_choice_3": "12.", + "answer_choice_4": "24.", + "answer_id": 4, + "answer": "24.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I watched and observed any time a dog appeared in the video. I found the dog at 00:06, 00:44, 01:06, 01:16, 01:28, 01:48, 04:01, 05:02, 05:16, 05:42, 05:52, and 06:08. I then counted these appearances together, and I got a total of 12. After that, I looked to see the total number of skillets the man used in the video. I located the skillet when it appeared on the screen for the first time at 04:26. After watching the rest of the video, I saw him cover the skillet with another one at 05:27 for a total of 2. I did not see any more skillets in the rest of the video. Then I multiplied the number of times a dog appeared in the video, 12, by the number of skillets in the video, 2. I found that 12x2 equals 24." + }, + { + "key": "IkalikR-pFs:ecf136bb0681917163edc110b9aaf2c0e6c7db14", + "video_id": "IkalikR-pFs", + "question": "What floats down the small stream while the man is slicing garlic?", + "answer_choice_0": "Leaves.", + "answer_choice_1": "The stirring stick.", + "answer_choice_2": "A red flower.", + "answer_choice_3": "Garlic peel.", + "answer_choice_4": "An onion peel.", + "answer_id": 2, + "answer": "A red flower.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watch the video at 02:10 when I see a bulb of garlic on the cutting board. I continue watching from 02:12-02:17 when the man starts cutting into the bulb of garlic and splitting it into cloves. I continue watching from 02:17-02:23 when I get a close up view of the stream and can hear the man chopping offscreen. Right at 02:21, a red flower floats around a rock to the left and downstream. At 02:23 I can see the man slicing garlic again; therefore, the red flower floats down stream when the man is slicing garlic." + }, + { + "key": "J1gKFnNU7XM:08a7f378e97badbb3a5589625a34fe5807de65b8", + "video_id": "J1gKFnNU7XM", + "question": "If Maya didn't miss catching the frisbee, what would have been her total score at the end?", + "answer_choice_0": "350.", + "answer_choice_1": "250.", + "answer_choice_2": "500.", + "answer_choice_3": "300.", + "answer_choice_4": "150.", + "answer_id": 0, + "answer": "350.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 01:22, I listened to the woman introduce her dog as Maya. Then, I watched Maya's performance from 02:24 - 03:40. I noticed during that time at 02:37, Maya missed catching her frisbee, and she was on the 50-point target. Then, at 03:42, I saw that the timer ran out, and her final score was 300. So, I added 50 points to her final score and got 350. Therefore, if she had not missed the frisbee, her total score would have been 350." + }, + { + "key": "J1gKFnNU7XM:12846e41d2474d999280c0774d33c743355078ad", + "video_id": "J1gKFnNU7XM", + "question": "How many all-blue ribbons are there during Wonder Bennie's intro?", + "answer_choice_0": "8.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "6.", + "answer_choice_4": "9.", + "answer_id": 4, + "answer": "9.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I watched as Wonder Bennie's intro was from 04:27 - 05:15. Then at 05:02, I counted 7 all-blue ribbons in the frame. Then, I continued watching and counted 2 all-blue ribbons at 05:04. There was no other ribbons shown throughout the rest of the video so I added 2 plus 7 and got 9. Therefore, there was 9 all-blue ribbons in total during Wonder Bennie's intro." + }, + { + "key": "J1gKFnNU7XM:1d804558b6865ea51731bd9714544f530f01ca08", + "video_id": "J1gKFnNU7XM", + "question": "What color outline on the ground surrounds Chewy when he catches the frisbee for the 3rd time?", + "answer_choice_0": "Yellow", + "answer_choice_1": "Blue.", + "answer_choice_2": "Black.", + "answer_choice_3": "Green.", + "answer_choice_4": "Red.", + "answer_id": 1, + "answer": "Blue.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified Chewy by looking at a chart that appeared on the screen at 00:25. I saw that he was the 3rd dog listed, along with his owner, Anh-Thu, and the flag of his country, Vietnam. I then watched until Chewy began competing in the competition at 08:30. After that, I watched as Chewy caught the frisbee for the first time at 08:37. Then he caught the frisbee for the 2nd time at 08:47. Then he caught the frisbee for the 3rd time at 08:57. When he caught the frisbee for the 3rd time, I looked to see what color rectangle on the ground surrounded him, and I saw the color blue." + }, + { + "key": "J1gKFnNU7XM:275a7806c5d915e8d1fd972b95b928b6107e63c1", + "video_id": "J1gKFnNU7XM", + "question": "If Wonder Bennie caught 6 more frisbees in the blue target zone, which dog would be in 3rd place?", + "answer_choice_0": "Justice.", + "answer_choice_1": "Chewy.", + "answer_choice_2": "Betty.", + "answer_choice_3": "Maya.", + "answer_choice_4": "Poison Ivy.", + "answer_id": 1, + "answer": "Chewy.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I read Wonder Bennie's final score at 19:25 and discovered it was 175. Then, I looked at the blue target zone and noticed that it is worth 50 points at 00:29. So, to find the final score Wonder Bennie would have had if he caught 6 more frisbees in the blue target zone, I multiplied 6 by 50 and got 300. Then, I added 300 plus 175 and got 475. After, I went back to the final scores at 19:25 and reordered the dogs' ranks based on Bennie's new score, which would have put him in 1st place. Then, I noticed the dog in 3rd place would have been Chewy because Chewy would have had the 3rd highest score at 425. Therefore, if Wonder Bennie would have caught 6 more frisbees in the blue target zone, Chewy would have been pushed to 3rd place." + }, + { + "key": "J1gKFnNU7XM:32cfb36ccfb423f0f03ce1c5c6df0e80ab50ca52", + "video_id": "J1gKFnNU7XM", + "question": "What is the center color of the frisbee Poision Ivy catches in her mouth the second time her owner bends backwards?", + "answer_choice_0": "Orange.", + "answer_choice_1": "Black.", + "answer_choice_2": "Red.", + "answer_choice_3": "Teal.", + "answer_choice_4": "Green.", + "answer_id": 4, + "answer": "Green.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 16:30, I read the name \"Poision Ivy\". Then I noticed that her owner bends backwards. I continued watching and at 16:40 the owner bends backwards again. So, I looked at the frisbee that Poision Ivy catches in her mouth and noticed the center was light green." + }, + { + "key": "J1gKFnNU7XM:806b37de28be2e1bbda9ad8d32b43f91aac2ab3a", + "video_id": "J1gKFnNU7XM", + "question": "How many countries are represented by a dog owner wearing black shoes?", + "answer_choice_0": "2.", + "answer_choice_1": "0.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "3.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched and looked specifically for the color of the dog owners' shoes during the competition, and I observed which country they were representing. At 01:12, I observed the dog owner from Mexico wearing white shoes. At 04:18, I observed the dog owner from Canada wearing black shoes. At 08:32, I observed the dog owner from Vietnam wearing purple shoes. At 10:38, I observed the dog owner from China wearing white shoes. At 13:17, I observed the dog owner from the United States wearing black shoes. At 16:52, I observed the dog owner representing Puerto Rico wearing black shoes. I then counted how many countries were represented by dog owners wearing black shoes, and I got a total of 3." + }, + { + "key": "J1gKFnNU7XM:aaf8f652a90500f4cbb4f64c365c59b00a1b04eb", + "video_id": "J1gKFnNU7XM", + "question": "After Maya catches the frisbee for the 9th time, what color towel can her owner be seen holding?", + "answer_choice_0": "White.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Red.", + "answer_choice_3": "Green.", + "answer_choice_4": "Black.", + "answer_id": 2, + "answer": "Red.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 01:06, I heard the female announcer say \"First up, representing Mexico, it's Maya and her human Elizabeth.\" I then saw Maya and Elizabeth walk onto the stage at 01:08. After that, I observed each time Maya caught a frisbee. I saw Maya catch a frisbee at 02:00, 02:14, 02:28, 02:46, 02:56, 03:05, 03:15, 03:27, and 03:38. After the 9th time Maya caught a frisbee, I paid attention to what color towel her owner, Elizabeth, was holding. At 03:58, I observed Elizabeth holding a red towel." + }, + { + "key": "J1gKFnNU7XM:af2c163dc9407988cc57bb5a4ab31f107fa30542", + "video_id": "J1gKFnNU7XM", + "question": "What collar color is not worn by a dog in the competition?", + "answer_choice_0": "Yellow.", + "answer_choice_1": "White.", + "answer_choice_2": "Black.", + "answer_choice_3": "Pink.", + "answer_choice_4": "Blue.", + "answer_id": 0, + "answer": "Yellow.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched and observed each dog and the colors of their collars when competing in the competition. At 02:21, the 1st dog to compete wore a white collar. At 04:17, the 2nd dog to compete wore a blue collar. At 08:28, the 3rd dog to compete wore a multicolored collar. At 10:37, the 4th dog to compete wore a black collar. At 13:17, the 5th dog to compete wore a pink collar. At 16:34, the 6th dog to compete wore a brown collar. Therefore, no dog wore a yellow collar in the competition." + }, + { + "key": "J1gKFnNU7XM:b66982a95bf01d85d25e7c63294498117ab1b8ec", + "video_id": "J1gKFnNU7XM", + "question": "How many more frisbees did Maya catch in the 50-point target than Chewy?", + "answer_choice_0": "4.", + "answer_choice_1": "0.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "While watching the film, I read a banner with the name \"Maya\" next to a dog at 01:29. Then, I read a banner with the name \"Chewy\" next to a dog at 07:43. After, I watched as Maya and Chewy performed and counted how many times they landed on the 50-point target. From 02:23 - 03:50, I counted and watched Maya catch 7 frisbees in the 50-point target. From 08:34 - 09:58, I counted and watched Chewy catch 6 frisbees in the 50-point target. Then, I subtracted 6 from 7 and got 1. Therefore, Maya caught 1 more frisbee in the 50-point target than Chewy." + }, + { + "key": "J1gKFnNU7XM:e8226b71bac7b431ba52e1aaab4e316f2062c00b", + "video_id": "J1gKFnNU7XM", + "question": "If the number of badges worn by Wonder Benny was multiplied by the number of paw-shaped statues earned by Maya, what would the answer be?", + "answer_choice_0": "32.", + "answer_choice_1": "8.", + "answer_choice_2": "16.", + "answer_choice_3": "10.", + "answer_choice_4": "24.", + "answer_id": 2, + "answer": "16.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified Wonder Benny by looking at a chart that appeared on the screen at 00:25. I saw that he was the 2nd dog listed, along with his owner, Luke, and the flag of his country, Canada. I then looked for any time Wonder Benny wore badges, and I found that he wore 4 badges at 05:04. I watched the rest of the video to ensure he did not wear badges at any other time. I then identified Maya in the video. I did this by looking at the chart on the screen at 00:25. I saw that she was the 1st dog listed, along with her owner, Elizabeth, and the flag of her country, Mexico. I then watched to see how many paw-shaped statues were earned by Maya. At 02:03-02:06, Elizabeth says \"Now Maya has been winning so many awards\" and at 02:05, I saw 4 paw-shaped statues that Maya earned. I then took the number of badges worn by Wonder Benny, 4, and multiplied it by the number of paw-shaped statues earned by Maya, 4, and I found that 4X4 equals 16." + }, + { + "key": "Jc50h1vbbSo:05e6baa4c377b841f3aff9a462be0f5117b20da0", + "video_id": "Jc50h1vbbSo", + "question": "What is the woman doing as the smoke inside the tent dissipates?", + "answer_choice_0": "Rubbing her hands together.", + "answer_choice_1": "Shaking her head.", + "answer_choice_2": "Looking down at the ground.", + "answer_choice_3": "Accepting the knife.", + "answer_choice_4": "Waving an incense stick.", + "answer_id": 2, + "answer": "Looking down at the ground.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene in the tent where smoke was visible, which began at 01:48 as the man began to wave the stick. I watched until the smoke dissipated, which occurred at 01:57 - I then looked at the woman to identify what she was doing while the smoke dissipated, and saw that she was looking down at the ground." + }, + { + "key": "Jc50h1vbbSo:29adc4518df25f645ced4414bd35665192504e04", + "video_id": "Jc50h1vbbSo", + "question": "How many white candles are lit in the small offering altar inside the red tent?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "6.", + "answer_choice_4": "0.", + "answer_id": 2, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked at the segment that starts at 01:00, where the woman with a pink shirt visits a natural healer in his tent. The scene opens with a close up view of the small offering altar, but only two lit candles are seen, a white one being one of them. The next segment, starting at 01:02 shows the small offering altar in the background, where three candles are lit and only one is white." + }, + { + "key": "Jc50h1vbbSo:4a0102eb2eb36e7dbb0c91de76c7a05ea0b63e57", + "video_id": "Jc50h1vbbSo", + "question": "Of the following events - the shaman creates the incense smoke, the woman receives the knife, the shaman begins speaking incantations, the shaman taps the idol, the woman falls to the ground - which one occurs third in the video?", + "answer_choice_0": "The shaman taps the idol.", + "answer_choice_1": "The woman falls to the ground.", + "answer_choice_2": "The woman receives the knife.", + "answer_choice_3": "The shaman begins speaking incantations.", + "answer_choice_4": "The shaman creates incense smoke.", + "answer_id": 4, + "answer": "The shaman creates incense smoke.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the part of the video where this sequence of events occurs - they all happen from 01:31-02:33. I took note of the order in which they occurred - the shaman began speaking incantations at 01:32; the shaman tapped the idol at 01:40, the shaman created the incense smoke at 01:48; the woman received the knife at 02:10, and the woman fell to the ground at 02:33. Of these events, the third one in the sequence was the shaman creating incense smoke." + }, + { + "key": "Jc50h1vbbSo:4e6aff9dfec79713a93a24b04292d1577c08da9a", + "video_id": "Jc50h1vbbSo", + "question": "How many times does the woman in the pink shirt fall to the ground after she is seated at 01:08?", + "answer_choice_0": "1.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "3.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to the part where the woman in the pink shirt is seated, starting at 01:08. I observed as she fell to the ground at 02:34 one time. I continued watching the rest of the video to make sure she does not fall to the ground again. So she fell to the ground one time." + }, + { + "key": "Jc50h1vbbSo:511c562e873a0d8acdbc85e3987a309fb6734c5a", + "video_id": "Jc50h1vbbSo", + "question": "How many different outfits does the woman wear in the video?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to any time the woman wore a different outfit. I noticed her first outfit appeared at 00:26 and her second outfit appeared at 01:08. I then continued watching the rest of the video to ensure she was not wearing any other outfits. So she wore a total of two outfits." + }, + { + "key": "Jc50h1vbbSo:faba02cf6ed262bf6ea445a670db64670880fd69", + "video_id": "Jc50h1vbbSo", + "question": "What object does the woman in the pink shirt hold?", + "answer_choice_0": "A hair brush.", + "answer_choice_1": "A knife.", + "answer_choice_2": "A plate.", + "answer_choice_3": "A fork.", + "answer_choice_4": "A laptop.", + "answer_id": 1, + "answer": "A knife.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to any time the woman in the pink shirt was holding an object. I saw the woman in the pink shirt for the first time at 01:08 and continued watching until a man passes her a knife from 02:06 to 02:09. I noticed that the only time she held an object was from 02:09 to 02:32 and that this object was a knife." + }, + { + "key": "L3yCNlNLJHc:cad2934434e0c1b4d6dff073a988978b64cc284f", + "video_id": "L3yCNlNLJHc", + "question": "Where is the bar placed inside the ballroom at 00:39?", + "answer_choice_0": "Near the stage of the ballroom.", + "answer_choice_1": "Near the right side of the ballroom.", + "answer_choice_2": "Near the left side of the ballroom.", + "answer_choice_3": "Near the back of the ballroom.", + "answer_choice_4": "Outside the ballroom.", + "answer_id": 3, + "answer": "Near the back of the ballroom.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I started watching the video until the male dancer walked into with the ballroom through the entrance with a middle-aged man at 00:38. From 00:38-00:40, I can see the full view of the bar. From At 00:40-00:42, I can see all the way to the front of the ballroom from behind the two men as they walk in, and I don't see the bar. Thus, the bar is at the back of the ballroom." + }, + { + "key": "LSFK2P5ud3g:079ebaa35d3b9d0f7e2d1dae149fdfadf2b7657e", + "video_id": "LSFK2P5ud3g", + "question": "How many points does the starring woman end up with against the guest named Matt?", + "answer_choice_0": "8.", + "answer_choice_1": "3.", + "answer_choice_2": "5.", + "answer_choice_3": "1.", + "answer_choice_4": "11.", + "answer_id": 4, + "answer": "11.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The starring woman sits with various guests, but with one guest there's a scoreboard that's keeping track of votes. One of the boxes is red and has \"Matt\" written inside. So, I watched all the clips with the starring woman and the guest identified as Matt. But the clip that had the highest and final number between the two was at 00:03 , with the starring woman score being 11." + }, + { + "key": "LSFK2P5ud3g:0d63051264462ea7378e1b81b4705653ba2603bb", + "video_id": "LSFK2P5ud3g", + "question": "How many unique bottles of alcohol appear at the end of the table?", + "answer_choice_0": "1", + "answer_choice_1": "3", + "answer_choice_2": "4", + "answer_choice_3": "5", + "answer_choice_4": "2", + "answer_id": 1, + "answer": "3", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for shots where the table was included in the frame. The first unique alcohol bottle is clear with a red bottle cap and it appears for the first time at 00:01. The second unique alcohol bottle is clear with a yellow liquid and gold label, and it appears for the first time at 00:35. The third unique alcohol bottle appears for the first time at 01:37, and it also has a clear bottle with a yellow liquid, along with a red bottle cap. I watched the rest of the video and found no other unique bottles. Therefore, there are 3 instances where unique alcohol bottles were present." + }, + { + "key": "LSFK2P5ud3g:1dc3f0347db66847736554d014fdd5d297231291", + "video_id": "LSFK2P5ud3g", + "question": "How many jokes were guessed correctly in the video?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "1.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched and listened for a joke's punchline being guessed correctly. The contestent guesses the correct answer to a rhetorical question intended to be a joke during the timeframe 06:07-06:14." + }, + { + "key": "LSFK2P5ud3g:39502f8253e17fcb706e9a73a31dc9e3e9a15034", + "video_id": "LSFK2P5ud3g", + "question": "At what point does a guest sitting at the table share with the starring woman that the joke she delivered was bad?", + "answer_choice_0": "05:00.", + "answer_choice_1": "06:45.", + "answer_choice_2": "01:25.", + "answer_choice_3": "01:20.", + "answer_choice_4": "03:30.", + "answer_id": 4, + "answer": "03:30.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched and listened to the entire video. At 03:30, the guest Matt said that was a horrible joke. Another person off-screen told her that the joke she said was not good at 06:45, but it wasn't one of the guests sitting in a chair in front of her." + }, + { + "key": "LSFK2P5ud3g:90cc122f2c729843ba5685de5b81cfdad80a3ce4", + "video_id": "LSFK2P5ud3g", + "question": "How does the man who self-identifies as Asian react when the starring woman jumps at him and yells \"bamboo\"?", + "answer_choice_0": "He laughs.", + "answer_choice_1": "He cries.", + "answer_choice_2": "He wears a straight face.", + "answer_choice_3": "He gives her a high five.", + "answer_choice_4": "He scoffs.", + "answer_id": 2, + "answer": "He wears a straight face.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:30 the starring woman jumps at the Asian man as she shouts \"bamboo\" at him. So I continued watching the clip afterward, and the Asian man had a straight face. He verbally identifies as Asian at 00:35." + }, + { + "key": "LSFK2P5ud3g:a0e8cc83e16b8cac3edb6491595ba916f3c0f236", + "video_id": "LSFK2P5ud3g", + "question": "How many different outfits does the starring woman have?", + "answer_choice_0": "2.", + "answer_choice_1": "10.", + "answer_choice_2": "6.", + "answer_choice_3": "4.", + "answer_choice_4": "8.", + "answer_id": 3, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "As I watched the video, I counted the starring woman's outfit changes. She has four different outfits that are first seen at these timestamps: 0:00, 0:04, 0:17, and 0:25." + }, + { + "key": "LSFK2P5ud3g:f2908e4344e962ef5a4b6f662de08f3c1cc552eb", + "video_id": "LSFK2P5ud3g", + "question": "At the 05:08 mark, what does the man in the black t-shirt do?", + "answer_choice_0": "He drinks a cola.", + "answer_choice_1": "He picks up his cellphone.", + "answer_choice_2": "He pounds the table.", + "answer_choice_3": "He looks at someone laughing.", + "answer_choice_4": "He walks away.", + "answer_id": 3, + "answer": "He looks at someone laughing.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched until I reached the scene at 05:08, when the man in the black t-shirt looked away from the woman at the table with him to look at someone laughing." + }, + { + "key": "LhVqb5ifpac:0c6bce28d95ae6efc19c3ca1a06332c81ea07723", + "video_id": "LhVqb5ifpac", + "question": "In Game 5, who gets more triple word tiles?", + "answer_choice_0": "Mack, 5 to 1.", + "answer_choice_1": "Ian, 5 to 1.", + "answer_choice_2": "They tie.", + "answer_choice_3": "Mack, 3 to 2.", + "answer_choice_4": "Ian, 3 to 2.", + "answer_id": 0, + "answer": "Mack, 5 to 1.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found Game 5 at 16:37 - 23:59 by reading the screen and listening to the announcer, who says \"Mack stuns Ian with his outplay of eschar for 45 to win Game 5\" at 23:51 - 23:56. During that timeframe, I watched the board and counted each time one of them got a triple word tile. At 18:02 - 18:04, Mack gets one with \"zany\". At 18:16 - 18:19, he gets a second one with \"emu\". At 18:38 - 18:42, he gets a third with \"eluviate\". At 19:50 - 19:54, he gets a fourth with \"vino\". At 20:01, Ian gets his first with \"doubting\". Finally, Mack gets his fifth with \"eschar\" at 23:51 - 23:56. After totaling them all up, Mack gets more triple word tiles than Ian, with a score of 5-1 respectively." + }, + { + "key": "LhVqb5ifpac:1e74b37a177a7d039010b2e54323ab31242a9212", + "video_id": "LhVqb5ifpac", + "question": "What is the color of the line between the words \"Scrabble\" and \"History\" at 00:55?", + "answer_choice_0": "Black.", + "answer_choice_1": "Yellow.", + "answer_choice_2": "Red.", + "answer_choice_3": "White.", + "answer_choice_4": "Blue.", + "answer_id": 2, + "answer": "Red.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found the words \"Scrabble\" and \"History\" at 00:55. At the same time, I located the line between the words. I then noticed the line was red. Therefore, the color of the line between the words \"Scrabble\" and \"History\" at 00:55 is red." + }, + { + "key": "LhVqb5ifpac:72fd390d9d91b0d8bbee4367d8a5080469573abf", + "video_id": "LhVqb5ifpac", + "question": "What is the mathematical sum of the ELO rankings for Mack and Ian?", + "answer_choice_0": "2041.", + "answer_choice_1": "2077.", + "answer_choice_2": "4082.", + "answer_choice_3": "4154.", + "answer_choice_4": "4118.", + "answer_id": 4, + "answer": "4118.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 00:20, I saw Mack and Ian being introduced with an on-screen graphic, their names, and place of origin. At the same time, as the narrator discussed their respective ELO rankings, I read the number \"2077\" below Mack's name and \"2041\" below Ian's, indicating their ELO rankings. I then calculated 2077+2041=4118. Therefore, the mathematical sum of the ELO rankings for Mack and Ian is 4118." + }, + { + "key": "LhVqb5ifpac:7d1e5a86a33d424e10ea8f7f04deb005437f2d02", + "video_id": "LhVqb5ifpac", + "question": "When the words \"harmonious burst\" appear on-screen, what is the score of the game?", + "answer_choice_0": "112-15.", + "answer_choice_1": "201-70.", + "answer_choice_2": "155-38.", + "answer_choice_3": "180-55.", + "answer_choice_4": "141-22.", + "answer_id": 4, + "answer": "141-22.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I saw the words \"harmonious burst\" appear on-screen at 17:11. At the same time, I found the score of the game, which was shown as red numbers under the photos of each player on both sides of the screen, reading \"141\" and \"22\", both of which previously started as \"0\" at the beginning of Game 1 at 01:00. Therefore, when the words \"harmonious burst\" appear on-screen, the score of the game is 141-22." + }, + { + "key": "LhVqb5ifpac:80b2efc09b10dad7352876d44672590acb1bda8a", + "video_id": "LhVqb5ifpac", + "question": "If Ian had lost both games against Mack earlier in the event, what would their lifetime head-to-head record be?", + "answer_choice_0": "Mack 6, Ian 3.", + "answer_choice_1": "Mack 4, Ian 5.", + "answer_choice_2": "Mack 8, Ian 3.", + "answer_choice_3": "Mack 8, Ian 5.", + "answer_choice_4": "Mack 7, Ian 4.", + "answer_id": 2, + "answer": "Mack 8, Ian 3.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 00:30, I saw an on-screen graphic, which details the past performances of both Mack and Ian. In the center, it lists their lifetime head-to-head record as Mack 6, Ian 5. Below that, I read that Ian won both meetings earlier in the event, which caused him to have a score of 5. Had Ian not won both games and had Mack won instead, Ian's score would be 5-2=3, while Mack's would then be 6+2=8. Therefore, if Ian had instead lost both games against Mack earlier in the event, their lifetime head-to-head record would then be Mack 8, Ian 3." + }, + { + "key": "LhVqb5ifpac:8e0fd1f66d37f38bca08ed28cccbfb3f1ad75017", + "video_id": "LhVqb5ifpac", + "question": "Which letter tile is positioned at H8 on the board at 07:27 - 07:32?", + "answer_choice_0": "X.", + "answer_choice_1": "W.", + "answer_choice_2": "B.", + "answer_choice_3": "E.", + "answer_choice_4": "N.", + "answer_id": 4, + "answer": "N.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 07:27 - 07:32, I located H8 on the board. I then noticed and read that the letter tile \"N\" was positioned at H8. Since no other letter tiles appeared in that space during this timeframe, the letter tile that is positioned at H8 on the board at 07:27 - 07:32 is \"N\"." + }, + { + "key": "LhVqb5ifpac:90a1e4acdeecaa054f06478e76ec4aa2b9f02c4e", + "video_id": "LhVqb5ifpac", + "question": "What direction does the \"GAME 1\" text graphic move on and off-screen?", + "answer_choice_0": "Down.", + "answer_choice_1": "Up.", + "answer_choice_2": "Left.", + "answer_choice_3": "Diagonal.", + "answer_choice_4": "Right.", + "answer_id": 4, + "answer": "Right.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found the \"GAME 1\" text graphic at 01:00, when I saw it move rightward on-screen before fixing itself in the center. Then, at 01:01, I saw the graphic move rightward off-screen. Therefore, the \"GAME 1\" text graphic moves on and off-screen to the right." + }, + { + "key": "LhVqb5ifpac:a0a4cf8384394a8b9adb34b5f93174b8e9be4a14", + "video_id": "LhVqb5ifpac", + "question": "What is Mack's first played word in Game 4?", + "answer_choice_0": "Axe.", + "answer_choice_1": "Eke.", + "answer_choice_2": "Brown.", + "answer_choice_3": "Fytte.", + "answer_choice_4": "Koine.", + "answer_id": 0, + "answer": "Axe.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found Game 4 at 09:24 by reading the screen. At 09:36, I saw the first move of the game was played by Ian, who played \"eke\". Then, I saw Mack play \"axe\" as his first word at 09:40. Therefore, Mack's first played word in Game 4 is \"axe\"." + }, + { + "key": "LhVqb5ifpac:bb2b2f5684a2790a64320034f87593273fcc0a0c", + "video_id": "LhVqb5ifpac", + "question": "In Game 2, how much does Ian's lead increase after playing \"vairs\" and \"fawner\"?", + "answer_choice_0": "110", + "answer_choice_1": "127", + "answer_choice_2": "122", + "answer_choice_3": "57", + "answer_choice_4": "74", + "answer_id": 3, + "answer": "57", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found Game 2 at 03:25 - 06:12 by reading the screen and listening to the announcer, who says \"It's Ian's turn to go first in Game 2\" at 03:25 - 03:29 and \"Ian takes Game 2\" at 06:08 - 06:12. I saw \"vairs\" was played at 06:01 and \"fawner\" at 06:03. I went back to 6:00 to find Ian's score before playing those two words and saw that it was 275. I then saw that Ian got 38 points for playing the word \"vairs\" and 39 points for playing the word \"fawner\" since \"+38\" and +\"39\" appear onscreen when he plays those words. I also saw that in between those two plays, Mack scored 20 points for the word \"feu\" since it and the number \"+20\" appear at 06:03. I then added together Ian's total number of gained points, 38+39=77 and then subtracted the number of points gained by Mack in between those two plays 77-20=57. I determined that Ian's lead increases by 57 points after playing \"vairs\" and \"fawner\" in Game 2." + }, + { + "key": "LhVqb5ifpac:c9990d1e7ed5884164c81285ee732fe80a8db5e2", + "video_id": "LhVqb5ifpac", + "question": "In Game 1, what is the mathematical difference between the players' scores when the speaker says \"The dreaded Q dooms him\"?", + "answer_choice_0": "15 points.", + "answer_choice_1": "40 points.", + "answer_choice_2": "20 points.", + "answer_choice_3": "50 points.", + "answer_choice_4": "10 points.", + "answer_id": 2, + "answer": "20 points.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found Game 1 at 01:00 by reading the screen. I then heard the speaker say \"The dreaded Q dooms him\" at 02:56 - 03:01. At the same time, I saw the score was 361-381, which was shown as red numbers under the photos of each player on both sides of the screen, previously starting as \"0\" at the beginning of Game 1 at 01:00. Then, I calculated 381-261=20. Therefore, the mathematical difference between the players' scores when the speaker says \"The dreaded Q dooms him\" in Game 1 is 20 points." + }, + { + "key": "LjRBanp0u_8:5138338a99d6c1f428d2356fda5eaca5f3f4eb9d", + "video_id": "LjRBanp0u_8", + "question": "Did a white pawn capture a piece in the video?", + "answer_choice_0": "Yes, the white pawn captured 1 piece.", + "answer_choice_1": "No, the white pawn only caused checks.", + "answer_choice_2": "No, only white rooks, knights, bishops, and the queen took pieces.", + "answer_choice_3": "No, only black pawns took pieces.", + "answer_choice_4": "Yes, the white pawn captured 2 pieces.", + "answer_id": 4, + "answer": "Yes, the white pawn captured 2 pieces.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the video looking for any white pawns to capture pieces. I noticed that a white pawn captures a black rook at 07:59. I kept watching and noticed that a white pawn captured another black rook at 16:33. Therefore, I concluded that, yes, the white pawn did capture 2 pieces." + }, + { + "key": "LjRBanp0u_8:52edac476eb254a9883918708b67f9104a232ef2", + "video_id": "LjRBanp0u_8", + "question": "Where is the black knight chess piece moved after the speaker compares the chess board to a Jackson Pollock painting?", + "answer_choice_0": "a6 to c5.", + "answer_choice_1": "f6 to g4.", + "answer_choice_2": "g8 to e7.", + "answer_choice_3": "e3 to c2.", + "answer_choice_4": "d5 to f4.", + "answer_id": 1, + "answer": "f6 to g4.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched until I heard the speaker say \"I made a mess of the chess board. I am the Jackson Pollock of chess\" at 07:35-07:39. I continued watching to see which chess piece was moved after this was said, and I observed the black knight get moved from f6 to g4." + }, + { + "key": "LjRBanp0u_8:6ffcbcd72afc1caa70dcb6278abb097f47976cbb", + "video_id": "LjRBanp0u_8", + "question": "How many chess puzzles does the video cover?", + "answer_choice_0": "11.", + "answer_choice_1": "7.", + "answer_choice_2": "10.", + "answer_choice_3": "1.", + "answer_choice_4": "5.", + "answer_id": 0, + "answer": "11.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I looked for chess puzzles, finding the first at the very beginning at 00:00. I knew this to be the first puzzle because \"Puzzle #1\" appears in the top right corner of the screen at 00:30. Having found a key to discovering how many puzzles there are, I kept watching until I found a \"Puzzle #11\" at 16:36. There were no more puzzles after this, so I concluded that there were 11 chess puzzles covered in the video." + }, + { + "key": "LjRBanp0u_8:a4b72285a3321da3bb3988536a3d2b3a39a78b79", + "video_id": "LjRBanp0u_8", + "question": "In the first 30 seconds of the video, how many anthropomorphic chess pieces wear fashion accessories?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched the first 30 seconds of the video, looking for anthropomorphic chess pieces wearing accessories. I found my first one at 00:12, when I saw a pawn wearing red gloves. I found my second at 00:22, when I saw a pawn wearing sunglasses and a purple hat. I got to the end of the 30 seconds, and found no more of these kinds of chess pieces, the the answer is 2." + }, + { + "key": "LjRBanp0u_8:c508eb7a12247a59eba30a86ce31ba26735f3946", + "video_id": "LjRBanp0u_8", + "question": "After the speaker explains the definition of a \"luft\", which two chess pieces are located closest to the black king?", + "answer_choice_0": "Black queen and white knight.", + "answer_choice_1": "White pawn and black queen.", + "answer_choice_2": "White pawn and black bishop.", + "answer_choice_3": "Black pawn and black rook.", + "answer_choice_4": "White rook and black rook.", + "answer_id": 3, + "answer": "Black pawn and black rook.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched and listened as the speaker explained the definition of a \"luft\", which is when the king is attempting to get an escape square, from 11:05-11:09. After that, I located the black king on the chess board in space g8. I then located which two chess pieces were in the closest proximity to the black king, and I noticed a black pawn in space g7 and black rook in space f8. Therefore, a black pawn and a black rook are located closest to the black king." + }, + { + "key": "LjRBanp0u_8:ca701d4ec7028a1a72ad00de3d6ce6ff870998b4", + "video_id": "LjRBanp0u_8", + "question": "Which chess piece is highlighted after the castled king is attacked from the side for the first time?", + "answer_choice_0": "A white rook.", + "answer_choice_1": "A white knight.", + "answer_choice_2": "A black pawn.", + "answer_choice_3": "A black queen.", + "answer_choice_4": "A black bishop.", + "answer_id": 2, + "answer": "A black pawn.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched and listened as the speaker said at 10:52-10:56, \"that was the first time we attacked the castled king from the side.\" After this, I then paid attention to which chess piece was highlighted and I observed a black pawn highlighted in a light shade of blue. It was the only highlighted chess piece on the board." + }, + { + "key": "LjRBanp0u_8:ca9349638a2b46d11ad10ffac92307e5a252c662", + "video_id": "LjRBanp0u_8", + "question": "When the speaker mentions a \"trebuchet\", how many more black pawns are there than white pawns on the chess board?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "6.", + "answer_choice_4": "0.", + "answer_id": 0, + "answer": "1.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:16-00:21, the speaker jokingly says, \"we're going to break out a trebuchet to launch ourselves over the castle wall\" in order to get at the king chess piece. After this, I counted 7 black pawns and 6 white pawns. There is 1 more black pawn than white pawns." + }, + { + "key": "LjRBanp0u_8:fc9bb097dec33733c2847d8205422c8dda156b51", + "video_id": "LjRBanp0u_8", + "question": "Where is the white queen in relation to the black queen at the beginning of the fourth puzzle?", + "answer_choice_0": "5 squares to the right of the black queen.", + "answer_choice_1": "2 squares to the left of the black queen.", + "answer_choice_2": "3 downward diagonal squares to the right of the black queen.", + "answer_choice_3": "4 squares below the black queen.", + "answer_choice_4": "1 square above the black queen.", + "answer_id": 0, + "answer": "5 squares to the right of the black queen.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I looked for the fourth puzzle, finding it at 05:53. I know this is the fourth puzzle because \"Puzzle #4\" is written in the top right corner of the screen. I then looked for the white queen on the chessboard and found it at c5. Then I looked for the black queen and found it at h5. The white queen, therefore, is five squares to the right of the black queen (from the black team's perspective)." + }, + { + "key": "LmUe4mh9wcA:09cbb020bd80b3e845086ead9854013099a5e3b6", + "video_id": "LmUe4mh9wcA", + "question": "What color are the squares on the chessboard displayed during the first transition between queen traps and tricks?", + "answer_choice_0": "Black and yellow.", + "answer_choice_1": "White and Gray.", + "answer_choice_2": "Dark blue, and light blue.", + "answer_choice_3": "Tan and Beige.", + "answer_choice_4": "Brown and Beige.", + "answer_id": 0, + "answer": "Black and yellow.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I looked for the first transition between the first and second queen tricks and traps and located it between 03:19 and 03:21 in the video. As she does, I observed the chessboard displayed during this transition and saw that its colors are black and yellow." + }, + { + "key": "LmUe4mh9wcA:3ece6ac938820cd0c92d1ed46b8a41cabe9f9630", + "video_id": "LmUe4mh9wcA", + "question": "How many red rectangle boxes are displayed on screen within the first 30 seconds?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "10.", + "answer_choice_4": "7.", + "answer_id": 2, + "answer": "1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching the first 30 seconds of the video, I noticed that there were various rectangle boxes on the screen at 00:09, 00:14, 00:23 and 00:30. Then, I looked at the rectangle boxes and counted how many were red. I counted only 1 red rectangle box. Therefore, there is only 1 rectangle box displayed on the screen within the first 30 seconds." + }, + { + "key": "LmUe4mh9wcA:4cdf080f46e767cb59be03f1600735ba84e52945", + "video_id": "LmUe4mh9wcA", + "question": "Which of the transitions introducing a new queen trap shows a human hand moving a chess piece across the board?", + "answer_choice_0": "The second.", + "answer_choice_1": "The first and the second.", + "answer_choice_2": "The first.", + "answer_choice_3": "None.", + "answer_choice_4": "The third.", + "answer_id": 4, + "answer": "The third.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching the video, I searched for the transitions introducing new traps. I found the first transition at 03:19 and did not see any human hands. The second transition, at 07:29, also did not have any. I continued watching and located the third transition at 09:42, where I saw a human hand moving a chess piece across the board. I then checked the remaining transitions: the fourth at 13:39, the fifth at 16:38, and the sixth at 23:59. These did not contain any human hands. Therefore, I concluded that only the third transition, at 09:42, included a human hand." + }, + { + "key": "LmUe4mh9wcA:5d05943a9c2e774d5d94417e4ff55ae8c26119ea", + "video_id": "LmUe4mh9wcA", + "question": "How long does the single black spinning chess piece stay on the screen?", + "answer_choice_0": "00:04.", + "answer_choice_1": "00:12.", + "answer_choice_2": "00:02.", + "answer_choice_3": "00:10.", + "answer_choice_4": "00:08.", + "answer_id": 0, + "answer": "00:04.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching, I looked for a single black spinning chess piece. There was another black chess piece at 07:30, but it wasn't alone; there were 2 other chess pieces there. Then, I noticed an insert of a black spinning chess piece starting at 03:17. The clip finished at 03:21. Then, I counted the difference between 03:21 and 03:17 and got 00:04. Therefore, the single black chess piece spins for 4 seconds." + }, + { + "key": "LmUe4mh9wcA:6e35479211b3c97566739e8a8aa210fed0cff5e1", + "video_id": "LmUe4mh9wcA", + "question": "How many more white chess pieces are there compared to the black chess pieces at 03:10?", + "answer_choice_0": "1.", + "answer_choice_1": "9.", + "answer_choice_2": "6.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "3.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I first located the 03:10 timestamp in the video. Then I paused it and counted the white chess pieces. I counted 15 white chess pieces. Then I counted the black chess pieces and counted 12. Afterward, I calculated the difference and got 3. Therefore, there are 3 more white chess pieces than black chess pieces at 03:10." + }, + { + "key": "LmUe4mh9wcA:8fe0022a6b68018243d4163255d1b2145345a848", + "video_id": "LmUe4mh9wcA", + "question": "How many chess pieces are visible on screen when the narrator first introduces the \"Hector Gambit\"?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "3.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I located the section where the narrator mentions the Hector Gambit and identified the visible chess pieces at 07:28. I counted three individual pieces. Watching until the end of the transition at 07:31, I observed no additional pieces. Therefore, I concluded that there were three pieces." + }, + { + "key": "LmUe4mh9wcA:a3fea96bda29e5d849e436a55a61e26628ea0de5", + "video_id": "LmUe4mh9wcA", + "question": "What are the colors of the arrows used throughout the video?", + "answer_choice_0": "Blue, Pink, & Yellow.", + "answer_choice_1": "Green, Pink, & Orange.", + "answer_choice_2": "Orange, Blue, & Black.", + "answer_choice_3": "Red, Green, & Blue.", + "answer_choice_4": "Purple, Red, & Green.", + "answer_id": 3, + "answer": "Red, Green, & Blue.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "Throughout the video, I noticed that different arrows were used. There was a red arrow at 01:12, a green arrow at 02:10, and a blue arrow at 17:10. At 12:23, all three colors show up at the same time. Therefore, the colors of the arrows used throughout the video are red, green, and blue." + }, + { + "key": "LmUe4mh9wcA:b2082e1a3b71d1088d63be0c9a777ca36c231e2b", + "video_id": "LmUe4mh9wcA", + "question": "Which pieces are on either side of the white king when it slowly falls on the board?", + "answer_choice_0": "A black bishop and a white knight.", + "answer_choice_1": "A white bishop and a black bishop.", + "answer_choice_2": "A black bishop and a black pawn.", + "answer_choice_3": "A white bishop and a white pawn.", + "answer_choice_4": "A black bishop and a white pawn.", + "answer_id": 3, + "answer": "A white bishop and a white pawn.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching, I looked for a clip of a falling king chess piece. I know that the chess piece with a cross at the top of it is the king because the speaker refers a chess piece at 06:10 the king, which has a cross at the top. Then, at 19:13, I noticed a white king chess piece falling on a board. I looked and saw a white bishop and a white pawn on either side of the king. Therefore, there is a white pawn and a white bishop on either side of the white king when it falls." + }, + { + "key": "LmUe4mh9wcA:d3d41b101efc8f355e21d4d36a20c9417cc057c2", + "video_id": "LmUe4mh9wcA", + "question": "At the 19:37 mark, what direction does the arrow displayed on the chessboard point?", + "answer_choice_0": "Leftwards.", + "answer_choice_1": "Rightwards.", + "answer_choice_2": "Downwards.", + "answer_choice_3": "Upwards.", + "answer_choice_4": "Diagonally leftwards.", + "answer_id": 2, + "answer": "Downwards.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I located the 19:37 mark in the video. Then, I identified the arrow that emerges from h2 and points down towards h3. Therefore, I concluded that the arrow at 19:37 points downwards." + }, + { + "key": "Ltt7AR-cVow:4df2f79ced94af4ef876d1c69645816e8b4f0e67", + "video_id": "Ltt7AR-cVow", + "question": "How many rows of golf carts are behind the gray building with the green awning when the runners go by?", + "answer_choice_0": "8.", + "answer_choice_1": "11.", + "answer_choice_2": "3.", + "answer_choice_3": "6.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "8.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched for a gray building with a green awning and found one at 00:30. At 00:34, I could begin to see rows of golf carts behind and to the right of the building. I continued watching until all the rows were visible, which occurred at 00:46 I counted 8 rows of golf carts. I also observed the runners going by the building between 00:34-00:46. I concluded that 8 rows of golf carts are behind the gray building with the green awning when the runners go by." + }, + { + "key": "Ltt7AR-cVow:adcf87fabce8dfcd8f00966dc01b953ebeebe1d1", + "video_id": "Ltt7AR-cVow", + "question": "How many unique bunkers are in between the apartment complex that appears at 07:25 and the sharp curve in the trail around a green directly after it?", + "answer_choice_0": "1.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for an apartment complex and found it becomes clearly visible between 07:25-08:05. Next, I looked for a curve in the trail around a putting green. It becomes clearly visible at 08:26. I went back to the last moment where the apartment complex was visible, 08:06, and began looking for bunkers between the apartment complex and the sharp curve in the trail. I saw 1 become clearly visible at 08:06, and another at 08:25. I concluded that there are 2 bunkers in between the apartment complex and the sharp curve in the trail." + }, + { + "key": "Ltt7AR-cVow:bb9b91f8e55cb702cf316732a986087468381f53", + "video_id": "Ltt7AR-cVow", + "question": "How many runners at the front of the race are seen running on a fairway adjacent to a large residential neighborhood after separating from the rest of the group?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "7.", + "answer_choice_3": "10.", + "answer_choice_4": "8.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First, I looked for a good view of a residential neighborhood and found the first one occurs at 13:36. I then carefully observed the field and looked for a moment where the front runners enter a fairway adjacent to the neighborhood. I saw the first one cross onto a fairway adjacent to the neighboorhood at 13:45. 2 other runners follow this runner onto the fairway at 13:54. The camera follows these three runners only, separating them from the rest of the group as they run on the fairway." + }, + { + "key": "Ltt7AR-cVow:bd4949d1f2cab1a5154c61df04014cab7ee4cc7c", + "video_id": "Ltt7AR-cVow", + "question": "What are the colors of the waving flag held up by a spectator in a red shirt standing on the left side of the field at the beginning of the race?", + "answer_choice_0": "Red and white.", + "answer_choice_1": "Orange and White.", + "answer_choice_2": "Orange and yellow.", + "answer_choice_3": "Red and yellow.", + "answer_choice_4": "Navy and white.", + "answer_id": 0, + "answer": "Red and white.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for the beginning of the race and found it starts at 00:00. I determined this moment denotes the beginning of the race because of the way the runners are grouped, their stance, and the fact that there are people standing directly behind them. As the runners took off, I looked at the large group of spectators standing on both sides of the field. I found a spectator in a red shirt waving a large flag on the left side of the field. I carefully looked at the colors of the flag and determined they are red and white." + }, + { + "key": "Ltt7AR-cVow:c75117bac81ad79a0519e8f7a6a49e8047866363", + "video_id": "Ltt7AR-cVow", + "question": "How long does it take for the runners at the front of the race to reach a stretch of narrow pavement after leaving their first stretch of narrow pavement?", + "answer_choice_0": "1 minute and 11 seconds", + "answer_choice_1": "1 minute and 46 seconds", + "answer_choice_2": "15 seconds", + "answer_choice_3": "38 seconds", + "answer_choice_4": "2 minutes and 37 seconds", + "answer_id": 0, + "answer": "1 minute and 11 seconds", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "First, I looked for a moment where the runners left a narrow stretch of pavement for the first time. I found this occurs for the front runner at 00:26, and the subsequent runners right afterward. I then continued to find the moment when a second stretch of pavement occurs, and when the runners reach it. I found this occurs for the front runner at 01:37, and the subsequent runners right afterward. I subtracted 00:26 from 01:37, and determined that it takes them 1 minute and 11 seconds." + }, + { + "key": "Ltt7AR-cVow:cf12d5a9d389587b38d7ef1b3f812c3de68fe70b", + "video_id": "Ltt7AR-cVow", + "question": "What movements does the spectator in the red shirt make when the yellow construction vehicle is onscreen?", + "answer_choice_0": "Walking backwards and pointing.", + "answer_choice_1": "Waving their arms and crouching.", + "answer_choice_2": "Skipping and falling.", + "answer_choice_3": "Turning in circles and waving.", + "answer_choice_4": "Running and jumping.", + "answer_id": 0, + "answer": "Walking backwards and pointing.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the video looking for the yellow construction vehicle, which appears at 06:30. I continued watching, looking for a spectator in a red shirt, and they are visible at 06:35. At 06:40 the spectator begins to point off and on, and at 06:47, they begin to walk backwards.The yellow construction vehicle is always visible during this time. I concluded that the spectator in the red shirt walks backwards and points when the yellow construction vehicle is onscreen." + }, + { + "key": "Ltt7AR-cVow:e22cb0f7733f84b958367787ab268fb31f99ad06", + "video_id": "Ltt7AR-cVow", + "question": "How many unique bunkers are visible during the first 2 minutes of the video?", + "answer_choice_0": "3", + "answer_choice_1": "1", + "answer_choice_2": "5", + "answer_choice_3": "2", + "answer_choice_4": "0", + "answer_id": 3, + "answer": "2", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for bunkers on the golf course and found the first one visible from 00:20-00:21. I saw another bunker at 00:57. I did not see any more bunkers between 00:57-02:00. Therefore, I concluded that a total of 2 bunkers are visible during the first 2 minutes of the video." + }, + { + "key": "Ltt7AR-cVow:f110ed6f95f44034f3f98bca26be0cb4eaa0192f", + "video_id": "Ltt7AR-cVow", + "question": "How many flags containing the color red are visible between 00:00-01:45?", + "answer_choice_0": "2.", + "answer_choice_1": "0.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I watched the first minute of the video and looked for flags containing the color red. I found the first at 00:00 when I observed a spectator waving a large red and white flag. At 00:20, I saw a red flag marking the hole of a green blowing. At 00:30, I saw an American flag containing the color red next to a large building. At 01:38, I observed a white flag demarcating the hole of another green, but did not count this flag since it didn't contain the color red. I continued watching until 01:45 but did not notice any other flags. I concluded that there are 3 flags containing the color red between 00:00-01:45." + }, + { + "key": "Ltt7AR-cVow:f3cb138ba292cbcf2ec2d5937be205fdf824f255", + "video_id": "Ltt7AR-cVow", + "question": "How many runners cross the finish line between 15:21-16:21?", + "answer_choice_0": "5.", + "answer_choice_1": "3.", + "answer_choice_2": "13.", + "answer_choice_3": "9.", + "answer_choice_4": "7.", + "answer_id": 3, + "answer": "9.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Misc Sports", + "reasoning": "I looked for a finish line and read the word \"FINISH' on an inflatable arch that became visible at 15:12. I looked for runners to begin passing beneath it between 15:21-16:21 and found the first runner did so at 15:24. I saw another runner go through at 15:33, and another at 15:40. I saw more runners pass beneath the arch at 15:52, 15:59, 16:03, 16:07, 16:13, and 16:19. I counted up the total number of runners that pass beneath the arch between 15:21-16:21 and got 9." + }, + { + "key": "M22bYjTWJw0:0c117280e4f4b5eaa64b7586a9384431024eadb6", + "video_id": "M22bYjTWJw0", + "question": "What does the man from Cirque du Soleil balance on his forehead?", + "answer_choice_0": "A beer bottle with a rose.", + "answer_choice_1": "A champagne bottle with a candle.", + "answer_choice_2": "A wine glass filled with water.", + "answer_choice_3": "A candleabra with burning candles.", + "answer_choice_4": "Three stacked bowling pins.", + "answer_id": 0, + "answer": "A beer bottle with a rose.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I heard the rap singer announce that the juggler was a performer, either past or present, employed by Cirque du Soleil at 01:47. He balanced a host of objects on his face, but at 01:51 I could see him balance a beer bottle with a red flower poking out of its neck on his forehead." + }, + { + "key": "M22bYjTWJw0:5f7e0d066465958b97f48eefa8fa91db350bb34e", + "video_id": "M22bYjTWJw0", + "question": "How many times does the number 1 juggler appear on screen?", + "answer_choice_0": "14.", + "answer_choice_1": "13.", + "answer_choice_2": "17.", + "answer_choice_3": "20.", + "answer_choice_4": "15.", + "answer_id": 3, + "answer": "20.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video segment relating to the number 1 listed juggler beginning at 06:05 and counted how many times he appeared. The 1st appearance was of the juggler's hands throwing red balls up into the air at 06:05. It was followed by a quick cut to a medium close up of the juggler juggling the same red balls at 06:07. The 3rd was an overhead shot of the juggler pushing balls up into the air at 06:09. The 4th showed the juggler spinning in countless circles as the balls were airborne at 06:11. The 5th was a low angle shot of the juggler gazing down the barrel of the lens from about a foot away at 06:13. Then, there were 2 of him at a gas station at night at 06:15; 3 of him on a basketball court at 06:17; and 9 of him in a kaleidoscopic overhead shot against a blue backdrop at 06:19. The last 1 occurred of the number 1 juggler on a court from afar at 06:20." + }, + { + "key": "M22bYjTWJw0:b213293383a0e2d460755faf8c89aa8a5122973b", + "video_id": "M22bYjTWJw0", + "question": "What is the first country mentioned in the on the \"Roll Call\" track?", + "answer_choice_0": "England.", + "answer_choice_1": "France.", + "answer_choice_2": "Italy.", + "answer_choice_3": "Germany.", + "answer_choice_4": "Japan.", + "answer_id": 1, + "answer": "France.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I saw the screen say Track 1: Roll Call at 00:05. I then listened to the audio for mentions of any countries and heard France mentioned at 00:11." + }, + { + "key": "M22bYjTWJw0:d5c6639ada0a13827af1d6c7274b4fab0ed09cfc", + "video_id": "M22bYjTWJw0", + "question": "What type of instrument does the number 12 juggler juggle with?", + "answer_choice_0": "Rings.", + "answer_choice_1": "Batons.", + "answer_choice_2": "Pins.", + "answer_choice_3": "Balls.", + "answer_choice_4": "Triangles.", + "answer_id": 2, + "answer": "Pins.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I saw the number 12 in the lower left corner at 04:09. The juggler juggled pins through his legs and up into the air in multiple locations from 04:09-04:17." + }, + { + "key": "M22bYjTWJw0:e358faf03ed65d628c00a3d0d9db87876efc24ba", + "video_id": "M22bYjTWJw0", + "question": "How many times does the juggler at 05:26-05:31 drop at least one of his balls?", + "answer_choice_0": "3 times.", + "answer_choice_1": "2 times.", + "answer_choice_2": "4 times.", + "answer_choice_3": "0 times.", + "answer_choice_4": "1 time.", + "answer_id": 0, + "answer": "3 times.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and went to the 05:26-05:31 time frame. During this range of time, a juggler is juggling white balls at the bottom and center of the frame. In quick succession, the juggler drops at least one ball in three successive clips at 05:27, 05:28, and 05:30." + }, + { + "key": "M5k9aB-OPsE:0c3f145da35c1a30a6319ed0e1f8ba7ecc5cacd1", + "video_id": "M5k9aB-OPsE", + "question": "How many times are the various qualifying low times listed beneath the words \"TIME TO BEAT\" beaten in the video?", + "answer_choice_0": "3", + "answer_choice_1": "0", + "answer_choice_2": "4", + "answer_choice_3": "5", + "answer_choice_4": "2", + "answer_id": 0, + "answer": "3", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 00:11, I identified the qualifying time to beat as \"14.78\" displayed on a digital scoreboard at the top left-center of the frame. The text 'TIME TO BEAT' was shown above the time, indicating that riders needed to achieve a faster time to qualify. I continued watching, and saw the first female rider complete the course under the allotted and qualifying time to beat. The time improved, from \"14.78\" to \"14.75\" on a separate scoreboard next to the one that reads \"14.78\" at 00:24. I counted this as the first time the qualifying time was beaten. Then, I watched the second rider, starting at 00:44 and saw her achieve a time faster than the qualifying time, with a final time of \"14.82 seconds at 01:03, shown on the scoreboard at the very top left of the frame, next to the one that reads \"14.82\". Finally, at 01:49, I witnessed the third rider beat with a time of \"14.52\" seconds, which was reflected on the same scoreboard to the top left of the frame. I continued watching, to find for more instances where riders beat the qualifying time. However, at 02:23, the final rider did not complete the rodeo's course within the qualifying time. I saw on the scoreboard that her final time was \"14:86. Therefore, the qualifying low time was beaten 3 times." + }, + { + "key": "M5k9aB-OPsE:0e4067f7fc015dd812fcb4d067220ad748379496", + "video_id": "M5k9aB-OPsE", + "question": "How much time does it take for the first rider and horse to exit the starting gate?", + "answer_choice_0": "8 seconds.", + "answer_choice_1": "7 seconds.", + "answer_choice_2": "9 seconds.", + "answer_choice_3": "5 seconds.", + "answer_choice_4": "6 seconds.", + "answer_id": 0, + "answer": "8 seconds.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 00:01, I watched the first rider duck beneath 2 steel beam sitting on her horse as she entered the rodeo's gate. From 00:01-00:05, I saw the horse proceed at a light trot, cantering through the start of the gate. At 00:05, I saw the horseback rider use her legs to buck the horse. As a result, the horse leapt back on its hind leg, kicking the light trot into a full-on sprint. From 00:05-00:08, I noticed the horse sprinting through the starting gate until 00:08 wherein the horse and the rider broke the plane and emerged into the rodeo's ovular pit." + }, + { + "key": "M5k9aB-OPsE:1284f9681284163bf63756422ba4a00891f0afa5", + "video_id": "M5k9aB-OPsE", + "question": "What would be the second rodeo rider's pants color if you combined the color of their pants with the color of the fourth rodeo rider's shirt?", + "answer_choice_0": "Yellow-green.", + "answer_choice_1": "Purple.", + "answer_choice_2": "Orange.", + "answer_choice_3": "Green.", + "answer_choice_4": "Red-orange.", + "answer_id": 1, + "answer": "Purple.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified the four rodeo riders in the competition. I identified the first rodeo rider at 00:05 when the announcer said \"Here comes Jordan Briggs\" while a woman rode the first horse. I then identified the second rodeo rider at 00:49 when the announcer said \"Dona K. Rule\" while a woman rode the second horse. I then identified the third rodeo rider when the announcer said \"Jessica Routier\" while a woman rode the third horse. I then identified the fourth rodeo rider when text appeared on the bottom of the screen that said \"Shelley Morgan\" at 02:29 while a woman rode the fourth horse. After that, I looked to see what color pants the second rodeo rider was wearing, and I could clearly see that she was wearing blue jeans at 00:50. I then looked to see what color shirt the fourth rodeo rider was wearing, and I found that she was wearing a red shirt at 02:04. After that, I found that if you were to combine the color blue with the color red, you would get the color purple. Therefore, if you combined the color of the second rodeo rider's pants with the color of the fourth rodeo rider's shirt, you would get the color purple." + }, + { + "key": "M5k9aB-OPsE:177907693a4c46e0c3bcb4e079b9c1d904f63ea8", + "video_id": "M5k9aB-OPsE", + "question": "Who is the third horse rider to take over the new leader, sporting 'best time' during the qualifying run?", + "answer_choice_0": "Shelley Morgan.", + "answer_choice_1": "Dona Kay.", + "answer_choice_2": "Jordon Briggs.", + "answer_choice_3": "Jessica Routier.", + "answer_choice_4": "Shirley Huntley.", + "answer_id": 3, + "answer": "Jessica Routier.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "While watching the video, I identified the first rider, and saw at 00:31, the end of her run. The title card for \"Jordon Briggs\" displayed a time of 14:75, designating her the \"New Leader\" on the scorecard at the bottom of the screen. This is the first best \"New Time\". At 01:13, I watched the second rider \"Dona Kay\" set a new best qualifying runtime, designating her the \"New Leader\" on the scorecard at the bottom of the screen and beating the previous time set by Jordon Briggs. This is the 2nd change of hands for the best time. Finally, at 01:55, I watched as the third rider \"Jessica Routier\" posted the 3rd and final best time, designating her the 'New Leader' during the qualifying section of the rodeo. Therefore, the 3rd and 'best time' holder is Jessica Routier.\" Notably, in this case, I did not hear the commentator mention that she had the 'best time' by saying her name at the end of her qualifying run. Therefore, at 01:55, I had to read her name on the scorecard during an instant replay of her time, which flashed her name \"Jessica Routier\" along with her \"GO 3 Time: 14.52\". Therefore, the 3rd and 'best time' holder is Jessica Routier." + }, + { + "key": "M5k9aB-OPsE:2dcf86dfb8795badfa9cebb9d8cc043c5d2c1943", + "video_id": "M5k9aB-OPsE", + "question": "How many times can the white truck be seen in the background of the rodeo competition?", + "answer_choice_0": "10 times.", + "answer_choice_1": "2 times.", + "answer_choice_2": "8 times.", + "answer_choice_3": "6 times.", + "answer_choice_4": "4 times.", + "answer_id": 3, + "answer": "6 times.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched until I located the white truck in the background of the rodeo competition. The first time I identified the white truck was at 00:06. After that, I looked to see how many additional times the white truck appeared on screen. I located the white truck in the background of the rodeo competition at 00:22, 01:01, 01:31, 01:46, and 02:20. I then counted these number of appearances together, and I got a total of 6. Therefore, the white truck can be seen in the background of the rodeo competition a total of 6 times." + }, + { + "key": "M5k9aB-OPsE:4490586e900ec1df69fb279ba06112e8d1e9e4e2", + "video_id": "M5k9aB-OPsE", + "question": "If the course added one more blue drum, how many rorations would the second horse complete?", + "answer_choice_0": "1.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "As I watch the video, I identified the first rider from 00:00-00:43. At 00:47, I identified the second rider, and saw her, and her horse exit the rodeo gate and emerged into the rodeo's qualifying course. I saw the horse burst into the rodeo's circular course and beeline for the first blue drum. From 00:49-00:51, I watched the horse complete a circular rotation around the first blue drum located at the near side of the course. At 00:52, I noticed that the horse broke toward a second blue drum. From 00:53-00:55, I watched the horse turn counterclockwise around the second drum, completing its 2nd rotation. Finally, from 00:58-00:59, I watched the horse finish a 3rd semicircle rotation around the last drum, striding back toward the course's gate, also known as the course's finishing line. If one were to add another drum, that would be a total of 4 rotations." + }, + { + "key": "M5k9aB-OPsE:6990bf24dc13b0b76fe1752f037e8b961d7c2672", + "video_id": "M5k9aB-OPsE", + "question": "According to the timer on the screen, the second rodeo rider rounds the second barrel before how many seconds pass?", + "answer_choice_0": "3 seconds.", + "answer_choice_1": "5 seconds.", + "answer_choice_2": "4 seconds.", + "answer_choice_3": "6 seconds.", + "answer_choice_4": "8 seconds.", + "answer_id": 4, + "answer": "8 seconds.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched and identified the first rodeo rider at 00:05 when the announcer said \"Here comes Jordan Briggs\", while Jordan and her horse entered the rodeo arena at 00:08. I then identified the second rodeo rider entering the rodeo arena on her horse at 00:47 and at 00:49 the announcer stated her name, which was \"Dona K. Rule.\" I continued watching the second rodeo rider, Dona K. Rule, as she rounded the first barrel on her horse at 00:49-00:51. I then watched as she rounded the second barrel from 00:53-00:55. After she rounded the second barrel, I located the timer on the screen and noticed that it had not yet reached the 8 second mark. Therefore, the second rodeo rider rounds the second barrel before 8 seconds pass on the timer." + }, + { + "key": "M5k9aB-OPsE:757200efa06333d828f7f65b6a1aad1baf9eb459", + "video_id": "M5k9aB-OPsE", + "question": "How many white numbers with orange backgrounds can be seen during the replay for the fourth rodeo rider?", + "answer_choice_0": "11.", + "answer_choice_1": "6.", + "answer_choice_2": "10.", + "answer_choice_3": "7.", + "answer_choice_4": "5.", + "answer_id": 0, + "answer": "11.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I watched and identified the four rodeo riders by reading the text that appeared on the bottom of the screen during each rider's round in the competition. At 00:30, the name \"Jordan Briggs\" identified the first rodeo rider. At 01:14, the name \"Dona Kay Rule\" identified the second rodeo rider. At 01:55, the name \"Jessica Routier\" identified the third rodeo rider. At 02:29, the name \"Shelley Morgan\" identified the fourth rodeo rider. After identifying the fourth rodeo rider, I then watched until the replay began at 02:25 for the fourth rodeo rider's round in the competition. I knew this was the replay because her actual round took place from 02:04-02:25. During the replay for the fourth rodeo rider, I then looked to see how many white numbers with orange backgrounds could be seen on screen. I found these numbers on the bottom of the individual horse gates in the rodeo arena. At 02:25-02:28, I found the numbers 1, 2, 3, 4, 5, and 6. Then from 02:29-02:30, I found the numbers 7, 8, 9, 10, and 11. That was all that could be seen until the replay ended at 02:35. I then counted these numbers together and got a total of 11. Therefore, 11 white numbers with orange backgrounds can be seen during the replay for the fourth rodeo rider." + }, + { + "key": "M5k9aB-OPsE:bb187e8896cf632ad691da5f3882c500c308a26f", + "video_id": "M5k9aB-OPsE", + "question": "If all of the dollar amounts that appear under the rodeo riders' names are added together, what would the total dollar amount be?", + "answer_choice_0": "$2,150.", + "answer_choice_1": "$5,950.", + "answer_choice_2": "$3,750.", + "answer_choice_3": "$1,350.", + "answer_choice_4": "$4,850.", + "answer_id": 2, + "answer": "$3,750.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched and observed each time a rodeo rider's name appeared as text on the screen, and I looked to see if there were any dollar amounts listed under their names. At 00:30, text appeared on the bottom of the screen that said \"Jordan Briggs\", and there was no dollar amount listed. At 01:14, text appeared on the bottom of the screen that said \"Dona K. Rule\", and a dollar amount of \"$2,000\" was listed under her name. At 01:55, text appeared on the bottom of the screen that said \"Jessica Routier\", and the dollar amounts \"$750\" and \"$1,000\" were listed under her name. At 02:29, text appeared on the bottom of the screen that said \"Shelley Morgan\", and there was no dollar amount listed. No other names or dollar amounts appeared as text in the video. After that, I added together all of the dollar amounts that were listed under the rodeo riders' names, and I found that $2,000+$750+$1,000 equals $3,750." + }, + { + "key": "M5k9aB-OPsE:cd3c3625c9c392ae23c99e1f1fb350db95c8bf6c", + "video_id": "M5k9aB-OPsE", + "question": "In the final leg of the first race, if you double the number of the rider's kicks, how many times does the rider kick her boots' heels against her horse's body when facing the camera?", + "answer_choice_0": "8.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "2.", + "answer_choice_4": "10.", + "answer_id": 4, + "answer": "10.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I first identified the first rider at the beginning of the video at 00:00, then I continued watching her till her final sprint to the end of the qualifying at 00:21. At 00:22, I saw her heading back to the initial gate, facing the camera. I noticed her kicking her horse with her boot at the 00:23 mark 5 times. I continued watching until 00:26, when she completely exited, and didn't see her kick it again. This makes a total of 5 times. If you double that number, She kicked her horse 10 times." + }, + { + "key": "Mcggugol2ts:0dd243c6b889951871e4e8642470d46438367a04", + "video_id": "Mcggugol2ts", + "question": "If the vlogger had continued walking forward past the sign that reads as \"RJ Line\", with the escalators to the left, where would he have ended up?", + "answer_choice_0": "Starbucks coffee.", + "answer_choice_1": "Information desk.", + "answer_choice_2": "Keisei Line.", + "answer_choice_3": "Cell phone booth.", + "answer_choice_4": "Lawson Market.", + "answer_id": 2, + "answer": "Keisei Line.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching the video, I found a sign that reads \"JR Line\" at 01:46, to the vlogger's left. I continued watching until 02:08, where I saw the vlogger turn to his left, passing the \"JR line\" sign. Further on, at 02:10, an escalator appeared to his left with a sign in front that reads as \"Keisei Line.\" with an upward-pointing arrow. Therefore, if the vlogger had continued walking past the \"JR Line\", proceeded forward, and taken the escalator to the left, he would have ended up at the \"Keisei Line\" train trail." + }, + { + "key": "Mcggugol2ts:2075bb009598bfae27eb1fd31056dc40ef6e5900", + "video_id": "Mcggugol2ts", + "question": "If all the people that were visibly sitting in the hotel lobby upon the vlogger's arrival decided to join the people visibly sitting behind him on the train he boards immediately after picking up his JR pass, how many people would be sitting behind him on the train?", + "answer_choice_0": "8", + "answer_choice_1": "9", + "answer_choice_2": "10", + "answer_choice_3": "7", + "answer_choice_4": "6", + "answer_id": 4, + "answer": "6", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for the part where the vlogger arrived at his hotel and located it at 10:19. I continued watching and saw him enter the lobby and counted 3 people sitting at 10:29. Then, I went back to the moment where the vlogger mentions obtaining his JR pass which occurs between 01:06-01:09. I continued watching as the vlogger boards a train. Just before he sits down, there is a shot of 3 people clearly sitting behind his seat at 03:23. No other people are ever seen sitting behind him during that train ride. I added the 3 people from the hotel lobby to the 3 people on the train and got a total of 6." + }, + { + "key": "Mcggugol2ts:34b9cebc9be67da55fc3f8fa956a947e374d2c4f", + "video_id": "Mcggugol2ts", + "question": "What object in the host's hotel room matches the color of his shirt?", + "answer_choice_0": "Bed sheets.", + "answer_choice_1": "Desk.", + "answer_choice_2": "Air conditioner.", + "answer_choice_3": "Hangers.", + "answer_choice_4": "Curtains.", + "answer_id": 3, + "answer": "Hangers.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 10:30, I watched the male host enter his Tokyo Stay hotel room. From 10:30-10:58, I watched as the male host brandished his camera to demonstration the various items populating his hotel room. At 10:58, I watched as the male host flipped the camera, revealing that he had been wearing a black shirt while he fell onto his white bedsheets. In doing so, I noticed at 11:06 he pointed to a white air conditioner. At 11:05, I watched the male host rise from his resting position and spotted that the window's curtains were beige. At 11:06, I saw that the room's desk was brown. At 11:49, I saw that over the male host's right shoulder were a series of metal hangers with a black exterior, resembling the exact color of his shirt." + }, + { + "key": "Mcggugol2ts:6e2c31d03c58d21e301fae975c04ad318c249392", + "video_id": "Mcggugol2ts", + "question": "What item is resting next to the complimentary teas and coffee in the hotel hallway?", + "answer_choice_0": "Toothbrushes.", + "answer_choice_1": "Cold medicine.", + "answer_choice_2": "Hand sanitizer.", + "answer_choice_3": "Coffee pot.", + "answer_choice_4": "Tea kettle.", + "answer_id": 2, + "answer": "Hand sanitizer.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I found the hotel hallway at 13:07. At 13:07-13:15, I found complimentary trays of partitioned teabags and brown paper packages on a folding table as I heard the male host describe the tea and coffee bags. Beside the teas and coffee, to the left of the table, is a container of hand sanitizer. Therefore, the item resting next to the complimentary teas and coffee in the hotel hallway is hand sanitizer." + }, + { + "key": "Mcggugol2ts:7a52e99bf6a3254c66199b59d81c8c36fc51837e", + "video_id": "Mcggugol2ts", + "question": "How much Yen would it cost to buy 2 of the largest and most expensive Kirin beers from the hotel vending machine?", + "answer_choice_0": "670.", + "answer_choice_1": "540.", + "answer_choice_2": "380.", + "answer_choice_3": "760.", + "answer_choice_4": "420.", + "answer_id": 3, + "answer": "760.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 13:20 I watched the male host point his camera at the second of 2 vending machines lined up against the wall. The vending machine is labelled Kirin in red letters. At 13:23, I noticed the male host pointed to the most expensive beer labelled on the vending machine at 380 yen. If the male host were to purchase 2 of the most expensive beers, he would require 760 Yen at his disposal." + }, + { + "key": "Mcggugol2ts:9b8520ff8de35b09c3aece95b133ecc71f52e612", + "video_id": "Mcggugol2ts", + "question": "How many people are waiting in the lobby of the Tokyo Stay?", + "answer_choice_0": "5.", + "answer_choice_1": "9.", + "answer_choice_2": "3.", + "answer_choice_3": "7.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I found the hotel sign for the Tokyo Stay at 10:19. At 10:22-10:29, I saw the male host enter the hotel, leading into a lobby. As the male host made his way through the lobby, I counted 3 people sitting in the area. Therefore, the number of people waiting in the lobby of the Tokyo Stay is 3." + }, + { + "key": "Mcggugol2ts:b162774890fd51985ed51edad2d309a8c26defd1", + "video_id": "Mcggugol2ts", + "question": "If the vlogger decided to go left at \"3Coins\" and then another left after arriving at the second train station in Tokyo, which platforms would he walk towards?", + "answer_choice_0": "5-6", + "answer_choice_1": "9-10", + "answer_choice_2": "1-4", + "answer_choice_3": "1-3", + "answer_choice_4": "13-14", + "answer_id": 0, + "answer": "5-6", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video to look for the second train station the vlogger visited. I saw him first arriving at a train station at 04:06, and he mentioned at 04:18 that he was at Tokyo Station. Then, I saw him taking the train again at 06:12, then arriving at the second one at 06:25. As he started exiting this train station, I saw a business called \"3Coins\" ahead on the left at 06:25. I saw the vlogger look to the left at 6:29 and saw a sign in the distance ahead. At 06:29, I read that the sign had the numbers \"5-6\" next to an arrow that pointed left. Therefore, if the vlogger had gone left at \"3Coins\" and then taken another left, he would've walked toward platforms 5 and 6." + }, + { + "key": "Mcggugol2ts:c2076bc9b4731bace2907801a1a2835a0d5f316d", + "video_id": "Mcggugol2ts", + "question": "If the vlogger positioned the bar \u201cYGGD RASSIL\u201d to his left and walked forward, passing 4 more storefronts on his left, then turned right, which storefront would he be facing?", + "answer_choice_0": "PON.", + "answer_choice_1": "Shotbar Ribbon.", + "answer_choice_2": "NICO.", + "answer_choice_3": "BAR LOUNGE.", + "answer_choice_4": "Pasela Resorts.", + "answer_id": 1, + "answer": "Shotbar Ribbon.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "As I watched the video, I located the bar storefront that reads \"YGGD RASSIL\" at 43:16, positioned to the vlogger's right as he walked. I rewound to identify the 4 storefronts preceding \"YGGD RASSIL\"on his right. These were, \"NICO\", at 43:57, \"BAR LOUNGE at 43:58, AMFUN at 43:08 and \"SUPER ANGEL at 43:12. Therefore, if the vlogger were to reverse his direction keeping the bar \"YGGD RASSIL\" and all the other 4 storefronts to his left, and then turn right when he passes \"NICO\", he would be facing the storefront that reads \"ShotBar\" on the first line and \"Ribbon\" on the second line." + }, + { + "key": "Mcggugol2ts:c5f8834b1e5e83463dc536cdcad7ea7d3e842406", + "video_id": "Mcggugol2ts", + "question": "If all the members of the live music band in kabukicho decided to eat Ramen at the same place the vlogger visited earlier in the video, what would the total bill be, excluding taxes?", + "answer_choice_0": "4600 Yen.", + "answer_choice_1": "4800 Yen.", + "answer_choice_2": "5000 Yen.", + "answer_choice_3": "4200 Yen.", + "answer_choice_4": "5200 Yen.", + "answer_id": 1, + "answer": "4800 Yen.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "As I watched the video, I saw the vlogger entering a restaurant that has ramen, labeled on the street storefront as 800 yen at 16:09. I observed him in the restaurant till 17:24. Then I continued watching to find the live band of musicians in Kubukicho. I heard the vlogger say, \"I hear live music here down in Kubukicho\" from 39:54-39:59, and identified his location. I continued watching as he kept walking, and saw the members of the live music performing in the street from 40:16-40:24, and counted 6 of them. To the question asked if the band members were to eat ramen at the restaurant the vlogger ate at, I would have to multiply 800 by 6, which makes their bill without taxes 4800 yen." + }, + { + "key": "Mcggugol2ts:e8204df22c1ebafc87f22c12b4f1c6f7a7a366c7", + "video_id": "Mcggugol2ts", + "question": "How many alcoholic beverages would the male host have consumed if he were to take an additional shot with his dinner?", + "answer_choice_0": "2", + "answer_choice_1": "4", + "answer_choice_2": "5", + "answer_choice_3": "1", + "answer_choice_4": "3", + "answer_id": 0, + "answer": "2", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 16:15, the man entered the restaurant where he will order and enjoy his dinner from 16:43 to 17:23. During this segment, the man drinks an alcoholic beverage once at 16:45. He does not consume any other alcoholic beverages with his dinner. If he were to take an additional shot, this would bring the total drinks consumed to 2." + }, + { + "key": "Mm1BoOVUT-U:180735b9d381dca9125edf1f772168f79532d975", + "video_id": "Mm1BoOVUT-U", + "question": "How many times does a headband appear on the dark blonde woman's head?", + "answer_choice_0": "0.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "2.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first look for the headband the dark blonde woman is wearing at 00:26. Soon after the 00:26 mark, I look for the next appearance of the headband at 02:25." + }, + { + "key": "Mm1BoOVUT-U:1ee868fc0619c8f319095e998f941978fdb1dc85", + "video_id": "Mm1BoOVUT-U", + "question": "According to the onscreen caption, who is the third person in the frame when John Lennon mentions the Ed Sullivan show?", + "answer_choice_0": "Brian Epstein.", + "answer_choice_1": "Stuart Sutcliffe.", + "answer_choice_2": "Aunt Mimi.", + "answer_choice_3": "Phyllis McKenzie.", + "answer_choice_4": "Paul McCartney.", + "answer_id": 0, + "answer": "Brian Epstein.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened to the video for when John Lennon mentions the Ed Sullivan show; he does so at 02:59. I then watched the scene from the beginning to find and read the caption onscreen, which reads \"Brian Epstein. Sefton Park\" at 02:55. Therefore, it can be concluded that the third person in the shot, besides John and Cynthia Lennon, who have already been introduced, is Brian Epstein, making his first appearance." + }, + { + "key": "Mm1BoOVUT-U:6975cef312b0b7c0c2580eb51855aafe95839d3f", + "video_id": "Mm1BoOVUT-U", + "question": "What does the sign on the building wall located under the one that reads \"Bass Ye Crack\" at 00:10 reads?", + "answer_choice_0": "The sign reads \"The Crackle\".", + "answer_choice_1": "The sign reads .\"John's Ales\".", + "answer_choice_2": "The sign reads \"Yee Cackle\"", + "answer_choice_3": "The sign reads \"Marston's Ales\".", + "answer_choice_4": "The sign reads \"Ye Cacke\".", + "answer_id": 4, + "answer": "The sign reads \"Ye Cacke\".", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the group walk at 00:08 to 00:09. The fade out transitions into a tracking shot of the combined buildings right at 00:10 where the sign flatly attached to the building resides." + }, + { + "key": "Mm1BoOVUT-U:ce07dbc4a40abe60a3a60191c31fc7517c3dbbcf", + "video_id": "Mm1BoOVUT-U", + "question": "Where does the scene immediately after John Lennon and Cynthia Lennon's first depicted sit-down date take place?", + "answer_choice_0": "A park.", + "answer_choice_1": "John Lennon's aunt's house.", + "answer_choice_2": "A studio.", + "answer_choice_3": "The Ye Cracke Pub.", + "answer_choice_4": "A restaurant.", + "answer_id": 0, + "answer": "A park.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the scene where the actor playing John Lennon and the actress playing Cynthia Lennon are shown on their first sit-down date: this is shown at 00:38, where they are sitting at a table together and ordering tea. I watched this scene through its ending and its cut to the next scene at 00:43, and noted the location of this next scene: it is a park." + }, + { + "key": "N3rm7Nq7A3o:31b7414440adade6dc16ff0771cb6c2caab7840f", + "video_id": "N3rm7Nq7A3o", + "question": "From 00:01 - 00:44, where is the man?", + "answer_choice_0": "Behind the woman.", + "answer_choice_1": "Near the stage exit.", + "answer_choice_2": "At the stage's edge.", + "answer_choice_3": "Against the wall.", + "answer_choice_4": "On the couch.", + "answer_id": 4, + "answer": "On the couch.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the man from 00:01 - 00:44. Then, I saw him sitting on the stage's couch during that timeframe, until he stood up at 00:44." + }, + { + "key": "N3rm7Nq7A3o:324f8ebe69c549c9ffa4c732e5be7cce337b7567", + "video_id": "N3rm7Nq7A3o", + "question": "At 00:42, what does the woman do to the man's face?", + "answer_choice_0": "Scratches his chin.", + "answer_choice_1": "Kisses his nose.", + "answer_choice_2": "Tickles it with her scarf.", + "answer_choice_3": "Pours water on it.", + "answer_choice_4": "Slaps him twice.", + "answer_id": 2, + "answer": "Tickles it with her scarf.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:42, I saw the woman shake her scarf against the man's face, causing it to tickle him based on him waving her scarf away at 00:43." + }, + { + "key": "N3rm7Nq7A3o:7e1f7cb0bebb7ba38ecd4b1c381835c80e85e273", + "video_id": "N3rm7Nq7A3o", + "question": "When did the woman start singing for the first time?", + "answer_choice_0": "03:18.", + "answer_choice_1": "02:18", + "answer_choice_2": "05:18.", + "answer_choice_3": "04:18.", + "answer_choice_4": "01:18.", + "answer_id": 0, + "answer": "03:18.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 00:00-00:07, I noticed the woman didn't speak or sing. Next, at 00:07, I listened to her speak, until 03:18, which was when she then started to sing. Since she did not sing at any time before 03:18, this was when the woman started singing for the first time." + }, + { + "key": "N3rm7Nq7A3o:bdf0d27732d8f821cc476b64ad1ff81e8b722c73", + "video_id": "N3rm7Nq7A3o", + "question": "What happens once the song ends?", + "answer_choice_0": "The spotlight dims.", + "answer_choice_1": "The bench breaks.", + "answer_choice_2": "The curtain descends.", + "answer_choice_3": "The woman exits.", + "answer_choice_4": "The man returns.", + "answer_id": 0, + "answer": "The spotlight dims.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I heard the song start when the woman started singing at 03:18. Next, I heard her stop singing at 05:35, followed by the accompanying music fading out by 05:45, indicating the end of the song. Then, at 05:36 - 05:39, I saw the stage\u2019s spotlight dim." + }, + { + "key": "NFVBRE_7yr0:77f8e02839505b68339f891f0650dc2ce4b5c157", + "video_id": "NFVBRE_7yr0", + "question": "In the opening scene of the video, where does the woman say she went?", + "answer_choice_0": "A hospital.", + "answer_choice_1": "An office.", + "answer_choice_2": "A store.", + "answer_choice_3": "A bus station.", + "answer_choice_4": "A park.", + "answer_id": 0, + "answer": "A hospital.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video's opening scene to listen for where the woman said she went. The opening scene begins at 00:07. After some establishing shots and opening credits, the woman begins to talk at 00:16. She says at 00:18 that she went to the hospital that day." + }, + { + "key": "NFVBRE_7yr0:81ae089c1bd34299d49c4a05f8a7160d247ccdc8", + "video_id": "NFVBRE_7yr0", + "question": "What room of the house are the man and woman in at the beginning of the video?", + "answer_choice_0": "The basement.", + "answer_choice_1": "The bathroom.", + "answer_choice_2": "The living room.", + "answer_choice_3": "The bedroom.", + "answer_choice_4": "The kitchen.", + "answer_id": 3, + "answer": "The bedroom.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video at the beginning in order to understand what room the man and woman were in. The first room appears at 00:07, fading into the frame as the camera pans to the right to show the characters. A man and woman are lying down on a bed, and a closet door is visible in the upper left corner of the frame. From these context clues, the man and woman are in a bedroom." + }, + { + "key": "NFVBRE_7yr0:8e7d7d92d5767515974c110213c14d5fc4cbd527", + "video_id": "NFVBRE_7yr0", + "question": "What can be seen on the TV in the first shot it appears in?", + "answer_choice_0": "A blank screen.", + "answer_choice_1": "A basketball game.", + "answer_choice_2": "A football match.", + "answer_choice_3": "A cooking show.", + "answer_choice_4": "An unclear static image.", + "answer_id": 4, + "answer": "An unclear static image.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the beginning to locate when the TV first appeared on screen. This happens at 01:06. I looked at the TV to discern what was displayed on the screen. This was a blurry, static image." + }, + { + "key": "NFVBRE_7yr0:b2166522a240c18182879cfc3e01070b43dda562", + "video_id": "NFVBRE_7yr0", + "question": "What instrument is prominently featured in the music that is playing at the store?", + "answer_choice_0": "Piano.", + "answer_choice_1": "Drums.", + "answer_choice_2": "Acoustic guitar.", + "answer_choice_3": "Flute.", + "answer_choice_4": "Bass guitar.", + "answer_id": 0, + "answer": "Piano.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the scene that takes place in the store, which begins at 01:06. I paid close attention to the music track to determine which instrument was playing. The most prominent instrument featured is a piano." + }, + { + "key": "NQi5s447mkg:0cc1b9af6dcd239c542a44f76811fc60f71adedc", + "video_id": "NQi5s447mkg", + "question": "Why is the man digging up a grave?", + "answer_choice_0": "To find stolen money.", + "answer_choice_1": "To bury a dead body.", + "answer_choice_2": "To save his friend.", + "answer_choice_3": "To earn a reward.", + "answer_choice_4": "To retrieve a ticket.", + "answer_id": 4, + "answer": "To retrieve a ticket.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:15, I confirmed that the man was digging up a grave. It wasn't until 01:41 that the man finds what he's looking for\u2014a ticket! I had to make sure that what the man was holding was a ticket, so at 01:45 there was an insert of the ticket that I was able to read to confirm." + }, + { + "key": "NQi5s447mkg:47f33746b6db1e2453c6821ba5f2c6fbe0e7a22f", + "video_id": "NQi5s447mkg", + "question": "What does the dead body/zombie do to the man after he retrieves the ticket?", + "answer_choice_0": "He drags him to the grave.", + "answer_choice_1": "He strangles him.", + "answer_choice_2": "He yells at him.", + "answer_choice_3": "He starts boxing him.", + "answer_choice_4": "He stabs him.", + "answer_id": 0, + "answer": "He drags him to the grave.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 01:49, the dead body/zombie attacks the man. From 01:51 to 02:01, the dead body/zombie has his hand around his neck. At 02:04, the dead body/zombie forces the man inside the grave." + }, + { + "key": "NQi5s447mkg:e62c21bf22ca031bf21a28190165aa5a6e169d84", + "video_id": "NQi5s447mkg", + "question": "What is the third name listed in the credits?", + "answer_choice_0": "Teeru Saarinen.", + "answer_choice_1": "Karo Von Rutenhjelm.", + "answer_choice_2": "Karu Bon Rutenhjelm.", + "answer_choice_3": "Karu Von Rutenhjelm.", + "answer_choice_4": "Teemu Saarinen.", + "answer_id": 1, + "answer": "Karo Von Rutenhjelm.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the portion of the video that has the credits, starting at 02:19. The first two names appear at 02:25, and the third at 02:28. This name is a repeat of one of the first two, but still the third name listed, so I wrote it down as the answer." + }, + { + "key": "NaXqGa0YLwE:3efcb8eb8be87f4adea188a4aede78b152bf8f8a", + "video_id": "NaXqGa0YLwE", + "question": "Why does Michael Patrick Kelly cup his face at 02:39 as he is reflecting?", + "answer_choice_0": "He is crying with both hands to his face.", + "answer_choice_1": "He is reflecting on when he chose to live.", + "answer_choice_2": "He is waving goodbye to the viewers.", + "answer_choice_3": "He is reflecting on an emotional therapy session.", + "answer_choice_4": "He is reflecting on a funny moment and is trying not to laugh.", + "answer_id": 1, + "answer": "He is reflecting on when he chose to live.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I locate the 02:39 portion of the video. Michael Patrick Kelly is sitting with his left hand cupping his face. He is reflecting in that moment on choosing life over death." + }, + { + "key": "NaXqGa0YLwE:52912fba77d064340d79e4842e81dabf17d99fe2", + "video_id": "NaXqGa0YLwE", + "question": "What item of clothing is the speaker wearing at 03:09-03:15 in the video?", + "answer_choice_0": "A red scarf.", + "answer_choice_1": "A white T-shirt.", + "answer_choice_2": "A green button-up shirt.", + "answer_choice_3": "A blue sweater.", + "answer_choice_4": "A black jacket.", + "answer_id": 4, + "answer": "A black jacket.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the specified timestamp in the video at 03:09 and I observed that the speaker is wearing a denim jacket. I continued watching until 03:15 to ensure he did not wear any different kinds of clothes." + }, + { + "key": "NaXqGa0YLwE:6061efa54ac0471a6cbfc365418f1289e8df54b0", + "video_id": "NaXqGa0YLwE", + "question": "How many times does Michael Patrick Kelly touch his head or face from 03:40-04:40?", + "answer_choice_0": "2", + "answer_choice_1": "3", + "answer_choice_2": "1", + "answer_choice_3": "5", + "answer_choice_4": "4", + "answer_id": 1, + "answer": "3", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video during the timespan listed in the question, from 03:40 to 04:40, and identified and counted each instance where Michael Patrick Kelly touched a place on his face and head. I identified the first instance where he touched his head at 03:49, when he brought his hand up to scratch behind his ear. I counted a second time at 04:21, when he rubbed under his nose. I counted a third time at 04:38, where he pressed his fingers to his lip. I then watched the remainder of the span to make sure that Michael Patrick Kelly didn't touch his face or head any more times, and finalized the count at 3." + }, + { + "key": "NaXqGa0YLwE:6304a3ce3a32054ae7cfae9edf8e846bd17fa57a", + "video_id": "NaXqGa0YLwE", + "question": "What direction is the primary source of light coming from (from the camera's viewpoint)?", + "answer_choice_0": "From the right.", + "answer_choice_1": "From behind.", + "answer_choice_2": "From below.", + "answer_choice_3": "From the left.", + "answer_choice_4": "From above.", + "answer_id": 0, + "answer": "From the right.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:00, I identified the man as the primary subject on-screen. At the same time, I noticed the brightest and most lit portion on-screen was the right side of the man's face. Then, I noticed the right side of his face was more brightly lit than the left side of his face, which was more shadowy. Since the right side of the man's face reflects light as a shadow is cast across the left side of his face, the primary source of light is therefore shining from the right, off-screen." + }, + { + "key": "NaXqGa0YLwE:7094d27ca8b7879f3b758628e929b30bb83b0fbf", + "video_id": "NaXqGa0YLwE", + "question": "How many letters are in the text graphic?", + "answer_choice_0": "5.", + "answer_choice_1": "8.", + "answer_choice_2": "6.", + "answer_choice_3": "9.", + "answer_choice_4": "7.", + "answer_id": 4, + "answer": "7.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the text graphic at 00:00 in the top right corner of the frame, which read \"Aleteia\". Then, I counted the number of letters in \"Aleteia\", calculating a total of 7 letters." + }, + { + "key": "NaXqGa0YLwE:f6bc3d7fe40728e6dc29faf62b7a80eb65d7f99d", + "video_id": "NaXqGa0YLwE", + "question": "From 01:43 to 01:44, in which direction does Michael move his hand?", + "answer_choice_0": "He moves his hand up, then down, with his palm facing downward.", + "answer_choice_1": "He moves his hand right, then left, with his palm facing downward.", + "answer_choice_2": "He moves his hand up, then down, with his palm facing upward.", + "answer_choice_3": "He moves his hand left, then right, with his palm facing upward.", + "answer_choice_4": "He moves his hand left, then up, with his palm facing upward.", + "answer_id": 0, + "answer": "He moves his hand up, then down, with his palm facing downward.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for 01:43 and watched until 01:44. In this segment, I observed Michael hold his hand flat with the palm facing downward. I observed that he then moved it up first and then down." + }, + { + "key": "NxDNQOiO8fA:1a81a4318455fe36eb7ef0757c7b75fdf7374ac6", + "video_id": "NxDNQOiO8fA", + "question": "How does the narrative about the white substance change over the course of the video?", + "answer_choice_0": "The white substance goes from hard drugs to salt.", + "answer_choice_1": "The white substance goes from aesbestos to salt.", + "answer_choice_2": "The white substance goes from anthrax to salt.", + "answer_choice_3": "The white substance goes from baking soda to salt.", + "answer_choice_4": "The white substance goes from dust to salt.", + "answer_id": 0, + "answer": "The white substance goes from hard drugs to salt.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "When I scroll to 04:20, I can see that the wife is cutting a hardboiled egg for her husband, and that she chastises him for using too much salt." + }, + { + "key": "NxDNQOiO8fA:5963ac5a178896f363f85551d2613862e0c0eee5", + "video_id": "NxDNQOiO8fA", + "question": "Which of these phrases spoken by the neighbor appears onscreen while the wife remembers their conversation?", + "answer_choice_0": "\"He'll have a party again this year.\"", + "answer_choice_1": "\"Abandoned by her abusive husband.\"", + "answer_choice_2": "\"Your husband from work is here.\"", + "answer_choice_3": "\"Remember Mila, who lives next door?\"", + "answer_choice_4": "\"Think about what I've told you.\"", + "answer_id": 1, + "answer": "\"Abandoned by her abusive husband.\"", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the place in the video where the wife thinks about her conversation with her neighbor, which takes place from 03:48-04:07. I then listened to, and read the white captions on the bottom of the screen while the wife's recalls the conversation. The phrase \"Abandoned by her abusive husband\" is onscreen 3 times from 03:52-04:00." + }, + { + "key": "NxDNQOiO8fA:6dcdccbcb5dab5bb5ae7c7f76cb9562174365135", + "video_id": "NxDNQOiO8fA", + "question": "What kind of essential oil is in the bottle second from right?", + "answer_choice_0": "Oregano.", + "answer_choice_1": "Lemon.", + "answer_choice_2": "Orange.", + "answer_choice_3": "Rosewater.", + "answer_choice_4": "Bergamot.", + "answer_id": 0, + "answer": "Oregano.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:36, when the wife gets up to choose from four bottles of essential oil on a shelf. The second bottle from the right is labeled \"Oregano.\"" + }, + { + "key": "NxDNQOiO8fA:d29957e2e759323a714bb652a3126f0a33870213", + "video_id": "NxDNQOiO8fA", + "question": "What does the wife do after she comes out of the bedroom?", + "answer_choice_0": "She takes off her robe.", + "answer_choice_1": "She picks up a knife from the dresser.", + "answer_choice_2": "She gets salt from the dresser.", + "answer_choice_3": "She calls her neighbor.", + "answer_choice_4": "She stabs her husband.", + "answer_id": 1, + "answer": "She picks up a knife from the dresser.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 04:08, when the wife comes out of the bedroom. After a few moments of hesitation, she picks up the knife that was resting on the dresser at 04:17." + }, + { + "key": "OZBQnmr5vT0:08d305dcbd786dc23d07c996f9b9f5b7a28f288b", + "video_id": "OZBQnmr5vT0", + "question": "What color outlines the top right section of the game board?", + "answer_choice_0": "Red.", + "answer_choice_1": "Yellow.", + "answer_choice_2": "Green.", + "answer_choice_3": "Blue.", + "answer_choice_4": "Black.", + "answer_id": 2, + "answer": "Green.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and first noticed, at 01:00, that the game board is separated into four player areas, one at each corner. I saw the top left is red, the bottom left is blue, the bottom right is yellow, and the top right player area has a green outline." + }, + { + "key": "OZBQnmr5vT0:2e8a2979fdd95513ce2ab3983996eb5ec85745d8", + "video_id": "OZBQnmr5vT0", + "question": "What card does the narrator select and mention at 27:38?", + "answer_choice_0": "OTHER MEMORY.", + "answer_choice_1": "EXPEDITE.", + "answer_choice_2": "SHAI-HALUD.", + "answer_choice_3": "FOLDSPACE.", + "answer_choice_4": "THE SPICE MUST FLOW.", + "answer_id": 2, + "answer": "SHAI-HALUD.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 27:37, I saw the narrator move his red cursor from right to left across the board to select a card. At 27:38 I saw the SHAI-HALUD card expand and get larger, indicating that he has selected that card. Then I heard the narrator say he is selecting the SHAI-HALUD card." + }, + { + "key": "OZBQnmr5vT0:301ed2142a155ad0e021aae3ceca70d6826f220f", + "video_id": "OZBQnmr5vT0", + "question": "What is the name of the player who's virtual game space is directly adjacent to the player that made the video?", + "answer_choice_0": "kash000.", + "answer_choice_1": "elessar.", + "answer_choice_2": "Lannister2005.", + "answer_choice_3": "ribbit.", + "answer_choice_4": "Orski.", + "answer_id": 2, + "answer": "Lannister2005.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I watched the video, looking to distinguish what the narrator/player that made the video's username is in the game. I found that at 00:37, the narrator uses a superimposed red arrow to point to some text on screen. The text reads Orski (ribbit) and is in a column named \"Name.\" At this point, he uses the pronouns \"we\" and \"our\", which in context show that his username in the game is either \"Orski\" or \"ribbit.\" At 00:59 the virtual game space is revealed for the first time. I noted that the top left red space is labeled \"ribbit.\" This space is separated by the virtual game board from all other players' spaces, save for the one labeled \"Lannister2005\"." + }, + { + "key": "OZBQnmr5vT0:30fd44e90c6b2cae5f14b990249ad2f1bf75be10", + "video_id": "OZBQnmr5vT0", + "question": "Whose turn is it at 1:17:33", + "answer_choice_0": "Ribbet.", + "answer_choice_1": "elessar.", + "answer_choice_2": "Rabban \"The Beast\".", + "answer_choice_3": "Lannister2005.", + "answer_choice_4": "Kash000.", + "answer_id": 3, + "answer": "Lannister2005.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and noticed that throughout the game, text appeared at the top center that stated whose turn it was. Then I read \"Lannister2005's turn\" at the top center in blue at 1:17:33." + }, + { + "key": "OZBQnmr5vT0:3cb04d8b014583ff8f7070ef1c5a5a4f35a33166", + "video_id": "OZBQnmr5vT0", + "question": "What is the last number to appear in the red hexagon at the top left of the board when the green hand cursor finishes clicking on it at 43:34?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "6.", + "answer_choice_3": "3.", + "answer_choice_4": "10.", + "answer_id": 3, + "answer": "3.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and saw the green hand cursor move to the red hexagon at 43:31. Then I saw the number changing, first increasing, then decreasing. I noted that the last number in the hexagon before the cursor moves away is 3." + }, + { + "key": "OZBQnmr5vT0:4814fec09009af45ec1d13792ef3542ffae34f14", + "video_id": "OZBQnmr5vT0", + "question": "What word is visible in white text on the 4th card from the left in the top row at 04:30?", + "answer_choice_0": "Ribbet.", + "answer_choice_1": "Acquire.", + "answer_choice_2": "Discard.", + "answer_choice_3": "Chrysknife.", + "answer_choice_4": "Draw.", + "answer_id": 4, + "answer": "Draw.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and noticed that at 4:30, two rows of cards appear on the screen. I looked at the top row of cards and read \"Draw\" at the bottom of the 4th card from the left." + }, + { + "key": "OZBQnmr5vT0:6b4dcc913ad31369a9fe865a61aceb439ba9db34", + "video_id": "OZBQnmr5vT0", + "question": "How many points would Kash000 need to have the same amount of points as the person with the highest points value?", + "answer_choice_0": "7.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "8.", + "answer_choice_4": "6.", + "answer_id": 0, + "answer": "7.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video, paying attention to when points were discussed or shown on screen. At 00:36 a chart appears showing various things, including players and their point totals. I noted that Kash000 had 1 point. I then saw that the person with the highest value was pmduguay (S4iler), who had 8 points. I subtracted 1 from 8 to find that Kash000 would need 7 points to have the same amount of points as the person with the highest point value." + }, + { + "key": "OZBQnmr5vT0:8f9f8f693eddd6ab13bc52fadca56ff1a8401132", + "video_id": "OZBQnmr5vT0", + "question": "What new text appears on screen when the narrator mentions a player named \"Kash\"?", + "answer_choice_0": "\"Rise of Ix.\"", + "answer_choice_1": "\"The First Player will be Lannister2005!\"", + "answer_choice_2": "\"elessar.\"", + "answer_choice_3": "\"Lannister2005's turn.\"", + "answer_choice_4": "\"Yellow is currently picking their leader.\"", + "answer_id": 4, + "answer": "\"Yellow is currently picking their leader.\"", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and waited for the narrator to mention someone named \"Kash.\" He does so at 01:07. At the same time, in the middle of the screen in small yellow text, the words \"Yellow is currently picking their leader.\" appear." + }, + { + "key": "OZBQnmr5vT0:99d47a7243046400c4cb6c9091a76baee90106ba", + "video_id": "OZBQnmr5vT0", + "question": "What is the average point percentage of the player who got second place in this game, before it began?", + "answer_choice_0": "29.27%.", + "answer_choice_1": "25.00%.", + "answer_choice_2": "27.50%.", + "answer_choice_3": "19.51%.", + "answer_choice_4": "30.86%.", + "answer_id": 2, + "answer": "27.50%.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and paid attention to any information regarding scores or placement. At 1:22:05, the speaker says, \"blue will be getting second place\". I then went back to the point in the video when the board was very clear, at 00:59, to see who blue was. I located their playspace on the bottom left and say the player was labeled as \"Lannister2005.\" I then rewatched the video, paying attention to information about point percentage, especially as it stood before the game in the video was played. I saw at 00:36 a chart that shows Lannister2005's average point percentage is 27.50% before the start of the game played in the video." + }, + { + "key": "QALo9woiXLU:2956b077a893b27a637119c26d538b1e501c9a67", + "video_id": "QALo9woiXLU", + "question": "How long would it take the chef to stir the grated lemon peel in with the sliced onions if it took 3 times as long?", + "answer_choice_0": "12 seconds", + "answer_choice_1": "18 seconds", + "answer_choice_2": "24 seconds", + "answer_choice_3": "6 seconds", + "answer_choice_4": "9 seconds", + "answer_id": 1, + "answer": "18 seconds", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to find the time when the chef stirs together the grated lemon peel and sliced onions. First, I see her slicing onions from 01:15-01:24. Then, I see her grating a lemon peel from 01:24-01:41. Then, from 01:45-01:51, she uses a wooden spoon to stir the ingredients together. Since the total time was 6 seconds, I multiplied that by 3 in order to get the correct answer of 18 seconds." + }, + { + "key": "QALo9woiXLU:2c69c5072294a764d3936be5aa1ba33cf3baaa58", + "video_id": "QALo9woiXLU", + "question": "How does the silver bucket move around the cottage throughout the video?", + "answer_choice_0": "From the counter, to the fire, back to the counter.", + "answer_choice_1": "From the floor, to the counter, to the stove, back to the counter.", + "answer_choice_2": "From the porch, to the counter, to the fire, to the floor.", + "answer_choice_3": "From the counter, to the floor, to the fire, back to the counter.", + "answer_choice_4": "From the counter, to the stove, to the porch, to the counter.", + "answer_id": 0, + "answer": "From the counter, to the fire, back to the counter.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video and kept track of the locations of the silver bucket. The bucket is first spotted at 00:35 at the far left end of the counter. At 00:51, she picks it up and moves it to her right, placing it on the counter. At 01:09, it is moved to the hook over the fireplace. At 08:58, it is seen back on the kitchen counter. At 10:18, its location is unknown, but it is no longer on the counter." + }, + { + "key": "QALo9woiXLU:393ba534117f6323624a09a3accc0c79e4b3fb43", + "video_id": "QALo9woiXLU", + "question": "Which spice or herb was not used in the recipe?", + "answer_choice_0": "Lemon.", + "answer_choice_1": "Thyme.", + "answer_choice_2": "Parsley.", + "answer_choice_3": "Sage.", + "answer_choice_4": "Nutmeg.", + "answer_id": 3, + "answer": "Sage.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to see which spices or herbs were added to the recipe. At 01:25, the woman adds lemon zest to the recipe. Later, at 03:04, she adds nutmeg to the meat. At 05:27, she adds rosemary, thyme, and parsley to the recipe. She never uses sage." + }, + { + "key": "QALo9woiXLU:5d2baf50086124f75d02d1eaa2808ac710fbeeb7", + "video_id": "QALo9woiXLU", + "question": "The second time that the woman moves the pat of butter in the otherwise-empty saucepan, in what direction does she push it?", + "answer_choice_0": "Diagonally down.", + "answer_choice_1": "Diagonally right.", + "answer_choice_2": "Directly right.", + "answer_choice_3": "Directly up.", + "answer_choice_4": "Directly left.", + "answer_id": 4, + "answer": "Directly left.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the span where the woman places the pat of butter in the empty saucepan, which she does at 04:11. From this point, I counted the number of times she moved it with the spoon, paying specific attention to the second time, which occurs from 04:15-04:16. During this timespan, I noted the direction in which the woman pushes the butter pat with the spoon - she pushes it directly leftward, from the lower right side of the pan to the lower left side." + }, + { + "key": "QALo9woiXLU:70b4f930f7e8285019ea789e2e6f70cc3068eb46", + "video_id": "QALo9woiXLU", + "question": "If the parsley & thyme combination was added to the potatoes before the butter, where would it be in the overall order of ingredients added from individual bowls to the potato bowl to season the potatoes?", + "answer_choice_0": "First", + "answer_choice_1": "Second", + "answer_choice_2": "Sixth", + "answer_choice_3": "Fifth", + "answer_choice_4": "Eighth", + "answer_id": 1, + "answer": "Second", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the section of video where ingredients are added to the potato bowl after they're boiled, from 08:55-09:21. A combination of salt and pepper is added from 09:10-09:12 from a single bowl making it the first ingredient added from an individual bowl. A pat of butter is added at 09:17, making it the second ingredient added from an individual bowl. The parsley & thyme combo is added at 09:21 from an individual bowl, making it the third ingredient added from an individual bowl. Since the butter was the second ingredient in an individual bowl added to season the potatoes, if the parsley and thyme combination was added before it, it would become the second ingredient from an individual bowl added to the potatoes." + }, + { + "key": "QALo9woiXLU:9d44bb8a21a8c8f3425c4efd733664aa22fc982f", + "video_id": "QALo9woiXLU", + "question": "In the clip shown immediately after the woman blows on the fire, how many times per second does she prod the stew with the wooden spoon?", + "answer_choice_0": "1.86.", + "answer_choice_1": "1.44.", + "answer_choice_2": "2.00.", + "answer_choice_3": "2.32.", + "answer_choice_4": "1.67.", + "answer_id": 0, + "answer": "1.86.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I first noted the clip where the woman blows on the fire with a large metal tube, which plays from 05:50-06:17. The clip immediately after this consists of the woman stirring the pan contents with a large wooden spoon - this clip plays from 06:17-06:24, for a total of 7 seconds. During those 7 seconds, I counted 13 times that the woman prodded the stew with her spoon. To find out how this averages out per second, I did the equation 13/7=1.86, rounded up to the second decimal place, making that result the correct answer." + }, + { + "key": "QALo9woiXLU:c6ab796a50693920760614f413e4291fae31566d", + "video_id": "QALo9woiXLU", + "question": "During the woman's favorite part of the recipe process, what is the difference between the number of times she uses a fork and the number of times she uses a spoon?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 1, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the clip in the video where the viewer learns the woman's favorite part of the recipe process - I learned when this was by reading the caption \"This is my favorite part! Sampling\", which is displayed onscreen at 09:40, making the clip where she conducts her favorite part of the process the one from 09:40-10:20. During this span, I watched to see how often the woman used a spoon vs. a fork. From 09:40-09:54, the woman uses a large spoon to gather stew. From 09:55-10:03, she uses a second spoon to retrieve potatoes. Then, from 10:04-10:20, the woman uses a fork to try the potatoes. Based on this, I see that she uses a fork once and a spoon twice. To find the difference, I subtracted 1 fork use from 2 spoon uses, coming to the conclusion that the difference between the two numbers is 1." + }, + { + "key": "QALo9woiXLU:d41f48225244598e4cc59303e958a8b2f14579de", + "video_id": "QALo9woiXLU", + "question": "In what order does the woman prepare the entire meal?", + "answer_choice_0": "Cook the sauce, boil potatoes, prep the onion, prep the beef, cook ingredients, garnish, plate the potatoes.", + "answer_choice_1": "Boil the potatoes, prep the onion, prep the beef, cook ingredients, make the sauce, garnish, plate potatoes.", + "answer_choice_2": "Prep the beef, prep the onions, boil potatoes, cook ingredients, make the sauce, garnish, plate potatoes.", + "answer_choice_3": "Boil the potatoes, plate potatoes, garnish, prep the beef, prep the onions, cook ingredients, make the sauce.", + "answer_choice_4": "Prep the onion, prep the beef, cook the ingredients, boil potaotes, make the sauce, garnish, plate potaotes.", + "answer_id": 1, + "answer": "Boil the potatoes, prep the onion, prep the beef, cook ingredients, make the sauce, garnish, plate potatoes.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video and took note of each step the woman took to prepare the meal. At 00:44, she begins cutting potatoes in order to boil them. At the bottom of the screen, the caption reads, \"To begin, let's boil some potatoes.\" So this is the first step. Next, at 01:17, the woman slices her onions and prepares them for the stew. After that, she begins to prep the beef at 02:02. Next, she prepares the skillet over the fire at 04:02. At 04:27, she cooks the meat in the skillet. At 04:54, she adds the onions to the skillet. At 05:08, she adds water to make the sauce. After it all cooks together, she takes the skillet off the heat at 06:38. At 08:11, she garnishes the bowl with the pickled cabbage and then onion. Lastly, at 08:56, she prepares the potaotes. She adds the rest of the ingredients to the potatoes at 09:12 before putting them in a bowl to be enjoyed with the stew." + }, + { + "key": "QALo9woiXLU:db646d7128cfbcbc812177e75d8f2b4d8af2a4fe", + "video_id": "QALo9woiXLU", + "question": "When are the herbs added to the skillet?", + "answer_choice_0": "Before the beef.", + "answer_choice_1": "After the butter rolled in flour.", + "answer_choice_2": "Before the butter rolled in flour.", + "answer_choice_3": "After the onions.", + "answer_choice_4": "After the pat of butter.", + "answer_id": 1, + "answer": "After the butter rolled in flour.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video as the woman places everything in the skillet. She starts with a pat of butter at 04:15 in order to prepare the skillet. She then adds the beef, at 04:30. At 04:55, she adds the onions. At 05:10, she pours water into the skillet to help everything cook. At 05:20, she adds salt and pepper. Then, at 05:24, she adds butter that has been rolled in flour. At 05:26, she lays the herbs on top of everything else in the skillet--parsely, rosemary, and thyme." + }, + { + "key": "QALo9woiXLU:e8680dba21a195035473bc11b949e6c13b6a2df0", + "video_id": "QALo9woiXLU", + "question": "During what timespan does the woman place the fourth forkful of pickled onions onto the dish?", + "answer_choice_0": "08:14-08:16.", + "answer_choice_1": "08:30-08:36.", + "answer_choice_2": "08:41-08:44.", + "answer_choice_3": "08:48-08:53.", + "answer_choice_4": "08:23-08:27.", + "answer_id": 3, + "answer": "08:48-08:53.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the span of the video in which the woman is placing forkfuls of pickled onions onto the finished dish. The first forkful was placed from 08:23-08:27, the second was placed from 08:30-08:36, the third was placed from 08:41-08:44, and the fourth was placed from 08:48-08:53, making the latter the correct answer. The fifth answer choice, 08:14-08:16, was a forkful of pickled cabbage, not onions." + }, + { + "key": "QNFQvX-MQgI:1ea2d2471ed4c9832b181cde44f3206ed9fa2b2f", + "video_id": "QNFQvX-MQgI", + "question": "When the second photo of Drake appears on the screen, where does it appear?", + "answer_choice_0": "Upper left corner.", + "answer_choice_1": "Lower right corner.", + "answer_choice_2": "Lower left corner.", + "answer_choice_3": "Upper right corner.", + "answer_choice_4": "The center.", + "answer_id": 2, + "answer": "Lower left corner.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "While watching, I looked for an image of Drake to appear on-screen. I noticed the first picture of the celebrity appeared at 03:30. The photo was present until 03:35, when a new photo of Drake appeared. I counted this as the second photo, and observed that the photo was in the bottom left corner of the screen." + }, + { + "key": "QNFQvX-MQgI:26cd10d342614d5f35540a3e345282aea462cd08", + "video_id": "QNFQvX-MQgI", + "question": "Between 00:15 - 00:30, how many more green Os are there compared to orange Xs?", + "answer_choice_0": "6", + "answer_choice_1": "12", + "answer_choice_2": "15", + "answer_choice_3": "3", + "answer_choice_4": "9", + "answer_id": 0, + "answer": "6", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I moved to 00:15 and observed a full tic-tac-toe board with Xs and Os in white. 3 green Os were visible in a winning diagonal position. The board was quickly reset, and at 00:16, another winning combination of 3 green Os were visible in the same diagonal position with the remaining white Xs and Os scrambled in new positions. The board was quickly reset a third time, and at 00:17, another winning combination of 3 green Os were visible in the same diagonal position with the remaining white Xs and Os scrambled in new positions. The board was quickly reset a fourth time, and at 00:17, another winning combination of 3 green Os were visible in the same diagonal position with the remaining white Xs and Os scrambled in new positions. This made a total of 12 green Os shown onscreen. \n\nThe board was quickly reset a fifth time, and at 00:18, a winning combination of 3 orange Xs were visible in a straight position on the left, with the remaining white Xs and Os scrambled. The board was quickly reset a sixth time, and at 00:28, another winning combination of 3 orange Xs were visible in a diagonal position with the remaining white Xs and Os scrambled in new positions. This made a total of 6 orange Xs shown onscreen. No other green Os or orange Xs were shown before 00:30, so I subtracted 12-6 which equaled 6. Therefore, I concluded there were 6 more green Os than orange Xs shown before 00:30." + }, + { + "key": "QNFQvX-MQgI:4b067b31c51ec7af5289b1421cb6077fca0e12ef", + "video_id": "QNFQvX-MQgI", + "question": "Between 01:05 - 01:10, how many degrees does the board on the right spin?", + "answer_choice_0": "180 degrees.", + "answer_choice_1": "90 degrees.", + "answer_choice_2": "360 degrees.", + "answer_choice_3": "450 degrees.", + "answer_choice_4": "270 degrees.", + "answer_id": 1, + "answer": "90 degrees.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I moved to the specified time of 01:05 and watched the board on the right. I noted that at 01:06, four spaces had been filled by Xs and Os. An X was in the center and top left section, while the two Os were on the bottom left and right corners. At 01:07, I observed that the board on the right began to rotate clockwise. Then at 01:08, the board on the right stopped rotating. I observed that the two Os were now on the left top and bottom corners, and there was now an X in the top right corner, in addition to the X that remained in the center. I watched until 01:10 and confirmed that the right board did not rotate any more. I deduced that because each of the Os and Xs in the corner moved one corner away from their starting positions, the board rotated 90 degrees clockwise." + }, + { + "key": "QNFQvX-MQgI:71ab37069fa2159253e0f2c6309ab5ddedc4207e", + "video_id": "QNFQvX-MQgI", + "question": "Based on the order of the 14 Tic-Tac-Toe boards presented after, the speaker asks, \"Want to see them all? Want to hear them all?\", what is the board number of the Tic-Tac-Toe board with the 3 green circles?", + "answer_choice_0": "14.", + "answer_choice_1": "2.", + "answer_choice_2": "6.", + "answer_choice_3": "12.", + "answer_choice_4": "9.", + "answer_id": 2, + "answer": "6.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I looked for the part in the video where the speaker asks, \"Want to see them all? Want to hear them all?\". I heard this from 04:51 - 04:53. After I heard him ask, I counted each game until 3 green circles were shown. The first game ended at 05:01. The second game ended at 05:02. The third game ended at 05:04. The fourth game ended at 05:06. The fifth game ended at 05:08. The sixth game ended at 05:10 and had 3 green circles. Therefore, I determined that the 6th game after the target phrase shows 3 green circles." + }, + { + "key": "QNFQvX-MQgI:79855e637415ee867d56ea27fc9b3b2b7585aaf3", + "video_id": "QNFQvX-MQgI", + "question": "What percentage of the Os shown between 05:00 - 05:25 are green?", + "answer_choice_0": "5.8%.", + "answer_choice_1": "33.33%.", + "answer_choice_2": "6.67%.", + "answer_choice_3": "29.41%.", + "answer_choice_4": "20%.", + "answer_id": 2, + "answer": "6.67%.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the specified time span and recognized that several games of tic-tac-toe were being played. I went back to 05:00 and counted the total number of Os in each game to add them together later. I also noted the times when green Os appeared. At 05:00, 3 white Os were present. In the next game, at 05:02, 3 white Os were present. At 05:04, 3 white Os were present. At 05:06, 3 white Os were present. At 05:08, 3 white Os were present. At 05:10, 3 green Os were present and 1 white O was present. At 05:13, 4 white Os were present. At 05:15, 4 white Os were present. At 05:17, 4 white Os were present. At 05:20, 4 white Os were present. At 05:22, 4 white Os were present. At 05:24, 4 white Os were present. At 05:25, in the middle of a game, 2 white Os are present. I counted the total number of Os in this range and found 45. Of these, I counted 3 green Os. To find the percentage, I divided 3/45=0.06. I multiplied this by 100 to get the percentage 0.06*100=6.67%." + }, + { + "key": "QNFQvX-MQgI:93bc26b49cc7704e61f0f8836c6a160482d5ced2", + "video_id": "QNFQvX-MQgI", + "question": "How many more orange Xs are there compared to white Xs at 00:29?", + "answer_choice_0": "0.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "1.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I went to 00:29 in the video. Then, I counted how many orange Xs there were and got 3. I then counted how many white Xs there were on the board and got 2. To get the difference, I subtracted 2 from 3 and got 1. Therefore, there is 1 more orange X compared to white Xs at 00:29." + }, + { + "key": "QNFQvX-MQgI:a71fff7a3c15f1cc40427e79778baf9e491677e0", + "video_id": "QNFQvX-MQgI", + "question": "Based on the text written, how many more wins does X have at the end of the video?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "7.", + "answer_choice_3": "9.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "Since the question mentioned the end of the video, and the video was 07:20 long, I went to 06:20 to watch the last minute. At 07:00, I noticed a tic-tac-toe board with win counts on the left and right sides of the board. On the left, the text read \"X Win Count: 6\". On the right side, the text read \"O Win Count: 1\". I watched through the end of the video and observed that the numbers didn't change. Therefore, I subtracted 6-1=5. I determined that at the end of the video, X has 5 more wins than O." + }, + { + "key": "QNFQvX-MQgI:a8a91db9679a887690c4fb453a9b64f3e35f7b07", + "video_id": "QNFQvX-MQgI", + "question": "What is X's winning position in the game before text appears about working on a PhD?", + "answer_choice_0": "The top left, center, and bottom right sections.", + "answer_choice_1": "The top right, center right, and bottom right sections.", + "answer_choice_2": "The bottom left, bottom center, and bottom right sections.", + "answer_choice_3": "The top right, center, and bottom left sections.", + "answer_choice_4": "The top left, center left, and bottom left sections.", + "answer_id": 4, + "answer": "The top left, center left, and bottom left sections.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked for the text about working on a PhD. At 05:03, I saw a line of text along the bottom of the screen that read: \"Can you tell that I spent 7 years doing a PhD in Music Composition?\" I noticed that a tic-tac-toe board with two moves was on the screen, indicating that it had just started. I went backwards 1 second to 05:02 and saw a tic-tac-toe board with three moves played. I watched as the moves filled in, and at 05:02, I saw 3 Xs make a winning position. I observed that the Xs were in a vertical line on the left side." + }, + { + "key": "QNFQvX-MQgI:c3e351eb4f525b75b74397e24852ebabccb02010", + "video_id": "QNFQvX-MQgI", + "question": "After the speaker says \"Want to hear them all?\", which text appears below the 9th tic-tac-toe game?", + "answer_choice_0": "Sonifying.", + "answer_choice_1": "Alive.", + "answer_choice_2": "Sheer.", + "answer_choice_3": "Sophistication.", + "answer_choice_4": "Composition.", + "answer_id": 1, + "answer": "Alive.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened for the target phrase and heard it from 04:52 - 04:53. I then counted each game of tic-tac-toe that appeared, up to the ninth one. I noted the beginnings of the games as: 04:59, 05:01, 05:03, 05:05, 05:07, 05:09, 05:11, 05:13, and 05:15 . When the ninth game began at 05:15, I noted that there was no text below the tic-tac-toe board. However at 05:16 a line of text faded in along the bottom edge of the screen. I looked for the words \"Composition\", \"alive\", \u201csonifying\", \"sheer\", and \"sophistication\". Of these, I saw that at 05:16, the word \"alive\" was present." + }, + { + "key": "QNFQvX-MQgI:d4eb566b8b48a6b8c620e47d96f3ca3f70f0f5a7", + "video_id": "QNFQvX-MQgI", + "question": "Rounding to the nearest whole, how much better is player 1's chance of winning if they start with the center square versus starting with an edge square?", + "answer_choice_0": "4 times better.", + "answer_choice_1": "They're the same odds.", + "answer_choice_2": "5 times better.", + "answer_choice_3": "2 times better.", + "answer_choice_4": "3 times better.", + "answer_id": 3, + "answer": "2 times better.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and paid attention for a written or verbal mention of percentages. The first written percentage occurs at 06:00 when a block of text outlines the percentage of player 1 wins, player 2 wins, and ties in the 64 possible games. I watched as 3 more blocks of text branched out from here depending on if you started with the center (06:01), the corner (06:03), or the edge (06:05). In the section for starting with the edge, I read that if they start with the edge, player 1 has 4 different win variations, totalling \"17.4%\" of all game scenarios for this starting move. In the section for starting in the center, I read that player 1 has 5 different win scenarios, for a total of 35.7%. To find out how much better player 1's odds are with starting in the center, I divided 35.7/17.4=2.05. Rounding to the nearest whole, I determined that player 1's odds are twice as good if they start in the center compared to starting on the edge." + }, + { + "key": "QjA0A3aAjv8:08e6710dd889a15145c93a137627ba638c2787c8", + "video_id": "QjA0A3aAjv8", + "question": "Other than brick and wood, what 2 starting resource hexes are touched by the starting position for the Road-Builder strategy?", + "answer_choice_0": "Ore and desert", + "answer_choice_1": "Ore and sheep", + "answer_choice_2": "Wheat and desert", + "answer_choice_3": "Ore and wheat", + "answer_choice_4": "Sheep and wheat", + "answer_id": 4, + "answer": "Sheep and wheat", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video until I heard the narrator introduce their Road Builder strategy at 01:00. At 01:01, a sample starting position is shown with 2 towns placed down. The topmost one is touching 2 wood hexes and a sheep. The lower one is touching 2 brick hexes and a wheat. Thus the answer is sheep and wheat." + }, + { + "key": "QjA0A3aAjv8:0ab63ce0f949ce51018937862afb49727f0cc6c1", + "video_id": "QjA0A3aAjv8", + "question": "Which attribute is second highest for the Road Builder strategy?", + "answer_choice_0": "Flexib.", + "answer_choice_1": "Army.", + "answer_choice_2": "Power.", + "answer_choice_3": "Easy.", + "answer_choice_4": "Under Radar.", + "answer_id": 2, + "answer": "Power.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video until I heard the narrator introduce their Road Builder strategy at 01:00. At 01:33, the narrator introduces a bar graph on screen with 6 different attributes, Power, Flexib., Under Radar, Easy, Road, and Army. The Road bar is the highest, and I observed Power to be the second highest." + }, + { + "key": "QjA0A3aAjv8:1b2af9dd45abfd6f7c43c35a038506a5239aff3c", + "video_id": "QjA0A3aAjv8", + "question": "In which of the following orders are the these bars in the graph at 03:46 - Easy, Under Radar, Flexib., Power - listed from tallest to shortest?", + "answer_choice_0": "Easy, Under Radar, Flexib., Power.", + "answer_choice_1": "Flexib., Easy, Power, Under Radar.", + "answer_choice_2": "Under Radar, Flexib., Power, Easy.", + "answer_choice_3": "Easy, Flexib., Under Radar, Power.", + "answer_choice_4": "Flexib., Power, Easy, Under Radar.", + "answer_id": 1, + "answer": "Flexib., Easy, Power, Under Radar.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked at the bar graph at 03:46, observing the height of the various labeled bars. By reading their designations and looking at them, I came to the conclusion that, of those listed, Flexib. was the tallest, followed by Easy, followed by power, with Under Radar being the shortest of the four." + }, + { + "key": "QjA0A3aAjv8:1e043eff34aed7a56339e3afe4a4ab7411127e45", + "video_id": "QjA0A3aAjv8", + "question": "At 01:14, how many more roads does the black team have than the white team?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I went to 01:14 in the video and identified the black team's pieces and the white team's pieces. I counted the black team's 3 roads and the white team's 1 road, and subtracted 1 from 3 to get 2." + }, + { + "key": "QjA0A3aAjv8:2828d7f3efc8788c1cbed1cc8c2edaa45109d531", + "video_id": "QjA0A3aAjv8", + "question": "Which of the following changes occurs to the appearance of the hexagonal game board between the last 2 times it is shown?", + "answer_choice_0": "The left blue circle shifts down, and the right shifts up.", + "answer_choice_1": "The left blue circle shifts up, and the right shifts down.", + "answer_choice_2": "Both blue circles shift down.", + "answer_choice_3": "Both blue circles shift up.", + "answer_choice_4": "The right blue circle shifts up.", + "answer_id": 2, + "answer": "Both blue circles shift down.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I observed the hexagonal game board the last 2 times it is shown onscreen: second-to-last at 03:40, and lastly at 04:29. Accordingly with the answer options, I observed the blue circles on the board between these 2 showings. On the board at 03:40, there is a blue circle at the top left corner and 1 toward the bottom right. On the board at 04:29, the leftmost circle has moved down toward the left middle, and the right circle has moved down and slightly left, meaning that both circles moved down." + }, + { + "key": "QjA0A3aAjv8:48ab54b3b8195d0f486ef6868553774833719b4c", + "video_id": "QjA0A3aAjv8", + "question": "From 02:30-03:30, which Settlers of Catan resource card is shown most frequently onscreen?", + "answer_choice_0": "Wheat.", + "answer_choice_1": "Brick.", + "answer_choice_2": "Ore.", + "answer_choice_3": "Wood.", + "answer_choice_4": "Sheep.", + "answer_id": 4, + "answer": "Sheep.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video in the specified timespan, identifying when resource cards are shown and tallying the total numbers of those cards. The first time resource cards are shown in this span is at 02:43 - 4 each of the ore and wheat cards are shown, as well as 2 each of sheep, wood, and brick. From 02:52-02:53, another 1 each of ore, wheat, wood, and brick are shown. At 02:54, another 1 sheep card is shown. From 03:23-03:24, 5 more sheep cards are shown. At 03:29, 4 more each of the ore and wheat cards are shown, as well as 2 more each of brick, wood, and sheep. Thus, the final tally of cards numbers is ore: 9, wheat: 9, brick: 5, wood: 5, and sheep: 10, making sheep the most frequently-shown card in this timespan." + }, + { + "key": "QjA0A3aAjv8:8e3c63febed4ef8d19114aa06e5e879606b2774f", + "video_id": "QjA0A3aAjv8", + "question": "What is the sum of the numbers shown when the narrator talks about recommended pips for their Hybrid OWS strategy?", + "answer_choice_0": "25.", + "answer_choice_1": "10.", + "answer_choice_2": "14.", + "answer_choice_3": "20.", + "answer_choice_4": "11.", + "answer_id": 0, + "answer": "25.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video until I saw the phrase \"Hybrid OWS\" appear on screen at 04:28 and realized it referred to hybrid ore-wheat-sheep. I continued watching while the narrator discussed the strategy until I heard him mention pips at 04:52. From 04:52-04:57 numbers appear across the resource tiles while he discusses the minimum pips. Although the number of pips shown is 4, 4, and 2, I can read the numbers 5, 9, and 11 on screen. When I add 5, 9, and 11 together, I get 25." + }, + { + "key": "QjA0A3aAjv8:a3cc77d68265a6353ca48329276e88cf39eb3af2", + "video_id": "QjA0A3aAjv8", + "question": "On the screen immediately before the narrator introduces his favorite strategy, how many total question marks can be seen onscreen?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "0.", + "answer_id": 3, + "answer": "5.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened until the narrator introduced his \"favorite strategy\" in Settlers of Catan, which occurred from 00:56-00:59. I then rewound the video to watch the scene immediately before this, from 0:55-0:56. On this screen, I counted the number of question marks I saw - I counted 2 on the leftmost card onscreen, and 3 on the rightmost card onscreen, for a total of 5 question marks." + }, + { + "key": "QjA0A3aAjv8:d08438cc152cb3e1b76c2facefc7e7027b8ec365", + "video_id": "QjA0A3aAjv8", + "question": "During the third time that the hexagonal game board is shown onscreen, which of the following is not one of the numbers in a hexagon that is overlapped by a blue circle?", + "answer_choice_0": "9.", + "answer_choice_1": "10.", + "answer_choice_2": "11.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "11.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to determine the third time a hexagonal game board is shown onscreen. I saw the first showing occurs from 00:10-00:28, the second showing occurs from 00:38-00:47 and finally found the third occurs from 01:00-01:09. On this section of video, I observed the blue circles overlapping hexagon edges on the board, which can be seen toward the upper right of the board, and read the numbers inside the hexagons that the blue circles overlapped: these numbers are 5, 9, 10, 2, 4, and 6. Thus, of the options listed in the answers, 11 is the only one that does not appear in an overlapped hexagon." + }, + { + "key": "ROIZoGM-y2o:0c8199a119063a95a8edbdeb6a52286201854d37", + "video_id": "ROIZoGM-y2o", + "question": "How many cuts per second does the cook complete on the skinless white onion before it is diced?", + "answer_choice_0": "5 cuts per second.", + "answer_choice_1": "4 cuts per second.", + "answer_choice_2": "1 cut per second.", + "answer_choice_3": "2 cuts per second.", + "answer_choice_4": "3 cuts per second.", + "answer_id": 2, + "answer": "1 cut per second.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for the cook to cut into a whole, skinless white onion, finding the shot at 04:22. He starts cutting into it at 04:24, and continues cutting until 04:30, when he begins dicing it. In this span, he slices the onion 6 times, not finishing his seventh. He is therefore cutting 6 times in 6 seconds (30-24=6). By setting 6 cuts over 6 seconds, I realized that this problem can be reduced to a simple answer: 1 cut per second." + }, + { + "key": "ROIZoGM-y2o:150545bf6227e07911950a484c927b32b5bf594c", + "video_id": "ROIZoGM-y2o", + "question": "When does the man slice something on his chopping board that isn't a vegetable?", + "answer_choice_0": "02:47-03:09.", + "answer_choice_1": "04:46-05:08.", + "answer_choice_2": "03:30-03:47.", + "answer_choice_3": "02:25-02:39.", + "answer_choice_4": "04:15-04:33.", + "answer_id": 1, + "answer": "04:46-05:08.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video paying attention to the things the man slices on his chopping board. I found the first thing to be green onions at 02:25-02:39, then ginger from 02:47-03:09, peppers from 03:30-03:47, garlic from 03:48-04:14, an onion from 04:15-04:33, and chicken breast from 04:46-05:08. Of these, the only one that is not a vegetable is the chicken breast. So the answer is 4:46-5:08." + }, + { + "key": "ROIZoGM-y2o:17ab8bc9756922d408a50613333f4e82f324da00", + "video_id": "ROIZoGM-y2o", + "question": "After the cook fries the chicken, what are the first and last ingredients added to the cast iron pan that were not shown on the cutting board?", + "answer_choice_0": "Honey and lemon zest.", + "answer_choice_1": "Onions and lemon juice.", + "answer_choice_2": "Soy sauce and sesame seeds.", + "answer_choice_3": "Honey and spring onions.", + "answer_choice_4": "Water and lemon.", + "answer_id": 2, + "answer": "Soy sauce and sesame seeds.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I looked for the time the cook added food to the cast iron pan after he cooked the chicken. I saw him cook the chicken in the pan from 05:41-05:57. At 05:57, the cook takes the pan away from the vertical branch it was affixed to, and at 05:59, I saw a new, clean pan with just a little bit of oil. I knew that this was the pan I was looking for. Then, I inspected the ingredients chopped up by the cook and found a good view at 04:30, where I saw white onion, chilis, garlic, ginger, and spring onion. At 05:57, the cook adds onion, garlic, ginger, and chilis to the pan, so I discount them because they were chopped on the cutting board. At 06:09, I saw the cook add soy sauce. That wasn't shown on the cutting board, so I knew this was my first ingredient. I looked for the last ingredient. After the soy sauce, the cook adds honey at 06:16 and lemon juice at 06:23 and leaves the pan to simmer. From 06:49 to 06:53, the cook adds lemon zest and pepper. At 06:59, the cook adds the seared chicken. But at 07:05, the cook adds sesame seeds and, at 07:11, takes the pan off the fire. I knew that I found my last ingredient, so I concluded that the answer is soy sauce first, and sesame seeds last." + }, + { + "key": "ROIZoGM-y2o:2751901bb5a740000f37eab125737b4ecebb636c", + "video_id": "ROIZoGM-y2o", + "question": "What do the second ingredient placed in the pot and the final ingredient added to the cast iron pan have in common?", + "answer_choice_0": "They are both vegetables.", + "answer_choice_1": "They are both bitter.", + "answer_choice_2": "They are both spices.", + "answer_choice_3": "They are both yellow.", + "answer_choice_4": "They are both seeds.", + "answer_id": 4, + "answer": "They are both seeds.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for the second ingredient placed in the pot. It is placed over the fire at 01:33, and the first ingredient added is water at 01:35. The second ingredient is rice, at 01:44, so I found my first answer. I looked for the final ingredient added to the cast iron pan and realized that it is sesame seeds at 07:05. Comparing rice with sesame seeds, I realized that they can both be classified as seeds, so I found my answer." + }, + { + "key": "ROIZoGM-y2o:315ee1b6fb917dcfe63054b909c0c217a37e59a7", + "video_id": "ROIZoGM-y2o", + "question": "How many unique shots were there of a cooking knife cutting an ingredient with its blade pointed straight up?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "The knife is never used this way.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I looked for examples of the cooking knife cutting with its blade pointed straight up. I found 3 examples: 00:02, 03:30, and 03:38. I realized that the shot at 00:02 was the same shot as a portion of the 03:30 shot -- for the 03:30 shot goes to 03:38, and the 00:02 shot goes to 00:06, and the 00:02 shot covers just shy of the 03:30 shot's last four seconds. Since it wasn't unique, I therefore concluded that the answer was 2." + }, + { + "key": "ROIZoGM-y2o:5ff165110f817273071c1ad7622f6ea3786d6b0a", + "video_id": "ROIZoGM-y2o", + "question": "In reverse order, what would be the color pattern of ingredients shown in the first 30 seconds of the video if the last ingredient was a spring onion?", + "answer_choice_0": "Green, red, and yellow.", + "answer_choice_1": "Brown, red, and yellow.", + "answer_choice_2": "Green, brown and red.", + "answer_choice_3": "Yellow, red, and green.", + "answer_choice_4": "Red, brown, and white.", + "answer_id": 0, + "answer": "Green, red, and yellow.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the first 30 seconds, looking for the colors of the ingredients shown. At 00:00, the cook cuts a yellow lemon. At 00:02, he cuts a red chili. At 00:08, he cooks brown chicken. After this, the cook prepares his cook stand, so there are no more ingredients to be shown. In reverse order the color pattern would be brown, red, and yellow, but I ought to replace \"brown\" with \"green\", for that is the color of the spring onions (first shown at 02:23). Therefore, I concluded that the answer is green, red, and yellow." + }, + { + "key": "ROIZoGM-y2o:917e679b670252999e924411359ea0c733091b70", + "video_id": "ROIZoGM-y2o", + "question": "From first to last, what is the order in which the following ingredients - rice, allspice, lemon, and water - are added to the first cookpot?", + "answer_choice_0": "Water, Lemon, Rice, Allspice.", + "answer_choice_1": "Rice, Allspice, Lemon, Water.", + "answer_choice_2": "Water, Rice, Allspice, Lemon.", + "answer_choice_3": "Allspice, Rice, Lemon, Water.", + "answer_choice_4": "Rice, Water, Allspice, Lemon.", + "answer_id": 2, + "answer": "Water, Rice, Allspice, Lemon.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the section of video in which ingredients are added to the rice cookpot from 01:35-02:16, noting the order in which the ingredients are added. I watched the water being poured into the pot first, from 01:35-01:43. Next, I watched the chef add the rice to the water from 01:43-01:46. Third, I watched a collection of salt, allspice, and bay leaf on the flat of the chef's knife be added to the pot from 01:53-01:56. Finally, I watched the chef slice off pieces of lemon and flick them into the cookpot from 02:04-02:16. Therefore, the proper order of addition to the pot is Water, Rice, Allspice, Lemon." + }, + { + "key": "ROIZoGM-y2o:a36e4a1fe55766d87ec847f4112619387b989154", + "video_id": "ROIZoGM-y2o", + "question": "Which ingredients do the rice cooking pot and the sauce cooking pot have in common?", + "answer_choice_0": "Onion.", + "answer_choice_1": "Bay leaf.", + "answer_choice_2": "Chili.", + "answer_choice_3": "Lemon.", + "answer_choice_4": "Garlic.", + "answer_id": 3, + "answer": "Lemon.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the two events in which ingredients are added to the two different pots - from 01:35-02:16, I watched water, rice, salt, allspice, bay leaf, and lemon be added to the rice pot. From 06:00-06:27, I watched onion, garlic, chili, soy sauce, honey, and lemon juice be added to the sauce pot. Later, I watched pepper and lemon zest be added to the sauce pot from 06:49-06:53, chicken at 06:57, and sesame seeds at 07:05. Of the two ingredient sets, the one that is common between the two is lemon - it is added from 02:04-02:16 to the rice cookpot, and to the saucepan as juice from 06:21-06:27 and as zest from 06:49-06:53." + }, + { + "key": "ROIZoGM-y2o:c1d29407c8225311e4130abec2eb604057182ba9", + "video_id": "ROIZoGM-y2o", + "question": "In how many shots is a dog visible during the last two minutes of the video?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "Since the video is 07:43 minutes long, I watched the video from 05:43-07:43, counting the number of unique camera shots in which I saw a dog, to answer this question. During this span, I counted three total shots in which I noticed a dog amongst the landscape - the first from 05:51-05:54, the second from 06:21-06:27, and the third from 06:49-06:53." + }, + { + "key": "ROIZoGM-y2o:e6f6646a37d4b63cf926052c672729933c909761", + "video_id": "ROIZoGM-y2o", + "question": "Which of the following ingredients has already been cut before the video's slow motion shot?", + "answer_choice_0": "Green onion.", + "answer_choice_1": "Chicken.", + "answer_choice_2": "Garlic.", + "answer_choice_3": "White onion.", + "answer_choice_4": "Ginger.", + "answer_id": 0, + "answer": "Green onion.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched to find the video's slow motion shot, which I identified as the shot from 02:40-02:44, where the chef is tossing the ginger root into the air. I then watched the video before this point to identify which ingredients had been cut before the shot. Of the options listed among the answers, only green onions had already been cut by the time of the slow-motion shot, which occurred from 02:32-02:36, making green onions the answer." + }, + { + "key": "Reza8udb47Y:19d9303547dcf7c97e968db825a97b6d7e054c3a", + "video_id": "Reza8udb47Y", + "question": "Which black pieces are diagonally placed on the chess board when the narrator calls the closed bishops \"useless\"?", + "answer_choice_0": "Black knights.", + "answer_choice_1": "Black bishops.", + "answer_choice_2": "Black pawns.", + "answer_choice_3": "Black rooks.", + "answer_choice_4": "Black king and queen.", + "answer_id": 2, + "answer": "Black pawns.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I searched in the video for the moment the narrator calls close Bishops \"useless\", which happens at 02:36. The camera zooms in on the chess board to focus on two white Bishops together. Toward the right side of the frame, a line of diagonally placed black pawns are visible on the board, right in front of a diagonal line of white pawns." + }, + { + "key": "Reza8udb47Y:2600b1e88dca693b135d0c76b9f304557c2f29ff", + "video_id": "Reza8udb47Y", + "question": "When the narrator explains why not to move the queen too early, which two pieces are first used in the animation to illustrate the point?", + "answer_choice_0": "A knight and a bishop.", + "answer_choice_1": "A rook and a knight.", + "answer_choice_2": "A pawn and a bishop.", + "answer_choice_3": "Two knights.", + "answer_choice_4": "A bishop and a rook.", + "answer_id": 0, + "answer": "A knight and a bishop.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:00, I noticed a 9x4 grid of circular icons with labels beneath them. The first icon in the top left corner was an icon of a queen with the text \"No queen too early\" beneath it. At 00:04, I observed that a white queen icon moved into the center of the frame in front of a dark alleyway backdrop. Then, from 00:04-00:05, I observed two black icons move into the center from the left and right sides. On the left was a knight. On the right was a bishop. Each of these pieces carried a baseball bat. At 00:08 I saw the queen make sad eyes brimming with tears. Immediately after, the screen cut to black and I heard two bonk noises. From these clues, I determined that the two pieces that threatened the queen to illustrate the lesson of bringing it out too early were the knight and bishop." + }, + { + "key": "Reza8udb47Y:32f17e549b8a57b0c9bca94f0440020a648cd80c", + "video_id": "Reza8udb47Y", + "question": "How many tips presented in the video included footage of people playing chess live online?", + "answer_choice_0": "1.", + "answer_choice_1": "6.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I played the video from the beginning to identify how many of the tips shared in the video included footage of people playing online chess. The online chess board is a 2D rendered digital board with some drag and drop features, that also includes a live window of the person playing. I found the first instance at 01:55, and the second at 02:10. These two instances were part of the \u201cCastle Before Move 10\u201d tip, as labeled at the middle upper part of the frame on both scenes. The third instance happened at 03:19, where the image of a young man appears on a smartphone as he is playing an online chess game. This scene belongs to the \u201cAlways play en passant when given the chance\u201d, as the label in the frame indicates. I watched the rest of the video, but no other time people who are playing online chess are shown in the video. Based on the information gathered as I watched the video, in only two tips, footage of people playing online chess are present." + }, + { + "key": "Reza8udb47Y:465fc621db39e97b96693e68cd0d72510c63c2c6", + "video_id": "Reza8udb47Y", + "question": "What is the third move on the first chess board that appears on-screen when the narrator is explaining the concept of \"Hope Chess\"?", + "answer_choice_0": "White knight moving from g5 to f7.", + "answer_choice_1": "Black pawn moving from d7 to d5.", + "answer_choice_2": "White knight moving from f7 to d8.", + "answer_choice_3": "Black rook moving from h8 to g8.", + "answer_choice_4": "Black pawn moving from h7 to h6.", + "answer_id": 3, + "answer": "Black rook moving from h8 to g8.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I looked at the section where the narrator is explaining the concept of \"Hope Chess\" at 04:22. At 04:24, a chess board appears on-screen for the first time in this section, with some squares highlighted in yellow. I paid close attention until the third move happened on screen at 04:26. The third move was a black Rook moving from H8 to G8." + }, + { + "key": "Reza8udb47Y:ccf923dc5a362a067bf69446d6c14c1b3b8d2f1e", + "video_id": "Reza8udb47Y", + "question": "At 06:11, how many more pieces has black activated compared to white?", + "answer_choice_0": "4.", + "answer_choice_1": "0.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I went to 06:11 and observed the board. I noticed that white had activated 3 pieces (a knight on f3, a pawn on e4, and a bishop on c4). I noticed that black had activated 4 pieces (knights on f6 and e6, and pawns on d5 and e5). I subtracted white's 3 pieces from black's 4 pieces and found that black had activated 1 additional piece compared to white." + }, + { + "key": "Reza8udb47Y:d21f0bcbe5b954183b102c0d2b9315618a2f3b4d", + "video_id": "Reza8udb47Y", + "question": "Other than the King piece icon, what is the first image used to help demonstrate the sixth chess tip?", + "answer_choice_0": "A girl making an L on her forehead.", + "answer_choice_1": "A boy wearing sunglasses and a medal.", + "answer_choice_2": "A boy making a W with his hands.", + "answer_choice_3": "A girl resting her chin between her thumb and forefinger.", + "answer_choice_4": "A boy making a heart shape with his hands.", + "answer_id": 0, + "answer": "A girl making an L on her forehead.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:00, I noticed a 9x4 grid of circular icons with labels beneath them. I looked across the top row to the sixth icon and read that the label was \"End game king is valuable\". To confirm that this was the sixth tip mentioned, I listened to each tip be read aloud and noted the time it began. The first tip began at 00:00. The second tip began at 00:21. The third tip began at 00:41. The fourth tip began at 00:57. The fifth tip began at 01:18. The sixth tip began at 01:38. At 01:39, a clip-art depiction of a brown-haired girl making an L-shape on her forehead and sticking out her tongue appears next to a King piece icon. The narrator states at 01:40 that the king is a \"loser\" in the opening. Therefore, the image of the girl making an L-shape on her forehead is the first image to depict the idea of the king being a loser in the beginning." + }, + { + "key": "Reza8udb47Y:d59d06c146a41fdd931086e29904640a286c3c46", + "video_id": "Reza8udb47Y", + "question": "When the set of chess tips first appears on-screen, which one occupies the second row from the top in the third column from the left?", + "answer_choice_0": "Avoid moving pawns in front of castled king", + "answer_choice_1": "Always play en passant when given the chance", + "answer_choice_2": "Don't trade bishops for knights", + "answer_choice_3": "Knights before bishops", + "answer_choice_4": "Develop quickly", + "answer_id": 1, + "answer": "Always play en passant when given the chance", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I looked for the set of chess tips appearing on-screen and found them at 00:00 at the very beginning of the video. I then located the tip that appeared in the second row from the top of the third column from the left. Finally, I read the line of text below the tip's image to identify what it is, and I found that it read, \"Always play en passant when given the chance\"." + }, + { + "key": "Reza8udb47Y:e38a6c2b72606a58f6f0b64e0af3063c17adbbe5", + "video_id": "Reza8udb47Y", + "question": "What's shown when the word \"pawns\" is said for the 6th time?", + "answer_choice_0": "An image of two people holding each other.", + "answer_choice_1": "An image of a man tapping his forehead.", + "answer_choice_2": "Footage of two pawns in an alleyway.", + "answer_choice_3": "Footage of a clock during a tripled pawn play.", + "answer_choice_4": "Footage of a chess board that is empty but for two pawns in the same file.", + "answer_id": 3, + "answer": "Footage of a clock during a tripled pawn play.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I listened and counted the first six times the word \"pawns\" was said. This occurred at: 00:58, 00:59, 01:00, 01:03, 01:08, and 01:12. At 01:12, I observed that there was footage of a chess clock and a hand was pressing down the button on the left side of the clock. In the foreground, I saw 3 white pawns lined up in the same file. These pawns were circled in red. I heard the narrator say at 01:12 that this move, \"tripled pawns\" was \"legendary.\"" + }, + { + "key": "Ru4Y3W103as:138df7d4af4650696eb425d6ae710a2551fa5f39", + "video_id": "Ru4Y3W103as", + "question": "How many times does the first screw get rotated in order to take off the electrical socket covering at the beginning of the intro of the video?", + "answer_choice_0": "6.", + "answer_choice_1": "8.", + "answer_choice_2": "12.", + "answer_choice_3": "15.", + "answer_choice_4": "7.5.", + "answer_id": 4, + "answer": "7.5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "At the beginning of the video, starting at 00:01, the electrician uses a screwdriver to unscrew the base of an electrical socket. He rotates the screw to the left (counterclockwise) to loosen it. He does this quickly till 00:04, so to obtain the most accurate number, I slowed down the video. At first glance, it seemed that it was rotated 15 times. However, with a closer and slower look into the detailing of the top of the screw as it does an entire 360-degree rotation at a slow-down speed, I see that it makes a complete total of 7.5 spins before the socket was released." + }, + { + "key": "Ru4Y3W103as:166d5f40eeec1017d5ba9f9a90498c45aaf6ca48", + "video_id": "Ru4Y3W103as", + "question": "What is the differnece between the code-required length of wire extending beyond the box and the mean length that the three wires extend beyond the box, before any repairs are undergone?", + "answer_choice_0": "1.0 inches", + "answer_choice_1": "0.5 inches", + "answer_choice_2": "2.5 inches", + "answer_choice_3": "1.5 inches", + "answer_choice_4": "2.0 inches", + "answer_id": 3, + "answer": "1.5 inches", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video from the beginning to find when the three wires were measured. At 00:32, I saw a tape measure placed against the wall underneath the three wires, and was able to measure the length of each wire's protrusion beyond the box. The shortest wire measured 1.1 inches. The middle-length wire measured 1.5 inches. The longest wire measured 1.9 inches. I calculated the mean of these numbers by adding them together (1.1+1.5+1.9=4.5) and dividing by 3 (4.5/3=1.5). I heard the technician say at 00:32 that the wires do not meet code. I listened for the technician to state the length of wires needed for meeting building codes and heard. At 01:01, I heard the technician say \"To meet code\" and begin to describe several different requirements. From 01:18-01:22, I heard the technician say that \"at least 3 inches\" need to extend past the box itself. Therefore, I subtracted the 3-1.5=1.5 to find that the difference between the required length and the mean actual length was 1.5 inches." + }, + { + "key": "Ru4Y3W103as:3f1f79f8c859406d729e4cfbe20ea284719ba350", + "video_id": "Ru4Y3W103as", + "question": "How many objects made, at least partially, from a shade of bright blue are visible within the first 30 seconds of the electrician's explanation of option 2?", + "answer_choice_0": "3", + "answer_choice_1": "1", + "answer_choice_2": "2", + "answer_choice_3": "7", + "answer_choice_4": "6", + "answer_id": 0, + "answer": "3", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I heard the electrician mention that he's moving to the second option at 02:55. From that point, I started looking for the bright blue items on screen and found that the lettering on his t-shirt and the electrical socket were both bright blue. At 03:02, he raised his right hand, and I observed that he was wearing a watch with a navy blue wristband. I did not count this since it was not bright blue. I continued watching and saw at 03:21 that the electrician used pliers with bright blue handles. I then continued watching until 03:25 which marked the end of the first 30 seconds of option 2, and didn't see any more blue items. Furthermore, I counted all these items, and concluded that the answer is 3 bright blue items." + }, + { + "key": "Ru4Y3W103as:64935b6883120184a610eeba0aac603e62660d7c", + "video_id": "Ru4Y3W103as", + "question": "After adding up all the visible numbers on the surfaces of the Wago 221 lever nut when it is first seen in the video, what is the total?", + "answer_choice_0": "528.34", + "answer_choice_1": "548.34", + "answer_choice_2": "438.44", + "answer_choice_3": "448.42", + "answer_choice_4": "522.34", + "answer_id": 4, + "answer": "522.34", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "At the 05:12 timestamp, the electrician introduces the Wago 221 lever nut into the frame. I noted that 221 was the first number displayed on an orange background. I observed as he rotated the device to reveal the plastic side profile view, which featured several black numbers. At the 05:14 timestamp, I examined each number, which read as follows: 24, 12, 0.14, 0.2, 4, 450, and 32. I added all the visible numbers to arrive at a sum of 522.34." + }, + { + "key": "Ru4Y3W103as:affa75a8c2ac2a5c30c8294b57c4deb915e7c778", + "video_id": "Ru4Y3W103as", + "question": "How many times does the electrician twist the wires with the pliers after he appears on camera for the fourth time?", + "answer_choice_0": "11 times.", + "answer_choice_1": "7 times.", + "answer_choice_2": "12 times.", + "answer_choice_3": "10 times.", + "answer_choice_4": "8 times.", + "answer_id": 2, + "answer": "12 times.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I played the video from the beginning to first locate the fourth instance where the electrician is on screen, talking to the camera. The first time happens at 00:26, the second time at 00:34, and the third time at 01:34. I located the fourth instance at 02:52, where the electrician is introducing Step number 2: Pulling the Old Wires. I continued to watch the scene after this one, which happened at 03:18. At 03:20, the hands of the electrician, holding a piece of wire and some pliers appear on screen. I watched carefully to count the times the electrician twisted the wires with the pliers. I counted 12 instances at the following timestamps: 03:25, 03:27, 03:28, 03:29, 03:30, 03:31, 03:32, 03:36, 03:39, 03:41, 03:42, and 03:43." + }, + { + "key": "Ru4Y3W103as:e354cec9240c7f13f903c91153b0db5dea57cbcb", + "video_id": "Ru4Y3W103as", + "question": "If my old wires measure less than 2\" inches long and I want to bring them up to code, which options will allow me to add length to my old wires without additional issues?", + "answer_choice_0": "Option 2 and 3.", + "answer_choice_1": "Option 3.", + "answer_choice_2": "Options 1 and 3.", + "answer_choice_3": "Option 2.", + "answer_choice_4": "Option 1.", + "answer_id": 1, + "answer": "Option 3.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video from the beginning to locate each option and see which one does not require having to add extensions to the existing cables. The explanation of Option 1 starts at 02:09, and it requires pulling cables to add length if there is extra wire behind the box. Option 2 starts at 02:53, and it requires you to attach a new wire to the old wire and pull it to install the new. Option 3 starts at 04:43, and it requires adding extensions to the existing old wires. Option 1 can add additional issues if there's not enough extra wire behind the box. Option 2 probably requires professional installation and could be unsuccessful if the wire stays stuck or if they are stapled to the wall inside. Option 3 is the only option that meets the question's criteria, since the additional issues are minimal, and it doesn't require manipulating or pulling wires that could lead to other hazards." + }, + { + "key": "Ru4Y3W103as:ee127ba37963c0afdf628d79c2e0c05fef2835d1", + "video_id": "Ru4Y3W103as", + "question": "According to the electrition what is the second to last step be successfully finishing the electrical wire box?", + "answer_choice_0": "Secure the mounting screws.", + "answer_choice_1": "Secure wire terminals.", + "answer_choice_2": "Put the wall plate in place.", + "answer_choice_3": "Folding the wires in place.", + "answer_choice_4": "Press the outlet back in.", + "answer_id": 0, + "answer": "Secure the mounting screws.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "At 07:00, the video begins with the male electrician completing the final stages of repairing the electrical box. At 07:04, he discusses securing the electrical wires in the terminal. At 07:15, he explains how to fold the wires and place them back into the socket. At 07:29, he starts screwing in the mounting screws while mentioning that he is securing them to the electrical socket. Finally, at 07:45, he mentions that this is the final step, as he places the wall plate onto the electrical socket and screws it closed. This marks the completion of the task, with securing the mounting screws being the second-to-last step, which is how I arrived at my answer." + }, + { + "key": "Ru4Y3W103as:ff1963e7fbee554df93774e99539fe9b6376d66a", + "video_id": "Ru4Y3W103as", + "question": "What two colors of pliers does the electrian utilize throughout the video?", + "answer_choice_0": "Black & Blue", + "answer_choice_1": "Yellow & Green", + "answer_choice_2": "Red & Green", + "answer_choice_3": "Black & Yellow", + "answer_choice_4": "Blue & Red", + "answer_id": 4, + "answer": "Blue & Red", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and looked for the instances in which a pair of pliers are utilized by the electrician. I also watched to make note of what colors they were in order to determine the correct answer. I found pliers in the following instances: from 00:21-00:24 (blue pliers), 02:16-02:38 (red pliers), 03:20-03:44 (blue pliers), 05:36-05:52 (red pliers), and 06:32-06:33 (red pliers). As red and blue are the only colors present, the answer is Blue & Red." + }, + { + "key": "S3zRhfI2GZo:d75734e8b46597f96ad8488e668daf1e44ed33a9", + "video_id": "S3zRhfI2GZo", + "question": "What color dress is the woman wearing when she blows a kiss toward camera?", + "answer_choice_0": "Pink with white flowers.", + "answer_choice_1": "Blue with yellow flowers.", + "answer_choice_2": "Yellow with red flowers.", + "answer_choice_3": "Black with purple flowers.", + "answer_choice_4": "Pink with pink flowers.", + "answer_id": 4, + "answer": "Pink with pink flowers.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a woman blowing a kiss toward camera. From 00:51 to 00:54, I observed this occurring. The woman was wearing a light pink dress with pink flowers. Therefore, the answer is pink with pink flowers." + }, + { + "key": "S4P3bfR-z40:1d3ea8e5401f5825f090d764d063207ff19172cc", + "video_id": "S4P3bfR-z40", + "question": "What is the poet wearing throughout the video?", + "answer_choice_0": "A sun dress.", + "answer_choice_1": "Pajamas.", + "answer_choice_2": "A cardigan sweater and jeans.", + "answer_choice_3": "A black shirt and flowy pants.", + "answer_choice_4": "Overalls and a blue blouse.", + "answer_id": 3, + "answer": "A black shirt and flowy pants.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to see what outfit the poet wears throughout the video. When she is first seen at 00:00, as the video begins, she is wearing a black, long-sleeved shirt with flowy, loose-fitting pants and a belt. I watched the rest of the video, and she does not change her outfit. So, she is wearing a black shirt and flowy pants." + }, + { + "key": "S4P3bfR-z40:6ad8946eb3056338b50483ac14cbdf6264f330d8", + "video_id": "S4P3bfR-z40", + "question": "How long does the actor's name stay on screen when she is performing?", + "answer_choice_0": "For 4 seconds.", + "answer_choice_1": "For 6 seconds.", + "answer_choice_2": "For 12 seconds.", + "answer_choice_3": "For 10 seconds.", + "answer_choice_4": "For 8 seconds.", + "answer_id": 0, + "answer": "For 4 seconds.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, and watched out for any text, superimposed or otherwise. I found the text specifying the actor and the piece she was performing at 00:03. I then watched the video, and noted when the actor's name disappeared, at 00:07. I then subtracted 00:03 from 00:07 to get four seconds." + }, + { + "key": "S4P3bfR-z40:ca3a3e550e18682d99ae02261ab5202000b5c2dd", + "video_id": "S4P3bfR-z40", + "question": "How many piercings does the actor have?", + "answer_choice_0": "6.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video I studied the visual appearance of the performer. I determined first that she did indeed have piercings. I then determined that she had three - two ear piercings and a septum piercing. These can be seen clearly for the first time at 00:07." + }, + { + "key": "S4P3bfR-z40:d261d3ec3fa2a09755520ed1d5fa9b57c507f70c", + "video_id": "S4P3bfR-z40", + "question": "As the video begins, what color are the text and shapes that appear on the frame?", + "answer_choice_0": "Orange.", + "answer_choice_1": "Yellow.", + "answer_choice_2": "Green.", + "answer_choice_3": "Red.", + "answer_choice_4": "Black", + "answer_id": 1, + "answer": "Yellow.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the beginning of the video to see what color the text and shapes are that appear on the frame. One small shape, a square, appears in the bottom left corner of the frame. It blinks a couple of times, and then thick lines appear above, which roll right and then roll back to the left, revealing letters. All of the letters and shapes are bright yellow in color." + }, + { + "key": "S4P3bfR-z40:dcb413fbfb638bdf707780d682439ef15dae0bf0", + "video_id": "S4P3bfR-z40", + "question": "How many times does the actor places her hand on her hip while performing?", + "answer_choice_0": "6.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and studied the performers movements. I noted that at 01:28 she rests her hand on her hip. I watched the rest of the video and determined that she did not put her hand on her hip again. Therefore, I know she did do it, but only once." + }, + { + "key": "S4P3bfR-z40:e90c6ea3feb01cb87852c1c7bb61099b77dabdfb", + "video_id": "S4P3bfR-z40", + "question": "How many times does the woman in the black shirt start happily dancing throughout the video?", + "answer_choice_0": "8.", + "answer_choice_1": "5.", + "answer_choice_2": "1.", + "answer_choice_3": "6.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for a moment when the woman in the balck shirt starts dancing happily and found it between 02:50 - 03:06. I only observed one other instance of her starting to dance happily between 03:57 - 04:11. I concluded that the number of times she starts dancing happily is 2." + }, + { + "key": "S4uJa0eY3QQ:225642403af03d70aaf664abffe5b3592aa5ea91", + "video_id": "S4uJa0eY3QQ", + "question": "What is different about the setting the third time the woman with a white coat and teal shirt has a falcon land on her arm, compared to the first 2 times?", + "answer_choice_0": "There are other people present.", + "answer_choice_1": "There are more clouds.", + "answer_choice_2": "There is a patio umbrella.", + "answer_choice_3": "It is near the lake.", + "answer_choice_4": "It is raining.", + "answer_id": 0, + "answer": "There are other people present.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video to find the woman with a white coat and teal shirt, and then look at her surroundings at each instance in which she is visible. I first found her from 00:36-01:02, when a falcon lands on her arm while she stands on a dirt pathway. The second time she is visible is from 01:34-01:41, when only her arm is visible. I can clearly see it is the same white coat, though, thanks to a blue portion toward the end of its visible section. The third time she is visible is from 02:27-02:44. Comparing this third time to the other times, the aspect that is different is that there are other people present in the video. So, this must be the answer." + }, + { + "key": "S4uJa0eY3QQ:3c4b428d38569eb04d3b9358b2af6f02758de3fd", + "video_id": "S4uJa0eY3QQ", + "question": "In the segment when someone says, \"Can you turn your face away from the hawk for just a moment,\" how many people in total were using their phones to record, not including the person filming the video?", + "answer_choice_0": "4", + "answer_choice_1": "3", + "answer_choice_2": "6", + "answer_choice_3": "2", + "answer_choice_4": "5", + "answer_id": 4, + "answer": "5", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I listened to the audio carefully until I heard someone say, \"Can you turn your face away from the hawk for just a moment,\" which happens from 01:29 to 01:31. I went back to mark the beginning of this segment, at 01:17, and I watched until the end of the segment at 01:34. In this timeframe, I observed the crowd carefully for anyone holding a phone in front of them to record. At 01:17, one person in the background pans her phone to follow the flight of the falcon. At 01:18, two women stand next to each other while recording in opposite directions. At 01:23, two people stand next to each other while recording the falcon on the arm of the handler. This totals 5 people who were recording with their phones." + }, + { + "key": "S4uJa0eY3QQ:5dbfec4b3fd05e6e74cac825db4a664489f95c5f", + "video_id": "S4uJa0eY3QQ", + "question": "What does the setting look like 4 subsequent shots after a whistle is heard in the video?", + "answer_choice_0": "A sidewalk between mowed grass.", + "answer_choice_1": "A road in a neighborhood.", + "answer_choice_2": "A muddy trail in a forest.", + "answer_choice_3": "A large, open field.", + "answer_choice_4": "A road in an overgrown forest.", + "answer_id": 0, + "answer": "A sidewalk between mowed grass.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I listened for a whistle as I watched the video, and I heard it at 00:37. I then looked for the subsequent shots after this one, which features a woman standing with her arm outstretched in the midst of a forested dirt pathway. The next shot, running from 01:02-01:10, shows 3 individuals standing on a sidewalk between mowed grass, which is among tall trees. The next shot, 2 shots after the whistle, running from 01:10-01:17, shows 2 of the same individuals from the previous shot from a different angle. Then, the next shot, 3 shots after the whistle, running from 01:17-01:34, shows a sidewalk near grass and bushes which is filled with about a dozen people. Then, the next shot, 4 shots after the whistle, running from 01:34-01:41, shows a woman with her arm outstretched on a sidewalk between mowed grass. So, the answer is a sidewalk between mowed grass." + }, + { + "key": "S4uJa0eY3QQ:6ca04d4c2a990f0ca3b7776b809e7092d43f4eb2", + "video_id": "S4uJa0eY3QQ", + "question": "In the segment after the slow motion footage, what did the woman do when the second falcon did not land properly?", + "answer_choice_0": "She held out her other hand.", + "answer_choice_1": "She offered it food.", + "answer_choice_2": "She whistled.", + "answer_choice_3": "She laughed.", + "answer_choice_4": "She jumped away.", + "answer_id": 3, + "answer": "She laughed.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I found the slow motion footage beginning at 00:06 and ending at 00:36. After the footage cut to the next clip, I identified the woman on the left of the screen. I observed the first falcon landing on her arm at 00:44, and I continued watching for the second falcon to arrive. From 00:47 to 00:49, the second falcon flies around the first falcon, who was perched on the woman's arm, and then flies away after realizing there was no more space to land. I carefully observed her reaction to this moment. At 00:50, the woman laughs." + }, + { + "key": "S4uJa0eY3QQ:91df9ef6137b98bb94050ffb4209f8786b772d7b", + "video_id": "S4uJa0eY3QQ", + "question": "During the third clip that fully shows the two falcons landing together, where is the puddle of water?", + "answer_choice_0": "On the edge of the dirt path, next to a mossy branch.", + "answer_choice_1": "On the edge of the dirt path, next to a tree.", + "answer_choice_2": "Under the feet of the two handlers.", + "answer_choice_3": "At the point of intersection between two dirt paths.", + "answer_choice_4": "In the middle of the dirt path.", + "answer_id": 4, + "answer": "In the middle of the dirt path.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I counted each time the video showed 2 falcons landing together. The first instance occurs from 01:07 to 01:09. The second instance occurs from 01:10 to 01:13. The third instance occurs from 02:44 to 02:47. I observed the setting during this third instance and found the puddle of water rippling in the rain. The puddle was located in the middle of the dirt path." + }, + { + "key": "S4uJa0eY3QQ:956ace2036d82d86950525882eed5ca3c46e1147", + "video_id": "S4uJa0eY3QQ", + "question": "How many times does a person wearing a short-sleeved shirt have a falcon land on them?", + "answer_choice_0": "5 times.", + "answer_choice_1": "2 times.", + "answer_choice_2": "3 times.", + "answer_choice_3": "0 times.", + "answer_choice_4": "1 time.", + "answer_id": 4, + "answer": "1 time.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and tried to determine how many times a person wearing a short-sleeved shirt has a falcon land on them. Right at the beginning, from 00:00-00:06, I notice a person wearing a short-sleeved shirt has a falcon land on their gloved hand. Then, I continued watching. By the time I reached the end of the video, I did not notice any other people wearing short-sleeved shirts which have falcons land on them. So, the answer is 1 time." + }, + { + "key": "S4uJa0eY3QQ:c937ce76cbdcedcd9367a41ec90f5c0d5444f7a9", + "video_id": "S4uJa0eY3QQ", + "question": "How many falcon landings on arms would there be in the video if one landing was omitted?", + "answer_choice_0": "15", + "answer_choice_1": "18", + "answer_choice_2": "14", + "answer_choice_3": "20", + "answer_choice_4": "16", + "answer_id": 1, + "answer": "18", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and counted the number of times falcons landed on arms. I recorded falcon landings at the following times: 00:03, 00:31, 00:44, 01:08, 01:09, 01:11, 01:12, 01:19, 01:38, 01:47, 01:56, 02:20, 02:28, for a total of 13. I recorded 2 falcon landings at 02:46, 03:46, and 03:47, for a total of 6. 13+6=19. Therefore, there was 19 total falcon landings visible in the video. If 1 was omitted, then there would be 18. So, the answer is 18." + }, + { + "key": "S4uJa0eY3QQ:ebd38e57a3f442db2fda0544d41d05f7c4596c40", + "video_id": "S4uJa0eY3QQ", + "question": "When a white object drifts across the air while the two falcons are descending toward their handlers, how many stone structures are visible on the path?", + "answer_choice_0": "5.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "4.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I identified the segments where two falcons are descending together beginning at 01:07, 01:41, and 02:44. In each of these scenes, I observed the air for any objects that drifted across the screen. Of these three, the segment beginning at 01:41 had a white object that drifted through the air from 01:44 to 01:45, at the top of the screen. I then examined the setting of this segment and counted 4 stone structures situated at the edge of the path." + }, + { + "key": "S4uJa0eY3QQ:f1ee9519de5a23aaf0dfd2851e328553d44ef8ca", + "video_id": "S4uJa0eY3QQ", + "question": "During the clip after the one when a woman was jogging into the distance, which of the following were not spoken?", + "answer_choice_0": "Good job.", + "answer_choice_1": "Perfect.", + "answer_choice_2": "You want your food?", + "answer_choice_3": "Yeah, I know.", + "answer_choice_4": "Are you gonna be good?", + "answer_id": 4, + "answer": "Are you gonna be good?", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I found the clip with the woman jogging in the background between 01:05 and 01:09. When the next clip began at 01:10, I continued watching until this clip ended at 01:17 and listened carefully to the words spoken. \"Perfect\" was said at 01:13. \"You want your food?\" was said at 01:14. \"Good job\" was said at 01:15. \"Yeah I know\" was said at 01:16. This leaves \"Are you gonna be good?\" as the option that was not spoken during this clip, as it appeared later at 02:20." + }, + { + "key": "S4uJa0eY3QQ:fc2c594ff0b99ca179e2482018f1ebf96d8b0ec4", + "video_id": "S4uJa0eY3QQ", + "question": "How long does the couple in the rain remain visible in the video with falcons on both of their arms?", + "answer_choice_0": "40 seconds.", + "answer_choice_1": "57 seconds.", + "answer_choice_2": "26 seconds.", + "answer_choice_3": "45 seconds.", + "answer_choice_4": "32 seconds.", + "answer_id": 3, + "answer": "45 seconds.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video to find a couple in the rain who both have falcons on their arms. Rainy conditions are not present until 02:44, when there is a man and a woman who are looking down a long, muddy pathway. Falcons land on their arms at nearly the exact same moment, at 02:46. They remain standing in place until 03:21, and then they start walking down the muddy pathway. The falcons stay with them during this time. At 03:31, the falcon that landed on the woman's arm flew away. Since the total time both falcons remained on the couples' arms was 02:46-03:31, I used subtraction to determine that the total duration of time was 45 seconds." + }, + { + "key": "SKnkzv8GFeg:23ff204b449b607161a9b762fa5fc8c0723064a3", + "video_id": "SKnkzv8GFeg", + "question": "What color shirt is Bryan Cranston wearing in his final photo shoot?", + "answer_choice_0": "Blue.", + "answer_choice_1": "Red.", + "answer_choice_2": "Black.", + "answer_choice_3": "White.", + "answer_choice_4": "Pink.", + "answer_id": 0, + "answer": "Blue.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 03:15, I saw Bryan Cranston doing a photo shoot. He had changed clothes after his speech. He was wearing a blue shirt." + }, + { + "key": "SKnkzv8GFeg:43475ae8c32d51699474f38616b806b565cf5925", + "video_id": "SKnkzv8GFeg", + "question": "According to the woman with blonde hair being interviewed, how many days did it take to shoot the movie?", + "answer_choice_0": "30 days.", + "answer_choice_1": "45 days.", + "answer_choice_2": "20 days.", + "answer_choice_3": "15 days.", + "answer_choice_4": "9 days.", + "answer_id": 2, + "answer": "20 days.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I noticed the woman with blonde hair getting interviewed starting at 00:15. I continued watching until 00:44 when she said it took them 20 days to shoot the movie. So it took them 20 days to shoot the movie." + }, + { + "key": "SKnkzv8GFeg:51754b3c65a5602ad9eaf598b3ab1d0bcfc2dc69", + "video_id": "SKnkzv8GFeg", + "question": "What joke does Bryan Cranston make that causes him to receive his second total round of audience laughter at the awards ceremony?", + "answer_choice_0": "Bryan Cranston jokes about a tattoo.", + "answer_choice_1": "Bryan Cranston jokes about shyness.", + "answer_choice_2": "Bryan Cranston jokes about celebrity.", + "answer_choice_3": "Bryan Cranston jokes about beer.", + "answer_choice_4": "Bryan Cranston jokes about Heisenberg.", + "answer_id": 1, + "answer": "Bryan Cranston jokes about shyness.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "To find this answer, I watched the section of video where Bryan Cranston is seen onstage at the awards ceremony, which begins at 01:57. At 02:01, Bryan Cranston jokingly responds to the person awarding him that he will say something, which gets him his first round of audience laughter. He then makes a joke about not 'necessarily' being shy at 02:03, which earns him his second total round of audience laughter." + }, + { + "key": "SKnkzv8GFeg:74168791d875ce9f0f0c925ed71208e3512d7106", + "video_id": "SKnkzv8GFeg", + "question": "Where can the Cinemerit Award be observed in relation to the microphone from Bryan Cranston's perspective after being placed on the podium during Bryan Cranston's speech?", + "answer_choice_0": "To the right of the microphone", + "answer_choice_1": "Under the microphone", + "answer_choice_2": "Behind the microphone", + "answer_choice_3": "To the left of the microphone", + "answer_choice_4": "In front of the microphone", + "answer_id": 0, + "answer": "To the right of the microphone", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the Cinemerit Award as the award handed to Bryan Cranston at 01:57, and watched the section of the video that shows Bryan Cranston's speech, after he placed the Cinemerit Award on the podium at 02:05, from 02:05 to 03:14. I observed the positioning of the Cinemerit Award and the microphone on the podium in this section from his perspective. In the shots shown during the speech, the Cinemerit Award can be seen on the podium, directly to the right of the microphone from Bryan Cranston's perspective since he is behind the podium." + }, + { + "key": "SKnkzv8GFeg:c3e37ed2ca89c1caf6251f154c1b1f06312fe91e", + "video_id": "SKnkzv8GFeg", + "question": "What is Sir Peter Jonas wearing under his jacket?", + "answer_choice_0": "A Power Rangers shirt.", + "answer_choice_1": "A Breaking Bad shirt.", + "answer_choice_2": "A Trumbo shirt.", + "answer_choice_3": "A Godzilla shirt.", + "answer_choice_4": "A Malcolm in the Middle shirt.", + "answer_id": 1, + "answer": "A Breaking Bad shirt.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Right at 01:46, I carefully observe Sir Jonas's hand movements when he goes to unbutton his brown jacket. He begins moving to the side of the podium at 01:49. I keep watching at 01:50 - 01:55 when Sir Jonas fully begins to take of his jacket about mid-shoulder. I observe the Breaking Bad shirt he is wearing underneath at 01:54." + }, + { + "key": "SKnkzv8GFeg:c5d75d99609d22ec807e2210cdc7cd94c0d2369f", + "video_id": "SKnkzv8GFeg", + "question": "What is the lady in white holding during the award speech?", + "answer_choice_0": "Flowers.", + "answer_choice_1": "A handkerchief.", + "answer_choice_2": "A book.", + "answer_choice_3": "A purse.", + "answer_choice_4": "A mic.", + "answer_id": 0, + "answer": "Flowers.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watch the video at 02:55 when Bryan Cranston is standing behind the podium and looks to the left. There are three people standing off to the side of the stage at 02:56. Between 02:56 and 02: 58, I carefully observed the three people standing near the stage and looked for a lady in white. After I spotted the woman in white, I noticed she was holding white flowers in her hand." + }, + { + "key": "TfI9nEKdGfg:000d934aaef9f9aef81e002090979eb47feb05a9", + "video_id": "TfI9nEKdGfg", + "question": "In which neighborhood is the location featured immediately before the 3rd shot of the speaker's baguette sandwich?", + "answer_choice_0": "Place des Vosges", + "answer_choice_1": "Parc des Batignolles", + "answer_choice_2": "Belleville", + "answer_choice_3": "Sainte-Avoye", + "answer_choice_4": "Jardin du Luxembourg", + "answer_id": 1, + "answer": "Parc des Batignolles", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and paid attention to shots of the speaker's baguette sandwich. I noted that the first appears from 02:51 to 02:53. The second shot of the baguette sandwich is from 07:06 to 07:08, followed immediately by the third shot of the baguette sandwich\u201407:08 to 07:11. This means the second shot of the baguette sandwich, is the one the question is asking about. I continued watching the video to see the name of the location. At 07:53 the speaker introduces Parc du Batignolles, and at 07:55, while speaking about the park, she shows the area where she was eating the baguette sandwich, at 07:06, meaning the location shown immediately before the 3rd shot of the baguette sandwich is Parc du Batignolles." + }, + { + "key": "TfI9nEKdGfg:231a666011b311e89a1fbdabd4b55faedcde94a3", + "video_id": "TfI9nEKdGfg", + "question": "How many times does a map appear throughout the video?", + "answer_choice_0": "6 times.", + "answer_choice_1": "1 time.", + "answer_choice_2": "3 times.", + "answer_choice_3": "2 times.", + "answer_choice_4": "4 times.", + "answer_id": 0, + "answer": "6 times.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked for a map and saw the first one appear at 02:08. I saw a second map appear at 09:21, a third at 09:34, a fourth at 09:49, a fifth at 09:56, and a sixth at 10:02. I counted up the total number of times a map appears in the video and arrived at 6." + }, + { + "key": "TfI9nEKdGfg:24333ca633401eb25fc0219355ea5aa4d059cc8d", + "video_id": "TfI9nEKdGfg", + "question": "During the section about shopping in Le Marais, how many people were walking in front of the store that includes a famous French philosopher's name?", + "answer_choice_0": "2.", + "answer_choice_1": "0.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "1.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for the section about shopping in Le Marais. I heard the host introduce the Le Marais neighborhood as the words, \"Le Marais\" appeared onscreen at 01:19. At 01:23, I heard the narrator refer to Le Marais as an area where people go to \"buy clothes\" and \"go shopping.\" I then started looking for the name of a French philosopher. At 01:38, the word \"Volatire\" on a store sign became prominent on the left side of the screen. At the same time, one man crosses in front of the store from right to left. At 01:46, the host moves onto a new section about eating. I concluded that Volatire is the only French philosopher's name that appears during the section about shopping in Le Marais." + }, + { + "key": "TfI9nEKdGfg:2568dbee51b3edda513a233301abd3c274a3efdf", + "video_id": "TfI9nEKdGfg", + "question": "If you take the fastest route on the map, how many minutes would it take to walk from Belleville to the Cathedral of Notre Dame if you pass through Le Carreau du Temple?", + "answer_choice_0": "49 minutes.", + "answer_choice_1": "21 minutes.", + "answer_choice_2": "47 minutes.", + "answer_choice_3": "26 minutes.", + "answer_choice_4": "28 minutes.", + "answer_id": 2, + "answer": "47 minutes.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for an image of a map of Belleville. The first time Belleville appears on a map is at 09:36, but it is not clear where it is in relation to the Cathedral of Notre Dame. The next time I saw Belleville appear on a map was at 09:56. It isn't clear in that image where Belleville is in relation to the Cathedral of Notre Dame either, but the map does show that if you walk on the fastest route, it takes 21 minutes to get from Belleville to the Le Carreau du Temple. I observed another map where the Cathedral of Notre Dame is also clearly marked at 10:02. On that map, if you take the fastest route from Le Carreau du Temple to the Cathedral of Notre Dame, you would arrive in 26 minutes. I added the total amount of time it takes to walk on the fastest route from Belleville to Le Carreau du Temple to the total time it takes to walk on the fastest route from Le Carreau du Temple to Notre Dame, 26+21=47. I concluded that if you follow the fastest route, it takes 47 minutes to get from Bellevillle to the Cathedral of Notre Dame." + }, + { + "key": "TfI9nEKdGfg:25c86ce619f895f0192145452739d973cf7443dc", + "video_id": "TfI9nEKdGfg", + "question": "How many pigeons appear when the guide discusses her 3 favorite parks in Paris?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "12.", + "answer_choice_4": "7.", + "answer_id": 4, + "answer": "7.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for the moment where the guide introduced her first favorite park. I heard her use the word, \"park\" at 07:09 and saw 2 pigeons visible onscreen. However, the guide is only referring to parks generally at that moment. She does not introduce her first favorite park until 07:12 when she says, \"A few of my favorite parks in Paris are...\" and then the words \"Jardin du Luxembourg\" appear onscreen, denoting her first favorite park at 07:15. I started looking for pigeons and noticed 1 walking in the background on the left at that timestamp. The next park the guide introduces is \"Place des Vosges\" at 07:32. I looked carefully for pigeons and spotted 3 on the ground beneath park benches at 07:33. I saw another pigeon walking on the ground at 07:39. The final park the guide discusses is \"parc des Batignolles,\" and I saw 2 pigeons barely visible near the water in the background at 07:59 in that park. I heard the guide move onto a new topic at 08:03 and determined she was finished discussing parks. I counted up the total number of pigeons visible between 07:12-08:03, 1+3+1+2=7. I concluded that 7 pigeons appear when the guide discusses her 3 favorite parks in Paris." + }, + { + "key": "TfI9nEKdGfg:61df3e3e9a49eba20593044a06d8133d32704382", + "video_id": "TfI9nEKdGfg", + "question": "At what timestamp does the guide first appear in Parc des Batignolles?", + "answer_choice_0": "07:57.", + "answer_choice_1": "07:55.", + "answer_choice_2": "00:52.", + "answer_choice_3": "03:24.", + "answer_choice_4": "00:23.", + "answer_id": 2, + "answer": "00:52.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for a moment when the guide first introduced Parc des Batignolles. I heard her mention the park at 07:54. I then carefully observed the different locations of the park and noted a peaceful river, a dirt path by that river, and the guide walking toward a wooden bridge over the river. I then went back in the video to find when any of these locations first appeared. I observed the guide walking along the dirt path towards the wooden bridge over the river at 00:52 and could clearly see that this location was a part of Parc des Batignolles since it is identical to a location in the Parc des Batignolles section. Therefore, the first time the guide appears in Parc des Batignolles is at 00:52." + }, + { + "key": "TfI9nEKdGfg:7604d2a26a47a900260e49fed8e8c111680c42fd", + "video_id": "TfI9nEKdGfg", + "question": "What tall building is present in the fourth location that Bobby appears together with the guide onscreen?", + "answer_choice_0": "The Eiffel Tower.", + "answer_choice_1": "A clock tower.", + "answer_choice_2": "A skyscraper.", + "answer_choice_3": "A lighthouse.", + "answer_choice_4": "The Notre Dame Cathedral.", + "answer_id": 3, + "answer": "A lighthouse.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I listened for the guide to introduce a character named \"Bobby.\" She mentions him at 03:06, but it is not immediately clear what he looks like as there is no image of him onscreen. He becomes partially visible at 03:40 as the guide discusses the meal she shared with him, but I continued watching to see if I could find a better visual. The guide refers to her American boyfriend \"Bobby\" at 04:57 and an image of them together becomes clearly visible at 04:58. The Eiffel Tower is in the background in that image. I then went back to find the other locations where Bobby appears in the video with the guide. I saw them eating cheese at a restaurant together between 02:31-02:34 and counted that as the first location. I counted the picture of them together in front of the Eiffel Tower as the second location. The next time Bobby appears with the guide is in front of a city in a still image at 06:17. And the fourth time they are seen together is on a beach at 06:18. I looked for a building in that shot and observed a red and white light house. I concluded that a lighthouse is the tall building visible in the fourth location where Bobby and the guide are seen together onscreen." + }, + { + "key": "TfI9nEKdGfg:8cbfc442b7e72120eb26e0b826e59d268a4ead6c", + "video_id": "TfI9nEKdGfg", + "question": "What traffic law would the silver car have violated if it had made a sharp right turn in front of Cafe Chappe?", + "answer_choice_0": "Ignoring a yield sign.", + "answer_choice_1": "Ignoring a red traffic light.", + "answer_choice_2": "Ignoring pedestrians with the right of way.", + "answer_choice_3": "Ignoring a passing car on its right.", + "answer_choice_4": "Ignoring a no entry sign.", + "answer_id": 4, + "answer": "Ignoring a no entry sign.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I looked for a moment in the video where a silver car is driving near Cafe Chappe. I read the words \"Cafe Chappe\" on a restaurant sign at 05:48. I observed the silver car on the road to the right of the restaurant. I noticed that the car is at an intersection in front of the restaurant and that there is a red sign with a white dash through it in front of the road that runs to the left. Since a sign with a red circle with a white dash through it means \"no entry\" in France, I concluded that this was the nature of the sign. I determined that had the car turned right sharply and continued on the road that runs to the left in front of Cafe Chappe, it would have violated this no entry sign." + }, + { + "key": "TfI9nEKdGfg:e3604e7999fa8b98424b56d877268ac0cea841d2", + "video_id": "TfI9nEKdGfg", + "question": "What did the host eat, the 6th time she put food into her mouth?", + "answer_choice_0": "Garlic potatoes.", + "answer_choice_1": "Snails.", + "answer_choice_2": "Steak frites.", + "answer_choice_3": "Croissant.", + "answer_choice_4": "Pork roast.", + "answer_id": 0, + "answer": "Garlic potatoes.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video, looking for each time the host puts food into her mouth. This happens at 00:00, 00:04, 00:33, 01:49, 01:58, and the sixth time is at 03:45. Just before this time, the host is discussing a pork roast dish with garlic potatoes. We see her partner cutting into the pork roast. However, when the host is shown next at 03:45, she is eating potatoes. Therefore, the answer is garlic potatoes." + }, + { + "key": "UNFgI5Jl7y8:7f4801d8d0dfbc385713b22e487f5cf198965704", + "video_id": "UNFgI5Jl7y8", + "question": "What instrument does the woman in black and white play?", + "answer_choice_0": "Piano.", + "answer_choice_1": "Violin.", + "answer_choice_2": "Flute.", + "answer_choice_3": "Organ.", + "answer_choice_4": "Harp.", + "answer_id": 0, + "answer": "Piano.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Clips from the series SERVANT begin at 01:17. At 01:21, a woman in a black blouse and a white skirt plays a piano on the right side of the screen." + }, + { + "key": "UNFgI5Jl7y8:7f742fc2a6505dd9ff05db2bfc51517814f56738", + "video_id": "UNFgI5Jl7y8", + "question": "What did Nell Tiger Free joke about taking after the SERVANT series wrapped?", + "answer_choice_0": "Wardrobe.", + "answer_choice_1": "A doll.", + "answer_choice_2": "A car.", + "answer_choice_3": "Curtains.", + "answer_choice_4": "The house.", + "answer_id": 4, + "answer": "The house.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 02:41, the interviewer asked Nell and Rupert if they kept items from their sets. Nell then replied by saying that she steals items from projects she's worked on. At 02:48, Rupert asked Nell what she took from SERVANT. She replied that she took the house and actually lives in it. Her laugh indicated that she was joking." + }, + { + "key": "UNFgI5Jl7y8:b278b8e9ca7d272127515e3298597810d6478acd", + "video_id": "UNFgI5Jl7y8", + "question": "What appears across the bottom of the screen as the interviewer asks his first question of the movie actors?", + "answer_choice_0": "Name of Podcast.", + "answer_choice_1": "Actors' names.", + "answer_choice_2": "Foreign language words.", + "answer_choice_3": "Event location.", + "answer_choice_4": "Movie title.", + "answer_id": 2, + "answer": "Foreign language words.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for when the interviewer asked his first question of the actors at 00:28. I watched the bottom of the screen during the question and for a bit of the response from 00:28 to 00:44. I saw that words in a foreign language appear at the bottom of the frame." + }, + { + "key": "UNFgI5Jl7y8:cc75f059120f0d1e971750a1ea1c389d43be638a", + "video_id": "UNFgI5Jl7y8", + "question": "What language are the subtitles in?", + "answer_choice_0": "English.", + "answer_choice_1": "Spanish.", + "answer_choice_2": "French.", + "answer_choice_3": "German.", + "answer_choice_4": "Italian.", + "answer_id": 2, + "answer": "French.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Throughout the video there are French subtitles along the bottom of the screen, translating each thing that is said into French." + }, + { + "key": "UNFgI5Jl7y8:d9d31d8cb0e0e59ace80851dc446f491d778cf63", + "video_id": "UNFgI5Jl7y8", + "question": "How many times does the chandelier blink before the screen goes black?", + "answer_choice_0": "Two times.", + "answer_choice_1": "Seven times.", + "answer_choice_2": "Five times.", + "answer_choice_3": "Three times.", + "answer_choice_4": "One time.", + "answer_id": 2, + "answer": "Five times.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the screen goes black for the first time at 00:14. I watched from the beginning to see when the chandelier first blinked, which happened at 00:13. Because the lamp was not in full view between its first blink and the screen going black from 00:13 to 00:14, I counted how many times the screen dimmed. It was a total of five times." + }, + { + "key": "UYPzrDsUD48:01d11180380aea358e26efaa7e664ba06a5eb277", + "video_id": "UYPzrDsUD48", + "question": "Sum all the integers that appear as text in the video, excluding integers used as units of measure (e.g., the \u201c3\u201d in cm^3). What is the result?", + "answer_choice_0": "15.", + "answer_choice_1": "104808.", + "answer_choice_2": "1599.", + "answer_choice_3": "3799.", + "answer_choice_4": "104899.", + "answer_id": 1, + "answer": "104808.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "At 00:26, \u201c1. Definition of Pressure\u201d appears as text on screen. At 01:20, the number \u201c760 mm\u201d appears on screen, and is said by the narrator. At 01:27, \u201c10 meters\u201d appears as text on screen and is said out loud. At 01:33, \u201c10/0.760\u201d appears on screen, but this isn\u2019t an integer. At 01:35, \u201c13/1\u201d appears on screen and is said out loud. This is an integer. At 01:45, \u201c2. The Concept of Fluid Density\u201d appears as text on screen, and is said out loud. At 02:14, \u201c1000 kg/m^3 = 1 g/cm^3\u201d appears as text on screen. At 02;57, \u201c1200 kg/m^3\u201d and \u201c800 kg/m^3\u201d appear as text on screen, and are said out loud. At about 03:07, \u201c3. Floating and Buoyancy\u201d appears on screen and is said out loud. At 04:43, \u201c4. Boyle\u2019s Law\u201d is put on screen and said out loud. At 05:27, \u201c1 N/m^2 = 1 pascal\u201d appears on screen. At 05:35, \u201c1 atm = 101,000 Pa\u201d appears on screen and is said out loud. At 05:43, \u201c5. The Spouting Cylinder\u201d appears as text on screen and is said out loud. At 06:51, \u201c6. Bernoulli\u2019s Principle\u201d appears on screen and is said out loud. Adding up all the integers, we get 1+760+10+13+2+1000+1+1200+800+3+4+1+1+1+101000+5+6 = 104808." + }, + { + "key": "UYPzrDsUD48:3b03ef6e9ad8355ee18d860a88663c7c25963587", + "video_id": "UYPzrDsUD48", + "question": "What is the product of the number of density cubes and physics textbooks used in the Boyle\u2019s Law demonstration?", + "answer_choice_0": "9.", + "answer_choice_1": "36.", + "answer_choice_2": "18.", + "answer_choice_3": "12.", + "answer_choice_4": "24.", + "answer_id": 1, + "answer": "36.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video and noticed many duplicate items. At 01:57, the narrator says \u201cdensity cubes,\u201d and then shows the cubes. At 02:01, they are all labeled. There are a total of 12 density cubes shown. At 04:43, the section about Boyle\u2019s Law begins. At 04:45, we see 3 textbooks on the table. At 05:04, all 3 textbooks are used to demonstrate Boyle\u2019s Law. Therefore, we multiply 12 by 3 and get 36." + }, + { + "key": "UYPzrDsUD48:44c4f64b1d18323342c3d2adbfd057bff0ac294b", + "video_id": "UYPzrDsUD48", + "question": "How many times heavier is the second density cube than the first?", + "answer_choice_0": "2.64.", + "answer_choice_1": "3.05.", + "answer_choice_2": "2.86.", + "answer_choice_3": "1.35.", + "answer_choice_4": "1.77.", + "answer_id": 0, + "answer": "2.64.", + "question_type": "Reading", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video and noticed many duplicate items. At 01:57, the narrator says \u201cdensity cubes,\u201d and then shows the cubes. At 02:01, they are all labeled. There are a total of 12 density cubes shown. At 02:07, the narrator takes 2 away to weigh them. The first cube displays a number of 44 on the scale, shown at 02:11. At 02:13, the second cube is weighed. The number 116 appears on the scale. These two numbers are not said out loud. If we divide 116 by 44 and round to 2 decimal places, we get 2.64." + }, + { + "key": "UYPzrDsUD48:45f3fe4f53010dccc712ba9d41d6f33d833b5f39", + "video_id": "UYPzrDsUD48", + "question": "In the segment on floating and buoyancy, how many times does the letter \u201cg\u201d appear as on-screen text?", + "answer_choice_0": "8.", + "answer_choice_1": "9.", + "answer_choice_2": "11.", + "answer_choice_3": "6.", + "answer_choice_4": "14.", + "answer_id": 1, + "answer": "9.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video and noticed a lot of text on screen. The question only asked for on-screen text. At 03:05, the words \u201c3. Floating and Buoyancy\u201d appear on screen. That is 1 case of the letter g. At 03:13, the sentence \u201cThe weight of the displaced fluid is equal to the force of buoyancy\u201d appears on screen. There is 1 g in that sentence. At 03:36, a transformed equation is shown. On this page, there are 6 instances of the letter g. At 03:45, the word \u201cFloating\u201d appears on screen. This is another case of the letter g. When you add up all of the times g appears as text, you get 1 + 1 + 6 + 1 = 9." + }, + { + "key": "UYPzrDsUD48:501f6762f5733541159be80743d54f3cebff54f3", + "video_id": "UYPzrDsUD48", + "question": "What color is the less dense fluid in the sixth experiment?", + "answer_choice_0": "Green.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Clear.", + "answer_choice_3": "Gold.", + "answer_choice_4": "Pink.", + "answer_id": 4, + "answer": "Pink.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Physics", + "reasoning": "While watching the video, I paid attention to the visuals and narration for lighter fluid in the third experiment. At 00:51 I see the first experiment demonstrating mechanical advantage. At 01:00 I see the second experiment demonstrating pressure. At 02:09 I see a new experiment to find the densities of various sample cubes beginning. At 02:25 I see another experiment begin about identifying the various materials by relative density. At 02:30 I see a relative fluid density experiment with salt and fresh water. Finally, at 02:44 I see the sixth experiment with a pink and green fluid, and due to the relative height of the pink fluid I know it is less dense. Therefore, the color of the less dense fluid in the sixth experiment is pink." + }, + { + "key": "UYPzrDsUD48:59eb4f46a0624349756bec7bf454426c8edd581c", + "video_id": "UYPzrDsUD48", + "question": "While demonstrating Boyle's law, what is the greatest amount of books stacked onto the compressed gas?", + "answer_choice_0": "4.", + "answer_choice_1": "0.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I pay attention to the video watching for a Boyle's law demonstration, which starts at 04:43. At 04:55 I see one book stacked on the gas. At 04:59 I see a second book is stacked onto the gas. At 5:05 I see a third book stacked onto the gas. From 05:06 until 05:14 I see the books taken off. At 05:27 I see the three books stacked onto the gas again. Therefore, the greatest amount of books stacked onto the compressed gas while demonstrating Boyle's law is 3." + }, + { + "key": "UYPzrDsUD48:5dc4db877ff719766043f25e9b4af4f4bb2b1aa3", + "video_id": "UYPzrDsUD48", + "question": "What is the quotient when the total number of density cubes shown in the first 2 minutes of the video is divided by the total number of frisbees the host shows in the video?", + "answer_choice_0": "4", + "answer_choice_1": "6", + "answer_choice_2": "12", + "answer_choice_3": "8", + "answer_choice_4": "1", + "answer_id": 0, + "answer": "4", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Physics", + "reasoning": "At 01:57, the narrator says \u201cdensity cubes,\u201d and then shows the cubes. At 02:00, they are all labeled. There are a total of 12 cubes shown. At 07:22, the narrator picks up a bright yellow frisbee. It is the first one he shows off. At 08:05, 2 more frisbees are shown. They are orange and white. I watched the rest of the video and confirmed that the narrator does not show any additional frisbee. This is a total of 3 frisbees. The total number of density cubes, 12, divided by the number of frisbees shown, 3, is 12/3 = 4." + }, + { + "key": "UYPzrDsUD48:add216f2a5bfcaaa4e53d511cc6e1a401ce11642", + "video_id": "UYPzrDsUD48", + "question": "What is the mathematical difference between the amount of cubic samples tested in water and the total amount of samples?", + "answer_choice_0": "11.", + "answer_choice_1": "9.", + "answer_choice_2": "8.", + "answer_choice_3": "10.", + "answer_choice_4": "12.", + "answer_id": 3, + "answer": "10.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "At 02:01, I found the cubic samples, counting a total of 12. Next, at 02:24, I saw and counted 2 samples tested in water. Then, I calculated 12-2=10. Therefore, the mathematical difference between the amount of cubic samples tested in water and the total amount of samples is 10." + }, + { + "key": "WmpPEoBp48A:513710932a10ef34ad6f10e288b4df8c087d60e8", + "video_id": "WmpPEoBp48A", + "question": "What words are briefly at the top of the screen when the guest announces that he will start calling pink magenta?", + "answer_choice_0": "Capital Conquest.", + "answer_choice_1": "Draft Attack.", + "answer_choice_2": "Continent Overlay.", + "answer_choice_3": "Advanced Modifiers.", + "answer_choice_4": "Dune Factions.", + "answer_id": 2, + "answer": "Continent Overlay.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video, listening for the guest to state that he was going to start calling pink magenta, which occurs from 43:22-43:26. A dropdown appears at the top of the screen at 43:22 and disappears again at 43:25. The words inside the dropdown box are \"Continent Overlay.\"" + }, + { + "key": "WmpPEoBp48A:756f6db745a62d30f9e12bc7bbf663c536d0c549", + "video_id": "WmpPEoBp48A", + "question": "In the first 2 minutes of the video, where is the player whose avatar is directly above HudsonHornet250 based?", + "answer_choice_0": "France.", + "answer_choice_1": "Canada.", + "answer_choice_2": "United States of America.", + "answer_choice_3": "United Kingdom.", + "answer_choice_4": "Christmas Island.", + "answer_id": 4, + "answer": "Christmas Island.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked for the avatar named HudsonHornet250, which I saw onscreen from 00:00 to 01:16, positioned on the left side in the middle. Directly above it, I saw another avatar and read its name as \"Brilliant Frog of White Meadow.\" Below that name, I read \"Christmas Island\", which indicated their location. Therefore, the answer is Christmas Island." + }, + { + "key": "WmpPEoBp48A:7fcc016123308b39a85fd24d779330f127327b95", + "video_id": "WmpPEoBp48A", + "question": "What object surrounds the avatar of the second grandmaster the host introduces?", + "answer_choice_0": "Curved daggers.", + "answer_choice_1": "Golden Laurel.", + "answer_choice_2": "Shark teeth.", + "answer_choice_3": "Green wreath.", + "answer_choice_4": "Garland of Roses.", + "answer_id": 2, + "answer": "Shark teeth.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video for where the host begins to introduce the players at 01:18. The first of 6 players to be introduced is Brilliant Frog of White Meadow. On their avatar board is their rank of \"grandmaster,\" and there is a golden laurel curved around their avatar image. The second competitor introduced by the host is Lina Kitty at 01:51. She is both noted by the host, and her avatar board says she is a \"grandmaster.\" This makes Lina Kitty the second grandmaster introduced by the host. Her avatar image is on the left side of her avatar box. She is wearing a purple jacket and hat, and around her avatar image is a set of gray shark teeth. Therefore, the answer is, Shark teeth." + }, + { + "key": "WmpPEoBp48A:7feeddbdffe27a40d2150f7e08892cab0b8eff6b", + "video_id": "WmpPEoBp48A", + "question": "On the map of the Northernmost part of North America fully visible just before a caller says the phrase, \"butcher the chance,\" what is the sum of all the numbers in orange diamonds on the map?", + "answer_choice_0": "23", + "answer_choice_1": "20", + "answer_choice_2": "10", + "answer_choice_3": "27", + "answer_choice_4": "14", + "answer_id": 1, + "answer": "20", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I listened for a caller to use the phrase, \"butcher the chance\" which I heard at 06:45-06:46. I then went back to find the fully visible version of the onscreen map of the northernmost part of North America just before this moment and saw it at 06:44. I looked at all the numbers in orange diamonds on the map and counted 12 number 1's, 1 number 2, and 2 number 3's. I added 12+2+6 and got a total of 20." + }, + { + "key": "WmpPEoBp48A:9421cfa33cb01b46c6e0a0d877106a59e6392ac3", + "video_id": "WmpPEoBp48A", + "question": "What color are the bottom 2 Capital Conquest map tabs on the opening digital board?", + "answer_choice_0": "Black and Blue.", + "answer_choice_1": "Orange and Pink.", + "answer_choice_2": "Yellow and Blue.", + "answer_choice_3": "Orange and Black.", + "answer_choice_4": "Yellow and Purple.", + "answer_id": 0, + "answer": "Black and Blue.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video from opening 00:00 to when the screen changed at 01:16. I read the various opening screen elements to see what was what. I located the text that read \"Capital Conquest\" at the top center of the screen. Below this are 6 colored tabs, set in 2 columns of 3 rows. There are 2 tabs at the bottom: the left one is Black and the right one is Blue. Therefore, the answer is Black and Blue." + }, + { + "key": "WmpPEoBp48A:be5daa6508e400a71b882d1d7b63bd17b15ac78a", + "video_id": "WmpPEoBp48A", + "question": "Who is the last player to return to the game after the host takes a coffee break?", + "answer_choice_0": "General Bains 15708.", + "answer_choice_1": "Dignia22.", + "answer_choice_2": "Brilliant Frog of White Meadow.", + "answer_choice_3": "Sir Tyler.", + "answer_choice_4": "Lina Kitty.", + "answer_id": 1, + "answer": "Dignia22.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened for the host to announce he was going for a coffee break, which happens at 37:03. I waited and watched while the guest talked in the host's absence, and the avatars begin popping up onscreen again at 37:27. The last to return is Dignia22 at 38:15." + }, + { + "key": "WmpPEoBp48A:d682a3ba9649f0184ee269a013dc0b7fe0b07b6b", + "video_id": "WmpPEoBp48A", + "question": "Among the avatars who appear after individually on the screen, with their awards and stats below them, who has a golden tooth?", + "answer_choice_0": "Sir Tyler.", + "answer_choice_1": "General Bains.", + "answer_choice_2": "Hudson Hornet.", + "answer_choice_3": "Lina Kitty.", + "answer_choice_4": "Dignia22.", + "answer_id": 0, + "answer": "Sir Tyler.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched to see when each avatar popped on scene after their avatar frame was already there. This happened at 01:16, 01:50, 02:18, 02:45, 03:32, 04:46. I looked at each avatar and saw that only one had a golden tooth. And that one showed up at 02:45. I read and heard the host mention its name as Sir Tyler. Therefore, the answer is Sir Tyler." + }, + { + "key": "WmpPEoBp48A:f5ef14254c7b567e9cac7763dbaca1f5565715a0", + "video_id": "WmpPEoBp48A", + "question": "From the viewer's perspective, what direction are the eyes looking of the avatar of the player, who the host says is \"absolutely no slouch\"?", + "answer_choice_0": "Left.", + "answer_choice_1": "Right.", + "answer_choice_2": "Ahead.", + "answer_choice_3": "Down.", + "answer_choice_4": "Up.", + "answer_id": 0, + "answer": "Left.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened to the video for when the host said the words, \"absolutely no slouch\" from 02:27-02:28. This was part of a longer sentence that started at 02:25: \"Master Hudson is a bit newer to the scene but absolutely no slouch.\" I then looked up and left to locate his avatar, and it is clearly looking to its right. However, the parameters of the questions were based on \"the viewer's perspective.\" Therefore, the answer is Left." + }, + { + "key": "X6xsyT-Dni8:05a27a6c5221fdddfaaf5bd7ee26552c39d5a352", + "video_id": "X6xsyT-Dni8", + "question": "How many portraits appear in the digital card grid on the screen at the beginning of the video?", + "answer_choice_0": "36.", + "answer_choice_1": "30.", + "answer_choice_2": "42.", + "answer_choice_3": "24.", + "answer_choice_4": "20.", + "answer_id": 3, + "answer": "24.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "When I scroll to 00:08, I see a split screen with a female host on the left. On the right is an animated grid of 24 digital cards with character faces on them." + }, + { + "key": "X6xsyT-Dni8:0863d202dc060231c4dc56aa0372432146ce8aa0", + "video_id": "X6xsyT-Dni8", + "question": "When the woman in the cropped white jacket asks the man in the black jacket about whether he would deem his character a \"daddy,\" what color is the background?", + "answer_choice_0": "Yellow.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Pink.", + "answer_choice_3": "Red.", + "answer_choice_4": "Green.", + "answer_id": 2, + "answer": "Pink.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:21, when the woman in the cropped white jacket interacted with the man in the black jacket. As she verbally asked the interview question, \"Would your character be deemed a daddy?\" the question also appeared along the bottom of the screen in text, confirming this was the correct time code. The background of the set that they stood in was clearly pink. The two were featured again at 01:17 and were still talking about the man in the black jacket's character being a daddy, and the background was still pink." + }, + { + "key": "X6xsyT-Dni8:2d628b5045e2a5ac50b3139498f30415f94d9c1b", + "video_id": "X6xsyT-Dni8", + "question": "What is the man with green hair's original response to the question about his earrings?", + "answer_choice_0": "They are heavy.", + "answer_choice_1": "They are expensive.", + "answer_choice_2": "They don't hurt him.", + "answer_choice_3": "They hurt him.", + "answer_choice_4": "They are beautiful.", + "answer_id": 2, + "answer": "They don't hurt him.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Watching the video, I see the interviewer ask the man with green hair if his earrings hurt at 02:03. The man with green hair responds in a jokingly dramatic way that they don't at 02:06 before admitting that they did hurt at 02:07." + }, + { + "key": "X6xsyT-Dni8:4be1d6107310fd0e54a76b1c79d673fabd2fa0bc", + "video_id": "X6xsyT-Dni8", + "question": "When the word \"Daddy\" is spoken for the last time in the video, what color hair does the person have who says it?", + "answer_choice_0": "Blue.", + "answer_choice_1": "Blonde.", + "answer_choice_2": "Brown.", + "answer_choice_3": "Pink.", + "answer_choice_4": "Red.", + "answer_id": 1, + "answer": "Blonde.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and observed each time the word \"Daddy\" is spoken. The word \"Daddy\" is spoken at 00:22, 01:16, 01:18, 01:21, 01:23, 02:33, 02:36, 02:38, 02:39, 02:40, and 04:57. Since 04:57 is the final time the word \"Daddy\" is spoken, I observed the color hair of the person who said it, which is blonde." + }, + { + "key": "X6xsyT-Dni8:689ac2c055606d11ac467073f3853168f1631f04", + "video_id": "X6xsyT-Dni8", + "question": "How many rings does the blonde man wear on the hand of the arm that is slung around the shoulders of the man in the red t-shirt?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 03:19, when the blonde man has his arm around the man with the red t-shirt. It is the blonde man's left arm, so I looked at his left hand and counted 3 rings present on his fingers." + }, + { + "key": "X6xsyT-Dni8:6c741ee7607eac4915d5035f5836918b7d37b710", + "video_id": "X6xsyT-Dni8", + "question": "During the interview in the pink room, what happens to the background behind the woman in the white outfit after she tells the man that his question is psychotic?", + "answer_choice_0": "The background displays a scene of a castle on fire.", + "answer_choice_1": "The background displays a scene of a bird eating a worm.", + "answer_choice_2": "The background displays a scene of 2 cars crashing.", + "answer_choice_3": "The background displays a scene of a burnt out forest.", + "answer_choice_4": "The background displays a scene of a cannonball hitting a ship.", + "answer_id": 4, + "answer": "The background displays a scene of a cannonball hitting a ship.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I identified which segments show the interview between the woman in the white outfit and her co-host in the pink room. I identified these segments to be 00:20 to 00:40, 01:17 to 01:26, 01:43 to 01:45, 02:09 to 02:20, 02:27 to 02:32, and 02:38 to 02:40. During each of these segments, I listened to the woman's responses to her co-host. During the 02:09 to 02:20 segment, she tells the man that his question is psychotic at 02:14. The shot cuts away from her, then when it returns at 02:17, the background behind her shows a scene where a cannonball collides into a ship." + }, + { + "key": "X6xsyT-Dni8:d492e509e1b0f9e786edae98f134e06d1c4e989d", + "video_id": "X6xsyT-Dni8", + "question": "What words appears at the start of the video until 00:02?", + "answer_choice_0": "\"I don't know how to use colon punctuation!\"", + "answer_choice_1": "\"The most supportive friend ever!\"", + "answer_choice_2": "\"Me coming back after almost 3 weeks of not posting like:\"", + "answer_choice_3": "\"Y'all during this time:\"", + "answer_choice_4": "\"These people have so little to say.\"", + "answer_id": 2, + "answer": "\"Me coming back after almost 3 weeks of not posting like:\"", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "When I start the video from 0:00, these words appear: \"Me coming back after almost 3 weeks of not posting like:\" I continued watching until 00:02 to ensure no other words appear onscreen during that specified time." + }, + { + "key": "X6xsyT-Dni8:e221feb997817291fd19a19640219b81ce152c73", + "video_id": "X6xsyT-Dni8", + "question": "When the grid of portraits appear for the third time, how many portraits flip over to reveal a skull?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "0.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "3.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From the beginning of the video, I counted each time the grid of portraits appeared on the screen. The first one appears at 00:06. The second one appears at 00:39. The third one appears at 02:11. During the appearance of the third grid, I counted each time a portrait flipped over to reveal a skull. On the top row, three portraits flip over in succession to reveal skulls." + }, + { + "key": "X6xsyT-Dni8:f660eb98fb74c21b7c932c75ed48b0a961bb2f25", + "video_id": "X6xsyT-Dni8", + "question": "What letter is present on the jacket of the man with the curly hair?", + "answer_choice_0": "M.", + "answer_choice_1": "F.", + "answer_choice_2": "X.", + "answer_choice_3": "A.", + "answer_choice_4": "D.", + "answer_id": 4, + "answer": "D.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:56, when the man with the curly hair first appears wearing a jacket with a letter \"D\" embroidered on it. He is the only person in the video with curly hair. I then watched the rest of the video to make sure he wore no other jacket with letters on it." + }, + { + "key": "XX_9Cr10IHo:09c825a14fe26f452dace3133182d404f94fb4fc", + "video_id": "XX_9Cr10IHo", + "question": "How many rings in total does the woman who interviews the man wear on her hands?", + "answer_choice_0": "3.", + "answer_choice_1": "6.", + "answer_choice_2": "7.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "7.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the woman at 01:18 when she began setting up her question for the man. The frame at 01:20 offers a clear look at each finger of her right hand. The total rings on her right hand are four. When she raises her left hand from 01:28-01:29, there are three rings on that hand. This brings the total number of rings she wears to seven." + }, + { + "key": "XX_9Cr10IHo:6e04238702db5b4bb9c28e1178661bcdac4abd83", + "video_id": "XX_9Cr10IHo", + "question": "At what time is the face of the woman with the white flowery blouse first fully visible?", + "answer_choice_0": "00:30.", + "answer_choice_1": "00:33.", + "answer_choice_2": "00:28.", + "answer_choice_3": "00:35.", + "answer_choice_4": "00:07.", + "answer_id": 1, + "answer": "00:33.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I spotted the woman with the white flowery blouse appear in the scene, which occurs at 00:06. From there, I continued to watch until I could spot her again at 00:28, when she steps out from behind Joel Edgerton. However, only her side profile is visible here, so I continued to watch until 00:33, when she first turns to fully face the camera." + }, + { + "key": "XX_9Cr10IHo:761df75d2d2181dcc99ebae2276deb7eca6cd10d", + "video_id": "XX_9Cr10IHo", + "question": "How many red items are present in the frame from 00:20 to 00:25?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "0.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video within the indicated time codes. From 00:20 to 00:25, I observed that the following items were red: the male interviewer's microphone wire, Joel Edgerton's necklace, and the backdrop. Therefore, 3 red items are present in the frame during the times given." + }, + { + "key": "XX_9Cr10IHo:ce5b5493af7f03b3573847f84248812c4735cb2c", + "video_id": "XX_9Cr10IHo", + "question": "Where is the woman in the white blouse when the graphic with the interviewee's name leaves the screen?", + "answer_choice_0": "Behind the interviewee.", + "answer_choice_1": "In front of the poster at the left of the screen.", + "answer_choice_2": "Next to the security guard on the right.", + "answer_choice_3": "In front of the poster behind the interviewee's left shoulder.", + "answer_choice_4": "In front of the security guard on the right.", + "answer_id": 0, + "answer": "Behind the interviewee.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the woman in the white blouse and first spotted her at 00:09, partially obscured by the interviewee. I waited until the interviewee's graphic displaying his name appeared at 00:14 while tracking the woman, who steps completely behind the interviewee and stays there. I then waited until the graphic left the screen at 00:16. At this time, the woman in the white blouse is still standing behind the interviewee." + }, + { + "key": "XoVW7CRR5JY:141820b809f68675892d39fe9d1009e92bb88f8f", + "video_id": "XoVW7CRR5JY", + "question": "How many virtual photons are exchanged by particles in this video?", + "answer_choice_0": "324.", + "answer_choice_1": "251.", + "answer_choice_2": "353.", + "answer_choice_3": "384.", + "answer_choice_4": "275.", + "answer_id": 3, + "answer": "384.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video looking for particles, which eventually are balls on screen. I count 14 virtual photons exchanged from 01:08 to 01:14. I count 34 more exchanges from 01:41 to 01:52. I count 33 more exchanges from 01:58 to 02:02. At 02:06 I see many particles appear on screen and exchange virtual photons until 02:15, totally 203 virtual photon exchanges. I see a proton appear on screen and exchange 42 virtual photons from 02:39 till 02:46. I see an electron appear on screen and exchange 23 virtual photons from 02:42 till 02:45. At 02:52 I see two photons exchange 11 virtual photons until 02:55. At 02:55 I see an electron and a photon exchange 24 virtual photons until 03:01. Those were the last virtual photons I saw, so the total virtual photon count was 384." + }, + { + "key": "XoVW7CRR5JY:1aa77b7c56338fbcf39b1bac16a928561d40ac4a", + "video_id": "XoVW7CRR5JY", + "question": "What direction is the proton traveling the third time there is a uniform field displayed?", + "answer_choice_0": "Left", + "answer_choice_1": "Diagonally up and to the right", + "answer_choice_2": "Right", + "answer_choice_3": "Up", + "answer_choice_4": "Down", + "answer_id": 2, + "answer": "Right", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I watched the video, counting the times a uniform field was displayed. The first uniform field occurs at 04:35, and it is a uniform electric field. The second uniform field is at 08:32 and it is a uniform magnetic field. There is an almost uniform field at 09:55, but it is not truly uniform, so I didn't count it. At 10:01 a third uniform field, this one magnetic, appears. A red particle labeled with a \"p\" is traveling to the right, so the proton is traveling to the right." + }, + { + "key": "XoVW7CRR5JY:2e265f708a96d495b99c67c03cce487cc83d12df", + "video_id": "XoVW7CRR5JY", + "question": "In what direction is the blue arrow extended from the electron pointing 45 seconds before the image depicting a uniform electric field appears?", + "answer_choice_0": "up and left", + "answer_choice_1": "right", + "answer_choice_2": "up and right", + "answer_choice_3": "down and left", + "answer_choice_4": "down and right", + "answer_id": 3, + "answer": "down and left", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I watch the video, waiting for the uniform electric field to be shown at 04:37. I know that 45 seconds before 04:37 will be 03:52 so I go back to that point in the video. I see three spheres on a field with lines, one red, and two blue. One of the blue spheres is labeled with an 'e', which is an electron, and has a blue arrow extended to the left and down, toward the other blue sphere. So the arrow is pointing down to the left." + }, + { + "key": "XoVW7CRR5JY:51c00526af77a27593dcc2f43763c504056f9ccc", + "video_id": "XoVW7CRR5JY", + "question": "What sort of things does a filled red circle represent throughout the video, other than the ScienceClic logo shown at the beginning?", + "answer_choice_0": "A magnet, an electron, a proton, and an electric charge.", + "answer_choice_1": "A ball, an electron, an apple, and an electric charge.", + "answer_choice_2": "A particle, a proton, and an electric charge.", + "answer_choice_3": "A ball, a proton, a particle, and an electric charge.", + "answer_choice_4": "An apple, a proton, a particle, and an electric charge.", + "answer_id": 3, + "answer": "A ball, a proton, a particle, and an electric charge.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I watched the video, looking for red circles given in different contexts. I noticed a red circle at 00:16. It shows up in a man's hand and is identified in the context of playing ball. So I knew a red circle was used to represent a ball. From 02:05 to 02:08 a few red circles appear in the context of particles exchanging photons, so I knew they appeared as particles. At 02:39, I noticed a red circle with a \"P\" in it, which appeared in the context of protons having a specific charge. I knew then that red circles were used to represent protons. At 3:00, another blank red circle appears while the narrator talks about the attractions or repulsions of charges. I knew that the red circle also represented an electric charge. I watched the rest of the video, but only these 4 representations were used. Discounting the ScienceClic logo that appears at 00:00 and 00:05, I realized that a filled red circle is used throughout the video to represent a ball, a proton, a particle, and an electric charge." + }, + { + "key": "XoVW7CRR5JY:692f6a66eaa2427e18d5264db3cf2e5d10c14ef3", + "video_id": "XoVW7CRR5JY", + "question": "Two people in space exchange momentum with each other while swinging their arms in this video, how many times do they exchange momentum?", + "answer_choice_0": "6.", + "answer_choice_1": "8.", + "answer_choice_2": "12.", + "answer_choice_3": "4.", + "answer_choice_4": "10.", + "answer_id": 4, + "answer": "10.", + "question_type": "Cause and Effect", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for people in space. Fairly quickly, I notice two people appear over a black background while the narrator clarifies these people are in space and playing catch, at 00:14. At 00:19-00:35 I see the first person's arm move and exchange a ball, and therefore momentum, with the second person. At 00:37-00:40 I see the video rewinds and plays this same exchange again, meaning momentum has only been exchanged once. At 00:45 I see the second person swings their arm and passes the ball again for a second momentum exchange, starting a flurry of such exchanges. At 00:52 I see the last of such exchanges, accompanied by a hand movement, had occurred. I notice this final exchange is the tenth. From here the ball continues to move, but the arm does not, implying that no momentum is being exchanged, but the ball's motion is now a metaphor for force exchange by virtual phonons as narrated." + }, + { + "key": "XoVW7CRR5JY:8e6932ccf20325babf8b712a740d9dc65415f320", + "video_id": "XoVW7CRR5JY", + "question": "In the first 3 minutes of the video, how many times does a photon appear?", + "answer_choice_0": "38.", + "answer_choice_1": "42.", + "answer_choice_2": "54.", + "answer_choice_3": "21.", + "answer_choice_4": "59.", + "answer_id": 0, + "answer": "38.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "From 00:00 to 03:07, I listened to the narrator discuss the electric charge. At 01:07, I listened to the narrator introduce photons into the discussion by saying, \"electrons which constantly exchange virtual photons.\" At the same time, I saw the photon depicted as a yellow circle and at 01:13, I saw the same yellow circle zoomed in with a gamma symbol at the center. I then saw 4 additional photons appear around the first photon at 01:17. I then saw 1 photon appear at 01:25 and then 3 additional photons appeared at 01:28. At 1:33, I saw 6 photons appear. I saw 1 photon appear at 01:41 and 01:58. At 2:07, I saw 13 photons appear. At 2:40, I saw 3 photons appear, and then I saw 3 additional photons appear at 2:42. I saw 1 photon appear at 2:53. At 2:59, I saw the last photon appear in the first 3 minutes of the video. I added all the times I saw a photon in the first 3 minutes and found the total to be 38." + }, + { + "key": "XoVW7CRR5JY:8edbf1cdab4c4f5660862d532b0419c49b836afe", + "video_id": "XoVW7CRR5JY", + "question": "During the video various particles exchange virtual particles with their neighbors, how many partners does the particle with the most partners have?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for virtual particles. At 01:10 the first virtual particle is shown, a virtual photon mediating the electrical field between two particles. From 01:44-02:3 another pair of electrons exchange a virtual photon. From 02:06 to 02:14 a network of particles exchanges virtual photons with each other, but no single particle in the network emits and receives more than 4 virtual photons. At 02:43 an electron and proton both exchange 3 virtual photons with unseen neighbors. At 02:54 a pair of electrons exchange a virtual particle, then at 02:58 an electron and proton exchange a virtual particle. This is the last appearance of virtual particles in the video, so the maximum was four." + }, + { + "key": "XoVW7CRR5JY:aff70e2a277d76f6d48f5e66d96b963304ec5c1b", + "video_id": "XoVW7CRR5JY", + "question": "What is the maximum number of virtual photons exchanged by protons at any one time?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "5.", + "answer_choice_3": "4.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "3.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I discovered that virtual photons are represented as yellow circles at 01:09, and I learned that protons are represented as red circles at 02:39. At 02:40, a proton is shown exchanging 3 virtual photons at 1 time. At 02:53, 2 protons are shown exchanging virtual photons, but they only exchange 1 at a time. The rest of the video proceeds without showing protons exchanging any more virtual photons than 3 at one time. Therefore, the answer is 3." + }, + { + "key": "XoVW7CRR5JY:b773329cee2cbcb5678b4b43482908196a79c3e7", + "video_id": "XoVW7CRR5JY", + "question": "How much faster in rotations per second does the electron loop compared to the proton when the narrator gives his example at 10:00?", + "answer_choice_0": "0.28 rotations per second.", + "answer_choice_1": "0.3 rotations per second.", + "answer_choice_2": "0.14 rotations per second.", + "answer_choice_3": "0.42 rotations per second.", + "answer_choice_4": "1 rotation per second.", + "answer_id": 0, + "answer": "0.28 rotations per second.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "I went to 10:00 to look at the looping electrons and protons. They started looping at 10:04, and I noticed that, though they moved at different speeds, neither one sped up or slowed down as they looped. I noticed that the electron made 5 rotations from 10:04 to 10:16. This made for 5 rotations in 12 seconds, or about 0.42 rotations in one second. The proton, by contrast, made about 1 rotation in 7 seconds from 10:04 to 10:11, leading to a speed of about 0.14 rotations per second. I find the difference between these numbers and get that the electron loop moves 0.28 rotations per second faster than the proton." + }, + { + "key": "YjZJtZ_6SBY:367b7fa836e2283472c3923a357706024b9ca1df", + "video_id": "YjZJtZ_6SBY", + "question": "How long is the longest shot in the first 15 seconds of the video?", + "answer_choice_0": "4 seconds.", + "answer_choice_1": "2 seconds.", + "answer_choice_2": "1 second.", + "answer_choice_3": "3 seconds.", + "answer_choice_4": "5 seconds.", + "answer_id": 4, + "answer": "5 seconds.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the first 15 seconds of the video. At 00:00 - 00:02, I saw the first shot, which spanned a total of 2 seconds. Next, I saw the second shot at 00:02 - 00:07, which spanned a total of 5 seconds. Then, at 00:07 - 00:09, I saw the third shot, which spanned a total of 2 seconds. Then, I saw the fourth shot at 00:09 - 00:10, which spanned a total of 1 second. Then, at 00:10 - 00:12, I saw the fifth shot, which spanned a total of 2 seconds. Then, I saw the sixth shot at 00:12 - 00:14, which spanned a total of 2 seconds. Lastly, at 00:14 - 00:15, I saw the seventh and final shot in the first 15 seconds of the video, which spanned a total of 1 second. Since the second shot has the highest number of total seconds in runtime, it is therefore the longest shot in the first 15 seconds of the video, with a total duration of 5 seconds at 00:02 - 00:07." + }, + { + "key": "YjZJtZ_6SBY:39c28d14af23f97150d2af460684a23592fb4b83", + "video_id": "YjZJtZ_6SBY", + "question": "How many water bottles are visible behind Johnny Depp in the final courtroom clip of him included in the video?", + "answer_choice_0": "0.", + "answer_choice_1": "4.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I found the last courtroom clip of Johnny Depp included in the video at 03:40. From there, I counted 2 water bottles that are clearly visible behind him." + }, + { + "key": "YjZJtZ_6SBY:6cc706b4d94b43cd4bf7d088e71164ec4aa56bf3", + "video_id": "YjZJtZ_6SBY", + "question": "How many tweets about Amber Herd are show throughout the video?", + "answer_choice_0": "8.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and counted how many tweets are shown throughout the video and I counted 4 at time codes 0:02, 1:28, 1:33, 1:59." + }, + { + "key": "YjZJtZ_6SBY:7966edeb2d85e3761d2c1ceb1bac81663e29eed6", + "video_id": "YjZJtZ_6SBY", + "question": "What is the date on the screen when the man with glasses answers questions about Amber Herd releasing an op-ed after Aquaman was released?", + "answer_choice_0": "Nov 4, 2021.", + "answer_choice_1": "Dec 21, 2021.", + "answer_choice_2": "Jan 1, 2022.", + "answer_choice_3": "Dec 2, 2021.", + "answer_choice_4": "Dec 12, 2021.", + "answer_id": 3, + "answer": "Dec 2, 2021.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and saw the part where a man with glasses is asked questions about Amber Herd releasing an op-ed after Aquman. The date at the bottom left of the frame when the man with glasses is on the screen is Dec 2, 2021." + }, + { + "key": "YkiGSYoo2BY:55cd34ede0171671dfa11d343dff8e22f7fa9685", + "video_id": "YkiGSYoo2BY", + "question": "How are the two men dressed as they drive to their destination at 00:43-01:11?", + "answer_choice_0": "They are wearing dresses.", + "answer_choice_1": "They are wearing professional suits.", + "answer_choice_2": "They are wearing shorts and T-shirts.", + "answer_choice_3": "They are wearing swim suits.", + "answer_choice_4": "They are wearing festive Hawaiian shirts.", + "answer_id": 1, + "answer": "They are wearing professional suits.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video's time frame of 00:43-01:11 in order to understand what kind of clothing they are wearing as they drive to their destination. At 00:43, the passenger can be seen in a close up shot, and I can see him wearing a collared shirt and a sport jacket layered on top of it. When the camera cuts to a shot of the driver at 00:50, I can see that he is also wearing a long-sleeved collared shirt with a sport jacket layered on top of it. Later on, when the two men leave the car at 01:32, their attire can be seen in more detail from behind as they walk with their luggage. They are clearly wearing professional suits." + }, + { + "key": "YkiGSYoo2BY:59c31e8bcbcb82cea44bca83484577daf12f0d2d", + "video_id": "YkiGSYoo2BY", + "question": "Of the 4 geese that appear, how many are brown?", + "answer_choice_0": "0.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I noticed once the men arrived at the farm and introduced themselves to one another, a montage of farm animals is shown at 01:43. Many animals are displayed. Particularly at 01:53 4 geese appear on the shot. Of the 4 geese only 1 of them is brown." + }, + { + "key": "YkiGSYoo2BY:5d356598ad26cc86addf10126b5c627d3bc2e54a", + "video_id": "YkiGSYoo2BY", + "question": "Why does the owner of the farm tell the visiting man to drink the infusion?", + "answer_choice_0": "It'll give him magic powers.", + "answer_choice_1": "It'll relax him.", + "answer_choice_2": "It'll be good for his digestion.", + "answer_choice_3": "It'll remind him of what's important.", + "answer_choice_4": "It'll open his third eye.", + "answer_id": 4, + "answer": "It'll open his third eye.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the time when the owner of the farm tells the visiting man to drink the infusion. From an earlier point in the video, at 01:32, the man with medium-length black hair is identified as the owner of the farm as he walks onto the frame. At 01:39, the man with short black hair is identified as the new visitor, as he is introduced to the owner of the farm. I found the moment when the owner of the farm hands the visiting man a cup of liquid at 06:58, and also at this time, he calls it an infusion. Immediately afterward, at 07:00, he says it'll open the man's third eye." + }, + { + "key": "YkiGSYoo2BY:8b6c71ee6d8388c972c0ee11d410204e059a3249", + "video_id": "YkiGSYoo2BY", + "question": "During the fire scene which takes place from 03:30-04:37, how does the owner of the farm think his new visitor feels about the farm?", + "answer_choice_0": "Skeptical.", + "answer_choice_1": "Aloof.", + "answer_choice_2": "Excited.", + "answer_choice_3": "Confused.", + "answer_choice_4": "Displeased.", + "answer_id": 0, + "answer": "Skeptical.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the time frame of 03:30-04:37 in order to watch the fire scene. Three men are sitting in front of the fire and having a deep conversation. From an earlier point in the video, at 01:32, the man with medium-length black hair is identified as the owner of the farm as he walks onto the frame. At 01:39, the man with short black hair is identified as the new visitor, as he is introduced to the owner of the farm. At 03:50, in front of the fire, the new visitor laughs and shakes his head as he listens to the owner of the farm. At 03:53, the owner of the farm asks the new visitor if he thinks something is funny. In reply, the new visitor shakes his head again and sarcastically says that what the owner of the farm is saying is wise. From 03:59-04:02, the owner of the farm responds to the new visitor, saying that he seems a bit skeptical. So, the answer is skeptical." + }, + { + "key": "YyIUsFAUFVU:04197ec3303225fc97120ec109ae7be369db3231", + "video_id": "YyIUsFAUFVU", + "question": "In the clip at 02:06, where can the microphone stand be observed in relation to the performers?", + "answer_choice_0": "In front of the seated performers, and to the left of the standing performer.", + "answer_choice_1": "To the right of the seated performers and the standing performer.", + "answer_choice_2": "To the right of the seated performers, and to the left of the standing performer.", + "answer_choice_3": "To the left of the seated performers, and behind the standing performer.", + "answer_choice_4": "Behind the seated performers, and to the left of the standing performer.", + "answer_id": 1, + "answer": "To the right of the seated performers and the standing performer.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 02:06, I observed the layout of the performers: three are sitting in chairs in the middle of the frame, and a standing performer stands to their right. I then identified the microphone stand and determined its location, which is to the right of both the seating and standing performers." + }, + { + "key": "YyIUsFAUFVU:2942b857b2a83717b3b001d1969b94efa1634d9a", + "video_id": "YyIUsFAUFVU", + "question": "What symbol can be seen to the immediate left of the second-row, right-side text on the screen displayed at 01:00?", + "answer_choice_0": "A hashtag.", + "answer_choice_1": "An asterisk.", + "answer_choice_2": "A dollar sign.", + "answer_choice_3": "A dash mark.", + "answer_choice_4": "An at sign.", + "answer_id": 0, + "answer": "A hashtag.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "To determine this, I went to the timestamp of 01:00 in the video and observed the screen shown onstage. I determined the line of text that was located in the second row and on the right side of the screen, and read it: it read \"#ChangingBritain\". The symbol to the immediate left of the text in this phrase is a hashtag." + }, + { + "key": "YyIUsFAUFVU:7411e371fbd19e63a0b1650024b6a210c3f6b29d", + "video_id": "YyIUsFAUFVU", + "question": "How many comedians are featured in the show?", + "answer_choice_0": "8.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "6.", + "answer_choice_4": "7.", + "answer_id": 4, + "answer": "7.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and located the segment between 00:46 and 00:54, where the woman in the peach blazer introduced and mentioned the performers she was with for the night. While watching, I counted the names she mentioned. Therefore, I was able to determine the number of performers presenting in the video, which was 7. To confirm her words, I watched each time a comedian showed up to see if any appeared on stage that weren't mentioned. At 00:25, 4 different comedians appear. At 00:32 a new comedian appears. At 01:48 another new comedian appears. Finally, at 02:11, a new comedian appears. All the rest that appear are previous comedians. Therefore, there are 7 comedians featured in the show." + }, + { + "key": "YyIUsFAUFVU:7f12d252388cdf28e98c2ca3a8744cd758844ff5", + "video_id": "YyIUsFAUFVU", + "question": "What image appears on top of the British Flag when the speaker talks about being Black?", + "answer_choice_0": "Clasped hands.", + "answer_choice_1": "Open lips.", + "answer_choice_2": "Open palms.", + "answer_choice_3": "Wide eyes.", + "answer_choice_4": "Crossed legs.", + "answer_id": 3, + "answer": "Wide eyes.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a British Flag that appears while someone talks about what it is like to be Black. I found this moment between 00:55-01:01 and listened as a Black man talks about what it's like to be Black. I looked for an image of a British flag and found it appears at 00:58. I then observed that an image of a person's wide eyes is on top of the image of a British flag. I concluded that a pair of wide eyes is on top of the image of a British flag when the speaker talks about being Black." + }, + { + "key": "YyIUsFAUFVU:8d1c83191f27cd6f1bae6978e3fc6c5460c7473e", + "video_id": "YyIUsFAUFVU", + "question": "The first time the image of a stage appears, how many people are shown to be sitting in the center of it on chairs?", + "answer_choice_0": "0.", + "answer_choice_1": "10.", + "answer_choice_2": "11.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "3.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the first image of a stage. I found this at 00:24, when a low-lit stage with a static video appears. I noticed that In the center of the stage, there are 3 individuals sitting in chairs, and concluded that the answer is 3." + }, + { + "key": "YyIUsFAUFVU:aa76e3d0a7f93c00e50c13119d0a8f589c799f6e", + "video_id": "YyIUsFAUFVU", + "question": "In the five-star review which appears as superimposed text on the screen at 00:10, what word is used to describe the show?", + "answer_choice_0": "Empowering.", + "answer_choice_1": "Historic.", + "answer_choice_2": "Beautiful.", + "answer_choice_3": "Amazing.", + "answer_choice_4": "Incredible.", + "answer_id": 0, + "answer": "Empowering.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video at the 00:10 time stamp in order to see which word appears on the screen. The graphic image of five stars appears at this time, indicating that this text refers to a five-star review. Below it, the word \"empowering\" appears in bold, capitalized text. Below this, smaller text which reads as \"Asian Culture Vulture\" appears, further cementing this as text from a five-star review as this is the name of a online arts and culture magazine. Thus, the answer is \"empowering\"." + }, + { + "key": "YyIUsFAUFVU:cde0836529ebbb761be38f4ff74511a42bff6ea3", + "video_id": "YyIUsFAUFVU", + "question": "Who or what lauds \"Immigrant Diaries\" as \"A SURE FIRE HIT\", according to the video?", + "answer_choice_0": "Asian Culture Vulture.", + "answer_choice_1": "Brighton Fringe Argus.", + "answer_choice_2": "Londontheatre1.", + "answer_choice_3": "Sajeela Kershi.", + "answer_choice_4": "Remote Goat.", + "answer_id": 4, + "answer": "Remote Goat.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video at the point where the words \"A SURE FIRE HIT\" are displayed onscreen - this occurred at 00:18. I observed that these words were a part of the quote, and read the quote to determine its source, which is listed just beneath the quote as 'Remote Goat'." + }, + { + "key": "ZAqIoDhornk:0c6781735301c6128da91f98eb4e59a871bb981e", + "video_id": "ZAqIoDhornk", + "question": "What would be the result if the mass lost during fission of 1.5 kg of U-235 given in the video is used in the formula given at 00:31 along with the value \"a = 500 m/s^2\"?", + "answer_choice_0": "0.0034 N", + "answer_choice_1": "0.085 N", + "answer_choice_2": "0.85 N.", + "answer_choice_3": "0.0085 N.", + "answer_choice_4": "0.34 N.", + "answer_id": 2, + "answer": "0.85 N.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "First, I looked for the mass lost during fission of 1.5 kg of U-235 given in the video. I found this information at 11:37 to be 1.7 g. It is shown on screen, but not said verbally. I looked for the formula at 00:31, and found it to be the formula for force F = ma. I then converted 1.7 g to kg, so that the answer is in Newtons. I found this to be 1.7/1000 = 0.0017 kg. I then used this along with a = 500 m/s^2 in the formula for force. I obtained F = (0.0017 kg)(500 m/s^2) = 0.85 N" + }, + { + "key": "ZAqIoDhornk:4a567dba3706174e4472f0ac98ebedd00b3aeaac", + "video_id": "ZAqIoDhornk", + "question": "The half-life of two carbon isotopes is given in the video, what is the ratio of the larger one over the smaller one?", + "answer_choice_0": "4.38X10^18.", + "answer_choice_1": "3.27X10^18.", + "answer_choice_2": "5.87X10^18.", + "answer_choice_3": "5.22X10^17.", + "answer_choice_4": "6.02X10^18.", + "answer_id": 4, + "answer": "6.02X10^18.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "I watched the video and paid attention for a reference to carbon isotopes. At around 09:28 I read that the half-lives of Carbon-21 and Carbon-14 are given to be 0.00000003 seconds and 5730 years, respectively. I computed their ratio to be approximately 6.02X10^18." + }, + { + "key": "ZAqIoDhornk:51ad8d40767b08d866cba4915e14ee551871b361", + "video_id": "ZAqIoDhornk", + "question": "What is the proton density of the element used to demonstrate energy mass equivalency in the video, in protons per cubic meter?", + "answer_choice_0": "6e40.", + "answer_choice_1": "6e43.", + "answer_choice_2": "9e43.", + "answer_choice_3": "8e45.", + "answer_choice_4": "8e42.", + "answer_id": 1, + "answer": "6e43.", + "question_type": "Reading", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video looking for a statement comparing energy to mass, which I found at 11:27. At 11:33 I saw the video display an atom, Uranium. I heard the narrator explain its diameter and atomic number. I saw that the atom has 922 protons. I used this information to calculate the proton density of uranium. I know that proton density should be a number of protons divided by the volume of the atom. The video gives us the diameter of the atom, 0.000000000000014 m, but in order to calculate volume I need the radius. I know the radius is half the diameter, 0.000000000000014/2. The volume of a sphere is (4/3)(pi)(r^3). I calculated the total volume as (4/3)(pi)(0.000000000000014/2)^2. I also noted that the video gave us the number of the atom has 92 protons. So I answered with the ratio of number of protons divided by the volume to find the density, which was 6e43 protons per cubic meter." + }, + { + "key": "ZAqIoDhornk:867c8f05e79cef10d16e2fdd984c8bea0b60e956", + "video_id": "ZAqIoDhornk", + "question": "Using the magnitude of the gravitational force of the moon given in the video and a value of d=5, what would the answer be to the equation given at 03:16?", + "answer_choice_0": "8.25.", + "answer_choice_1": "8.0.", + "answer_choice_2": "8.1.", + "answer_choice_3": "8.5.", + "answer_choice_4": "7.9", + "answer_id": 2, + "answer": "8.1.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "I heard the narrator say that weight relates to the force of gravity at 02:20. Then, I observed an example of the same mass on the earth versus the moon at 02:26. I read that the weight was mass times the force of gravity. I read that the force of gravity in the example for the moon was 1.62 m/s^2 at 02:26. I moved to 03:16 to find the equation. I heard the equation was \"W = Fd\" and heard that the variables were \"Work\" \"Force\" and \"Distance\". Therefore, I used the gravitational force of the moon for F and the value of 15 given from the question for D. I calculated (1.62 m/s^2)(5 m) = 8.1 J." + }, + { + "key": "ZAqIoDhornk:8bd4a2ffa746682303a27fe98c4f6fef9275ac23", + "video_id": "ZAqIoDhornk", + "question": "When the second system is used as an example of gravitation, what image is used as a metaphor for the force of gravity?", + "answer_choice_0": "A bungee cord.", + "answer_choice_1": "An apple.", + "answer_choice_2": "Interlocking arms.", + "answer_choice_3": "Lines symbolizing the movement of air.", + "answer_choice_4": "A vector symbol.", + "answer_id": 2, + "answer": "Interlocking arms.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video looking for examples of gravitation. I saw the first example appear at 00:54 when the narrator talks about applied forces to a basketball determining its path of motion. After this, I identified the story of an apple hitting Newton from 01:01-01:11. However, this was not explained in terms of physics, but merely as an anecdote about what led Newton to realize gravitation. I noted at 01:11 that the narrator explained the concept of gravitation in physical terms of two masses attracting each other. At this time, I saw an illustration of the earth and the moon with images of hands coming out from each of them holding each other in the middle. Therefore, I determined that the second physical system used to explain gravitation was the moon and earth and the image used as a metaphor for the force of gravity is the interlocking arms." + }, + { + "key": "ZAqIoDhornk:d7892e60a98600d17fc4dcf7e3c8d157c7f2448f", + "video_id": "ZAqIoDhornk", + "question": "After the second nonclassical theory is mentioned in this video, an equation immediately follows, connecting to which classical theory by way of its constants?", + "answer_choice_0": "Statistical Mechanics.", + "answer_choice_1": "Quantum Mechanics.", + "answer_choice_2": "Electromagnetism.", + "answer_choice_3": "Thermodynamics.", + "answer_choice_4": "Theory of Relativity.", + "answer_id": 2, + "answer": "Electromagnetism.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video and noting if the theories discussed were classical or non-classical. The first theory I saw explicitly named that was non-classical was Quantum Mechanics, which is shown onscreen at 10:11. At 10:17 I noticed the video explicitly name the theory of relativity, which makes it the second non-classical theory mentioned. Shortly after at 10:21 I saw an equation for the speed of light, which calculates the speed of light in terms of the electric and magnetic permittivities of free space. From this, I deduced this makes the correct answer electromagnetism." + }, + { + "key": "ZAqIoDhornk:e50388b04487cda7bf70156fede53c95f26b65a1", + "video_id": "ZAqIoDhornk", + "question": "What is the total half-life of Technetium-95, Carbon-21, and Carbon-14?", + "answer_choice_0": "5730 years and 60.99999997 seconds.", + "answer_choice_1": "5791 years and 61.00000003 seconds.", + "answer_choice_2": "5791 years and 60.99999997 seconds.", + "answer_choice_3": "5730 years and 61.00000003 seconds.", + "answer_choice_4": "5669 years and 61.00000003 seconds.", + "answer_id": 3, + "answer": "5730 years and 61.00000003 seconds.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I listened for a moment when the narrator begins discussing the half-life of isotopes and found this begins at 09:19 when the narrator mentions \"half-life.\" Next, I looked for the half-life of Technetium-95m and found it written onscreen as \"61s\" at 09:24. At 09:25, the word Carbon-21 appears and its half life is written as \"0.00000003s.\" Finally, I saw the word Carbon-14 appear at 09:26 and observed its half-life as \"5730 years.\" Then, I added 61s+0.00000003s to get 61.00000003s as the total half-life of Technetium-95m and Carbon-21. I then added those total seconds to the half-life of Carbon-14 and came up with a total of 5,730 years and 61.00000003 seconds. I concluded that the total half-life of Technetium-95, Carbon-21, and Carbon-14 is 5730 years and 61.00000003 seconds." + }, + { + "key": "ZAqIoDhornk:f7c10cd2268d408ec3620ff1f7cc0bf96671a61c", + "video_id": "ZAqIoDhornk", + "question": "The narrator describes these as the smallest things in the universe--what is the difference between the two heaviest of them in GeV/c^2?", + "answer_choice_0": "47.", + "answer_choice_1": "11.", + "answer_choice_2": "45.", + "answer_choice_3": "34", + "answer_choice_4": "81.", + "answer_id": 0, + "answer": "47.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "I noticed at 08:52 the standard model is onscreen, which the narrator describes as the smallest things at 08:54. I know the heaviest element of the standard model is the top quark, with a mass of 172 GeV/c^2. I know the second-heaviest thing is the Higgs boson, with 125 GeV/c^2. I then calculated the difference as 47 GeV/c^2." + }, + { + "key": "ZF4T833lln4:014cc01adc83219efbfd00cbfaaf175ac38cb187", + "video_id": "ZF4T833lln4", + "question": "How many letter \"s\"'s are in the largest username handle ever on-screen?", + "answer_choice_0": "3.", + "answer_choice_1": "6.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "3.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:01, I saw a large username handle in the top left corner of the screen, reading \"@absolutechess\". Throughout the entire video, there was never another username handle that was larger than \"@absolutechess\" on-screen. Since \"@absolutechess\" is the largest username handle ever on-screen, I then counted the number of letter \"s\"'s in \"@absolutechess\", calculating a total of 3. Therefore, there are 3 letter \"s\"'s in the largest username handle ever on-screen." + }, + { + "key": "ZF4T833lln4:0acb471fef89de5ed7e081afd081a5b2de0c7e33", + "video_id": "ZF4T833lln4", + "question": "What is the biggest number of green arrows that appear on-screen at any one time?", + "answer_choice_0": "10.", + "answer_choice_1": "4.", + "answer_choice_2": "8.", + "answer_choice_3": "2.", + "answer_choice_4": "6.", + "answer_id": 0, + "answer": "10.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While looking for and counting green arrows on-screen, I found 2 at 03:20 and 10 at 04:27. There are no more green arrows on-screen after 04:27. Therefore, the biggest number of green arrows that appear on-screen at any one time is 10." + }, + { + "key": "ZF4T833lln4:1dfafc96cbac920e117980de0bd47bc81c5e51a4", + "video_id": "ZF4T833lln4", + "question": "How many total pieces have both players lost when the match concludes?", + "answer_choice_0": "3.", + "answer_choice_1": "8.", + "answer_choice_2": "16.", + "answer_choice_3": "17.", + "answer_choice_4": "32.", + "answer_id": 3, + "answer": "17.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I noticed a resignation message at 05:18, signaling the conclusion of the match. I then knew that the final state would be just before this message. At 05:17, I counted 8 white pieces and 7 black pieces on the board. Since each player started with 16 pieces at 00:01, I then calculated 16-8=8 and 16-7=9. Next, I concluded white lost 8 pieces and black lost 9 pieces. Then, I calculated 8+9=17. Therefore, when the match concludes, both players have lost a total of 17 pieces." + }, + { + "key": "ZF4T833lln4:38b5cdd64cf08c199cc05e70faca16fc6ac53bec", + "video_id": "ZF4T833lln4", + "question": "When the game finished, how much time did the winning player have left?", + "answer_choice_0": "00:30.", + "answer_choice_1": "00:20.", + "answer_choice_2": "00:42.", + "answer_choice_3": "01:00.", + "answer_choice_4": "00:55.", + "answer_id": 4, + "answer": "00:55.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 05:19, I saw a box pop up that informed the speaking player that he was the winner and that the game was therefore finished. In the box, I saw his username \"MagzyBogues\". I then looked at the end times listed under the usernames. Then, I located MagzyBogues's end time, which was 00:55. Therefore, when the game finished, the winning player had 00:55 remaining." + }, + { + "key": "ZF4T833lln4:5b5c5d7917fe4430c4e250f3ccee7ccbbc611d98", + "video_id": "ZF4T833lln4", + "question": "What is behind the speaker in the room?", + "answer_choice_0": "Mirror.", + "answer_choice_1": "TV.", + "answer_choice_2": "Couch.", + "answer_choice_3": "Dresser.", + "answer_choice_4": "Bed.", + "answer_id": 2, + "answer": "Couch.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:00, I first identified who the speaker was when I noticed a superimposed video of a man sitting in a chair in a room appearing in the bottom left corner of the screen, which remained for the entire video, until 05:44. I then examined the room the speaker was sitting in and saw the object positioned behind him: a couch. Therefore, a couch is behind the speaker in the room." + }, + { + "key": "ZF4T833lln4:634fa9b6ef53753e19df69fd25e410a39db20f57", + "video_id": "ZF4T833lln4", + "question": "What's the difference in time between the losing player's start time and end time?", + "answer_choice_0": "01:00.", + "answer_choice_1": "01:50.", + "answer_choice_2": "02:18.", + "answer_choice_3": "02:45.", + "answer_choice_4": "01:42.", + "answer_id": 2, + "answer": "02:18.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 05:19, I saw a box pop up that informed the speaking player that he was the winner and that the other player therefore lost. In the box, I saw both players' usernames. Since \"MagzyBogues\" was the username for the winning player, I looked at the other player's name, which read \"Zhansaya\", identifying them as the losing player. I then looked at Zhansaya's end time, which was 00:42. Before that, at 00:00, I saw the players start their game, where I noticed Zhansaya's start time was 03:00. I then calculated the difference between 03:00 and 00:42, resulting in 02:18. Therefore, the difference in time between the losing player's start time and end time is 02:18." + }, + { + "key": "ZF4T833lln4:735bc6673545587d17ce3ed7eefc18d71c5a525b", + "video_id": "ZF4T833lln4", + "question": "At what time in the video did the losing player resign?", + "answer_choice_0": "05:19.", + "answer_choice_1": "02:00.", + "answer_choice_2": "04:50.", + "answer_choice_3": "05:44.", + "answer_choice_4": "04:20.", + "answer_id": 0, + "answer": "05:19.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 05:19, I noticed a box popped up on-screen, with text inside. I read the text, which informed the speaking player that he won and the other player resigned. Therefore, the losing player resigned at 05:19." + }, + { + "key": "ZF4T833lln4:a21e3ee09c09c6907315879eaeb31cbecc816f20", + "video_id": "ZF4T833lln4", + "question": "When are 2 white knights within 1 square of each other?", + "answer_choice_0": "04:25 - 04:30.", + "answer_choice_1": "02:03 - 03:57.", + "answer_choice_2": "03:40 - 03:59.", + "answer_choice_3": "01:55 - 02:49.", + "answer_choice_4": "00:30 - 01:22.", + "answer_id": 3, + "answer": "01:55 - 02:49.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 01:55, I noticed 2 white knights within 1 square of each other for the first time, with 1 at f3 and another at e1, thus being 1 diagonal square away from each other. At 01:57, I saw the white knight at e1 move to g3, but it was still 1 square away from the knight at f3. At 02:49, when the white knight at f3 moves to capture a black pawn at d4, the 2 white knights are now no longer within 1 square from each other. Since there is no other time that 2 white knights are within 1 square of each other, the only time when 2 white knights are within 1 square from each other is at 01:55 - 02:49." + }, + { + "key": "ZF4T833lln4:ab34298ed61bd3f3e5be572fcfb3c22d89f012ec", + "video_id": "ZF4T833lln4", + "question": "Which buttons show up on-screen below the speaker's timer?", + "answer_choice_0": "A record button and a star button.", + "answer_choice_1": "A fast-forward button and a rewind button", + "answer_choice_2": "A crown button and a \"C\" button.", + "answer_choice_3": "A pause button and a play button.", + "answer_choice_4": "An \"X\" button and a flag button.", + "answer_id": 4, + "answer": "An \"X\" button and a flag button.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 00:01, I noticed there were 2 timers on the right side of the screen. One of them is next to a player with the username \"Zhansaya\" and the other is next to another player with the username \"MagzyBogues\". Since the speaker, who shows up in a superimposed video in the bottom left corner of the screen, says \"Now we have Zhansaya\" at 00:05 - 00:07, Zhansaya must be the speaker's opponent and the speaker is therefore MagzyBogues. I then looked below the timer for MagzyBogues, where I saw an \"X\" button and a flag button. Therefore, the buttons that show up on-screen below the speaker's timer are an \"X\" button and a flag button." + }, + { + "key": "ZhnXo3XUnzI:2498214b0cc4d0af3fc0232478169d703757d582", + "video_id": "ZhnXo3XUnzI", + "question": "When the female judge begins to critique the kid in the black suit, what color is the podium she is seated behind?", + "answer_choice_0": "Black.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Red.", + "answer_choice_3": "Yellow.", + "answer_choice_4": "Purple.", + "answer_id": 3, + "answer": "Yellow.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until the female judge began to critique the kid in the black suit, which started at 03:53. I observed that the podium she is seated behind is yellow." + }, + { + "key": "ZhnXo3XUnzI:2d31e618cbfbc30e20506f41455c05a7cb42a95d", + "video_id": "ZhnXo3XUnzI", + "question": "What happens after the boy repeats the phrase \"human skeletal system\"?", + "answer_choice_0": "The audience laughs at him.", + "answer_choice_1": "The boy introduces himself.", + "answer_choice_2": "The boy continues his lecture.", + "answer_choice_3": "The audience remains silent.", + "answer_choice_4": "The audience repeats the phrase.", + "answer_id": 4, + "answer": "The audience repeats the phrase.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:01, I found the boy on-stage. Next, I heard him say \"human skeletal system\" at 00:14 - 00:17. Since there was not another occurrence of him saying this before this timeframe, this was the first time he said it. Then, at 00:18 - 00:20, I heard him say \"human skeletal system\" again, which was the first time he repeated the phrase. After, I then heard the audience repeat it back to the boy at 00:21 - 00:23." + }, + { + "key": "ZhnXo3XUnzI:55f8b8276ea43d8615d43f6430496f4a72ca0d61", + "video_id": "ZhnXo3XUnzI", + "question": "How does the graphic change immediately after \"most people call it the spinal cord\"?", + "answer_choice_0": "A boy sleeping becomes a girl studying.", + "answer_choice_1": "A girl thinking becomes a boy playing drums.", + "answer_choice_2": "A girl biking becomes a boy playing soccer.", + "answer_choice_3": "A boy playing basketball becomes a girl reading.", + "answer_choice_4": "A boy on a computer becomes a girl writing on paper.", + "answer_id": 1, + "answer": "A girl thinking becomes a boy playing drums.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the target phrase and heard it between 01:19 and 01:21. I looked at the screen behind the boy during this segment and saw that at first, there was a girl thinking with her right hand under her chin. As soon as the boy finished saying the target phrase, I observed that the graphic on screen changed to show a boy playing drums." + }, + { + "key": "ZhnXo3XUnzI:7ca8b824c9cb081d1b54b6fd845281335b3d1d5e", + "video_id": "ZhnXo3XUnzI", + "question": "How many times does the boy in the black suit step in front of the skeleton?", + "answer_choice_0": "2", + "answer_choice_1": "6", + "answer_choice_2": "8", + "answer_choice_3": "5", + "answer_choice_4": "4", + "answer_id": 4, + "answer": "4", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video and paid attention to where the boy in the black suit was in relation to the skeleton. For most of the video, I observed that the boy was next to or behind the skeleton. The first time he steps in front of the skeleton is at 00:30. The second time the boy steps in front of the skeleton is at 02:16. The third occurrence is at 02:55. The fourth occurrence is at 03:26. I watched the remainder of the video and did not see any more occurrences, so the total number is 4." + }, + { + "key": "ZhnXo3XUnzI:d8b1110460e5205b8993a678d385b3f3d38743df", + "video_id": "ZhnXo3XUnzI", + "question": "Between 03:30 and 04:30, how long are the judges seen writing?", + "answer_choice_0": "21 seconds.", + "answer_choice_1": "9 seconds.", + "answer_choice_2": "7 seconds.", + "answer_choice_3": "3 seconds.", + "answer_choice_4": "14 seconds.", + "answer_id": 2, + "answer": "7 seconds.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the 03:30 section of the video. I watched the judges and noticed that the man behind the red podium begins to write at 03:53. The man behind the green podium begins to write at 03:54. The camera cuts to the boy in the suit at 04:00. The next time the judges are shown, neither of the judges is writing. This means that during the specified timeframe, the judges were seen writing for 7 seconds." + }, + { + "key": "ZhnXo3XUnzI:f83101eb687a9a1eeef6ec6929a33ce4aa071593", + "video_id": "ZhnXo3XUnzI", + "question": "What is the purpose of the blue rectangle that appears along the bottom of the screen from 00:09-01:11?", + "answer_choice_0": "It gives background information about the speaker.", + "answer_choice_1": "It shares the speaker's date of birth.", + "answer_choice_2": "It displays the title of the show.", + "answer_choice_3": "It announces who's coming next.", + "answer_choice_4": "It provides instructions on how to vote for the speaker.", + "answer_id": 4, + "answer": "It provides instructions on how to vote for the speaker.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the blue rectangle at the bottom of the video at 00:09. I watched the video through the specified timeframe and observed that there was text written on the rectangle. I read, \"vote DELA to *713*13# on all networks or download the Tv3 Reality App on Play Store or App Store\". I moved to the end of the video and heard the speaker identify himself as \"Dela\" at 03:38. From the remainder of the video and the comments from judges, I understood that this speaker was presenting in a competition. From this information, I understood that the blue rectangle contained the contact information and instructions for at-home viewers to vote for this speaker to win." + }, + { + "key": "_kzVZfGlPZI:3ca7fbd88e0bca12923d0c56645bf37dad881e53", + "video_id": "_kzVZfGlPZI", + "question": "Which truck is stuck when a man in a blue shirt is seen and heard speaking through a microphone?", + "answer_choice_0": "The Euro Part 402.", + "answer_choice_1": "The Euro Part 404.", + "answer_choice_2": "The Euro Part 401.", + "answer_choice_3": "The Euro Part 405.", + "answer_choice_4": "The Euro Part 403.", + "answer_id": 2, + "answer": "The Euro Part 401.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I looked for a man in a blue shirt speaking into a microphone. I saw him appear for the first time at 08:32. I could also hear his voice booming over a loudspeaker as he gestured with his hands. I looked for a stuck truck at that mark and saw a sign identifying one as the Euro Part 401. I watched the rest of the video to make sure that the man in the blue shirt is never seen or heard again at the same time that a truck is stuck." + }, + { + "key": "_kzVZfGlPZI:601baf80678128221194e24ecdc7f84be26e041c", + "video_id": "_kzVZfGlPZI", + "question": "What is the Euro Part 401 doing between 17:34-17:40?", + "answer_choice_0": "Driving into a puddle.", + "answer_choice_1": "Driving down a hill.", + "answer_choice_2": "Driving up a hill.", + "answer_choice_3": "Backing off a hill.", + "answer_choice_4": "Backing into a puddle.", + "answer_id": 2, + "answer": "Driving up a hill.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I identified the Euro Part 401 by reading 2 signs attached to its front at 17:34. I then observed the truck drive up a hill between 17:34-17:40." + }, + { + "key": "_kzVZfGlPZI:7a9538ddc4c04da9362b3448349b89d4b6af15b5", + "video_id": "_kzVZfGlPZI", + "question": "What prominent logo is visible in the center of the truck's grille from 00:27 to 00:42?", + "answer_choice_0": "Rolls-Royce.", + "answer_choice_1": "GMC.", + "answer_choice_2": "Mercedes-Benz.", + "answer_choice_3": "Nissan.", + "answer_choice_4": "Ford.", + "answer_id": 2, + "answer": "Mercedes-Benz.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 00:27 timestamp, I search for the truck's grille. As the truck approaches, I can clearly see the chrome Mercedes-Benz logo in the center of the black grille. It is most prominent at 00:42." + }, + { + "key": "_kzVZfGlPZI:80c68c66c579ae83e99e3d01f4cad887d05b50e1", + "video_id": "_kzVZfGlPZI", + "question": "After the truck takes off, why do the spectators disperse from 00:05 through 00:07?", + "answer_choice_0": "To allow the other vehicles to pass.", + "answer_choice_1": "To avoid witnessing a crash.", + "answer_choice_2": "To give the truck a clear path.", + "answer_choice_3": "To obtain a better view.", + "answer_choice_4": "The event has ended.", + "answer_id": 2, + "answer": "To give the truck a clear path.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 00:05 time stamp, I watch as the truck takes off towards a steep incline. Spectators are standing at the top of the incline. The spectators disperse as the truck gets closer to give the truck a clear path to pass by." + }, + { + "key": "_kzVZfGlPZI:9183c281876390866f3de9be1fd9c651f99e5f8b", + "video_id": "_kzVZfGlPZI", + "question": "What does the Euro Part 401 drive through between 19:32-21:13?", + "answer_choice_0": "Two cliffs.", + "answer_choice_1": "Several trees.", + "answer_choice_2": "A tunnel.", + "answer_choice_3": "A few puddles.", + "answer_choice_4": "A river.", + "answer_id": 1, + "answer": "Several trees.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I identified the truck at 19:32 as the Euro Part 401 by reading a sign attached to its side. I also saw the truck begin to bump into several trees at that mark. I continued watching and noticed that the truck drives through a group of trees until it finally emerges on the other side at 21:13." + }, + { + "key": "_kzVZfGlPZI:a3440ac188b451d6a429b93efce1f4fe0c3bd504", + "video_id": "_kzVZfGlPZI", + "question": "What phrase is printed on the side of the burgundy truck in large white letters at the start of the video?", + "answer_choice_0": "\"BEAST MODE\".", + "answer_choice_1": "\"I'M THE FASTEST BEAST\".", + "answer_choice_2": "\"I'M THE BIGGEST BEAST\".", + "answer_choice_3": "\"I'M THE BEAST\".", + "answer_choice_4": "\"BIGGEST, FASTEST BEAST.\"", + "answer_id": 3, + "answer": "\"I'M THE BEAST\".", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I search for the truck at the start of the video. When I find it at 00:00, I notice several advertisements and text printed on its side starting at 00:00 - 00:08. I then search for the phrase with the largest letters in white. I find the phrase against a black background which reads, \"I'M THE BEAST\"." + }, + { + "key": "_kzVZfGlPZI:dde86f7b8ef46408ea6d1b795268c7af84b30973", + "video_id": "_kzVZfGlPZI", + "question": "How many \"NORD-LOCK\" stickers are on the front of the Euro Part 401?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "0.", + "answer_id": 1, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I looked for a truck identified as the Euro Part 401. Between 00:00-00:10, I saw several signs that read, \"Euro Part 401\", attached to a truck. I then looked for the front of that truck and saw it for the first time at 00:09. I noticed 2 stickers reading \"NORD-LOCK\" clearly attached to its front." + }, + { + "key": "_kzVZfGlPZI:ebaef891cbb2ad24f3c18e6e863e2960bd6d5410", + "video_id": "_kzVZfGlPZI", + "question": "Why is the man in the pink shirt pointing while standing next to the truck from 09:58 through 10:10?", + "answer_choice_0": "To keep the driver from hitting another truck.", + "answer_choice_1": "To direct the driver out of a ditch.", + "answer_choice_2": "To signal the driver to get out of the truck.", + "answer_choice_3": "To keep the driver from hitting spectators.", + "answer_choice_4": "To signal to the driver the road is blocked.", + "answer_id": 1, + "answer": "To direct the driver out of a ditch.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 09:58 timestamp, I search for the man in the pink shirt. I find him pointing towards the left as the truck struggles to move ahead. I watch until 10:10 to assess the situation. I determine the truck is stuck in a ditch, and the man in the pink shirt is pointing, using his hand to guide the driver forward to safety." + }, + { + "key": "_kzVZfGlPZI:f301ebd40d23f5e87e3c43e66121e4ce4fc0ee9f", + "video_id": "_kzVZfGlPZI", + "question": "Why are the spectators cheering at 04:00?", + "answer_choice_0": "A truck maneuvers over a dirt mound.", + "answer_choice_1": "A driver escapes a firery vehicle.", + "answer_choice_2": "A driver is honored for their skills.", + "answer_choice_3": "A truck emerges from deep water.", + "answer_choice_4": "A truck avoids a collision.", + "answer_id": 0, + "answer": "A truck maneuvers over a dirt mound.", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "After locating the 04:00 timestamp, I determine what happened before this by rewinding the video back to 03:30. From there, I can see the truck's wheels are stuck on a dirt mound. The driver struggles to maneuver over the mound but is not successful until 03:57. The truck is then able to drive over the mound, and the spectators are heard cheering over the driver achieving its goal." + }, + { + "key": "_kzVZfGlPZI:ff01f2141ecb475132b2804573cdabd0a9c6c7c5", + "video_id": "_kzVZfGlPZI", + "question": "What color helmet is the passenger of the Euro Part 404 truck wearing between 01:23-01:28?", + "answer_choice_0": "Red.", + "answer_choice_1": "Brown.", + "answer_choice_2": "White.", + "answer_choice_3": "Gray.", + "answer_choice_4": "Yellow.", + "answer_id": 3, + "answer": "Gray.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I looked for a truck identified as the Euro Part 404 and found it for the first time at 01:23. I saw 2 signs reading \"Euro Part 404\" clearly attached to it. I observed a passenger in the truck at 01:23 as well. I watched him stick his head in and out of the window between 01:23-01:28 and observed him wearing a shiny gray helmet." + }, + { + "key": "aQaZU0gxLK8:8709af03170519543e26132f42849f8f64c03901", + "video_id": "aQaZU0gxLK8", + "question": "Why is the chirping, furry creature trembling at 03:27?", + "answer_choice_0": "The Treacle Person in the construction hat didn't fix the reverse gear.", + "answer_choice_1": "The Treacle Person in the construction hat is about to give a speech.", + "answer_choice_2": "The Treacle Person in the construction hat is going under the hill.", + "answer_choice_3": "The Treacle Person in the construction hat is going over the hill.", + "answer_choice_4": "The Treacle Person in the construction hat has built a new contraption.", + "answer_id": 1, + "answer": "The Treacle Person in the construction hat is about to give a speech.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene that begins with the chirping, furry creature trembling at 03:27. I listened as a Treacle Person tries to figure out what's wrong with him, and discern from the chirping 03:32 that the creature is trembling in anticipation of the Treacle Person in the construction hat's speech, which is commenced right after." + }, + { + "key": "aQaZU0gxLK8:afd635e0788ecfeb19b620cb597ed2a67dd74273", + "video_id": "aQaZU0gxLK8", + "question": "Which character first has the idea to go under the hill instead of over it?", + "answer_choice_0": "The Treacle Person wearing leopard print.", + "answer_choice_1": "The Treacle Person wearing the spiral shirt.", + "answer_choice_2": "The Treacle Person wearing the hard hat.", + "answer_choice_3": "The Treacle Person wearing pigtails.", + "answer_choice_4": "The Treacle Person wearing the checkered bandana.", + "answer_id": 1, + "answer": "The Treacle Person wearing the spiral shirt.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene beginning at 05:30 in which a group of the Treacle People discussed the incident with the barn and the hill. I listened to the scene to identify which Treacle Person first had the idea to go under the hill, and identified the Treacle Person who first proposed the idea, from 05:35-05:38. I identified him by his shirt with a spiral on it. Though other Treacle People in the scene later have this idea, the spiral shirt Treacle Person has it first." + }, + { + "key": "aYlI5KCynCM:3593fba6be8f6069476791fe74096e473c3c8abf", + "video_id": "aYlI5KCynCM", + "question": "What does the host of the show, \"Ask David Bergman\" do directly after he tells the other photographer he hopes he'll check out his show next Monday?", + "answer_choice_0": "He fist-bumps the other photographer", + "answer_choice_1": "He pats the other photographer on the shoulder 3 times", + "answer_choice_2": "He gives the other photographer a high five", + "answer_choice_3": "He places a hand on the other photographer's back", + "answer_choice_4": "He gives the other photographer a handshake", + "answer_id": 4, + "answer": "He gives the other photographer a handshake", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I identified the host of the \"David Bergman Show\" by listening to the other photographer explain that he is hijacking the \"David Bergman Show\" from 00:00-00:07. I saw David Bergman enter at 00:18 and identified this person as David Bergman by observing his interactions with the other photographer from 00:18-00:25 when the other photographer refers to the show as \"his.\" I then listened for the host of the \"Ask David Bergman\" show to tell the other photographer to check out his show. From 11:38-11:40 in the video, I listened to the host say that he was back \"every Monday at 10:00 AM Eastern.\" He then says to the audience, \"I hope you'll check that out,\" and then to the other photographer, \"I hope you'll check that out.\" Immediately after this at 11:45, he gives a handshake to the other photographer." + }, + { + "key": "aYlI5KCynCM:4f874e8b3cb69cdda4bb563ec760d221865864ef", + "video_id": "aYlI5KCynCM", + "question": "What happens when David moves the light closer to Mark?", + "answer_choice_0": "The image turns black.", + "answer_choice_1": "The image turns yellow.", + "answer_choice_2": "The image gets brighter.", + "answer_choice_3": "The image gets darker.", + "answer_choice_4": "The image turns white.", + "answer_id": 3, + "answer": "The image gets darker.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "There are two moments in the film where David moves the light closer to Mark. One time at 04:53 and another time at 06:55. I looked at the image results at 05:22 and 07:20, and they both looked dark." + }, + { + "key": "aYlI5KCynCM:aaec06c49de19dc4c260593c43b73788fc7404f0", + "video_id": "aYlI5KCynCM", + "question": "What does the photographer do with his right hand when he mentions \"lot of white\" two times in a row?", + "answer_choice_0": "He touches the white backdrop.", + "answer_choice_1": "He moves it around in a circle.", + "answer_choice_2": "He points it at the white backdrop.", + "answer_choice_3": "He raises it above his head.", + "answer_choice_4": "He motions towards the light.", + "answer_id": 1, + "answer": "He moves it around in a circle.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for a moment when the photographer says \"lot of white\" twice in a row. I found this between 07:05-07:07. I observed what he's doing with his right hand and saw him move it around in a circle." + }, + { + "key": "aYlI5KCynCM:b4aa02a82a60df97199da7a9442c1fdb5cf013ab", + "video_id": "aYlI5KCynCM", + "question": "In what city is the video being shot?", + "answer_choice_0": "Miami.", + "answer_choice_1": "Phoenix.", + "answer_choice_2": "Seattle.", + "answer_choice_3": "Newark.", + "answer_choice_4": "Austin.", + "answer_id": 1, + "answer": "Phoenix.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for any mentions of the studio's location. At 00:29 one of the hosts says where the studio is located." + }, + { + "key": "aYlI5KCynCM:e8e58324ce469da4107c5717c06dd3874d9aede5", + "video_id": "aYlI5KCynCM", + "question": "How many white-colored words displayed onscreen with the first viewer's question card are not set against a black background?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "0.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the part of the video where the first question card is fully displayed, beginning at 01:16. I then observed all color of all the words displayed onscreen, and noted the white-colored ones. I then paid attention to how many of those words were displayed on a black background, and how many were not: in total, only one white-colored word was not displayed on a black background, the word \"Adorama\" in the bottom right corner of the screen." + }, + { + "key": "a_90z_4CkA4:26420d292ba77333536c01bcecfa2ad45b997b69", + "video_id": "a_90z_4CkA4", + "question": "Where is the woman in white looking when she says \"That's the thing though\"?", + "answer_choice_0": "Right, to the man in the red hat.", + "answer_choice_1": "Down at the ground.", + "answer_choice_2": "Forward, at the camera.", + "answer_choice_3": "Down, at her racket.", + "answer_choice_4": "Backward, at her opponent.", + "answer_id": 3, + "answer": "Down, at her racket.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I listened for the target phrase and heard it at 01:01. I observed the woman in white's posture and noticed that her head was tilted slightly down while she held the head of her racket at chest height. I concluded that she was looking down at the racket." + }, + { + "key": "a_90z_4CkA4:345bcba5d3ef09b2e1bd97a3389c221d88830262", + "video_id": "a_90z_4CkA4", + "question": "What is the second action that the man with the red hat does after he approaches the baseline for the first time?", + "answer_choice_0": "He picks up a water bottle", + "answer_choice_1": "He tells something to the woman in white", + "answer_choice_2": "He hands the woman in white more balls", + "answer_choice_3": "He catches a ball with his racket", + "answer_choice_4": "He takes his turn to serve", + "answer_id": 3, + "answer": "He catches a ball with his racket", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the video to find the first moment when the man with the red hat approaches the baseline. I notice this occurs starting at 00:22, when he begins to walk forward as the woman in white finishes a point with a backhand. I continued watching and observed that the man in the red hat places two new balls on the woman's racket as he steps closer to the baseline, and the woman in white steps further from the baseline. Then, after he gets closer to the baseline at 00:29, a ball reaches him from the other side, and he stops it with his racket, catching it as the shot fades. Therefore, I concluded that the man with the red hat catches a ball with his racket as his second action." + }, + { + "key": "a_90z_4CkA4:45f47e8d67c84d5df5378e1ac84a9b0520dfe5c7", + "video_id": "a_90z_4CkA4", + "question": "Is the ball successfully hit at 00:40?", + "answer_choice_0": "Yes, by the man in gray.", + "answer_choice_1": "Yes, by the woman in white.", + "answer_choice_2": "No, the woman in white misses.", + "answer_choice_3": "No, it's between points.", + "answer_choice_4": "No, the man in gray misses.", + "answer_id": 0, + "answer": "Yes, by the man in gray.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I moved to 00:40 and observed that the ball was on the far side of the court by the man in gray. I watched and noticed that at 00:40, the man in gray made contact with the ball. I continued watching and saw that the ball successfully passed over the net and landed in bounds on the near side of the court. I therefore concluded that the man in gray made a successful hit at 00:40." + }, + { + "key": "a_90z_4CkA4:4b984fa1b70f2848d3f9f0a5d94013ef01037b72", + "video_id": "a_90z_4CkA4", + "question": "How many stationary objects match the color of the man with curly blond hair's shoes?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "0.", + "answer_id": 1, + "answer": "2.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for the man with the curly blond hair and found him at 00:10. However, his shoes were not present at this time. I observed the man with curly blond hair step forward enough to show his shoes at 00:27. I observed that the shoes were bright orange. Because the camera remains level and shoots the same scene the entire video, I observed the surrounding area and looked for other orange stationary objects. I noticed an orange box to the left of the net. I also observed an orange bag on the far side of the court along the fence. I continued watching to check to see if there were any more stationary orange objects. A man wearing orange appears at 00:44, but he is not stationary, nor an object. Therefore, I counted that there were 2 stationary objects that matched the man's shoes." + }, + { + "key": "a_90z_4CkA4:74c73c790fff87061051ef00c52c81cfafb24a3a", + "video_id": "a_90z_4CkA4", + "question": "How many times does the woman in white hit into the net?", + "answer_choice_0": "0.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I counted each occurrence of the woman in white hitting the ball into the net. The first occurrence was at 00:33. The second occurrence was at 00:52. I noticed that the final ball hit the top of the net at 01:18, but it went over so I didn't count this. There were no more occurrences in the remainder of the video, so I counted 2." + }, + { + "key": "a_90z_4CkA4:8f89fa35d8b9e2c580e3fda209615b20c8122b7b", + "video_id": "a_90z_4CkA4", + "question": "How does the girl in white move across the court during her fifth point?", + "answer_choice_0": "From the doubles alley to the net.", + "answer_choice_1": "From the ad side to the deuce side.", + "answer_choice_2": "From the baseline to the net.", + "answer_choice_3": "From the ad side to the doubles alley.", + "answer_choice_4": "From the deuce side to the ad side.", + "answer_id": 1, + "answer": "From the ad side to the deuce side.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I counted each point until I got to the girl in white's fifth point, which happened at 00:46. During this point, I examined how she moved along the court. After she served, she remained on the ad side to hit a backhand. When her opponent responded with a down the line backhand, she moved to the deuce side to hit the ball, where she missed in the net. Therefore, she moved from the ad side to the deuce side during her fifth point." + }, + { + "key": "a_90z_4CkA4:99c523547d0561380a19192bc9a76603e6c06030", + "video_id": "a_90z_4CkA4", + "question": "With what stroke did the girl in white finish her second point?", + "answer_choice_0": "A serve.", + "answer_choice_1": "A forehand.", + "answer_choice_2": "An overhead.", + "answer_choice_3": "A backhand.", + "answer_choice_4": "A volley.", + "answer_id": 3, + "answer": "A backhand.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked for the girl in white to play her second point. After she finished her first point with an ace at 00:06, she began her second point at 00:10 and started a rally with her opponent. The rally went on for 8 shots until the girl in white hit a backhand down the line and won the point. Therefore, the girl in white finished the second point with a backhand." + }, + { + "key": "a_90z_4CkA4:c62a14fb6e73cda2ce04396d1a74b83f0c63e991", + "video_id": "a_90z_4CkA4", + "question": "Why did the girl in white's opponent hit a high return at 00:56?", + "answer_choice_0": "He was trying to lob her.", + "answer_choice_1": "He was trying to confuse her.", + "answer_choice_2": "He was trying to drop shot her.", + "answer_choice_3": "He made a mistake.", + "answer_choice_4": "He was trying to push her back.", + "answer_id": 3, + "answer": "He made a mistake.", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked at the point at 00:56, where the opponent hit a high return. I noticed immediately after that he audibly groaned and physically stretched to get the ball. This suggested that he needed to exert a good deal of unexpected effort to get the ball. When the girl in white hits the ball at 00:58, she easily crushes it across the court and wins the point. This doesn't suggest that he was trying to push her back, because his ball didn't go far enough. Neither does this suggest he was trying to lob her, as the ball didn't go over her head. He wasn't drop shotting, because the ball didn't go short enough, and he wasn't trying to confuse her, because the girl in white easily won the point. This leaves the fact that he was caught off guard and made a mistake. Unable to adequately respond to the serve, he was caught off balance and hit a weak, high return that the girl in white was easily able to capitalize on." + }, + { + "key": "a_90z_4CkA4:f6039e86f326299b21524a84496c2b327c40fe6c", + "video_id": "a_90z_4CkA4", + "question": "When does the girl in white hit a swinging volley?", + "answer_choice_0": "At her eighth and second points.", + "answer_choice_1": "At her third and fourth points.", + "answer_choice_2": "At her fifth and third points.", + "answer_choice_3": "After she serves her first two points.", + "answer_choice_4": "At her sixth and seventh points.", + "answer_id": 4, + "answer": "At her sixth and seventh points.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I counted each time the girl in white hit a swinging volley. She hits one at 00:58, and another at 01:18. Then, I counted how many points there were previously and found that she hit these swinging volleys in her sixth and seventh points." + }, + { + "key": "amdM-Z-32sM:4c0f1a7a7a6da474098aa9f5dba251478eac0eff", + "video_id": "amdM-Z-32sM", + "question": "What does the watermark say that intermittently appears at the center and bottom of the frame throughout the video?", + "answer_choice_0": "Breakfast Chats.", + "answer_choice_1": "Warm Toast.", + "answer_choice_2": "Sunday Roast.", + "answer_choice_3": "Top of the Morning.", + "answer_choice_4": "Cuppa Joe.", + "answer_id": 2, + "answer": "Sunday Roast.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I began watching the video from the beginning to see what watermark is located at the center and bottom of the frame. Immediately at 00:00, a watermark appears with a rounded line at the top and a flat line at the bottom with a black background and white text. The white text reads: Sunday Roast. I then watched the rest of the video, and this watermark stays there the entire time. The watermark is never replaced." + }, + { + "key": "amdM-Z-32sM:b2a470677df71b2a14797518b026b773eac6e4d6", + "video_id": "amdM-Z-32sM", + "question": "From [0:32 - 0:36], what is Lady Gaga wearing?", + "answer_choice_0": "A dark red velvet dress that has a flared skirt.", + "answer_choice_1": "A dark red velvet dress that is belted and has a plunging neckline.", + "answer_choice_2": "A dark red velvet dress that is belted and is off of the left shoulder.", + "answer_choice_3": "A black velvet dress that is belted and is off of the left shoulder.", + "answer_choice_4": "A black velvet dress that is belted and has a plunging neckline.", + "answer_id": 2, + "answer": "A dark red velvet dress that is belted and is off of the left shoulder.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from [0:32 - 0:36] and identified the dress as velvet, belted, and the left shoulder of the dress was off the shoulder. Initially the dress looked black, but when it caught the light, it was clearly a dark red." + }, + { + "key": "amdM-Z-32sM:c79b6919230cf3114f158a5f1c7e69e005af377e", + "video_id": "amdM-Z-32sM", + "question": "What religious figure is visible when the narrator reads a quote from Lady Gaga about her views on religion?", + "answer_choice_0": "The Virgin Mary.", + "answer_choice_1": "Moses.", + "answer_choice_2": "Jesus Christ.", + "answer_choice_3": "Mary Magdalene.", + "answer_choice_4": "Eve.", + "answer_id": 0, + "answer": "The Virgin Mary.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I observed a quote from Lady Gaga appear onscreen beginning at 00:28 and heard a narrator reading the quote outloud. I listened to the quote discuss Lady Gaga's views on religion between 00:28-00:44. I looked for a religious figure in that timespan and observed an image of a female religious figure appear at 00:37. I determined from her classic blue and white garments and the halo around her head that she was the Virgin Mary." + }, + { + "key": "amdM-Z-32sM:cb7f776cdc61c3ddd10fa9b7d077a0d25c397dba", + "video_id": "amdM-Z-32sM", + "question": "How many years did Glenn Close live in the MRA?", + "answer_choice_0": "Fifteen.", + "answer_choice_1": "Twenty-two.", + "answer_choice_2": "Seven.", + "answer_choice_3": "Twenty.", + "answer_choice_4": "Eighteen.", + "answer_id": 0, + "answer": "Fifteen.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened to the section on Glenn Close from 2:55 - 3:15. Glenn Close states that she joined the MRA at age seven and left at twenty-two, which is fifteen years." + }, + { + "key": "c9-Nlqy7wxg:095da11563e456e00842a7749d64ffde7a4bbdce", + "video_id": "c9-Nlqy7wxg", + "question": "How many small gray circles appear on the board between 03:53-04:14 when the narrator discusses the \"Scotch Gambit?\"", + "answer_choice_0": "5.", + "answer_choice_1": "12.", + "answer_choice_2": "8.", + "answer_choice_3": "10.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "12.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I started watching the video at 03:53 and saw 5 small gray circles appear on the board at that timestamp. I heard the narrator mention the \"Scotch Gambit\" at 03:58. At 04:03, I saw 5 more small gray circles appear. I saw 1 small gray circle appear at 04:08, and 1 small gray circle appear at 04:12. I did not observe any other small gray circles appear between 04:12-04:14. I counted up the small gray circles by adding 5+5+1+1=12. Therefore, the total number of small gray circles that appear between 03:53-04:14 is 12." + }, + { + "key": "c9-Nlqy7wxg:4770e15df6ea40489bcedae366931b70a19c3c95", + "video_id": "c9-Nlqy7wxg", + "question": "In what direction is the third yellow arrow that appears pointing between 04:50-05:01?", + "answer_choice_0": "Diagonally up and left.", + "answer_choice_1": "Diagonally down and left.", + "answer_choice_2": "Straight down.", + "answer_choice_3": "Straight up.", + "answer_choice_4": "Diagonally up and right.", + "answer_id": 4, + "answer": "Diagonally up and right.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I started looking for yellow arrows at 04:50. I saw one appear at 04:55 and noticed that it was pointing diagonally down and to the left. Next, I noticed another yellow arrow appear at 04:56 and observed it pointing up and to the left. I saw the next arrow appear at 04:58 and saw it pointing diagonally up and to the right. Only one other arrow appears during the specified timeframe at 05:01 and it points straight down. Therefore, the third arrow that appears between 04:50-05:01 points diagonally up and right." + }, + { + "key": "c9-Nlqy7wxg:5707400618626bddc8134b30473ed643290c7714", + "video_id": "c9-Nlqy7wxg", + "question": "During the first opening, what symbol appears above the black king between the first and second times the narrator moves the white queen to cell f7?", + "answer_choice_0": "A hashtag.", + "answer_choice_1": "A crown.", + "answer_choice_2": "An arrow.", + "answer_choice_3": "A star.", + "answer_choice_4": "A hand.", + "answer_id": 0, + "answer": "A hashtag.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I identified that this chess instructional video is broken up into 4 sections called \"openings\" by reading the words, \"Chess Openings, 4 Best Openings For White\" on the right side of the screen at the 00:00 mark. I identified the first opening as the time when play begins and the narrator uses the word \"start\" at 00:33. I then looked for a play where the white queen moves to cell f7 and found this occurs at 02:40. At 02:53, the narrator moves the queen off of f7. At 02:54, I saw a hashtag symbol appear above the black king. At 02:59, the narrator moves the queen back to f7, and the hashtag symbol disappears. I concluded that a hashtag is the symbol that appears above the black king between the first and second times the narrator moves the white queen to f7 during the first opening." + }, + { + "key": "c9-Nlqy7wxg:663f47c00a2b9bd465feffeca2aecc51719aeacd", + "video_id": "c9-Nlqy7wxg", + "question": "How does the color of the black queen's square change between 12:16-12:58?", + "answer_choice_0": "Red, dark blue, bright blue, red.", + "answer_choice_1": "Bright blue, dark blue, bright blue, red.", + "answer_choice_2": "Bright blue, dark blue, red, dark blue.", + "answer_choice_3": "Bright blue, red, dark blue, bright blue.", + "answer_choice_4": "Dark blue, bright blue, red, dark blue.", + "answer_id": 2, + "answer": "Bright blue, dark blue, red, dark blue.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 12:16, I observed the color of the black queen's square as being bright blue in cell d8. At 12:19, that square changes back to dark blue. At 12:49, that same square changes to red, and at 12:57 the square changes back to dark blue. It remains dark blue through 12:58, and the black queen never moves from cell d8 between 12:16-12:58. Therefore, the black queen's square goes from bright blue to dark blue to red to dark blue between 12:16-12:58." + }, + { + "key": "c9-Nlqy7wxg:ab60ffa723aecd0baa2e7bbda4209095ef6edf61", + "video_id": "c9-Nlqy7wxg", + "question": "How does the symbol on the cursor change between 01:07-01:12?", + "answer_choice_0": "Nothing, hand, arrow, hand, arrow, nothing.", + "answer_choice_1": "Arrow, hand, arrow, nothing, arrow, hand.", + "answer_choice_2": "Hand, arrow, nothing, arrow, hand, nothing.", + "answer_choice_3": "Hand, arrow, hand, arrow, nothing, arrow.", + "answer_choice_4": "Arrow, nothing, arrow, hand, arrow, nothing.", + "answer_id": 3, + "answer": "Hand, arrow, hand, arrow, nothing, arrow.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I identified the cursor as the object moving around onscreen that interchanges between an arrow and a hand during the first 1 minute of the video. I then observed the cursor as a hand at 01:07. The cursor changes to an arrow at 01:08, then goes briefly back to a hand at that same time stamp before becoming an arrow once again. The cursor disappears at 01:08. It appears again as an arrow at 01:12 and does not change again during that timestamp. I concluded that between 01:07-01:12, the cursor changes from hand, to arrow, to hand, to arrow, to nothing, to arrow." + }, + { + "key": "c9-Nlqy7wxg:ae988d907d84d863637532052fd53b79598b3c86", + "video_id": "c9-Nlqy7wxg", + "question": "What happens to the bar graphic on the side of the chessboard from 01:05-02:25?", + "answer_choice_0": "It slowly and constantly fills with black.", + "answer_choice_1": "It fills mostly with black, but then fills entirely with white.", + "answer_choice_2": "It wavers slightly between half black and half white.", + "answer_choice_3": "It fills mostly with white, but then fills entirely with black.", + "answer_choice_4": "It slowly and constantly fills with white.", + "answer_id": 1, + "answer": "It fills mostly with black, but then fills entirely with white.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I examined the 01:05-02:25 span, and I located the bar graphic on the side of the chessboard. I noticed that at 01:05, it is filled halfway with white -- the black takes the other half. I also noticed that when chess pieces are moved over the course of the span, the bar fills with white or black depending on the move. From 01:05 to 01:11, after the white knight is moved, the black begins to take up a little more of the bar, about 60%. From 01:24 to 01:27, after the black pawn is moved, the white increases a tiny amount. Then, from 01:34 to 01:44, after the white knight moves and while the black king is moving in response, the bar fills once more, even further, with black. Now it is about 80% filled with black. From 01:44 to 01:50, after the white bishop moves, the white creeps back up, but by a negligible amount. But then, from 02:20 to 02:25, after the black king is moved, the bar fills completely with white. Even though the bar occasionally wavers and gets small boosts of white, in general, the bar fills mostly with black but then fills entirely with white." + }, + { + "key": "c9-Nlqy7wxg:af436a506990f80955583c143d13506e1621a979", + "video_id": "c9-Nlqy7wxg", + "question": "How many yellow arrows appear on screen between the 05:20 and 05:50 timestamps in the video?", + "answer_choice_0": "3", + "answer_choice_1": "1", + "answer_choice_2": "0", + "answer_choice_3": "4", + "answer_choice_4": "5", + "answer_id": 4, + "answer": "5", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I first located the 05:20-05:50 timestamp in the video. I then saw the first arrow appear at 05:24 and fade out at 5:36. As I continued watching, another arrow faded in at 05:37, and I counted it. A third arrow appeared and overlapped the existing one at 05:40, while the narrator explained the game, and I counted that one too. A fourth arrow appeared at 05:46, and a fifth at 05:47, which I also counted. Therefore, I concluded that there were 5 arrows between 05:20 and 05:50." + }, + { + "key": "c9-Nlqy7wxg:e72e3679bd23ec95e47859fe7ed59db4668d537c", + "video_id": "c9-Nlqy7wxg", + "question": "How many dark blue squares are between the white pawn nearest the black queen and the black pawn furthest from the black queen at 12:41?", + "answer_choice_0": "3.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "0.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "0.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I had to identify which image represented the white pawn. I observed the narrator hover over a white pawn with the mouse, highlighting it in blue, and referring to it as a \"pawn\" at 00:55. Next, I had to identify the black queen. I observed the narrator hover over the white queen, calling it \"queen\" at 02:06. Since both the black and white queens have the same shape in chess, I determined that the black image that mirrored the white queen in d8 was the black queen. Then, I went to 12:41 and saw the black queen in cell d8. Next, I looked for the nearest white pawn and found it 2 squares down from the black queen at d6. I looked for the furthest black pawn from the black queen and found it in cell e5. Since the white pawn closest to the black queen and the black pawn furthest from the black queen are diagonally adjacent, I determined there are no dark blue squares between them." + }, + { + "key": "c9-Nlqy7wxg:fbe6c99e4df7892ea993fd40f330c4f7036de75d", + "video_id": "c9-Nlqy7wxg", + "question": "Between 06:30-07:10, how many individual black chess pieces are touched by yellow arrows?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "0.", + "answer_id": 3, + "answer": "4.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I started looking for yellow arrows at 06:30. The first appears at 06:40 and touches the black queen and the white knight. The second appears at 06:42 and does not touch any chess piece. The third arrow appears at 06:55 and touches the nose of the black knight in f6. The fourth arrow appears at 06:57 and crosses over the black knight in f6 to touch the black queen. Both of those chess pieces have already been touched by an arrow so I did not count them towards the final total. A final arrow appears at 07;03 and touches the black king, the black queen, and the knight in e5. I did not count the black queen in the final total since it had already been touched by an arrow. No other arrows are drawn between 07:03-07:10. I counted up the total number of individual black chess pieces touched by a black arrow, including the black queen, the black king, the knight in f6, and the knight in e5 for a total of 4." + }, + { + "key": "cxHtplim5Ic:0dcbc7b19f19cb1bda4b0f31317cde0ff544e9e1", + "video_id": "cxHtplim5Ic", + "question": "How many titled subsections were in the video?", + "answer_choice_0": "11.", + "answer_choice_1": "5.", + "answer_choice_2": "9.", + "answer_choice_3": "3.", + "answer_choice_4": "7.", + "answer_id": 0, + "answer": "11.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I saw the video's first titled subsection at 00:33, reading \"The Greeting\". Next, at 01:00, I saw the second titled subsection, \"The Drinks\". Then, at 01:15, I saw the third, \"The Bill\". Then, at 01:25, I saw the fourth, \"The Chat\". Then, at 01:40, I saw the fifth, \"The Next Stop\". Then, at 01:53, I saw the sixth, \"The Coming-Out Story\". Then, at 02:35, I saw the seventh, \"The Fart\". Then, at 02:50, I saw the eighth, \"The Kiss\". Then, at 03:15, I saw the ninth, \"The Prep\". Then, at 03:45, I saw the tenth, \"The Burial\". Then, at 04:08, I saw the eleventh, \"The Interrogation\". Since another titled subsection never appeared after \"The Interrogation\", that was the last titled subsection. Therefore, the video had a total of 11 titled subsections." + }, + { + "key": "cxHtplim5Ic:2cdcec72740300fb40c44c60d5e7b6ceff97d684", + "video_id": "cxHtplim5Ic", + "question": "What did the woman in the video eat for her meal?", + "answer_choice_0": "A sandwich.", + "answer_choice_1": "A pizza.", + "answer_choice_2": "Chinese food.", + "answer_choice_3": "Pasta.", + "answer_choice_4": "Tacos.", + "answer_id": 1, + "answer": "A pizza.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a woman. A woman first appears at 00:45, and she greets a man outside a restaurant. The man and woman are seen sitting at a table from 01:04-01:12. Directly afterward, at 01:13, a half-eaten plate of pizza is shown in front of the woman seated at the table. Clearly, she has eaten pizza for her meal." + }, + { + "key": "cxHtplim5Ic:5499876321860cb4f484cb999753429494119a01", + "video_id": "cxHtplim5Ic", + "question": "What does the man suggest that he and the woman do as they put on their coats?", + "answer_choice_0": "Go back to his place.", + "answer_choice_1": "Go catch a movie.", + "answer_choice_2": "Go their separate ways.", + "answer_choice_3": "Go get ice cream.", + "answer_choice_4": "Go find a bar.", + "answer_id": 4, + "answer": "Go find a bar.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for a moment when the man and woman in the video are putting on their coats. This occurs from 01:39-01:42. As they put on their coats, I heard the man ask if the woman wants to go find a bar." + }, + { + "key": "cxHtplim5Ic:8ac35a02d18fa61000b116dcde851346071d8d80", + "video_id": "cxHtplim5Ic", + "question": "What passed by the couple from 01:55-01:58?", + "answer_choice_0": "Another couple.", + "answer_choice_1": "Nothing passed by.", + "answer_choice_2": "A car.", + "answer_choice_3": "A truck.", + "answer_choice_4": "Another person.", + "answer_id": 2, + "answer": "A car.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the couple at 01:55, in addition to a car in the background. Next, from 01:55-01:58, I saw the car move from the background to the foreground and past the couple before then moving off-screen." + }, + { + "key": "cxHtplim5Ic:9d42e0459e21cc1eeed0072e1f52cab610b2bd57", + "video_id": "cxHtplim5Ic", + "question": "How many dates does the man in the gray sweater go on in the video?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "3.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video first to find the man in the gray sweater. He appears in the first scene, which begins at 00:05. I then watched the rest of the video to understand how many dates he goes on. At 00:35, he is shown greeting a man outside of a restaurant. At 00:45, he is seen greeting a woman outside of a different restaurant. Throughout the rest of the video, he does not encounter any other individuals to go on a date with them. Thus, he went out on two dates during the video." + }, + { + "key": "cxHtplim5Ic:a214c6fc4ff66fbba10a043f36fa2c387e69246d", + "video_id": "cxHtplim5Ic", + "question": "What was the title of the fourth subsection of the video?", + "answer_choice_0": "The Chat.", + "answer_choice_1": "The Greeting.", + "answer_choice_2": "The Dates.", + "answer_choice_3": "The Drinks.", + "answer_choice_4": "The Bill.", + "answer_id": 0, + "answer": "The Chat.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I read and counted each titled subsection throughout the video. At 00:15, I saw the main title of the video, reading \"The Dates\". Next, I saw the video's first titled subsection at 00:33, reading \"The Greeting\". Then, at 01:00, I saw the second titled subsection, \"The Drinks\". Then, at 01:15, I saw the third, \"The Bill\". Then, at 01:25, I saw the fourth, \"The Chat\"." + }, + { + "key": "cxHtplim5Ic:daaeafc7c0f0c52d42aa19a92b03fe34e90c2ffc", + "video_id": "cxHtplim5Ic", + "question": "Before the man kisses the other man, what does he do before this?", + "answer_choice_0": "He looks down.", + "answer_choice_1": "He walks away.", + "answer_choice_2": "He gestures around.", + "answer_choice_3": "He looks up.", + "answer_choice_4": "He looks around.", + "answer_id": 4, + "answer": "He looks around.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the moment when the man kisses the other man. This occurs from 03:06-03:10. The most recent scene before this which features both men runs from 02:53-03:01. During this scene, the man looks down and around the two of them, up and down the stairwell where they are standing. Thus, he looks around before he kisses the other man." + }, + { + "key": "d8UESxnuVAY:558a60f9176432b3603c2a4c818feab0b654aa5c", + "video_id": "d8UESxnuVAY", + "question": "What would have been a valid alternative to the move white made upon being first put in check?", + "answer_choice_0": "No valid alternative.", + "answer_choice_1": "Queen from d2 to e2.", + "answer_choice_2": "Queen from d2 to e3.", + "answer_choice_3": "Rook from f1 to f2.", + "answer_choice_4": "King from g1 to g2.", + "answer_id": 0, + "answer": "No valid alternative.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the first time white is put in check at 03:33-03:37, when the black knight moves from d4 to e2. I recognized that this was check because the white king was in g1, and therefore in range of the knight. I also noticed that the king's square flashed red at 03:35. I then considered each of the given options while taking the state of the board in account. Options (1) and (3) would have blocked the check from the black queen at b6, but not from the black knight at e2, making them invalid. Option (2) would have taken the black knight at e2, but the check from the black queen would have remained, making it invalid. Option (4) was invalid as there was a white pawn at g2, so the white king could not move there. Because the king can only move from g1 to h1 and because no other piece could capture or block the checking pieces, there was only one valid move for white, which is what white chose at 03:43. Therefore, there was no valid alternative move, which is option (5)." + }, + { + "key": "d8UESxnuVAY:56babcfc28d2e6994e5cb7515f3c1f323eb4e286", + "video_id": "d8UESxnuVAY", + "question": "Which pawn does black use to move en passant?", + "answer_choice_0": "The c-file pawn.", + "answer_choice_1": "The a-file pawn.", + "answer_choice_2": "The b-file pawn.", + "answer_choice_3": "The d-file pawn.", + "answer_choice_4": "The e-file pawn.", + "answer_id": 2, + "answer": "The b-file pawn.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I understood that \"en passant\" means taking a pawn that has just moved two steps forward with the pawn to its left or right. I watched for white to move a pawn two squares forward into the same rank as a black pawn, and I saw that this occurred at 00:36 when white moved the c-file pawn into c4. At 00:44, I saw black take the white's c-file pawn with her b-file pawn en passant. I also heard the woman in yellow playing black say \"I'm taking en passant\" at 00:45. I watched the remainder of the video and confirmed that there were no additional pieces taken en passant by black." + }, + { + "key": "d8UESxnuVAY:74b20c2d500ce55f4b072a6bf0846798a5656d57", + "video_id": "d8UESxnuVAY", + "question": "What is the last move white made before they are first put in check?", + "answer_choice_0": "White knight from h4 to f5.", + "answer_choice_1": "White queen from e3 to d2.", + "answer_choice_2": "White queen from d2 to e3.", + "answer_choice_3": "White knight from g4 to e5.", + "answer_choice_4": "White knight from f3 to h4.", + "answer_id": 0, + "answer": "White knight from h4 to f5.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the first time white is put in check at 03:35, when the black knight moves from d4 to e2, delivering a check on the king at g1. The check was further indicated by a red flash under the king's square at 03:35. Before that, at 03:28-03:31, I saw white move their knight from h4 to f5. I confirmed that the very next move was black's knight from d4 to e2. Therefore, the last move that white made before they were first put in check was moving the white knight from h4 to f5." + }, + { + "key": "d8UESxnuVAY:927eb4129621ec97aacc28c58bdb4cc893f9faa3", + "video_id": "d8UESxnuVAY", + "question": "How many turns does white play between the first time they are put in check and the end of the game?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "2.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the first time white is put in check at 03:33-03:37, when the black knight moves from d4 to e2. I recognized that this was check because the white king was in g1, and therefore in range of the knight. I also noticed that the king's square flashed red at 03:35. I then watched the rest of the game, counting each time white moved. At 03:42-03:44, I saw white take a turn. Then, I saw white take another turn at 03:46-03:48. After this, black checkmated white, who made no further moves, indicated by the white king's square remaining red and the players shaking hands, signaling the end of the game. Therefore, white plays 2 turns between the first time they are put in check and the end of the game." + }, + { + "key": "d8UESxnuVAY:9bc7c925368c1a842cf73f31798e572976382089", + "video_id": "d8UESxnuVAY", + "question": "What's the last piece black moves to deliver checkmate?", + "answer_choice_0": "A bishop.", + "answer_choice_1": "A knight.", + "answer_choice_2": "A pawn.", + "answer_choice_3": "The queen.", + "answer_choice_4": "A rook.", + "answer_id": 1, + "answer": "A knight.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I that a checkmate is delivered when a king cannot escape the attack from one or more opponent pieces through movement or capturing an attacking piece. As I watched the video and looked for this moment, I heard that the woman in yellow, playing black, said \"Checkmate\" at 03:35. I noticed that this move, knight to e2, only put the king in check. So I continued watching to see what black's final piece to move would be. At 03:45, I saw black move her queen to g1, but this still didn't put the king in checkmate because white was able to take the queen at 03:47. Then, black moved her second knight to f2, which delivered a checkmate on the king in h1. Therefore, I determined that the last piece black moves to deliver checkmate was a knight." + }, + { + "key": "d8UESxnuVAY:c3d27c150a989512b1f053f73ffce13a482135ca", + "video_id": "d8UESxnuVAY", + "question": "What move results in the first piece being taken out of the game?", + "answer_choice_0": "Black knight at c6 takes white pawn at d4.", + "answer_choice_1": "Black pawn at c5 takes white pawn at b4.", + "answer_choice_2": "White knight at b1 takes black pawn at c3.", + "answer_choice_3": "White pawn at d4 takes black pawn at c5.", + "answer_choice_4": "Black pawn at b4 takes white pawn at c4.", + "answer_id": 1, + "answer": "Black pawn at c5 takes white pawn at b4.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I saw the first piece taken out of the game at 00:22-00:24. On the board displayed at the top of the screen, I then saw that black moved a pawn from c5 to b4, taking out a white pawn there. Therefore, the move that resulted in the first piece being taken out of the game was when the black pawn at c5 moved to take the white pawn at b4." + }, + { + "key": "d8UESxnuVAY:cca3d9962d6bacd04da247cb7265f4b396b9a475", + "video_id": "d8UESxnuVAY", + "question": "When does white get checkmated?", + "answer_choice_0": "03:39.", + "answer_choice_1": "03:49.", + "answer_choice_2": "03:45.", + "answer_choice_3": "03:33.", + "answer_choice_4": "04:05.", + "answer_id": 1, + "answer": "03:49.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the first time white is put in check at 03:33-03:37, when the black knight moves from d4 to e2. I recognized that this was in check because the white king was in g1, and therefore in range of the knight. I also noticed that the king's square flashed red at 03:35. Even though the female player says \"checkmate\" at 03:35, the male player continues to play, which implies that she anticipated a checkmate further along in the game. At 03:49, I saw black move their final piece, knight to f2, and checkmate white. I noticed that from 03:49-03:53, when the chessboard graphic faded out, the king's square stayed red. I also saw the players shake hands at 03:52, further signaling the end of the game. Therefore, white got checkmated at 03:49." + }, + { + "key": "d8UESxnuVAY:f1e26961b55a1a854888941b1e79ef328b882a4b", + "video_id": "d8UESxnuVAY", + "question": "How much time was on black's clock when black first achieved an advantage over 4 points?", + "answer_choice_0": "04:43.", + "answer_choice_1": "03:58.", + "answer_choice_2": "04:52.", + "answer_choice_3": "03:24.", + "answer_choice_4": "02:47.", + "answer_id": 3, + "answer": "03:24.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "As the game began at 00:20, a graphic display of the chess board appeared in the top half of the frame. I noticed that there was also a thin strip divided in half with white on top and black on the bottom to the left of the chess board graphic. When black took their first piece at 00:23, I noticed that the thin strip's black half grew slightly upward, signalling a very slight advantage in the game from having more pieces. I looked closely and noted that there was a number written at the bottom of the bar in white font that read \"0.1\" at 00:23, signaling that black's advantage at this time was 0.1 points. I understood that each piece has a point value according to its relative position, where a pawn is worth 1 point, bishops and knights are worth 3 points, rooks are worth 5 points, and queens are worth 9 points. I noticed that at 00:37, the black strip grew a bit larger from white's move, but black's advantage was not overwhelming at this point. As I continued watching, I saw that the strip fluctuated a few times but stayed fairly stable in the middle. Then, at 03:23, white's move caused the black bar to jump all the way up to the top of the bar so only a small fraction of white space remained. I read the advantage evaluation number at the bottom and saw that it read \"4.2\" at 03:23. Since this was the first time the value was over 4 points, I looked at the time on black's clock and saw that it read \"03:24\"." + }, + { + "key": "d8UESxnuVAY:f386c6b4bb9b8a9ddbc479c0652c416a7f334fa2", + "video_id": "d8UESxnuVAY", + "question": "Why does black move a knight to the g4 square of the graphically generated board in the top center of the screen?", + "answer_choice_0": "To pressure whites queen", + "answer_choice_1": "To pressure whites rook", + "answer_choice_2": "To check whites king", + "answer_choice_3": "To take whites queen", + "answer_choice_4": "To take whites bishop", + "answer_id": 0, + "answer": "To pressure whites queen", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched for black to move a knight to the g4 square on the graphically generated board in the top center of the screen which differs from the physical board. I saw that this occurred at 02:36. I understood that knights move in an L-shape: two squares in one direction, and then one square in another direction. I looked at the game board to determine that white's queen was within range of black's knight from the g4 move (two squares to the right, and one up). Therefore, I determined that black moved the knight to g4 to put pressure on white's queen." + }, + { + "key": "dAZZ1jUM_z4:4ad09da93062f7810ace4bcc19875095ee3b6204", + "video_id": "dAZZ1jUM_z4", + "question": "Which steps of the pancake cooking process appear in the recipe but not in the actual cooking segment?", + "answer_choice_0": "Melting butter and adding sugar to the mix.", + "answer_choice_1": "Adding butter to the pan and making the first pancake thin.", + "answer_choice_2": "Melting butter by fire and adding butter to the first pancake.", + "answer_choice_3": "Straining eggs and adding butter to the pan.", + "answer_choice_4": "Grating nutmeg and melting butter.", + "answer_id": 2, + "answer": "Melting butter by fire and adding butter to the first pancake.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the pancake cooking section and watched the entirety of it, from 05:49 to 07:49 and from 08:51 to 09:32. I then scrolled forward to the written recipe that appears at 10:31, paused the video, and read through it. I noticed two steps on the recipe that are not shown in the actual cooking. The recipe mentions setting fresh butter \"on the fire\" to \"stir it\". In the cooking segment, the cook opts instead for an already melted bowl of butter at 06:46. It also mentions frying the first pancake \"with a bit of butter\" but this is not shown at 08:53 when the cook drips her first pancake onto its grill." + }, + { + "key": "dAZZ1jUM_z4:4eca4c9d5d44c9c6239290f00b65ec726c3b251e", + "video_id": "dAZZ1jUM_z4", + "question": "If the cook followed the pancake recipe exactly, how many pancakes did the cook not add butter to when she cooked them?", + "answer_choice_0": "4.", + "answer_choice_1": "5.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I read the pancake recipe carefully at 10:31. I read that it directs the cook to \"fry the pancakes very thin; the first with a bit of butter, but not the others.\" This means that I must count the number of pancakes after the first pancake; or I can subtract 1 pancake from the total amount of pancakes to find out how many pancakes the cook does not add butter to. I found that the cook places the plate of pancakes down at 09:34. I counted at least 2 pancakes. I continued watching for a better view. At 09:57, she picks up 1 of the pancakes, leaving the other 2 on a plate. This totals 3 pancakes. Assuming that the cook followed the recipe exactly, if the first was cooked with butter, that means the other 2 were not. This means the answer is (2) 2." + }, + { + "key": "dAZZ1jUM_z4:7f63837712f8b2f777437f4c91c106c042d5bded", + "video_id": "dAZZ1jUM_z4", + "question": "What ingredient did the Irish Stew recipe recommend, but the cook did not add to the stew?", + "answer_choice_0": "Beets.", + "answer_choice_1": "Ham.", + "answer_choice_2": "Rosemary.", + "answer_choice_3": "Corn.", + "answer_choice_4": "Tomato.", + "answer_id": 1, + "answer": "Ham.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I found the recipe at 10:17. I identified the Irish Stew recipe from the title at the top of the screen. I read the text carefully and searched for any ingredient that was not integral to the recipe. I found the sentence, \"A small slice of ham is a great addition to this dish,\" indicating that ham is not integral to the recipe. I rewatched the segment where the cook prepares the stew to see if the cook adds ham. This segment is from 00:49 to 03:58. I did not see the cook add ham into the stew." + }, + { + "key": "dAZZ1jUM_z4:9caf5eae6ff4d7b379455140109e1618a871bb04", + "video_id": "dAZZ1jUM_z4", + "question": "While preparing her Irish Stew, what thing does the cook do with her onions that is in conflict with the text on-screen?", + "answer_choice_0": "She grills them instead of leaving them raw.", + "answer_choice_1": "She caramelizes them, instead of grilling them.", + "answer_choice_2": "She fries them instead of pickling them.", + "answer_choice_3": "She pickles them instead of caramelizing them.", + "answer_choice_4": "She slices them instead of dicing them.", + "answer_id": 4, + "answer": "She slices them instead of dicing them.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for the segment in the video where the cook is cutting the onions for the stew, which starts at 01:28. I noticed that the words \"Dice an onion\" appear at the bottom of the screen as well. She starts cutting the onion at 01:30, by first cutting the root part of the onion with a knife. The scene then cuts to the cook cutting in half some slices of onion at 01:33, which is not dicing an onion. I looked further to see if the onions were cut differently when she added them to the stew, but noticed at 02:21 that she added sliced, not diced onions to the stew. From this information, I understood that the text \"dice an onion\" at 01:28 did not match the actual cutting of the onion in the video." + }, + { + "key": "dAZZ1jUM_z4:a9a5539c98a080ca965ac49f87fd67837b0705b9", + "video_id": "dAZZ1jUM_z4", + "question": "When cooking the pancakes, which ingredient goes after the eggs but before the nutmeg?", + "answer_choice_0": "Sugar.", + "answer_choice_1": "Cream.", + "answer_choice_2": "Water.", + "answer_choice_3": "Butter.", + "answer_choice_4": "Flour.", + "answer_id": 3, + "answer": "Butter.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for the segment where the cook is mixing the pancake ingredients, which starts at 05:50. She first breaks and beats two eggs from 05:50 to 06:16. At 06:18, she strains the eggs into warm cream. She then adds butter to the mixture at 06:46, and adds nutmeg at 07:07. The ingredient that comes after eggs but before nutmeg is butter." + }, + { + "key": "dAZZ1jUM_z4:e01718d9500e9c78cebdcf5627f74671e939ae5e", + "video_id": "dAZZ1jUM_z4", + "question": "How many times did the cook take a bite from her food before the music starts?", + "answer_choice_0": "2.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video from the beginning and carefully counted each time that the cook took a bite from her food. I prepared to stop when I heard music. The cook took a bite of her food at 00:24, 09:42, 09:46, 09:54, and 09:59. The music started at 10:02, so I stopped counting. This equals 5 bites before the music started." + }, + { + "key": "dAZZ1jUM_z4:ed1c001e418ca31e8b91e4e1dd1ff5371e88cc5d", + "video_id": "dAZZ1jUM_z4", + "question": "How many pounds of potatoes would I need if I had 10 pounds of mutton loin and wanted to make Irish Stew?", + "answer_choice_0": "20 lbs.", + "answer_choice_1": "4 lbs.", + "answer_choice_2": "3 lbs.", + "answer_choice_3": "6 lbs.", + "answer_choice_4": "10 lbs.", + "answer_id": 0, + "answer": "20 lbs.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "In this video, there is no talking, so I looked for hints of measurements for Irish Stew and found a recipe that appears near the end of the video at 10:16. I read the list of ingredients to find the ratio between potatoes and mutton needed for the stew. The original recipe calls for four pounds of potatoes for two pounds of Mutton loin, which can be expressed mathematically as pounds of Mutton multiplied by 2, equals the pounds of potatoes needed for the stew. For this reason, if I had 10 pounds of mutton loin, I would need 20 pounds of potatoes to make Irish Stew." + }, + { + "key": "dAZZ1jUM_z4:f360f977cc851c68d32b224d1d4dd6d9a5e02b56", + "video_id": "dAZZ1jUM_z4", + "question": "What step of the Irish Stew preparation involves adding seasonings?", + "answer_choice_0": "Third step.", + "answer_choice_1": "Second step.", + "answer_choice_2": "First step.", + "answer_choice_3": "Fifth step.", + "answer_choice_4": "Fourth step.", + "answer_id": 4, + "answer": "Fourth step.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I located the segment where the cook starts preparing the Irish Stew to look at the moment she adds seasonings to the stew to figure out what step of the process is that. The cooking starts at 00:34. The first thing she does is peeling and slicing the potatoes, which she starts doing at 00:35. The second step she does is slicing an onion, which starts at 01:29. The third step starts at 01:47, where she layers the potatoes, meat, and onions on a cast iron skillet. At 02:51, she then adds seasonings to a jar of stock that is poured over the meat at 03:10 before putting the pan in the fire. I concluded that adding seasonings is the fourth step in the cooking process." + }, + { + "key": "dTp0c41XnrQ:026b556f4c6f5dfbf3c7e53475fb9f7f1bb27ed5", + "video_id": "dTp0c41XnrQ", + "question": "Early in the video, the narrator mentions that C-programming can be used to develop games; what is the genre of the video game that can be seen being played in the background when the narrator says this?", + "answer_choice_0": "Tower Defense.", + "answer_choice_1": "MOBA.", + "answer_choice_2": "Team-Based Shooter.", + "answer_choice_3": "RPG.", + "answer_choice_4": "Real Time Strategy.", + "answer_id": 1, + "answer": "MOBA.", + "question_type": "Event Occurence", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video, listening for the narrator to say that C-progamming can be used to develop games. At 00:22 I hear the narrator mention that C-programming can also be used for developing games and applications. I look at the game being played on the screen and it appears to be League of Legends. I can deduce that League of Legends is a video game in the MOBA genre." + }, + { + "key": "dTp0c41XnrQ:09ccd850663f7cf4e1018826facc3c852760a0dd", + "video_id": "dTp0c41XnrQ", + "question": "How many times does the main function in a C file appear in the video?", + "answer_choice_0": "24.", + "answer_choice_1": "21.", + "answer_choice_2": "32.", + "answer_choice_3": "18.", + "answer_choice_4": "28.", + "answer_id": 3, + "answer": "18.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "At 0.46, I listened to the narrator state, \"a mandatory main function is required in every C file.\" At the same time I saw that the main function is depicted as int (in blue) main (cream) () (in gold). Through the rest of the video, I saw the main function at 01:00, 01:46, 01:55, 02:30, 03:03, 03:42, 03:46, 03:55, 04:40, 05:06, 06:23, 07:08, 08:04, 08:37, 09:06, 09:48, and 10:11. I added the times I saw the main function and found the total to be 18." + }, + { + "key": "dTp0c41XnrQ:1eac86b2d62a79d4dafe60be192b6ee0a804b038", + "video_id": "dTp0c41XnrQ", + "question": "In the first three minutes of the video, how many times does the Backhand Index Pointing Left emoji appear?", + "answer_choice_0": "8.", + "answer_choice_1": "6.", + "answer_choice_2": "10.", + "answer_choice_3": "9.", + "answer_choice_4": "7.", + "answer_id": 0, + "answer": "8.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "In the first three minutes of the video, I saw the Backhand Index Pointing Left emoji appear at 00:46, 00:49, 01:01, 01:11, 01:47, 02:01, 02:05, and 02:33. I counted the number of times and found that the Backhand Index Pointing Left emoji appears 8 times in the first three minutes of the video." + }, + { + "key": "dTp0c41XnrQ:2eb713d9614e6e9fbbbd25f96e052f93af06df9f", + "video_id": "dTp0c41XnrQ", + "question": "What is the difference in the number of times the function printf appears in the line of code found in the section on switch statement in C language versus the section on printf and scanf in C language?", + "answer_choice_0": "1.", + "answer_choice_1": "0.", + "answer_choice_2": "2.", + "answer_choice_3": "3.", + "answer_choice_4": "4.", + "answer_id": 3, + "answer": "3.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video looking for the number of times the function printf appears in the line of code found in the section on switch statement in C language versus the section on printf and scanf in C language. At 02:05, I hear the narrator say to print something you can type printf. I continue to watch until the end of the segment and only see printf appears one time. I continue watching the video looking looking and listening for the section on switch statements. I see and hear the switch section beginning at 03:50 when the narrator gives the definition. At 04:10 I see one printf appear in the lines of code. At 04:15 I see two more lines of printf added to the lines of code. At 04:32 I see a fourth printf appear in the lines of code. To find the difference I know that the function printf appears in the line of code found in the section on switch statement in C language 4 times and it appears in the section on printf and scanf one time. Four minus one = Three." + }, + { + "key": "dTp0c41XnrQ:520f6eac6f59bc3e5eb3036d4bc8084437f7ae8a", + "video_id": "dTp0c41XnrQ", + "question": "When the narrator says that %d is a format specifier used for integer datatype and uses it in a line of code, what format specifier would be used if the datatype was the example found on the second row of the table found later in the video?", + "answer_choice_0": "%i.", + "answer_choice_1": "%c.", + "answer_choice_2": "%d.", + "answer_choice_3": "%f.", + "answer_choice_4": "%s.", + "answer_id": 3, + "answer": "%f.", + "question_type": "Event Occurence", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I begin watching the video by listening for the narrator to say that %d is a format specifier used for integer data types and what format specifier could be used for datatype with 15.123 as an example. At 02:18, and I hear the narrator say percentage D is used for integer datatype. I continue to watch the video. At 2:25, I see a chart with Common Format Specifiers and a column for Format specifiers, Used for, and Examples. Under examples I see the number 10.123 a floating value similar to 15.123. I look to the left and see the corresponding format specifier is %f." + }, + { + "key": "dTp0c41XnrQ:6d51e8fad424307cf25938797482ac28530c28a2", + "video_id": "dTp0c41XnrQ", + "question": "If you specify the data type as char, what format specifier do you include after printf?", + "answer_choice_0": "%d.", + "answer_choice_1": "%c.", + "answer_choice_2": "%f.", + "answer_choice_3": "%s.", + "answer_choice_4": "%i.", + "answer_id": 1, + "answer": "%c.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator explain that char is a data type used for characters or strings at 01:27. I then looked at the table provided at 02:25 and saw that the format specifier used for characters is %c. At 02:06, I saw that you place the format specifier after printf to print something." + }, + { + "key": "dTp0c41XnrQ:d682bad4a6dc157ddb2b6ce3158a56a63abdf8a4", + "video_id": "dTp0c41XnrQ", + "question": "How many times does the format specifier for a decimal integer appear in the video?", + "answer_choice_0": "9.", + "answer_choice_1": "4.", + "answer_choice_2": "13.", + "answer_choice_3": "18.", + "answer_choice_4": "21.", + "answer_id": 0, + "answer": "9.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator say, \"These are other format specifiers,\" at 02:25. Looking at the table, I saw that the format specifier for a decimal integer is depicted as %d. Throughout the entire video, I saw 1 %d at 02:18, 02:25, 02:36, 05:39, 07:31, 09:36, and 09:55. I saw 2 %d at 03:27." + }, + { + "key": "dTp0c41XnrQ:df0e5f6140ac2694eeabf5068159b121119c1f82", + "video_id": "dTp0c41XnrQ", + "question": "When the narrator says, \"if a equals 6 and b equals 9,\" what is the hastag on top of the screen an example of?", + "answer_choice_0": "Header file.", + "answer_choice_1": "Object file.", + "answer_choice_2": "Temporary file.", + "answer_choice_3": "Executable file.", + "answer_choice_4": "Source file.", + "answer_id": 0, + "answer": "Header file.", + "question_type": "Reading", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator discuss what a header file is and that this file ends in a dot h extension from 00:49 to 01:16. I then listened to the narrator say \"if a equals 6 and b equals 9,\" at 03:04. At the same time, I saw \"#include \" appear on top of the screen. I identified the hashtag having a header file due to the presence of a dot h extension." + }, + { + "key": "ddc_WzEDMNA:21f567f03d073fa3fb71ee2c4fc80eae657edc81", + "video_id": "ddc_WzEDMNA", + "question": "In which of the following settings can Ron Swanson be observed pointing to a pyramid graphic with his face on it?", + "answer_choice_0": "A birthday party.", + "answer_choice_1": "A filming set.", + "answer_choice_2": "A conference room.", + "answer_choice_3": "A hunting lodge.", + "answer_choice_4": "A basketball court.", + "answer_id": 4, + "answer": "A basketball court.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I paid attention to the video to find the scene where Ron Swanson points to a pyramid graphic \u2014 this scene first occurs at 01:04. I then observed the surroundings of the scene where Ron Swanson points to the graphic \u2014 the brick walls, light-colored laminated wooden floors with painted lines, and a scoreboard in the background indicate that this is a basketball court." + }, + { + "key": "ddc_WzEDMNA:40990bea9cd9ef9e32a29e65eaee81d0160edcef", + "video_id": "ddc_WzEDMNA", + "question": "How many rectangles are there on the first pyramid chart?", + "answer_choice_0": "45.", + "answer_choice_1": "30.", + "answer_choice_2": "75.", + "answer_choice_3": "15.", + "answer_choice_4": "60.", + "answer_id": 0, + "answer": "45.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a pyramid chart. I observed one for the first time from 01:04 to 01:05. I then counted 45 rectangles on that chart." + }, + { + "key": "ddc_WzEDMNA:4a69e799c02d67940c2c4d286d757bc3cbf7bb7b", + "video_id": "ddc_WzEDMNA", + "question": "In which direction does Ron Swanson point his golden gun?", + "answer_choice_0": "At the sky.", + "answer_choice_1": "At the ground.", + "answer_choice_2": "To his left.", + "answer_choice_3": "At the camera.", + "answer_choice_4": "To his right.", + "answer_id": 2, + "answer": "To his left.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video looking for a scene where Ron Swanson has a golden gun and found him holding one at 01:02. I observed him point it to his left with his right hand from 01:02 to 01:03." + }, + { + "key": "ddc_WzEDMNA:68316733a1d418a37100b8bdb0aa4c72a3c9cbb0", + "video_id": "ddc_WzEDMNA", + "question": "What material coats the Ron Swanson's shoes while he sits on newspapers?", + "answer_choice_0": "Red paint.", + "answer_choice_1": "Black soot.", + "answer_choice_2": "Newspaper ink.", + "answer_choice_3": "Brown leather.", + "answer_choice_4": "Plastic wrap.", + "answer_id": 0, + "answer": "Red paint.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a spot where Ron Swanson sits on newspapers. I found this moment at 02:10 and observed that his shoes are covered in red paint." + }, + { + "key": "ddc_WzEDMNA:6fc6cd76f3f7fc46f1df1bd1aa7f82d6c1e56813", + "video_id": "ddc_WzEDMNA", + "question": "When \"Swanson\" is said for the fifth time, what is the person who says it wearing?", + "answer_choice_0": "A gray suit and a white bow.", + "answer_choice_1": "A brown polo and a wristwatch.", + "answer_choice_2": "A pink polo and a wristwatch.", + "answer_choice_3": "A brown suit and red tie.", + "answer_choice_4": "A black suit and a yellow tie.", + "answer_id": 4, + "answer": "A black suit and a yellow tie.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and counted the number of times the word \"Swanson\" was spoken until I reached the fifth occurrence. I noted the first five occurrences at 00:00, 00:01, 00:02, 00:02-00:03 and 00:04. At the fifth occurrence at 00:04, I observed that the person who said it wore a black suit and a yellow tie." + }, + { + "key": "ddc_WzEDMNA:bbfd2240e2e52d2d4dcc2a56ce3cc1d04d841175", + "video_id": "ddc_WzEDMNA", + "question": "What kind of candy is sitting on the table when April holds up the doll and calls it \"Ron?\"", + "answer_choice_0": "Sprinkles.", + "answer_choice_1": "Candy canes.", + "answer_choice_2": "Marshmellows.", + "answer_choice_3": "Chocolate.", + "answer_choice_4": "Gum drops.", + "answer_id": 1, + "answer": "Candy canes.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the moment where April holds up a doll and calls it \"Ron Swanson.\" I found this spot between 01:39-01:40. I looked at the table and saw that it was covered in candy canes." + }, + { + "key": "dz--r7BfvNk:35e4e8fd95617ddd856b75d0978e8d44b15d2b6d", + "video_id": "dz--r7BfvNk", + "question": "How does the color of the female protagonist's outfit change over the course of the video?", + "answer_choice_0": "She wears a red outfit, then a blue one.", + "answer_choice_1": "She wears a black outfit, then a white one.", + "answer_choice_2": "She wears a white outfit, then a black one.", + "answer_choice_3": "She wears a black outfit, and then a gray one.", + "answer_choice_4": "She doesn't change outfits.", + "answer_id": 1, + "answer": "She wears a black outfit, then a white one.", + "question_type": "State Changes", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The female protagonist is first shown at 00:00, as she is the woman with a prominent role in the story, and is, in fact, the only notable woman in the video. At 00:00, and more clearly at 00:01, the female protagonist is wearing black. She wears the same outfit until 02:28, at which point she is shown wearing white \u2014 this is made most clear at 02:31. Therefore, the female protagonist wears a black outfit, then a white one." + }, + { + "key": "dz--r7BfvNk:67143439e40b0b78ec44f761a441f3884c178ff2", + "video_id": "dz--r7BfvNk", + "question": "At the end of the video, where does the female protagonist wake up?", + "answer_choice_0": "In a tent.", + "answer_choice_1": "In a market stall.", + "answer_choice_2": "In a bar.", + "answer_choice_3": "In a junkyard.", + "answer_choice_4": "In a cave.", + "answer_id": 0, + "answer": "In a tent.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The female protagonist struggles against the forces of poison at the 02:28 mark. From 02:28-02:30, she wakes up in a black tent, fastened to the ground with ropes, surrounded by palm trees. Therefore, she wakes up in a tent." + }, + { + "key": "dz--r7BfvNk:e064ac29e30d0fb8cb740aad8a915f438f4d9e08", + "video_id": "dz--r7BfvNk", + "question": "Why is the woman attending the meeting in the room where she is ambushed?", + "answer_choice_0": "To find the rescuer.", + "answer_choice_1": "To try the tea.", + "answer_choice_2": "To break up with her lover.", + "answer_choice_3": "To see a necklace.", + "answer_choice_4": "To cure her poisoning.", + "answer_id": 3, + "answer": "To see a necklace.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I paid attention to the video from the time that the woman arrives at the meeting, which starts at 00:37. I then listened for the purpose of the meeting, which is revealed at 00:40 when the woman demands to see a necklace from the meeting's broker. Therefore, it can be inferred that her goal at the meeting is to see and obtain a necklace." + }, + { + "key": "dz--r7BfvNk:faadc6d72d5ac683d0e7a87f9f864bbc282e5ff0", + "video_id": "dz--r7BfvNk", + "question": "Where do the woman and her rescuer first speak to one another?", + "answer_choice_0": "At the ambush.", + "answer_choice_1": "In the tent.", + "answer_choice_2": "On the street.", + "answer_choice_3": "At the bar.", + "answer_choice_4": "In the desert.", + "answer_id": 0, + "answer": "At the ambush.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video, I paid attention to the locations and the interactions between the woman and her rescuer, to find out when they first spoke. The rescuer first speaks to the woman at 01:51, in the ambush room. She first speaks to him 02:18, also in the room where she was ambushed - therefore, they first speak to one another in the ambush room." + }, + { + "key": "dz--r7BfvNk:fc8f207d88e3b93a5aaf9c150e441a06aff57c82", + "video_id": "dz--r7BfvNk", + "question": "What does the rescuer tell the woman when he traps her lover?", + "answer_choice_0": "\"You decide.\"", + "answer_choice_1": "\"He never loved you.\"", + "answer_choice_2": "\"See him for who he is.\"", + "answer_choice_3": "\"He cheated\"", + "answer_choice_4": "\"Only one survives.\"", + "answer_id": 0, + "answer": "\"You decide.\"", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 01:54, the rescuer in the white suit holds a knife to the lover's throat and says to the woman, \"You decide.\"" + }, + { + "key": "e1Os-U5XA-E:229d9294d7f55d7e0518079f95e2de0cdff7ec04", + "video_id": "e1Os-U5XA-E", + "question": "How many times do the men both yell into the tape recorder?", + "answer_choice_0": "4 times.", + "answer_choice_1": "5 times.", + "answer_choice_2": "1 time.", + "answer_choice_3": "7 times.", + "answer_choice_4": "2 times.", + "answer_id": 1, + "answer": "5 times.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first watched the video at 01:42 when both men are standing up at this time. Then the man in the white suit starts shouting into the tape recorder at 01:43. The man in the burgundy shirt does the same action next. They alternate shouting abrupt words into the tape recorder at 01:43 - 01:47." + }, + { + "key": "e1Os-U5XA-E:33accc4895198851ee14c7bd8a99a3fa3c26272d", + "video_id": "e1Os-U5XA-E", + "question": "How many times does the officer stand up from his chair?", + "answer_choice_0": "5.", + "answer_choice_1": "0.", + "answer_choice_2": "6.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the officer. When he appears on-screen at 00:06, he is sitting in his chair. I looked for the moments where he stood up. The first was at 01:15. At 01:36, he stands up again. Between 01:43-01:47, he bends over and straightens back up, but I did not count those since he was not rising from the chair. At 03:00, he stands up from the chair again. In total, he stands up 3 times." + }, + { + "key": "e1Os-U5XA-E:6074f47c5747aea10de3f72c82f7fb6b3c546772", + "video_id": "e1Os-U5XA-E", + "question": "What does the suspect do after the officer says he \"feels the walls tumbling down around him\"?", + "answer_choice_0": "Tries to stand up.", + "answer_choice_1": "Runs his hands through his air.", + "answer_choice_2": "Folds his arms over his chest..", + "answer_choice_3": "Stops the recording.", + "answer_choice_4": "Holds his hands out in front.", + "answer_id": 4, + "answer": "Holds his hands out in front.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the moment when the officer says the suspect \"feels the walls tumbling down around him\". This happens between 01:16-01:18. I looked for the suspect after that. At 01:19, he holds his hands up in front of his body." + }, + { + "key": "e1Os-U5XA-E:6c30a24cba7a5b051490af6b4a908f64e4ae792b", + "video_id": "e1Os-U5XA-E", + "question": "Why does the suspect re-start the recording?", + "answer_choice_0": "To record the officer admitting his guilt.", + "answer_choice_1": "To tape over the interview.", + "answer_choice_2": "To record himself playing insane.", + "answer_choice_3": "To express his dissatisfaction with the interview.", + "answer_choice_4": "To apologize to the victim's family.", + "answer_id": 0, + "answer": "To record the officer admitting his guilt.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the moment the suspect turned on the recording. At 02:07, the suspect pulls the recorder towards him. At 02:12, he turns the recording on. I looked at the moments before turning it on. At 01:57, the suspect begins to look at the officer and the tape recorder. He appears to be realizing something. I continued watching the video after he turned the recording on. At, 02:17, he starts to question the officer. Between 02:17-03:07, he interrogates the officer. At 03:07, the officer shouts \"I killed Stephanie.\" Therefore, the suspect started the recording to record the officer admitting his guilt." + }, + { + "key": "e1Os-U5XA-E:f1eb82c874ea10b10fa5935d21ee83ce02ab9d33", + "video_id": "e1Os-U5XA-E", + "question": "In this video, at what point did the sketch's dramatic power shift to the man in burgundy?", + "answer_choice_0": "He never gets dramatic power.", + "answer_choice_1": "When the police sergeant enters.", + "answer_choice_2": "After the policeman finishes his story.", + "answer_choice_3": "When he protests the policeman's first accusation.", + "answer_choice_4": "When the policeman starts getting carried away.", + "answer_id": 2, + "answer": "After the policeman finishes his story.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I examine the story of the sketch. From the beginning until about 02:05, the policemanis the one who speaks, interrogating the man in burgundy and getting carried away with a fanciful story describing how the man in burgundy killed Stephanie. After this, however the man in burgundy begins to narrate his own fanciful story where it is in fact the policeman who killed Stephanie. It is at this point, then, after the policeman finishes his story, where the man in burgundy has all the dramatic power." + }, + { + "key": "e1cbnb2uw_I:3e89ec1c3ec66266e61fa102929281bf46c96605", + "video_id": "e1cbnb2uw_I", + "question": "Who eats the Pac-Man cookies over the course of the video?", + "answer_choice_0": "Ethan.", + "answer_choice_1": "The first interviewee.", + "answer_choice_2": "The last interviewee.", + "answer_choice_3": "Kari.", + "answer_choice_4": "The second interviewee.", + "answer_id": 0, + "answer": "Ethan.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the Pac-Man cookies in each frame to see if anyone ate them. At 00:12, a boy in a red shirt took a bite of one -- he is identified as Ethan by the girl in the green shirt at 00:09. At 01:38, the first interviewee reached for a Pan-Man cookie but I never saw him eat it. I watched the rest of the video and no one touches the cookies, so I concluded the answer is Ethan." + }, + { + "key": "e1cbnb2uw_I:7e7d023ed2258aeac693b72f8e3edf693963785d", + "video_id": "e1cbnb2uw_I", + "question": "If the man wearing orange and red had not eaten any of the completed PAC-man cookies with blueberries, how many whole cookies with blueberries would have been on the plate when the couple interviewed the roommate candidate dressed like a warrior?", + "answer_choice_0": "10", + "answer_choice_1": "7", + "answer_choice_2": "12", + "answer_choice_3": "0", + "answer_choice_4": "3", + "answer_id": 1, + "answer": "7", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I had to determine how many cookies the man wearing orange and red ate. I identified him at 00:09. I then saw him bite into a completed PAC-man cookie with a blueberry at 00:12. I did not see him eat any other cookies during the video. I then observed the plate of PAC-man cookies on the table when the couple interviews the roommate candidate dressed like a warrior at 01:39. I counted six cookies with blueberries on them and added 1 to account for the cookie eaten by the man. Therefore, the total number of cookies with blueberries on the plate would have been 7, if the man had not eaten a cookie." + }, + { + "key": "eK00WgK5zic:1789432f604e8c9b8fa64d1fd125c10b834ef14c", + "video_id": "eK00WgK5zic", + "question": "How many different clothing items and accessories does the performer wear in the video?", + "answer_choice_0": "2", + "answer_choice_1": "7", + "answer_choice_2": "8", + "answer_choice_3": "11", + "answer_choice_4": "10", + "answer_id": 4, + "answer": "10", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to the performer's outfit changes. At 00:37 he initially wears three garments: leather tights, a suit jacket, and a sweater. He also wears a wristwatch. This totals 4 items. At 03:27 he wears a star mask, which adds one item. At 4:29 he puts on a wig cap, a fake nose and a fanny pack after stripping down to a purple singlet. This adds 4 additional items. At 5:17 he puts on a scarf, adding one item. When added together, 4+1+4+1, the performer wears a total of 10 different articles of clothing and accessories throughout the video." + }, + { + "key": "eK00WgK5zic:2afff41a0739361ee11b62f78888e517148d99e3", + "video_id": "eK00WgK5zic", + "question": "How many times does the performer say \"theatre\" in the final minute of the video?", + "answer_choice_0": "Four.", + "answer_choice_1": "Three.", + "answer_choice_2": "One.", + "answer_choice_3": "Two.", + "answer_choice_4": "None.", + "answer_id": 0, + "answer": "Four.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the final minute of the video, from 06:40 to 07:40, listening and counting how many times the performer says the word \"theatre\" - he says it once at 07:12, and again at 07:13. He says it for a third time from 07:14-07:15, and a fourth and final time at 07:25." + }, + { + "key": "eK00WgK5zic:824aa2235981bc539768938452628757d98177bd", + "video_id": "eK00WgK5zic", + "question": "What is the third prop clothing item that the performer puts on for his performance?", + "answer_choice_0": "A golden star headpiece.", + "answer_choice_1": "A fanny pack.", + "answer_choice_2": "A cap over his hair.", + "answer_choice_3": "A long prosthetic nose.", + "answer_choice_4": "A pair of black leather pants.", + "answer_id": 3, + "answer": "A long prosthetic nose.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the addition of prop clothing accessories that the performer puts on throughout the video: the first clothing prop he puts on is the gold star headpiece at 03:22, the second one he puts on is the hair cap over his hair at 04:19, and the third clothing prop he puts on is the long prosthetic nose at 04:33." + }, + { + "key": "eK00WgK5zic:8649cd0ee9807394f14f05a6fa684fb2e157611d", + "video_id": "eK00WgK5zic", + "question": "What does the performer do between the first and third time he says the word, \"theatre?\"", + "answer_choice_0": "He shouts and gestures with his hands.", + "answer_choice_1": "He gestures with his hands and exits the stage.", + "answer_choice_2": "He throws confetti and takes a bow.", + "answer_choice_3": "He laughs and throws confetti.", + "answer_choice_4": "He smiles and takes a bow.", + "answer_id": 1, + "answer": "He gestures with his hands and exits the stage.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for the first time the performer says \"theater\". I found this moment at 01:34. I continued watchiing to observe his actions and observed him gesture with his hands and exit the stage while saying theatre for the second time between 01:36-01:37. I continued watching and saw him re-enter the stage as he says theatre for a third time at 01:47. I concluded that he gestures with his hands and exits the stage between the first and third times he says the word, \"theatre.\"" + }, + { + "key": "eK00WgK5zic:8e9f2a3d4fa8531e4b54f24066f2165c2a3e48d8", + "video_id": "eK00WgK5zic", + "question": "What is the second item the performer throws on the stage?", + "answer_choice_0": "His shirt.", + "answer_choice_1": "His jacket.", + "answer_choice_2": "His pants.", + "answer_choice_3": "His cape.", + "answer_choice_4": "His hat.", + "answer_id": 1, + "answer": "His jacket.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:58 when the performer throws his first item, confetti, into the air. At 01:01 there is a clear shot of the confetti landing on the stage. I continued watching until 02:03 when the performer takes off his jacket. A clear shot of the jacket lying on the stage appears at 02:05. I concluded that a jacket is the second item the performer throws on the stage." + }, + { + "key": "eK00WgK5zic:a7676df995eaa478bb179b339f5ecf075c8a91e1", + "video_id": "eK00WgK5zic", + "question": "Did the man throw confetti on purpose before 01:00?", + "answer_choice_0": "He did not throw confetti before 01:00.", + "answer_choice_1": "He threw confetti on purpose after 01:00.", + "answer_choice_2": "He threw confetti on purpose before 01:00.", + "answer_choice_3": "He threw confetti by accident before 01:00.", + "answer_choice_4": "He did not throw confetti at all.", + "answer_id": 2, + "answer": "He threw confetti on purpose before 01:00.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to when the performer threw confetti. I marked that he began throwing the confetti at 00:58. I also noticed he did so with flourish and deliberate action\u2014it couldn't have been by accident." + }, + { + "key": "eK00WgK5zic:f82fa1ed9fe1cf6b5c0164e2068ae6e701486c1a", + "video_id": "eK00WgK5zic", + "question": "What is the final change to the performer's second outfit before he puts on the scarf?", + "answer_choice_0": "He takes off his hat.", + "answer_choice_1": "He twists his fanny pack.", + "answer_choice_2": "He takes off his belt.", + "answer_choice_3": "He pulls up his socks.", + "answer_choice_4": "He pulls up his hood.", + "answer_id": 1, + "answer": "He twists his fanny pack.", + "question_type": "State Changes", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the performer change from his first outfit into a second outfit, from the moment he takes off his jacket at 02:03 until the moment he puts on a fake nose at 04:23, nearly completing his look. At 04:44, the performer twists his fanny pack so that its in front of him, adding one additional change to the outfit. At 5:17 he puts on the scarf, making the twisting of the fanny pack the final change to his outfit before the scarf." + }, + { + "key": "eYgEGfmVhm4:1e4cf7a5762a820d8e190fdaf9d3f21a4c2f60f6", + "video_id": "eYgEGfmVhm4", + "question": "What do the woman with blue braids and her male student do after warming up on the beach?", + "answer_choice_0": "They put on their snorkel and diving gear.", + "answer_choice_1": "They proceed to get in the water.", + "answer_choice_2": "They put on their diving suits.", + "answer_choice_3": "They take some time to meditate.", + "answer_choice_4": "They motivate each other.", + "answer_id": 3, + "answer": "They take some time to meditate.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched in the video for the moment where the woman in blue braids is on the beach with her male student and found that it starts at 05:05. From 05:06 through 05:12 I observed them stretch and warm up. The scene cuts at 05:13, and I observed them kneeling on the sand with their eyes closed while breathing deeply through 05:20." + }, + { + "key": "eYgEGfmVhm4:4775a5762c552fba75248879fe53b69c8fdb1fbc", + "video_id": "eYgEGfmVhm4", + "question": "Where is the woman with blue braids when the voiceover talks about creating a safe space for discussions?", + "answer_choice_0": "A cliff.", + "answer_choice_1": "An office.", + "answer_choice_2": "Underwater.", + "answer_choice_3": "A park.", + "answer_choice_4": "A beach.", + "answer_id": 4, + "answer": "A beach.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched for the segment where the voiceover discussed creating a safe space for discussions and heard it from 05:34-05:36. I observed that the woman with blue braids was walking along a beach while this was stated." + }, + { + "key": "eYgEGfmVhm4:772c1461ec909d2326df000d43597bd067e2d170", + "video_id": "eYgEGfmVhm4", + "question": "What is the male-to-female ratio in the group of students drinking beer with the woman with blue braids at the shore? Exclude the instructor.", + "answer_choice_0": "3:2.", + "answer_choice_1": "1:3.", + "answer_choice_2": "2:1.", + "answer_choice_3": "3:1.", + "answer_choice_4": "1:2.", + "answer_id": 4, + "answer": "1:2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the segment where the woman with blue braids is sitting on the sand with her students laughing and sharing beers, and found that it begins at 05:53. I counted 4 people total, 1 of which was the woman with blue braids. Of those 4, I counted 3 women and 1 man. To find the ratio of men to women among the students, I excluded the woman with blue braids and counted 1 man and 2 women." + }, + { + "key": "eYgEGfmVhm4:c87efabb86676018f38956894a6887938d12f965", + "video_id": "eYgEGfmVhm4", + "question": "What aquatic sports are presented in the video when the statistics about humans and time spent indoors are shared on the screen?", + "answer_choice_0": "Jet skiing and rafting.", + "answer_choice_1": "Kiteboarding and swimming.", + "answer_choice_2": "Scuba diving and snorkeling.", + "answer_choice_3": "Paddle boarding and surfing.", + "answer_choice_4": "Sailing and kayaking.", + "answer_id": 3, + "answer": "Paddle boarding and surfing.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the segment where a white text over a shot of a female surfer walking with her board reads \"HUMANS SPEND 90% OF THEIR LIVES INSIDE\" starting at 00:43. I continued watching and noted each aquatic sport that appeared as this text remained on the screen. The first sport was paddle boarding at 00:44. Next, surfing is shown at 00:45. Then, the text graphic fades away." + }, + { + "key": "er0gMDb7F4c:1277c8d79953953883bf797d41db43313bb5e85c", + "video_id": "er0gMDb7F4c", + "question": "What happens as a result of the man in a green sweatband hitting the giant tennis ball at 13:06?", + "answer_choice_0": "The tennis ball hits the net.", + "answer_choice_1": "The tennis ball ricochets off the ground.", + "answer_choice_2": "The tennis ball knocks down his opponent.", + "answer_choice_3": "The tennis ball breaks his racket.", + "answer_choice_4": "The tennis ball hits a tree.", + "answer_id": 2, + "answer": "The tennis ball knocks down his opponent.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to 13:06 and watched the action to see what happened as a result the man in the green sweatband hitting the tennis ball. I observed that, after the man in the green sweatband hit the tennis ball, the tennis ball knocked down his opponent at 13:09." + }, + { + "key": "er0gMDb7F4c:38bd561d13f7c6cf0db460f1211e39fe7d08880e", + "video_id": "er0gMDb7F4c", + "question": "What inanimate animal is positioned behind the man holding a teacup between 09:28 and 09:31?", + "answer_choice_0": "A dog.", + "answer_choice_1": "A horse.", + "answer_choice_2": "A bear.", + "answer_choice_3": "A cat.", + "answer_choice_4": "A zebra.", + "answer_id": 2, + "answer": "A bear.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the part of the video with the man holding a teacup at 09:28. I observed that there was an inanimate bear positioned behind him. I continued watching until 09:31 to ensure no other inanimate animals appeared onscreen." + }, + { + "key": "er0gMDb7F4c:45720bdd584a344862c67155b7b31ef08da1aecb", + "video_id": "er0gMDb7F4c", + "question": "Who is the referee in the tennis match?", + "answer_choice_0": "The man in the green headband's brother.", + "answer_choice_1": "The man in the green headband's grandmother.", + "answer_choice_2": "The man in the green headband's landlord.", + "answer_choice_3": "The man in the green headband's boss.", + "answer_choice_4": "The man in the green headband's mother.", + "answer_id": 0, + "answer": "The man in the green headband's brother.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 11:17, I noticed the man in the green headband's brother sitting in the referee seat during the tennis match. He's watching from the side of the court in a high chair and making judgement calls on the game as the man in the green headband and his opponent are playing against one another. It is implied that the relationship between the two men is that of brothers, when the mustached man gestures to his brother at 09:03 at says they have the same last name, implying close familial relation. That they are about the same age suggests that the two are brothers." + }, + { + "key": "er0gMDb7F4c:795a78709cc3c89cc66cf0dbb33b5ddbd64b95ac", + "video_id": "er0gMDb7F4c", + "question": "When does the fifth shot that the old man is in end?", + "answer_choice_0": "At 13:58.", + "answer_choice_1": "At 00:58.", + "answer_choice_2": "At 08:50", + "answer_choice_3": "At 05:58.", + "answer_choice_4": "At 01:58.", + "answer_id": 1, + "answer": "At 00:58.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First I watched the video, and counted the shots that the old man is in, starting with the first one. The old man first appeared from 00:43 to 00:45, the second ran from 00:46 to 00:47, the third ran from 00:47 to 00:49, and the fourth ran from 00:51 to 00:55. At this point, I counted the fifth shot the old man was in, which started at 00:55. I then watched the scene, and noted its end time at 00:58." + }, + { + "key": "er0gMDb7F4c:9ad4001df14623404dd9e5314217e91d5c02c77a", + "video_id": "er0gMDb7F4c", + "question": "How many times is the man in the green sweatband shown hitting the tennis ball before ending up in the final match point?", + "answer_choice_0": "10.", + "answer_choice_1": "6.", + "answer_choice_2": "8.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the time the man with the green sweatband began to hit the ball, starting with the first hit at 12:25. I watched him hit it a second time at 12:28, and then a third time at 12:34. I then watched him hit it for a fourth time at 12:39, totalling 4 hits in the round that takes him to the final match point, which occurs subsequently." + }, + { + "key": "er0gMDb7F4c:b62477346b942d364eb942b30a33ab7926ae0aa0", + "video_id": "er0gMDb7F4c", + "question": "What is the primary color of the jacket the man is wearing as he lounges by the pool and reads a book?", + "answer_choice_0": "Blue.", + "answer_choice_1": "Pink.", + "answer_choice_2": "Green.", + "answer_choice_3": "Black.", + "answer_choice_4": "Yellow.", + "answer_id": 2, + "answer": "Green.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I found the man in a jacket reading a book by the pool starting at 00:17. I noticed that the primary color of his jacket is green. I then watched the rest of the video to ensure there were no other instances of the man reading a book by the pool." + }, + { + "key": "fRCohICNVws:07452ed34089172c37221aa8a1284d9a62fefa17", + "video_id": "fRCohICNVws", + "question": "What sound is happening when the girl with brown hair wears a magician's cape?", + "answer_choice_0": "A dog is barking.", + "answer_choice_1": "A woman is laughing.", + "answer_choice_2": "A man is screaming.", + "answer_choice_3": "A baby is crying.", + "answer_choice_4": "A cat is meowing.", + "answer_id": 3, + "answer": "A baby is crying.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I observed the girl with brown hair wearing a magician's cape from [01:45 - 01:48]. I listened to what sounds were taking place and observed the sound of a baby crying. I then watched the rest of the video to ensure there were no other sections where the girl with brown hair was wearing a magician's cape." + }, + { + "key": "fRCohICNVws:2f099e118efdb4ed612b5deaf76cab75d334edae", + "video_id": "fRCohICNVws", + "question": "What color hair does the girl with braces have when she first appears onscreen?", + "answer_choice_0": "Black.", + "answer_choice_1": "Blonde.", + "answer_choice_2": "Purple.", + "answer_choice_3": "Brown.", + "answer_choice_4": "Red.", + "answer_id": 1, + "answer": "Blonde.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to the people onscreen. The three people from 00:00 to 00:21 do not have braces. I noticed that the girl at 00:22 has braces, and I observed that her hair is blonde." + }, + { + "key": "fRCohICNVws:327ff2fe802dcd88daade97e5970209ddeb3b22f", + "video_id": "fRCohICNVws", + "question": "What is depicted in the two art prints that are hanging above the couch?", + "answer_choice_0": "A sun and a moon.", + "answer_choice_1": "Monet paintings.", + "answer_choice_2": "A cupcake and a painting of a snowy landscape with a house.", + "answer_choice_3": "An ice cream sundae and a fancy cake. (3) Cherry blossom trees.", + "answer_choice_4": "A crouching tiger and a dragon flying in the sky.", + "answer_id": 2, + "answer": "A cupcake and a painting of a snowy landscape with a house.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the couch at 00:00 and observed the two art prints hanging on the wall above the couch. I continued watching for a wider view, which arrived at 00:12. I observed the art prints. The one on the left is a pink and white cupcake with sprinkles. The one on the right is a dark brown house and a yard covered in snow." + }, + { + "key": "fRCohICNVws:486fdabdf6441e0755418714a0213e7ef94d565b", + "video_id": "fRCohICNVws", + "question": "What is being learned on the whiteboard at timecode 4:35?", + "answer_choice_0": "Matrices.", + "answer_choice_1": "Quadratic equations.", + "answer_choice_2": "Variables.", + "answer_choice_3": "Long division.", + "answer_choice_4": "Square roots.", + "answer_id": 2, + "answer": "Variables.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I paused the video at 4:35 to see what was written on the whiteboard. The whiteboard has two equations on it, both unfinished. One is: 2x-3y=12, and the second is: 3x+2y=6. Both of these equations are about solving variables." + }, + { + "key": "fRCohICNVws:c5652cd8728855985a3165284867f3a9bedac2a9", + "video_id": "fRCohICNVws", + "question": "What is the girl doing at 01:02?", + "answer_choice_0": "Putting her doll's head back on.", + "answer_choice_1": "Staring at the picture of her adopted sister in braces.", + "answer_choice_2": "Crying in front of her parents.", + "answer_choice_3": "Adjusting the pillows on the couch.", + "answer_choice_4": "Undoing her braids.", + "answer_id": 0, + "answer": "Putting her doll's head back on.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "To accurately determine what the girl is doing at 01:02, I started watching at 01:00 and saw that the girl is holding the body of the doll in one hand and the head of the doll in her other hand. I continued watching to see what she does. At 01:02, she reattaches the doll's head to its body and stores it in a drawer at 01:03." + }, + { + "key": "gBQLXfLJxH4:53ba57aec3e4006913a7aa1d34b638f1303b8344", + "video_id": "gBQLXfLJxH4", + "question": "What are the colors used to represent each team?", + "answer_choice_0": "Light blue for the man with dark hair, and dark blue for the man with white hair.", + "answer_choice_1": "Green for the man with dark hair, and blue for the man with white hair.", + "answer_choice_2": "No colors are assigned to each team.", + "answer_choice_3": "Beige for the man with dark hair, and green for the man with white hair.", + "answer_choice_4": "Blue for the man with dark hair, and green for the man with white hair.", + "answer_id": 4, + "answer": "Blue for the man with dark hair, and green for the man with white hair.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked at the beginning of the drinking game where the scores appear for the first time onscreen at 00:30 on either side of the frame. The score in the lower left corner of the frame is colored blue. The score in the lower right corner is marked green. I continued to watch as the blond-haired man told a joke that made the brown-haired man struggle not to spit his beer out. When the brown-haired man finally spit his beer out, I observed that a \"ding\" sound occurred and the green score in the lower right corner changed from 0 to 1. I understood this to mean that the blond-haired man scored a point. Therefore, the text in blue is the brown-haired man's score and the text in green is the blond-haired man's score." + }, + { + "key": "gBQLXfLJxH4:91951c213c1b964f102b3714cb8f8d17d5d8d1b4", + "video_id": "gBQLXfLJxH4", + "question": "Of the several glass beers in the video, how many of them have less liquid at the end than at the beginning?", + "answer_choice_0": "2.", + "answer_choice_1": "7.", + "answer_choice_2": "3.", + "answer_choice_3": "6.", + "answer_choice_4": "0.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for all the glass mugs of beer. At 00:30, I counted three glass mugs on a poster to the left of the brown-haired man, two glass mugs on a poster to the right of the blond-haired man, and two glass mugs on the table between them. At 00:30 I also observed that the mug closest to the man with brown hair was about half full while the mug closest to the man with blond hair was about three-quarters full. I kept watching and noticed the men drinking from the glasses of beer on the table throughout the video. At 06:03, I noticed that the brown-haired man's glass was almost empty and the blond-haired man's glass was about a quarter full. The images at 06:03 on the posters on the wall showed the same volume of liquid. Therefore, two glasses had less liquid at the end than at the beginning." + }, + { + "key": "gBQLXfLJxH4:bb4a14fdd00619ce3bcc967fb47477f2b02d4500", + "video_id": "gBQLXfLJxH4", + "question": "After the two men begin to play the drinking game, how many times does the man with blond hair stand all the way up?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "0.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video to understand the context of the drinking game. I identified from the words \"Points\" on the bottom left and right corners of the screen that the drinking game began at 00:30. I then continued watching and paid attention to each time the man with blond hair stood all the way up. I noticed that he stood up at 01:13. I noticed that he stood partially up at 02:55, but he sat down again so I did not count this occurrence. I continued watching and noticed that he stood all the way up three more times, at 03:35, 04:38, and 05:29. So the man with blond hair stood up a total of four times during the game." + }, + { + "key": "gBQLXfLJxH4:c42052348e80276ceb7c665256f1143c12f248b8", + "video_id": "gBQLXfLJxH4", + "question": "Out of all the jokes, which one needed to be repeated twice due to the man in the white hair laughing uncontrollably?", + "answer_choice_0": "The joke about the janitor supplies.", + "answer_choice_1": "The joke about the hillbilly.", + "answer_choice_2": "The joke about the grandfather on life support.", + "answer_choice_3": "The joke about rednecks.", + "answer_choice_4": "The joke about ants in the pants.", + "answer_id": 4, + "answer": "The joke about ants in the pants.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "For this question, I needed to listen carefully to all the jokes to locate the one that was repeated twice. I noticed that the joke about ants in the pants started at 02:53. Then I detected the man with the white hair. He starts to burst out laughing before the man with the brown hair could finish. The man with the brown hair starts telling the joke again at 03:01. After that, there was no other joke is retold." + }, + { + "key": "gBQLXfLJxH4:f4f119073eda70dc1890824c9c1c74a9ef39e809", + "video_id": "gBQLXfLJxH4", + "question": "What was the score after the fifth joke?", + "answer_choice_0": "2 - 2.", + "answer_choice_1": "1 - 4.", + "answer_choice_2": "0 - 4.", + "answer_choice_3": "1 - 2.", + "answer_choice_4": "2 - 3.", + "answer_id": 1, + "answer": "1 - 4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and counted each joke until I got to the fifth one, which occurred at 02:35. I watched the man with brown hair spit his beer, laughing at the joke. As the blond-haired man laughed, I heard a ding noise and noticed that the score in the bottom right of the screen changed from 3 to 4. The score in the bottom left of the screen stays the same as the man with brown hair spits his breaks out in laughter the score at 1. Therefore, the score is 1 to 4 after the fifth joke is told." + }, + { + "key": "gBQLXfLJxH4:fd5c97dcd928b90d9ef0420cf6cddad689bb512c", + "video_id": "gBQLXfLJxH4", + "question": "When the two men begin to play the drinking game at 00:31, what is the first question asked by the man in the denim jeans and blonde hair?", + "answer_choice_0": "\"Can beer make you happier?\"", + "answer_choice_1": "\"Can beer make you smarter?\"", + "answer_choice_2": "\"Can beer make you more social?\"", + "answer_choice_3": "\"Can beer make you calmer?\"", + "answer_choice_4": "\"Can beer make you less social?\"", + "answer_id": 1, + "answer": "\"Can beer make you smarter?\"", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video to understand the context of the drinking game. I identified from the words \"Points\" on the bottom left and right corners of the screen that the drinking game began at 00:30. I then heard the man with blond hair ask, \"Can beer make you smarter?\" from 00:31 to 00:32. So that was the first question asked during the game." + }, + { + "key": "gFT3Cw3fAN4:10e9b1ef2aad466a41fe1d1de3059a078d7cde26", + "video_id": "gFT3Cw3fAN4", + "question": "After the third time a cookie or part of one gets broken in the video, what is the second place that the baker places a part of the piece she broke off?", + "answer_choice_0": "In her mouth", + "answer_choice_1": "On the teal towel", + "answer_choice_2": "On the pan", + "answer_choice_3": "On the cookie rack", + "answer_choice_4": "On the plate", + "answer_id": 2, + "answer": "On the pan", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I looked for a moment when a cookie was broken in the video. I found the first instance at 00:05 when a cookie gets broken in half. A cookie doesn't get broken again until 10:12, when the baker breaks a cookie she takes from the pan. I counted this as the second instance of a cookie being broken. At 10:27, I saw her break half of the already broken piece in two and counted that as the third instance. At 10:28, she takes a bite from one of these pieces of the cookie. This is the first thing she does with a piece of the broken cookie. The second thing she does with a piece of the cookie is to drop it on the pan at 10:33. Therefore, after the third instance of a cookie being broken in the video, the second place the baker places the broken cookie piece is on the pan." + }, + { + "key": "gFT3Cw3fAN4:24c7c28758e182fdce3bc3b03532898e6e782aee", + "video_id": "gFT3Cw3fAN4", + "question": "How many glass bowls does the baker handle when mixing together the dough?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "6.", + "answer_id": 4, + "answer": "6.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the baker as she added the ingredients in order to make her cookie dough. At 00:40, I noticed 2 large glass bowls. 1 bowl is for the wet ingredients (i.e. butter); the other is for the dry leavening agents (i.e. baking soda). I watched as the baker handled the wet ingredients glass bowl for the first time at 00:51. She dropped a stick of butter with her right hand as she clutched the glass bowl's rime with her left hand. At 01:11, I saw the baker reach for a tiny glass bowl of firmly packed light brown sugar, which she dumps into the glass wet mixing bowl. At 01:22, I watched the baker clasp the small glass mixing bowl of dark brown sugar and add it to the large glass bowl with her wet ingredients. At 01:40, I watched the baker's hands lift a bowl of granulated sugar, and like her brown sugar, drop the granulated sugar into her mixing bowl. At 02:28, I watched the baker extract a separate tiny glass bowl to crack her two eggs, which she later plops into her wet ingredient mix at 02:56. She places the wet glass bowl her side and slides over a new large glass bowl for her dry ingredients at 03:27. The glass bowl contains flour. At 04:02, I watched the baker add cornstarch from a porcelain bowl. I did not count this bowl since it is not made from glass. At 04:52, I also saw the baker add salt from a tiny porcelain bowl. Again, I did not count this bowl to overall figure since it is not made from glass. Therefore, I counted up the total times she handles glass bowls and got 6." + }, + { + "key": "gFT3Cw3fAN4:3fb5b3144869f05700ffdc12f7b6b84f18b62bfd", + "video_id": "gFT3Cw3fAN4", + "question": "If you wanted to bake 6 more cookies than the baker, how many cups of dough would you need to scoop?", + "answer_choice_0": "2.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "4.", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "First, I observed that the baker makes a total of 6 cookies which I determined by observing her pan of 6 baked cookies at 09:37. No other baked cookies are shown in the video. Next, I added 6 more cookies to her total of 6 to 12. Then, I went back to 09:01 where the baker explained each scoop gives her about 1/3rd a cup of dough. I saw that 1 cookie = 1 scoop and then calculated that it would take 3 scoops to get 1 cup of dough. Since you would need 12 total scoops to get 12 cookies, and 3 scoops = 1 cup, I divided 12 by 3 and got a total of 4 cups of dough." + }, + { + "key": "gFT3Cw3fAN4:530327a3c098273bed34ec0efba4d5b9a9a523c8", + "video_id": "gFT3Cw3fAN4", + "question": "How many balls of cookie dough is the baker shown to be placing on her tray?", + "answer_choice_0": "6", + "answer_choice_1": "3", + "answer_choice_2": "4", + "answer_choice_3": "2", + "answer_choice_4": "0", + "answer_id": 1, + "answer": "3", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the video to see when the baker is placing cookie dough on a sheet. From 09:02-09:24, I watched the baker scoop cookie dough out of the chilled mixing dough and onto the cookie sheet. I watched the baker place the first round ball of dough from 09:04-09:15. She places a second scoop at 09:20, and then there is a jump cut at 09:22, which shows 5 balls of cookie dough on the sheet. Then, the camera shows her placing a sixth ball at 09:24. Therefore, the total number of balls of dough the baker places on her tray is 6. However, the video only shows the baker placing 3 of the balls down. I concluded, therefore, that 3 balls of cookie dough are shown to be placed on the tray." + }, + { + "key": "gFT3Cw3fAN4:99ea520b3e14d5bc6f2d638275046a20706886f9", + "video_id": "gFT3Cw3fAN4", + "question": "How many times does the baker touch the butter wrappers with the purple spatula when handling the butter?", + "answer_choice_0": "8.", + "answer_choice_1": "6.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 1, + "answer": "6.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 00:50, I watched the baker urfurl the wax paper surrounding the first stick of butter, dropping the full stick into the glassware. At 00:54, I saw the baker grab the purple spatula. In a series of 3 successive scrapes, I watched the baker touch the butter wrapper with her spatula at 00:56, 00:57, and 00:58. Afterwards, I saw the baker place the purple spatula into the glass bowl at 01:02. At 01:03, I watched the baker snag the second stick of butter and unwrap its contents, dropping the full stick into the bowl at 01:06. At 01:07, I saw the baker, once again, scrape the butter with the purple spatula 3 times from 01:07-01:09. I noticed her place the rubber spatula into the bowl again. Therefore, I watched the baker touch the butter wrappers with the spatuala 3 times for both sticks of butter. Consequently, I witnessed a total of 6 times in which the baker touched her purple spatula to the butter's wax paper." + }, + { + "key": "gFT3Cw3fAN4:ae3a401fd2a448e20edac52375819439b60f0146", + "video_id": "gFT3Cw3fAN4", + "question": "What speed would the hand mixer be if it was half of the highest speed shown?", + "answer_choice_0": "3", + "answer_choice_1": "0.5", + "answer_choice_2": "2.5", + "answer_choice_3": "3.5", + "answer_choice_4": "4", + "answer_id": 4, + "answer": "4", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 02:03, I watched the baker flick on the switch of the hand mixer and begin to swirl the device in a circular motion. While the hand mixer stirred the wet ingredients, I noticed the speed at which the mixer was on at 02:12. The digital reader flashes the numeral 6. I continued watching for more times the hand mixer speed was shown. At 03:20, I saw the baker use the mixer again and observed that the speed showed the numeral \"8.\" I continued watching for more times the hand mixer speed was shown. From 05:37-06:28, I noticed the baker using the mixer again. At 05:59, 06:09, and 06:14, I observed that the speed shown was \"1\". At 06:25, I observed the speed shown was \"2.\" I continued watching and did not see the hand mixer used any more times. Therefore I identified the highest speed as \"8\" and halved it to find the answer: 8/2=4." + }, + { + "key": "gFT3Cw3fAN4:c0e7a197377cd44e0c9b22fa1b9e7b53a5ad53bd", + "video_id": "gFT3Cw3fAN4", + "question": "The cookie recipe requires 2 raw eggs. However, if the baker used 3 eggs instead, how many eggs would be left in the egg carton?", + "answer_choice_0": "5.", + "answer_choice_1": "None.", + "answer_choice_2": "4.", + "answer_choice_3": "8.", + "answer_choice_4": "10.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched for a moment when the baker mentioned eggs and saw her add them to the recipe at 02:29. At 02:27, I heard her say she is using 2 large eggs. Next, I had to determine the size of the carton holding the eggs. There isn't a clear view of the carton until 08:44 when I saw that it holds 12 total eggs. I then went back to 02:36. I noticed the 12-egg carton next to the bowl has 7 spaces missing after the baker removes the 2nd egg, meaning there are 5 eggs left in the carton. I then subtracted another egg, to arrive at the number that would be in the carton had the baker used 3 eggs instead of 2. I got 5-1=4. Therefore, the answer is (1) 4." + }, + { + "key": "gFT3Cw3fAN4:cca13eb0aa33207d9961b4964d32550641e15641", + "video_id": "gFT3Cw3fAN4", + "question": "How many times does the baker add dry flour to her wet cookie mix before it's all combined?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "3.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I found the section of the video where the baker is about to combine the flour at 05:18. I heard her say to do it in several steps and watched her gradually add the flour into the cookie dough at 05:19, 05:48, 06:06, and 06:21. At 06:21, I noticed that the flour bowl was empty and at 06:24, I saw the flour combined with the rest of the cookie mixture. Therefore, the answer is (4) 4." + }, + { + "key": "gFT3Cw3fAN4:cdf748cf3befc6911f8de58df38f6ecdb2505e9a", + "video_id": "gFT3Cw3fAN4", + "question": "How many times does the baker use a metal measuring tool?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "6.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 1, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 03:06, I watched the baker pour 1 teaspoon of vanilla extract into the metal measuring spoon and dump the liquid into the wet batter. At 04:18, I saw that the baker had once again picked up her metal teaspoon, extracting the helping of baking powder into the glass bowl of dry ingredients. Subsequently, at 04:28, I witnessed the baker pick up a metal quarter teaspoon and dump baking soda into a glass bowl of dry ingredients. Next, I watched the baker use a metal teaspoon to pour salt into her glass bowl at 04:55. At 08:57, I saw the baker pickup a metal scoop to measure the cookie dough. She identifies it as an ice cream scoop at 08:59. I counted the total number of metal measuring tools the baker uses and got 5." + }, + { + "key": "gO6YHAEk8nI:197d6b11ea59ebe0efb2dbac26ae1c4cb818f00d", + "video_id": "gO6YHAEk8nI", + "question": "From 06:42 to 06:44, how many silhouettes are pictured walking towards the sunset?", + "answer_choice_0": "Six.", + "answer_choice_1": "Three.", + "answer_choice_2": "Five.", + "answer_choice_3": "Four.", + "answer_choice_4": "Two.", + "answer_id": 4, + "answer": "Two.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video. From 06:42 to 06:44, I saw two silhouettes of cowboys walking away from the camera and toward the sunset. Therefore, the answer is two." + }, + { + "key": "gO6YHAEk8nI:567c453a48125de88358362fe4af5308ff6dfd4c", + "video_id": "gO6YHAEk8nI", + "question": "From 01:45 to 01:49, what sport are the two men depicted playing?", + "answer_choice_0": "Wrestling.", + "answer_choice_1": "Tennis.", + "answer_choice_2": "Baseball.", + "answer_choice_3": "Football.", + "answer_choice_4": "Rugby.", + "answer_id": 4, + "answer": "Rugby.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video. From 01:45 to 01:49, I observed two men wearing rugby uniforms running at each other, with the one on the left carrying a rugby ball. Therefore, the answer is rugby." + }, + { + "key": "gO6YHAEk8nI:5825393c6f975f7e6937ef73b4bf0d643b2f368a", + "video_id": "gO6YHAEk8nI", + "question": "At what time is a photo of Bass' wife first shown?", + "answer_choice_0": "4.32.", + "answer_choice_1": "1:11.", + "answer_choice_2": "5:21", + "answer_choice_3": "2:21.", + "answer_choice_4": "3:01.", + "answer_id": 3, + "answer": "2:21.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched until Bass' wife, Nelly Jenny, is shown on-screen at 02:21. She is also identified by an on-screen title. For extra confimation the narrator reinforces their relationship verbally at the same time." + }, + { + "key": "gO6YHAEk8nI:5c1acb5620c34013601b25a4269c5643bb24e144", + "video_id": "gO6YHAEk8nI", + "question": "What appears in the background of the first painting of the video?", + "answer_choice_0": "A herd of buffalo.", + "answer_choice_1": "A teepee.", + "answer_choice_2": "Bass Reeves.", + "answer_choice_3": "A house.", + "answer_choice_4": "A horse.", + "answer_id": 4, + "answer": "A horse.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I look for the first painting to appear. The first shows up at 00:35. I examine the painting, and look in the background, where I find the image of a horse. Therefore, a horse appears in the first painting of the video." + }, + { + "key": "gO6YHAEk8nI:a123a05cdddf8d2375890f3bff5596a64d6631fd", + "video_id": "gO6YHAEk8nI", + "question": "What cards does the person on the right play at 01:43?", + "answer_choice_0": "An ace and king of diamonds.", + "answer_choice_1": "An ace and queen of spades.", + "answer_choice_2": "An ace and queen of clubs.", + "answer_choice_3": "An ace and jack of hearts.", + "answer_choice_4": "An ace and jack of spades.", + "answer_id": 4, + "answer": "An ace and jack of spades.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I identified that cards were being played at 01:43. From there, I observed that the person on the right played the ace and jack of spades." + }, + { + "key": "gO6YHAEk8nI:c9e043777ca256a88fc6096e6412ff324a8861af", + "video_id": "gO6YHAEk8nI", + "question": "At 02:20, how many chairs are there?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video at 02:20 and I noticed chairs in front of the house, on the left. The location of the house mentions Van Buren, Arkansas. From there, I counted two chairs." + }, + { + "key": "gO6YHAEk8nI:fe2d49aa36a5c0154ba15e03a68bfb9fed8ec1b2", + "video_id": "gO6YHAEk8nI", + "question": "At 01:16, what is the child doing?", + "answer_choice_0": "Planting seeds.", + "answer_choice_1": "Watering plants.", + "answer_choice_2": "Picking tomatoes.", + "answer_choice_3": "Pulling weeds.", + "answer_choice_4": "Digging a hole.", + "answer_id": 1, + "answer": "Watering plants.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from 01:15-01:17, which shows three people in a field, two adults and one child. The man is helping the child with a watering can. At 01:16, the child is holding it on his own and watering the plants in front of him. A person waters plants so that they will grow." + }, + { + "key": "gVDj6ptNDpA:312ad391673e7cff6034b42602d896d8fb00ca8e", + "video_id": "gVDj6ptNDpA", + "question": "In which direction is the ball served at 07:46 - 07:48?", + "answer_choice_0": "To the left towards the player in the yellow hat.", + "answer_choice_1": "To the center towards the player in the red shirt.", + "answer_choice_2": "To the right towards the player in the red shirt.", + "answer_choice_3": "To the right towards the player in the yellow hat.", + "answer_choice_4": "To the left towards the player in the red shirt.", + "answer_id": 3, + "answer": "To the right towards the player in the yellow hat.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I watched the player serve at 07:46 - 07:48. I recognized this as a serve due to the fact that he holds the ball, throws it up into the air, and hits it towards the opposing team. I then found and watched the ball, which I saw move toward the right as it was served. I also noticed that it moves towards the player in the yellow hat. Therefore, the ball is served to the right towards the player in the yellow hat at 07:46 - 07:48." + }, + { + "key": "gVDj6ptNDpA:37f48f0d2615fbefe53d8f428b6f031ce76559f0", + "video_id": "gVDj6ptNDpA", + "question": "How many people are standing on the adjacent tennis court during the play that ends in the third point of the first game?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "5.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "During the first game of the video which begins at 00:01, I looked at the scoreboard in the top left corner of the screen to determine when the third point was scored. I saw the score change from 30-0 to 30-15 at 00:20. Since a total score of 30 comprises 2 points in tennis, and a total score of 15 comprises 1 point, I determined that this denotes the end of play resulting in the third point of the first game. I then went back to watch that play, and found it begins at 00:17 when the score is still 30-0 on the scoreboard. I continued watching and until that play ends at 00:20, and observed 2 people standing on the adjacent court during that time." + }, + { + "key": "gVDj6ptNDpA:4fe52e54095fe09b04901abcd2b0018af28b76c9", + "video_id": "gVDj6ptNDpA", + "question": "How many times does the team on the far side of the court score before the opposing team scores for the first time?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I saw the team on the farther side of the court score for the first time at 00:03, further indicated by the scoreboard graphic at the top left corner of the screen as their score changed from \"0\" to \"15\". Next, at 00:14, I saw the same team score again, further indicated by the scoreboard as their score changed from \"15\" to \"30\". Then, I saw the team on the closer side of the court score for the first time at 00:20, further indicated by the scoreboard as their score changed from \"0\" to \"15\". I counted the number of times the team on the far side of the court scored before the team opposing them scored, calculating a total of 2. Therefore, the team on the far side of the court scores 2 times before the opposing eam scores for the first time." + }, + { + "key": "gVDj6ptNDpA:57708d11eea54e467bf4c96d94d7585c80886893", + "video_id": "gVDj6ptNDpA", + "question": "How much did the ball's speed change between when it was served and when it was returned at 00:01 - 00:03?", + "answer_choice_0": "It increased by 36 mph.", + "answer_choice_1": "It remained at 70 mph.", + "answer_choice_2": "It remained at 36 mph.", + "answer_choice_3": "It decreased by 36 mph.", + "answer_choice_4": "It remained at 34 mph.", + "answer_id": 3, + "answer": "It decreased by 36 mph.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the ball in the boy with the white hat's hands at 00:00. Next, at 00:01, I saw the boy with the white hat serve the ball to the other side of the court. At the same time, I saw a graphic in the top right corner of the screen, indicating the speed of the ball after it was initially struck by the player, which read \"70 mph\". Then, I saw the other team return the ball back to the other side of the court at 00:03. At the same time, I saw the graphic in the top right corner change to \"34 mph\", indicating the new speed of the ball. Then, I calculated 70-34=36. Therefore, the ball decreased by 36 mph between when it was served and when it was returned at 00:01 - 00:03." + }, + { + "key": "gVDj6ptNDpA:7772a5d3f5fa00b5c4b270c3475f2a859e403f59", + "video_id": "gVDj6ptNDpA", + "question": "What do the player in the maroon shirt and the player in the yellow hat do after they score their first points of the ninth game?", + "answer_choice_0": "They touch rackets.", + "answer_choice_1": "They high-five.", + "answer_choice_2": "They laugh.", + "answer_choice_3": "They hug.", + "answer_choice_4": "They fist bump.", + "answer_id": 0, + "answer": "They touch rackets.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "First, I noticed that the scoreboard in the top left corner of the screen keeps track of points in the rightmost column. I determined this when the first points of the game are scored and appear in that space at 00:03. After the completion of the first game, I noticed a 1 appear in the middle column of the scoreboard next to the winning team. I noticed this at 00:56. I concluded that the numbers in this column indicate the numbers of complete games. I then looked for the numbers in that column to add up to 8, which would indicate that 8 games have been completed and that the players are in the ninth game. I saw 2 4's in this column at 07:23. I added the 4's together and got 8. I concluded that this signals the start of the next game, which is also the ninth game. I then looked for the player in the maroon shirt and the player in the yellow hat to score their first points. I found this moment at 08:06 when the team opposing them serves the ball into the net. The team featuring the player in the maroon shirt and the player in the yellow ht's score goes from 0 to 15 on the scoreboard. I then looked to observe their actions. I watched the player in the maroon shirt and the player in the yellow hat touch their rackets together as a respectful sign of mutual support." + }, + { + "key": "gVDj6ptNDpA:98edeb0265c40fb4cf7f864c969c0eab6327362d", + "video_id": "gVDj6ptNDpA", + "question": "Why does the play at 15:31 - 15:35 end?", + "answer_choice_0": "The player in the blue hat returns the serve out-of-bounds.", + "answer_choice_1": "The player in the white hat misses his swing at the ball.", + "answer_choice_2": "The player in the yellow hat serves the ball out-of-bounds.", + "answer_choice_3": "The player in the black shirt returns the ball into the net.", + "answer_choice_4": "The player in the maroon shirt serves the ball into the net.", + "answer_id": 0, + "answer": "The player in the blue hat returns the serve out-of-bounds.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the play at 15:31 - 15:35. I watched the player in the yellow hat throw the ball in the air and hit it towards the opposing team and concluded that this was the serve. After the serve, I saw the player in the blue hat return the serve, which lands out-of-bounds, causing the play to end. Therefore, the play at 15:31 - 15:35 ends, because the player in the blue hat returns the serve out-of-bounds." + }, + { + "key": "gVDj6ptNDpA:c5616f1cc3b39916860edbe8d148d9d5a77c020c", + "video_id": "gVDj6ptNDpA", + "question": "What series of events result in a 40 to 30 score during the sixth game?", + "answer_choice_0": "The player in the white hat serves, then the player in the yellow hat hits the ball into the net.", + "answer_choice_1": "The player in the red shirt serves, then the player in the white hat hits the ball into the net.", + "answer_choice_2": "The player in the blue hat serves, then the player in the red shirt swings and misses.", + "answer_choice_3": "The player in the red shirt serves, then the player in the blue cap swings and misses.", + "answer_choice_4": "The player in the yellow hat serves, then the player in the red shirt swings and misses.", + "answer_id": 1, + "answer": "The player in the red shirt serves, then the player in the white hat hits the ball into the net.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "First, I noticed that the scoreboard in the top left corner of the screen keeps track of points in the rightmost column. I determined this when the first points of the game are scored and appear in that space at 00:03. After the completion of the first game, I noticed a 1 appear in the middle column of the scoreboard next to the winning team. I noticed this at 00:56. I concluded that the numbers in this column indicate the numbers of complete games. I continued watching until 05:05 when I noticed a 2 in that column next to the name of one team, and a 3 in that column next to the name of the other team. I added these numbers together to get 5, and determined that 5 games had been completed. I concluded that at 05:05, the sixth game begins. I continued watching until I saw the score change to 40 to 30 at 05:35. I then went back to determine what events led to that score. At 05:31, I saw the player in the red shirt serve the ball to the opposing team. I then saw the player in the white hat return his serve by hitting the ball into the net. I concluded that the player in the red shirt serves, and then the player in the white hat hits the ball into the net to make the score 40 to 30." + }, + { + "key": "gVDj6ptNDpA:d1300c3e9dc1a206a24f872b1a4faf98da9b14f4", + "video_id": "gVDj6ptNDpA", + "question": "Who scored the point during the play at 00:35 - 00:41?", + "answer_choice_0": "The boy with the red shirt.", + "answer_choice_1": "The boy with the blue hat.", + "answer_choice_2": "The boy with the yellow hat.", + "answer_choice_3": "Nobody scored a point.", + "answer_choice_4": "The boy with the white hat.", + "answer_id": 1, + "answer": "The boy with the blue hat.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the play that began at 00:35. At the same time, I saw the ball in the boy with the white hat's hands. Next, at 00:37, I saw the boy with the white hat serve the ball to the boy with the red shirt on the other side of the court. Then, I saw the boy with the red shirt return the ball to the boy with the blue hat on the other side of the court at 00:38. Then, at 00:39, I saw the boy with the blue hat return the ball to the other side of the court, sending it past the opposing team (the boy with the red shirt and the boy with the yellow hat). Since the boy with the blue hat's return was in-bounds and because the opposing team failed to return the ball, the play ended at 00:41 with the boy with the blue hat scoring the point. Therefore, the boy with the blue hat scored the point during the play at 00:35 - 00:41." + }, + { + "key": "gVDj6ptNDpA:eb97d071324ce5d516cc73fd7560894c9583945c", + "video_id": "gVDj6ptNDpA", + "question": "What color hat is worn by the player who makes the second serve of the video?", + "answer_choice_0": "White.", + "answer_choice_1": "Red.", + "answer_choice_2": "Black.", + "answer_choice_3": "Blue.", + "answer_choice_4": "Yellow.", + "answer_id": 0, + "answer": "White.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 00:01, I saw the player holding the ball in his hand throw that ball into the air and hit it towards the opposing team. I recognized this action as a serve, and determined it constitutes the first serve of the game. I continued watching until I saw a player holding the ball throw it into the air and hit it towards the opposing team at 00:06. I recognized this action as a serve, and since it is the 2nd time this action occurs during the game, determined that it constitutes the second serve in the video. I then looked for the player who completed the serve, and noticed they were wearing a white hat. Therefore, the color of the hat that's worn by the player who makes the second serve of the video is white." + }, + { + "key": "gt_raJgxKis:1b22b15bf440496a3990622c7a4bd955068d05af", + "video_id": "gt_raJgxKis", + "question": "When the narrator says \"cells ultimately are restricted in their size because the larger they are the harder it is for them to be able to maintain homeostasis\"; how many cell membrane shapes on screen are made from only columnar cells?", + "answer_choice_0": "7", + "answer_choice_1": "4", + "answer_choice_2": "1", + "answer_choice_3": "2", + "answer_choice_4": "0", + "answer_id": 3, + "answer": "2", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video listening for the narrator to say the specified phrase. I heard this from 11:18-11:28. During this time, I looked at the graphics on screen and recognized different cell membrane shapes. First I noticed a column labeled \"cell shapes\" on the left edge that had 3 different examples: squamous, cuboidal and columnar. To the right, I saw two columns with 7 different shapes. The first column had \"simple\" shapes while the right column had \"stratified\" shapes. I looked for all of the cell membrane shapes that were made from only columnar cells and identified 2: the Simple Columnar and the Pseudostratified." + }, + { + "key": "gt_raJgxKis:6290525bcf5d675049fbfed49a8e5e08a1891581", + "video_id": "gt_raJgxKis", + "question": "What is the difference in size between the frog eggs found on the Microscopy and Resolution graph and microtubules found on the Cytoskeleton slide?", + "answer_choice_0": "1.0 mm.", + "answer_choice_1": "9.0 mm.", + "answer_choice_2": "0.9 mm.", + "answer_choice_3": "0.1 mm.", + "answer_choice_4": "0 cmm.", + "answer_id": 2, + "answer": "0.9 mm.", + "question_type": "Reading", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video looking and listening for any information about the difference between the size of frog cells and microtubules. At 01:17 on the screen I see a graph labeled Microscopy and Resolution and the sizes of different organisms and molecules. I look at the graph and see the size of the frog eggs is 1.0 mm. I continue watching the video for the Cytoskeleton slide. At 1:02:36, I read \"Cytoskeleton\" at the top of the screen and I saw a diagram where the size of microtubules is listed as .023 um. I know that 1m = 0.001 mm. I then converted .023 um to mm by multiplying 0.023 x 0.001mm = 0.000023 mm. To find the difference I subtract the size of microtubules- 0.0000023 mm from the size of frog eggs- 1.0 mm and I get 0.9 mm." + }, + { + "key": "gt_raJgxKis:a0e775d73a03b41fc1fcdcb113b425626972a409", + "video_id": "gt_raJgxKis", + "question": "In the video, how many slides does the organelle where transcription occurs appear with its constituent parts labeled?", + "answer_choice_0": "2", + "answer_choice_1": "1", + "answer_choice_2": "5", + "answer_choice_3": "3", + "answer_choice_4": "4", + "answer_id": 4, + "answer": "4", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I listened to the narrator discuss that DNA copies itself and then RNA is transcribed from 08:02 to 09:05. I identified that the organelle in which DNA transcription occurs is the nucleus. I went back to the beginning to count the number of slides that contained a nucleus with its constituent parts labeled. The slides at 23:09, 24:55, 32:10, and 33:08 all contained a labeled nucleus. Therefore, I counted a total of 4 slides containing a nucleus with its constituent parts labeled." + }, + { + "key": "gt_raJgxKis:bbf0cd14e3771ad12d115b6a5d3324b8e5a0f714", + "video_id": "gt_raJgxKis", + "question": "How much larger is the ant compared to the blue, circular prokaryotic cell?", + "answer_choice_0": "15,000 times.", + "answer_choice_1": "5,000 times.", + "answer_choice_2": "10,000 times.", + "answer_choice_3": "20,000 times.", + "answer_choice_4": "25,000 times.", + "answer_id": 0, + "answer": "15,000 times.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "At 01:16, I listened to the narrator discuss microscopy and resolution. At the same time, I saw a scale of sizes of different organisms. I identified the right most organism to be an ant and read the size below to be 1 centimeter. I continued watching and looked for the blue, circular prokaryotic cell size. At 22:10, I saw 3 images of prokaryotic cells. I saw the image in the center has blue circular cells and had a scale bar of 2 micrometers. Using the scale bar, I saw that the size of one cell is 2/3 of a micrometer. To calculate how much larger an ant is compared to a blue circular prokaryotic cell, I divided 2/3 micrometers from 10,000 micrometers (1 centimeter). I found the ant to be 15,000 times larger than the blue circular prokaryotic cell." + }, + { + "key": "gt_raJgxKis:c270f6a0940a9c30e920656992242841433f2568", + "video_id": "gt_raJgxKis", + "question": "In the fourth group of images to appear in the video, the rightmost image depicts which stage of mitosis?", + "answer_choice_0": "Interphase", + "answer_choice_1": "Anaphase", + "answer_choice_2": "Prophase", + "answer_choice_3": "Telophase", + "answer_choice_4": "Metaphase", + "answer_id": 4, + "answer": "Metaphase", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I saw the first group of images at 00:00. I saw the second group of images at 01:17. I saw the third group of images at 11:18. I then listened to the narrator discuss microtubules and saw the fourth group of images at 13:05. I identified the rightmost image to be a phase of cellular division. I identified the blue structure in the image to be a cell. I identified the bright yellow structures in the middle to be chromosomes attached to other yellow structures known as spindles. I understand that this image depicts metaphase. In this phase of mitosis, the chromosomes condense and move together, aligning in the center of the dividing cell." + }, + { + "key": "gt_raJgxKis:d58c265817795b305d870177b90f01f71f683d46", + "video_id": "gt_raJgxKis", + "question": "From 00:22:00 to 01:05:00, how many fully formed mitochondria are depicted?", + "answer_choice_0": "9", + "answer_choice_1": "16", + "answer_choice_2": "12", + "answer_choice_3": "15", + "answer_choice_4": "7", + "answer_id": 3, + "answer": "15", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I looked at the specified timecodes 00:22:00 to 01:05:00. The first mitochondrion is visible in the eukaryotic animal cell diagram that appears at timecode 00:23:10, where 3 total mitochondria can be seen. From there, 2 mitochondria can be seen in the eukaryotic plant cell diagram at 00:24:53, 2 mitochondria in the plant cell diagram at 00:24:53, and 2 mitochondria in the apoptosis diagram at 00:46:14. This apoptosis diagram appears again at 00:49:50, adding another 2 mitochondria to the count. Lastly, 4 mitochondria can be seen in the energy organelles diagram at 00:59:21. Adding all of these together equals 15 mitochondria seen in the specified timecodes." + }, + { + "key": "gt_raJgxKis:fe89e1c906af4e74e6051aab0d0d2c688323bf2c", + "video_id": "gt_raJgxKis", + "question": "What color is the organelle that is shown in the diagram in the step of the endomembrane system after lipids are manufactured?", + "answer_choice_0": "Blue.", + "answer_choice_1": "Pink.", + "answer_choice_2": "Yellow.", + "answer_choice_3": "Orange.", + "answer_choice_4": "Green.", + "answer_id": 1, + "answer": "Pink.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video looking and listening for the steps of the endomembrane system. At 32:10, I see a diagram of the Endomembrane System with steps listed along the bottom. I continue listening. From 32:43-32:47, the narrator lists the organelles involved in the endomembrane system as the nucleus at 32:43, rough ER at 33:44, smooth ER at 33:45 and golgi apparatus at 33:46. On the diagram, I see that lipids are manufactured in smooth ER at step 4. The step after says that they are packaged and transported to the Golgi. Because they are being transported, this step takes place in the cytoplasm. I identified that the cytoplasm, which looks like a sideways stack of pancakes in this diagram, is pink. Therefore I determined that the answer was pink." + }, + { + "key": "gt_raJgxKis:ff568083ba398e01f34e181ea7e55527bfeff04c", + "video_id": "gt_raJgxKis", + "question": "In the fourth group of images shown, which structure is stained in yellow in the rightmost image?", + "answer_choice_0": "Lysosomes.", + "answer_choice_1": "Chromosomes.", + "answer_choice_2": "Peroxisomes.", + "answer_choice_3": "Mitochondria.", + "answer_choice_4": "Vacuoles.", + "answer_id": 1, + "answer": "Chromosomes.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I saw the first group of images at 00:00. I saw the second group of images at 00:17. I saw the third group of images at 11:18. I then listened to the narrator discuss microtubules and saw the fourth group of images at 13:05. I identified the rightmost image to be a phase of cellular division. I identified the blue structure in the image to be a cell. I identified the bright yellow structures in the middle to be chromosomes attached to other yellow structures known as spindles." + }, + { + "key": "hk2wyOFErKE:119a3a392c269a1972334c432b96875f2723da93", + "video_id": "hk2wyOFErKE", + "question": "Where is the brunette girl with long hair when she appears in the video for the first time?", + "answer_choice_0": "In her bedroom.", + "answer_choice_1": "In front of a lattice wall.", + "answer_choice_2": "In her car.", + "answer_choice_3": "Inside the bathtub.", + "answer_choice_4": "At the beach.", + "answer_id": 0, + "answer": "In her bedroom.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I look at the beginning of the video where the people that were going to be talked about in the video are introduced. The brunette girl with long hair appears for the first time at 00:03 and she is talking to the camera from inside her bedroom." + }, + { + "key": "hk2wyOFErKE:83ddcc6f09d97aa9f9478dea57a0c2096f7b8b15", + "video_id": "hk2wyOFErKE", + "question": "What image is showing at the bottom right corner of the frame when the social media post from a user named \"loljmao\" appears on the screen?", + "answer_choice_0": "A wooden chair in a bathroom.", + "answer_choice_1": "A pair of comfy sandals.", + "answer_choice_2": "The edges of a white tiled wall.", + "answer_choice_3": "A girl filing her nails.", + "answer_choice_4": "A white rug.", + "answer_id": 3, + "answer": "A girl filing her nails.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I carefully look at the social media post screenshots presented throughout the video. The post by social media user \"loljmao\" appears at 03:57. The setting for this frame is inside an animated bathroom, where a female animated character is sitting on a wooden chair at the bottom right corner of the frame filing her nails." + }, + { + "key": "hk2wyOFErKE:8df933ab802a4a3887e5779e1f2b3323ffee6c28", + "video_id": "hk2wyOFErKE", + "question": "What does the cartoon woman hold in her hands most often?", + "answer_choice_0": "A book.", + "answer_choice_1": "A nail file.", + "answer_choice_2": "A clipboard.", + "answer_choice_3": "A cup of tea.", + "answer_choice_4": "A cell phone.", + "answer_id": 3, + "answer": "A cup of tea.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The cartoon woman holds a cup of tea nine times in the video, at 00:11, 00:24, 00:46, 01:03, 01:11, 02:34, 03:21, 04:17, and 05:55. I watched the rest of the video and the only other object I saw her hold was a nail file. I counted her holding it 4 times, at 01:58, 02:14, 03:57, and 05:46." + }, + { + "key": "hk2wyOFErKE:c345239e433b6167fe4842d941c2aced4f727d11", + "video_id": "hk2wyOFErKE", + "question": "What happens right after an extreme close up scene where tea is being served in a cup?", + "answer_choice_0": "The scene cuts to black with the phrase \"and y'all...\".", + "answer_choice_1": "The scene cuts to a cartoon girl drinking tea.", + "answer_choice_2": "The scene cuts to a screenshot of a social media post.", + "answer_choice_3": "The scene cuts to a wide shot of a tea pot.", + "answer_choice_4": "The scene cuts to black.", + "answer_id": 0, + "answer": "The scene cuts to black with the phrase \"and y'all...\".", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the image of the tea being served in a cup in the video, which is at 00:12, but this image is not an extreme close up shot. A little further, at 00:14, an overhead camera zooms in at a cup of tea being served. This is the image referred to in the question. I looked attentively, waiting for the next cut, until a black background appeared with the words \"and y'all...\" written in white letters, appeared at the center of the screen at 00:15." + }, + { + "key": "hk2wyOFErKE:fc4fa0ef7c023bd3aaff435103f0e59ca2132c38", + "video_id": "hk2wyOFErKE", + "question": "What beverage is shown 10 seconds before the narrator says \"I'm not kidding\"?", + "answer_choice_0": "Soda.", + "answer_choice_1": "Beer.", + "answer_choice_2": "Water.", + "answer_choice_3": "Tea.", + "answer_choice_4": "Coffee.", + "answer_id": 3, + "answer": "Tea.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the target phrase and found it at 00:23. I went back 10 seconds to 00:13. I observed a clear brown liquid being poured from a teapot. I identified that the beverage shown ten seconds before the target phrase was tea." + }, + { + "key": "i59AlrByh3Y:3b96be5e653cf383edf95d1ee47cc5b3df8b27b3", + "video_id": "i59AlrByh3Y", + "question": "At 01:00 - 02:00, what are the colors of the circles that are drawn on-screen?", + "answer_choice_0": "Yellow and blue.", + "answer_choice_1": "Red and yellow.", + "answer_choice_2": "Blue and green.", + "answer_choice_3": "Red and green.", + "answer_choice_4": "Red and blue.", + "answer_id": 4, + "answer": "Red and blue.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found the segment at 01:00 - 02:00. At 01:36, I saw a red circle being drawn around 3 hexagons while the commentator discussed them. The same thing happened again at 01:49 - 01:52, except this time, the circle was drawn in blue. By 02:00, there were no other circles that were drawn on-screen. Therefore, the colors of the circles that are drawn on-screen at 01:00 - 02:00 are red and blue." + }, + { + "key": "i59AlrByh3Y:6677fa4f7af6273f0eacd5ea62c70ec5ffb698d1", + "video_id": "i59AlrByh3Y", + "question": "What name appears directly below \"Sir Lulsalot\" on the list of patron names displayed as the commentator congratulates the winner?", + "answer_choice_0": "Bobthebandit.", + "answer_choice_1": "Amanda Sargent.", + "answer_choice_2": "LightningLuke.", + "answer_choice_3": "EmeraldAngel.", + "answer_choice_4": "Whiteclawlaw.", + "answer_id": 1, + "answer": "Amanda Sargent.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I heard the commentator congratulate the winner at 36:10. At the same time, I saw the list of patron names displayed on-screen. Next, I found \"Sir Lulsalot\" as the second to last name in the right-most column. Below \"Sir Lulsalot\", I then found the name \"Amanda Sargent\". Therefore, the name that appears directly below \"Sir Lulsalot\" on the list of patron names displayed as the commentator congratulates the winner is Amanda Sargent." + }, + { + "key": "i59AlrByh3Y:6772f6f14b21ad554c6bafcc173bec7fd0653928", + "video_id": "i59AlrByh3Y", + "question": "If each settlement is surrounded by 3 tiles with numbers, what is the sum of the numbers on the tiles surrounding both the blue and black settlements at 05:10?", + "answer_choice_0": "38.", + "answer_choice_1": "47.", + "answer_choice_2": "50.", + "answer_choice_3": "49.", + "answer_choice_4": "42.", + "answer_id": 1, + "answer": "47.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found the blue and black settlements on the board at 05:16. At the same time, I noticed the blue settlement was surrounded by 3 tiles with the numbers \"5\", \"8\", and \"10\". Likewise, I saw the black settlement was surrounded by 3 tiles with the numbers \"9\", \"11\", and \"4\". I then calculated 5+8+10+9+11+4=47. Therefore, the sum of the numbers on the tiles surrounding both the blue and black settlements at 05:10 is 47." + }, + { + "key": "i59AlrByh3Y:6e9505b17b912110df87a2cf0d7400c8f3c594c9", + "video_id": "i59AlrByh3Y", + "question": "At 33:35 - 33:55, how many times does the dice change?", + "answer_choice_0": "0.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "0.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found 2 dice at 33:35 near the bottom right corner of the screen, close to each other. The left die showed a \"4\" while the right one showed a \"5\". I continued watching until 33:35, counting the number of times either die changed. However, they remained in the same position during that timeframe, never changing. Therefore, the number of times that the dice change at 33:35 - 33:55 is 0." + }, + { + "key": "i59AlrByh3Y:73c0e6d65aabfb9f65e863074b57377c7d22d1ae", + "video_id": "i59AlrByh3Y", + "question": "At 12:00 - 14:00, how much time is left on the timer when 3 players gain sheep?", + "answer_choice_0": "01:56.", + "answer_choice_1": "01:23.", + "answer_choice_2": "01:54.", + "answer_choice_3": "01:42.", + "answer_choice_4": "01:48.", + "answer_id": 0, + "answer": "01:56.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I searched for when 3 players gained sheep at 12:00 - 14:00. At 13:36, I saw blue, black, and green (a total of 3 players) all gained sheep. At the same time, I noticed there was 01:56 left on the timer. Therefore, 01:56 is left on the timer when 3 players gain sheep at 12:00 - 14:00." + }, + { + "key": "i59AlrByh3Y:8ba536bc1c84ed6de53b9badaef80aefffe08fa3", + "video_id": "i59AlrByh3Y", + "question": "At what time does the first black settlement appear on the board?", + "answer_choice_0": "04:44.", + "answer_choice_1": "03:41.", + "answer_choice_2": "04:30.", + "answer_choice_3": "03:59.", + "answer_choice_4": "04:35.", + "answer_id": 3, + "answer": "03:59.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I saw a black settlement appear on the board at 03:59. Since there were no other black settlements on the board prior to this time, this was then the first black settlement to appear. Therefore, the first black settlement appears on the board at 03:59." + }, + { + "key": "i59AlrByh3Y:a47d5fcfb1e567b38aa3463a49336b78808dd7d6", + "video_id": "i59AlrByh3Y", + "question": "What is the color of the space connected to the wood port?", + "answer_choice_0": "Gray.", + "answer_choice_1": "Yellow.", + "answer_choice_2": "White.", + "answer_choice_3": "Green.", + "answer_choice_4": "Orange.", + "answer_id": 3, + "answer": "Green.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 00:50, I heard the commentator mention the wood port as a red circle highlighted it. I then noticed the wood port was connected to the first green space at the top left corner of the hexagonal board. Therefore, the color of the space connected to the wood port is green." + }, + { + "key": "i59AlrByh3Y:aab0cd9e369d028cd2d21e67f2bf6a671310d6e4", + "video_id": "i59AlrByh3Y", + "question": "What is the mathematical average of all the red numbers on the board at 01:00?", + "answer_choice_0": "8.", + "answer_choice_1": "5.", + "answer_choice_2": "6.", + "answer_choice_3": "7.", + "answer_choice_4": "9.", + "answer_id": 3, + "answer": "7.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found all the red numbers on the board at 01:00, reading a total of 4 numbers: 8, 6, 8, and 6. Then, I calculated 8+6+8+6=28. I then calculated 28/4=7. Therefore, the mathematical average of all the red numbers on the board at 01:00 is 7." + }, + { + "key": "i59AlrByh3Y:ed60918446dbac6314f53975bc2a1172f1dd12e3", + "video_id": "i59AlrByh3Y", + "question": "What player has direct access to a 3:1 port at 09:30?", + "answer_choice_0": "Black.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Green.", + "answer_choice_3": "Blue.", + "answer_choice_4": "None.", + "answer_id": 4, + "answer": "None.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I found a 3:1 port circled in red at 09:30 as the commentator called it out by name. The closest player to this port was black, but they didn't have direct access. I then noticed 2 more 3:1 ports. The closest player to that port was green, but they also didn't have direct access. No player was near the third 3:1 port. Therefore, no player has direct access to a 3:1 port at 09:30." + }, + { + "key": "iQGTWM1jkgE:0e0ba12f3785e932c3b68ac8a9eac2e12796e1e1", + "video_id": "iQGTWM1jkgE", + "question": "When the host player lowered his thermos immediately after drinking from it for the first time, on which continent did the yellow player add their troops?", + "answer_choice_0": "Australia", + "answer_choice_1": "North America", + "answer_choice_2": "Africa", + "answer_choice_3": "Asia", + "answer_choice_4": "Europe", + "answer_id": 3, + "answer": "Asia", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I identified the host as the person talking in the bottom left corner of the screen. I watched carefully to find when he grabbed his thermos. At 04:32, I saw him pick up a silver cup with a lid and I identified this as his thermos. From 04:34-04:36, I saw the host drink from the thermos. As he lowered his thermos from 04:36-04:37, I saw a yellow \"+2\" appear over the yellow territory of Japan. I understood this to mean that yellow was adding 2 troops to Japan. I understood that Japan is a territory in Asia. Therefore, I concluded that yellow added troops to Asia." + }, + { + "key": "iQGTWM1jkgE:5ba347fbf32a7e7bc3055b6e17173489bc2352b6", + "video_id": "iQGTWM1jkgE", + "question": "When orange first takes control of the four territories of Australia, what is the average value per territory that green controls?", + "answer_choice_0": "2.9.", + "answer_choice_1": "2.8.", + "answer_choice_2": "3.2.", + "answer_choice_3": "2.7.", + "answer_choice_4": "2.3.", + "answer_id": 3, + "answer": "2.7.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I identified Australia on the map as the continent in the bottom right section of the frame. At 12:11, I saw the leftmost territory of mainland Australia attack the chain of islands west of New Zealand. I saw that the attack was successful, as the chain of islands was now colored orange and had orange \"10\" on it. At this point, this territory, New Zealand, and the left and right mainland territories of Australia, all glowed orange. I understood this to mean that the orange player now controlled the entire continent. I observed the rest of the map and looked for green territories. I counted 10 territories colored green, each with their own cloud-shaped green icon on them that had a number inside. I understood from my knowledge of Risk that this corresponds to the number of troops in that territory. From left to right, top to bottom, I recorded the number of troops present in each of the territories: 1, 1, 4, 4, 3, 3, 6, 3, 1, 1. I added these together to get the total value: 1+1+4+4+3+3+6+3+1+1=27. To find the average value per territory, I divided 27/10=2.7." + }, + { + "key": "iQGTWM1jkgE:6780a0ed6066f05025a979eaf7686b2cbee6ac85", + "video_id": "iQGTWM1jkgE", + "question": "If, when the host says \"Bot's putting troops in NA\", green had placed the same number of troops in Africa, what would the difference in troop value be between green and black in Africa?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "3.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and listened for the target phrase. I heard the phrase from 11:21-11:22. At 11:21, I also noticed a green \"+3\" above a green territory in northern North America. I determined that green had placed 3 troops there. I observed the rest of the map and looked for the number of troops black and green held in Africa. I noticed that at this time, there were 3 territories in Africa colored black, indicating that they were under black's control, while 2 were colored green. I looked at the specific point values in the icons above each of these territories. Black's troop values were 5, 5, and 1. Green's point values were 4 and 1. If green had placed their 3 troops in Africa instead of North America, they would have 7 and 1 (or 4 and 4). I added the total troop values for each color. Black's total value was 5+5+1=11. And green's, if they added 3 to Africa, would be 7+1=8. I found the difference between black and green: 11-8=3. Therefore, if green had placed their troops in Africa instead of North America at 11:21, they would have a troop deficit, compared to black, of 3." + }, + { + "key": "iQGTWM1jkgE:6efabed46f594269af6a2932f09ae1c41357ac55", + "video_id": "iQGTWM1jkgE", + "question": "Arrange these colors according to their appearance while the host introduces himself: Blue, orange, purple, yellow.", + "answer_choice_0": "Blue, orange, yellow, purple.", + "answer_choice_1": "Blue, orange, purple, yellow.", + "answer_choice_2": "Purple, blue, orange, yellow.", + "answer_choice_3": "Purple, blue, yellow, orange.", + "answer_choice_4": "Yellow, purple, blue, orange.", + "answer_id": 3, + "answer": "Purple, blue, yellow, orange.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I identified the host as the man in the bottom left corner of the frame that talked beginning at 00:00. I listened as the host introduced himself and his video channel from 00:10-00:30. During this period, I paid attention to the colors that appeared. At 00:18 I saw purple. At 00:20, I saw blue. At 00:23, I saw yellow. And at 00:25 I saw orange. Therefore the correct order is Purple, blue, yellow, orange." + }, + { + "key": "iQGTWM1jkgE:8f0fc871ff7a83c6a402ea57d0ecae71d9029724", + "video_id": "iQGTWM1jkgE", + "question": "When did the black player take control of two continents?", + "answer_choice_0": "17:04.", + "answer_choice_1": "16:56.", + "answer_choice_2": "17:12.", + "answer_choice_3": "17:00.", + "answer_choice_4": "17:08.", + "answer_id": 0, + "answer": "17:04.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the game and focused on the black territories. I watched them grow and saw that the black player took control of their first continent, South America, at 12:35. Since Africa is nearby and has a large number of the black player's troops, I watched Africa closely. From 16:41 to 17:04, the black player takes all of the territories in Africa. At this point, 17:04, the black player now has control of 2 continents." + }, + { + "key": "iQGTWM1jkgE:95577e49b7a885a2abc4e78c7522fe1d0f5fce09", + "video_id": "iQGTWM1jkgE", + "question": "At the start of the tournament, what percentage of online games had the first-position gamer won?", + "answer_choice_0": "32.46%.", + "answer_choice_1": "35.29%.", + "answer_choice_2": "33.41%.", + "answer_choice_3": "47.43%.", + "answer_choice_4": "64.68%.", + "answer_id": 2, + "answer": "33.41%.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First I looked for the beginning of the tournament. I noticed that there was a countdown from 9 to 0 from 01:58-02:08. Then I read a line of text that said \"Starting Game...\" at 02:12. Then, I saw the gameboard appear at 02:14. I also noticed a message pop up to notify players of the orange player's 3-troop bonus \"for occupying 7 territories\" at 02:15. Therefore, I determined that the game had begun. I heard the host say \"I am in the fourth position\" at 02:17. I noticed that there was a vertical stack of six players on the right side of the screen and the player in red was fourth from the top. There was also a small text bubble that read \"YOU\" beneath the red player's avatar. I also noticed that the orange player was on the top of the stack, making them the first position. At 02:38 I heard the host identify the first position player as \"Booker Freedom 9\". I watched as the host clicked on Booker Freedom 9's avatar and scrolled down to view their stats from 02:39-02:41. I read four different statistics from this section: Games played, Hours played, Online games won and lost, and Play Friends games won and lost. Since the question asked for the percentage of online games won, I first found the total number of online games played by adding 398+793=1191. Then I divided 398/1191=0.3341. Then I multiplied by 100 to convert the figure into a percent: 0.3341*100=33.41%." + }, + { + "key": "iQGTWM1jkgE:d0f051ec095338ebd63ef0b364244200dc017634", + "video_id": "iQGTWM1jkgE", + "question": "When the host says \"Holding a strong lead, 30 troops ahead of me\", how many territories does that player who is 30 troops ahead control?", + "answer_choice_0": "6.", + "answer_choice_1": "3.", + "answer_choice_2": "8.", + "answer_choice_3": "10.", + "answer_choice_4": "9.", + "answer_id": 3, + "answer": "10.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I listened for the target phrase and heard it from 31:00-31:02. I observed the game board. I saw a stack of player avatars on the right side of the screen. I looked for the host's icon to see how many troops they had. I saw that the fourth from the top had a small text bubble that read \"YOU\" and I determined this was the host's avatar. I looked to the left of the avatar and saw the number \"57\" next to an icon of a soldier holding a weapon. I determined that this meant the host had 57 troops at 31:02. I looked for the player with 30 troops more than the host and saw that the troop count to the left of the black player read \"87\". I then observed the map and counted the number of territories colored black. I counted 4 territories in South America that were black. I counted 6 territories in Africa that were black. I did not see any more territories that were black at this time. I added 4+6=10. I determined that when the host comments on the black player being 30 troops ahead, the black player controls 10 territories." + }, + { + "key": "iQGTWM1jkgE:da5ce0ebf04402db501aca4c20e01ffca5971541", + "video_id": "iQGTWM1jkgE", + "question": "How many snowflake territories would there be if all the islands on the world map disappeared?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "5.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "2.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I observed the map carefully at 02:15 to search for the territories with a snowflake icon above them. I identified 3 in total: 1 in Mexico, 1 in Iceland, and 1 in eastern Asia. I watched the remainder of the video and confirmed that no additional snowflake territories appeared and that no existing snowflake territories disappeared. I then looked at which of these was an island. Iceland is an island, but the other two territories are adjacent to land. Therefore, there is only 1 island that is a snowflake territory. Therefore, if all the islands of the world disappeared, 1 snowflake territory would disappear. I calculated 3-1=2 to find that there would be 2 remaining snowflake territories." + }, + { + "key": "iQGTWM1jkgE:f94a5eb550669cbed6d0b0340285657b5acf11ea", + "video_id": "iQGTWM1jkgE", + "question": "At the beginning of the game, what is the sum of all the territories with the orange circles on the map?", + "answer_choice_0": "23.", + "answer_choice_1": "19.", + "answer_choice_2": "20.", + "answer_choice_3": "22.", + "answer_choice_4": "21.", + "answer_id": 2, + "answer": "20.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to see when the game started. At 01:58, text on the screen begins a countdown from 9 seconds. I continued to watch until the map showed up at 02:15, signalling the beginning of the game. I identified all the orange territories on the map by the icon above them, which is a round, orange circle containing a number. I identified 7 orange territories and added the numbers in their circles together. Moving from left to right, top to bottom, the first territory is Greenland and has the number \"2\" in it. There are two territories in northeast Asia worth 4 and 2. There is 1 territory in western Asia worth 4 points. New Zealand is worth 3 points. A territory in central Africa is worth 2 points. And a territory in southern South America is worth 3 points. I added these numbers together to find the total: 2+4+2+4+3+2+3=20. Therefore, at the beginning of the game, orange's territories have a total value of 20." + }, + { + "key": "iqaM4QNusng:12a50862880e8bafa1df2ea01be6754175388057", + "video_id": "iqaM4QNusng", + "question": "What is the predominant color of the butterfly?", + "answer_choice_0": "Black.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Yellow.", + "answer_choice_3": "Orange.", + "answer_choice_4": "Red.", + "answer_id": 1, + "answer": "Blue.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until the butterfly first appeared. This occurred at 00:13. I looked to see its predominent color and noticed that it is blue." + }, + { + "key": "iqaM4QNusng:16f126619b395f37affde68c3c6e31dce6c8c1b3", + "video_id": "iqaM4QNusng", + "question": "At 01:56, what is the bat surrounded by?", + "answer_choice_0": "Birds.", + "answer_choice_1": "Butterflies.", + "answer_choice_2": "It's fellow bats.", + "answer_choice_3": "Trees.", + "answer_choice_4": "The bat is submerged in water.", + "answer_id": 1, + "answer": "Butterflies.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched and noticed at 01:15, the bat falls from the branch it was resting on. At 01:17, the bat plummets into what looks to be water. Throughout the next segments, the bat is seen observing the atmosphere underwater and eventually begins to chase a flock of butterflies at 01:38. At 01:56 the flock of butterflies can be seen surrounding the bat as it flies through the air." + }, + { + "key": "iqaM4QNusng:33f9a393a3197f647e0bba6d8b9c94341444cd0d", + "video_id": "iqaM4QNusng", + "question": "Throughout the video, how many bats appear?", + "answer_choice_0": "2.", + "answer_choice_1": "1.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "4.", + "answer_id": 1, + "answer": "1.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Throughout watching the entire video, I noticed that of the three chrysalis, two hatch while the bat is hanging upside down. The first instance is in the beginning of the video at 00:13. And the final instance I saw was at the end of the video, at 02:12." + }, + { + "key": "iqaM4QNusng:3616b28626b9b871fab96a212d5d71d8afa7fe84", + "video_id": "iqaM4QNusng", + "question": "What is the fruitbat's wing shown to resemble?", + "answer_choice_0": "A tree branch.", + "answer_choice_1": "A golf club.", + "answer_choice_2": "A river.", + "answer_choice_3": "A cloud.", + "answer_choice_4": "A lightning bolt.", + "answer_id": 0, + "answer": "A tree branch.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video, looking for similarities between the fruitbat's wing and something else. The shot at 01:06 shows the bat's wing looking like a tree branch." + }, + { + "key": "iqaM4QNusng:43113df83ac4939729c0ed7df15686ae4c75a1ea", + "video_id": "iqaM4QNusng", + "question": "When the fruitbat falls from the tree, what does it do?", + "answer_choice_0": "Sleep on the ground.", + "answer_choice_1": "Fall in the water.", + "answer_choice_2": "Fly in the air.", + "answer_choice_3": "Grab at a butterfly's wing.", + "answer_choice_4": "Fall on another bat.", + "answer_id": 1, + "answer": "Fall in the water.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until the bat fell from the tree. This occurred at 01:13. I looked to see what happens next and the bat fell in the water by 01:17." + }, + { + "key": "iqaM4QNusng:465c63a3266a722e0589cf8853a93b553a39b25d", + "video_id": "iqaM4QNusng", + "question": "What creature does the fruitbat befriend?", + "answer_choice_0": "A dog.", + "answer_choice_1": "A caterpillar.", + "answer_choice_2": "A moth.", + "answer_choice_3": "A butterfly.", + "answer_choice_4": "An ant.", + "answer_id": 3, + "answer": "A butterfly.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video looking for signs of friendship between the fruitbat and another creature. I noticed it befriends a butterfly at 00:22 by smiling when it lands on its nose." + }, + { + "key": "iqaM4QNusng:b76ea24925adb1343b881f9763a52d7b31e34f32", + "video_id": "iqaM4QNusng", + "question": "What body part of the bat do the bufferflies first land on after they emerge from the chrysalis?", + "answer_choice_0": "The bat's chest.", + "answer_choice_1": "The bat's right wing.", + "answer_choice_2": "The bat's feet.", + "answer_choice_3": "The bat's nose.", + "answer_choice_4": "The bat's left wing.", + "answer_id": 3, + "answer": "The bat's nose.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "The first instance of the butterfly hatching occurs at 00:12. The butterfly spreads its wings and flies around, ultimately landing on the bat's nose at 00:22. The final instance when the hatching occurs is at 02:11. The butterfly flies around and lands on the bat's nose at 02:20." + }, + { + "key": "iqaM4QNusng:c18a706572b59b3cca3bf04415edd5cdd69ef9c6", + "video_id": "iqaM4QNusng", + "question": "What species of butterfly emerge from chrysalis?", + "answer_choice_0": "A red admiral.", + "answer_choice_1": "A mourning cloak.", + "answer_choice_2": "A blue monarch.", + "answer_choice_3": "A painted lady.", + "answer_choice_4": "A giant swallowtail.", + "answer_id": 2, + "answer": "A blue monarch.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "When the butterfly emerges, at 00:17, I had a clear view of te butterfly. I analyzed it and concluded that the species is a blue monarch butterfly." + }, + { + "key": "iuqA9uwIVSM:0799f091f61beec04bda39e8cfa89500f5d11323", + "video_id": "iuqA9uwIVSM", + "question": "What is the opening shot of the film?", + "answer_choice_0": "A wide shot of the dark blonde dancer.", + "answer_choice_1": "A close-up of the brunette dancer.", + "answer_choice_2": "A wide shot of tall hills.", + "answer_choice_3": "A medium shot of the brunette dancer.", + "answer_choice_4": "A medium shot of the dark blonde dancer.", + "answer_id": 3, + "answer": "A medium shot of the brunette dancer.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I saw the first shot come into focus at 00:08. I observed a medium shot of the brunette dancer on her right side in the dirt." + }, + { + "key": "iuqA9uwIVSM:48e1eb618f3f4ac36f8dbc2df86be3e3a5c44da5", + "video_id": "iuqA9uwIVSM", + "question": "How many times do both dancers drop to their sides simultaneously between 02:03 and 02:07 in the video?", + "answer_choice_0": "2 times.", + "answer_choice_1": "7 times.", + "answer_choice_2": "3 times.", + "answer_choice_3": "10 times.", + "answer_choice_4": "1 time.", + "answer_id": 2, + "answer": "3 times.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video between 02:03 and 02:07, paying close attention to the dancers' movements. I counted the number of times both dancers dropped to their sides simultaneously and observed their positions relative to each other. I found that they dropped three times, and each time, they were positioned in front of each other." + }, + { + "key": "iuqA9uwIVSM:7ed7e74f9e9a5ab74d5c59cf55afc4695f9003b7", + "video_id": "iuqA9uwIVSM", + "question": "From 02:25 - 02:28, what is the dancer in the background doing?", + "answer_choice_0": "Climbing up a hill.", + "answer_choice_1": "Laying on a hill.", + "answer_choice_2": "Sliding down a hill.", + "answer_choice_3": "Sitting on a hill.", + "answer_choice_4": "Standing on a hill.", + "answer_id": 2, + "answer": "Sliding down a hill.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video during this time range and the dancer is face down. Her belly pressed up against a steep decline at 02:25. She loses her foot, and her torso slides down the hill, twisting her upper torso as she flings her face up towards the sky at 02:25. She glides down the decline on her back, as her right arm remains above her head at 02:26. She then tumbles, clumsily rolling down the hill at 02:27-02:28." + }, + { + "key": "iuqA9uwIVSM:af518a073218cbab2df66e1d9ff162302835f204", + "video_id": "iuqA9uwIVSM", + "question": "What happens after the brunette dancer and the dark blonde dancer's backs touch each other at 2:58?", + "answer_choice_0": "They jump together.", + "answer_choice_1": "They alternate slowly kneeling.", + "answer_choice_2": "They bow individually.", + "answer_choice_3": "They move apart.", + "answer_choice_4": "They embrace each other.", + "answer_id": 4, + "answer": "They embrace each other.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until the indicated time code, 2:58, where the dancers are touching each other's backs. Afterward, the dark blonde dancer leans back while the brunette dancer holds her." + }, + { + "key": "iuqA9uwIVSM:f2a6ccc8fb0ae9e11597c586051bd584e84008f4", + "video_id": "iuqA9uwIVSM", + "question": "How many quick cuts are between the shot of the dancers turning on their knees and the profile shot of the dark blonde dancer?", + "answer_choice_0": "8.", + "answer_choice_1": "4.", + "answer_choice_2": "7.", + "answer_choice_3": "5.", + "answer_choice_4": "6.", + "answer_id": 4, + "answer": "6.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to 2:48, where I watched the medium wide shot of the dancers turning on their knees toward the left. Then, at 2:51, I counted six quick cuts until the medium profile shot appeared of the dark blonde dancer." + }, + { + "key": "j4a2X_frKZM:6c454ded121f3c15f6ab4331a641f1aa72a515ba", + "video_id": "j4a2X_frKZM", + "question": "What animal did the person with a digital camera observe during their fourth appearance?", + "answer_choice_0": "A stingray.", + "answer_choice_1": "A dolphin.", + "answer_choice_2": "A penguin.", + "answer_choice_3": "A shark.", + "answer_choice_4": "A group of fish.", + "answer_id": 0, + "answer": "A stingray.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I carefully watched each person who held an object in front of the glass and ignored people who were using smartphones. I identified a woman at 17:33 who holds a digital camera, identifiable by its large body and protruding lens. At this moment, she was taking a picture of a group of fish. I continued watching and saw that she appeared for the second time at 18:24 and took pictures of the stingray. I continued to watch until she appeared for a third time at 19:27. She exits the screen at 19:32 and returns at 19:39, which is her fourth appearance. She stands in front of the glass while observing the stingrays." + }, + { + "key": "j4a2X_frKZM:9370e25af458f9a2bb4b4591cd50958f71ef78ad", + "video_id": "j4a2X_frKZM", + "question": "After the vlogger passes a green sign with a tree for the second time, what kind of animal inhabits the space behind the third aquarium window he peeks through?", + "answer_choice_0": "Ducks.", + "answer_choice_1": "Otters.", + "answer_choice_2": "Penguins.", + "answer_choice_3": "Fish.", + "answer_choice_4": "Sharks.", + "answer_id": 0, + "answer": "Ducks.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I saw a green sign with a white tree become visible at the top of the escalator at 01:58. I observed the vlogger pass this sign at 02:09. I counted this as the first instance. I watched the vlogger walk through a part of the aquarium that contained several otters before passing another green sign with several trees at 03:44. He looks through the first aquarium window at 03:55, the second aquarium window at 04:35, and the third aquarium window at 06:01. I observed what kind of animals were inside this window and concluded they are ducks." + }, + { + "key": "j4a2X_frKZM:ad622e3f05f5f0ebcb792f8f381770bbeb56cc2d", + "video_id": "j4a2X_frKZM", + "question": "The first time the whale shark is seen, how many sting rays are also in the tank with it?", + "answer_choice_0": "2.", + "answer_choice_1": "4.", + "answer_choice_2": "0.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "During the time stamp of 17:40 leading up to 17:55, there were several fish swimming around the tank, including several stingrays. At 17:40, I see a stingray on the left of the frame. As the camera comes closer to the tank, I see another stingray swimming in front of a mirror-like glass that appears to make it look like there are 2 stingrays swimming towards each other when it is really just 1. I paid close attention to the way the tank is made. At the end of this segment, at 07:52 leading up to 07:55, there is 1 more stingray that swims into the frame." + }, + { + "key": "j4a2X_frKZM:c3bd4580b4bc2db2920f2be98d101f7e83617bc6", + "video_id": "j4a2X_frKZM", + "question": "After leaving the section of the aquarium housing the exhibit with the diver, which color of the shifting lighting in the next section of the aquarium preceded red?", + "answer_choice_0": "White.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Yellow.", + "answer_choice_3": "Green.", + "answer_choice_4": "Blue.", + "answer_id": 4, + "answer": "Blue.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I identified the exhibit with the diver at 30:31, when the diver can be seen swimming across the floor. I continued watching and saw that the vlogger left the exhibit with the diver at 33:53. I continued watching until he entered the next area, which happened at 34:15, and I noticed that indeed this area has shifting lights. I saw that the lighting of this area was initially yellow, but it transitioned to green at 34:23. The green lighting then transitioned to blue at 34:33. The blue lighting then transitioned to red at 34:42. This means that the color before red was blue." + }, + { + "key": "j4a2X_frKZM:cf6fc5b9e407f226601028b3e99d1728629ed681", + "video_id": "j4a2X_frKZM", + "question": "During the dolphin exhibit and after the moment when the woman with the blue highlighted hair is crouching, what does the man do as the dolphin approaches the glass?", + "answer_choice_0": "He laughs.", + "answer_choice_1": "He waves.", + "answer_choice_2": "He puts his hand to the glass.", + "answer_choice_3": "He claps.", + "answer_choice_4": "He walks away.", + "answer_id": 3, + "answer": "He claps.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I identified the dolphin exhibit at 14:40 as a dolphin swam by. I continued watching to find a crouching woman. I saw two at 14:53, one of whom has locks of blue highlighted hair. I continued watching to find the interaction between the dolphin and a man, which begins at 15:33. I watched the dolphin as it approached the glass at 15:38, when I saw the man clapping." + }, + { + "key": "j4a2X_frKZM:d1ed4fb4b9d876cf40023f36f48a0904fa9a1538", + "video_id": "j4a2X_frKZM", + "question": "After passing by the penguins, what is the largest animal the vlogger views in the aquarium opposite and behind the 4th man in a hat?", + "answer_choice_0": "A shark.", + "answer_choice_1": "A stingray.", + "answer_choice_2": "An otter.", + "answer_choice_3": "A dolphin.", + "answer_choice_4": "An eel.", + "answer_id": 4, + "answer": "An eel.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I observed the vlogger walk away from the area with the penguins at 14:20. The first man in a hat becomes clearly visible at 14:24. I saw the second person wearing a hat at 16:55, and the third at 17:40. At 20:05, the vlogger observes an eel inside a tank. There are fish inside the tank as well, but the eel is the largest animal. The 4th man in a hat becomes visible at 20:21 and is clearly standing opposite the tank that contains the eel and a bit in front of it. Therefore, the answer is an eel." + }, + { + "key": "j4a2X_frKZM:f7b80d27ebcfc279f073e3eab7b45a77ff276fb3", + "video_id": "j4a2X_frKZM", + "question": "If you took the number of swimming birds shown after the mural of flying insects and made that number a millimeter, then added it to the average precipitation during the dry season in the Gulf of Panama according to the blue sign the vlogger shows, what would the final value be in millimeters?", + "answer_choice_0": "15mm", + "answer_choice_1": "16mm", + "answer_choice_2": "18mm", + "answer_choice_3": "17mm", + "answer_choice_4": "19mm", + "answer_id": 1, + "answer": "16mm", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I found the mural of flying insects on the wall in the hallway from 05:44 to 05:49. I continued to watch until the swimming birds appeared at 05:57 on the left. The vlogger closes into a clear view at 06:05, allowing me to count accurately. There are 6 swimming birds. I continued to watch the video until the vlogger showed a blue sign. This happens from 08:13 to 08:19. I read the English text carefully and learned that the average precipitation during the dry season is \"10mm.\" When the number of swimming birds is taken as a millimeter value: 6mm, then added to the average perciptation of 10mm, the final value in millimeters is 16mm." + }, + { + "key": "j5s0h42GfvM:0570bb9ce94653f2f9c9d6da5fb082bea4ea12ea", + "video_id": "j5s0h42GfvM", + "question": "Determine the result of substituting the 8th largest number found when \"Wilson's theorem\" appears on-screen into Willans' Formula (1).", + "answer_choice_0": "0", + "answer_choice_1": "0.149", + "answer_choice_2": "0.674", + "answer_choice_3": "1", + "answer_choice_4": "0.232", + "answer_id": 1, + "answer": "0.149", + "question_type": "Counterfactual", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed it was about Willans\u2019 formula. At 02:25, the text \u201cWilson\u2019s theorem\u201d appears on screen, and is said out loud by the narrator. On this page, there are many numbers: 1, 7/4, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 121/6, 24, 103, 120, 5041/8, 40321/9, 362881/10, and 329891. The 8th largest number is 121/6. From 13:58 to 14:22, a paper by C. P. Willans is shown, with many different formulas on it. Each formula is labeled from (1) to (7). Each formula seems to build off of the previous formula. At 14:03, formula (1) is shown on screen, but not audibly talked about. The formula reads F(x) = [cos^2(pi((x - 1)! + 1)/x)] = 1 for x = 1 and for x prime, and = 0 for x composite. This also corresponds to the section of the formula highlights at 05:16. When we put 121/6 into the formula, we get 0.149. Fractions are neither prime, nor composite, so a result other than 0 or 1 was expected." + }, + { + "key": "j5s0h42GfvM:37cb15e9aa0bc6d02a51730c34af2490e08a0660", + "video_id": "j5s0h42GfvM", + "question": "Between 04:33 and 05:20, how many times does the graph show a value of zero?", + "answer_choice_0": "10.", + "answer_choice_1": "9.", + "answer_choice_2": "6.", + "answer_choice_3": "12.", + "answer_choice_4": "11.", + "answer_id": 3, + "answer": "12.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I moved to the beginning of the specified time frame of 04:33. I identified a graph in the top right corner of the screen and saw that it modeled the formula cos(pi)x. I observed that the wave crossed the x-axis, spaced evenly between 1 and -1 (meaning its value was 0) 6 times. Then at 05:16, I observed that the formula and graph changed so that it represented (cos(pi)x)^2. I observed that the axes were still the same and that the graph now touched the x-axis another 6 times. There were no other graphs showing a value of 0 before the end of the specified timeframe, so I added these 2 values together: 6+6=12. Therefore, in the specified time, the graphs show a value of 0 12 times." + }, + { + "key": "j5s0h42GfvM:3ba75bd9012b14838659eb71b65f5ffdf2768cf8", + "video_id": "j5s0h42GfvM", + "question": "What would the limit be as x approaches infinity at 08:30 if the denominator in this function is changed to the largest number on screen at 02:09?", + "answer_choice_0": "1.", + "answer_choice_1": "0.", + "answer_choice_2": "1/e.", + "answer_choice_3": "e.", + "answer_choice_4": "3/2.", + "answer_id": 0, + "answer": "1.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Maths", + "reasoning": "First I moved to 08:30 to find the function. I saw two functions, one was for finding the nth prime number that appeared at 00:05, and the other, with variable x, appeared to be a simplified version: (x/(4 + 1)))^(1/x). I noticed that the denominator of this function was 4+1. Then, I moved to 02:09 to find the largest number on screen. I saw that the largest number was 329891. I plugged this number in as the denominator and computed that the limit would not change, it would still be 1." + }, + { + "key": "j5s0h42GfvM:3e9d073f4ca5398a9d6705d09eea6cd5ed1468e6", + "video_id": "j5s0h42GfvM", + "question": "What is the result when the value of j that equals 103 is plugged into the equation highlighted when the graph changes?", + "answer_choice_0": "11.", + "answer_choice_1": "3.", + "answer_choice_2": "7.", + "answer_choice_3": "0.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Listening", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed the formula for primes is made up of smaller mathematical equations. At 01:42, the narrator begins to discuss the innermost part of the formula, ((j - 1)! + 1)/j. A table of values appears at 02:09, that contains j values and their corresponding ((j - 1)! + 1)/j value. If we find the number 103 in that table, the corresponding j value is 7. This is shown on the video through the table, but not auditorily said. Out loud at 02:13, the narrator says, \u201cWhen j is a prime it seems we always get an integer. When j is not a prime and not 1 then we don\u2019t get an integer.\u201d This hints that the j value corresponding to 103 is a prime number. At 05:12, the equation (cos(pi ((j-1)! + 1)/j))^2 is boxed. At 05:16, the graph of cos(pi x) becomes the graph of cos(pi x)^2. This indicates that the equation we want to plug 7 into (cos(pi ((j-1)! + 1)/j))^2. The result is 1." + }, + { + "key": "j5s0h42GfvM:5141527efcea1d3edb368f06d2e414e25f5b7785", + "video_id": "j5s0h42GfvM", + "question": "If n is the first number on the list shown at 00:05, how many factorials would need to be computed to find the nth prime number using the formula given in the video?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "12.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "10.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "First I moved to the specified time of 00:05 and observed a list of numbers. I saw that the first number in the list was \"2\", so I let n=2. Then I looked for a formula that gave the nth prime number. This first appeared at 00:09. I looked for a part of the formula where a factorial is needed and saw that there is only one part where a factorial shows up, which is inside the cosine function in the denominator of the outer fraction. There are two nested summations in the formula, and the inner summation contains the cosine containing the factorial. I figured out that computing the number of factorials needed to find the second prime (since n=2) number using the formula was just a matter of determining how many terms the nested summations will generate when n=2. When I plugged in 2 for n into the formula, I got that the outer summation goes from i=1 to i=4. Hence, the inner summation will go from j=1 to j=1, j=1 to j=2, j=1 to j=3, and j=1 to j=4. With that, I got that there will be 1 + 2 + 3 + 4 = 10 factorials computed." + }, + { + "key": "j5s0h42GfvM:845e9abbcf8868ea154328ffe3c78a75de4993d5", + "video_id": "j5s0h42GfvM", + "question": "What is the value of the nonnegative function whose graph is shown between 04:00 and 05:29 if you take the 7th number on the list that appears at 00:05 and plug it into this function?", + "answer_choice_0": "0.", + "answer_choice_1": "1.", + "answer_choice_2": "1/6.", + "answer_choice_3": "1/2.", + "answer_choice_4": "1/3.", + "answer_id": 1, + "answer": "1.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Maths", + "reasoning": "Between 04:00 and 05:29 the graphs of the functions cos(pi*x) and cos^2(pi*x) are displayed on the screen. Out of those two, cos^2(pi*x) is the only one that is nonnegative. This can be seen from their graphs. I moved to 00:05 to find the 7th number on the list and saw that it was 17. I plugged this into the equation and found: cos^2(pi*17) = 1." + }, + { + "key": "j5s0h42GfvM:8b21ff6f1620d30f85cabc7f27fa878c19accfc7", + "video_id": "j5s0h42GfvM", + "question": "Using the formula presented at 01:42, calculate the result when substituting in 23 first and then 9; what is the sum of each of the results?", + "answer_choice_0": "48869596859896026408.", + "answer_choice_1": "439826371739063915104/9.", + "answer_choice_2": "48869596859895986087/9.", + "answer_choice_3": "439926371748263915104.", + "answer_choice_4": "439826371739063915562/9.", + "answer_id": 1, + "answer": "439826371739063915104/9.", + "question_type": "Counterfactual", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed the formula for primes is made up of smaller mathematical equations. At 01:42, the narrator begins to discuss the innermost part of the formula, ((j - 1)! + 1)/j. This part of the formula is explained more at 02:51, where we are told and shown that if the result is an integer, j is prime or 1, and if the result is not an integer, j is composite. If we plug 23 into this formula, we get ((23 - 1)! + 1)/23 = 48869596859895986087, which is an integer because 23 is prime. If we plug 9 into this formula, we get ((9 - 1)! + 1)/9 = 40321/9, this is not an integer, because 9 is not prime. Then when we add them together, we get 48869596859895986087 + 40321/9 = 439826371739063915104/9." + }, + { + "key": "j5s0h42GfvM:ed5a31dc2c362852f999f5c6fc35ce1d8590c70e", + "video_id": "j5s0h42GfvM", + "question": "When \"Wilson's theorem\" is onscreen, what is the largest number divided by the second smallest number, rounded to 2 decimal places if necessary?", + "answer_choice_0": "207360.57.", + "answer_choice_1": "329891.00.", + "answer_choice_2": "188509.14.", + "answer_choice_3": "362881.00.", + "answer_choice_4": "36288.10.", + "answer_id": 2, + "answer": "188509.14.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I looked for \"Wilson's theorem\" to appear on screen. This occurs from 02:25-04:01. During this time, I noticed many numbers appear on screen. The largest number given is 329891. The smallest number is 1, and the second smallest number given is 7/4 = 1.75. To find the largest number divided by the smallest number, I calculated: 329891/1.75=188509.14." + }, + { + "key": "k-mXsUHDqwA:2b4d70f090af1e16b805213fed2c04fc682eefea", + "video_id": "k-mXsUHDqwA", + "question": "When is the word \"feminist\" or its plural, \"feminists\", said for the fourth time?", + "answer_choice_0": "02:18.", + "answer_choice_1": "00:48.", + "answer_choice_2": "00:18.", + "answer_choice_3": "01:18.", + "answer_choice_4": "01:48.", + "answer_id": 4, + "answer": "01:48.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for the word \"feminist\" and its plural, \"feminists\". I first heard \"feminists\" at 01:09. I counted watching and heard \"feminist\" stated for a second time at 01:20. I continued watching and heard the word \"feminist\" stated a third time at 01:29. I continued watching and heard the word \"feminist\" stated a fourth time at 01:48." + }, + { + "key": "k-mXsUHDqwA:42d46f7ac7b264281dbb131c3e96fa1a6b17a101", + "video_id": "k-mXsUHDqwA", + "question": "What object is behind the person who says \"I love women\"?", + "answer_choice_0": "A black pencil cup.", + "answer_choice_1": "A white presenter board.", + "answer_choice_2": "A small blue box.", + "answer_choice_3": "A silver laptop.", + "answer_choice_4": "A white fan.", + "answer_id": 2, + "answer": "A small blue box.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the phrase \"I love women\" and heard it at 02:50. I identified that the person who said this was the man in the white shirt. I studied the area behind the man in the white shirt and found a table with a small blue box on it." + }, + { + "key": "k-mXsUHDqwA:5a4b4b253a9049c311acbadc2380aa766ea4634a", + "video_id": "k-mXsUHDqwA", + "question": "What does the man in white do with his hands as he explains his view of feminism?", + "answer_choice_0": "He raises his hand, rocks forward, puts both hands behind his head, and puts both hands on the table.", + "answer_choice_1": "He lowers his hand, rocks forward, puts both hands behind his head, and leans back.", + "answer_choice_2": "He raises his hand, scoots back, lowers his hand, and leans back.", + "answer_choice_3": "He puts both hands on the table, leans forward, puts both hands behind his head, and leans back.", + "answer_choice_4": "He lowers his hand, scoots back, puts both hands on the table, and leans forward.", + "answer_id": 1, + "answer": "He lowers his hand, rocks forward, puts both hands behind his head, and leans back.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and paid attention to the man in white. At 02:47, I heard the man in white say \"I'm a feminist.\" I noticed that as he said this, he held his left hand in the air with a finger pointed up. I noticed that he put his hand down and rocked in his chair slightly. Then, as he explained from 02:50 to 02:53 that he loves women because he sleeps with them all the time, I noticed that he raised both of his hands behind his head and leaned back." + }, + { + "key": "k-mXsUHDqwA:621c04e7620bfa20c89cb2f8af48abff13582efd", + "video_id": "k-mXsUHDqwA", + "question": "Why does the short presenter say, \"They're not for men\"?", + "answer_choice_0": "A male colleague said he was confused about how to use the product.", + "answer_choice_1": "She disagrees with the head marketer's concerns.", + "answer_choice_2": "Her colleague said some people should be cautious with the product.", + "answer_choice_3": "It's part of the product's slogan.", + "answer_choice_4": "To answer a question about the product's audience.", + "answer_id": 1, + "answer": "She disagrees with the head marketer's concerns.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to understand the context that the presenters are presenting their marketing plan for tampons. I watched from the beginning and heard that the head marketer mentioned a concern over \"scaring male viewers\" from 00:27 to 00:29. I continued watching and noticed at 00:32 that the short presenter's eyebrows were slightly furrowed in confusion. I observed the short presenter shake her head lightly and smile as she said \"They're not for men\" from 00:34 to 00:36. I noticed that while the short presenter spoke, she was looking directly forward toward the head marketer, confirming that she was responding to the head marketer about her concerns." + }, + { + "key": "k-mXsUHDqwA:73b4c828cc77f9ef94052ca552ae15fcc7c72cb4", + "video_id": "k-mXsUHDqwA", + "question": "Where is the third person to say the word \"women\" in the video in relation to the presenter's board from the perspective of the front of the board?", + "answer_choice_0": "Behind and on the right", + "answer_choice_1": "Behind and on the left", + "answer_choice_2": "Directly to the left", + "answer_choice_3": "In front and on the left", + "answer_choice_4": "In front and on the right", + "answer_id": 4, + "answer": "In front and on the right", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I counted each time the word \"women\" was said. The first occurrence was at 00:10 by the woman at the head of the table. The second occurrence was at 00:23 by one of the female presenters. The third occurrence is at 01:25, by the female presenter. The woman at the head of the table says the word, \"woman\" at 1:40, but I did not count this or the 2nd repetition of the word women by the female presenter since one is the incorrect word and the other is the correct word spoken twice by the same person. At 2:50, I heard a man with whispy brown hair and a beard sitting on the right side of the table from the perspective of the board say the word, \"women.\" This makes him the third person to use the word, \"women.\" Therefore, the third person to say the word \"women\" is directly in front of the board and on the right from the board's perspective, since the board is on the same side of the table as that person and positioned diagonally." + }, + { + "key": "k6kOI1P6Cuc:32465bce48cb806b9e8bf9726e52b08fc57e8412", + "video_id": "k6kOI1P6Cuc", + "question": "Which 2 fingers does the man use to flick the bobbin lever, the third time he does so?", + "answer_choice_0": "Thumb and middle finger", + "answer_choice_1": "Middle and ring finger", + "answer_choice_2": "Thumb and ring finger", + "answer_choice_3": "Thumb and pinkie finger", + "answer_choice_4": "Thumb and pointer finger", + "answer_id": 2, + "answer": "Thumb and ring finger", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found the third time the man flicked the bobbin lever at the top of the sewing machine. The first time happens at 02:42, the second at 02:56 (here, the sound of the level being flicked is heard, but the man's hand obscures the lever from view), and the third happens at 05:02. I look at the man's hand as he flicks and I notice that he grasps the bobbin lever with both the thumb and ring finger of his left hand." + }, + { + "key": "k6kOI1P6Cuc:34c557c379aee327040b75eb0473bc534a09cebe", + "video_id": "k6kOI1P6Cuc", + "question": "After the words \"upper thread tension control\" appear on screen, what 2 numbers does he briefly stop the dial between before resetting to 0?", + "answer_choice_0": "7 and 8.", + "answer_choice_1": "2 and 3.", + "answer_choice_2": "9 and 0.", + "answer_choice_3": "5 and 6.", + "answer_choice_4": "0 and 1.", + "answer_id": 3, + "answer": "5 and 6.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and looked for the moment the words \"upper thread tension control\" appear on screen. I observed this from 01:07 to 01:09. The narrator started turning the dial at 01:09. At 01:12, he briefly pauses the dial. I noted that it stopped between the 5 and 6. He turned the dial in the opposite direction, setting it back to 0. Since that was the last turn, the answer is between 5 and 6." + }, + { + "key": "k6kOI1P6Cuc:3e49c64280e8999feaf1f1aa674afe3c68f4981a", + "video_id": "k6kOI1P6Cuc", + "question": "How long does the bobbin take to wind during the segment in which the man sets up the sewing machine?", + "answer_choice_0": "4 seconds.", + "answer_choice_1": "3 seconds.", + "answer_choice_2": "2 seconds.", + "answer_choice_3": "6 seconds.", + "answer_choice_4": "7 seconds.", + "answer_id": 4, + "answer": "7 seconds.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I looked for the segment in which the man sets up the sewing machine, which happens at 02:16. A bobbin is wound starting at 01:32, but since this takes place before the man sets the sewing machine up -- I knew this because at 02:16 the man says \"we're going to look at how to set up this sewing machine.\" -- I didn't count the time it takes for this one to wind. I kept looking and I noticed that the bobbin started winding at 02:46. It kept winding until 02:53. I find the difference between these times and come to a total of 7 seconds." + }, + { + "key": "k6kOI1P6Cuc:b75cc820e51d5e2153cdb5248827f6a2b49d0bf9", + "video_id": "k6kOI1P6Cuc", + "question": "How many more times does the narrator show his entire face to the camera before he places the plastic cover over the bobbin than afterwards?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 1, + "answer": "4.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "8 time before, 1:51, I started at the beginning of the video and noted each time that the narrator showed his face to directly address the camera. I noted that it happened at 00:00, 00:09, 00:18, 00:41, 00:47, 01:01, 01:17, 01:37. I noticed that he places the plastic cover over the bobbin at 01:51. I counted 8 instances of the narrator facing the camera so far. I proceed to count the number of times it happened after the plastic cover was placed. It happened at 02:03, 02:09, 04:50, and 05:24 for a total of 4 times. I subtracted 4 from 8 and got 4 times." + }, + { + "key": "k6kOI1P6Cuc:f5bd512fbf8e7e6ac3b0e4591ce8488d2261cb86", + "video_id": "k6kOI1P6Cuc", + "question": "If you rearranged the sum of the numbers on the small dial and put it over the sum of the numbers on the larger dial, what would be the result as a simplified fraction?", + "answer_choice_0": "4/17.", + "answer_choice_1": "45/153.", + "answer_choice_2": "6/18.", + "answer_choice_3": "6/37.", + "answer_choice_4": "5/17.", + "answer_id": 4, + "answer": "5/17.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I looked for the smaller dial, finding it in at 01:04. The numbers go from 0 to 9, so I discount the 0, add these up, and get 1+2+3+4+5+6+7+8+9=45. Then I find the larger dial, which shows up at 00:26. I find that these numbers go from 1 to 17, so I add 1+2+3+4+5+6+7+8+9+10+11+12+13+14+15+16+17=153. This creates a fraction of 45/153, which can be reduced to 5/17." + }, + { + "key": "k6kOI1P6Cuc:f871b4e975850a29f83fad086c12e39d825a820c", + "video_id": "k6kOI1P6Cuc", + "question": "What differences can you spot between the appearance of the Before model and the appearance of the After model?", + "answer_choice_0": "1.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 4, + "answer": "2.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I looked for the Before and After models, finding them in a split screen at 00:05. I examined the models and looked for differences. One clear difference is that the Before model's sweatpants are loose and baggy, while the After model's sweatpants fit well. Moreover, the Before model is carrying a white object with white and black wire in his left hand. The After model isn't holding anything. I counted these up and came to a total of 2 differences." + }, + { + "key": "k6kOI1P6Cuc:ff6e992ec8d6bb5eafc8f90213da6347554d98c3", + "video_id": "k6kOI1P6Cuc", + "question": "In how many shots is a sewing machine shown turned on and stitching fabric before the time the man clicks the reverse lever for the first time?", + "answer_choice_0": "3 times", + "answer_choice_1": "2 times", + "answer_choice_2": "4 times", + "answer_choice_3": "0 times", + "answer_choice_4": "1 time", + "answer_id": 0, + "answer": "3 times", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I looked for the reverse lever and found that the man clicks it at 00:57. Then I went back from here and looked for the number of times the sewing machine is shown on and stitching fabric. I find the first continuous shot from 00:03-00:04, when the man stitches sweatpants. I find the second range of time in a continuous shot from 00:31-00:33, where the man performs a straight stitch on some blue fabric. At 00:35, I observed a quick cut, marking a new shot in the video. From 00:36-00:39, I observed the machine on and sewing again. There were no more occurrences before the reverse lever was licked. This comes to a total of 3 times the machine is shown stitching before the reverse lever is clicked." + }, + { + "key": "kOATCKG9xgg:10b4dd4f9d9c4a9fea7f3a8f45e2112c313dbfb6", + "video_id": "kOATCKG9xgg", + "question": "Over the course of the video, what weapons does Chris use and in what order?", + "answer_choice_0": "A knife, a pipe, and a flamethrower.", + "answer_choice_1": "A knife, a flamethrower, and a shotgun.", + "answer_choice_2": "A knife, a pipe, and a shotgun.", + "answer_choice_3": "A knife, a handgun, and a shotgun.", + "answer_choice_4": "A knife, an herb, and a flamethrower.", + "answer_id": 1, + "answer": "A knife, a flamethrower, and a shotgun.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and counted that Chris uses three weapons throughout. He uses a knife at 00:41. From 02:36 - 02:42 he uses a flamethrower. Then at 03:38, he has a shotgun until 03:42." + }, + { + "key": "kOATCKG9xgg:24829088669ed4a1bda13faf753a16e82979a385", + "video_id": "kOATCKG9xgg", + "question": "Why does Richard approach the shark?", + "answer_choice_0": "Nervous and distressed, he wanted to save someone from the shark.", + "answer_choice_1": "Needing to vent his energy, he wanted to punch it in the face.", + "answer_choice_2": "Diplomatic and easygoing, he wanted to talk to the shark and convince it to stop attacking.", + "answer_choice_3": "Feeling heroic, he wanted to distract it so that Chris could get past it.", + "answer_choice_4": "Trying to prove his manliness, he wanted to kill it with a harpoon.", + "answer_id": 1, + "answer": "Needing to vent his energy, he wanted to punch it in the face.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First I look for Richard. When a character in an orange shirt suddenly seems to die from a caffeine overdose at 01:31, the character with black hair yells \"Richard!\" dramatically. I conclude that this is Richard. Somehow, Richard returns from 01:59 to 02:12, looking overloaded with frantic energy. During this timeframe, I listened as Richard says at 02:07 that he wants to punch the shark in the face. However, the shaky, intense way in which he says this also suggests that he is hyped on caffeine and wants to punch the shark because he doesn't know any other way to vent his energy." + }, + { + "key": "kOATCKG9xgg:4c55ecdc1c52630de9ae434eeb691928baeaa51c", + "video_id": "kOATCKG9xgg", + "question": "How many characters are depicted being attacked by dogs?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "2.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 00:05 to 00:10, I observed a sequence in which two characters are attacked by dogs. I watched the rest of the video, and did not see this occur again. Therefore, the answer is two." + }, + { + "key": "kOATCKG9xgg:7c162b5420f5db347d31fb301a4ae3ddc4ede39a", + "video_id": "kOATCKG9xgg", + "question": "How many members other than himself are on the man in the green vest's team?", + "answer_choice_0": "2.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a man in a green vest. He appears for the first time at 00:01. I continued watching and listening to determine how many people are on his team. The man refers to his team from 00:03-00:05 while gently motioning towards the characters standing behind him with his head. I concluded that those characters must comprise his team. I counted them and determined that there are 3 members on his team, not including him." + }, + { + "key": "kOATCKG9xgg:8d56decc2c5d7468a87d567466c04694b270e8d2", + "video_id": "kOATCKG9xgg", + "question": "At 04:21, what is written on the cube-shaped object?", + "answer_choice_0": "\"Resident evil\".", + "answer_choice_1": "\"Zombie bait\".", + "answer_choice_2": "\"Umbrella corporation\".", + "answer_choice_3": "\"Spare parts\".", + "answer_choice_4": "\"Funni box :)\".", + "answer_id": 4, + "answer": "\"Funni box :)\".", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 04:21 I noticed a cube-shaped object. I read the side of the object and it reads \"Funni box :)\". I looked throughout the rest of the video and there was no other cube-shaped object in sight." + }, + { + "key": "kOATCKG9xgg:e94e4b1121672100a31d45fdc7670adc2a7f5c85", + "video_id": "kOATCKG9xgg", + "question": "From her perspective, where is the blonde man in relation to the woman in the blue hat when she stands at the bottom of a staircase and punches towards him?", + "answer_choice_0": "To her left.", + "answer_choice_1": "Above her.", + "answer_choice_2": "Below her.", + "answer_choice_3": "To her right.", + "answer_choice_4": "Behind her.", + "answer_id": 0, + "answer": "To her left.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a scene where a woman in a blue hat at the bottom of a staircase punches towards a blonde man. I found this event occurs between 00:28-00:29 as I observed a staircase in the scene, the woman at the bottom of it, and watched her punch towards a blonde man several times. I observed that the blonde man is standing to the woman's left from her perspective." + }, + { + "key": "l0E7Uzz1DqU:19dce8cc5d9c2b6e375e28d5deb99bb12a58b335", + "video_id": "l0E7Uzz1DqU", + "question": "What was the score right before the third commercial break?", + "answer_choice_0": "5 to 3.", + "answer_choice_1": "7 to 12.", + "answer_choice_2": "5 to 10.", + "answer_choice_3": "3 to 3.", + "answer_choice_4": "10 to 10.", + "answer_id": 4, + "answer": "10 to 10.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for the third commercial break during the game. The first commercial break happened at 02:21, the second at 08:47, and the third one at 21:41. I looked back at the segment right before the third commercial break and noticed there was a tie, both teams having scored 10 points each." + }, + { + "key": "l0E7Uzz1DqU:46f4de231cc6cb3761b0928b0d6c6a61c1093e2e", + "video_id": "l0E7Uzz1DqU", + "question": "How much time was left on the clock when time out was called for the second-to-last time?", + "answer_choice_0": "10 seconds.", + "answer_choice_1": "7.9 seconds.", + "answer_choice_2": "2.1 seconds.", + "answer_choice_3": "6.4 seconds.", + "answer_choice_4": "9.7 seconds.", + "answer_id": 4, + "answer": "9.7 seconds.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked towards the end of the video to listen to the final buzzer that indicates the end of the game. This happens at 01:36:41. From there, I rewound the video to locate the second-to-last time out, which happened at 01:33:43. The score bar at the bottom of the screen indicated that there were 9.7 seconds left on the clock." + }, + { + "key": "l0E7Uzz1DqU:4a3cb4d8178a5baf7f9c11a3f5a7b201b53d444d", + "video_id": "l0E7Uzz1DqU", + "question": "What type of shot did the New London team use to score their first points?", + "answer_choice_0": "A jump shot.", + "answer_choice_1": "A layup.", + "answer_choice_2": "A 3-pointer.", + "answer_choice_3": "A dunk.", + "answer_choice_4": "A free throw.", + "answer_id": 3, + "answer": "A dunk.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching the video, I looked for the part where the New London team scored first and found it at the 13:58 mark. Observing the shot from 13:56 leading up to the first score, I saw that player number 33 was passed the ball. He then jumped and dunked, and the commentator mentioned that it was a \"thunderous dunk.\" Therefore, I concluded that New London's first points were scored from a dunk." + }, + { + "key": "l0E7Uzz1DqU:63144ba9bb90c0c966bd7608769b9d23428c2944", + "video_id": "l0E7Uzz1DqU", + "question": "What color was the second player's basketball jersey that the commentator highlighted in the video?", + "answer_choice_0": "Yellow.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Green.", + "answer_choice_3": "Black.", + "answer_choice_4": "White.", + "answer_id": 2, + "answer": "Green.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching the video, I found the part where the commentators mention the highlighted players. The first player was highlighted at the 01:02 mark. I watched further to find the second highlighted player and located him at the 01:28 mark. He was shown in an image as the commentator spoke about him, and I saw that he was wearing a green jersey. Therefore, I concluded that the second highlighted player was wearing a green jersey." + }, + { + "key": "l0E7Uzz1DqU:a242d22555222bdd72a0344ebf226f26a983478b", + "video_id": "l0E7Uzz1DqU", + "question": "What led to the first tied score of the game in the first quarter?", + "answer_choice_0": "The player in the white jersey, number 25, scored a 3-pointer.", + "answer_choice_1": "The player in the white jersey, number 20, scored 2 points as a result of a dunk.", + "answer_choice_2": "The player in the green jersey, number 20, scored 1 point as a result of the opposing team's foul.", + "answer_choice_3": "The player in the white jersey, number 33, scored 1 point as a result of the opposing team's foul.", + "answer_choice_4": "The player in the green jersey, number 33, scored a 3-pointer.", + "answer_id": 3, + "answer": "The player in the white jersey, number 33, scored 1 point as a result of the opposing team's foul.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching the video, I found the part where the first quarter of the game started at the 11:03 mark. I watched further and found, at the 12:30 mark, the Griswold team scored their first 3 points, which is reflected on the scoreboard at the bottom of the screen. I watched further and saw that the New London team scored a dunk, which is reflected on the score bar at the bottom of the frame as 2 points. Then, I watched further to look for the part where both teams were first tied in score. I found that number 33 from the New London team was tripped by a player from the opposing team at the 15:20 mark as he was trying to score. Therefore, the other team received a foul, which led number 33 in the white jersey to score a point at the 15:41 mark, making both teams tied in score." + }, + { + "key": "l0E7Uzz1DqU:ba6c5a6f80d32c19ba4d99fe8c7b5a904befdbc7", + "video_id": "l0E7Uzz1DqU", + "question": "What player makes the first 3-point shot in the game?", + "answer_choice_0": "Player #25 from Griswold.", + "answer_choice_1": "Player #11 from Griswold.", + "answer_choice_2": "Player #2 from New London.", + "answer_choice_3": "Player #5 from New London.", + "answer_choice_4": "Player #5 from Griswold.", + "answer_id": 1, + "answer": "Player #11 from Griswold.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "I looked for the first instance where a player scored a 3-point shot. This event happened at 12:26, where player #11 from the Griswold Wolverines scored the first 3-point shot." + }, + { + "key": "l0E7Uzz1DqU:be9ed712b3d9c152c6a40cfe6bba48c83b031efc", + "video_id": "l0E7Uzz1DqU", + "question": "How many Griswold players touch the ball before turning it over directly following the first dunk by a Whaler's player?", + "answer_choice_0": "2.", + "answer_choice_1": "4.", + "answer_choice_2": "1.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "3.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "First I identified the 2 teams playing in the game as the New London Whalers and the Griswold Wolverines by reading their names on a graphic at the 00:00 mark of the video. Next, I had to identify the jersey colors of the Griswold team and the Whalers team. All the players are wearing a combination of green and white during the warm up period with long sleeve shirts covering their jerseys. At 05:01, there is a clear image of the players on the Griswold team, with the word \"Griswold\" written across the front of their green shirts. I determined that their shorts were mostly green. At 05:04, I saw a clear image of the Whaler's team and identified their shorts as primarily white. This allowed me to distinguish between the two teams. I then looked for the first time a Whaler's player made a dunk. I saw this at 13:58 and heard the announcer refer to it as a dunk at 14:00. I also saw #3 and #23 from the Griswold team handle the ball between 13:58-14:00. I continued watching and observed #3 on the Griswold team touch the ball at 14:04, and pass it to Griswold player #23. Griswold player #23 passes it back to Griswold player #3 who then attempts to pass it to Griswold player #1 at 14:10. Griswold player #1 touches the ball at 14:11 before it goes out of bounds, resulting in a turnover. Since only numbers #23, #3, and #1 from the Griswold team touched the ball after the first dunk by the Whalers before turning it over out of bounds. I concluded that the total number of players is 3." + }, + { + "key": "l0E7Uzz1DqU:c036f13c16f169542350b7ebc0f0791a98384494", + "video_id": "l0E7Uzz1DqU", + "question": "How many audience members in the bleachers are shown wearing over-the-ear headphones between the second and third quarters of the game?", + "answer_choice_0": "3", + "answer_choice_1": "2", + "answer_choice_2": "1", + "answer_choice_3": "5", + "answer_choice_4": "4", + "answer_id": 0, + "answer": "3", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "For the majority of the video, from 01:07-37:05 and from 47:18-01:38:06, I observed that a graphic at the bottom of the screen showed the scores for the two teams labeled \"NL\" and \"GRIS\", the quarter, and the time left in the quarter. I looked for when the quarter section showed \"2nd\" and the time, to the right, ran down to \"0.0.\" This occurred at 36:28. I then looked for when the third quarter between \"NL\" and \"GRIS\" started. I found that this occurred at 47:23. I went back to 36:28 and began looking for people in the audience in the bleachers wearing over-the-ear headphones. I observed camera crew members with over-the-ear headphones, but did not count them. At 38:57, I observed 2 young men sitting on the bleachers in the audience in the bleachers wearing over-the-ear headphones. At 39:05, I observed one person sitting on the bleachers in the audience wearing over-the-ear headphones. There wasn't another image of the audience before the second half officially started at 47:23. I added the 2 young men wearing headphones from 38:57 to the other 1 young man from 39:05 for a total of 3 audience members wearing over-the-ear headphones." + }, + { + "key": "l0E7Uzz1DqU:edf55702d4ebaae3bc500944f52904717bb91067", + "video_id": "l0E7Uzz1DqU", + "question": "How many 3-point shots did player number 25, wearing a white jersey, make in the last 3 minutes of the first quarter?", + "answer_choice_0": "4.", + "answer_choice_1": "0.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "1.", + "answer_id": 4, + "answer": "1.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Basketball", + "reasoning": "While watching the video, I found the part where the first quarter started at the 11:03 mark. I determined that the last 3 minutes of the first quarter began at 17:43, which I confirmed by checking the scoreboard at the bottom of the frame. I watched from that point until the end of the first quarter and found that player number 25, wearing a white jersey, first scored a 3-pointer at 18:58. Then, I watched further until the 21:30 mark, which is the end of the first quarter, and did not see player 25 score any other 3-pointers. Therefore, I concluded that he scored only 1 3-pointer in the last 3 minutes of the first quarter." + }, + { + "key": "l_V_7PeK2cw:1117c1a59c9ad6ba7b24b959debf5bc62f7eed53", + "video_id": "l_V_7PeK2cw", + "question": "What does the title on the flyer stuck on the trunk of the tree say?", + "answer_choice_0": "\"In need of blood donors!\"", + "answer_choice_1": "\"Looking for a babysitter!\"", + "answer_choice_2": "\"Have you seen this cat?\"", + "answer_choice_3": "\"Interested in a used car?\"", + "answer_choice_4": "\"Have you seen this man?\"", + "answer_id": 1, + "answer": "\"Looking for a babysitter!\"", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I observed at 00:12 that the flyer has text at the top, which reads \u201cLooking for a Babysitter!\u201d Additionally, there\u2019s a picture of what appears to be a drawing of a child smiling, as well as more info listed on the side." + }, + { + "key": "l_V_7PeK2cw:2779b1272c0ccb396b409486f5614fb791e69289", + "video_id": "l_V_7PeK2cw", + "question": "After the little boy plays with Legos, what happens next?", + "answer_choice_0": "He watches TV.", + "answer_choice_1": "He goes back to his room.", + "answer_choice_2": "He washes the dishes.", + "answer_choice_3": "He plays with some dice.", + "answer_choice_4": "He plays a video game.", + "answer_id": 3, + "answer": "He plays with some dice.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and observed when the little boy with brown hair started playing with Legos at 01:59. I continued watching and observed that the next thing that happens is he plays with some dice starting at 02:16." + }, + { + "key": "l_V_7PeK2cw:2c629631dffd07a1e653490796c06dce79e985ba", + "video_id": "l_V_7PeK2cw", + "question": "How many dice do the boy and the babysitter play with?", + "answer_choice_0": "8.", + "answer_choice_1": "11.", + "answer_choice_2": "10.", + "answer_choice_3": "7.", + "answer_choice_4": "9.", + "answer_id": 4, + "answer": "9.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the part of the video where the boy and the babysitter are playing with the dice, which begins at the 02:17 mark. I counted 9 dice that were laid out in front of them on the table as they played." + }, + { + "key": "l_V_7PeK2cw:43c03af1e9988342dbe76af13c7dfa1aa4700e09", + "video_id": "l_V_7PeK2cw", + "question": "What are the child and babysitter playing with on the living room table?", + "answer_choice_0": "Dice.", + "answer_choice_1": "Food.", + "answer_choice_2": "Action figures.", + "answer_choice_3": "Cards.", + "answer_choice_4": "Their phones.", + "answer_id": 0, + "answer": "Dice.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 02:17, I watched the scene of the babysitter and the child at the living room table, playing with dice on the tabletop They are sitting next to one another and are very much engaged in the game." + }, + { + "key": "l_V_7PeK2cw:65780258e1f88e7acfd2035f8850a732343701ae", + "video_id": "l_V_7PeK2cw", + "question": "What is the boy depicted doing directly after he finishes eating dinner?", + "answer_choice_0": "Playing by himself.", + "answer_choice_1": "Taking his medication.", + "answer_choice_2": "Playing with the babysitter.", + "answer_choice_3": "Going to bed.", + "answer_choice_4": "Playing with a neighbor.", + "answer_id": 3, + "answer": "Going to bed.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the part where the boy was eating his dinner, from 02:24-02:29. Then, I watched the scene directly and saw that the babysitter was tucking him into bed, at 02:34. Therefore, I concluded that he goes to bed after he has dinner." + }, + { + "key": "l_V_7PeK2cw:66720f81420e721974dc7143a0abdb4214ea3812", + "video_id": "l_V_7PeK2cw", + "question": "What do the instructions specify about when the boy should take his medication?", + "answer_choice_0": "He should take it before midnight.", + "answer_choice_1": "He should take it during lunch.", + "answer_choice_2": "He should take it during dinner.", + "answer_choice_3": "He should take it before dinner.", + "answer_choice_4": "He should take it in the morning.", + "answer_id": 0, + "answer": "He should take it before midnight.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the part where there are instructions for the boy's scheduled medication - I found it at 02:51, and it read: \"Make sure to give Hunter his medicine before midnight\". There were no more specific instructions than this. Therefore, I concluded from these instructions that this is the cutoff for the boy's medication." + }, + { + "key": "l_V_7PeK2cw:83c88c156d26dd8250a1bf3ca5de7a4eca6d5e1c", + "video_id": "l_V_7PeK2cw", + "question": "What object is the little boy holding between 04:49 and 04:56?", + "answer_choice_0": "A towel.", + "answer_choice_1": "A pillow.", + "answer_choice_2": "A cookie.", + "answer_choice_3": "A knife.", + "answer_choice_4": "A plate.", + "answer_id": 3, + "answer": "A knife.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the specified time at 04:49 and observed the little boy with brown hair holding a knife. I continued watching until 04:56 to ensure he did not hold any other objects. So the only object he was holding was a knife." + }, + { + "key": "l_V_7PeK2cw:c7c992c927f490798c47912ed98c714bfab14b3d", + "video_id": "l_V_7PeK2cw", + "question": "Why did the babysitter panic after waking up?", + "answer_choice_0": "She dreamt the boy left the house at night.", + "answer_choice_1": "She dreamt she missed the boy's medication.", + "answer_choice_2": "She dreamt she forgot to turn the stove off.", + "answer_choice_3": "She dreamt she was falling off a cliff.", + "answer_choice_4": "She dreamt she forgot to feed the boy before bed.", + "answer_id": 1, + "answer": "She dreamt she missed the boy's medication.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video closely and focused on the events leading up to the babysitter's actual awakening at 04:15. A sign at 02:56 stated that the boy needed his medication before midnight. I noted that the medication time had already passed by 1-hour and 20-minutes by reading the clock at 02:58. I saw the babysitter sleeping at 03:04 and she awoke at 03:07. She immediately went to the boy's room to check on him and at 04:15, the babysitter woke up, startled. She checked the clock and saw that it was 5 minutes before midnight at 04:19. Therefore, I concluded that her panic stemmed from a dream where she had missed the scheduled medication time." + }, + { + "key": "l_V_7PeK2cw:ecfe194207a6afdaad145282ec9bb245c59ee6d1", + "video_id": "l_V_7PeK2cw", + "question": "How does the boy react to the dinner fed to him by the babysitter?", + "answer_choice_0": "He is jealous.", + "answer_choice_1": "He is content.", + "answer_choice_2": "He is disgusted.", + "answer_choice_3": "He is surprised.", + "answer_choice_4": "He is enthusiastic.", + "answer_id": 1, + "answer": "He is content.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the part where the boy was handed a burger for dinner by the babysitter at 02:23. Then, I watched the following moments, from 02:23 to 02:28, to observe his reaction. As he smiled and took a bite, I concluded that he was happy and content." + }, + { + "key": "l_V_7PeK2cw:ff56e3ba32a4fbf791e30bc76e2bc47c3f3e017e", + "video_id": "l_V_7PeK2cw", + "question": "What does the child do with the knife by the end of the short film?", + "answer_choice_0": "He threatens the babysitter with it.", + "answer_choice_1": "He throws it out of the window.", + "answer_choice_2": "He accidentally cuts himself.", + "answer_choice_3": "He puts it into a drawer.", + "answer_choice_4": "He uses it to cut himself some cucumbers.", + "answer_id": 0, + "answer": "He threatens the babysitter with it.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At the end of the video, I watched the shot where the child stands menacingly and stares at the babysitter, which occurs at 4:47. Watching the scene, I observed the camera tilting down to show the knife being held threateningly in the child's hand, indicating a threat to the babysitter." + }, + { + "key": "luPzRnaVc7A:15aacd3dcdd13923f7c9fb101417e92e7f642b07", + "video_id": "luPzRnaVc7A", + "question": "What famous dancer's name appears in the room projection?", + "answer_choice_0": "Fred Astaire.", + "answer_choice_1": "Gregory Hines.", + "answer_choice_2": "Mikhail Baryshnikov.", + "answer_choice_3": "Gene Kelly.", + "answer_choice_4": "Tommy Tune.", + "answer_id": 0, + "answer": "Fred Astaire.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled through much of the dancers' routine, searching for the far right wall. I spotted the project on the wall, reading the name of the competition. The name of the event honors a famous dancer and his legacy. Freid Astaire's full name can be seen projected on white letter on the far wall at [04:55 - 5:06]." + }, + { + "key": "luPzRnaVc7A:7b854f451b698f9af79955fa51cbf41aae6f82db", + "video_id": "luPzRnaVc7A", + "question": "How many times does the couple bow together during the standing ovation after the performance?", + "answer_choice_0": "3 times.", + "answer_choice_1": "4 times.", + "answer_choice_2": "1 time.", + "answer_choice_3": "2 times.", + "answer_choice_4": "5 times.", + "answer_id": 2, + "answer": "1 time.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a standing ovation. I found that the standing ovation begins at 06:35. I continued watching to see how many times the couple would bow. I saw them bow together at 08:36. I watched the remainder of the video and determined that they never bow together again, making the total number of times they bow as a couple 1." + }, + { + "key": "luPzRnaVc7A:87bc180d88ea1b3d693918ac930cfe3902549444", + "video_id": "luPzRnaVc7A", + "question": "Before they both bowed, how many times did the male dancer twirl the female dancer while holding her hand?", + "answer_choice_0": "5 times", + "answer_choice_1": "1 time", + "answer_choice_2": "4 times", + "answer_choice_3": "2 times", + "answer_choice_4": "3 times", + "answer_id": 4, + "answer": "3 times", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I identified the moment where the dancers both bowed at 08:36. I watched the video from the beginning to this moment to search for instances when the man spun the woman while holding her hand. One spin happens at 04:07, then 04:09, and finally at 08:33. This totals 3 times." + }, + { + "key": "luPzRnaVc7A:8861dd9290365e5b7739d5f9fdce312b6cf29e63", + "video_id": "luPzRnaVc7A", + "question": "What does the male dance do right as the female dancer tumbles to the floor?", + "answer_choice_0": "Snaps his fingers.", + "answer_choice_1": "Strikes a pose.", + "answer_choice_2": "Drops to his left knee.", + "answer_choice_3": "Twirls in a circle.", + "answer_choice_4": "Crawls on the floor.", + "answer_id": 2, + "answer": "Drops to his left knee.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the male dancer wrap his hands around the waist around the female dancer who is bent over his right arm as he stands behind her 06:25. Then, he yanks on her waist, spinning the female dancer to the right as she tumbles to the dance floor [06:25 - 06:30]...and he drops his left knee to the ground." + }, + { + "key": "luPzRnaVc7A:9a1830b8fe5ccbd33e2bebedd8d5b02de999dd5e", + "video_id": "luPzRnaVc7A", + "question": "What happens when the blonde woman in the crimson dress fall on the floor?", + "answer_choice_0": "The dance continues, the audience claps.", + "answer_choice_1": "The dance pauses, the audience claps.", + "answer_choice_2": "The dance continues, the audience gasps.", + "answer_choice_3": "The dance pauses, the audience is silent.", + "answer_choice_4": "The dance ends, the audience boos.", + "answer_id": 1, + "answer": "The dance pauses, the audience claps.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the dance looking for the moment when the blonde woman in the crimson dress falls on the floor. I found this event at 06:29. I continued watching and observed that this moment effectively signals the end of the main part of the dance where the two dancers perform as a couple. They remain motionless from 06:29-06:54 I also observed the audience stand to their feet and clap during this time, giving a standing ovation beginning at 06:35. This indicated that her fall was meant to signal the end of the dance." + }, + { + "key": "luPzRnaVc7A:b944d5d840f572392f26622d3e003f10f237e7df", + "video_id": "luPzRnaVc7A", + "question": "What is the second word of the phrase visible to the left of the spinning star on the giant screen?", + "answer_choice_0": "Dance.", + "answer_choice_1": "Show.", + "answer_choice_2": "Studio.", + "answer_choice_3": "Contest.", + "answer_choice_4": "League.", + "answer_id": 4, + "answer": "League.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a shot of the giant screen with the spinning star. The rays of the star become partially visible at 02:48 but it is unclear what it is. I continued watching for a clearer image of it and found one at 04:52 that confirmed the spinning rays belong to a star. I looked to the left of the star for a phrase and read the words, \"Amateur League.\" I came to the conclusion that \"League\" is the second word of the phrase to the left of the spinning star on the giant screen." + }, + { + "key": "luPzRnaVc7A:e51c73e2102afe9f3a26ddc357333e3c7d45016f", + "video_id": "luPzRnaVc7A", + "question": "Where is the couple dancer located on the dancerfloor when the sound of the audience clapping their hands to the beat at 02:28?", + "answer_choice_0": "The far right of the dancefloor.", + "answer_choice_1": "Towards the very front.", + "answer_choice_2": "The center of the dancefloor.", + "answer_choice_3": "Towards the far back.", + "answer_choice_4": "The far left of the dancefloor.", + "answer_id": 4, + "answer": "The far left of the dancefloor.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watch the video up until the 02:28 mark and observe the audience closely. The dancer couple has moves further to the left of the dancefloor. At 02:38, I observe the audience and look for a man wearing a blue shirt and glasses clapping his hands." + }, + { + "key": "mZPbhxl2ark:0fd29ab9be43624453d8e1c7fed80dea866a19a5", + "video_id": "mZPbhxl2ark", + "question": "At 06:50 - 06:53, how many total squares away from its original position does the black knight move?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "7.", + "answer_choice_3": "5.", + "answer_choice_4": "9.", + "answer_id": 1, + "answer": "3.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 06:50 - 06:53, I saw the black knight move from d4 to f3 by traveling leftward across 2 columns and up 1 row. Since f3 is 2 squares to the left and 1 square up from d4, I then calculated 2+1=3. Therefore, the black knight moves a total of 3 squares away from its original position at 06:50 - 06:53." + }, + { + "key": "mZPbhxl2ark:1f1cb5138c7e73c880d160dee978f66ff1e05570", + "video_id": "mZPbhxl2ark", + "question": "What was the second move that white made after their first piece was taken out of the game?", + "answer_choice_0": "Bishop from c8 to g4.", + "answer_choice_1": "Knight from d4 to f3.", + "answer_choice_2": "Bishop from g4 to h3.", + "answer_choice_3": "Knight from g1 to e2.", + "answer_choice_4": "King from e1 to f1.", + "answer_id": 4, + "answer": "King from e1 to f1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I saw the first white piece was taken out of the game at 06:26. Since no other white piece was taken out of the game prior to this instance, 06:26 was the first time a white piece was taken out. I then counted and observed each move white after 06:26. At 06:26, I saw a white knight move from g1 to e2, which was the first move. Then, I saw white's second move when their king moved from e1 to f1 at 06:54. Therefore, the second move that white made after their first piece was taken out of the game was moving their king from e1 to f1." + }, + { + "key": "mZPbhxl2ark:3be5f9630c2cda5722a3a957cf9806c9c5fa1eb3", + "video_id": "mZPbhxl2ark", + "question": "What piece has an arrow extending from it when the narrator says \"That's it for our video\"?", + "answer_choice_0": "White knight.", + "answer_choice_1": "Black rook.", + "answer_choice_2": "White queen.", + "answer_choice_3": "White pawn.", + "answer_choice_4": "Black pawn.", + "answer_id": 1, + "answer": "Black rook.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I heard the narrator say \"That's it for our video\" at 19:33 - 19:34. At the same time, I found the arrow, which was positioned with its point on f1 and its end on f8, where I also noticed a black rook was positioned. Since the arrow was extending from f8, it was then also extending from the black rook. Therefore, the piece that has an arrow extending from it when the narrator says \"That's it for the video\" is the black rook at f8." + }, + { + "key": "mZPbhxl2ark:48a1a7f0274f233b0055c666f629934c40d6db6d", + "video_id": "mZPbhxl2ark", + "question": "What is the sum of the 2 numbers in the parentheses located next to the words \"Disciple\" and \"Sensei Subscriber\"?", + "answer_choice_0": "3333.", + "answer_choice_1": "3030.", + "answer_choice_2": "3000.", + "answer_choice_3": "3300.", + "answer_choice_4": "3003.", + "answer_id": 3, + "answer": "3300.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found two lines of text on the right side of the screen at 00:01, reading \"Disciple (300)\" and \"Sensei Subscriber (3000)\". I then read the 2 numbers in the parentheses located next to the words \"Disciple\" and \"Sensei Subscriber\", reading \"300\" and \"3000\". Then, I calculated 300+3000=3300. Therefore, the sum of the 2 numbers in the parentheses located next to the words \"Disciple\" and \"Sensei Subscriber\" is 3300." + }, + { + "key": "mZPbhxl2ark:525f0b8184e52ec96229bdfbeb8d2913b8d92fc6", + "video_id": "mZPbhxl2ark", + "question": "At 03:25 - 03:34, which direction is the blue arrow pointing?", + "answer_choice_0": "Straight right.", + "answer_choice_1": "Up right.", + "answer_choice_2": "Straight down.", + "answer_choice_3": "Down left.", + "answer_choice_4": "Straight up.", + "answer_id": 2, + "answer": "Straight down.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the blue arrow at 03:25 - 03:34. Since its end was positioned on the white queen at f3 and because its point was positioned on a black pawn at f7, the arrow was therefore pointing downward. In addition, since the arrow remains inside column \"f\" during 03:25 - 03:34, without changing position, the direction the blue arrow is pointing in is therefore straight down." + }, + { + "key": "mZPbhxl2ark:7d9f95be0510b729db6df86de5153a45b67a8133", + "video_id": "mZPbhxl2ark", + "question": "How many total words are in the yellow and red outlined rectangular boxes?", + "answer_choice_0": "1.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I found the yellow and red outlined rectangular boxes in the bottom right corner of the screen at 00:01, with text inside, reading \"CHESS SENSEI\" and \"SUBSCRIBE\" correspondingly. Then, I counted the total number of words within \"CHESS SENSEI\" and \"SUBSCRIBE\", calculating a total of 3. Therefore, there are 3 total words in the yellow and red outlined rectangular boxes." + }, + { + "key": "mZPbhxl2ark:a6ae8bc46f8bc02b443c9c37ddff79bd26fb8325", + "video_id": "mZPbhxl2ark", + "question": "How many turns does black play before their first piece is taken out of the game?", + "answer_choice_0": "4.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "2.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I saw the first black piece was taken out of the game at 01:06. Before that, I counted each turn black played according to the number of times they moved a piece. At 00:27, I saw black's first move. Then, I saw their second turn at 00:57. Since black did not move again before their first piece was taken out of the game at 01:06, I then counted the number of turns black made previously, calculating a total of 2. Therefore, black plays 2 turns before their first piece is taken out of the game." + }, + { + "key": "mZPbhxl2ark:c3d27c150a989512b1f053f73ffce13a482135ca", + "video_id": "mZPbhxl2ark", + "question": "What move results in the first piece being taken out of the game?", + "answer_choice_0": "White queen from h5 to e5.", + "answer_choice_1": "White pawn from e2 to e4.", + "answer_choice_2": "White bishop from f1 to c4.", + "answer_choice_3": "White queen from d1 to h5.", + "answer_choice_4": "Black pawn from e7 to e5.", + "answer_id": 0, + "answer": "White queen from h5 to e5.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 01:06, I saw the first piece that was taken out of the game: a black pawn at e5, taken by the white queen. Since there was no piece taken before this instance, this was the first piece taken out of the game. Before that, I saw the white queen at h5 before moving to e5. Therefore, the move that results in the first piece being taken out of the game is the white queen moving from h5 to e5." + }, + { + "key": "mZPbhxl2ark:c67543a583acb3a611c03724224821cfebfc6d8a", + "video_id": "mZPbhxl2ark", + "question": "How many total pieces are out of the game at 07:15 - 07:18?", + "answer_choice_0": "4", + "answer_choice_1": "5", + "answer_choice_2": "3", + "answer_choice_3": "2", + "answer_choice_4": "1", + "answer_id": 1, + "answer": "5", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "At 07:15, I saw a graphic on the right side of the screen, indicating which pieces for each team are out of the game. I then counted the number of pieces each team had out of the game. Since black had a pawn and a bishop out of the game, they had a total of 2 pieces taken. Likewise, since white had a pawn and a bishop out of the game, they also had a total of 2 pieces taken. At 07:18, white had another bishop taken. This is a total of 3 pieces taken for white. I then calculated 2+3=5. Therefore, the total number of pieces that are out of the game at 07:15-07:18 is 5." + }, + { + "key": "mZPbhxl2ark:ea882ec1821fbc1b26c1d717e1ed51fbb55d5563", + "video_id": "mZPbhxl2ark", + "question": "When is the first white piece taken out of the game?", + "answer_choice_0": "06:26.", + "answer_choice_1": "01:33.", + "answer_choice_2": "01:14.", + "answer_choice_3": "01:06.", + "answer_choice_4": "06:21.", + "answer_id": 0, + "answer": "06:26.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I saw the first white piece taken out of the game at 06:26, when a black bishop moved from c8 to g4, taking a white pawn out of the game. Since no other white piece was taken out of the game prior to this instance, 06:26 is therefore when the first white piece is taken out of the game." + }, + { + "key": "maLy1naVpjg:21d1d44ec187a61c597e1b2a78ab99f250486f8f", + "video_id": "maLy1naVpjg", + "question": "What happens to the final disc shot of the game?", + "answer_choice_0": "It lands in the center hole.", + "answer_choice_1": "It misses the hole and lands off the board.", + "answer_choice_2": "It knocks a red disc off the board.", + "answer_choice_3": "It hits one of posts and stops.", + "answer_choice_4": "It knocks a white disc off the board.", + "answer_id": 2, + "answer": "It knocks a red disc off the board.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find the final disc shot of the game. It occurs at 13:38, when the player identified by the text below him as Steven Alfieri shoots one of his white discs. It hits one of the red discs on the board and knocks it completely off, sending it back toward the other player. So, the answer is that it knocks a red disc off the board." + }, + { + "key": "maLy1naVpjg:2e68d786bf572ea54ce3db4e4df7820608af1e06", + "video_id": "maLy1naVpjg", + "question": "At what time in the video does the player on the right knock over his clear plastic tube which contains his discs?", + "answer_choice_0": "09:15.", + "answer_choice_1": "00:19.", + "answer_choice_2": "07:01.", + "answer_choice_3": "03:58.", + "answer_choice_4": "01:42.", + "answer_id": 1, + "answer": "00:19.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find the time when the player on the right knocks over his clear plastic tube which contains his discs. I went to the 00:19 time stamp and it is at this moment that the player on the right places a red disc inside the tube, and the tube immediately falls over. I went to the other possible time stamps in the video, and at each one, the tube does not fall over. So, the answer is 00:19." + }, + { + "key": "maLy1naVpjg:2e789fb739ba0a2bfb638cd7d539c05c8ce74f37", + "video_id": "maLy1naVpjg", + "question": "What is the difference in the number of points that Steven Alfieri has at 03:30 and the number of points that Henry Allen has at 11:10?", + "answer_choice_0": "1.", + "answer_choice_1": "3.", + "answer_choice_2": "2.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 1, + "answer": "3.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked at each time stamp in the video specified by the question, and read the respective scores of the players. At 03:30, according to the caption of his name in the bottom left corner of the screen, Steven Alfieri has 2 points. At 11:10, according to the caption of his name in the bottom right of the screen, Henry Allen has 5 points. I then conducted the problem of 5-2=3, to find that the point difference between Steven Alfieri at 03:30 and Henry Allen at 11:10 was 3." + }, + { + "key": "maLy1naVpjg:4255dcf8be46660a1c0dff58ebcca3d533faa6fc", + "video_id": "maLy1naVpjg", + "question": "Just before the score of the game is tied 3-3, how many discs are in play on top of the dark brown portion of the game board?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "6.", + "answer_choice_4": "5.", + "answer_id": 3, + "answer": "6.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find the point when the game becomes tied at a 3-3 score. I found this point at 05:39. At this time, the scores at the bottom of the frame have changed to read \"Steven Alfieri: 3\" and \"Henry Allen: 3\". Just before this, from 05:23-05:38, the two players are looking at the board and counting points based on the number of discs remaining in play. During this period, one white disc is visible and five red discs are visible on top of the brown portion of the game board. So, the total number is 6." + }, + { + "key": "maLy1naVpjg:68c4dda0371ef355b808028b9bb8947906cf2754", + "video_id": "maLy1naVpjg", + "question": "During the period of the match where Steven Alfieri and Henry Allen are tied with 5 points, how many times does a disc go into the ditch?", + "answer_choice_0": "11.", + "answer_choice_1": "10.", + "answer_choice_2": "12.", + "answer_choice_3": "13.", + "answer_choice_4": "14.", + "answer_id": 3, + "answer": "13.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the portion of the video where Steven Alfieri and Henry Allen are tied with 5 points from 10:07-11:54, which I determined based on reading the scores beside their names. I then counted the number of times a disc goes into the ditch of the board, which is the outer recessed ring: a disc goes into the ditch at 10:15, 10:20, 10:22, 10:28, 10:46, 10:57, 11:17, 11:23, 11:27, 11:32, 11:36, 11:43, and 11:50, for a total of 13 times in that timespan." + }, + { + "key": "maLy1naVpjg:7aace09a05cd0fba9d2305a4070302b5a63b1ddf", + "video_id": "maLy1naVpjg", + "question": "How many times does a disc enter and remain inside the board's central hole in the first minute of the video?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "0.", + "answer_choice_3": "3.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the first minute of the video, from 00:00-01:00, and paid attention to the plays where a disc entered and remained inside the board's central hole. The first time this occurred was by accident at 00:16. The second time happened at 00:33, and the third time was at 00:41. It occurred for the fourth and final time in the first minute at 00:47, for a total of four times." + }, + { + "key": "maLy1naVpjg:9198a208ac599275c7835cc49d5235ed448943c8", + "video_id": "maLy1naVpjg", + "question": "What causes both players to laugh and smile at 00:18 in the video?", + "answer_choice_0": "One player accidentally hits one of the other player's discs into the hole.", + "answer_choice_1": "A comment from one of the spectators.", + "answer_choice_2": "The players have hit 4 discs in a row into the hole.", + "answer_choice_3": "Several new spectators arrive and watch the players closely.", + "answer_choice_4": "One of the players misses the board completely.", + "answer_id": 0, + "answer": "One player accidentally hits one of the other player's discs into the hole.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to understand why the two players laughed and smiled at 00:18 in the video. Before this point in the video, the previous shot had been completed at 00:16 by the player on the left, identified via the text below him as Steven Alfieri. This shot, with his white disc, hits a red disc that is close to the hole in the center and causes the red disc to go into the hole. Shortly afterward, as the players both retrieve discs, they both laugh and smile. So, the answer is that one of the players accidentally hits one of the other player's discs into the hole." + }, + { + "key": "maLy1naVpjg:a5242e73c5fdc00d3b191df12141da8003c9728c", + "video_id": "maLy1naVpjg", + "question": "How many times does Steven Alfieri shift to his left in his chair in the final minute of the video?", + "answer_choice_0": "2.", + "answer_choice_1": "5.", + "answer_choice_2": "3.", + "answer_choice_3": "0.", + "answer_choice_4": "1.", + "answer_id": 2, + "answer": "3.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the final minute of the video - since the video is 13:46 long, I watched from 12:46-13:46 - and observed the number of times Steven Alfieri shifted to his left in his chair. I noted him shifting to his left at 13:02, at 13:26, and at 13:36, for a total of three times in this span." + }, + { + "key": "maLy1naVpjg:c27454654a0625ce9d7420b8b365c7228972d8db", + "video_id": "maLy1naVpjg", + "question": "What gesture does Henry Allen make right after he receives a fist bump?", + "answer_choice_0": "A finger snap.", + "answer_choice_1": "A fist pump.", + "answer_choice_2": "A shrug.", + "answer_choice_3": "A bow.", + "answer_choice_4": "A raise-the-roof.", + "answer_id": 2, + "answer": "A shrug.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the portion of the video where Steven Alfieri gives Henry Allen a fist bump. This occurs at 03:24, after a skilled play by Henry Allen. I then watched Henry Allen immediately after this time to see what he did. I watched him perform a shrugging gesture by raising his hands up and lifting his shoulders at 03:25." + }, + { + "key": "maLy1naVpjg:cf05014bb587f71c06359ee6b754c6dba7bf1611", + "video_id": "maLy1naVpjg", + "question": "What object is placed next to a lanyard on the table at 08:24 during the video?", + "answer_choice_0": "A trophy.", + "answer_choice_1": "A pen.", + "answer_choice_2": "A cell phone.", + "answer_choice_3": "A score sheet.", + "answer_choice_4": "A disc.", + "answer_id": 2, + "answer": "A cell phone.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find out what object is placed onto the table next to a lanyard. At 08:24, Steven Alfieri, identified on the screen via text as the man sitting on the left, pulls an object out of his pocket and places it on the table next to a lanyard at 08:25. The object is a cell phone, which makes the answer a cell phone." + }, + { + "key": "mat5oKZPY6Q:438f73e2f139b7fb94a5507d74e7fd46a7149751", + "video_id": "mat5oKZPY6Q", + "question": "In the scene where the young man is calling out into the forest, and the woman is in the background walking toward him, what is in the background behind both of them?", + "answer_choice_0": "A makeshift fort.", + "answer_choice_1": "A guard tower.", + "answer_choice_2": "An old car.", + "answer_choice_3": "A train track.", + "answer_choice_4": "A derelict building.", + "answer_id": 0, + "answer": "A makeshift fort.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first found the scene described in the question 06:24. I then observed what can be seen in the background behind the two characters, and identified it as a small makeshift fort, made out of sticks." + }, + { + "key": "mat5oKZPY6Q:d1b06fbae6f40481b204130c4834322e077a70e4", + "video_id": "mat5oKZPY6Q", + "question": "What type of hair does the stoner character have?", + "answer_choice_0": "Red mohawk.", + "answer_choice_1": "Short blonde.", + "answer_choice_2": "Brown dreadlocks.", + "answer_choice_3": "Long black.", + "answer_choice_4": "Frizzy brown.", + "answer_id": 3, + "answer": "Long black.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened when the \"stoner\" character was mentioned at 6:33. I then watched to see who the character was and what they looked like 6:33 - 6:56. He had long black hair." + }, + { + "key": "mat5oKZPY6Q:d72011b813c08db362c7f193783c93a5cd75410e", + "video_id": "mat5oKZPY6Q", + "question": "In the first clip of the video to feature multiple characters, what is the shorter character wearing in his ear?", + "answer_choice_0": "An ear plug.", + "answer_choice_1": "A microphone.", + "answer_choice_2": "A hearing aid.", + "answer_choice_3": "A gauge.", + "answer_choice_4": "An earring.", + "answer_id": 1, + "answer": "A microphone.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the first clip in which multiple characters appear: it is the third overall clip in the video, which appears at the 00:09. In this clip, I identified the shorter character and looked at his ear to determine what was present there - I determined that the item in his ear was an earset microphone." + }, + { + "key": "mfS9bBj6IcQ:262e5d6eade7308e28722bc6b686517d4928d715", + "video_id": "mfS9bBj6IcQ", + "question": "How do we know the tall detective feels emboldened by the short detective's support?", + "answer_choice_0": "Because he defuses the bomb.", + "answer_choice_1": "Because he is willing to kick a football again.", + "answer_choice_2": "Because he shakes the short detective's hand.", + "answer_choice_3": "Because he says he feels emboldened.", + "answer_choice_4": "Because he scores a goal.", + "answer_id": 1, + "answer": "Because he is willing to kick a football again.", + "question_type": "Goal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the short detective to say something supportive to the tall detective, which he does beginning at 03:18, telling the tall detective that he isn't the name his stepfather called him, but he is a detective and his best friend. The tall detective is emboldened and kicks the football at 03:33" + }, + { + "key": "mfS9bBj6IcQ:30bc7b08cf4e106df17f615e546be87b14f4dc5d", + "video_id": "mfS9bBj6IcQ", + "question": "What happened to the soccer ball after it bounced off the crossbar of the soccer goal?", + "answer_choice_0": "It dropped in front of the detective wearing the brown-furred jacket.", + "answer_choice_1": "It bounced to the right of the detective wearing the brown-furred jacket.", + "answer_choice_2": "It hit the stomach of the detective wearing the brown-furred jacket.", + "answer_choice_3": "It hit the head of the detective wearing the brown-furred jacket.", + "answer_choice_4": "It flew over the detective wearing the brown-furred jacket.", + "answer_id": 3, + "answer": "It hit the head of the detective wearing the brown-furred jacket.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video right at 03:30 when the soccer ball is on the ground. I watch the detective in the gray hoodie run and kick the ball at 03:34. I watch closely as the soccer ball flies towards the goal at 03:35 - 03:37. At the exact mark of 03:41 I watch the soccer ball bounce off the crossbar. It hits the detective wearing the brown furred jacket on the side of his head." + }, + { + "key": "mfS9bBj6IcQ:37fe16a72169c77c8dbe745291e8832cb038d2dd", + "video_id": "mfS9bBj6IcQ", + "question": "Does the tall detective succeed in proving his stepdad's words against him wrong?", + "answer_choice_0": "No, the tall detective misses the goal.", + "answer_choice_1": "Yes, the tall detective kicks a perfect goal.", + "answer_choice_2": "No, the tall detective realizes that he shouldn't care what his stepdad says.", + "answer_choice_3": "Yes, he becomes a professional football player.", + "answer_choice_4": "No, the tall detective begins to act like a fat goat.", + "answer_id": 0, + "answer": "No, the tall detective misses the goal.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I look for any mention of the stepdad's words toward the tall detective. At 03:07, the tall detective explains to the short detective that when he was seven, he kicked a football into the crossbar and his stepfather called him a \"fat goat.\" The short detective encourages him at 03:18, and the tall detective kicks a goal at 03:33. Unfortunately, the ball bounces off the crossbar at 3:40, and, at 03:42 rolls back to the short detective where it subsequently blows up. Therefore, the tall detective did not prove wrong the words his stepfather used against him." + }, + { + "key": "mfS9bBj6IcQ:3b60bc7c165b51e9e4c8ff97f9fbb2eb097984a3", + "video_id": "mfS9bBj6IcQ", + "question": "In the beginning of the video, how many injuries is the injured man purported to have, and what are they?", + "answer_choice_0": "One; a bruised rib.", + "answer_choice_1": "One; a fractured wrist.", + "answer_choice_2": "Two; a broken leg and a swollen tongue.", + "answer_choice_3": "One; a broken leg.", + "answer_choice_4": "Two; a fractured wrist and a sprained bum.", + "answer_id": 4, + "answer": "Two; a fractured wrist and a sprained bum.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the injured man, who appeared from 0:11 to 0:15. I then listened as another man described his prognosis; from 0:23-0:26, I heard him say he has a \"fractured wrist and sprained bum.\"" + }, + { + "key": "mfS9bBj6IcQ:58fe12cf663b71ea9fbaa30738fcf8ee406156c5", + "video_id": "mfS9bBj6IcQ", + "question": "What item of clothing flies off of the short detective when the bomb goes off?", + "answer_choice_0": "His pants.", + "answer_choice_1": "His shoes.", + "answer_choice_2": "His shirt.", + "answer_choice_3": "His hat.", + "answer_choice_4": "His coat.", + "answer_id": 4, + "answer": "His coat.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "For the duration of the video, the short detective is usually wearing a brown shearling coat. I saw him wearing it in the scene when they find the football/bomb, beginning at 02:30. He is wearing it just before the football/bomb explodes, at 03:41. I watched until 03:49, when the tall detective has been thrown to the ground by the football/bomb, and the brown shearling jacket lands on him." + }, + { + "key": "mfS9bBj6IcQ:5fb3a91ca3fe6648ffac9bf20f47d8364ee95411", + "video_id": "mfS9bBj6IcQ", + "question": "What happens after the second time the tall detective hits the crossbar?", + "answer_choice_0": "His stepfather calls him a name.", + "answer_choice_1": "It starts to rain.", + "answer_choice_2": "The ball explodes.", + "answer_choice_3": "He starts to cry.", + "answer_choice_4": "The other team shows up.", + "answer_id": 2, + "answer": "The ball explodes.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the tall detective to mention hitting the crossbar. I heard him mention it at 03:14. I then watched for him to kick a ball and hit the crossbar, and the crossbar is hit by the ball at 03:41, after which it rolls next to the short detective and explodes, as it is a bomb 3:45." + }, + { + "key": "mfS9bBj6IcQ:635de3f68759966e0e48fc540908dabef76c6dbb", + "video_id": "mfS9bBj6IcQ", + "question": "What does it say on the chief villain's jacket after he puts it on?", + "answer_choice_0": "The first line says \"RUGBY\" and the second says \"MUDDY FIELDS\".", + "answer_choice_1": "The first line says \"BAN'EI\" and the second says \"YELLOW SANDS\".", + "answer_choice_2": "The first line says \"WRESTLING\" and the second says \"MUD OLYMPICS\".", + "answer_choice_3": "The first line says \"REGATTA\" and the second says \"GREAT OUTDOORS\".", + "answer_choice_4": "The first line says \"CURLING\" and the second says \"OPEN ARENA\".", + "answer_id": 3, + "answer": "The first line says \"REGATTA\" and the second says \"GREAT OUTDOORS\".", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the chief villain, who first appears onscreen in a video at 01:05. He is not wearing a jacket, so I continued watching until 0:49, when he is seen again, this time wearing a jacket. On the left lapel, I read two lines, the first is \"REGATTA\" and the second is \"GREAT OUTDOORS.\"" + }, + { + "key": "mfS9bBj6IcQ:e6ea471cfc4a8e8d3767b0a17f9443096c666272", + "video_id": "mfS9bBj6IcQ", + "question": "What is the guy holding on the TV at 01:06?", + "answer_choice_0": "A bible.", + "answer_choice_1": "A book.", + "answer_choice_2": "Nothing.", + "answer_choice_3": "A paper.", + "answer_choice_4": "A folder.", + "answer_id": 3, + "answer": "A paper.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watch the video at 01:01 and continue watching until I spot the TV at 01:02. I continue to carefully observe the man in the black suit until his hand touches the power button at 01:05. I watch what the man on the TV is holding in his hand, then by himself at 01:06." + }, + { + "key": "mfS9bBj6IcQ:f45f74b2de22383186074d8ae1933fae6495f3a2", + "video_id": "mfS9bBj6IcQ", + "question": "How long would the soccer ball have been airborne if it was airborne for twice as long?", + "answer_choice_0": "8 seconds", + "answer_choice_1": "20 seconds", + "answer_choice_2": "16 seconds", + "answer_choice_3": "12 seconds", + "answer_choice_4": "24 seconds", + "answer_id": 0, + "answer": "8 seconds", + "question_type": "State Changes", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the moment when the soccer ball is airborne. I found this moment beginning at 03:34, when the young man kicks the ball. Then, there is a camera cut, after which the ball is shown in the air starting at 03:34. It flies until 03:36, when the camera cuts again. The camera cuts back to the flying ball at 03:38, and it continues until 03:40, when the camera cuts once again, this time to the ball hitting the crossbar and bouncing back. Adding these times up (2 seconds, and an additional 2 seconds) leads to a total of 4 seconds. Multiplying this by 2 (4x2) equals 8 seconds, making that the answer." + }, + { + "key": "mfS9bBj6IcQ:f59ebcbb95204d93bcbccc5df11334727b3c28d9", + "video_id": "mfS9bBj6IcQ", + "question": "How many wooden statues are placed up on the shelf in the back behind the man in the black suit?", + "answer_choice_0": "5.", + "answer_choice_1": "2.", + "answer_choice_2": "9.", + "answer_choice_3": "3.", + "answer_choice_4": "7.", + "answer_id": 1, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At the mark of 00:58, I spot the man in the black suit. I continue looking towards the wall behind him and see two wooden statues on the black shelf behind him 0:58 - 01:02." + }, + { + "key": "mnNadjPSu60:04af6e2098ffd648527da51c4b6a6f66c4c941e7", + "video_id": "mnNadjPSu60", + "question": "In the news headline featured from 02:38 to 02:40, what is the phrase in quotations?", + "answer_choice_0": "'I am completely devastated.'", + "answer_choice_1": "'I am completely stunned.'", + "answer_choice_2": "'I am completely heartsick.'", + "answer_choice_3": "'I am completely shattered.'", + "answer_choice_4": "'I am completely heartbroken.'", + "answer_id": 2, + "answer": "'I am completely heartsick.'", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went 02:38 in the video and watched until 02:40. While watching I observed a snippet of a news headline. The headline read \"Jennifer Lopez cancels US tour: 'I am completely heartsick'\". The phrase in quotations, therefore, is \"'I am completely heartsick'\"." + }, + { + "key": "mnNadjPSu60:29310c2a21fbfcd960abf7feba89e7e17c5ea975", + "video_id": "mnNadjPSu60", + "question": "How did the text graphic move at 01:56 - 02:01?", + "answer_choice_0": "It descended on-screen, then slowly shrank before fading away off-screen.", + "answer_choice_1": "It faded in on-screen, then slowly shrank before spinning away off-screen.", + "answer_choice_2": "It ascended on-screen, then slowly rotated before fading away off-screen.", + "answer_choice_3": "It faded in on-screen, then slowly rotated before spinning away off-screen.", + "answer_choice_4": "It spun on-screen, then slowly grew in size before cutting away off-screen.", + "answer_id": 4, + "answer": "It spun on-screen, then slowly grew in size before cutting away off-screen.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the text graphic at 01:56. At the same time, I saw it spin on-screen. Next, from 01:56 - 02:01, I saw the graphic slowly grow in size. Then, I saw it cut away off-screen at 02:01." + }, + { + "key": "mnNadjPSu60:a02e6a4617885e74ef55b788c60572b3410cb1de", + "video_id": "mnNadjPSu60", + "question": "What type of outerwear is Diddy wearing while walking around Times Square?", + "answer_choice_0": "A beige fleece jacket.", + "answer_choice_1": "A black leather trenchcoat.", + "answer_choice_2": "A red puffer jacket.", + "answer_choice_3": "A gray peacoat.", + "answer_choice_4": "A tan coat with fur lining.", + "answer_id": 4, + "answer": "A tan coat with fur lining.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the part in the film where Diddy is in Times Square. He is walking in Times Square at 07:53. I looked at what he was wearing and noticed he has on a tan coat with fur lining." + }, + { + "key": "mnNadjPSu60:cb41ae32db3f184abf858f7896d6042a3013e422", + "video_id": "mnNadjPSu60", + "question": "What colors are the background at 00:01 of the video?", + "answer_choice_0": "Crimson, blue, white, black.", + "answer_choice_1": "Red, auburn, yellow, green.", + "answer_choice_2": "Blush, green, navy, purple.", + "answer_choice_3": "Periwinkle, blue, yellow, pink.", + "answer_choice_4": "Pink, gray, white, maroon.", + "answer_id": 4, + "answer": "Pink, gray, white, maroon.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 0:01 of the video, I noticed the background was a moving pattern of triangles that were pink, gray, white, and maroon." + }, + { + "key": "mv5_b50V9x8:1588beb3be663144f004951425f1e57f79069dcd", + "video_id": "mv5_b50V9x8", + "question": "What words does Ben Schwartz use to describe John Malkovich after Larry King says John Malkovich is \"crazy\"?", + "answer_choice_0": "So wise and so intelligent.", + "answer_choice_1": "So lovely and so kind.", + "answer_choice_2": "So loyal and so smart.", + "answer_choice_3": "So courageous and so resilient.", + "answer_choice_4": "So generous and so friendly.", + "answer_id": 1, + "answer": "So lovely and so kind.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened when Larry King and Ben Schwartz were talking about John Malkovich. I observed at 09:31, Ben Schwartz listed his co-stars in an upcoming project and John Malkovich was one of them. At 09:48, Larry King called John Malkovich \"crazy\" and then Ben Schwartz described him as \"so lovely\" and \"so kind\" at 09:51 - 09:52." + }, + { + "key": "mv5_b50V9x8:3bc27657008594b42850b70b1fef9e7bf7115d07", + "video_id": "mv5_b50V9x8", + "question": "When a wide shot of Larry King and Ben Schwartz first appears, where is the colorful painting situated?", + "answer_choice_0": "Between Larry King and Ben Schwartz.", + "answer_choice_1": "In front of Larry King and Ben Schwartz.", + "answer_choice_2": "Behind Ben Schwartz on the wall.", + "answer_choice_3": "There is no colorful painting.", + "answer_choice_4": "Behind Larry King on the wall.", + "answer_id": 4, + "answer": "Behind Larry King on the wall.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first look for the first wide shot of Larry King and Ben Schartz together. I find it at 00:34. Then I look for a colorful painting. A vivid painting with colors of red, yellow, green and blue shows up behind Larry King, in the background, hung up on a wall. This is, therefore, where the colorful painting is when the first wide shot of Larry King and Ben Schwartz appears." + }, + { + "key": "mv5_b50V9x8:cf76a8d1f57a63711fb046ec678bfe542fb60c46", + "video_id": "mv5_b50V9x8", + "question": "What is the scenery when a sculpture of a dog is first shown?", + "answer_choice_0": "A bright and modern studio.", + "answer_choice_1": "A comfortable and homey dining room.", + "answer_choice_2": "A tiny and cluttered studio.", + "answer_choice_3": "A neat and tidy bedroom.", + "answer_choice_4": "A comfortable and homey studio.", + "answer_id": 4, + "answer": "A comfortable and homey studio.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and waited for a statue of a dog to be shown on screen, which it was, at 00:33. I stopped the video at 00:33 and took some time to study the scenery. I saw that it was a comfortable and homey studio." + }, + { + "key": "mv5_b50V9x8:dbbab213eb5e653b7958d40b8c79ade4f3554284", + "video_id": "mv5_b50V9x8", + "question": "What letter is on the blue hat on the top shelf, to the right of a picture frame?", + "answer_choice_0": "D.", + "answer_choice_1": "E.", + "answer_choice_2": "C.", + "answer_choice_3": "B.", + "answer_choice_4": "A.", + "answer_id": 3, + "answer": "B.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 00:33, when Ben and Larry are both in wide view of the camera. At 00:33, I looked for the shelf, and was able to identify it in the background. I then looked to the very top shelf for a blue hat. I spotted the blue hat then tried to discern the letter stitched onto it. I was able to identify the letter as \"B.\" I was then able to verify that this blue hat rests to the right of a picture frame." + }, + { + "key": "mv5_b50V9x8:fd74f3035a20845766cea18602e5e9295313f080", + "video_id": "mv5_b50V9x8", + "question": "What object can be found positioned behind Larry King's head on the left side of the frame between [01:40 - 01:43]?", + "answer_choice_0": "Pink flowers.", + "answer_choice_1": "White flowers.", + "answer_choice_2": "Lotus flowers.", + "answer_choice_3": "Sunflowers.", + "answer_choice_4": "Red roses.", + "answer_id": 1, + "answer": "White flowers.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the specified section of the video starting at 01:40. I then searched for any objects positioned behind Larry King's head on the left side of the frame, and was able to discern some flowers. I continued watching until 01:43 to ensure no other objects appeared onscreen in that area." + }, + { + "key": "n7cOlBxtKSo:3ce12c32d68ab1b9d6ab942be36155840824ecff", + "video_id": "n7cOlBxtKSo", + "question": "An orange particle appears after a white particle splits into six different colored particles. How much more matter does the particle depicted in orange contain compared to the particle depicted in red?", + "answer_choice_0": "3.2 MeV.", + "answer_choice_1": "7.1 MeV.", + "answer_choice_2": "4.8 MeV.", + "answer_choice_3": "9.2 MeV.", + "answer_choice_4": "2.5 MeV.", + "answer_id": 4, + "answer": "2.5 MeV.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "At 02:23, a white particle appears. I then saw the white particle split into six particles at 02:28. At 2:32, I saw the particle depicted in orange labeled as d and the particle depicted in red labeled as u. I saw the mass listed below each particle. I understand that the amount of matter a particle contains is mass. I subtracted the listed mass (2.3 MeV) of the particle u from the listed mass (4.8 MeV) of the particle d: 4.8 MeV - 2.3 MeV. I found the numerical value to be 2.5 MeV. Particle d contains 2.5 MeV more matt than particle u." + }, + { + "key": "n7cOlBxtKSo:976216a0a18931be44efc09a7dfdbba95ab9816a", + "video_id": "n7cOlBxtKSo", + "question": "An object is on top of the letter, G, when the narrator says, \"quanta of space-time curvature, called gravitons.\" How many times do we see this object in the first 5 minutes of the video?", + "answer_choice_0": "8.", + "answer_choice_1": "12.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "16.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "At 01:39, I listened to the narrator say, \"quanta of space-time curvature, called gravitons.\" At 01:41, I saw a capital G start to appear, and I identified the object on top of the letter as a magnifying glass. In the first five minutes, I saw the magnifying glass appear at 01:39, 02:40, and 03:54. I added the number of times we see the magnifying glass in the first five times and found the total to be 3." + }, + { + "key": "n7cOlBxtKSo:a0bfd9fdb37bc284bba0625487433a7c7f76aa30", + "video_id": "n7cOlBxtKSo", + "question": "How does the depiction of a photon at 00:35 differ from a photon at 07:40?", + "answer_choice_0": "The photon at 00:35 is depicted as a white, Greek Gamma letter, and the photon at 07:40 is depicted as a white, straight line with a white aura.", + "answer_choice_1": "The photon at 00:35 is depicted as a white, Greek Beta letter, and the photon at 07:40 is depicted as a white, wavy line with a green aura.", + "answer_choice_2": "The photon at 00:35 is depicted as a white circle with a green aura, and the photon at 07:40 is depicted as a green, Greek Beta letter.", + "answer_choice_3": "The photon at 00:35 is depicted as a white square with a white aura, and the photon at 07:40 is depicted as a white, Greek Alpha letter.", + "answer_choice_4": "The photon at 00:35 is depicted as a green, Greek Gamma letter, and the photon at 07:40 is depicted as a white, straight line with a green aura.", + "answer_id": 4, + "answer": "The photon at 00:35 is depicted as a green, Greek Gamma letter, and the photon at 07:40 is depicted as a white, straight line with a green aura.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "At 00:35, I listened to the narrator say, \"exchange of photons,\" and at the same time, I saw the photon depicted as a green, Greek Gamma letter. At 07:40, I saw the photon, depicted as a white, straight line with a green aura, highlighted as I listened to the narrator say, \"photon.\"" + }, + { + "key": "n7cOlBxtKSo:a13505790c4fdce1a49ca53d3edb0110293c996e", + "video_id": "n7cOlBxtKSo", + "question": "Which description of a string matches the visual portrayal of the graviton in this video?", + "answer_choice_0": "A closed string with two ripples.", + "answer_choice_1": "No consistent depiction.", + "answer_choice_2": "An open string with one ripple.", + "answer_choice_3": "A closed string with one ripple.", + "answer_choice_4": "An open string with two ripples.", + "answer_id": 3, + "answer": "A closed string with one ripple.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for a string representation of a graviton. I notice at 03:09 they take a closed and open string and explain what they look like with various different levels of ripples. At 03:35 they take a diagram of strings with various numbers of ripples and explain the closed loop with one ripple represents the graviton. I note that this is only the first appearance of a graviton as a string, I need to make sure the representation is consistent. At 03:53 the same graph appears, identifying the same string as the graviton. From 07:38-07:48 this figure transforms into another figure keeping the graviton depiction consistent, making this visual representation consistent." + }, + { + "key": "n7cOlBxtKSo:b105c23f747e893675fe6ca9a984b5a18a4311a1", + "video_id": "n7cOlBxtKSo", + "question": "How many different theories which reconcile the theories of quantum mechanics and gravity, including subvarients of string theory, are pictographically depicted in this video?", + "answer_choice_0": "6.", + "answer_choice_1": "9.", + "answer_choice_2": "5.", + "answer_choice_3": "4.", + "answer_choice_4": "10.", + "answer_id": 4, + "answer": "10.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video listening and looking for theories of everything. At 02:06 I see a diagram with 4 different theories of everything, one of which is string theory. At 14:04 the same diagram is shown. At 15:15 string theory is shown to actually be 5 different theories, which can be displayed as a sixth supertheory at 15:36. Splitting string theory into 6 different theories and additionally the overall theory, I count the video showing pictographically 10 different theories which reconcile gravity and quantum mechanics." + }, + { + "key": "n7cOlBxtKSo:b375899463b9f94a18db2ccbe2f9c1eb85f27b66", + "video_id": "n7cOlBxtKSo", + "question": "This video describes the string theory version of Feynman diagrams, how many unique such diagrams are shown?", + "answer_choice_0": "12.", + "answer_choice_1": "17.", + "answer_choice_2": "18.", + "answer_choice_3": "16.", + "answer_choice_4": "15.", + "answer_id": 4, + "answer": "15.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for the string theory equivalent of Feynman diagrams. From 04:51-05:24 I noticed Feynman diagrams and their purpose are implicitly described. At 05:44 I saw the first string theory version of these paths, a surface diagram which is a cylinder. Subsequently, to this, I see a superposition of these diagrams shown over the original diagram, and a few are traced out. Ultimately, each of these are shown side by side at 06:18 and there are 15 unique diagrams." + }, + { + "key": "n7cOlBxtKSo:c8f9381a24af71e0601f1656e6837cd0758ceb16", + "video_id": "n7cOlBxtKSo", + "question": "The dichotomy of bosons and fermions is an important part of understanding fundamental physics. How many distinct final figures in this video juxtapose them?", + "answer_choice_0": "10.", + "answer_choice_1": "21.", + "answer_choice_2": "4.", + "answer_choice_3": "17.", + "answer_choice_4": "28.", + "answer_id": 1, + "answer": "21.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, specifically looking for figures juxtaposing bosons and fermions. I see the first such figure, the standard model, which appears at 00:41 and develops until its final form at 00:49. I see the figure transform to containing pictogram representations of the various elements at 01:04, forming the second distinct figure. At 01:50 I see the standard model appear again, dividing and therefore juxtaposing, the bosons and fermion, but this time with the addition of the graviton, making this the third distinct such figure. At 06:54 I see the standard model with the graviton appears again, failing to be distinct. At 07:50 I see a version of the standard model with the string versions of the bosons and no fermions, making this the fourth such figure. At 08:04 I see a tachyon splits the dichotomy in our standard model, but this is still a distinct figure which juxtaposes fermions and bosons and therefore constitutes the fifth such figure. At 08:15 I see the label for the tachyon is removed, but this is still the same figure. At 08:27 I see arrows surround the figure, but it is still the same figure. At 09:00 I see a new figure with strings representing the fermions and an empty tachyon box which represents the sixth such figure. At 09:06 I see the empty tachyon box removed, constituting the seventh such figure. At 09:40 I see a previous figure, and at 09:45 I see another old figure. At 12:41 I see another figure juxtaposing fermions and bosons with many more strings constituting the eight such figure. From 12:57 till 13:06 different dimensional configurations each with their own version of this string standard model are show, generating 9 more figures bringing us to 16 total figures. At 13:26 I see 3 more distinct such figures on screen, bringing the total to 19. At 14:53 I see another such figure, bringing the total to 20. I also remembered seeing a similar figure to this that I skipped at 09:17 bringing the final to 21." + }, + { + "key": "n7cOlBxtKSo:febd3191fde5a89c31963cac1b159030cf16e42c", + "video_id": "n7cOlBxtKSo", + "question": "After a white particle splits into six different colored particles, which colors are depicted of particles with a zero charge?", + "answer_choice_0": "Orange, yellow, and pink.", + "answer_choice_1": "Yellow, green, and blue.", + "answer_choice_2": "Pink and green.", + "answer_choice_3": "Pink, green, and blue.", + "answer_choice_4": "Red and orange.", + "answer_id": 3, + "answer": "Pink, green, and blue.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Physics", + "reasoning": "At 02:23, a white particle appears. I then saw the white particle split into six particles at 02:28. At 2:32, under each particle, I saw the mass (m), charge (q), and spin (s) listed. I saw that the only particles that had listed a charge of zero were depicted in pink, green, and blue." + }, + { + "key": "nkc-MUJgNfQ:8a804944309fdb4f9b49f57f36a9a2e71e6b3373", + "video_id": "nkc-MUJgNfQ", + "question": "How many clothing items are visible on the Forbidden clothing company's website page at 02:40?", + "answer_choice_0": "12.", + "answer_choice_1": "8.", + "answer_choice_2": "7.", + "answer_choice_3": "6.", + "answer_choice_4": "10.", + "answer_id": 1, + "answer": "8.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the parts that feature the website page of the forbidden clothing company at 02:40. At the same time, I then counted the items shown on the page, calculating 8 total." + }, + { + "key": "nkc-MUJgNfQ:95e86e2c4272405bb2534aca4cd98592aad73424", + "video_id": "nkc-MUJgNfQ", + "question": "How many different dumpsters are visible during the times that the man being pushed in a shopping cart?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 3, + "answer": "2.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the man being pushed in a shopping cart and found the first segment ran from 00:30 to 00:32. During this segment, I noticed two blue dumpsters behind the men. I continued watching and noticed another segment where a man was being pushed in a shopping cart from 00:57 to 00:59. During this segment, The same two blue dumpsters were shown here, so I did not count them as new dumpsters. I continued watching and found the man being pushed in a shopping cart again from 01:08 to 01:10. In this segment, there were no dumpsters visible. I did not see any more segments with men being pushed in shopping carts, therefore I counted the number of dumpsters visible to be 2." + }, + { + "key": "nkc-MUJgNfQ:dcb1a8f5354a5e30f257ae9d940eb35afdc8cea8", + "video_id": "nkc-MUJgNfQ", + "question": "What is the name of the Rabbi mentioned by the long-bearded man in the video, who claimed that the COVID-19 vaccine turns people gay?", + "answer_choice_0": "Daniel Asir.", + "answer_choice_1": "David Asor.", + "answer_choice_2": "Darin Asir.", + "answer_choice_3": "David Asir.", + "answer_choice_4": "Daniel Asor.", + "answer_id": 4, + "answer": "Daniel Asor.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found the part where the long bearded man started talking about the rabbi that claimed COVID-19 vaccine turns people gay at 00:15. I kept watching and heard the man with the long beard say his name at 00:16. Then, I read and found his name at 00:17 on the left of the frame under a picture of him, on a digital post about his concerns, which read \"Daniel Asor\"." + }, + { + "key": "no-DgUnLZxo:177e70d584e7a5c8c632e8b4a874909c861548ab", + "video_id": "no-DgUnLZxo", + "question": "Which team benefits from the swap done at 02:49?", + "answer_choice_0": "The blue team.", + "answer_choice_1": "The green and blue teams.", + "answer_choice_2": "The red and blue teams.", + "answer_choice_3": "The green team.", + "answer_choice_4": "The red team.", + "answer_id": 2, + "answer": "The red and blue teams.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I went to 02:49 in the video. Then, I watched as the red pawn swapped places with the blue pawn. I listened as the red player shared he made that move so he could go right into home. So, I knew the red team benefited from the swap. But I also looked at where the blue pawn was before the swap and after. The blue pawn is shown closer to his home base after the swap, so overall he benefited from the swap as well. Therefore, the red and blue teams both benefited from the swap at 02:49?" + }, + { + "key": "no-DgUnLZxo:47e6227f936ff767a55ce5758dcb3f019c6c13bc", + "video_id": "no-DgUnLZxo", + "question": "How many swaps are done throughout the video?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "6.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "While watching, I looked for moments where the pawns swapped places. I noticed that the only times pawns swapped places were at 02:49 and 03:10. There are moments in the video where pawns take over another pawn's spot, but they didn't swap but rather send them back home, such as at 03:26, so I didn't count those moments. Then I added the times they swapped and got two. Therefore, there are two swaps throughout the video." + }, + { + "key": "no-DgUnLZxo:53dd724037544d6ff4c593fd485f4804b40c1489", + "video_id": "no-DgUnLZxo", + "question": "At 07:07, which colors only have 1 game piece in their designated 'Home' space?", + "answer_choice_0": "Blue and Green.", + "answer_choice_1": "Blue, Yellow, and Red.", + "answer_choice_2": "Red, Yellow, and Green.", + "answer_choice_3": "Green, Blue, and Red.", + "answer_choice_4": "Green and Red.", + "answer_id": 2, + "answer": "Red, Yellow, and Green.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watch the video at 07:02-07:04 and look for the circular spaces labeled \"Home\" for each color Yellow, Red, Green, and Blue. I look for the game pieces that sit in the \"Home\" space for each color at 07:07-07:08. I look at Yellow, Green, and Red and spot only 1 game piece in the \"Home\" space. The color Blue has 2 total game pieces in its \"Home\" space. I conclude that Yellow, Green, and Red are the colors with only 1 game piece in each of its \"Home\" space." + }, + { + "key": "no-DgUnLZxo:77cfef48c0b809e4d454d27c0dd5d85f61b0845c", + "video_id": "no-DgUnLZxo", + "question": "What numbered card lays underneath the 5 numbered card at 02:53?", + "answer_choice_0": "11.", + "answer_choice_1": "10.", + "answer_choice_2": "2.", + "answer_choice_3": "8.", + "answer_choice_4": "7.", + "answer_id": 0, + "answer": "11.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video at 02:53 when the boy in the blue shirt draws a card. I continued to watch when he placed the card down on the stack of cards laying on the board at 02:54. The number on the card is 5. I carefully observe the numbers on the cards stacked haphazardly and look for the card directly underneath the number 5 card. The card is numbered 11." + }, + { + "key": "no-DgUnLZxo:9e4612315ca0914b0c8364c3484e1b45e022f8ae", + "video_id": "no-DgUnLZxo", + "question": "How many squares did the boy in the blue shirt move immediately before sliding the blue game piece down to the final square at 03:18?", + "answer_choice_0": "0 squares.", + "answer_choice_1": "1 square.", + "answer_choice_2": "5 squares.", + "answer_choice_3": "3 squares.", + "answer_choice_4": "4 squares.", + "answer_id": 0, + "answer": "0 squares.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watch the boy in the blue shirt at 03:17. I carefully observe him move his hand to lift the blue game piece off the board at 03:18. I watch him immediately slide the blue game piece down the board without counting individual squares. The blue game piece sits at the bottom of the arrow." + }, + { + "key": "no-DgUnLZxo:c9da7d6ec5a3da9113a044fed60c9207369f9a5c", + "video_id": "no-DgUnLZxo", + "question": "How many times was the \"Sorry\" card pulled between 03:00-04:00?", + "answer_choice_0": "4 times.", + "answer_choice_1": "None.", + "answer_choice_2": "2 times.", + "answer_choice_3": "1 time.", + "answer_choice_4": "3 times.", + "answer_id": 4, + "answer": "3 times.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watch the video during the specified timespan, and counted when the \"Sorry\" cards were drawn. I counted the first draw at 03:20, the second 03:31, and a third, final draw at 03:50. This makes it a total of 3 times when the \"Sorry\" card is drawn. I watched the rest of the span to ensure no more \"Sorry\" cards were drawn up to 04:00." + }, + { + "key": "no-DgUnLZxo:cf52817651f4f31acfc1008ca5190e85d2e2f2ad", + "video_id": "no-DgUnLZxo", + "question": "What furniture does the game room have?", + "answer_choice_0": "Couch and coffee table.", + "answer_choice_1": "Couch and TV.", + "answer_choice_2": "Table and chair.", + "answer_choice_3": "Bed and TV.", + "answer_choice_4": "Bed and dresser.", + "answer_id": 0, + "answer": "Couch and coffee table.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "While watching, I looked at the environment. I noticed that the players were in a room, possibly a game room for the little boy. The video is mostly a close up shot of the sorry game board on a coffee table. However, at 00:29, I spotted a couch and a coffee table shown together." + }, + { + "key": "no-DgUnLZxo:f818b7ce473dc3e764a6d2697ef9546dcfc18d1f", + "video_id": "no-DgUnLZxo", + "question": "What card helped the first team to reach home?", + "answer_choice_0": "Sorry.", + "answer_choice_1": "2.", + "answer_choice_2": "5.", + "answer_choice_3": "12.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "5.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "While watching, I noticed at 10:02 that the first to reach home was blue because I counted four blue pawns now, all at home base. Then, I went back to the video and looked for the card he drew beforehand. At 09:58, the boy flips over a 5-number card. Therefore, the card that helped the first team reach home was 5." + }, + { + "key": "no-O694RwVw:2c8a7f4ae3b6db6e941e015b574cef61fd86bce5", + "video_id": "no-O694RwVw", + "question": "When the girl meets Robot 723, what electric object attacks her?", + "answer_choice_0": "Her toothbrush.", + "answer_choice_1": "Her hairdryer.", + "answer_choice_2": "Her straightener", + "answer_choice_3": "Her curling iron", + "answer_choice_4": "Her flosser.", + "answer_id": 0, + "answer": "Her toothbrush.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find out how the robot wins the girl over. From 02:01-02:19, the voiceover narration confirms that the robot has saved the girl from a malfunctioning toothbrush. This wins her over, and she allows the robot to stay in the shed." + }, + { + "key": "no-O694RwVw:5b550a14cd9c2b2994368f343aee18ea0d89c28c", + "video_id": "no-O694RwVw", + "question": "While flying in the sewers, what is the robot holding in its hands?", + "answer_choice_0": "A dog and a purple-haired girl.", + "answer_choice_1": "A cat and a purple-haired girl.", + "answer_choice_2": "A cat and a dog.", + "answer_choice_3": "A brown-haired boy and a dog.", + "answer_choice_4": "A purple-haired girl and a brown-haired boy.", + "answer_id": 0, + "answer": "A dog and a purple-haired girl.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for the scene where the robot flies inside of the sewers. I found the segment from 06:13 to 06:18. I looked at the segment from 06:16 to 06:18 for a clear view of what the robot is holding in each hand as it flies. I identified a dog in the robot's right hand and the purple-haired girl in the robot's left hand." + }, + { + "key": "no-O694RwVw:6904ddfafd57e8e4eb13839454e546ee1306d0c0", + "video_id": "no-O694RwVw", + "question": "When the girl goes outside to check on her dog, what happens next and where is the setting?", + "answer_choice_0": "She finds her dog in a tree.", + "answer_choice_1": "She finds a robot in a car.", + "answer_choice_2": "She finds a robot in a pool.", + "answer_choice_3": "She finds her dog in a dog house.", + "answer_choice_4": "She finds a robot in her backyard.", + "answer_id": 4, + "answer": "She finds a robot in her backyard.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until the section where the girl goes outside to check on her dog at 02:01. I listened as the voiceover narration at 02:06-02:07 confirmed that Maya found a robot in her backyard. I also saw the robot standing in Maya's backyard between 02:02-02:09." + }, + { + "key": "no-O694RwVw:eabffa15c28324fc0dbf50b0981eff9fbdbd39e8", + "video_id": "no-O694RwVw", + "question": "Why is the girl bullied by her peers?", + "answer_choice_0": "For befriending a robot.", + "answer_choice_1": "For not owning a robot.", + "answer_choice_2": "For creating a robot.", + "answer_choice_3": "For owning too many robots.", + "answer_choice_4": "For destroying a robot.", + "answer_id": 1, + "answer": "For not owning a robot.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to find the point when the girl is bullied by her peers. When I arrive at 00:25, I learn that the girl's peers are bullying her because her family cannot afford a personal robot, a luxury that only some families can afford." + }, + { + "key": "nq9WnmCGoFQ:206516dc02751ec6ffab5d3fa88114dcd19f9504", + "video_id": "nq9WnmCGoFQ", + "question": "What is the only substep in the final step of making Summery Chicken Salad that is actually completed and shown on camera?", + "answer_choice_0": "Thinly slice chicken", + "answer_choice_1": "Season with salt and pepper", + "answer_choice_2": "Top with chicken", + "answer_choice_3": "Sprinkle seed blend", + "answer_choice_4": "Toss to combine", + "answer_id": 2, + "answer": "Top with chicken", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched until I saw a recipe card for Summery Chicken Salad on screen from 05:15-05:18, cluing me in to the moment where I could look closer for steps and substeps. The card only showed a picture of the finished dish and ingredients, and the cook started making another dish afterwards, so I went back to 05:08 where I can see the detailed steps of the recipe. At 05:10 I can read the last step is to \"Finish and serve\" and the substeps include \"Thinly slice chicken\", \"Divide salad between plates. Top with chicken\", and \"Sprinkle seed blend over top.\" I continued watching from 05:10-05:15 as the cook prepared the Summery Chicken Salad. At 05:15 he slides the already sliced chicken onto the plate. I did not see him slice the chicken, toss to combine, season with salt and pepper, nor top it with a seed blend, therefore the answer is top with chicken." + }, + { + "key": "nq9WnmCGoFQ:60338cacbd857df095471c172a1b4094dbedcced", + "video_id": "nq9WnmCGoFQ", + "question": "What happens when the cook throws potatoes at the wall?", + "answer_choice_0": "They become skinned.", + "answer_choice_1": "They turn into buns.", + "answer_choice_2": "They become mashed potatoes.", + "answer_choice_3": "They split into cubes.", + "answer_choice_4": "They disappear through the wall.", + "answer_id": 1, + "answer": "They turn into buns.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for the time the cook throws potatoes at the wall, and I find the event at 01:21. I realized that the minute they hit the wall, a subtle cut happens, and the potatoes become buns. Therefore, I concluded that they became buns." + }, + { + "key": "nq9WnmCGoFQ:60e18970681192e28aee0c3678b9ab9ac2c4c540", + "video_id": "nq9WnmCGoFQ", + "question": "Where is the tomato placed after all items are on the cutting board?", + "answer_choice_0": "Below the meat.", + "answer_choice_1": "Below the buns.", + "answer_choice_2": "Above the pickle.", + "answer_choice_3": "Above the meat.", + "answer_choice_4": "Below the pickle.", + "answer_id": 2, + "answer": "Above the pickle.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "At 01:57, I noticed that the man began to discuss how he would assemble the burger. After putting ingredients on the cutting board, I saw that the sliced tomato was placed at the top right side of the cutting board and above the pickle at 02:06." + }, + { + "key": "nq9WnmCGoFQ:93665e4b4ec639a05989f8764396221438a62125", + "video_id": "nq9WnmCGoFQ", + "question": "How long is the second item measured by the tape measure?", + "answer_choice_0": "3/4 inch", + "answer_choice_1": "1 inch", + "answer_choice_2": "1/4 inch", + "answer_choice_3": "1 1/2 inches", + "answer_choice_4": "1/2 inch", + "answer_id": 4, + "answer": "1/2 inch", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I first saw a tape measure in a drawer at 00:37. I continued watching and looking for it to be used as a measurement tool. I saw the chef use it to measure a whole cucumber at 05:18. Directly after that at 5:19, the chef measured a slice of cucumber. I looked at the measuring tape and determined that the slice of cucumber was 1/2 an inch long since it stretches from the 1 inch mark to the 1 and 1/2 inch mark." + }, + { + "key": "nq9WnmCGoFQ:9f05aac3e899a9f2bd369229a60dfca3d12fdb3f", + "video_id": "nq9WnmCGoFQ", + "question": "According to the schedule, what dates would you need to act on if you want to have a family?", + "answer_choice_0": "The 7th and the 17th.", + "answer_choice_1": "The 1st and the 2nd.", + "answer_choice_2": "The 3rd and the 30th.", + "answer_choice_3": "The 2nd and the 11th.", + "answer_choice_4": "The 19th and the 28th.", + "answer_id": 3, + "answer": "The 2nd and the 11th.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "The calendar that is displayed at 4:51-4:54 has every date crammed with handwritten activities that were planned for that day. I read the calendar and took note of all the activities that have to do with having a family. The activities that fit this search were \"have kids\", which I found on the 2nd and the 11th." + }, + { + "key": "nq9WnmCGoFQ:a7cc738656623dce52ad1227d1c43539b27aa0ca", + "video_id": "nq9WnmCGoFQ", + "question": "When the vlogger is drunk texting, what fraction of his sent texts contain misspelled words?", + "answer_choice_0": "5/6.", + "answer_choice_1": "4/7.", + "answer_choice_2": "1/2.", + "answer_choice_3": "5/7.", + "answer_choice_4": "3/4.", + "answer_id": 3, + "answer": "5/7.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched the vlogger drunk texting from 3:25 to 3:31. I observed his phone and looked for sent texts with misspelled words. I count 4 out of the 6 options: \"Wasssuuuuuup,\" \"I lug youiii siiiiii miiich\" (this shows up twice), and \"I lug you sookinjj much you don't even unreturned ine dr\". At 03:27, however, the cook sends another text that contains misspelled words: \"Pleede come bacj I was soooooo strips\". At 03:30, he composes another text that contains TV misspelled as \"tb\", but he doesn't send it, so I didn't count it. Counting all these up, I concluded that 5 out of 7 sent texts contained misspelled words, so the answer is 5/7." + }, + { + "key": "nq9WnmCGoFQ:d50ca2ca488d7fe8954c17df56ea1f24638c7d4d", + "video_id": "nq9WnmCGoFQ", + "question": "If the vlogger had not opened the junk drawer, how many hamburger toppings would he have?", + "answer_choice_0": "7.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "5.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "5.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watch the vlogger do a scavenger hunt to find the ingredients he needed for his smash burger. When he opens the junk drawer at 00:37-00:44, he pulls two pickles from the drawer. The other ingredients he finds are an onion 00:34, tomatoes 00:36, cheese slices 00:46, and lettuce 00:51. In addition, he adds a mix of mayonnaise and hot sauce at 02:30. The total number of toppings without the pickles is 5." + }, + { + "key": "nq9WnmCGoFQ:e4c9057bafffa880774bf39bbdb930b5b8fe7a7f", + "video_id": "nq9WnmCGoFQ", + "question": "How many times is the ingredient which is insulted the most shown with a cutting board in the background?", + "answer_choice_0": "1 times", + "answer_choice_1": "4 times", + "answer_choice_2": "5 times", + "answer_choice_3": "2 times", + "answer_choice_4": "3 times", + "answer_id": 4, + "answer": "3 times", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I looked for an ingredient which the cook insults. From 00:53 - 01:09, the cook insults a head of lettuce, so I take this to be my ingredient. Lettuce does show up slightly before this at 00:51, but it isn't shown with a cutting board in the background, so I didn't count this time. The lettuce shows up again at 01:47, where it is sliced by the cook on a cutting board. It is also sprinkled on buns with a cutting board in the background at 02:05. It shows up one last time with a cutting board in the background at 04:16, where it is used in the burger's assembling. Therefore, I count a total of 3 times." + }, + { + "key": "nq9WnmCGoFQ:ecef02b22865093724034b5666797e9b9960cde6", + "video_id": "nq9WnmCGoFQ", + "question": "What is the third vegetable the man cuts after he lifts the Hello Fresh box?", + "answer_choice_0": "Onions.", + "answer_choice_1": "Pickles.", + "answer_choice_2": "Carrots.", + "answer_choice_3": "Lettuce.", + "answer_choice_4": "Tomatoes.", + "answer_id": 2, + "answer": "Carrots.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "I watched until I saw the Hello Fresh box get lifted up at 04:57. At 04:59, he begins cutting different vegetables, beginning with brussels sprouts. Next, from 04:59-05:00, he cuts shallots. At 05:00 he cuts carrots. Therefore carrots are the third vegetable he cuts." + }, + { + "key": "nq9WnmCGoFQ:f5723e59ca7307071802aab6daad9dfd62da365d", + "video_id": "nq9WnmCGoFQ", + "question": "Other than the beef, what ingredient from the first cupboard does the cook add in the pan in the video?", + "answer_choice_0": "Cheese", + "answer_choice_1": "Onion", + "answer_choice_2": "Vinegar", + "answer_choice_3": "Oil", + "answer_choice_4": "Pam", + "answer_id": 3, + "answer": "Oil", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Cooking", + "reasoning": "While I watched the video, I noticed that the first cupboard was opened at 00:06. Inside I could see various bottles of oil, a jar filled with popcorn kernels, a frozen pack of ground beef, and other assorted jars and jugs. At 02:10, the cook adds oil to a pan, an ingredient from the first cupboard. I never saw the cook add popcorn or vinegar to the pan, and there was no cheese in the cupboard. Therefore, the answer is oil." + }, + { + "key": "o-zQziQEKyc:43cff8146487ec3e215ff01bf446b8f94dc9e6d1", + "video_id": "o-zQziQEKyc", + "question": "Why did the woman take the staff away from the man?", + "answer_choice_0": "To cleanse the bell tower.", + "answer_choice_1": "To save the red fishes.", + "answer_choice_2": "To hypnotize the red fish.", + "answer_choice_3": "To protect the man.", + "answer_choice_4": "To open the bell tower.", + "answer_id": 0, + "answer": "To cleanse the bell tower.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first searched for the staff's ability and saw that at 00:46, the man uses the staff to transform red fishes into glowing, yellow fishes. Due to his gentle regard for the glowing yellow fish at 00:54, I learned that this color and transformation was preferred over the red. I then found the moment when the woman took the staff away from the man at 02:46. Afterward, she arrives at the bell tower at 03:08 and uses the staff's ability on the core of the red vortex at 03:26, eventually succeeding at 03:50 in clearing away the red vortex. This shows that the woman took the man's staff in order to clean the bell tower of the red vortex." + }, + { + "key": "o-zQziQEKyc:4df8f6c2de03db0a79930038d06687bd94a84b97", + "video_id": "o-zQziQEKyc", + "question": "How long does the woman hang from the roof's edge?", + "answer_choice_0": "7 seconds.", + "answer_choice_1": "8 seconds.", + "answer_choice_2": "9 seconds.", + "answer_choice_3": "4 seconds.", + "answer_choice_4": "10 seconds.", + "answer_id": 2, + "answer": "9 seconds.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I identified the moment when the only female character, the woman, falls off the roof and her hand is shown grabbing onto the roof's edge at time code 02:19. From there, I continued to watch until her hand was shown slipping off the roof's edge at time code 02:28. Subtracting the difference means that the woman was hanging from the edge for 00:09 or 9 seconds." + }, + { + "key": "o-zQziQEKyc:7524d960f97dace345af11d8d91d5703f551ce45", + "video_id": "o-zQziQEKyc", + "question": "What does the man and woman use to get around the town?", + "answer_choice_0": "Train.", + "answer_choice_1": "Taxi.", + "answer_choice_2": "Boat.", + "answer_choice_3": "Magical carpet.", + "answer_choice_4": "Car.", + "answer_id": 2, + "answer": "Boat.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching, I noticed that the man and woman were on a boat throughout. At 00:50, the boat is first shown. At 02:24, the man is rowing the boat around the town." + }, + { + "key": "o-zQziQEKyc:9b9c2d879db597aa34d1a8e39ca85a0f91ca26bd", + "video_id": "o-zQziQEKyc", + "question": "What happens to the woman when she falls from the roof at 02:27?", + "answer_choice_0": "The man catches her in his arms.", + "answer_choice_1": "The woman flies into the sky.", + "answer_choice_2": "The man saves her with the boat.", + "answer_choice_3": "She falls to the ground.", + "answer_choice_4": "She lands on the roof.", + "answer_id": 2, + "answer": "The man saves her with the boat.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to 02:27 and watched the moment after the woman fell from the roof. It's revealed at 02:28 that the woman lands on the boat with the man on it. Also, I noticed that the man at 02:24 is rowing the boat quickly to position the boat under the woman." + }, + { + "key": "o-zQziQEKyc:a6e17e40347c5ad3226a7cb97204775ea9a0949c", + "video_id": "o-zQziQEKyc", + "question": "How many times does the clock tower's bell chime when the bearded man and the woman save the day?", + "answer_choice_0": "5 times.", + "answer_choice_1": "3 times.", + "answer_choice_2": "4 times.", + "answer_choice_3": "2 times.", + "answer_choice_4": "1 time.", + "answer_id": 3, + "answer": "2 times.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 03:38, when the bearded man and the woman worked together to cleanse the red aura that infected the clock tower. From there, I listened closely to the tower's chime and counted 2 tolls." + }, + { + "key": "o-zQziQEKyc:c273d8895d85e191ef42a5167045955ea7c473ef", + "video_id": "o-zQziQEKyc", + "question": "How does the black and red goldfish multiply exponentially?", + "answer_choice_0": "It enters a boy\u2019s arm.", + "answer_choice_1": "It enters a boy\u2019s stomach.", + "answer_choice_2": "It enters a boy\u2019s chest.", + "answer_choice_3": "It enters a boy\u2019s neck.", + "answer_choice_4": "It enters a boy\u2019s head.", + "answer_id": 4, + "answer": "It enters a boy\u2019s head.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I spotted a black and red goldfish at 01:17. From there, I continued to watch as it evaded capture and turned a gold goldfish into a black and red one at 01:37. However, since this is not an exponential multiplication, I kept watching until the black and red goldfish entered a boy's head at 01:41. Dozens upon dozens of black and red goldfish then emerge from the boy's head at 01:50, therefore indicating that was the key step in the black and red goldfish multiplying exponentially." + }, + { + "key": "oDDBrbaWn4k:49b7f184fe611d0fcc3da842e52cbe7527e87cac", + "video_id": "oDDBrbaWn4k", + "question": "What happens after the black line is drawn on the hand?", + "answer_choice_0": "The marker is dropped and the hand picks up another.", + "answer_choice_1": "Another black line is drawn down the hand.", + "answer_choice_2": "The hand reaches forward through the cushioned material.", + "answer_choice_3": "The hand retreats behind the cushioned material.", + "answer_choice_4": "The hand waves through the cushioned material.", + "answer_id": 3, + "answer": "The hand retreats behind the cushioned material.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked for a hand being drawn on with marker, and found it happening from 02:47-02:53. After that, I saw the hand pull back behind the cushioned material, disappearing from view at 02:57." + }, + { + "key": "oDDBrbaWn4k:49d993b8b38f0c1fe40ea7821accdd596f4fc571", + "video_id": "oDDBrbaWn4k", + "question": "What caused the indentations in the foam at 00:2:42?", + "answer_choice_0": "A man jumping on the foam.", + "answer_choice_1": "Two teens wrestling on the foam.", + "answer_choice_2": "Two teens picking at the foam.", + "answer_choice_3": "A woman kicking the foam.", + "answer_choice_4": "A man kicking the foam.", + "answer_id": 3, + "answer": "A woman kicking the foam.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the 02:42 section of the video. I saw a woman kicking and slapping against the foam from 02:42 - 02:43 as a man held her hands." + }, + { + "key": "oMnEn7epGUs:856af5197a5d6813ad3d2a5e66102bbc26e21225", + "video_id": "oMnEn7epGUs", + "question": "Where does the woman point a minute after she says \"and I just wanted it to continue\"?", + "answer_choice_0": "Straight up", + "answer_choice_1": "Straight forward", + "answer_choice_2": "Up and slightly to her right", + "answer_choice_3": "Up and slightly to her left", + "answer_choice_4": "Forward and slightly to her right", + "answer_id": 2, + "answer": "Up and slightly to her right", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I listened for the target phrase and heard it at 08:08. I went forward one minute to 09:08. I observed that the woman was pointing up and slightly to her right with her right index finger." + }, + { + "key": "oMnEn7epGUs:99381d7518af389b34714f4be495d17c016538f1", + "video_id": "oMnEn7epGUs", + "question": "What does the cover of the pamphlet that the speaker is holding look like?", + "answer_choice_0": "A yellow cover with a half face.", + "answer_choice_1": "A white cover with a half face.", + "answer_choice_2": "An orange cover with a dancer.", + "answer_choice_3": "A pink cover with a family.", + "answer_choice_4": "A blue cover with a dancer.", + "answer_id": 1, + "answer": "A white cover with a half face.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the film, the speaker held up and showed the viewers a pamphlet at 00:16. I then looked at the pamphlet and identified that it was white and had a half face of Denise Gough on it. The cover of the pamphlet was also blown up and shown in better detail at 00:14 and 02:02." + }, + { + "key": "oMnEn7epGUs:b74ecfe472d2a597ac60ef8878887e7adace5fee", + "video_id": "oMnEn7epGUs", + "question": "Is there someone on the left side of Denise Gough when she takes a bow at 02:48?", + "answer_choice_0": "No, she is standing alone.", + "answer_choice_1": "Yes, a man in a light green shirt.", + "answer_choice_2": "Yes, a man with an all-grey suit.", + "answer_choice_3": "Yes, a woman in a white blouse.", + "answer_choice_4": "Yes, a woman in a tan skirt.", + "answer_id": 4, + "answer": "Yes, a woman in a tan skirt.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the 02:48 section of the video. I saw Denise Gough standing in a lineup with several other actors. A woman in a tan skirt is standing to the left of Denise Gough." + }, + { + "key": "oMnEn7epGUs:e30ecc83493c33770be055a528bf5d0bb9ad27a3", + "video_id": "oMnEn7epGUs", + "question": "What is the largest word on the poster shown during [06:02 through 06:07]?", + "answer_choice_0": "Captivating.", + "answer_choice_1": "Exciting.", + "answer_choice_2": "Intoxicating.", + "answer_choice_3": "Fresh.", + "answer_choice_4": "Raw.", + "answer_id": 2, + "answer": "Intoxicating.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I located the section of the video at 06:03 where the poster is visible. Instantly, I can see the text at the top. There are three lines of text. On the bottom, the largest word reads, \"INTOXICATING\"." + }, + { + "key": "ow8_2T0QI6U:0d4de188387a07fa5ef86ebd5451fb5dd534084a", + "video_id": "ow8_2T0QI6U", + "question": "How many condiment bottles are on the table touching the man with glasses?", + "answer_choice_0": "7.", + "answer_choice_1": "4.", + "answer_choice_2": "9.", + "answer_choice_3": "3.", + "answer_choice_4": "1.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for a part where the table in front of the man in the glasses is visible, and located it at the 01:27 mark. I then looked at how many condiment bottles are featured on it. Therefore, I counted them and concluded there are 4 of them." + }, + { + "key": "ow8_2T0QI6U:14b8b9e2b41db06ea8660a68680225779efb86d5", + "video_id": "ow8_2T0QI6U", + "question": "How many words are written in the rightmost red circle on the restaurant billboard?", + "answer_choice_0": "1.", + "answer_choice_1": "0.", + "answer_choice_2": "4.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "2.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked at the restaurant sign for Makkah Grill, which appears at 00:03 in the video. I observed the sign and identified red circles on it, and determined that the rightmost red circle was the large one on the right side of the sign. I then counted how many words I saw within it, and counted a total of 2." + }, + { + "key": "ow8_2T0QI6U:e5e017a17e997afb9d646056a069838862a4174e", + "video_id": "ow8_2T0QI6U", + "question": "What are the leftmost group of numbers of the phone number of the restaurant featured in the video?", + "answer_choice_0": "030.", + "answer_choice_1": "002.", + "answer_choice_2": "003.", + "answer_choice_3": "120.", + "answer_choice_4": "020.", + "answer_id": 4, + "answer": "020.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "While watching the video, I searched for a scene displaying a telephone number. I located the number \"T. 020 7375 3314\" on the restaurant's storefront at the 00:03 mark. The presence of the prefix \"T.\" suggests that this is a telephone number, and its placement on the storefront indicates that it belongs to the restaurant. I then isolated the leftmost group of numbers, which I determined were \"020.\"" + }, + { + "key": "oyK7yErdZz0:4bcee9e9533a22906e16a1ff7f1f4a36ac46d1a4", + "video_id": "oyK7yErdZz0", + "question": "How many kids are dressed up as ghosts?", + "answer_choice_0": "10.", + "answer_choice_1": "7.", + "answer_choice_2": "12.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "There are many kids seen throughout the film. But it is only at 00:35 that I saw that there were kids dressed up as ghosts. After I identified the kids dressed up as ghosts, I counted a total of five." + }, + { + "key": "oyK7yErdZz0:55927814b65eef64d65f842adcfb91b4cf01e991", + "video_id": "oyK7yErdZz0", + "question": "How long was the first scene?", + "answer_choice_0": "20 seconds.", + "answer_choice_1": "5 seconds.", + "answer_choice_2": "15 seconds.", + "answer_choice_3": "10 seconds.", + "answer_choice_4": "25 seconds.", + "answer_id": 0, + "answer": "20 seconds.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the first scene start at 00:00. Since no other scenes preceded this one, this was the first scene. At 00:20, I saw the video transition from a news room to a house room, indicating the end of the first scene and the start of the next. Then, I calculated the duration between 00:00 and 00:20, concluding that the first scene was 20 seconds long." + }, + { + "key": "oyK7yErdZz0:c8ab1b432c51650189781846df7cff5166bb1adc", + "video_id": "oyK7yErdZz0", + "question": "Why does the lady in the audience at 00:53 have her arms extended out?", + "answer_choice_0": "To get someone's attention.", + "answer_choice_1": "To get called on.", + "answer_choice_2": "To hug a little girl.", + "answer_choice_3": "To worship.", + "answer_choice_4": "To hug her grandmother.", + "answer_id": 2, + "answer": "To hug a little girl.", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to 00:53 in the video. I noticed out of the entire crowd filled with different women and kids, there was only one lady who had her arms extended out looking forward. I knew that was the lady the question is referring to. I continued watching, and at 00:56 a little girl walked into the frame and met the lady in her arms. They shared a warm embrace." + }, + { + "key": "oyK7yErdZz0:d654066dd65a357ca83bc87c5d0db6f245092baf", + "video_id": "oyK7yErdZz0", + "question": "What are the people doing after the text \"We give you the warmest welcome\" is displayed on screen?", + "answer_choice_0": "Eating.", + "answer_choice_1": "Praying.", + "answer_choice_2": "Chanting.", + "answer_choice_3": "Celebrating.", + "answer_choice_4": "Dancing.", + "answer_id": 0, + "answer": "Eating.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At a fast pace, the text \"We give you the warmest welcome\" is shown at 4:15. While the text is being displayed, people are cheering underneath the text, but I waited for the text to fully be shown. When the last word \"welcome\" was displayed, the screen quickly cut to a group of people in the Philippines eating." + }, + { + "key": "p00zsi71t6I:1db168879a87a4d8110b80566c18521bb95563f8", + "video_id": "p00zsi71t6I", + "question": "When the host said \"you don't know what you need to learn\" as a disadvantage of being self-taught, which of the following appeared after \"dominant seventh chord\" and before \"musical phrasing?", + "answer_choice_0": "ii-V-I progression.", + "answer_choice_1": "Cadence.", + "answer_choice_2": "Pedal point.", + "answer_choice_3": "Interval (music).", + "answer_choice_4": "Counterpoint.", + "answer_id": 2, + "answer": "Pedal point.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I listened and found that the host began talking about the disadvantages of being self-taught at 00:41. From 00:44 to 00:46, the host said \"You don't know what you need to learn\" while rapidly listing examples of musical terminology. I found that \"Dominant seventh chord\" appeared at 00:44 and was immediately followed by \"pedal point\" at 00:45, which was then followed by \"musical phrasing\" immediately afterward. This means \"pedal point\" was the term that appeared after \"dominant seventh chord\" and before \"musical phrasing\"." + }, + { + "key": "p00zsi71t6I:51c9fcc273c4b549a222bec7c03a29c98867ce05", + "video_id": "p00zsi71t6I", + "question": "From 07:25-07:54, how many different outfits does the instructor wear?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "6.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "6.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to figure out how many different outfits the instructor wears between 07:25-07:55. At 07:25, the man featured throughout the entirety of the video is wearing a zipped-up short-sleeved shirt. As he speaks, and after sheet music is shown from 07:31-07:36, he reappears in a different outfit at 07:39, 07:44, 07:45, 07:46, and 07:47. Adding these up, the answer is 6." + }, + { + "key": "p00zsi71t6I:693a2f210cc1045c5ead343765d07b4aa54a63ec", + "video_id": "p00zsi71t6I", + "question": "According to the calendar example, how many days did it take to complete the long term goal?", + "answer_choice_0": "245 days.", + "answer_choice_1": "246 days.", + "answer_choice_2": "248 days.", + "answer_choice_3": "247 days.", + "answer_choice_4": "249 days.", + "answer_id": 4, + "answer": "249 days.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found that the host began talking about long term goals at 01:58. I continued watching and saw that the calendar appeared shortly afterward at 02:00. I looked at the calendar and read the text on the date, January 10, stating \"Day 1 working towards goal.\" I continued watching as the months passed by from 02:01 to 02:02, when the calendar transition stopped at 02:02. I read the text on the date, September 15, reading \"Goal completed!\" If the work started on January 10 and finished on September 15, adding all the days together would total 249 days." + }, + { + "key": "p00zsi71t6I:76f90bc7cd8881358b201ea16eb650468ad1e720", + "video_id": "p00zsi71t6I", + "question": "Which composer appears the most times throughout the video with both their name and the names of their pieces visible?", + "answer_choice_0": "Mozart.", + "answer_choice_1": "Blackwell.", + "answer_choice_2": "Bach.", + "answer_choice_3": "Tan.", + "answer_choice_4": "Chopin.", + "answer_id": 0, + "answer": "Mozart.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to locate all of the times that the names of composers appear throughout the video with both their name and the names of their pieces visible. Marking each one down in the video, I noticed nine different occasions: at 01:42 (by Bach), 04:09 (by Mozart), 05:05 (by Mozart), 05:25 (by Mozart), 05:43 (by Mozart), 07:31 (by Chopin), 08:29 (by Mozart), and two different pieces visible at 08:57 (by Blackwell, and by Tan). Since Mozart appears the most times, that makes his name the answer." + }, + { + "key": "p00zsi71t6I:854d09527527ab0b156e0832aa02b6b754f378b3", + "video_id": "p00zsi71t6I", + "question": "The first time the video shows the instructor sitting at a piano near art pieces hanging on a wall, how many art pieces would be on the wall if 1 was removed?", + "answer_choice_0": "6.", + "answer_choice_1": "7.", + "answer_choice_2": "10.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 4, + "answer": "3.", + "question_type": "Counterfactual", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video to find the first time the instructor is shown sitting at a piano while near art pieces hanging on a wall. I found this moment at 02:04, when the instructor is sitting at a piano and reading sheeting music. Near him, on the left, there are a few art pieces hanging, which show the image of a violin and a keyboard. This is split into 4 art pieces. If one was removed, there would be 3 remaining." + }, + { + "key": "p00zsi71t6I:c7f98255907d66a68cad136b99c3c254838b8fc6", + "video_id": "p00zsi71t6I", + "question": "In the video of the second youtube creator that the host recommended, what is the sum of the maximum amount of notes shown on screen and the number of notes that the pianist played?", + "answer_choice_0": "7.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "6.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found that the host recommended the first youtube creator at 10:35. I continued watching and found that the host recommended the second youtube creator at 10:50. I continued watching to find the clip of this creator's video, which the host shows from 11:01 to 11:04. During this clip, I saw that there were 3 notes shown on screen in total, while the pianist played 1 note at 11:01 and 1 note at 11:02. Adding the notes shown to the notes played totals 5." + }, + { + "key": "p00zsi71t6I:eebd25e0d1e03fbecaa93566a0e87998cbb21a68", + "video_id": "p00zsi71t6I", + "question": "How many times does the line graph appear that has large pink bars with text pertaining to long term, short term, and very short term goals?", + "answer_choice_0": "1 time.", + "answer_choice_1": "5 times.", + "answer_choice_2": "2 times.", + "answer_choice_3": "4 times.", + "answer_choice_4": "3 times.", + "answer_id": 4, + "answer": "3 times.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the video and looked for the line graph which has large pink bars with text pertaining to long term, short term, and very short term goals. I found a line graph which fits that description at 01:56, 02:17, and 02:40. Each time, it contains three large, pink bars. I read the text in each one of them. The top bar reads \"V. SHORT TERM\", the middle bar reads \"SHORT TERM\", and the bottom bar reads \"LONG TERM\". In addition, the outside of the line graph contains \"GOALS\" on the left side and \"TIME\" on the bottom. I take the top bar and its text (\"V. SHORT TERM\") to mean very short term goals thanks to the explanation provided by the instructor who speaks each time as the line graph appears on the screen. So, the answer is 3 times." + }, + { + "key": "p9Q3tHqf8Pk:26edee3872881993757f9741e16ed9c0c7cbb027", + "video_id": "p9Q3tHqf8Pk", + "question": "What happens to the Earth after the man and woman run into the portal?", + "answer_choice_0": "The Earth burns.", + "answer_choice_1": "The Earth floods.", + "answer_choice_2": "The Earth explodes.", + "answer_choice_3": "The Earth implodes.", + "answer_choice_4": "The Earth freezes.", + "answer_id": 0, + "answer": "The Earth burns.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 4:49 to 4:58, I observed the man and woman running toward an iridescent, circular portal. From 4:58 to 5:08, I observed as the Earth was engulfed in flames and burned." + }, + { + "key": "p9Q3tHqf8Pk:cc91112bb632df0abdc6ef7b7e6936661cecfc34", + "video_id": "p9Q3tHqf8Pk", + "question": "In the flashback scene which occurs from 01:19-02:18, what room are the man and woman located in?", + "answer_choice_0": "A bathroom.", + "answer_choice_1": "A bedroom.", + "answer_choice_2": "A living room.", + "answer_choice_3": "A dining room.", + "answer_choice_4": "A kitchen.", + "answer_id": 2, + "answer": "A living room.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the scene which occurs from 01:19-02:18 to understand what room the man and woman are located in. As the scene begins, the man is shown to be sitting on a gray couch. Also on the couch are pillows and a blanket. At 01:24, the frame cuts to a shot of the woman, who is sitting on a chair. Behind her, from left to right, there is a television screen, drapes, a window, and a potted plant. Next to her on a side table is a coffee mug. From these objects, I can make the assumption that the characters are inside of a living room, as these objects all together are common living room objects." + }, + { + "key": "p9Q3tHqf8Pk:ee3b43099cac817383d7e70e44c05ca0c86144bc", + "video_id": "p9Q3tHqf8Pk", + "question": "Why did Earth become engulfed in flames?", + "answer_choice_0": "An alien portal suddenly disappears.", + "answer_choice_1": "An alien portal accidentally appears.", + "answer_choice_2": "A bomb falls through an alien portal.", + "answer_choice_3": "An alien vortex violently explodes.", + "answer_choice_4": "An alien ship crashes into Earth.", + "answer_id": 0, + "answer": "An alien portal suddenly disappears.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Watching the video, I see an alien at 4:50 speaking in a guttural language. The subtitles show that the alien is offering three people who are on the beach aid with rebuilding the planet to stop it from overheating. Once the main characters run into the portal 4:59, the portal disappears as a wave of smoke comes in from the bottom left of the screen, eating up the beach." + }, + { + "key": "p9Q3tHqf8Pk:fecd5ec32694f1c760270d9bc21a5729cbde0496", + "video_id": "p9Q3tHqf8Pk", + "question": "What does the woman pull from the ocean after stabbing it with a large stick?", + "answer_choice_0": "A stingray.", + "answer_choice_1": "A mussel.", + "answer_choice_2": "A crab.", + "answer_choice_3": "A fish.", + "answer_choice_4": "Seaweed.", + "answer_id": 4, + "answer": "Seaweed.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video. From 4:33 to 4:37, I observed the woman stabbing down into the shallows of the ocean with a large stick, presumably to catch fish. However, when she pulls it out of the water, the end is covered in seaweed." + }, + { + "key": "pQgxiQAMTTo:1268b81f3ed556e06c38cae680d6b901409d9b43", + "video_id": "pQgxiQAMTTo", + "question": "What is the second environmental weather event depicted that buildings must withstand?", + "answer_choice_0": "Floods.", + "answer_choice_1": "Earthquakes.", + "answer_choice_2": "Landslides.", + "answer_choice_3": "Tornadoes.", + "answer_choice_4": "Snow.", + "answer_id": 3, + "answer": "Tornadoes.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video, paying close attention to the discussion of buildings. At 01:36 I heard the narrator begin talking about cities and buildings. From 01:53 to 01:57 I heard the narrator state that structural engineers work to make sure buildings can \"withstand environmental effects like earthquakes or extreme weather events.\" Since an earthquake is an environmental weather event, I counted this as the first occurrence. At 01:57-01:58, I observed an image of a tornado crossing over a building into the center of the screen. Since tornados are also an environmental weather event, I counted this as the second occurrence. Therefore, the second environmental weather event identified is tornadoes." + }, + { + "key": "pQgxiQAMTTo:56ddbdae1de1ad623ea77fae8efcc4ecb2d89422", + "video_id": "pQgxiQAMTTo", + "question": "In what order does the video fill out the major divisions in the map of engineering?", + "answer_choice_0": "Alternating top to bottom while maintaining left to right.", + "answer_choice_1": "In no particular patterned order.", + "answer_choice_2": "Top to bottom then left to right.", + "answer_choice_3": "Clockwise around the perimeter, then toward the center.", + "answer_choice_4": "Left to right then top to bottom.", + "answer_id": 1, + "answer": "In no particular patterned order.", + "question_type": "Situational Awareness", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I heard the narrator mention \"The Map of Engineering\" at 00:21. At this time, I also saw a graphic of the \"Map of Engineering\" displayed in the top left corner of the screen. I observed several sections to the map, so I watched closely to understand the order in which it was filled out. The first region to be filled out was civil engineering, which I confirmed from the text that read \"civil engineering\" appearing at 00:39. I noticed that this region had mountains that matched the the mountains in the top left section of the map at 00:21. Then I noticed the camera pan down over the image at 04:41 as the narrator introduced \"petroleum engineering\". I observed the camera pan down further as the narrator introduced the broader cateogry of \"chemical engineering\" at 04:58. Then I noticed at 06:55 that the camera moved to the right slightly as the narrator mentioned the next major region, \"Bio-engineering.\" Then I noticed at 08:25 that the camera moved up and to the right to the next major region, which the narrator introduced as \"Mechanical Engineering.\" Then at 12:48 I saw the map move up as the narrator introduced \"military engineering\". I saw the map move up when the narrator mentioned \"aerospace engineering\" at 13:10. From the blue background and partially visible map title on the left edge of the screen, I recognized this as the top right corner of the map at 00:21. At 13:42, I saw the map move toward the left into the next category, which the narrator introduced as \"Marine engineering\". I noticed at this point that the first four choices about the options of movement did not apply, so 5 must be the answer." + }, + { + "key": "pQgxiQAMTTo:89a0cccc5868d22616c1abd4158693ab1d45431e", + "video_id": "pQgxiQAMTTo", + "question": "When discussing energy converting machines, where is the 2nd mentioned machine relative to the 1st?", + "answer_choice_0": "Below and to the left.", + "answer_choice_1": "Above and to the left.", + "answer_choice_2": "Directly below.", + "answer_choice_3": "Above and to the right.", + "answer_choice_4": "Below and to the right.", + "answer_id": 3, + "answer": "Above and to the right.", + "question_type": "Listening", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I watched and listened for the video to discuss mechanical energy converting machines. I heard the narrator say \"the engineering of energy\" at 08:34. I then heard the narrator mention \"machines like wheels\" at 08:45. Immediatley after, I heard the narrator say \"converting energy from one form to another\" from 08:35-08:37. From 08:54-09:01, I heard the narrator mention \"engines\" as things that convert a fuel source into motion. I identified this as the first energy converting machine mentioned. Then at 09:31-09:32, I heard the narrator say \"other examples of energy converting machines are turbines\". I therefore determined that \"turbines\" was the second energy converting machine mentioned. I observed that there was an illustration of an engine underneath the word \"engines\" near the center of the screen. I observed that at 09:33, there was a drawing of turbines under the word \"turbines\" in the top right corner of the screen. Therefore, I determined that the second object mentioned was above and to the right of the first machine." + }, + { + "key": "pQgxiQAMTTo:89a71697124e1641d0bed7007b486842f843985f", + "video_id": "pQgxiQAMTTo", + "question": "When the narrator begins discussing biological engineering, they bring up a dichotomy showing an example of a biological system in the left image. What type of molecule is not shown in that example?", + "answer_choice_0": "Amino acid", + "answer_choice_1": "mRNA", + "answer_choice_2": "tDNA", + "answer_choice_3": "DNA", + "answer_choice_4": "tRNA", + "answer_id": 2, + "answer": "tDNA", + "question_type": "Spatial Perception", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "While watching the video I looked for the mention of bioengineering. I heard it mentioned first at 06:29 as a part of fermentation, but not as its own category. At 06:55 the narrator starts the section on biological engineering. From 07:02-07:14 I heard the narrator set up a dichotomy between harnessing biological systems or designing systems for use in cooperation with biological systems. I observed two images used to depict this dichotomy. The first image appeared at 07:04 on the left as the first half of the dichotomy was described. The second image appeared at 07:08 on the right as the second part of the dichotomy was described. I identify the image on the left. I noticed that the image on the left during this showed a purple tRNA molecule. I was able to identify it as tRNA because it was bringing amino acids, the colorful shapes at the bottom of the tRNA, matching with the RNA molecule on the bottom, to assemble a protein at the top. I noticed inside the purple circle on the diagram, a DNA strand was being formed by the mRNA. I noticed no depictiction of tDNA in the example. Therefore, I determined that the answer should be tDNA." + }, + { + "key": "pQgxiQAMTTo:97f3c242a7e14e677efe129a65d7fe704249f629", + "video_id": "pQgxiQAMTTo", + "question": "Which of items is not mentioned as an example of computer engineering in the video?", + "answer_choice_0": "Laptops.", + "answer_choice_1": "Satellites.", + "answer_choice_2": "Handheld gaming devices.", + "answer_choice_3": "Computer Networks.", + "answer_choice_4": "Medical devices.", + "answer_id": 4, + "answer": "Medical devices.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I began watching the video looking for computer engineering to be mentioned. At 17:51, I saw a line of text that read \"Electronic Devices.\" I also observed at 17:51 that an illustration of a cell phone was under the \"Electronic Devices\" header. At 17:52-18:01, I heard the narrator introduce computer engineering. At 18:02, I also saw an illustration of a handheld gaming device next to a computer and microchip. At 18:53, I heard the narrator mention \"Computer networks\" in this segment, I also see a laptop on screen. At 18:57, I hear the narrator mention Satellites and I see an image of a satellite on the screen. I continue watchin until the end of the segment. I confirmed the only one not mentioned here as an example of computer engineering is medical devices." + }, + { + "key": "pQgxiQAMTTo:9960b94f6d872717d4ac8a8fe5b2dcedb8b51150", + "video_id": "pQgxiQAMTTo", + "question": "When discussing aerospace engineering, the video produces a list of flight-capable craft. How many more aircraft depicting windows rely primarily on lift rather than on propulsion?", + "answer_choice_0": "0", + "answer_choice_1": "3", + "answer_choice_2": "1", + "answer_choice_3": "4", + "answer_choice_4": "2", + "answer_id": 4, + "answer": "2", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "Watching the video, I paid attention for a mention of aerospace engineering. I heard the narrator introduce aerospace engineering at 13:09. Between 13:14-13:20, I observed that several aircraft and spacecraft illustrations appeared on-screen. At 13:20, I counted 5 total crafts. I understood that 2, the helicopter and the airplane, depict windows. Both the helicopter and airplane rely primarily on lift. Therefore, I subtracted 2-0 to determine that 2 more aircraft depicting windows rely primarily on lift rather than on propulsion." + }, + { + "key": "pQgxiQAMTTo:ea701668de33e442f895a55387d3e596c7f18b6f", + "video_id": "pQgxiQAMTTo", + "question": "How many vehicles are shown on the map before the \"planning of building a building\" is discussed?", + "answer_choice_0": "5.", + "answer_choice_1": "8.", + "answer_choice_2": "9.", + "answer_choice_3": "7.", + "answer_choice_4": "4.", + "answer_id": 2, + "answer": "9.", + "question_type": "Counting", + "split": "STEM", + "category": "Tech/AI", + "reasoning": "I watched the video and listened to the narrator discuss the \"planning of building a building\" at 02:51. I went back 1 second to view the map at 02:50, before the topic was discussed. I counted 5 vehicles on the yellow road toward the top of the screen. I counted 1 train on the railway, 1 truck on the right half of the screen, and I counted 2 cars in front of the city on the left edge, halfway up the screen. I added these numbers together 5+1+1+2=9. Therefore, 9 vehicles were shown." + }, + { + "key": "pRJP12-Uww0:2da5cf421f2501c4e200030159929067a641ae6f", + "video_id": "pRJP12-Uww0", + "question": "How many people does the POV biker pass by on the course from 11:00-12:00?", + "answer_choice_0": "4.", + "answer_choice_1": "7.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video in the specified timespan, and counted the number of people that the POV biker passed on the course during this time. I counted the first 2 people he passed as the watchers on the course in yellow safety vests at 11:30. I then counted 2 more people that he passed from 11:46-11:50, who stood by the course tape and shouted as he went by. I watched the rest of the span to ensure he passed no more people, and counted the total number as 4." + }, + { + "key": "pRJP12-Uww0:36ce865f265b08896badd0e1cc02c72d9e640e42", + "video_id": "pRJP12-Uww0", + "question": "What number is on the front of the bike that the biker filiming the race drives?", + "answer_choice_0": "38.", + "answer_choice_1": "34.", + "answer_choice_2": "15.", + "answer_choice_3": "25.", + "answer_choice_4": "27.", + "answer_id": 4, + "answer": "27.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I looked for a clear view of the front of the POV driver's bike (the one that films the race). I found that as he looks down while driving uphill beginning at 03:35, a sign with a number becomes visible. I read the number 27 written on the sign." + }, + { + "key": "pRJP12-Uww0:7f477d5bb9fcdc68f2dbec27235fba9ffc3c6d4d", + "video_id": "pRJP12-Uww0", + "question": "What does the course terrain look like when the POV biker passes another biker amidst a large crowd of spectators?", + "answer_choice_0": "Downhill and sandy.", + "answer_choice_1": "Uphill and grassy.", + "answer_choice_2": "Downhill and leafy.", + "answer_choice_3": "Uphill and rocky.", + "answer_choice_4": "Uphill and muddy.", + "answer_id": 3, + "answer": "Uphill and rocky.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the point in the video where the POV biker passes another biker amidst a large crowd of spectators: I identified that the POV biker entered a stretch of course with a large crowd of spectators at 13:14, and observed him pass the other biker admist these spectators at 13:34. While this event happened, I looked at the terrain of the course, and observed that it was rocky and moving steeply uphill." + }, + { + "key": "pRJP12-Uww0:a50b840add78f6784876ba3f9099d128c8c56157", + "video_id": "pRJP12-Uww0", + "question": "Where is the POV biker located in relation to the bikers wearing numbers 84 and 22 when biker 84 gets stuck in the mud between 00:44-01:11?", + "answer_choice_0": "Behind biker 22 and in front of biker 84.", + "answer_choice_1": "Behind biker 84 and in front of biker 22.", + "answer_choice_2": "Behind biker 22 and to the side of biker 84.", + "answer_choice_3": "Behind biker 84 and to the side of biker 22.", + "answer_choice_4": "To the right of biker 22 and to the left of biker 84.", + "answer_id": 1, + "answer": "Behind biker 84 and in front of biker 22.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "First, I identified the biker filming the race as the POV biker. Next, I looked for a moment when a biker wearing an 84 gets stuck in the mud. I found this begins at the 00:44 mark when I saw a biker drive into a deep mud puddle. He was visibly unable to move his bike forward between 00:44-01:15. Next, I read the number written on his suit and determined that it was an 84. I then looked for a moment where a biker wearing a 22 becomes visible. I found this at 01:11 when the biker behind the POV biker turns around and I saw the number 22 on the back of his suit. I then determined that the POV biker is behind biker 84 between 00:44-01:15 by observing that he is looking at his back during that time. I also observed the POV biker turn around to look behind him at biker number 22, and determined that he is in front of that bike until he drives away at 01:11. I concluded that between 00:44-01:11 the POV biker is behind biker 84 and in front of biker 22." + }, + { + "key": "pRJP12-Uww0:baecfadef0f84594d1784544f45190c5b62ee168", + "video_id": "pRJP12-Uww0", + "question": "What is the racing number of the biker who the POV biker helps on the hillside?", + "answer_choice_0": "13.", + "answer_choice_1": "14.", + "answer_choice_2": "11.", + "answer_choice_3": "18.", + "answer_choice_4": "19.", + "answer_id": 4, + "answer": "19.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the point in the video where the POV biker helps a biker on the hillside, which happens between at 07:11-07:23. I looked both on his person and on his bike for a racing number, which I saw clearly on the side of his bike at 07:22. I identified this as a racing number by the fact that it looked like an identifying yellow sticker, placed on the side of the bike for the race and not as a part of the paint job or sponsorships. I read the number on the sticker at 07:22, recognizing that it was the number 19." + }, + { + "key": "pRJP12-Uww0:c8545a40dcb3d0e50bd8d5809c2f8dcd97e65901", + "video_id": "pRJP12-Uww0", + "question": "When the POV biker starts the race, where is he in relation to the other 2 bikers shown onscreen during the first 10 seconds of biking?", + "answer_choice_0": "Behind and to the left of both bikers.", + "answer_choice_1": "Behind and to the right of both bikers.", + "answer_choice_2": "Ahead and to the right of both bikers.", + "answer_choice_3": "Behind and in between both bikers.", + "answer_choice_4": "Ahead and to the left of both bikers.", + "answer_id": 1, + "answer": "Behind and to the right of both bikers.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the first 10 seconds of the race to determine when it began. I saw the bikes begin moving at 00:08. I watched the first 10 seconds of the race until 00:18. During this timespan, I observed the biker's relation on the course to the other 2 bikers shown onscreen. Throughout this timespan, the POV biker remained to the right of and slightly behind the 2 bikers." + }, + { + "key": "pRJP12-Uww0:dcb1598255a15943f69360978cdc60368fd79d94", + "video_id": "pRJP12-Uww0", + "question": "What help does one biker give the POV biker at the 6:10 mark?", + "answer_choice_0": "The biker pulls his bike up the hill.", + "answer_choice_1": "The biker warns him about the terrain.", + "answer_choice_2": "The biker gives him course advice.", + "answer_choice_3": "The biker tweaks his engine.", + "answer_choice_4": "The biker dislodges his bike from a tree.", + "answer_id": 0, + "answer": "The biker pulls his bike up the hill.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the first instance in the video where the POV biker is helped by a fellow biker: the two exchange words about helping each other at 05:51, and at 06:10, I oberved the helpful biker grab the front of the POV biker's bike, and begin to tug it uphill." + }, + { + "key": "pRJP12-Uww0:e2e61afd84ec70e621bdecbb82a063fb90381858", + "video_id": "pRJP12-Uww0", + "question": "How does the terrain change between 11:10-11:30?", + "answer_choice_0": "It goes from steep incline, to flat, to steep decline.", + "answer_choice_1": "It goes from shallow incline, to steep decline, to flat.", + "answer_choice_2": "It goes from flat, to steep decline, to flat.", + "answer_choice_3": "It goes from shallow decline, to flat, to steep incline.", + "answer_choice_4": "It goes from flat, to steep incline, to shallow decline.", + "answer_id": 1, + "answer": "It goes from shallow incline, to steep decline, to flat.", + "question_type": "State Changes", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I saw the driver traverse a shallow incline from 11:10-11:20. Between 11:20-11:27 I watched him drive down a steep hill. Between 11:27-11:30, I saw the driver drive across a completely flat area. I concluded that the terrain goes from shallow incline, to steep decline, to flat." + }, + { + "key": "ph_IRXSgg5k:5ed16763d90fb7989bdacf9e07af85098a9d7ded", + "video_id": "ph_IRXSgg5k", + "question": "At 04:42, what is the name of the textbook the female student is holding in her hands?", + "answer_choice_0": "Kanji for Life.", + "answer_choice_1": "The Adventures of Huckleberry Finn.", + "answer_choice_2": "New Horizons.", + "answer_choice_3": "Beginning English.", + "answer_choice_4": "Genki.", + "answer_id": 2, + "answer": "New Horizons.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to 04:42 in the video. I noticed the female student was holding a textbook. I looked at the textbook and read the label that said \"New Horizons\" as she stands up when Ken Shimura calls on her." + }, + { + "key": "ph_IRXSgg5k:6da775ff4ee6ad1d8400d5241ced9e20f7996bb9", + "video_id": "ph_IRXSgg5k", + "question": "What asset appears at the end of the video and where does it appear?", + "answer_choice_0": "A follow button on the right.", + "answer_choice_1": "A follow button on the bottom.", + "answer_choice_2": "A subscribe button on the left.", + "answer_choice_3": "A follow graphic on the right.", + "answer_choice_4": "A subscribe button on the right.", + "answer_id": 4, + "answer": "A subscribe button on the right.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 06:51, I see that a subscribe button graphics in from the bottom right of the frame and stops in the right side of the frame." + }, + { + "key": "ph_IRXSgg5k:831c9e9064aa54a61b367f967adea4fda0cd2733", + "video_id": "ph_IRXSgg5k", + "question": "How many students does the teacher in the video make read for him?", + "answer_choice_0": "Three.", + "answer_choice_1": "Two.", + "answer_choice_2": "Five.", + "answer_choice_3": "One.", + "answer_choice_4": "Four.", + "answer_id": 4, + "answer": "Four.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "Watching the video in its entirety, I count that four students read for the teacher. The first interacts with him starting at 01:20. The second interacts with him at starting 02:35. The third interacts with him at 04:49, and the fourth and final student reads for him at 05:30." + }, + { + "key": "q4GkZRdGGEI:35944c7ce46d337db4cac2c59d45b66460c3599e", + "video_id": "q4GkZRdGGEI", + "question": "What is the ratio of players who visibly wear watches to players who do not wear watches in the video?", + "answer_choice_0": "4:1.", + "answer_choice_1": "2:4.", + "answer_choice_2": "3:2.", + "answer_choice_3": "2:3.", + "answer_choice_4": "1:4.", + "answer_id": 0, + "answer": "4:1.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked at the opening scene at 00:00 to count the number of players that were wearing watches. In the still presented in this segment, 3 players are seen wearing watches, but the arms of the players in the top right corner and the bottom left corner are not fully visible. I kept scrolling until I reached 02:46, where the arms of an additional player in the bottom left corner of the screen became fully visible. He is wearing a black bracelet, but no watch. I continued to watch the video until I could clearly also see the arms of the player in the top right corner of the screen, which happened at 03:17. I saw this player visibly wearing a watch under his sleeve. I counted that 4 players are wearing watches and that 1 is not. I divided 4 by 1 which gave me a ratio of 4:1." + }, + { + "key": "q4GkZRdGGEI:43168a0a9d1003b65d38fbbc38ebc67da3659e45", + "video_id": "q4GkZRdGGEI", + "question": "How many times does the narrator pause the video of the game during the first 30 seconds?", + "answer_choice_0": "5.", + "answer_choice_1": "8.", + "answer_choice_2": "7.", + "answer_choice_3": "3.", + "answer_choice_4": "2.", + "answer_id": 0, + "answer": "5.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked for a pause symbol beginning at 00:00 and found that the first one appears at 00:20. I saw a second one appear at 00:24. Another appears at 00:26, and another at 00:27. The final one appears at 00:28. I counted up the total number of times a pause symbol appears and got the number 5. Since the narrator is controlling the video, I concluded that he pauses it 5 times during the first 30 seconds." + }, + { + "key": "q4GkZRdGGEI:5a6cabc51872c7995342b2384f27731f6209bb4f", + "video_id": "q4GkZRdGGEI", + "question": "Where is Matt in relation to the player wearing a blue shirt with a single white stripe on the sleeve?", + "answer_choice_0": "Next to him on the right.", + "answer_choice_1": "Straight across from him.", + "answer_choice_2": "Below and diagonally across from him.", + "answer_choice_3": "Next to him on the left.", + "answer_choice_4": "Above and diagonally across from him.", + "answer_id": 4, + "answer": "Above and diagonally across from him.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I identified which player was Matt. I saw that the player in the plaid shirt in the upper right corner of the screen has a nametag that says \"Matt\" at 00:00. Next, I looked for a player wearing a blue shirt with a single white stripe, but did not immediately see one. At 01:04, the hand of a 5th player is revealed for the first time. I continued watching and found a clear image of this player wearing a blue shirt with a single white stripe on the sleeve at 01:19. Since this player occupies the bottom left corner of the screen and Matt occupies the top right corner of the screen, Matt is above and diagonally across from the player." + }, + { + "key": "q4GkZRdGGEI:91154be91bbea540e3d2c8fe52f2390ce6c699f7", + "video_id": "q4GkZRdGGEI", + "question": "Over what image does the cursor move when the narrator talks about the other players giving the player that owns the dark blue spaces both utilities?", + "answer_choice_0": "A ring.", + "answer_choice_1": "The chance cards.", + "answer_choice_2": "A train.", + "answer_choice_3": "A question mark.", + "answer_choice_4": "The monopoly logo.", + "answer_id": 4, + "answer": "The monopoly logo.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First I listened for a moment when the narrator talks about the other players giving the player that owns the dark blue spaces both utilities. Between 03:07 - 03:08, the narrator refers to a player that has been given \"too much cash\" and moves his cursor over the dark blue properties, indicating he is referring to the player that owns them. At 03:11, while still referring to this same player, the narrator says, \"they even gave him both utilities\". I looked for the location of the cursor and saw its arrow hovering above the Monopoly symbol during the time that the narrator says the word \"utilities.\"" + }, + { + "key": "q4GkZRdGGEI:b49bd1a1d44017b25a4c164af7653685eb467091", + "video_id": "q4GkZRdGGEI", + "question": "What color card does the player in the bottom left corner of the screen grab in between Matt's handling of $1 and $50 dollar bills?", + "answer_choice_0": "Red and white.", + "answer_choice_1": "Orange and white.", + "answer_choice_2": "Yellow and white.", + "answer_choice_3": "Brown and white.", + "answer_choice_4": "Blue and white.", + "answer_id": 3, + "answer": "Brown and white.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I identified the player in the top right corner of the screen by reading his name, \"Matt\" on his nametag at 00:00. Next, I watched the moments where he handles $1 dollar bills. I saw him clearly handle a stack of $1 dollar bills for the first time at 03:15. At 03:21, I saw the player in the bottom left corner of the screen grab a brown and white card. Immediately after that, still at 03:21, Matt picks up a few $50 dollar bills. I confirmed that at no other time in the video does this sequence of events occur. Therefore, the player in the bottom left corner of the screen grabs a brown and white card in between Matt's handling of $1 and $50 dollar bills." + }, + { + "key": "q4GkZRdGGEI:c3b7dfea057423aab13ac949af991b1fe9b50dfe", + "video_id": "q4GkZRdGGEI", + "question": "At 02:05, which player owns the largest bill with a clearly visible number on the table?", + "answer_choice_0": "The player in the top right corner.", + "answer_choice_1": "The player in the bottom left corner.", + "answer_choice_2": "The player in the top left corner.", + "answer_choice_3": "The player centered at the top.", + "answer_choice_4": "The player in the bottom right corner.", + "answer_id": 2, + "answer": "The player in the top left corner.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I looked at 02:05, which presents a still image of the players around the Monopoly table. I only saw 3 Monopoly money stashes visible on screen. I noticed that the player in the top left corner has a $100 dollar bill visible on top of his stash. I saw that the player in the top right corner of the screen has a $50 bill on top of his stash, and that the player in the bottom right corner of the screen also has a $50 dollar bill on his stash. Since 100 is greater than 50, I concluded that the player in the top left corner owns the largest bill with a clearly visible number at 02:05." + }, + { + "key": "q4GkZRdGGEI:d551a494c61e362cbbdcd8882fd7675570e9de0b", + "video_id": "q4GkZRdGGEI", + "question": "Where is the iron player token in relation to the dice the first time they visibly have the sum of 9?", + "answer_choice_0": "Straight across.", + "answer_choice_1": "To the right.", + "answer_choice_2": "Below and to the left.", + "answer_choice_3": "Above and to the right.", + "answer_choice_4": "To the left.", + "answer_id": 4, + "answer": "To the left.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First, I looked for an iron player token. I saw that it was visible on top of the \"B. & O. Railroad\" at 00:00. The dice have a sum total of 5 at that time stamp. I watched and looked for the moment where the dice added up to 9 for the first time. I found this at 01:04. I noticed that the iron player token is still on \"B. & O. Railroad\" at that mark. At 01:04, the dice are on top of the \"Chance\" space to the right of \"B. & O. Railroad\". Therefore, I concluded that the iron player token is to the left of the dice the first time they visibly have the sum of 9." + }, + { + "key": "r4cn92VyHbk:1e57dc5eda2f91916d07981bc51b663cf4b6e344", + "video_id": "r4cn92VyHbk", + "question": "What words appear beneath the letter tile \"Z\" when the word \"Zone\" is played on the Scrabble Pass card?", + "answer_choice_0": "Triple letter score.", + "answer_choice_1": "Double word score.", + "answer_choice_2": "Play begins here.", + "answer_choice_3": "Triple word score.", + "answer_choice_4": "Double letter score.", + "answer_id": 0, + "answer": "Triple letter score.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched until I saw the word \"zone\" played on the Scrabble Pass card, which occurred at 01:22. I continued watching until I could read what words appeared beneath the letter tile \"Z\", and this happened at the 01:39 mark. I read the words \"triple letter score.\"" + }, + { + "key": "r4cn92VyHbk:381f6c168c6d37049d72517135b62f9f8febe718", + "video_id": "r4cn92VyHbk", + "question": "Why does a red \"X\" appear over the Z tile?", + "answer_choice_0": "The word is too long.", + "answer_choice_1": "The player ran out of time.", + "answer_choice_2": "The word is a proper noun.", + "answer_choice_3": "The word is misspelled.", + "answer_choice_4": "The word starts in the wrong spot.", + "answer_id": 4, + "answer": "The word starts in the wrong spot.", + "question_type": "Cause and Effect", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and looked for a red \"X\" to appear over a Z tile. At 00:58, I saw the red \"X\" over the Z tile. I observed that the Z tile had been placed in the center of its line, in the third spot. I moved back in the video to 00:55 to understand more of the moment's context, and the narrator explained from 00:55 - 00:58 that the first letter of a word has to start in the far left space on the line. I watched the remainder of the video and did not see any more occurrences of a red \"X\" over a Z tile. So, the answer is that the word had been placed in the wrong spot." + }, + { + "key": "r4cn92VyHbk:66e44f68ade6eee1807d43f3eed113315408e4b2", + "video_id": "r4cn92VyHbk", + "question": "Rank the following words according to their score if played on the first row of the standard side of the game card: Wage, price, quiet, fizz.", + "answer_choice_0": "Quiet, Price, Fizz, Wage.", + "answer_choice_1": "Fizz, Price, Wage, Quiet.", + "answer_choice_2": "Wage, Quiet, Fizz, Price.", + "answer_choice_3": "Price, Fizz, Quiet, Wage.", + "answer_choice_4": "Fizz, Quiet, Price, Wage.", + "answer_id": 4, + "answer": "Fizz, Quiet, Price, Wage.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "First I identified the standard side of the game card as the one with 5 rows when the narrator said at 00:13 that this was the side to use for a \"standard game\". I observed that the first row of the standard side had a double letter score on the second letter, a triple word score on the fourth letter, and a triple letter score on the fifth letter. Then, I looked for information about how many points each letter was worth. At 00:22, all letters were present and showed their point values in the lower right corners. I listened for additional information about how to score. From 01:40 - 01:50, I heard the narrator discuss how the premium \"letter\" tiles only apply to the letter on top of it while the premium \"word\" tiles apply to the whole word. I also heard the narrator say that premium letter bonuses are applied before premium word bonuses from 01:50 - 01:55. From 02:00 - 02:05, I also heard the narrator say that using all 5 spaces in a word results in a bonus of 5 points after the rest of the score has been taken. I listened for any additional rules about scoring based on the tiles and card and did not hear any. I noticed that all of the words in the question were at least 4 letters, so all words would receive a triple word score. Then I calculated the point values for each of the words in the question based on the point values shown at 00:22. W is worth 4 points, A is worth 1 point (and doubled since it's the second letter), G is worth 2 points, and E is worth 1 point. Thus, \"Wage\"'s point total is (4+2+2+1)*3=27. Next, P is worth 3 points, R is worth 1 point (doubled to 2), I is worth 1 point, C is worth 3 points, and E is worth 1 point (tripled to 3). Since this word is 5 letters long, it will also receive an added 5 points after being tripled. I calculated this word's point value as ((3+2+1+3+3)*3)+5=41. Next, Q is worth 10 points, U is worth 3 points (doubled to 6), I is worth 1 point, E is worth 1 point, and T is worth 1 point (tripled to 3). This word is also 5 letters so it also receives a 5 point bonus after being tripled. I calculated this word's point value as ((10+6+1+1+3)*3)+5=68. Last, F is worth 4 points, I is worth 1 point (doubled to 2), Z is worth 10 points, and Z is worth 10 points. I calculated this word's point value as (4+2+10+10)*3=78. I put these words in order from highest to lowest point values: Fizz (78 points), Quiet (68 points), Price (41 points), and Wage (27 points)." + }, + { + "key": "r4cn92VyHbk:7e5829e401ddca4ce232695dc2fd76cea455b1fe", + "video_id": "r4cn92VyHbk", + "question": "After the third time a sand timer is shown, how many letter tiles are positioned on the Scrabble Pass card?", + "answer_choice_0": "3 letter tiles.", + "answer_choice_1": "8 letter tiles.", + "answer_choice_2": "4 letter tiles.", + "answer_choice_3": "5 letter tiles.", + "answer_choice_4": "6 letter tiles.", + "answer_id": 2, + "answer": "4 letter tiles.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched and paid attention to any time a sand timer appeared onscreen. The sand timer appeared onscreen for the first time at 00:19, a second time at 01:08, and a third time at 01:18. After the third time the sand timer appeared onscreen, I looked for the next time the Scrabble Pass card was visible. This occurred at 01:22. I then counted how many letter tiles were positioned on the card and there were a total of 4 letter tiles." + }, + { + "key": "r4cn92VyHbk:a4870dbb4be567f040b9cd0fc16ee064cde44365", + "video_id": "r4cn92VyHbk", + "question": "How many different green boxes appear on the Scrabble Pass card between 01:30 - 02:00?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "6.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I scrolled to the specified timestamp at 01:30 and paid attention to any time a green box appeared on the Scrabble Pass card. At 01:39, there were two green boxes highlighting two premium squares. At 01:45, there was a third green box that highlighted the Z tile. At 01:49 2 new green boxes appeared, one around the O and N titles, and 1 around the E tile. I watched until 02:00 and confirmed there were no additional green boxes in that time. So, between 01:30 - 02:00 a total of 5 different green boxes appeared on the Scrabble Pass card." + }, + { + "key": "r4cn92VyHbk:d80deab58b38ee65bbfdb44eb092bd1a1534e971", + "video_id": "r4cn92VyHbk", + "question": "When the video displays some example words which are not acceptable to play in Scrabble Pass, which of the following foreign language words is used as an example?", + "answer_choice_0": "Konnichiwa.", + "answer_choice_1": "Bonjour.", + "answer_choice_2": "Hola.", + "answer_choice_3": "Ciao.", + "answer_choice_4": "Ni Hao.", + "answer_id": 2, + "answer": "Hola.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find the point when example words are displayed which are not acceptable to play in Scrabble Pass. I found this point at 02:18 when there was a black screen with the words \"Illegal Words\" at the top in red text. At 02:26, the word \"hola\" appears in white text. So, the answer is hola." + }, + { + "key": "r4cn92VyHbk:e15dd0ab9f9ff5eb92d9d0f99eae03b29d4b3a9f", + "video_id": "r4cn92VyHbk", + "question": "If the player in the video had played \"zoner\" instead of \"zone\" as shown from 01:33 - 01:55, what would the player's score have been?", + "answer_choice_0": "72.", + "answer_choice_1": "68.", + "answer_choice_2": "70.", + "answer_choice_3": "74.", + "answer_choice_4": "66.", + "answer_id": 2, + "answer": "70.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to understand what the score would have been if the player had played \"zoner\" instead of \"zone\" as shown from 01:33 - 01:55. At 01:33, I can see that the line the word is being played on has a fifth space where the \"r\" could go, which is worth a double letter score. I went back in the video and noticed that at 00:21, all of the letters in the alphabet are shown, along with their numerical values. I see here that \"r\" is worth 1 point. Doubled, it would be worth 2 points. At 01:53, the video shows the math for the word \"zone\", which would equal 66 points, since the initial \"z\" is tripled, and then the entire word is doubled thanks to the fourth tile. Adding 2 points to the base word value and then doubling the entire word would mean that the word would score 70 points. So, the answer is 70." + }, + { + "key": "r4cn92VyHbk:e64ce7a11dda1b2e1ea9952b35c79c772b05fb7a", + "video_id": "r4cn92VyHbk", + "question": "How many times does the narrator appear with his face shown in the video to explain how to play Scrabble Pass?", + "answer_choice_0": "1 time.", + "answer_choice_1": "2 times.", + "answer_choice_2": "4 times.", + "answer_choice_3": "5 times.", + "answer_choice_4": "3 times.", + "answer_id": 2, + "answer": "4 times.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video to find out the number of times the narrator appears with his face shown in the video to explain how to play Scrabble Pass. I first identified the narrator by hearing him speak immediately as the video began at 00:00. I then observed that at 00:02, a man appeared and was talking to the camera. I observed that this man's voice was the same as the man speaking at 00:00. Therefore, I determined that this was the narrator and counted this as his first appearance. I noted that he was onscreen from 00:02 - 00:07. I continued watching and noted the times that the narrator appeared again. The next appearance was from 00:33 - 00:38. Then, he appeared from 02:08 - 02:18. Then, he appeared from 02:54 - 03:00. He did not appear again before the end of the video. So, I counted the occurrences and concluded that the narrator appears with his face shown 4 times in the video." + }, + { + "key": "r4cn92VyHbk:ecb1df8d7c9f3c3ee7a06b844918c541449b0ae1", + "video_id": "r4cn92VyHbk", + "question": "Which word does not appear on the Scrabble Pass card in the video?", + "answer_choice_0": "Diner.", + "answer_choice_1": "Zoo.", + "answer_choice_2": "Cook.", + "answer_choice_3": "Wise.", + "answer_choice_4": "Green.", + "answer_id": 2, + "answer": "Cook.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I paid attention to any time a word was spelled with letter tiles on the Scrabble Pass card. The first word I found was \"bar\" at 00:28 (and \"barn\" once the blank tile is declared as an \"n\" at 00:30). The next word I found was \"wise\" at 00:54. \"Wise\" appeared again at 01:07. The next word I found was \"zoo\" at 00:56. The next word I found was \"gee\" at 01:15. The next word I found was \"green\" at 01:17. The next word I found was \"zone\" at 01:22. \"Zone\" appeared again at 01:34. The next word I found was \"diner\" at 02:00. \"Diner\" was the last real word to appear on the Scrabble Pass card. Therefore, the word \"cook\" does not appear on the Scrabble Pass card." + }, + { + "key": "r4cn92VyHbk:f6956c177adad441848cea651b31551c2484753f", + "video_id": "r4cn92VyHbk", + "question": "When a cell phone is visible for the first time, what words are positioned beneath the search bar on its screen?", + "answer_choice_0": "Family Game Night.", + "answer_choice_1": "Hasbro Shop.", + "answer_choice_2": "Scrabble Dictionary.", + "answer_choice_3": "See if your word is valid.", + "answer_choice_4": "Hasbro Gaming.", + "answer_id": 4, + "answer": "Hasbro Gaming.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched until a cell phone first appeared. This occurred at 02:38 on the right side of the screen. I then located the search bar in the middle of the phone screen. I looked below the search bar and saw a phrase made out of letter tiles that read: \"Hasbro Gaming\"." + }, + { + "key": "r6vTvfmi0LI:7d032b1b209cd0e8cd818516991b85d739a5650f", + "video_id": "r6vTvfmi0LI", + "question": "What does the character put on her head after the veil?", + "answer_choice_0": "A white flower.", + "answer_choice_1": "A flower headband.", + "answer_choice_2": "A crown.", + "answer_choice_3": "A tiara.", + "answer_choice_4": "A blue flower.", + "answer_id": 3, + "answer": "A tiara.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 06:04, I observed that the character placed a veil on her head. She continues with her dialogue while breaking the fourth wall, looking directly at the camera. She then proceeds by adding a tiara on her head at 06:31 while in a crouched position on top of the lounging chair." + }, + { + "key": "r6vTvfmi0LI:84fce54ebeb22e10c4d60f3053705f9f6be66833", + "video_id": "r6vTvfmi0LI", + "question": "What does the performer carry with her as she turns away at the end of the video?", + "answer_choice_0": "Her headpiece.", + "answer_choice_1": "A bag.", + "answer_choice_2": "A candle.", + "answer_choice_3": "A microphone.", + "answer_choice_4": "A rose.", + "answer_id": 4, + "answer": "A rose.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 07:50, I saw the performer pick up a rose. Next, at 08:05, I saw her walk away while carrying it. Then, the performance ended." + }, + { + "key": "r6vTvfmi0LI:90046a572a73a6dbe97bff33732bb375c0a55192", + "video_id": "r6vTvfmi0LI", + "question": "What does the performer do while walking away in the end?", + "answer_choice_0": "Sing.", + "answer_choice_1": "Nothing.", + "answer_choice_2": "Scream.", + "answer_choice_3": "Cry.", + "answer_choice_4": "Hum.", + "answer_id": 4, + "answer": "Hum.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 08:05, I saw the performer walk away to end the performance. At the same time, I heard her humming as she walked away." + }, + { + "key": "r6vTvfmi0LI:d2ea0e126a802387f3fb361e5543fed20663248a", + "video_id": "r6vTvfmi0LI", + "question": "What changes about the performer's appearance at 06:07?", + "answer_choice_0": "She puts on a veil.", + "answer_choice_1": "She puts on a pair of shoes.", + "answer_choice_2": "She puts on a coat.", + "answer_choice_3": "She puts on a dress.", + "answer_choice_4": "She puts on a hat.", + "answer_id": 0, + "answer": "She puts on a veil.", + "question_type": "State Changes", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video near the 06:07 time stamp to understand what has changed about the performer's appearance. Directly before, from 05:28-06:03, the performer holds a long, white veil in her left hand. At 06:07, she successfully places the veil on her head, where it drapes down her back." + }, + { + "key": "rbCXajpMaiU:295a9f0fff2c04b793d091cf174d5f01af1c9106", + "video_id": "rbCXajpMaiU", + "question": "At what point in the video is the player in the blue shirt's queen captured?", + "answer_choice_0": "03:32.", + "answer_choice_1": "03:34.", + "answer_choice_2": "03:38.", + "answer_choice_3": "03:30.", + "answer_choice_4": "03:41.", + "answer_id": 0, + "answer": "03:32.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched until I observed the player in blue move his black queen to d5 on the chess board at 03:25. I saw the player in white remove the black queen from the board at 03:32. After that, I listened to the speaker say that the player in white \"almost immediately takes the queen\" at 03:33. Therefore, the player in blue's black queen is captured at 03:32." + }, + { + "key": "rbCXajpMaiU:37c354c3bab9b68ad1710e6fc1a1c3bc03dc283b", + "video_id": "rbCXajpMaiU", + "question": "After the sixth move is played on the board, where do the two players look?", + "answer_choice_0": "In opposite directions.", + "answer_choice_1": "They close their eyes.", + "answer_choice_2": "At the chess board.", + "answer_choice_3": "At each other.", + "answer_choice_4": "At the ceiling.", + "answer_id": 0, + "answer": "In opposite directions.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I watched and counted each time the players made a move on the chess board. The player in a white shirt made the first move at 00:05. The player in a blue shirt made the second move at 00:07. The player in a white shirt made the third move at 00:09. The player in a blue shirt made the fourth move at 00:10. The player in a white shirt made the fifth move at 00:11. And finally, the player in a blue shirt made the sixth move at 00:13. I then observed that the players turned their heads from 00:13-00:16. The player in white looked toward his right, toward the camera, while the player in blue looked away from the camera, also to his right. Therefore, I determined that after the sixth move was played, the players looked in opposite directions." + }, + { + "key": "rbCXajpMaiU:48977248c9d7ac0bddb71f1638d327ea3d5810df", + "video_id": "rbCXajpMaiU", + "question": "Who has a material advantage when the narrator says \"slightly damaged pawn structure\"?", + "answer_choice_0": "No one.", + "answer_choice_1": "Black, by 2.", + "answer_choice_2": "White, by 1.", + "answer_choice_3": "White, by 2.", + "answer_choice_4": "Black, by 1.", + "answer_id": 2, + "answer": "White, by 1.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched until I heard the speaker say \"slightly damaged pawn structure\", and I found that this occurred from 05:15-05:16. I observed the graphic chess board in the lower right corner of the screen. I used my knowledge of chess to understand that every piece has a material value that corresponds to its overall strength, with pawns being worth 1 point, bishops and knights being worth 3 points, rooks being worth 5 points, and queens being worth 9 points. I then counted how many of each piece white had at that time. I counted 5 pawns. Since they're worth 1 point each, I calculated that white had 5 points worth of pawns. White also had 2 bishops, each worth 3 points for a total of 6 points. White also had 2 rooks, each worth 5 points, for a total of 10 points. I added each of these point values and calculated white's material value was 5+6+10=21. I repeated these steps for black. I counted that black had 4 pawns (1 point each, so 4 points total), 1 knight (3 points each, so 3 points), 1 bishop (3 points each, so 3 points), and 2 rooks (5 points each, so 10 points). I added black's point values and calculated their material value was 4+3+3+10=20. I saw that white had a higher score and subtracted black's to find the overall difference, calculating 21-20=1. Therefore, I determined that white had 1 point of material advantage when the target phrase was uttered." + }, + { + "key": "rbCXajpMaiU:6407738d9be6b738753859a26030b5a958e2fbec", + "video_id": "rbCXajpMaiU", + "question": "Which square does the narrator mention first after the sixth occurrence of someone walking across the screen?", + "answer_choice_0": "f4.", + "answer_choice_1": "a3.", + "answer_choice_2": "h1.", + "answer_choice_3": "g5.", + "answer_choice_4": "d2.", + "answer_id": 0, + "answer": "f4.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "While watching, I counted up to the sixth occurrence of someone walking across the screen. I counted the first 6 occurrences at: 00:45-00:46, 09:59-10:00, 10:19-10:20, 10:47-10:48, 11:21-22. and 11:22-11:23. I listened as the sixth person passed out of the screen for the next time the narrator mentions a specific square. At 11:23, after the sixth person had passed, I heard the narrator say \"to anchor it to the f4 pawn.\" I understood from my knowledge of chess that each square has a name that corresponds to its rank (row) and file (column). Further, I understood from my knowledge of chess that the files are assigned a letter from \"a\" to \"h\" while the ranks are assigned a number from \"1\" to \"8\" (with a1 being the queen's side rook). Therefore, I concluded that the square that the narrator referenced was f4." + }, + { + "key": "rbCXajpMaiU:76ffc8195273923f3bc247f8b75029975a2355b3", + "video_id": "rbCXajpMaiU", + "question": "What were the winner's first 3 moves?", + "answer_choice_0": "Pawn to d5, pawn to e5, knight to c6.", + "answer_choice_1": "Pawn to d4, knight to f3, pawn to e3.", + "answer_choice_2": "Pawn to c4, pawn to d4, knight to c3.", + "answer_choice_3": "Pawn to d3, bishop to f4, knight to d2.", + "answer_choice_4": "Pawn to e3, knight to f3, bishop to b4.", + "answer_id": 2, + "answer": "Pawn to c4, pawn to d4, knight to c3.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I identified who won the game. I observed the player in blue, who played black, reach his hand across the board at 12:47, signalling the end of the game. And from 12:47-12:48 I saw the players shake hands. At 12:48 I saw the player in white, who played white, stand up and leave the table. At 12:50-12:52, I heard the narrator say \"Hikaru resigns and Gary Kasparov with an amazing win.\" I went back to the beginning to confirm which player was which. At 00:06, I saw the player playing white move the Queen's pawn forward two squares. Then at 00:10, I heard the narrator say \"Kasparov starts with d4.\" I understood from my knowledge of chess that each square has a name that corresponds to its rank (row) and file (column). Further, I understood that the files are assigned a letter from \"a\" to \"h\" while the ranks are assigned a number from \"1\" to \"8\" (with a1 being the queen's side rook). Therefore I confirmed that the first move was the pawn from d2 to d4. Since Kasparov was the winner and made the first move, I noted the rest of his opening moves. At 00:09 I saw Kasparov make his second move of pawn to c4. Then at 00:12 I saw Kasparov make his third move of knight to c3. Therefore, I determined that the winner's first three moves were: 1. Pawn to d4, pawn to c4, and knight to c3." + }, + { + "key": "rbCXajpMaiU:a37aac9e0f3e36494cc0a90446d600fd99477f4e", + "video_id": "rbCXajpMaiU", + "question": "How many times is the chess clock touched in the first 30 seconds of the video?", + "answer_choice_0": "9 times.", + "answer_choice_1": "10 times.", + "answer_choice_2": "12 times.", + "answer_choice_3": "6 times.", + "answer_choice_4": "7 times.", + "answer_id": 4, + "answer": "7 times.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I identified the chess clock at 00:00 as the small rectangular wooden-framed object with a digital screen on the far side of the board. Then I watched the remainder of the first 30 seconds and I counted each time the chess clock was touched by either player. The first time was at 00:04. The second time was at 00:06. The third time was at 00:08. The fourth time was at 00:10. The fifth time was at 00:11. The sixth time was at 00:12. The seventh time was at 00:13. There were no more occurrences until after 00:30. I counted the occurrences I observed and determined that the chess clock was touched 7 times in the first 30 seconds." + }, + { + "key": "rbCXajpMaiU:a841d0aca1f51c3432230672ec4550d435105c4e", + "video_id": "rbCXajpMaiU", + "question": "Which spaces on the chessboard are highlighted in yellow when the speaker says, \"it's not the most dangerous thing\"?", + "answer_choice_0": "d5 and d4.", + "answer_choice_1": "f4 and f5.", + "answer_choice_2": "d5 and e6.", + "answer_choice_3": "a8 and d8.", + "answer_choice_4": "e1 and d2.", + "answer_id": 2, + "answer": "d5 and e6.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I identified when the speaker said \"it's not the most dangerous thing\", which happened at 08:54-08:55. I observed a chess board graphic in the bottom right corner of the screen. I noticed that while the narrator began speaking the target phrase, two squares were highlighted yellow. In order to identify the specific squares, I used my knowledge of chess that each square has a name that corresponds to its rank (row) and file (column). Further, I understood from my knowledge of chess that the files are assigned a letter from \"a\" to \"h\" while the ranks are assigned a number from \"1\" to \"8\" (with a1 being white's queen's side rook and a8 being white's king-side rook). I went back to 08:54 and observed that the two squares highlighted were d5 and e6." + }, + { + "key": "rbCXajpMaiU:a88249f16e622eb8c8a274518dd24adc76c0813f", + "video_id": "rbCXajpMaiU", + "question": "How long does the player in the white shirt take to make his move at 00:36?", + "answer_choice_0": "16 seconds.", + "answer_choice_1": "22 seconds.", + "answer_choice_2": "20 seconds.", + "answer_choice_3": "10 seconds.", + "answer_choice_4": "12 seconds.", + "answer_id": 1, + "answer": "22 seconds.", + "question_type": "Numerical Reasoning", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I went to 00:36 and watched as the player in the white shirt made a move. To learn how long it took for him to make that move, I went back and watched for when the player in the blue shirt made his last move. At 00:14, the player in the blue shirt finishes his move, and it is now the player in the white shirt's turn. I watched through the span of 00:14-00:36 and confirmed that the man did not make any other moves. Then, I calculated the difference between 00:36 and 00:14 and got 00:22.Therefore, it took the player in the white shirt 22 seconds to make his move at 00:36." + }, + { + "key": "rbCXajpMaiU:e3dbb4f291024170d9f9b5adcbbb69fde27b1cbc", + "video_id": "rbCXajpMaiU", + "question": "What's the total time that the players shake hands?", + "answer_choice_0": "2 seconds", + "answer_choice_1": "4 seconds", + "answer_choice_2": "5 seconds", + "answer_choice_3": "3 seconds", + "answer_choice_4": "1 second", + "answer_id": 0, + "answer": "2 seconds", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "I watched for the first time the players shook hands. This occurred for 1 second at 00:03. I continued watching, looking for any other occurrences of shaking hands. At the end of the video I saw the two players shake hands again at 12:48. This handshake was also only 1 second long. I watched the remainder of the video and did not see any more occurrences. I added the two durations together and calculated 00:01+00:01=00:02. Therefore, I concluded that the players shook hands for 2 seconds total." + }, + { + "key": "rbCXajpMaiU:f10c4150b454f869b7d87efb7790512642034304", + "video_id": "rbCXajpMaiU", + "question": "How much time elapses between white moving their first pawn and white moving the queen for the first time?", + "answer_choice_0": "31 seconds.", + "answer_choice_1": "24 seconds.", + "answer_choice_2": "28 seconds.", + "answer_choice_3": "39 seconds.", + "answer_choice_4": "33 seconds.", + "answer_id": 0, + "answer": "31 seconds.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Chess", + "reasoning": "First, I watched for white to move a pawn and recorded the time. I identified from my knowledge of chess that pawns all begin on the 2nd rank. White's first pawn move (d2 to d4) occurred at 00:06. Then, I watched until white moved their queen. I understood from my knowledge of chess that the queen begins on d1. White moved their queen from d1 to c2 at 00:37. Additionally I heard the narrator mention that white moved his queen at 00:39. To find how much time had elapsed between those two moves, I calculated 00:37-00:06=00:31. Therefore, I determined that 31 seconds had elapsed between white's first pawn move and the first time they moved the queen." + }, + { + "key": "rcBO-3tjtQE:0a3fb4d260a9ad33c30cb9cdc9e0c00ddef3d891", + "video_id": "rcBO-3tjtQE", + "question": "How many black dogs come into the shelter yard before Athena arrives?", + "answer_choice_0": "5.", + "answer_choice_1": "3.", + "answer_choice_2": "10.", + "answer_choice_3": "9.", + "answer_choice_4": "13.", + "answer_id": 0, + "answer": "5.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "At 00:55, a dog came into the shelter yard, and next to the dog the name Athena appeared, so I knew up until that dog came in I should count the black dogs that arrived. These are the times when a black dog enters the shelter yard: 00:01, 00:05, 00:09, 00:11, and 00:16. Then, I counted these moments and got 5. Therefore, there are 5 black dogs that come into the shelter yard before Athena arrives." + }, + { + "key": "rcBO-3tjtQE:5e5cc156c9198c03c1d2112bc52b7b181850064c", + "video_id": "rcBO-3tjtQE", + "question": "Who are the fourth and last dogs seen on-screen?", + "answer_choice_0": "Poppy fourth and July last.", + "answer_choice_1": "Trevor fourth and Kogi last.", + "answer_choice_2": "July fourth and Saul last.", + "answer_choice_3": "Charlie fourth and Promise last.", + "answer_choice_4": "Poppy fourth and Kogi last.", + "answer_id": 4, + "answer": "Poppy fourth and Kogi last.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified the first dog seen on-screen by reading a text on-screen at 00:02 that read \"Hazel\" to the first dog I saw walking into the shelter yard at 00:00. At 00:04, I saw July and Trevor's back half appear onscreen at the same time, making them the second and third dogs shown - I identified July by the onscreen caption, and Trevor by an employee calling his name. From 00:10-00:11, I saw Poppy slip in behind Trevor, making her the fourth dog to appear onscreen - I learned her name by reading it in the caption at 00:11. Then, I went to the end of the video and noticed that a dog with an orange harness at 14:49 - 14:55 was leaving the shelter yard. I watched the film before that timestamp to look for the dog with the orange harness' name. At 13:36, I read the name Kogi on-screen next to the same dog with the orange harness. Therefore, Poppy is the fourth dog seen on-screen and Kogi is the last dog seen leaving the shelter yard at the end of the video." + }, + { + "key": "rcBO-3tjtQE:9e1d3a98b5ffc9e56327602d9bbadc6b224ebe59", + "video_id": "rcBO-3tjtQE", + "question": "Who does Buster growl at during his visit at the shelter yard?", + "answer_choice_0": "Pip", + "answer_choice_1": "Mr. Bones", + "answer_choice_2": "Clove", + "answer_choice_3": "Charlie", + "answer_choice_4": "Holly", + "answer_id": 1, + "answer": "Mr. Bones", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I looked for a dog named Buster. While watching, I read text on-screen with the name Buster next to a brown dog at 03:13. I noticed, at 03:16, Buster growled at a gray dog that had a light green collar on. So, I went back into the video to look for the name of the dog Buster growled at. At 01:21, I read the name Mr. Bones next to a gray dog with a light green collar on it. Therefore, Buster growls at Mr. Bones during his visit at the shelter yard." + }, + { + "key": "rcBO-3tjtQE:af1f8bb3c6deba763aa717c1cd43f94a94b276b5", + "video_id": "rcBO-3tjtQE", + "question": "Who does Wendy play with directly after she plays with Mr. Bones?", + "answer_choice_0": "Choppers.", + "answer_choice_1": "Poppy.", + "answer_choice_2": "Charlie.", + "answer_choice_3": "July.", + "answer_choice_4": "Kogi.", + "answer_id": 2, + "answer": "Charlie.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for dogs identified as Wendy and Mr. Bones. A dog enters the dog run at 01:19 who is identified as Mr. Bones at 01:21 with the name onscreen. At 01:51, a dog enters who is identified as Wendy at 01:59 with the name onscreen. The two dogs play together from 01:56 until 02:19. Wendy plays with another dog directly afterwards. I went back in the video to find this dog who first appears at 01:02, and is identified with his name onscreen as Charlie at 01:05. So Charlie is the dog that Wendy plays with directly after she plays with Mr. Bones." + }, + { + "key": "rcBO-3tjtQE:db00e687a7721e013976c5ac383a2dc2ea4433ce", + "video_id": "rcBO-3tjtQE", + "question": "What color collar is not seen within the first 30 seconds of the video?", + "answer_choice_0": "Green.", + "answer_choice_1": "Blue.", + "answer_choice_2": "Purple.", + "answer_choice_3": "Red.", + "answer_choice_4": "Pink.", + "answer_id": 4, + "answer": "Pink.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "While watching just the first 30 seconds of the video, I looked at the different collars that dogs had on. At 00:01, I noticed a dog had on a green collar. At 00:13, I noticed a dog had a blue collar. At 00:22, I noticed 2 dogs had purple collars. At 00:28, I noticed a dog had on a red collar. Therefore, the collar that was not seen within the first 30 seconds of the video is pink." + }, + { + "key": "rcBO-3tjtQE:f3abdd8461a7baae6d2f671485413edbeaf40308", + "video_id": "rcBO-3tjtQE", + "question": "What is name of the second dog seen to enter the dog area after the woman greets Charlie?", + "answer_choice_0": "Athena.", + "answer_choice_1": "Zeus.", + "answer_choice_2": "Rocky.", + "answer_choice_3": "Saul.", + "answer_choice_4": "Homelander.", + "answer_id": 3, + "answer": "Saul.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video, listening for a woman to greet Charlie. This occurs at 04:08. I watched to see what dogs enter after that. The next to enter is a dog named Homelander, who comes in at 04:45 and is identified by the name on the screen at 04:49. The next dog to enter after that is at 6:01, identified with their name onscreen as Saul at 06:03. So the second dog to enter after the woman greets Charlie is Saul." + }, + { + "key": "rcBO-3tjtQE:f80a11fafca8924dea584159fa1d5a67c0754ef2", + "video_id": "rcBO-3tjtQE", + "question": "What color leash and collar is worn by the first dog who enters after the dog whose name is mentioned at 08:28?", + "answer_choice_0": "Red leash, black collar", + "answer_choice_1": "Black leash, green collar", + "answer_choice_2": "Orange leash, purple collar", + "answer_choice_3": "Green leash, blue collar", + "answer_choice_4": "Black leash, orange collar", + "answer_id": 3, + "answer": "Green leash, blue collar", + "question_type": "Listening", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video, listening for a dog's name to be mentioned at 08:28. The name mentioned is Homelander, so I went back through the video waiting for Homelander to enter and be identified. Homelander enters at 04:45, a white dog with the name onscreen at 04:49. I went back to the 08:28 timestamp. Homelander is playing with another dog. A third dog joins in at 08:29, with a green leash and a blue collar. I concluded this is the first dog to enter after Homelander's name is mentioned." + }, + { + "key": "rcBO-3tjtQE:f98ee1324536632dc7fab79db7823be2f24999e5", + "video_id": "rcBO-3tjtQE", + "question": "After Rocky's entrance into the group dog run, how long is he onscreen before his name appears?", + "answer_choice_0": "15 seconds.", + "answer_choice_1": "21 seconds.", + "answer_choice_2": "32 seconds.", + "answer_choice_3": "36 seconds.", + "answer_choice_4": "17 seconds.", + "answer_id": 2, + "answer": "32 seconds.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video looking for the name Rocky to appear onscreen, which it did at 10:48. I went back to see at what time the corresponding dog entered the dog run, and it was at 10:16. I subtracted 10:16 from 10:48, and the answer is 32 seconds." + }, + { + "key": "s-r38R6jtgk:1869f546c84847a6531032ce2ddbd8ddd9351463", + "video_id": "s-r38R6jtgk", + "question": "Why are the pink properties described as being mediocre?", + "answer_choice_0": "Players rarely land on them.", + "answer_choice_1": "They have low mortgage value compared to their cost.", + "answer_choice_2": "They're hard to acquire.", + "answer_choice_3": "They have low rent compared to their cost.", + "answer_choice_4": "There are a lot of negative Chance cards involving them.", + "answer_id": 0, + "answer": "Players rarely land on them.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video and saw it start to describe the pink properties at 05:25. The segment is accompanied by text on screen that reads \"very mediocre\". From 05:35-05:40, I heard the narrator say that because it's only a few spaces past jail, players usually roll right past it." + }, + { + "key": "s-r38R6jtgk:23a9cda4c7398421a504915210d55e3e823fc278", + "video_id": "s-r38R6jtgk", + "question": "Why does the wheelbarrow want a firstborn child?", + "answer_choice_0": "It knows it has leverage in a trade.", + "answer_choice_1": "It's making fun of another game piece.", + "answer_choice_2": "It's being violent because it lost the game.", + "answer_choice_3": "It knows the trade will be rejected.", + "answer_choice_4": "It's angry about the cost of Boardwalk.", + "answer_id": 0, + "answer": "It knows it has leverage in a trade.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched until I saw the wheelbarrow on screen with a speech bubble demanding a firstborn child at 08:32. I went back to 08:22 so I could understand the context. From 08:22-08:35, the narrator outlines hypothetical trade scenarios when trying to consolidate properties of the same color. When the wheelbarrow demands a firstborn child, I can see it holding onto the last of the 3 orange properties while the narrator describes having to fight tooth and nail for this third property. Thus, the wheelbarrow knows it has leverage in the trade and is asking for a hyperbolically large return in value." + }, + { + "key": "s-r38R6jtgk:3771d4a750b7862df4e2fd836e658dc073d25a13", + "video_id": "s-r38R6jtgk", + "question": "What is the sum of the money that is visible on the screen at 04:23?", + "answer_choice_0": "$1000.", + "answer_choice_1": "$500.", + "answer_choice_2": "$2000.", + "answer_choice_3": "$1500.", + "answer_choice_4": "$2500.", + "answer_id": 3, + "answer": "$1500.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video beginning at 04:20. A graphic of three money notes appeared. The money notes are for 500 dollars of Monopoly money. So three of them at 500 each would equal out to $1500." + }, + { + "key": "s-r38R6jtgk:9c6a5b96df652312af681b57cafd40e665888953", + "video_id": "s-r38R6jtgk", + "question": "Every single player on every single turn can land on what specifc spaces?", + "answer_choice_0": "Railroad.", + "answer_choice_1": "Greens.", + "answer_choice_2": "Yellow.", + "answer_choice_3": "Chance.", + "answer_choice_4": "Jail.", + "answer_id": 0, + "answer": "Railroad.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the entire video to see if I could identify which specific property or spaces could be landed on by every player. At 07:24 the narrator is discussing the overall value of the railroads. At 07:26, a graphic appears in the upper left quadrant that reads \"Every single player on every single turn can land on a railroad\"" + }, + { + "key": "s-r38R6jtgk:b0605d0ddf521823b90cd2bcd0bf5ee6ed9729a6", + "video_id": "s-r38R6jtgk", + "question": "How many house game pieces are visible when the narrator discusses the catch-22 of Monopoly?", + "answer_choice_0": "15.", + "answer_choice_1": "23.", + "answer_choice_2": "19.", + "answer_choice_3": "6.", + "answer_choice_4": "9.", + "answer_id": 0, + "answer": "15.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video until I heard the narrator mention the phrase \"catch-22\" at 03:18. At that time, I can see a magnified version of the board with 6 properties, each with houses placed on them. I counted 2 each on the 3 red properties and 3 each on the 3 orange properties for a total of 15. While there are two title deeds on the screen, each with 4 house symbols, the question specified house game pieces. Therefore the answer is 15." + }, + { + "key": "s-r38R6jtgk:b287d3882e0b52d96d96b29a59b2d60b5b099639", + "video_id": "s-r38R6jtgk", + "question": "If the dog had landed on Atlantic Avenue each time it went around the board in the timespan 10:26-10:54, and also owed the amount of money shown in a previous section next to the words \"is dangerous\", how much money would it owe the owner of Atlantic Avenue?", + "answer_choice_0": "$2010", + "answer_choice_1": "$1020", + "answer_choice_2": "$690", + "answer_choice_3": "$1350", + "answer_choice_4": "$1680", + "answer_id": 4, + "answer": "$1680", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video starting at 10:26 and first saw the dog pass Atlantic Avenue 3 times. At 10:38, I heard the narrator say that the rent is still $330. I confirmed this when I saw the title deed for Atlantic Avenue on screen at 10:39, and could read that rent with 2 houses is $330. At 10:45, the dog lands on Atlantic Avenue, totalling 4 times. I did not see the dog go around the board again after this in the timespan. I multiplied $330 by 4 to reach a total of $1320. Then, I looked back at the video to find the section where the words \"is dangerous\" are visible. I found this moment at 10:02, when the amount of money shown is \"$360\". I added this total to $1320 and got to a total of $1680." + }, + { + "key": "s-r38R6jtgk:f2aa9d8b5362b14fd8fa1af7684c569b86474f51", + "video_id": "s-r38R6jtgk", + "question": "What two characters flash on the screen when the video discusses how awful the utilities are?", + "answer_choice_0": "Elmo and Big Bird.", + "answer_choice_1": "Grover and The Grouch.", + "answer_choice_2": "SpongeBob and Patrick.", + "answer_choice_3": "Tom and Jerry.", + "answer_choice_4": "Bluey and Bingo.", + "answer_id": 2, + "answer": "SpongeBob and Patrick.", + "question_type": "Listening", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "I watched the video from the beginning to identify when the video would discuss the utilities. I noticed that at 08:00, the utilities appear on the screen. At 08:03, the two utility cards fade away quickly and a graphic of SpongeBob and Patrick illuminate on the cards. Their graphics fade away quickly and the utility cards are showing again after that." + }, + { + "key": "s-r38R6jtgk:f826dc334c4894cce9cb6d2a3df2987255ecf24d", + "video_id": "s-r38R6jtgk", + "question": "At 08:28, which game piece is holding Tennessee Avenue?", + "answer_choice_0": "Hat.", + "answer_choice_1": "Wheelbarrow.", + "answer_choice_2": "Racecar.", + "answer_choice_3": "Thimble.", + "answer_choice_4": "Iron.", + "answer_id": 4, + "answer": "Iron.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Board Games", + "reasoning": "At 08:28, I can see the hat and iron game pieces on screen, each with a title deed card placed below. Listening to the narrator, I heard they were illustrating trading principles and determined that each deed was placed below the game piece to signify ownership. The title deed card for Tennessee Avenue is placed under the iron game piece; therefore, the answer is the iron." + }, + { + "key": "sHnL1zqxOBg:0313935eaac5e91437d5af53517abd28614be5a1", + "video_id": "sHnL1zqxOBg", + "question": "At timecode 4:18, what is the actress wearing in her hair and what is its purpose?", + "answer_choice_0": "A headband.", + "answer_choice_1": "A barrett.", + "answer_choice_2": "A comb.", + "answer_choice_3": "A sponge.", + "answer_choice_4": "A roller.", + "answer_id": 4, + "answer": "A roller.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 4:18, the actress can be seen talking to another crew member. She wears a velcro roller in her hair in order to keep her bangs volumized, an aesthetically pleasing look for the hair." + }, + { + "key": "sHnL1zqxOBg:2d2ee9ddf24960d212a15f17b20866fe056c01d5", + "video_id": "sHnL1zqxOBg", + "question": "What is the job of the second character introduced in the video?", + "answer_choice_0": "Singer/Songwriter.", + "answer_choice_1": "Writer/Director.", + "answer_choice_2": "Director/Producer.", + "answer_choice_3": "Cinematographer/Camera Operator.", + "answer_choice_4": "Producer/Singer.", + "answer_id": 0, + "answer": "Singer/Songwriter.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the first character to be introduced. I witnessed this event between 00:02-00:10. I continued watching and looking for the second character who appears immediately after the first at 00:10. I continued watching to determine his job, and read on the screen that he is the \"Singer/Songwriter\" at 00:12." + }, + { + "key": "sHnL1zqxOBg:8ee4248dc52c1dc93076abd1f74ce226dde5878c", + "video_id": "sHnL1zqxOBg", + "question": "At what time do we first see a man with facial hair, and what color shirt is he wearing?", + "answer_choice_0": "00:19; Orange.", + "answer_choice_1": "02:02; Black.", + "answer_choice_2": "01:04; White.", + "answer_choice_3": "06:40; Yellow.", + "answer_choice_4": "05:38; Blue.", + "answer_id": 1, + "answer": "02:02; Black.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until I located the first man onscreen with facial hair at 02:02. I observed that the shirt he was wearing was black." + }, + { + "key": "sS8xkv9-dtQ:4418cffa756031874222cd703201b93a5328467f", + "video_id": "sS8xkv9-dtQ", + "question": "How does Tom Cruise act after he lands the helicopter and walks out of it?", + "answer_choice_0": "Panicked.", + "answer_choice_1": "Goofy.", + "answer_choice_2": "Confused.", + "answer_choice_3": "Guarded.", + "answer_choice_4": "Happy.", + "answer_id": 4, + "answer": "Happy.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and found the point when the helicopter landed. It reaches the ground at 02:06. Right after this, at 02:07, there is a cut to Tom Cruise walking forward away from the helicopter and toward the crowd in front of him, which is outside the view of the frame. As Tom Cruise walks, he waves with his hand and smiles widely. Members of the crowd can be heard cheering for him. It is clear that he feels happy after the successful landing." + }, + { + "key": "sS8xkv9-dtQ:78a9c00b74607f518d1dfb9639c1aaaf9d630960", + "video_id": "sS8xkv9-dtQ", + "question": "What is flying in the sky from 00:01-00:05?", + "answer_choice_0": "A helicopter.", + "answer_choice_1": "Nothing.", + "answer_choice_2": "A kite.", + "answer_choice_3": "An airplane.", + "answer_choice_4": "A bird.", + "answer_id": 0, + "answer": "A helicopter.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 00:01, I saw an extreme wide shot of something flying in the sky. Then, the shot dissolved to a closer view of the object flying in the sky at 00:05, which I recognized to be a helicopter." + }, + { + "key": "sS8xkv9-dtQ:eb891abb02c5d965d1786e2636b35ad1807e5353", + "video_id": "sS8xkv9-dtQ", + "question": "When a reporter appears on the left side of the frame at 03:05, what TV network's microphone is he holding?", + "answer_choice_0": "MSNBC.", + "answer_choice_1": "MTV.", + "answer_choice_2": "ABC.", + "answer_choice_3": "CNN.", + "answer_choice_4": "NBC.", + "answer_id": 1, + "answer": "MTV.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to the video's time stamp of 03:05 in order to find the reporter. He appears at this time on the left side of the frame. He holds a microphone in his left hand, and although his audio is not heard, his microphone has a clear and recogniable image of a TV network's logo on it: MTV." + }, + { + "key": "sazxUitIq7k:05df51b82e89ac988372b8d087fa43277d431a74", + "video_id": "sazxUitIq7k", + "question": "When the hosts talk about their guest's recent theater experience from 03:53-04:17, how many photographs of their guest appear in the frame?", + "answer_choice_0": "0.", + "answer_choice_1": "1.", + "answer_choice_2": "2.", + "answer_choice_3": "4.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and moved to the 03:53 time stamp in order to see how many photographs appear as the hosts talk about their guest's recent theater experience. The two hosts sit on the left side of the couch and frame and begin talking about their guest and the theater. The guest sits on the right side of the couch. They continue talking as a photograph appears in the frame at 04:04, which shows their guest. At 04:11, this photograph swipes off the frame to the left and is replaced by a second photograph, which stays on the frame until 04:17. No other photographs appear during this time frame, so the answer is two." + }, + { + "key": "sazxUitIq7k:395708fdba22da742e3fc589f94ba0fa82e225dc", + "video_id": "sazxUitIq7k", + "question": "What material does the background wall of the talk show studio look like it is made of?", + "answer_choice_0": "Wood panels.", + "answer_choice_1": "Circular tiles.", + "answer_choice_2": "Aluminum siding.", + "answer_choice_3": "Stone pieces.", + "answer_choice_4": "Clay bricks.", + "answer_id": 4, + "answer": "Clay bricks.", + "question_type": "Situational Awareness", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video to identify the talk show studio and see what the background wall is made of. The studio first appears at 00:04 with two hosts sitting on a long couch as they introduce their next segment looking directly at the camera. Behind them, there is a long wall which fills the background of the frame. There is a double-pane window in the center. To the left and right of the window is what looks to be clay bricks. So, the answer is clay bricks." + }, + { + "key": "sazxUitIq7k:538b7e37c6529bfc9d0ae5f80eb7a7b8f002e8b8", + "video_id": "sazxUitIq7k", + "question": "Which of the following is NOT one of the creative ways that the crew filmed the two sister's parts in the film?", + "answer_choice_0": "Used individual actresses for each sister.", + "answer_choice_1": "Used split screens.", + "answer_choice_2": "Used an amazing VOP on set.", + "answer_choice_3": "Used body doubles for difficult shots.", + "answer_choice_4": "Used wigs to appear different.", + "answer_id": 0, + "answer": "Used individual actresses for each sister.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 03:01 - 03:07, I first listen to the host begin the conversation about how this film uses the same actress for both sister's parts. He then goes on to ask how they were able to use one actress for two different roles. I then listen at 03:08 - 03:16 when the actress starts explaining in detail how the production crew. After 03:16 - 03:43, I continued listening to the actress speak in great detail about being able to successfully piece together this film about two different sisters... while using only one actress to play those two roles." + }, + { + "key": "sazxUitIq7k:9f43564311a90d5c642891bfc054e723147ef117", + "video_id": "sazxUitIq7k", + "question": "What comment from the female guest made only the male host laugh?", + "answer_choice_0": "The female guest references a famous quote", + "answer_choice_1": "The female guest jokes about working as an actor", + "answer_choice_2": "The female guest compliments him", + "answer_choice_3": "The female guest says her job was difficult", + "answer_choice_4": "The female guest says she's shy", + "answer_id": 0, + "answer": "The female guest references a famous quote", + "question_type": "Cause and Effect", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video from the beginning to locate the instance where only the male host laughs at a comment from the female guest. There were several times when both the male and female hosts laughed, but I did not count these because the question asked for times when only the male host laughed. This occurred at 08:54. Immediately preceding this, I listened and heard that the comment from the female guest that made him laugh was a quote by Moliere about comedy being harder than death." + }, + { + "key": "sazxUitIq7k:e02afb7284a3554a4af0b9c5514a2778eae161e9", + "video_id": "sazxUitIq7k", + "question": "How are the three circular tables arranged in the studio?", + "answer_choice_0": "They are spaced out over the studio.", + "answer_choice_1": "The bigger ones are in front of the smaller one.", + "answer_choice_2": "They are arranged in a vertical line.", + "answer_choice_3": "They are arranged in a horizontal line.", + "answer_choice_4": "The smaller one is in front of the bigger ones.", + "answer_id": 1, + "answer": "The bigger ones are in front of the smaller one.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I look for three circular tables to appear. At 01:10, three circular tables show up as the camera creeps in toward the interviewers and the interviewee. I look and see they are arranged in a triangle, with the bigger ones in front and the smaller behind." + }, + { + "key": "sazxUitIq7k:e9c8bbfb4636c4fab32508fe5dea96ce807f51ce", + "video_id": "sazxUitIq7k", + "question": "What is the name of the talk show which appears at the beginning of the video?", + "answer_choice_0": "Weekend: AM.", + "answer_choice_1": "This Morning.", + "answer_choice_2": "The Chat Show.", + "answer_choice_3": "Talk To Me.", + "answer_choice_4": "Small Talk.", + "answer_id": 0, + "answer": "Weekend: AM.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I started the video from the beginning to find the name of the talk show which appears at the beginning of the video. Right at 00:00, text falls into place on the screen which takes up most of the frame: \"Weekend: AM\". It stays on screen until 00:04. At 00:05, a shot shows a man and a woman sitting on a long couch in a studio set, and there is a watermark in the bottom left-hand corner of the frame which shows the time as well as more text, which again reads \"Weekend: AM\". Through these heavy context clues, I can surmise that this is the name of the talk show." + }, + { + "key": "tBdwetBS1DA:5ca1aa6c4a1f0c7d120d72693ccc7a7fd089d6f7", + "video_id": "tBdwetBS1DA", + "question": "What is the second way in which the Vlogger's First Class Premier compartment's interior setup changes, after he has his first meal?", + "answer_choice_0": "The window shades are closed.", + "answer_choice_1": "The window shades are opened.", + "answer_choice_2": "The curtains are closed.", + "answer_choice_3": "The bed is made up.", + "answer_choice_4": "The bed is unmade.", + "answer_id": 0, + "answer": "The window shades are closed.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I had to identify the Vlogger's First Class Premier compartment, which I did by reading a title card identifying the room as such between 00:00-00:02. I then noted that he had his first meal at 00:07. I watched further for visible changes to the room and counted the first instance at 02:33 when the bed was unmade. At 04:06, I saw the vlogger close the window shades and counted this as the second change. Therefore, the second way in which the setup of the Vlogger's First Class Premier compartment changes is that the window shades are closed." + }, + { + "key": "tBdwetBS1DA:6491f47b9b39fba16b1cb40f5203f45e00884a63", + "video_id": "tBdwetBS1DA", + "question": "What are the 2 most noticeable differences between the Nobi-Nobi Couchette in car 5 and the Nobi-Nobi Couchette in the women's only car?", + "answer_choice_0": "The color scheme and the floor pattern.", + "answer_choice_1": "The color of the railing and the number of beds.", + "answer_choice_2": "The number of blankets and the floor pattern.", + "answer_choice_3": "The number of tables and the number of blankets.", + "answer_choice_4": "The number of beds and the color scheme.", + "answer_id": 0, + "answer": "The color scheme and the floor pattern.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for an image of the Nobi-Nobi Couchette in car 5 and found that one appears at 07:35. I noticed the color scheme is green and yellow. I noted that there were silver railings, one flat pillow on each pad, and one side pillow on the two top bunks.I noted one small table in the middle of the room and no blankets. I also noted that the floor pattern featured large concentric circles with 5 rings where the inner 3 rings were fairly uniform in size. These circles featured predominantly in the center of the aisle between the beds. At 08:28, I noted that the vlogger entered the women's only car. At 08:31, they look at the Nobi-Nobi Couchette in that car. I noted that it looks almost identical to the one in car 5, with the same number of pillows, the same color of railings, the same table, and no blankets, except for the fact that the color scheme is pink and orange and the floor pattern included small concentric circles (of 3 rings) and large concentric circles with thinner outer bands placed irregularly on the carpet. Therefore, the color scheme and the floor pattern are the most noticeable differences between the Nobi-Nobi Couchette in car 5 and the women's only car." + }, + { + "key": "tBdwetBS1DA:750d76bd07e39d35a5beb762cddc0c9556cc03c2", + "video_id": "tBdwetBS1DA", + "question": "If you add the number of food treats in the final bento box the vlogger eats to the number of train cars that have reserved seating on the train they board, what would the new percentage of train cars that have reserved seating be?", + "answer_choice_0": "83%.", + "answer_choice_1": "50%.", + "answer_choice_2": "67%.", + "answer_choice_3": "17%.", + "answer_choice_4": "33%.", + "answer_id": 2, + "answer": "67%.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First I looked for the final bento box the vlogger eats from and found that he retrieved a bento box for the last time at 14:59. He opens the box at 15:10 and a roll of sushi and a plastic carton of Ayu become visible within the box. Therefore, the number of items in the final bento box is 2. Then, I went back and at 01:56, I saw the vlogger board the train. At the same time, I saw a sign that displayed 6 train cars and what each one was designated for. The label for train car #1 read \"First Seat Green Car\". The label for train car #2 read \"Reserved Seats for Ladies\" and \"Couchette for Ladies\". The label for train car #3 read \"Reserved Seating\" and \"Family Cabin\". The closest label for train car #4 read \"Lounge Space\". The label for train car #5 read \"Couchette\". And the label for train car #6 read \"Premier Room Green Car\", which was also marked with a golden star as the vlogger's current location. Then, I counted all the train cars out of the 6 that have reserved seating, resulting in a total of 2: cars #2 and #3. I then added the 2 items from the final bento box to that total and got 4. I then calculated 4/6=0.67, then 0.67*100=67%. Therefore, if you add the number of items in the final bento box the vlogger eats to the cars with reserved seating on the train that the vlogger boards, the new percentage of train cars that have reserved seating is 67%." + }, + { + "key": "tBdwetBS1DA:7529c1e714581fa74e5df62dd08b4ab553c519f8", + "video_id": "tBdwetBS1DA", + "question": "If you subtract the number of times the vlogger looks at their phone as hours from the 2nd departure time shown for the \"West Express\" train, what would the new departure time be?", + "answer_choice_0": "16:00.", + "answer_choice_1": "22:00.", + "answer_choice_2": "14:00.", + "answer_choice_3": "13:00.", + "answer_choice_4": "19:00.", + "answer_id": 4, + "answer": "19:00.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, I looked for a departure time for the West Express train and found a clear image of a sign stating that the departure time is 16:00 at 00:55. Next, I noticed the vlogger looked at their phone screen for the first time at 02:55 and counted that as the first instance of them looking at their phone. At 04:53, I saw the vlogger look at their phone again and counted that as the second instance. At 09:36, I counted the third instance of the vlogger looking at their phone. Then, at 13:57, I noted the appearance of a second departure time for the West Express train listed as 22:00. I never observed the vlogger looking at their phone again, making the total number of times they look at their phone 3. I subtracted 3 from 22 and got a new departure time of 19:00 for the West Express train." + }, + { + "key": "tBdwetBS1DA:7fa07288ee9c93835b0a539cf061b3d81d1e86fb", + "video_id": "tBdwetBS1DA", + "question": "How long is the video transition to the first Google Earth image?", + "answer_choice_0": "10 seconds.", + "answer_choice_1": "2 seconds.", + "answer_choice_2": "8 seconds.", + "answer_choice_3": "6 seconds.", + "answer_choice_4": "4 seconds.", + "answer_id": 1, + "answer": "2 seconds.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 00:57, I saw the video transition with a cross-dissolve to a Google Earth image. Since there was no Google Earth image prior to this, this was the first one. The transition to the image ended at 00:59 when the cross-dissolve finished. I then calculated 00:59-00:57=00:02. Therefore, the video transition to the first Google Earth image is 2 seconds long." + }, + { + "key": "tBdwetBS1DA:904541a43945205ef4d94e4ef931bc579257a51b", + "video_id": "tBdwetBS1DA", + "question": "According to the second Google Earth image, if the first charted course was actually plotted in the opposite direction, what would it be?", + "answer_choice_0": "West.", + "answer_choice_1": "Round.", + "answer_choice_2": "East.", + "answer_choice_3": "South.", + "answer_choice_4": "North.", + "answer_id": 2, + "answer": "East.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 00:57, I found a Google Earth image. Since there was no Google Earth image prior to this, this was the first one. Next, I found the second Google Earth image at 01:10. Then, from 01:11-01:12, I saw a dotted line chart a course westward from Kyoto to Izumo. Since there was no charted course on this image prior to this, this was the first course on the second Google Earth image. Because the opposite of west is east, according to the second Google Earth image, if the first charted course was actually plotted in the opposite direction, it would be heading east." + }, + { + "key": "tBdwetBS1DA:c4e50706437713986efe3139b5e58c81f5138b0c", + "video_id": "tBdwetBS1DA", + "question": "What is the sum of all the digits in the code to the vlogger's first private room?", + "answer_choice_0": "8.", + "answer_choice_1": "2.", + "answer_choice_2": "0.", + "answer_choice_3": "4.", + "answer_choice_4": "6.", + "answer_id": 4, + "answer": "6.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 02:23, I found the vlogger outside his private room. Since there was no private room before this, this was the first one. Next, at 02:25-02:28, I saw him input the following code to the room: 0420. At 02:30, the vlogger then opened the door, proving 0420 to be the correct code to the room. I then calculated 0+4+2+0=6. Therefore, the sum of all the digits in the code to the vlogger's first private room is 6." + }, + { + "key": "tBdwetBS1DA:efc30df1b8a32056789038b865499b7a87b4dbe9", + "video_id": "tBdwetBS1DA", + "question": "What is the waist-level water fountain in the train's private bathroom not intended for?", + "answer_choice_0": "Drinking water.", + "answer_choice_1": "Cleaning dishes.", + "answer_choice_2": "Washing hands.", + "answer_choice_3": "Filling bottles.", + "answer_choice_4": "Pet usage.", + "answer_id": 0, + "answer": "Drinking water.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I saw the vlogger tour the train's private bathroom at 08:40. Then, at 09:00, I saw the vlogger rinse their hands at a waist-level water fountain, as if it were a sink. At the same time, I saw a small sign at the top of the fountain, which read \"Not for drink.\" Therefore, the waist-level water fountain in the train's private bathroom is not intended for drinking." + }, + { + "key": "tBdwetBS1DA:f83c187d34f92c241a377e1a209a630f25f07539", + "video_id": "tBdwetBS1DA", + "question": "What is directly to the left of the black phone booth at the station where the train stops in the evening?", + "answer_choice_0": "A red mailbox.", + "answer_choice_1": "A couple of steps.", + "answer_choice_2": "A few white vans.", + "answer_choice_3": "A telephone pole.", + "answer_choice_4": "A display of flowers.", + "answer_id": 4, + "answer": "A display of flowers.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 11:15, I heard and saw the vlogger announce the train had stopped at a station for the evening, with the sun now setting. Then, at 11:25, I found the black phone booth outside the station. At the same time, I noticed it was directly to the right of a display of flowers. Therefore, the display of flowers is directly to the left of the black phone booth at the station where the train stops in the evening." + }, + { + "key": "tVxw8bDV1MI:c4ee6a8bc78a292d1bd88d5cb76e799c9be49402", + "video_id": "tVxw8bDV1MI", + "question": "How many times does the dramaturg appear?", + "answer_choice_0": "5 times", + "answer_choice_1": "6 times", + "answer_choice_2": "8 times", + "answer_choice_3": "2 times", + "answer_choice_4": "4 times", + "answer_id": 1, + "answer": "6 times", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and looked for the dramaturg. I see a woman speaking to a camera for the first time at 01:58, and she is identified via text at 02:00 that reads \"UZMA HAMEED\" and \"Dramaturg\". I continued watching and also saw her appear at 02:32, 02:51, 04:03, 04:06, and 04:11. This totals 6, making that the correct answer." + }, + { + "key": "tVxw8bDV1MI:c71efc3cbf1fefc6cc2e6cd40600630f32d8ce15", + "video_id": "tVxw8bDV1MI", + "question": "What takes place onscreen between [03:26 - 03:27] and how are the dancers positioned?", + "answer_choice_0": "A dancer laces their slippers; Seated.", + "answer_choice_1": "A dancer stretches thier body; Standing.", + "answer_choice_2": "A dancer asks a question; Standing.", + "answer_choice_3": "A dancer looks in a mirror; Standing.", + "answer_choice_4": "A dancer takes a nap; Lying down.", + "answer_id": 0, + "answer": "A dancer laces their slippers; Seated.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I scrolled to the speicifed section of the video at 03:26 and observed that a dancer is lacing their slippers. I also observed that they are seated on the floor. I continued watching until 03:27 to ensure nothing else happened." + }, + { + "key": "u62j1So3Zwo:47e3b0e44e7e46728da4617dbe79ec9c8ba5df0f", + "video_id": "u62j1So3Zwo", + "question": "What color is the second vegetable eaten by the second gorilla to exit the building?", + "answer_choice_0": "Yellow.", + "answer_choice_1": "Orange.", + "answer_choice_2": "Green.", + "answer_choice_3": "Red.", + "answer_choice_4": "White.", + "answer_id": 3, + "answer": "Red.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from the beginning and watched for the first gorilla to exit the building. I observed this occur from 00:03 to 00:07. I then continued watching until the second gorilla exited, which occured at 00:12. I then continued watching to see when it ate its first vegetable, which occured at 00:17. It then ate the second vegetable at 00:22, and I observed that this vegetable was red. Therefore, the answer is red." + }, + { + "key": "u62j1So3Zwo:5e641a2b682d8c0549d95f755020be3c258cb189", + "video_id": "u62j1So3Zwo", + "question": "In the span of 01:40-02:20, what happens to the fourth vegetable that a gorilla picks up with its left hand?", + "answer_choice_0": "It is switched to another hand.", + "answer_choice_1": "It is dropped and rolls away.", + "answer_choice_2": "It is taken by another gorilla.", + "answer_choice_3": "It is promptly eaten.", + "answer_choice_4": "It is given to a larger gorilla.", + "answer_id": 1, + "answer": "It is dropped and rolls away.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the span of the video in question, which largely features gorillas gathering vegetables. During the span, I noted when a vegetable was picked up by a gorilla with its left hand, and counted the number of times this happened to identify the fourth occurrence. The first two left hand pickups occur in quick succession, the first at 02:04, and the second at 02:09, when a female gorilla gathers up chunks of zucchini or cucumber and eats them. The third left hand pickup occurs at 02:13, when the silverback gorilla can be seen picking up a head of lettuce. The fourth pickup can be seen at 02:15, when the female gorilla grabs an intact zucchini-like vegetable on the ground. Since this is the vegetable in question, I watched closely from this point to see what happened to it - I observed that, quickly after the female gorilla picks up the vegetable, she drops it and it rolls across the floor, making this the answer." + }, + { + "key": "u62j1So3Zwo:613db4bad6804c9aa559305324e99686ed9ba3fb", + "video_id": "u62j1So3Zwo", + "question": "Where is the female gorilla at 09:19, compared to the male gorilla?", + "answer_choice_0": "Below him.", + "answer_choice_1": "Behind him.", + "answer_choice_2": "There is no male gorilla.", + "answer_choice_3": "Above him.", + "answer_choice_4": "In front of him.", + "answer_id": 3, + "answer": "Above him.", + "question_type": "Spatial Perception", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and saw a female gorilla on a platform at 9:19. As she sits on the platform, I could see she was on the very top of the structure. I looked at other nearby parts of the video to see if there was a male gorilla nearby. At 09:16, I noticed a male gorilla standing motionless on another platform. When the camera moves off this gorilla to the female, it swings to the left, and zooms in while tilting up. Because the camera must tilt up to see the female gorilla, that means that the female must be above the male." + }, + { + "key": "u62j1So3Zwo:7d8607cc27a77f8ebd1dd18287cde2e2d89c08a3", + "video_id": "u62j1So3Zwo", + "question": "From 01:50 to 02:25, what is the largest vegetable held by the smallest gorilla?", + "answer_choice_0": "Celery.", + "answer_choice_1": "Onion.", + "answer_choice_2": "Tomato.", + "answer_choice_3": "Cucumber.", + "answer_choice_4": "Carrot.", + "answer_id": 3, + "answer": "Cucumber.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 01:50 to 02:15 and observed the small gorilla standing to the left of a large gorilla. I then looked to see which vegetables it holds during this time. From 01:50 to 02:25, I observed it carrying a cucumber. I then observed it eat a smaller vegetable at 02:05. At 2:11, I saw it eat another small vegetable. At 02:15, it grabbed another cucumber, then released it. Until 02:25, I did not observe it gather any more vegetables, instead eating the cucumber in its right hand. This cucumber is the largest vegetable I observed being held by this gorilla. Therefore, the answer is cucumber." + }, + { + "key": "u62j1So3Zwo:82e3c0a3f09cf5cb8fd059fae29b22648241e921", + "video_id": "u62j1So3Zwo", + "question": "What sounds can be heard after an adult ape is seen holding a baby ape?", + "answer_choice_0": "A gorilla munching.", + "answer_choice_1": "Bird calling.", + "answer_choice_2": "Tourists speaking.", + "answer_choice_3": "An ape huffing.", + "answer_choice_4": "An ape screeching.", + "answer_id": 4, + "answer": "An ape screeching.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the adult chimpanzee holding a baby chimpanzee, which occurred from 05:40 to 05:52. I then continued watching as it transitioned to a scene of two gorillas on the platform, and I heard the sound of a gorilla screeching in the background. I also heard birdsong and tourists speaking in the background of the scene, but only after I heard the ape screeching. Therefore, the answer is the sound of an ape screeching." + }, + { + "key": "u62j1So3Zwo:8e6e97273069d653fc5514cf84a5a8cfa601642b", + "video_id": "u62j1So3Zwo", + "question": "What object can be seen through the large glass window when a lone female gorilla passes by it?", + "answer_choice_0": "A cabbage.", + "answer_choice_1": "A zucchini.", + "answer_choice_2": "A rope.", + "answer_choice_3": "A shoe.", + "answer_choice_4": "A broom.", + "answer_id": 4, + "answer": "A broom.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I looked for a female gorilla to pass by a large glass window. This happens from 01:50 to 02:24, but the female gorilla isn't alone. She is accompanied by a large male, so I kept looking. Another lone gorilla passes by from 02:57 to 03:01, but it is a male. Finally, from 04:31 to 04:45, I saw a female gorilla pass by large glass window panes. I looked through 1 of these and at 04:35, I saw a pair of feet. Then I saw a broom being pushed along the floor by the person whose feet are visible. So the answer is a broom." + }, + { + "key": "u62j1So3Zwo:a9003f505d71f10b66664a92c47b06f01757ab56", + "video_id": "u62j1So3Zwo", + "question": "How many green vegetables would be in the gorilla's hand from 3:38-3:50 if 2 cucumbers were added?", + "answer_choice_0": "3.", + "answer_choice_1": "4.", + "answer_choice_2": "5.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "5.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from 03:38 to 03:50 and observed the gorilla holding 4 vegetables in its hand. Of these 4, I counted 3 green vegetables. As cucumbers are also green, I added 2 to the existing total. By adding 3 + 2, I came to a sum of 5. Therefore, the answer is 5." + }, + { + "key": "u62j1So3Zwo:b07eead9dd81254d664389a3b5e4bb550a92f3dc", + "video_id": "u62j1So3Zwo", + "question": "When, in the sequence of gorillas who emerge outdoors from the small opening, does the largest gorilla emerge?", + "answer_choice_0": "Fourth.", + "answer_choice_1": "First.", + "answer_choice_2": "Second.", + "answer_choice_3": "Fifth.", + "answer_choice_4": "Third.", + "answer_id": 0, + "answer": "Fourth.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the beginning of the video, observing the gorillas as they emerged from their indoor habitat through a square hole in the wall. The first gorilla emerged from 00:05-00:08, followed shortly by the second gorilla from 00:11-00:13 - though only the last part of this emergence is captured in the frame. The third gorilla can be seen emerging from 00:16-00:20, and the fourth gorilla can be seen emerging from 00:29-00:33 - this gorilla is significantly larger than the previous gorillas that emerged, and has a silver back, suggesting that it is the dominant male of the group. Therefore, the largest gorilla to emerge does so fourth in the sequence." + }, + { + "key": "u62j1So3Zwo:c99c3eb5f5585d1b5b0dead8ae78e2b7ce6852ce", + "video_id": "u62j1So3Zwo", + "question": "During the third time the silverback gorilla is rushed or chased by one or more female gorillas, where does he ultimately flee?", + "answer_choice_0": "Indoors.", + "answer_choice_1": "Into a hammock.", + "answer_choice_2": "On top of a platform.", + "answer_choice_3": "Behind a bush.", + "answer_choice_4": "Behind a building.", + "answer_id": 4, + "answer": "Behind a building.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched and counted up the number of times that the silverback gorilla is chased or rushed by a female gorilla in the video, noting the timestamps where it happened. The first time the silverback is rushed by a female occurs from 02:36-02:38, when a female defends another female. The second time, the silverback is chased from 06:32-06:40 by multiple females. The third time it occurs, the silverback is chased by multiple females across the exhibit from 06:41-06:51 - this is the shot in question, so I watched it for its duration to find where the silverback flees to while being chased. I observed that he first fled behind a bush, but ultimately emerged from behind the bush and fled behind a building, making behind a building the correct answer." + }, + { + "key": "u62j1So3Zwo:fc3234b3903862a765fc697da7d71edbce986666", + "video_id": "u62j1So3Zwo", + "question": "In the shot after the silverback gorilla is shown standing on top of the tall platform, what is the rightmost gorilla pictured lying on?", + "answer_choice_0": "A bed of grass.", + "answer_choice_1": "A metal platform.", + "answer_choice_2": "A tire.", + "answer_choice_3": "A hammock.", + "answer_choice_4": "A wooden plank.", + "answer_id": 2, + "answer": "A tire.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the time the largest male gorilla is shown standing on the tall platform, which I observed from 08:22 to 09:34. I then continued watching to see two more different gorilllas from 9:24 to 9:48 and looked for the rightmost gorilla beneath the stairs. When I identified this gorilla, I looked to see what it was laying on. I identified this object as a tire, suspended by ropes." + }, + { + "key": "uIU4uoeNxnI:4469c74af99f9ef54dbea11019e82b8c5a398d9d", + "video_id": "uIU4uoeNxnI", + "question": "While the video is discussing Maxewll's equations, what is the fifth image that appears on the left side of the screen?", + "answer_choice_0": "A man flexing with a crossed out eye above him.", + "answer_choice_1": "Maxwell.", + "answer_choice_2": "A man at a chalk board.", + "answer_choice_3": "An equation in a speech bubble.", + "answer_choice_4": "A lightning bolt.", + "answer_id": 4, + "answer": "A lightning bolt.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "While watching the video, I began paying attention for Maxwell's equations to be discussed, which they come up at 07:49. Although he initially appears in the center, I see a doodle of a man representing Maxwell shift to the left side of the screen at 07:52. I see some lightning appear at the left of the screen at 07:55. I notice it slide over but remain on the left, staying the second image. At 07:59 a blue speech bubble with an equation in it appears on the left side of the screen, the third image. At 08:00 a man at a chalk board appears in the center of the screen, but slides to the left side, making it the fourth image. And finally I see a lighting bolt appears in the middle of the screen but slides to the left at 08:07 making a lightning bolt the fifth image to appear on the screen." + }, + { + "key": "uIU4uoeNxnI:780bb29522873972c4361ec6828af97458e4f8bd", + "video_id": "uIU4uoeNxnI", + "question": "Which equation is displayed twice?", + "answer_choice_0": "The Lorentz transformations.", + "answer_choice_1": "Gauss's law for electricity.", + "answer_choice_2": "The second law of thermodynamics.", + "answer_choice_3": "Gauss's law for magnetism.", + "answer_choice_4": "Newton's law of gravity.", + "answer_id": 1, + "answer": "Gauss's law for electricity.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin looking for an equation that is shown twice. At 01:30 I see an equation, but it is not an option from the list. The equation was a simple example of an equation rather than anything specific, x+y=z. At 08:00 I see the same equation come up again, but it is not in the list of options. At 08:04 I see Gauss's law for electricity. The equation is phi=q/episolon_naught. I see the same equation comes up again incorrectly at 08:15 while Gauss's law for magnetism is being discussed. This equation is an option from the list, so I know the correct answer is Gauss's law for electricity." + }, + { + "key": "uIU4uoeNxnI:ae9adcee2c14bb839cf26907ea1bd82e05145db5", + "video_id": "uIU4uoeNxnI", + "question": "A clip board, a Newton's cradle, and charging battery symbol as used in a cell phone are all visual metaphors for different components of which general theory?", + "answer_choice_0": "Eletromagnetism.", + "answer_choice_1": "Relativity.", + "answer_choice_2": "Thermodynamics.", + "answer_choice_3": "Newton's laws of motion.", + "answer_choice_4": "Particle physics.", + "answer_id": 2, + "answer": "Thermodynamics.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for a clip board, a newton's cradle, and a batter symbol to appear all in the same segment. The battery shows up multiple times in the video, but when it appears at 06:54 I notice it is while discussing thermodynamics, and it is the only section with all three of these objects. At 07:08 I see a Newton's cradle and at 06:16 the clipboard appeared, all while discussing thermodynamics." + }, + { + "key": "uIU4uoeNxnI:b441b35097fc58429eaaa9b238da7682236a06bb", + "video_id": "uIU4uoeNxnI", + "question": "When discussing the physical law underpinning the idea of momentum how many graphics slide to the right?", + "answer_choice_0": "7.", + "answer_choice_1": "6.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "6.", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I know the physical law most directly related to momentum is Newton's first law. At 00:08 I see an apple slide to the right. At 00:11 I see a dotted and a red square slide to the right. At 00:21 I saw three apples slide to the right. At 00:40 I saw the earth slide to the right. At 00:48 I saw microscopic regularities shift to the right. At 00:51 I see a yellow wedge with a red ball on it slide to the right. I counted 6 total graphics sliding to the right." + }, + { + "key": "uIU4uoeNxnI:c225835567cd55f798cb27a2ec6152b31e3e0080", + "video_id": "uIU4uoeNxnI", + "question": "What is the product of all the unique integers shown in the video?", + "answer_choice_0": "0.", + "answer_choice_1": "36.", + "answer_choice_2": "285120.", + "answer_choice_3": "7920.", + "answer_choice_4": "47520.", + "answer_id": 4, + "answer": "47520.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video and noticed many numbers. At 00:01, \u201c1st Law of Motion\u201d is shown. At 00:43, \u201c1st Law\u201d is shown again, so it is not unique. At 01:11, \u201c2nd Law of Motion\u201d is shown. At 02:12, \u201cV6\u201d is shown and said out loud. At 02:20, \u201c3rd Law of Motion\u201d is shown. At 03:41, \u201c2\u201d is shown on screen as the distance between 2 squares. However, 2 is not unique. At 04:10, \u201c99%\u201d appears on screen. At 07:24 \u201c3rd LAW\u201d is shown. Now 3 is not a unique number. At 07:26, there is a \u201c0\u201d drawn with the degrees symbol next to it. However, at 07:43, a \u201c0\u201d with ice on it appears, making this number not unique. At 09:31, \u201c80 SPEED\u201d appears on screen. Therefore, the only unique integers in this video are 6, 99, and 80. When multiplied together, we get 6*99*80 = 47520." + }, + { + "key": "uIU4uoeNxnI:f071879a1da9f41236278bf1b9fa3014ae17fe35", + "video_id": "uIU4uoeNxnI", + "question": "While the narrator discusses the law of motion that relates to having a spring in your step, how many apples gold stars or sparkles appear?", + "answer_choice_0": "3", + "answer_choice_1": "7", + "answer_choice_2": "1", + "answer_choice_3": "5", + "answer_choice_4": "9", + "answer_id": 4, + "answer": "9", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I used inherent knowledge to recall that the concept of having a spring in your step is related to actions having an equal and opposite reaction. This was confirmed when the narrator discussed how stepping on the floor produces an equal and opposite reaction that lets you feel a bounce in your step from 02:40-02:53. I read at the top of the screen that this is part of the Third Law of Motion. I then went back to the beginning of the section on the Third Law of Motion, which began at 02:20, to count the appearance of gold stars or sparkles. At 02:46, 2 gold sparkles appeared, remaining present until 02:49. At 03:06, 5 gold stars appeared around a stick figure. They remained present until 03:22. At 03:26, the discussion of the next concept begins, so I stop counting. I counted the total number throughout the section and found a total of 9." + }, + { + "key": "uMfnJ6TJinc:0e1ceab7871c880e7cf3539cac0255b856d65872", + "video_id": "uMfnJ6TJinc", + "question": "What is the sine of the smallest number, in degrees, from the fifth triangle shown in the video, rounded to 3 decimal places?", + "answer_choice_0": "0.841.", + "answer_choice_1": "0.087.", + "answer_choice_2": "0.682.", + "answer_choice_3": "0.866.", + "answer_choice_4": "0.987.", + "answer_id": 1, + "answer": "0.087.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed a lot of shapes. Because we are talking about trigonometric functions, there were lots of triangles. At 01:28, the first triangle is shown. At 02:21, the second triangle is shown. At 02:51, the third triangle is shown. At 03:08, the fourth triangle is shown, but it doesn\u2019t have any numbers attached to it. At 03:57, the fifth triangle is shown. The numbers given here are 5 and 60. The triangles are briefly talked about, but most of the information comes from the images/text on screen. 5 is the smallest number attached to the fifth triangle, so the answer is sin(5) = 0.087, rounded to 3 decimal places." + }, + { + "key": "uMfnJ6TJinc:1e7a16885eb1172efe818cc07ef2e6f2c73306f0", + "video_id": "uMfnJ6TJinc", + "question": "What is the cosine, in radians, of the average side length of the smallest triangle, rounded to three decimal places?", + "answer_choice_0": "0.999.", + "answer_choice_1": "0.799.", + "answer_choice_2": "0.378.", + "answer_choice_3": "-0.007.", + "answer_choice_4": "0.020.", + "answer_id": 2, + "answer": "0.378.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed a lot of shapes. At 01:28, the first triangle is shown, with side lengths 1, 1.732, and 2. These numbers are said out loud. At 02:21, the second triangle is shown. This triangle has side lengths 3, 5.196, and 6. 5.196 and 6 are said out loud, but not 3. At 02:52, another triangle with side lengths 0.75, 1.5, and 1.299 are shown. None of these numbers are said out loud. At 03:08, the fourth triangle is shown, but it doesn\u2019t have any numbers attached to it. At 03:57, the fifth triangle is shown, and the hypotenuse is labeled 5 km. The rest of the triangles are in cm. At 04:58, a sixth triangle is drawn, but it is the same as triangle 1. At 05:28, a seventh triangle is drawn, but it is the same as triangle 2. At 05:32, an eighth triangle is drawn, but it is the same as triangle 3. At 07:42, the ninth triangle is drawn. At 03:08, the fourth triangle is shown, but it doesn\u2019t have any numbers attached to it. At 03:57, the fifth triangle is shown. At 04:58, a sixth triangle is drawn. At 05:28, a seventh triangle is drawn. At 05:32, an eighth triangle is drawn. At 07:42, the ninth triangle is drawn, which is the same as triangle 1 and 6. At 08:13, the tenth triangle is drawn. It doesn\u2019t have any labels, and is instead just labeled with hypotenuse, adjacent, and opposite. The smallest triangle corresponds to triangles 3 and 8, with side lengths 0.75, 1.5, and 1.299. These numbers aren\u2019t said out loud. To find the average, we take those numbers and divide by 3, so (0.75 + 1.5 + 1.299)/3 = 1.183. Then, cos(1.183) = 0.378." + }, + { + "key": "uMfnJ6TJinc:273e0d21fb74216da07c9f71c939da0a1eb82aaf", + "video_id": "uMfnJ6TJinc", + "question": "Using the trigonometric table given in the video, what is the cosine of the sum of the missing angles of the triangles shown at 01:32 and 02:24?", + "answer_choice_0": "0.", + "answer_choice_1": "0.3420.", + "answer_choice_2": "0.1736.", + "answer_choice_3": "0.5.", + "answer_choice_4": "0.2588.", + "answer_id": 3, + "answer": "0.5.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "I found the unlabeled angle of the triangle at 01:32. The two angles labeled are 60 and 90. I used the fact that the sum of the interior angles of a triangle must be equal to 180, so its third angle must be equal to 180 - 90 - 60 = 30. The two labeled angles of the triangle at 02:24 are also 60 and 90, hence the unlabeled side is also 30 degrees. The sum is 30 + 30 = 60 degrees. I watched until I found the trigonometric table 07:03. Using the table, I found that cos(60) = 0.5." + }, + { + "key": "uMfnJ6TJinc:3803b5aad8afa30ec61187429d73b5f27f289c68", + "video_id": "uMfnJ6TJinc", + "question": "Using the trigonometric table given in the video, what is the length of the hypotenuse of a triangle with an adjacent side 3 times longer than the adjacent side of the second triangle in the video, and a 25 degree angle?", + "answer_choice_0": "8.3555.", + "answer_choice_1": "8.1854.", + "answer_choice_2": "8.1228.", + "answer_choice_3": "7.9345.", + "answer_choice_4": "8.1567.", + "answer_id": 4, + "answer": "8.1567.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "First, I looked for the second triangle in the video. The first triangle appears at 01:28 while the second triangle appears at around 02:28. The second triangle has an adjacent side equal to 3. 3 x 3 = 9. To find the missing length of the hypotenuse, I looked for an equation that uses the adjacent side. I found the equation for cosine at 08:13 and I calculated that hypothenuse = cos(25)*9. Using the table at 07:03, I got that hypothenuse = (0.9063)(9) = 8.1567." + }, + { + "key": "uMfnJ6TJinc:63d0d2fea1eb9db469b13ecb7279470885def7f1", + "video_id": "uMfnJ6TJinc", + "question": "What is the tangent, in degrees, of the difference between the number of triangles and the number of circles shown in the video? Round your answer to three decimal places.", + "answer_choice_0": "-0.143.", + "answer_choice_1": "0.123.", + "answer_choice_2": "-2.185.", + "answer_choice_3": "0.105.", + "answer_choice_4": "0.087.", + "answer_id": 3, + "answer": "0.105.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed a lot of shapes. At 00:38, the first circle appears. At 00:57, a second circle appears. At 01:03, a third circle appears. At 01:07, the fourth circle is drawn. The narrator talks about the circles, but doesn\u2019t explicitly count them out loud. At 01:28, the first triangle is shown. At 02:21, the second triangle is shown. At 02:51, the third triangle is shown. At 03:08, the fourth triangle is shown, but it doesn\u2019t have any numbers attached to it. At 03:57, the fifth triangle is shown. At 04:58, a sixth triangle is drawn. At 05:28, a seventh triangle is drawn. At 05:32, an eighth triangle is drawn. At 07:42, the ninth triangle is drawn. At 08:13, the tenth triangle is drawn. It doesn\u2019t have any labels, and is instead just labeled with hypotenuse, adjacent, and opposite. There are a total of 10 triangles and 4 circles. 10 - 4 = 6. The tan(6) in degrees is 0.105." + }, + { + "key": "uMfnJ6TJinc:a0c074ed05e3a821149c469deca1bf6e9ac0cf12", + "video_id": "uMfnJ6TJinc", + "question": "If we take the product of the dimensions of the first circle shown on screen, round to the nearest integer, and look for the row with that value in the fifth column of the table labeled \"Trigonometric Table\", what is the value on that row in the seventh column of that table?", + "answer_choice_0": "0.7771.", + "answer_choice_1": "0.77660.", + "answer_choice_2": "0.64428.", + "answer_choice_3": "0.6293.", + "answer_choice_4": "1.1918.", + "answer_id": 2, + "answer": "0.64428.", + "question_type": "Object Recognition", + "split": "STEM", + "category": "Maths", + "reasoning": "The first circle appears at around 0:52. The product of its dimensions is (4)(12.566) = 50.264. Rounded to the nearest integers gives 50. The table labeled \"Trigonometric Table\" appears at around 07:03. Looking at the table, I found the value of 0.64428 in the 7th column of the same row with the value of 50 in the 5th column." + }, + { + "key": "uMfnJ6TJinc:cf73a032d0deb78218a4d980c9c4ab1e15fc8ea5", + "video_id": "uMfnJ6TJinc", + "question": "Calculate the product of sine and cosine of the third-smallest number in the video in radians, then round the result to 2 decimal places.", + "answer_choice_0": "0.43.", + "answer_choice_1": "0.50.", + "answer_choice_2": "0.99.", + "answer_choice_3": "0.02.", + "answer_choice_4": "0.05.", + "answer_id": 4, + "answer": "0.05.", + "question_type": "Counting", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed many different numbers being used for examples. At 01:05, the smallest number on screen is 3.141. At 01:30, a triangle is shown on screen. It shows the numbers 1, 2, and 1.732. These numbers are said out loud. At 02:17, the number 0.866 is shown and said out loud. At 02:25, another triangle with side lengths 3, 6, 5.196 are shown. 5.196 and 6 are said out loud, but not 3. At 02:52, another triangle with side lengths 0.75, 1.5, and 1.299 are shown. None of these numbers are said out loud. At 05:26, the number 0.5 is shown, but it is said out loud. At 07:00, a trigonometric table is shown. While the degrees are said out loud, the other numbers aren\u2019t. The three smallest numbers shown on the table are 0.0175, 0.0439, and 0.0523. When looking at the smallest numbers listed in the video, we get 0.0175, 0.0439, 0.0523, 0.5, 0.75, 0.866, 1, 1.299, 1.5, 1.732, 2, 3, 3.141, 5.196, 6. Therefore, the third smallest number is 0.0523. Then sin(0.0523) is approximately 0.0522762\u2026 radians, and cos(0.0523) is approximately 0.998632667\u2026 radians. When multiplying these numbers, we get a final, rounded answer of 0.05." + }, + { + "key": "uMfnJ6TJinc:d98e4b274e0140fa33d03f9b4edaa7f08897bc2e", + "video_id": "uMfnJ6TJinc", + "question": "Using the \"Trigonometric Table\" shown in the video, what is the cosine of the similarity ratio of the second triangle over the first triangle shown in the video times 11?", + "answer_choice_0": "0.8234.", + "answer_choice_1": "0.9798.", + "answer_choice_2": "0.8387.", + "answer_choice_3": "0.5764", + "answer_choice_4": "0.3487.", + "answer_id": 2, + "answer": "0.8387.", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "The first triangle appears at around 1:32 while the second triangle appears at around 02:24. Both triangles are similar as they are both 30-60-90 triangles. Hence, the similarity ratio of the two can be computed by taking the ratio of the hypothenuses. The hypothenuse of the second triangle is 6 while the one of the first one is 2. 6/2 = 3. 3 * 11 = 33. cosine(33) = 0.8387 using the table labeled \"Trigonometric Table\" that appears at around 07:03" + }, + { + "key": "uMfnJ6TJinc:fa25aeb6571e36b738bbd7fb7fdab55fddc6017c", + "video_id": "uMfnJ6TJinc", + "question": "Calculate the product of the largest circle\u2019s circumference and the smallest triangle\u2019s area.", + "answer_choice_0": "16.32.", + "answer_choice_1": "12.46.", + "answer_choice_2": "6.12.", + "answer_choice_3": "9.18.", + "answer_choice_4": "10.88.", + "answer_id": 3, + "answer": "9.18.", + "question_type": "Numerical Reasoning", + "split": "STEM", + "category": "Maths", + "reasoning": "I began watching the video and noticed a lot of shapes. At 00:38, the first circle appears. At 00:57, a second circle appears. At 01:03, a third circle appears. At 01:07, the fourth circle is drawn. A number value is not assigned to the fourth circle, so the circle with the largest circumference is the second circle, drawn at 00:57, with a circumference of 18.85. The narrator talks about how dividing the circumference of the circle by the diameter results in 3.141, but he does not explicitly give the values for the circumference. At 01:28, the first triangle is shown. At 02:21, the second triangle is shown. At 02:51, the third triangle is shown. At 03:08, the fourth triangle is shown, but it doesn\u2019t have any numbers attached to it. At 03:57, the fifth triangle is shown. At 04:58, a sixth triangle is drawn. At 05:28, a seventh triangle is drawn. At 05:32, an eighth triangle is drawn. At 07:42, the ninth triangle is drawn. The tenth triangle shown also doesn\u2019t have any numbers attached to it. The formula for the area of a triangle is \u00bd bh. The only units given are for the fifth triangle. Through calculating, we find the triangles with the sides 1.5, 1.299, and 0.75 to have the smallest area, which is 0.487125. This value corresponds to the third triangle and the eighth triangle. To get the answer, we multiple 18.85 by 0.487125 and get 9.18230625." + }, + { + "key": "uMfnJ6TJinc:ffb81fbfb3e9aa3b2a7d2e4d360b234824f1823c", + "video_id": "uMfnJ6TJinc", + "question": "Using the number of plot points shown in the second image of a graph that appears in the video, what is the tangent of that number according to the trigonometric table shown in the video?", + "answer_choice_0": "0.0349", + "answer_choice_1": "0.1763", + "answer_choice_2": "0.0875", + "answer_choice_3": "0.1228", + "answer_choice_4": "0.5774", + "answer_id": 0, + "answer": "0.0349", + "question_type": "Reading", + "split": "STEM", + "category": "Maths", + "reasoning": "First, I looked for the graphs. The first one appears at 04:42 and the second one appears at 05:49. When the second image of a graph appears, it has 2 plot points. I then looked at the trigonometric table that appears on the same page to find tan(2) = 0.0349." + }, + { + "key": "vbUlJr1s7qU:27078b84d852d8f153c1c28a785beae881d12568", + "video_id": "vbUlJr1s7qU", + "question": "Which are the second to last animals presented in the video?", + "answer_choice_0": "Meerkats.", + "answer_choice_1": "Gorillas.", + "answer_choice_2": "African Lions.", + "answer_choice_3": "Secretary Birds.", + "answer_choice_4": "Angolan Colobus Monkeys.", + "answer_id": 4, + "answer": "Angolan Colobus Monkeys.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I located the timestamp where the visitors are leaving the Zoo at 38:03. I then scrolled back to look for the second to last animals presented in the video. I found the last animal introduced at 36:48, which were Meerkats. I scrolled back once again and noticed some black and white monkeys on a branch. I tried to locate the name of this kind of monkey, which I found in on-screen text at 35:34. The second to last animals presented in the video are Angolan Colobus Monkeys." + }, + { + "key": "vbUlJr1s7qU:399351ab334dc5833c20fd4fee44b9ded1d29c57", + "video_id": "vbUlJr1s7qU", + "question": "When the words \"coming up\" are on-screen, what type of animal is shown third?", + "answer_choice_0": "Orangutans.", + "answer_choice_1": "Lions.", + "answer_choice_2": "Gorillas.", + "answer_choice_3": "Giraffes.", + "answer_choice_4": "Hippos.", + "answer_id": 4, + "answer": "Hippos.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the words \"coming up\", which I saw from 00:00 to 01:19. While those words were on-screen, I noted each animal kind that appeared on-screen while watching from 00:00 to 01:19. The orangutans were first, from 00:00-00:15; then the gorillas, from 00:15-00:34; and then the hippos, from 00:34-00:39. Therefore, hippos were the third animal type shown while \"coming up\" was on-screen." + }, + { + "key": "vbUlJr1s7qU:43393d153e14899cf5e13a864d14c5c2b2339f26", + "video_id": "vbUlJr1s7qU", + "question": "How many rocks would be in the \"Africa Rocks\" sign if 3 were subtracted?", + "answer_choice_0": "5.", + "answer_choice_1": "3.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 3, + "answer": "1.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the \"Africa Rocks\" sign, which I observed from 22:13 to 22:23. I then observed 4 rocks stacked on top of each other between the words \"Africa\" and \"Rocks\". I substracted 4-3 and calculated a difference of 1. Therefore, the answer is 1." + }, + { + "key": "vbUlJr1s7qU:5573b5797ab5b1bb467e772b9f5508684c0541f8", + "video_id": "vbUlJr1s7qU", + "question": "Before the vlogger ascends an escalator in the first 5 minutes of the video, what is the ratio of people he sees inside the aquarium tube to people he sees outside the aquarium tube inside Osaka Aqaurium?", + "answer_choice_0": "4:1.", + "answer_choice_1": "3:2.", + "answer_choice_2": "5:3.", + "answer_choice_3": "1:2.", + "answer_choice_4": "7:4.", + "answer_id": 2, + "answer": "5:3.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "First, I identified the location as Osaka Aquarium by reading its name on a banner on screen at 00:08. Next, I observed the vlogger ascend an escalator beginning at 00:49. I then went back and counted the number of people inside the aquarium tube between 00:00-00:24. I saw a man with a phone at 00:04, and a couple with a child behind him. I saw an additional man at 00:07. That totaled 5 people. I continued watching and saw 2 more people visible outside the aquarium tube at 00:25. An additional person became visible at 00:31. Though the vlogger sees many people visible outside the Osaka Aquarium through the window between 00:42-00:45, I did not count them since they are not inside Osaka Aqaurium. I did not observe any more people inside Osaka Aquarium until the vlogger ascended the escalator at 00:49. That makes the total number of people outside the aquarium tube but inside Osaka Aqaurium 3. Therefore, the ratio of people inside the aquarium tube to people outside the aquarium tube inside Osaka Aqarium before the vlogger ascends the escalator is 5:3." + }, + { + "key": "vbUlJr1s7qU:76f6c3ccd06a6afb9a89576adb96036cb6dd8842", + "video_id": "vbUlJr1s7qU", + "question": "What phrase appears immediately below the words, \"Shop with us online from anywhere!\" on the shop front window of the \"Roar Store\"?", + "answer_choice_0": "Wildlife Alliance", + "answer_choice_1": "San Diego Zoo", + "answer_choice_2": "Buy Stuffed Animals", + "answer_choice_3": "Shop Zoo", + "answer_choice_4": "The Kid's Store", + "answer_id": 3, + "answer": "Shop Zoo", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video from the beginning to locate the \"Roar Store\". I found a sign that read \"Roar Store\" at 02:26. At the same time, I saw a woman pushing a stroller walking towards it. In the next scene, which begins at 02:27, the woman walks in front of that same store which I identified by the reflection of the word \"Roar\" on the wall from the glass door and by the color pattern of the wall which was the same as the previous shot. Next, I looked for the phrase, \"Shop with us online from anywhere\" on the shop front window. I found this on the left and identified the words, \"Shop Zoo\" directly below it at 02:32." + }, + { + "key": "vbUlJr1s7qU:94c3a8b4527403915b678f3c010c3d4a35fee6b4", + "video_id": "vbUlJr1s7qU", + "question": "What animal skull is pictured on the sign above the head and to the left of the child wearing the watermelon backpack when the child is hitting the rock?", + "answer_choice_0": "Dodo bird.", + "answer_choice_1": "Sabretooth tiger.", + "answer_choice_2": "T-rex.", + "answer_choice_3": "Giant sloth.", + "answer_choice_4": "Wooly mammoth.", + "answer_id": 4, + "answer": "Wooly mammoth.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the child wearing the watermelon backpack. I first observed this child at 27:41. I then continued watching for the child to hit the rock, which I observed from 27:59 to 28:04. I then looked above the child's head, where I observed two signs. I looked at the sign on the left and looked for an animal skull. When I saw it, I identified it as the skull of a wooly mammoth. Therefore, the answer is wooly mammoth." + }, + { + "key": "vbUlJr1s7qU:a532f2decc41a3b6e058f0653de572f120efc72f", + "video_id": "vbUlJr1s7qU", + "question": "After the vlogger's second time using an escalator, what is the difference between the number of jellyfishes in the second container visited and the number of jellyfishes in the third container visited?", + "answer_choice_0": "4.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 4, + "answer": "5.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I saw that the vlogger used the escalator for the first time at 00:50. I continued watching the video and found that the vlogger used an escalator for the second time at 45:14. I continued watching and found that the vlogger visited the first jellyfish container at 46:02, and then visited the second container at 46:22. I counted 3 jellyfishes in the second container. I then watched as the vlogger visited the third container at 46:44. I counted the number of jellyfishes in the third container and saw 5 of them. The difference between 3 and 5 is 2." + }, + { + "key": "vbUlJr1s7qU:e07435570325a61c67447a6ccfb334430bb8d449", + "video_id": "vbUlJr1s7qU", + "question": "Where is the Kid's Store located in relation to the zoo's exit, if someone enters back to the zoo from the exit?", + "answer_choice_0": "Diagonally across the zoo's exit on the right.", + "answer_choice_1": "Left side corner of the zoo's exit.", + "answer_choice_2": "Diagonally across the zoo's exit on the left.", + "answer_choice_3": "Across the street from the zoo's exit.", + "answer_choice_4": "Right side corner of the zoo's exit.", + "answer_id": 1, + "answer": "Left side corner of the zoo's exit.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video until I saw the Kid's Store at 38:03 -- \"Kid's Store\" is written on the sign above the shop's entrance. The camera pans right and then left to show the rest of the strip mall where the Kid's Store is located. At 38:16, the person holding the camera walks forward, past another store to the person's left, and then finds the exit of the zoo at 38:35 identified by a green sign that reads \"Thank you for visiting the San Diego Zoo\" hanging from the zoo's exit. This means that, if a person reenters the zoo from the exit, the Kid's Store will be located to the left side corner of the zoo's exit." + }, + { + "key": "vbUlJr1s7qU:e9d53830458e5ca3ca26e24a477706b0fcfaa0df", + "video_id": "vbUlJr1s7qU", + "question": "If 4 baboons were added, how many baboons would be in the baboon habitat?", + "answer_choice_0": "10.", + "answer_choice_1": "9.", + "answer_choice_2": "11.", + "answer_choice_3": "12.", + "answer_choice_4": "8.", + "answer_id": 0, + "answer": "10.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Animals", + "reasoning": "I watched the video and looked for the baboons to appear in their habitat. I observed them in their habitat from 22:23 to 24:59. The camera swayed back and forth, so I kept track of each baboon through each pass and made sure I wasn't missing any or counting any twice. Throughout this segment, I counted 6 baboons in total. To imagine that 4 baboons were added, I calculated the sum of 6 + 4 for a total of 10. Therefore, the answer is 10." + }, + { + "key": "vcMxTGsmAS4:0036579e3c754d2b43f22ff3e925de4f49e257e7", + "video_id": "vcMxTGsmAS4", + "question": "What's the difference in price between the non-frozen butterbeer and the Super Star Plaza Berry & Apple Ice Cream?", + "answer_choice_0": "300 yen.", + "answer_choice_1": "200 yen.", + "answer_choice_2": "1100 yen.", + "answer_choice_3": "1000 yen.", + "answer_choice_4": "400 yen.", + "answer_id": 1, + "answer": "200 yen.", + "question_type": "Reading", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First I looked for the price of a non-frozen butterbeer. At 02:55 I saw a menu for Butterbeer which included both a frozen and unfrozen option. Without any commemorative cups, I read that the base level of butterbeer cost 800 yen. Next, I looked for the \"Super Star Plaza Berry & Apple Ice Cream\" and found it under the drinks section of a menu at 19:09. I read that it cost 600 yen. I subtracted 800-600=200. Therefore, the difference in price between the two specified drinks is 200 yen." + }, + { + "key": "vcMxTGsmAS4:08859afd333c4c50fba3a45f68d4b4dc17f862e7", + "video_id": "vcMxTGsmAS4", + "question": "What Pok\u00e9mon character does the vlogger find in their beef stew?", + "answer_choice_0": "Gengar.", + "answer_choice_1": "Morpeko.", + "answer_choice_2": "Pikachu.", + "answer_choice_3": "Mimikyu.", + "answer_choice_4": "Minun.", + "answer_id": 0, + "answer": "Gengar.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and saw the vlogger eating a beef stew at the Studio Stars Restaurant at 10:54. After they cut into the pastry covering the stew at 10:54, they begin to show some of the ingredients. After showing a potato, they find a carrot cut into the shape of Gengar in the stew at 11:55. They remove the carrot Gengar with their fork and then text appears that reads \"The carrot is shaped like Gengar\"." + }, + { + "key": "vcMxTGsmAS4:33d3865971646cb0015d4866bdd13c39a3d064e8", + "video_id": "vcMxTGsmAS4", + "question": "How many desserts did the vlogger eat throughout the day?", + "answer_choice_0": "4.", + "answer_choice_1": "3.", + "answer_choice_2": "6.", + "answer_choice_3": "2.", + "answer_choice_4": "1.", + "answer_id": 0, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching, I looked for the desserts the vlogger ate throughout. At 02:09, the vlogger ate a chocolate-based churro. At 06:07, the vlogger ate a cream soda roll cake. At 14:19, the vlogger took a piece of a round Pumpkaboo pumpkin cake. At 21:18, the vlogger ate the goal pole cake. The vlogger did have a butterbeer drink at 03:08, but he didn't eat it, it was a drink, so I didn't count that. Then, I counted all the moments the vlogger ate a dessert and got 4. Therefore, the vlogger had 4 desserts throughout the day." + }, + { + "key": "vcMxTGsmAS4:4693182f2aac5b5c1ade249438a3a9ed71f90397", + "video_id": "vcMxTGsmAS4", + "question": "What is the difference in price in U.S. dollars between frozen butter beer in a commemorative cup, and the price of the Mimikyu White Cream Burger Cutlet?", + "answer_choice_0": "$27.49.", + "answer_choice_1": "$21.14.", + "answer_choice_2": "$6.13.", + "answer_choice_3": "$10.52.", + "answer_choice_4": "$31.37.", + "answer_id": 1, + "answer": "$21.14.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "At 03:00, I read the subtitles that said that the commemorative cup is $37.50. At 09:55, I read the subtitles that said the price was $16.36 on the Mimkyu Cream Burger, which was also labeled with writing onscreen. Then, to find the difference in the price, I subtracted $16.36 from $37.50 and got $21.14." + }, + { + "key": "vcMxTGsmAS4:48288190c35d764d9b8a14b57d32d83d23156627", + "video_id": "vcMxTGsmAS4", + "question": "Rank the meals from most to least expensive (excluding cost of drinks): (A) Jaws-themed meal, (B) Pokemon-themed meal, (C) Harry Potter-themed Meal", + "answer_choice_0": "C, B, A.", + "answer_choice_1": "B, C, A.", + "answer_choice_2": "A, B, C.", + "answer_choice_3": "B, A, C.", + "answer_choice_4": "A, C, B.", + "answer_id": 1, + "answer": "B, C, A.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "The Jaws-themed meal, consisting of nuggets, fries, and a dessert, costs 650 + 600 = 1250 yen, as shown at 06:00-06:14. The Pokemon-themed meal, shown at 09:46-10:31, consists of 2 entr\u00e9es and a dessert and costs 2400 + 2400 + 950 = 5750 yen, without including the drink. Finally, I saw the Harry Potter-themed meal at around 15:29, and it cost 2400 yen in total. So, the Pokemon-themed meal was the most expensive, followed by the Harry Potter one, followed by the Jaws-themed one. This means the correct order is B, C, A." + }, + { + "key": "vcMxTGsmAS4:8ca7d2f5fc88460a41711d56e722851bd3d93a16", + "video_id": "vcMxTGsmAS4", + "question": "What is the order of entr\u00e9e protein the vlogger ate throughout the day?", + "answer_choice_0": "Beef stew, cutlet burger, shark nuggets, chicken, and pork ribs.", + "answer_choice_1": "Chicken, pork ribs, beef stew, shark nuggets, and cutlet burger.", + "answer_choice_2": "Chicken, pork ribs, beef stew, cutlet burger, and shark nuggets.", + "answer_choice_3": "Shark nuggets, beef stew, cutlet burger, pork ribs, and chicken.", + "answer_choice_4": "Pork ribs, shark nuggets, cutlet burger, beef stew, and chicken.", + "answer_id": 3, + "answer": "Shark nuggets, beef stew, cutlet burger, pork ribs, and chicken.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "First, while watching the video, I examined the food the vlogger showed throughout. I then spotted out the different entr\u00e9es that included protein. The vlogger eats the beef stew at 11:30. At 13:34, the vlogger eats the cutlet burger. At 16:06 the vlogger eats a pork rib. At 20:00, the vlogger eats a piece of chicken. Therefore, the order of entr\u00e9e protein eaten by the vlogger throughout the day is shark nuggets, beef stew, cutlet burger, pork ribs and chicken." + }, + { + "key": "vcMxTGsmAS4:a024ce8bbb84a9d274581e7c4fa6ce735a2d5a90", + "video_id": "vcMxTGsmAS4", + "question": "Place the following items in the order in which they appear: Halloween Hello Kitty; Bowser hat; Minions bucket hat; Red panda shirt.", + "answer_choice_0": "Bowser hat; Red Halloween Hello Kitty; Minions bucket hat; Red panda shirt.", + "answer_choice_1": "Minions bucket hat; Bowser Hat; Halloween Hello Kitty; Red panda shirt.", + "answer_choice_2": "Halloween Hello Kitty; Bowser hat; Minions bucket hat; Red panda shirt.", + "answer_choice_3": "Red panda shirt; Minions bucket hat; Halloween Hello Kitty; Bowser hat.", + "answer_choice_4": "Red panda shirt; Minions bucket hat; Bowser hat; Halloween Hello Kitty.", + "answer_id": 4, + "answer": "Red panda shirt; Minions bucket hat; Bowser hat; Halloween Hello Kitty.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched carefully for each of the specified items. At 01:02, I saw a man wearing a green shirt that had a red panda on the bottom. At 04:43, I saw a fuzzy bucket hat with the yellow face of a Minions character on it and a blue rim that corresponded to their overalls. At 05:14 I saw a woman wearing a hat that resembled the face of the character Bowser. At 14:50, I saw a character actor wearing a Hello Kitty costume that had an orange dress with jack-o-lanterns on it. I determined that this was Halloween Hello Kitty. I watched through the end of the video and did not see these objects appear again. Therefore, I determined that the correct order of appearance was: Red panda shirt, Minions bucket hat, Bowser hat, and Halloween Hello Kitty." + }, + { + "key": "vcMxTGsmAS4:b183f67db5551c5acb8f11fe480ffed9841dd15c", + "video_id": "vcMxTGsmAS4", + "question": "If the vlogger wanted to order Shark Nuggets, at what time would they need to arrive at the restaurant where they're available for it to be 30 minutes before it closed?", + "answer_choice_0": "8:00", + "answer_choice_1": "10:00", + "answer_choice_2": "9:00", + "answer_choice_3": "7:30", + "answer_choice_4": "9:30", + "answer_id": 3, + "answer": "7:30", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video and looked for the Shark Nuggets, to see where they are available to be ordered from. I found them at 05:49, and then they are shown to be \"Shark Nuggets\" through an on-screen caption at 05:57. To determine what restaurant they are from, I went slightly backward, to 05:37, to see that they are from the Amity Landing Restaurant. Then, I looked for its operating hours. These appear on screen in small text from 05:42-05:45, and these are 09:30-20:00. Since 20:00 is 8:00 pm, I went back 30 minutes to determine the time, which would be 7:30. This makes 7:30 the answer." + }, + { + "key": "vcMxTGsmAS4:bb87580528be7d525798d90a3a010b90197afb88", + "video_id": "vcMxTGsmAS4", + "question": "Upon what does the cameraperson spot something that they admit they would like for their house?", + "answer_choice_0": "A gift shop shelf.", + "answer_choice_1": "A kitchen window.", + "answer_choice_2": "A park sign.", + "answer_choice_3": "A bar counter.", + "answer_choice_4": "A food platter.", + "answer_id": 3, + "answer": "A bar counter.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "I watched the video at the point where the vlogger spots a red Coca-Cola machine, which they see in the Pok\u00e9mon Studio Stars Restaurant at 09:33. When they see the machine, I read the text that appears at the bottom of the screen, which reads, \"I want one of these for my house\". I then identified what the Coca-Cola machine was sitting on, which was a bar counter in the Pok\u00e9mon Studio Stars Restaurant." + }, + { + "key": "vcMxTGsmAS4:c5fa47fcd9d5338f8e8f5f04816e5e3be3d8b0ec", + "video_id": "vcMxTGsmAS4", + "question": "What is the total cost of the vlogger's last meal?", + "answer_choice_0": "\u00a55600.", + "answer_choice_1": "\u00a55300.", + "answer_choice_2": "\u00a52400.", + "answer_choice_3": "\u00a53040.", + "answer_choice_4": "\u00a54600.", + "answer_id": 4, + "answer": "\u00a54600.", + "question_type": "Situational Awareness", + "split": "VLOG Style", + "category": "Travel", + "reasoning": "While watching, I saw the vlogger present a meal at 19:34. As I kept watching, I noticed that this was their last meal of the day because there was no other time they ate in the video. Then, I watched the moment before at 19:08 and noticed a menu. I read the menu and looked for the food items the vlogger had at 19:34. For the chicken and rice, the cost was \u00a52400. Then, I looked over and noticed the dessert was \u00a5950. The mushroom soup was \u00a5900 and the drink was \u00a5350. Then I added all the items up and got \u00a54600. Therefore, the total cost of the vlogger's last meal is \u00a54600." + }, + { + "key": "vkHs_rKdloc:0df795992d4f043bfd95e2945fae196666c6c7fc", + "video_id": "vkHs_rKdloc", + "question": "During the first 2 graphics of 3 animated dogs, what is the mathematical difference between the total amount of sitting and standing dogs?", + "answer_choice_0": "3", + "answer_choice_1": "0", + "answer_choice_2": "1", + "answer_choice_3": "2", + "answer_choice_4": "4", + "answer_id": 1, + "answer": "0", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found the first graphic of 3 animated dogs at 00:46. At the same time, I counted 1 sitting dog and 1 standing dog. The third dog is lying down, so I don't include that dog in the equation. Next, I found the second graphic of 3 animated dogs at 01:55. At the same time, I counted 1 sitting dog and 1 standing dog. Again, the third dog is lying down, so I don't include that dog in the equation. I then calculated the total number of sitting dogs, 1+1=2. Then, I calculated the total number of standing dogs, 1+1=2. The difference between the total amount of sitting and standing dogs during the first 2 graphics of 3 animated dogs is 2-2=0." + }, + { + "key": "vkHs_rKdloc:3a42d56a6baccff1a66738ad58ecbb2b43277c03", + "video_id": "vkHs_rKdloc", + "question": "What object acts as a bridge for the third animated dog in the \"Shaping by Bridging\" training?", + "answer_choice_0": "A coffee table.", + "answer_choice_1": "A person's legs.", + "answer_choice_2": "A wooden stool.", + "answer_choice_3": "A cushioned chair.", + "answer_choice_4": "A bent knee.", + "answer_id": 0, + "answer": "A coffee table.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found the \"Shaping by Bridging\" training by reading the text that appears on-screen at 04:20. Next, I saw the first animated dog at 04:32. Then, I saw the second animated dog at 04:35. Then, I saw the third animated dog at 04:38. At the same time, I observed the dog to be under a small black coffee table, which then acts as a bridge over the dog. Therefore, the object that acts as a bridge for the third animated dog in the \"Shaping by Bridging\" training is a coffee table." + }, + { + "key": "vkHs_rKdloc:47551f8876cd881a242273ed2e377a493d142cb4", + "video_id": "vkHs_rKdloc", + "question": "On what piece of furniture does the host sit when in an enclosed enviroment with a dog?", + "answer_choice_0": "Stool.", + "answer_choice_1": "Toilet.", + "answer_choice_2": "Floor.", + "answer_choice_3": "Table.", + "answer_choice_4": "Couch.", + "answer_id": 1, + "answer": "Toilet.", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched as the host of the dog video appeared on-screen. At 00:20, I noticed the host stood sporting an external lav microphone hidden in his clothing. Wearing a black shirt, which camouflaged his sound device, I noticed the black microphone attached to his shirt collar. At 01:56, I watched the host reappeared back in the studio, remaining standing. However, at 03:37, the host opened the door to the bathroom and entered the home's facilities. At 03:44, I noticed that the host took a seat in the corner of the bathroom beside the sink but not on top of the countertop. Rather, at 03:50, I watched as the host smiled wide and made eye contact with the dog from a seated position. I continued to watch as his lower half remained out of frame but his back was positioned against the vertical back of the porcelain throne. Thereby, I inferred that the host was seated on the toilet." + }, + { + "key": "vkHs_rKdloc:5a5a158abf1fa344902d23ab670f80ac7ff377ac", + "video_id": "vkHs_rKdloc", + "question": "How many times did the white dog lay down if you were to add one additional time?", + "answer_choice_0": "3.", + "answer_choice_1": "5.", + "answer_choice_2": "4.", + "answer_choice_3": "1.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the white dog lay down upon its trainer's command at 01:31. From 01:36-01:37, I watched the dog return to its standing position on all four paws. Once again, I witnessed the trainer give the dog a command with a treat, placing the treat on the ground at 01:40. As a result, I saw the dog return to resting position on all fours. I watched this process repeat for a final third time between 01:46-01:49. I deduced that if you were to add another 'down' command using a treat as a form of bribery, the white dog would lie down for a total of 4 times." + }, + { + "key": "vkHs_rKdloc:65e84c57a1303a02143c088656a7f7cfab942248", + "video_id": "vkHs_rKdloc", + "question": "Which of the 5 training sections has the most words in its title?", + "answer_choice_0": "The third.", + "answer_choice_1": "The second.", + "answer_choice_2": "The fifth.", + "answer_choice_3": "The fourth.", + "answer_choice_4": "The first.", + "answer_id": 3, + "answer": "The fourth.", + "question_type": "Event Occurence", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found the first training section title at 01:13, which read \"1. Lure Reward Training\". I then counted the number of words in this title, calculating a total of 3. Next, I found the second training section title at 02:05, which read \"2. Building from a Bow\". I then counted the number of words in this title, calculating a total of 4. Then, I found the third training section title at 02:48, which read \"3. Shaping from the Neck\". I then counted the number of words in this title, calculating a total of 4. Then, I found the fourth training section title at 03:25, which read \"4. All-or-None Reward Training (a.k.a. \"The Bathroom Down\")\". I then counted the number of words in this title, calculating a total of 8. Then, I found the fifth training section title at 04:21, which read \"5. Shaping by Bridging\". I then counted the number of words in this title, calculating a total of 3. Since the training section title \"4. All-or-None Reward Training (a.k.a. \"The Bathroom Down\")\" contains a total of 8 words, which is the highest number of words out of all 5 training section titles, the fourth title is therefore the one that has the most words." + }, + { + "key": "vkHs_rKdloc:6d86120ca87e3809a8bf99be5b5422cd0b3f9a72", + "video_id": "vkHs_rKdloc", + "question": "From 05:37-06:04 to the end of the video, how many words are circled in the graphics?", + "answer_choice_0": "1.", + "answer_choice_1": "4.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "5.", + "answer_id": 1, + "answer": "4.", + "question_type": "Counting", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First, I watched a green line encircle the lower case word \"cause\" at 05:48. Next, I watched a green line encircle the capitalized word \"after\" at 05:54. Then, I saw that the font coloring had changed from green to red, flashing the warning signs \"error\" at the top and bottom of the screen. The words were encircled by a red line from 05:58-05:59. Hence, 4 words were circled in graphics." + }, + { + "key": "vkHs_rKdloc:a4f412f9958f793ab4b806deba0465b9a9eb8e2a", + "video_id": "vkHs_rKdloc", + "question": "What is the mathematical difference between the number of unique dog breeds shown as animations versus the number of unique dog breeds shown in live-action, if you multiplied both counts by two?", + "answer_choice_0": "8", + "answer_choice_1": "6", + "answer_choice_2": "2", + "answer_choice_3": "4", + "answer_choice_4": "0", + "answer_id": 4, + "answer": "0", + "question_type": "Object Recognition", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "First I watched the video and counted all of the unique dog breeds shown as animations. From 00:43-00:50 I saw 3 depictions of an animated German Shepherd, counting it as the first unique dog breed shown as an animation. From 01:50-01:56 and 02:13-02:46, I saw more depictions of animated German Shepherds, but that breed was already counted. From 04:30-04:33, I saw an animated Rottweiler, and counted it as the second breed shown animated. From 04:34-04:38, I saw a Jack Russell Terrier shown animated and counted it as the third animated breed. From 04:38-04:49, I saw an animated Great Dane and counted it as the fourth animated breed. I also saw an animated Great Dane at 05:35 but did not count it since that breed had already been counted. Watching through the end of the video, I confirmed that no more dog breeds appeared animated. In total, I counted 4 different dog breeds that were shown animated. I multiplied this count by 2: 4*2=8. Then I watched the video and counted all of the unique dog breeds shown in live-action. From 01:28-01:50, I saw live-action footage of a Pyredoodle, counting it as the first unique breed shown in live-action. From 02:56-03:22, I saw live-action footage of a German Shepherd, and I counted this as the second live-action breed. From 03:37-03:50, I saw live-action footage of a Boston Terrier, and I counted this as the third live-action breed. A live-action Boston Terrier also appeared from 03:53-04:19, from 04:51-05:07, and from 05:22-05:25, but I did not add these occurrences to the count. From 05:29-05:34, I saw a live-action Great Dane, and counted this as the fourth breed shown in live-action. Watching through the end of the video, I confirmed that no more dog breeds appeared live-action. In total, I counted 4 different dog breeds that were shown in live-action. I multiplied this count by 2: 4*2=8. I subtracted twice the number of unique breeds shown animated from twice the number of unique breeds shown in live-action: 8-8=0. Therefore, the difference is 0." + }, + { + "key": "vkHs_rKdloc:e63289458902cae9c7c0da4a518297f6bc5c59ae", + "video_id": "vkHs_rKdloc", + "question": "If you were to add a ring to each of the host's hands, how many rings would he be wearing in total?", + "answer_choice_0": "8.", + "answer_choice_1": "10.", + "answer_choice_2": "6.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "6.", + "question_type": "Numerical Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I watched the host speak directly into the camera as he gesticulated with his hands from 01:00-01:10. Furthermore, I saw that he had two rings on each respective hand, thereby making the total number of rings 4. However, if one were to add a ring to each hand, that would make an additional 2 rings. Therefore, that would bring the total number of rings to 6." + }, + { + "key": "vkHs_rKdloc:ffe3d8cd01ac9adf3733346446a587958aaefca3", + "video_id": "vkHs_rKdloc", + "question": "If the dog in the first training section was given twice the amount of treats, how many more treats would the dog have eaten compared to the dog in the third training section?", + "answer_choice_0": "0.", + "answer_choice_1": "2.", + "answer_choice_2": "6.", + "answer_choice_3": "8.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Temporal Reasoning", + "split": "VLOG Style", + "category": "How-To", + "reasoning": "I found the first training section at 01:13-02:02. During that time, I saw a dog eat 3 treats. Next, I found the third training section at 02:48-03:22. During that time, I saw another dog eat 2 treats. I then doubled the amount of treats the dog in the first training section ate by calculating 3*2=6. Then, I calculated 6-2=4. Therefore, if the dog in the first training section was given twice the amount of treats, the dog would have eaten 4 more treats than the dog in the third training section." + }, + { + "key": "vw8viezKTp8:2658d0fe472a2d04afeb54cb95a6dfd03b5aa4f4", + "video_id": "vw8viezKTp8", + "question": "Which of the three characters on the rooftop spoke the fewest number of times?", + "answer_choice_0": "None of them spoke.", + "answer_choice_1": "The black-haired man.", + "answer_choice_2": "The blonde-haired woman.", + "answer_choice_3": "The brown-haired man.", + "answer_choice_4": "They spoke the same amount.", + "answer_id": 1, + "answer": "The black-haired man.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "First, I identified the three characters on the rooftop during the scene at 01:03-03:09. Then, I listened and counted the number of times each of them spoke, starting at 01:03. At 01:28-01:32, I heard the blonde-haired woman speak for the first time. Then, at 01:32-02:08, I heard the brown-haired man speak for the first time. Then, at 02:08-02:13, I heard the blonde-haired woman speak for the second time. Then, at 02:13-02:24, I heard the brown-haired man speak for the second time. Then, at 02:24-02:38, I heard the black-haired man speak for the first time. Then, at 02:38-02:43, I heard the blonde-haired woman speak for the third time. Then, at 02:43-03:09, I heard the brown-haired man speak for the third time. Then, at 03:09, the video cuts away from the scene, indicating the end of it. Since the brown-haired man spoke a total of 3 times, the blonde-haired woman also spoke a total of 3 times, and the black-haired man only spoke a total of 1 time, the black-haired man therefore spoke the least number of times out of all the characters on the rooftop." + }, + { + "key": "vw8viezKTp8:502a6a64aefb6719ce61851b2690affe670bdc67", + "video_id": "vw8viezKTp8", + "question": "How many times does a cellphone appear after the conversation on the rooftop?", + "answer_choice_0": "7.", + "answer_choice_1": "5.", + "answer_choice_2": "2.", + "answer_choice_3": "1.", + "answer_choice_4": "3.", + "answer_id": 2, + "answer": "2.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until after the conversation on the rooftop at 03:09. I then watched the video until 03:34 when the man took a cellphone out of his pocket. This is the first time that a cellphone has appeared. The cellphone appeared again at 03:46. I watched the rest of the video and did not see another cellphone, making the total number of times a cellphone appears to be 2." + }, + { + "key": "vw8viezKTp8:95d57fdc33bfe34b8180aa7a115dc06eeaf21c12", + "video_id": "vw8viezKTp8", + "question": "Where is the old man with glasses standing when he pulls out his cellphone?", + "answer_choice_0": "On a rooftop ledge overlooking the skyline.", + "answer_choice_1": "On a pier overlooking the ocean.", + "answer_choice_2": "In his penthouse office with city views.", + "answer_choice_3": "Under a gazebo beside a body of water.", + "answer_choice_4": "Inside of a spacious limousine driving in a city.", + "answer_id": 3, + "answer": "Under a gazebo beside a body of water.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I searched in the video for a shot of an old man with glasses. I found him at 00:53, when the old man was walking down a hallway with a suitcase and wearing a suit. I kept looking and found a shot of the old man as he walked towards a gazebo with a glass roof overlooking a body of water at 03:22. At 03:29 he puts the suitcase down, and at 03:35 the man pulls out a cellphone from the inside pocket of his blazer. He is still standing under the gazebo, in front of a railing overlooking a body of water." + }, + { + "key": "vw8viezKTp8:aa5cd5a0d9bc4d92d6adf988f9f6577069a72133", + "video_id": "vw8viezKTp8", + "question": "What is the setting where the three characters have a conversation?", + "answer_choice_0": "A basement.", + "answer_choice_1": "An attic.", + "answer_choice_2": "A sidewalk.", + "answer_choice_3": "An office.", + "answer_choice_4": "A rooftop.", + "answer_id": 4, + "answer": "A rooftop.", + "question_type": "Temporal Reasoning", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video between 01:03 and 3:09 which was the only part of the video that contained a scene with a conversation instead of narration. I determined that the setting was a rooftop during that span." + }, + { + "key": "vw8viezKTp8:b180d29c72db0a68a1c863df3986d2b432d1ab88", + "video_id": "vw8viezKTp8", + "question": "How many people come out from the building to sit at the rooftop?", + "answer_choice_0": "3.", + "answer_choice_1": "2.", + "answer_choice_2": "1.", + "answer_choice_3": "5.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "3.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked at the segment starting at 01:03, which is the moment where a wooden door leading to the rooftop opens. The first person comes out at 01:04, the second person at 01:06, and the third and final person comes out to the rooftop at 01:11." + }, + { + "key": "vw8viezKTp8:d22ee1e7f731106f774ff88f5461603bda233cf8", + "video_id": "vw8viezKTp8", + "question": "In what direction did the camera move from 01:32-01:35?", + "answer_choice_0": "Down.", + "answer_choice_1": "Left.", + "answer_choice_2": "The camera is stationary.", + "answer_choice_3": "Right.", + "answer_choice_4": "Up.", + "answer_id": 3, + "answer": "Right.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "From 01:32-01:35, I saw everything move leftward across the frame, with some surroundings moving off-screen towards the left side of the frame and more surroundings moving on-screen from the right side of the frame. Because these spatial movements are in relation to the camera's movements, the camera is therefore moving toward the right." + }, + { + "key": "vw8viezKTp8:f1c7f7c8f0220c32f929110b8d01043f263c91af", + "video_id": "vw8viezKTp8", + "question": "What shot type was the last shot of the video?", + "answer_choice_0": "Wide.", + "answer_choice_1": "Extreme Wide.", + "answer_choice_2": "Close-up.", + "answer_choice_3": "Medium.", + "answer_choice_4": "Extreme Close-up.", + "answer_id": 0, + "answer": "Wide.", + "question_type": "Spatial Perception", + "split": "Short Films", + "category": "Short Films", + "reasoning": "At 04:10, the video cut to a shot of the three characters. Because their full body heights are large enough to be completely visible on-screen but smaller than the shot frame's full height, this is a wide shot, which plays from 04:10 - 04:20 before cutting to the credits, implying this wide shot is the last shot of the video." + }, + { + "key": "vw8viezKTp8:f5c46fc6f5e2d22c6341a23b798ee2a22e3f2145", + "video_id": "vw8viezKTp8", + "question": "What object does the older man set down before looking out at the water?", + "answer_choice_0": "His cellphone.", + "answer_choice_1": "His glasses.", + "answer_choice_2": "His briefcase.", + "answer_choice_3": "His book.", + "answer_choice_4": "His umbrella.", + "answer_id": 2, + "answer": "His briefcase.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video until 03:29 when I noticed an older man set his briefcase down. I then continued to watch that video until he looked out at the water for the first time at 03:31." + }, + { + "key": "wLOD-wbRJNs:109a4baa8fb3e1d826fe4f20cad76db375443cf7", + "video_id": "wLOD-wbRJNs", + "question": "What is the main logo on the third place driver's shirt that is plastered across the upper part of his torso?", + "answer_choice_0": "Monster.", + "answer_choice_1": "Nos.", + "answer_choice_2": "Feal.", + "answer_choice_3": "Simpson.", + "answer_choice_4": "Ford.", + "answer_id": 2, + "answer": "Feal.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video and waited until all the races were over. Then, at 07:12, I heard an announcer say that racers were \"stepping out of their vehicles\". Then, at 07:13, I heard the announcer say \"third place\". I listened as the announcer named the third place winner from 07:23-07:24. At 07:23, the camera showed one man. And from 07:24-07:29, that man raised his hand and waved. I determined that this was the third place winner. I observed the upper part of his torso and saw a large logo that read \"Feal\"." + }, + { + "key": "wLOD-wbRJNs:226e99b1787d4e0af5567641e78b5ec43f34ad75", + "video_id": "wLOD-wbRJNs", + "question": "What happens to the orange, red, and white car at 00:17?", + "answer_choice_0": "It drifts into the grass.", + "answer_choice_1": "It crashes and flips over.", + "answer_choice_2": "It collides with another car.", + "answer_choice_3": "Its wheels catch on fire.", + "answer_choice_4": "It drifts across the finish line.", + "answer_id": 0, + "answer": "It drifts into the grass.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the orange, red, and white car at 00:17. At the same time, I saw the car drift and skid off the track, with its back wheels skidding away and into the grass. Part of its front wheel also drifted into the grass. I observed that as it drifted, the car kicked up dirt and mud everywhere from the terrain. Therefore, at 00:17, the orange, red, and white car drifted into the grass." + }, + { + "key": "wLOD-wbRJNs:3975aed6c59fea790bb1eec3d4141681edae4ff9", + "video_id": "wLOD-wbRJNs", + "question": "What order are the colored signs the Rain-x car passes after its first turn?", + "answer_choice_0": "Red, black, white, blue, blue.", + "answer_choice_1": "Yellow, red, blue, green, white.", + "answer_choice_2": "Red, green, yellow, blue, black.", + "answer_choice_3": "White, yellow, green, black, blue.", + "answer_choice_4": "Blue, red, white, black, blue.", + "answer_id": 0, + "answer": "Red, black, white, blue, blue.", + "question_type": "Object Recognition", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video and looked for the Rain-x car. At 03:42, I saw a yellow car with blue text on the driver-side door that read \"Rain-x\". I also heard the announcer say \"Rain-x\" at 03:43, so I determined that this was the Rain-x car. I observed the Rain-x car drift around its first corner from 03:45-03:47. At 03:47, I observed several large signs in the background along the length of the track. I noted the predominant color of each sign starting from the left as red, black, white, blue, and blue." + }, + { + "key": "wLOD-wbRJNs:461558e3390683f99652139d9377dadcd9502869", + "video_id": "wLOD-wbRJNs", + "question": "How many more white words are there than blue words at 00:02?", + "answer_choice_0": "5.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "1.", + "answer_choice_4": "4.", + "answer_id": 0, + "answer": "5.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the white words and the blue words at 00:02. Next, I read and counted all the white words, which read \"RD2: Atlanta, GA | Road to the Championship Highlights\", calculating a total of 8 words. Then, I read and counted all the blue words, which read \"Touring Items Types\", calculating a total of 3 words. Then, I calculated 8-3=5. Therefore, there are 5 more white words than blue words at 00:02." + }, + { + "key": "wLOD-wbRJNs:bb15203d5a972623b9f85042f64a5cbeb6008d4c", + "video_id": "wLOD-wbRJNs", + "question": "What direction do the cars drift at 00:05-00:07?", + "answer_choice_0": "Into the background in the screen's top left corner.", + "answer_choice_1": "Into the foreground in the screen's bottom right corner.", + "answer_choice_2": "Into the foreground in the screen's top right corner.", + "answer_choice_3": "Into the background in the screen's bottom right corner.", + "answer_choice_4": "Into the background in the screen's bottom left corner.", + "answer_id": 1, + "answer": "Into the foreground in the screen's bottom right corner.", + "question_type": "Temporal Reasoning", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the cars drifting at 00:05-00:07. At the same time, I saw the cars' surroundings move towards the background (away from the camera) in the top left corner of the screen in relation to the camera's and cars' movement. By contrast, the cars were therefore drifting towards the foreground (towards the camera) in the bottom right corner of the screen." + }, + { + "key": "wLOD-wbRJNs:d0e8b5bf7b0da7877478e2ff728a6016d7eb6f63", + "video_id": "wLOD-wbRJNs", + "question": "What does the thirteenth sign from the back on the left of the track say?", + "answer_choice_0": "ProSpec.", + "answer_choice_1": "Torque.", + "answer_choice_2": "Chevy.", + "answer_choice_3": "Monster.", + "answer_choice_4": "Ford.", + "answer_id": 1, + "answer": "Torque.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "At 00:05 I observed that there were several signs on both sides of the racetrack, but I could not see how many there were. As the race progressed, I saw that the cars drifted around one curve at 00:08, completed a loop from 00:14-00:23, and then returned to the first curve from 00:28-00:30. At 02:45, I had a clear view of the signs on the left and right sides of the track. I started from the very back sign, the one furthest away from the camera, and counted until the thirteenth sign. I observed that the sign had a white background and read the word \"Torque\" on it. Therefore, the thirteenth sign from the back on the left side of the track reads: Torque." + }, + { + "key": "wLOD-wbRJNs:fa14f6b9c768946e360230a6db67cc4679a5ac55", + "video_id": "wLOD-wbRJNs", + "question": "What is the weather like when the announcer first mentions \"tire particulates\"?", + "answer_choice_0": "Rainy.", + "answer_choice_1": "Sunny.", + "answer_choice_2": "Snowy.", + "answer_choice_3": "Windy.", + "answer_choice_4": "Overcast.", + "answer_id": 4, + "answer": "Overcast.", + "question_type": "Situational Awareness", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I watched the video and listened for the announcer to comment on the \"tire particulates\". I heard this phrase from 00:32-00:33. I observed the sky and noticed lots of gray, puffy clouds. I did not see any signs of rain. I determined that this constituted overcast conditions." + }, + { + "key": "wLOD-wbRJNs:faa32b18cd77f68982ff419fd432432599e7d01a", + "video_id": "wLOD-wbRJNs", + "question": "How long were the blue and white car's tires on fire during the first racing replay?", + "answer_choice_0": "7 seconds.", + "answer_choice_1": "6 seconds.", + "answer_choice_2": "4 seconds.", + "answer_choice_3": "5 seconds.", + "answer_choice_4": "3 seconds.", + "answer_id": 4, + "answer": "3 seconds.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Motorsports", + "reasoning": "I found the blue and white car in the first racing replay at 00:05. Then, at 00:18, I saw its tires catch on fire. From 00:18-00:21, I watched the tires flicker with flames before extinguishing themselves at 00:21. Since the fire started at 00:18 and stopped at 00:21, I calculated the duration within that time frame, resulting in a total of 3 seconds. Therefore, the blue and white car's tires were on fire for 3 seconds during the first replay." + }, + { + "key": "wWWY6nsYNnA:0bb4575433f8963753d7c7d3e072732ab36e9391", + "video_id": "wWWY6nsYNnA", + "question": "How many spectators are watching the match when the narrator says \"There you have it, guys\"?", + "answer_choice_0": "5.", + "answer_choice_1": "4.", + "answer_choice_2": "1.", + "answer_choice_3": "2.", + "answer_choice_4": "3.", + "answer_id": 3, + "answer": "2.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I heard the voiceover narrator say \"There you have it, guys\" at 04:11 - 04:13. At the same time, I looked at the spectators around the court, counting each one. I saw 2 people sitting at a park table to the right of the court, watching the match. I did not see any other spectators watching the match. Therefore, there are 2 spectators watching the match when the narrator says \"There you have it, guys\"." + }, + { + "key": "wWWY6nsYNnA:1adfef12254813058fdd90649228a520cd1776d9", + "video_id": "wWWY6nsYNnA", + "question": "What would the score have been if the player from team S/J had hit the ball into the net at 06:07?", + "answer_choice_0": "S/J 0; T/V 15.", + "answer_choice_1": "T/V 30; S/J 0.", + "answer_choice_2": "T/V 30; S/J 15.", + "answer_choice_3": "T/V 15; S/J 15.", + "answer_choice_4": "T/V 40; S/J 0.", + "answer_id": 2, + "answer": "T/V 30; S/J 15.", + "question_type": "Counterfactual", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 06:07, I saw a player successfully return a ball to the opposing team. I then saw the opposing team hit the ball out of bounds. I looked at the scoreboard and saw that the points went to team S/J after the ball went out at 06:10. I then identified the team that hit the ball out of bounds as team T/V and the team that scored the points as team S/J, by reading their names on the scoreboard. Therefore, if the player from team S/J had hit the ball into the net instead of successfully returning it to team T/V, the points would have gone to team T/V, making the score T/V 30 and S/J 15." + }, + { + "key": "wWWY6nsYNnA:2c686abf01e522961cf32d87863af6e65a1da1b7", + "video_id": "wWWY6nsYNnA", + "question": "In which direction does the player in black walk after the first point of the ninth game is scored?", + "answer_choice_0": "Towards the net and right.", + "answer_choice_1": "Towards the net and left.", + "answer_choice_2": "Towards the net and straight.", + "answer_choice_3": "Away from the net and left.", + "answer_choice_4": "Away from the net and right.", + "answer_id": 4, + "answer": "Away from the net and right.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 09:17, I noticed that an additional column was added to the scoreboard to keep track of how many games each team had won. I looked at the numbers of the games that had been won in those 2 columns and saw a 6, a 1, and a 1. I added those numbers together and got 8. I concluded that since 8 games have already been played, this must be the start of the ninth game. I watched until the first point of that game was scored at 09:23. I then observed the player in black walk away from the net and to the right. Therefore, after the first point of the ninth game is scored, the player in black walks away from the net and right." + }, + { + "key": "wWWY6nsYNnA:32179adc160f631970c367babe55e8d8218faae0", + "video_id": "wWWY6nsYNnA", + "question": "How many MPH is the first serve after the scoreboard appears?", + "answer_choice_0": "69 MPH.", + "answer_choice_1": "72 MPH.", + "answer_choice_2": "67 MPH.", + "answer_choice_3": "70 MPH.", + "answer_choice_4": "79 MPH.", + "answer_id": 0, + "answer": "69 MPH.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I saw the scoreboard appear at 00:40. I then watched the player in the lower right corner perform the first serve of the match. I looked at the black rectangular graphic in the top right corner of the screen, which indicates the ball's speed, reading \"69 MPH\". Therefore, after the scoreboard appears, the first serve is 69 MPH." + }, + { + "key": "wWWY6nsYNnA:5154d9dd2756195b8f65482eb1c23aaa6ec4b3a6", + "video_id": "wWWY6nsYNnA", + "question": "What series of events happen to make the score 30-15 during the 3rd game?", + "answer_choice_0": "S/J returns, then T/V hits the ball into the net.", + "answer_choice_1": "S/J serves, then T/V hits the ball into the net.", + "answer_choice_2": "T/V returns, then S/J misses their return.", + "answer_choice_3": "T/V serves, then S/J hits the ball into the net.", + "answer_choice_4": "S/J returns, then T/V misses their return.", + "answer_id": 3, + "answer": "T/V serves, then S/J hits the ball into the net.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I looked at the scoreboard to identify the start of the third game, in addition to the teams T/V and S/J. At 02:35, I saw the score in the middle column of the board in the top left corner of the screen reset to \"0\". I also saw the numbers \"0\" and \"2\" in the rightmost column that keeps track of how many games have been won by each team. I determined that since a total of 2 games have already been won, this is the moment that begins the third game. I then found the score \"30-15\" on the scoreboard at 02:52. Before that, at 02:48, I saw T/V serve, then team S/J hit the ball into the net at 02:52, making the score 30-15 between T/V and S/J respectively. Therefore, the series of events that happen to make the score 30-15 during the third game is T/V serves, then S/J hits the ball into the net." + }, + { + "key": "wWWY6nsYNnA:6850a0fb071df76a7adf86466198065a80392037", + "video_id": "wWWY6nsYNnA", + "question": "What words appear on top of the leftmost player at 00:09 - 00:12?", + "answer_choice_0": "Mike, 5.0, On a good day.", + "answer_choice_1": "Jason, 4.5, On a bad day.", + "answer_choice_2": "Mike, 4.5, On a good day.", + "answer_choice_3": "Jared, 4.5, On a bad day.", + "answer_choice_4": "Jason, 4.5, On a good day.", + "answer_id": 4, + "answer": "Jason, 4.5, On a good day.", + "question_type": "Reading", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the leftmost player on-screen at 00:09, near the bottom left corner of the screen. At the same time, I saw three lines of graphic text pop up on-screen on top of the player, which read \"Jason, 4.5, On a good day\". Therefore, \"Jason, 4.5, On a good day\" are the words that appear on top of the leftmost player at 00:09 - 00:12." + }, + { + "key": "wWWY6nsYNnA:77b163b1fd02e7f13d1bf2b52cafe2a817d501f2", + "video_id": "wWWY6nsYNnA", + "question": "What color shirt is worn by the player who scores the second point of the match?", + "answer_choice_0": "Purple.", + "answer_choice_1": "Gray.", + "answer_choice_2": "Black.", + "answer_choice_3": "Blue.", + "answer_choice_4": "White.", + "answer_id": 1, + "answer": "Gray.", + "question_type": "Counting", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I found the first point of the match at 00:45. I then saw the second point at 00:49 - 00:51. At the same time, I observed the player who scored the second point and I noticed their shirt was gray. Therefore, the color of the shirt that's worn by the player who scores the second point of the match is gray." + }, + { + "key": "wWWY6nsYNnA:ac5507c326ef190f3502737822fd9d80c1d7d32d", + "video_id": "wWWY6nsYNnA", + "question": "When a player misses a ball and team T/V loses their eleventh game, where on the court does the ball land?", + "answer_choice_0": "Back right.", + "answer_choice_1": "Front right.", + "answer_choice_2": "Back left.", + "answer_choice_3": "Back center.", + "answer_choice_4": "Front left.", + "answer_id": 4, + "answer": "Front left.", + "question_type": "Spatial Perception", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I determined that team T/V lost their eleventh game at 12:38 when the numbers in the 2 columns keeping track of the games won by team S/J changed to 6 and 5. I added 6 to 5 and got 11 total wins for team S/J, 11 total losses for team T/V. I then went back to observe the play that resulted in this score. I saw the play begin at 12:34. I observed a team fail to return a ball that lands in the front left section of the court, and determined due to their loss that this must be team T/V. Therefore, the ball lands in the front left section of the court in the final play, when the player misses the ball and team T/V loses their eleventh game." + }, + { + "key": "wWWY6nsYNnA:de2ea2e3060457bc23c79eb922d4d23fe07d6673", + "video_id": "wWWY6nsYNnA", + "question": "When does a player serve the ball that signals the start of the first game?", + "answer_choice_0": "00:40.", + "answer_choice_1": "01:00.", + "answer_choice_2": "00:52.", + "answer_choice_3": "00:35.", + "answer_choice_4": "00:23.", + "answer_id": 0, + "answer": "00:40.", + "question_type": "Event Occurence", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "I saw a scoreboard appear for the first time at 00:40 and concluded that the prior tennis action was a warmup and the first game was now starting. At the same time, I saw a player serve the ball for the first time, signaling the start of the game. Therefore, the player serves the ball to signal the start of the first game at 00:40." + }, + { + "key": "wWWY6nsYNnA:de5610dc23421b4ca7d4414cadb0da81ebbf5d80", + "video_id": "wWWY6nsYNnA", + "question": "Why does the player in the blue shirt yell at 13:56 - 13:57?", + "answer_choice_0": "He collapsed to the ground.", + "answer_choice_1": "He missed the ball with his racket.", + "answer_choice_2": "He served into the net.", + "answer_choice_3": "He was struck by the ball.", + "answer_choice_4": "He collided with his teammate.", + "answer_id": 2, + "answer": "He served into the net.", + "question_type": "Goal Reasoning", + "split": "Sports and Board Games", + "category": "Tennis", + "reasoning": "At 13:56 - 13:57, I heard the player in the blue shirt yell. Before that, at 13:55, I saw the same player serve straight into the net. Therefore, the player in the blue shirt yells at 13:56 - 13:57, because he served into the net before that." + }, + { + "key": "wz0X5cEVHsg:6c6c5edc98714c6e503c34c3a740f7660f682e67", + "video_id": "wz0X5cEVHsg", + "question": "What is the name of the second movie franchise mentioned in the video?", + "answer_choice_0": "The Hunger Games.", + "answer_choice_1": "Harry Potter.", + "answer_choice_2": "The Lord of the Rings.", + "answer_choice_3": "Transformers.", + "answer_choice_4": "Star Trek.", + "answer_id": 2, + "answer": "The Lord of the Rings.", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the video and listened for the name of a movie franchise. The first time a character mentions a franchise is when they say, \"Star Wars\" at 02:59. I continued listening and heard the same character mention, \"The Lord of the Rings\" at 03:00. I determined that the second movie franchise mentioned in the video is \"The Lord of the Rings.\"" + }, + { + "key": "wz0X5cEVHsg:a6e58abb6402b01bec6c72116d28654b1dcb26b0", + "video_id": "wz0X5cEVHsg", + "question": "What does the front of the man's shirt say at 01:39?", + "answer_choice_0": "KY:CS.", + "answer_choice_1": "YS:KC.", + "answer_choice_2": "KC:SY.", + "answer_choice_3": "KS:CY.", + "answer_choice_4": "YK:SC.", + "answer_id": 3, + "answer": "KS:CY.", + "question_type": "Reading", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I went to the 01:39 time point and read the man's shirt. I observed that it said \"KS:CY\" with some extra designing to make it less plain." + }, + { + "key": "wz0X5cEVHsg:bf5ba0c6e156b5c581313eef9b3dccf5af7d2b4a", + "video_id": "wz0X5cEVHsg", + "question": "What item does the comedian add to his outfit between 00:17-00:22?", + "answer_choice_0": "A navy blazer.", + "answer_choice_1": "A red vest.", + "answer_choice_2": "A black cap.", + "answer_choice_3": "A green tie.", + "answer_choice_4": "A purple beanie.", + "answer_id": 2, + "answer": "A black cap.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I looked to see what outfit the comedian was wearing at the 00:17 mark and observed that he's wearing a black t-shirt. I continued watching until 00:20 when the scene changes and he adds a black baseball cap to his outfit. I continued watching until 00:22 to make sure there were no other outfit changes. I concluded that he adds a black baseball cap to his outfit between 00:17-00:22." + }, + { + "key": "xY15DkgH7Aw:29d2bcd52d3d65049d25ad90b7e1293813d8ca32", + "video_id": "xY15DkgH7Aw", + "question": "What does the male host do when Bobby Lee chases the woman?", + "answer_choice_0": "Remains seated.", + "answer_choice_1": "Reprimands Bobby Lee.", + "answer_choice_2": "Leaves the set.", + "answer_choice_3": "Intervenes physically.", + "answer_choice_4": "Tells Bobby Lee to sit down.", + "answer_id": 0, + "answer": "Remains seated.", + "question_type": "Event Occurence", + "split": "Short Films", + "category": "Short Films", + "reasoning": "When Bobby Lee assaults the woman at 02:04, I observed her male co-host in the background, remaining seated and doing nothing to help her." + }, + { + "key": "xY15DkgH7Aw:ca3bc5420bd48783528d0b42120fe49b609978d8", + "video_id": "xY15DkgH7Aw", + "question": "What type of video game footage plays intermittently throughout?", + "answer_choice_0": "Pac-Man.", + "answer_choice_1": "Baseball and hockey.", + "answer_choice_2": "Mario.", + "answer_choice_3": "Skateboarding and driving.", + "answer_choice_4": "Tetris.", + "answer_id": 3, + "answer": "Skateboarding and driving.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video and noted the different types of video game segments present. These are seemingly put in at random to provide B-roll for the voiceover. There are selections from a game with the focus of skateboarding then driving a vehicle, and alternating between the two throughout." + }, + { + "key": "xpcX3B4xE7Q:21dba8ac08dfe757cca63046edabc0d0a273058e", + "video_id": "xpcX3B4xE7Q", + "question": "In what region of the screen does the third convex lens appear?", + "answer_choice_0": "Upper left.", + "answer_choice_1": "Lower left.", + "answer_choice_2": "Center.", + "answer_choice_3": "Lower right.", + "answer_choice_4": "Upper right.", + "answer_id": 3, + "answer": "Lower right.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, waiting for lenses to appear. At 00:04 I see two lenses appear in the upper left and right sections of the screen. One of them is convex, so I found my first. At 00:16 and 00:17 I see two more lenses appear. Both are convex (one is a magnifying glass and magnifying glasses use convex lenses), so I have found my second and third. The magnifying glass appears at 00:17, so it is my third, and I see that it is located in the lower right half of the screen." + }, + { + "key": "xpcX3B4xE7Q:2809f8d8657bc5050efabef96bc60e0c6cde8242", + "video_id": "xpcX3B4xE7Q", + "question": "What object produced the third virtual image used as an example in this video?", + "answer_choice_0": "Concave lens.", + "answer_choice_1": "Convex lens.", + "answer_choice_2": "Camera.", + "answer_choice_3": "Magnifying glass.", + "answer_choice_4": "Mirror.", + "answer_id": 4, + "answer": "Mirror.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I began watching the video, looking out for virtual images. At 00:17 I see a virtual image of a green chicken being produced by a magnifying glass. At 04:36 I see another virtual image, this time a blue walrus with a purple hat. This one is produced by a concave lens. Finally, at 05:13, I see the third virtual image of the same blue walrus, only this time the image is produced by a mirror." + }, + { + "key": "xpcX3B4xE7Q:29400974d1ec40a0b05fd3abbe0817b8e8963a3b", + "video_id": "xpcX3B4xE7Q", + "question": "During the discussion on real and virtual images, if a line that represented the focal length appeared on the first convex lens shown, which letter underneath the convex lens would align directly with the imagined focal length?", + "answer_choice_0": "A", + "answer_choice_1": "G", + "answer_choice_2": "F", + "answer_choice_3": "R", + "answer_choice_4": "I", + "answer_id": 4, + "answer": "I", + "question_type": "Listening", + "split": "STEM", + "category": "Physics", + "reasoning": "I looked for the discussion on real and virtual images, finding it from 03:05 to the end of the video. The first convex lens appears at 03:30. I imagine a line cutting down the middle of the convex lens, because that is where the lens's focal length is measured (this is also discussed from 02:30 to 02:36). I look around the screen and notice at 03:30, the letter directly underneath the lens is the \"I\" from the word \"Image,\" making this the letter that directly aligns with the focal length of the lens." + }, + { + "key": "xpcX3B4xE7Q:33a6f782b6aca287b8a5a7de9626729fbc5ae876", + "video_id": "xpcX3B4xE7Q", + "question": "When the image of the convex lens appears on-screen for the 2nd time, how many light rays are making contact with the lens?", + "answer_choice_0": "5.", + "answer_choice_1": "1.", + "answer_choice_2": "3.", + "answer_choice_3": "2.", + "answer_choice_4": "4.", + "answer_id": 4, + "answer": "4.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video looking for an image on a convex lens to appear on-screen. At 00:04 I see a convex lens appear on the right side of the screen for the first time. At 00:09 I see 4 light rays making contact with this lens. At 00:16 a second convex lens appears just below the first one. 4 light rays emit from a green chicken and hit this lens. Therefore, the second convex lens has 4 light rays." + }, + { + "key": "xpcX3B4xE7Q:3eb4deb5aed0e7bd498e0b433b5cfdb97da59530", + "video_id": "xpcX3B4xE7Q", + "question": "How many more light rays are there in the first concave lens which has them, compared to the number of light rays the last concave lens has?", + "answer_choice_0": "1.", + "answer_choice_1": "2.", + "answer_choice_2": "3.", + "answer_choice_3": "4.", + "answer_choice_4": "5.", + "answer_id": 2, + "answer": "3.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for when the first convex lens with light rays and the last convex lens with light rays appears. The first convex lens with light rays appears at 00:09. I see 5 light rays making contact with the lens. I see that the last convex lens appears at 05:40, and it has 2 light rays making contact with the lens. The difference in light rays, therefore, is 3." + }, + { + "key": "xpcX3B4xE7Q:7ace7fbec222dc079c406226db4d66986fb296f8", + "video_id": "xpcX3B4xE7Q", + "question": "If a light ray travelled parallel to, and through, the principal axis of the convex lens that appears when the narrator discusses real and virtual images, at what approximate place on the green chicken would the light ray hit?", + "answer_choice_0": "The chicken's comb", + "answer_choice_1": "The chicken's feet", + "answer_choice_2": "The bottom of the chicken's wing", + "answer_choice_3": "The chicken's eye", + "answer_choice_4": "The chicken's neck", + "answer_id": 4, + "answer": "The chicken's neck", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I looked for the green chicken that shows up during the discussion on real and virtual images. From 03:05-03:10, the narrator discussed real and virtual images, so when the image of a green chicken looking through a convex lens appeared at 03:30, I knew I found my image. Since the axis of a lens is an imaginary line bisecting its widest length through the middle--this is also defined at 02:24--I projected an imaginary line through the principal axis and extended it to the chicken. I noticed that the bottom of the chicken's neck is where the extended imaginary line would make contact with the green chicken, so I concluded that the light ray would hit the chicken's neck." + }, + { + "key": "xpcX3B4xE7Q:7fc42abc93441fa3beedef117ec469b3c6e98c36", + "video_id": "xpcX3B4xE7Q", + "question": "What is the third image in this video to appear inverted?", + "answer_choice_0": "Magnifying glass.", + "answer_choice_1": "Mirror.", + "answer_choice_2": "Chicken.", + "answer_choice_3": "Walrus.", + "answer_choice_4": "Wrench.", + "answer_id": 4, + "answer": "Wrench.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for an inverted image. At 00:16, I see a green chicken with an inverted image on the other side of a convex lens. At 03:32 I see the second inverted image, another green chicken inverted by a convex lens. At 04:00 the video puts a screen behind the chicken, but it remains the same first inverted image I saw. At 04:19 I see a third inverted image behind an eye. This image is a wrench." + }, + { + "key": "xpcX3B4xE7Q:9904b8cf4c3c6bffcb412908606cf9fa69a999d4", + "video_id": "xpcX3B4xE7Q", + "question": "What differentiates the eighth and ninth lens from the first and second lens?", + "answer_choice_0": "None of the above.", + "answer_choice_1": "Different material.", + "answer_choice_2": "Different color.", + "answer_choice_3": "All of the above.", + "answer_choice_4": "Different curvature.", + "answer_id": 3, + "answer": "All of the above.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, waiting for lenses to appear. At 00:04 I see the first two lenses appear in the upper left and right sections of the screen. At 00:16 I see the third lens appear in the lower left. At 00:17 I see the fourth lens appear in the lower left. I do not see another lens appear until 02:31 when the fifth and sixth lenses appear. I see the sixth and seventh lenses appear at 02:54 and the narrator and onscreen text explain these lenses are more curved. I see the eight and ninth lenses appear onscreen and retain the same curvature as the previous lenses, but the narrator and onscreen text explain these lenses are a different material as well as a different color." + }, + { + "key": "xpcX3B4xE7Q:9ebce574908a1d97504535c29d53a5c19689dd5d", + "video_id": "xpcX3B4xE7Q", + "question": "Which animal is used in this video to consistently represent virtual images?", + "answer_choice_0": "Green chicken.", + "answer_choice_1": "Purple walrus.", + "answer_choice_2": "Blue chicken.", + "answer_choice_3": "Blue walrus.", + "answer_choice_4": "Green walrus.", + "answer_id": 3, + "answer": "Blue walrus.", + "question_type": "Counting", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking for an animal. At 00:17, I see a green chicken with a magnifying glass over its head, representing a virtual image. At 04:35 I see a blue walrus while the video is talking about virtual images. As the video continues to discuss virtual images, I see a blue walrus formed with a mirror at 05:13. Because the blue walrus was used twice when discussing virtual images, while the green chicken was only used once, the blue walrus was used consistently." + }, + { + "key": "xpcX3B4xE7Q:e8a1b98d559a32052861635608a55e8069cf6cc6", + "video_id": "xpcX3B4xE7Q", + "question": "When the narrator finishes talking about his real life example of a convex lens, which things are shown to be inverted?", + "answer_choice_0": "Chicken and spanner.", + "answer_choice_1": "Two chickens.", + "answer_choice_2": "Chicken and eye.", + "answer_choice_3": "Chicken and walrus.", + "answer_choice_4": "Two walruses.", + "answer_id": 0, + "answer": "Chicken and spanner.", + "question_type": "Goal Reasoning", + "split": "STEM", + "category": "Physics", + "reasoning": "I begin watching the video, looking and listening for the real life example of a convex lens to be shown. At 04:06, I hear the narrator say \"to give you some example of where this happens in real life,\" and, at 04:14, I see the image of an eye appear on-screen. At 04:31, the narrator finishes talking and afterward begins to talk about something else. I look for objects that are inverted at this point, and I notice an inverted spanner behind the lens of the eye, and an inverted chicken enclosed in a light gray screen. So, the answer is a chicken and a spanner." + }, + { + "key": "zHV8o9cyVYk:2014f6962c7c43ff84de241919efbbf51b45d5b0", + "video_id": "zHV8o9cyVYk", + "question": "How many excuses does the comedian give for why he is not always in the mood for sex?", + "answer_choice_0": "4", + "answer_choice_1": "2", + "answer_choice_2": "3", + "answer_choice_3": "1", + "answer_choice_4": "5", + "answer_id": 2, + "answer": "3", + "question_type": "Counting", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I found while watching the video, the comedian gives excuses as to why he is not always in the mood for sex at 05:27. The first excuse was having a long week of work at 05:38. The second excuse was having a headache at 05:40, and the third was feeling gassy at 05:43. This comes to a total of 3 excuses the comedian mentions as to why he is not always in the mood for sex." + }, + { + "key": "zHV8o9cyVYk:5883deb47ce12e4f690655343ac9d42105db7629", + "video_id": "zHV8o9cyVYk", + "question": "What item does the comedian lean over to pick up at 08:38?", + "answer_choice_0": "A photo.", + "answer_choice_1": "A prop.", + "answer_choice_2": "A water bottle.", + "answer_choice_3": "A cigarette.", + "answer_choice_4": "A sign.", + "answer_id": 2, + "answer": "A water bottle.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched closely at 08:38 as the comedian remains seated but bends down to pick up something from the stage at 08:39 - 08:40. It's a clear plastic water bottle, which he sips from while taking a momentary pause at 08:47." + }, + { + "key": "zHV8o9cyVYk:7204961cafbafabd09ddcada160bfbf773884ddd", + "video_id": "zHV8o9cyVYk", + "question": "How many microphones are in the video?", + "answer_choice_0": "3.", + "answer_choice_1": "12.", + "answer_choice_2": "1.", + "answer_choice_3": "4.", + "answer_choice_4": "2.", + "answer_id": 2, + "answer": "1.", + "question_type": "Object Recognition", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I watched the entire video looking for when microphones appear and how many of them show up. When the comedian sits down at 00:02, he holds the only microphone he will use." + }, + { + "key": "zHV8o9cyVYk:8dcc6d6863d425a95551a1ea768aac858b153742", + "video_id": "zHV8o9cyVYk", + "question": "Which rapper does the comedian compare to the Wolf of Wall Street character?", + "answer_choice_0": "DMX.", + "answer_choice_1": "50 Cent.", + "answer_choice_2": "25 Cent.", + "answer_choice_3": "Flavor Flav.", + "answer_choice_4": "Xzibit.", + "answer_id": 0, + "answer": "DMX.", + "question_type": "Listening", + "split": "Short Films", + "category": "Short Films", + "reasoning": "I first go to where the comedian discusses The Wolf of Wall Street, which happens at 00:54. Then, I go to 01:20, where the comedian calls Leo DiCaprio's character in The Wolf of Wall Street \"the white DMX\" because of the way he parties." + } +] diff --git a/video/--C26cvIFdY.mkv b/video/--C26cvIFdY.mkv new file mode 100644 index 0000000000000000000000000000000000000000..5a2f3a1e7aa41e0b37de6d1235111842e9adb878 --- /dev/null +++ b/video/--C26cvIFdY.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aec094ed8c5fab4b6e007faadf2bd0259e8a80ece0b41b77c98881b1189e0513 +size 147867475 diff --git a/video/--mHv6CeVbg.webm b/video/--mHv6CeVbg.webm new file mode 100644 index 0000000000000000000000000000000000000000..39a2eb5f54418be396be3ada20f9ae12bdd38bfc --- /dev/null +++ b/video/--mHv6CeVbg.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b6ec4bc7ed015d2bf7eca0fb5867a8c95fbfe079801d1482a83e40ca1d3c1f28 +size 85365362 diff --git a/video/--oWChJdE-o.mkv b/video/--oWChJdE-o.mkv new file mode 100644 index 0000000000000000000000000000000000000000..0ca64daf0134fd9cd04e0bcce12f169b8a54cc01 --- /dev/null +++ b/video/--oWChJdE-o.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9896e675e34c6633c09168453d0618c1dd133f9054e8150c78fb3bd8072c10fd +size 22588392 diff --git a/video/--rEUC2Zwvs.webm b/video/--rEUC2Zwvs.webm new file mode 100644 index 0000000000000000000000000000000000000000..d17c615349f3e38c32d3b633757f8fa0857e7722 --- /dev/null +++ b/video/--rEUC2Zwvs.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:bcfc0b2f775225a8b3130784318a0cc2a2e45e313e527afe58b42d07a0e478da +size 48407205 diff --git a/video/--w-FuLNttw.webm b/video/--w-FuLNttw.webm new file mode 100644 index 0000000000000000000000000000000000000000..194e8a9721a1a5a82d6861c991a44f684f530aa5 --- /dev/null +++ b/video/--w-FuLNttw.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4d69c84323c207c58ff907ca3c8de4e192b1059eed0feeeb44cb4f5990801bd0 +size 8020882 diff --git a/video/-0XB0BWhzNc.mkv b/video/-0XB0BWhzNc.mkv new file mode 100644 index 0000000000000000000000000000000000000000..308d6b4eeb6227b5643238cfe74cf943231fbdb5 --- /dev/null +++ b/video/-0XB0BWhzNc.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:cf59bd221e3e62b5e79310e9c7ffd3e9e9b803d86f5904a1f2e6237256660b39 +size 109643234 diff --git a/video/-0ZosUeqDg0.webm b/video/-0ZosUeqDg0.webm new file mode 100644 index 0000000000000000000000000000000000000000..2f6ab7c262ced86d00485832c1e6698dfd3537ab --- /dev/null +++ b/video/-0ZosUeqDg0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:bc2965fb687999182e014f40733fe9cd0435c159134240c15e3adb1a42564974 +size 74456983 diff --git a/video/-18ZO2Pda2A.webm b/video/-18ZO2Pda2A.webm new file mode 100644 index 0000000000000000000000000000000000000000..28d54e6ed1ad9cc3c8d006159db1f25626d8535f --- /dev/null +++ b/video/-18ZO2Pda2A.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:270a0e37645724cfa238c80114115c9769a6a20f7e2eda52435b7d11cb4a1278 +size 25104134 diff --git a/video/-1UXq-FzmQA.mkv b/video/-1UXq-FzmQA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..257a45e64add4a3f42e6b6d536d8ccb21c12a949 --- /dev/null +++ b/video/-1UXq-FzmQA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:ca0301cfb120cb9847418d1b67f1e7a8c4e38b78f6227cee8e14ef3480b162bf +size 74356009 diff --git a/video/-1YjD_Epw9M.mkv b/video/-1YjD_Epw9M.mkv new file mode 100644 index 0000000000000000000000000000000000000000..fd141955d57d6fbe16cd10b192e03689e9c9c414 --- /dev/null +++ b/video/-1YjD_Epw9M.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:236c8740c7ea6a0d15f97480964275252144b37dfcbe13e27cef591955edc842 +size 76724493 diff --git a/video/-2ADJedUQv0.mkv b/video/-2ADJedUQv0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..5582b7af290032d4b1c1df4276570d9f35bd1522 --- /dev/null +++ b/video/-2ADJedUQv0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9f3dab2d7ca529404bf4f0f0452afba18bb94eb7365087322cc1464c034f3e7f +size 30100385 diff --git a/video/-3ab4xjUXNQ.mkv b/video/-3ab4xjUXNQ.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e159a4eaebd9edcf191aa8fc40cee9e4f9fc6955 --- /dev/null +++ b/video/-3ab4xjUXNQ.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3116cb6e298b5d1b07b1c5172d1521ff827f349feb66f258a8910e50a3e34066 +size 165259650 diff --git a/video/-45ykBNkhpc.mkv b/video/-45ykBNkhpc.mkv new file mode 100644 index 0000000000000000000000000000000000000000..f9ac04333de8d612c4cdc6bb3fb2ac6f1715f005 --- /dev/null +++ b/video/-45ykBNkhpc.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c645521c089bc6bbe303cccf44d9661b6cf12e9ca56a51e1e0dfb2fc715a8824 +size 59209570 diff --git a/video/-4IduHFnEwg.mkv b/video/-4IduHFnEwg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..5abaa6a9cd9e7aadf2142c160814fddf5e11b3d0 --- /dev/null +++ b/video/-4IduHFnEwg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c723841307f4ba1542183761102044631db956758c402e2d448da837918cfbe7 +size 219637050 diff --git a/video/-4PUD-TNhU4.mkv b/video/-4PUD-TNhU4.mkv new file mode 100644 index 0000000000000000000000000000000000000000..8d8873e5aeb5f8e064726ab42d1cae43d048ab1f --- /dev/null +++ b/video/-4PUD-TNhU4.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2f05145b950924ab7b5832f188a12b98e3d3c84ceabd3dbaa9c8340b0149cd8f +size 85139639 diff --git a/video/-5Uz0Pz-mI0.webm b/video/-5Uz0Pz-mI0.webm new file mode 100644 index 0000000000000000000000000000000000000000..182b4d5ee0dcad2d548c1e6a210db6c45ec2cbe0 --- /dev/null +++ b/video/-5Uz0Pz-mI0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b677d71eeff242c50128804456d918e9696e559759e6a07037b7de3a30cd7c3d +size 76091638 diff --git a/video/-8Az6UgyLVQ.webm b/video/-8Az6UgyLVQ.webm new file mode 100644 index 0000000000000000000000000000000000000000..e3c9f32751cefc4feb999cddd0742b65c741ebf2 --- /dev/null +++ b/video/-8Az6UgyLVQ.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e21b5711c85e2cbae4239f23d42d704bc0ab53ca005a2dc584154142c4302633 +size 746293209 diff --git a/video/-AY84ybskqI.mkv b/video/-AY84ybskqI.mkv new file mode 100644 index 0000000000000000000000000000000000000000..9bd15ddf2bf4ee4cf47479b5d2452769faa2d43c --- /dev/null +++ b/video/-AY84ybskqI.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0c2f9291e465747ae39e131924d15b269a5bf602bcabe4c565409b4cbc2e8eff +size 92741428 diff --git a/video/-Bdlf7Ke5aU.mkv b/video/-Bdlf7Ke5aU.mkv new file mode 100644 index 0000000000000000000000000000000000000000..26fc47bbef81d86cef1e71d3ba0bc70409b46dc3 --- /dev/null +++ b/video/-Bdlf7Ke5aU.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:63cf887940e43e68490254634209d7e447d4750d1ac1d163d862f1b9b1d3ce50 +size 548146847 diff --git a/video/-D_S2Ys7m7M.mkv b/video/-D_S2Ys7m7M.mkv new file mode 100644 index 0000000000000000000000000000000000000000..ce4f17b528309b1031d3278b9ee701cd984b673a --- /dev/null +++ b/video/-D_S2Ys7m7M.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:43abcae00f1ffae5b2998dc221aa76e879b42fe3672d81c2ea302e31b0b5e918 +size 232982466 diff --git a/video/-DlsYwroLME.mkv b/video/-DlsYwroLME.mkv new file mode 100644 index 0000000000000000000000000000000000000000..77da3e66c102724eb38ec5c0701cb0aec430a890 --- /dev/null +++ b/video/-DlsYwroLME.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:76146f48d9cdb43a7b98d126d8029cde70a87c14673e3d9e3f169fe14383d871 +size 52076824 diff --git a/video/-KpTOB2hoG4.mkv b/video/-KpTOB2hoG4.mkv new file mode 100644 index 0000000000000000000000000000000000000000..14f33ab1019e2e39272b87b9135e23254b508aba --- /dev/null +++ b/video/-KpTOB2hoG4.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:da6b460b48939bcf07bc8294aecd0d74e892b111255b615f3a033406e793c029 +size 409230211 diff --git a/video/-Ngy_kr1oGQ.mkv b/video/-Ngy_kr1oGQ.mkv new file mode 100644 index 0000000000000000000000000000000000000000..acaf29bafd4a81e59c9af3f2085cda8594bf33f0 --- /dev/null +++ b/video/-Ngy_kr1oGQ.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f8ec90a11b798604ead5069584065873cfebe4962af54864c083e2a5e81046a0 +size 287719304 diff --git a/video/-ODflyuHFr0.mkv b/video/-ODflyuHFr0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..63f604175c7bc4c795dfe12b8a6bebb401a5eca7 --- /dev/null +++ b/video/-ODflyuHFr0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:942d4797e1098e25b7db32fd8f799bda4a9b9dded25730080df2e32cd02bee03 +size 86976518 diff --git a/video/-PCNlAxHXAE.mkv b/video/-PCNlAxHXAE.mkv new file mode 100644 index 0000000000000000000000000000000000000000..21a8991daa2329c95464b2c16010734ab1450f64 --- /dev/null +++ b/video/-PCNlAxHXAE.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:213362d6dc54e69a3e2e31fdd365a6085d46a7548550cae2ccf22c19bd3bee29 +size 328466505 diff --git a/video/-QACREXoI9w.webm b/video/-QACREXoI9w.webm new file mode 100644 index 0000000000000000000000000000000000000000..0fd2166ecc3e8358d438c596e259bc1df9faeb29 --- /dev/null +++ b/video/-QACREXoI9w.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f0c40cb1c1a9f260aae8664ba97b92946f795eb025df69f8c59f0642befebf12 +size 107862790 diff --git a/video/-RyqpUcmspo.webm b/video/-RyqpUcmspo.webm new file mode 100644 index 0000000000000000000000000000000000000000..41342e1044380e4cc64feb64e07fa074473510d4 --- /dev/null +++ b/video/-RyqpUcmspo.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:35533c5dc86246193999b4724646f0fbe8863f7cf95001a858d4cd27c317bb8f +size 1189238177 diff --git a/video/-g1O2PNqDzw.mp4 b/video/-g1O2PNqDzw.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..cea247ec9dce495b99994c31fc930b02577c4042 --- /dev/null +++ b/video/-g1O2PNqDzw.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5555040662264d648d4d4015c88033ef83219b0af467c774814bba11b2feb380 +size 573583553 diff --git a/video/-g1O2PNqDzw.webm b/video/-g1O2PNqDzw.webm new file mode 100644 index 0000000000000000000000000000000000000000..9d50fb33414b7d050a57358565a4ed3081adf42d --- /dev/null +++ b/video/-g1O2PNqDzw.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9d488faedbc64fcebd538549766bcc5ddbed14ff25a7d7e9d7a3338949e88c68 +size 572518409 diff --git a/video/-hJg2ScKAr4.mkv b/video/-hJg2ScKAr4.mkv new file mode 100644 index 0000000000000000000000000000000000000000..ee12d6f18b409bd0293a48f0218bb1d07b5e7bb6 --- /dev/null +++ b/video/-hJg2ScKAr4.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5861e93cb79d5ef704540c923411e567bc6dec441a79959c3703ccd7448540ef +size 71560914 diff --git a/video/-ooQI03JqYM.mkv b/video/-ooQI03JqYM.mkv new file mode 100644 index 0000000000000000000000000000000000000000..684e0fafcd392bdb61e5f71d9a5bdb0877232c5c --- /dev/null +++ b/video/-ooQI03JqYM.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2dfdb8067abbaaa17ecdf3d2bac66ac799d038f45b38dcb4e58df297d102c2e0 +size 117196953 diff --git a/video/-ywXYEaP8KA.mkv b/video/-ywXYEaP8KA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..a22676f91b16bd2540364329210899b7f08abfac --- /dev/null +++ b/video/-ywXYEaP8KA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:13ef87d34181f2969e39bd2b9567e2c70fe134fd507e3b1f8364b7f653ba6e09 +size 107866187 diff --git a/video/0-iiPxDyO68.mkv b/video/0-iiPxDyO68.mkv new file mode 100644 index 0000000000000000000000000000000000000000..b0018761fae6dcd7134e5a7f9f155f82374bcba6 --- /dev/null +++ b/video/0-iiPxDyO68.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:ef6eb3d50b3e1e12695528df50ff7fc7a2ebc3b1bea2762ab3cbc01cd2a4e15f +size 561835896 diff --git a/video/02HpVRfxSF4.webm b/video/02HpVRfxSF4.webm new file mode 100644 index 0000000000000000000000000000000000000000..a67a6ecf8f41c419b1ab8e79bb131312544b5503 --- /dev/null +++ b/video/02HpVRfxSF4.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:bd3c778f71dceff92726300c6a93ab8ceecfaa41bd0f33347692efe3ea01dac6 +size 155914634 diff --git a/video/03hFktDJ6zc.mkv b/video/03hFktDJ6zc.mkv new file mode 100644 index 0000000000000000000000000000000000000000..6b4a57768aa3dcb54ba5049e5a4ba5dd40e4e2e6 --- /dev/null +++ b/video/03hFktDJ6zc.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e6356920750f23bff301b1a540b751d19c80143a194687e4bd4df3ab778eadbe +size 119760306 diff --git a/video/076Q76G0ptA.mkv b/video/076Q76G0ptA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..15f7363f1309a3e04e1c1eb6521b4ab19979eaec --- /dev/null +++ b/video/076Q76G0ptA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d84da7678504531b2bf9a565c65d8b3da4ad1c97ac04252653f08b47dc98cf99 +size 193275281 diff --git a/video/0BIYhbK6JWA.mkv b/video/0BIYhbK6JWA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e96bc54b764fed99f94bd2befca91c2f6433aa12 --- /dev/null +++ b/video/0BIYhbK6JWA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:533d51d107d7647b916467565830cf12d98b5905e147ba38d651a0c551cc6a72 +size 35788283 diff --git a/video/0ILGJ9r9BbY.webm b/video/0ILGJ9r9BbY.webm new file mode 100644 index 0000000000000000000000000000000000000000..fbeba2c86af3a9d842049b8a4885c3798e547d60 --- /dev/null +++ b/video/0ILGJ9r9BbY.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0bd578d9bf9eb4a5e1d2c23c3bcaac6bba69b00e57262d002257c3fda66b1343 +size 33645560 diff --git a/video/0JZ5AE0erU0.mp4 b/video/0JZ5AE0erU0.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..049b499dd6dbba842aa8c07b6077e5a9a5dc6356 --- /dev/null +++ b/video/0JZ5AE0erU0.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:cced5196591df32875417739b153428247a57517767f94be036eeed210f1a2b2 +size 409609425 diff --git a/video/0WDXJ9g7KAw.mkv b/video/0WDXJ9g7KAw.mkv new file mode 100644 index 0000000000000000000000000000000000000000..7b08502cf2bd4f43c7f18cdf419c9087278edfdb --- /dev/null +++ b/video/0WDXJ9g7KAw.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:70ba20049809048ac12bed21a2bef63c2fd3ec3144d170c88743a7acb26e5f9d +size 162947181 diff --git a/video/0e9Q7n11tvg.webm b/video/0e9Q7n11tvg.webm new file mode 100644 index 0000000000000000000000000000000000000000..36eefd5d39ee721b0b2355685bd00530e7c5e1f5 --- /dev/null +++ b/video/0e9Q7n11tvg.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:23e0db42b59669f8f8cf37cad5b0d12cb073c57b9312d694d61d90aa07d8ac10 +size 1061116703 diff --git a/video/0lR8NhqOkGE.mkv b/video/0lR8NhqOkGE.mkv new file mode 100644 index 0000000000000000000000000000000000000000..88f496832e73f656b281e0ae519c84544b521aee --- /dev/null +++ b/video/0lR8NhqOkGE.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0c96ff3a77954c6d1412bcb8cfd1fc4d819d551b6fa53678016ba8f5cc418f90 +size 73682042 diff --git a/video/0wbPOJ7gG4Q.mkv b/video/0wbPOJ7gG4Q.mkv new file mode 100644 index 0000000000000000000000000000000000000000..1090ef37d4ee335a59ecf19014da07ac453e2600 --- /dev/null +++ b/video/0wbPOJ7gG4Q.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4ded68662e95cd699d074be8204c21d25763cfb40c3ea7a631ddc8c439073344 +size 441719734 diff --git a/video/12fnJva0ypU.mkv b/video/12fnJva0ypU.mkv new file mode 100644 index 0000000000000000000000000000000000000000..327bb9b14589f6feeee896b07098936f599da4af --- /dev/null +++ b/video/12fnJva0ypU.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c83aca2b4198754696833e57f8bceb90a653f418f8479723dfe687740c4a05f3 +size 305935481 diff --git a/video/1QiiEPNv9wM.mkv b/video/1QiiEPNv9wM.mkv new file mode 100644 index 0000000000000000000000000000000000000000..1cb8c56b845561f85d95a0c00f522a8a53256898 --- /dev/null +++ b/video/1QiiEPNv9wM.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:baaa80316be937fb107f9fbb93c4cbe5c5e2e2441f2f6c2d84d0b18ddf07c447 +size 675243322 diff --git a/video/1jzROE6EhxM.webm b/video/1jzROE6EhxM.webm new file mode 100644 index 0000000000000000000000000000000000000000..6b57d2ae8d85e6181c817a921daa645c9132b6dc --- /dev/null +++ b/video/1jzROE6EhxM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c340a755d93a38f1dc78c256ae1da50f8ed568c22010f739ee9fdac61afa2382 +size 36831438 diff --git a/video/2SdMmx_sLNc.webm b/video/2SdMmx_sLNc.webm new file mode 100644 index 0000000000000000000000000000000000000000..2601ea7df92d30aaa518d15437fc1719038515b8 --- /dev/null +++ b/video/2SdMmx_sLNc.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e2e92715a3935b08f2c11faafe6e6f259ec0b62fa6cbbd7962b90202bd97c877 +size 384182308 diff --git a/video/2dKCBcRehFY.webm b/video/2dKCBcRehFY.webm new file mode 100644 index 0000000000000000000000000000000000000000..ca16b1371092bfddf2b4afa6178b4c533e0eff19 --- /dev/null +++ b/video/2dKCBcRehFY.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:7fa7102b646857e619b80aafb2a37a0fbffb9a903e2653ddafb645b44d2ef535 +size 75700108 diff --git a/video/2tapJf1frt0.mkv b/video/2tapJf1frt0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..0cb6f24a89924aea3376d44dc605bf2613d8bf78 --- /dev/null +++ b/video/2tapJf1frt0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3e9ef78bae662697fb299af765724c5e60a968c9ff4b059866da908d12a34df8 +size 94833903 diff --git a/video/3X3tKlr5am8.mkv b/video/3X3tKlr5am8.mkv new file mode 100644 index 0000000000000000000000000000000000000000..942a3882f4ed13567e786daf1fc45ebb73ba4e5e --- /dev/null +++ b/video/3X3tKlr5am8.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:645a063f7d96bd3c88ba562f64800a2ef233db64f8027cd64b11507cb107586b +size 298639219 diff --git a/video/3lxklYVZYEk.webm b/video/3lxklYVZYEk.webm new file mode 100644 index 0000000000000000000000000000000000000000..05f7084cbc8d4d561dcef2309930cc53f9b9dcde --- /dev/null +++ b/video/3lxklYVZYEk.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:991960625e6a25d039d6491f889aaf5c541482fbb9caeedf2e696f8a31fade09 +size 2251143762 diff --git a/video/3tisOnOkwzo.webm b/video/3tisOnOkwzo.webm new file mode 100644 index 0000000000000000000000000000000000000000..761f674eea3865b10510a45410211224378a5290 --- /dev/null +++ b/video/3tisOnOkwzo.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:67ef469900970a7705fa9c9a5ab1153af9622c92381e582f40a9459c398812d1 +size 157443367 diff --git a/video/3wEth2tcL5k.webm b/video/3wEth2tcL5k.webm new file mode 100644 index 0000000000000000000000000000000000000000..00236e37560095cf0f5e9e8d3e9e284108c1168c --- /dev/null +++ b/video/3wEth2tcL5k.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:27e005f74f82ee079e95fe434fa37c8b21ebb39768f5534555d3aeda22b1d3d7 +size 92150454 diff --git a/video/3zrHa2Qh0I0.mkv b/video/3zrHa2Qh0I0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..3e88d59d9b550796950ce16a821731cd744a3978 --- /dev/null +++ b/video/3zrHa2Qh0I0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5cf1e2e028ba1e062f2b5d8fde018aa7dd53a187d7207dfdaade50bb20c4c42f +size 232904062 diff --git a/video/4I36G3B_sPA.webm b/video/4I36G3B_sPA.webm new file mode 100644 index 0000000000000000000000000000000000000000..c7de286299d48b9066263975243605653fb6b5a8 --- /dev/null +++ b/video/4I36G3B_sPA.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5b79e466b3185ac0c13d713e56dae24728db7321c6aa48d695c533d7d80867c0 +size 252360975 diff --git a/video/4M0lZPaJKto.webm b/video/4M0lZPaJKto.webm new file mode 100644 index 0000000000000000000000000000000000000000..34a9f7bb3b0004d39b6386541d829d8d64e2c207 --- /dev/null +++ b/video/4M0lZPaJKto.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:849f07e94a6dad85a8f7707385583ae91f4075e1b0c9fdea209464de94086283 +size 992164858 diff --git a/video/4n_mRf7j920.mp4 b/video/4n_mRf7j920.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..54e347904aa469aa47191cb754585020193035bf --- /dev/null +++ b/video/4n_mRf7j920.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4f4cf8a78802ba691be13590375534bfa335745077caa319ea4461addfd3c4e7 +size 203726338 diff --git a/video/5-otljNyRmQ.mkv b/video/5-otljNyRmQ.mkv new file mode 100644 index 0000000000000000000000000000000000000000..d2440942b4747ec8acccf435ba673cff640a996b --- /dev/null +++ b/video/5-otljNyRmQ.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:da287ed4bdcc7a7ee1104d518cf69e11c77f0a4a481b3e37e85542fab2c2259d +size 67034567 diff --git a/video/5BSjRjAcuL4.mp4 b/video/5BSjRjAcuL4.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..d0c23d9d920200dda8249d8921f070a71c302a74 --- /dev/null +++ b/video/5BSjRjAcuL4.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9710762520d7cf27e4e6e6199fc764dbb26db789b4b8a0f4dc8ccf4296a2b3b4 +size 26700136 diff --git a/video/5Jrv1h4AztM.mp4 b/video/5Jrv1h4AztM.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..3ea4b2bd5c47790e05ba168a4b762a23834f20b8 --- /dev/null +++ b/video/5Jrv1h4AztM.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:8f2992f4b508f159030a8ef6e6818e99d9ad6bcd0bf02d1faf206e35ea6ea013 +size 460441880 diff --git a/video/6anotlZtbCg.mkv b/video/6anotlZtbCg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..6cbfddde07d6bc3403b1498d3991a85b4d0b9259 --- /dev/null +++ b/video/6anotlZtbCg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0a1e2d451c0b4787dcf6b69a25f6dfd52d325be543af8ee0a33333635f668d52 +size 152668656 diff --git a/video/6jvaV9NJrTo.webm b/video/6jvaV9NJrTo.webm new file mode 100644 index 0000000000000000000000000000000000000000..d65769b91abae3a5f4be72134ee1b8a3e45adccb --- /dev/null +++ b/video/6jvaV9NJrTo.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:97a3823319171d2324017ae5af74539e46e496f38e787f9b83d2d2c50dc32e78 +size 274754176 diff --git a/video/7Mn9jqmcD6w.mkv b/video/7Mn9jqmcD6w.mkv new file mode 100644 index 0000000000000000000000000000000000000000..6f1a91b0a14ba99417a00e845f1e5e3e21e58caa --- /dev/null +++ b/video/7Mn9jqmcD6w.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f4d7c447ab19250f9c015e276ec667c1b52ef540a32dc0b5719b28c9aca28d0c +size 113389190 diff --git a/video/7S9q1kAVmc0.webm b/video/7S9q1kAVmc0.webm new file mode 100644 index 0000000000000000000000000000000000000000..de5ea47af71777d17a89cbd632dd95560baf7432 --- /dev/null +++ b/video/7S9q1kAVmc0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:654ca43ebbb044f74e8bf9ef52b5ca7c818a0b1b6b01e76e3ec4d6f7c1013c3d +size 6359108578 diff --git a/video/7VBalG0IhhI.webm b/video/7VBalG0IhhI.webm new file mode 100644 index 0000000000000000000000000000000000000000..1dc371c35140da3670c9a48b91fb9cbc34ede20a --- /dev/null +++ b/video/7VBalG0IhhI.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:bad9cf4c100a23998f1f65fb61b3a5e47dfc27c5da043387eeb8f866fa8572c2 +size 1309592720 diff --git a/video/7eF4EjdYZ7k.mp4 b/video/7eF4EjdYZ7k.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6b21c45e84b1b7cc78eba36f3d40230f128b48d3 --- /dev/null +++ b/video/7eF4EjdYZ7k.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:25f10062519d17ec26d631765f8c053a0d3b8809a0adc8b92fabf657c09f362f +size 194799563 diff --git a/video/8FKq6r2rad8.mkv b/video/8FKq6r2rad8.mkv new file mode 100644 index 0000000000000000000000000000000000000000..64ff22d2e072fbe98074401254f2a7cc5e663ca8 --- /dev/null +++ b/video/8FKq6r2rad8.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aaefa1fce63267050422551a2cb93113e0784c81ae45960286184486ef798d24 +size 395801591 diff --git a/video/8LOFc5FmVbI.mkv b/video/8LOFc5FmVbI.mkv new file mode 100644 index 0000000000000000000000000000000000000000..c504192c038a163eaaa35dae080ae70965f35148 --- /dev/null +++ b/video/8LOFc5FmVbI.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2aa48acd3b02bb830edc80fdba104f046bba97befebe06f8f1b4fb311a3625bf +size 326637350 diff --git a/video/8dSWPmf0hnQ.mkv b/video/8dSWPmf0hnQ.mkv new file mode 100644 index 0000000000000000000000000000000000000000..40163bb76ae95502d2cf56a3c512d00a671342a1 --- /dev/null +++ b/video/8dSWPmf0hnQ.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:119708ca1a5ef2f996bb924038205cebe1ac073a09e984bb92510cde40b6b983 +size 65811812 diff --git a/video/8epJyi9TjZQ.webm b/video/8epJyi9TjZQ.webm new file mode 100644 index 0000000000000000000000000000000000000000..9e4329131945c2e990ad2a6a1621909bffc9fad1 --- /dev/null +++ b/video/8epJyi9TjZQ.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:7903fa168d0346d2cd9cb50993da2e83eb8c042df7e3ab936f925b2eeaf5daf6 +size 618582689 diff --git a/video/8rdIuLhEQso.webm b/video/8rdIuLhEQso.webm new file mode 100644 index 0000000000000000000000000000000000000000..7e9e0bc55feb87f507daa681509cafdb0c0d6377 --- /dev/null +++ b/video/8rdIuLhEQso.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:7d350b334653b727febbd5d822a9b38d95b02369aa732820c389406b0d4ce11e +size 59553479 diff --git a/video/9120Php3Kh4.webm b/video/9120Php3Kh4.webm new file mode 100644 index 0000000000000000000000000000000000000000..2a4851239b5bdc310edaf59bbf8fceea88da1009 --- /dev/null +++ b/video/9120Php3Kh4.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:29b3ef36562eb9ede79acedf5eced0731848340c2aa8768254960161cc349942 +size 29127278 diff --git a/video/91ub3om9Fg0.mkv b/video/91ub3om9Fg0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e3fcf71c39751b1614172c7f0185a14f6a2a9667 --- /dev/null +++ b/video/91ub3om9Fg0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:63588bb6cec2c24d90bccb295a7291a860671591109dba2eeb97f4da8f529c4b +size 52575482 diff --git a/video/9hLit9A8gso.webm b/video/9hLit9A8gso.webm new file mode 100644 index 0000000000000000000000000000000000000000..4b06c26460c9ae24923cfe446b5b09c63879d398 --- /dev/null +++ b/video/9hLit9A8gso.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:208717fb37abc31e748b574b06dda2c93d4459a9163af47e2299fb1acc6a388c +size 868735687 diff --git a/video/9jFOIkFIaVg.mp4 b/video/9jFOIkFIaVg.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4d49d4f58aca713a996590b33cf17c35e7120c24 --- /dev/null +++ b/video/9jFOIkFIaVg.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:89d4f035597093e9d1d9b2b1c3cb547a92f0930de2220607934c30c5decc92d9 +size 21193845 diff --git a/video/9u2I5D55tfU.mp4 b/video/9u2I5D55tfU.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..cccc75d479eecbd554e2ead67e90c391c73d6798 --- /dev/null +++ b/video/9u2I5D55tfU.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:999f2fbcd57409ded3fc6efad7f4a669bf12ccd4a8310a53e7e716f67506c127 +size 25638967 diff --git a/video/AztHIuOAu7E.mp4 b/video/AztHIuOAu7E.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..e64d757c00ef81c602ab16d60c83724461f0e822 --- /dev/null +++ b/video/AztHIuOAu7E.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b283a2e5fc931a808212e86741ab7827341d31af32bdde1eb4f93b776900431e +size 329883844 diff --git a/video/CkX3sA-8-hw.mkv b/video/CkX3sA-8-hw.mkv new file mode 100644 index 0000000000000000000000000000000000000000..d29c36cf471ac2d4684d4b9ada19b10ae1f2b589 --- /dev/null +++ b/video/CkX3sA-8-hw.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:dc133a958fe24291279ab5eb04bd99db6e7e97557f426fd37ee354500545235c +size 379448922 diff --git a/video/DwRpgqbs7bY.mp4 b/video/DwRpgqbs7bY.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c0e58df530984b3fe3c8ab5cbbb92d2c5815ccf4 --- /dev/null +++ b/video/DwRpgqbs7bY.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5befd503aa5a24ea944f0ddf1fe8cb20ecc5e8e8dda06b15e74e4348ea7bedc3 +size 389991319 diff --git a/video/E4F77emUnqQ.webm b/video/E4F77emUnqQ.webm new file mode 100644 index 0000000000000000000000000000000000000000..9177eb3e9d3401ada5d1685481b267a738df7fa1 --- /dev/null +++ b/video/E4F77emUnqQ.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4312b16c1d1624adbb33b46a69917ca31cccd3462cd15ba85b5810a1fe1a1785 +size 146365113 diff --git a/video/E5dOAWyh3uk.mkv b/video/E5dOAWyh3uk.mkv new file mode 100644 index 0000000000000000000000000000000000000000..294195b42ce798555b678ca578432f35a34ea654 --- /dev/null +++ b/video/E5dOAWyh3uk.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f2dfff69d3a829cbea2de10eae26ca7d333792e3001d619fbdb5a6861178ced8 +size 135947813 diff --git a/video/E5oMSKck2J8.mp4 b/video/E5oMSKck2J8.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..ead857016683da09568f5031234e2e1dced19e17 --- /dev/null +++ b/video/E5oMSKck2J8.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:da4a3e25a53b46faa0309d6fb7cfa2d2fe8e3bf33c1cc9974309c9f99cf99384 +size 14492779 diff --git a/video/E7cAz-bnsqM.webm b/video/E7cAz-bnsqM.webm new file mode 100644 index 0000000000000000000000000000000000000000..fff416df39d2928b12f9896d01caba993d4ef342 --- /dev/null +++ b/video/E7cAz-bnsqM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a76828536e0e1015d3c90b5777c4129fdcdcd3c1992a90b90b1fde4fe375b3b9 +size 214779773 diff --git a/video/ECMMct_jnEM.webm b/video/ECMMct_jnEM.webm new file mode 100644 index 0000000000000000000000000000000000000000..239b0fedb642b0cefd55a82517fd4ea57fc2dabd --- /dev/null +++ b/video/ECMMct_jnEM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:78f4ab4d5c04a274db675805e644d4b8c40c526738c380799924e3098730f756 +size 74673664 diff --git a/video/FJlnDef8Qww.mkv b/video/FJlnDef8Qww.mkv new file mode 100644 index 0000000000000000000000000000000000000000..8e73878e94dd8bd07e19d4297d981aca255104f2 --- /dev/null +++ b/video/FJlnDef8Qww.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a155b58525d61f3245f0488c44112145ef4af948c51a39f5b31a22c04033ed93 +size 365184233 diff --git a/video/FUJYcbCZFeI.webm b/video/FUJYcbCZFeI.webm new file mode 100644 index 0000000000000000000000000000000000000000..25c73990ba700dc3038473c0351f22876fa9216b --- /dev/null +++ b/video/FUJYcbCZFeI.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b1624991faa3213f169becb20e2ac60a30d24e3b8b6f82efbf1b66d0700f0200 +size 67255649 diff --git a/video/FadiuRRgvAw.mp4 b/video/FadiuRRgvAw.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..259543e7dc7d453d8adf63e03573933bc1cc47a9 --- /dev/null +++ b/video/FadiuRRgvAw.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9f0d34a16aee18ce505ef1975e036c8ddfc1703ccd49d5e0aca2a1206cbf0a47 +size 188834340 diff --git a/video/FkuqYtE1rw0.webm b/video/FkuqYtE1rw0.webm new file mode 100644 index 0000000000000000000000000000000000000000..c757631365933074226ef180b33cfc0ec7fd2adb --- /dev/null +++ b/video/FkuqYtE1rw0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:8a07865c81cdd7a236a178afd885696b4a92d224f7d1dce1a54a39aecc4326e9 +size 84962802 diff --git a/video/G0oXM9YPLcg.mkv b/video/G0oXM9YPLcg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..511411d896e168bcc0c572fb1f09e4790b47a7f6 --- /dev/null +++ b/video/G0oXM9YPLcg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:467e0c0289091ab658156ad139330b62a63f2a02376d45f586c9b0f336eee64a +size 151336861 diff --git a/video/GcOzdAzmtNM.webm b/video/GcOzdAzmtNM.webm new file mode 100644 index 0000000000000000000000000000000000000000..5edb614756b8e5343c00e9b9373fb22692d27ddf --- /dev/null +++ b/video/GcOzdAzmtNM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aa60edda610c4748260d4e0b85ecd6acca8b6aabd1a94353b07f7326e1f168b5 +size 48497469 diff --git a/video/GlecDUdZdkE.mp4 b/video/GlecDUdZdkE.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..89d42aaed31af922b84d7f2dd80a8617913c7218 --- /dev/null +++ b/video/GlecDUdZdkE.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:164fe9a9404ef06219e9199afa87c4d364484471aee75e6c3493f347a1618eea +size 563931137 diff --git a/video/H5tOnBKITXo.mp4 b/video/H5tOnBKITXo.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..b87ee5b27ee12c097892354ca040d6115ca25d3a --- /dev/null +++ b/video/H5tOnBKITXo.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:82f7c5c7f85e019d926af9a43fcf35b4ec6353b9d56df5e2afab5c45bf6d5060 +size 371710967 diff --git a/video/I3GWzXRectE.webm b/video/I3GWzXRectE.webm new file mode 100644 index 0000000000000000000000000000000000000000..2739924edb23de792894a89d4e8e6dccd5c7b887 --- /dev/null +++ b/video/I3GWzXRectE.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:47adcdc9548d7987defb512de023a630bff9b1e3ca154e8a395e245d58cc417f +size 274216056 diff --git a/video/IEP7f0uWURs.webm b/video/IEP7f0uWURs.webm new file mode 100644 index 0000000000000000000000000000000000000000..8cb05ccddca3a700ac563c33241ebe23e34a51b2 --- /dev/null +++ b/video/IEP7f0uWURs.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f5a0bcf288d2aaa7dd2e9d12cd6503cb83db5b7fe37d684afaf262c30e27cb84 +size 35430956 diff --git a/video/IkalikR-pFs.webm b/video/IkalikR-pFs.webm new file mode 100644 index 0000000000000000000000000000000000000000..1ada026bf3a6adda48527a9fecffff9d5efb095d --- /dev/null +++ b/video/IkalikR-pFs.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c6729e3d80a6bb975c6888309b96621313460722f8e79787cea11366c0307bff +size 790009023 diff --git a/video/J1gKFnNU7XM.mp4 b/video/J1gKFnNU7XM.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4a0f1b738bbdfb9d3ec69d014836f0e06d7dae78 --- /dev/null +++ b/video/J1gKFnNU7XM.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aa92b9ec9aaa758f0dc47186447cdef49da5685d2d0daf4871a7af61e04b6522 +size 141605755 diff --git a/video/J1gKFnNU7XM.webm b/video/J1gKFnNU7XM.webm new file mode 100644 index 0000000000000000000000000000000000000000..1ea4049aa4448a35fdbaf72e9719b25cd2ef6c98 --- /dev/null +++ b/video/J1gKFnNU7XM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5cfb397a33b7326cd3cd7e976384d04ca66a103945679d0bb4149876d765dc22 +size 136085450 diff --git a/video/Jc50h1vbbSo.mp4 b/video/Jc50h1vbbSo.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..7449805302118bd5d390d1670a1791ddeac44499 --- /dev/null +++ b/video/Jc50h1vbbSo.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:eddd2e7fe1e210eeb932bb4cab0d19cd131c3822ae1222d20ba3a8f948322f82 +size 69867170 diff --git a/video/L3yCNlNLJHc.mp4 b/video/L3yCNlNLJHc.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..42ff69752c9cf4775ec1ef58f08f6277804771b3 --- /dev/null +++ b/video/L3yCNlNLJHc.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a2614ddc148e7da8768821186822ea9b63b1bae6b6bd2760e40dc8dbd3d1850d +size 12812380 diff --git a/video/LSFK2P5ud3g.webm b/video/LSFK2P5ud3g.webm new file mode 100644 index 0000000000000000000000000000000000000000..ad0a4f2a681a744a9b7ff966913d7095c644a2bd --- /dev/null +++ b/video/LSFK2P5ud3g.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3ec40186e20231e78c0c71681c67bd1e132b8f39a74637be825f48c95a259d18 +size 34752145 diff --git a/video/LhVqb5ifpac.webm b/video/LhVqb5ifpac.webm new file mode 100644 index 0000000000000000000000000000000000000000..356333c9067f10fb27e6caadf97c2efa61e45a59 --- /dev/null +++ b/video/LhVqb5ifpac.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:8637eac4fa229ad6efd02771f9372025b47388b6b6a9cce6f01f12d8f109f836 +size 97347723 diff --git a/video/LjRBanp0u_8.webm b/video/LjRBanp0u_8.webm new file mode 100644 index 0000000000000000000000000000000000000000..e3a745dce68e07462d1ed31602bfecc98e5023a2 --- /dev/null +++ b/video/LjRBanp0u_8.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b6acd9fd73744db55c19a5c77074d171fd3ebb5b870edd41bfd2832a79510bbb +size 47852305 diff --git a/video/LmUe4mh9wcA.webm b/video/LmUe4mh9wcA.webm new file mode 100644 index 0000000000000000000000000000000000000000..fc6035cf6df15e91831c9b9d1528813d438aad31 --- /dev/null +++ b/video/LmUe4mh9wcA.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:92ff1bd286a1f6d59a56b7d451bb74cbad849f194111693160502a2769571d38 +size 97397845 diff --git a/video/Ltt7AR-cVow.mp4 b/video/Ltt7AR-cVow.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..154a9fc46f4c59e6571cf48ffb77e347e28bac28 --- /dev/null +++ b/video/Ltt7AR-cVow.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:227ddbdc01d85516f70dda0bb264596dc82071d3cca63864757ffad8330621c0 +size 2348226587 diff --git a/video/M22bYjTWJw0.mkv b/video/M22bYjTWJw0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..8cf7c53ffe6c295003bbcd8e6d3f83bf9b3bcaab --- /dev/null +++ b/video/M22bYjTWJw0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6ac803367b967068394328eeab5029adf2482c4f24f6eb08fde2ecff40244117 +size 168955127 diff --git a/video/M5k9aB-OPsE.mkv b/video/M5k9aB-OPsE.mkv new file mode 100644 index 0000000000000000000000000000000000000000..7b1da1074a0d8065c00c2ba66c46f0b964e8a796 --- /dev/null +++ b/video/M5k9aB-OPsE.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e2e59815e511f80838094e7dbc0e297f66e5b6916d8253f1f99149951599379f +size 36628725 diff --git a/video/Mcggugol2ts.mp4 b/video/Mcggugol2ts.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6b2e0d10a151bb8b57413c5f3c9c91f8ef60ef64 --- /dev/null +++ b/video/Mcggugol2ts.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2966481375dcee9c6fdac48289ad0f8837864ac56cba3e7deb5f1e108e13a7e0 +size 8769877653 diff --git a/video/Mm1BoOVUT-U.mp4 b/video/Mm1BoOVUT-U.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..3073ed296027160dfd1be382a8d10ee7ad787b71 --- /dev/null +++ b/video/Mm1BoOVUT-U.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:05c7d57c55d29a14f0c7099f9379c58d7f8cbf6c39464127aa47bceb5a86cd63 +size 48715506 diff --git a/video/N3rm7Nq7A3o.mkv b/video/N3rm7Nq7A3o.mkv new file mode 100644 index 0000000000000000000000000000000000000000..aa18e139ea9a779fc2442380946548fc5b951ea0 --- /dev/null +++ b/video/N3rm7Nq7A3o.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b94317281b65430f7f03e06b1bb5e176708b6a6cb0ef02bab7c39a651d2bc39e +size 70224265 diff --git a/video/NFVBRE_7yr0.webm b/video/NFVBRE_7yr0.webm new file mode 100644 index 0000000000000000000000000000000000000000..a97b595ab99bf4eb4e0e43effea5254db59e7fff --- /dev/null +++ b/video/NFVBRE_7yr0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c992374e55686e86c0e5d8eb0c78b1c16355ba8ec874c228da0607396ff3897f +size 19574473 diff --git a/video/NQi5s447mkg.mkv b/video/NQi5s447mkg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e80b2a47264e082e3f2b47f4346da7e2ccc158ff --- /dev/null +++ b/video/NQi5s447mkg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:cbb3fbc6827b4637caf6471db6cf76ab88a840170aac3393ce5b9c13b0559255 +size 38502107 diff --git a/video/NaXqGa0YLwE.mp4 b/video/NaXqGa0YLwE.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..ffad844619679178824e71d9faf5dba3e3359419 --- /dev/null +++ b/video/NaXqGa0YLwE.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d53766c2a9374936f6c177e3baed8addf2ac768304dfee249cd37a89e3c0fa5f +size 15424460 diff --git a/video/NxDNQOiO8fA.mkv b/video/NxDNQOiO8fA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..ebf4cf04e320e1474243653f06fe6a5556efa163 --- /dev/null +++ b/video/NxDNQOiO8fA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:bab9589929ee393e677d33baf0fe02efd24694917407ad6cb5bfdfbf0006918b +size 106970547 diff --git a/video/OZBQnmr5vT0.mkv b/video/OZBQnmr5vT0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..10eb4fcae2e8be0c98520b36ea761d4686ac865b --- /dev/null +++ b/video/OZBQnmr5vT0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e4fdbe505d029f6c430d161e3024ae752fd4c9557b0d017adbf4782063e013ed +size 1037083734 diff --git a/video/QALo9woiXLU.webm b/video/QALo9woiXLU.webm new file mode 100644 index 0000000000000000000000000000000000000000..4a0797c263ca854ed5bda081c2187e545f1fe61d --- /dev/null +++ b/video/QALo9woiXLU.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:db04de6636275bef041bebf4eb60e53504b31f0afcf127faa818bffa5e40ccd1 +size 710178999 diff --git a/video/QNFQvX-MQgI.mp4 b/video/QNFQvX-MQgI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c35b81ab073ddc42a279338830f3cc27ad4cceae --- /dev/null +++ b/video/QNFQvX-MQgI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:eb77c1446db8395e86e19ca73a4f10a63e54c94f443aeeefa19eeef384472006 +size 56713354 diff --git a/video/QjA0A3aAjv8.mp4 b/video/QjA0A3aAjv8.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..89b277bff3d2c8c7b960d4abdfbb7ecdac586db9 --- /dev/null +++ b/video/QjA0A3aAjv8.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c5e08d9ad796c8ebd657aaabfd4dc63c7ea0af713d0b195e2cbc268349421f56 +size 15114833 diff --git a/video/ROIZoGM-y2o.webm b/video/ROIZoGM-y2o.webm new file mode 100644 index 0000000000000000000000000000000000000000..b3669975a5f4e93bda322a4379bddb14fd54ba97 --- /dev/null +++ b/video/ROIZoGM-y2o.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b4420ecbe83c2dd4a768bc1086520e6a4381d07db36215acc29dcca51722bbcc +size 771697938 diff --git a/video/Reza8udb47Y.webm b/video/Reza8udb47Y.webm new file mode 100644 index 0000000000000000000000000000000000000000..cebc54cb05ba0e5d1b5f82d00d163c11383cf74a --- /dev/null +++ b/video/Reza8udb47Y.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aa860fb6335b859b0bd6539cfccc38e71a26fd4ca1d41ae95a853eb484cf3efc +size 35843932 diff --git a/video/Ru4Y3W103as.webm b/video/Ru4Y3W103as.webm new file mode 100644 index 0000000000000000000000000000000000000000..a810c9aa08154f40c3017c2fec5234d3c8a88cf7 --- /dev/null +++ b/video/Ru4Y3W103as.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:f5494af3008e1a737a3c826d11ebdc750bcd4fa321b419b608f8f9cbee79989a +size 66958893 diff --git a/video/S3zRhfI2GZo.mp4 b/video/S3zRhfI2GZo.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..a09120f732782cf894fcad28223a28ea6f6d46ed --- /dev/null +++ b/video/S3zRhfI2GZo.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:29ca1cfc9b25ed4b570ced65f6501bd04f4c5c8fc560faf50d52837c8191467f +size 19774168 diff --git a/video/S4P3bfR-z40.mp4 b/video/S4P3bfR-z40.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6599bcb57f3fbff7c2c30e4523b2a5a026a0d782 --- /dev/null +++ b/video/S4P3bfR-z40.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2a4c70885b6b3f9752bcc77de2cda0d8222b71d66a0f88011e2080a981b71f0c +size 17087526 diff --git a/video/S4uJa0eY3QQ.webm b/video/S4uJa0eY3QQ.webm new file mode 100644 index 0000000000000000000000000000000000000000..07834f2cda2e307737376dfdddbc64252f6394e9 --- /dev/null +++ b/video/S4uJa0eY3QQ.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:22baa7f63d8ef10c524c08ccae224005bb8dcb6edeed91259644fab2ef386399 +size 61560809 diff --git a/video/SKnkzv8GFeg.mp4 b/video/SKnkzv8GFeg.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..39039209b92483f06518d679c95022a2a5c221bf --- /dev/null +++ b/video/SKnkzv8GFeg.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:52a213f5d3284fad4aadd3f0806c42a93d4053a7f06cf461301b14de9e79950b +size 12841608 diff --git a/video/TfI9nEKdGfg.webm b/video/TfI9nEKdGfg.webm new file mode 100644 index 0000000000000000000000000000000000000000..febbe67fb5b7dd0d394d2a547bf5b8a13db4dfc2 --- /dev/null +++ b/video/TfI9nEKdGfg.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:67b3a3ffbd0cae01e72a2a2cfcdef2d5a4b1369f2cfbecaa82918b6472491bcf +size 195571246 diff --git a/video/UNFgI5Jl7y8.mp4 b/video/UNFgI5Jl7y8.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4255ce2ac7e122752b1d7aa71e47743f75f870b4 --- /dev/null +++ b/video/UNFgI5Jl7y8.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b457d4cdfde9fc99c7a6dfc701938c4fa132f0ebbd99937873ccd56842ea03a0 +size 13712035 diff --git a/video/UYPzrDsUD48.mp4 b/video/UYPzrDsUD48.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4d0d7552b9edb9365985e06385c6f016b85f8feb --- /dev/null +++ b/video/UYPzrDsUD48.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:33a4758bad52d80a4e60388bf6f65e372efe9a8151e00b731530fbbab112041b +size 26087668 diff --git a/video/WmpPEoBp48A.webm b/video/WmpPEoBp48A.webm new file mode 100644 index 0000000000000000000000000000000000000000..80a541ab4338dcf13475d531bda65844d32ae866 --- /dev/null +++ b/video/WmpPEoBp48A.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9a589048fa124b6bba68e4c0b7584ccd20121b312f69cf11cbf15a0e25a0609c +size 1564205360 diff --git a/video/X6xsyT-Dni8.mp4 b/video/X6xsyT-Dni8.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..d0afac22dcce253fb9bbc04893ea259a77d785a1 --- /dev/null +++ b/video/X6xsyT-Dni8.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:eacad45c8f8ed6b044f037432bb1b810e2ebbfffb86eeaaa02144be084498197 +size 15469473 diff --git a/video/X6xsyT-Dni8.webm b/video/X6xsyT-Dni8.webm new file mode 100644 index 0000000000000000000000000000000000000000..5c758b72f0e7dc131df90711d0b834bf6aeef015 --- /dev/null +++ b/video/X6xsyT-Dni8.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:cea9941a8d7f2ad92ad9a92e8c5e9f4304fe020d1469086dc5c2a16e3db78f42 +size 42042672 diff --git a/video/XX_9Cr10IHo.mkv b/video/XX_9Cr10IHo.mkv new file mode 100644 index 0000000000000000000000000000000000000000..63d44af20def82ad31efde504814bdadf6b6539c --- /dev/null +++ b/video/XX_9Cr10IHo.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:ac53271c1ebea09a227671e2d7042019acdf2ef6c0a0584f9fdc605815a93bb5 +size 70161471 diff --git a/video/XoVW7CRR5JY.mp4 b/video/XoVW7CRR5JY.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4cb5e1b8a72c3316197e551f34df33d4d5d438b7 --- /dev/null +++ b/video/XoVW7CRR5JY.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:184a20b1849f28f841287a12c22e5823a6350614ba6cec341fa4136d50dabfa3 +size 65883710 diff --git a/video/XoVW7CRR5JY.webm b/video/XoVW7CRR5JY.webm new file mode 100644 index 0000000000000000000000000000000000000000..54079c31f5c2d37a3e043f926fafb432a17ef2ab --- /dev/null +++ b/video/XoVW7CRR5JY.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:eaa7d06204318ee0a813a905e32bc1e45589d6b404a36672076fcdbb647557df +size 31261329 diff --git a/video/YjZJtZ_6SBY.mp4 b/video/YjZJtZ_6SBY.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..8319a8c43dbfa61cd48cfff5afa36d3995b59674 --- /dev/null +++ b/video/YjZJtZ_6SBY.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:8d2856d326c19242d2e1703b4d422d2c20abcfcbb22e36984fa7bbbf79daac16 +size 45503274 diff --git a/video/YkiGSYoo2BY.mp4 b/video/YkiGSYoo2BY.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..a9d0326fcb0abb83fad24b3d6f2f76f8fd33a7ef --- /dev/null +++ b/video/YkiGSYoo2BY.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:672555cd35d5260cc5ff355878e2ca99cfda16cb1b7d413732da2f9affa853b9 +size 36552842 diff --git a/video/YyIUsFAUFVU.mkv b/video/YyIUsFAUFVU.mkv new file mode 100644 index 0000000000000000000000000000000000000000..fe3663b0bbe9e9a4896a9311a98aed0ab9c3d441 --- /dev/null +++ b/video/YyIUsFAUFVU.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6ea0298b8251928c5b5a261483b559bbe3a19e27745629c283e4b8b1598920e4 +size 63558139 diff --git a/video/YyIUsFAUFVU.mp4 b/video/YyIUsFAUFVU.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..81fcd2eb3c49a15493b482e79459aef02cf03285 --- /dev/null +++ b/video/YyIUsFAUFVU.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c9ca6a0340611732475e47dcba820a9b30c5d5fcaeab0867e27c5d80f7974df8 +size 64205735 diff --git a/video/ZAqIoDhornk.mp4 b/video/ZAqIoDhornk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..27a5f0ed23f1240da44ad3eb53bc3a7f03d2dbc9 --- /dev/null +++ b/video/ZAqIoDhornk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d761bd29b583f140eae52aab0be948f781deb037488a8f897b41ce1a2729690c +size 353969298 diff --git a/video/ZAqIoDhornk.webm b/video/ZAqIoDhornk.webm new file mode 100644 index 0000000000000000000000000000000000000000..5af07ca0a89bf180026be7944ea62c549140867f --- /dev/null +++ b/video/ZAqIoDhornk.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a9b859905b4a8484b9e833a0a14ee25f32128b3b1ec26779d08f3585c0737b09 +size 170302541 diff --git a/video/ZF4T833lln4.mp4 b/video/ZF4T833lln4.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..282a63d9fd2ec9920c94deb65f6204f1faf130f1 --- /dev/null +++ b/video/ZF4T833lln4.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d31b7e3749f94c6bf48d25adeb4bdc8058ee948de0d4e49301e6a625eb010c88 +size 41156876 diff --git a/video/ZhnXo3XUnzI.mp4 b/video/ZhnXo3XUnzI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..891b4c0e8b181ad755dda439486f73b2ba10d84f --- /dev/null +++ b/video/ZhnXo3XUnzI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:df386e38d8f18593a11702ef4a79bafd7936f6afba58e7aa2b766e5b3bbe2f6d +size 18005372 diff --git a/video/_kzVZfGlPZI.mp4 b/video/_kzVZfGlPZI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..54e9aae636343e74d480699d450da64f41d5ce3c --- /dev/null +++ b/video/_kzVZfGlPZI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4518ba9c92b9ec897f944354864fcef5169fb5403ed544014e87d525445bf391 +size 118613073 diff --git a/video/aQaZU0gxLK8.mkv b/video/aQaZU0gxLK8.mkv new file mode 100644 index 0000000000000000000000000000000000000000..677e88613a84c7d55ddf34bc371361dee20b6ef7 --- /dev/null +++ b/video/aQaZU0gxLK8.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d501cf080e80cf87c689641d0206305d785a0942b29ec987eaa5f692c9b178f3 +size 264802383 diff --git a/video/aYlI5KCynCM.mkv b/video/aYlI5KCynCM.mkv new file mode 100644 index 0000000000000000000000000000000000000000..8a8bc95fda237faebdd6e4e6f3e6c9a6ef3d42c4 --- /dev/null +++ b/video/aYlI5KCynCM.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9fe68fa140ca335c25e36acf1aba6ade212d73aae878024c2c47a9ba396dd6a3 +size 125777492 diff --git a/video/aYlI5KCynCM.mp4 b/video/aYlI5KCynCM.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6ca16f8a5126239a72b8cd06c3be256f6dbb4760 --- /dev/null +++ b/video/aYlI5KCynCM.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:236533a4409b19dfd3ad46490ea7c932191ec5c1345bdb51fd4bca63b4181b25 +size 128853692 diff --git a/video/a_90z_4CkA4.f642.mp4 b/video/a_90z_4CkA4.f642.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c2abf967a145bdc048884dc8424fc613e5dbc811 --- /dev/null +++ b/video/a_90z_4CkA4.f642.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:073ceeddd914b755225943ae48334a3c94c844c58a243ca9fe0633c3e60f2744 +size 292716326 diff --git a/video/a_90z_4CkA4.webm b/video/a_90z_4CkA4.webm new file mode 100644 index 0000000000000000000000000000000000000000..33225d8348ca4125bab636cc28a99fc0d5ac9332 --- /dev/null +++ b/video/a_90z_4CkA4.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:81120f27f82f51a587fedd649f04698721c77410641aac9e9cc34e326da46213 +size 293947210 diff --git a/video/amdM-Z-32sM.webm b/video/amdM-Z-32sM.webm new file mode 100644 index 0000000000000000000000000000000000000000..7195713459dda6d6ae34c5d066cdc9b9ce089b66 --- /dev/null +++ b/video/amdM-Z-32sM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6e870e7b1974b5da7b1a08df12d010897da1385d5ee29e17b807bcb5d1b44947 +size 37408577 diff --git a/video/c9-Nlqy7wxg.mp4 b/video/c9-Nlqy7wxg.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..7028273c8f098a5141c8f29312d25c2fb239523e --- /dev/null +++ b/video/c9-Nlqy7wxg.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3c77e6554651ad1fbe6a95c94847de9c1fd0ee06741ed6650fcd50a46f044389 +size 61737508 diff --git a/video/cxHtplim5Ic.mp4 b/video/cxHtplim5Ic.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..166a2588dfc6bdbdeccdf641df7dc29d7c488fd9 --- /dev/null +++ b/video/cxHtplim5Ic.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2390442075b838c344934682cbd64c4aa744bd8651fabb01e639103eb4a47898 +size 47993923 diff --git a/video/d8UESxnuVAY.webm b/video/d8UESxnuVAY.webm new file mode 100644 index 0000000000000000000000000000000000000000..32a9ac4ee4b221f82bba001c2a65d7df4ce69294 --- /dev/null +++ b/video/d8UESxnuVAY.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:697f059f0ccb3549d0260836eae2d8a0694e509bdef8722b396227f206347ee4 +size 43034143 diff --git a/video/dAZZ1jUM_z4.webm b/video/dAZZ1jUM_z4.webm new file mode 100644 index 0000000000000000000000000000000000000000..558d7f036a62e6fa9ad9c258eb18ed6477c06c88 --- /dev/null +++ b/video/dAZZ1jUM_z4.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0a8a8cdea773ae88d264e30ee7d4c27275296a9af36f0c8a401f7b4db74f421e +size 647138540 diff --git a/video/dTp0c41XnrQ.mp4 b/video/dTp0c41XnrQ.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..d889b09158c1c7dfa103b43a2bbdff6aae2eab8d --- /dev/null +++ b/video/dTp0c41XnrQ.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2e68cab2be341f7111c7e9786e1e7da27724615f40feb8d74ed612f3f8ed23e3 +size 11328288 diff --git a/video/ddc_WzEDMNA.mkv b/video/ddc_WzEDMNA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e3c13e5ac6eeb7b255544632374d8786269a6c39 --- /dev/null +++ b/video/ddc_WzEDMNA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:55b5e2d646b608bbb5bf25b1676675753ecfd3303ffaf7688a151184e0a6b4fe +size 83156653 diff --git a/video/dz--r7BfvNk.mp4 b/video/dz--r7BfvNk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..535176c2056b85321c58fe2cc0137e54763dfbbd --- /dev/null +++ b/video/dz--r7BfvNk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:13ff3458121a068e82f9c076e815fee8192a63621d4b2bba8ebd733f933610e5 +size 12894420 diff --git a/video/e1Os-U5XA-E.mkv b/video/e1Os-U5XA-E.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e4bc4ffeb63ffd20726a4113130c7516a2174ba1 --- /dev/null +++ b/video/e1Os-U5XA-E.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:7ae19ac2358ecd1178f7c4831b4e6b3f80006c2f22716c365ebef9e4a13616ce +size 25795954 diff --git a/video/e1cbnb2uw_I.mp4 b/video/e1cbnb2uw_I.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..034b9c73b457a6008ffafcea6a14230c3683733c --- /dev/null +++ b/video/e1cbnb2uw_I.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:60b8ee3f9409ceb5ecba7990b9b67de3350e20d2ab6e91217b6336397cfafc00 +size 14012717 diff --git a/video/eK00WgK5zic.mkv b/video/eK00WgK5zic.mkv new file mode 100644 index 0000000000000000000000000000000000000000..fea965633d4da80d0205f4b51d66000f67dec56c --- /dev/null +++ b/video/eK00WgK5zic.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b9a2882a20dfaad315fe9c69faa8b1a89d42e813fc9f842282f331d783996c92 +size 143604765 diff --git a/video/eYgEGfmVhm4.mp4 b/video/eYgEGfmVhm4.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..09d6374094dc4c3796eb04cf65613d1b32777593 --- /dev/null +++ b/video/eYgEGfmVhm4.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3373dae595a3e24b6543155add6b625d448c6a12dae7eb65565cab5a87c0b28e +size 21888170 diff --git a/video/er0gMDb7F4c.mp4 b/video/er0gMDb7F4c.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..707ef9dadb7b5ca525222428c80f32c907d16793 --- /dev/null +++ b/video/er0gMDb7F4c.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:1615687495f744f4542a4c25967fa678bfa2bd09a78b571f515bc04a6c21307a +size 61649749 diff --git a/video/fRCohICNVws.mkv b/video/fRCohICNVws.mkv new file mode 100644 index 0000000000000000000000000000000000000000..fdfc659255148c1e467634c00bbbfbb18911808b --- /dev/null +++ b/video/fRCohICNVws.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e4bc87e6ba4436ecc938a10dcc59eb20a84e65cf5ce609bf46945568762411e2 +size 305911941 diff --git a/video/fRCohICNVws.mp4 b/video/fRCohICNVws.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..cf33c8f2479d407773c98950c23357529cda3810 --- /dev/null +++ b/video/fRCohICNVws.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:ffd21be51630538f08f7fab05c725f3b132d279b726beb80520594f1c396f802 +size 306437472 diff --git a/video/gBQLXfLJxH4.mkv b/video/gBQLXfLJxH4.mkv new file mode 100644 index 0000000000000000000000000000000000000000..7ebb5e5bd8fb4b89e07da0455b5834a5f13d8ea3 --- /dev/null +++ b/video/gBQLXfLJxH4.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e3b3aed8eac5508d4850cbb8af2b4c624b48fc04140a899fbd86a653e1d15bd6 +size 150922183 diff --git a/video/gBQLXfLJxH4.mp4 b/video/gBQLXfLJxH4.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..d6edd9383c6158cc00b4d2bac9816bca03c51117 --- /dev/null +++ b/video/gBQLXfLJxH4.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:fe876175eebfbcc040bb9ee81493df602c783b217ed89c44ddd11d8c59a031db +size 151392354 diff --git a/video/gFT3Cw3fAN4.webm b/video/gFT3Cw3fAN4.webm new file mode 100644 index 0000000000000000000000000000000000000000..38c1b4c6f342c33d36fa3511034f98f939040f23 --- /dev/null +++ b/video/gFT3Cw3fAN4.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c297ac8a5f943fac2999a5213fd92ded5680727c36dcd506a56757348ece7b68 +size 212269757 diff --git a/video/gO6YHAEk8nI.mkv b/video/gO6YHAEk8nI.mkv new file mode 100644 index 0000000000000000000000000000000000000000..e7bc0676854e2b90b5d55e1e1931de504561e7e5 --- /dev/null +++ b/video/gO6YHAEk8nI.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:da7678399e92123ffeb9b7cd481924d3b16d45ad5636aef456779792eb556a20 +size 86809646 diff --git a/video/gVDj6ptNDpA.webm b/video/gVDj6ptNDpA.webm new file mode 100644 index 0000000000000000000000000000000000000000..ed0531d81faf2f0224d75a86d0511d87a7e09191 --- /dev/null +++ b/video/gVDj6ptNDpA.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:15d77b8e6b463ddff13d81fc157c5176167644cf26fb0659e124da103d9fcdf6 +size 218704666 diff --git a/video/gt_raJgxKis.mp4 b/video/gt_raJgxKis.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..e29a7713691286e6fdf18cd9bc3c36ac8e35b711 --- /dev/null +++ b/video/gt_raJgxKis.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6e7d4d8c0aa9c375b1a288af4613034435fe1731737c7d0d220123fd05e4aa58 +size 80956962 diff --git a/video/hk2wyOFErKE.mkv b/video/hk2wyOFErKE.mkv new file mode 100644 index 0000000000000000000000000000000000000000..f842ccc93088c0411cef07e6be6054762a051cbb --- /dev/null +++ b/video/hk2wyOFErKE.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9c8f66f285d5c8c1597c16e584a91505746ad21fc935461bf34d2ab8e1c07553 +size 69912626 diff --git a/video/i59AlrByh3Y.mp4 b/video/i59AlrByh3Y.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..771fa49eb68898853b0485986facc712fcfa26b3 --- /dev/null +++ b/video/i59AlrByh3Y.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b050d5c4aaa55242e8d1dee57c73dfed1317273bcc11a5258f6ec37f91193ef9 +size 44489332 diff --git a/video/iQGTWM1jkgE.webm b/video/iQGTWM1jkgE.webm new file mode 100644 index 0000000000000000000000000000000000000000..956ea15b5615b0a829a4c33ebb9ca567b1cb7d22 --- /dev/null +++ b/video/iQGTWM1jkgE.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:42a474a74f2f5f02f3f7bb21b1041d98b9cd6013da8e03fe866eaf4b846fdefd +size 1005028396 diff --git a/video/iqaM4QNusng.mp4 b/video/iqaM4QNusng.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..4950d3aabf5f3b49a00427366a68df0f7b56ffd2 --- /dev/null +++ b/video/iqaM4QNusng.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e333b56d766613f8611f13fa1c339722b0e51e3938d666aa3b0fa6298ddca811 +size 8180955 diff --git a/video/iuqA9uwIVSM.mp4 b/video/iuqA9uwIVSM.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..a5e8e232f8b83b115c54a9ece6cb6eba4ba55341 --- /dev/null +++ b/video/iuqA9uwIVSM.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:076361c4d210e563e0ce24c30b9a183551ce13c2568b1ec8b815139f89595d05 +size 15065855 diff --git a/video/j4a2X_frKZM.webm b/video/j4a2X_frKZM.webm new file mode 100644 index 0000000000000000000000000000000000000000..906ba6b07540a159988d421df2896de393d70f0f --- /dev/null +++ b/video/j4a2X_frKZM.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d35fd87ad9b6ec2da5e78f25657c6b0fa975289594d1a5da9aa2bbaf8549c5a5 +size 11085078872 diff --git a/video/j5s0h42GfvM.mp4 b/video/j5s0h42GfvM.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..f911ca7dd5a84df6b10332709096821f3b3e79d7 --- /dev/null +++ b/video/j5s0h42GfvM.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:751f346810bd1e2128dd179a5fe13f2f4588827d7f095e19987e840244a5f6d1 +size 17222375 diff --git a/video/k-mXsUHDqwA.mkv b/video/k-mXsUHDqwA.mkv new file mode 100644 index 0000000000000000000000000000000000000000..7bf7551c250e5ae9886953d951bef9b65aca18e7 --- /dev/null +++ b/video/k-mXsUHDqwA.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4594dc7cb6603ec0c6694163d38bae528f7046b7900e0f7cca5c36246c83146d +size 77201894 diff --git a/video/k6kOI1P6Cuc.webm b/video/k6kOI1P6Cuc.webm new file mode 100644 index 0000000000000000000000000000000000000000..8e0ad6f3e930b1c22e43c3fcde39b3b653a6fa05 --- /dev/null +++ b/video/k6kOI1P6Cuc.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9e4d0f745aaa9794da31197140b6fdb790b706e92eb4a250e539beb1a4d22b41 +size 31036295 diff --git a/video/kOATCKG9xgg.mkv b/video/kOATCKG9xgg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..41aed8cfd2b37392874d9a6a1cb94869faa81a02 --- /dev/null +++ b/video/kOATCKG9xgg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:95005cf901a0f8b7fdfd1cba8eb48188e276175e6d1347fea69ffe24d756c9cd +size 151524858 diff --git a/video/l0E7Uzz1DqU.mkv b/video/l0E7Uzz1DqU.mkv new file mode 100644 index 0000000000000000000000000000000000000000..be4970c3b6d34fee60d19eecd6d20bde4e4d42c3 --- /dev/null +++ b/video/l0E7Uzz1DqU.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:ad83bfe3ffed8668c936c5987de9453fc16261a11ffec021eaf01aeee869d3ca +size 3178566813 diff --git a/video/l_V_7PeK2cw.mkv b/video/l_V_7PeK2cw.mkv new file mode 100644 index 0000000000000000000000000000000000000000..80102d508e217e51af55f7cf56075153b7d2c7a1 --- /dev/null +++ b/video/l_V_7PeK2cw.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:076071665c21a0727cdd2e525763143c8eb982b259ba33f958d7a4b9512dae7e +size 70238879 diff --git a/video/luPzRnaVc7A.mkv b/video/luPzRnaVc7A.mkv new file mode 100644 index 0000000000000000000000000000000000000000..cc080f30e63479a6ab489978a713657dc03554a2 --- /dev/null +++ b/video/luPzRnaVc7A.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c51622df7c2e7933b3fa23abac3458c2961ff3caeceea919c9d405c860fca53d +size 155359180 diff --git a/video/luPzRnaVc7A.mp4 b/video/luPzRnaVc7A.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..e4c1db2256a36cfe0b78c56507cfe4ada98a1e74 --- /dev/null +++ b/video/luPzRnaVc7A.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6a67302c1672c011ce78b2022acd638fa154e714597c2a931aaffe3a8d640264 +size 157529791 diff --git a/video/mZPbhxl2ark.webm b/video/mZPbhxl2ark.webm new file mode 100644 index 0000000000000000000000000000000000000000..ebb5607cf753fdc5dab7c45a05cc883cb40e5503 --- /dev/null +++ b/video/mZPbhxl2ark.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:394ec798e3d485ce9637083de9364c3c0a9706c968a085a002a9e0b38ede934c +size 67586228 diff --git a/video/maLy1naVpjg.mkv b/video/maLy1naVpjg.mkv new file mode 100644 index 0000000000000000000000000000000000000000..9fc3baff27bd79a1f1b58adeb426121cb5e99a2c --- /dev/null +++ b/video/maLy1naVpjg.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:9c08b675541223d694e21d5f786914b5c8646c3ce8fa135038b919dce4926d92 +size 278481804 diff --git a/video/mat5oKZPY6Q.mkv b/video/mat5oKZPY6Q.mkv new file mode 100644 index 0000000000000000000000000000000000000000..3c4fb08fb5eb4a5801c5fac29b33ac75ae7539ed --- /dev/null +++ b/video/mat5oKZPY6Q.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:7330ef7d2f7658015dc0f67d8c594da56ccc3a78654be76f3b9f57e4161d9f43 +size 100029693 diff --git a/video/mfS9bBj6IcQ.mp4 b/video/mfS9bBj6IcQ.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..fda8eb8b923bac371a4767b28588b48095b2500d --- /dev/null +++ b/video/mfS9bBj6IcQ.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:647eadaa02ff003e639f17f0ca28bf64498008327a0ae09f8875e88ed2a87de6 +size 125008304 diff --git a/video/mnNadjPSu60.mp4 b/video/mnNadjPSu60.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..723613566affaa1ef17cb2c202926bbe3554278f --- /dev/null +++ b/video/mnNadjPSu60.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:73382ad3562591e35ed7a19f92166847b6ed61ce375ad5846b41c59ad3537362 +size 81008337 diff --git a/video/mv5_b50V9x8.mp4 b/video/mv5_b50V9x8.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..fa9c68587fd56e0c2678460eb2c7fe77f4ab671f --- /dev/null +++ b/video/mv5_b50V9x8.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:99fc624535431e1a6c9f3e52f9c1f36cda6ea56aa877450b2185dff5c7de7300 +size 120876927 diff --git a/video/n7cOlBxtKSo.webm b/video/n7cOlBxtKSo.webm new file mode 100644 index 0000000000000000000000000000000000000000..07142f1fc21094c20ad66d6f54cd98813f72bcb5 --- /dev/null +++ b/video/n7cOlBxtKSo.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2eaca51ece9c797c7f10ee7fbbc0d526b7a821ad7cc94ece3584b50065afc5ec +size 104027823 diff --git a/video/nkc-MUJgNfQ.mkv b/video/nkc-MUJgNfQ.mkv new file mode 100644 index 0000000000000000000000000000000000000000..db3774ca1dabbb67bac5410da13af34b8424ecdd --- /dev/null +++ b/video/nkc-MUJgNfQ.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2d34a1647a67e1970a7f54d75a86b2de7a873b1ad9eebedee3a396e7132bc8ab +size 87789843 diff --git a/video/no-DgUnLZxo.mp4 b/video/no-DgUnLZxo.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..7334f269d7b4658453a9f87f66512b03edc2b8b9 --- /dev/null +++ b/video/no-DgUnLZxo.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:60a55b9bbf06260672109e53f508f29e8a6654c9f1d30f72af24684173d43a6b +size 59417215 diff --git a/video/no-O694RwVw.mp4 b/video/no-O694RwVw.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..067fcdf660df95cb2d57e1939e97bf0f8bdd0e2a --- /dev/null +++ b/video/no-O694RwVw.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6c3dd593693600c3153ad2054305e18946bac73e651bef7f04a4cd70440b95c6 +size 30583762 diff --git a/video/nq9WnmCGoFQ.mp4 b/video/nq9WnmCGoFQ.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c3d11f39ecf81814fe6c228b079866cc818b4e51 --- /dev/null +++ b/video/nq9WnmCGoFQ.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b1f517fdcb8305c011044d416b6a6dd7ff67eef8fa219244693730de20466d7a +size 15113782 diff --git a/video/o-zQziQEKyc.webm b/video/o-zQziQEKyc.webm new file mode 100644 index 0000000000000000000000000000000000000000..fc063428b370b59607079d3649eb34eb4efcc0fd --- /dev/null +++ b/video/o-zQziQEKyc.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e11026833afb5bc071cd409f8bf1c8599f843caaf9efd38300b7e062576652d6 +size 40427549 diff --git a/video/oDDBrbaWn4k.webm b/video/oDDBrbaWn4k.webm new file mode 100644 index 0000000000000000000000000000000000000000..51f328c1c37253a51428f559ad09deffc7f71c7b --- /dev/null +++ b/video/oDDBrbaWn4k.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b27c64cce9aaa8f5801c4ee7d38ec08dda837c6891b79e24c8d9c89eb5752842 +size 38754097 diff --git a/video/oMnEn7epGUs.webm b/video/oMnEn7epGUs.webm new file mode 100644 index 0000000000000000000000000000000000000000..cd8181715460489b94ceadcadca934c0fb6800c7 --- /dev/null +++ b/video/oMnEn7epGUs.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:cef2fad0e5ddead6cfef400b885532da28f8a924759e06a5332f3a15b1fa4d84 +size 231192380 diff --git a/video/ow8_2T0QI6U.webm b/video/ow8_2T0QI6U.webm new file mode 100644 index 0000000000000000000000000000000000000000..fd79b77ab063b1ef1c29d59ed111edbe021eae8b --- /dev/null +++ b/video/ow8_2T0QI6U.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3ee0ab88e6ae5c0803178498f7518d99599ed64d50642e8a5b2e0ea2e03eb852 +size 170678050 diff --git a/video/oyK7yErdZz0.mkv b/video/oyK7yErdZz0.mkv new file mode 100644 index 0000000000000000000000000000000000000000..a3ed388321cac4aa6e5147d2ec53bced36685926 --- /dev/null +++ b/video/oyK7yErdZz0.mkv @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:df15a9ec348d07b15ba989f179db3a86494d487a8cee137d981c2a4157792dd1 +size 151161546 diff --git a/video/p00zsi71t6I.webm b/video/p00zsi71t6I.webm new file mode 100644 index 0000000000000000000000000000000000000000..0744638e7b24004592c3ed1f39d452d2f018898c --- /dev/null +++ b/video/p00zsi71t6I.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5e629cf4043d8d4af50164720964e00cad8c16193edceaa7c8944fb908b926c3 +size 356957926 diff --git a/video/p9Q3tHqf8Pk.mp4 b/video/p9Q3tHqf8Pk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6e240fa2b5ca575de6b2304305fafc4293370f55 --- /dev/null +++ b/video/p9Q3tHqf8Pk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:c1ec37428db6d277ad126bffb901fc44612f9f99b1b76afb24489518170ee1a4 +size 19382764 diff --git a/video/pQgxiQAMTTo.webm b/video/pQgxiQAMTTo.webm new file mode 100644 index 0000000000000000000000000000000000000000..68edb799789122829b1eed2dab69e5422baf2f15 --- /dev/null +++ b/video/pQgxiQAMTTo.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6802bc1a7cf9fcc6c9acf53e31d6269661c1590f59b69cfae9e35c374ee44362 +size 100314361 diff --git a/video/pRJP12-Uww0.webm b/video/pRJP12-Uww0.webm new file mode 100644 index 0000000000000000000000000000000000000000..f91c2a71bbac69f9910f516cce439ab798582edf --- /dev/null +++ b/video/pRJP12-Uww0.webm @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:23468044291addc1e5579ea1f480613f8124c098e4646b05799e6a1435658036 +size 456876615 diff --git a/video/ph_IRXSgg5k.mp4 b/video/ph_IRXSgg5k.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c2f352ae22c6911bca18fef5fd249295c5663693 --- /dev/null +++ b/video/ph_IRXSgg5k.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:fc2e8255b52b0a9a0fc9b70dde681c1abc60b99636cabc174c56c33a8406d031 +size 21077609 diff --git a/video/q4GkZRdGGEI.mp4 b/video/q4GkZRdGGEI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..46bdacd43c8bc014f98c62b4a35d09305fc1256b --- /dev/null +++ b/video/q4GkZRdGGEI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:fda0d721e578ef360cca89b1451d26699aa229162d0a12a12c9be6b87e980532 +size 25774348 diff --git a/video/r4cn92VyHbk.mp4 b/video/r4cn92VyHbk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..e244940910187e171a90d7c43f48cbccf7dcfd17 --- /dev/null +++ b/video/r4cn92VyHbk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:2dcdefd952e9b3c67f818e725b875103b0d92618e6dd4022c6403a8678410fa0 +size 10243262 diff --git a/video/r6vTvfmi0LI.mp4 b/video/r6vTvfmi0LI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..b637b74ddb64e8bd638904a3931917d4ff705abd --- /dev/null +++ b/video/r6vTvfmi0LI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:44852807d7ceab6522db5a4734e7aee5b756cb5912c97d0d1ab5200512769bdb +size 26292974 diff --git a/video/rbCXajpMaiU.mp4 b/video/rbCXajpMaiU.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..a01ef6a07b5fbcdab63557960e1dbc9b0ccd0eab --- /dev/null +++ b/video/rbCXajpMaiU.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:5d44fb21ab2d0fe7a117c11da338debae1151414f0005fe1dda1955f1400b1fe +size 20584716 diff --git a/video/rcBO-3tjtQE.mp4 b/video/rcBO-3tjtQE.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..dc2e7e9dca8b1c28a947a2081c34d54b924d4279 --- /dev/null +++ b/video/rcBO-3tjtQE.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:4ba494b341804d8ace3bd08cc7d14997a39d23d32eb4fc3e75b4264522fd1573 +size 91585537 diff --git a/video/s-r38R6jtgk.mp4 b/video/s-r38R6jtgk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..327f4e9d63c18de60e7565cd21c0ba56b33ef108 --- /dev/null +++ b/video/s-r38R6jtgk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:b971b66ee295117431c4dda82653213c906ca1552e166c5521bab11e80e852e4 +size 20682802 diff --git a/video/sHnL1zqxOBg.mp4 b/video/sHnL1zqxOBg.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..d1406251f9c5707e40a9a750946e6a1aa38c53a7 --- /dev/null +++ b/video/sHnL1zqxOBg.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:974a680fd1887ab2e5f519712e448556fbc373d0f66387f4378df5b58d7e6cdf +size 30520322 diff --git a/video/sS8xkv9-dtQ.mp4 b/video/sS8xkv9-dtQ.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..fc3239c428b5e49637749687f30b9165bbd6e869 --- /dev/null +++ b/video/sS8xkv9-dtQ.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:d4216f9758955c267afe4cadaf57cdc035256768f8de7bdba42ec17270a73f84 +size 15646882 diff --git a/video/sazxUitIq7k.mp4 b/video/sazxUitIq7k.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..df89b43051ddaf5eaa9e30aef448b9b53cf6439b --- /dev/null +++ b/video/sazxUitIq7k.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:3f035109c88510e780437cd1309f23ca8f7eecaca2bc64c474ee2fa7dc2f7c0f +size 30652740 diff --git a/video/tBdwetBS1DA.mp4 b/video/tBdwetBS1DA.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..6b658a3480a8e9607aa351a31c9e31f54d219d7c --- /dev/null +++ b/video/tBdwetBS1DA.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:de79230b89e6e8198fe21f2b45880dbeaa52268f2df76af6d11eaf3bd922200e +size 59133502 diff --git a/video/tVxw8bDV1MI.mp4 b/video/tVxw8bDV1MI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..2766d581da9ec3eedcfce9a4af736ae42b45eddc --- /dev/null +++ b/video/tVxw8bDV1MI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a9b6b30d6b1fd752fd3861837050ad2cdb11f20d7deeeb83de486f7077310be5 +size 22413742 diff --git a/video/u62j1So3Zwo.mp4 b/video/u62j1So3Zwo.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..762ebaba242c48f6a242a89f398eddd4cb979977 --- /dev/null +++ b/video/u62j1So3Zwo.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:18bfd5f08610df04798db4491d8af2f0137815ca6931ca48b7950a286b33fabf +size 33530303 diff --git a/video/uIU4uoeNxnI.mp4 b/video/uIU4uoeNxnI.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..a84b3302d28053f510d581c781cbea65d4d050cf --- /dev/null +++ b/video/uIU4uoeNxnI.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:55f9d786557ea7820351380c353462ae7183c4144e017a80981f221285743292 +size 35791177 diff --git a/video/uMfnJ6TJinc.mp4 b/video/uMfnJ6TJinc.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..250611105c9e85ac5c1660c9f6b0bff1bab82239 --- /dev/null +++ b/video/uMfnJ6TJinc.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:458196598ba7200373bc02b2bf3c8e2c5a798d2bc27e2073d73cec44c5bc2007 +size 10291208 diff --git a/video/vbUlJr1s7qU.mp4 b/video/vbUlJr1s7qU.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..91b9820b2ac955432efd3bb0a02ecd99a5c6fead --- /dev/null +++ b/video/vbUlJr1s7qU.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a7061c36e631efdc09cd8d0e30b05b7cf9ab4811dc3d091f3e3dc7159b6e516d +size 175745127 diff --git a/video/vcMxTGsmAS4.mp4 b/video/vcMxTGsmAS4.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..c86d90d323e9a8b6fd2016882c8b2ccb60c33556 --- /dev/null +++ b/video/vcMxTGsmAS4.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a41376659fb8d10e7470f6ca907cd8af3e04f4ff89d2208d2235d125c89656ca +size 4323659076 diff --git a/video/vkHs_rKdloc.mp4 b/video/vkHs_rKdloc.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..0f7d3c29c9f28ba5ca9af0d521bc10504da48a5e --- /dev/null +++ b/video/vkHs_rKdloc.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:a3ecd99f3da065d33b8be34ca17bdadbb9ecd3acbe2ecdf1fb38b563fdc8ff45 +size 44592375 diff --git a/video/vw8viezKTp8.f313.webm.part b/video/vw8viezKTp8.f313.webm.part new file mode 100644 index 0000000000000000000000000000000000000000..fae1e034cfc0736929941f9b5fffe62f9b1f1e16 --- /dev/null +++ b/video/vw8viezKTp8.f313.webm.part @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:aa19d39d0e812548786b9379c4fc38a2cc04ed4386649edd81e16b4d1bdacfed +size 142226365 diff --git a/video/wLOD-wbRJNs.mp4 b/video/wLOD-wbRJNs.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..fe0e0e88b5ed7a0cde259432e13da7bcec05a137 --- /dev/null +++ b/video/wLOD-wbRJNs.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:0f723aa6406f2b2f7e3c57d5b346ce68426b9bea5879e0440d37f1bbabc1ebfe +size 24807788 diff --git a/video/wWWY6nsYNnA.mp4 b/video/wWWY6nsYNnA.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..b304621a1f1f0766728afd7ddf78912e9387760e --- /dev/null +++ b/video/wWWY6nsYNnA.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:e867a7d5de91265519d5adf6e0a0b244816629808258f9bde970e52af556b2c9 +size 35581421 diff --git a/video/wz0X5cEVHsg.mp4 b/video/wz0X5cEVHsg.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..efb586b9aff263aa0e5517559a19f2dad50832eb --- /dev/null +++ b/video/wz0X5cEVHsg.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:6bbe56ba4f8281726b5ef4e6cc752071587d41627209387dbaf44633496e29a7 +size 16639835 diff --git a/video/xY15DkgH7Aw.mp4 b/video/xY15DkgH7Aw.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..5e134093c96a94498ea7314b9ca70c8b33f6b8b0 --- /dev/null +++ b/video/xY15DkgH7Aw.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:1f961b95af9495b3c05c4feb15dc6bcfc509fb04f80a01b03512c4c8d6cce842 +size 36314706 diff --git a/video/xpcX3B4xE7Q.mp4 b/video/xpcX3B4xE7Q.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..f14e03e952fd2f84e2f94c9a29efd691a27bfbe6 --- /dev/null +++ b/video/xpcX3B4xE7Q.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:667bfb54fa5a019b9f14dac7d563321b82209d687face0ef8551fcc22bc5783b +size 13790648 diff --git a/video/zHV8o9cyVYk.mp4 b/video/zHV8o9cyVYk.mp4 new file mode 100644 index 0000000000000000000000000000000000000000..2b7705ec879291f749c96dd0eb2996509f5661ef --- /dev/null +++ b/video/zHV8o9cyVYk.mp4 @@ -0,0 +1,3 @@ +version https://git-lfs.github.com/spec/v1 +oid sha256:fcc96cd8476769537ddce4c5d93a08f90b0dacbc51b1bc89f7b5f51074436cd9 +size 20772121 diff --git a/youtube_video_download.py b/youtube_video_download.py new file mode 100644 index 0000000000000000000000000000000000000000..15d287ca004338846a2c2f5f2c789991e888749a --- /dev/null +++ b/youtube_video_download.py @@ -0,0 +1,217 @@ +import os +import json +from glob import glob +from yt_dlp import YoutubeDL +import cv2 +# conda install -c conda-forge opencv ffmpeg +# ─── CONFIG ───────────────────────────────────────────────────────────── +SAVE_DIR = "~/videobench_analysis/video" +MINERVA_JSON = "~/videobench_analysis/minerva.json" +LOG_PREFIX = "download_log_v" +LOG_SUFFIX = ".json" +COOKIE_FILE = "~/videobench_analysis/youtube_cookies_laptop.txt" + +os.makedirs(SAVE_DIR, exist_ok=True) + + +# ─── HELPERS ──────────────────────────────────────────────────────────── +def find_video_file(vid): + """Find any file in SAVE_DIR named vid.*""" + matches = glob(os.path.join(SAVE_DIR, f"{vid}.*")) + return matches[0] if matches else None + + +# def is_valid_video(path, check_frames=5): +# cap = cv2.VideoCapture(path) +# if not cap.isOpened(): +# return False + +# # basic metadata checks +# if int(cap.get(cv2.CAP_PROP_FRAME_COUNT)) < 2 \ +# or cap.get(cv2.CAP_PROP_FRAME_WIDTH) <= 0 \ +# or cap.get(cv2.CAP_PROP_FRAME_HEIGHT) <= 0 \ +# or cap.get(cv2.CAP_PROP_FPS) <= 0: +# cap.release() +# return False + +# # try reading a few frames +# valid = False +# for _ in range(check_frames): +# ret, _ = cap.read() +# if ret: +# valid = True +# break + +# cap.release() + +# if not valid: +# print('!') +# return valid + + +import av + +def is_valid_video(path, check_frames=5): + try: + container = av.open(path) + except av.AVError: + # couldn’t open or demux the file + return False + + # grab the first video stream + video_streams = [s for s in container.streams if s.type == "video"] + if not video_streams: + container.close() + return False + stream = video_streams[0] + + # basic metadata checks + # stream.frames may be 0 or None if unknown, so only check if > 0 + if stream.frames and stream.frames < 2: + container.close() + return False + + width = stream.codec_context.width + height = stream.codec_context.height + if width <= 0 or height <= 0: + container.close() + return False + + # average_rate is a Fraction; cast to float + fps = float(stream.average_rate) if stream.average_rate else 0 + if fps <= 0: + container.close() + return False + + # try decoding up to `check_frames` frames + valid = False + frame_iter = container.decode(video=0) + for _ in range(check_frames): + try: + _ = next(frame_iter) + valid = True + break + except StopIteration: + # no more frames + break + except av.AVError: + # decode error + break + + container.close() + + if not valid: + print('!') + return valid + + + +# ─── STEP 1: Load candidates from last log or from minerva.json ──────── +all_logs = sorted(glob(f"{LOG_PREFIX}*{LOG_SUFFIX}")) +if all_logs: + versions = [int(fn[len(LOG_PREFIX):-len(LOG_SUFFIX)]) for fn in all_logs] + last_v = max(versions) + prev_log = f"{LOG_PREFIX}{last_v}{LOG_SUFFIX}" + next_v = last_v + 1 + + with open(prev_log, "r", encoding="utf-8") as f: + prev_entries = json.load(f) + candidate_ids = [e["video_id"] for e in prev_entries if not e.get("success", False)] +else: + next_v = 1 + prev_entries = [] + with open(MINERVA_JSON, "r", encoding="utf-8") as f: + data = json.load(f) + candidate_ids = [item["video_id"] for item in data] + print("MARVINA len:", len(candidate_ids)) + print("MARVINA set len:", len(set(candidate_ids))) + + +with open(MINERVA_JSON, "r", encoding="utf-8") as f: + data = json.load(f) +all_video_ids = [item["video_id"] for item in data] + +# ─── STEP 2: Dedupe & decide which are already good vs. need download ─── +seen = set() +unique_ids = [] +for vid in all_video_ids: + if vid not in seen: + seen.add(vid) + unique_ids.append(vid) + +good_ids = [] +to_download = [] +for vid in unique_ids: + fp = find_video_file(vid) + if fp and is_valid_video(fp): + good_ids.append(vid) + else: + # remove any broken file so yt-dlp will overwrite + if fp: + pass + # os.remove(fp) + to_download.append(vid) + +print(f"Total candidates: {len(unique_ids)}") +print(f" ↳ already valid: {len(good_ids)}") +print(f" ↳ will download: {len(to_download)}") + + +# ─── STEP 3: Seed download_log with past successes & skips ────────────── +download_log = {} +for e in prev_entries: + if e.get("success", False): + vid = e["video_id"] + download_log[vid] = { + "video_id": vid, + "title": e.get("title"), + "success": True, + "skipped": True + } + +# also mark today’s skips +for vid in good_ids: + if vid not in download_log: + download_log[vid] = { + "video_id": vid, + "title": None, + "success": True, + "skipped": True + } + + +# ─── STEP 4: Download loop ───────────────────────────────────────────── +ydl_opts = { + "format": "bestvideo+bestaudio/best", + "outtmpl": os.path.join(SAVE_DIR, "%(id)s.%(ext)s"), + "quiet": True, + "ignoreerrors": True, + "cookiefile": COOKIE_FILE, +} + +with YoutubeDL(ydl_opts) as ydl: + for vid in to_download: + url = f"https://www.youtube.com/watch?v={vid}" + try: + info = ydl.extract_info(url, download=True) + vid_ = info.get("id", vid) + download_log[vid_] = { + "video_id": vid_, + "title": info.get("title", ""), + "success": True + } + except Exception as e: + download_log[vid] = { + "video_id": vid, + "title": None, + "success": False, + "error": str(e) + } + + +# ─── STEP 5: Write new log ───────────────────────────────────────────── +new_log = f"{LOG_PREFIX}{next_v}{LOG_SUFFIX}" +with open(new_log, "w", encoding="utf-8") as f: + json.dump(list(download_log.values()), f, indent=2, ensure_ascii=False) + +print(f"Run complete. {len(to_download)} downloaded/retried; log → {new_log}")