text
stringlengths
12
1.05M
repo_name
stringlengths
5
86
path
stringlengths
4
191
language
stringclasses
1 value
license
stringclasses
15 values
size
int32
12
1.05M
keyword
listlengths
1
23
text_hash
stringlengths
64
64
# -*- coding: utf-8 -*- """This file contains a parser for the Mozilla Firefox history.""" import sqlite3 from plaso.events import time_events from plaso.lib import event from plaso.lib import eventdata from plaso.parsers import sqlite from plaso.parsers.sqlite_plugins import interface # Check SQlite version, bail out early if too old. if sqlite3.sqlite_version_info < (3, 7, 8): raise ImportWarning( u'FirefoxHistoryParser requires at least SQLite version 3.7.8.') class FirefoxPlacesBookmarkAnnotation(time_events.TimestampEvent): """Convenience class for a Firefox bookmark annotation event.""" DATA_TYPE = u'firefox:places:bookmark_annotation' def __init__(self, timestamp, usage, row_id, title, url, content): """Initializes the event object. Args: timestamp: The timestamp value. usage: Timestamp description string. row_id: The identifier of the corresponding row. title: The title of the bookmark folder. url: The bookmarked URL. content: The content of the annotation. """ super(FirefoxPlacesBookmarkAnnotation, self).__init__( timestamp, usage) self.offset = row_id self.title = title self.url = url self.content = content class FirefoxPlacesBookmarkFolder(time_events.TimestampEvent): """Convenience class for a Firefox bookmark folder event.""" DATA_TYPE = u'firefox:places:bookmark_folder' def __init__(self, timestamp, usage, row_id, title): """Initializes the event object. Args: timestamp: The timestamp value. usage: Timestamp description string. row_id: The identifier of the corresponding row. title: The title of the bookmark folder. """ super(FirefoxPlacesBookmarkFolder, self).__init__( timestamp, usage) self.offset = row_id self.title = title class FirefoxPlacesBookmark(time_events.TimestampEvent): """Convenience class for a Firefox bookmark event.""" DATA_TYPE = u'firefox:places:bookmark' # TODO: move to formatter. _TYPES = { 1: u'URL', 2: u'Folder', 3: u'Separator', } _TYPES.setdefault(u'N/A') def __init__( self, timestamp, usage, row_id, bookmark_type, title, url, places_title, hostname, visit_count): """Initializes the event object. Args: timestamp: The timestamp value. usage: Timestamp description string. row_id: The identifier of the corresponding row. bookmark_type: Integer value containing the bookmark type. title: The title of the bookmark folder. url: The bookmarked URL. places_title: The places title. hostname: The hostname. visit_count: The visit count. """ super(FirefoxPlacesBookmark, self).__init__(timestamp, usage) self.offset = row_id self.type = self._TYPES[bookmark_type] self.title = title self.url = url self.places_title = places_title self.host = hostname self.visit_count = visit_count class FirefoxPlacesPageVisitedEvent(event.EventObject): """Convenience class for a Firefox page visited event.""" DATA_TYPE = u'firefox:places:page_visited' def __init__(self, timestamp, row_id, url, title, hostname, visit_count, visit_type, extra): """Initializes the event object. Args: timestamp: The timestamp time value. The timestamp contains the number of microseconds since Jan 1, 1970 00:00:00 UTC. row_id: The identifier of the corresponding row. url: The URL of the visited page. title: The title of the visited page. hostname: The visited hostname. visit_count: The visit count. visit_type: The transition type for the event. extra: A list containing extra event data (TODO refactor). """ super(FirefoxPlacesPageVisitedEvent, self).__init__() self.timestamp = timestamp self.timestamp_desc = eventdata.EventTimestamp.PAGE_VISITED self.offset = row_id self.url = url self.title = title self.host = hostname self.visit_count = visit_count self.visit_type = visit_type if extra: self.extra = extra class FirefoxDownload(time_events.TimestampEvent): """Convenience class for a Firefox download event.""" DATA_TYPE = u'firefox:downloads:download' def __init__(self, timestamp, usage, row_id, name, url, referrer, full_path, temporary_location, received_bytes, total_bytes, mime_type): """Initializes the event object. Args: timestamp: The timestamp value. usage: Timestamp description string. row_id: The identifier of the corresponding row. name: The name of the download. url: The source URL of the download. referrer: The referrer URL of the download. full_path: The full path of the target of the download. temporary_location: The temporary location of the download. received_bytes: The number of bytes received. total_bytes: The total number of bytes of the download. mime_type: The mime type of the download. """ super(FirefoxDownload, self).__init__(timestamp, usage) self.offset = row_id self.name = name self.url = url self.referrer = referrer self.full_path = full_path self.temporary_location = temporary_location self.received_bytes = received_bytes self.total_bytes = total_bytes self.mime_type = mime_type class FirefoxHistoryPlugin(interface.SQLitePlugin): """Parses a Firefox history file. The Firefox history is stored in a SQLite database file named places.sqlite. """ NAME = u'firefox_history' DESCRIPTION = u'Parser for Firefox history SQLite database files.' # Define the needed queries. QUERIES = [ ((u'SELECT moz_historyvisits.id, moz_places.url, moz_places.title, ' u'moz_places.visit_count, moz_historyvisits.visit_date, ' u'moz_historyvisits.from_visit, moz_places.rev_host, ' u'moz_places.hidden, moz_places.typed, moz_historyvisits.visit_type ' u'FROM moz_places, moz_historyvisits ' u'WHERE moz_places.id = moz_historyvisits.place_id'), u'ParsePageVisitedRow'), ((u'SELECT moz_bookmarks.type, moz_bookmarks.title AS bookmark_title, ' u'moz_bookmarks.dateAdded, moz_bookmarks.lastModified, ' u'moz_places.url, moz_places.title AS places_title, ' u'moz_places.rev_host, moz_places.visit_count, moz_bookmarks.id ' u'FROM moz_places, moz_bookmarks ' u'WHERE moz_bookmarks.fk = moz_places.id AND moz_bookmarks.type <> 3'), u'ParseBookmarkRow'), ((u'SELECT moz_items_annos.content, moz_items_annos.dateAdded, ' u'moz_items_annos.lastModified, moz_bookmarks.title, ' u'moz_places.url, moz_places.rev_host, moz_items_annos.id ' u'FROM moz_items_annos, moz_bookmarks, moz_places ' u'WHERE moz_items_annos.item_id = moz_bookmarks.id ' u'AND moz_bookmarks.fk = moz_places.id'), u'ParseBookmarkAnnotationRow'), ((u'SELECT moz_bookmarks.id, moz_bookmarks.title,' u'moz_bookmarks.dateAdded, moz_bookmarks.lastModified ' u'FROM moz_bookmarks WHERE moz_bookmarks.type = 2'), u'ParseBookmarkFolderRow')] # The required tables. REQUIRED_TABLES = frozenset([ u'moz_places', u'moz_historyvisits', u'moz_bookmarks', u'moz_items_annos']) # Cache queries. URL_CACHE_QUERY = ( u'SELECT h.id AS id, p.url, p.rev_host FROM moz_places p, ' u'moz_historyvisits h WHERE p.id = h.place_id') def ParseBookmarkAnnotationRow( self, parser_mediator, row, query=None, **unused_kwargs): """Parses a bookmark annotation row. Args: parser_mediator: A parser mediator object (instance of ParserMediator). row: The row resulting from the query. query: Optional query string. The default is None. """ # Note that pysqlite does not accept a Unicode string in row['string'] and # will raise "IndexError: Index must be int or string". if row['dateAdded']: event_object = FirefoxPlacesBookmarkAnnotation( row['dateAdded'], eventdata.EventTimestamp.ADDED_TIME, row['id'], row['title'], row['url'], row['content']) parser_mediator.ProduceEvent(event_object, query=query) if row['lastModified']: event_object = FirefoxPlacesBookmarkAnnotation( row['lastModified'], eventdata.EventTimestamp.MODIFICATION_TIME, row['id'], row['title'], row['url'], row['content']) parser_mediator.ProduceEvent(event_object, query=query) def ParseBookmarkFolderRow( self, parser_mediator, row, query=None, **unused_kwargs): """Parses a bookmark folder row. Args: parser_mediator: A parser mediator object (instance of ParserMediator). row: The row resulting from the query. query: Optional query string. The default is None. """ # Note that pysqlite does not accept a Unicode string in row['string'] and # will raise "IndexError: Index must be int or string". if not row['title']: title = u'N/A' else: title = row['title'] if row['dateAdded']: event_object = FirefoxPlacesBookmarkFolder( row['dateAdded'], eventdata.EventTimestamp.ADDED_TIME, row['id'], title) parser_mediator.ProduceEvent(event_object, query=query) if row['lastModified']: event_object = FirefoxPlacesBookmarkFolder( row['lastModified'], eventdata.EventTimestamp.MODIFICATION_TIME, row['id'], title) parser_mediator.ProduceEvent(event_object, query=query) def ParseBookmarkRow( self, parser_mediator, row, query=None, **unused_kwargs): """Parses a bookmark row. Args: parser_mediator: A parser mediator object (instance of ParserMediator). row: The row resulting from the query. query: Optional query string. The default is None. """ if row['dateAdded']: event_object = FirefoxPlacesBookmark( row['dateAdded'], eventdata.EventTimestamp.ADDED_TIME, row['id'], row['type'], row['bookmark_title'], row['url'], row['places_title'], getattr(row, u'rev_host', u'N/A'), row['visit_count']) parser_mediator.ProduceEvent(event_object, query=query) if row['lastModified']: event_object = FirefoxPlacesBookmark( row['lastModified'], eventdata.EventTimestamp.MODIFICATION_TIME, row['id'], row['type'], row['bookmark_title'], row['url'], row['places_title'], getattr(row, u'rev_host', u'N/A'), row['visit_count']) parser_mediator.ProduceEvent(event_object, query=query) def ParsePageVisitedRow( self, parser_mediator, row, query=None, cache=None, database=None, **unused_kwargs): """Parses a page visited row. Args: parser_mediator: A parser mediator object (instance of ParserMediator). row: The row resulting from the query. query: Optional query string. The default is None. cache: A cache object (instance of SQLiteCache). database: A database object (instance of SQLiteDatabase). """ # Note that pysqlite does not accept a Unicode string in row['string'] and # will raise "IndexError: Index must be int or string". # TODO: make extra conditional formatting. extras = [] if row['from_visit']: extras.append(u'visited from: {0}'.format( self._GetUrl(row['from_visit'], cache, database))) if row['hidden'] == u'1': extras.append(u'(url hidden)') if row['typed'] == u'1': extras.append(u'(directly typed)') else: extras.append(u'(URL not typed directly)') if row['visit_date']: event_object = FirefoxPlacesPageVisitedEvent( row['visit_date'], row['id'], row['url'], row['title'], self._ReverseHostname(row['rev_host']), row['visit_count'], row['visit_type'], extras) parser_mediator.ProduceEvent(event_object, query=query) def _ReverseHostname(self, hostname): """Reverses the hostname and strips the leading dot. The hostname entry is reversed: moc.elgoog.www. Should be: www.google.com Args: hostname: The reversed hostname. Returns: Reversed string without a leading dot. """ if not hostname: return u'' if len(hostname) > 1: if hostname[-1] == '.': return hostname[::-1][1:] else: return hostname[::-1][0:] return hostname def _GetUrl(self, url_id, cache, database): """Return an URL from a reference to an entry in the from_visit table.""" url_cache_results = cache.GetResults(u'url') if not url_cache_results: cursor = database.cursor result_set = cursor.execute(self.URL_CACHE_QUERY) # Note that pysqlite does not accept a Unicode string in row['string'] and # will raise "IndexError: Index must be int or string". cache.CacheQueryResults( result_set, 'url', 'id', ('url', 'rev_host')) url_cache_results = cache.GetResults(u'url') url, reverse_host = url_cache_results.get(url_id, [u'', u'']) if not url: return u'' hostname = self._ReverseHostname(reverse_host) return u'{:s} ({:s})'.format(url, hostname) class FirefoxDownloadsPlugin(interface.SQLitePlugin): """Parses a Firefox downloads file. The Firefox downloads history is stored in a SQLite database file named downloads.sqlite. """ NAME = u'firefox_downloads' DESCRIPTION = u'Parser for Firefox downloads SQLite database files.' # Define the needed queries. QUERIES = [ ((u'SELECT moz_downloads.id, moz_downloads.name, moz_downloads.source, ' u'moz_downloads.target, moz_downloads.tempPath, ' u'moz_downloads.startTime, moz_downloads.endTime, moz_downloads.state, ' u'moz_downloads.referrer, moz_downloads.currBytes, ' u'moz_downloads.maxBytes, moz_downloads.mimeType ' u'FROM moz_downloads'), u'ParseDownloadsRow')] # The required tables. REQUIRED_TABLES = frozenset([u'moz_downloads']) def ParseDownloadsRow( self, parser_mediator, row, query=None, **unused_kwargs): """Parses a downloads row. Args: parser_mediator: A parser mediator object (instance of ParserMediator). row: The row resulting from the query. query: Optional query string. The default is None. """ # Note that pysqlite does not accept a Unicode string in row['string'] and # will raise "IndexError: Index must be int or string". if row['startTime']: event_object = FirefoxDownload( row['startTime'], eventdata.EventTimestamp.START_TIME, row['id'], row['name'], row['source'], row['referrer'], row['target'], row['tempPath'], row['currBytes'], row['maxBytes'], row['mimeType']) parser_mediator.ProduceEvent(event_object, query=query) if row['endTime']: event_object = FirefoxDownload( row['endTime'], eventdata.EventTimestamp.END_TIME, row['id'], row['name'], row['source'], row['referrer'], row['target'], row['tempPath'], row['currBytes'], row['maxBytes'], row['mimeType']) parser_mediator.ProduceEvent(event_object, query=query) sqlite.SQLiteParser.RegisterPlugins([ FirefoxHistoryPlugin, FirefoxDownloadsPlugin])
jorik041/plaso
plaso/parsers/sqlite_plugins/firefox.py
Python
apache-2.0
15,322
[ "VisIt" ]
ca9a9a55d281cfc86b4f22c18e2ce9bd125499d30588f20236c008f1f7bf1a42
# # Copyright 2011-2013 Blender Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # <pep8 compliant> import bpy from bpy.props import (BoolProperty, EnumProperty, FloatProperty, IntProperty, PointerProperty) # enums import _cycles enum_devices = ( ('CPU', "CPU", "Use CPU for rendering"), ('GPU', "GPU Compute", "Use GPU compute device for rendering, configured in user preferences"), ) if _cycles.with_network: enum_devices += (('NETWORK', "Networked Device", "Use networked device for rendering"),) enum_feature_set = ( ('SUPPORTED', "Supported", "Only use finished and supported features"), ('EXPERIMENTAL', "Experimental", "Use experimental and incomplete features that might be broken or change in the future", 'ERROR', 1), ) enum_displacement_methods = ( ('BUMP', "Bump", "Bump mapping to simulate the appearance of displacement"), ('TRUE', "True", "Use true displacement only, requires fine subdivision"), ('BOTH', "Both", "Combination of displacement and bump mapping"), ) enum_bvh_types = ( ('DYNAMIC_BVH', "Dynamic BVH", "Objects can be individually updated, at the cost of slower render time"), ('STATIC_BVH', "Static BVH", "Any object modification requires a complete BVH rebuild, but renders faster"), ) enum_filter_types = ( ('BOX', "Box", "Box filter"), ('GAUSSIAN', "Gaussian", "Gaussian filter"), ('BLACKMAN_HARRIS', "Blackman-Harris", "Blackman-Harris filter"), ) enum_aperture_types = ( ('RADIUS', "Radius", "Directly change the size of the aperture"), ('FSTOP', "F-stop", "Change the size of the aperture by f-stop"), ) enum_panorama_types = ( ('EQUIRECTANGULAR', "Equirectangular", "Render the scene with a spherical camera, also known as Lat Long panorama"), ('FISHEYE_EQUIDISTANT', "Fisheye Equidistant", "Ideal for fulldomes, ignore the sensor dimensions"), ('FISHEYE_EQUISOLID', "Fisheye Equisolid", "Similar to most fisheye modern lens, takes sensor dimensions into consideration"), ('MIRRORBALL', "Mirror Ball", "Uses the mirror ball mapping"), ) enum_curve_primitives = ( ('TRIANGLES', "Triangles", "Create triangle geometry around strands"), ('LINE_SEGMENTS', "Line Segments", "Use line segment primitives"), ('CURVE_SEGMENTS', "Curve Segments", "Use segmented cardinal curve primitives"), ) enum_triangle_curves = ( ('CAMERA_TRIANGLES', "Planes", "Create individual triangles forming planes that face camera"), ('TESSELLATED_TRIANGLES', "Tessellated", "Create mesh surrounding each strand"), ) enum_curve_shape = ( ('RIBBONS', "Ribbons", "Ignore thickness of each strand"), ('THICK', "Thick", "Use thickness of strand when rendering"), ) enum_tile_order = ( ('CENTER', "Center", "Render from center to the edges"), ('RIGHT_TO_LEFT', "Right to Left", "Render from right to left"), ('LEFT_TO_RIGHT', "Left to Right", "Render from left to right"), ('TOP_TO_BOTTOM', "Top to Bottom", "Render from top to bottom"), ('BOTTOM_TO_TOP', "Bottom to Top", "Render from bottom to top"), ) enum_use_layer_samples = ( ('USE', "Use", "Per render layer number of samples override scene samples"), ('BOUNDED', "Bounded", "Bound per render layer number of samples by global samples"), ('IGNORE', "Ignore", "Ignore per render layer number of samples"), ) enum_sampling_pattern = ( ('SOBOL', "Sobol", "Use Sobol random sampling pattern"), ('CORRELATED_MUTI_JITTER', "Correlated Multi-Jitter", "Use Correlated Multi-Jitter random sampling pattern"), ) enum_integrator = ( ('BRANCHED_PATH', "Branched Path Tracing", "Path tracing integrator that branches on the first bounce, giving more control over the number of light and material samples"), ('PATH', "Path Tracing", "Pure path tracing integrator"), ) enum_volume_sampling = ( ('DISTANCE', "Distance", "Use distance sampling, best for dense volumes with lights far away"), ('EQUIANGULAR', "Equiangular", "Use equiangular sampling, best for volumes with low density with light inside or near the volume"), ('MULTIPLE_IMPORTANCE', "Multiple Importance", "Combine distance and equi-angular sampling for volumes where neither method is ideal"), ) enum_volume_interpolation = ( ('LINEAR', "Linear", "Good smoothness and speed"), ('CUBIC', "Cubic", "Smoothed high quality interpolation, but slower") ) class CyclesRenderSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Scene.cycles = PointerProperty( name="Cycles Render Settings", description="Cycles render settings", type=cls, ) cls.device = EnumProperty( name="Device", description="Device to use for rendering", items=enum_devices, default='CPU', ) cls.feature_set = EnumProperty( name="Feature Set", description="Feature set to use for rendering", items=enum_feature_set, default='SUPPORTED', ) cls.shading_system = BoolProperty( name="Open Shading Language", description="Use Open Shading Language (CPU rendering only)", ) cls.progressive = EnumProperty( name="Integrator", description="Method to sample lights and materials", items=enum_integrator, default='PATH', ) cls.use_square_samples = BoolProperty( name="Square Samples", description="Square sampling values for easier artist control", default=False, ) cls.samples = IntProperty( name="Samples", description="Number of samples to render for each pixel", min=1, max=2147483647, default=10, ) cls.preview_samples = IntProperty( name="Preview Samples", description="Number of samples to render in the viewport, unlimited if 0", min=0, max=2147483647, default=10, ) cls.preview_pause = BoolProperty( name="Pause Preview", description="Pause all viewport preview renders", default=False, ) cls.preview_active_layer = BoolProperty( name="Preview Active Layer", description="Preview active render layer in viewport", default=False, ) cls.aa_samples = IntProperty( name="AA Samples", description="Number of antialiasing samples to render for each pixel", min=1, max=10000, default=4, ) cls.preview_aa_samples = IntProperty( name="AA Samples", description="Number of antialiasing samples to render in the viewport, unlimited if 0", min=0, max=10000, default=4, ) cls.diffuse_samples = IntProperty( name="Diffuse Samples", description="Number of diffuse bounce samples to render for each AA sample", min=1, max=10000, default=1, ) cls.glossy_samples = IntProperty( name="Glossy Samples", description="Number of glossy bounce samples to render for each AA sample", min=1, max=10000, default=1, ) cls.transmission_samples = IntProperty( name="Transmission Samples", description="Number of transmission bounce samples to render for each AA sample", min=1, max=10000, default=1, ) cls.ao_samples = IntProperty( name="Ambient Occlusion Samples", description="Number of ambient occlusion samples to render for each AA sample", min=1, max=10000, default=1, ) cls.mesh_light_samples = IntProperty( name="Mesh Light Samples", description="Number of mesh emission light samples to render for each AA sample", min=1, max=10000, default=1, ) cls.subsurface_samples = IntProperty( name="Subsurface Samples", description="Number of subsurface scattering samples to render for each AA sample", min=1, max=10000, default=1, ) cls.volume_samples = IntProperty( name="Volume Samples", description="Number of volume scattering samples to render for each AA sample", min=1, max=10000, default=0, ) cls.sampling_pattern = EnumProperty( name="Sampling Pattern", description="Random sampling pattern used by the integrator", items=enum_sampling_pattern, default='SOBOL', ) cls.use_layer_samples = EnumProperty( name="Layer Samples", description="How to use per render layer sample settings", items=enum_use_layer_samples, default='USE', ) cls.sample_all_lights_direct = BoolProperty( name="Sample All Direct Lights", description="Sample all lights (for direct samples), rather than randomly picking one", default=True, ) cls.sample_all_lights_indirect = BoolProperty( name="Sample All Indirect Lights", description="Sample all lights (for indirect samples), rather than randomly picking one", default=True, ) cls.caustics_reflective = BoolProperty( name="Reflective Caustics", description="Use reflective caustics, resulting in a brighter image (more noise but added realism)", default=True, ) cls.caustics_refractive = BoolProperty( name="Refractive Caustics", description="Use refractive caustics, resulting in a brighter image (more noise but added realism)", default=True, ) cls.blur_glossy = FloatProperty( name="Filter Glossy", description="Adaptively blur glossy shaders after blurry bounces, " "to reduce noise at the cost of accuracy", min=0.0, max=10.0, default=0.0, ) cls.min_bounces = IntProperty( name="Min Bounces", description="Minimum number of bounces, setting this lower " "than the maximum enables probabilistic path " "termination (faster but noisier)", min=0, max=1024, default=3, ) cls.max_bounces = IntProperty( name="Max Bounces", description="Total maximum number of bounces", min=0, max=1024, default=12, ) cls.diffuse_bounces = IntProperty( name="Diffuse Bounces", description="Maximum number of diffuse reflection bounces, bounded by total maximum", min=0, max=1024, default=4, ) cls.glossy_bounces = IntProperty( name="Glossy Bounces", description="Maximum number of glossy reflection bounces, bounded by total maximum", min=0, max=1024, default=4, ) cls.transmission_bounces = IntProperty( name="Transmission Bounces", description="Maximum number of transmission bounces, bounded by total maximum", min=0, max=1024, default=12, ) cls.volume_bounces = IntProperty( name="Volume Bounces", description="Maximum number of volumetric scattering events", min=0, max=1024, default=0, ) cls.transparent_min_bounces = IntProperty( name="Transparent Min Bounces", description="Minimum number of transparent bounces, setting " "this lower than the maximum enables " "probabilistic path termination (faster but " "noisier)", min=0, max=1024, default=8, ) cls.transparent_max_bounces = IntProperty( name="Transparent Max Bounces", description="Maximum number of transparent bounces", min=0, max=1024, default=8, ) cls.use_transparent_shadows = BoolProperty( name="Transparent Shadows", description="Use transparency of surfaces for rendering shadows", default=True, ) cls.volume_step_size = FloatProperty( name="Step Size", description="Distance between volume shader samples when rendering the volume " "(lower values give more accurate and detailed results, but also increased render time)", default=0.1, min=0.0000001, max=100000.0, soft_min=0.01, soft_max=1.0 ) cls.volume_max_steps = IntProperty( name="Max Steps", description="Maximum number of steps through the volume before giving up, " "to avoid extremely long render times with big objects or small step sizes", default=1024, min=2, max=65536 ) cls.film_exposure = FloatProperty( name="Exposure", description="Image brightness scale", min=0.0, max=10.0, default=1.0, ) cls.film_transparent = BoolProperty( name="Transparent", description="World background is transparent with premultiplied alpha", default=False, ) cls.filter_type = EnumProperty( name="Filter Type", description="Pixel filter type", items=enum_filter_types, default='GAUSSIAN', ) cls.filter_width = FloatProperty( name="Filter Width", description="Pixel filter width", min=0.01, max=10.0, default=1.5, ) cls.seed = IntProperty( name="Seed", description="Seed value for integrator to get different noise patterns", min=0, max=2147483647, default=0, ) cls.use_animated_seed = BoolProperty( name="Use Animated Seed", description="Use different seed values (and hence noise patterns) at different frames", default=False, ) cls.sample_clamp_direct = FloatProperty( name="Clamp Direct", description="If non-zero, the maximum value for a direct sample, " "higher values will be scaled down to avoid too " "much noise and slow convergence at the cost of accuracy", min=0.0, max=1e8, default=0.0, ) cls.sample_clamp_indirect = FloatProperty( name="Clamp Indirect", description="If non-zero, the maximum value for an indirect sample, " "higher values will be scaled down to avoid too " "much noise and slow convergence at the cost of accuracy", min=0.0, max=1e8, default=0.0, ) cls.debug_tile_size = IntProperty( name="Tile Size", description="", min=1, max=4096, default=1024, ) cls.preview_start_resolution = IntProperty( name="Start Resolution", description="Resolution to start rendering preview at, " "progressively increasing it to the full viewport size", min=8, max=16384, default=64, ) cls.debug_reset_timeout = FloatProperty( name="Reset timeout", description="", min=0.01, max=10.0, default=0.1, ) cls.debug_cancel_timeout = FloatProperty( name="Cancel timeout", description="", min=0.01, max=10.0, default=0.1, ) cls.debug_text_timeout = FloatProperty( name="Text timeout", description="", min=0.01, max=10.0, default=1.0, ) cls.debug_bvh_type = EnumProperty( name="Viewport BVH Type", description="Choose between faster updates, or faster render", items=enum_bvh_types, default='DYNAMIC_BVH', ) cls.debug_use_spatial_splits = BoolProperty( name="Use Spatial Splits", description="Use BVH spatial splits: longer builder time, faster render", default=False, ) cls.tile_order = EnumProperty( name="Tile Order", description="Tile order for rendering", items=enum_tile_order, default='CENTER', options=set(), # Not animatable! ) cls.use_progressive_refine = BoolProperty( name="Progressive Refine", description="Instead of rendering each tile until it is finished, " "refine the whole image progressively " "(this renders somewhat slower, " "but time can be saved by manually stopping the render when the noise is low enough)", default=False, ) cls.bake_type = EnumProperty( name="Bake Type", default='COMBINED', description="Type of pass to bake", items=( ('COMBINED', "Combined", ""), ('AO', "Ambient Occlusion", ""), ('SHADOW', "Shadow", ""), ('NORMAL', "Normal", ""), ('UV', "UV", ""), ('EMIT', "Emit", ""), ('ENVIRONMENT', "Environment", ""), ('DIFFUSE_DIRECT', "Diffuse Direct", ""), ('DIFFUSE_INDIRECT', "Diffuse Indirect", ""), ('DIFFUSE_COLOR', "Diffuse Color", ""), ('GLOSSY_DIRECT', "Glossy Direct", ""), ('GLOSSY_INDIRECT', "Glossy Indirect", ""), ('GLOSSY_COLOR', "Glossy Color", ""), ('TRANSMISSION_DIRECT', "Transmission Direct", ""), ('TRANSMISSION_INDIRECT', "Transmission Indirect", ""), ('TRANSMISSION_COLOR', "Transmission Color", ""), ('SUBSURFACE_DIRECT', "Subsurface Direct", ""), ('SUBSURFACE_INDIRECT', "Subsurface Indirect", ""), ('SUBSURFACE_COLOR', "Subsurface Color", ""), ), ) cls.use_camera_cull = BoolProperty( name="Use Camera Cull", description="Allow objects to be culled based on the camera frustum", default=False, ) cls.camera_cull_margin = FloatProperty( name="Camera Cull Margin", description="Margin for the camera space culling", default=0.1, min=0.0, max=5.0 ) cls.motion_blur_position = EnumProperty( name="Motion Blur Position", default='CENTER', description="Offset for the shutter's time interval, allows to change the motion blur trails", items=( ('START', "Start on Frame", "The shutter opens at the current frame"), ('CENTER', "Center on Frame", "The shutter is open during the current frame"), ('END', "End on Frame", "The shutter closes at the current frame"), ), ) @classmethod def unregister(cls): del bpy.types.Scene.cycles class CyclesCameraSettings(bpy.types.PropertyGroup): @classmethod def register(cls): import math bpy.types.Camera.cycles = PointerProperty( name="Cycles Camera Settings", description="Cycles camera settings", type=cls, ) cls.aperture_type = EnumProperty( name="Aperture Type", description="Use f-stop number or aperture radius", items=enum_aperture_types, default='RADIUS', ) cls.aperture_fstop = FloatProperty( name="Aperture f-stop", description="F-stop ratio (lower numbers give more defocus, higher numbers give a sharper image)", min=0.0, soft_min=0.1, soft_max=64.0, default=5.6, step=10, precision=1, ) cls.aperture_size = FloatProperty( name="Aperture Size", description="Radius of the aperture for depth of field (higher values give more defocus)", min=0.0, soft_max=10.0, default=0.0, step=1, precision=4, subtype='DISTANCE', ) cls.aperture_blades = IntProperty( name="Aperture Blades", description="Number of blades in aperture for polygonal bokeh (at least 3)", min=0, max=100, default=0, ) cls.aperture_rotation = FloatProperty( name="Aperture Rotation", description="Rotation of blades in aperture", soft_min=-math.pi, soft_max=math.pi, subtype='ANGLE', default=0, ) cls.aperture_ratio = FloatProperty( name="Aperture Ratio", description="Distortion to simulate anamorphic lens bokeh", min=0.01, soft_min=1.0, soft_max=2.0, default=1.0, precision=4, ) cls.panorama_type = EnumProperty( name="Panorama Type", description="Distortion to use for the calculation", items=enum_panorama_types, default='FISHEYE_EQUISOLID', ) cls.fisheye_fov = FloatProperty( name="Field of View", description="Field of view for the fisheye lens", min=0.1745, soft_max=2.0 * math.pi, max=10.0 * math.pi, subtype='ANGLE', default=math.pi, ) cls.fisheye_lens = FloatProperty( name="Fisheye Lens", description="Lens focal length (mm)", min=0.01, soft_max=15.0, max=100.0, default=10.5, ) cls.latitude_min = FloatProperty( name="Min Latitude", description="Minimum latitude (vertical angle) for the equirectangular lens", min=-0.5 * math.pi, max=0.5 * math.pi, subtype='ANGLE', default=-0.5 * math.pi, ) cls.latitude_max = FloatProperty( name="Max Latitude", description="Maximum latitude (vertical angle) for the equirectangular lens", min=-0.5 * math.pi, max=0.5 * math.pi, subtype='ANGLE', default=0.5 * math.pi, ) cls.longitude_min = FloatProperty( name="Min Longitude", description="Minimum longitude (horizontal angle) for the equirectangular lens", min=-math.pi, max=math.pi, subtype='ANGLE', default=-math.pi, ) cls.longitude_max = FloatProperty( name="Max Longitude", description="Maximum longitude (horizontal angle) for the equirectangular lens", min=-math.pi, max=math.pi, subtype='ANGLE', default=math.pi, ) @classmethod def unregister(cls): del bpy.types.Camera.cycles class CyclesMaterialSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Material.cycles = PointerProperty( name="Cycles Material Settings", description="Cycles material settings", type=cls, ) cls.sample_as_light = BoolProperty( name="Multiple Importance Sample", description="Use multiple importance sampling for this material, " "disabling may reduce overall noise for large " "objects that emit little light compared to other light sources", default=True, ) cls.use_transparent_shadow = BoolProperty( name="Transparent Shadows", description="Use transparent shadows for this material if it contains a Transparent BSDF, " "disabling will render faster but not give accurate shadows", default=True, ) cls.homogeneous_volume = BoolProperty( name="Homogeneous Volume", description="When using volume rendering, assume volume has the same density everywhere " "(not using any textures), for faster rendering", default=False, ) cls.volume_sampling = EnumProperty( name="Volume Sampling", description="Sampling method to use for volumes", items=enum_volume_sampling, default='DISTANCE', ) cls.volume_interpolation = EnumProperty( name="Volume Interpolation", description="Interpolation method to use for smoke/fire volumes", items=enum_volume_interpolation, default='LINEAR', ) @classmethod def unregister(cls): del bpy.types.Material.cycles class CyclesLampSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Lamp.cycles = PointerProperty( name="Cycles Lamp Settings", description="Cycles lamp settings", type=cls, ) cls.cast_shadow = BoolProperty( name="Cast Shadow", description="Lamp casts shadows", default=True, ) cls.samples = IntProperty( name="Samples", description="Number of light samples to render for each AA sample", min=1, max=10000, default=1, ) cls.max_bounces = IntProperty( name="Max Bounces", description="Maximum number of bounces the light will contribute to the render", min=0, max=1024, default=1024, ) cls.use_multiple_importance_sampling = BoolProperty( name="Multiple Importance Sample", description="Use multiple importance sampling for the lamp, " "reduces noise for area lamps and sharp glossy materials", default=False, ) cls.is_portal = BoolProperty( name="Is Portal", description="Use this area lamp to guide sampling of the background, " "note that this will make the lamp invisible", default=False, ) @classmethod def unregister(cls): del bpy.types.Lamp.cycles class CyclesWorldSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.World.cycles = PointerProperty( name="Cycles World Settings", description="Cycles world settings", type=cls, ) cls.sample_as_light = BoolProperty( name="Multiple Importance Sample", description="Use multiple importance sampling for the environment, " "enabling for non-solid colors is recommended", default=False, ) cls.sample_map_resolution = IntProperty( name="Map Resolution", description="Importance map size is resolution x resolution; " "higher values potentially produce less noise, at the cost of memory and speed", min=4, max=8192, default=256, ) cls.samples = IntProperty( name="Samples", description="Number of light samples to render for each AA sample", min=1, max=10000, default=4, ) cls.max_bounces = IntProperty( name="Max Bounces", description="Maximum number of bounces the background light will contribute to the render", min=0, max=1024, default=1024, ) cls.homogeneous_volume = BoolProperty( name="Homogeneous Volume", description="When using volume rendering, assume volume has the same density everywhere" "(not using any textures), for faster rendering", default=False, ) cls.volume_sampling = EnumProperty( name="Volume Sampling", description="Sampling method to use for volumes", items=enum_volume_sampling, default='EQUIANGULAR', ) cls.volume_interpolation = EnumProperty( name="Volume Interpolation", description="Interpolation method to use for volumes", items=enum_volume_interpolation, default='LINEAR', ) @classmethod def unregister(cls): del bpy.types.World.cycles class CyclesVisibilitySettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Object.cycles_visibility = PointerProperty( name="Cycles Visibility Settings", description="Cycles visibility settings", type=cls, ) bpy.types.World.cycles_visibility = PointerProperty( name="Cycles Visibility Settings", description="Cycles visibility settings", type=cls, ) cls.camera = BoolProperty( name="Camera", description="Object visibility for camera rays", default=True, ) cls.diffuse = BoolProperty( name="Diffuse", description="Object visibility for diffuse reflection rays", default=True, ) cls.glossy = BoolProperty( name="Glossy", description="Object visibility for glossy reflection rays", default=True, ) cls.transmission = BoolProperty( name="Transmission", description="Object visibility for transmission rays", default=True, ) cls.shadow = BoolProperty( name="Shadow", description="Object visibility for shadow rays", default=True, ) cls.scatter = BoolProperty( name="Volume Scatter", description="Object visibility for volume scatter rays", default=True, ) @classmethod def unregister(cls): del bpy.types.Object.cycles_visibility del bpy.types.World.cycles_visibility class CyclesMeshSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Mesh.cycles = PointerProperty( name="Cycles Mesh Settings", description="Cycles mesh settings", type=cls, ) bpy.types.Curve.cycles = PointerProperty( name="Cycles Mesh Settings", description="Cycles mesh settings", type=cls, ) bpy.types.MetaBall.cycles = PointerProperty( name="Cycles Mesh Settings", description="Cycles mesh settings", type=cls, ) cls.displacement_method = EnumProperty( name="Displacement Method", description="Method to use for the displacement", items=enum_displacement_methods, default='BUMP', ) cls.use_subdivision = BoolProperty( name="Use Subdivision", description="Subdivide mesh for rendering", default=False, ) cls.dicing_rate = FloatProperty( name="Dicing Rate", description="", min=0.001, max=1000.0, default=1.0, ) @classmethod def unregister(cls): del bpy.types.Mesh.cycles del bpy.types.Curve.cycles del bpy.types.MetaBall.cycles class CyclesObjectBlurSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Object.cycles = PointerProperty( name="Cycles Object Settings", description="Cycles object settings", type=cls, ) cls.use_motion_blur = BoolProperty( name="Use Motion Blur", description="Use motion blur for this object", default=True, ) cls.use_deform_motion = BoolProperty( name="Use Deformation Motion", description="Use deformation motion blur for this object", default=True, ) cls.motion_steps = IntProperty( name="Motion Steps", description="Control accuracy of deformation motion blur, more steps gives more memory usage (actual number of steps is 2^(steps - 1))", min=1, soft_max=8, default=1, ) cls.use_camera_cull = BoolProperty( name="Use Camera Cull", description="Allow this object and its duplicators to be culled by camera space culling", default=False, ) @classmethod def unregister(cls): del bpy.types.Object.cycles class CyclesCurveRenderSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.Scene.cycles_curves = PointerProperty( name="Cycles Hair Rendering Settings", description="Cycles hair rendering settings", type=cls, ) cls.primitive = EnumProperty( name="Primitive", description="Type of primitive used for hair rendering", items=enum_curve_primitives, default='LINE_SEGMENTS', ) cls.shape = EnumProperty( name="Shape", description="Form of hair", items=enum_curve_shape, default='THICK', ) cls.cull_backfacing = BoolProperty( name="Cull back-faces", description="Do not test the back-face of each strand", default=True, ) cls.use_curves = BoolProperty( name="Use Cycles Hair Rendering", description="Activate Cycles hair rendering for particle system", default=True, ) cls.resolution = IntProperty( name="Resolution", description="Resolution of generated mesh", min=3, max=64, default=3, ) cls.minimum_width = FloatProperty( name="Minimal width", description="Minimal pixel width for strands (0 - deactivated)", min=0.0, max=100.0, default=0.0, ) cls.maximum_width = FloatProperty( name="Maximal width", description="Maximum extension that strand radius can be increased by", min=0.0, max=100.0, default=0.1, ) cls.subdivisions = IntProperty( name="Subdivisions", description="Number of subdivisions used in Cardinal curve intersection (power of 2)", min=0, max=24, default=4, ) @classmethod def unregister(cls): del bpy.types.Scene.cycles_curves class CyclesCurveSettings(bpy.types.PropertyGroup): @classmethod def register(cls): bpy.types.ParticleSettings.cycles = PointerProperty( name="Cycles Hair Settings", description="Cycles hair settings", type=cls, ) cls.radius_scale = FloatProperty( name="Radius Scaling", description="Multiplier of width properties", min=0.0, max=1000.0, default=0.01, ) cls.root_width = FloatProperty( name="Root Size", description="Strand's width at root", min=0.0, max=1000.0, default=1.0, ) cls.tip_width = FloatProperty( name="Tip Multiplier", description="Strand's width at tip", min=0.0, max=1000.0, default=0.0, ) cls.shape = FloatProperty( name="Strand Shape", description="Strand shape parameter", min=-1.0, max=1.0, default=0.0, ) cls.use_closetip = BoolProperty( name="Close tip", description="Set tip radius to zero", default=True, ) @classmethod def unregister(cls): del bpy.types.ParticleSettings.cycles def register(): bpy.utils.register_class(CyclesRenderSettings) bpy.utils.register_class(CyclesCameraSettings) bpy.utils.register_class(CyclesMaterialSettings) bpy.utils.register_class(CyclesLampSettings) bpy.utils.register_class(CyclesWorldSettings) bpy.utils.register_class(CyclesVisibilitySettings) bpy.utils.register_class(CyclesMeshSettings) bpy.utils.register_class(CyclesCurveRenderSettings) bpy.utils.register_class(CyclesCurveSettings) def unregister(): bpy.utils.unregister_class(CyclesRenderSettings) bpy.utils.unregister_class(CyclesCameraSettings) bpy.utils.unregister_class(CyclesMaterialSettings) bpy.utils.unregister_class(CyclesLampSettings) bpy.utils.unregister_class(CyclesWorldSettings) bpy.utils.unregister_class(CyclesMeshSettings) bpy.utils.unregister_class(CyclesVisibilitySettings) bpy.utils.unregister_class(CyclesCurveRenderSettings) bpy.utils.unregister_class(CyclesCurveSettings)
Passtechsoft/TPEAlpGen
blender/intern/cycles/blender/addon/properties.py
Python
gpl-3.0
41,098
[ "Gaussian" ]
7dc65d27c9e51d41fcf8ed51f19d5212d046adef84898342eaa9296a4acffa4f
#!/usr/bin/env python from pymatgen.core.periodic_table import all_symbols, Element import urllib def get_nist_data(element): url = "http://physics.nist.gov/cgi-bin/Elements/elInfo.pl?element=%d&context=text" lines = urllib.urlopen(url % element.Z).read().split('\n') data = {} for line in lines: if "Atomic Weight" in line: print line.split()[2] for symbol in all_symbols(): element = Element(symbol) print element.Z print element.symbol print element.name print element.atomic_mass print element.data['Electronic structure']
ldamewood/figures
scripts/periodic_table.py
Python
mit
591
[ "pymatgen" ]
6583a2c309b7def7926557e83ed6aa209a98de8d8e904b0e71f42d4e195e188e
import os import unittest import numpy as np import tensorflow as tf from pymatgen.core import Structure from megnet.data.crystal import (CrystalGraph, CrystalGraphDisordered, CrystalGraphWithBondTypes, get_elemental_embeddings) from megnet.data.graph import GaussianDistance from megnet.utils.general import to_list module_dir = os.path.dirname(os.path.abspath(__file__)) class TestGraph(unittest.TestCase): @classmethod def setUpClass(cls): cls.structures = [ Structure.from_file(os.path.join(module_dir, "cifs", "LiFePO4_mp-19017_computed.cif")), Structure.from_file(os.path.join(module_dir, "cifs", "BaTiO3_mp-2998_computed.cif")), ] def test_crystalgraph(self): cg = CrystalGraph(cutoff=4) graph = cg.convert(self.structures[0]) self.assertEqual(cg.cutoff, 4) keys = set(graph.keys()) self.assertSetEqual({"bond", "atom", "index1", "index2", "state"}, keys) cg2 = CrystalGraph(cutoff=6) self.assertEqual(cg2.cutoff, 6) graph2 = cg2.convert(self.structures[0]) self.assertListEqual(to_list(graph2["state"][0]), [0, 0]) graph3 = cg(self.structures[0]) np.testing.assert_almost_equal(graph["atom"], graph3["atom"]) def test_crystalgraph_disordered(self): cg = CrystalGraphDisordered(cutoff=4.0) graph = cg.convert(self.structures[0]) self.assertEqual(cg.atom_converter.convert(graph["atom"]).shape[1], 16) def test_crystal_graph_with_bond_types(self): graph = { "atom": [11, 8, 8], "index1": [0, 0, 1, 1, 2, 2], "index2": [0, 1, 2, 2, 1, 1], "bond": [0.1, 0.2, 0.3, 0.4, 0.5, 0.6], "state": [[0, 0]], } cgbt = CrystalGraphWithBondTypes(nn_strategy="VoronoiNN") new_graph = cgbt._get_bond_type(graph) self.assertListEqual(to_list(new_graph["bond"]), [2, 1, 0, 0, 0, 0]) def test_convert(self): cg = CrystalGraph(cutoff=4) graph = cg.convert(self.structures[0]) self.assertListEqual(to_list(graph["atom"]), [i.specie.Z for i in self.structures[0]]) def test_get_input(self): cg = CrystalGraph(cutoff=4, bond_converter=GaussianDistance(np.linspace(0, 5, 100), 0.5)) inp = cg.get_input(self.structures[0]) self.assertEqual(len(inp), 7) shapes = [i.shape for i in inp] true_shapes = [(1, 28), (1, 704, 100), (1, 1, 2), (1, 704), (1, 704), (1, 28), (1, 704)] for i, j in zip(shapes, true_shapes): self.assertListEqual(list(i), list(j)) def test_get_flat_data(self): cg = CrystalGraph(cutoff=4) graphs = [cg.convert(i) for i in self.structures] targets = [0.1, 0.2] inp = cg.get_flat_data(graphs, targets) self.assertListEqual([len(i) for i in inp], [2] * 6) def test_get_elemental_embeddings(self): data = get_elemental_embeddings() for k, v in data.items(): self.assertTrue(len(v) == 16) if __name__ == "__main__": unittest.main()
materialsvirtuallab/megnet
megnet/data/tests/test_crystal.py
Python
bsd-3-clause
3,152
[ "CRYSTAL", "pymatgen" ]
6159716b7b6dbaea7ba8b40381f3aa29a2a064b025d8ac79e438b774b52b1bb6
# coding: utf-8 """ Vericred API Vericred's API allows you to search for Health Plans that a specific doctor accepts. ## Getting Started Visit our [Developer Portal](https://developers.vericred.com) to create an account. Once you have created an account, you can create one Application for Production and another for our Sandbox (select the appropriate Plan when you create the Application). ## SDKs Our API follows standard REST conventions, so you can use any HTTP client to integrate with us. You will likely find it easier to use one of our [autogenerated SDKs](https://github.com/vericred/?query=vericred-), which we make available for several common programming languages. ## Authentication To authenticate, pass the API Key you created in the Developer Portal as a `Vericred-Api-Key` header. `curl -H 'Vericred-Api-Key: YOUR_KEY' "https://api.vericred.com/providers?search_term=Foo&zip_code=11215"` ## Versioning Vericred's API default to the latest version. However, if you need a specific version, you can request it with an `Accept-Version` header. The current version is `v3`. Previous versions are `v1` and `v2`. `curl -H 'Vericred-Api-Key: YOUR_KEY' -H 'Accept-Version: v2' "https://api.vericred.com/providers?search_term=Foo&zip_code=11215"` ## Pagination Endpoints that accept `page` and `per_page` parameters are paginated. They expose four additional fields that contain data about your position in the response, namely `Total`, `Per-Page`, `Link`, and `Page` as described in [RFC-5988](https://tools.ietf.org/html/rfc5988). For example, to display 5 results per page and view the second page of a `GET` to `/networks`, your final request would be `GET /networks?....page=2&per_page=5`. ## Sideloading When we return multiple levels of an object graph (e.g. `Provider`s and their `State`s we sideload the associated data. In this example, we would provide an Array of `State`s and a `state_id` for each provider. This is done primarily to reduce the payload size since many of the `Provider`s will share a `State` ``` { providers: [{ id: 1, state_id: 1}, { id: 2, state_id: 1 }], states: [{ id: 1, code: 'NY' }] } ``` If you need the second level of the object graph, you can just match the corresponding id. ## Selecting specific data All endpoints allow you to specify which fields you would like to return. This allows you to limit the response to contain only the data you need. For example, let's take a request that returns the following JSON by default ``` { provider: { id: 1, name: 'John', phone: '1234567890', field_we_dont_care_about: 'value_we_dont_care_about' }, states: [{ id: 1, name: 'New York', code: 'NY', field_we_dont_care_about: 'value_we_dont_care_about' }] } ``` To limit our results to only return the fields we care about, we specify the `select` query string parameter for the corresponding fields in the JSON document. In this case, we want to select `name` and `phone` from the `provider` key, so we would add the parameters `select=provider.name,provider.phone`. We also want the `name` and `code` from the `states` key, so we would add the parameters `select=states.name,states.code`. The id field of each document is always returned whether or not it is requested. Our final request would be `GET /providers/12345?select=provider.name,provider.phone,states.name,states.code` The response would be ``` { provider: { id: 1, name: 'John', phone: '1234567890' }, states: [{ id: 1, name: 'New York', code: 'NY' }] } ``` ## Benefits summary format Benefit cost-share strings are formatted to capture: * Network tiers * Compound or conditional cost-share * Limits on the cost-share * Benefit-specific maximum out-of-pocket costs **Example #1** As an example, we would represent [this Summary of Benefits &amp; Coverage](https://s3.amazonaws.com/vericred-data/SBC/2017/33602TX0780032.pdf) as: * **Hospital stay facility fees**: - Network Provider: `$400 copay/admit plus 20% coinsurance` - Out-of-Network Provider: `$1,500 copay/admit plus 50% coinsurance` - Vericred's format for this benefit: `In-Network: $400 before deductible then 20% after deductible / Out-of-Network: $1,500 before deductible then 50% after deductible` * **Rehabilitation services:** - Network Provider: `20% coinsurance` - Out-of-Network Provider: `50% coinsurance` - Limitations & Exceptions: `35 visit maximum per benefit period combined with Chiropractic care.` - Vericred's format for this benefit: `In-Network: 20% after deductible / Out-of-Network: 50% after deductible | limit: 35 visit(s) per Benefit Period` **Example #2** In [this other Summary of Benefits &amp; Coverage](https://s3.amazonaws.com/vericred-data/SBC/2017/40733CA0110568.pdf), the **specialty_drugs** cost-share has a maximum out-of-pocket for in-network pharmacies. * **Specialty drugs:** - Network Provider: `40% coinsurance up to a $500 maximum for up to a 30 day supply` - Out-of-Network Provider `Not covered` - Vericred's format for this benefit: `In-Network: 40% after deductible, up to $500 per script / Out-of-Network: 100%` **BNF** Here's a description of the benefits summary string, represented as a context-free grammar: ``` root ::= coverage coverage ::= (simple_coverage | tiered_coverage) (space pipe space coverage_modifier)? tiered_coverage ::= tier (space slash space tier)* tier ::= tier_name colon space (tier_coverage | not_applicable) tier_coverage ::= simple_coverage (space (then | or | and) space simple_coverage)* tier_limitation? simple_coverage ::= (pre_coverage_limitation space)? coverage_amount (space post_coverage_limitation)? (comma? space coverage_condition)? coverage_modifier ::= limit_condition colon space (((simple_coverage | simple_limitation) (semicolon space see_carrier_documentation)?) | see_carrier_documentation | waived_if_admitted | shared_across_tiers) waived_if_admitted ::= ("copay" space)? "waived if admitted" simple_limitation ::= pre_coverage_limitation space "copay applies" tier_name ::= "In-Network-Tier-2" | "Out-of-Network" | "In-Network" limit_condition ::= "limit" | "condition" tier_limitation ::= comma space "up to" space (currency | (integer space time_unit plural?)) (space post_coverage_limitation)? coverage_amount ::= currency | unlimited | included | unknown | percentage | (digits space (treatment_unit | time_unit) plural?) pre_coverage_limitation ::= first space digits space time_unit plural? post_coverage_limitation ::= (((then space currency) | "per condition") space)? "per" space (treatment_unit | (integer space time_unit) | time_unit) plural? coverage_condition ::= ("before deductible" | "after deductible" | "penalty" | allowance | "in-state" | "out-of-state") (space allowance)? allowance ::= upto_allowance | after_allowance upto_allowance ::= "up to" space (currency space)? "allowance" after_allowance ::= "after" space (currency space)? "allowance" see_carrier_documentation ::= "see carrier documentation for more information" shared_across_tiers ::= "shared across all tiers" unknown ::= "unknown" unlimited ::= /[uU]nlimited/ included ::= /[iI]ncluded in [mM]edical/ time_unit ::= /[hH]our/ | (((/[cC]alendar/ | /[cC]ontract/) space)? /[yY]ear/) | /[mM]onth/ | /[dD]ay/ | /[wW]eek/ | /[vV]isit/ | /[lL]ifetime/ | ((((/[bB]enefit/ plural?) | /[eE]ligibility/) space)? /[pP]eriod/) treatment_unit ::= /[pP]erson/ | /[gG]roup/ | /[cC]ondition/ | /[sS]cript/ | /[vV]isit/ | /[eE]xam/ | /[iI]tem/ | /[sS]tay/ | /[tT]reatment/ | /[aA]dmission/ | /[eE]pisode/ comma ::= "," colon ::= ":" semicolon ::= ";" pipe ::= "|" slash ::= "/" plural ::= "(s)" | "s" then ::= "then" | ("," space) | space or ::= "or" and ::= "and" not_applicable ::= "Not Applicable" | "N/A" | "NA" first ::= "first" currency ::= "$" number percentage ::= number "%" number ::= float | integer float ::= digits "." digits integer ::= /[0-9]/+ (comma_int | under_int)* comma_int ::= ("," /[0-9]/*3) !"_" under_int ::= ("_" /[0-9]/*3) !"," digits ::= /[0-9]/+ ("_" /[0-9]/+)* space ::= /[ \t]/+ ``` OpenAPI spec version: 1.0.0 Generated by: https://github.com/swagger-api/swagger-codegen.git Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from pprint import pformat from six import iteritems import re class NetworkComparisonResponse(object): """ NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ def __init__(self, networks=None, network_comparisons=None): """ NetworkComparisonResponse - a model defined in Swagger :param dict swaggerTypes: The key is attribute name and the value is attribute type. :param dict attributeMap: The key is attribute name and the value is json key in definition. """ self.swagger_types = { 'networks': 'list[Network]', 'network_comparisons': 'list[NetworkComparison]' } self.attribute_map = { 'networks': 'networks', 'network_comparisons': 'network_comparisons' } self._networks = networks self._network_comparisons = network_comparisons @property def networks(self): """ Gets the networks of this NetworkComparisonResponse. Networks :return: The networks of this NetworkComparisonResponse. :rtype: list[Network] """ return self._networks @networks.setter def networks(self, networks): """ Sets the networks of this NetworkComparisonResponse. Networks :param networks: The networks of this NetworkComparisonResponse. :type: list[Network] """ self._networks = networks @property def network_comparisons(self): """ Gets the network_comparisons of this NetworkComparisonResponse. NetworkComparisons :return: The network_comparisons of this NetworkComparisonResponse. :rtype: list[NetworkComparison] """ return self._network_comparisons @network_comparisons.setter def network_comparisons(self, network_comparisons): """ Sets the network_comparisons of this NetworkComparisonResponse. NetworkComparisons :param network_comparisons: The network_comparisons of this NetworkComparisonResponse. :type: list[NetworkComparison] """ self._network_comparisons = network_comparisons def to_dict(self): """ Returns the model properties as a dict """ result = {} for attr, _ in iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value return result def to_str(self): """ Returns the string representation of the model """ return pformat(self.to_dict()) def __repr__(self): """ For `print` and `pprint` """ return self.to_str() def __eq__(self, other): """ Returns true if both objects are equal """ return self.__dict__ == other.__dict__ def __ne__(self, other): """ Returns true if both objects are not equal """ return not self == other
vericred/vericred-python
vericred_client/models/network_comparison_response.py
Python
apache-2.0
13,134
[ "VisIt" ]
b043509fde9fb0751a3951ed5f557ea9482b9abe11a420930a12369615b6a7b3
from paraview.simple import * import os import sys import numpy as np path = os.getcwd() + "/" file_name = sys.argv[1] + ".e" csv_name = sys.argv[2] + ".csv" offset = int(sys.argv[3]) reader = ExodusIIReader(FileName=path+file_name) tsteps = reader.TimestepValues writer = CreateWriter(path + csv_name , reader) writer.FieldAssociation = "Cells" # or "Points" if len(tsteps) == 0: writer.UpdatePipeline() else: if offset >= 0: writer.UpdatePipeline(time=tsteps[offset]) else: writer.UpdatePipeline(time=tsteps[len(tsteps) + offset]) del writer
jhaase1/zapdos
problems/Schottky_emission/transient/no_ballast/parametric/extra/toCSV2.py
Python
lgpl-2.1
556
[ "ParaView" ]
181f3e22acac6b89e9e63d9e5b62cad009420b54ffaf6cfb1f37e8d3b27a090c
#!/usr/bin/python # -*- coding: utf-8 -*- ''' Python wrapper for librfn. Copyright © 2015 Thomas Unterthiner Licensed under GPL, version 2 or a later (see LICENSE.txt) ''' import os import time import ctypes as ct import numpy as np import matplotlib.pyplot as plt import warnings import sys if sys.version_info < (3,): range = xrange _curdir = os.path.dirname(os.path.realpath(__file__)) _librfn = ct.cdll.LoadLibrary(os.path.join(_curdir, 'librfn.so')) _default_gpu_id = -1 _librfn.calculate_W_cpu.argtypes = [ np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_float] _librfn.train_cpu.restype = ct.c_int _librfn.train_cpu.argtypes = [ np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int ] try: _librfn.calculate_W_gpu.argtypes = [ np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_float, ct.c_int] _librfn.train_gpu.restype = ct.c_int _librfn.train_gpu.argtypes = [ np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), np.ctypeslib.ndpointer(np.float32), ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_float, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int, ct.c_int ] except AttributeError as err: warnings.warn("GPU mode is not available") _input_noise_types = {"dropout": 1, "saltpepper": 2, "gaussian": 3} _activation_types = {"linear": 0, "relu": 1, "leaky": 2, "sigmoid": 3, "tanh": 4} def train_rfn(X, n_hidden, n_iter, etaW, etaP, minP, dropout_rate, input_noise_rate=0.0, startP=0.1, startW=None, l2_weightdecay=0.0, l1_weightdecay=0.0, input_noise_type="saltpepper", activation="relu", h_threshold=0.0, momentum=0.0, applyNewtonUpdate=True, batch_size=-1, seed=None, gpu_id="default"): '''Trains a Rectified Factor Network (RFN). Trains an RFN as explained in "Rectified Factor Networks", Clevert et al., NIPS 2015 Parameters ---------- X : array-like, shape = (n_samples, n_features) Input samples n_hidden : int Number of latent variables to estimate n_iter : int Number of iterations to run the algorithm etaW : float Learning rate of the W parameter etaP : float Learning rate of the Psi parameter (It's probably save to set this to the same value as etaW) minP : float Minimal value for Psi. Should be in 1e-8 - 1e-1 dropout_rate : float in [0, 1) Dropout rate for the latent variables input_noise_rate : float Noise/dropout rate for input variables startW : array-like, shape = (n_hidden, n_features) Optional pre-initialized weights parameters. Useful if one wants to continue training of an old result. l2_weightdecay : float L2 penalty for weight decay l1_weightdecay : float L1 penalty for weight decay input_noise_type : one of 'dropout', 'saltpapper' or 'gaussian' Type of input noise activation : one of ('linear', 'relu', 'leaky', 'sigmoid', 'tanh') Activation function for hidden/latent variables. h_threshold : float Threshhold for rectifying/leaky activations momentum : float Momentum term for learning applyNewtonUpdate : boolean Whether to use a Newton update (default) or a Gradient Descent step. batch_size : int If > 2, this will activate mini-batch learning instead of full batch learning. seed : int Seed for the random number generator gpu_id : int or "cpu" ID of the gpu device to use. If set to "cpu", the calculations will be performed on the CPU instead. Returns ------- A tuple of three elements: W : array-like, shape = (n_hidden, n_features) The weight matrix W used in the paper, used to transform the hidden/latent variables back to visibles. Psi : array-like, shape = (n_features, ) Variance of each input feature dimension (Psi in the paper's formulas) Wout : array-like, shape = (n_hidden, n_features) Weight matrix needed to transform the visible variables back into hidden variables. Normally this is done via `H = np.maximum(0, np.dot(Wout, X.T))` ''' if seed is None: seed = np.uint32(time.time()*100) if gpu_id == "default": gpu_id = _default_gpu_id rng = np.random.RandomState(seed) if startW is None: W = rng.normal(scale=0.01, size=(n_hidden, X.shape[1])).astype(np.float32) W = abs(W) else: W = startW.astype(np.float32) if isinstance(startP, np.ndarray): P = startP else: P = np.array([startP] * X.shape[1], dtype=np.float32) X = X.astype(np.float32, order="C") Wout = np.empty((W.shape[0], W.shape[1]), np.float32) if gpu_id == "cpu": _librfn.train_cpu(X, W, P, X.shape[0], X.shape[1], n_hidden, n_iter, batch_size, etaW, etaP, minP, h_threshold, dropout_rate, input_noise_rate, l2_weightdecay, l1_weightdecay, momentum, _input_noise_types[input_noise_type], _activation_types[activation], 1, applyNewtonUpdate, seed) _librfn.calculate_W_cpu(X, W, P, Wout, X.shape[0], X.shape[1], W.shape[0], _activation_types[activation], 1, h_threshold) else: _librfn.train_gpu(X, W, P, X.shape[0], X.shape[1], n_hidden, n_iter, batch_size, etaW, etaP, minP, h_threshold, dropout_rate, input_noise_rate, l2_weightdecay, l1_weightdecay, momentum, _input_noise_types[input_noise_type], _activation_types[activation], 1, applyNewtonUpdate, seed, gpu_id) _librfn.calculate_W_gpu(X, W, P, Wout, X.shape[0], X.shape[1], W.shape[0], _activation_types[activation], 1, h_threshold, gpu_id) return W, P, Wout
Tamme/mutationalsignaturesNCSUT
RFN/rfn.py
Python
gpl-3.0
6,855
[ "Gaussian" ]
5718f824aff26a5d224e12a45e2c03e3a1ecf28b9395cb04770c5cdd2a2c5e1e
# # Copyright (c) 2015 nexB Inc. and others. All rights reserved. # http://nexb.com and https://github.com/nexB/scancode-toolkit/ # The ScanCode software is licensed under the Apache License version 2.0. # Data generated with ScanCode require an acknowledgment. # ScanCode is a trademark of nexB Inc. # # You may not use this software except in compliance with the License. # You may obtain a copy of the License at: http://apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software distributed # under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR # CONDITIONS OF ANY KIND, either express or implied. See the License for the # specific language governing permissions and limitations under the License. # # When you publish or redistribute any data created with ScanCode or any ScanCode # derivative work, you must accompany this data with the following acknowledgment: # # Generated with ScanCode and provided on an "AS IS" BASIS, WITHOUT WARRANTIES # OR CONDITIONS OF ANY KIND, either express or implied. No content created from # ScanCode should be considered or used as legal advice. Consult an Attorney # for any legal advice. # ScanCode is a free software code scanning tool from nexB Inc. and others. # Visit https://github.com/nexB/scancode-toolkit/ for support and download. from __future__ import absolute_import, print_function import os from commoncode.testcase import FileBasedTesting from textcode import strings class TestStrings(FileBasedTesting): test_data_dir = os.path.join(os.path.dirname(__file__), 'data') def test_to_filter(self): assert strings.filter_string('aw w we ww ') assert not strings.filter_string('w as wew wee wew ') assert strings.filter_string('as we we we ', 2) assert not strings.filter_string('as we we we ', 1) assert not strings.filter_string('asw wew wee wew ') assert strings.filter_strict('asw wew wee wew ') assert strings.filter_string('aaaa') assert not strings.filter_strict('aaaaqa') def test_is_good(self): assert not strings.is_good('aw w we ww ') assert strings.is_good('ww asww wew wee wew ') self.assertFalse(strings.is_good('asw wew wee wew ', strings.filter_strict)) assert strings.is_good('gnu as') assert strings.is_good('gnu as', strings.filter_strict) assert not strings.is_good('aaqa', strings.filter_strict) assert strings.is_good('aaqa') def test_strings_in_file(self): expected = [ u'__text', u'__TEXT', u'__cstring', u'__TEXT', u'__jump_table', u'__IMPORT', u'__textcoal_nt', u'__TEXT', u'_main', u'___i686.get_pc_thunk.bx', u'_setlocale', u'_yyparse', u'/sw/src/fink.build/bison-2.3-1002/bison-2.3/lib/', u'main.c', u'gcc2_compiled.', u'main:F(0,2)', u'int:t(0,2)=r(0,2);-2147483648;2147483647;' ] test_file = self.get_test_loc('strings/basic/main.o') result = list(strings.strings_in_file(test_file)) assert expected == result def test_strings_in_file_does_fail_if_contains_ERROR_string(self): test_file = self.get_test_loc('strings/bin/file_stripped') list(strings.strings_in_file(test_file)) def test_file_strings_is_good(self): expected = [ u'__text', u'__TEXT', u'__cstring', u'__TEXT', u'__jump_table', u'__IMPORT', u'__textcoal_nt', u'__TEXT', u'_main', u'___i686.get_pc_thunk.bx', u'_setlocale', u'_yyparse', u'/sw/src/fink.build/bison-2.3-1002/bison-2.3/lib/', u'main.c', u'gcc2_compiled.', u'main:F(0,2)', u'int:t(0,2)=r(0,2);-2147483648;2147483647;' ] test_file = self.get_test_loc('strings/basic/main.o') result = [s for s in strings.file_strings(test_file) if strings.is_good(s)] assert expected == result def test_strings_in_fonts(self): expected = self.get_test_loc('strings/font/DarkGardenMK.ttf.results') expected = open(expected, 'rb').read().splitlines() test_file = self.get_test_loc('strings/font/DarkGardenMK.ttf') result = [s for s in strings.file_strings(test_file) if strings.is_good(s)] assert sorted(expected) == sorted(result) def test_strings_in_elf(self): test_file = self.get_test_loc('strings/elf/shash.i686') result = [s for s in strings.file_strings(test_file) if strings.is_good(s)] expected = self.get_test_loc('strings/elf/shash.i686.results') # with open(expected, 'wb') as o: # o.write('\n'.join(result)) expected = open(expected, 'rb').read().splitlines() assert sorted(expected) == sorted(result) def test_strings_in_obj(self): test_file = self.get_test_loc('strings/obj/test.o') result = [s for s in strings.file_strings(test_file) if strings.is_good(s)] expected = self.get_test_loc('strings/obj/test.o.results') # with open(expected, 'wb') as o: # o.write('\n'.join(result)) expected = open(expected, 'rb').read().splitlines() assert sorted(expected) == sorted(result) def test_strings_in_windows_pdb(self): test_file = self.get_test_loc('strings/pdb/QTMovieWin.pdb') result = list(strings.file_strings(test_file)) expected = self.get_test_loc('strings/pdb/QTMovieWin.pdb.results') # with open(expected, 'wb') as o: # o.write('\n'.join(result)) expected = open(expected, 'rb').read().splitlines() assert sorted(expected) == sorted(result) def test_strings_in_all_bin(self): test_dir = self.get_test_loc('strings/bin', copy=True) expec_dir = self.get_test_loc('strings/bin-expected') for tf in os.listdir(test_dir): result = list(strings.file_strings(os.path.join(test_dir, tf))) expected = os.path.join(expec_dir, tf + '.strings') # with open(expected, 'wb') as o: # o.write('\n'.join(result)) expected = open(expected, 'rb').read().splitlines() assert sorted(expected) == sorted(result)
vinodpanicker/scancode-toolkit
tests/textcode/test_strings.py
Python
apache-2.0
6,592
[ "VisIt" ]
6e28dde27faaf71a7f92ecaa63fffa9857479d9f75433bec1f3a6652f870974f
#!/usr/bin/env python import vtk from vtk.test import Testing from vtk.util.misc import vtkGetDataRoot VTK_DATA_ROOT = vtkGetDataRoot() def GetRGBColor(colorName): ''' Return the red, green and blue components for a color as doubles. ''' rgb = [0.0, 0.0, 0.0] # black vtk.vtkNamedColors().GetColorRGB(colorName, rgb) return rgb # define a Single Cube Scalars = vtk.vtkFloatArray() Scalars.InsertNextValue(1.0) Scalars.InsertNextValue(0.0) Scalars.InsertNextValue(0.0) Scalars.InsertNextValue(0.0) Scalars.InsertNextValue(0.0) Scalars.InsertNextValue(0.0) Points = vtk.vtkPoints() Points.InsertNextPoint(0, 0, 0) Points.InsertNextPoint(1, 0, 0) Points.InsertNextPoint(1, 1, 0) Points.InsertNextPoint(0, 1, 0) Points.InsertNextPoint(.5, .5, 1) Ids = vtk.vtkIdList() Ids.InsertNextId(0) Ids.InsertNextId(1) Ids.InsertNextId(2) Ids.InsertNextId(3) Ids.InsertNextId(4) Grid = vtk.vtkUnstructuredGrid() Grid.Allocate(10, 10) Grid.InsertNextCell(14, Ids) Grid.SetPoints(Points) Grid.GetPointData().SetScalars(Scalars) # Clip the pyramid clipper = vtk.vtkClipDataSet() clipper.SetInputData(Grid) clipper.SetValue(0.5) # build tubes for the triangle edges # pyrEdges = vtk.vtkExtractEdges() pyrEdges.SetInputConnection(clipper.GetOutputPort()) pyrEdgeTubes = vtk.vtkTubeFilter() pyrEdgeTubes.SetInputConnection(pyrEdges.GetOutputPort()) pyrEdgeTubes.SetRadius(.005) pyrEdgeTubes.SetNumberOfSides(6) pyrEdgeMapper = vtk.vtkPolyDataMapper() pyrEdgeMapper.SetInputConnection(pyrEdgeTubes.GetOutputPort()) pyrEdgeMapper.ScalarVisibilityOff() pyrEdgeActor = vtk.vtkActor() pyrEdgeActor.SetMapper(pyrEdgeMapper) pyrEdgeActor.GetProperty().SetDiffuseColor(GetRGBColor('lamp_black')) pyrEdgeActor.GetProperty().SetSpecular(.4) pyrEdgeActor.GetProperty().SetSpecularPower(10) # shrink the triangles so we can see each one aShrinker = vtk.vtkShrinkFilter() aShrinker.SetShrinkFactor(1) aShrinker.SetInputConnection(clipper.GetOutputPort()) aMapper = vtk.vtkDataSetMapper() aMapper.ScalarVisibilityOff() aMapper.SetInputConnection(aShrinker.GetOutputPort()) Pyrs = vtk.vtkActor() Pyrs.SetMapper(aMapper) Pyrs.GetProperty().SetDiffuseColor(GetRGBColor('banana')) # build a model of the pyramid Edges = vtk.vtkExtractEdges() Edges.SetInputData(Grid) Tubes = vtk.vtkTubeFilter() Tubes.SetInputConnection(Edges.GetOutputPort()) Tubes.SetRadius(.01) Tubes.SetNumberOfSides(6) TubeMapper = vtk.vtkPolyDataMapper() TubeMapper.SetInputConnection(Tubes.GetOutputPort()) TubeMapper.ScalarVisibilityOff() CubeEdges = vtk.vtkActor() CubeEdges.SetMapper(TubeMapper) CubeEdges.GetProperty().SetDiffuseColor(GetRGBColor('khaki')) CubeEdges.GetProperty().SetSpecular(.4) CubeEdges.GetProperty().SetSpecularPower(10) # build the vertices of the pyramid # Sphere = vtk.vtkSphereSource() Sphere.SetRadius(0.04) Sphere.SetPhiResolution(20) Sphere.SetThetaResolution(20) ThresholdIn = vtk.vtkThresholdPoints() ThresholdIn.SetInputData(Grid) ThresholdIn.ThresholdByUpper(.5) Vertices = vtk.vtkGlyph3D() Vertices.SetInputConnection(ThresholdIn.GetOutputPort()) Vertices.SetSourceConnection(Sphere.GetOutputPort()) SphereMapper = vtk.vtkPolyDataMapper() SphereMapper.SetInputConnection(Vertices.GetOutputPort()) SphereMapper.ScalarVisibilityOff() CubeVertices = vtk.vtkActor() CubeVertices.SetMapper(SphereMapper) CubeVertices.GetProperty().SetDiffuseColor(GetRGBColor('tomato')) # define the text for the labels caseLabel = vtk.vtkVectorText() caseLabel.SetText("Case 1") aLabelTransform = vtk.vtkTransform() aLabelTransform.Identity() aLabelTransform.Translate(-.2, 0, 1.25) aLabelTransform.Scale(.05, .05, .05) labelTransform = vtk.vtkTransformPolyDataFilter() labelTransform.SetTransform(aLabelTransform) labelTransform.SetInputConnection(caseLabel.GetOutputPort()) labelMapper = vtk.vtkPolyDataMapper() labelMapper.SetInputConnection(labelTransform.GetOutputPort()) labelActor = vtk.vtkActor() labelActor.SetMapper(labelMapper) # define the base baseModel = vtk.vtkCubeSource() baseModel.SetXLength(1.5) baseModel.SetYLength(.01) baseModel.SetZLength(1.5) baseMapper = vtk.vtkPolyDataMapper() baseMapper.SetInputConnection(baseModel.GetOutputPort()) base = vtk.vtkActor() base.SetMapper(baseMapper) # Create the RenderWindow, Renderer and both Actors # ren1 = vtk.vtkRenderer() renWin = vtk.vtkRenderWindow() renWin.AddRenderer(ren1) iren = vtk.vtkRenderWindowInteractor() iren.SetRenderWindow(renWin) # position the base base.SetPosition(.5, -.09, .5) ren1.AddActor(pyrEdgeActor) ren1.AddActor(base) ren1.AddActor(labelActor) ren1.AddActor(CubeEdges) ren1.AddActor(CubeVertices) ren1.AddActor(Pyrs) ren1.SetBackground(GetRGBColor('slate_grey')) renWin.SetSize(400, 400) ren1.ResetCamera() ren1.GetActiveCamera().Dolly(1.3) ren1.GetActiveCamera().Elevation(15) ren1.ResetCameraClippingRange() renWin.Render() iren.Initialize() def cases (id, mask): i = 0 while i < 5: m = mask[i] if m & id == 0: Scalars.SetValue(i, 0) pass else: Scalars.SetValue(i, 1) pass caseLabel.SetText("Case " + str(id)) i += 1 Grid.Modified() renWin.Render() mask = [1, 2, 4, 8, 16, 32] cases(20, mask) # iren.Start()
hlzz/dotfiles
graphics/VTK-7.0.0/Filters/General/Testing/Python/clipPyramid.py
Python
bsd-3-clause
5,443
[ "VTK" ]
401f1ab7fb4ee13253300c517da40edc2fd332e689dea186fa7a2a146f9202ba
# -*- coding: utf-8 -*- #!/usr/bin/env python # # Gramps - a GTK+/GNOME based genealogy program # # Copyright (C) 2000-2007 Donald N. Allingham # Copyright (C) 2007 Johan Gonqvist <johan.gronqvist@gmail.com> # Copyright (C) 2007-2009 Gary Burton <gary.burton@zen.co.uk> # Copyright (C) 2007-2009 Stephane Charette <stephanecharette@gmail.com> # Copyright (C) 2008-2009 Brian G. Matherly # Copyright (C) 2008 Jason M. Simanek <jason@bohemianalps.com> # Copyright (C) 2008-2011 Rob G. Healey <robhealey1@gmail.com> # Copyright (C) 2010 Doug Blank <doug.blank@gmail.com> # Copyright (C) 2010 Jakim Friant # Copyright (C) 2010- Serge Noiraud # Copyright (C) 2011 Tim G L Lyons # Copyright (C) 2013 Benny Malengier # Copyright (C) 2016 Allen Crider # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # """ Narrative Web Page generator. Classe: FamilyPage - Family index page and individual Family pages """ #------------------------------------------------ # python modules #------------------------------------------------ from collections import defaultdict from decimal import getcontext import logging #------------------------------------------------ # Gramps module #------------------------------------------------ from gramps.gen.const import GRAMPS_LOCALE as glocale from gramps.gen.lib import (EventType, Family) from gramps.gen.plug.report import Bibliography from gramps.plugins.lib.libhtml import Html #------------------------------------------------ # specific narrative web import #------------------------------------------------ from gramps.plugins.webreport.basepage import BasePage from gramps.plugins.webreport.common import (get_first_letters, _KEYPERSON, alphabet_navigation, sort_people, primary_difference, first_letter, FULLCLEAR, get_index_letter) _ = glocale.translation.sgettext LOG = logging.getLogger(".NarrativeWeb") getcontext().prec = 8 ################################################# # # creates the Family List Page and Family Pages # ################################################# class FamilyPages(BasePage): """ This class is responsible for displaying information about the 'Family' database objects. It displays this information under the 'Families' tab. It is told by the 'add_instances' call which 'Family's to display, and remembers the list of Family. A single call to 'display_pages' displays both the Family List (Index) page and all the Family pages. The base class 'BasePage' is initialised once for each page that is displayed. """ def __init__(self, report): """ @param: report -- The instance of the main report class for this report """ BasePage.__init__(self, report, title="") self.family_dict = defaultdict(set) self.familymappages = None def display_pages(self, title): """ Generate and output the pages under the Family tab, namely the family index and the individual family pages. @param: title -- Is the title of the web page """ LOG.debug("obj_dict[Family]") for item in self.report.obj_dict[Family].items(): LOG.debug(" %s", str(item)) message = _("Creating family pages...") index = 1 with self.r_user.progress(_("Narrated Web Site Report"), message, len(self.report.obj_dict[Family]) + 1 ) as step: for family_handle in self.report.obj_dict[Family]: step() index += 1 self.familypage(self.report, title, family_handle) step() self.familylistpage(self.report, title, self.report.obj_dict[Family].keys()) def familylistpage(self, report, title, fam_list): """ Create a family index @param: report -- The instance of the main report class for this report @param: title -- Is the title of the web page @param: fam_list -- The handle for the place to add """ BasePage.__init__(self, report, title) output_file, sio = self.report.create_file("families") result = self.write_header(self._("Families")) familieslistpage, dummy_head, dummy_body, outerwrapper = result ldatec = 0 prev_letter = " " # begin Family Division with Html("div", class_="content", id="Relationships") as relationlist: outerwrapper += relationlist # Families list page message msg = self._("This page contains an index of all the " "families/ relationships in the " "database, sorted by their family name/ surname. " "Clicking on a person&#8217;s " "name will take you to their " "family/ relationship&#8217;s page.") relationlist += Html("p", msg, id="description") # go through all the families, and construct a dictionary of all the # people and the families thay are involved in. Note that the people # in the list may be involved in OTHER families, that are not listed # because they are not in the original family list. pers_fam_dict = defaultdict(list) for family_handle in fam_list: family = self.r_db.get_family_from_handle(family_handle) if family: if family.get_change_time() > ldatec: ldatec = family.get_change_time() husband_handle = family.get_father_handle() spouse_handle = family.get_mother_handle() if husband_handle: pers_fam_dict[husband_handle].append(family) if spouse_handle: pers_fam_dict[spouse_handle].append(family) # add alphabet navigation index_list = get_first_letters(self.r_db, pers_fam_dict.keys(), _KEYPERSON, rlocale=self.rlocale) alpha_nav = alphabet_navigation(index_list, self.rlocale) if alpha_nav: relationlist += alpha_nav # begin families table and table head with Html("table", class_="infolist relationships") as table: relationlist += table thead = Html("thead") table += thead trow = Html("tr") thead += trow # set up page columns trow.extend( Html("th", trans, class_=colclass, inline=True) for trans, colclass in [(self._("Letter"), "ColumnRowLabel"), (self._("Person"), "ColumnPartner"), (self._("Family"), "ColumnPartner"), (self._("Marriage"), "ColumnDate"), (self._("Divorce"), "ColumnDate")] ) tbody = Html("tbody") table += tbody # begin displaying index list ppl_handle_list = sort_people(self.r_db, pers_fam_dict.keys(), self.rlocale) first = True for (surname, handle_list) in ppl_handle_list: if surname and not surname.isspace(): letter = get_index_letter(first_letter(surname), index_list, self.rlocale) else: letter = '&nbsp;' # get person from sorted database list for person_handle in sorted( handle_list, key=self.sort_on_name_and_grampsid): person = self.r_db.get_person_from_handle(person_handle) if person: family_list = person.get_family_handle_list() first_family = True for family_handle in family_list: get_family = self.r_db.get_family_from_handle family = get_family(family_handle) trow = Html("tr") tbody += trow tcell = Html("td", class_="ColumnRowLabel") trow += tcell if first or primary_difference(letter, prev_letter, self.rlocale): first = False prev_letter = letter trow.attr = 'class="BeginLetter"' ttle = self._("Families beginning with " "letter ") tcell += Html("a", letter, name=letter, title=ttle + letter, inline=True) else: tcell += '&nbsp;' tcell = Html("td", class_="ColumnPartner") trow += tcell if first_family: trow.attr = 'class ="BeginFamily"' tcell += self.new_person_link( person_handle, uplink=self.uplink) first_family = False else: tcell += '&nbsp;' tcell = Html("td", class_="ColumnPartner") trow += tcell tcell += self.family_link( family.get_handle(), self.report.get_family_name(family), family.get_gramps_id(), self.uplink) # family events; such as marriage and divorce # events fam_evt_ref_list = family.get_event_ref_list() tcell1 = Html("td", class_="ColumnDate", inline=True) tcell2 = Html("td", class_="ColumnDate", inline=True) trow += (tcell1, tcell2) if fam_evt_ref_list: fam_evt_srt_ref_list = sorted( fam_evt_ref_list, key=self.sort_on_grampsid) for evt_ref in fam_evt_srt_ref_list: evt = self.r_db.get_event_from_handle( evt_ref.ref) if evt: evt_type = evt.get_type() if evt_type in [EventType.MARRIAGE, EventType.DIVORCE]: cell = self.rlocale.get_date( evt.get_date_object()) if (evt_type == EventType.MARRIAGE): tcell1 += cell else: tcell1 += '&nbsp;' if (evt_type == EventType.DIVORCE): tcell2 += cell else: tcell2 += '&nbsp;' else: tcell1 += '&nbsp;' tcell2 += '&nbsp;' first_family = False # add clearline for proper styling # add footer section footer = self.write_footer(ldatec) outerwrapper += (FULLCLEAR, footer) # send page out for processing # and close the file self.xhtml_writer(familieslistpage, output_file, sio, ldatec) def familypage(self, report, title, family_handle): """ Create a family page @param: report -- The instance of the main report class for this report @param: title -- Is the title of the web page @param: family_handle -- The handle for the family to add """ family = report.database.get_family_from_handle(family_handle) if not family: return BasePage.__init__(self, report, title, family.get_gramps_id()) ldatec = family.get_change_time() self.bibli = Bibliography() self.uplink = True family_name = self.report.get_family_name(family) self.page_title = family_name self.familymappages = report.options["familymappages"] output_file, sio = self.report.create_file(family.get_handle(), "fam") result = self.write_header(family_name) familydetailpage, dummy_head, dummy_body, outerwrapper = result # begin FamilyDetaill division with Html("div", class_="content", id="RelationshipDetail") as relationshipdetail: outerwrapper += relationshipdetail # family media list for initial thumbnail if self.create_media: media_list = family.get_media_list() # If Event pages are not being created, then we need to display # the family event media here if not self.inc_events: for evt_ref in family.get_event_ref_list(): event = self.r_db.get_event_from_handle(evt_ref.ref) media_list += event.get_media_list() relationshipdetail += Html( "h2", self.page_title, inline=True) + ( Html('sup') + (Html('small') + self.get_citation_links( family.get_citation_list()))) # display relationships families = self.display_family_relationships(family, None) if families is not None: relationshipdetail += families # display additional images as gallery if self.create_media and media_list: addgallery = self.disp_add_img_as_gallery(media_list, family) if addgallery: relationshipdetail += addgallery # Narrative subsection notelist = family.get_note_list() if notelist: relationshipdetail += self.display_note_list(notelist, Family) # display family LDS ordinance... family_lds_ordinance_list = family.get_lds_ord_list() if family_lds_ordinance_list: relationshipdetail += self.display_lds_ordinance(family) # get attribute list attrlist = family.get_attribute_list() if attrlist: attrsection, attrtable = self.display_attribute_header() self.display_attr_list(attrlist, attrtable) relationshipdetail += attrsection # source references srcrefs = self.display_ind_sources(family) if srcrefs: relationshipdetail += srcrefs # add clearline for proper styling # add footer section footer = self.write_footer(ldatec) outerwrapper += (FULLCLEAR, footer) # send page out for processing # and close the file self.xhtml_writer(familydetailpage, output_file, sio, ldatec)
sam-m888/gramps
gramps/plugins/webreport/family.py
Python
gpl-2.0
17,542
[ "Brian" ]
a9f9e878907d0975cb517b64e9581e5ad86719ce6f257aec17c9529236bb030b
import sys sys.path.append('../../../vmdgadgets') import vmdutil from vmdutil import vmddef def avoid_collision1(vmd): center = vmdutil.str_to_b('センター') right_arm = vmdutil.str_to_b('右腕') right_elb = vmdutil.str_to_b('右ひじ') #1032 追加 c_1032 = vmddef.BONE_SAMPLE._replace( frame=1032, name=center, position=(2.141899824142456, -0.4837593138217926, 3.3104584217071533)) ra_1032 = vmddef.BONE_SAMPLE._replace( frame=1032, name=right_arm, rotation=(0.17264382541179657, 0.13622286915779114, 0.361983984708786, 0.905872106552124)) re_1032 = vmddef.BONE_SAMPLE._replace( frame=1032, name=right_elb, rotation=(0.635169506072998, -0.47617700695991516, -0.3107016980648041, 0.5227601528167725)) # 1036 センター削除 # 1036 入れ替え ra_1036_rot = (0.17034076154232025, 0.14684468507766724, 0.3597466051578522, 0.905540406703949) re_1036_rot = (0.6970929503440857, -0.4250965118408203, -0.27151989936828613, 0.5095357894897461) bone_frames = vmd.get_frames('bones') new_frames = [] for frame in bone_frames: if frame.frame != 1036: new_frames.append(frame) else: bone_name = vmdutil.b_to_str(frame.name) if bone_name == 'センター': continue elif bone_name == '右腕': new_frames.append(frame._replace( rotation=ra_1036_rot)) elif bone_name == '右ひじ': new_frames.append(frame._replace( rotation=re_1036_rot)) else: new_frames.append(frame) new_frames.append(c_1032) new_frames.append(ra_1032) new_frames.append(re_1032) vmd.set_frames('bones', new_frames) return def avoid_collision2(vmd): modify = { 1317: { '右ひじ':((0.0, 0.0, 0.0), (0.5303139090538025, -0.5535628199577332, 0.12653225660324097, 0.6295421719551086))}, 1322: { '右腕': ((0.0, 0.0, 0.0), (0.25283217430114746, 0.24778856337070465, -0.011708247475326061, 0.9351678490638733)), '右ひじ': ((0.0, 0.0, 0.0), (0.5284314155578613, -0.5674738883972168, 0.11908495426177979, 0.6201204061508179))}, 1330: { 'センター': ((1.5169070959091187, -0.11587631702423096, 3.358367443084717), (0.0, -0.0, -0.0, 1.0)), '右腕': ((0.0, 0.0, 0.0), (0.20906804502010345, 0.13286317884922028, 0.27482205629348755, 0.9290382266044617)), '右ひじ': ((0.0, 0.0, 0.0), (0.6034250259399414, -0.5745618939399719, -0.04226955026388168, 0.5513404607772827))}, 1333: { '右ひじ': ((0.0, 0.0, 0.0), (0.6193941831588745, -0.5532808899879456, -0.14503660798072815, 0.5377723574638367))}, 1339: { 'センター': ((2.3029496669769287, 0.0, 1.9691747426986694), (0.0, -0.0, -0.0, 1.0)), '右腕': ((0.0, 0.0, 0.0), (0.18227244913578033, 0.19123366475105286, 0.2656165361404419, 0.9271727800369263)), '右ひじ': ((0.0, 0.0, 0.0), (0.574394702911377, -0.5680624842643738, -0.36492064595222473, 0.4628258943557739))}, 1342: { '右ひじ': ((0.0, 0.0, 0.0), (0.574394702911377, -0.5680624842643738, -0.36492064595222473, 0.4628258943557739))}, 1346: { 'センター': ((3.0592546463012695, 0.0, 0.2976529598236084), (0.0, -0.0, -0.0, 1.0)), '右腕': ((0.0, 0.0, 0.0), (0.1709841787815094, 0.2831650674343109, 0.12234087288379669, 0.9357418417930603)), '右ひじ': ((0.0, 0.0, 0.0), (0.6452091336250305, -0.5575323700904846, -0.011836055666208267, 0.5222232341766357))} } bone_frames = vmd.get_frames('bones') for i, frame in enumerate(bone_frames): bone_name = vmdutil.b_to_str(frame.name) if frame.frame in modify: if bone_name in modify[frame.frame]: pos, rot = modify[frame.frame][bone_name] bone_frames[i] = frame._replace( position=pos, rotation=rot) return if __name__ == '__main__': vmd_name = sys.argv[1] vmd = vmdutil.Vmdio() vmd.load(vmd_name) avoid_collision1(vmd) avoid_collision2(vmd) vmd.store(vmd_name)
Hashi4/vmdgadgets
sample/lookat/sm31942771/minor_adjust.py
Python
apache-2.0
4,178
[ "VMD" ]
e6f427f2f96cfb783dca861a4911f4d7dac803c44ecc7b8f74cdc9d64a6d7a8c
# Bioclimatic Chart # # Ladybug: A Plugin for Environmental Analysis (GPL) started by Mostapha Sadeghipour Roudsari # # This file is part of Ladybug. # # Copyright (c) 2013-2015, Abraham Yezioro <ayez@ar.technion.ac.il> # Ladybug is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published # by the Free Software Foundation; either version 3 of the License, # or (at your option) any later version. # # Ladybug is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ladybug; If not, see <http://www.gnu.org/licenses/>. # # @license GPL-3.0+ <http://spdx.org/licenses/GPL-3.0+> """ This is the Bioclimactic Chart. It is based in the originally proposed chart by V. Olgyay and then in the chart presented in the book "Sun, Climate and Architecture" by Brown. Use this component to draw a Bioclimatic chart in the Rhino scene and evaluate a set of temperatures and humidity ratios in terms of indoor comfort. Connected data can include either outdoor temperature and humidty ratios from imported EPW weather data, indoor temperature and humidity ratios from an energy simulation, or indivdual numerical inputs of temperature and humidity. The input data will be plotted alongside polygons on the chart representing comfort as well as polygons representing the efects of passive building strategies on comfort. References: 1. Olgyay, V., 1963. Design with Climate. Bioclimatic Approach to Architectural Regionalism. Van Nostrand reinhold, New York. 2. Givoni B., 1976. Man, Climate and Architecture. Applied Science Publishers, Ltd., London. 3. Murray M. and Givoni B., 1979. Architectural Design Based on Climate in Watson D. (ed), 1979. Energy COnservation Through Building Design. McGraw Hill Book Company. 4. Yezioro, A. & E. Shaviv. 1996. A Knowledge Based CAD System for Determining Thermal Comfort Design Strategies. Renewable Energy, 8: (1-4), (pp. 133-138). 5. Brown G.Z. and DeKay M., 2001. Sun, WInd & Light. Architectural Design Strategies (2nd edition). John WIley & Sons, Inc. - Provided by Ladybug 0.0.60 Args: _dryBulbTemperature: A number representing the dry bulb temperature of the air in degrees Celcius. This input can also accept a list of temperatures representing conditions at different times or the direct output of dryBulbTemperature from the Import EPW component. Indoor temperatures from Honeybee energy simulations are also possible inputs. _relativeHumidity: A number between 0 and 100 representing the relative humidity of the air in percentage. This input can also accept a list of relative humidity values representing conditions at different times or the direct output of relativeHumidity from of the Import EPW component. ------------------------------: ... metabolicRate_: A number representing the metabolic rate of the human subject in met. This input can also accept text inputs for different activities. Acceptable text inputs include Sleeping, Reclining, Sitting, Typing, Standing, Driving, Cooking, House Cleaning, Walking, Walking 2mph, Walking 3mph, Walking 4mph, Running 9mph, Lifting 10lbs, Lifting 100lbs, Shoveling, Dancing, and Basketball. If no value is input here, the component will assume a metabolic rate of 1 met, which is the metabolic rate of a seated human being. clothingLevel_: A number representing the clothing level of the human subject in clo. If no value is input here, the component will assume a clothing level of 1 clo, which is roughly the insulation provided by a 3-piece suit. A person dressed in shorts and a T-shirt has a clothing level of roughly 0.5 clo and a person in a thick winter jacket can have a clothing level as high as 2 to 4 clo. passiveStrategy_: An optional text input of passive strategies to be laid over the Bioclimatic chart as polygons. Text inputs include "Passive Solar Heating", "Evaporative Cooling", "Thermal Mass + Night Vent" and "Natural Ventilation". NOT WORKING RIGHT NOW!! ------------------------------: ... cullMesh_: Set to "True" to cull the colored mesh to where they have climatic data on them. See chartMesh output. Deafult "False" calculateCharts_: Set to "True" to calculate and show a column type graph showing the percentage of time each strategy is capable of providing comfort conditions. See resultsChart output. Deafult "False" ------------------------------: ... analysisPeriodWinter_: An optional analysis period from the Analysis Period component. If no Analysis period is given and epw data from the ImportEPW component has been connected, the analysis will be run for the enitre year. ONLY WORKS FOR THE WHOLE YEAR RIGHT NOW!! analysisPeriodSummer_: An optional analysis period from the Analysis Period component. If no Analysis period is given and epw data from the ImportEPW component has been connected, the analysis will be run for the enitre year. ONLY WORKS FOR THE WHOLE YEAR RIGHT NOW!! basePoint_: An optional base point that will be used to place the Bioclimatic Chart in the Rhino scene. If no base point is provided, the base point will be the Rhino model origin. scale_: An optional number to change the scale of the Bioclimatic chart in the Rhino scene. By default, this value is set to 1. legendPar_: Optional legend parameters from the Ladybug Legend Parameters component. _runIt: Set to "True" to run the component and calculate the adaptive comfort metrics. Returns: readMe!: ... ------------------------------: ... comfortResults: The number of hours and percent of the input data that are inside all comfort and passive strategy polygons. totalComfortOrNot: A list of 0's and 1's indicating, for each hour of the input data, if the hour is inside a comfort and/or strategy polygon (1) or not(0). strategyOrNot: A list of 0's and 1's indicating, for each hour of the input temperature and humidity ratio, if the hour is inside (1) or not(0), for each passive strategy and comfort polygons. If there are multiple comfort polyogns or passive strategies connected to the passiveStrategy_ input, this output will be a grafted list for each polygon. ------------------------------: ... chartGridAndTxt: The grid and text labels of the Bioclimatic chart. chartMesh: A colored mesh showing the number of input hours happen in each part of the Bioclimatic chart. chartHourPoints: Points representing each of the hours of input temperature and humidity ratio. By default, this ouput is hidden and, to see it, you should connect it to a Grasshopper preview component. hourPointColorsByComfort: Color the chartHourPoints above according to Comfort results. They can be hooked up to the "Swatch" input of a Grasshopper Preview component that has the hour points above connected as geometry. By default, points are colored red if they lie inside comfort or strategy polygons and are colored blue if they do not meet such comfort criteria. hourPointColorsByMonth: Colors that the chartHourPoints above according to each month. They can be hooked up to the "Swatch" input of a Grasshopper Preview component that has the hour points above connected as geometry. By default, points are colored red if they lie inside comfort or strategy polygons and are colored blue if they do not meet such comfort criteria. min_maxPoints: Plot each month's Minimal/Maximal values for Temperature and Relative Humidity. By default, this ouput is hidden and, to see it, you should connect it to a Grasshopper preview component. comfort_strategyPolygons: A tree of polygons representing the comfort and passive strategies areas of the chart made comfortable. legend: A colored legend showing the number of hours that correspond to each color for the chartMesh output. legendBasePt: The legend base point, which can be used to move the legend in relation to the chart with the grasshopper "move" component. ------------------------------: ... resultsChart: A column type graph showing the percentage of time each strategy is capable of providing comfort conditions. These results are summarizing the whole year and each month. Each column shows three areas: Comfort Zone (black), Passive Solar Heating (yellow), as the only heating strategy for winter time Evaporative Cooling or High Termal Mass with Night Ventilation or Natural Ventilation (green, red, blue) as the possible cooling strategies for summer time. """ ghenv.Component.Name = "Ladybug_Bioclimatic Chart" ghenv.Component.NickName = 'Bioclimatic Chart' ghenv.Component.Message = 'VER 0.0.60\nJUL_21_2015' ghenv.Component.Category = "Ladybug" #ghenv.Component.SubCategory = "2 | VisualizeWeatherData" ghenv.Component.SubCategory = "6 | WIP" try: ghenv.Component.AdditionalHelpFromDocStrings = "1" except: pass import Grasshopper.Kernel as gh import math import scriptcontext as sc import Rhino as rc import rhinoscriptsyntax as rs import System from System import Object from clr import AddReference as addr addr("Grasshopper") from Grasshopper import DataTree from Grasshopper.Kernel.Data import GH_Path ################################### import Rhino.Geometry as rg #Define Model Tolerance tol = sc.doc.ModelAbsoluteTolerance meshingP = rc.Geometry.MeshingParameters.Coarse meshingP.SimplePlanes = True lb_visualization = sc.sticky["ladybug_ResultVisualization"]() lb_preparation = sc.sticky["ladybug_Preparation"]() MonthNames = ['Jan', 'Feb', 'Mar', 'Apr', 'May', 'Jun', 'Jul', 'Aug', 'Sep', 'Oct', 'Nov', 'Dec'] MonthDays = [31, 59, 90, 120, 151, 181, 212, 243, 273, 304, 334, 365] #MonthDays = [0, 31, 59, 90, 120, 151, 181, 212, 243, 273, 304, 334, 365] StNames = ['ComfortZone', 'PassiveSolarHeating', 'EvaporativeCooling', 'HighTermalMass+NightVent', 'NaturalVentilation'] def checkInputs(): #Define a value that will indicate whether someone has hooked up epw data. epwData = False epwStr = [] checkData1 = False if _dryBulbTemperature and _relativeHumidity: try: #if str(_dryBulbTemperature[2]) == 'Dry Bulb Temperature' and \ # str(_relativeHumidity[2]) == 'Relative Humidity': if "Temperature" in _dryBulbTemperature[2] and "Humidity" in _relativeHumidity[2]: epwData = True epwStr = _dryBulbTemperature[0:7] checkData1 = True else: pass except: pass else: print 'Connect a temperature in degrees celcius for _dryBulbTemperature and relative humidity to the proper input items' #Check the metabolic rate. ##checkData2 = False #if len(metabolicRate_) > 0: #if metabolicRate_ > 9.5 or metabolicRate_ < 0.5: #print 'metabolicRate_ ', metabolicRate_ #print 'You entered a probably invalid metabolic rate (%.1f met). Changed to Standing rate (1.2 met) ' (float(metabolicRate_)) #metabolicRate_ = 1.2 ##checkData2 = True #else: #print 'metabolicRate_ ', metabolicRate_ ##checkData2 = True #Check the passive strategy inputs to be sure that they are correct. checkData3 = True if len(passiveStrategy_) > 0: for item in passiveStrategy_: if item == "Passive Solar Heating" or item == "Evaporative Cooling" or item == "Thermal Mass + Night Vent" or item == "Natural Ventilation": pass else: checkData3 = False if checkData3 == False: warning = 'Input for passiveStrategy_ is not valid.' print warning ghenv.Component.AddRuntimeMessage(gh.GH_RuntimeMessageLevel.Warning, warning) #If all of the checkDatas have been good to go, let's give a final go ahead. ##if checkData1 == True and checkData2 and checkData3 == True : if checkData1 == True and checkData3 == True : checkData = True else: checkData = False #print 'checkData ', checkData return checkData, epwData, epwStr #Define colors for the following output situations (points and legends): Month colored (12 colors), comfortNOcomfort (2 colors). def colors(): customColors = [System.Drawing.Color.FromArgb(75, 107, 169), System.Drawing.Color.FromArgb(115, 147, 202), System.Drawing.Color.FromArgb(170, 200, 247), System.Drawing.Color.FromArgb(193, 213, 208), System.Drawing.Color.FromArgb(245, 239, 103), System.Drawing.Color.FromArgb(252, 230, 74), System.Drawing.Color.FromArgb(239, 156, 21), System.Drawing.Color.FromArgb(234, 123, 0), System.Drawing.Color.FromArgb(234, 74, 0), System.Drawing.Color.FromArgb(234, 38, 0)] monthColors = [System.Drawing.Color.FromArgb(0, 0, 0), System.Drawing.Color.FromArgb(0, 125, 0), System.Drawing.Color.FromArgb(0, 255, 0), System.Drawing.Color.FromArgb(0, 125, 125), System.Drawing.Color.FromArgb(0, 125, 255), System.Drawing.Color.FromArgb(0, 255, 255), System.Drawing.Color.FromArgb(0, 0, 125), System.Drawing.Color.FromArgb(0, 0, 255), System.Drawing.Color.FromArgb(125, 0, 0), System.Drawing.Color.FromArgb(255, 0, 0), System.Drawing.Color.FromArgb(125, 125, 0), System.Drawing.Color.FromArgb(255, 125, 0)] comfortNOcomfortColors = [System.Drawing.Color.FromArgb(75, 107, 169), # Comfort System.Drawing.Color.FromArgb(234, 38, 0)] # NoComfort strategiesColors = [System.Drawing.Color.FromArgb(50, 50, 50), # CZ System.Drawing.Color.FromArgb(200, 200, 0), # PSH or (220, 220, 50) System.Drawing.Color.FromArgb(50, 220, 50), # EC System.Drawing.Color.FromArgb(220, 50, 50), # HTM System.Drawing.Color.FromArgb(50, 50, 220)] # NV return monthColors, comfortNOcomfortColors, strategiesColors #Define a function to offset curves and return things that will stand out on the Bioclimatic chart. def outlineCurve(curve): try: offsetCrv = curve.Offset(rc.Geometry.Plane.WorldXY, 0.25, sc.doc.ModelAbsoluteTolerance, rc.Geometry.CurveOffsetCornerStyle.Sharp)[0] finalBrep = (rc.Geometry.Brep.CreatePlanarBreps([curve, offsetCrv])[0]) except: finalBrep = rc.Geometry.Brep.CreatePlanarBreps([curve])[0] warning = "Creating an outline of one of the comfort or strategy curves failed. Component will return a solid brep." print warning w = gh.GH_RuntimeMessageLevel.Warning ghenv.Component.AddRuntimeMessage(w, warning) return finalBrep def createResultsLegend(orgX, orgY, orgZ, gridStep, monthStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, lb_preparation, legendFontSize, legendFont, strategiesColors): if legendFontSize == None: legendFontSize = 2 #Make axis labels for the chart. xAxisLabels = [] xAxisTxt = ["Comfort Strategies"] xAxisPt = [rc.Geometry.Point3d(orgX + 0., orgY - 5.0, 0)] xAxisLabels.extend(text2srf(xAxisTxt, xAxisPt, legendFont, legendFontSize*1.25)[0]) # Make the percentage text for the chart Y axis. percentText = [] percentLabels = [] percentLabelBasePts = [] percentNum = range(0, 110, 10) for count, percent in enumerate(percentNum): percentLabelBasePts.append(rc.Geometry.Point3d(orgX - 8, orgY + (percent)-0.75, 0)) percentText.append(str(percent)+"%") for count, text in enumerate(percentText): percentLabels.extend(text2srf([text], [percentLabelBasePts[count]], legendFont, legendFontSize*.75)[0]) # Make the Title at top. titleLabels = [] titleTxt = "Year Results" titlePt = [rc.Geometry.Point3d(orgX + 0., (100 + orgY + 1), 0)] titleLabels.extend(text2srf([titleTxt], [titlePt[0]], legendFont, legendFontSize*1.5)[0]) #Months titles loop step = monthStep for m in range(0, len(MonthNames)): #titleLabels = [] titleTxt = MonthNames[m] titlePt = [rc.Geometry.Point3d(orgX + step, (100 + orgY + 1), 0)] step += monthStep titleLabels.extend(text2srf([titleTxt], [titlePt[0]], legendFont, legendFontSize*1.5)[0]) # Create legend with Strategies Names, at bottom right. legLabels = [] legLabels1 = [] legResultstText = [] legPolygon = [] legLabelBasePts = [] legLabelBasePts1 = [] legColorLabelBasePts = [] legColorLabelBasePts1 = [] legNum = range(int(orgY), 50, 8) radius = 2.0 segments = 4 for count, leg in enumerate(legNum): legLabelBasePts.append(rc.Geometry.Point3d(xLineValue[12] + 50, leg + 1.50, 0)) legColorLabelBasePts.append(rc.Geometry.Point3d(xLineValue[12] + 46, leg + 1.25, 0)) legColorLabelBasePts1.append(rc.Geometry.Point3d(xLineValue[12] + 50, leg - 1.0, 0)) #### for count, text in enumerate(strategyNames): combString = '%.1f%% - %d hours' % (strategyPercent[count], strategyHours[count]) legResultstText.append(combString) #strategyPercent, strategyHours for count, text in enumerate(legResultstText): legLabels1.extend(text2srf([text], [legColorLabelBasePts1[count]], legendFont, legendFontSize*.75)[0]) for count, text in enumerate(strategyNames): if count == 0: colorP = strategiesColors[0] # CZ elif count == 1: colorP = strategiesColors[1] # PSH or (220, 220, 50) elif count == 2: colorP = strategiesColors[2] # EC elif count == 3: colorP = strategiesColors[3] # HTM elif count == 4: colorP = strategiesColors[4] # NV else : colorP = System.Drawing.Color.FromArgb(255, 255, 255, 255) legLabels.extend(text2srf([text], [legLabelBasePts[count]], legendFont, legendFontSize*0.75)[0]) legPol = drawPolygon(legColorLabelBasePts[count], radius, segments, colorP) legPolygon.append(legPol) #Bring all legend and text together in one list. restText = [] for item in percentLabels: restText.append(item) #for item in relHumidLabels: # restText.append(item) for item in xAxisLabels: restText.append(item) #for item in yAxisLabels: # restText.append(item) for item in titleLabels: restText.append(item) for item in legLabels: restText.append(item) for item in legLabels1: restText.append(item) for item in legPolygon: restText.append(item) return restText def createChartLayout(orgX, orgY, orgZ, location, legendFont, legendFontSize): if legendFontSize == None: legendFontSize = 2 #Make axis labels for the chart. xAxisLabels = [] xAxisTxt = ["Humidity Ratio"] #xAxisPt = [rc.Geometry.Point3d(orgX + 35., orgY - 10.0, 0)] xAxisPt = [rc.Geometry.Point3d(orgX, orgY - 10.0, 0)] xAxisLabels.extend(text2srf(xAxisTxt, xAxisPt, legendFont, legendFontSize*1.25)[0]) yAxisLabels = [] yAxisTxt = ["Dry Bulb Temperature"] #yAxisPt = [rc.Geometry.Point3d(orgX - 10.0, orgY + 35., 0)] yAxisPt = [rc.Geometry.Point3d(orgX - 10.0, orgY, 0)] yAxisLabels.extend(text2srf(yAxisTxt, yAxisPt, legendFont, legendFontSize*1.25)[0]) #rotateTransf = rc.Geometry.Transform.Rotation(1.57079633, rc.Geometry.Point3d(orgX - 10.0, orgY + 35., 0)) rotateTransf = rc.Geometry.Transform.Rotation(1.57079633, rc.Geometry.Point3d(orgX - 10.0, orgY, 0)) for geo in yAxisLabels: geo.Transform(rotateTransf) #tempNum = range(orgY + 5, 55, 5) tempNum = range(int(orgY/2), 55, 5) relHumidNum = range(0, 110, 10) # Make the relative humidity text for the chart. relHumidBasePts = [] relHumidTxt = [] relHumidLabels = [] for count, humid in enumerate(relHumidNum): #print 'count ', count, humid relHumidBasePts.append(rc.Geometry.Point3d(humid - 2, orgY - 3, 0)) relHumidTxt.append(str(humid)+"%") for count, text in enumerate(relHumidTxt): relHumidLabels.extend(text2srf([text], [relHumidBasePts[count]], legendFont, legendFontSize*.75)[0]) # Make the temperature text for the chart. tempText = [] tempLabels = [] tempLabelBasePts = [] for count, temp in enumerate(tempNum): #print 'count ', count, temp tempLabelBasePts.append(rc.Geometry.Point3d(-5, (temp * 2)-0.75, 0)) tempText.append(str(temp)) for count, text in enumerate(tempText): tempLabels.extend(text2srf([text], [tempLabelBasePts[count]], legendFont, legendFontSize*.75)[0]) titleLabels = [] titleTxt = ["Bio Climatic Chart", location] titlePt = [rc.Geometry.Point3d(orgX, 108, 0), rc.Geometry.Point3d(orgX, 103, 0)] for count, text in enumerate(titleTxt): titleLabels.extend(text2srf([text], [titlePt[count]], legendFont, legendFontSize*1.5)[0]) #Bring all text and curves together in one list. chartLayout = [] for item in tempLabels: chartLayout.append(item) for item in relHumidLabels: chartLayout.append(item) for item in xAxisLabels: chartLayout.append(item) for item in yAxisLabels: chartLayout.append(item) for item in titleLabels: chartLayout.append(item) return chartLayout def createChartLegend(orgX, orgY, orgZ, strategyNames, lb_preparation, legendScale, legendFont, legendFontSize, lb_visualization, strategiesColors, monthColors, comfortNOcomfortColors, customColors, totalComfortOrNot): if legendFontSize == None: legendFontSize = 2 # ************** Generate a legend for strategies *********** legStrategyLabels = [] legLabelBasePts = [] finalLegPolyline = [] legMonthLabels = [] legMonthLabelBasePts = [] legComfLabels = [] legComfLabelBasePts = [] shiftY = -20 #-15 leg = int(orgY) + shiftY #legNum = range(int(orgY) + shiftY, -23 + shiftY, -3) # [-25, -28, -31, -34, -37] Need 5 values for 5 strategies legStrategyPolygons = [] for count, text in enumerate(strategyNames): if count == 0: color = strategiesColors[0] # CZ elif count == 1: color = strategiesColors[1] # PSH or (220, 220, 50) elif count == 2: color = strategiesColors[2] # EC elif count == 3: color = strategiesColors[3] # HTM elif count == 4: color = strategiesColors[4] # NV else : color = System.Drawing.Color.FromArgb(255, 0, 255, 255) legLinePt = [] legLabelBasePts.append(rc.Geometry.Point3d(orgX + 10, leg + 0.0, 0)) # Base point for each strategy name points = [orgX, leg + 0.75, 0.0],[orgX + 9.0, leg + 0.75, 0.0], [orgX + 9.0, leg + 0.751, 0.0], [orgX, leg + 0.751, 0.0], \ [orgX, leg + 0.75, 0.0] # Coords for the line in the strategies legend for cc in range(0, len(points)): legLinePt.append(rc.Geometry.Point3d(points[cc][0], points[cc][1], points[cc][2])) legPolyline = rc.Geometry.PolylineCurve(legLinePt) leg += -3 finalLegPolyline.append(outlineCurve(legPolyline)) # This is the element to use for coloring the legend legMesh = rc.Geometry.Mesh() legMesh.Append(rc.Geometry.Mesh.CreateFromBrep(finalLegPolyline[count])[0]) legMesh.VertexColors.CreateMonotoneMesh(color) legStrategyPolygons.append(legMesh) # Draw the strategies names legStrategyLabels.extend(text2srf([text], [legLabelBasePts[count]], legendFont, legendFontSize*0.75)[0]) # ************** End Legend of strategies *********** """ # ************** Generate a legend for comfortOrNot Using Chris's way from Psychrometric chart *********** leg = int(orgY) + shiftY - 11.0 ##pointColors = [] legComfBasePts = rc.Geometry.Point3d(orgX + 45, leg, 0) # Base point comfortOrNot legend if str(totalComfortOrNot[0]) == "key:location/dataType/units/frequency/startsAt/endsAt": totalComfortOrNot = totalComfortOrNot[7:] ##pointColors.append(lb_visualization.gradientColor(totalComfortOrNot, 0, 1, customColors)) legend = [] #legendSrfs, legendText, legendTextCrv, textPt, textSize = lb_visualization.createLegend(totalComfortOrNot, 0, 1, 2, "Comfort", lb_visualization.BoundingBoxPar, legComfBasePts, legendScale, legendFont, legendFontSize) legendSrfs, legendText, legendTextCrv, textPt, textSize = lb_visualization.createLegend(totalComfortOrNot, 0, 1, 2, "Comfort or Not", lb_visualization.BoundingBoxPar, legComfBasePts, .45, legendFont, 1.5) legendColors = lb_visualization.gradientColor(legendText[:-1], 0, 1, customColors) legendSrfs = lb_visualization.colorMesh(legendColors, legendSrfs) legend.append(legendSrfs) for list in legendTextCrv: for item in list: legend.append(item) # ************** End Legend of comfortOrNot *********** """ radius = 0.7 segments = 6 # ************** Generate a legend for comfortOrNot *********** leg = int(orgY) + shiftY legComfCircle = [] circCenter = [] circPolyline = [] for m in range(0, 2): # 0 to 2 for Comfort or NoComfort possibilities if m == 0: text = "No Comfort" else : text = "Comfort" circCenter.append(rc.Geometry.Point3d(orgX + 55, leg + radius/2, 0)) # Base point for each month circle legComfLabelBasePts.append(rc.Geometry.Point3d(orgX + 57, leg + 0.0, 0)) # Base point for each month name leg += -3 # Draw the comfortOrNot circles and value cP, dataPolyline = circPoints(circCenter[m], radius, segments) circPolyline.append(outlineCurve(dataPolyline)) # This is the element to use for coloring the legend legMesh = rc.Geometry.Mesh() legMesh.Append(rc.Geometry.Mesh.CreateFromBrep(circPolyline[m])[0]) legMesh.VertexColors.CreateMonotoneMesh(comfortNOcomfortColors[m]) legComfCircle.append(legMesh) legComfLabels.extend(text2srf([text], [legComfLabelBasePts[m]], legendFont, legendFontSize*0.75)[0]) # ************** End Legend of comfortOrNot *********** # ************** Generate a legend for Month colored *********** leg = int(orgY) + shiftY legMonthsCircle = [] circCenter = [] circPolyline = [] for count, text in enumerate(MonthNames): circCenter.append(rc.Geometry.Point3d(orgX + 85, leg + radius/2, 0)) # Base point for each month circle legMonthLabelBasePts.append(rc.Geometry.Point3d(orgX + 87, leg + 0.0, 0)) # Base point for each month name leg += -3 # Draw the Months circles and names cP, dataPolyline = circPoints(circCenter[count], radius, segments) circPolyline.append(outlineCurve(dataPolyline)) # This is the element to use for coloring the legend legMesh = rc.Geometry.Mesh() legMesh.Append(rc.Geometry.Mesh.CreateFromBrep(circPolyline[count])[0]) legMesh.VertexColors.CreateMonotoneMesh(monthColors[count]) legMonthsCircle.append(legMesh) legMonthLabels.extend(text2srf([text], [legMonthLabelBasePts[count]], legendFont, legendFontSize*0.75)[0]) # ************** End Legend of Month colors *********** #Bring all text and curves together in one list. chartLegend = [] for item in finalLegPolyline: chartLegend.append(item) for item in legStrategyPolygons: chartLegend.append(item) for item in legStrategyLabels: chartLegend.append(item) #for item in legend: # This is for Chris's way - Keep commented/uncommented together with the block above # chartLegend.append(item) for item in legComfCircle: chartLegend.append(item) for item in legComfLabels: chartLegend.append(item) for item in legMonthsCircle: chartLegend.append(item) for item in legMonthLabels: chartLegend.append(item) return chartLegend def text2srf(text, textPt, font, textHeight): # Thanks to Giulio Piacentino for his version of text to curve textSrfs = [] for n in range(len(text)): plane = rc.Geometry.Plane(textPt[n], rc.Geometry.Vector3d(0,0,1)) if type(text[n]) is not str: preText = rc.RhinoDoc.ActiveDoc.Objects.AddText(`text[n]`, plane, textHeight, font, True, False) else: preText = rc.RhinoDoc.ActiveDoc.Objects.AddText( text[n], plane, textHeight, font, True, False) postText = rc.RhinoDoc.ActiveDoc.Objects.Find(preText) TG = postText.Geometry crvs = TG.Explode() # join the curves joindCrvs = rc.Geometry.Curve.JoinCurves(crvs) # create the surface srfs = rc.Geometry.Brep.CreatePlanarBreps(joindCrvs) extraSrfCount = 0 # = generate 2 surfaces if "=" in text[n]: extraSrfCount += -1 if ":" in text[n]: extraSrfCount += -1 if len(text[n].strip()) != len(srfs) + extraSrfCount: # project the curves to the place in case number of surfaces # doesn't match the text projectedCrvs = [] for crv in joindCrvs: projectedCrvs.append(rc.Geometry.Curve.ProjectToPlane(crv, plane)) srfs = rc.Geometry.Brep.CreatePlanarBreps(projectedCrvs) textSrfs.append(srfs) rc.RhinoDoc.ActiveDoc.Objects.Delete(postText, True) # find and delete the text return textSrfs #def strategyDraw_Calc(name, shiftFactor, *points): # The x is for a list of points passed one by one def strategyDraw_Calc(name, shiftFactor, points, hourPoints, tol, dryBulbTemperature, totalHrs, cR, cG, cB): strategyID = [0 for x in range(totalHrs)] strategyPt = [] for x in range(0, len(points)): strategyPt.append(rc.Geometry.Point3d(points[x][0], points[x][1] + shiftFactor, points[x][2] + 0.05)) #Draw Polygon strategyPolyline = rc.Geometry.PolylineCurve(strategyPt) #meshedC = rc.Geometry.Mesh.CreateFromPlanarBoundary(strategyPolyline.ToNurbsCurve(), meshingP) #Turn the comfort curve into a brep that will show up well on the chart. #finalStrategyPolyline = [] finalStrategyPolyline = outlineCurve(strategyPolyline) strategyPolygon = rc.Geometry.Brep.CreatePlanarBreps(strategyPolyline)[0] ### try: strategyPolygon = rc.Geometry.Brep.CreatePlanarBreps(strategyPolyline)[0] ### except: strategyPolygon = None #Start STRATEGY statistics ******************************** #Find the hours in the STRATEGY. strategyList = [] n = 0 for point in hourPoints: containment = strategyPolyline.Contains(point, rc.Geometry.Plane.WorldXY, tol) if str(containment) == 'Inside': strategyList.append(1) strategyID[n] = 1 else: strategyList.append(0) n += 1 #Find the STRATEGY Percentage. numStrHrs = sum(strategyList) totalHrs = len(dryBulbTemperature) strPercent = (numStrHrs / totalHrs)*100 #End STRATEGY statistics ******************************** #return numStrHrs, strPercent, strategyID, strategyPolygon return numStrHrs, strPercent, strategyID, strategyPolygon, finalStrategyPolyline def drawColorResults(czPt, pshPt, stPt, colorCZ, colorPSH, colorST): alpha = 255 # 0 = Transparent, 255 = Opaque ... supposed to be so colResMesh = [] for count in range(3): if count == 0: color = colorCZ #Draw each Result dataPolyline = rc.Geometry.PolylineCurve(czPt) meshedC = rc.Geometry.Mesh.CreateFromPlanarBoundary(dataPolyline.ToNurbsCurve(), meshingP) elif count == 1: color = colorPSH dataPolyline = rc.Geometry.PolylineCurve(pshPt) meshedC = rc.Geometry.Mesh.CreateFromPlanarBoundary(dataPolyline.ToNurbsCurve(), meshingP) elif count == 2: color = colorST dataPolyline = rc.Geometry.PolylineCurve(stPt) meshedC = rc.Geometry.Mesh.CreateFromPlanarBoundary(dataPolyline.ToNurbsCurve(), meshingP) # generate the color list for all the vertices repeatedColors = [] for face in range(meshedC.Faces.Count): repeatedColors.append(color) # use ladybug functions to color the circle ##colMesh = lb_visualization.colorMesh(repeatedColors, meshedC) if count == 0 : colMesh1 = lb_visualization.colorMesh(repeatedColors, meshedC) elif count == 1 : colMesh2 = lb_visualization.colorMesh(repeatedColors, meshedC) elif count == 2 : colMesh3 = lb_visualization.colorMesh(repeatedColors, meshedC) ####colResMesh.append(colMesh) #colResMesh[count] = colMesh #print count, colMesh #Bring all legend and text together in one list. ##colMeshGGraph = [] #for item in colResMesh: #for item in colMesh: #colMeshGGraph.append(item) ##return colMesh ####return colResMesh return colMesh1, colMesh2, colMesh3 ##return colMeshGGraph def graphResults(orgX, orgY, orgZ, gridStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, lb_preparation, legendFontSize, legendFont, strategiesColors): czBot = orgY czTop = orgY + strategyPercent[0] pshBot = czTop pshTop = czTop + strategyPercent[1] firstX = orgX colorCZ = strategiesColors[0] # CZ colorPSH = strategiesColors[1] # PSH stResGraph = [] seeChartResults = [] for count in range(2, len(strategyNames)): # Start from third strategy. First 2 are: CZ and PSH which are fixed if count == 0: colorST = strategiesColors[0] # CZ elif count == 1: colorST = strategiesColors[1] # PSH elif count == 2: colorST = strategiesColors[2] # EC elif count == 3: colorST = strategiesColors[3] # HTM elif count == 4: colorST = strategiesColors[4] # NV else : colorST = [255, 255, 255] czPt = [] pshPt = [] stPt = [] czPt.append(rc.Geometry.Point3d(firstX + 2.0, czBot, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 8.0, czBot, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 8.0, czTop, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 2.0, czTop, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 2.0, czBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 8.0, pshBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 8.0, pshTop, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshBot, 0.0)) stTop = pshTop + strategyPercent[count] stPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 8.0, pshTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 8.0, stTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 2.0, stTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) firstX = firstX + 10.0 #Draw Polygon strategyPolyline = rc.Geometry.PolylineCurve(stPt) stResGraph.append(strategyPolyline) strategyPolyline = rc.Geometry.PolylineCurve(pshPt) stResGraph.append(strategyPolyline) strategyPolyline = rc.Geometry.PolylineCurve(czPt) stResGraph.append(strategyPolyline) #print colorCZ, colorPSH, colorST, colorKK ##colorResultsMesh = drawColorResults(czPt, pshPt, stPt, colorCZ, colorPSH, colorST) # Calling routine for drawing the results in color ##stResGraph.append(colorResultsMesh) colorResultsMesh1, colorResultsMesh2, colorResultsMesh3 = drawColorResults(czPt, pshPt, stPt, colorCZ, colorPSH, colorST) # Calling routine for drawing the results in color stResGraph.append(colorResultsMesh1) stResGraph.append(colorResultsMesh2) stResGraph.append(colorResultsMesh3) #Bring all legend and text together in one list. ##seeChartResults = [] for item in stResGraph: seeChartResults.append(item) ##return seeChartResults return stResGraph def graphResultsMonth(orgX, orgY, orgZ, gridStep, monthStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, strategyMonth, lb_preparation, legendFontSize, legendFont, strategiesColors): colorCZ = strategiesColors[0] # CZ colorPSH = strategiesColors[1] # PSH y = float() #Months titles loop step = 0 seeChartResults = [] stResGraph = [] for month in range(0, len(MonthNames)): step += monthStep czBot = orgY for line in strategyMonth[0][month][0:1]: if line == 0: line = 0.01 czTop = orgY + line # CZ & Percentage in the list pshBot = czTop for line in strategyMonth[1][month][0:1]: if line == 0: line = 0.01 pshTop = czTop + line # PSH & Percentage in the list firstX = orgX + step ##for count in range(0, len(StNames)): for count in range(2, len(strategyNames)): #for count in range(2, len(strategyNames)): # Start from third strategy. First 2 are: CZ and PSH which are fixed if count == 0: colorST = strategiesColors[0] # CZ elif count == 1: colorST = strategiesColors[1] # PSH elif count == 2: colorST = strategiesColors[2] # EC elif count == 3: colorST = strategiesColors[3] # HTM elif count == 4: colorST = strategiesColors[4] # NV else : colorST = [255, 255, 255] czPt = [] pshPt = [] stPt = [] czPt.append(rc.Geometry.Point3d(firstX + 2.0, czBot, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 8.0, czBot, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 8.0, czTop, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 2.0, czTop, 0.0)) czPt.append(rc.Geometry.Point3d(firstX + 2.0, czBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 8.0, pshBot, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 8.0, pshTop, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) pshPt.append(rc.Geometry.Point3d(firstX + 2.0, pshBot, 0.0)) for line in strategyMonth[count][month][0:1]: if line == 0: line = 0.01 stTop = pshTop + float(line) # Strategy & Percentage in the list #stTop = pshTop + strategyPercent[count] stPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 8.0, pshTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 8.0, stTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 2.0, stTop, 0.0)) stPt.append(rc.Geometry.Point3d(firstX + 2.0, pshTop, 0.0)) firstX = firstX + 10.0 #Draw Polygon strategyPolyline = rc.Geometry.PolylineCurve(stPt) stResGraph.append(strategyPolyline) strategyPolyline = rc.Geometry.PolylineCurve(pshPt) stResGraph.append(strategyPolyline) strategyPolyline = rc.Geometry.PolylineCurve(czPt) stResGraph.append(strategyPolyline) ##colorResultsMesh = drawColorResults(czPt, pshPt, stPt, colorCZ, colorPSH, colorST) # Calling routine for drawing the results in color ##stResGraph.append(colorResultsMesh) colorResultsMesh1, colorResultsMesh2, colorResultsMesh3 = drawColorResults(czPt, pshPt, stPt, colorCZ, colorPSH, colorST) # Calling routine for drawing the results in color stResGraph.append(colorResultsMesh1) stResGraph.append(colorResultsMesh2) stResGraph.append(colorResultsMesh3) #Bring all legend and text together in one list. for item in stResGraph: seeChartResults.append(item) #return stResGraph return seeChartResults def showResults(basePoint_, mainLegHeight, strategyNames, strategyPercent, strategyHours, strategyMonth, \ lowB, highB, numSeg, customColors, legendBasePoint, legendScale, legendFont, legendFontSize, lb_preparation, lb_visualization, strategiesColors): gridLines = [] resultsChart = [] shiftRes = 45 orgX = int(shiftRes + legendBasePoint[0]) orgY = int(legendBasePoint[1]) orgZ = int(legendBasePoint[2]) monthStep = 40 resLimitX = monthStep * 13 boundBoxX = 40 boundBoxY = abs(orgY) + 100 scaleLegBox = mainLegHeight / 100 #print 'BB = ', boundBoxX, boundBoxY, orgX, orgY, mainLegHeight, scaleLegBox gridStep = 10 # Grid Lines ******************************* #xLineValue = range(orgX, orgX + 50, 40) xLineValue = range(orgX, orgX + resLimitX + monthStep, monthStep) yLineValue = range(orgY, orgY + 110, gridStep) #for m in range(0, len(MonthNames)+1): for value in xLineValue: #Bottom to Top lines gridLines.append(rc.Geometry.Line(value, orgY, 0, value, (100 + orgY), 0)) #print value-orgX for value in yLineValue: # Left to right lines #gridLines.append(rc.Geometry.Line(orgX, value, 0, orgX + 40, value, 0)) gridLines.append(rc.Geometry.Line(orgX, value, 0, orgX + resLimitX, value, 0)) # End Grid Lines **************************** # Print Title and legends in grid: X/Y axis **************************** location = 'Results' resText = createResultsLegend(orgX, orgY, orgZ, gridStep, monthStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, lb_preparation, legendFontSize, legendFont, strategiesColors) # This is for Year results --- in the future this and the monthly results should be unified in one single routine seeChartResults = graphResults(orgX, orgY, orgZ, gridStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, lb_preparation, legendFontSize, legendFont, strategiesColors) # This is for monthly results seeMonthChartResults = graphResultsMonth(orgX, orgY, orgZ, gridStep, monthStep, xLineValue, yLineValue, location, strategyNames, strategyPercent, strategyHours, strategyMonth, lb_preparation, legendFontSize, legendFont, strategiesColors) # Collect all Results, Legend and Gridlines in one list. for item in gridLines: resultsChart.append(item) for item in resText: resultsChart.append(item) for item in seeChartResults: resultsChart.append(item) for item in seeMonthChartResults: resultsChart.append(item) bPt = rc.Geometry.Point3d(20., -2., 0.) #bPtSc = rc.Geometry.Point3d(0., 0., 0.) scale = rc.Geometry.Transform.Scale(bPt, scaleLegBox) move = rc.Geometry.Transform.Translation(bPt.X, bPt.Y, bPt.Z) transformMtx = scale * move for geo in resultsChart: geo.Transform(transformMtx) return resultsChart def circPoints(centerPt, radius, secs): dt = 2.0 * math.pi / secs div = 2*math.pi/secs ang = 0 cP = [] for n in range(0, secs+1): # The +1 is to make the last point equal to the first, so the polygon will be closed if n == secs+1: ang = 0 ptX = (centerPt.X + radius * math.cos(ang)) ptY = (centerPt.Y + radius * math.sin(ang)) ptZ = (centerPt.Z)+ 0.1 cP.append(rc.Geometry.Point3d(ptX, ptY, ptZ)) ang += div #Draw each climatic data dataPolyline = rc.Geometry.PolylineCurve(cP) return cP, dataPolyline def drawPolygon(centerPt, radius, secs, color): dt = 2.0 * math.pi / secs div = 2*math.pi/secs ang = 0 cP = [] for n in range(0, secs+1): # The +1 is to make the last point equal to the first, so the polygon will be closed if n == secs+1: ang = 0 ptX = (centerPt.X + radius * math.cos(ang)) ptY = (centerPt.Y + radius * math.sin(ang)) ptZ = (centerPt.Z)+ 0.1 cP.append(rc.Geometry.Point3d(ptX, ptY, ptZ)) ang += div #Draw each climatic data dataPolyline = rc.Geometry.PolylineCurve(cP) meshedC = rc.Geometry.Mesh.CreateFromPlanarBoundary(dataPolyline.ToNurbsCurve(), meshingP) # generate the color list for all the vertices repeatedColors = [] for face in range(meshedC.Faces.Count): repeatedColors.append(color) # use ladybug functions to color the circle colMesh = lb_visualization.colorMesh(repeatedColors, meshedC) return colMesh # Routine that gets monthly statistics and Min/Max values def monthCalcs(totalHrs, comfID, pshID, ecID, htmID, nvID, dryBulbTemperature, relativeHumidity, monthPoints, monthColors, comfortNOcomfortColors): stM = 0 pointMinMax = [] geoMinMax = [] allMinMax = [] comfID_m = [] pshID_m = [] ecID_m = [] htmID_m = [] nvID_m = [] colByComfort = [] colByMonth = [] for m in range(0, len(monthPoints)): geoMinMax.append([]) comfID_m.append([]) pshID_m.append([]) ecID_m.append([]) htmID_m.append([]) nvID_m.append([]) cfZ = pshZ = ecZ = htmZ = nvZ = 0 colByComfort.append([]) colByMonth.append([]) minTemp = 50.0 maxTemp = -50.0 minHum = 100.0 maxHum = 0.0 monthHours = len(monthPoints[m]) for n in range(stM, stM + len(monthPoints[m])): #Start the counter from the previos month hour #for temp in dryBulbTemperature: if dryBulbTemperature[n] < minTemp: minTemp = dryBulbTemperature[n] if dryBulbTemperature[n] > maxTemp: maxTemp = dryBulbTemperature[n] if relativeHumidity[n] < minHum: minHum = relativeHumidity[n] if relativeHumidity[n] > maxHum: maxHum = relativeHumidity[n] # Summing up the points for each strategy if comfID[n] == 1: cfZ += 1 if pshID[n] == 1: pshZ += 1 if ecID[n] == 1: ecZ += 1 if htmID[n] == 1: htmZ += 1 if nvID[n] == 1: nvZ += 1 # See if the point is in any comfort strategy and the use a color for Comfort/NotComfort if comfID[n] == 1 or pshID[n] == 1 or ecID[n] == 1 or htmID[n] == 1 or nvID[n] == 1: colByComfort[m].append(comfortNOcomfortColors[1]) else: colByComfort[m].append(comfortNOcomfortColors[0]) #colByMonth[m].append(colorP) colByMonth[m].append(monthColors[m]) # Calculate the effective percentage per month and number of comfort for each strategy czM_Perc = cfZ * 100 / len(monthPoints[m]) comfID_m[m] = [czM_Perc, cfZ, monthHours] pshM_Perc = pshZ * 100 / len(monthPoints[m]) pshID_m[m] = [pshM_Perc, pshZ, monthHours] ecM_Perc = ecZ * 100 / len(monthPoints[m]) ecID_m[m] = [ecM_Perc, ecZ, monthHours] htmM_Perc = htmZ * 100 / len(monthPoints[m]) htmID_m[m] = [htmM_Perc, htmZ, monthHours] nvM_Perc = nvZ * 100 / len(monthPoints[m]) nvID_m[m] = [nvM_Perc, nvZ, monthHours] #print m, comfID_m[m], pshID_m[m], ecID_m[m], htmID_m[m], nvID_m[m] pointMinMax.append([minTemp * 2, maxTemp * 2, minHum, maxHum]) stM = stM + len(monthPoints[m]) geoMinMax[m].append(rc.Geometry.Line(pointMinMax[m][3], pointMinMax[m][0], 0, pointMinMax[m][2], pointMinMax[m][1], 0)) #Line connecting min-max colorP = System.Drawing.Color.FromArgb(0, 0, 0) minPt = rc.Geometry.Point3d(pointMinMax[m][3], pointMinMax[m][0], 0) maxPt = rc.Geometry.Point3d(pointMinMax[m][2], pointMinMax[m][1], 0) dataPolygon = drawPolygon (minPt, .8, 4, colorP) geoMinMax[m].append(dataPolygon) dataPolygon = drawPolygon (maxPt, .8, 4, colorP) geoMinMax[m].append(dataPolygon) #geoMinMax[m].append(rc.Geometry.Circle(minPt, 0.5)) #geoMinMax[m].append(rc.Geometry.Circle(maxPt, 0.5)) # Collect all monthly results for all strategies under one variable - in the future all calculations should be done under this variable strategyMonth = [] for count in range(0, len(StNames)): strategyMonth.append([]) for month in range(0, len(MonthNames)): strategyMonth[count].append([]) if StNames[count] == 'ComfortZone': strategyMonth[count][month] = comfID_m[month] elif StNames[count] == 'PassiveSolarHeating': strategyMonth[count][month] = pshID_m[month] elif StNames[count] == 'EvaporativeCooling': strategyMonth[count][month] = ecID_m[month] elif StNames[count] == 'HighTermalMass+NightVent': strategyMonth[count][month] = htmID_m[month] elif StNames[count] == 'NaturalVentilation': strategyMonth[count][month] = nvID_m[month] #Bring all set of lines and circles per month together in one list. for item in geoMinMax: allMinMax.append(item) #return allMinMax, strategyMonth, comfID_m, pshID_m, ecID_m, htmID_m, nvID_m return allMinMax, strategyMonth, colByComfort, colByMonth def monthForHour(hour): for m in range(0, len(MonthNames)+1): if int(hour) < ((MonthDays[m] * 24)): hrCol = m break return hrCol def seasonHours(period, totalHrs): x = period.split(' ') season = [[],[]] season[0].append(int(x[0]) - 1) # Month season[0].append(int(x[1]) - 1) # Day season[0].append(int(x[2]) - 1) # Hour season[1].append(int(x[3]) - 1) # Month season[1].append(int(x[4]) - 1) # Day season[1].append(int(x[5]) - 1) # Hour return season def calcHourYear(season, i): # print 'in calcHourYear ----- ----- ----- season is ', season[i] JulDay = MonthDays[season[i][0]] + season[i][1] HourYear = (JulDay) * 24 + season[i][2] # print '1. For month %d day %d hour %d Julian Day is %d HourYear is %d \n' % (season[i][0], season[i][1], season[i][2], JulDay, HourYear) return JulDay, HourYear def assignHour2Season(start, end, totalHrs, iSeason, seasonID, dbtValue, rhValue): # seasonHrs = [[],[],[]] if start > end: hrs = totalHrs - start numSeasHrs = hrs + end else: numSeasHrs = end - start # print 'St, End, totalHrs, numHrs, Season ', start, end, totalHrs, numSeasHrs, iSeason ############################## if start > end: hrs = totalHrs - start numSeasHrs = hrs + end SeasHrs = range(start, totalHrs) + range(0, end + 1) else: numSeasHrs = end - start SeasHrs = range(start, end + 1) ############################## ##for id in range(start, end): #to iterate between start to end for id, m in enumerate(SeasHrs): # print 'Serial id - Choosen Hour m ', id, m seasonID[m] = iSeason # return seasonHrs, seasonID return seasonID def setSeasonID(dryBulbTemperature, relativeHumidity, totalHrs): #Define Model Tolerance tol = sc.doc.ModelAbsoluteTolerance #Plot Point Values. #****************** dbtValue = [] seasonID = [0 for x in range(totalHrs)] for temp in dryBulbTemperature: dbtValue.append(temp) rhValue = [] relativeHumidity = _relativeHumidity[7:] for temp in relativeHumidity: rhValue.append(temp) if analysisPeriodWinter_: stMonth, stDay, stHour, endMonth, endDay, endHour = lb_preparation.readRunPeriod(analysisPeriodWinter_, False) stringWinter = str(stMonth) + ' ' + str(stDay) + ' ' + str(stHour) + ' ' + str(endMonth) + ' ' + str(endDay) + ' ' + str(endHour) periodWinter = stringWinter winterSeason = seasonHours(periodWinter, totalHrs) # # Calling function to calculate Day of Year and Hour of Year for START-END period JulDay1, hourWinterStart = calcHourYear(winterSeason, 0) JulDay2, hourWinterEnd = calcHourYear(winterSeason, 1) # seasonHrsWinter, seasonID = assignHour2Season(hourWinterStart, hourWinterEnd, totalHrs, 3, seasonID, dbtValue, rhValue) seasonID = assignHour2Season(hourWinterStart, hourWinterEnd, totalHrs, 3, seasonID, dbtValue, rhValue) ## print 'Winter: Start %d End %d Total Hours %d \n' % (hourWinterStart, hourWinterEnd, hourWinterEnd - hourWinterStart + 1) # print 'seasonHrsWinter ', seasonHrsWinter if analysisPeriodSummer_: stMonth, stDay, stHour, endMonth, endDay, endHour = lb_preparation.readRunPeriod(analysisPeriodSummer_, False) stringSummer = str(stMonth) + ' ' + str(stDay) + ' ' + str(stHour) + ' ' + str(endMonth) + ' ' + str(endDay) + ' ' + str(endHour) periodSummer = stringSummer summerSeason = seasonHours(periodSummer, totalHrs) # Calling function to calculate Day of Year and Hour of Year for START-END period JulDay1, hourSummerStart = calcHourYear(summerSeason, 0) JulDay2, hourSummerEnd = calcHourYear(summerSeason, 1) # seasonHrsSummer, seasonID = assignHour2Season(hourSummerStart, hourSummerEnd, totalHrs, 1, seasonID, dbtValue, rhValue) seasonID = assignHour2Season(hourSummerStart, hourSummerEnd, totalHrs, 1, seasonID, dbtValue, rhValue) ## print 'Summer: Start %d End %d Total Hours %d \n' % (hourSummerStart, hourSummerEnd, hourSummerEnd - hourSummerStart + 1) # print 'seasonHrsSummer ', seasonHrsSummer # f = open("C:\WorkingFolder\Courses\Rhino-Grasshopper-Diva\PythonStuff\BioclimaticChart\dataTMP.csv","wr") # f.write('SeasonID,Temperature,RelativeHumidity\n') # for m in range(0, totalHrs): # string = str(seasonID[m])+', '+str(dbtValue[m])+', '+str(rhValue[m])+',' # f.write(string+'\n') # f.close() # print 'winterSeason ', winterSeason # print 'summerSeason ', summerSeason ## return seasonID, winterSeason, summerSeason return seasonID def createFrequencyMesh(orgY, dryBulbTemperature, relativeHumidity, cullMesh, lb_preparation, lb_visualization): #Read Legend Parameters if legendPar_ == None: legendPar = [None, None, None, None, None, None, None, None] else: legendPar = legendPar_ lowB, highB, numSeg, customColors, legendBasePoint, legendScale,\ legendFont, legendFontSize, legendBold = lb_preparation.readLegendParameters(legendPar, False) hourPts = [] for count, ratio in enumerate(relativeHumidity): hourPts.append(rc.Geometry.Point3d(dryBulbTemperature[count], relativeHumidity[count], 0)) #Make a mesh. gridSize = 5 joinedMesh = rc.Geometry.Mesh() meshPoints = [] for yVal in range(orgY, 100, gridSize): #####for yVal in range(0, 100, gridSize): for xVal in range(0, 100, gridSize): point1 = rc.Geometry.Point3d(xVal, yVal, 0) point2 = rc.Geometry.Point3d(xVal+gridSize, yVal, 0) point3 = rc.Geometry.Point3d(xVal+gridSize, yVal+gridSize, 0) point4 = rc.Geometry.Point3d(xVal, yVal+gridSize, 0) meshPoints.append([point1, point2, point3, point4]) for list in meshPoints: mesh = rc.Geometry.Mesh() for point in list: mesh.Vertices.Add(point) mesh.Faces.AddFace(0, 1, 2, 3) joinedMesh.Append(mesh) polyCurveList = [] for list in meshPoints: pointList = [list[0], list[1], list[2], list[3],list[0]] polyLine = rc.Geometry.PolylineCurve(pointList) polyCurveList.append(polyLine) #Make a list to hold values for all of the mesh faces. meshFrequency = [] for count, value in enumerate(range(orgY, 100, 5)): ####for count, value in enumerate(range(0, 100, 5)): meshFrequency.append([]) for face in range(0, 100, 5): meshFrequency[count].append([]) def getHumidityIndex(hour): if relativeHumidity[hour] < 5: index = 0 elif relativeHumidity[hour] < 10: index = 1 elif relativeHumidity[hour] < 15: index = 2 elif relativeHumidity[hour] < 20: index = 3 elif relativeHumidity[hour] < 25: index = 4 elif relativeHumidity[hour] < 30: index = 5 elif relativeHumidity[hour] < 35: index = 6 elif relativeHumidity[hour] < 40: index = 7 elif relativeHumidity[hour] < 45: index = 8 elif relativeHumidity[hour] < 50: index = 9 elif relativeHumidity[hour] < 55: index = 10 elif relativeHumidity[hour] < 60: index = 11 elif relativeHumidity[hour] < 65: index = 12 elif relativeHumidity[hour] < 70: index = 13 elif relativeHumidity[hour] < 75: index = 14 elif relativeHumidity[hour] < 80: index = 15 elif relativeHumidity[hour] < 85: index = 16 elif relativeHumidity[hour] < 90: index = 17 elif relativeHumidity[hour] < 95: index = 18 else: index = 19 return index addGridToIndex = abs(orgY/2) module = gridSize/2 for hour, temp in enumerate(dryBulbTemperature): tempIndex = int((float(temp)+addGridToIndex) / module) humIndex = getHumidityIndex(hour) if tempIndex < 28: meshFrequency[tempIndex][humIndex].append(1) #Sum all of the lists together to get the frequency. finalMeshFrequency = [] for templist in meshFrequency: for humidlist in templist: finalMeshFrequency.append(sum(humidlist)) #Get a list of colors colors = lb_visualization.gradientColor(finalMeshFrequency, lowB, highB, customColors) # color the mesh faces. joinedMesh.VertexColors.CreateMonotoneMesh(System.Drawing.Color.Gray) for srfNum in range (joinedMesh.Faces.Count): joinedMesh.VertexColors[4 * srfNum + 0] = colors[srfNum] joinedMesh.VertexColors[4 * srfNum + 1] = colors[srfNum] joinedMesh.VertexColors[4 * srfNum + 3] = colors[srfNum] joinedMesh.VertexColors[4 * srfNum + 2] = colors[srfNum] # Remove the mesh faces that do not have any hour associated with them. if cullMesh == True: cullFaceIndices = [] for count, freq in enumerate(finalMeshFrequency): if freq == 0: cullFaceIndices.append(count) joinedMesh.Faces.DeleteFaces(cullFaceIndices) #Return everything that's useful. return hourPts, joinedMesh, finalMeshFrequency def raggedListToDataTree(rl): result = DataTree[System.Object]() for i, leg in enumerate(rl): #for i in range(len(rl)): path = GH_Path(i) temp = [] for j, leg in enumerate(rl[i]): temp.append(rl[i][j]) #print 'J ', j, rl[i][j] result.AddRange(temp, path) return result def checkComfortOrNot(strategyNames, totalHrs, comfID, pshID, ecID, htmID, nvID, epwData, epwStr): totalComfortOrNot = [] comfHours = 0 for m in range(0, totalHrs): if comfID[m] == 1 or pshID[m] == 1 or ecID[m] == 1 or htmID[m] == 1 or nvID[m] == 1: #if comfID[m] == 1: #if pshID[m] == 1: #if ecID[m] == 1: #if htmID[m] == 1: #if nvID[m] == 1: totalComfortOrNot.append(1) comfHours += 1 else: totalComfortOrNot.append(0) percComfTotal = comfHours / totalHrs * 100 ##print 'Comfortable Hours %d, which are %.2f%%' % (comfHours, percComfTotal) #$#$comfortResults.append('CMF: ' + str(hrsCMF) + ' hours, ' + str(cmfPercent) + '%') totalComfortOrNot.insert(0, epwStr[6]) totalComfortOrNot.insert(0, epwStr[5]) totalComfortOrNot.insert(0, epwStr[4]) totalComfortOrNot.insert(0, "Boolean Value") combString = '%.1f%% (%d hrs) Comfortable Hours in All Strategies, ' % (percComfTotal, comfHours) totalComfortOrNot.insert(0, combString) totalComfortOrNot.insert(0, epwStr[1]) totalComfortOrNot.insert(0, epwStr[0]) #Calculate wheather each strategy is in comfort or not for each hour. For output "strategyOrNot" #--------------------------------------------- strategyOrNotList = [] comfHoursStrategy = [] percComfStrategy = [] for count, text in enumerate(strategyNames): if count == 0: stComf = list(comfID) # CZ elif count == 1: stComf = list(pshID) # PSH elif count == 2: stComf = list(ecID) # EC elif count == 3: stComf = list(htmID) # HTM elif count == 4: stComf = list(nvID) # NV comfHours = 0 strategyOrNotList.append([]) for m in range(0, totalHrs): if stComf[m] == 1: strategyOrNotList[count].append(1) comfHours += 1 else: strategyOrNotList[count].append(0) comfHoursStrategy.append(comfHours) percComfStrategy.append(comfHoursStrategy[count] / totalHrs * 100) #print 'Comfortable Hours %d, which are %.2f%%' % (comfHoursStrategy[count], percComfStrategy[count]) strategyOrNotList[count].insert(0, epwStr[6]) strategyOrNotList[count].insert(0, epwStr[5]) strategyOrNotList[count].insert(0, epwStr[4]) strategyOrNotList[count].insert(0, "Boolean Value") combString = '%.1f%% (%d hrs) Comfortable Hours in %s, ' % (percComfStrategy[count], comfHoursStrategy[count], text) strategyOrNotList[count].insert(0, combString) strategyOrNotList[count].insert(0, epwStr[1]) strategyOrNotList[count].insert(0, epwStr[0]) #--------------------------------------------- return totalComfortOrNot, strategyOrNotList # ****** END DEF ********************* # ************************************ def main(epwData, epwStr): if sc.sticky.has_key('ladybug_release'): lb_preparation = sc.sticky["ladybug_Preparation"]() lb_visualization = sc.sticky["ladybug_ResultVisualization"]() # Read the legend parameters. lowB, highB, numSeg, customColors, legendBasePoint, legendScale, \ legendFont, legendFontSize, legendBold = lb_preparation.readLegendParameters(legendPar_, False) if cullMesh_: cullMesh = cullMesh_ else: cullMesh = False # Fix MET and Clo factor for strategies position. lowActivity = 3 highActivity = 4 defMet = 1.3 winterClo = 2 SummerClo = 5 defClo = 0.8 if basePoint_ != None: basePoint = basePoint_ xP = 0.0 #basePoint_.X yP = 0.0 #basePoint_.Y zP = 0.0 #basePoint_.Z else: basePoint = rc.Geometry.Point3d(0,0,0) xP, yP, zP = 0.0, 0.0, 0.0 if metabolicRate_ : metRate = metabolicRate_ if metabolicRate_ >= 2.0: actShift = highActivity else: actShift = lowActivity shiftFactorMet = (defMet - metRate) * actShift # Proof of concept. Need to fix later else: metRate_ = defMet shiftFactorMet = 0 if clothingLevel_: cloLevel = clothingLevel_ shiftFactorClo = (defClo - clothingLevel_) * winterClo # Proof of concept. Need to fix later else: cloLevel_ = 0.8 shiftFactorClo = 0 shiftFactor = shiftFactorMet + shiftFactorClo #print 'shiftFactorMet %.2f, shiftFactorClo %.2f, shiftFactor %.2f' % (shiftFactorMet, shiftFactorClo, shiftFactor) #Define color palettes for outputs and legends. monthColors, comfortNOcomfortColors, strategiesColors = colors() #Make chart curves. #Plot Point Values. #****************** strategyNames = [] strategyNames.append('Comfort') strategyNames.append('Passive Solar Heating') strategyNames.append('Evaporative Cooling') strategyNames.append('Thermal Mass + Night Vent') strategyNames.append('Natural Ventilation') chartHourPoints = [] hourPointColorsByComfort = [] hourPointColorsByMonth = [] min_maxPoints = [] monthPoints = [] comfort_strategyPolygons = [] yPointValue = [] dbtValue = [] location = _dryBulbTemperature[1:2][0] dryBulbTemperature = _dryBulbTemperature[7:] totalHrs = len(dryBulbTemperature) minTemp = 0.0 for temp in dryBulbTemperature: dbtValue.append(temp) if temp < minTemp: minTemp = temp #print 'minTemp ', minTemp yPointValue.append(temp*2 + yP) gridSize = 5.0 addGrid = (int(math.ceil(abs(minTemp / gridSize))) * (-1) * gridSize) * 2 # This is for negative temperatures #print 'minTemp %.1f addGrid %d' % (minTemp, addGrid) # Grid Lines ******************************* gridLines = [] orgX = int(0 + xP) orgY = int(int(addGrid) + yP) orgZ = int(0 + zP) gridStep = 10 #print 'orgY ', orgY xLineValue = range(orgX, orgX + 110, gridStep) yLineValue = range(orgY, 110, gridStep) #starLine = rc.Geometry.Line(0, 0, 0, 0, 100, 0) for value in xLineValue: gridLines.append(rc.Geometry.Line(value+xP, int(addGrid)+yP, 0+zP, value+xP, 100+yP, 0+zP)) for value in yLineValue: # Left to right lines gridLines.append(rc.Geometry.Line(0+xP, value+yP, 0+zP, 100+xP, value+yP, 0+zP)) # End Grid Lines **************************** # Print Title and legends in grid: X/Y axis **************************** chartLayout = createChartLayout(orgX, orgY, orgZ, location, legendFont, legendFontSize) xPointValue = [] rhValue = [] relativeHumidity = _relativeHumidity[7:] for temp in relativeHumidity: rhValue.append(temp) xPointValue.append(temp + xP) #stringSummer, stringWinter, seasonID = setSeasonID(dryBulbTemperature, relativeHumidity, totalHrs) seasonID = setSeasonID(dryBulbTemperature, relativeHumidity, totalHrs) # print 'SeasonID ', seasonID # Winter = 3, Summer = 1 hourPoints = [] hourPointsCirc = [] ##hourColor = [] colPnt1 = [] colPnt2 = [] colPnt3 = [] colPnt4 = [] colPnt5 = [] colPnt6 = [] colPnt7 = [] colPnt8 = [] colPnt9 = [] colPnt10 = [] colPnt11 = [] colPnt12 = [] dataRadius = 0.4 nVert = 4 # for count, xVal in enumerate(xPointValue): # centerPt = rc.Geometry.Point3d(xVal+xP, yPointValue[count]+yP, 0+zP) for hour in range(0, totalHrs): ##for hour in range(0, totalHrs - 1): # Colors according to Season if seasonID[hour] == 3: # Winter colorP = [50, 50, 255] elif seasonID[hour] == 1: # Summer colorP = [255, 255, 50] centerPt = rc.Geometry.Point3d(xPointValue[hour], yPointValue[hour]+yP, 0+zP) hourPoints.append(rc.Geometry.Point3d(centerPt)) hourPointsCirc = rc.Geometry.Circle(centerPt, 0.25) # Colors according to Month col = monthForHour(hour) ##hourColor.append(col) # Here you get the month that the hour belongs to if col == 0: colPnt1.append(hourPointsCirc) elif col == 1: colPnt2.append(hourPointsCirc) elif col == 2: colPnt3.append(hourPointsCirc) elif col == 3: colPnt4.append(hourPointsCirc) elif col == 4: colPnt5.append(hourPointsCirc) elif col == 5: colPnt6.append(hourPointsCirc) elif col == 6: colPnt7.append(hourPointsCirc) elif col == 7: colPnt8.append(hourPointsCirc) elif col == 8: colPnt9.append(hourPointsCirc) elif col == 9: colPnt10.append(hourPointsCirc) elif col == 10: colPnt11.append(hourPointsCirc) elif col == 11: colPnt12.append(hourPointsCirc) # Collect points according to MONTH monthPoints.append(colPnt1) monthPoints.append(colPnt2) monthPoints.append(colPnt3) monthPoints.append(colPnt4) monthPoints.append(colPnt5) monthPoints.append(colPnt6) monthPoints.append(colPnt7) monthPoints.append(colPnt8) monthPoints.append(colPnt9) monthPoints.append(colPnt10) monthPoints.append(colPnt11) monthPoints.append(colPnt12) hourPts, chartMesh, meshFaceValues = createFrequencyMesh(orgY, dryBulbTemperature, relativeHumidity, cullMesh, lb_preparation, lb_visualization) # Legend for Mesh of Colors from FrequencyMesh routine if legendBasePoint == None: ####legendBasePoint = lb_visualization.BoundingBoxPar[0] #legendBasePoint = (rc.Geometry.Point3d(lb_visualization.BoundingBoxPar[0], lb_visualization.BoundingBoxPar[1], 0)) legendBasePoint = rc.Geometry.Point3d(orgX + 101, orgY, 0) legendChartMesh = [] legendTitle = "Hours" legendScale = .6 #legendFontSize = 2 #lb_visualization.calculateBB(chartText, True) lb_visualization.calculateBB(chartLayout[0:90], True) legendSrfs, legendText, legendTextCrv, textPt, textSize = lb_visualization.createLegend(meshFaceValues, lowB, highB, numSeg, legendTitle, lb_visualization.BoundingBoxPar, legendBasePoint, legendScale, legendFont, legendFontSize) ##legendColors = lb_visualization.gradientColor(legendText[:-1], lowB, highB, customColors) legendColors = lb_visualization.gradientColor(legendText[:-1], lowB, highB, customColors) legendSrfs = lb_visualization.colorMesh(legendColors, legendSrfs) legendChartMesh.append(legendSrfs) for list in legendTextCrv: for item in list: legendChartMesh.append(item) legendBasePoint = rc.Geometry.Point3d(orgX + 105, orgY, 0) mainLegHeight = ((lb_visualization.BoundingBoxPar[2] / 10) * legendScale) * numSeg # *********** # List of Comfort Coordinates ************************** cf_Ptlist = [27.02+xP, 42.12+yP,0.0+zP],[18.27+xP,52.64+yP,0.0+zP], [64.03+xP,45.77+yP,0.0+zP],[80.00+xP,40.78+yP,0.0+zP],\ [27.02+xP, 42.12+yP,0.0+zP] hrsCMF, cmfPercent, comfID, comfortPolygon, comfortPolyline = strategyDraw_Calc('COMF', shiftFactor, cf_Ptlist, hourPoints, tol, dryBulbTemperature, totalHrs, 30,30,30) ##print 'Comf hours %d, Comf Percentage %.2f' % (hrsCMF, cmfPercent) # List of Passive Solar Heating Coordinates ************************** pshPtList = [1.07+xP,11.83+yP,0.00+zP],[1.07+xP,42.82+yP,0.00+zP],[98.97+xP,40.44+yP,0.00+zP],[98.97+xP,9.61+yP,0.00+zP], \ [1.07+xP,11.83+yP,0.00+zP] hrsPSH, pshPercent, pshID, pshPolygon, pshPolyline = strategyDraw_Calc('PSH', shiftFactor, pshPtList, hourPoints, tol, dryBulbTemperature, totalHrs, 200, 200, 20) ##print 'PSH hours %d, PSH Percentage %.2f' % (hrsPSH, pshPercent) #List of Evaporative Cooling Coordinates ************************** ec_Ptlist = [16.62+xP,42.42+yP,0.0+zP],[1.07+xP,57.79+yP,0.0+zP], [1.07+xP,82.21+yP,0.0+zP],[11.18+xP,82.21+yP,0.0+zP],\ [80.0+xP,45.79+yP,0.0+zP],[80.0+xP,40.78+yP,0.0+zP],[64.03+xP,45.77+yP,0.0+zP],[18.27+xP,52.64+yP,0.0+zP],\ [27.02+xP,42.12+yP,0.0+zP], [16.62+xP,42.42+yP,0.0+zP] hrsEC, ecPercent, ecID, ecPolygon, ecPolyline = strategyDraw_Calc('EC', shiftFactor, ec_Ptlist, hourPoints, tol, dryBulbTemperature, totalHrs, 20, 220, 20) ##print 'EC hours %d, EC Percentage %.2f' % (hrsEC, ecPercent) #List of High Termal Mass ************************** htmPtlist = [19.80+xP,42.35+yP,0.0+zP],[7.86+xP,71.28+yP,0.0+zP],[30.08+xP,71.28+yP,0.0+zP],[46.95+xP,66.03+yP,0.0+zP],\ [80.0+xP,49.12+yP,0.0+zP],[80.0+xP,40.78+yP,0.0+zP],[64.03+xP,45.77+yP,0.0+zP],[18.27+xP,52.64+yP,0.0+zP],\ [27.02+xP,42.12+yP,0.0+zP],[19.80+xP,42.35+yP,0.0+zP] hrsHTM, htmPercent, htmID, htmPolygon, htmPolyline = strategyDraw_Calc('HTM', shiftFactor, htmPtlist, hourPoints, tol, dryBulbTemperature, totalHrs, 180, 50, 50) ##print 'HTM hours %d, HTM Percentage %.2f' % (hrsHTM, htmPercent) #List of Natural Ventilation ************************** nvPtlist = [18.27+xP,52.64+yP,0.0+zP],[18.08+xP,62.56+yP,0.0+zP],[45.56+xP,62.56+yP,0.0+zP],[97.91+xP,53.79+yP,0.0+zP],\ [97.91+xP,40.47+yP,0.+zP], [80.0+xP,40.78+yP,0.0+zP],[64.03+xP,45.77+yP,0.0+zP],[18.27+xP,52.64+yP,0.0+zP] hrsNV, nvPercent, nvID, nvPolygon, nvPolyline = strategyDraw_Calc('NV', shiftFactor, nvPtlist, hourPoints, tol, dryBulbTemperature, totalHrs, 50, 50, 180) ##print 'NV hours %d, NV Percentage %.2f' % (hrsNV, nvPercent) # Collect all strategies and results ##comfort_strategyPolygons.append(comfortPolygon) ##comfort_strategyPolygons.append(pshPolygon) ##comfort_strategyPolygons.append(ecPolygon) ##comfort_strategyPolygons.append(htmPolygon) ##comfort_strategyPolygons.append(nvPolygon) #This block draws the polygons with the same color. The block below this draws the strategies colored #If wanted, uncomment this block and comment the block below ###comfort_strategyPolygons.append(comfortPolyline) ###comfort_strategyPolygons.append(pshPolyline) ###comfort_strategyPolygons.append(ecPolyline) ###comfort_strategyPolygons.append(htmPolyline) ###comfort_strategyPolygons.append(nvPolyline) comfortMesh = rc.Geometry.Mesh() comfortMesh.Append(rc.Geometry.Mesh.CreateFromBrep(comfortPolyline)[0]) comfortMesh.VertexColors.CreateMonotoneMesh(strategiesColors[0]) comfort_strategyPolygons.append(comfortMesh) pshMesh = rc.Geometry.Mesh() pshMesh.Append(rc.Geometry.Mesh.CreateFromBrep(pshPolyline)[0]) pshMesh.VertexColors.CreateMonotoneMesh(strategiesColors[1]) comfort_strategyPolygons.append(pshMesh) ecMesh = rc.Geometry.Mesh() ecMesh.Append(rc.Geometry.Mesh.CreateFromBrep(ecPolyline)[0]) ecMesh.VertexColors.CreateMonotoneMesh(strategiesColors[2]) comfort_strategyPolygons.append(ecMesh) htmMesh = rc.Geometry.Mesh() htmMesh.Append(rc.Geometry.Mesh.CreateFromBrep(htmPolyline)[0]) htmMesh.VertexColors.CreateMonotoneMesh(strategiesColors[3]) comfort_strategyPolygons.append(htmMesh) nvMesh = rc.Geometry.Mesh() nvMesh.Append(rc.Geometry.Mesh.CreateFromBrep(nvPolyline)[0]) nvMesh.VertexColors.CreateMonotoneMesh(strategiesColors[4]) comfort_strategyPolygons.append(nvMesh) #for count, value in enumerat(evapCooling): # if comfortList[count] == 1: # value = 0 # else: pass comfortResults = [] comfortResults.append('CMF: ' + str(hrsCMF) + ' hours, ' + str(cmfPercent) + '%') comfortResults.append('PSH: ' + str(hrsPSH) + ' hours, ' + str(pshPercent) + '%') comfortResults.append('EC: ' + str(hrsEC) + ' hours, ' + str(ecPercent) + '%') comfortResults.append('HTM: ' + str(hrsHTM) + ' hours, ' + str(htmPercent) + '%') comfortResults.append('NV: ' + str(hrsNV) + ' hours, ' + str(nvPercent) + '%') strategyPercent = [] strategyPercent.append(cmfPercent) strategyPercent.append(pshPercent) strategyPercent.append(ecPercent) strategyPercent.append(htmPercent) strategyPercent.append(nvPercent) strategyHours = [] strategyHours.append(hrsCMF) strategyHours.append(hrsPSH) strategyHours.append(hrsEC) strategyHours.append(hrsHTM) strategyHours.append(hrsNV) min_maxPointsList, strategyMonth, colByComfortList, colByMonthList = monthCalcs(totalHrs, comfID, pshID, ecID, htmID, nvID, dryBulbTemperature, relativeHumidity, monthPoints, monthColors, comfortNOcomfortColors) #f = open("C:\WorkingFolder\Courses\Rhino-Grasshopper-Diva\PythonStuff\BioclimaticChart\dataTMP.csv","wr") #f.write('SeasonID,Temperature,RelativeHumidity, Comfort, PSH, EC, HTM, NV\n') #for m in range(0, totalHrs): # string = str(seasonID[m])+', '+str(dbtValue[m])+', '+str(rhValue[m])+', '+str(comfID[m])+', '+str(pshID[m])+', '+str(ecID[m])+', '+str(htmID[m])+', '+str(nvID[m])+',' # f.write(string+'\n') #f.close() totalComfortOrNot, strategyOrNotList = checkComfortOrNot(strategyNames, totalHrs, comfID, pshID, ecID, htmID, nvID, epwData, epwStr) chartLegend = createChartLegend(orgX, orgY, orgZ, strategyNames, lb_preparation, legendScale, legendFont, legendFontSize, lb_visualization, strategiesColors, monthColors, comfortNOcomfortColors, customColors, totalComfortOrNot) if calculateCharts_ == True: resultsChart = showResults(basePoint_, mainLegHeight, strategyNames, strategyPercent, strategyHours, strategyMonth, \ lowB, highB, numSeg, customColors, legendBasePoint, legendScale, legendFont, legendFontSize, lb_preparation, lb_visualization, strategiesColors) else: resultsChart = None #If the user has selected to scale or move the geometry, scale it all and/or move it all. #if basePoint_ != None: #basePoint = basePoint_ #else: basePoint = rc.Geometry.Point3d(0,0,0) if scale_ != None: scale = scale_ else: scale = 1 chartGridAndTxt = [] for item in gridLines: chartGridAndTxt.append(item) for item in chartLayout: chartGridAndTxt.append(item) for item in chartLegend: chartGridAndTxt.append(item) scaleFinal = rc.Geometry.Transform.Scale(basePoint, scale) move = rc.Geometry.Transform.Translation(basePoint.X, basePoint.Y, basePoint.Z) transformMtx = scaleFinal * move for geo in comfort_strategyPolygons: geo.Transform(transformMtx) chartMesh.Transform(transformMtx) for geo in chartLayout: geo.Transform(transformMtx) for geo in chartLegend: geo.Transform(transformMtx) for geo in legendChartMesh: geo.Transform(transformMtx) legendBasePoint.Transform(transformMtx) for geo in gridLines: geo.Transform(transformMtx) for geoList in monthPoints: for geo in geoList: geo.Transform(transformMtx) for geoList in min_maxPointsList: for geo in geoList: geo.Transform(transformMtx) if calculateCharts_ == True: for geo in resultsChart: geo.Transform(transformMtx) #hourPointColorsByComfort = [] #hourPointColorsByMonth = [] #Unpack the data tree of point colors. THIS WORKS FINE BUT I LEFT THE BELOW's OPTION. #hourPointColorsByComfort = DataTree[Object]() #for listCount, list in enumerate(colByComfortList): # for item in list: # hourPointColorsByComfort.Add(item, GH_Path(listCount)) #print 'monthPoints ', len(monthPoints[0]) chartHourPoints = raggedListToDataTree(monthPoints) hourPointColorsByComfort = raggedListToDataTree(colByComfortList) hourPointColorsByMonth = raggedListToDataTree(colByMonthList) strategyOrNot = raggedListToDataTree(strategyOrNotList) ##monthPointsTree = raggedListToDataTree(monthPoints) min_maxPoints = raggedListToDataTree(min_maxPointsList) return comfortResults, totalComfortOrNot, strategyOrNot, \ chartGridAndTxt, chartMesh, legendChartMesh, chartHourPoints, hourPointColorsByComfort, hourPointColorsByMonth, min_maxPoints, \ comfort_strategyPolygons, legendComfortStrategies, legendBasePt, resultsChart else: print "You should first let the Ladybug fly..." w = gh.GH_RuntimeMessageLevel.Warning ghenv.Component.AddRuntimeMessage(w, "You should first let the Ladybug fly...") return -1 #Check the inputs. checkData = False if _runIt == True: checkData, epwData, epwStr = checkInputs() #If the inputs are good, run the function. if checkData == True: comfortResults, totalComfortOrNot, strategyOrNot, \ chartGridAndTxt, chartMesh, legendChartMesh, chartHourPoints, hourPointColorsByComfort, hourPointColorsByMonth, min_maxPoints, \ comfort_strategyPolygons, legendComfortStrategies, legendBasePt, resultsChart = main(epwData, epwStr) #Hide/Show outnputs ghenv.Component.Params.Output[6].Hidden = False # Grid and Text ghenv.Component.Params.Output[7].Hidden = True # Chart Mesh ghenv.Component.Params.Output[8].Hidden = True # legendChartMesh ghenv.Component.Params.Output[9].Hidden = True # chartHourPoints #ghenv.Component.Params.Output[10].Hidden = True # hourPointColorsByComfort - This is data #ghenv.Component.Params.Output[11].Hidden = True # hourPointColorsByMonth - This is data ghenv.Component.Params.Output[12].Hidden = True # min/max Points ghenv.Component.Params.Output[13].Hidden = False # StrategyPolygons ghenv.Component.Params.Output[14].Hidden = True # legend ghenv.Component.Params.Output[17].Hidden = True # Results Chart
samuto/ladybug
src/Ladybug_Bioclimatic Chart.py
Python
gpl-3.0
83,572
[ "EPW" ]
d5297a84bdbcd32351192cc05792514e7eb1b4c66aafed5f2374085ad89bd787
''' Generate a reference for alignment This |spi| batch file (`spi-reference`) generates a properly filtered and scaled reference for alignment. Tips ==== #. The volumes do not have to be in SPIDER format (automatic conversion is attempted). However, :option:`--data-ext` must be used to set the appropriate SPIDER extension. #. For MRC volumes, the pixel size is extracted from the header, otherwise you must specify it with `--curr-apix`. Examples ======== .. sourcecode :: sh # Source AutoPart - FrankLab only $ source /guam.raid.cluster.software/arachnid/arachnid.rc # Create a reference filtered to 30 A from an MRC map $ spi-reference emd_1076.map -p params.ter -o reference.ter --data-ext ter -r 30 Critical Options ================ .. program:: spi-reference .. option:: -i <FILENAME1,FILENAME2>, --input-files <FILENAME1,FILENAME2>, FILENAME1 FILENAME2 List of input filenames containing volumes to convert to references. If you use the parameters `-i` or `--inputfiles` they must be comma separated (no spaces). If you do not use a flag, then separate by spaces. For a very large number of files (>5000) use `-i "filename*"` .. option:: -o <FILENAME>, --output <FILENAME> Output filename for references with correct number of digits (e.g. enhanced_0000.spi) .. option:: -p <FILENAME>, --param-file <FILENAME> Path to SPIDER params file .. option:: --bin-factor <FLOAT> Number of times to decimate params file .. option:: --resolution <FLOAT> Resolution to filter the volumes .. option:: --curr_apix <FLOAT> Current pixel size of the input volume (only necessary if not MRC) Low-pass Filter Options ======================= .. option:: --filter-type <INT> Type of low-pass filter to use with resolution: [1] Fermi(SP, fermi_temp) [2] Butterworth (SP-bp_pass, SP+bp_stop) [3] Gaussian (SP) .. option:: --fermi-temp <FLOAT> Fall off for Fermi filter (both high pass and low pass) .. option:: --bw-pass <FLOAT> Offset for pass band of the butterworth lowpass filter (sp-bw_pass) .. option:: --bw-stop <FLOAT> Offset for stop band of the butterworth lowpass filter (sp+bw_stop) Other Options ============= This is not a complete list of options available to this script, for additional options see: #. :ref:`Options shared by all scripts ... <shared-options>` #. :ref:`Options shared by |spi| scripts... <spider-options>` #. :ref:`Options shared by file processor scripts... <file-proc-options>` #. :ref:`Options shared by SPIDER params scripts... <param-options>` .. Created on Jul 15, 2011 .. codeauthor:: Robert Langlois <rl2528@columbia.edu> ''' from ..core.app import program from ..core.metadata import spider_params, spider_utility from ..core.parallel import mpi_utility from ..core.image import ndimage_file from ..core.spider import spider, spider_file import filter_volume import logging, os, numpy _logger = logging.getLogger(__name__) _logger.setLevel(logging.DEBUG) def process(filename, spi, output, resolution, curr_apix=0.0, disable_center=False, disable_even=False, **extra): ''' Create a reference from from a given density map :Parameters: filename : str Input volume file output : str Output reference file resolution : float Target resolution to filter reference curr_apix : float, optional Current pixel size of input map extra : dict Unused key word arguments :Returns: filename : str Filename for correct location ''' if not disable_even and (extra['window']%2)==1: extra['window'] += 1 _logger.info("Window size: %d (Forced Even)"%(extra['window'])) _logger.info("Processing: %s"%os.path.basename(filename)) _logger.info("Finished: %d,%d"%(0,5)) if spider_utility.is_spider_filename(filename): output = spider_utility.spider_filename(output, filename) header = ndimage_file.read_header(filename) if curr_apix == 0: if header['apix'] == 0: raise ValueError, "Pixel size of input volume is unknown - please use `--curr-apix` to set it" curr_apix = header['apix'] _logger.info("Pixel size: %f for %s"%(curr_apix, filename)) tempfile = mpi_utility.safe_tempfile(spi.replace_ext('tmp_spi_file')) try: filename = spider_file.copy_to_spider(filename, tempfile) except: if os.path.dirname(tempfile) == "": raise tempfile = mpi_utility.safe_tempfile(spi.replace_ext('tmp_spi_file'), False) filename = spider_file.copy_to_spider(filename, tempfile) w, h, d = spi.fi_h(filename, ('NSAM', 'NROW', 'NSLICE')) if w != h: raise ValueError, "Width does not match height - requires box" if w != d: raise ValueError, "Width does not match depth - requires box" _logger.info("Finished: %d,%d"%(1,5)) _logger.debug("Filtering volume") if resolution > 0: filename = filter_volume.filter_volume_lowpass(filename, spi, extra['apix']/resolution, outputfile=output, **extra) _logger.info("Finished: %d,%d"%(2,5)) _logger.debug("Resizing volume") filename = resize_volume(filename, spi, curr_apix, outputfile=output, **extra) _logger.info("Finished: %d,%d"%(3,5)) if not disable_center: _logger.debug("Centering volume") filename = center_volume(filename, spi, output) _logger.info("Finished: %d,%d"%(4,5)) try: if os.path.exists(tempfile): os.unlink(tempfile) except: pass return filename def center_volume(filename, spi, output): ''' Center the volume in the box :Parameters: filename : str Input volume file spi : spider.Session Current SPIDER session output : str Output centered volume file :Returns: output : str Output centered volume file ''' if filename == output: filename = spi.cp(filename) coords = spi.cg_ph(filename) return spi.sh_f(filename, tuple(-numpy.asarray(coords[3:])), outputfile=output) def resize_volume(filename, spi, curr_apix, apix, window, outputfile=None, **extra): ''' Interpolate the volume and change the box size to match the params file :Parameters: filename : str Input volume file spi : spider.Session Current SPIDER session curr_apix : float Pixel size of input volume apix : float Target pixel size (params file) window : float Target window size (params file) output : str Output interpolated volume file :Returns: output : str Output interpolated volume file ''' w, h, d = spi.fi_h(filename, ('NSAM', 'NROW', 'NSLICE')) if w != h: raise ValueError, "Width does not match height - requires box" if w != d: raise ValueError, "Width does not match depth - requires box" if not numpy.allclose(curr_apix, apix): bin_factor = curr_apix / apix _logger.info("Interpolating Structure: %f * %f = %f | %f/%f | %f"%(w, bin_factor, w*bin_factor, apix, curr_apix, window)) w *= bin_factor h *= bin_factor d *= bin_factor filename = spi.ip(filename, (int(w), int(h), int(d))) if w < window: _logger.info("Increasing window size from %d -> %d"%(w, window)) filename = spi.pd(filename, window, outputfile=outputfile) elif w > window: _logger.info("Decreasing window size from %d -> %d"%(w, window)) filename = spi.wi(filename, window, outputfile=outputfile) return outputfile def initialize(files, param): # Initialize global parameters for the script if len(files) == 0: return if param['param_file'] != "" and os.path.splitext(param['param_file'])[1] != "": _logger.warn("Using extension from SPIDER params file: %s"%param['param_file']) files=[param['param_file']] param['spi'] = spider.open_session(files, **param) if param['new_window'] > 0: param['bin_factor'] = float(param['window'])/param['new_window'] _logger.info("Params: %s"%param['param_file']) _logger.info("Bin-factor: %f"%param['bin_factor']) spider_params.read(param['spi'].replace_ext(param['param_file']), param) _logger.info("Pixel size: %f"%param['apix']) _logger.info("Window: %f"%param['window']) _logger.info("Thread Count: %d"%param['thread_count']) if os.path.dirname(param['output']) != "" and not os.path.exists(os.path.dirname(param['output'])): _logger.info("Creating directory: %s"%os.path.dirname(param['output'])) try: os.makedirs(os.path.dirname(param['output'])) except: pass def finalize(files, **extra): # Finalize global parameters for the script _logger.info("Completed") def supports(files, raw_reference_file="", **extra): ''' Test if this module is required in the project workflow :Parameters: files : list List of filenames to test raw_reference_file : str Input filename for raw reference map extra : dict Unused keyword arguments :Returns: flag : bool True if this module should be added to the workflow ''' return raw_reference_file != "" def setup_options(parser, pgroup=None, main_option=False): #Setup options for automatic option parsing from ..core.app.settings import setup_options_from_doc if main_option: pgroup.add_option("-i", "--raw-reference-file", input_files=[], help="List of input filenames containing volumes to convert to references", required_file=True, gui=dict(filetype="file-list")) pgroup.add_option("-o", "--reference-file", output="", help="Output filename for references with correct number of digits (e.g. enhanced_0000.spi)", gui=dict(filetype="save"), required_file=True) spider_params.setup_options(parser, pgroup, True) pgroup.add_option("-r", resolution=30.0, help="Resolution to filter the volumes") pgroup.add_option("", curr_apix=0.0, help="Current pixel size of the input volume (only necessary if not MRC)") pgroup.add_option("", new_window=0.0, help="Set bin_factor based on new window size") pgroup.add_option("", disable_center=False, help="Disable centering") setup_options_from_doc(parser, spider.open_session, group=pgroup) parser.change_default(thread_count=4, log_level=3) def check_options(options, main_option=False): #Check if the option values are valid from ..core.app.settings import OptionValueError path = spider.determine_spider(options.spider_path) if path == "": raise OptionValueError, "Cannot find SPIDER executable in %s, please use --spider-path to specify"%options.spider_path if main_option: spider_params.check_options(options) #if options.resolution <= 0.0: raise OptionValueError, "--resolution must be a positive value greater than 0" if not spider_utility.test_valid_spider_input(options.input_files): raise OptionValueError, "Multiple input files must have numeric suffix, e.g. vol0001.spi" def flags(): ''' Get flags the define the supported features :Returns: flags : dict Supported features ''' return dict(description = '''Generate a reference for alignment Example: $ %prog emd_1076.map -p params.ter -o reference.ter --data-ext ter -r 30 ''', supports_MPI=False, supports_OMP=False, use_version=True, max_filename_len=78) def main(): #Main entry point for this script program.run_hybrid_program(__name__) def dependents(): return [filter_volume] if __name__ == "__main__": main()
ezralanglois/arachnid
arachnid/pyspider/reference.py
Python
gpl-2.0
12,115
[ "Gaussian" ]
41b50b4f1e6ff1db61380ae79148848a97deea1fccfde85675aa5543a74e82d9
from django.core.management.base import BaseCommand from django.conf import settings from django.db import connection from collections import defaultdict import os from datetime import datetime, timedelta from common.utils import Date from schools.models import ( School, Boundary) from stories.models import ( Question, Questiongroup, QuestionType, QuestiongroupQuestions, Source, UserType, Story, Answer) from optparse import make_option from collections import OrderedDict from django.db.models import Q, Count from reportlab.pdfgen import canvas from reportlab.lib.pagesizes import A4, cm from reportlab.platypus import Paragraph, Table, TableStyle, Image from reportlab.platypus.flowables import HRFlowable from reportlab.lib.enums import TA_JUSTIFY, TA_LEFT, TA_CENTER from reportlab.lib import colors from reportlab.lib.styles import getSampleStyleSheet from common.utils import send_attachment class Command(BaseCommand): help = """ Description: Generates a report on SMS data. Accepts either a --from and --to date pair or a --days parameter. Days will be calculated backwards from today. Also accepts --emails as a list of email IDs for the generated report to be sent to. Usage: ./manage.py generate_sms_report [--from=YYYY-MM-DD] [--to=YYYY-MM-DD] \ [--days=number_of_days] --emails=a@b.com,c@d.com """ option_list = BaseCommand.option_list + ( make_option('--from', help='Start date'), make_option('--to', help='End date'), make_option('--days', help='Number of days'), make_option('--emails', help='Comma separated list of email ids'), ) def handle(self, *args, **options): start_date = options.get('from') end_date = options.get('to') days = options.get('days') emails = options.get('emails') if not emails: print """ Error: --emails parameter not specificed. """ print self.help return elif days: end_date = datetime.today() start_date = end_date - timedelta(days=int(days)) elif start_date or end_date: if not (start_date and end_date): print """ Error: Please specify both --from and --to parameters. """ print self.help return date = Date() if start_date: sane = date.check_date_sanity(start_date) if not sane: print """ Error: Wrong --from format. Expected YYYY-MM-DD """ print self.help return else: start_date = date.get_datetime(start_date) if end_date: sane = date.check_date_sanity(end_date) if not sane: print """ Error: Wrong --to format. Expected YYYY-MM-DD """ print self.help return else: end_date = date.get_datetime(end_date) else: print self.help return emails = emails.split(",") districts = [] gka_district_ids = set( Story.objects.filter( group__source__name="sms" ).values_list( 'school__admin3__parent__parent__id', flat=True ) ) for district_id in gka_district_ids: district = Boundary.objects.get(id=district_id) admin1_json = { 'name': district.name, 'id': district.id} admin1_json['sms'] = self.get_story_meta(district.id,'district',start_date, end_date) admin1_json['details'] = self.get_story_details(district.id,'district',start_date, end_date) admin1_json['blocks'] = [] #print admin1_json blocks = (Boundary.objects.all_active().filter( parent_id=district_id, type=district.type ).select_related('boundarycoord__coord', 'type__name', 'hierarchy__name')) for block in blocks: admin2_json = { 'name': block.name, 'id': block.id} admin2_json['sms'] = self.get_story_meta(block.id,'block', start_date, end_date) admin2_json['details'] = self.get_story_details(block.id,'block', start_date, end_date) #if(int(admin2_json['sms']['stories']) > 0): admin1_json['blocks'].append(admin2_json) districts.append(admin1_json) for each in districts: blks = self.transform_data(each) for blk in blks: self.make_pdf(blk,start_date,end_date,blk[0][1],emails) def make_pdf(self, data, start_date, end_date, filename, emails): width, height = A4 styles = getSampleStyleSheet() styleN = styles["BodyText"] styleN.alignment = TA_LEFT styleN.fontName = 'Helvetica' styleN.textColor = colors.black styleBH = styles["Heading3"] styleBH.alignment = TA_CENTER styleBH.fontName = 'Helvetica' styleBH.textColor = colors.darkslategray styleTH = styles["Heading1"] styleTH.alignment = TA_CENTER styleTH.fontName = 'Helvetica' styleTH.textColor = colors.darkslateblue styleGH = styles["Heading2"] styleGH.alignment = TA_CENTER styleGH.fontName = 'Helvetica' styleGH.textColor = colors.darkslategray #styleGH.backColor = colors.lightgrey styleNC = styles["BodyText"] #styleNC.alignment = TA_CENTER styleNC.fontName = 'Helvetica' def coord(x, y, unit=1): x, y = x * unit, height - y * unit return x, y def style_row(row_array, style): styled_array = [] for each in row_array: styled_array.extend([Paragraph(str(each),style)]) return styled_array c = canvas.Canvas(os.path.join(settings.PDF_REPORTS_DIR, 'gka_sms/')+filename+".pdf", pagesize=A4) #logo logo_image = Image("%s/images/akshara_logo.jpg" % settings.STATICFILES_DIRS) logo_image.drawOn(c, *coord(14, 3, cm)) #HR hr = HRFlowable(width="80%", thickness=1, lineCap='round', color=colors.lightgrey, spaceBefore=1, spaceAfter=1, hAlign='CENTER', vAlign='BOTTOM', dash=None) hr.wrapOn(c, width, height) hr.drawOn(c, *coord(1.8, 3.2, cm)) #Headings header = Paragraph('GKA SMS Summary<br/><hr/>', styleTH) header.wrapOn(c, width, height) header.drawOn(c, *coord(0, 4, cm)) #Date Range date_range = Paragraph("From " + start_date.strftime("%d %b, %Y") + " to " + end_date.strftime("%d %b, %Y"), styleBH) date_range.wrapOn(c, width, height) date_range.drawOn(c, *coord(0, 4.5, cm)) #Details styled_data = [style_row(data[0],styleGH)] for row in data[1:4]: styled_data.append(style_row(row,styleN)) table_header = Table(styled_data, colWidths=[7 * cm, 5* cm, 5 * cm]) table_header.setStyle(TableStyle([ ('INNERGRID', (0,0), (-1,-1), 0.25, colors.lightgrey), ('BOX', (0,0), (-1,-1), 0.25, colors.lightgrey), ('LINEBELOW', (0,0), (2, 0), 1.0, colors.darkgrey), ('LINEBELOW', (0,3), (2, 3), 1.0, colors.darkgrey), ])) table_header.wrapOn(c, width, height) table_header.drawOn(c, *coord(1.8, 9, cm)) #Questions styled_data =[style_row(['Questions','Yes','No','Yes','No'],styleBH)] for row in data[4:len(data)]: styled_data.append(style_row(row,styleN)) table = Table(styled_data, colWidths=[7 * cm, 2.5 * cm, 2.5 * cm, 2.5 * cm, 2.5 * cm]) table.setStyle(TableStyle([ ('INNERGRID', (0,0), (-1,-1), 0.25, colors.lightgrey), ('BOX', (0,0), (-1,-1), 0.25, colors.lightgrey), #('LINEBELOW', (0,0), (2, 0), 1.0, colors.green), ])) table.wrapOn(c, width, height) table.drawOn(c, *coord(1.8, 17.5, cm)) #Footer #HR hr = HRFlowable(width="80%", thickness=1, lineCap='round', color=colors.lightgrey, spaceBefore=1, spaceAfter=1, hAlign='CENTER', vAlign='BOTTOM', dash=None) hr.wrapOn(c, width, height) hr.drawOn(c, *coord(1.8, 27, cm)) #Disclaimer klp_text = Paragraph("This report has been generated by Karnataka Learning Partnership(www.klp.org.in/gka) for Akshara Foundation.",styleN) klp_text.wrapOn(c, width, height) klp_text.drawOn(c, *coord(1.8, 27.5, cm)) c.save() self.send_email(start_date.strftime("%d/%m/%Y") + " to " + end_date.strftime("%d/%m/%Y"),filename, emails) def send_email(self,date_range, block, emails): print 'Sending email for', block send_attachment( from_email=settings.EMAIL_DEFAULT_FROM, to_emails=emails, subject= block + ': GKA SMS Report for '+ date_range, folder='gka_sms', filename=block ) def get_json(self, source, stories_qset): json = {} json['stories'] = stories_qset.count() json['schools'] = stories_qset.distinct('school').count() return json def transform_data(self, district): blocks =[] questions = {} gka_question_seq = ['How many responses indicate that Math classes were happening in class 4 and 5 during the visit?', 'How many responses indicate that class 4 and 5 math teachers are trained in GKA methodology in the schools visited?', 'How many responses indicate evidence of Ganitha Kalika Andolana TLM being used in class 4 or 5 during the visit?', 'How many responses indicate that representational stage was being practiced during Math classes in class 4 and 5 during the visit?', 'How many responses indicate that group work was happening in the schools visited?'] for block in district["blocks"]: data = [["Details", "Block-"+block["name"].capitalize(), "District-"+district["name"].capitalize()]] data.append(["Schools", block["sms"]["schools"], district["sms"]["schools"]]) data.append(["SMS Messages", block["sms"]["stories"], district["sms"]["stories"]]) data.append(["Schools with SMS Messages", block["sms"]["schools_with_stories"], district["sms"]["schools_with_stories"]]) for each in block["details"]: questions[each["question"]["display_text"]]= {"block": self.get_response_str(each["answers"])} for each in district["details"]: questions[each["question"]["display_text"]]["district"] = self.get_response_str(each["answers"]) custom_sort = self.make_custom_sort([ gka_question_seq ]) result = custom_sort(questions) for question in result: row = [question] row.extend(questions[question]["block"]) row.extend(questions[question]["district"]) data.append(row) blocks.append(data) return blocks def make_custom_sort(self,orders): orders = [{k: -i for (i, k) in enumerate(reversed(order), 1)} for order in orders] def process(stuff): if isinstance(stuff, dict): l = [(k, process(v)) for (k, v) in stuff.items()] keys = set(stuff) for order in orders: if keys.issuperset(order): return OrderedDict(sorted(l, key=lambda x: order.get(x[0], 0))) return OrderedDict(sorted(l)) if isinstance(stuff, list): return [process(x) for x in stuff] return stuff return process def get_response_str(self, answers): yes = 0 no = 0 if answers["options"]: if "Yes" in answers["options"]: yes = answers["options"]["Yes"] if "No" in answers["options"]: no = answers["options"]["No"] #return [str(yes)+'('+str((yes*100)/(yes+no))+'%)',str(no)+'('+str((no*100)/(yes+no))+'%)'] return [str(yes),str(no)] else: return ["No Responses","-"] def source_filter(self, source, stories_qset): stories_qset = stories_qset.filter( group__source__name=source) return stories_qset def get_story_meta(self, boundary_id, boundary_type, start_date, end_date): source = 'sms' admin2_id = None admin1_id = None if boundary_type == 'block': admin2_id = boundary_id if boundary_type == 'district': admin1_id = boundary_id school_type = 'Primary School' school_qset = School.objects.filter( admin3__type__name=school_type, status=2) stories_qset = Story.objects.filter( school__admin3__type__name=school_type) if admin1_id: school_qset = school_qset.filter( schooldetails__admin1__id=admin1_id) stories_qset = stories_qset.filter( school__schooldetails__admin1__id=admin1_id) if admin2_id: school_qset = school_qset.filter( schooldetails__admin2__id=admin2_id) stories_qset = stories_qset.filter( school__schooldetails__admin2__id=admin2_id) if start_date: stories_qset = stories_qset.filter( date_of_visit__gte=start_date) if end_date: stories_qset = stories_qset.filter( date_of_visit__lte=end_date) if source: stories_qset = self.source_filter( source, stories_qset ) #print stories_qset.count() response_json = {} response_json['schools'] = school_qset.count() response_json['stories'] = stories_qset.count() response_json['schools_with_stories'] = stories_qset.distinct('school').count() #print response_json return response_json def get_que_and_ans(self, stories, source, school_type): response_list = [] questions = Question.objects.all().select_related('question_type') if source: questions = questions.filter( questiongroup__source__name=source) if school_type: questions = questions.filter( school_type__name=school_type) #print questions.count() for question in questions.distinct('id'): j = {} j['question'] = {} j['question']['key'] = question.key j['question']['text'] = question.text j['question']['display_text'] = question.display_text j['answers'] = {} j['answers']['question_type'] = question.question_type.name answer_counts = question.answer_set.filter( story__in=stories ).values('text').annotate(answer_count=Count('text')) options = {} for count in answer_counts: options[count['text']] = count['answer_count'] j['answers']['options'] = options response_list.append(j) return response_list def get_story_details(self, boundary_id, boundary_type, start_date, end_date): source = 'sms' admin1_id = None admin2_id = None school_type = 'Primary School' if boundary_type == 'block': admin2_id = boundary_id if boundary_type == 'district': admin1_id = boundary_id stories = Story.objects.all() if source: stories = stories.filter(group__source__name=source) if school_type: stories = stories.filter(school__admin3__type__name=school_type) if admin1_id: stories = stories.filter( school__schooldetails__admin1__id=admin1_id ) if admin2_id: stories = stories.filter( school__schooldetails__admin2__id=admin2_id ) if start_date: stories = stories.filter(date_of_visit__gte=start_date) if end_date: stories = stories.filter(date_of_visit__lte=end_date) response_json = self.get_que_and_ans(stories, source, school_type) return response_json
klpdotorg/dubdubdub
apps/stories/management/commands/generate_sms_report.py
Python
mit
17,179
[ "VisIt" ]
83df2da148cdcc76c6934db4db7a78e3d77c4744acaa37183458c0055648644c
# -*- coding: utf-8 -*- import datetime import json import os import shutil from django.conf import settings from django.core.files.storage import default_storage as storage from django.core.urlresolvers import reverse import mock from nose.tools import eq_, ok_ from pyquery import PyQuery as pq import mkt from mkt.constants.applications import DEVICE_TYPES from mkt.files.tests.test_models import UploadTest as BaseUploadTest from mkt.reviewers.models import EscalationQueue from mkt.site.fixtures import fixture from mkt.site.tests import formset, initial, TestCase, user_factory from mkt.site.tests.test_utils_ import get_image_path from mkt.submit.decorators import read_dev_agreement_required from mkt.submit.forms import AppFeaturesForm, NewWebappVersionForm from mkt.submit.models import AppSubmissionChecklist from mkt.translations.models import Translation from mkt.users.models import UserNotification, UserProfile from mkt.users.notifications import app_surveys from mkt.webapps.models import AddonDeviceType, AddonUser, AppFeatures, Webapp class TestSubmit(TestCase): fixtures = fixture('user_999') def setUp(self): self.fi_mock = mock.patch( 'mkt.developers.tasks.fetch_icon').__enter__() self.user = self.get_user() self.login(self.user.email) def tearDown(self): self.fi_mock.__exit__() def get_user(self): return UserProfile.objects.get(email='regular@mozilla.com') def get_url(self, url): return reverse('submit.app.%s' % url, args=[self.webapp.app_slug]) def _test_anonymous(self): self.client.logout() r = self.client.get(self.url, follow=True) self.assertLoginRedirects(r, self.url) def _test_progress_display(self, completed, current): """Test that the correct steps are highlighted.""" r = self.client.get(self.url) progress = pq(r.content)('#submission-progress') # Check the completed steps. completed_found = progress.find('.completed') for idx, step in enumerate(completed): li = completed_found.eq(idx) eq_(li.text(), unicode(mkt.APP_STEPS_TITLE[step])) # Check that we link back to the Developer Agreement. terms_link = progress.find('.terms a') if 'terms' in completed: eq_(terms_link.attr('href'), reverse('mkt.developers.docs', args=['policies', 'agreement'])) else: eq_(terms_link.length, 0) # Check the current step. eq_(progress.find('.current').text(), unicode(mkt.APP_STEPS_TITLE[current])) class TestProceed(TestSubmit): def setUp(self): super(TestProceed, self).setUp() self.user.update(read_dev_agreement=None) self.url = reverse('submit.app') def test_is_authenticated(self): # Redirect user to Terms. r = self.client.get(self.url) self.assert3xx(r, reverse('submit.app.terms')) def test_is_anonymous(self): # Show user to Terms page but with the login prompt. self.client.logout() r = self.client.get(self.url) eq_(r.status_code, 200) eq_(r.context['proceed'], True) class TestTerms(TestSubmit): def setUp(self): super(TestTerms, self).setUp() self.user.update(read_dev_agreement=None) self.url = reverse('submit.app.terms') def test_anonymous(self): self.client.logout() r = self.client.get(self.url, follow=True) self.assertLoginRedirects(r, self.url) def test_jump_to_step(self): r = self.client.get(reverse('submit.app'), follow=True) self.assert3xx(r, self.url) def test_page(self): r = self.client.get(self.url) eq_(r.status_code, 200) doc = pq(r.content)('#submit-terms') eq_(doc.length, 1) eq_(doc.find('input[name=newsletter]').siblings('label').length, 1, 'Missing its <label>!') def test_progress_display(self): self._test_progress_display([], 'terms') @mock.patch('basket.subscribe') def test_agree(self, subscribe_mock): self.client.post(self.url, {'read_dev_agreement': True}) dt = self.get_user().read_dev_agreement self.assertCloseToNow(dt) eq_(UserNotification.objects.count(), 0) assert not subscribe_mock.called @mock.patch('basket.subscribe') def test_agree_and_sign_me_up(self, subscribe_mock): self.client.post(self.url, {'read_dev_agreement': datetime.datetime.now(), 'newsletter': True}) dt = self.get_user().read_dev_agreement self.assertCloseToNow(dt) eq_(UserNotification.objects.count(), 1) notes = UserNotification.objects.filter(user=self.user, enabled=True, notification_id=app_surveys.id) eq_(notes.count(), 1, 'Expected to not be subscribed to newsletter') subscribe_mock.assert_called_with( self.user.email, 'app-dev', lang='en-US', country='restofworld', format='H', source_url='http://testserver/developers/submit') def test_disagree(self): r = self.client.post(self.url) eq_(r.status_code, 200) eq_(self.user.read_dev_agreement, None) eq_(UserNotification.objects.count(), 0) def test_read_dev_agreement_required(self): f = mock.Mock() f.__name__ = 'function' request = mock.Mock() request.user.read_dev_agreement = None request.get_full_path.return_value = self.url func = read_dev_agreement_required(f) res = func(request) assert not f.called eq_(res.status_code, 302) eq_(res['Location'], reverse('submit.app')) class TestManifest(TestSubmit): def setUp(self): super(TestManifest, self).setUp() self.user.update(read_dev_agreement=None) self.url = reverse('submit.app') def _step(self): self.user.update(read_dev_agreement=datetime.datetime.now()) def test_anonymous(self): r = self.client.get(self.url, follow=True) eq_(r.context['step'], 'terms') def test_cannot_skip_prior_step(self): r = self.client.get(self.url, follow=True) # And we start back at one... self.assert3xx(r, reverse('submit.app.terms')) def test_jump_to_step(self): # I already read the Terms. self._step() # So jump me to the Manifest step. r = self.client.get(reverse('submit.app'), follow=True) eq_(r.context['step'], 'manifest') def test_legacy_redirects(self): def check(): for before, status in redirects: r = self.client.get(before, follow=True) self.assert3xx(r, dest, status) # I haven't read the dev agreement. redirects = ( ('/developers/submit/', 302), ('/developers/submit/app', 302), ('/developers/submit/app/terms', 302), ('/developers/submit/app/manifest', 302), ) dest = '/developers/submit/terms' check() # I have read the dev agreement. self._step() redirects = ( ('/developers/submit/app', 302), ('/developers/submit/app/terms', 302), ('/developers/submit/app/manifest', 302), ('/developers/submit/manifest', 301), ) dest = '/developers/submit/' check() def test_page(self): self._step() r = self.client.get(self.url) eq_(r.status_code, 200) eq_(pq(r.content)('#upload-file').length, 1) def test_progress_display(self): self._step() self._test_progress_display(['terms'], 'manifest') class UploadAddon(object): def post(self, expect_errors=False, data=None): if data is None: data = {'free_platforms': ['free-desktop']} data.update(upload=self.upload.pk) response = self.client.post(self.url, data, follow=True) eq_(response.status_code, 200) if not expect_errors: # Show any unexpected form errors. if response.context and 'form' in response.context: eq_(response.context['form'].errors, {}) return response class BaseWebAppTest(BaseUploadTest, UploadAddon, TestCase): fixtures = fixture('user_999', 'user_10482') def setUp(self): super(BaseWebAppTest, self).setUp() self.manifest = self.manifest_path('mozball.webapp') self.manifest_url = 'http://allizom.org/mozball.webapp' self.upload = self.get_upload(abspath=self.manifest, user=UserProfile.objects.get(pk=999)) self.upload.update(name=self.manifest_url) self.url = reverse('submit.app') self.login('regular@mozilla.com') def post_addon(self, data=None): eq_(Webapp.objects.count(), 0) self.post(data=data) return Webapp.objects.get() class TestCreateWebApp(BaseWebAppTest): @mock.patch('mkt.developers.tasks.fetch_icon') def test_post_app_redirect(self, fi_mock): r = self.post() webapp = Webapp.objects.get() self.assert3xx(r, reverse('submit.app.details', args=[webapp.app_slug])) assert fi_mock.delay.called, ( 'The fetch_icon task was expected to be called') def test_no_hint(self): self.post_addon() self.upload = self.get_upload(abspath=self.manifest) r = self.client.post(reverse('mkt.developers.upload_manifest'), dict(manifest=self.manifest_url), follow=True) eq_(r.status_code, 200) assert 'already submitted' not in r.content, ( 'Unexpected helpful error (trap_duplicate)') assert 'already exists' not in r.content, ( 'Unexpected validation error (verify_app_domain)') def test_no_upload(self): data = {'free_platforms': ['free-desktop']} res = self.client.post(self.url, data, follow=True) eq_(res.context['form'].errors, {'upload': NewWebappVersionForm.upload_error}) @mock.patch('mkt.developers.tasks.fetch_icon') def test_bad_upload(self, fi_mock): data = {'free_platforms': ['free-desktop'], 'upload': 'foo'} res = self.client.post(self.url, data, follow=True) eq_(res.context['form'].errors, {'upload': NewWebappVersionForm.upload_error}) assert not fi_mock.delay.called, ( 'The fetch_icon task was not expected to be called') def test_hint_for_same_manifest(self): self.create_switch(name='webapps-unique-by-domain') self.post_addon() self.upload = self.get_upload(abspath=self.manifest) r = self.client.post(reverse('mkt.developers.upload_manifest'), dict(manifest=self.manifest_url)) data = json.loads(r.content) assert 'Oops' in data['validation']['messages'][0]['message'], ( 'Expected oops') def test_no_hint_for_same_manifest_different_author(self): self.create_switch(name='webapps-unique-by-domain') self.post_addon() # Submit same manifest as different user. self.login('clouserw@mozilla.com') self.upload = self.get_upload(abspath=self.manifest) r = self.client.post(reverse('mkt.developers.upload_manifest'), dict(manifest=self.manifest_url)) data = json.loads(r.content) eq_(data['validation']['messages'][0]['message'], 'An app already exists on this domain; only one app per domain is ' 'allowed.') def test_app_from_uploaded_manifest(self): addon = self.post_addon() eq_(addon.is_packaged, False) assert addon.guid is not None, ( 'Expected app to have a UUID assigned to guid') eq_(unicode(addon.name), u'MozillaBall ょ') eq_(addon.app_slug, u'mozillaball-ょ') eq_(addon.description, u'Exciting Open Web development action!') eq_(addon.manifest_url, u'http://allizom.org/mozball.webapp') eq_(addon.app_domain, u'http://allizom.org') eq_(Translation.objects.get(id=addon.description.id, locale='it'), u'Azione aperta emozionante di sviluppo di fotoricettore!') eq_(addon.latest_version.developer_name, 'Mozilla Labs') eq_(addon.latest_version.manifest, json.loads(open(self.manifest).read())) def test_manifest_with_any_extension(self): self.manifest = os.path.join(settings.ROOT, 'mkt', 'developers', 'tests', 'addons', 'mozball.owa') self.upload = self.get_upload(abspath=self.manifest, user=UserProfile.objects.get(pk=999)) addon = self.post_addon() ok_(addon.id) def test_version_from_uploaded_manifest(self): addon = self.post_addon() eq_(addon.latest_version.version, '1.0') def test_file_from_uploaded_manifest(self): addon = self.post_addon() files = addon.latest_version.files.all() eq_(len(files), 1) eq_(files[0].status, mkt.STATUS_PENDING) def test_set_platform(self): app = self.post_addon( {'free_platforms': ['free-android-tablet', 'free-desktop']}) self.assertSetEqual(app.device_types, [mkt.DEVICE_TABLET, mkt.DEVICE_DESKTOP]) def test_free(self): app = self.post_addon({'free_platforms': ['free-firefoxos']}) self.assertSetEqual(app.device_types, [mkt.DEVICE_GAIA]) eq_(app.premium_type, mkt.ADDON_FREE) def test_premium(self): app = self.post_addon({'paid_platforms': ['paid-firefoxos']}) self.assertSetEqual(app.device_types, [mkt.DEVICE_GAIA]) eq_(app.premium_type, mkt.ADDON_PREMIUM) def test_supported_locales(self): addon = self.post_addon() eq_(addon.default_locale, 'en-US') eq_(addon.versions.latest().supported_locales, 'es,it') def test_short_locale(self): # This manifest has a locale code of "pt" which is in the # SHORTER_LANGUAGES setting and should get converted to "pt-PT". self.manifest = self.manifest_path('short-locale.webapp') self.upload = self.get_upload(abspath=self.manifest, user=UserProfile.objects.get(pk=999)) addon = self.post_addon() eq_(addon.default_locale, 'pt-PT') eq_(addon.versions.latest().supported_locales, 'es') def test_unsupported_detail_locale(self): # This manifest has a locale code of "en-GB" which is unsupported, so # we default to "en-US". self.manifest = self.manifest_path('unsupported-default-locale.webapp') self.upload = self.get_upload(abspath=self.manifest, user=UserProfile.objects.get(pk=999)) addon = self.post_addon() eq_(addon.default_locale, 'en-US') eq_(addon.versions.latest().supported_locales, 'es,it') def test_appfeatures_creation(self): addon = self.post_addon(data={ 'free_platforms': ['free-desktop'], 'has_contacts': 'on' }) features = addon.latest_version.features ok_(isinstance(features, AppFeatures)) field_names = [f.name for f in AppFeaturesForm().all_fields()] for field in field_names: expected = field == 'has_contacts' eq_(getattr(features, field), expected) class TestCreateWebAppFromManifest(BaseWebAppTest): def setUp(self): super(TestCreateWebAppFromManifest, self).setUp() Webapp.objects.create(app_slug='xxx', app_domain='http://existing-app.com') def upload_webapp(self, manifest_url, **post_kw): self.upload.update(name=manifest_url) # Simulate JS upload. return self.post(**post_kw) def post_manifest(self, manifest_url): rs = self.client.post(reverse('mkt.developers.upload_manifest'), dict(manifest=manifest_url)) if 'json' in rs['content-type']: rs = json.loads(rs.content) return rs def test_duplicate_domain(self): self.create_switch(name='webapps-unique-by-domain') rs = self.upload_webapp('http://existing-app.com/my.webapp', expect_errors=True) eq_(rs.context['form'].errors, {'upload': ['An app already exists on this domain; only one ' 'app per domain is allowed.']}) def test_allow_duplicate_domains(self): self.upload_webapp('http://existing-app.com/my.webapp') # No errors. def test_duplicate_domain_from_js(self): self.create_switch(name='webapps-unique-by-domain') data = self.post_manifest('http://existing-app.com/my.webapp') eq_(data['validation']['errors'], 1) eq_(data['validation']['messages'][0]['message'], 'An app already exists on this domain; ' 'only one app per domain is allowed.') def test_allow_duplicate_domains_from_js(self): rs = self.post_manifest('http://existing-app.com/my.webapp') eq_(rs.status_code, 302) class BasePackagedAppTest(BaseUploadTest, UploadAddon, TestCase): fixtures = fixture('webapp_337141', 'user_999') def setUp(self): super(BasePackagedAppTest, self).setUp() self.app = Webapp.objects.get(pk=337141) self.app.update(is_packaged=True) self.version = self.app.latest_version self.file = self.version.all_files[0] self.file.update(filename='mozball.zip') self.upload = self.get_upload( abspath=self.package, user=UserProfile.objects.get(email='regular@mozilla.com')) self.upload.update(name='mozball.zip') self.url = reverse('submit.app') self.login('regular@mozilla.com') @property def package(self): return self.packaged_app_path('mozball.zip') def post_addon(self, data=None): eq_(Webapp.objects.count(), 1) self.post(data=data) return Webapp.objects.order_by('-id')[0] def setup_files(self, filename='mozball.zip'): # Make sure the source file is there. # Original packaged file. if not storage.exists(self.file.file_path): try: # We don't care if these dirs exist. os.makedirs(os.path.dirname(self.file.file_path)) except OSError: pass shutil.copyfile(self.packaged_app_path(filename), self.file.file_path) # Signed packaged file. if not storage.exists(self.file.signed_file_path): try: # We don't care if these dirs exist. os.makedirs(os.path.dirname(self.file.signed_file_path)) except OSError: pass shutil.copyfile(self.packaged_app_path(filename), self.file.signed_file_path) class TestEscalatePrereleaseWebApp(BasePackagedAppTest): def setUp(self): super(TestEscalatePrereleaseWebApp, self).setUp() user_factory(email=settings.NOBODY_EMAIL_ADDRESS) def post(self): super(TestEscalatePrereleaseWebApp, self).post(data={ 'free_platforms': ['free-firefoxos'], 'packaged': True, }) def test_prerelease_permissions_get_escalated(self): validation = json.loads(self.upload.validation) validation['permissions'] = ['moz-attention'] self.upload.update(validation=json.dumps(validation)) eq_(EscalationQueue.objects.count(), 0) self.post() eq_(EscalationQueue.objects.count(), 1) def test_normal_permissions_dont_get_escalated(self): validation = json.loads(self.upload.validation) validation['permissions'] = ['contacts'] self.upload.update(validation=json.dumps(validation)) eq_(EscalationQueue.objects.count(), 0) self.post() eq_(EscalationQueue.objects.count(), 0) class TestCreatePackagedApp(BasePackagedAppTest): @mock.patch('mkt.webapps.models.Webapp.get_cached_manifest') def test_post_app_redirect(self, _mock): res = self.post() webapp = Webapp.objects.order_by('-created')[0] self.assert3xx(res, reverse('submit.app.details', args=[webapp.app_slug])) @mock.patch('mkt.webapps.models.Webapp.get_cached_manifest') @mock.patch('mkt.submit.forms.verify_app_domain') def test_app_from_uploaded_package(self, _verify, _mock): addon = self.post_addon( data={'packaged': True, 'free_platforms': ['free-firefoxos']}) eq_(addon.latest_version.version, '1.0') eq_(addon.is_packaged, True) assert addon.guid is not None, ( 'Expected app to have a UUID assigned to guid') eq_(unicode(addon.name), u'Packaged MozillaBall ょ') eq_(addon.app_slug, u'packaged-mozillaball-ょ') eq_(addon.description, u'Exciting Open Web development action!') eq_(addon.manifest_url, None) eq_(addon.app_domain, 'app://hy.fr') eq_(Translation.objects.get(id=addon.description.id, locale='it'), u'Azione aperta emozionante di sviluppo di fotoricettore!') eq_(addon.latest_version.developer_name, 'Mozilla Labs') assert _verify.called, ( '`verify_app_domain` should be called for packaged apps with ' 'origins.') @mock.patch('mkt.webapps.models.Webapp.get_cached_manifest') def test_packaged_app_not_unique(self, _mock): Webapp.objects.create(is_packaged=True, app_domain='app://hy.fr') res = self.post( data={'packaged': True, 'free_platforms': ['free-firefoxos']}, expect_errors=True) eq_(res.context['form'].errors, { 'upload': ['An app already exists on this domain; only one app ' 'per domain is allowed.']}) class TestDetails(TestSubmit): fixtures = fixture('webapp_337141', 'user_999', 'user_10482') def setUp(self): super(TestDetails, self).setUp() self.webapp = self.get_webapp() self.webapp.update(status=mkt.STATUS_NULL) self.url = reverse('submit.app.details', args=[self.webapp.app_slug]) self.cat1 = 'books' def get_webapp(self): return Webapp.objects.get(id=337141) def upload_preview(self, image_file=None): if not image_file: image_file = get_image_path('preview.jpg') return self._upload_image(self.webapp.get_dev_url('upload_preview'), image_file=image_file) def upload_icon(self, image_file=None): if not image_file: image_file = get_image_path('mozilla-sq.png') return self._upload_image(self.webapp.get_dev_url('upload_icon'), image_file=image_file) def _upload_image(self, url, image_file): with open(image_file, 'rb') as data: rp = self.client.post(url, {'upload_image': data}) eq_(rp.status_code, 200) hash_ = json.loads(rp.content)['upload_hash'] assert hash_, 'No hash: %s' % rp.content return hash_ def _step(self): self.user.update(read_dev_agreement=datetime.datetime.now()) self.cl = AppSubmissionChecklist.objects.create( addon=self.webapp, terms=True, manifest=True) # Associate app with user. AddonUser.objects.create(addon=self.webapp, user=self.user) # Associate device type with app. self.dtype = DEVICE_TYPES.values()[0] AddonDeviceType.objects.create(addon=self.webapp, device_type=self.dtype.id) self.device_types = [self.dtype] # Associate category with app. self.webapp.update(categories=[self.cat1]) def test_anonymous(self): self._test_anonymous() def test_resume_later(self): self._step() self.webapp.appsubmissionchecklist.update(details=True) r = self.client.get(reverse('submit.app.resume', args=[self.webapp.app_slug])) self.assert3xx(r, self.webapp.get_dev_url('edit')) def test_not_owner(self): self._step() self.login('clouserw@mozilla.com') eq_(self.client.get(self.url).status_code, 403) def test_page(self): self._step() r = self.client.get(self.url) eq_(r.status_code, 200) eq_(pq(r.content)('#submit-details').length, 1) def test_progress_display(self): self._step() self._test_progress_display(['terms', 'manifest'], 'details') def new_preview_formset(self, *args, **kw): ctx = self.client.get(self.url).context blank = initial(ctx['form_previews'].forms[-1]) blank.update(**kw) return blank def preview_formset(self, *args, **kw): kw.setdefault('initial_count', 0) kw.setdefault('prefix', 'files') fs = formset(*[a for a in args] + [self.new_preview_formset()], **kw) return dict([(k, '' if v is None else v) for k, v in fs.items()]) def get_dict(self, **kw): data = { 'app_slug': 'testname', 'description': 'desc', 'privacy_policy': 'XXX <script>alert("xss")</script>', 'homepage': 'http://www.goodreads.com/user/show/7595895-krupa', 'support_url': 'http://www.goodreads.com/user_challenges/351558', 'support_email': 'krupa+to+the+rescue@goodreads.com', 'categories': [self.cat1], 'flash': '1', 'publish_type': mkt.PUBLISH_IMMEDIATE, 'notes': 'yes' } # Add the required screenshot. data.update(self.preview_formset({ 'upload_hash': '<hash>', 'position': 0 })) data.update(**kw) # Remove fields without values. data = dict((k, v) for k, v in data.iteritems() if v is not None) return data def check_dict(self, data=None, expected=None): if data is None: data = self.get_dict() addon = self.get_webapp() # Build a dictionary of expected results. expected_data = { 'app_slug': 'testname', 'description': 'desc', 'privacy_policy': 'XXX &lt;script&gt;alert("xss")&lt;/script&gt;', 'uses_flash': True, 'publish_type': mkt.PUBLISH_IMMEDIATE, } if expected: expected_data.update(expected) uses_flash = expected_data.pop('uses_flash') eq_(addon.latest_version.all_files[0].uses_flash, uses_flash) self.assertSetEqual(addon.device_types, self.device_types) for field, expected in expected_data.iteritems(): got = unicode(getattr(addon, field)) expected = unicode(expected) eq_(got, expected, 'Expected %r for %r. Got %r.' % (expected, field, got)) @mock.patch('mkt.submit.views.record_action') def test_success(self, record_action): self._step() data = self.get_dict() r = self.client.post(self.url, data) self.assertNoFormErrors(r) self.check_dict(data=data) self.webapp = self.get_webapp() self.assert3xx(r, self.get_url('done')) eq_(self.webapp.status, mkt.STATUS_NULL) assert record_action.called def test_success_paid(self): self._step() self.webapp = self.get_webapp() self.make_premium(self.webapp) data = self.get_dict() r = self.client.post(self.url, data) self.assertNoFormErrors(r) self.check_dict(data=data) self.webapp = self.get_webapp() self.assert3xx(r, self.get_url('done')) eq_(self.webapp.status, mkt.STATUS_NULL) eq_(self.webapp.highest_status, mkt.STATUS_PENDING) def test_success_prefill_device_types_if_empty(self): """ The new submission flow asks for device types at step one. This ensures that existing incomplete apps still have device compatibility. """ self._step() AddonDeviceType.objects.all().delete() self.device_types = mkt.DEVICE_TYPES.values() data = self.get_dict() r = self.client.post(self.url, data) self.assertNoFormErrors(r) self.check_dict(data=data) self.webapp = self.get_webapp() self.assert3xx(r, self.get_url('done')) def test_success_for_approved(self): self._step() data = self.get_dict(publish_type=mkt.PUBLISH_PRIVATE) r = self.client.post(self.url, data) self.assertNoFormErrors(r) self.check_dict(data=data, expected={'publish_type': mkt.PUBLISH_PRIVATE}) self.webapp = self.get_webapp() self.assert3xx(r, self.get_url('done')) def test_media_types(self): self._step() res = self.client.get(self.url) doc = pq(res.content) eq_(doc('.screenshot_upload').attr('data-allowed-types'), 'image/jpeg|image/png|video/webm') eq_(doc('#id_icon_upload').attr('data-allowed-types'), 'image/jpeg|image/png') def test_screenshot(self): self._step() im_hash = self.upload_preview() data = self.get_dict() data.update(self.preview_formset({ 'upload_hash': im_hash, 'position': 0 })) rp = self.client.post(self.url, data) eq_(rp.status_code, 302) ad = Webapp.objects.get(pk=self.webapp.pk) eq_(ad.previews.all().count(), 1) def test_icon(self): self._step() im_hash = self.upload_icon() data = self.get_dict() data['icon_upload_hash'] = im_hash data['icon_type'] = 'image/png' rp = self.client.post(self.url, data) eq_(rp.status_code, 302) ad = self.get_webapp() eq_(ad.icon_type, 'image/png') for size in mkt.APP_ICON_SIZES: fn = '%s-%s.png' % (ad.id, size) assert os.path.exists(os.path.join(ad.get_icon_dir(), fn)), ( 'Expected %s in %s' % (fn, os.listdir(ad.get_icon_dir()))) def test_screenshot_or_video_required(self): self._step() data = self.get_dict() for k in data: if k.startswith('files') and k.endswith('upload_hash'): data[k] = '' rp = self.client.post(self.url, data) eq_(rp.context['form_previews'].non_form_errors(), ['You must upload at least one screenshot or video.']) def test_unsaved_screenshot(self): self._step() # If there are form errors we should still pass the previews URIs. preview_type = 'video/webm' preview_uri = 'moz-filedata:p00p' data = self.preview_formset({ 'position': 1, 'upload_hash': '<hash_one>', 'unsaved_image_type': preview_type, 'unsaved_image_data': preview_uri }) r = self.client.post(self.url, data) eq_(r.status_code, 200) form = pq(r.content)('form') eq_(form.find('input[name=files-0-unsaved_image_type]').val(), preview_type) eq_(form.find('input[name=files-0-unsaved_image_data]').val(), preview_uri) def test_unique_allowed(self): self._step() r = self.client.post(self.url, self.get_dict(name=self.webapp.name)) self.assertNoFormErrors(r) app = Webapp.objects.exclude(app_slug=self.webapp.app_slug)[0] self.assert3xx(r, reverse('submit.app.done', args=[app.app_slug])) eq_(self.get_webapp().status, mkt.STATUS_NULL) def test_slug_invalid(self): self._step() # Submit an invalid slug. d = self.get_dict(app_slug='slug!!! aksl23%%') r = self.client.post(self.url, d) eq_(r.status_code, 200) self.assertFormError( r, 'form_basic', 'app_slug', "Enter a valid 'slug' consisting of letters, numbers, underscores " "or hyphens.") def test_slug_required(self): self._step() r = self.client.post(self.url, self.get_dict(app_slug='')) eq_(r.status_code, 200) self.assertFormError(r, 'form_basic', 'app_slug', 'This field is required.') def test_description_required(self): self._step() r = self.client.post(self.url, self.get_dict(description='')) eq_(r.status_code, 200) self.assertFormError(r, 'form_basic', 'description', 'This field is required.') def test_privacy_policy_required(self): self._step() r = self.client.post(self.url, self.get_dict(privacy_policy=None)) self.assertFormError(r, 'form_basic', 'privacy_policy', 'This field is required.') def test_clashing_locale(self): self.webapp.default_locale = 'de' self.webapp.save() self._step() self.client.cookies['current_locale'] = 'en-us' data = self.get_dict(name=None, name_de='Test name', privacy_policy=None, **{'privacy_policy_en-us': 'XXX'}) r = self.client.post(self.url, data) self.assertNoFormErrors(r) def test_homepage_url_optional(self): self._step() r = self.client.post(self.url, self.get_dict(homepage=None)) self.assertNoFormErrors(r) def test_homepage_url_invalid(self): self._step() r = self.client.post(self.url, self.get_dict(homepage='xxx')) self.assertFormError(r, 'form_basic', 'homepage', 'Enter a valid URL.') def test_support_url_optional_if_email_present(self): self._step() r = self.client.post(self.url, self.get_dict(support_url=None)) self.assertNoFormErrors(r) def test_support_url_invalid(self): self._step() r = self.client.post(self.url, self.get_dict(support_url='xxx')) self.assertFormError(r, 'form_basic', 'support_url', 'Enter a valid URL.') def test_support_email_optional_if_url_present(self): self._step() r = self.client.post(self.url, self.get_dict(support_email=None)) self.assertNoFormErrors(r) def test_support_email_invalid(self): self._step() r = self.client.post(self.url, self.get_dict(support_email='xxx')) self.assertFormError(r, 'form_basic', 'support_email', 'Enter a valid email address.') def test_support_need_email_or_url(self): self._step() res = self.client.post(self.url, self.get_dict(support_email=None, support_url=None)) self.assertFormError( res, 'form_basic', 'support', 'You must provide either a website, an email, or both.') ok_(pq(res.content)('#support-fields .error #trans-support_url')) ok_(pq(res.content)('#support-fields .error #trans-support_email')) # While the inputs will get the error styles, there is no need for an # individual error message on each, the hint on the parent is enough. eq_(pq(res.content)('#support-fields .error .errorlist').text(), '') def test_categories_required(self): self._step() r = self.client.post(self.url, self.get_dict(categories=[])) eq_(r.context['form_cats'].errors['categories'], ['This field is required.']) def test_categories_max(self): self._step() eq_(mkt.MAX_CATEGORIES, 2) cat2 = 'games' cat3 = 'social' cats = [self.cat1, cat2, cat3] r = self.client.post(self.url, self.get_dict(categories=cats)) eq_(r.context['form_cats'].errors['categories'], ['You can have only 2 categories.']) def _post_cats(self, cats): self.client.post(self.url, self.get_dict(categories=cats)) eq_(sorted(self.get_webapp().categories), sorted(cats)) def test_categories_add(self): self._step() cat2 = 'games' self._post_cats([self.cat1, cat2]) def test_categories_add_and_remove(self): self._step() cat2 = 'games' self._post_cats([cat2]) def test_categories_remove(self): # Add another category here so it gets added to the initial formset. cat2 = 'games' self.webapp.update(categories=[self.cat1, cat2]) self._step() # `cat2` should get removed. self._post_cats([self.cat1]) class TestDone(TestSubmit): fixtures = fixture('user_999', 'webapp_337141') def setUp(self): super(TestDone, self).setUp() self.webapp = self.get_webapp() self.url = reverse('submit.app.done', args=[self.webapp.app_slug]) def get_webapp(self): return Webapp.objects.get(id=337141) def _step(self, **kw): data = dict(addon=self.webapp, terms=True, manifest=True, details=True) data.update(kw) self.cl = AppSubmissionChecklist.objects.create(**data) AddonUser.objects.create(addon=self.webapp, user=self.user) def test_anonymous(self): self._test_anonymous() def test_progress_display(self): self._step() self._test_progress_display(['terms', 'manifest', 'details'], 'next_steps') def test_done(self): self._step() res = self.client.get(self.url) eq_(res.status_code, 200) class TestNextSteps(TestCase): # TODO: Delete this test suite once we deploy IARC. fixtures = fixture('user_999', 'webapp_337141') def setUp(self): self.user = UserProfile.objects.get(email='regular@mozilla.com') self.login(self.user.email) self.webapp = Webapp.objects.get(id=337141) self.webapp.update(status=mkt.STATUS_PENDING) self.url = reverse('submit.app.done', args=[self.webapp.app_slug]) def test_200(self, **kw): data = dict(addon=self.webapp, terms=True, manifest=True, details=True) data.update(kw) self.cl = AppSubmissionChecklist.objects.create(**data) AddonUser.objects.create(addon=self.webapp, user=self.user) res = self.client.get(self.url) eq_(res.status_code, 200)
clouserw/zamboni
mkt/submit/tests/test_views.py
Python
bsd-3-clause
38,827
[ "exciting" ]
89680f2bc0bfa2390c2cc11fb41dde7482ac00133ec85f5a0e8e60bc9b6a81db
# -*- coding: utf-8 -*- # Copyright (C) 2017 by Pedro Mendes, Virginia Tech Intellectual # Properties, Inc., University of Heidelberg, and University of # of Connecticut School of Medicine. # All rights reserved. # Copyright (C) 2010 - 2016 by Pedro Mendes, Virginia Tech Intellectual # Properties, Inc., University of Heidelberg, and The University # of Manchester. # All rights reserved. # Copyright (C) 2008 - 2009 by Pedro Mendes, Virginia Tech Intellectual # Properties, Inc., EML Research, gGmbH, University of Heidelberg, # and The University of Manchester. # All rights reserved. # Copyright (C) 2006 - 2007 by Pedro Mendes, Virginia Tech Intellectual # Properties, Inc. and EML Research, gGmbH. # All rights reserved. import COPASI import unittest from types import * class Test_CCommonName(unittest.TestCase): def setUp(self): self.datamodel=COPASI.CRootContainer.addDatamodel() self.model=self.datamodel.getModel() self.compartment=self.model.createCompartment("Comp1") self.metab=self.model.createMetabolite("metab3","Comp1") self.cn=self.metab.getCN() self.model.compileIfNecessary() def test_getPrimary(self): prim=self.cn.getPrimary() self.assert_(prim.__class__==COPASI.CCommonName) self.assert_(prim.getString()=="CN=Root") def test_getRemainder(self): prim=self.cn.getRemainder() self.assert_(prim.__class__==COPASI.CCommonName) self.assert_(prim.getString()=='Model=New Model,Vector=Compartments[Comp1],Vector=Metabolites[metab3]') def test_getObjectType(self): prim=self.cn.getObjectType() self.assert_(type(prim)==StringType) self.assert_(prim=="CN") def test_getObjectName(self): prim=self.cn.getObjectName() self.assert_(type(prim)==StringType) self.assert_(prim=="Root") def test_escape(self): a="This- \ \ is a test--!" o=COPASI.CCommonName.escape(a) self.assert_(type(o)==StringType) self.assert_(len(o)==len(a)+2) def test_unescape(self): a="This- \\ \\ is a test--!" o=COPASI.CCommonName.unescape(a) self.assert_(type(o)==StringType) self.assert_(len(o)==len(a)-2) def suite(): tests=[ 'test_getPrimary' ,'test_getRemainder' ,'test_getObjectType' ,'test_getObjectName' ,'test_escape' ,'test_unescape' ] return unittest.TestSuite(map(Test_CCommonName,tests)) if(__name__ == '__main__'): unittest.TextTestRunner(verbosity=2).run(suite())
jonasfoe/COPASI
copasi/bindings/python/unittests/Test_CCopasiObjectName.py
Python
artistic-2.0
2,523
[ "COPASI" ]
dffc6ec29610bd8e4b7a478cf45e0fb99079699449c41a1860d9551bf6f891ec
""" This script is used to design the design matrix for our linear regression. We explore the influence of linear and quadratic drifts on the model performance. Script for the filtered data. Run with: python noise-pca_filtered_script.py from this directory """ from __future__ import print_function, division import sys, os, pdb from scipy import ndimage from scipy.ndimage import gaussian_filter from matplotlib import colors from os.path import splitext from scipy.stats import t as t_dist import numpy as np import numpy.linalg as npl import matplotlib.pyplot as plt import nibabel as nib import scipy import pprint as pp import json #Specicy the path for functions sys.path.append(os.path.join(os.path.dirname(__file__), "../functions/")) sys.path.append(os.path.join(os.path.dirname(__file__), "./")) from smoothing import * from diagnostics import * from glm import * from plot_mosaic import * from mask_filtered_data import * # Locate the paths project_path = '../../../' data_path = project_path+'data/ds005/' path_dict = {'data_filtered':{ 'type' : 'filtered', 'feat' : '.feat', 'bold_img_name' : 'filtered_func_data_mni.nii.gz', 'run_path' : 'model/model001/' }, 'data_original':{ 'type' : '', 'feat': '', 'bold_img_name' : 'bold.nii.gz', 'run_path' : 'BOLD/' }} # TODO: uncomment for final version #subject_list = [str(i) for i in range(1,17)] #run_list = [str(i) for i in range(1,4)] # Run only for subject 1 and 5 - run 1 run_list = [str(i) for i in range(1,2)] subject_list = ['1', '5'] d_path = path_dict['data_filtered'] #OR original or filtered images_paths = [('ds005' + '_sub' + s.zfill(3) + '_t1r' + r, \ data_path + 'sub%s/'%(s.zfill(3)) + d_path['run_path'] \ + 'task001_run%s%s/%s' %(r.zfill(3),d_path['feat'],\ d_path['bold_img_name'])) \ for r in run_list \ for s in subject_list] # set gray colormap and nearest neighbor interpolation by default plt.rcParams['image.cmap'] = 'gray' plt.rcParams['image.interpolation'] = 'nearest' # Mask # To be used with the normal data thres = 375 #From analysis of the histograms # To be used with the filtered data mask_path = project_path+'data/mni_icbm152_t1_tal_nlin_asym_09c_mask_2mm.nii' template_path = project_path+'data/mni_icbm152_t1_tal_nlin_asym_09c_2mm.nii' sm = '' #sm='not_smooth/' project_path = project_path + sm # Create the needed directories if they do not exist dirs = [project_path+'fig/',\ project_path+'fig/BOLD',\ project_path+'fig/drifts',\ project_path+'fig/pca',\ project_path+'fig/pca/projections/',\ project_path+'fig/linear_model/mosaic',\ project_path+'fig/linear_model/mosaic/middle_slice',\ project_path+'txt_output/',\ project_path+'txt_output/MRSS/',\ project_path+'txt_output/pca/',\ project_path+'txt_output/drifts/'] for d in dirs: if not os.path.exists(d): os.makedirs(d) # Progress bar print("\nStarting noise-pca for filtered data analysis\n") for image_path in images_paths: name = image_path[0] if d_path['type']=='filtered': #in_brain_img = nib.load('../../../'+ # 'data/ds005/sub001/model/model001/task001_run001.feat/'\ # + 'masked_filtered_func_data_mni.nii.gz') # Image shape (91, 109, 91, 240) md = data_path + 'sub%s/'%(s.zfill(3)) + d_path['run_path'] \ + 'task001_run%s%s/masked_%s' %(r.zfill(3),d_path['feat'],\ d_path['bold_img_name']) if not os.path.exists(md): print("Filtering brain image for: ") print(str(name)) in_brain_img = make_mask_filtered_data(image_path[1],mask_path) print("brain image filtered\n") else: print("Loading filtered brain image for: ") print(str(name)) in_brain_img = nib.load(md) print("brain image loaded\n") data_int = in_brain_img.get_data() data = data_int.astype(float) mean_data = np.mean(data, axis=-1) template = nib.load(template_path) template_data_int = template.get_data() template_data = template_data_int.astype(float) Transpose = False in_brain_mask = (mean_data - 0.0) < 0.01 plt.imshow(plot_mosaic(template_data, transpose=Transpose),\ cmap='gray', alpha=1) else: img = nib.load(image_path[1]) data = img.get_data() mean_data = np.mean(data, axis=-1) in_brain_mask = mean_data > thres Transpose = True plt.contour(plot_mosaic(in_brain_mask, transpose=Transpose), \ cmap='gray' , alpha=1) # Smoothing with Gaussian filter smooth_data = smoothing(data,1,range(data.shape[-1])) # Selecting the voxels in the brain in_brain_tcs = smooth_data[in_brain_mask, :] #in_brain_tcs = data[in_brain_mask, :] vol_shape = data.shape[:-1] # Plotting the voxels in the brain plt.imshow(plot_mosaic(mean_data, transpose=Transpose), cmap='gray', alpha=1) plt.colorbar() plt.title('In brain voxel mean values' + '\n' + (d_path['type'] + str(name))) plt.savefig(project_path+'fig/BOLD/%s_mean_voxels.png'\ %(d_path['type'] + str(name))) #plt.show() #plt.clf() # Convolution with 1 to 4 conditions convolved = np.zeros((240,5)) for i in range(1,5): #convolved = np.loadtxt(\ # '../../../txt_output/conv_normal/%s_conv_00%s_canonical.txt'\ # %(str(name),str(i))) convolved[:,i] = np.loadtxt(\ '../../../txt_output/conv_high_res/%s_conv_00%s_high_res.txt'\ %(str(name),str(i))) reg_str = ['Intercept','Task', 'Gain', 'Loss', 'Distance', 'Linear Drift',\ 'Quadratic drift', 'PC#1', 'PC#2', 'PC#3', 'PC#4'] # Create design matrix X - Including drifts P = 7 #number of regressors of X including the ones for intercept n_trs = data.shape[-1] X = np.ones((n_trs, P)) for i in range(1,5): X[:,i] = convolved[:,i] linear_drift = np.linspace(-1, 1, n_trs) X[:,5] = linear_drift quadratic_drift = linear_drift ** 2 quadratic_drift -= np.mean(quadratic_drift) X[:,6] = quadratic_drift # Save the design matrix np.savetxt(project_path+\ 'txt_output/drifts/%s_design_matrix_with_drift.txt'\ %(d_path['type'] + str(name)), X) # Linear Model - Including drifts Y = in_brain_tcs.T betas = npl.pinv(X).dot(Y) # Save the betas for the linear model including drifts np.savetxt(project_path+\ 'txt_output/drifts/%s_betas_with_drift.txt'%(d_path['type'] + str(name)), betas) betas_vols = np.zeros(vol_shape + (P,)) betas_vols[in_brain_mask] = betas.T # Plot # Set regions outside mask as missing with np.nan mean_data[~in_brain_mask] = np.nan betas_vols[~in_brain_mask] = np.nan nice_cmap_values = np.loadtxt('actc.txt') nice_cmap = colors.ListedColormap(nice_cmap_values, 'actc') # Plot each slice on the 3rd dimension of the image in a mosaic for k in range(1,P): plt.imshow(plot_mosaic(mean_data, transpose=Transpose), cmap='gray', alpha=1) #plt.imshow(plot_mosaic(betas_vols[...,k], transpose=Transpose), cmap='gray', alpha=1) plt.imshow(plot_mosaic(betas_vols[...,k], transpose=Transpose), cmap=nice_cmap, alpha=1) plt.colorbar() plt.title('Beta (with drift) values for brain voxel related to ' \ + str(reg_str[k]) + '\n' + d_path['type'] + str(name)) plt.savefig(project_path+'fig/linear_model/mosaic/%s_withdrift_%s'\ %(d_path['type'] + str(name), str(reg_str[k]))+'.png') plt.close() #plt.show() #plt.clf() #Show the middle slice only plt.imshow(betas_vols[:, :, 18, k], cmap='gray', alpha=0.5) plt.colorbar() plt.title('In brain voxel - Slice 18 \n' \ 'Projection on %s - %s'\ %(str(reg_str[k]), d_path['type'] + str(name))) plt.savefig(\ project_path+'fig/linear_model/mosaic/middle_slice/%s_withdrift_middleslice_%s'\ %(d_path['type'] + str(name), str(k))+'.png') #plt.show() #plt.clf() plt.close() # PCA Analysis Y_demeaned = Y - np.mean(Y, axis=1).reshape([-1, 1]) unscaled_cov = Y_demeaned.dot(Y_demeaned.T) U, S, V = npl.svd(unscaled_cov) projections = U.T.dot(Y_demeaned) projection_vols = np.zeros(data.shape) projection_vols[in_brain_mask, :] = projections.T # Plot the projection of the data on the 5 first principal component # from SVD for i in range(1,5): plt.plot(U[:, i]) plt.title('U' + str(i) + ' vector from SVD \n' + str(name)) plt.imshow(projection_vols[:, :, 18, i]) plt.colorbar() plt.title('PCA - 18th slice projection on PC#' + str(i) + ' from SVD \n ' +\ d_path['type'] + str(name)) plt.savefig(project_path+'fig/pca/projections/%s_PC#%s.png' \ %((d_path['type'] + str(name),str(i)))) #plt.show() #plt.clf() plt.close() # Variance Explained analysis s = [] #S is diag -> trace = sum of the elements of S for i in S: s.append(i/np.sum(S)) np.savetxt(project_path+\ 'txt_output/pca/%s_variance_explained' % (d_path['type'] + str(name)) +\ '.txt', np.array(s[:40])) ind = np.arange(len(s[1:40])) plt.bar(ind, s[1:40], width=0.5) plt.xlabel('Principal Components indices') plt.ylabel('Explained variance in percent') plt.title('Variance explained graph \n' + (d_path['type'] + str(name))) plt.savefig(project_path+\ 'fig/pca/%s_variance_explained.png' %(d_path['type'] + str(name))) #plt.show() plt.close() # Linear Model - including PCs from PCA analysis PC = 3 # Number of PCs to include in the design matrix P_pca = P + PC X_pca = np.ones((n_trs, P_pca)) for i in range(1,5): X_pca[:,i] = convolved[:,i] linear_drift = np.linspace(-1, 1, n_trs) X_pca[:,5] = linear_drift quadratic_drift = linear_drift ** 2 quadratic_drift -= np.mean(quadratic_drift) X_pca[:,6] = quadratic_drift for i in range(3): X_pca[:,7+i] = U[:, i] # Save the design matrix - with PCs np.savetxt(project_path+'txt_output/pca/%s_design_matrix_pca.txt'\ %(d_path['type'] + str(name)), X_pca) #plt.imshow(X_pca, aspect=0.25) B_pca = npl.pinv(X_pca).dot(Y) np.savetxt(project_path+'txt_output/pca/%s_betas_pca.txt'\ %(d_path['type'] + str(name)), B_pca) b_pca_vols = np.zeros(vol_shape + (P_pca,)) b_pca_vols[in_brain_mask, :] = B_pca.T # Save betas as nii files # Plot - with PCs # Set regions outside mask as missing with np.nan mean_data[~in_brain_mask] = np.nan b_pca_vols[~in_brain_mask] = np.nan # Plot each slice on the 3rd dimension of the image in a mosaic for k in range(1,P_pca): fig = plt.figure(figsize = (8, 5)) #plt.imshow(plot_mosaic(b_pca_vols[...,k], transpose=Transpose), cmap='gray', alpha=0.5) plt.imshow(plot_mosaic(mean_data, transpose=Transpose), cmap='gray', alpha=1) plt.imshow(plot_mosaic(b_pca_vols[...,k], transpose=Transpose), cmap=nice_cmap, alpha=1) plt.colorbar() plt.title('Beta (with PCA) values for brain voxel related to ' \ + str(reg_str[k]) + '\n' + d_path['type'] + str(name)) plt.savefig(project_path+'fig/linear_model/mosaic/%s_withPCA_%s'\ %(d_path['type'] + str(name), str(reg_str[k]))+'.png') #plt.show() plt.close() #Show the middle slice only plt.imshow(b_pca_vols[:, :, 18, k], cmap='gray', alpha=0.5) plt.colorbar() plt.title('In brain voxel model - Slice 18 \n' \ 'Projection on X%s \n %s'\ %(str(reg_str[k]),d_path['type'] + str(name))) plt.savefig(\ project_path+\ 'fig/linear_model/mosaic/middle_slice/%s_withPCA_middle_slice_%s'\ %(d_path['type'] + str(name), str(k))+'.png') #plt.show() #plt.clf() plt.close() # Residuals MRSS_dict = {} MRSS_dict['ds005' + d_path['type']] = {} MRSS_dict['ds005' + d_path['type']]['drifts'] = {} MRSS_dict['ds005' + d_path['type']]['pca'] = {} for z in MRSS_dict['ds005' + d_path['type']]: MRSS_dict['ds005' + d_path['type']][z]['MRSS'] = [] residuals = Y - X.dot(betas) df = X.shape[0] - npl.matrix_rank(X) MRSS = np.sum(residuals ** 2 , axis=0) / df residuals_pca = Y - X_pca.dot(B_pca) df_pca = X_pca.shape[0] - npl.matrix_rank(X_pca) MRSS_pca = np.sum(residuals_pca ** 2 , axis=0) / df_pca MRSS_dict['ds005' + d_path['type']]['drifts']['mean_MRSS'] = np.mean(MRSS) MRSS_dict['ds005' + d_path['type']]['pca']['mean_MRSS'] = np.mean(MRSS_pca) # Save the mean MRSS values to compare the performance # of the design matrices for design_matrix, beta, mrss, name in \ [(X, betas, MRSS, 'drifts'), (X_pca, B_pca, MRSS_pca, 'pca')]: MRSS_dict['ds005' + d_path['type']][name]['p-values'] = [] MRSS_dict['ds005' + d_path['type']][name]['t-test'] = [] with open(project_path+'txt_output/MRSS/ds005%s_MRSS.json'\ %(d_path['type']), 'w') as file_out: json.dump(MRSS_dict, file_out) # SE = np.zeros(beta.shape) # for i in range(design_matrix.shape[-1]): # c = np.zeros(design_matrix.shape[-1]) # c[i]=1 # c = np.atleast_2d(c).T # SE[i,:]= np.sqrt(\ # mrss* c.T.dot(npl.pinv(design_matrix.T.dot(design_matrix)).dot(c))) # zeros = np.where(SE==0) # SE[zeros] = 1 # t = beta / SE # t[:,zeros] = 0 # # Get p value for t value using CDF of t didstribution # ltp = t_dist.cdf(abs(t), df) # p = 1 - ltp # upper tail # t_brain = t[in_brain_mask] # p_brain = p[in_brain_mask] # # # Save 3D data in .nii files # for k in range(1,4): # t_nib = nib.Nifti1Image(t_brain[..., k], affine) # nib.save(t-test, project_path+'txt_output/%s/%s_t-test_%s.nii.gz'\ # %(name, d_path['type'] + str(name),str(reg_str[k]))) # p_nib = nib.Nifti1Image(p_brain[..., k], affine) # nib.save(p-values,project_path+'txt_output/%s/%s_p-values_%s.nii.gz'\ # %(name, d_path['type'] + str(name),str(reg_str[k]))) # pdb.set_trace() # pdb.set_trace() plt.close() print("=") print("======================================") print("\n Noise and PCA analysis for filtered data done") print("Design Matrix including drift terms stored in project_epsilon/txt_output/drifts/ \n\n") print("Design Matrix including PCs terms stored in project_epsilon/txt_output/pca/\n\n") print("Mean MRSS models results in project_epsilon/txt_output/MRSS/ds005filtered_MRSS.json\n\n")
ye-zhi/project-epsilon
code/utils/scripts/noise-pca_filtered_script.py
Python
bsd-3-clause
14,797
[ "Gaussian" ]
f0d1e48df3e76da2a0962f1c74316d73f5d5be5f6d8943249bdc2506016cb5a9
# -*- coding: utf-8 -*- """ Django settings for echo_seeds project. For more information on this file, see https://docs.djangoproject.com/en/dev/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/dev/ref/settings/ """ # Build paths inside the project like this: os.path.join(BASE_DIR, ...) import os from os.path import join, dirname from configurations import Configuration, values BASE_DIR = dirname(dirname(__file__)) class Common(Configuration): BASE_DIR = BASE_DIR PROJECT_DIR = dirname(BASE_DIR) # APP CONFIGURATION DJANGO_APPS = ( # Default Django apps: 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.messages', 'django.contrib.staticfiles', # Useful template tags: # 'django.contrib.humanize', # Admin 'suit', # Admin theme. 'django.contrib.admin', ) THIRD_PARTY_APPS = ( 'crispy_forms', # Form layouts 'avatar', # for user avatars 'allauth', # registration 'allauth.account', # registration 'allauth.socialaccount', # registration 'django_extensions', ) # Apps specific for this project go here. LOCAL_APPS = ( 'users', # custom users app 'core', 'seedbank', # Your stuff: custom apps go here ) # See: https://docs.djangoproject.com/en/dev/ref/settings/#installed-apps INSTALLED_APPS = DJANGO_APPS + THIRD_PARTY_APPS + LOCAL_APPS # END APP CONFIGURATION # MIDDLEWARE CONFIGURATION MIDDLEWARE_CLASSES = ( # Make sure djangosecure.middleware.SecurityMiddleware is listed first 'djangosecure.middleware.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ) # END MIDDLEWARE CONFIGURATION # MIGRATIONS CONFIGURATION MIGRATION_MODULES = { 'sites': 'contrib.sites.migrations' } # END MIGRATIONS CONFIGURATION # DEBUG # See: https://docs.djangoproject.com/en/dev/ref/settings/#debug DEBUG = values.BooleanValue(False) # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-debug TEMPLATE_DEBUG = DEBUG # END DEBUG # SECRET CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#secret-key # Note: This key only used for development and testing. # In production, this is changed to a values.SecretValue() setting SECRET_KEY = "G62O.9dUnhTrI[wqvv]YD]EM5@x'rm" # END SECRET CONFIGURATION # FIXTURE CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#std:setting-FIXTURE_DIRS FIXTURE_DIRS = ( join(BASE_DIR, 'fixtures'), ) # END FIXTURE CONFIGURATION # EMAIL CONFIGURATION EMAIL_BACKEND = values.Value('django.core.mail.backends.smtp.EmailBackend') # END EMAIL CONFIGURATION # MANAGER CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#admins ADMINS = ( ("Brian Dant", 'briandant414@gmail.com'), ) # See: https://docs.djangoproject.com/en/dev/ref/settings/#managers MANAGERS = ADMINS # END MANAGER CONFIGURATION # DATABASE CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#databases DATABASES = values.DatabaseURLValue('postgres://localhost/echo_seeds') # END DATABASE CONFIGURATION # CACHING # Do this here because thanks to django-pylibmc-sasl and pylibmc # memcacheify (used on heroku) is painful to install on windows. CACHES = { 'default': { 'BACKEND': 'django.core.cache.backends.locmem.LocMemCache', 'LOCATION': '' } } # END CACHING # GENERAL CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#time-zone TIME_ZONE = 'America/Los_Angeles' # See: https://docs.djangoproject.com/en/dev/ref/settings/#language-code LANGUAGE_CODE = 'en-us' # See: https://docs.djangoproject.com/en/dev/ref/settings/#site-id SITE_ID = 1 # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-i18n USE_I18N = True # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-l10n USE_L10N = True # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-tz USE_TZ = True # END GENERAL CONFIGURATION # TEMPLATE CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-context-processors TEMPLATE_CONTEXT_PROCESSORS = ( 'django.contrib.auth.context_processors.auth', "allauth.account.context_processors.account", "allauth.socialaccount.context_processors.socialaccount", 'django.core.context_processors.debug', 'django.core.context_processors.i18n', 'django.core.context_processors.media', 'django.core.context_processors.static', 'django.core.context_processors.tz', 'django.contrib.messages.context_processors.messages', 'django.core.context_processors.request', # Your stuff: custom template context processers go here ) # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-dirs TEMPLATE_DIRS = ( join(BASE_DIR, 'templates'), ) TEMPLATE_LOADERS = ( 'django.template.loaders.filesystem.Loader', 'django.template.loaders.app_directories.Loader', ) # See: http://django-crispy-forms.readthedocs.org/en/latest/install.html#template-packs CRISPY_TEMPLATE_PACK = 'bootstrap3' # END TEMPLATE CONFIGURATION # STATIC FILE CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#static-root STATIC_ROOT = join(os.path.dirname(BASE_DIR), 'staticfiles') # See: https://docs.djangoproject.com/en/dev/ref/settings/#static-url STATIC_URL = '/static/' STATICFILES_DIRS = ( join(BASE_DIR, 'static'), ) # See: https://docs.djangoproject.com/en/dev/ref/contrib/staticfiles/#staticfiles-finders STATICFILES_FINDERS = ( 'django.contrib.staticfiles.finders.FileSystemFinder', 'django.contrib.staticfiles.finders.AppDirectoriesFinder', ) # END STATIC FILE CONFIGURATION # MEDIA CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#media-root MEDIA_ROOT = join(BASE_DIR, 'media') # See: https://docs.djangoproject.com/en/dev/ref/settings/#media-url MEDIA_URL = '/media/' # END MEDIA CONFIGURATION # URL Configuration ROOT_URLCONF = 'urls' # See: https://docs.djangoproject.com/en/dev/ref/settings/#wsgi-application WSGI_APPLICATION = 'wsgi.application' # End URL Configuration # AUTHENTICATION CONFIGURATION AUTHENTICATION_BACKENDS = ( "django.contrib.auth.backends.ModelBackend", "allauth.account.auth_backends.AuthenticationBackend", ) # Some really nice defaults ACCOUNT_AUTHENTICATION_METHOD = "username" ACCOUNT_EMAIL_REQUIRED = True ACCOUNT_EMAIL_VERIFICATION = "mandatory" # END AUTHENTICATION CONFIGURATION # Custom user app defaults # Select the correct user model AUTH_USER_MODEL = "users.User" LOGIN_REDIRECT_URL = "users:redirect" LOGIN_URL = "account_login" # END Custom user app defaults # SLUGLIFIER AUTOSLUG_SLUGIFY_FUNCTION = "slugify.slugify" # END SLUGLIFIER # LOGGING CONFIGURATION # See: https://docs.djangoproject.com/en/dev/ref/settings/#logging # A sample logging configuration. The only tangible logging # performed by this configuration is to send an email to # the site admins on every HTTP 500 error when DEBUG=False. # See http://docs.djangoproject.com/en/dev/topics/logging for # more details on how to customize your logging configuration. LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'filters': { 'require_debug_false': { '()': 'django.utils.log.RequireDebugFalse' } }, 'handlers': { 'mail_admins': { 'level': 'ERROR', 'filters': ['require_debug_false'], 'class': 'django.utils.log.AdminEmailHandler' } }, 'loggers': { 'django.request': { 'handlers': ['mail_admins'], 'level': 'ERROR', 'propagate': True, }, } } # END LOGGING CONFIGURATION # Your common stuff: Below this line define 3rd party library settings
briandant/echo-seeds
echo_seeds/config/common.py
Python
bsd-3-clause
8,943
[ "Brian" ]
42827adf9252966a4499a04cf6e79c62ab57205c89e3193f4a95521fc5143668
''' Created on 2013 mai 24 @author: peio ''' import subprocess import os from tempfile import NamedTemporaryFile from Bio import SeqIO from Bio.Seq import Seq class IsIndelError(Exception): pass class OutsideAlignment(Exception): pass class BetweenSegments(Exception): pass class SeqCoords(object): '''This class creates a coord system relation between tow secuences. First it alignes the sequences and creates de coord system. It uses internally 0 coord system. The coord system is a list of start, stop segments in both secuences ej: 1 2 3 4 5 6 01234567890123456789012345678901234567890123456789012345678901234 ATCTAGGCTGCTACGATTAGCTGATCGATGTTATCGTAGATCTAGCTGATCATGCTAGCTGATCG ATCTAGGCTGCTACGA-TAGCTGATCGATGTTATCGTAGATCTAGCTGATCATGC-AGCTGATCG 0-15, 17-54, 56-64 0-15, 16-53, 54-62 1 2 3 4 5 6 01234567890123456789012345678901234567890123456789012345678901234 012345678901234567890123 4567890123456789012345678901 2345678901234 ATCTAGGCTGCTACGATTAGCTGA-CGATGTTATCGTAGATCTAGCTGATCAT-CTAGCTGATCG ATCTAGGCT-CTACGATTAGCTGATCGATGTTATCGTAGATC-AGCTGATCATGCTAGCTGATCG 012345678 90123456789012345678901234567890 123456789012345678901234 0-8, 10-23, 24-40, 42-51, 52-62 0-8, 9-22, 24-40, 41-50, 52-62 ''' def __init__(self, seq1, seq2): "Both secuences are biopython secuences" self.coord_system = self._get_coord_system(seq1, seq2) self.seq1_name = seq1.id self.seq2_name = seq2.id self._seq2_len = len(seq2) def _get_coord_system(self, seq1, seq2): out_fhand, reverse = get_water_alignment(seq1, seq2) self.reverse = reverse coord_system = build_relations_from_aligment(out_fhand) out_fhand.close() return coord_system def _reverse_pos(self, pos): reverse = self.reverse if reverse: return self._seq2_len - pos - 1 else: return pos def _get_segment(self, pos, seq_name): 'returns the segment index of the given position' segments = self.coord_system[seq_name] for index, (start, stop) in enumerate(segments): if pos >= start and pos <= stop: return index, (start, stop) if pos < segments[0][0] or pos > segments[-1][1]: raise OutsideAlignment else: raise BetweenSegments def _to_seq_pos(self, pos, to_seq1=True): if to_seq1: seq1_name = self.seq1_name seq2_name = self.seq2_name else: seq2_name = self.seq1_name seq1_name = self.seq2_name segment2 = self._get_segment(pos, seq2_name) segment2_index, segment2 = segment2 segment1 = self.coord_system[seq1_name][segment2_index] return segment1[0] + pos - segment2[0] def to_seq1_pos(self, seq2_pos): seq2_pos = self._reverse_pos(seq2_pos) return self._to_seq_pos(seq2_pos, to_seq1=True) def to_seq2_pos(self, seq1_pos): seq2_pos = self._to_seq_pos(seq1_pos, to_seq1=False) return self._reverse_pos(seq2_pos) def _to_seq_slice(self, start, end, to_seq1=True): if to_seq1: seq1_name = self.seq1_name seq2_name = self.seq2_name else: seq2_name = self.seq1_name seq1_name = self.seq2_name stop = end - 1 segment2_start = self._get_segment(start, seq2_name) segment2_stop = self._get_segment(stop, seq2_name) segment2_index_start, segment2_start = segment2_start segment2_index_stop, segment2_stop = segment2_stop if segment2_index_start != segment2_index_stop: raise BetweenSegments segment1 = self.coord_system[seq1_name][segment2_index_start] start = segment1[0] + start - segment2_start[0] stop = segment1[0] + stop - segment2_stop[0] return (start, stop + 1) def to_seq1_slice(self, start, end): if self.reverse: start = self._reverse_pos(start) end = self._reverse_pos(end) slice2 = self._to_seq_slice(start, end, to_seq1=True) if self.reverse: return slice2[1], slice2[0] return slice2 def to_seq2_slice(self, start, end): slice1 = self._to_seq_slice(start, end, to_seq1=False) if self.reverse: start = self._reverse_pos(slice1[1]) end = self._reverse_pos(slice1[0]) else: start, end = slice1 return (start, end) def build_relations_from_aligment(fhand): 'It returns a relations dict given an alignment in markx10 format' #print open(fhand.name).read() #we parse the aligment in_seq_section = 0 seq, al_start, seq_len = None, None, None seq0_name = None for line in fhand: line = line.strip() if not line: continue if line[0] == '>' and line[1] != '>': if seq0_name is None: seq0_name = line.split()[0][1:] else: seq1_name = line.split()[0][1:] if in_seq_section: seq0 = {'seq': seq, 'length': seq_len, 'al_start': al_start - 1, 'name': seq0_name} in_seq_section += 1 seq = '' continue if not in_seq_section: continue if '; sq_len:' in line: seq_len = int(line.split(':')[-1]) if '; al_display_start:' in line: al_start = int(line.split(':')[-1]) if line[0] not in (';', '#'): seq += line seq1 = {'seq': seq, 'length': seq_len, 'al_start': al_start - 1, 'name': seq1_name} #now we get the segments gap = '-' segments = [] segment0, segment1 = None, None seq0_start, seq1_start = seq0['al_start'], seq1['al_start'] seq0_start_delta, seq1_start_delta = seq0_start, seq1_start seq0_delta, seq1_delta = 0, 0 for index, (nucl0, nucl1) in enumerate(zip(seq0['seq'], seq1['seq'])): seq0_index = seq0_start_delta + index - seq0_delta seq1_index = seq1_start_delta + index - seq1_delta if nucl0 == gap: segment0 = seq0_start, seq0_index - 1 segment1 = seq1_start, seq1_index - 1 seq0_start = seq0_index seq1_start = seq1_index + 1 seq0_delta += 1 elif nucl1 == gap: segment0 = seq0_start, seq0_index - 1 segment1 = seq1_start, seq1_index - 1 seq1_start = seq1_index seq0_start = seq0_index + 1 seq1_delta += 1 if segment0 and segment1: segment = {seq0['name']: segment0, seq1['name']: segment1} segments.append(segment) segment0, segment1 = None, None else: segment0 = seq0_start, seq0_index segment1 = seq1_start, seq1_index segment = {seq0['name']: segment0, seq1['name']: segment1} segments.append(segment) relations = {} for seg in segments: for seq_name, limits in seg.items(): if seq_name not in relations: relations[seq_name] = [] relations[seq_name].append(limits) return relations def _get_water_score(fhand): for line in fhand: if line.startswith('# Score:'): return float(line.split(':')[1].strip()) return None def get_water_alignment(seq1, seq2, gap_open=10.0, gap_extend=0.5, out_fmt='markx10'): out_fhand = NamedTemporaryFile() _do_water_alignment(seq1, seq2, out_fhand, gap_open=10.0, gap_extend=0.5, out_fmt='markx10', reverse2=False) out_fhand2 = NamedTemporaryFile() _do_water_alignment(seq1, seq2, out_fhand2, gap_open=10.0, gap_extend=0.5, out_fmt='markx10', reverse2=True) forw_score = _get_water_score(out_fhand) rev_score = _get_water_score(out_fhand2) if forw_score > rev_score: out_fhand.seek(0) return out_fhand, False else: out_fhand2.seek(0) return out_fhand2, True def _do_water_alignment(seq1, seq2, out_fhand, gap_open=10.0, gap_extend=0.5, out_fmt='markx10', reverse2=False): seq1_fhand = NamedTemporaryFile() seq2_fhand = NamedTemporaryFile() SeqIO.write(seq1, seq1_fhand, 'fasta') SeqIO.write(seq2, seq2_fhand, 'fasta') seq1_fhand.flush() seq2_fhand.flush() cmd = ['water', '-asequence', seq1_fhand.name, '-bsequence', seq2_fhand.name, '-outfile', out_fhand.name, '-gapopen', str(gap_open), '-gapextend', str(gap_extend), '-aformat3', out_fmt] if reverse2: cmd.append('-sreverse2') stdout = open(os.devnull, 'w') stderr = open(os.devnull, 'w') subprocess.check_call(cmd, stdout=stdout, stderr=stderr) def get_amino_change(seq_ref, seq_estscan, snv): if snv.is_indel: raise IsIndelError() position = snv.pos alt_allele = snv.alleles[1] seq_coord = SeqCoords(seq_ref, seq_estscan) estscan_pos = seq_coord.to_seq2_pos(position) if estscan_pos is None: return None estscan_frame = (estscan_pos % 3) + 1 estscan_start = estscan_pos + estscan_frame - 1 estscan_stop = estscan_start + 2 # check if there is a frameshift in the ref_seq ref_slice = seq_coord.to_seq1_slice(estscan_start, estscan_stop) if ref_slice is None: return None ref_seq_aa = seq_ref[ref_slice[0]: ref_slice[1] + 1].seq[:3].translate() estscan_seq_aa = seq_estscan[estscan_start: estscan_stop + 1].seq[:3] ref_aa = str(estscan_seq_aa.translate()) if str(ref_seq_aa) != str(ref_aa): return None aminos = {'ref_amino': ref_aa, 'alt_amino': []} for alt_allele in snv.alleles[1:]: alt_seq = [nucl for nucl in (estscan_seq_aa)] alt_seq[estscan_frame - 1] = alt_allele alt_seq = Seq("".join(alt_seq)) alt_aa = str(alt_seq.translate()) aminos['alt_amino'].append(alt_aa) return aminos
JoseBlanca/vcf_crumbs
vcf_crumbs/prot_change.py
Python
gpl-3.0
10,257
[ "Biopython" ]
8c29496d60888c492918b0c445988a7b9e2312fde71b5b2a4f91e3d928bf4613
# coding=utf8 # # Copyright 2013 Dreamlab Onet.pl # # This library is free software; you can redistribute it and/or # modify it under the terms of the GNU Lesser General Public # License as published by the Free Software Foundation; # version 3.0. # This library is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # Lesser General Public License for more details. # You should have received a copy of the GNU Lesser General Public # License along with this library; if not, visit # # http://www.gnu.org/licenses/lgpl.txt # import requests import logging import time from nose.tools import assert_equals from nose.tools import assert_true from nose.tools import assert_is from nose.tools import assert_in from nose.tools import assert_raises from nose.tools import assert_raises_regexp import rmock from rmock import call from rmock.errors import RmockError from rmock.tools import find_random_port from testtools import http_call class TestRmockStartStopServer(object): def test_server_already_running(self): port = find_random_port() with rmock.run(port=port): assert_raises_regexp( RmockError, 'error starting server process.*port.*%s.*' % port, rmock.run, port=port ) def test_stop_server(self): port = find_random_port() with rmock.run(port=port) as mock: #time.sleep(1) assert_equals(http_call(mock, "func").text, '') mock.stop_server() # to prevent connection reset by peer socket error time.sleep(.1) assert_raises((requests.ConnectionError), http_call, mock, 'func') mock.start_server() assert_equals(http_call(mock, "func").text, '') @rmock.patch("http", classvar="http_mock") class TestRmockStartStopServerClassDecorator(object): '''While patch as using class decorator mock server should be started and ready to handle requests always, event if it was stopped in previous test execution ''' def test_function1(self): assert_equals(http_call(self.http_mock, "func").text, '') self.http_mock.stop_server() def test_function2(self): assert_equals(http_call(self.http_mock, "func").text, '') self.http_mock.stop_server()
tikan/rmock
tests/func_tests/test_start_stop_server.py
Python
lgpl-3.0
2,709
[ "VisIt" ]
5d5e364665ba28fb04c2a44dc9380028a3321b1518b04abdced864f067c364c4
from __pyosshell__ import * from __molecules__ import * from __qmshell__ import * import xml.dom.minidom as xml def WriteSystemXml(name,gro,xyz,xml = 'system.xml'): mol = SingleMoleculeFromGro(gro)[0] mol.fragment() mol.make_dict() mol.name = name es,xyz = e_xyz_from_xyz(xyz) # CHECK CONGRUENCY for atm, e, xyz in zip(mol.atoms,es,xyz): print atm.fragName, atm.name, "=>", e, xyz assert atm.name[0:1] == e or atm.name[0:2].lower() == e.lower() outt = open(xml,'w') # MOLECULE HEADER outt.write('<topology>\n') outt.write('\t<molecules>\n') outt.write('\t<molecule>\n') outt.write('\t\t<name>%s</name>\n' % mol.name) outt.write('\t\t<mdname>%s</mdname>\n' % mol.name) outt.write('\t\t<segments>\n') # SEGMENT HEADER outt.write('\t\t<segment>\n') outt.write('\t\t\t<name>%s</name>\n' % mol.name) # XYZ FILE outt.write('\t\t\t<qmcoords>QC_FILES/%s.xyz</qmcoords>\n' % mol.name) # MPS FILES outt.write('\t\t\t<multipoles_n>MP_FILES/%s_n.mps</multipoles_n>\n' % (mol.name)) outt.write('\t\t\t<multipoles_h>MP_FILES/%s_h.mps</multipoles_h>\n' % (mol.name)) outt.write('\t\t\t<multipoles_e>MP_FILES/%s_e.mps</multipoles_e>\n' % (mol.name)) outt.write('\t\t\t<map2md>0</map2md>\n') # FRAGMENTS outt.write('\t\t\t<fragments>\n') for frag in mol.frags: # FRAGMENT HEADER fragName = '%s%d' % (frag.name,mol.frags.index(frag)) outt.write('\t\t\t<fragment>\n') outt.write('\t\t\t\t<name>%s</name>\n' % fragName) # MD-ATOMS mdatoms = '' for atom in frag.atoms: mdatoms += ' %-11s ' % ('%d:%s:%s' % (atom.fragId, atom.fragName, atom.name)) outt.write('\t\t\t\t<mdatoms>%s</mdatoms>\n' % mdatoms) # QM-ATOMS, M-POLES, WEIGHTS qmatoms = '' weights = '' ms = { 'H' : 1, 'C' : 12, 'N' : 14, 'O' : 16, 'S' : 32, 'Zn' : 65 } for atom in frag.atoms: idx = mol.atoms.index(atom) typ = es[idx] qmatoms += ' %-11s ' % ('%d:%s' % (atom.Id,typ)) weights += ' %-11s ' % ('%d' % ms[typ]) outt.write('\t\t\t\t<qmatoms>%s</qmatoms>\n' % qmatoms) outt.write('\t\t\t\t<mpoles> %s</mpoles>\n' % qmatoms) outt.write('\t\t\t\t<weights>%s</weights>\n' % weights) # LOCAL FRAME localframe = '' count_atoms = 0 for atom in frag.atoms: if count_atoms == 3: break idx = mol.atoms.index(atom) typ = es[idx] if typ != 'H': count_atoms += 1 localframe += ' %d ' % atom.Id outt.write('\t\t\t\t<localframe>%s</localframe>\n' % localframe) outt.write('\t\t\t</fragment>\n') # CLOSING TAGS outt.write('\t\t\t</fragments>\n') outt.write('\t\t</segment>\n') outt.write('\t\t</segments>\n') outt.write('\t</molecule>\n') outt.write('\t</molecules>\n') outt.write('</topology>\n') outt.close() return def WriteSystemXmlUsingPattern(name, gro, xyz, mpsfile, gropattern, xyzpattern, mpspattern, xml='system.xml', outt=None, map2md=False, segment_properties={}): assert len(gropattern) == len(xyzpattern) assert len(gropattern) == len(mpspattern) mol = SingleMoleculeFromGro(gro)[0] mol.fragment() mol.make_dict() mol.name = name es,xyz = e_xyz_from_xyz(xyz) mps = mps_from_mpsfile(mpsfile) if outt == None: outt = open(xml,'w') outt.write('<topology>\n') outt.write('\t<molecules>\n') # MOLECULE HEADER outt.write('\t<molecule>\n') outt.write('\t\t<name>%s</name>\n' % mol.name) outt.write('\t\t<mdname>%s</mdname>\n' % mol.name) outt.write('\t\t<segments>\n') # SEGMENT HEADER outt.write('\t\t<segment>\n') outt.write('\t\t\t<name>%s</name>\n' % mol.name) # XYZ FILE outt.write('\t\t\t<qmcoords>QC_FILES/%s.xyz</qmcoords>\n' % mol.name) # OPTIONAL PROPERTIES (WRITTEN IF SUPPLIED) orbital_keys = ['orbitals', 'basisset', 'torbital_h', 'torbital_e'] energy_keys = ['U_cC_nN_h', 'U_nC_nN_h', 'U_cN_cC_h', 'U_cC_nN_e', 'U_nC_nN_e', 'U_cN_cC_e'] for key in orbital_keys: if segment_properties.has_key(key): outt.write('\t\t\t<{key:s}>{val:s}</{key:s}>\n'.format(key=key, val=str(segment_properties[key]))) for key in energy_keys: if segment_properties.has_key(key): outt.write('\t\t\t<{key:s}>{val:s}</{key:s}>\n'.format(key=key, val=str(segment_properties[key]))) # MPS FILES outt.write('\t\t\t<multipoles_n>MP_FILES/%s_n.mps</multipoles_n>\n' % (mol.name)) outt.write('\t\t\t<multipoles_h>MP_FILES/%s_h.mps</multipoles_h>\n' % (mol.name)) outt.write('\t\t\t<multipoles_e>MP_FILES/%s_e.mps</multipoles_e>\n' % (mol.name)) outt.write('\t\t\t<map2md>%d</map2md>\n' % (0 if map2md == False else 1)) # FRAGMENTS outt.write('\t\t\t<fragments>\n') ctp_frag_count = 0 gro_atom_count = 0 xyz_atom_count = 0 mps_atom_count = 0 for ctp_frag_size, xyz_frag_size, mps_frag_size in zip(gropattern, xyzpattern, mpspattern): ctp_frag_count += 1 first_gro_atom_in_frag = mol.atoms[gro_atom_count] fragName = '%s%d' % (first_gro_atom_in_frag.fragName, ctp_frag_count) outt.write('\t\t\t<fragment>\n') outt.write('\t\t\t\t<name>%s</name>\n' % fragName) # MD-ATOMS, QM-ATOMS, M-POLES, WEIGHTS mdatoms = '' qmatoms = '' mpoles = '' weights = '' local_frame_str = '' local_frame_ids = [] ms = { 'H' : 1, 'C' : 12, 'N' : 14, 'O' : 16, 'S' : 32, 'Zn' : 65 } for i in range(ctp_frag_size): gro_atom_count += 1 atom = mol.atoms[gro_atom_count-1] mdatoms += ' %-11s ' % ('%d:%s:%s' % (atom.fragId, atom.fragName, atom.name)) if i < xyz_frag_size: xyz_atom_count += 1 id = xyz_atom_count typ = es[id-1] m = ms[typ] qmatoms += ' %-11s ' % ('%d:%s' % (id, typ)) weights += ' %-11s ' % ('%d' % m) if len(local_frame_ids) < 3 and typ != 'H': local_frame_ids.append(id) local_frame_str += ' %d ' % id else: qmatoms += ' %-11s ' % ':' weights += ' %-11s ' % '0' if i < mps_frag_size: mps_atom_count += 1 id = mps_atom_count typ = mps[id-1].e mpoles += ' %-11s ' % ('%d:%s' % (id, typ)) else: pass outt.write('\t\t\t\t<mdatoms>%s</mdatoms>\n' % mdatoms) outt.write('\t\t\t\t<qmatoms>%s</qmatoms>\n' % qmatoms) outt.write('\t\t\t\t<mpoles> %s</mpoles>\n' % mpoles) outt.write('\t\t\t\t<weights>%s</weights>\n' % weights) outt.write('\t\t\t\t<localframe>%s</localframe>\n' % local_frame_str) outt.write('\t\t\t</fragment>\n') # CLOSING TAGS outt.write('\t\t\t</fragments>\n') outt.write('\t\t</segment>\n') outt.write('\t\t</segments>\n') outt.write('\t</molecule>\n') if outt == None: outt.write('\t</molecules>\n') outt.write('</topology>\n') outt.close() return def TopItpFromXyzGro(xyzfile, grofile, molname): mols = SingleMoleculeFromGro(grofile) atoms = mols[0].atoms if xyzfile != None: elem,xyz = e_xyz_from_xyz(xyzfile) else: elem = [ atom.name[0:1] for atom in atoms ] xyz = [ np.array([0,0,0]) for i in range(len(atoms)) ] # Sanity checks assert len(atoms) == len(elem) == len(xyz) for atm,e in zip(atoms,elem): if atm.name[0:1] != e[0:1]: print "WARNING: Possible mismatch", atm.name, "<>", e os.system('mkdir -p FORCEFIELD') os.chdir('FORCEFIELD') # WRITE TOPOLOGY FILE HEADER ofs = open('%s.itp' % molname, 'w') ofs.write('[ moleculetype ]\n') ofs.write('; Name nrexcl\n') ofs.write('%s 3\n' % molname) ofs.write('\n') ofs.write('[ atoms ]\n') ofs.write('; nr type rsdnr rsd atom cgnr charge\n') # List of atoms in molecule for atm,e in zip(atoms,elem): ofs.write('{nr:5d} {typ:3s} {rsdnr:5d} {rsd:3s} {atom:3s} {cgnr:5d} {chrg:1.3f}\n'.format(\ nr=atm.Id, typ=e, rsdnr=atm.fragId, rsd=atm.fragName, atom=atm.name, cgnr=atm.fragId+1, chrg=0.0)) ofs.write('\n') # Potentials ofs.write('[ bonds ]\n') ofs.write('; ai aj funct c0 c1 c2 c3\n') ofs.write('\n') ofs.write('[ pairs ]\n') ofs.write('; ai aj funct c0 c1 c2 c3\n') ofs.write('\n') ## System #ofs.write('[ system ]\n') #ofs.write('%1s\n' % molname) # WRITE ITP HEADER # Collect types atps = [] for e in elem: if not PTABLE[e] in atps: atps.append(PTABLE[e]) ofs = open('%s_forcefield.itp' % molname, 'w') # Atom types ofs.write('[ atomtypes ]\n') ofs.write('; name mass charge ptype sigma eps\n') for atp in atps: ofs.write(' {name:2s} {mass:1.5f} +0.00 A 0.325 0.293\n'.format(\ name=atp, mass=PTABLE[e].mass)) ofs.close() # DEFAULT ITP ofs = open('default.itp', 'w') # Defaults ofs.write('[ defaults ]\n') ofs.write('; nbfunc comb-rule gen-pairs fudgeLJ fudgeQQ\n') ofs.write(' 1 3 yes 0.5 0.5\n') ofs.write('\n') ofs.close() os.chdir('../') # SYSTEM TOP ofs = open('system.top', 'w') ofs.write('; FORCEFIELD\n') ofs.write('#include "./FORCEFIELD/default.itp"\n') ofs.write('#include "./FORCEFIELD/%s_forcefield.itp"\n' % molname) ofs.write('\n') ofs.write('; MOLECULES\n') ofs.write('#include "./FORCEFIELD/%s.itp"\n' % molname) ofs.write('\n') ofs.write('[ system ]\n') ofs.write('%s\n' % molname) ofs.write('\n') ofs.write('[ molecules ]\n') ofs.write('%s 1\n' % molname) ofs.write('\n') ofs.close() return def ConvertToGhost(mol): # Atom name conversion rule # name = 'C' + name[0:1] + counter # Molecule name # name = 'G' + name # Fragment name # name = 'G' + name[0:2] series = '0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ' if mol.frags == []: mol.fragment() mol.make_dict() for frag in mol.frags: assert len(frag.atoms) <= len(series) for frag in mol.frags: counter = 0 frag.name = 'C' + frag.name[0:2] for atom in frag.atoms: atom.name = 'C%s%s' % (atom.name[0:1], series[counter]) atom.fragName = 'G' + atom.fragName[0:2] counter += 1 mol.name = 'G' + mol.name return mol def GhostTopItpFromXyzGro(xyzfile, grofile, molname): mols = SingleMoleculeFromGro(grofile) atoms = mols[0].atoms elem,xyz = e_xyz_from_xyz(xyzfile) # Sanity checks assert len(atoms) == len(elem) == len(xyz) for atm,e in zip(atoms,elem): if atm.name[0:1] != e[0:1]: print "WARNING: Possible mismatch", atm.name, "<>", e # Convert to ghost mol = ConvertToGhost(mols[0]) atoms = mol.atoms elem = [ 'C' for i in range(len(atoms)) ] mol.write_gro(molname+'.gro') # Write ghost xyz e_xyz_to_xyz(elem, xyz, molname + '.xyz') os.system('mkdir -p FORCEFIELD') os.chdir('FORCEFIELD') # WRITE TOPOLOGY FILE HEADER ofs = open('%s.itp' % molname, 'w') ofs.write('[ moleculetype ]\n') ofs.write('; Name nrexcl\n') ofs.write('%s 3\n' % molname) ofs.write('\n') ofs.write('[ atoms ]\n') ofs.write('; nr type rsdnr rsd atom cgnr charge\n') # List of atoms in molecule for atm,e in zip(atoms,elem): ofs.write('{nr:5d} {typ:3s} {rsdnr:5d} {rsd:3s} {atom:3s} {cgnr:5d} {chrg:1.3f}\n'.format(\ nr=atm.Id, typ=e, rsdnr=atm.fragId, rsd=atm.fragName, atom=atm.name, cgnr=atm.fragId+1, chrg=0.0)) ofs.write('\n') # Potentials ofs.write('[ bonds ]\n') ofs.write('; ai aj funct c0 c1 c2 c3\n') ofs.write('\n') ofs.write('[ pairs ]\n') ofs.write('; ai aj funct c0 c1 c2 c3\n') ofs.write('\n') ## System #ofs.write('[ system ]\n') #ofs.write('%1s\n' % molname) # WRITE ITP HEADER # Collect types atps = [] for e in elem: if not PTABLE[e] in atps: atps.append(PTABLE[e]) ofs = open('%s_forcefield.itp' % molname, 'w') # Atom types ofs.write('[ atomtypes ]\n') ofs.write('; name mass charge ptype sigma eps\n') for atp in atps: ofs.write(' {name:2s} {mass:1.5f} +0.00 A 0.325 0.293\n'.format(\ name=atp, mass=PTABLE[e].mass)) ofs.close() # DEFAULT ITP ofs = open('default.itp', 'w') # Defaults ofs.write('[ defaults ]\n') ofs.write('; nbfunc comb-rule gen-pairs fudgeLJ fudgeQQ\n') ofs.write(' 1 3 yes 0.5 0.5\n') ofs.write('\n') ofs.close() os.chdir('../') # SYSTEM TOP ofs = open('system.top', 'w') ofs.write('; FORCEFIELD\n') ofs.write('#include "./FORCEFIELD/default.itp"\n') ofs.write('#include "./FORCEFIELD/%s_forcefield.itp"\n' % molname) ofs.write('\n') ofs.write('; MOLECULES\n') ofs.write('#include "./FORCEFIELD/%s.itp"\n' % molname) ofs.write('\n') ofs.write('[ system ]\n') ofs.write('%s\n' % molname) ofs.write('\n') ofs.write('[ molecules ]\n') ofs.write('%s 1\n' % molname) ofs.write('\n') ofs.close() return def ctp_map_auto(sql='state.sql', xml='system.xml', md_files='MD_FILES'): abort = False ext_dict = dict_by_ext(md_files) # MD COORDINATE + TOPOLOGY FILE tpr = ext_dict['tpr'] try: gro = ext_dict['gro'] except KeyError: gro = ext_dict['pdb'] except KeyError: print "No coordinate file in", os.getcwd(), md_files abort = True # DATABASE + MAPPING FILE if sql in os.listdir('./'): print "ERROR SQL-file '%s' already exists, will abort." % sql abort = True if not xml in os.listdir('./'): print "ERROR XML-file '%s' missing, will abort." % xml abort = True # EXECUTE opts = '-c %s -t %s -s %s -f %s' % (gro, tpr, xml, sql) print 'ctp_map %s' % (opts) if abort: sys.exit(1) os.system('ctp_map %s' % opts) return def ctp_run_auto(exe, xml='options.xml', sql='state.sql', save=0, threads=1): abort = False # RUN THROUGH CHECKLIST if not xml in os.listdir('./'): print "ERROR Options file '%s' missing, will abort." % xml abort = True if not sql in os.listdir('./'): print "ERROR Sql file '%s' missing, will abort." % sql abort = True # EXECUTE opts = '-e "%s" -o %s -f %s -s %d -t %d' % (exe,xml,sql,save,threads) print 'ctp_run %s' % (opts) if abort: sys.exit(1) os.system('ctp_run %s' % opts) return def write_xqmp_options(jobfile): ofs = open('options.xml','w') ofs.write('''<options> <xqmultipole> <multipoles>system.xml</multipoles> <!-- XML allocation polar sites -> fragment --> <control> ''') ofs.write(' <job_file>%s</job_file>\n' % jobfile) ofs.write(''' <emp_file>mps.tab</emp_file> <!-- Allocation of .mps files to segs; for template, run 'stateserver' with key = 'emp' --> <pdb_check>0</pdb_check> <!-- Output - Check mapping of polar sites --> <!--write_chk></write_chk--> <!-- Write x y z charge file with dipoles split onto point charges spaced 1fm apart --> <format_chk>xyz</format_chk> <!-- 'gaussian' or 'xyz' --> <split_dpl>1</split_dpl> <!-- '0' do not split dipoles onto point charges, '1' do split --> <dpl_spacing>1e-4</dpl_spacing> <!-- Spacing a [nm] to be used when splitting dipole onto point charges: d = q * a --> </control> <coulombmethod> <method>cut-off</method> <cutoff1>3.0</cutoff1> <cutoff2>6.0</cutoff2> </coulombmethod> <tholemodel> <induce>1</induce> <induce_intra_pair>1</induce_intra_pair> <exp_damp>0.39</exp_damp> <scaling>0.25 0.50 0.75</scaling> </tholemodel> <convergence> <wSOR_N>0.30</wSOR_N> <wSOR_C>0.30</wSOR_C> <max_iter>512</max_iter> <tolerance>0.001</tolerance> </convergence> </xqmultipole> </options> ''') ofs.close() return def write_ewald_options(jobfile): ofs = open('options.xml','w') ofs.write('''<options> <ewald> <multipoles>system.xml</multipoles> <!-- XML allocation polar sites -> fragment --> <control> ''') ofs.write(' <job_file>%s</job_file>\n' % jobfile) ofs.write(''' <mps_table>mps.tab</mps_table> <!-- Allocation of .mps files to segs; for template, run 'stateserver' with key = 'emp' --> <pdb_check>0</pdb_check> <!-- Output - Check mapping of polar sites --> </control> <coulombmethod> <method>ewald</method> <cutoff>12.0</cutoff> <shape>xyslab</shape> </coulombmethod> <polarmethod> <method>thole</method> <induce>1</induce> <cutoff>3.0</cutoff> </polarmethod> <convergence> <energy>1e-5</energy> <kfactor>100</kfactor> <rfactor>6.0</rfactor> <kmetric>1 1 1</kmetric> </convergence> </ewald> </options> ''') ofs.close() return class Batch(object): def __init__(self, xmlfile = None): self.jobs = [] if xmlfile != None: tree = xml.parse(xmlfile) for node in tree.getElementsByTagName('job'): self.jobs.append(Job(node=node)) return def AddJob(self, jobTag, jobInput): jobId = len(self.jobs)+1 newJob = Job(jobId,jobTag,jobInput) self.jobs.append(newJob) return def WriteToFile(self, outFile = 'jobs.xml'): if outFile in os.listdir('./'): print "Already exists:", os.getcwd(), outFile sys.exit(1) outt = open(outFile,'w') outt.write('<jobs>\n') for job in self.jobs: job.WriteToStream(outt) outt.write('</jobs>\n') outt.close() return def ProcessAsEwaldSiteJobs(self, states=['n','e','h']): segID_state_dict = {} for job in self.jobs: jobID = int(job.id_) tag = job.tag_.split(':') out = job.output_.split() stat = job.status_ segID = int(tag[0]) segName = tag[1] state = tag[2] #x = float(out[35]) #y = float(out[36]) #z = float(out[37]) pos = np.array([0,0,0]) pp = float(out[3]) if state not in states: continue jobResult = JobResultXqm(jobID, segID, segName, state, pos, 0, pp, 0) try: segID_state_dict[segID][state] = jobResult except KeyError: segID_state_dict[segID] = {} segID_state_dict[segID][state] = jobResult # SUBTRACT ENERGIES TO OBTAIN IP, EA assert 'n' in states chrgStates = states[:] chrgStates.remove('n') ips_eas = { 'e' : [], 'h' : [] } keyIDs = segID_state_dict.keys() keyIDs.sort() for ID in keyIDs: for state in chrgStates: n = segID_state_dict[ID]['n'] c = segID_state_dict[ID][state] cn = n.SubtractFrom(c) ips_eas[state].append(cn) #n.PrintInfo() #c.PrintInfo() #cn.PrintInfo() return ips_eas def ProcessAsXqmSiteJobs(self, states=['n','e','h']): # OUTPUT STRUCTURE # 0 1 2 3 4 5 6 7 # 1 1:C60:n TT +0.0000000 PP +0.0000000 PU +0.0000000 # # 8 9 10 11 12 13 14 15 # UU +0.0000000 F00 +0.0000000 F01 +0.0000000 F02 +0.0000000 # # 16 17 18 19 20 21 22 23 # F11 +0.0000000 F12 +0.0000000 M0 +0.0000000 M1 +0.0000000 # # 24 25 26 27 28 29 30 31 32 33 # M2 +0.0000000 |QM0| 1 |MM1| 30 |MM2| 90 IT 0 # # 34 35 36 37 # XYZ +4.5579834 +1.0736500 +0.3511333 # # ASSEMBLE INTO DICTIONARY segID_state_dict = {} for job in self.jobs: jobID = int(job.id_) tag = job.tag_.split(':') out = job.output_.split() stat = job.status_ segID = int(tag[0]) segName = tag[1] state = tag[2] x = float(out[35]) y = float(out[36]) z = float(out[37]) pos = np.array([x,y,z]) tt = float(out[3]) pp = float(out[5]) pu = float(out[7]) if state not in states: continue jobResult = JobResultXqm(jobID, segID, segName, state, pos, tt, pp, pu) try: segID_state_dict[segID][state] = jobResult except KeyError: segID_state_dict[segID] = {} segID_state_dict[segID][state] = jobResult # SUBTRACT ENERGIES TO OBTAIN IP, EA assert 'n' in states chrgStates = states[:] chrgStates.remove('n') ips_eas = { 'e' : [], 'h' : [] } keyIDs = segID_state_dict.keys() keyIDs.sort() for ID in keyIDs: for state in chrgStates: n = segID_state_dict[ID]['n'] c = segID_state_dict[ID][state] cn = n.SubtractFrom(c) ips_eas[state].append(cn) #n.PrintInfo() #c.PrintInfo() #cn.PrintInfo() return ips_eas class JobResultXqm(object): def __init__(self, jobID, segID, segName, state, pos, tt, pp, pu): self.jobID = jobID self.segID = segID self.segName = segName self.state = state self.pos = pos self.tt = tt self.pp = pp self.pu = pu return def PrintInfo(self): print "ID %5d %5d %-10s %-2s XYZ %+1.7e %+1.7e %+1.7e TT %+1.7e PP %+1.7e PU %+1.7e" % \ (self.jobID, self.segID, self.segName, self.state, self.pos[0], self.pos[1], self.pos[2], self.tt, self.pp, self.pu) return def SubtractFrom(self, other): assert other.segID == self.segID assert other.segName == self.segName if self.state == 'n': assert other.state in ['e','h'] elif self.state in ['e','h']: assert self.state == 'n' else: assert False # State combination other than 'n' <> ['e','h']? Error. dtt = other.tt - self.tt dpp = other.pp - self.pp dpu = other.pu - self.pu dstate = '%s%s' % (other.state,self.state) return JobResultXqm(0, self.segID, self.segName, dstate, self.pos, dtt, dpp, dpu) class JobResultEwald(object): def __init__(self, jobID, segID, segName, state, pos, pp): self.jobID = jobID self.segID = segID self.segName = segName self.state = state self.pos = pos self.pp = pp class Job(object): def __init__(self, id_ = None, tag_ = None, input_ = None, node = None): self.id_ = id_ self.tag_ = tag_ self.input_ = input_ self.status_ = 'AVAILABLE' self.time_ = None self.host_ = None self.output_ = None self.error_ = None self.node_ = node if node != None: self.LoadFromXmlNode(node) return def LoadFromXmlNode(self, node): self.id_ = node.getElementsByTagName('id')[0].firstChild.nodeValue self.tag_ = node.getElementsByTagName('tag')[0].firstChild.nodeValue self.input_ = node.getElementsByTagName('input')[0].firstChild.nodeValue status = node.getElementsByTagName('status') if status == []: self.status_ = 'AVAILABLE' else: self.status_ = status[0].firstChild.nodeValue time = node.getElementsByTagName('time') if time == []: self.time_ = None else: self.time_ = time[0].firstChild.nodeValue host = node.getElementsByTagName('host') if host == []: self.host_ = None else: self.host_ = host[0].firstChild.nodeValue output = node.getElementsByTagName('output') if output == []: self.output_ = None else: self.output_ = output[0].firstChild.nodeValue error = node.getElementsByTagName('error') if error == []: self.error_ = None else: if self.status_ == 'COMPLETE': try: self.error_ = error[0].firstChild.nodeValue print "Has error", self.id_, self.tag_, self.input_, ":", self.error_ except AttributeError: #print "Has error", self.id_, self.tag_, self.input_, ", yet complete." pass return def WriteToStream(self, ofs): # TODO Extend this function to incorporate output, timestamp, ... ofs.write('<job>\n') ofs.write('\t<id>%d</id>\n' % self.id_) ofs.write('\t<tag>%s</tag>\n' % self.tag_) ofs.write('\t<input>%s</input>\n' % self.input_) ofs.write('</job>\n') return def jobs_from_pop(pop, includeList = None, states = ['n','e','h']): # INCLUDE LIST checkInclude = True # GENERATE BATCH batch = Batch() if includeList == None: checkInclude = False for mol in pop.mols: if checkInclude and mol.Id not in includeList: continue for state in states: jobTag = '%d:%s:%s' % (mol.Id,mol.name,state) jobInput = '%d:%s:MP_FILES/%s_%s.mps' % (mol.Id,mol.name,mol.name,state) batch.AddJob(jobTag,jobInput) else: for idx in includeList: mol = pop.mols[idx-1] assert idx == mol.Id for state in states: jobTag = '%d:%s:%s' % (mol.Id,mol.name,state) jobInput = '%d:%s:MP_FILES/%s_%s.mps' % (mol.Id,mol.name,mol.name,state) batch.AddJob(jobTag,jobInput) return batch
12AngryMen/votca-scripts
lib/Carlstuff/evaporation/__votca_ctp__.py
Python
apache-2.0
23,221
[ "Gaussian" ]
52b91164c7c466df916cf53ee1f549e982f6ef7a8cde3acae2622c5e9469d6c3
#!/usr/bin/env python # -*- coding: utf-8 -*- # This file is part of the SPORCO package. Details of the copyright # and user license can be found in the 'LICENSE.txt' file distributed # with the package. """ Greyscale ℓ2-TV Denoising ========================= This example demonstrates the use of class :class:`.tvl2.TVL2Denoise` for removing Gaussian white noise from a greyscale image using Total Variation regularization with an ℓ2 data fidelity term (ℓ2-TV denoising). """ from __future__ import print_function from builtins import input import numpy as np from sporco.admm import tvl2 from sporco import util from sporco import metric from sporco import plot """ Load reference image. """ img = util.ExampleImages().image('monarch.png', scaled=True, idxexp=np.s_[:,160:672], gray=True) """ Construct test image corrupted by Gaussian white noise with a 0.05 standard deviation. """ np.random.seed(12345) imgn = img + np.random.normal(0.0, 0.05, img.shape) """ Set regularization parameter and options for ℓ2-TV denoising solver. The regularization parameter used here has been manually selected for good performance. """ lmbda = 0.04 opt = tvl2.TVL2Denoise.Options({'Verbose': True, 'MaxMainIter': 200, 'gEvalY': False, 'AutoRho': {'Enabled': True}}) """ Create solver object and solve, returning the the denoised image ``imgr``. """ b = tvl2.TVL2Denoise(imgn, lmbda, opt) imgr = b.solve() """ Display solve time and denoising performance. """ print("TVL2Denoise solve time: %5.2f s" % b.timer.elapsed('solve')) print("Noisy image PSNR: %5.2f dB" % metric.psnr(img, imgn)) print("Denoised image PSNR: %5.2f dB" % metric.psnr(img, imgr)) """ Display reference, corrupted, and denoised images. """ fig = plot.figure(figsize=(20, 5)) plot.subplot(1, 3, 1) plot.imview(img, title='Reference', fig=fig) plot.subplot(1, 3, 2) plot.imview(imgn, title='Corrupted', fig=fig) plot.subplot(1, 3, 3) plot.imview(imgr, title=r'Restored ($\ell_2$-TV)', fig=fig) fig.show() """ Get iterations statistics from solver object and plot functional value, ADMM primary and dual residuals, and automatically adjusted ADMM penalty parameter against the iteration number. """ its = b.getitstat() fig = plot.figure(figsize=(20, 5)) plot.subplot(1, 3, 1) plot.plot(its.ObjFun, xlbl='Iterations', ylbl='Functional', fig=fig) plot.subplot(1, 3, 2) plot.plot(np.vstack((its.PrimalRsdl, its.DualRsdl)).T, ptyp='semilogy', xlbl='Iterations', ylbl='Residual', lgnd=['Primal', 'Dual'], fig=fig) plot.subplot(1, 3, 3) plot.plot(its.Rho, xlbl='Iterations', ylbl='Penalty Parameter', fig=fig) fig.show() # Wait for enter on keyboard input()
bwohlberg/sporco
examples/scripts/tv/tvl2den_gry.py
Python
bsd-3-clause
2,718
[ "Gaussian" ]
dd5f2ea877bcf4bcd0a9b9935b105fec3713ba3fc6f2a7ffe73e870ee7d4b81b
""" ======================================== Special functions (:mod:`scipy.special`) ======================================== .. currentmodule:: scipy.special Nearly all of the functions below are universal functions and follow broadcasting and automatic array-looping rules. .. seealso:: `scipy.special.cython_special` -- Typed Cython versions of special functions Error handling ============== Errors are handled by returning NaNs or other appropriate values. Some of the special function routines can emit warnings or raise exceptions when an error occurs. By default this is disabled; to query and control the current error handling state the following functions are provided. .. autosummary:: :toctree: generated/ geterr -- Get the current way of handling special-function errors. seterr -- Set how special-function errors are handled. errstate -- Context manager for special-function error handling. SpecialFunctionWarning -- Warning that can be emitted by special functions. SpecialFunctionError -- Exception that can be raised by special functions. Available functions =================== Airy functions -------------- .. autosummary:: :toctree: generated/ airy -- Airy functions and their derivatives. airye -- Exponentially scaled Airy functions and their derivatives. ai_zeros -- Compute `nt` zeros and values of the Airy function Ai and its derivative. bi_zeros -- Compute `nt` zeros and values of the Airy function Bi and its derivative. itairy -- Integrals of Airy functions Elliptic Functions and Integrals -------------------------------- .. autosummary:: :toctree: generated/ ellipj -- Jacobian elliptic functions ellipk -- Complete elliptic integral of the first kind. ellipkm1 -- Complete elliptic integral of the first kind around `m` = 1 ellipkinc -- Incomplete elliptic integral of the first kind ellipe -- Complete elliptic integral of the second kind ellipeinc -- Incomplete elliptic integral of the second kind Bessel Functions ---------------- .. autosummary:: :toctree: generated/ jv -- Bessel function of the first kind of real order and complex argument. jve -- Exponentially scaled Bessel function of order `v`. yn -- Bessel function of the second kind of integer order and real argument. yv -- Bessel function of the second kind of real order and complex argument. yve -- Exponentially scaled Bessel function of the second kind of real order. kn -- Modified Bessel function of the second kind of integer order `n` kv -- Modified Bessel function of the second kind of real order `v` kve -- Exponentially scaled modified Bessel function of the second kind. iv -- Modified Bessel function of the first kind of real order. ive -- Exponentially scaled modified Bessel function of the first kind hankel1 -- Hankel function of the first kind hankel1e -- Exponentially scaled Hankel function of the first kind hankel2 -- Hankel function of the second kind hankel2e -- Exponentially scaled Hankel function of the second kind The following is not an universal function: .. autosummary:: :toctree: generated/ lmbda -- Jahnke-Emden Lambda function, Lambdav(x). Zeros of Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^^ These are not universal functions: .. autosummary:: :toctree: generated/ jnjnp_zeros -- Compute zeros of integer-order Bessel functions Jn and Jn'. jnyn_zeros -- Compute nt zeros of Bessel functions Jn(x), Jn'(x), Yn(x), and Yn'(x). jn_zeros -- Compute zeros of integer-order Bessel function Jn(x). jnp_zeros -- Compute zeros of integer-order Bessel function derivative Jn'(x). yn_zeros -- Compute zeros of integer-order Bessel function Yn(x). ynp_zeros -- Compute zeros of integer-order Bessel function derivative Yn'(x). y0_zeros -- Compute nt zeros of Bessel function Y0(z), and derivative at each zero. y1_zeros -- Compute nt zeros of Bessel function Y1(z), and derivative at each zero. y1p_zeros -- Compute nt zeros of Bessel derivative Y1'(z), and value at each zero. Faster versions of common Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ .. autosummary:: :toctree: generated/ j0 -- Bessel function of the first kind of order 0. j1 -- Bessel function of the first kind of order 1. y0 -- Bessel function of the second kind of order 0. y1 -- Bessel function of the second kind of order 1. i0 -- Modified Bessel function of order 0. i0e -- Exponentially scaled modified Bessel function of order 0. i1 -- Modified Bessel function of order 1. i1e -- Exponentially scaled modified Bessel function of order 1. k0 -- Modified Bessel function of the second kind of order 0, :math:`K_0`. k0e -- Exponentially scaled modified Bessel function K of order 0 k1 -- Modified Bessel function of the second kind of order 1, :math:`K_1(x)`. k1e -- Exponentially scaled modified Bessel function K of order 1 Integrals of Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ .. autosummary:: :toctree: generated/ itj0y0 -- Integrals of Bessel functions of order 0 it2j0y0 -- Integrals related to Bessel functions of order 0 iti0k0 -- Integrals of modified Bessel functions of order 0 it2i0k0 -- Integrals related to modified Bessel functions of order 0 besselpoly -- Weighted integral of a Bessel function. Derivatives of Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ .. autosummary:: :toctree: generated/ jvp -- Compute nth derivative of Bessel function Jv(z) with respect to `z`. yvp -- Compute nth derivative of Bessel function Yv(z) with respect to `z`. kvp -- Compute nth derivative of real-order modified Bessel function Kv(z) ivp -- Compute nth derivative of modified Bessel function Iv(z) with respect to `z`. h1vp -- Compute nth derivative of Hankel function H1v(z) with respect to `z`. h2vp -- Compute nth derivative of Hankel function H2v(z) with respect to `z`. Spherical Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^^^ .. autosummary:: :toctree: generated/ spherical_jn -- Spherical Bessel function of the first kind or its derivative. spherical_yn -- Spherical Bessel function of the second kind or its derivative. spherical_in -- Modified spherical Bessel function of the first kind or its derivative. spherical_kn -- Modified spherical Bessel function of the second kind or its derivative. Riccati-Bessel Functions ^^^^^^^^^^^^^^^^^^^^^^^^ These are not universal functions: .. autosummary:: :toctree: generated/ riccati_jn -- Compute Ricatti-Bessel function of the first kind and its derivative. riccati_yn -- Compute Ricatti-Bessel function of the second kind and its derivative. Struve Functions ---------------- .. autosummary:: :toctree: generated/ struve -- Struve function. modstruve -- Modified Struve function. itstruve0 -- Integral of the Struve function of order 0. it2struve0 -- Integral related to the Struve function of order 0. itmodstruve0 -- Integral of the modified Struve function of order 0. Raw Statistical Functions ------------------------- .. seealso:: :mod:`scipy.stats`: Friendly versions of these functions. .. autosummary:: :toctree: generated/ bdtr -- Binomial distribution cumulative distribution function. bdtrc -- Binomial distribution survival function. bdtri -- Inverse function to `bdtr` with respect to `p`. bdtrik -- Inverse function to `bdtr` with respect to `k`. bdtrin -- Inverse function to `bdtr` with respect to `n`. btdtr -- Cumulative distribution function of the beta distribution. btdtri -- The `p`-th quantile of the beta distribution. btdtria -- Inverse of `btdtr` with respect to `a`. btdtrib -- btdtria(a, p, x) fdtr -- F cumulative distribution function. fdtrc -- F survival function. fdtri -- The `p`-th quantile of the F-distribution. fdtridfd -- Inverse to `fdtr` vs dfd gdtr -- Gamma distribution cumulative distribution function. gdtrc -- Gamma distribution survival function. gdtria -- Inverse of `gdtr` vs a. gdtrib -- Inverse of `gdtr` vs b. gdtrix -- Inverse of `gdtr` vs x. nbdtr -- Negative binomial cumulative distribution function. nbdtrc -- Negative binomial survival function. nbdtri -- Inverse of `nbdtr` vs `p`. nbdtrik -- Inverse of `nbdtr` vs `k`. nbdtrin -- Inverse of `nbdtr` vs `n`. ncfdtr -- Cumulative distribution function of the non-central F distribution. ncfdtridfd -- Calculate degrees of freedom (denominator) for the noncentral F-distribution. ncfdtridfn -- Calculate degrees of freedom (numerator) for the noncentral F-distribution. ncfdtri -- Inverse cumulative distribution function of the non-central F distribution. ncfdtrinc -- Calculate non-centrality parameter for non-central F distribution. nctdtr -- Cumulative distribution function of the non-central `t` distribution. nctdtridf -- Calculate degrees of freedom for non-central t distribution. nctdtrit -- Inverse cumulative distribution function of the non-central t distribution. nctdtrinc -- Calculate non-centrality parameter for non-central t distribution. nrdtrimn -- Calculate mean of normal distribution given other params. nrdtrisd -- Calculate standard deviation of normal distribution given other params. pdtr -- Poisson cumulative distribution function pdtrc -- Poisson survival function pdtri -- Inverse to `pdtr` vs m pdtrik -- Inverse to `pdtr` vs k stdtr -- Student t distribution cumulative distribution function stdtridf -- Inverse of `stdtr` vs df stdtrit -- Inverse of `stdtr` vs `t` chdtr -- Chi square cumulative distribution function chdtrc -- Chi square survival function chdtri -- Inverse to `chdtrc` chdtriv -- Inverse to `chdtr` vs `v` ndtr -- Gaussian cumulative distribution function. log_ndtr -- Logarithm of Gaussian cumulative distribution function. ndtri -- Inverse of `ndtr` vs x chndtr -- Non-central chi square cumulative distribution function chndtridf -- Inverse to `chndtr` vs `df` chndtrinc -- Inverse to `chndtr` vs `nc` chndtrix -- Inverse to `chndtr` vs `x` smirnov -- Kolmogorov-Smirnov complementary cumulative distribution function smirnovi -- Inverse to `smirnov` kolmogorov -- Complementary cumulative distribution function of Kolmogorov distribution kolmogi -- Inverse function to `kolmogorov` tklmbda -- Tukey-Lambda cumulative distribution function logit -- Logit ufunc for ndarrays. expit -- Expit ufunc for ndarrays. boxcox -- Compute the Box-Cox transformation. boxcox1p -- Compute the Box-Cox transformation of 1 + `x`. inv_boxcox -- Compute the inverse of the Box-Cox transformation. inv_boxcox1p -- Compute the inverse of the Box-Cox transformation. owens_t -- Owen's T Function. Information Theory Functions ---------------------------- .. autosummary:: :toctree: generated/ entr -- Elementwise function for computing entropy. rel_entr -- Elementwise function for computing relative entropy. kl_div -- Elementwise function for computing Kullback-Leibler divergence. huber -- Huber loss function. pseudo_huber -- Pseudo-Huber loss function. Gamma and Related Functions --------------------------- .. autosummary:: :toctree: generated/ gamma -- Gamma function. gammaln -- Logarithm of the absolute value of the Gamma function for real inputs. loggamma -- Principal branch of the logarithm of the Gamma function. gammasgn -- Sign of the gamma function. gammainc -- Regularized lower incomplete gamma function. gammaincinv -- Inverse to `gammainc` gammaincc -- Regularized upper incomplete gamma function. gammainccinv -- Inverse to `gammaincc` beta -- Beta function. betaln -- Natural logarithm of absolute value of beta function. betainc -- Incomplete beta integral. betaincinv -- Inverse function to beta integral. psi -- The digamma function. rgamma -- Gamma function inverted polygamma -- Polygamma function n. multigammaln -- Returns the log of multivariate gamma, also sometimes called the generalized gamma. digamma -- psi(x[, out]) poch -- Rising factorial (z)_m Error Function and Fresnel Integrals ------------------------------------ .. autosummary:: :toctree: generated/ erf -- Returns the error function of complex argument. erfc -- Complementary error function, ``1 - erf(x)``. erfcx -- Scaled complementary error function, ``exp(x**2) * erfc(x)``. erfi -- Imaginary error function, ``-i erf(i z)``. erfinv -- Inverse function for erf. erfcinv -- Inverse function for erfc. wofz -- Faddeeva function dawsn -- Dawson's integral. fresnel -- Fresnel sin and cos integrals fresnel_zeros -- Compute nt complex zeros of sine and cosine Fresnel integrals S(z) and C(z). modfresnelp -- Modified Fresnel positive integrals modfresnelm -- Modified Fresnel negative integrals voigt -- Voigt profile. These are not universal functions: .. autosummary:: :toctree: generated/ erf_zeros -- Compute nt complex zeros of error function erf(z). fresnelc_zeros -- Compute nt complex zeros of cosine Fresnel integral C(z). fresnels_zeros -- Compute nt complex zeros of sine Fresnel integral S(z). Legendre Functions ------------------ .. autosummary:: :toctree: generated/ lpmv -- Associated Legendre function of integer order and real degree. sph_harm -- Compute spherical harmonics. These are not universal functions: .. autosummary:: :toctree: generated/ clpmn -- Associated Legendre function of the first kind for complex arguments. lpn -- Legendre function of the first kind. lqn -- Legendre function of the second kind. lpmn -- Sequence of associated Legendre functions of the first kind. lqmn -- Sequence of associated Legendre functions of the second kind. Ellipsoidal Harmonics --------------------- .. autosummary:: :toctree: generated/ ellip_harm -- Ellipsoidal harmonic functions E^p_n(l) ellip_harm_2 -- Ellipsoidal harmonic functions F^p_n(l) ellip_normal -- Ellipsoidal harmonic normalization constants gamma^p_n Orthogonal polynomials ---------------------- The following functions evaluate values of orthogonal polynomials: .. autosummary:: :toctree: generated/ assoc_laguerre -- Compute the generalized (associated) Laguerre polynomial of degree n and order k. eval_legendre -- Evaluate Legendre polynomial at a point. eval_chebyt -- Evaluate Chebyshev polynomial of the first kind at a point. eval_chebyu -- Evaluate Chebyshev polynomial of the second kind at a point. eval_chebyc -- Evaluate Chebyshev polynomial of the first kind on [-2, 2] at a point. eval_chebys -- Evaluate Chebyshev polynomial of the second kind on [-2, 2] at a point. eval_jacobi -- Evaluate Jacobi polynomial at a point. eval_laguerre -- Evaluate Laguerre polynomial at a point. eval_genlaguerre -- Evaluate generalized Laguerre polynomial at a point. eval_hermite -- Evaluate physicist's Hermite polynomial at a point. eval_hermitenorm -- Evaluate probabilist's (normalized) Hermite polynomial at a point. eval_gegenbauer -- Evaluate Gegenbauer polynomial at a point. eval_sh_legendre -- Evaluate shifted Legendre polynomial at a point. eval_sh_chebyt -- Evaluate shifted Chebyshev polynomial of the first kind at a point. eval_sh_chebyu -- Evaluate shifted Chebyshev polynomial of the second kind at a point. eval_sh_jacobi -- Evaluate shifted Jacobi polynomial at a point. The following functions compute roots and quadrature weights for orthogonal polynomials: .. autosummary:: :toctree: generated/ roots_legendre -- Gauss-Legendre quadrature. roots_chebyt -- Gauss-Chebyshev (first kind) quadrature. roots_chebyu -- Gauss-Chebyshev (second kind) quadrature. roots_chebyc -- Gauss-Chebyshev (first kind) quadrature. roots_chebys -- Gauss-Chebyshev (second kind) quadrature. roots_jacobi -- Gauss-Jacobi quadrature. roots_laguerre -- Gauss-Laguerre quadrature. roots_genlaguerre -- Gauss-generalized Laguerre quadrature. roots_hermite -- Gauss-Hermite (physicst's) quadrature. roots_hermitenorm -- Gauss-Hermite (statistician's) quadrature. roots_gegenbauer -- Gauss-Gegenbauer quadrature. roots_sh_legendre -- Gauss-Legendre (shifted) quadrature. roots_sh_chebyt -- Gauss-Chebyshev (first kind, shifted) quadrature. roots_sh_chebyu -- Gauss-Chebyshev (second kind, shifted) quadrature. roots_sh_jacobi -- Gauss-Jacobi (shifted) quadrature. The functions below, in turn, return the polynomial coefficients in ``orthopoly1d`` objects, which function similarly as `numpy.poly1d`. The ``orthopoly1d`` class also has an attribute ``weights`` which returns the roots, weights, and total weights for the appropriate form of Gaussian quadrature. These are returned in an ``n x 3`` array with roots in the first column, weights in the second column, and total weights in the final column. Note that ``orthopoly1d`` objects are converted to `~numpy.poly1d` when doing arithmetic, and lose information of the original orthogonal polynomial. .. autosummary:: :toctree: generated/ legendre -- Legendre polynomial. chebyt -- Chebyshev polynomial of the first kind. chebyu -- Chebyshev polynomial of the second kind. chebyc -- Chebyshev polynomial of the first kind on :math:`[-2, 2]`. chebys -- Chebyshev polynomial of the second kind on :math:`[-2, 2]`. jacobi -- Jacobi polynomial. laguerre -- Laguerre polynomial. genlaguerre -- Generalized (associated) Laguerre polynomial. hermite -- Physicist's Hermite polynomial. hermitenorm -- Normalized (probabilist's) Hermite polynomial. gegenbauer -- Gegenbauer (ultraspherical) polynomial. sh_legendre -- Shifted Legendre polynomial. sh_chebyt -- Shifted Chebyshev polynomial of the first kind. sh_chebyu -- Shifted Chebyshev polynomial of the second kind. sh_jacobi -- Shifted Jacobi polynomial. .. warning:: Computing values of high-order polynomials (around ``order > 20``) using polynomial coefficients is numerically unstable. To evaluate polynomial values, the ``eval_*`` functions should be used instead. Hypergeometric Functions ------------------------ .. autosummary:: :toctree: generated/ hyp2f1 -- Gauss hypergeometric function 2F1(a, b; c; z). hyp1f1 -- Confluent hypergeometric function 1F1(a, b; x) hyperu -- Confluent hypergeometric function U(a, b, x) of the second kind hyp0f1 -- Confluent hypergeometric limit function 0F1. Parabolic Cylinder Functions ---------------------------- .. autosummary:: :toctree: generated/ pbdv -- Parabolic cylinder function D pbvv -- Parabolic cylinder function V pbwa -- Parabolic cylinder function W These are not universal functions: .. autosummary:: :toctree: generated/ pbdv_seq -- Parabolic cylinder functions Dv(x) and derivatives. pbvv_seq -- Parabolic cylinder functions Vv(x) and derivatives. pbdn_seq -- Parabolic cylinder functions Dn(z) and derivatives. Mathieu and Related Functions ----------------------------- .. autosummary:: :toctree: generated/ mathieu_a -- Characteristic value of even Mathieu functions mathieu_b -- Characteristic value of odd Mathieu functions These are not universal functions: .. autosummary:: :toctree: generated/ mathieu_even_coef -- Fourier coefficients for even Mathieu and modified Mathieu functions. mathieu_odd_coef -- Fourier coefficients for even Mathieu and modified Mathieu functions. The following return both function and first derivative: .. autosummary:: :toctree: generated/ mathieu_cem -- Even Mathieu function and its derivative mathieu_sem -- Odd Mathieu function and its derivative mathieu_modcem1 -- Even modified Mathieu function of the first kind and its derivative mathieu_modcem2 -- Even modified Mathieu function of the second kind and its derivative mathieu_modsem1 -- Odd modified Mathieu function of the first kind and its derivative mathieu_modsem2 -- Odd modified Mathieu function of the second kind and its derivative Spheroidal Wave Functions ------------------------- .. autosummary:: :toctree: generated/ pro_ang1 -- Prolate spheroidal angular function of the first kind and its derivative pro_rad1 -- Prolate spheroidal radial function of the first kind and its derivative pro_rad2 -- Prolate spheroidal radial function of the secon kind and its derivative obl_ang1 -- Oblate spheroidal angular function of the first kind and its derivative obl_rad1 -- Oblate spheroidal radial function of the first kind and its derivative obl_rad2 -- Oblate spheroidal radial function of the second kind and its derivative. pro_cv -- Characteristic value of prolate spheroidal function obl_cv -- Characteristic value of oblate spheroidal function pro_cv_seq -- Characteristic values for prolate spheroidal wave functions. obl_cv_seq -- Characteristic values for oblate spheroidal wave functions. The following functions require pre-computed characteristic value: .. autosummary:: :toctree: generated/ pro_ang1_cv -- Prolate spheroidal angular function pro_ang1 for precomputed characteristic value pro_rad1_cv -- Prolate spheroidal radial function pro_rad1 for precomputed characteristic value pro_rad2_cv -- Prolate spheroidal radial function pro_rad2 for precomputed characteristic value obl_ang1_cv -- Oblate spheroidal angular function obl_ang1 for precomputed characteristic value obl_rad1_cv -- Oblate spheroidal radial function obl_rad1 for precomputed characteristic value obl_rad2_cv -- Oblate spheroidal radial function obl_rad2 for precomputed characteristic value Kelvin Functions ---------------- .. autosummary:: :toctree: generated/ kelvin -- Kelvin functions as complex numbers kelvin_zeros -- Compute nt zeros of all Kelvin functions. ber -- Kelvin function ber. bei -- Kelvin function bei berp -- Derivative of the Kelvin function `ber` beip -- Derivative of the Kelvin function `bei` ker -- Kelvin function ker kei -- Kelvin function ker kerp -- Derivative of the Kelvin function ker keip -- Derivative of the Kelvin function kei These are not universal functions: .. autosummary:: :toctree: generated/ ber_zeros -- Compute nt zeros of the Kelvin function ber(x). bei_zeros -- Compute nt zeros of the Kelvin function bei(x). berp_zeros -- Compute nt zeros of the Kelvin function ber'(x). beip_zeros -- Compute nt zeros of the Kelvin function bei'(x). ker_zeros -- Compute nt zeros of the Kelvin function ker(x). kei_zeros -- Compute nt zeros of the Kelvin function kei(x). kerp_zeros -- Compute nt zeros of the Kelvin function ker'(x). keip_zeros -- Compute nt zeros of the Kelvin function kei'(x). Combinatorics ------------- .. autosummary:: :toctree: generated/ comb -- The number of combinations of N things taken k at a time. perm -- Permutations of N things taken k at a time, i.e., k-permutations of N. Lambert W and Related Functions ------------------------------- .. autosummary:: :toctree: generated/ lambertw -- Lambert W function. wrightomega -- Wright Omega function. Other Special Functions ----------------------- .. autosummary:: :toctree: generated/ agm -- Arithmetic, Geometric Mean. bernoulli -- Bernoulli numbers B0..Bn (inclusive). binom -- Binomial coefficient diric -- Periodic sinc function, also called the Dirichlet function. euler -- Euler numbers E0..En (inclusive). expn -- Exponential integral E_n exp1 -- Exponential integral E_1 of complex argument z expi -- Exponential integral Ei factorial -- The factorial of a number or array of numbers. factorial2 -- Double factorial. factorialk -- Multifactorial of n of order k, n(!!...!). shichi -- Hyperbolic sine and cosine integrals. sici -- Sine and cosine integrals. softmax -- Softmax function. spence -- Spence's function, also known as the dilogarithm. zeta -- Riemann zeta function. zetac -- Riemann zeta function minus 1. Convenience Functions --------------------- .. autosummary:: :toctree: generated/ cbrt -- Cube root of `x` exp10 -- 10**x exp2 -- 2**x radian -- Convert from degrees to radians cosdg -- Cosine of the angle `x` given in degrees. sindg -- Sine of angle given in degrees tandg -- Tangent of angle x given in degrees. cotdg -- Cotangent of the angle `x` given in degrees. log1p -- Calculates log(1+x) for use when `x` is near zero expm1 -- exp(x) - 1 for use when `x` is near zero. cosm1 -- cos(x) - 1 for use when `x` is near zero. round -- Round to nearest integer xlogy -- Compute ``x*log(y)`` so that the result is 0 if ``x = 0``. xlog1py -- Compute ``x*log1p(y)`` so that the result is 0 if ``x = 0``. logsumexp -- Compute the log of the sum of exponentials of input elements. exprel -- Relative error exponential, (exp(x)-1)/x, for use when `x` is near zero. sinc -- Return the sinc function. """ from __future__ import division, print_function, absolute_import from .sf_error import SpecialFunctionWarning, SpecialFunctionError from . import _ufuncs from ._ufuncs import * from . import _basic from ._basic import * from ._logsumexp import logsumexp, softmax from . import orthogonal from .orthogonal import * from .spfun_stats import multigammaln from ._ellip_harm import ( ellip_harm, ellip_harm_2, ellip_normal ) from .lambertw import lambertw from ._spherical_bessel import ( spherical_jn, spherical_yn, spherical_in, spherical_kn ) __all__ = _ufuncs.__all__ + _basic.__all__ + orthogonal.__all__ + [ 'SpecialFunctionWarning', 'SpecialFunctionError', 'orthogonal', # Not public, but kept in __all__ for back-compat 'logsumexp', 'softmax', 'multigammaln', 'ellip_harm', 'ellip_harm_2', 'ellip_normal', 'lambertw', 'spherical_jn', 'spherical_yn', 'spherical_in', 'spherical_kn', ] from scipy._lib._testutils import PytestTester test = PytestTester(__name__) del PytestTester
lhilt/scipy
scipy/special/__init__.py
Python
bsd-3-clause
27,314
[ "Gaussian" ]
71865e408e75c70ba5a3658eac5517bdaa7e4ef301505432d93c28c4b38b7dd4
""" Open Babel utilities. """ __author__ = "Steven Kearnes" __copyright__ = "Copyright 2014, Stanford University" __license__ = "BSD 3-clause" from StringIO import StringIO import subprocess from rdkit import Chem from rdkit_utils import serial from vs_utils.utils import image_utils class Ionizer(object): """ Calculate atomic formal charges at the given pH. Parameters ---------- pH : float, optional (default 7.4) pH at which to calculate formal charges. """ def __init__(self, pH=7.4): self.pH = pH def __call__(self, mol): """ Ionize a molecule. Parameters ---------- mol : RDMol Molecule. """ return self.ionize(mol) def ionize(self, mol): """ Ionize a molecule while preserving 3D coordinates. Parameters ---------- mol : RDMol Molecule. """ if mol.GetNumConformers() > 0: return self._ionize_3d(mol) else: return self._ionize_2d(mol) def _ionize_2d(self, mol): """ Ionize a molecule without preserving conformers. Note: this method removes explicit hydrogens from the molecule. Parameters ---------- mol : RDMol Molecule. """ smiles = Chem.MolToSmiles(mol, isomericSmiles=True, canonical=True) args = ['obabel', '-i', 'can', '-o', 'can', '-p', str(self.pH)] p = subprocess.Popen(args, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE) ionized_smiles, _ = p.communicate(smiles) ionized_mol = Chem.MolFromSmiles(ionized_smiles) # catch ionizer error if ionized_mol is None: raise IonizerError(mol) return ionized_mol def _ionize_3d(self, mol): """ Ionize a molecule while preserving conformers. Parameters ---------- mol : RDMol Molecule. """ assert mol.GetNumConformers() > 0 sdf = '' for conf in mol.GetConformers(): sdf += Chem.MolToMolBlock(mol, confId=conf.GetId(), includeStereo=True) sdf += '$$$$\n' args = ['obabel', '-i', 'sdf', '-o', 'sdf', '-p', str(self.pH)] p = subprocess.Popen(args, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE) ionized_sdf, _ = p.communicate(sdf) reader = serial.MolReader(StringIO(ionized_sdf), mol_format='sdf', remove_salts=False) # no changes try: mols = list(reader.get_mols()) except RuntimeError as e: # catch pre-condition violations raise IonizerError(e.message) # catch ionizer failure if len(mols) == 0: raise IonizerError(mol) # detection of stereochemistry based on 3D coordinates might result # in issues when attempting to recombine ionized conformers, but we # merge them anyway if len(mols) == 1: ionized_mol, = mols else: ionized_mol = mols[0] for other in mols[1:]: for conf in other.GetConformers(): ionized_mol.AddConformer(conf, assignId=True) return ionized_mol class MolImage(object): """ Generate 2D depictions of molecules. Parameters ---------- size : int, optional (default 32) Size (in any direction) of generated images. """ def __init__(self, size=32): self.size = size def __call__(self, mol): """ Generate a PNG image from a SMILES string. Parameters ---------- mol : RDMol Molecule. size : int, optional (default 32) Size (in any direction) of generated image. """ return self.depict(mol) def depict(self, mol): """ Generate a PNG image from a SMILES string. Parameters ---------- mol : RDMol Molecule. size : int, optional (default 32) Size (in any direction) of generated image. """ smiles = Chem.MolToSmiles(mol, isomericSmiles=True, canonical=True) args = ['obabel', '-i', 'can', '-o', 'png', '-xd', '-xC', '-xp {}'.format(self.size)] p = subprocess.Popen(args, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE) png, _ = p.communicate(smiles) im = image_utils.load(png) return im class IonizerError(Exception): """ Generic Ionizer exception. """
rbharath/pande-gas
vs_utils/utils/ob_utils.py
Python
bsd-3-clause
4,834
[ "Open Babel", "RDKit" ]
e0c2dbec2eb9e40fe9f43b3b54cf53e8768eb2988e17eae8d78a8351cf19bdfc
from Bio.PDB import Selection, PDBParser from Bio.PDB.NeighborSearch import NeighborSearch from contactnetwork.interaction import * from contactnetwork.pdb import * from contactnetwork.models import * from io import StringIO from protein.models import ProteinConformation from structure.models import Structure from signprot.models import SignprotComplex import copy # Distance between residues in peptide NUM_SKIP_RESIDUES = 4 def compute_interactions(pdb_name,save_to_db = False): do_distances = True do_interactions = True do_complexes = True distances = [] classified = [] classified_complex = [] # Ensure that the PDB name is lowercase pdb_name = pdb_name.lower() # Get the pdb structure struc = Structure.objects.get(protein_conformation__protein__entry_name=pdb_name) pdb_io = StringIO(struc.pdb_data.pdb) # Get the preferred chain preferred_chain = struc.preferred_chain.split(',')[0] # Get the Biopython structure for the PDB s = PDBParser(PERMISSIVE=True, QUIET=True).get_structure('ref', pdb_io)[0] #s = pdb_get_structure(pdb_name)[0] chain = s[preferred_chain] #return classified, distances # remove residues without GN and only those matching receptor. residues = struc.protein_conformation.residue_set.exclude(generic_number=None).all().prefetch_related('generic_number') dbres = {} dblabel = {} for r in residues: dbres[r.sequence_number] = r dblabel[r.sequence_number] = r.generic_number.label ids_to_remove = [] for res in chain: if not res.id[1] in dbres.keys() and res.get_resname() != "HOH": ids_to_remove.append(res.id) for i in ids_to_remove: chain.detach_child(i) if do_distances: for i1,res1 in enumerate(chain,1): if not is_water(res1): for i2,res2 in enumerate(chain,1): if i2>i1 and not is_water(res2): # Do not calculate twice. distance = res1['CA']-res2['CA'] distances.append((dbres[res1.id[1]],dbres[res2.id[1]],distance,dblabel[res1.id[1]],dblabel[res2.id[1]])) if do_interactions: atom_list = Selection.unfold_entities(s[preferred_chain], 'A') # Search for all neighbouring residues ns = NeighborSearch(atom_list) all_neighbors = ns.search_all(6.6, "R") # Filter all pairs containing non AA residues all_aa_neighbors = [pair for pair in all_neighbors if is_aa(pair[0]) and is_aa(pair[1])] # Only include contacts between residues more than NUM_SKIP_RESIDUES sequence steps apart all_aa_neighbors = [pair for pair in all_aa_neighbors if abs(pair[0].id[1] - pair[1].id[1]) > NUM_SKIP_RESIDUES] # For each pair of interacting residues, determine the type of interaction interactions = [InteractingPair(res_pair[0], res_pair[1], dbres[res_pair[0].id[1]], dbres[res_pair[1].id[1]], struc) for res_pair in all_aa_neighbors if not is_water(res_pair[0]) and not is_water(res_pair[1]) ] # Split unto classified and unclassified. classified = [interaction for interaction in interactions if len(interaction.get_interactions()) > 0] if do_complexes: try: # check if structure in signprot_complex complex = SignprotComplex.objects.get(structure=struc) # Get all GPCR residue atoms based on preferred chain gpcr_atom_list = [ atom for residue in Selection.unfold_entities(s[preferred_chain], 'R') if is_aa(residue) \ for atom in residue.get_atoms()] # Get all residue atoms from the coupled protein (e.g. G-protein) # NOW: select alpha subnit protein chain using complex model sign_atom_list = [ atom for residue in Selection.unfold_entities(s[complex.alpha], 'R') if is_aa(residue) \ for atom in residue.get_atoms()] ns_gpcr = NeighborSearch(gpcr_atom_list) ns_sign = NeighborSearch(sign_atom_list) # For each GPCR atom perform the neighbor search on the signaling protein all_neighbors = {(gpcr_atom.parent, match_res) for gpcr_atom in gpcr_atom_list for match_res in ns_sign.search(gpcr_atom.coord, 4.5, "R")} # For each pair of interacting residues, determine the type of interaction residues_sign = ProteinConformation.objects.get(protein__entry_name=pdb_name+"_"+complex.alpha.lower()).residue_set.exclude(generic_number=None).all().prefetch_related('generic_number') # grab labels from sign protein dbres_sign = {} dblabel_sign = {} for r in residues_sign: dbres_sign[r.sequence_number] = r dblabel_sign[r.sequence_number] = r.generic_number.label # Find interactions interactions = [InteractingPair(res_pair[0], res_pair[1], dbres[res_pair[0].id[1]], dbres_sign[res_pair[1].id[1]], struc) for res_pair in all_neighbors if res_pair[0].id[1] in dbres and res_pair[1].id[1] in dbres_sign ] # Filter unclassified interactions classified_complex = [interaction for interaction in interactions if len(interaction.get_interactions()) > 0] # Convert to dictionary for water calculations interaction_pairs = {} for pair in classified_complex: res_1 = pair.get_residue_1() res_2 = pair.get_residue_2() key = res_1.get_parent().get_id()+str(res_1.get_id()[1]) + "_" + res_2.get_parent().get_id()+str(res_2.get_id()[1]) interaction_pairs[key] = pair # Obtain list of all water molecules in the structure water_list = { water for chain in s for residue in chain if residue.get_resname() == "HOH" for water in residue.get_atoms() } # If waters are present calculate water-mediated interactions if len(water_list) > 0: ## Iterate water molecules over coupled and gpcr atom list water_neighbors_gpcr = {(water, match_res) for water in water_list for match_res in ns_gpcr.search(water.coord, 3.5, "R")} water_neighbors_sign = {(water, match_res) for water in water_list for match_res in ns_sign.search(water.coord, 3.5, "R")} # TODO: DEBUG AND VERIFY this code as water-mediated interactions were present at this time # 1. UPDATE complexes to include also mini Gs and peptides (e.g. 4X1H/6FUF/5G53) # 2. Run and verify water-mediated do_interactions # 3. Improve the intersection between the two hit lists ## TODO: cleaner intersection between hits from the two Lists # see new code below # for water_pair_one in water_neighbors_gpcr: # for water_pair_two in water_neighbors_sign: # if water_pair_one[0]==water_pair_two[0]: # res_1 = water_pair_one[1] # res_2 = water_pair_two[1] # key = res_1.get_parent().get_id()+str(res_1.get_id()[1]) + "_" + res_2.get_parent().get_id()+str(res_2.get_id()[1]) # Check if interaction is polar # if any(get_polar_interactions(water_pair_one[0].get_parent(), water_pair_one[1])) and any(get_polar_interactions(water_pair_two[0].get_parent(), water_pair_two[1])): # TODO Check if water interaction is already present (e.g. multiple waters) # TODO Is splitting of sidechain and backbone-mediated interactions desired? # if not key in interaction_pairs: # interaction_pairs[key] = InteractingPair(res_1, res_2, dbres[res_1.id[1]], dbres_sign[res_2.id[1]], struc) # TODO: fix assignment of interacting atom labels (now seems limited to residues) # interaction_pairs[key].interactions.append(WaterMediated(a + "|" + str(water_pair_one[0].get_parent().get_id()[1]), b)) except SignprotComplex.DoesNotExist: # print("No complex definition found for", pdb_name) log = "No complex definition found for " + pdb_name except ProteinConformation.DoesNotExist: print("No protein conformation definition found for signaling protein of ", pdb_name) # log = "No protein conformation definition found for signaling protein of " + pdb_name if save_to_db: if do_interactions: # Delete previous for faster load in InteractingResiduePair.objects.filter(referenced_structure=struc).all().delete() # bulk_pair = [] # for d in distances: # pair = InteractingResiduePair(res1=d[0], res2=d[1], referenced_structure=struc) # bulk_pair.append(pair) # Create interaction dictionary interaction_pairs = {} for pair in classified: res_1 = pair.get_residue_1() res_2 = pair.get_residue_2() key = res_1.get_parent().get_id()+str(res_1.get_id()[1]) + "_" + res_2.get_parent().get_id()+str(res_2.get_id()[1]) interaction_pairs[key] = pair # POSSIBLE ADDON: support for multiple water-mediated bonds ## Obtain list of water molecules water_list = { water for residue in s[preferred_chain] if residue.get_resname() == "HOH" for water in residue.get_atoms() } if len(water_list) > 0: ## Iterate water molecules over residue atom list water_neighbors = [(water, match_res) for water in water_list for match_res in ns.search(water.coord, 3.5, "R") if not is_water(match_res) and (is_hba(match_res) or is_hbd(match_res))] # intersect between residues sharing the same interacting water for index_one in range(len(water_neighbors)): water_pair_one = water_neighbors[index_one] for index_two in [ index for index in range(index_one+1, len(water_neighbors)) if water_pair_one[0]==water_neighbors[index][0] ]: water_pair_two = water_neighbors[index_two] res_1 = water_pair_one[1] res_2 = water_pair_two[1] # TODO: order residues + check minimum spacing between residues key = res_1.get_parent().get_id()+str(res_1.get_id()[1]) + "_" + res_2.get_parent().get_id()+str(res_2.get_id()[1]) # Verify h-bonds between water and both residues matches_one = InteractingPair.verify_water_hbond(water_pair_one[1], water_pair_one[0]) matches_two = InteractingPair.verify_water_hbond(water_pair_two[1], water_pair_two[0]) if len(matches_one) > 0 and len(matches_two) > 0: # if not exists, create residue pair without interactions if not key in interaction_pairs: interaction_pairs[key] = InteractingPair(res_1, res_2, dbres[res_1.id[1]], dbres[res_2.id[1]], struc) for a,b in zip(matches_one, matches_two): # HACK: store water ID as part of first atom name interaction_pairs[key].interactions.append(WaterMediated(a + "|" + str(water_pair_one[0].get_parent().get_id()[1]), b)) for p in classified: p.save_into_database() if do_complexes: for pair in classified_complex: pair.save_into_database() if do_distances: # Distance.objects.filter(structure=struc).all().delete() bulk_distances = [] for i,d in enumerate(distances): distance = Distance(distance=int(100*d[2]),res1=d[0], res2=d[1],gn1=d[3], gn2=d[4], gns_pair='_'.join([d[3],d[4]]), structure=struc) bulk_distances.append(distance) if len(bulk_distances)>1000: pairs = Distance.objects.bulk_create(bulk_distances) bulk_distances = [] pairs = Distance.objects.bulk_create(bulk_distances) return classified, distances
cmunk/protwis
contactnetwork/cube.py
Python
apache-2.0
12,696
[ "Biopython" ]
4cecb3b1d09475a204c68ae11aa770feafd518015286425279885a8d01c6c7aa
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Activity analysis. Requires qualified name annotations (see qual_names.py). """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import copy import gast from tensorflow.python.autograph.pyct import anno from tensorflow.python.autograph.pyct import qual_names from tensorflow.python.autograph.pyct import transformer from tensorflow.python.autograph.pyct.static_analysis.annos import NodeAnno # TODO(mdan): Add support for PY3 (e.g. Param vs arg). # TODO(alexbw): Ignore named literals (e.g. None) class Scope(object): """Encloses local symbol definition and usage information. This can track for instance whether a symbol is modified in the current scope. Note that scopes do not necessarily align with Python's scopes. For example, the body of an if statement may be considered a separate scope. Attributes: modified: identifiers modified in this scope created: identifiers created in this scope used: identifiers referenced in this scope """ def __init__(self, parent, isolated=True, add_unknown_symbols=False): """Create a new scope. Args: parent: A Scope or None. isolated: Whether the scope is isolated, that is, whether variables created in this scope should be visible to the parent scope. add_unknown_symbols: Whether to handle attributed and subscripts without having first seen the base name. E.g., analyzing the statement 'x.y = z' without first having seen 'x'. """ self.isolated = isolated self.parent = parent self.add_unknown_symbols = add_unknown_symbols self.modified = set() # TODO(mdan): Completely remove this. self.created = set() self.used = set() self.params = {} self.returned = set() # TODO(mdan): Rename to `locals` @property def referenced(self): if not self.isolated and self.parent is not None: return self.used | self.parent.referenced return self.used def __repr__(self): return 'Scope{r=%s, c=%s, w=%s}' % (tuple(self.used), tuple(self.created), tuple(self.modified)) def copy_from(self, other): """Recursively copies the contents of this scope from another scope.""" if (self.parent is None) != (other.parent is None): raise ValueError('cannot copy scopes of different structures') if other.parent is not None: self.parent.copy_from(other.parent) self.isolated = other.isolated self.modified = copy.copy(other.modified) self.created = copy.copy(other.created) self.used = copy.copy(other.used) self.params = copy.copy(other.params) self.returned = copy.copy(other.returned) @classmethod def copy_of(cls, other): if other.parent is not None: parent = cls.copy_of(other.parent) else: parent = None new_copy = cls(parent) new_copy.copy_from(other) return new_copy def merge_from(self, other): if (self.parent is None) != (other.parent is None): raise ValueError('cannot merge scopes of different structures') if other.parent is not None: self.parent.merge_from(other.parent) self.modified |= other.modified self.created |= other.created self.used |= other.used self.params.update(other.params) self.returned |= other.returned def has(self, name): if name in self.modified: return True elif self.parent is not None: return self.parent.has(name) return False def mark_read(self, name): self.used.add(name) if self.parent is not None and name not in self.created: self.parent.mark_read(name) def mark_param(self, name, owner): self.params[name] = owner def mark_creation(self, name, writes_create_symbol=False): """Mark a qualified name as created.""" if name.is_composite(): parent = name.parent if not writes_create_symbol: return else: if not self.has(parent): if self.add_unknown_symbols: self.mark_read(parent) else: raise ValueError('Unknown symbol "%s".' % parent) self.created.add(name) def mark_write(self, name): """Marks the given symbol as modified in the current scope.""" self.modified.add(name) if self.isolated: self.mark_creation(name) else: if self.parent is None: self.mark_creation(name) else: if not self.parent.has(name): self.mark_creation(name) self.parent.mark_write(name) def mark_returned(self, name): self.returned.add(name) if not self.isolated and self.parent is not None: self.parent.mark_returned(name) class ActivityAnalyzer(transformer.Base): """Annotates nodes with local scope information. See Scope. The use of this class requires that qual_names.resolve() has been called on the node. This class will ignore nodes have not been annotated with their qualified names. """ def __init__(self, context, parent_scope=None, add_unknown_symbols=False): super(ActivityAnalyzer, self).__init__(context) self.scope = Scope(parent_scope, None, add_unknown_symbols) self._in_return_statement = False self._in_aug_assign = False @property def _in_constructor(self): if len(self.enclosing_entities) > 1: innermost = self.enclosing_entities[-1] parent = self.enclosing_entities[-2] return isinstance(parent, gast.ClassDef) and innermost.name == '__init__' return False def _node_sets_self_attribute(self, node): if anno.hasanno(node, anno.Basic.QN): qn = anno.getanno(node, anno.Basic.QN) # TODO(mdan): The 'self' argument is not guaranteed to be called 'self'. if qn.has_attr and qn.parent.qn == ('self',): return True return False def _track_symbol(self, node, composite_writes_alter_parent=False, writes_create_symbol=False): # A QN may be missing when we have an attribute (or subscript) on a function # call. Example: a().b if not anno.hasanno(node, anno.Basic.QN): return qn = anno.getanno(node, anno.Basic.QN) if isinstance(node.ctx, gast.Store): self.scope.mark_write(qn) if qn.is_composite and composite_writes_alter_parent: self.scope.mark_write(qn.parent) if writes_create_symbol: self.scope.mark_creation(qn, writes_create_symbol=True) if self._in_aug_assign: self.scope.mark_read(qn) elif isinstance(node.ctx, gast.Load): self.scope.mark_read(qn) elif isinstance(node.ctx, gast.Param): # Param contexts appear in function defs, so they have the meaning of # defining a variable. self.scope.mark_write(qn) self.scope.mark_param(qn, self.enclosing_entities[-1]) else: raise ValueError('Unknown context %s for node %s.' % (type(node.ctx), qn)) anno.setanno(node, NodeAnno.IS_LOCAL, self.scope.has(qn)) if self._in_return_statement: self.scope.mark_returned(qn) def _enter_scope(self, isolated): self.scope = Scope(self.scope, isolated=isolated) def _exit_scope(self): self.scope = self.scope.parent def _process_statement(self, node): self._enter_scope(False) node = self.generic_visit(node) anno.setanno(node, anno.Static.SCOPE, self.scope) self._exit_scope() return node def visit_Expr(self, node): return self._process_statement(node) def visit_Return(self, node): self._in_return_statement = True node = self._process_statement(node) self._in_return_statement = False return node def visit_Assign(self, node): return self._process_statement(node) def visit_AugAssign(self, node): # Special rules for AugAssign. In Assign, the target is only written, # but in AugAssig (e.g. a += b), the target is both read and written. self._in_aug_assign = True node = self._process_statement(node) self._in_aug_assign = False return node def visit_Name(self, node): node = self.generic_visit(node) self._track_symbol(node) return node def visit_Attribute(self, node): node = self.generic_visit(node) if self._in_constructor and self._node_sets_self_attribute(node): self._track_symbol( node, composite_writes_alter_parent=True, writes_create_symbol=True) else: self._track_symbol(node) return node def visit_Subscript(self, node): node = self.generic_visit(node) # Subscript writes (e.g. a[b] = "value") are considered to modify # both the element itself (a[b]) and its parent (a). self._track_symbol(node) return node def visit_Print(self, node): self._enter_scope(False) node.values = self.visit_block(node.values) anno.setanno(node, anno.Static.SCOPE, self.scope) anno.setanno(node, NodeAnno.ARGS_SCOPE, self.scope) self._exit_scope() return node def visit_Assert(self, node): return self._process_statement(node) def visit_Call(self, node): self._enter_scope(False) node.args = self.visit_block(node.args) node.keywords = self.visit_block(node.keywords) # TODO(mdan): Account starargs, kwargs anno.setanno(node, NodeAnno.ARGS_SCOPE, self.scope) self._exit_scope() node.func = self.visit(node.func) return node def _process_block_node(self, node, block, scope_name): self._enter_scope(False) block = self.visit_block(block) anno.setanno(node, scope_name, self.scope) self._exit_scope() return node def _process_parallel_blocks(self, parent, children): # Because the scopes are not isolated, processing any child block # modifies the parent state causing the other child blocks to be # processed incorrectly. So we need to checkpoint the parent scope so that # each child sees the same context. before_parent = Scope.copy_of(self.scope) after_children = [] for child, scope_name in children: self.scope.copy_from(before_parent) parent = self._process_block_node(parent, child, scope_name) after_child = Scope.copy_of(self.scope) after_children.append(after_child) for after_child in after_children: self.scope.merge_from(after_child) return parent def visit_arguments(self, node): return self._process_statement(node) def visit_FunctionDef(self, node): # The FunctionDef node itself has a Scope object that tracks the creation # of its name, along with the usage of any decorator accompany it. self._enter_scope(False) node.decorator_list = self.visit_block(node.decorator_list) self.scope.mark_write(qual_names.QN(node.name)) anno.setanno(node, anno.Static.SCOPE, self.scope) self._exit_scope() # A separate Scope tracks the actual function definition. self._enter_scope(True) node.args = self.visit(node.args) # Track the body separately. This is for compatibility reasons, it may not # be strictly needed. self._enter_scope(False) node.body = self.visit_block(node.body) anno.setanno(node, NodeAnno.BODY_SCOPE, self.scope) self._exit_scope() self._exit_scope() return node def visit_With(self, node): self._enter_scope(False) node = self.generic_visit(node) anno.setanno(node, NodeAnno.BODY_SCOPE, self.scope) self._exit_scope() return node def visit_withitem(self, node): return self._process_statement(node) def visit_If(self, node): self._enter_scope(False) node.test = self.visit(node.test) anno.setanno(node, NodeAnno.COND_SCOPE, self.scope) anno.setanno(node.test, anno.Static.SCOPE, self.scope) self._exit_scope() node = self._process_parallel_blocks(node, ((node.body, NodeAnno.BODY_SCOPE), (node.orelse, NodeAnno.ORELSE_SCOPE))) return node def visit_For(self, node): self._enter_scope(False) node.target = self.visit(node.target) node.iter = self.visit(node.iter) anno.setanno(node.iter, anno.Static.SCOPE, self.scope) self._exit_scope() node = self._process_parallel_blocks(node, ((node.body, NodeAnno.BODY_SCOPE), (node.orelse, NodeAnno.ORELSE_SCOPE))) return node def visit_While(self, node): self._enter_scope(False) node.test = self.visit(node.test) anno.setanno(node, NodeAnno.COND_SCOPE, self.scope) anno.setanno(node.test, anno.Static.SCOPE, self.scope) self._exit_scope() node = self._process_parallel_blocks(node, ((node.body, NodeAnno.BODY_SCOPE), (node.orelse, NodeAnno.ORELSE_SCOPE))) return node def resolve(node, context, parent_scope=None): return ActivityAnalyzer(context, parent_scope).visit(node)
xodus7/tensorflow
tensorflow/python/autograph/pyct/static_analysis/activity.py
Python
apache-2.0
13,600
[ "VisIt" ]
2303cce48ac2557d8e6ffddae22226d8deb1b76717431a033c1e8d38f6dace86
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Lingvo layers that depend on attention layers but are not recurrent.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import REDACTED.transformer_lingvo.lingvo.compat as tf from REDACTED.transformer_lingvo.lingvo.core import attention from REDACTED.transformer_lingvo.lingvo.core import base_layer from REDACTED.transformer_lingvo.lingvo.core import layers from REDACTED.transformer_lingvo.lingvo.core import py_utils from REDACTED.transformer_lingvo.lingvo.core import symbolic from six.moves import range class TransformerAttentionLayer(base_layer.BaseLayer): """Multi-headed attention, add and norm used by 'Attention Is All You Need'. This class implements the first sub-layer of Transformer Layer. Input is first processed using a multi-headed (self) attention. Output of the attention layer is combined with the residual connection. And the finally, output is normalized using Layer Normalization. Layer can be used in five scenarios: 1. Multi-Headed Self-Attention, where attention keys (source vectors), attention values (context vectors) and queries come from the same previous layer output, `query_vec`. This is the general use case for encoder Transformer Layers. 2. Masked Multi-Headed Self-Attention, where attention keys, attention values and queries all come from the same previous layer output, but rightward activations are masked to prevent information flow from future. This is the use case for decoder self-attention Transformer Layers. Can be activated by setting `is_masked` flag of this layer. 3. Multi-Headed Attention, where attention keys and attention values `source_vecs`, are coming from a different source (output of the encoder) and queries `query_vec`, coming from the previous layer outputs (decoder). This corresponds to the standard attention mechanism, decoder attending the encoder outputs. 4. Multi-Headed Attention, where attention values `context_vecs` are coming from a different source than queries and keys, e.g. for positional attention, where keys and queries are positional encodings and values are decoder states. 5. Masked Multi-Headed Self-Attention, where attention keys, attention values and queries all come from the same previous layer output, but the activations for the current position are masked to reduce the impact of high self-similarity. This is the use case for non-autoregressive decoder self-attention Transformer Layers. Can be activated by setting `is_masked` flag of this layer and setting `mask_type="eye"`. 6. Masked Multi-Headed Self-Attention, where attention keys, attention values and queries all come from the same previous layer output, but: . rightward activations are masked to prevent information flow from future. . leftward activations are also masked to prevent information flow from past tokens that are beyond the N-gram context [K-N+1, K-1] when predicting the target token in position K. This is the use case for decoder self-attention Transformer Layers in N-gram mode. Can be activated by setting `is_masked` flag of this layer, and setting both `mask_type="ngram"` and `mask_ngram_order=N-1` to use as context only the previous N-1 tokens (as expected for an N-gram model); for details and experimental results see https://arxiv.org/abs/2001.04589. """ @classmethod def Params(cls): p = super(TransformerAttentionLayer, cls).Params() p.Define('source_dim', 0, 'Dimension of the transformer block input.') p.Define('context_dim', 0, 'Dimension of the attention contexts.') p.Define('atten_hidden_dim', 0, 'Dimension of the attention hidden dim.') p.Define('num_attention_heads', 8, 'Number of attention heads.') p.Define('is_masked', False, 'If set, uses masked MultiHeadedAttention.') p.Define( 'mask_ngram_order', 0, 'N-gram order, relevant only when' '`mask_type` is set to "ngram".') p.Define( 'mask_type', 'future', 'Type of attention mask if `is_masked` is' 'set. Either "future" for masking out attention to future' 'positions or "eye" for masking out the token itself, or "ngram" for' 'bounding the left context to the previous N-1 tokens, where N is set' 'by `mask_ngram_order`.') p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params.') p.Define( 'atten_tpl', attention.MultiHeadedAttention.Params().Set( use_source_vec_as_attention_value=False, enable_ctx_post_proj=True), 'Multi-Headed Dot-Attention default params.') p.Define( 'atten_dropout_prob', 0.0, 'Probability at which we apply dropout to the attention probs. ' 'This practically drops memory values at random positions.') p.Define( 'residual_dropout_prob', 0.0, 'Probability at which we apply dropout to the residual layers, ' 'such that, residual(x, f(x)) = (x + dropout(f(x))).') p.Define( 'residual_dropout_tpl', layers.DropoutLayer.Params(), 'Residual dropout params template. keep_prop will be reset to ' '(1.0 - residual_dropout_prob).') p.Define('packed_input', False, 'If True, each training example may pack multiple sequences.') p.Define('add_unnormalized_input', False, 'If set, uses unnormalized input ' 'in the residual add.') p.Define( 'residual_function', None, 'When None (the default), use simple ' 'sum for the residual connection (output = x + f(x)). For example, can ' 'use layers.HighwaySkipLayer.Params() or layers.GatingLayer.Params() ' 'for gated residual add, where output is instead ' 'residual_function.FProp(x, f(x)).') return p @base_layer.initializer def __init__(self, params): super(TransformerAttentionLayer, self).__init__(params) p = self.params assert p.name assert p.source_dim if not p.atten_hidden_dim: p.atten_hidden_dim = p.source_dim if not p.context_dim: p.context_dim = p.source_dim if p.is_masked: assert p.mask_type in ['future', 'eye', 'ngram'] with tf.variable_scope(p.name): params = self._InitAttention(p.atten_tpl) self.CreateChild('atten', params) # Initialize attention layer norm params = p.ln_tpl.Copy() params.name = 'atten_ln' params.input_dim = p.source_dim self.CreateChild('layer_norm', params) dropout_tpl = p.residual_dropout_tpl.Copy() dropout_tpl.keep_prob = (1.0 - p.residual_dropout_prob) self.CreateChild('residual_dropout', dropout_tpl) if p.residual_function is not None: params = p.residual_function.Copy() params.input_dim = p.atten_hidden_dim self.CreateChild('residual_function', params) def _InitAttention(self, atten_tpl): p = self.params # Initialize multi-headed attention params = atten_tpl.Copy() params.name = 'multihead_atten' params.source_dim = p.source_dim params.query_dim = p.source_dim params.hidden_dim = p.atten_hidden_dim params.context_dim = p.context_dim params.ctx_post_proj_dim = p.source_dim params.num_attention_heads = p.num_attention_heads params.atten_dropout_prob = p.atten_dropout_prob params.packed_input = p.packed_input return params def _GetSourceLength(self, source_paddings): return py_utils.GetShape(source_paddings)[0] def FProp(self, theta, query_vec, source_paddings, source_vecs=None, query_segment_id=None, source_segment_id=None, context_vecs=None, **kwargs): """Transformer attention, residual and normalization layer. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_time, target_batch, dim] source_paddings: [source_time, source_batch] source_vecs: [source_time, source_batch, dim]. query_segment_id: [target_time, target_batch] source_segment_id: [source_time, source_batch] context_vecs: [source_time, target_batch, dim] **kwargs: Can be optional params for the attention layer, eg. attention projection index tensor. Returns: (output, atten_probs). output is of shape [target_time, target_batch, context_dim], atten_probs is of shape [target_time, target_batch, source_time]. """ p = self.params unnormalized_query_vec = query_vec query_vec = self.layer_norm.FProp(theta.layer_norm, query_vec) if source_vecs is None: # For self-attention: keys = queries. source_vecs = query_vec source_segment_id = query_segment_id if context_vecs is None: # Inter/self-attention: keys = values/contexts. context_vecs = source_vecs target_time, target_bs, query_dim = py_utils.GetShape(query_vec, 3) if p.is_masked: assert source_vecs is not None query_vec = py_utils.with_dependencies([ py_utils.assert_shape_match( tf.shape(source_vecs), tf.shape(query_vec)) ], query_vec) # Prepares mask for self-attention # Padding is complemented, so time indexes that we want to mask out # receive padding weight 1.0. if p.mask_type == 'future': padding = 1.0 - tf.linalg.band_part( tf.ones([target_time, target_time], dtype=py_utils.FPropDtype(p)), -1, 0) elif p.mask_type == 'eye': padding = tf.eye(target_time, target_time, dtype=py_utils.FPropDtype(p)) elif p.mask_type == 'ngram': # Maybe apply N-gram mask. assert p.mask_ngram_order padding = 1.0 - tf.linalg.band_part( tf.ones([target_time, target_time], dtype=py_utils.FPropDtype(p)), tf.minimum(p.mask_ngram_order - 1, target_time - 1), 0) # [time, batch, time] causal_padding = tf.tile(tf.expand_dims(padding, 1), [1, target_bs, 1]) causal_padding = tf.reshape(causal_padding, [-1, target_time]) else: causal_padding = None # Projects keys and values. packed_src = self.atten.PackSource( theta=theta.atten, source_vecs=source_vecs, # keys source_contexts=context_vecs, # values source_padding=source_paddings, source_segment_id=source_segment_id) if query_segment_id is not None: query_segment_id = tf.reshape(query_segment_id, [-1]) ctx_vec, atten_prob, _ = self.atten.ComputeContextVectorWithSource( theta=theta.atten, packed_src=packed_src, query_vec=tf.reshape(query_vec, [-1, query_dim]), per_step_source_padding=causal_padding, query_segment_id=query_segment_id, **kwargs) ctx_vec = self.residual_dropout.FProp(theta.residual_dropout, ctx_vec) input_to_add = ( unnormalized_query_vec if p.add_unnormalized_input else query_vec) input_after_sublayer = tf.reshape( ctx_vec, [ target_time, target_bs, -1 # Either projected or not. ]) if p.residual_function is None: h = input_to_add + input_after_sublayer else: h = self.residual_function.FProp(theta.residual_function, input_to_add, input_after_sublayer) atten_prob = tf.reshape( atten_prob, [target_time, target_bs, self._GetSourceLength(source_paddings)]) return h, atten_prob def _FinishExtendStep(self, theta, query_vec, unnormalized_query_vec, extended_packed_src, t=None): """Finish extending prefix by one more time step. Isolating this function from ExtendStep allows generalizing self-attention to causal attention on other inputs. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_batch, dim] unnormalized_query_vec: [target_batch, dim] extended_packed_src: A `.NestedMap` object containing source_vecs, source_contexts, source_paddings, and source_segment_ids t: a scalar, the current time step, 0-based. Returns: A triplet (cur_output, atten_prob, new_state) where cur_output is a tensor representing the output from the current state, and new_state is the new state `.NestedMap`. """ p = self.params # Compute per_step_source_padding. Padding is complemented, so time indexes # that we want to mask out receive padding weight 1.0. query_batch_size = py_utils.GetShape(query_vec)[0] source_seq_len = py_utils.GetShape(extended_packed_src.source_vecs)[0] zero_padding = tf.fill([source_seq_len], tf.constant(0.0, dtype=query_vec.dtype)) ones_padding = tf.ones_like(zero_padding, dtype=query_vec.dtype) if t is not None: per_step_source_padding = tf.where( tf.less(tf.range(source_seq_len), tf.fill([source_seq_len], t + 1)), zero_padding, ones_padding) per_step_source_padding = tf.tile( tf.expand_dims(per_step_source_padding, axis=0), [query_batch_size, 1]) # Maybe apply N-gram masking. # TODO(ciprianchelba): As pointed out by miachen, to get the expected # speed-up we should go with per_step_source_padding=None here, and # everytime we update the prefix_states, we not only extend one step, but # also only keep the prefix_states for the most recent N steps instead of # the prefix states all the way from step 0. elif p.is_masked and p.mask_type == 'ngram': assert p.mask_ngram_order idx = tf.maximum(0, source_seq_len - p.mask_ngram_order) per_step_source_padding = tf.where( tf.less(tf.range(source_seq_len), tf.fill([source_seq_len], idx)), ones_padding, zero_padding) per_step_source_padding = tf.tile( tf.expand_dims(per_step_source_padding, axis=0), [query_batch_size, 1]) else: per_step_source_padding = None ctx_vec, atten_prob, _ = self.atten.ComputeContextVectorWithCachedSource( theta.atten, extended_packed_src, query_vec, per_step_source_padding=per_step_source_padding) ctx_vec = self.residual_dropout.FProp(theta.residual_dropout, ctx_vec) input_to_add = ( unnormalized_query_vec if p.add_unnormalized_input else query_vec) input_after_sublayer = tf.reshape(ctx_vec, py_utils.GetShape(query_vec)) if p.residual_function is None: h = input_to_add + input_after_sublayer else: h = self.residual_function.FProp(theta.residual_function, input_to_add, input_after_sublayer) new_states = py_utils.NestedMap( key=extended_packed_src.source_vecs, value=extended_packed_src.source_contexts) return h, atten_prob, new_states def ExtendStep(self, theta, query_vec, prefix_state, t=None): """Extend prefix by one more time step. This function is expected to be called during fast decoding of the Transformer model. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_batch, dim] prefix_state: dict, containing tensors which are the results of previous attentions, used for fast decoding. t: a scalar, the current time step, 0-based. Returns: A triplet (cur_output, atten_prob, new_state) where cur_output is a tensor representing the output from the current state, and new_state is the new state `.NestedMap`. """ p = self.params assert p.is_masked # Must be causal attention. unnormalized_query_vec = query_vec query_vec = self.layer_norm.FProp(theta.layer_norm, query_vec) cached_packed_src = py_utils.NestedMap( source_vecs=prefix_state.key, source_contexts=prefix_state.value, source_padding=None, source_segment_id=None) extended_packed_src = self.atten.ExtendSourcePacked(theta.atten, query_vec, query_vec, None, None, cached_packed_src, t) return self._FinishExtendStep(theta, query_vec, unnormalized_query_vec, extended_packed_src, t) class TransformerMultiSourceAttentionLayer(TransformerAttentionLayer): """Multi-source multi-headed attention. Only supports scenarios 3 and 4 in the base class. Now the two scenarios are: 3. Multi-source multi-Headed Attention, where attention keys and attention values `source_vecs`, are different encodings and queries `query_vec`, coming from the previous layer outputs (decoder). In addition, attention keys and values are NestedMaps containing encodings of different sources. This corresponds to a multi-source decoder-to-encoder attention mechanism, i.e., decoder attends to encoder outputs and other sources. 4. Similar to 3 but attention values `context_vecs` are coming from a different source than queries and keys. """ @classmethod def Params(cls): p = super(TransformerMultiSourceAttentionLayer, cls).Params() p.Define('num_source', 0, 'Number of sources to attend to.') p.Define( 'primary_source_index', 0, 'Index of the primary source whose ' 'attention probs will be returned.') p.Define('multi_source_atten', attention.MultiSourceAttention.Params(), 'Multi-source attention params.') # Only used for case 3 and 4. p.is_masked = False return p @base_layer.initializer def __init__(self, params): super(TransformerMultiSourceAttentionLayer, self).__init__(params) def _InitAttention(self, atten_tpl): p = self.params source_atten_tpls = [] # Set up each source attention. for i in range(p.num_source): src_key = 'source_%d' % i src_atten = atten_tpl.Copy() src_atten = super(TransformerMultiSourceAttentionLayer, self)._InitAttention(src_atten) src_atten.name = 'multihead_atten_%s' % src_key source_atten_tpls.append((src_key, src_atten)) # Initialize multi-source attention. msa = p.multi_source_atten.Copy() msa.name = 'multi_source_atten' msa.source_dim = p.source_dim msa.query_dim = p.source_dim msa.source_atten_tpls = source_atten_tpls msa.primary_source_key = 'source_%d' % p.primary_source_index return msa def _GetSourceLength(self, source_paddings): return py_utils.GetShape( source_paddings['source_%d' % self.params.primary_source_index])[0] class TransformerFeedForwardLayer(base_layer.BaseLayer): """Feed-forward, add and norm layer used by 'Attention Is All You Need'. This class implements the second sub-layer of Transformer Layer. First, input passes through a feed-forward neural network with one hidden layer and then projected back to the original input dimension to apply residual. Output of the layer, is then normalized using Layer Normalization. """ @classmethod def Params(cls): p = super(TransformerFeedForwardLayer, cls).Params() p.Define('input_dim', 0, 'Dimension of the layer input.') p.Define('output_dim', 0, 'Dimension of the layer output.') p.Define('hidden_dim', 0, 'Dimension of the hidden layer.') p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params') p.Define('activation', 'RELU', 'Non-linearity.') p.Define('fflayer_tpl', layers.FeedForwardNet.Params().Set(activation=['RELU', 'NONE']), 'Feed forward layer default params') p.Define( 'res_proj_tpl', layers.ProjectionLayer.Params().Set(batch_norm=True), 'Residual projection default params, used when input_dim != ' 'output_dim.') p.Define( 'residual_dropout_prob', 0.0, 'Probability at which we apply dropout to the residual layers, ' 'such that, residual(x, y) = (x + dropout(y)).') p.Define( 'residual_dropout_tpl', layers.DropoutLayer.Params(), 'Residual dropout params template. keep_prop will be reset to ' '(1.0 - residual_dropout_prob).') p.Define( 'relu_dropout_prob', 0.0, 'Probability at which we apply dropout to the hidden layer ' 'of feed-forward network.') p.Define('add_skip_connection', True, 'If True, add skip_connection from input to output.') return p @base_layer.initializer def __init__(self, params): super(TransformerFeedForwardLayer, self).__init__(params) p = self.params assert p.name assert p.input_dim assert symbolic.ToStatic(p.hidden_dim) > 0 with tf.variable_scope(p.name): # Initialize feed-forward layer params = p.fflayer_tpl.Copy() params.name = 'fflayer' params.input_dim = p.input_dim params.activation = [p.activation, 'NONE'] if p.output_dim == 0: params.hidden_layer_dims = [p.hidden_dim, p.input_dim] else: params.hidden_layer_dims = [p.hidden_dim, p.output_dim] if p.output_dim != p.input_dim: pj = p.res_proj_tpl.Copy() pj.name = 'res_proj' pj.input_dim = p.input_dim pj.output_dim = p.output_dim pj.activation = 'NONE' self.CreateChild('res_proj_layer', pj) params.dropout = [ params.dropout.cls.Params().Set(keep_prob=1.0 - p.relu_dropout_prob), params.dropout.cls.Params().Set(keep_prob=1.0) ] self.CreateChild('fflayer', params) # Initialize feed-forward layer norm params = p.ln_tpl.Copy() params.name = 'fflayer_ln' params.input_dim = p.input_dim self.CreateChild('layer_norm', params) dropout_tpl = p.residual_dropout_tpl.Copy() dropout_tpl.keep_prob = (1.0 - p.residual_dropout_prob) self.CreateChild('residual_dropout', dropout_tpl) @property def output_dim(self): """Returns output dimension of the transformer layer.""" return self.fflayer.output_dim @classmethod def NumOutputNodes(cls, p): return p.output_dim if p.output_dim else p.input_dim def FProp(self, theta, inputs, paddings): """Feed-forward, residual and layer-norm. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. inputs: [time, batch, dim]. paddings: [time, batch] Returns: tensor of the same shape with inputs """ inputs_normalized = self.layer_norm.FProp(theta.layer_norm, inputs) if hasattr(self, 'res_proj_layer'): inputs = self.res_proj_layer.FProp(theta.res_proj_layer, inputs) h = self.residual_dropout.FProp( theta.residual_dropout, self.fflayer.FProp(theta.fflayer, inputs_normalized, tf.expand_dims(paddings, -1))) if self.params.add_skip_connection: h += inputs return h class TransformerLayer(base_layer.BaseLayer): """Transformer Layer proposed by 'Attention Is All You Need'. Applies self-attention followed by a feed forward network and layer normalization. Uses residual connections between each consecutive layer. In particular, adds residuals from layer input and attention output and from attention output (feed-forward input) to feed-forward output. Implements the transformer block in 'Attention is All You Need': https://arxiv.org/abs/1706.03762. """ @classmethod def Params(cls): p = super(TransformerLayer, cls).Params() p.Define('source_dim', 0, 'Dimension of the transformer block input.') p.Define('output_dim', 0, 'Dimension of the transformer block output.') p.Define('tr_atten_tpl', TransformerAttentionLayer.Params().Set(num_attention_heads=8), 'Transformer Attention Layer params.') p.Define('tr_post_ln_tpl', None, '(Optional) Layer norm at end of transformer layer.') p.Define('tr_fflayer_tpl', TransformerFeedForwardLayer.Params().Set(hidden_dim=2048), 'Transformer Feed-Forward Layer params.') p.Define( 'has_aux_atten', False, 'If set, introduces a second attention layer, which attends to' ' the auxiliary source contexts.') p.Define('tr_aux_atten_tpl', None, 'Transformer Attention Layer params.') p.Define('mask_self_atten', False, 'If True, use masked self-attention.') p.Define('packed_input', False, 'If True, each training example may pack multiple sequences.') p.Define( 'is_decoder', False, '(Deprecated) ' 'If true, forces both has_aux_atten and mask_self_atten to true.') p.Define( 'num_aux_atten_post_proj', 1, 'Number of post projections for aux ' 'attention. This is usually used in multi-task setting, in which ' 'each task uses one dedicated projection layer.') return p @base_layer.initializer def __init__(self, params): super(TransformerLayer, self).__init__(params) p = self.params assert p.name assert p.source_dim if p.is_decoder: tf.logging.warning('TransformerLayer.is_decoder is deprecated.') p.has_aux_atten = True p.mask_self_atten = True with tf.variable_scope(p.name): # Initialize multi-headed self-attention params = p.tr_atten_tpl.Copy() params.name = 'multihead_self_atten' params.source_dim = p.source_dim params.packed_input = p.packed_input params.is_masked = p.mask_self_atten self.CreateChild('self_atten', params) if p.has_aux_atten: # Initialize masked-multi-headed attention params = ( p.tr_atten_tpl.Copy() if p.tr_aux_atten_tpl is None else p.tr_aux_atten_tpl.Copy()) params.name = 'multihead_atten' params.source_dim = p.source_dim params.packed_input = p.packed_input if hasattr(params.atten_tpl, 'num_post_proj'): params.atten_tpl.num_post_proj = p.num_aux_atten_post_proj self.CreateChild('atten', params) # Initialize feed-forward layer params = p.tr_fflayer_tpl.Copy() params.name = 'tr_fflayer' params.input_dim = p.source_dim params.output_dim = p.output_dim self.CreateChild('fflayer', params) # Initialize output layer norm if p.tr_post_ln_tpl: params = p.tr_post_ln_tpl.Copy() params.name = 'tr_post_layer_norm' params.input_dim = p.source_dim self.CreateChild('layer_norm', params) @property def output_dim(self): """Returns output dimension of the transformer layer.""" # output_dim is equal to p.source_dim when p.output_dim is zero. return self.fflayer.output_dim @classmethod def NumOutputNodes(cls, p): return p.output_dim if p.output_dim else p.source_dim def FProp(self, theta, source_vecs, source_paddings, aux_vecs=None, aux_paddings=None, source_segment_id=None, aux_segment_id=None, **kwargs): """Transformer Layer. Transformer layer has the naming scheme as follows: `source_vecs` and `source_paddings` are all assumed to be coming from the activations of the layer below. When `TransformerLayer` is used in the Encoder (default behavior of this layer) `source_*` tensors correspond to the outputs of previous encoder layer. Further, keys, values and queries are all forked from `source_vecs`. When TransformerLayer is used in the Decoder (has_aux_atten=True), `source_*` tensors correspond to the outputs of previous decoder layer and used as the queries. For the cases when `TransformerLayer` is used in the decoder (has_aux_atten=True) `aux_*` tensors have to be provided. Auxiliary inputs, `aux_*` tensors, are then correspond to the top-most layer encoder outputs and used by the second `TransformerAttentionLayer` as keys and values. Regardless of the encoder or decoder, queries are always assumed to be coming from the activations of layer below, in particular `source_vecs`. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_time, source_batch, dim]. source_paddings: [source_time, source_batch] aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] source_segment_id: [source_time, source_batch] aux_segment_id: [aux_time, aux_batch] **kwargs: Can be optional params for the attention layer, eg. attention projection index tensor. Returns: The attention context vector, [source_time, source_batch, dim]. The attention probability vector, [source_time, source_batch, source_time] if has_aux_atten is False, otherwise [source_time, source_batch, aux_time]. """ p = self.params if p.packed_input: assert source_segment_id is not None, ('Need to specify segment id for ' 'packed input.') with tf.name_scope('self_atten'): atten_vec, atten_prob = self.self_atten.FProp( theta.self_atten, source_vecs, source_paddings, query_segment_id=source_segment_id) if p.has_aux_atten: assert aux_vecs is not None assert aux_paddings is not None with tf.name_scope('aux_atten'): atten_vec, atten_prob = self.atten.FProp(theta.atten, atten_vec, aux_paddings, aux_vecs, source_segment_id, aux_segment_id, **kwargs) with tf.name_scope('fflayer'): h = self.fflayer.FProp(theta.fflayer, atten_vec, source_paddings) if p.tr_post_ln_tpl: with tf.name_scope('layer_norm'): h = self.layer_norm.FProp(theta.layer_norm, h) return h, atten_prob def ExtendStep(self, theta, source_vecs, prefix_states, aux_vecs=None, aux_paddings=None, t=None, **kwargs): """Transformer Layer, extend one step in decoding. This function is expected to be called during fast decoding of Transformer models. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_batch, dim]. prefix_states: dict, containing tensors which are the results of previous attentions, used for fast decoding. aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] t: a scalar, the current time step, 0-based. **kwargs: Can be optional params for the attention layer, eg. attention projection index tensor. Returns: The attention context vector, [target_batch, source_dim] The attention probability vector, [source_time, target_batch] Updated prefix states """ p = self.params if p.has_aux_atten: assert aux_vecs is not None assert aux_paddings is not None batch_size = py_utils.GetShape(source_vecs)[0] # First the self-attention layer. atten_vec, atten_prob, new_states = self.self_atten.ExtendStep( theta.self_atten, source_vecs, prefix_states, t) atten_vec = tf.expand_dims(atten_vec, axis=0) # Next the source attention layer. if p.has_aux_atten: atten_vec, atten_prob = self.atten.FProp(theta.atten, atten_vec, aux_paddings, aux_vecs, **kwargs) # Finally, the feedforward layer. h = self.fflayer.FProp( theta.fflayer, atten_vec, tf.zeros([1, batch_size], dtype=py_utils.FPropDtype(p))) if p.tr_post_ln_tpl: h = self.layer_norm.FProp(theta.layer_norm, h) h = tf.squeeze(h, 0) return h, atten_prob, new_states class EvolvedTransformerEncoderBranchedConvsLayer(base_layer.BaseLayer): """Evolved Transformer encoder branched convolutions layer. This constructs the branched convolution portion of the Evolved Transformer encoder described in https://arxiv.org/abs/1901.11117 . """ @classmethod def Params(cls): p = super(EvolvedTransformerEncoderBranchedConvsLayer, cls).Params() p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params') p.Define('input_dim', 0, 'Dimension of the layer input.') p.Define('activation', 'RELU', 'Activation applied after the left and right branches.') p.Define('dropout_tpl', layers.DropoutLayer.Params(), 'Dropout applied to each layer output.') p.Define('dense_tpl', layers.FCLayer.Params(), 'Fully connected "dense" layer.') p.Define('conv_tpl', layers.Conv2DLayer.Params(), 'Standard convolution layer.') p.Define('separable_conv_tpl', layers.SeparableConv2DLayer.Params(), 'Separable convolution layer.') return p @base_layer.initializer def __init__(self, params): super(EvolvedTransformerEncoderBranchedConvsLayer, self).__init__(params) p = self.params assert p.name assert p.input_dim with tf.variable_scope(p.name): # Initialize first layer norm. params = p.ln_tpl.Copy() params.name = 'first_layer_norm' params.input_dim = p.input_dim self.CreateChild('first_layer_norm', params) # Initialize second layer norm. params = p.ln_tpl.Copy() params.name = 'second_layer_norm' params.input_dim = p.input_dim * 4 self.CreateChild('second_layer_norm', params) # Initialize dense layer. params = p.dense_tpl.Copy() params.name = 'dense_layer' params.input_dim = p.input_dim params.activation = p.activation params.output_dim = p.input_dim * 4 self.CreateChild('dense_layer', params) # Initialize standard conv. params = p.conv_tpl.Copy() params.name = 'conv_layer' params.bias = True params.batch_norm = False params.activation = p.activation params.filter_stride = (1, 1) params.filter_shape = (3, 1, p.input_dim, int(p.input_dim / 2)) self.CreateChild('conv_layer', params) # Initialize separable conv. params = p.separable_conv_tpl.Copy() params.name = 'separable_conv_layer' params.bias = True params.batch_norm = False params.activation = 'NONE' params.filter_stride = (1, 1) params.filter_shape = (9, 1, int(p.input_dim * 4), p.input_dim) self.CreateChild('separable_conv_layer', params) # Initialize dropout. dropout_tpl = p.dropout_tpl.Copy() self.CreateChild('dropout', dropout_tpl) def FProp(self, theta, inputs, paddings): inputs_normalized = self.first_layer_norm.FProp(theta.first_layer_norm, inputs) left_branch = self.dense_layer.FProp(theta.dense_layer, inputs_normalized, tf.expand_dims(paddings, -1)) left_branch = self.dropout.FProp(theta.dropout, left_branch) # Newly computed padding is discarded. right_branch = self.conv_layer.FProp( theta.conv_layer, tf.expand_dims(inputs_normalized, axis=2), paddings)[0] right_branch = tf.squeeze(right_branch, axis=2) right_branch = self.dropout.FProp(theta.dropout, right_branch) right_branch = tf.pad( right_branch, [[0, 0], [0, 0], [0, tf.shape(left_branch)[-1] - tf.shape(right_branch)[-1]]], constant_values=0) hidden_state = left_branch + right_branch hidden_state = self.second_layer_norm.FProp(theta.second_layer_norm, hidden_state) # Newly computed padding is discarded. hidden_state = self.separable_conv_layer.FProp( theta.separable_conv_layer, tf.expand_dims(hidden_state, axis=2), paddings)[0] hidden_state = tf.squeeze(hidden_state, axis=2) hidden_state = tf.pad( hidden_state, [[0, 0], [0, 0], [0, tf.shape(inputs)[-1] - tf.shape(hidden_state)[-1]]], constant_values=0) hidden_state = self.dropout.FProp(theta.dropout, hidden_state) hidden_state += inputs return hidden_state class EvolvedTransformerDecoderBranchedConvsLayer(base_layer.BaseLayer): """Evolved Transformer decoder branched convolutions layer. This constructs the branched convolution portion of the Evolved Transformer decoder described in https://arxiv.org/abs/1901.11117 . """ @classmethod def Params(cls): p = super(EvolvedTransformerDecoderBranchedConvsLayer, cls).Params() p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params') p.Define('input_dim', 0, 'Dimension of the layer input.') p.Define('activation', 'RELU', 'Activation applied to the left convolution branch output.') p.Define('dropout_tpl', layers.DropoutLayer.Params(), 'Dropout applied to each layer output.') p.Define('separable_conv_tpl', layers.SeparableConv2DLayer.Params().Set(causal_convolution=True), 'Separable convolution layer.') return p @base_layer.initializer def __init__(self, params): super(EvolvedTransformerDecoderBranchedConvsLayer, self).__init__(params) p = self.params assert p.name assert p.input_dim with tf.variable_scope(p.name): # Initialize first layer norm. params = p.ln_tpl.Copy() params.name = 'first_layer_norm' params.input_dim = p.input_dim self.CreateChild('first_layer_norm', params) # Initialize second layer norm. params = p.ln_tpl.Copy() params.name = 'second_layer_norm' params.input_dim = p.input_dim * 2 self.CreateChild('second_layer_norm', params) # Initialize separable conv. params = p.separable_conv_tpl.Copy() params.name = 'separable_conv_11x1_layer' params.bias = True params.batch_norm = False params.activation = p.activation params.filter_stride = (1, 1) params.filter_shape = (11, 1, p.input_dim, int(p.input_dim * 2)) self.CreateChild('separable_conv_11x1_layer', params) # Initialize first separable conv. params = p.separable_conv_tpl.Copy() params.name = 'separable_conv_7x1_layer' params.bias = True params.batch_norm = False params.activation = 'NONE' params.filter_stride = (1, 1) params.filter_shape = (7, 1, p.input_dim, int(p.input_dim / 2)) self.CreateChild('separable_conv_7x1_layer', params) # Initialize second separable conv. params = p.separable_conv_tpl.Copy() params.name = 'separable_conv_7x1_layer_2' params.bias = True params.batch_norm = False params.activation = 'NONE' params.filter_stride = (1, 1) params.filter_shape = (7, 1, int(p.input_dim * 2), p.input_dim) self.CreateChild('separable_conv_7x1_layer_2', params) # Initialize dropout. dropout_tpl = p.dropout_tpl.Copy() self.CreateChild('dropout', dropout_tpl) def FProp(self, theta, inputs, paddings): inputs_normalized = self.first_layer_norm.FProp(theta.first_layer_norm, inputs) left_branch = self.separable_conv_11x1_layer.FProp( theta.separable_conv_11x1_layer, tf.expand_dims(inputs_normalized, axis=2), paddings)[0] left_branch = self.dropout.FProp(theta.dropout, left_branch) right_branch = self.separable_conv_7x1_layer.FProp( theta.separable_conv_7x1_layer, tf.expand_dims(inputs_normalized, axis=2), paddings)[0] right_branch = self.dropout.FProp(theta.dropout, right_branch) right_branch = tf.pad( right_branch, [[0, 0], [0, 0], [0, 0], [0, tf.shape(left_branch)[-1] - tf.shape(right_branch)[-1]]], constant_values=0) hidden_state = left_branch + right_branch hidden_state = self.second_layer_norm.FProp(theta.second_layer_norm, hidden_state) hidden_state = self.separable_conv_7x1_layer_2.FProp( theta.separable_conv_7x1_layer_2, hidden_state, paddings)[0] hidden_state = self.dropout.FProp(theta.dropout, hidden_state) hidden_state = tf.squeeze(hidden_state, axis=2) return hidden_state + inputs class EvolvedTransformerBaseLayer(base_layer.BaseLayer): """Base layer for the Evolved Transformer.""" @classmethod def Params(cls): p = super(EvolvedTransformerBaseLayer, cls).Params() p.Define('source_dim', 0, 'Dimension of the transformer block input.') p.Define( 'has_aux_atten', False, 'If set, introduces a second attention layer, which attends to' ' the auxiliary source contexts.') p.Define('packed_input', False, 'If True, each training example may pack multiple sequences.') return p class EvolvedTransformerEncoderLayer(EvolvedTransformerBaseLayer): """Evolved Transformer encoder layer. An Evolved Transformer encoder layer as described in https://arxiv.org/abs/1901.11117 . """ @classmethod def Params(cls): p = super(EvolvedTransformerEncoderLayer, cls).Params() p.Define('glu_tpl', layers.GluLayer.Params(), 'Glu layer.') p.Define('branched_convs_tpl', EvolvedTransformerEncoderBranchedConvsLayer.Params(), 'Evolved Transformer branched convolutional layers.') p.Define('transformer_tpl', TransformerLayer.Params(), 'Transformer layer.') return p @base_layer.initializer def __init__(self, params): super(EvolvedTransformerEncoderLayer, self).__init__(params) p = self.params assert p.name assert p.source_dim # Auxiliary attention not supported. if p.has_aux_atten: raise ValueError('Auxiliary attention not supported.') with tf.variable_scope(p.name): # Initialize Glu layer. params = p.glu_tpl.Copy() params.name = 'glu_layer' params.input_dim = p.source_dim self.CreateChild('glu_layer', params) # Initialize branched convolutions layer. params = p.branched_convs_tpl.Copy() params.name = 'branched_convs_layer' params.input_dim = p.source_dim self.CreateChild('branched_convs_layer', params) # Initialize branched convolutional layers. params = p.transformer_tpl.Copy() params.name = 'transformer_layer' params.source_dim = p.source_dim params.output_dim = p.source_dim params.tr_fflayer_tpl.hidden_dim = 4 * p.source_dim # Decoder functionality is not supported so disable auxiliary attention. params.has_aux_atten = False params.tr_aux_atten_tpl = None params.mask_self_atten = False params.is_decoder = False params.packed_input = p.packed_input self.CreateChild('transformer_layer', params) def FProp(self, theta, source_vecs, source_paddings, aux_vecs=None, aux_paddings=None, source_segment_id=None, aux_segment_id=None): hidden_state = self.glu_layer.FProp(theta.glu_layer, source_vecs, source_paddings) hidden_state = tf.transpose(hidden_state, [1, 0, 2]) source_paddings = tf.transpose(source_paddings, [1, 0]) hidden_state = self.branched_convs_layer.FProp(theta.branched_convs_layer, hidden_state, source_paddings) hidden_state = tf.transpose(hidden_state, [1, 0, 2]) source_paddings = tf.transpose(source_paddings, [1, 0]) hidden_state, atten_prob = self.transformer_layer.FProp( theta.transformer_layer, hidden_state, source_paddings, aux_vecs, aux_paddings, source_segment_id, aux_segment_id) return hidden_state, atten_prob class EvolvedTransformerDecoderLayer(EvolvedTransformerBaseLayer): """Evolved Transformer decoder layer. An Evolved Transformer decoder layer as described in https://arxiv.org/abs/1901.11117 . """ @classmethod def Params(cls): p = super(EvolvedTransformerDecoderLayer, cls).Params() p.Define('tr_atten_tpl', TransformerAttentionLayer.Params().Set(num_attention_heads=8), 'Transformer attention layer params.') p.Define('tr_double_heads_atten_tpl', TransformerAttentionLayer.Params().Set(num_attention_heads=16), 'Transformer double heads attention layer params.') p.Define('branched_convs_tpl', EvolvedTransformerDecoderBranchedConvsLayer.Params(), 'Evolved Transformer branched convolutional layers.') p.Define('transformer_tpl', TransformerLayer.Params(), 'Transformer layer.') p.Define('tr_aux_atten_tpl', None, 'Transformer Attention Layer params.') p.Define('mask_self_atten', False, 'If True, use masked self-attention.') p.has_aux_atten = True return p @base_layer.initializer def __init__(self, params): super(EvolvedTransformerDecoderLayer, self).__init__(params) p = self.params assert p.name assert p.source_dim with tf.variable_scope(p.name): # Initialize multi-headed self-attention. params = p.tr_double_heads_atten_tpl.Copy() params.name = 'self_atten_double_heads' params.source_dim = p.source_dim params.is_masked = p.mask_self_atten # Packed input is not supported. params.packed_input = p.packed_input self.CreateChild('self_atten_double_heads', params) if p.has_aux_atten: # Initialize masked-multi-headed encoder attention. params = ( p.tr_aux_atten_tpl.Copy() if p.tr_aux_atten_tpl is not None else p.tr_atten_tpl.Copy()) params.name = 'attend_to_encoder' params.source_dim = p.source_dim # Packed input is not supported. params.packed_input = p.packed_input self.CreateChild('attend_to_encoder', params) # Initialize branched convolutional layers. params = p.branched_convs_tpl.Copy() params.name = 'branched_convs' params.input_dim = p.source_dim self.CreateChild('branched_convs', params) # Initialize transformer layer. params = p.transformer_tpl.Copy() params.name = 'transformer_layer' params.source_dim = p.source_dim params.output_dim = p.source_dim params.tr_fflayer_tpl.hidden_dim = 4 * p.source_dim params.tr_aux_atten_tpl = p.tr_aux_atten_tpl params.has_aux_atten = p.has_aux_atten params.mask_self_atten = p.mask_self_atten params.tr_fflayer_tpl.activation = 'SWISH' # Packed input is not supported. params.packed_input = p.packed_input self.CreateChild('transformer_layer', params) def FProp(self, theta, source_vecs, source_paddings, aux_vecs=None, aux_paddings=None, source_segment_id=None, aux_segment_id=None): p = self.params if p.has_aux_atten: assert aux_vecs is not None assert aux_paddings is not None with tf.name_scope('self_atten_double_heads'): left_branch, _ = self.self_atten_double_heads.FProp( theta.self_atten_double_heads, source_vecs, source_paddings, query_segment_id=source_segment_id) if p.has_aux_atten: with tf.name_scope('attend_to_encoder'): right_branch, _ = self.attend_to_encoder.FProp(theta.attend_to_encoder, source_vecs, aux_paddings, aux_vecs, source_segment_id, aux_segment_id) hidden_state = left_branch + right_branch + source_vecs else: hidden_state = left_branch + source_vecs hidden_state = tf.transpose(hidden_state, [1, 0, 2]) source_paddings = tf.transpose(source_paddings, [1, 0]) hidden_state = self.branched_convs.FProp(theta.branched_convs, hidden_state, source_paddings) hidden_state = tf.transpose(hidden_state, [1, 0, 2]) source_paddings = tf.transpose(source_paddings, [1, 0]) hidden_state, atten_prob = self.transformer_layer.FProp( theta.transformer_layer, hidden_state, source_paddings, aux_vecs, aux_paddings, source_segment_id, aux_segment_id) return hidden_state, atten_prob def ExtendStep(self, theta, source_vecs, prefix_states, aux_vecs=None, aux_paddings=None, t=None): """Evolved Transformer decoder layer, extended one step in decoding. This function is expected to be called during fast decoding of Evolved Transformer models. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_batch, dim]. prefix_states: dict, containing tensors which are the results of previous attentions, used for fast decoding. aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] t: a scalar, the current time step, 0-based. Returns: The attention context vector, [target_batch, source_dim]. The attention probability vector, [source_time, target_batch]. Updated prefix states. """ p = self.params if p.has_aux_atten: assert aux_vecs is not None assert aux_paddings is not None inputs = tf.expand_dims(source_vecs, axis=0) new_states = prefix_states double_head_attention_states = prefix_states.double_head_attention_states # First the self-attention layer. (left_branch, _, double_head_attention_states) = self.self_atten_double_heads.ExtendStep( theta.self_atten_double_heads, source_vecs, double_head_attention_states, t) new_states.double_head_attention_states = double_head_attention_states left_branch = tf.expand_dims(left_branch, axis=0) hidden_state = left_branch + inputs # Next the source attention layer. if p.has_aux_atten: hidden_state += self.attend_to_encoder.FProp(theta.attend_to_encoder, inputs, aux_paddings, aux_vecs)[0] branched_convs_input = prefix_states.branched_convs_input branched_convs_input = tf.concat([branched_convs_input, hidden_state], axis=0) new_states.branched_convs_input = branched_convs_input # The receptive field of the branched convs is 17 and so we do not need # to consider inputs that come before that to compute the final position. # TODO(davidso): Create an ExtendStep method for branched_convs to make this # more efficient. inputs_length = tf.minimum(tf.shape(branched_convs_input)[0], 17) branched_convs_input = branched_convs_input[-inputs_length:, :, :] branched_convs_input = tf.transpose(branched_convs_input, [1, 0, 2]) hidden_state = self.branched_convs.FProp(theta.branched_convs, branched_convs_input, None) hidden_state = tf.transpose(hidden_state, [1, 0, 2]) transformer_layer_input = tf.squeeze(hidden_state[-1, :, :]) transformer_layer_states = prefix_states.transformer_layer_states (hidden_state, atten_prob, transformer_layer_states) = self.transformer_layer.ExtendStep( theta.transformer_layer, transformer_layer_input, transformer_layer_states, aux_vecs=aux_vecs, aux_paddings=aux_paddings, t=t) new_states.transformer_layer_states = transformer_layer_states return hidden_state, atten_prob, new_states class StyleLayer(base_layer.BaseLayer): """A layer that performs weighted style emb lookup.""" @classmethod def Params(cls): p = super(StyleLayer, cls).Params() p.Define('input_dim', 0, 'Dimension of the input.') p.Define('output_dim', 0, 'Dimension of the output.') p.Define('num_styles', 0, 'Num of styles.') p.Define('num_heads', 4, 'Number of attention heads.') p.Define( 'enable_ctx_post_proj', True, 'If True, computed context is post projected into' ' ctx_post_proj_dim.') return p @base_layer.initializer def __init__(self, params): super(StyleLayer, self).__init__(params) p = self.params assert p.num_styles > 0 assert p.input_dim > 0 assert p.output_dim > 0 with tf.variable_scope(p.name): # The styles table. w_shape = [p.num_styles, 1, p.output_dim] w_init = py_utils.WeightInit.Gaussian(scale=1.0, seed=p.random_seed) w_pc = py_utils.WeightParams( shape=w_shape, init=w_init, dtype=p.dtype, collections=[self.__class__.__name__ + '_vars']) self.CreateVariable('styles_w', w_pc) # Lastly the attention module. atten_p = attention.MultiHeadedAttention.Params().Set( source_dim=p.output_dim, context_dim=p.output_dim, hidden_dim=p.output_dim, query_dim=p.input_dim, ctx_post_proj_dim=p.output_dim, num_attention_heads=p.num_heads, use_source_vec_as_attention_value=False, enable_ctx_post_proj=p.enable_ctx_post_proj) self.CreateChild('atten', atten_p) def EmbLookup(self, theta, ids): """Looks up style embedding vectors for ids only for test purpose. Args: theta: Named tuple with the weight matrix for the embedding. ids: A rank-N int32 tensor. Returns: embs, A rank-(N+1) params.dtype tensor. embs[indices, :] is the embedding vector for ids[indices]. """ p = self.params # TODO(ngyuzh): call this function for virsualize big discrete table, # e.g. num_styles > 2^10. embs = tf.nn.embedding_lookup(theta.styles_w, tf.reshape(ids, [-1])) out_shape = tf.concat([tf.shape(ids), [p.output_dim]], 0) return tf.reshape(tf.nn.tanh(embs), out_shape) def StyleEmbFromProbs(self, theta, inp): """Look up style embedding based on feedin probabilities. Args: theta: params for this layer and its sub-layers. inp: attention probabilities of shape [batch_size, num_styles]. Returns: style_emb - weighted combined style embedding based on inp. """ p = self.params b_size = tf.shape(inp)[0] styles_w = tf.tile(tf.nn.tanh(theta.styles_w), [1, b_size, 1]) styles_paddings = tf.zeros([p.num_styles, b_size], dtype=py_utils.FPropDtype(p)) atten_probs = tf.tile(tf.expand_dims(inp, 1), [1, p.num_heads, 1]) atten_probs = tf.reshape(atten_probs, [-1, p.num_styles]) packed_src = self.atten.InitForSourcePacked(theta.atten, styles_w, styles_w, styles_paddings) style_emb, _ = self.atten.ComputeContextVectorWithAttenProbs( theta.atten, packed_src.source_contexts, atten_probs) return style_emb def FProp(self, theta, inp): """Look up style embedding.""" p = self.params b_size = tf.shape(inp)[0] styles_w = tf.tile(tf.nn.tanh(theta.styles_w), [1, b_size, 1]) styles_paddings = tf.zeros([p.num_styles, b_size], dtype=py_utils.FPropDtype(p)) packed_src = self.atten.InitForSourcePacked(theta.atten, styles_w, styles_w, styles_paddings) style_emb, probs, _ = self.atten.ComputeContextVectorWithSource( theta.atten, packed_src, inp) # TODO(yonghui): Extract and return the attention probabilities. return style_emb, probs class TransformerLayerWithMultitaskAdapters(TransformerLayer): """Transformer Layer with multitask residual adapters. Applies transformer layer, followed by multitask adapters. Requires an additional input specifying the task_id for each input. """ @classmethod def Params(cls): p = super(TransformerLayerWithMultitaskAdapters, cls).Params() p.Define('adapter_tpl', layers.MultitaskAdapterLayer.Params(), 'Template to use for multitask adapters.') return p @base_layer.initializer def __init__(self, params): super(TransformerLayerWithMultitaskAdapters, self).__init__(params) p = self.params with tf.variable_scope(p.name): params = p.adapter_tpl.Copy() params.name = 'adapters' self.CreateChild('adapters', params) def FProp(self, theta, source_vecs, source_paddings, aux_vecs=None, aux_paddings=None, source_segment_id=None, aux_segment_id=None, source_task_id=None): """Transformer Layer with multitask adapters. First applies the standard transformer layer. Then applies adapter layers. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_time, source_batch, dim]. source_paddings: [source_time, source_batch] aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] source_segment_id: [source_time, source_batch] aux_segment_id: [aux_time, aux_batch] source_task_id: [source_time, source_batch] Returns: The attention context vector, [source_time, source_batch, dim]. The attention probability vector, [source_time, source_batch, source_time] if has_aux_atten is False, otherwise [source_time, source_batch, aux_time]. """ p = self.params hidden, atten_prob = super(TransformerLayerWithMultitaskAdapters, self).FProp(theta, source_vecs, source_paddings, aux_vecs, aux_paddings, source_segment_id, aux_segment_id) # Assumes the same task_id for the entire sequence during eval or when # not using packed_input. if not p.packed_input and not self.do_eval: source_task_id = source_task_id[0, :] hidden = self.adapters.FProp(theta.adapters, hidden, source_task_id) return hidden, atten_prob def ExtendStep(self, theta, source_vecs, prefix_states, aux_vecs=None, aux_paddings=None, timestep=None, source_task_id=None): """Transformer Layer with adapters, extend one step in decoding. Applies TransformerLayer.ExtendStep, then applies adapters. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_batch, dim]. prefix_states: dict, containing tensors which are the results of previous attentions, used for fast decoding. aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] timestep: a scalar, the current time step, 0-based. source_task_id: [source_batch] Returns: The attention context vector, [target_batch, source_dim] The attention probability vector, [source_time, target_batch] Updated prefix states """ p = self.params if p.has_aux_atten: assert aux_vecs is not None assert aux_paddings is not None batch_size = tf.shape(source_vecs)[0] # First the self-attention layer. atten_vec, atten_prob, new_states = self.self_atten.ExtendStep( theta.self_atten, source_vecs, prefix_states, timestep) atten_vec = tf.expand_dims(atten_vec, axis=0) # Next the source attention layer. if p.has_aux_atten: atten_vec, atten_prob = self.atten.FProp(theta.atten, atten_vec, aux_paddings, aux_vecs) # Finally, the feedforward layer. hidden = self.fflayer.FProp( theta.fflayer, atten_vec, tf.zeros([1, batch_size], dtype=py_utils.FPropDtype(p))) # Now adapter layers. hidden = self.adapters.FProp(theta.adapters, hidden, source_task_id) hidden = tf.squeeze(hidden, 0) return hidden, atten_prob, new_states # TODO(ankurbpn): Implementation is slightly different from the original. # In the original implementation the KV projection outputs were explicitly # zeroed out by the gating networks. Here we control the inputs instead. # Verify if this still works as well as the original implementation. class CCTAttentionLayer(base_layer.BaseLayer): """Multi-headed attention, add and norm used by 'Attention Is All You Need'. Supports CCT attention gating as in the paper here: https://arxiv.org/abs/2002.07106 """ @classmethod def Params(cls): p = super(CCTAttentionLayer, cls).Params() # Transformer Attention params. p.Define('source_dim', 0, 'Dimension of the transformer block input.') p.Define('context_dim', 0, 'Dimension of the attention contexts.') p.Define('atten_hidden_dim', 0, 'Dimension of the attention hidden dim.') p.Define('num_attention_heads', 8, 'Number of attention heads.') p.Define('is_masked', False, 'If set, uses masked MultiHeadedAttention.') p.Define( 'mask_type', 'future', 'Type of attention mask if `is_masked` is' 'set. Either "future" for masking out attention to future' 'positions or "eye" for masking out the token itself.') p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params') p.Define( 'atten_tpl', attention.MultiHeadedAttention.Params().Set( use_source_vec_as_attention_value=False, enable_ctx_post_proj=True), 'Multi-Headed Dot-Attention default params') p.Define( 'atten_dropout_prob', 0.0, 'Probability at which we apply dropout to the attention probs. ' 'This practically drops memory values at random positions.') p.Define( 'residual_dropout_prob', 0.0, 'Probability at which we apply dropout to the residual layers, ' 'such that, residual(x, y) = (x + dropout(y)).') p.Define( 'residual_dropout_tpl', layers.DropoutLayer.Params(), 'Residual dropout params template. keep_prop will be reset to ' '(1.0 - residual_dropout_prob).') p.Define('packed_input', False, 'If True, each training example may pack multiple sequences.') p.Define('add_unnormalized_input', False, 'If set, uses unnormalized input ' 'in the residual add.') # CCT params. p.Define('gating_tpl', layers.CCTGatingNetwork.Params(), '') return p @base_layer.initializer def __init__(self, params): super(CCTAttentionLayer, self).__init__(params) p = self.params assert p.name assert p.source_dim if not p.atten_hidden_dim: p.atten_hidden_dim = p.source_dim if not p.context_dim: p.context_dim = p.source_dim if p.is_masked: assert p.mask_type in ['future', 'eye'] with tf.variable_scope(p.name): # Initialize multi-headed attention params = p.atten_tpl.Copy() params.name = 'multihead_atten' params.source_dim = p.source_dim params.query_dim = p.source_dim params.hidden_dim = p.atten_hidden_dim params.context_dim = p.context_dim params.ctx_post_proj_dim = p.source_dim params.num_attention_heads = p.num_attention_heads params.atten_dropout_prob = p.atten_dropout_prob params.packed_input = p.packed_input self.CreateChild('atten', params) dropout_tpl = p.residual_dropout_tpl.Copy() dropout_tpl.keep_prob = (1.0 - p.residual_dropout_prob) self.CreateChild('residual_dropout', dropout_tpl) # Initialize attention layer norm params = p.ln_tpl.Copy() params.name = 'atten_ln' params.input_dim = p.source_dim self.CreateChild('layer_norm', params) # CCT specific operations. ff_gating = p.gating_tpl.Copy() ff_gating.input_dim = p.source_dim ff_gating.num_outputs = 1 ff_gating.name = 'query_gating_net' self.CreateChild('query_gating', ff_gating) ff_gating = p.gating_tpl.Copy() ff_gating.input_dim = p.source_dim ff_gating.num_outputs = 1 ff_gating.name = 'kv_gating_net' self.CreateChild('kv_gating', ff_gating) # Initialize source_vec layer norm params = p.ln_tpl.Copy() params.name = 'source_ln' params.input_dim = p.source_dim self.CreateChild('source_layer_norm', params) # Initialize ctx_vec layer norm params = p.ln_tpl.Copy() params.name = 'ctx_ln' params.input_dim = p.source_dim self.CreateChild('ctx_layer_norm', params) def FProp(self, theta, query_vec, source_paddings, source_vecs=None, query_segment_id=None, source_segment_id=None, **kwargs): """CCT attention, residual and normalization layer. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_time, target_batch, dim] source_paddings: [source_time, source_batch] source_vecs: [source_time, source_batch, dim]. query_segment_id: [target_time, target_batch] source_segment_id: [source_time, source_batch] **kwargs: Can be optional params for the attention layer, eg. attention projection index tensor. Returns: (output, atten_probs). output is of shape [target_time, target_batch, context_dim], atten_probs is of shape [target_time, target_batch, source_time]. """ p = self.params unnormalized_query_vec = query_vec query_vec = self.layer_norm.FProp(theta.layer_norm, query_vec) if source_vecs is None: # For self-attention: keys = queries. source_vecs = query_vec source_segment_id = query_segment_id else: source_vecs = self.source_layer_norm.FProp(theta.source_layer_norm, source_vecs) # Gating the query computation. query_p_c = self.query_gating.FProp(theta.query_gating, query_vec) source_p_c = self.kv_gating.FProp(theta.kv_gating, source_vecs) source_vecs *= source_p_c # Gate the source vectors. if p.is_masked: assert source_vecs is not None query_vec = py_utils.with_dependencies([ py_utils.assert_shape_match( tf.shape(source_vecs), tf.shape(query_vec)) ], query_vec) # Prepares mask for self-attention # [time, time] target_time = tf.shape(query_vec)[0] target_bs = tf.shape(query_vec)[1] if p.mask_type == 'future': padding = 1.0 - tf.linalg.band_part( tf.ones([target_time, target_time], dtype=py_utils.FPropDtype(p)), -1, 0) elif p.mask_type == 'eye': padding = tf.eye(target_time, target_time, dtype=py_utils.FPropDtype(p)) # [time, batch, time] causal_padding = tf.tile(tf.expand_dims(padding, 1), [1, target_bs, 1]) causal_padding = tf.reshape(causal_padding, [-1, target_time]) else: causal_padding = None query_dim = tf.shape(query_vec)[-1] # Projects keys and values. packed_src = self.atten.PackSource( theta=theta.atten, source_vecs=source_vecs, # keys source_contexts=source_vecs, # values source_padding=source_paddings, source_segment_id=source_segment_id) if query_segment_id is not None: query_segment_id = tf.reshape(query_segment_id, [-1]) ctx_vec, atten_prob, _ = self.atten.ComputeContextVectorWithSource( theta=theta.atten, packed_src=packed_src, query_vec=tf.reshape(query_vec, [-1, query_dim]), per_step_source_padding=causal_padding, query_segment_id=query_segment_id, **kwargs) # Gating operations ctx_vec = query_p_c * tf.reshape( self.ctx_layer_norm.FProp(theta.ctx_layer_norm, ctx_vec), tf.shape(query_vec)) ctx_vec = self.residual_dropout.FProp(theta.residual_dropout, ctx_vec) input_to_add = ( unnormalized_query_vec if p.add_unnormalized_input else query_vec) h = input_to_add + ctx_vec atten_prob = tf.reshape(atten_prob, [ tf.shape(query_vec)[0], tf.shape(query_vec)[1], tf.shape(source_vecs)[0] ]) return h, atten_prob, query_p_c, source_p_c def _FinishExtendStep(self, theta, query_vec, unnormalized_query_vec, extended_packed_src, t=None): """Finish extending prefix by one more time step. Isolating this function from ExtendStep allows generalizing self-attention to causal attention on other inputs. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_batch, dim] unnormalized_query_vec: [target_batch, dim] extended_packed_src: A `.NestedMap` object containing source_vecs, source_contexts, source_paddings, and source_segment_ids t: a scalar, the current time step, 0-based. Returns: A triplet (cur_output, atten_prob, new_state) where cur_output is a tensor representing the output from the current state, and new_state is the new state `.NestedMap`. """ p = self.params # Gating operations query_p_c = self.query_gating.FProp(theta.query_gating, query_vec) if t is not None: source_seq_len = tf.shape(extended_packed_src.source_vecs)[0] zero_padding = tf.fill([source_seq_len], tf.constant(0.0, dtype=query_vec.dtype)) per_step_source_padding = tf.where( tf.less(tf.range(source_seq_len), tf.fill([source_seq_len], t + 1)), zero_padding, tf.ones_like(zero_padding, dtype=query_vec.dtype)) query_batch_size = tf.shape(query_vec)[0] per_step_source_padding = tf.tile( tf.expand_dims(per_step_source_padding, axis=0), [query_batch_size, 1]) else: per_step_source_padding = None ctx_vec, atten_prob, _ = self.atten.ComputeContextVectorWithCachedSource( theta.atten, extended_packed_src, query_vec, per_step_source_padding=per_step_source_padding) # Gating operations ctx_vec = self.ctx_layer_norm.FProp(theta.ctx_layer_norm, ctx_vec) ctx_vec = query_p_c * tf.reshape(ctx_vec, tf.shape(query_vec)) ctx_vec = self.residual_dropout.FProp(theta.residual_dropout, ctx_vec) input_to_add = ( unnormalized_query_vec if p.add_unnormalized_input else query_vec) h = input_to_add + ctx_vec new_states = py_utils.NestedMap( key=extended_packed_src.source_vecs, value=extended_packed_src.source_contexts) return h, atten_prob, new_states def ExtendStep(self, theta, query_vec, prefix_state, t=None): """Extend prefix by one more time step. This function is expected to be called during fast decoding of the Transformer model. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. query_vec: [target_batch, dim] prefix_state: dict, containing tensors which are the results of previous attentions, used for fast decoding. t: a scalar, the current time step, 0-based. Returns: A triplet (cur_output, atten_prob, new_state) where cur_output is a tensor representing the output from the current state, and new_state is the new state `.NestedMap`. """ p = self.params assert p.is_masked # Must be causal attention. # Gating operations unnormalized_query_vec = query_vec query_vec = self.layer_norm.FProp(theta.layer_norm, query_vec) source_p_c = self.kv_gating.FProp(theta.kv_gating, query_vec) source_vec = source_p_c * query_vec cached_packed_src = py_utils.NestedMap( source_vecs=prefix_state.key, source_contexts=prefix_state.value, source_padding=None, source_segment_id=None) extended_packed_src = self.atten.ExtendSourcePacked(theta.atten, source_vec, source_vec, None, None, cached_packed_src, t) return self._FinishExtendStep(theta, query_vec, unnormalized_query_vec, extended_packed_src, t) class CCTFeedForwardLayer(base_layer.BaseLayer): """Transformer FF layer with CCT gating. https://arxiv.org/abs/2002.07106 Differences from standard Transformer FF layer: 1. Each feedforward layer is divided into num_blocks smaller layers (divided along the hidden dimension). 2. Each block has its separate input layer norm. 3. Each block has its separate output layer norm. 4. Outputs from each block are gated with CCTGatingNetwork output - which is between 0 and 1 for training and either 0 or 1 during inference. """ @classmethod def Params(cls): p = super(CCTFeedForwardLayer, cls).Params() # Transformer Feedforward params. p.Define('input_dim', 0, 'Dimension of the layer input.') p.Define('output_dim', 0, 'Dimension of the layer output.') # Deprecated. p.Define('hidden_dim', 0, 'Dimension of the hidden layer.') p.Define('ln_tpl', layers.LayerNorm.Params(), 'Layer norm default params') p.Define('activation', 'RELU', 'Non-linearity.') p.Define('fflayer_tpl', layers.FeedForwardNet.Params().Set(activation=['RELU', 'NONE']), 'Feed forward layer default params') p.Define( 'res_proj_tpl', layers.ProjectionLayer.Params(), 'Residual projection default params, used when input_dim != ' 'output_dim.') p.Define( 'residual_dropout_prob', 0.0, 'Probability at which we apply dropout to the residual layers, ' 'such that, residual(x, y) = (x + dropout(y)).') p.Define( 'residual_dropout_tpl', layers.DropoutLayer.Params(), 'Residual dropout params template. keep_prop will be reset to ' '(1.0 - residual_dropout_prob).') p.Define( 'relu_dropout_prob', 0.0, 'Probability at which we apply dropout to the hidden layer ' 'of feed-forward network.') # Expert params. p.Define('num_blocks', 1, 'Number of separately gated ff blocks.') p.Define('gating_tpl', layers.CCTGatingNetwork.Params(), 'gating template.') return p @base_layer.initializer def __init__(self, params): super(CCTFeedForwardLayer, self).__init__(params) p = self.params assert p.name assert p.input_dim assert p.hidden_dim assert not p.output_dim, 'output_dim should not be set.' with tf.variable_scope(p.name): # Initialize feed-forward layer params = p.fflayer_tpl.Copy() params.name = 'fflayer' params.input_dim = p.input_dim params.activation = [p.activation, 'NONE'] if p.output_dim == 0: params.hidden_layer_dims = [p.hidden_dim, p.input_dim] else: params.hidden_layer_dims = [p.hidden_dim, p.output_dim] params.dropout = [ params.dropout.cls.Params().Set(keep_prob=1.0 - p.relu_dropout_prob), params.dropout.cls.Params().Set(keep_prob=1.0) ] ffs = [] ln_params = [] out_layer_norm = [] # Required for stabilizing CCT. for i in range(p.num_blocks): ff_p = params.Copy() ff_p.name += '_%d' % i ffs.append(ff_p) ln_p = p.ln_tpl.Copy() ln_p.name = 'fflayer_ln_%d' % i ln_p.input_dim = p.input_dim ln_params.append(ln_p) ln_p = p.ln_tpl.Copy() ln_p.name = 'fflayer_ln_out_%d' % i ln_p.input_dim = p.input_dim out_layer_norm.append(ln_p) self.CreateChildren('fflayers', ffs) self.CreateChildren('layer_norm', ln_params) self.CreateChildren('out_layer_norm', out_layer_norm) # Note: Set gating noise and warmup in parent layer. ff_gating = p.gating_tpl.Copy() ff_gating.input_dim = p.input_dim ff_gating.num_outputs = p.num_blocks ff_gating.name = 'gating_net' self.CreateChild('ff_gating', ff_gating) dropout_tpl = p.residual_dropout_tpl.Copy() dropout_tpl.keep_prob = (1.0 - p.residual_dropout_prob) self.CreateChild('residual_dropout', dropout_tpl) def FProp(self, theta, inputs, paddings): """Feed-forward, layer-norm, residual, gating and layer-norm. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. inputs: [time, batch, dim]. paddings: [time, batch] Returns: tensor of the same shape with inputs """ p = self.params ff_outputs = [] for i in range(p.num_blocks): inputs_normalized = self.layer_norm[i].FProp(theta.layer_norm[i], inputs) ff_output = self.fflayers[i].FProp( theta.fflayers[i], inputs_normalized, paddings=tf.expand_dims(paddings, -1)) ff_output = self.out_layer_norm[i].FProp(theta.out_layer_norm[i], ff_output) ff_outputs.append(ff_output) p_c = self.ff_gating.FProp(theta.ff_gating, inputs_normalized) out = inputs + self.residual_dropout.FProp( theta.residual_dropout, tf.reduce_sum( tf.expand_dims(p_c, -1) * tf.stack(ff_outputs, -2), axis=-2)) return out, p_c class TransformerWithContextLayer(base_layer.BaseLayer): """A transformer layer with 3 attention layers. The same as layers_with_attention.TransformerLayer, but with an additional attention layer to attend to a third transformer stack representing context. self-attention => context attention (newly added as tertiary_atten) => encoder attention (named aux_atten in TransformerLayer). The weights are *not* shared between these three attention layers. See https://arxiv.org/pdf/1810.03581.pdf """ @classmethod def Params(cls): p = super(TransformerWithContextLayer, cls).Params() p.Define('source_dim', 0, 'Dimension of the transformer block input.') p.Define('output_dim', 0, 'Dimension of the transformer block output.') p.Define( 'tr_atten_tpl', TransformerAttentionLayer.Params().Set(num_attention_heads=8), 'Transformer Attention Layer params. The same template is applied ' 'to all three attention layers.') p.Define('tr_fflayer_tpl', TransformerFeedForwardLayer.Params().Set(hidden_dim=2048), 'Transformer Feed-Forward Layer params.') p.Define('packed_input', False, 'If True, each training example may pack multiple sequences.') # removed: p.has_aux_atten and p.mask_self_atten: they are always True, # removed: p.num_aux_atten_post_proj, p.tr_post_ln_tpl return p @base_layer.initializer def __init__(self, params): super(TransformerWithContextLayer, self).__init__(params) p = self.params if not p.source_dim: raise ValueError('p.source_dim not set') with tf.variable_scope(p.name): # Initialize multi-headed self-attention params = p.tr_atten_tpl.Copy() params.name = 'multihead_self_atten' params.source_dim = p.source_dim params.packed_input = p.packed_input params.is_masked = True self.CreateChild('self_atten', params) # Initialize tertiary attention. params = p.tr_atten_tpl.Copy() params.name = 'tertiary_multihead_atten' params.source_dim = p.source_dim params.packed_input = p.packed_input self.CreateChild('tertiary_atten', params) # Initialize multi-headed encoder attention params = p.tr_atten_tpl.Copy() params.name = 'multihead_atten' params.source_dim = p.source_dim params.packed_input = p.packed_input self.CreateChild('atten', params) # Initialize feed-forward layer params = p.tr_fflayer_tpl.Copy() params.name = 'tr_fflayer' params.input_dim = p.source_dim params.output_dim = p.output_dim self.CreateChild('fflayer', params) def FProp(self, theta, source_vecs, source_paddings, aux_vecs, aux_paddings, tertiary_vecs, tertiary_paddings, source_segment_id=None, aux_segment_id=None, tertiary_segment_id=None): """Transformer Layer. Please see docstring of TransformerAttentionLayer.FProp. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_time, source_batch, dim]. source_paddings: [source_time, source_batch] aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] tertiary_vecs: [tertiary_time, tertiary_batch, dim] tertiary_paddings: [tertiary_time, tertiary_batch] source_segment_id: [source_time, source_batch] aux_segment_id: [aux_time, aux_batch] tertiary_segment_id: [tertiary_time, tertiary_batch] Returns: The attention context vector, [source_time, source_batch, dim]. The attention probability vector, [source_time, source_batch, aux_time]. """ p = self.params if p.packed_input: assert source_segment_id is not None, ('Need to specify segment id for ' 'packed input.') assert aux_segment_id is not None, ('Need to specify segment id for ' 'packed input.') assert tertiary_segment_id is not None, ('Need to specify segment id for ' 'packed input.') atten_vec, atten_prob = self.self_atten.FProp( theta.self_atten, source_vecs, source_paddings, query_segment_id=source_segment_id) atten_vec, atten_prob = self.tertiary_atten.FProp( theta.tertiary_atten, atten_vec, tertiary_paddings, tertiary_vecs, source_segment_id, tertiary_segment_id) atten_vec, atten_prob = self.atten.FProp(theta.atten, atten_vec, aux_paddings, aux_vecs, source_segment_id, aux_segment_id) h = self.fflayer.FProp(theta.fflayer, atten_vec, source_paddings) return h, atten_prob def ExtendStep(self, theta, source_vecs, prefix_states, aux_vecs, aux_paddings, tertiary_vecs, tertiary_paddings, t=None): """Transformer Layer, extend one step in decoding. Please see docstring of TransformerAttentionLayer.ExtendStep. Args: theta: A `.NestedMap` object containing weights' values of this layer and its children layers. source_vecs: [source_batch, dim]. prefix_states: dict, containing tensors which are the results of previous attentions, used for fast decoding. aux_vecs: [aux_time, aux_batch, dim] aux_paddings: [aux_time, aux_batch] tertiary_vecs=None, tertiary_paddings=None, tertiary_vecs: [tertiary_time, tertiary_batch, dim] tertiary_paddings: [tertiary_time, tertiary_batch] t: a scalar, the current time step, 0-based. Returns: The attention context vector, [target_batch, source_dim] The attention probability vector from the encoder attention layer (the last attention layer) only, [source_time, target_batch]. TODO(zhouwk): Return also the attention prob from the tertiary attention. Updated prefix states """ p = self.params batch_size = py_utils.GetShape(source_vecs)[0] # First the self-attention layer. atten_vec, _, new_states = self.self_atten.ExtendStep( theta.self_atten, source_vecs, prefix_states, t) # Next the context attention (tertiary_atten) layer. atten_vec = tf.expand_dims(atten_vec, axis=0) atten_vec, _ = self.tertiary_atten.FProp(theta.tertiary_atten, atten_vec, tertiary_paddings, tertiary_vecs) # Next the source attention (aux_atten) layer. atten_vec, atten_prob = self.atten.FProp(theta.atten, atten_vec, aux_paddings, aux_vecs) # Finally, the feedforward layer. h = self.fflayer.FProp( theta.fflayer, atten_vec, tf.zeros([1, batch_size], dtype=py_utils.FPropDtype(p))) h = tf.squeeze(h, 0) return h, atten_prob, new_states
mlperf/training_results_v0.7
Google/benchmarks/transformer/implementations/transformer-research-TF-tpu-v4-512/lingvo/core/layers_with_attention.py
Python
apache-2.0
85,989
[ "Gaussian" ]
d352f3c32233430ddd270f727fbc142f7e9898ee0e9cb178bcf82e3b0c4b8c02
from rpython.rtyper.lltypesystem.lltype import (Struct, Array, FixedSizeArray, FuncType, typeOf, GcStruct, GcArray, RttiStruct, ContainerType, parentlink, Void, OpaqueType, Float, RuntimeTypeInfo, getRuntimeTypeInfo, Char, _subarray) from rpython.rtyper.lltypesystem import llmemory, llgroup from rpython.translator.c.funcgen import FunctionCodeGenerator from rpython.translator.c.external import CExternalFunctionCodeGenerator from rpython.translator.c.support import USESLOTS # set to False if necessary while refactoring from rpython.translator.c.support import cdecl, forward_cdecl, somelettersfrom from rpython.translator.c.support import c_char_array_constant, barebonearray from rpython.translator.c.primitive import PrimitiveType, name_signed from rpython.rlib import exports from rpython.rlib.rfloat import isfinite, isinf def needs_gcheader(T): if not isinstance(T, ContainerType): return False if T._gckind != 'gc': return False if isinstance(T, GcStruct): if T._first_struct() != (None, None): return False # gcheader already in the first field return True class Node(object): __slots__ = ("db", ) def __init__(self, db): self.db = db class NodeWithDependencies(Node): __slots__ = ("dependencies", ) def __init__(self, db): Node.__init__(self, db) self.dependencies = set() class StructDefNode(NodeWithDependencies): typetag = 'struct' extra_union_for_varlength = True def __init__(self, db, STRUCT, varlength=None): NodeWithDependencies.__init__(self, db) self.STRUCT = STRUCT self.LLTYPE = STRUCT self.varlength = varlength if varlength is None: basename = STRUCT._name with_number = True else: basename = db.gettypedefnode(STRUCT).barename basename = '%s_len%d' % (basename, varlength) with_number = False if STRUCT._hints.get('union'): self.typetag = 'union' assert STRUCT._gckind == 'raw' # not supported: "GcUnion" if STRUCT._hints.get('typedef'): self.typetag = '' assert STRUCT._hints.get('external') if self.STRUCT._hints.get('external'): # XXX hack self.forward_decl = None if STRUCT._hints.get('c_name'): self.barename = self.name = STRUCT._hints['c_name'] self.c_struct_field_name = self.verbatim_field_name else: (self.barename, self.name) = db.namespace.uniquename(basename, with_number=with_number, bare=True) self.prefix = somelettersfrom(STRUCT._name) + '_' # self.fieldnames = STRUCT._names if STRUCT._hints.get('typeptr', False): if db.gcpolicy.need_no_typeptr(): assert self.fieldnames == ('typeptr',) self.fieldnames = () # self.fulltypename = '%s %s @' % (self.typetag, self.name) def setup(self): # this computes self.fields if self.STRUCT._hints.get('external'): # XXX hack self.fields = None # external definition only return self.fields = [] db = self.db STRUCT = self.STRUCT if self.varlength is not None: self.normalizedtypename = db.gettype(STRUCT, who_asks=self) if needs_gcheader(self.STRUCT): HDR = db.gcpolicy.struct_gcheader_definition(self) if HDR is not None: gc_field = ("_gcheader", db.gettype(HDR, who_asks=self)) self.fields.append(gc_field) for name in self.fieldnames: T = self.c_struct_field_type(name) if name == STRUCT._arrayfld: typename = db.gettype(T, varlength=self.varlength, who_asks=self) else: typename = db.gettype(T, who_asks=self) self.fields.append((self.c_struct_field_name(name), typename)) self.computegcinfo(self.db.gcpolicy) def computegcinfo(self, gcpolicy): # let the gcpolicy do its own setup self.gcinfo = None # unless overwritten below rtti = None STRUCT = self.STRUCT if isinstance(STRUCT, RttiStruct): try: rtti = getRuntimeTypeInfo(STRUCT) except ValueError: pass if self.varlength is None: gcpolicy.struct_setup(self, rtti) return self.gcinfo def gettype(self): return self.fulltypename def c_struct_field_name(self, name): # occasionally overridden in __init__(): # self.c_struct_field_name = self.verbatim_field_name return self.prefix + name def verbatim_field_name(self, name): assert name.startswith('c_') # produced in this way by rffi return name[2:] def c_struct_field_type(self, name): return self.STRUCT._flds[name] def access_expr(self, baseexpr, fldname): fldname = self.c_struct_field_name(fldname) return '%s.%s' % (baseexpr, fldname) def ptr_access_expr(self, baseexpr, fldname, baseexpr_is_const=False): fldname = self.c_struct_field_name(fldname) if baseexpr_is_const: return '%s->%s' % (baseexpr, fldname) return 'RPyField(%s, %s)' % (baseexpr, fldname) def definition(self): if self.fields is None: # external definition only return yield '%s %s {' % (self.typetag, self.name) is_empty = True for name, typename in self.fields: line = '%s;' % cdecl(typename, name) if typename == PrimitiveType[Void]: line = '/* %s */' % line else: if is_empty and typename.endswith('[RPY_VARLENGTH]'): yield '\tRPY_DUMMY_VARLENGTH' is_empty = False yield '\t' + line if is_empty: yield '\t' + 'char _dummy; /* this struct is empty */' yield '};' if self.varlength is not None: assert self.typetag == 'struct' yield 'union %su {' % self.name yield ' struct %s a;' % self.name yield ' %s;' % cdecl(self.normalizedtypename, 'b') yield '};' def visitor_lines(self, prefix, on_field): for name in self.fieldnames: FIELD_T = self.c_struct_field_type(name) cname = self.c_struct_field_name(name) for line in on_field('%s.%s' % (prefix, cname), FIELD_T): yield line def deflength(varlength): if varlength is None: return 'RPY_VARLENGTH' elif varlength == 0: return 'RPY_LENGTH0' else: return varlength class ArrayDefNode(NodeWithDependencies): typetag = 'struct' extra_union_for_varlength = True def __init__(self, db, ARRAY, varlength=None): NodeWithDependencies.__init__(self, db) self.ARRAY = ARRAY self.LLTYPE = ARRAY self.gcfields = [] self.varlength = varlength if varlength is None: basename = 'array' with_number = True else: basename = db.gettypedefnode(ARRAY).barename basename = '%s_len%d' % (basename, varlength) with_number = False (self.barename, self.name) = db.namespace.uniquename(basename, with_number=with_number, bare=True) self.fulltypename = '%s %s @' % (self.typetag, self.name) self.fullptrtypename = '%s %s *@' % (self.typetag, self.name) def setup(self): if hasattr(self, 'itemtypename'): return # setup() was already called, likely by __init__ db = self.db ARRAY = self.ARRAY self.computegcinfo(db.gcpolicy) if self.varlength is not None: self.normalizedtypename = db.gettype(ARRAY, who_asks=self) if needs_gcheader(ARRAY): HDR = db.gcpolicy.array_gcheader_definition(self) if HDR is not None: gc_field = ("_gcheader", db.gettype(HDR, who_asks=self)) self.gcfields.append(gc_field) self.itemtypename = db.gettype(ARRAY.OF, who_asks=self) def computegcinfo(self, gcpolicy): # let the gcpolicy do its own setup self.gcinfo = None # unless overwritten below if self.varlength is None: gcpolicy.array_setup(self) return self.gcinfo def gettype(self): return self.fulltypename def getptrtype(self): return self.fullptrtypename def access_expr(self, baseexpr, index): return '%s.items[%s]' % (baseexpr, index) access_expr_varindex = access_expr def ptr_access_expr(self, baseexpr, index, dummy=False): assert 0 <= index <= sys.maxint, "invalid constant index %r" % (index,) return self.itemindex_access_expr(baseexpr, index) def itemindex_access_expr(self, baseexpr, indexexpr): if self.ARRAY._hints.get('nolength', False): return 'RPyNLenItem(%s, %s)' % (baseexpr, indexexpr) else: return 'RPyItem(%s, %s)' % (baseexpr, indexexpr) def definition(self): yield 'struct %s {' % self.name for fname, typename in self.gcfields: yield '\t' + cdecl(typename, fname) + ';' if not self.ARRAY._hints.get('nolength', False): yield '\tlong length;' line = '%s;' % cdecl(self.itemtypename, 'items[%s]' % deflength(self.varlength)) if self.ARRAY.OF is Void: # strange line = '/* array of void */' if self.ARRAY._hints.get('nolength', False): line = 'char _dummy; ' + line yield '\t' + line yield '};' if self.varlength is not None: yield 'union %su {' % self.name yield ' struct %s a;' % self.name yield ' %s;' % cdecl(self.normalizedtypename, 'b') yield '};' def visitor_lines(self, prefix, on_item): assert self.varlength is None ARRAY = self.ARRAY # we need a unique name for this C variable, or at least one that does # not collide with the expression in 'prefix' i = 0 varname = 'p0' while prefix.find(varname) >= 0: i += 1 varname = 'p%d' % i body = list(on_item('(*%s)' % varname, ARRAY.OF)) if body: yield '{' yield '\t%s = %s.items;' % (cdecl(self.itemtypename, '*' + varname), prefix) yield '\t%s = %s + %s.length;' % (cdecl(self.itemtypename, '*%s_end' % varname), varname, prefix) yield '\twhile (%s != %s_end) {' % (varname, varname) for line in body: yield '\t\t' + line yield '\t\t%s++;' % varname yield '\t}' yield '}' class BareBoneArrayDefNode(NodeWithDependencies): """For 'simple' array types which don't need a length nor GC headers. Implemented directly as a C array instead of a struct with an items field. rffi kind of expects such arrays to be 'bare' C arrays. """ gcinfo = None name = None forward_decl = None extra_union_for_varlength = False def __init__(self, db, ARRAY, varlength=None): NodeWithDependencies.__init__(self, db) self.ARRAY = ARRAY self.LLTYPE = ARRAY self.varlength = varlength contained_type = ARRAY.OF # There is no such thing as an array of voids: # we use a an array of chars instead; only the pointer can be void*. self.itemtypename = db.gettype(contained_type, who_asks=self) self.fulltypename = self.itemtypename.replace('@', '(@)[%s]' % deflength(varlength)) if ARRAY._hints.get("render_as_void"): self.fullptrtypename = 'void *@' else: self.fullptrtypename = self.itemtypename.replace('@', '*@') if ARRAY._hints.get("render_as_const"): self.fullptrtypename = 'const ' + self.fullptrtypename def setup(self): """Array loops are forbidden by ForwardReference.become() because there is no way to declare them in C.""" def gettype(self): return self.fulltypename def getptrtype(self): return self.fullptrtypename def access_expr(self, baseexpr, index): return '%s[%d]' % (baseexpr, index) access_expr_varindex = access_expr def ptr_access_expr(self, baseexpr, index, dummy=False): assert 0 <= index <= sys.maxint, "invalid constant index %r" % (index,) return self.itemindex_access_expr(baseexpr, index) def itemindex_access_expr(self, baseexpr, indexexpr): if self.ARRAY._hints.get("render_as_void"): return 'RPyBareItem((char*)%s, %s)' % (baseexpr, indexexpr) else: return 'RPyBareItem(%s, %s)' % (baseexpr, indexexpr) def definition(self): return [] # no declaration is needed def visitor_lines(self, prefix, on_item): raise Exception("cannot visit C arrays - don't know the length") class FixedSizeArrayDefNode(NodeWithDependencies): gcinfo = None name = None typetag = 'struct' extra_union_for_varlength = False def __init__(self, db, FIXEDARRAY): NodeWithDependencies.__init__(self, db) self.FIXEDARRAY = FIXEDARRAY self.LLTYPE = FIXEDARRAY self.itemtypename = db.gettype(FIXEDARRAY.OF, who_asks=self) self.fulltypename = self.itemtypename.replace('@', '(@)[%d]' % FIXEDARRAY.length) self.fullptrtypename = self.itemtypename.replace('@', '*@') def setup(self): """Loops are forbidden by ForwardReference.become() because there is no way to declare them in C.""" def gettype(self): return self.fulltypename def getptrtype(self): return self.fullptrtypename def access_expr(self, baseexpr, index, dummy=False): if not isinstance(index, int): assert index.startswith('item') index = int(index[4:]) if not (0 <= index < self.FIXEDARRAY.length): raise IndexError("refusing to generate a statically out-of-bounds" " array indexing") return '%s[%d]' % (baseexpr, index) ptr_access_expr = access_expr def access_expr_varindex(self, baseexpr, index): return '%s[%s]' % (baseexpr, index) def itemindex_access_expr(self, baseexpr, indexexpr): return 'RPyFxItem(%s, %s, %d)' % (baseexpr, indexexpr, self.FIXEDARRAY.length) def definition(self): return [] # no declaration is needed def visitor_lines(self, prefix, on_item): FIXEDARRAY = self.FIXEDARRAY # we need a unique name for this C variable, or at least one that does # not collide with the expression in 'prefix' i = 0 varname = 'p0' while prefix.find(varname) >= 0: i += 1 varname = 'p%d' % i body = list(on_item('(*%s)' % varname, FIXEDARRAY.OF)) if body: yield '{' yield '\t%s = %s;' % (cdecl(self.itemtypename, '*' + varname), prefix) yield '\t%s = %s + %d;' % (cdecl(self.itemtypename, '*%s_end' % varname), varname, FIXEDARRAY.length) yield '\twhile (%s != %s_end) {' % (varname, varname) for line in body: yield '\t\t' + line yield '\t\t%s++;' % varname yield '\t}' yield '}' class ExtTypeOpaqueDefNode(NodeWithDependencies): """For OpaqueTypes created with the hint render_structure.""" typetag = 'struct' def __init__(self, db, T): NodeWithDependencies.__init__(self, db) self.T = T self.name = 'RPyOpaque_%s' % (T.tag,) def setup(self): pass def definition(self): return [] # ____________________________________________________________ class ContainerNode(Node): if USESLOTS: # keep the number of slots down! __slots__ = """db obj typename implementationtypename name _funccodegen_owner globalcontainer""".split() eci_name = '_compilation_info' def __init__(self, db, T, obj): Node.__init__(self, db) self.obj = obj self.typename = db.gettype(T) #, who_asks=self) self.implementationtypename = db.gettype( T, varlength=self.getvarlength()) parent, parentindex = parentlink(obj) if obj in exports.EXPORTS_obj2name: self.name = exports.EXPORTS_obj2name[obj] self.globalcontainer = 2 # meh elif parent is None: self.name = db.namespace.uniquename('g_' + self.basename()) self.globalcontainer = True else: self.globalcontainer = False parentnode = db.getcontainernode(parent) defnode = db.gettypedefnode(parentnode.getTYPE()) self.name = defnode.access_expr(parentnode.name, parentindex) if self.typename != self.implementationtypename: if db.gettypedefnode(T).extra_union_for_varlength: self.name += '.b' self._funccodegen_owner = None def getptrname(self): return '(&%s)' % self.name def getTYPE(self): return typeOf(self.obj) def is_thread_local(self): T = self.getTYPE() return hasattr(T, "_hints") and T._hints.get('thread_local') def is_exported(self): return self.globalcontainer == 2 # meh def compilation_info(self): return getattr(self.obj, self.eci_name, None) def get_declaration(self): if self.name[-2:] == '.b': # xxx fish fish assert self.implementationtypename.startswith('struct ') assert self.implementationtypename.endswith(' @') uniontypename = 'union %su @' % self.implementationtypename[7:-2] return uniontypename, self.name[:-2] else: return self.implementationtypename, self.name def forward_declaration(self): if llgroup.member_of_group(self.obj): return type, name = self.get_declaration() yield '%s;' % ( forward_cdecl(type, name, self.db.standalone, is_thread_local=self.is_thread_local(), is_exported=self.is_exported())) def implementation(self): if llgroup.member_of_group(self.obj): return [] lines = list(self.initializationexpr()) type, name = self.get_declaration() if name != self.name and len(lines) < 2: # a union with length 0 lines[0] = cdecl(type, name, self.is_thread_local()) else: if name != self.name: lines[0] = '{ ' + lines[0] # extra braces around the 'a' part lines[-1] += ' }' # of the union lines[0] = '%s = %s' % ( cdecl(type, name, self.is_thread_local()), lines[0]) lines[-1] += ';' return lines def startupcode(self): return [] def getvarlength(self): return None assert not USESLOTS or '__dict__' not in dir(ContainerNode) class StructNode(ContainerNode): nodekind = 'struct' if USESLOTS: __slots__ = () def basename(self): T = self.getTYPE() return T._name def enum_dependencies(self): T = self.getTYPE() for name in T._names: yield getattr(self.obj, name) def getvarlength(self): T = self.getTYPE() if T._arrayfld is None: return None else: array = getattr(self.obj, T._arrayfld) return len(array.items) def initializationexpr(self, decoration=''): T = self.getTYPE() is_empty = True defnode = self.db.gettypedefnode(T) data = [] if needs_gcheader(T): gc_init = self.db.gcpolicy.struct_gcheader_initdata(self) data.append(('gcheader', gc_init)) for name in defnode.fieldnames: data.append((name, getattr(self.obj, name))) # Reasonably, you should only initialise one of the fields of a union # in C. This is possible with the syntax '.fieldname value' or # '.fieldname = value'. But here we don't know which of the # fields need initialization, so XXX we pick the first one # arbitrarily. if hasattr(T, "_hints") and T._hints.get('union'): data = data[0:1] if 'get_padding_drop' in T._hints: d = {} for name, _ in data: T1 = defnode.c_struct_field_type(name) typename = self.db.gettype(T1) d[name] = cdecl(typename, '') padding_drop = T._hints['get_padding_drop'](d) else: padding_drop = [] type, name = self.get_declaration() if name != self.name and self.getvarlength() < 1 and len(data) < 2: # an empty union yield '' return yield '{' for name, value in data: if name in padding_drop: continue c_expr = defnode.access_expr(self.name, name) lines = generic_initializationexpr(self.db, value, c_expr, decoration + name) for line in lines: yield '\t' + line if not lines[0].startswith('/*'): is_empty = False if is_empty: yield '\t%s' % '0,' yield '}' assert not USESLOTS or '__dict__' not in dir(StructNode) class GcStructNodeWithHash(StructNode): # for the outermost level of nested structures, if it has a _hash_cache_. nodekind = 'struct' if USESLOTS: __slots__ = () def get_hash_typename(self): return 'struct _hashT_%s @' % self.name def forward_declaration(self): T = self.getTYPE() assert self.typename == self.implementationtypename # no array part hash_typename = self.get_hash_typename() hash_offset = self.db.gctransformer.get_hash_offset(T) yield '%s {' % cdecl(hash_typename, '') yield '\tunion {' yield '\t\t%s;' % cdecl(self.implementationtypename, 'head') yield '\t\tchar pad[%s];' % name_signed(hash_offset, self.db) yield '\t} u;' yield '\tlong hash;' yield '};' yield '%s;' % ( forward_cdecl(hash_typename, '_hash_' + self.name, self.db.standalone, self.is_thread_local()),) yield '#define %s _hash_%s.u.head' % (self.name, self.name) def implementation(self): hash_typename = self.get_hash_typename() hash = self.db.gcpolicy.get_prebuilt_hash(self.obj) assert hash is not None lines = list(self.initializationexpr()) lines.insert(0, '%s = { {' % ( cdecl(hash_typename, '_hash_' + self.name, self.is_thread_local()),)) lines.append('}, %s /* hash */ };' % name_signed(hash, self.db)) return lines def gcstructnode_factory(db, T, obj): if db.gcpolicy.get_prebuilt_hash(obj) is not None: cls = GcStructNodeWithHash else: cls = StructNode return cls(db, T, obj) class ArrayNode(ContainerNode): nodekind = 'array' if USESLOTS: __slots__ = () def getptrname(self): if barebonearray(self.getTYPE()): return self.name return ContainerNode.getptrname(self) def basename(self): return 'array' def enum_dependencies(self): return self.obj.items def getvarlength(self): return len(self.obj.items) def initializationexpr(self, decoration=''): T = self.getTYPE() yield '{' if needs_gcheader(T): gc_init = self.db.gcpolicy.array_gcheader_initdata(self) lines = generic_initializationexpr(self.db, gc_init, 'gcheader', '%sgcheader' % (decoration,)) for line in lines: yield line if T._hints.get('nolength', False): length = '' else: length = '%d, ' % len(self.obj.items) if T.OF is Void or len(self.obj.items) == 0: yield '\t%s' % length.rstrip(', ') yield '}' elif T.OF == Char: if len(self.obj.items) and self.obj.items[0] is None: s = ''.join([self.obj.getitem(i) for i in range(len(self.obj.items))]) else: s = ''.join(self.obj.items) array_constant = c_char_array_constant(s) if array_constant.startswith('{') and barebonearray(T): assert array_constant.endswith('}') array_constant = array_constant[1:-1].strip() yield '\t%s%s' % (length, array_constant) yield '}' else: barebone = barebonearray(T) if not barebone: yield '\t%s{' % length for j in range(len(self.obj.items)): value = self.obj.items[j] basename = self.name if basename.endswith('.b'): basename = basename[:-2] + '.a' lines = generic_initializationexpr(self.db, value, '%s.items[%d]' % (basename, j), '%s%d' % (decoration, j)) for line in lines: yield '\t' + line if not barebone: yield '} }' else: yield '}' assert not USESLOTS or '__dict__' not in dir(ArrayNode) class FixedSizeArrayNode(ContainerNode): nodekind = 'array' if USESLOTS: __slots__ = () def getptrname(self): if not isinstance(self.obj, _subarray): # XXX hackish return self.name return ContainerNode.getptrname(self) def basename(self): T = self.getTYPE() return T._name def enum_dependencies(self): for i in range(self.obj.getlength()): yield self.obj.getitem(i) def getvarlength(self): return None # not variable-sized! def initializationexpr(self, decoration=''): T = self.getTYPE() assert self.typename == self.implementationtypename # not var-sized yield '{' # _names == ['item0', 'item1', ...] for j, name in enumerate(T._names): value = getattr(self.obj, name) lines = generic_initializationexpr(self.db, value, '%s[%d]' % (self.name, j), '%s%d' % (decoration, j)) for line in lines: yield '\t' + line yield '}' def generic_initializationexpr(db, value, access_expr, decoration): if isinstance(typeOf(value), ContainerType): node = db.getcontainernode(value) lines = list(node.initializationexpr(decoration+'.')) lines[-1] += ',' return lines else: comma = ',' if typeOf(value) == Float and not isfinite(value): db.late_initializations.append(('%s' % access_expr, db.get(value))) if isinf(value): name = '-+'[value > 0] + 'inf' else: name = 'NaN' expr = '0.0 /* patched later with %s */' % (name,) else: expr = db.get(value) if typeOf(value) is Void: comma = '' expr += comma i = expr.find('\n') if i<0: i = len(expr) expr = '%s\t/* %s */%s' % (expr[:i], decoration, expr[i:]) return expr.split('\n') # ____________________________________________________________ class FuncNode(ContainerNode): nodekind = 'func' eci_name = 'compilation_info' # there not so many node of this kind, slots should not # be necessary def __init__(self, db, T, obj, forcename=None): Node.__init__(self, db) self.globalcontainer = True self.T = T self.obj = obj callable = getattr(obj, '_callable', None) if (callable is not None and getattr(callable, 'c_name', None) is not None): self.name = forcename or obj._callable.c_name elif getattr(obj, 'external', None) == 'C' and not db.need_sandboxing(obj): self.name = forcename or self.basename() else: self.name = (forcename or db.namespace.uniquename('g_' + self.basename())) self.make_funcgens() self.typename = db.gettype(T) #, who_asks=self) def getptrname(self): return self.name def make_funcgens(self): self.funcgens = select_function_code_generators(self.obj, self.db, self.name) if self.funcgens: argnames = self.funcgens[0].argnames() #Assume identical for all funcgens self.implementationtypename = self.db.gettype(self.T, argnames=argnames) self._funccodegen_owner = self.funcgens[0] else: self._funccodegen_owner = None def basename(self): return self.obj._name def enum_dependencies(self): if not self.funcgens: return [] return self.funcgens[0].allconstantvalues() #Assume identical for all funcgens def forward_declaration(self): callable = getattr(self.obj, '_callable', None) is_exported = getattr(callable, 'exported_symbol', False) for funcgen in self.funcgens: yield '%s;' % ( forward_cdecl(self.implementationtypename, funcgen.name(self.name), self.db.standalone, is_exported=is_exported)) def implementation(self): for funcgen in self.funcgens: for s in self.funcgen_implementation(funcgen): yield s def graphs_to_patch(self): for funcgen in self.funcgens: for i in funcgen.graphs_to_patch(): yield i def funcgen_implementation(self, funcgen): funcgen.implementation_begin() # recompute implementationtypename as the argnames may have changed argnames = funcgen.argnames() implementationtypename = self.db.gettype(self.T, argnames=argnames) yield '%s {' % cdecl(implementationtypename, funcgen.name(self.name)) # # declare the local variables # localnames = list(funcgen.cfunction_declarations()) lengths = [len(a) for a in localnames] lengths.append(9999) start = 0 while start < len(localnames): # pack the local declarations over as few lines as possible total = lengths[start] + 8 end = start+1 while total + lengths[end] < 77: total += lengths[end] + 1 end += 1 yield '\t' + ' '.join(localnames[start:end]) start = end # # generate the body itself # bodyiter = funcgen.cfunction_body() for line in bodyiter: # performs some formatting on the generated body: # indent normal lines with tabs; indent labels less than the rest if line.endswith(':'): if line.startswith('err'): try: nextline = bodyiter.next() except StopIteration: nextline = '' # merge this 'err:' label with the following line line = '\t%s\t%s' % (line, nextline) else: line = ' ' + line elif line: line = '\t' + line yield line yield '}' del bodyiter funcgen.implementation_end() def sandbox_stub(fnobj, db): # unexpected external function for --sandbox translation: replace it # with a "Not Implemented" stub. To support these functions, port them # to the new style registry (e.g. rpython.module.ll_os.RegisterOs). from rpython.translator.sandbox import rsandbox graph = rsandbox.get_external_function_sandbox_graph(fnobj, db, force_stub=True) return [FunctionCodeGenerator(graph, db)] def sandbox_transform(fnobj, db): # for --sandbox: replace a function like os_open_llimpl() with # code that communicates with the external process to ask it to # perform the operation. from rpython.translator.sandbox import rsandbox graph = rsandbox.get_external_function_sandbox_graph(fnobj, db) return [FunctionCodeGenerator(graph, db)] def select_function_code_generators(fnobj, db, functionname): sandbox = db.need_sandboxing(fnobj) if hasattr(fnobj, 'graph'): if sandbox and sandbox != "if_external": # apply the sandbox transformation return sandbox_transform(fnobj, db) exception_policy = getattr(fnobj, 'exception_policy', None) return [FunctionCodeGenerator(fnobj.graph, db, exception_policy, functionname)] elif getattr(fnobj, 'external', None) is not None: if sandbox: return sandbox_stub(fnobj, db) elif fnobj.external == 'C': return [] else: assert fnobj.external == 'CPython' return [CExternalFunctionCodeGenerator(fnobj, db)] elif hasattr(fnobj._callable, "c_name"): return [] # this case should only be used for entrypoints else: raise ValueError("don't know how to generate code for %r" % (fnobj,)) class ExtType_OpaqueNode(ContainerNode): nodekind = 'rpyopaque' def enum_dependencies(self): return [] def initializationexpr(self, decoration=''): T = self.getTYPE() raise NotImplementedError( 'seeing an unexpected prebuilt object: %s' % (T.tag,)) def startupcode(self): T = self.getTYPE() args = [self.getptrname()] # XXX how to make this code more generic? if T.tag == 'ThreadLock': lock = self.obj.externalobj if lock.locked(): args.append('1') else: args.append('0') yield 'RPyOpaque_SETUP_%s(%s);' % (T.tag, ', '.join(args)) def opaquenode_factory(db, T, obj): if T == RuntimeTypeInfo: return db.gcpolicy.rtti_node_factory()(db, T, obj) if T.hints.get("render_structure", False): return ExtType_OpaqueNode(db, T, obj) raise Exception("don't know about %r" % (T,)) def weakrefnode_factory(db, T, obj): assert isinstance(obj, llmemory._wref) ptarget = obj._dereference() wrapper = db.gcpolicy.convert_weakref_to(ptarget) container = wrapper._obj #obj._converted_weakref = container # hack for genllvm :-/ return db.getcontainernode(container, _dont_write_c_code=False) class GroupNode(ContainerNode): nodekind = 'group' count_members = None def __init__(self, *args): ContainerNode.__init__(self, *args) self.implementationtypename = 'struct group_%s_s @' % self.name def basename(self): return self.obj.name def enum_dependencies(self): # note: for the group used by the GC, it can grow during this phase, # which means that we might not return all members yet. This is fixed # by get_finish_tables() in rpython.memory.gctransform.framework. for member in self.obj.members: yield member._as_ptr() def _fix_members(self): if self.obj.outdated: raise Exception(self.obj.outdated) if self.count_members is None: self.count_members = len(self.obj.members) else: # make sure no new member showed up, because it's too late assert len(self.obj.members) == self.count_members def forward_declaration(self): self._fix_members() yield '' ctype = ['%s {' % cdecl(self.implementationtypename, '')] for i, member in enumerate(self.obj.members): structtypename = self.db.gettype(typeOf(member)) ctype.append('\t%s;' % cdecl(structtypename, 'member%d' % i)) ctype.append('} @') ctype = '\n'.join(ctype) yield '%s;' % ( forward_cdecl(ctype, self.name, self.db.standalone, self.is_thread_local())) yield '#include "src/llgroup.h"' yield 'PYPY_GROUP_CHECK_SIZE(%s)' % (self.name,) for i, member in enumerate(self.obj.members): structnode = self.db.getcontainernode(member) yield '#define %s %s.member%d' % (structnode.name, self.name, i) yield '' def initializationexpr(self): self._fix_members() lines = ['{'] lasti = len(self.obj.members) - 1 for i, member in enumerate(self.obj.members): structnode = self.db.getcontainernode(member) lines1 = list(structnode.initializationexpr()) lines1[0] += '\t/* member%d: %s */' % (i, structnode.name) if i != lasti: lines1[-1] += ',' lines.extend(lines1) lines.append('}') return lines ContainerNodeFactory = { Struct: StructNode, GcStruct: gcstructnode_factory, Array: ArrayNode, GcArray: ArrayNode, FixedSizeArray: FixedSizeArrayNode, FuncType: FuncNode, OpaqueType: opaquenode_factory, llmemory._WeakRefType: weakrefnode_factory, llgroup.GroupType: GroupNode, }
jptomo/rpython-lang-scheme
rpython/translator/c/node.py
Python
mit
38,642
[ "VisIt" ]
7984dc11df831622fbc5d28abd37adf2c6db3e47490067da6639c794f24f01fb
# Copyright 2007-2016 The HyperSpy developers # # This file is part of HyperSpy. # # HyperSpy is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # HyperSpy is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with HyperSpy. If not, see <http://www.gnu.org/licenses/>. import numpy as np import pytest from hyperspy import signals, model from hyperspy.decorators import lazifyTestClass @lazifyTestClass class Test_Estimate_Elastic_Scattering_Threshold: def setup_method(self, method): # Create an empty spectrum s = signals.EELSSpectrum(np.zeros((3, 2, 1024))) energy_axis = s.axes_manager.signal_axes[0] energy_axis.scale = 0.02 energy_axis.offset = -5 gauss = model.components1d.Gaussian() gauss.centre.value = 0 gauss.A.value = 5000 gauss.sigma.value = 0.5 gauss2 = model.components1d.Gaussian() gauss2.sigma.value = 0.5 # Inflexion point 1.5 gauss2.A.value = 5000 gauss2.centre.value = 5 s.data[:] = (gauss.function(energy_axis.axis) + gauss2.function(energy_axis.axis)) self.signal = s def test_min_in_window_with_smoothing(self): s = self.signal thr = s.estimate_elastic_scattering_threshold( window=5, window_length=5, tol=0.00001, ) np.testing.assert_allclose(thr.data, 2.5, atol=10e-3) assert thr.metadata.Signal.signal_type == "" assert thr.axes_manager.signal_dimension == 0 def test_min_in_window_without_smoothing_single_spectrum(self): s = self.signal.inav[0, 0] thr = s.estimate_elastic_scattering_threshold( window=5, window_length=0, tol=0.001, ) np.testing.assert_allclose(thr.data, 2.49, atol=10e-3) def test_min_in_window_without_smoothing(self): s = self.signal thr = s.estimate_elastic_scattering_threshold( window=5, window_length=0, tol=0.001, ) np.testing.assert_allclose(thr.data, 2.49, atol=10e-3) def test_min_not_in_window(self): # If I use a much lower window, this is the value that has to be # returned as threshold. s = self.signal data = s.estimate_elastic_scattering_threshold(window=1.5, tol=0.001, ).data assert np.all(np.isnan(data)) def test_estimate_elastic_scattering_intensity(self): s = self.signal threshold = s.estimate_elastic_scattering_threshold(window=4.) # Threshold is nd signal t = s.estimate_elastic_scattering_intensity(threshold=threshold) assert t.metadata.Signal.signal_type == "" assert t.axes_manager.signal_dimension == 0 np.testing.assert_array_almost_equal(t.data, 249999.985133) # Threshold is signal, 1 spectrum s0 = s.inav[0] t0 = s0.estimate_elastic_scattering_threshold(window=4.) t = s0.estimate_elastic_scattering_intensity(threshold=t0) np.testing.assert_array_almost_equal(t.data, 249999.985133) # Threshold is value t = s.estimate_elastic_scattering_intensity(threshold=2.5) np.testing.assert_array_almost_equal(t.data, 249999.985133) @lazifyTestClass class TestEstimateZLPCentre: def setup_method(self, method): s = signals.EELSSpectrum(np.diag(np.arange(1, 11))) s.axes_manager[-1].scale = 0.1 s.axes_manager[-1].offset = 100 self.signal = s def test_estimate_zero_loss_peak_centre(self): s = self.signal zlpc = s.estimate_zero_loss_peak_centre() np.testing.assert_allclose(zlpc.data, np.arange(100, 101, 0.1)) assert zlpc.metadata.Signal.signal_type == "" assert zlpc.axes_manager.signal_dimension == 0 @lazifyTestClass class TestAlignZLP: def setup_method(self, method): s = signals.EELSSpectrum(np.zeros((10, 100))) self.scale = 0.1 self.offset = -2 eaxis = s.axes_manager.signal_axes[0] eaxis.scale = self.scale eaxis.offset = self.offset self.izlp = eaxis.value2index(0) self.bg = 2 self.ishifts = np.array([0, 4, 2, -2, 5, -2, -5, -9, -9, -8]) self.new_offset = self.offset - self.ishifts.min() * self.scale s.data[np.arange(10), self.ishifts + self.izlp] = 10 s.data += self.bg s.axes_manager[-1].offset += 100 self.signal = s def test_align_zero_loss_peak_calibrate_true(self): s = self.signal s.align_zero_loss_peak( calibrate=True, print_stats=False, show_progressbar=None) zlpc = s.estimate_zero_loss_peak_centre() np.testing.assert_allclose(zlpc.data.mean(), 0) np.testing.assert_allclose(zlpc.data.std(), 0) def test_align_zero_loss_peak_calibrate_true_with_mask(self): s = self.signal mask = s._get_navigation_signal(dtype="bool").T mask.data[[3, 5]] = (True, True) s.align_zero_loss_peak( calibrate=True, print_stats=False, show_progressbar=None, mask=mask) zlpc = s.estimate_zero_loss_peak_centre(mask=mask) np.testing.assert_allclose(np.nanmean(zlpc.data), 0, atol=np.finfo(float).eps) np.testing.assert_allclose(np.nanstd(zlpc.data), 0, atol=np.finfo(float).eps) def test_align_zero_loss_peak_calibrate_false(self): s = self.signal s.align_zero_loss_peak( calibrate=False, print_stats=False, show_progressbar=None) zlpc = s.estimate_zero_loss_peak_centre() np.testing.assert_allclose(zlpc.data.std(), 0, atol=10e-3) def test_also_aligns(self): s = self.signal s2 = s.deepcopy() s.align_zero_loss_peak(calibrate=True, print_stats=False, also_align=[s2], show_progressbar=None) zlpc = s2.estimate_zero_loss_peak_centre() assert zlpc.data.mean() == 0 assert zlpc.data.std() == 0 def test_align_zero_loss_peak_with_spike_signal_range(self): s = self.signal spike = np.zeros((10, 100)) spike_amplitude = 20 spike[:, 75] = spike_amplitude s.data += spike s.align_zero_loss_peak( print_stats=False, subpixel=False, signal_range=(98., 102.)) zlp_max = s.isig[-0.5:0.5].max(-1).data # Max value in the original spectrum is 12, but due to the aligning # the peak is split between two different channels. So 8 is the # maximum value for the aligned spectrum assert np.allclose(zlp_max, 8) def test_align_zero_loss_peak_crop_false(self): s = self.signal original_size = s.axes_manager.signal_axes[0].size s.align_zero_loss_peak( crop=False, print_stats=False, show_progressbar=None) assert original_size == s.axes_manager.signal_axes[0].size @lazifyTestClass class TestPowerLawExtrapolation: def setup_method(self, method): s = signals.EELSSpectrum(0.1 * np.arange(50, 250, 0.5) ** -3.) s.metadata.Signal.binned = False s.axes_manager[-1].offset = 50 s.axes_manager[-1].scale = 0.5 self.s = s def test_unbinned(self): sc = self.s.isig[:300] s = sc.power_law_extrapolation(extrapolation_size=100) np.testing.assert_allclose(s.data, self.s.data, atol=10e-3) def test_binned(self): self.s.data *= self.s.axes_manager[-1].scale self.s.metadata.Signal.binned = True sc = self.s.isig[:300] s = sc.power_law_extrapolation(extrapolation_size=100) np.testing.assert_allclose(s.data, self.s.data, atol=10e-3) @lazifyTestClass class TestFourierRatioDeconvolution: @pytest.mark.parametrize(('extrapolate_lowloss'), [True, False]) def test_running(self, extrapolate_lowloss): s = signals.EELSSpectrum(np.arange(200)) gaussian = model.components1d.Gaussian() gaussian.A.value = 50 gaussian.sigma.value = 10 gaussian.centre.value = 20 s_ll = signals.EELSSpectrum(gaussian.function(np.arange(0, 200, 1))) s_ll.axes_manager[0].offset = -50 s.fourier_ratio_deconvolution(s_ll, extrapolate_lowloss=extrapolate_lowloss) class TestRebin: def setup_method(self, method): # Create an empty spectrum s = signals.EELSSpectrum(np.ones((4, 2, 1024))) self.signal = s def test_rebin_without_dwell_time(self): s = self.signal s.rebin(scale=(2, 2, 1)) def test_rebin_dwell_time(self): s = self.signal s.metadata.add_node("Acquisition_instrument.TEM.Detector.EELS") s_mdEELS = s.metadata.Acquisition_instrument.TEM.Detector.EELS s_mdEELS.dwell_time = 0.1 s_mdEELS.exposure = 0.5 s2 = s.rebin(scale=(2, 2, 8)) s2_mdEELS = s2.metadata.Acquisition_instrument.TEM.Detector.EELS assert s2_mdEELS.dwell_time == (0.1 * 2 * 2) assert s2_mdEELS.exposure == (0.5 * 2 * 2) def test_rebin_exposure(self): s = self.signal s.metadata.exposure = 10.2 s2 = s.rebin(scale=(2, 2, 8)) assert s2.metadata.exposure == (10.2 * 2 * 2) def test_offset_after_rebin(self): s = self.signal s.axes_manager[0].offset = 1 s.axes_manager[1].offset = 2 s.axes_manager[2].offset = 3 s2 = s.rebin(scale=(2, 2, 1)) assert s2.axes_manager[0].offset == 1.5 assert s2.axes_manager[1].offset == 2.5 assert s2.axes_manager[2].offset == s.axes_manager[2].offset
francisco-dlp/hyperspy
hyperspy/tests/signal/test_eels.py
Python
gpl-3.0
10,558
[ "Gaussian" ]
4fd0cba058d49f29d4ac51b1dd3837d47e84347c1cda1f9e3d0037ab7536228f
# # Copyright (C) 2013-2019 The ESPResSo project # # This file is part of ESPResSo. # # ESPResSo is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # import unittest as ut import espressomd import numpy as np class CellSystem(ut.TestCase): system = espressomd.System(box_l=[5.0, 5.0, 5.0]) system.cell_system.skin = 0.0 n_nodes = system.cell_system.get_state()['n_nodes'] def test_cell_system(self): self.system.cell_system.set_n_square(use_verlet_lists=False) s = self.system.cell_system.get_state() self.assertEqual([s['use_verlet_list'], s['type']], [0, "nsquare"]) self.system.cell_system.set_regular_decomposition( use_verlet_lists=True) s = self.system.cell_system.get_state() self.assertEqual( [s['use_verlet_list'], s['type']], [1, "regular_decomposition"]) @ut.skipIf(n_nodes == 1, "Skipping test: only runs for n_nodes >= 2") def test_node_grid(self): self.system.cell_system.set_regular_decomposition() for i in range(3): node_grid_ref = [1, 1, 1] node_grid_ref[i] = self.n_nodes self.system.cell_system.node_grid = node_grid_ref node_grid = self.system.cell_system.get_state()['node_grid'] np.testing.assert_array_equal(node_grid, node_grid_ref) if __name__ == "__main__": ut.main()
espressomd/espresso
testsuite/python/cellsystem.py
Python
gpl-3.0
1,941
[ "ESPResSo" ]
7f45545cd59fae170b5ce4ad29b8f78d5c7698bfc55f6c617e9aef324e327f7a
# -*- coding: utf-8 -*- """Single-dipole functions and classes.""" # Authors: Alexandre Gramfort <alexandre.gramfort@telecom-paristech.fr> # Eric Larson <larson.eric.d@gmail.com> # # License: Simplified BSD from copy import deepcopy from functools import partial import re import numpy as np from scipy import linalg from .cov import read_cov, compute_whitener from .io.constants import FIFF from .io.pick import pick_types, channel_type from .io.proj import make_projector, _needs_eeg_average_ref_proj from .bem import _fit_sphere from .evoked import _read_evoked, _aspect_rev, _write_evokeds from .transforms import _print_coord_trans, _coord_frame_name, apply_trans from .viz.evoked import _plot_evoked from .forward._make_forward import (_get_trans, _setup_bem, _prep_meg_channels, _prep_eeg_channels) from .forward._compute_forward import (_compute_forwards_meeg, _prep_field_computation) from .surface import transform_surface_to, _compute_nearest from .bem import _bem_find_surface, _surf_name from .source_space import (_make_volume_source_space, SourceSpaces, _points_outside_surface) from .parallel import parallel_func from .utils import (logger, verbose, _time_mask, warn, _check_fname, check_fname, _pl, fill_doc, _check_option) @fill_doc class Dipole(object): u"""Dipole class for sequential dipole fits. .. note:: This class should usually not be instantiated directly, instead :func:`mne.read_dipole` should be used. Used to store positions, orientations, amplitudes, times, goodness of fit of dipoles, typically obtained with Neuromag/xfit, mne_dipole_fit or certain inverse solvers. Note that dipole position vectors are given in the head coordinate frame. Parameters ---------- times : array, shape (n_dipoles,) The time instants at which each dipole was fitted (sec). pos : array, shape (n_dipoles, 3) The dipoles positions (m) in head coordinates. amplitude : array, shape (n_dipoles,) The amplitude of the dipoles (Am). ori : array, shape (n_dipoles, 3) The dipole orientations (normalized to unit length). gof : array, shape (n_dipoles,) The goodness of fit. name : str | None Name of the dipole. conf : dict Confidence limits in dipole orientation for "vol" in m^3 (volume), "depth" in m (along the depth axis), "long" in m (longitudinal axis), "trans" in m (transverse axis), "qlong" in Am, and "qtrans" in Am (currents). The current confidence limit in the depth direction is assumed to be zero (although it can be non-zero when a BEM is used). .. versionadded:: 0.15 khi2 : array, shape (n_dipoles,) The χ^2 values for the fits. .. versionadded:: 0.15 nfree : array, shape (n_dipoles,) The number of free parameters for each fit. .. versionadded:: 0.15 %(verbose)s See Also -------- fit_dipole DipoleFixed read_dipole Notes ----- This class is for sequential dipole fits, where the position changes as a function of time. For fixed dipole fits, where the position is fixed as a function of time, use :class:`mne.DipoleFixed`. """ @verbose def __init__(self, times, pos, amplitude, ori, gof, name=None, conf=None, khi2=None, nfree=None, verbose=None): # noqa: D102 self.times = np.array(times) self.pos = np.array(pos) self.amplitude = np.array(amplitude) self.ori = np.array(ori) self.gof = np.array(gof) self.name = name self.conf = deepcopy(conf) if conf is not None else dict() self.khi2 = np.array(khi2) if khi2 is not None else None self.nfree = np.array(nfree) if nfree is not None else None self.verbose = verbose def __repr__(self): # noqa: D105 s = "n_times : %s" % len(self.times) s += ", tmin : %0.3f" % np.min(self.times) s += ", tmax : %0.3f" % np.max(self.times) return "<Dipole | %s>" % s def save(self, fname): """Save dipole in a .dip file. Parameters ---------- fname : str The name of the .dip file. """ # obligatory fields fmt = ' %7.1f %7.1f %8.2f %8.2f %8.2f %8.3f %8.3f %8.3f %8.3f %6.2f' header = ('# begin end X (mm) Y (mm) Z (mm)' ' Q(nAm) Qx(nAm) Qy(nAm) Qz(nAm) g/%') t = self.times[:, np.newaxis] * 1000. gof = self.gof[:, np.newaxis] amp = 1e9 * self.amplitude[:, np.newaxis] out = (t, t, self.pos / 1e-3, amp, self.ori * amp, gof) # optional fields fmts = dict(khi2=(' khi^2', ' %8.1f', 1.), nfree=(' free', ' %5d', 1), vol=(' vol/mm^3', ' %9.3f', 1e9), depth=(' depth/mm', ' %9.3f', 1e3), long=(' long/mm', ' %8.3f', 1e3), trans=(' trans/mm', ' %9.3f', 1e3), qlong=(' Qlong/nAm', ' %10.3f', 1e9), qtrans=(' Qtrans/nAm', ' %11.3f', 1e9), ) for key in ('khi2', 'nfree'): data = getattr(self, key) if data is not None: header += fmts[key][0] fmt += fmts[key][1] out += (data[:, np.newaxis] * fmts[key][2],) for key in ('vol', 'depth', 'long', 'trans', 'qlong', 'qtrans'): data = self.conf.get(key) if data is not None: header += fmts[key][0] fmt += fmts[key][1] out += (data[:, np.newaxis] * fmts[key][2],) out = np.concatenate(out, axis=-1) # NB CoordinateSystem is hard-coded as Head here with open(fname, 'wb') as fid: fid.write('# CoordinateSystem "Head"\n'.encode('utf-8')) fid.write((header + '\n').encode('utf-8')) np.savetxt(fid, out, fmt=fmt) if self.name is not None: fid.write(('## Name "%s dipoles" Style "Dipoles"' % self.name).encode('utf-8')) def crop(self, tmin=None, tmax=None): """Crop data to a given time interval. Parameters ---------- tmin : float | None Start time of selection in seconds. tmax : float | None End time of selection in seconds. Returns ------- self : instance of Dipole The cropped instance. """ sfreq = None if len(self.times) > 1: sfreq = 1. / np.median(np.diff(self.times)) mask = _time_mask(self.times, tmin, tmax, sfreq=sfreq) for attr in ('times', 'pos', 'gof', 'amplitude', 'ori', 'khi2', 'nfree'): if getattr(self, attr) is not None: setattr(self, attr, getattr(self, attr)[mask]) for key in self.conf.keys(): self.conf[key] = self.conf[key][mask] return self def copy(self): """Copy the Dipoles object. Returns ------- dip : instance of Dipole The copied dipole instance. """ return deepcopy(self) @verbose def plot_locations(self, trans, subject, subjects_dir=None, mode='orthoview', coord_frame='mri', idx='gof', show_all=True, ax=None, block=False, show=True, verbose=None): """Plot dipole locations in 3d. Parameters ---------- trans : dict The mri to head trans. subject : str The subject name corresponding to FreeSurfer environment variable SUBJECT. subjects_dir : None | str The path to the freesurfer subjects reconstructions. It corresponds to Freesurfer environment variable SUBJECTS_DIR. The default is None. mode : str Currently only ``'orthoview'`` is supported. .. versionadded:: 0.14.0 coord_frame : str Coordinate frame to use, 'head' or 'mri'. Defaults to 'mri'. .. versionadded:: 0.14.0 idx : int | 'gof' | 'amplitude' Index of the initially plotted dipole. Can also be 'gof' to plot the dipole with highest goodness of fit value or 'amplitude' to plot the dipole with the highest amplitude. The dipoles can also be browsed through using up/down arrow keys or mouse scroll. Defaults to 'gof'. Only used if mode equals 'orthoview'. .. versionadded:: 0.14.0 show_all : bool Whether to always plot all the dipoles. If True (default), the active dipole is plotted as a red dot and it's location determines the shown MRI slices. The the non-active dipoles are plotted as small blue dots. If False, only the active dipole is plotted. Only used if mode equals 'orthoview'. .. versionadded:: 0.14.0 ax : instance of matplotlib Axes3D | None Axes to plot into. If None (default), axes will be created. Only used if mode equals 'orthoview'. .. versionadded:: 0.14.0 block : bool Whether to halt program execution until the figure is closed. Defaults to False. Only used if mode equals 'orthoview'. .. versionadded:: 0.14.0 show : bool Show figure if True. Defaults to True. Only used if mode equals 'orthoview'. .. versionadded:: 0.14.0 %(verbose_meth)s Returns ------- fig : instance of mayavi.mlab.Figure or matplotlib.figure.Figure The mayavi figure or matplotlib Figure. Notes ----- .. versionadded:: 0.9.0 """ from .viz import plot_dipole_locations dipoles = self if mode in [None, 'cone', 'sphere']: # support old behavior dipoles = [] for t in self.times: dipoles.append(self.copy()) dipoles[-1].crop(t, t) elif mode != 'orthoview': raise ValueError("mode must be 'cone', 'sphere' or 'orthoview'. " "Got %s." % mode) return plot_dipole_locations( dipoles, trans, subject, subjects_dir, mode, coord_frame, idx, show_all, ax, block, show) def plot_amplitudes(self, color='k', show=True): """Plot the dipole amplitudes as a function of time. Parameters ---------- color: matplotlib Color Color to use for the trace. show : bool Show figure if True. Returns ------- fig : matplotlib.figure.Figure The figure object containing the plot. """ from .viz import plot_dipole_amplitudes return plot_dipole_amplitudes([self], [color], show) def __getitem__(self, item): """Get a time slice. Parameters ---------- item : array-like or slice The slice of time points to use. Returns ------- dip : instance of Dipole The sliced dipole. """ if isinstance(item, int): # make sure attributes stay 2d item = [item] selected_times = self.times[item].copy() selected_pos = self.pos[item, :].copy() selected_amplitude = self.amplitude[item].copy() selected_ori = self.ori[item, :].copy() selected_gof = self.gof[item].copy() selected_name = self.name selected_conf = dict() for key in self.conf.keys(): selected_conf[key] = self.conf[key][item] selected_khi2 = self.khi2[item] if self.khi2 is not None else None selected_nfree = self.nfree[item] if self.nfree is not None else None return Dipole( selected_times, selected_pos, selected_amplitude, selected_ori, selected_gof, selected_name, selected_conf, selected_khi2, selected_nfree) def __len__(self): """Return the number of dipoles. Returns ------- len : int The number of dipoles. Examples -------- This can be used as:: >>> len(dipoles) # doctest: +SKIP 10 """ return self.pos.shape[0] def _read_dipole_fixed(fname): """Read a fixed dipole FIF file.""" logger.info('Reading %s ...' % fname) info, nave, aspect_kind, first, last, comment, times, data = \ _read_evoked(fname) return DipoleFixed(info, data, times, nave, aspect_kind, first, last, comment) @fill_doc class DipoleFixed(object): """Dipole class for fixed-position dipole fits. .. note:: This class should usually not be instantiated directly, instead :func:`mne.read_dipole` should be used. Parameters ---------- info : instance of Info The measurement info. data : array, shape (n_channels, n_times) The dipole data. times : array, shape (n_times,) The time points. nave : int Number of averages. aspect_kind : int The kind of data. first : int First sample. last : int Last sample. comment : str The dipole comment. %(verbose)s See Also -------- read_dipole Dipole fit_dipole Notes ----- This class is for fixed-position dipole fits, where the position (and maybe orientation) is static over time. For sequential dipole fits, where the position can change a function of time, use :class:`mne.Dipole`. .. versionadded:: 0.12 """ @verbose def __init__(self, info, data, times, nave, aspect_kind, first, last, comment, verbose=None): # noqa: D102 self.info = info self.nave = nave self._aspect_kind = aspect_kind self.kind = _aspect_rev.get(aspect_kind, 'unknown') self.first = first self.last = last self.comment = comment self.times = times self.data = data self.verbose = verbose def __repr__(self): # noqa: D105 s = "n_times : %s" % len(self.times) s += ", tmin : %s" % np.min(self.times) s += ", tmax : %s" % np.max(self.times) return "<DipoleFixed | %s>" % s def copy(self): """Copy the DipoleFixed object. Returns ------- inst : instance of DipoleFixed The copy. Notes ----- .. versionadded:: 0.16 """ return deepcopy(self) @property def ch_names(self): """Channel names.""" return self.info['ch_names'] @verbose def save(self, fname, verbose=None): """Save dipole in a .fif file. Parameters ---------- fname : str The name of the .fif file. Must end with ``'.fif'`` or ``'.fif.gz'`` to make it explicit that the file contains dipole information in FIF format. %(verbose_meth)s """ check_fname(fname, 'DipoleFixed', ('-dip.fif', '-dip.fif.gz', '_dip.fif', '_dip.fif.gz',), ('.fif', '.fif.gz')) _write_evokeds(fname, self, check=False) def plot(self, show=True, time_unit='s'): """Plot dipole data. Parameters ---------- show : bool Call pyplot.show() at the end or not. time_unit : str The units for the time axis, can be "ms" or "s" (default). .. versionadded:: 0.16 Returns ------- fig : instance of matplotlib.figure.Figure The figure containing the time courses. """ return _plot_evoked(self, picks=None, exclude=(), unit=True, show=show, ylim=None, xlim='tight', proj=False, hline=None, units=None, scalings=None, titles=None, axes=None, gfp=False, window_title=None, spatial_colors=False, plot_type="butterfly", selectable=False, time_unit=time_unit) # ############################################################################# # IO @verbose def read_dipole(fname, verbose=None): """Read .dip file from Neuromag/xfit or MNE. Parameters ---------- fname : str The name of the .dip or .fif file. %(verbose)s Returns ------- dipole : instance of Dipole or DipoleFixed The dipole. See Also -------- Dipole DipoleFixed fit_dipole """ _check_fname(fname, overwrite='read', must_exist=True) if fname.endswith('.fif') or fname.endswith('.fif.gz'): return _read_dipole_fixed(fname) else: return _read_dipole_text(fname) def _read_dipole_text(fname): """Read a dipole text file.""" # Figure out the special fields need_header = True def_line = name = None # There is a bug in older np.loadtxt regarding skipping fields, # so just read the data ourselves (need to get name and header anyway) data = list() with open(fname, 'r') as fid: for line in fid: if not (line.startswith('%') or line.startswith('#')): need_header = False data.append(line.strip().split()) else: if need_header: def_line = line if line.startswith('##') or line.startswith('%%'): m = re.search('Name "(.*) dipoles"', line) if m: name = m.group(1) del line data = np.atleast_2d(np.array(data, float)) if def_line is None: raise IOError('Dipole text file is missing field definition ' 'comment, cannot parse %s' % (fname,)) # actually parse the fields def_line = def_line.lstrip('%').lstrip('#').strip() # MNE writes it out differently than Elekta, let's standardize them... fields = re.sub(r'([X|Y|Z] )\(mm\)', # "X (mm)", etc. lambda match: match.group(1).strip() + '/mm', def_line) fields = re.sub(r'\((.*?)\)', # "Q(nAm)", etc. lambda match: '/' + match.group(1), fields) fields = re.sub('(begin|end) ', # "begin" and "end" with no units lambda match: match.group(1) + '/ms', fields) fields = fields.lower().split() required_fields = ('begin/ms', 'x/mm', 'y/mm', 'z/mm', 'q/nam', 'qx/nam', 'qy/nam', 'qz/nam', 'g/%') optional_fields = ('khi^2', 'free', # standard ones # now the confidence fields (up to 5!) 'vol/mm^3', 'depth/mm', 'long/mm', 'trans/mm', 'qlong/nam', 'qtrans/nam') conf_scales = [1e-9, 1e-3, 1e-3, 1e-3, 1e-9, 1e-9] missing_fields = sorted(set(required_fields) - set(fields)) if len(missing_fields) > 0: raise RuntimeError('Could not find necessary fields in header: %s' % (missing_fields,)) handled_fields = set(required_fields) | set(optional_fields) assert len(handled_fields) == len(required_fields) + len(optional_fields) ignored_fields = sorted(set(fields) - set(handled_fields) - {'end/ms'}) if len(ignored_fields) > 0: warn('Ignoring extra fields in dipole file: %s' % (ignored_fields,)) if len(fields) != data.shape[1]: raise IOError('More data fields (%s) found than data columns (%s): %s' % (len(fields), data.shape[1], fields)) logger.info("%d dipole(s) found" % len(data)) if 'end/ms' in fields: if np.diff(data[:, [fields.index('begin/ms'), fields.index('end/ms')]], 1, -1).any(): warn('begin and end fields differed, but only begin will be used ' 'to store time values') # Find the correct column in our data array, then scale to proper units idx = [fields.index(field) for field in required_fields] assert len(idx) >= 9 times = data[:, idx[0]] / 1000. pos = 1e-3 * data[:, idx[1:4]] # put data in meters amplitude = data[:, idx[4]] norm = amplitude.copy() amplitude /= 1e9 norm[norm == 0] = 1 ori = data[:, idx[5:8]] / norm[:, np.newaxis] gof = data[:, idx[8]] # Deal with optional fields optional = [None] * 2 for fi, field in enumerate(optional_fields[:2]): if field in fields: optional[fi] = data[:, fields.index(field)] khi2, nfree = optional conf = dict() for field, scale in zip(optional_fields[2:], conf_scales): # confidence if field in fields: conf[field.split('/')[0]] = scale * data[:, fields.index(field)] return Dipole(times, pos, amplitude, ori, gof, name, conf, khi2, nfree) # ############################################################################# # Fitting def _dipole_forwards(fwd_data, whitener, rr, n_jobs=1): """Compute the forward solution and do other nice stuff.""" B = _compute_forwards_meeg(rr, fwd_data, n_jobs, verbose=False) B = np.concatenate(B, axis=1) assert np.isfinite(B).all() B_orig = B.copy() # Apply projection and whiten (cov has projections already) B = np.dot(B, whitener.T) # column normalization doesn't affect our fitting, so skip for now # S = np.sum(B * B, axis=1) # across channels # scales = np.repeat(3. / np.sqrt(np.sum(np.reshape(S, (len(rr), 3)), # axis=1)), 3) # B *= scales[:, np.newaxis] scales = np.ones(3) return B, B_orig, scales def _make_guesses(surf, grid, exclude, mindist, n_jobs): """Make a guess space inside a sphere or BEM surface.""" if 'rr' in surf: logger.info('Guess surface (%s) is in %s coordinates' % (_surf_name[surf['id']], _coord_frame_name(surf['coord_frame']))) else: logger.info('Making a spherical guess space with radius %7.1f mm...' % (1000 * surf['R'])) logger.info('Filtering (grid = %6.f mm)...' % (1000 * grid)) src = _make_volume_source_space(surf, grid, exclude, 1000 * mindist, do_neighbors=False, n_jobs=n_jobs) assert 'vertno' in src # simplify the result to make things easier later src = dict(rr=src['rr'][src['vertno']], nn=src['nn'][src['vertno']], nuse=src['nuse'], coord_frame=src['coord_frame'], vertno=np.arange(src['nuse'])) return SourceSpaces([src]) def _fit_eval(rd, B, B2, fwd_svd=None, fwd_data=None, whitener=None): """Calculate the residual sum of squares.""" if fwd_svd is None: fwd = _dipole_forwards(fwd_data, whitener, rd[np.newaxis, :])[0] uu, sing, vv = linalg.svd(fwd, overwrite_a=True, full_matrices=False) else: uu, sing, vv = fwd_svd gof = _dipole_gof(uu, sing, vv, B, B2)[0] # mne-c uses fitness=B2-Bm2, but ours (1-gof) is just a normalized version return 1. - gof def _dipole_gof(uu, sing, vv, B, B2): """Calculate the goodness of fit from the forward SVD.""" ncomp = 3 if sing[2] / (sing[0] if sing[0] > 0 else 1.) > 0.2 else 2 one = np.dot(vv[:ncomp], B) Bm2 = np.sum(one * one) gof = Bm2 / B2 return gof, one def _fit_Q(fwd_data, whitener, B, B2, B_orig, rd, ori=None): """Fit the dipole moment once the location is known.""" if 'fwd' in fwd_data: # should be a single precomputed "guess" (i.e., fixed position) assert rd is None fwd = fwd_data['fwd'] assert fwd.shape[0] == 3 fwd_orig = fwd_data['fwd_orig'] assert fwd_orig.shape[0] == 3 scales = fwd_data['scales'] assert scales.shape == (3,) fwd_svd = fwd_data['fwd_svd'][0] else: fwd, fwd_orig, scales = _dipole_forwards(fwd_data, whitener, rd[np.newaxis, :]) fwd_svd = None if ori is None: if fwd_svd is None: fwd_svd = linalg.svd(fwd, full_matrices=False) uu, sing, vv = fwd_svd gof, one = _dipole_gof(uu, sing, vv, B, B2) ncomp = len(one) # Counteract the effect of column normalization Q = scales[0] * np.sum(uu.T[:ncomp] * (one / sing[:ncomp])[:, np.newaxis], axis=0) else: fwd = np.dot(ori[np.newaxis], fwd) sing = np.linalg.norm(fwd) one = np.dot(fwd / sing, B) gof = (one * one)[0] / B2 Q = ori * (scales[0] * np.sum(one / sing)) ncomp = 3 B_residual_noproj = B_orig - np.dot(fwd_orig.T, Q) return Q, gof, B_residual_noproj, ncomp def _fit_dipoles(fun, min_dist_to_inner_skull, data, times, guess_rrs, guess_data, fwd_data, whitener, ori, n_jobs, rank): """Fit a single dipole to the given whitened, projected data.""" from scipy.optimize import fmin_cobyla parallel, p_fun, _ = parallel_func(fun, n_jobs) # parallel over time points res = parallel(p_fun(min_dist_to_inner_skull, B, t, guess_rrs, guess_data, fwd_data, whitener, fmin_cobyla, ori, rank) for B, t in zip(data.T, times)) pos = np.array([r[0] for r in res]) amp = np.array([r[1] for r in res]) ori = np.array([r[2] for r in res]) gof = np.array([r[3] for r in res]) * 100 # convert to percentage conf = None if res[0][4] is not None: conf = np.array([r[4] for r in res]) keys = ['vol', 'depth', 'long', 'trans', 'qlong', 'qtrans'] conf = {key: conf[:, ki] for ki, key in enumerate(keys)} khi2 = np.array([r[5] for r in res]) nfree = np.array([r[6] for r in res]) residual_noproj = np.array([r[7] for r in res]).T return pos, amp, ori, gof, conf, khi2, nfree, residual_noproj '''Simplex code in case we ever want/need it for testing def _make_tetra_simplex(): """Make the initial tetrahedron""" # # For this definition of a regular tetrahedron, see # # http://mathworld.wolfram.com/Tetrahedron.html # x = np.sqrt(3.0) / 3.0 r = np.sqrt(6.0) / 12.0 R = 3 * r d = x / 2.0 simplex = 1e-2 * np.array([[x, 0.0, -r], [-d, 0.5, -r], [-d, -0.5, -r], [0., 0., R]]) return simplex def try_(p, y, psum, ndim, fun, ihi, neval, fac): """Helper to try a value""" ptry = np.empty(ndim) fac1 = (1.0 - fac) / ndim fac2 = fac1 - fac ptry = psum * fac1 - p[ihi] * fac2 ytry = fun(ptry) neval += 1 if ytry < y[ihi]: y[ihi] = ytry psum[:] += ptry - p[ihi] p[ihi] = ptry return ytry, neval def _simplex_minimize(p, ftol, stol, fun, max_eval=1000): """Minimization with the simplex algorithm Modified from Numerical recipes""" y = np.array([fun(s) for s in p]) ndim = p.shape[1] assert p.shape[0] == ndim + 1 mpts = ndim + 1 neval = 0 psum = p.sum(axis=0) loop = 1 while(True): ilo = 1 if y[1] > y[2]: ihi = 1 inhi = 2 else: ihi = 2 inhi = 1 for i in range(mpts): if y[i] < y[ilo]: ilo = i if y[i] > y[ihi]: inhi = ihi ihi = i elif y[i] > y[inhi]: if i != ihi: inhi = i rtol = 2 * np.abs(y[ihi] - y[ilo]) / (np.abs(y[ihi]) + np.abs(y[ilo])) if rtol < ftol: break if neval >= max_eval: raise RuntimeError('Maximum number of evaluations exceeded.') if stol > 0: # Has the simplex collapsed? dsum = np.sqrt(np.sum((p[ilo] - p[ihi]) ** 2)) if loop > 5 and dsum < stol: break ytry, neval = try_(p, y, psum, ndim, fun, ihi, neval, -1.) if ytry <= y[ilo]: ytry, neval = try_(p, y, psum, ndim, fun, ihi, neval, 2.) elif ytry >= y[inhi]: ysave = y[ihi] ytry, neval = try_(p, y, psum, ndim, fun, ihi, neval, 0.5) if ytry >= ysave: for i in range(mpts): if i != ilo: psum[:] = 0.5 * (p[i] + p[ilo]) p[i] = psum y[i] = fun(psum) neval += ndim psum = p.sum(axis=0) loop += 1 ''' def _fit_confidence(rd, Q, ori, whitener, fwd_data): # As describedd in the Xfit manual, confidence intervals can be calculated # by examining a linearization of model at the best-fitting location, # i.e. taking the Jacobian and using the whitener: # # J = [∂b/∂x ∂b/∂y ∂b/∂z ∂b/∂Qx ∂b/∂Qy ∂b/∂Qz] # C = (J.T C^-1 J)^-1 # # And then the confidence interval is the diagonal of C, scaled by 1.96 # (for 95% confidence). direction = np.empty((3, 3)) # The coordinate system has the x axis aligned with the dipole orientation, direction[0] = ori # the z axis through the origin of the sphere model rvec = rd - fwd_data['inner_skull']['r0'] direction[2] = rvec - ori * np.dot(ori, rvec) # orthogonalize direction[2] /= np.linalg.norm(direction[2]) # and the y axis perpendical with these forming a right-handed system. direction[1] = np.cross(direction[2], direction[0]) assert np.allclose(np.dot(direction, direction.T), np.eye(3)) # Get spatial deltas in dipole coordinate directions deltas = (-1e-4, 1e-4) J = np.empty((whitener.shape[0], 6)) for ii in range(3): fwds = [] for delta in deltas: this_r = rd[np.newaxis] + delta * direction[ii] fwds.append( np.dot(Q, _dipole_forwards(fwd_data, whitener, this_r)[0])) J[:, ii] = np.diff(fwds, axis=0)[0] / np.diff(deltas)[0] # Get current (Q) deltas in the dipole directions deltas = np.array([-0.01, 0.01]) * np.linalg.norm(Q) this_fwd = _dipole_forwards(fwd_data, whitener, rd[np.newaxis])[0] for ii in range(3): fwds = [] for delta in deltas: fwds.append(np.dot(Q + delta * direction[ii], this_fwd)) J[:, ii + 3] = np.diff(fwds, axis=0)[0] / np.diff(deltas)[0] # J is already whitened, so we don't need to do np.dot(whitener, J). # However, the units in the Jacobian are potentially quite different, # so we need to do some normalization during inversion, then revert. direction_norm = np.linalg.norm(J[:, :3]) Q_norm = np.linalg.norm(J[:, 3:5]) # omit possible zero Z norm = np.array([direction_norm] * 3 + [Q_norm] * 3) J /= norm J = np.dot(J.T, J) C = linalg.pinvh(J, rcond=1e-14) C /= norm C /= norm[:, np.newaxis] conf = 1.96 * np.sqrt(np.diag(C)) # The confidence volume of the dipole location is obtained from by # taking the eigenvalues of the upper left submatrix and computing # v = 4π/3 √(c^3 λ1 λ2 λ3) with c = 7.81, or: vol_conf = 4 * np.pi / 3. * np.sqrt( 476.379541 * np.prod(linalg.eigh(C[:3, :3], eigvals_only=True))) conf = np.concatenate([conf, [vol_conf]]) # Now we reorder and subselect the proper columns: # vol, depth, long, trans, Qlong, Qtrans (discard Qdepth, assumed zero) conf = conf[[6, 2, 0, 1, 3, 4]] return conf def _surface_constraint(rd, surf, min_dist_to_inner_skull): """Surface fitting constraint.""" dist = _compute_nearest(surf['rr'], rd[np.newaxis, :], return_dists=True)[1][0] if _points_outside_surface(rd[np.newaxis, :], surf, 1)[0]: dist *= -1. # Once we know the dipole is below the inner skull, # let's check if its distance to the inner skull is at least # min_dist_to_inner_skull. This can be enforced by adding a # constrain proportional to its distance. dist -= min_dist_to_inner_skull return dist def _sphere_constraint(rd, r0, R_adj): """Sphere fitting constraint.""" return R_adj - np.sqrt(np.sum((rd - r0) ** 2)) def _fit_dipole(min_dist_to_inner_skull, B_orig, t, guess_rrs, guess_data, fwd_data, whitener, fmin_cobyla, ori, rank): """Fit a single bit of data.""" B = np.dot(whitener, B_orig) # make constraint function to keep the solver within the inner skull if 'rr' in fwd_data['inner_skull']: # bem surf = fwd_data['inner_skull'] constraint = partial(_surface_constraint, surf=surf, min_dist_to_inner_skull=min_dist_to_inner_skull) else: # sphere surf = None constraint = partial( _sphere_constraint, r0=fwd_data['inner_skull']['r0'], R_adj=fwd_data['inner_skull']['R'] - min_dist_to_inner_skull) # Find a good starting point (find_best_guess in C) B2 = np.dot(B, B) if B2 == 0: warn('Zero field found for time %s' % t) return np.zeros(3), 0, np.zeros(3), 0, B idx = np.argmin([_fit_eval(guess_rrs[[fi], :], B, B2, fwd_svd) for fi, fwd_svd in enumerate(guess_data['fwd_svd'])]) x0 = guess_rrs[idx] fun = partial(_fit_eval, B=B, B2=B2, fwd_data=fwd_data, whitener=whitener) # Tested minimizers: # Simplex, BFGS, CG, COBYLA, L-BFGS-B, Powell, SLSQP, TNC # Several were similar, but COBYLA won for having a handy constraint # function we can use to ensure we stay inside the inner skull / # smallest sphere rd_final = fmin_cobyla(fun, x0, (constraint,), consargs=(), rhobeg=5e-2, rhoend=5e-5, disp=False) # simplex = _make_tetra_simplex() + x0 # _simplex_minimize(simplex, 1e-4, 2e-4, fun) # rd_final = simplex[0] # Compute the dipole moment at the final point Q, gof, residual_noproj, n_comp = _fit_Q( fwd_data, whitener, B, B2, B_orig, rd_final, ori=ori) khi2 = (1 - gof) * B2 nfree = rank - n_comp amp = np.sqrt(np.dot(Q, Q)) norm = 1. if amp == 0. else amp ori = Q / norm conf = _fit_confidence(rd_final, Q, ori, whitener, fwd_data) msg = '---- Fitted : %7.1f ms' % (1000. * t) if surf is not None: dist_to_inner_skull = _compute_nearest( surf['rr'], rd_final[np.newaxis, :], return_dists=True)[1][0] msg += (", distance to inner skull : %2.4f mm" % (dist_to_inner_skull * 1000.)) logger.info(msg) return rd_final, amp, ori, gof, conf, khi2, nfree, residual_noproj def _fit_dipole_fixed(min_dist_to_inner_skull, B_orig, t, guess_rrs, guess_data, fwd_data, whitener, fmin_cobyla, ori, rank): """Fit a data using a fixed position.""" B = np.dot(whitener, B_orig) B2 = np.dot(B, B) if B2 == 0: warn('Zero field found for time %s' % t) return np.zeros(3), 0, np.zeros(3), 0, np.zeros(6) # Compute the dipole moment Q, gof, residual_noproj = _fit_Q(guess_data, whitener, B, B2, B_orig, rd=None, ori=ori)[:3] if ori is None: amp = np.sqrt(np.dot(Q, Q)) norm = 1. if amp == 0. else amp ori = Q / norm else: amp = np.dot(Q, ori) rd_final = guess_rrs[0] # This will be slow, and we don't use it anyway, so omit it for now: # conf = _fit_confidence(rd_final, Q, ori, whitener, fwd_data) conf = khi2 = nfree = None # No corresponding 'logger' message here because it should go *very* fast return rd_final, amp, ori, gof, conf, khi2, nfree, residual_noproj @verbose def fit_dipole(evoked, cov, bem, trans=None, min_dist=5., n_jobs=1, pos=None, ori=None, verbose=None): """Fit a dipole. Parameters ---------- evoked : instance of Evoked The dataset to fit. cov : str | instance of Covariance The noise covariance. bem : str | instance of ConductorModel The BEM filename (str) or conductor model. trans : str | None The head<->MRI transform filename. Must be provided unless BEM is a sphere model. min_dist : float Minimum distance (in millimeters) from the dipole to the inner skull. Must be positive. Note that because this is a constraint passed to a solver it is not strict but close, i.e. for a ``min_dist=5.`` the fits could be 4.9 mm from the inner skull. n_jobs : int Number of jobs to run in parallel (used in field computation and fitting). pos : ndarray, shape (3,) | None Position of the dipole to use. If None (default), sequential fitting (different position and orientation for each time instance) is performed. If a position (in head coords) is given as an array, the position is fixed during fitting. .. versionadded:: 0.12 ori : ndarray, shape (3,) | None Orientation of the dipole to use. If None (default), the orientation is free to change as a function of time. If an orientation (in head coordinates) is given as an array, ``pos`` must also be provided, and the routine computes the amplitude and goodness of fit of the dipole at the given position and orientation for each time instant. .. versionadded:: 0.12 %(verbose)s Returns ------- dip : instance of Dipole or DipoleFixed The dipole fits. A :class:`mne.DipoleFixed` is returned if ``pos`` and ``ori`` are both not None, otherwise a :class:`mne.Dipole` is returned. residual : instance of Evoked The M-EEG data channels with the fitted dipolar activity removed. See Also -------- mne.beamformer.rap_music Dipole DipoleFixed read_dipole Notes ----- .. versionadded:: 0.9.0 """ # This could eventually be adapted to work with other inputs, these # are what is needed: evoked = evoked.copy() # Determine if a list of projectors has an average EEG ref if _needs_eeg_average_ref_proj(evoked.info): raise ValueError('EEG average reference is mandatory for dipole ' 'fitting.') if min_dist < 0: raise ValueError('min_dist should be positive. Got %s' % min_dist) if ori is not None and pos is None: raise ValueError('pos must be provided if ori is not None') data = evoked.data if not np.isfinite(data).all(): raise ValueError('Evoked data must be finite') info = evoked.info times = evoked.times.copy() comment = evoked.comment # Convert the min_dist to meters min_dist_to_inner_skull = min_dist / 1000. del min_dist # Figure out our inputs neeg = len(pick_types(info, meg=False, eeg=True, ref_meg=False, exclude=[])) if isinstance(bem, str): bem_extra = bem else: bem_extra = repr(bem) logger.info('BEM : %s' % bem_extra) mri_head_t, trans = _get_trans(trans) logger.info('MRI transform : %s' % trans) bem = _setup_bem(bem, bem_extra, neeg, mri_head_t, verbose=False) if not bem['is_sphere']: # Find the best-fitting sphere inner_skull = _bem_find_surface(bem, 'inner_skull') inner_skull = inner_skull.copy() R, r0 = _fit_sphere(inner_skull['rr'], disp=False) # r0 back to head frame for logging r0 = apply_trans(mri_head_t['trans'], r0[np.newaxis, :])[0] inner_skull['r0'] = r0 logger.info('Head origin : ' '%6.1f %6.1f %6.1f mm rad = %6.1f mm.' % (1000 * r0[0], 1000 * r0[1], 1000 * r0[2], 1000 * R)) del R, r0 else: r0 = bem['r0'] if len(bem.get('layers', [])) > 0: R = bem['layers'][0]['rad'] kind = 'rad' else: # MEG-only # Use the minimum distance to the MEG sensors as the radius then R = np.dot(linalg.inv(info['dev_head_t']['trans']), np.hstack([r0, [1.]]))[:3] # r0 -> device R = R - [info['chs'][pick]['loc'][:3] for pick in pick_types(info, meg=True, exclude=[])] if len(R) == 0: raise RuntimeError('No MEG channels found, but MEG-only ' 'sphere model used') R = np.min(np.sqrt(np.sum(R * R, axis=1))) # use dist to sensors kind = 'max_rad' logger.info('Sphere model : origin at (% 7.2f % 7.2f % 7.2f) mm, ' '%s = %6.1f mm' % (1000 * r0[0], 1000 * r0[1], 1000 * r0[2], kind, R)) inner_skull = dict(R=R, r0=r0) # NB sphere model defined in head frame del R, r0 accurate = False # can be an option later (shouldn't make big diff) # Deal with DipoleFixed cases here if pos is not None: fixed_position = True pos = np.array(pos, float) if pos.shape != (3,): raise ValueError('pos must be None or a 3-element array-like,' ' got %s' % (pos,)) logger.info('Fixed position : %6.1f %6.1f %6.1f mm' % tuple(1000 * pos)) if ori is not None: ori = np.array(ori, float) if ori.shape != (3,): raise ValueError('oris must be None or a 3-element array-like,' ' got %s' % (ori,)) norm = np.sqrt(np.sum(ori * ori)) if not np.isclose(norm, 1): raise ValueError('ori must be a unit vector, got length %s' % (norm,)) logger.info('Fixed orientation : %6.4f %6.4f %6.4f mm' % tuple(ori)) else: logger.info('Free orientation : <time-varying>') fit_n_jobs = 1 # only use 1 job to do the guess fitting else: fixed_position = False # Eventually these could be parameters, but they are just used for # the initial grid anyway guess_grid = 0.02 # MNE-C uses 0.01, but this is faster w/similar perf guess_mindist = max(0.005, min_dist_to_inner_skull) guess_exclude = 0.02 logger.info('Guess grid : %6.1f mm' % (1000 * guess_grid,)) if guess_mindist > 0.0: logger.info('Guess mindist : %6.1f mm' % (1000 * guess_mindist,)) if guess_exclude > 0: logger.info('Guess exclude : %6.1f mm' % (1000 * guess_exclude,)) logger.info('Using %s MEG coil definitions.' % ("accurate" if accurate else "standard")) fit_n_jobs = n_jobs if isinstance(cov, str): logger.info('Noise covariance : %s' % (cov,)) cov = read_cov(cov, verbose=False) logger.info('') _print_coord_trans(mri_head_t) _print_coord_trans(info['dev_head_t']) logger.info('%d bad channels total' % len(info['bads'])) # Forward model setup (setup_forward_model from setup.c) ch_types = [channel_type(info, idx) for idx in range(info['nchan'])] megcoils, compcoils, megnames, meg_info = [], [], [], None eegels, eegnames = [], [] if 'grad' in ch_types or 'mag' in ch_types: megcoils, compcoils, megnames, meg_info = \ _prep_meg_channels(info, exclude='bads', accurate=accurate, verbose=verbose) if 'eeg' in ch_types: eegels, eegnames = _prep_eeg_channels(info, exclude='bads', verbose=verbose) # Ensure that MEG and/or EEG channels are present if len(megcoils + eegels) == 0: raise RuntimeError('No MEG or EEG channels found.') # Whitener for the data logger.info('Decomposing the sensor noise covariance matrix...') picks = pick_types(info, meg=True, eeg=True, ref_meg=False) # In case we want to more closely match MNE-C for debugging: # from .io.pick import pick_info # from .cov import prepare_noise_cov # info_nb = pick_info(info, picks) # cov = prepare_noise_cov(cov, info_nb, info_nb['ch_names'], verbose=False) # nzero = (cov['eig'] > 0) # n_chan = len(info_nb['ch_names']) # whitener = np.zeros((n_chan, n_chan), dtype=np.float) # whitener[nzero, nzero] = 1.0 / np.sqrt(cov['eig'][nzero]) # whitener = np.dot(whitener, cov['eigvec']) whitener, _, rank = compute_whitener(cov, info, picks=picks, return_rank=True) # Proceed to computing the fits (make_guess_data) if fixed_position: guess_src = dict(nuse=1, rr=pos[np.newaxis], inuse=np.array([True])) logger.info('Compute forward for dipole location...') else: logger.info('\n---- Computing the forward solution for the guesses...') guess_src = _make_guesses(inner_skull, guess_grid, guess_exclude, guess_mindist, n_jobs=n_jobs)[0] # grid coordinates go from mri to head frame transform_surface_to(guess_src, 'head', mri_head_t) logger.info('Go through all guess source locations...') # inner_skull goes from mri to head frame if 'rr' in inner_skull: transform_surface_to(inner_skull, 'head', mri_head_t) if fixed_position: if 'rr' in inner_skull: check = _surface_constraint(pos, inner_skull, min_dist_to_inner_skull) else: check = _sphere_constraint( pos, inner_skull['r0'], R_adj=inner_skull['R'] - min_dist_to_inner_skull) if check <= 0: raise ValueError('fixed position is %0.1fmm outside the inner ' 'skull boundary' % (-1000 * check,)) # C code computes guesses w/sphere model for speed, don't bother here fwd_data = dict(coils_list=[megcoils, eegels], infos=[meg_info, None], ccoils_list=[compcoils, None], coil_types=['meg', 'eeg'], inner_skull=inner_skull) # fwd_data['inner_skull'] in head frame, bem in mri, confusing... _prep_field_computation(guess_src['rr'], bem, fwd_data, n_jobs, verbose=False) guess_fwd, guess_fwd_orig, guess_fwd_scales = _dipole_forwards( fwd_data, whitener, guess_src['rr'], n_jobs=fit_n_jobs) # decompose ahead of time guess_fwd_svd = [linalg.svd(fwd, overwrite_a=False, full_matrices=False) for fwd in np.array_split(guess_fwd, len(guess_src['rr']))] guess_data = dict(fwd=guess_fwd, fwd_svd=guess_fwd_svd, fwd_orig=guess_fwd_orig, scales=guess_fwd_scales) del guess_fwd, guess_fwd_svd, guess_fwd_orig, guess_fwd_scales # destroyed logger.info('[done %d source%s]' % (guess_src['nuse'], _pl(guess_src['nuse']))) # Do actual fits data = data[picks] ch_names = [info['ch_names'][p] for p in picks] proj_op = make_projector(info['projs'], ch_names, info['bads'])[0] fun = _fit_dipole_fixed if fixed_position else _fit_dipole out = _fit_dipoles( fun, min_dist_to_inner_skull, data, times, guess_src['rr'], guess_data, fwd_data, whitener, ori, n_jobs, rank) assert len(out) == 8 if fixed_position and ori is not None: # DipoleFixed data = np.array([out[1], out[3]]) out_info = deepcopy(info) loc = np.concatenate([pos, ori, np.zeros(6)]) out_info['chs'] = [ dict(ch_name='dip 01', loc=loc, kind=FIFF.FIFFV_DIPOLE_WAVE, coord_frame=FIFF.FIFFV_COORD_UNKNOWN, unit=FIFF.FIFF_UNIT_AM, coil_type=FIFF.FIFFV_COIL_DIPOLE, unit_mul=0, range=1, cal=1., scanno=1, logno=1), dict(ch_name='goodness', loc=np.full(12, np.nan), kind=FIFF.FIFFV_GOODNESS_FIT, unit=FIFF.FIFF_UNIT_AM, coord_frame=FIFF.FIFFV_COORD_UNKNOWN, coil_type=FIFF.FIFFV_COIL_NONE, unit_mul=0, range=1., cal=1., scanno=2, logno=100)] for key in ['hpi_meas', 'hpi_results', 'projs']: out_info[key] = list() for key in ['acq_pars', 'acq_stim', 'description', 'dig', 'experimenter', 'hpi_subsystem', 'proj_id', 'proj_name', 'subject_info']: out_info[key] = None out_info['bads'] = [] out_info._update_redundant() out_info._check_consistency() dipoles = DipoleFixed(out_info, data, times, evoked.nave, evoked._aspect_kind, evoked.first, evoked.last, comment) else: dipoles = Dipole(times, out[0], out[1], out[2], out[3], comment, out[4], out[5], out[6]) residual = evoked.copy().apply_proj() # set the projs active residual.data[picks] = np.dot(proj_op, out[-1]) logger.info('%d time points fitted' % len(dipoles.times)) return dipoles, residual def get_phantom_dipoles(kind='vectorview'): """Get standard phantom dipole locations and orientations. Parameters ---------- kind : str Get the information for the given system: ``vectorview`` (default) The Neuromag VectorView phantom. ``otaniemi`` The older Neuromag phantom used at Otaniemi. Returns ------- pos : ndarray, shape (n_dipoles, 3) The dipole positions. ori : ndarray, shape (n_dipoles, 3) The dipole orientations. Notes ----- The Elekta phantoms have a radius of 79.5mm, and HPI coil locations in the XY-plane at the axis extrema (e.g., (79.5, 0), (0, -79.5), ...). """ _check_option('kind', kind, ['vectorview', 'otaniemi']) if kind == 'vectorview': # these values were pulled from a scanned image provided by # Elekta folks a = np.array([59.7, 48.6, 35.8, 24.8, 37.2, 27.5, 15.8, 7.9]) b = np.array([46.1, 41.9, 38.3, 31.5, 13.9, 16.2, 20.0, 19.3]) x = np.concatenate((a, [0] * 8, -b, [0] * 8)) y = np.concatenate(([0] * 8, -a, [0] * 8, b)) c = [22.9, 23.5, 25.5, 23.1, 52.0, 46.4, 41.0, 33.0] d = [44.4, 34.0, 21.6, 12.7, 62.4, 51.5, 39.1, 27.9] z = np.concatenate((c, c, d, d)) signs = ([1, -1] * 4 + [-1, 1] * 4) * 2 elif kind == 'otaniemi': # these values were pulled from an Neuromag manual # (NM20456A, 13.7.1999, p.65) a = np.array([56.3, 47.6, 39.0, 30.3]) b = np.array([32.5, 27.5, 22.5, 17.5]) c = np.zeros(4) x = np.concatenate((a, b, c, c, -a, -b, c, c)) y = np.concatenate((c, c, -a, -b, c, c, b, a)) z = np.concatenate((b, a, b, a, b, a, a, b)) signs = [-1] * 8 + [1] * 16 + [-1] * 8 pos = np.vstack((x, y, z)).T / 1000. # Locs are always in XZ or YZ, and so are the oris. The oris are # also in the same plane and tangential, so it's easy to determine # the orientation. ori = list() for pi, this_pos in enumerate(pos): this_ori = np.zeros(3) idx = np.where(this_pos == 0)[0] # assert len(idx) == 1 idx = np.setdiff1d(np.arange(3), idx[0]) this_ori[idx] = (this_pos[idx][::-1] / np.linalg.norm(this_pos[idx])) * [1, -1] this_ori *= signs[pi] # Now we have this quality, which we could uncomment to # double-check: # np.testing.assert_allclose(np.dot(this_ori, this_pos) / # np.linalg.norm(this_pos), 0, # atol=1e-15) ori.append(this_ori) ori = np.array(ori) return pos, ori def _concatenate_dipoles(dipoles): """Concatenate a list of dipoles.""" times, pos, amplitude, ori, gof = [], [], [], [], [] for dipole in dipoles: times.append(dipole.times) pos.append(dipole.pos) amplitude.append(dipole.amplitude) ori.append(dipole.ori) gof.append(dipole.gof) return Dipole(np.concatenate(times), np.concatenate(pos), np.concatenate(amplitude), np.concatenate(ori), np.concatenate(gof), name=None)
adykstra/mne-python
mne/dipole.py
Python
bsd-3-clause
52,898
[ "Mayavi" ]
b1fc1c2f003eb97d49a2bc7568fb87001d0038b3e9e20bbd9fda08d365cf1652
import os from zombie.compat import TestCase, PY3 if PY3: from socketserver import UnixStreamServer, StreamRequestHandler else: from SocketServer import UnixStreamServer, StreamRequestHandler import threading try: from json import loads, dumps except ImportError: from simplejson import loads, dumps # noqa import fudge from zombie.proxy.client import ( encode, encode_args, decode, Element, NodeError, ZombieServerConnection, ZombieProxyClient) from zombie.proxy.server import ZombieProxyServer from zombie.tests.webserver import WebServerTestCase class EncodeTests(TestCase): def test_json(self): obj = lambda: 1 obj.json = "myjson" self.assertEqual("myjson", encode(obj)) def test_json_method(self): obj = lambda: 1 obj.__json__ = lambda: "anotherjson" self.assertEqual("anotherjson", encode(obj)) def test_asis(self): obj = [1, 2] self.assertEqual("[1, 2]", encode(obj)) class EncodeArgsTests(TestCase): def test_none(self): self.assertEqual('', encode_args(None)) def test_empty(self): self.assertEqual('', encode_args([])) def test_arguments(self): self.assertEqual('"one", "two"', encode_args(['one', 'two'])) def test_arguments_extra(self): self.assertEqual('"one", ', encode_args(['one'], True)) class DecodeTests(TestCase): def test_none(self): self.assertEqual(None, decode(None)) def test_something(self): self.assertEqual([1], decode("[1]")) class ElementTests(TestCase): def test_index(self): self.assertEqual(15, Element(15).index) def test_json(self): self.assertEqual("ELEMENTS[15]", Element(15).json) def test_str(self): self.assertEqual("ELEMENTS[15]", str(Element(15))) class EchoHandler(StreamRequestHandler): def handle(self): self.wfile.write(self.rfile.readline()) class EchoServer(threading.Thread): def __init__(self, address): super(EchoServer, self).__init__() self.daemon = True self.server = UnixStreamServer(address, EchoHandler) def run(self): self.server.handle_request() def stop(self): self.server.shutdown() class ZombieServerConnectionTests(TestCase): address = '/tmp/testing-unix-server' def cleanup(self): if os.path.exists(self.address): os.remove(self.address) def setUp(self): self.cleanup() self.server = EchoServer(self.address) self.server.start() self.connection = ZombieServerConnection(self.address) def tearDown(self): self.cleanup() def test_send(self): res = self.connection.send('Hello world!\n') self.assertEqual('Hello world!\n', res) class ZombieProxyClientTests(WebServerTestCase): def setUp(self): super(ZombieProxyClientTests, self).setUp() # Note, As a singleton so it will be created once, not in every test. self.server = ZombieProxyServer() self.client = ZombieProxyClient(self.server.socket) def tearDown(self): super(ZombieProxyClientTests, self).tearDown() def test_simple_json(self): obj = { 'foo': 'bar', 'test': 500 } self.assertEqual(obj, self.client.json(obj)) def test_malformed_command(self): with self.assertRaises(NodeError): self.client.json("banana") def test_nowait(self): self.assertEqual('Test', self.client.nowait("result = 'Test';")) def test_wait(self): self.client.wait('browser.visit', self.base_url) def test_wait_error(self): with self.assertRaises(NodeError): self.client.wait('browser.visit', self.base_url + 'notfound') def test_ping(self): self.assertEqual("pong", self.client.ping()) def test_cleanup(self): client = self.client self.assertEqual(1, client.json('browser.testing = 1')) client.cleanup() self.assertFalse(client.json('"testing" in browser')) def test_create_element(self): client = self.client client.wait('browser.visit', self.base_url) self.assertEqual( 0, client.create_element('browser.query', ('form',)).index) self.assertEqual( 1, client.create_element('browser.query', ('form',)).index) def test_create_element_attribute(self): client = self.client client.wait('browser.visit', self.base_url) self.assertEqual( 0, client.create_element('browser.html').index) def test_create_elements(self): client = self.client client.wait('browser.visit', self.base_url) res = client.create_elements('browser.queryAll', ('input', )) self.assertEqual(list(range(6)), [x.index for x in res])
ryanpetrello/python-zombie
zombie/tests/test_client.py
Python
mit
4,899
[ "VisIt" ]
6c96dc371589a9a91ace524710452d1901d6b1a388e32c67b3e7fca035394c00
import os, re, time, shutil, json import dendropy from seq_util import * from date_util import * from virus_stability import virus_stability import rethinkdb as r import hashlib class tree_stability(object): ''' Goes back through all virus objects, looks up their calculated ddg from outgroup. Virus_stability determines all their other meta data. Prints all this information to /stability-data/ddg_output.txt. Assigns ddg to the 'ep' attribute of all nodes. ''' def __init__(self, **kwargs): self.stability_output = "stability-data/" self.output_file = open(self.stability_output + "ddg_output.txt", 'w') self.sequence_to_stability = {} if 'RETHINK_AUTH_KEY' in os.environ: self.auth_key = os.environ['RETHINK_AUTH_KEY'] if self.auth_key is None: raise Exception("Missing auth_key") self.database = 'test' self.table = 'stability' self.connect_rethink() self.structure_seqs = {} self.structure_seqs['1HA0'] = "MKTIIALSYILCLVFAQKLPGNDNSTATLCLGHHAVPNGTLVKTITDDQIEVTNATELVQSSSTGKICNNPHRILDGIDCTLIDALLGDPHCDVFQNETWDLFVERSKAFSNCYPYDVPDYASLRSLVASSGTLEFITEGFTWTGVTQNGGSNACKRGPGSGFFSRLNWLTKSGSTYPVLNVTMPNNDNFDKLYIWGIHHPSTNQEQTSLYVQASGRVTVSTRRSQQTIIPNIGSRPWVRGLSSRISIYWTIVKPGDVLVINSNGNLIAPRGYFKMRTGKSSIMRSDAPIDTCISECITPNGSIPNDKPFQNVNKITYGACPKYVKQNTLKLATGMRNVPEKQTQGLFGAIAGFIENGWEGMIDGWYGFRHQNSEGTGQAADLKSTQAAIDQINGKLNRVIEKTNEKFHQIEKEFSEVEGRIQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTRRQLRENAEEMGNGCFKIYHKCDNACIESIRNGTYDHDVYRNEALNNRFQI" self.structure_seqs['2YP7'] = "MKTIIALSYILCLVFAQKLPGNDNSTATLCLGHHAVPNGTIVKTITNDQIEVTNATELVQSSSTGGICDSPHQILDGENCTLIDALLGDPQCDGFQNKKWDLFVERSKAYSNCYPYDVPDYASLRSLVASSGTLEFNNESFNWTGVTQNGTSSACKRKSNNSFFSRLNWLTHLKFKYPALNVTMPNNEKFDKLYIWGVHHPGTDNDQIFLYAQASGRITVSTKRSQQTVIPNIGSRPRVRNIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCNSECITPNGSIPNDKPFQNVNRITYGACPRYVKQNTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGIGQAADLKSTQAAINQINGKLNRLIGKTNEKFHQIEKEFSEVEGRIQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFERTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNGTYDHDVYRDEALNNRFQIKGVELKSGYKDWILWISFAISCFLLCVALLGFIMWACQKGNIRCNICI" self.structure_seqs['2YP2'] = "MKTIIALSYILCLVFAQKLPGNDNSTATLCLGHHAVPNGTIVKTITNDQIEVTNATELVQSSSTGGICDSPHQILDGENCTLIDALLGDPQCDGFQNKKWDLFVERSKAYSNCYPYDVPDYASLRSLVASSGTLEFNNESFNWTGVTQNGTSSACKRRSNNSFFSRLNWLTHLKFKYPALNVTMPNNEKFDKLYIWGVHHPGTDNDQISLYAQASGRITVSTKRSQQTVIPNIGSRPRVRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCNSECITPNGSIPNDKPFQNVNRITYGACPRYVKQNTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGIGQAADLKSTQAAINQINGKLNRLIGKTNEKFHQIEKEFSEVEGRIQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFERTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNGTYDHDVYRDEALNNRFQIKGVELKSGYKDWILWISFAISCFLLCVALLGFIMWACQKGNIRCNICI" def connect_rethink(self): ''' Connect to rethink database, Check for existing table, otherwise create it ''' try: r.connect(host="ec2-52-90-204-136.compute-1.amazonaws.com", port=28015, db=self.database, auth_key=self.auth_key).repl() print("Connected to the \"" + self.database + "\" database") except: print("Failed to connect to the database, " + self.database) raise Exception def calculate_stability(self): print("Reading in new calculated stabilities for sequences") self.sum_ddg() self.classify() #self.epistasis_ddG() self.print_viruses() self.assign_node_ddG() def classify(self): for virus in self.hash_to_virus.values(): if virus['trunk'] == True: classification = 'trunk' elif virus['tip'] == True: classification = 'tip' else: classification = 'branch' virus['classification'] = classification def print_viruses(self): print("Printing Viruses") json.dump(self.hash_to_virus, self.output_file, indent=1) self.output_file.close() def epistasis_ddG(self): ''' go through each virus object and determine the list of foldx formatted mutations for each structure. Also calculate the ddG from the outgroup to the current virus for each structure ''' for virus in self.hash_to_virus.values(): self.get_stability(virus) def get_stability(self, virus): ''' checks the stability table to see if the sequence already has had stability calculated for it :return returns a list containing the stability output for that sequence, if it can't find the stability, raises an exception ''' sequence = virus['seq'] hash_function = hashlib.md5() hash_function.update(sequence) hash_sequence = hash_function.hexdigest() document = r.table(self.table).get(hash_sequence).run() if document is not None: if all(structure in document for structure in self.structures): for structure in self.structures: virus[structure]['epistasis_ddg'] = document[structure] else: print("Couldn't find " + hash_sequence + " in rethinkdb") def sum_ddg(self): ''' sum up individual ddg mutation effects compared to each structure ''' print("Determining stability change by summing individual mutation effects on each structure") self.open_mutator() for virus in self.hash_to_virus.values(): for structure in self.structures: virus[structure] = self.align_to_structure(virus, structure) ddg = 0 for mut in virus[structure]['mutations']: if '*' not in mut: ddg += self.mutator_ddg[structure][mut] virus[structure]['sum_ddg'] = ddg def open_mutator(self): self.mutator_ddg = {} for structure in self.structures: file = open("source-data/" + structure + "_mutator_ddg.txt", 'r') mut_ddg = {} for line in file: info = line.split() mut_ddg[info[1]] = float(info[0]) self.mutator_ddg[structure] = mut_ddg def align_to_structure(self, virus, structure): ''' aligns to structure sequence to virus sequence :return: mutations from structure to self.seq ''' mutations = [] structure_align_seq = self.structure_seqs[structure][24:] virus_align_seq = virus['seq'][24:] if (len(structure_align_seq)>virus_align_seq): print("Outgroup Sequence longer than the virus sequence") raise Exception for index in range(len(structure_align_seq)): site = index + 9 # for both 1HA0 and 2YP7, start at site number 9 in structure ("STAT...") if structure_align_seq[index] != virus_align_seq[index]: mutation = structure_align_seq[index] + str(site) + virus_align_seq[index] mutations.append(mutation) mutations = filter(lambda mut: self.site_range_valid(mut), mutations) if structure == '1HA0': virus['predtime'] = len(mutations) return {'mutations': mutations} #self.structure_muts[structure] = list(mutations_set) def site_range_valid(self, mutation): ''' protein structures (1HA0, 2YP7) are missing certain amino acid sites, method checks that mutation is in structure :param mutation: mutation in standard format :return: true if site is in structure, false if site range is not in structure ''' lowerRange = 9 upperRange = 502 missing_lower = 328 missing_upper = 333 site = int(mutation[1:len(mutation) - 1]) if missing_lower <= site <= missing_upper: # in missing middle section return False elif lowerRange <= site <= upperRange: # in range of protein structure besides middle section return True else: return False ''' def viruses_parent_ddG(self): go through each virus object and calculate ddG from the parent to the current virus, also get mutations from parent to new virus print("Calculating parent to virus ddg") print(len(self.virus_and_parent)) for pair in self.virus_and_parent: virus = pair[0] parent = pair[1] try: virus_ddg = self.sequence_to_stability[virus.seq] except: virus_ddg = ['0.0', '0.0'] print("Couldn't find in dictionary") print(virus.seq) try: parent_ddg = self.sequence_to_stability[parent.seq] except: parent_ddg = ['0.0', '0.0'] print("Couldn't find in dictionary") print(parent.seq) virus.parent_strain = parent.strain virus.calculate_ddg_parent(virus_ddg, parent_ddg) virus.get_parent_mutations(virus.mutations_from_outgroup, parent.mutations_from_outgroup) ''' def assign_node_ddG(self): print("assigning ddg attribute to nodes") for node in self.tree.postorder_node_iter(): hash = str(node) virus = self.hash_to_virus[hash] ddg = ((virus['2YP7']['sum_ddg'] + virus['2YP2']['sum_ddg']) / 2) try: setattr(node, 'yvalue', ddg) setattr(node, 'ep', ddg) except: print("couldn't assign ddg attribute to current node")
blab/stability
augur/src/tree_stability.py
Python
agpl-3.0
9,594
[ "FoldX" ]
84d17a0778b46ef46814c02e3222a246bf8199549cbb5585119da79f8b754966
from pymatgen.analysis.chemenv.coordination_environments.coordination_geometries import AllCoordinationGeometries from pymatgen.analysis.chemenv.coordination_environments.coordination_geometry_finder import LocalGeometryFinder import logging allcg = AllCoordinationGeometries() lgf = LocalGeometryFinder() logging.basicConfig(format="%(levelname)s:%(module)s:%(funcName)s:%(message)s", level="DEBUG") mp_symbol = "DD:20" coordination = 20 myindices = [8, 12, 11, 0, 14, 10, 13, 6, 18, 1, 9, 17, 3, 19, 5, 7, 15, 2, 16, 4] cg = allcg.get_geometry_from_mp_symbol(mp_symbol=mp_symbol) lgf.allcg = AllCoordinationGeometries(only_symbols=[mp_symbol]) lgf.setup_test_perfect_environment( mp_symbol, randomness=False, indices=myindices, random_translation="NONE", random_rotation="NONE", random_scale="NONE", ) se = lgf.compute_structure_environments( only_indices=[0], maximum_distance_factor=1.01 * cg.distfactor_max, min_cn=cg.coordination_number, max_cn=cg.coordination_number, only_symbols=[mp_symbol], ) print(se.ce_list[0][20][0])
vorwerkc/pymatgen
dev_scripts/chemenv/check_new_coordination_geometry.py
Python
mit
1,080
[ "pymatgen" ]
61324ec0868dc3327548e00ff91917d2c825a1606235ca217fb8b4554450edef
# iCraft is Copyright 2010 both # # The Archives team: # <Adam Guy> adam@adam-guy.com AKA "Adam01" # <Andrew Godwin> andrew@aeracode.org AKA "Aera" # <Dylan Lukes> lukes.dylan@gmail.com AKA "revenant" # <Gareth Coles> colesgareth2@hotmail.com AKA "gdude2002" # # And, # # The iCraft team: # <Andrew Caluzzi> tehcid@gmail.com AKA "tehcid" # <Andrew Dolgov> fox@bah.org.ru AKA "gothfox" # <Andrew Horn> Andrew@GJOCommunity.com AKA "AndrewPH" # <Brad Reardon> brad@bradness.co.cc AKA "PixelEater" # <Clay Sweetser> CDBKJmom@aol.com AKA "Varriount" # <James Kirslis> james@helplarge.com AKA "iKJames" # <Jason Sayre> admin@erronjason.com AKA "erronjason" # <Jonathon Dunford> sk8rjwd@yahoo.com AKA "sk8rjwd" # <Joseph Connor> destroyerx100@gmail.com AKA "destroyerx1" # <Joshua Connor> fooblock@live.com AKA "Fooblock" # <Kamyla Silva> supdawgyo@hotmail.com AKA "NotMeh" # <Kristjan Gunnarsson> kristjang@ffsn.is AKA "eugo" # <Nathan Coulombe> NathanCoulombe@hotmail.com AKA "Saanix" # <Nick Tolrud> ntolrud@yahoo.com AKA "ntfwc" # <Noel Benzinger> ronnygmod@gmail.com AKA "Dwarfy" # <Randy Lyne> qcksilverdragon@gmail.com AKA "goober" # <Willem van der Ploeg> willempieeploeg@live.nl AKA "willempiee" # # # And, # # The iCraftBlah Single-Man modifier! # # <Brian Hansen> jabawakijadehawk@gmail.com AKA "blahblahbal" # # # Disclaimer: Parts of this code may have been contributed by the end-users. # # iCraft is licensed under the Creative Commons # Attribution-NonCommercial-ShareAlike 3.0 Unported License. # To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/ # Or, send a letter to Creative Commons, 171 2nd Street, # Suite 300, San Francisco, California, 94105, USA. var_cango = True try: blocktocheck = ord(world.blockstore.raw_blocks[world.blockstore.get_offset(x,y-1,z)]) if blocktocheck != 0: var_cango = False except: var_cango = False if var_cango: block = '\x00' world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block) var_position = (x,y-1,z) x,y,z = var_position block = chr(21) world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) block = chr(3) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block) else: closestposition = (0,0) closestclient = None closestdistance = None for entry in userpositionlist: client = entry[0] var_pos = entry[1] i,j,k = var_pos distance = ((i-x)**2+(j-y)**2+(k-z)**2)**0.5 if closestdistance == None: closestdistance = distance closestclient = client closestposition = (var_pos[0],var_pos[2]) else: if distance < closestdistance: closestdistance = distance closestclient = client closestposition = (var_pos[0],var_pos[2]) if closestdistance < 2: closestclient.sendServerMessage("I pity the fool.") i,k = closestposition distance = ((i-x)**2+(k-z)**2)**0.5 if distance != 0 and distance > 2: target = [int((i-x)/(distance/1.75)) + x,y,int((k-z)/(distance/1.75)) + z] i,j,k = target var_cango = True try: blocktocheck = ord(world.blockstore.raw_blocks[world.blockstore.get_offset(i,j,k)]) if blocktocheck != 0: var_cango = False blocktocheck = ord(world.blockstore.raw_blocks[world.blockstore.get_offset(i,j+1,k)]) if blocktocheck != 0: var_cango = False except: var_cango = False if var_cango: block = '\x00' world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block) var_position = target x,y,z = var_position block = chr(21) world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) block = chr(3) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block) else: var_cango = True target[1] = target[1] + 1 j = target[1] try: blocktocheck = ord(world.blockstore.raw_blocks[world.blockstore.get_offset(i,j,k)]) if blocktocheck != 0: var_cango = False blocktocheck = ord(world.blockstore.raw_blocks[world.blockstore.get_offset(i,j+1,k)]) if blocktocheck != 0: var_cango = False except: var_cango = False if var_cango: block = '\x00' world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block) var_position = target x,y,z = var_position block = chr(21) world[x, y, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y, z, block), world=world) self.client.sendBlock(x, y, z, block) block = chr(3) world[x, y+1, z] = block self.client.queueTask(TASK_BLOCKSET, (x, y+1, z, block), world=world) self.client.sendBlock(x, y+1, z, block)
TheArchives/Nexus
core/entities/mrt.py
Python
bsd-2-clause
6,657
[ "Brian", "VisIt" ]
3b1bba3c13e793c6e5563b2005d000f13fc058ac8b5649fc4a1dca7d10a6636e
import logging import numpy as np import pytest import nengo from neurons import AdaptiveLIF from nengo.utils.numpy import rms logger = logging.getLogger(__name__) def test_alif_neuron(Simulator, plt): """Test that the adaptive LIF dynamic model matches the predicted rates Tests a single neuron across multiple input currents """ tau_n = .1 inc_n = 10. max_rates = np.array([8.095]) intercepts = np.array([.059]) # tau_n = .1 # inc_n = .1 # max_rates = np.array([200.]) # intercepts = np.array([.2]) alif_neuron = AdaptiveLIF(tau_rc=.05, tau_ref=.002, tau_n=tau_n, inc_n=inc_n) u_vals = np.array([ 0, .1, .2, .3, .4, .5, .6, .7, .8, .9, 1.]) Ts = [ .1, 3.0, 3.0, 3.0, 3.0, 4.0, 4.0, 4.0, 4.0, 4.0] sim_rates = np.zeros_like(u_vals) num_rates = np.zeros_like(u_vals) for idx, (u, T) in enumerate(zip(u_vals, Ts)): net = nengo.Network() with net: stim = nengo.Node(u) net.ens = nengo.Ensemble( 1, 1, neuron_type=alif_neuron, max_rates=max_rates, intercepts=intercepts) nengo.Connection(stim, net.ens.neurons, transform=np.array([[1.]]), synapse=None) net.ps = nengo.Probe(net.ens.neurons, 'spikes') sim = Simulator(net) est_rate = net.ens.neuron_type.rates( u, sim.data[net.ens].gain, sim.data[net.ens].bias) sim.run(T) num_rates[idx] = est_rate spks = sim.data[net.ps] spk_times = np.nonzero(spks)[0]*sim.dt if len(spk_times) > 1: isi = np.diff(spk_times) sim_rates[idx] = 1. / np.mean(isi[-10:]) if est_rate > 0.: rel_diff = abs(est_rate - sim_rates[idx]) / est_rate assert rel_diff < .01, ( 'Estimated rate differs from rate extracted from simulation' + ' by more than 1%% for u=%f' % (u)) else: assert sim_rates[idx] == 0. plt.plot(u_vals, sim_rates, 'bo', ms=6, label='simulated rate') plt.plot(u_vals, num_rates, 'ro', ms=6, label='numerically estimated rate') plt.legend(loc='upper left') plt.xlabel('input') plt.ylabel('rate') def test_alif_neurons(Simulator, plt, rng): """Test that the adaptive LIF dynamic model matches the predicted rates Tests an Ensemble of neurons at a single input value """ dt = 0.001 n = 100 x = .5 encoders = np.ones((n, 1)) max_rates = rng.uniform(low=10, high=200, size=n) intercepts = rng.uniform(low=-1, high=1, size=n) net = nengo.Network() with net: ins = nengo.Node(x) ens = nengo.Ensemble( n, dimensions=1, encoders=encoders, max_rates=max_rates, intercepts=intercepts, neuron_type=AdaptiveLIF(tau_n=.1, inc_n=.1)) nengo.Connection(ins, ens.neurons, transform=np.ones((n, 1)), synapse=None) spike_probe = nengo.Probe(ens.neurons) voltage_probe = nengo.Probe(ens.neurons, 'voltage') adaptation_probe = nengo.Probe(ens.neurons, 'adaptation') ref_probe = nengo.Probe(ens.neurons, 'refractory_time') sim = Simulator(net, dt=dt) t_final = 3.0 t_ss = 1.0 # time to consider neurons at steady state sim.run(t_final) n_select = rng.choice(n) # pick a random neuron t = sim.trange() idx = t < t_ss plt.figure(figsize=(10, 6)) plt.subplot(411) plt.plot(t[idx], sim.data[spike_probe][idx, n_select]) plt.ylabel('spikes') plt.subplot(412) plt.plot(t[idx], sim.data[voltage_probe][idx, n_select]) plt.ylabel('voltage') plt.subplot(413) plt.plot(t[idx], sim.data[adaptation_probe][idx, n_select]) plt.ylabel('adaptation') plt.subplot(414) plt.plot(t[idx], sim.data[ref_probe][idx, n_select]) plt.ylim([-dt, ens.neuron_type.tau_ref + dt]) plt.xlabel('time') plt.ylabel('ref time') # check rates against analytic rates math_rates = ens.neuron_type.rates( x, *ens.neuron_type.gain_bias(max_rates, intercepts)) idx = t >= t_ss spikes = sim.data[spike_probe][idx, :] sim_rates = (spikes > 0).sum(0) / (t_final - t_ss) logger.debug("ME = %f", (sim_rates - math_rates).mean()) logger.debug("RMSE = %f", rms(sim_rates - math_rates) / (rms(math_rates) + 1e-20)) assert np.sum(math_rates > 0) > 0.5 * n, ( "At least 50% of neurons must fire") assert np.allclose(sim_rates, math_rates, atol=1, rtol=0.001) if __name__ == "__main__": nengo.log(debug=True) pytest.main([__file__, '-v'])
fragapanagos/adaptive_lif
test_neurons.py
Python
mit
4,689
[ "NEURON" ]
61fd7ea29d30cd592336e88f1e5a28fb634af9925224b17dad1037c93ebab373
''' Utilities for tests. ''' from six.moves import zip import numpy as np import astropy.units as u from astropy.io import fits from astropy.utils import NumpyRNGContext from ..spectral_cube import SpectralCube def generate_header(pixel_scale, spec_scale, beamfwhm, imshape, v0): header = {'CDELT1': -(pixel_scale).to(u.deg).value, 'CDELT2': (pixel_scale).to(u.deg).value, 'BMAJ': beamfwhm.to(u.deg).value, 'BMIN': beamfwhm.to(u.deg).value, 'BPA': 0.0, 'CRPIX1': imshape[0] / 2., 'CRPIX2': imshape[1] / 2., 'CRVAL1': 0.0, 'CRVAL2': 0.0, 'CTYPE1': 'GLON-CAR', 'CTYPE2': 'GLAT-CAR', 'CUNIT1': 'deg', 'CUNIT2': 'deg', 'CRVAL3': v0, 'CUNIT3': spec_scale.unit.to_string(), 'CDELT3': spec_scale.value, 'CRPIX3': 1, 'CTYPE3': 'VRAD', 'BUNIT': 'K', } return fits.Header(header) def generate_hdu(data, pixel_scale, spec_scale, beamfwhm, v0): imshape = data.shape[1:] header = generate_header(pixel_scale, spec_scale, beamfwhm, imshape, v0) return fits.PrimaryHDU(data, header) def gaussian(x, amp, mean, sigma): return amp * np.exp(- (x - mean)**2 / (2 * sigma**2)) def generate_gaussian_cube(shape=(100, 25, 25), sigma=8., amp=1., noise=None, spec_scale=1 * u.km / u.s, pixel_scale=1 * u.arcsec, beamfwhm=3 * u.arcsec, v0=None, vel_surface=None, seed=247825498): ''' Generate a SpectralCube with Gaussian profiles. The peak velocity positions can be given with `vel_surface`. Otherwise, the peaks of the profiles are randomly assigned positions in the cubes. This is primarily to test shuffling and stacking of spectra, rather than trying to be being physically meaningful. Returns ------- spec_cube : SpectralCube The generated cube. mean_positions : array The peak positions in the cube. ''' test_cube = np.empty(shape) mean_positions = np.empty(shape[1:]) spec_middle = int(shape[0] / 2) spec_quarter = int(shape[0] / 4) if v0 is None: v0 = 0 with NumpyRNGContext(seed): spec_inds = np.mgrid[-spec_middle:spec_middle] * spec_scale.value if len(spec_inds) == 0: spec_inds = np.array([0]) spat_inds = np.indices(shape[1:]) for y, x in zip(spat_inds[0].flatten(), spat_inds[1].flatten()): # Lock the mean to within 25% from the centre if vel_surface is not None: mean_pos = vel_surface[y,x] else: mean_pos = \ np.random.uniform(low=spec_inds[spec_quarter], high=spec_inds[spec_quarter + spec_middle]) test_cube[:, y, x] = gaussian(spec_inds, amp, mean_pos, sigma) mean_positions[y, x] = mean_pos + v0 if noise is not None: test_cube[:, y, x] += np.random.normal(0, noise, shape[0]) test_hdu = generate_hdu(test_cube, pixel_scale, spec_scale, beamfwhm, spec_inds[0] + v0) spec_cube = SpectralCube.read(test_hdu) mean_positions = mean_positions * spec_scale.unit return spec_cube, mean_positions
jzuhone/spectral-cube
spectral_cube/tests/utilities.py
Python
bsd-3-clause
3,524
[ "Gaussian" ]
6d09cbf3e4ba26802982a45ca57165d030031faa217f1f064f2f63a94123b8f9
# -*- coding: utf-8 -*- import sys import math from pylab import * try: import moose except ImportError: print("ERROR: Could not import moose. Please add the directory containing moose.py in your PYTHONPATH") import sys sys.exit(1) from moose.utils import * # for BSplineFill class GluSyn_STG(moose.SynChan): """Glutamate graded synapse""" def __init__(self, *args): moose.SynChan.__init__(self,*args) self.Ek = -70e-3 # V # For event based synapses, I had a strength of 5e-6 S # to compensate for event-based, # but for the original graded synapses, 5e-9 S is correct. self.Gbar = 5e-9 # S # set weight on connecting the network self.tau1 = 40e-3 # s # this is Vpre dependent (see below) self.tau2 = 0.0 # single first order equation Vth = -35e-3 # V Delta = 5e-3 # V ######## Graded synapse activation inhsyntable = moose.Interpol(self.path+"/graded_table") graded = moose.Mstring(self.path+'/graded') graded.value = 'True' mgblock = moose.Mstring(self.path+'/mgblockStr') mgblock.value = 'False' # also needs a synhandler moosesynhandler = moose.SimpleSynHandler(self.path+'/handler') # connect the SimpleSynHandler to the SynChan (double exp) moose.connect( moosesynhandler, 'activationOut', self, 'activation' ) # ds/dt = s_inf/tau - s/tau = A - Bs # where A=s_inf/tau is activation, B is 1/tau # Fill up the activation and tau tables # Graded synapse tau inhtautable = moose.Interpol(self.path+"/tau_table") inhtautable.xmin = -70e-3 # V inhtautable.xmax = 0e-3 # V tau = [self.tau1] # at -70 mV tau.extend( [self.tau1*(1. - 1./(1+math.exp((Vth-vm)/Delta))) \ for vm in arange(-70e-3,0.00001e-3,70e-3/1000.)] ) inhtautable.vector = array(tau) inhtautable.connect("lookupOut",self,"setTau1") # Graded synapse activation inhsyntable.xmin = -70e-3 # V inhsyntable.xmax = 0e-3 # V act = [0.0] # at -70 mV act.extend( [1/(1+math.exp((Vth-vm)/Delta)) \ for vm in arange(-70e-3,0.00001e-3,70e-3/1000.)] ) act = array(act) / array(tau) # element-wise division # NOTE: A = s_inf/tau inhsyntable.vector = array(act) inhsyntable.connect("lookupOut",self,"activation")
BhallaLab/moose-examples
neuroml/lobster_pyloric/synapses/GluSyn_STG.py
Python
gpl-2.0
2,442
[ "MOOSE" ]
ff0527035c1c8792577135dbc240a535b1e9ca1caf42b3688ca332d57931ec20
from __future__ import absolute_import from __future__ import unicode_literals import logging from functools import reduce from docker.errors import APIError from docker.errors import NotFound from .config import ConfigurationError from .config import get_service_name_from_net from .const import DEFAULT_TIMEOUT from .const import LABEL_ONE_OFF from .const import LABEL_PROJECT from .const import LABEL_SERVICE from .container import Container from .legacy import check_for_legacy_containers from .service import ContainerNet from .service import ConvergenceStrategy from .service import Net from .service import parse_volume_from_spec from .service import Service from .service import ServiceNet from .service import VolumeFromSpec from .utils import parallel_execute log = logging.getLogger(__name__) def sort_service_dicts(services): # Topological sort (Cormen/Tarjan algorithm). unmarked = services[:] temporary_marked = set() sorted_services = [] def get_service_names(links): return [link.split(':')[0] for link in links] def get_service_names_from_volumes_from(volumes_from): return [ parse_volume_from_spec(volume_from).source for volume_from in volumes_from ] def get_service_dependents(service_dict, services): name = service_dict['name'] return [ service for service in services if (name in get_service_names(service.get('links', [])) or name in get_service_names_from_volumes_from(service.get('volumes_from', [])) or name == get_service_name_from_net(service.get('net'))) ] def visit(n): if n['name'] in temporary_marked: if n['name'] in get_service_names(n.get('links', [])): raise DependencyError('A service can not link to itself: %s' % n['name']) if n['name'] in n.get('volumes_from', []): raise DependencyError('A service can not mount itself as volume: %s' % n['name']) else: raise DependencyError('Circular import between %s' % ' and '.join(temporary_marked)) if n in unmarked: temporary_marked.add(n['name']) for m in get_service_dependents(n, services): visit(m) temporary_marked.remove(n['name']) unmarked.remove(n) sorted_services.insert(0, n) while unmarked: visit(unmarked[-1]) return sorted_services class Project(object): """ A collection of services. """ def __init__(self, name, services, client, use_networking=False, network_driver=None): self.name = name self.services = services self.client = client self.use_networking = use_networking self.network_driver = network_driver def labels(self, one_off=False): return [ '{0}={1}'.format(LABEL_PROJECT, self.name), '{0}={1}'.format(LABEL_ONE_OFF, "True" if one_off else "False"), ] @classmethod def from_dicts(cls, name, service_dicts, client, use_networking=False, network_driver=None): """ Construct a ServiceCollection from a list of dicts representing services. """ project = cls(name, [], client, use_networking=use_networking, network_driver=network_driver) if use_networking: remove_links(service_dicts) for service_dict in sort_service_dicts(service_dicts): links = project.get_links(service_dict) volumes_from = project.get_volumes_from(service_dict) net = project.get_net(service_dict) project.services.append( Service( client=client, project=name, use_networking=use_networking, links=links, net=net, volumes_from=volumes_from, **service_dict)) return project @property def service_names(self): return [service.name for service in self.services] def get_service(self, name): """ Retrieve a service by name. Raises NoSuchService if the named service does not exist. """ for service in self.services: if service.name == name: return service raise NoSuchService(name) def validate_service_names(self, service_names): """ Validate that the given list of service names only contains valid services. Raises NoSuchService if one of the names is invalid. """ valid_names = self.service_names for name in service_names: if name not in valid_names: raise NoSuchService(name) def get_services(self, service_names=None, include_deps=False): """ Returns a list of this project's services filtered by the provided list of names, or all services if service_names is None or []. If include_deps is specified, returns a list including the dependencies for service_names, in order of dependency. Preserves the original order of self.services where possible, reordering as needed to resolve dependencies. Raises NoSuchService if any of the named services do not exist. """ if service_names is None or len(service_names) == 0: return self.get_services( service_names=self.service_names, include_deps=include_deps ) else: unsorted = [self.get_service(name) for name in service_names] services = [s for s in self.services if s in unsorted] if include_deps: services = reduce(self._inject_deps, services, []) uniques = [] [uniques.append(s) for s in services if s not in uniques] return uniques def get_links(self, service_dict): links = [] if 'links' in service_dict: for link in service_dict.get('links', []): if ':' in link: service_name, link_name = link.split(':', 1) else: service_name, link_name = link, None try: links.append((self.get_service(service_name), link_name)) except NoSuchService: raise ConfigurationError( 'Service "%s" has a link to service "%s" which does not ' 'exist.' % (service_dict['name'], service_name)) del service_dict['links'] return links def get_volumes_from(self, service_dict): volumes_from = [] if 'volumes_from' in service_dict: for volume_from_config in service_dict.get('volumes_from', []): volume_from_spec = parse_volume_from_spec(volume_from_config) # Get service try: service_name = self.get_service(volume_from_spec.source) volume_from_spec = VolumeFromSpec(service_name, volume_from_spec.mode) except NoSuchService: try: container_name = Container.from_id(self.client, volume_from_spec.source) volume_from_spec = VolumeFromSpec(container_name, volume_from_spec.mode) except APIError: raise ConfigurationError( 'Service "%s" mounts volumes from "%s", which is ' 'not the name of a service or container.' % ( service_dict['name'], volume_from_spec.source)) volumes_from.append(volume_from_spec) del service_dict['volumes_from'] return volumes_from def get_net(self, service_dict): net = service_dict.pop('net', None) if not net: if self.use_networking: return Net(self.name) return Net(None) net_name = get_service_name_from_net(net) if not net_name: return Net(net) try: return ServiceNet(self.get_service(net_name)) except NoSuchService: pass try: return ContainerNet(Container.from_id(self.client, net_name)) except APIError: raise ConfigurationError( 'Service "%s" is trying to use the network of "%s", ' 'which is not the name of a service or container.' % ( service_dict['name'], net_name)) def start(self, service_names=None, **options): for service in self.get_services(service_names): service.start(**options) def stop(self, service_names=None, **options): parallel_execute( objects=self.containers(service_names), obj_callable=lambda c: c.stop(**options), msg_index=lambda c: c.name, msg="Stopping" ) def pause(self, service_names=None, **options): for service in reversed(self.get_services(service_names)): service.pause(**options) def unpause(self, service_names=None, **options): for service in self.get_services(service_names): service.unpause(**options) def kill(self, service_names=None, **options): parallel_execute( objects=self.containers(service_names), obj_callable=lambda c: c.kill(**options), msg_index=lambda c: c.name, msg="Killing" ) def remove_stopped(self, service_names=None, **options): all_containers = self.containers(service_names, stopped=True) stopped_containers = [c for c in all_containers if not c.is_running] parallel_execute( objects=stopped_containers, obj_callable=lambda c: c.remove(**options), msg_index=lambda c: c.name, msg="Removing" ) def restart(self, service_names=None, **options): for service in self.get_services(service_names): service.restart(**options) def build(self, service_names=None, no_cache=False, pull=False): for service in self.get_services(service_names): if service.can_be_built(): service.build(no_cache, pull) else: log.info('%s uses an image, skipping' % service.name) def up(self, service_names=None, start_deps=True, strategy=ConvergenceStrategy.changed, do_build=True, timeout=DEFAULT_TIMEOUT, detached=False): services = self.get_services(service_names, include_deps=start_deps) for service in services: service.remove_duplicate_containers() plans = self._get_convergence_plans(services, strategy) if self.use_networking: self.ensure_network_exists() return [ container for service in services for container in service.execute_convergence_plan( plans[service.name], do_build=do_build, timeout=timeout, detached=detached ) ] def _get_convergence_plans(self, services, strategy): plans = {} for service in services: updated_dependencies = [ name for name in service.get_dependency_names() if name in plans and plans[name].action == 'recreate' ] if updated_dependencies and strategy.allows_recreate: log.debug('%s has upstream changes (%s)', service.name, ", ".join(updated_dependencies)) plan = service.convergence_plan(ConvergenceStrategy.always) else: plan = service.convergence_plan(strategy) plans[service.name] = plan return plans def pull(self, service_names=None, ignore_pull_failures=False): for service in self.get_services(service_names, include_deps=False): service.pull(ignore_pull_failures) def containers(self, service_names=None, stopped=False, one_off=False): if service_names: self.validate_service_names(service_names) else: service_names = self.service_names containers = list(filter(None, [ Container.from_ps(self.client, container) for container in self.client.containers( all=stopped, filters={'label': self.labels(one_off=one_off)})])) def matches_service_names(container): return container.labels.get(LABEL_SERVICE) in service_names if not containers: check_for_legacy_containers( self.client, self.name, self.service_names, ) return [c for c in containers if matches_service_names(c)] def get_network(self): try: return self.client.inspect_network(self.name) except NotFound: return None def ensure_network_exists(self): # TODO: recreate network if driver has changed? if self.get_network() is None: log.info( 'Creating network "{}" with driver "{}"' .format(self.name, self.network_driver) ) self.client.create_network(self.name, driver=self.network_driver) def remove_network(self): network = self.get_network() if network: self.client.remove_network(network['id']) def _inject_deps(self, acc, service): dep_names = service.get_dependency_names() if len(dep_names) > 0: dep_services = self.get_services( service_names=list(set(dep_names)), include_deps=True ) else: dep_services = [] dep_services.append(service) return acc + dep_services def remove_links(service_dicts): services_with_links = [s for s in service_dicts if 'links' in s] if not services_with_links: return if len(services_with_links) == 1: prefix = '"{}" defines'.format(services_with_links[0]['name']) else: prefix = 'Some services ({}) define'.format( ", ".join('"{}"'.format(s['name']) for s in services_with_links)) log.warn( '\n{} links, which are not compatible with Docker networking and will be ignored.\n' 'Future versions of Docker will not support links - you should remove them for ' 'forwards-compatibility.\n'.format(prefix)) for s in services_with_links: del s['links'] class NoSuchService(Exception): def __init__(self, name): self.name = name self.msg = "No such service: %s" % self.name def __str__(self): return self.msg class DependencyError(ConfigurationError): pass
KevinGreene/compose
compose/project.py
Python
apache-2.0
15,116
[ "VisIt" ]
0006bdd5fdd8e867a83f2775a64d0c2a5d27d3f71e621972605b2428f7cf4e90
#!/usr/bin/env python # Copyright 2014-2018 The PySCF Developers. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # Contact "Bingbing Suo" <bsuo@nwu.edu.cn> to download and install Xian-CI # program. # ''' Generate Xian-CI input file and integral file ''' from functools import reduce import numpy import h5py from pyscf import ao2mo from pyscf import symm def write_integrals(xci, orb): mol = xci.mol orbsym = symm.label_orb_symm(mol, mol.irrep_id, mol.symm_orb, orb) h1e = reduce(numpy.dot, (orb.T, xci.get_hcore(), orb)) norb = orb.shape[1] if xci._eri is not None: h2e = ao2mo.restore(1, ao2mo.full(xci._eri, orb), norb) else: h2e = ao2mo.restore(1, ao2mo.full(mol, orb), norb) with h5py.File(xci.integralfile, 'w') as f: f['h1e'] = h1e f['h2e'] = h2e f['norb' ] = numpy.array(norb, dtype=numpy.int32) f['group' ] = mol.groupname f['orbsym'] = numpy.asarray(orbsym, dtype=numpy.int32) f['ecore' ] = mol.energy_nuc() def write_input(xci, orb): mol = xci.mol with open(xci.inputfile, 'w') as f: f.write('%d 1 %d %g %g ! nroots; default; IC modes(0: UC, 1: WK, 2: CW, 3: VD, 4: FC, 8: DS, 9: SS, 10: SD); PLP cut; Ref cut \n' % (xci.nroots, xci.ic_mode, xci.plpcut, xci.refcut)) f.write('%d %2.1f %d %d %f ! CI electrons; spin value; total irrep; irrep index; CI coeff print criterion \n' % (xci.nelec, mol.spin*.5, len(mol.irrep_id), xci.wfnsym, xci.print_thr)) f.write('%d %d %d %d ! norb_frz,norb_dz,norb_act,next_frz\n' % (xci.frozen, xci.ndocc, xci.ncas, xci.next_frozen)) f.write('%d %d ! RUNPT2 modes(1: MS-SR-MRPT2; 2: MS-MR-MRPT2; 3: Dyall-MRPT2) ; RUNCI modes(0: ICMRCI; 1: ICMRPT2)\n' % (xci.pt2_mode, xci.ic_mode)) f.write('0 0 0 0 0 0\n') f.write('4 0 ! default\n') class XianCiInpHandler(object): def __init__(self, method, inputfile, integralfile): self.mol = method.mol assert(mol.symmetry) if getattr(method, '_eri', None) is not None: self._eri = method._eri elif (getattr(method, '_scf', None) and getattr(method._scf, '_eri', None) is not None): self._eri = method._scf._eri else: self._eri = None self.get_hcore = method.get_hcore self.mo_coeff = method.mo_coeff #self.exe = settings.XIANCIEXE self.inputfile = inputfile self.integralfile = integralfile self.nroots = 1 self.nelec = mol.nelectron self.ic_mode = 0 self.plpcut = 1e-3 self.refcut = 1e-3 self.print_thr = 0.05 self.wfnsym = 1 self.frozen = 0 self.ndocc = 0 self.ncas = self.mo_coeff.shape[1] self.next_frozen = 0 self.pt2_mode = 0 self.ic_mode = 0 def gen_input(self): write_input(self, self.mo_coeff) write_integrals(self, self.mo_coeff) def kernel(self): self.gen_input() if __name__ == '__main__': from pyscf import gto, scf mol = gto.M( atom = [['O',(0, 0, 0)], ['H',(0.790689766, 0, 0.612217330)], ['H',(-0.790689766, 0, 0.612217330)]], basis = 'ccpvdz', symmetry = 1) mf = scf.RHF(mol).run() XianCiInpHandler(mf, 'drt.inp', 'eri.h5').kernel()
gkc1000/pyscf
pyscf/xianci/xianci.py
Python
apache-2.0
4,002
[ "PySCF" ]
091062fc180987ef85ef47efd59ab97233a2d70c8439f5f2f12bbfbfc1c8b062
#!/usr/bin/env python """ roms.interp Methods to interpolate ROMS fields onto other grids Written by Brian Powell on 11/02/13 Copyright (c)2017 University of Hawaii under the MIT-License. """ import numpy as np import netCDF4 import os import seapy from seapy.timeout import timeout, TimeoutError from joblib import Parallel, delayed from warnings import warn _up_scaling = {"zeta": 1.0, "u": 1.0, "v": 1.0, "temp": 1.0, "salt": 1.0} _down_scaling = {"zeta": 1.0, "u": 0.99, "v": 0.99, "temp": 0.99, "salt": 1.001} _ksize_range = (7, 15) # Limit amount of memory in bytes to process in a single read. This determines how to # divide up the time-records in interpolation _max_memory = 768 * 1024 * 1024 # 768 MBytes def __mask_z_grid(z_data, src_depth, z_depth): """ When interpolating to z-grid, we need to apply depth dependent masking based on the original ROMS depths """ for k in np.arange(0, z_depth.shape[0]): idx = np.nonzero(z_depth[k, :, :] < src_depth) if z_data.ndim == 4: z_data.mask[:, k, idx[0], idx[1]] = True elif z_data.ndim == 3: z_data.mask[k, idx[0], idx[1]] = True def __interp2_thread(rx, ry, data, zx, zy, pmap, weight, nx, ny, mask): """ internal routine: 2D interpolation thread for parallel interpolation """ data = np.ma.fix_invalid(data, copy=False) # Convolve the water over the land ksize = 2 * np.round(np.sqrt((nx / np.median(np.diff(rx)))**2 + (ny / np.median(np.diff(ry.T)))**2)) + 1 if ksize < _ksize_range[0]: warn("nx or ny values are too small for stable OA, {:f}".format(ksize)) ksize = _ksize_range[0] elif ksize > _ksize_range[1]: warn("nx or ny values are too large for stable OA, {:f}".format(ksize)) ksize = _ksize_range[1] data = seapy.convolve_mask(data, ksize=ksize, copy=False) # Interpolate the field and return the result with timeout(minutes=30): res, pm = seapy.oasurf(rx, ry, data, zx, zy, pmap, weight, nx, ny) return np.ma.masked_where(np.logical_or(mask == 0, np.abs(res) > 9e4), res, copy=False) def __interp3_thread(rx, ry, rz, data, zx, zy, zz, pmap, weight, nx, ny, mask, up_factor=1.0, down_factor=1.0): """ internal routine: 3D interpolation thread for parallel interpolation """ # Make the mask 3D mask = seapy.adddim(mask, zz.shape[0]) data = np.ma.fix_invalid(data, copy=False) # To avoid extrapolation, we are going to convolve ocean over the land # and add a new top and bottom layer that replicates the data of the # existing current and top. 1) iteratively convolve until we have # filled most of the points, 2) Determine which way the # depth goes and add/subtract new layers, and 3) fill in masked values # from the layer above/below. gradsrc = (rz[0, 1, 1] - rz[-1, 1, 1]) > 0 # Convolve the water over the land ksize = 2 * np.round(np.sqrt((nx / np.median(np.diff(rx)))**2 + (ny / np.median(np.diff(ry.T)))**2)) + 1 if ksize < _ksize_range[0]: warn("nx or ny values are too small for stable OA, {:f}".format(ksize)) ksize = _ksize_range[0] elif ksize > _ksize_range[1]: warn("nx or ny values are too large for stable OA, {:f}".format(ksize)) ksize = _ksize_range[1] # Iterate at most 5 times, but we will hopefully break out before that by # checking if we have filled at least 40% of the bottom to be like # the surface bot = -1 if gradsrc else 0 top = 0 if gradsrc else -1 topmask = np.maximum(1, np.ma.count_masked(data[top, :, :])) if np.ma.count_masked(data[bot, :, :]) > 0: for iter in range(5): # Check if we have most everything by checking the bottom data = seapy.convolve_mask(data, ksize=ksize + iter, copy=False) if topmask / np.maximum(1, np.ma.count_masked(data[bot, :, :])) > 0.4: break # Now fill vertically nrz = np.zeros((data.shape[0] + 2, data.shape[1], data.shape[2])) nrz[1:-1, :, :] = rz nrz[bot, :, :] = rz[bot, :, :] - 5000 nrz[top, :, :] = 1 if not gradsrc: # The first level is the bottom # factor = down_factor levs = np.arange(data.shape[0], 0, -1) - 1 else: # The first level is the top # factor = up_factor levs = np.arange(0, data.shape[0]) # Fill in missing values where we have them from the shallower layer for k in levs[1:]: if np.ma.count_masked(data[k, :, :]) == 0: continue idx = np.nonzero(np.logical_xor(data.mask[k, :, :], data.mask[k - 1, :, :])) data.mask[k, idx[0], idx[1]] = data.mask[k - 1, idx[0], idx[1]] data[k, idx[0], idx[1]] = data[k - 1, idx[0], idx[1]] * down_factor # Add upper and lower boundaries ndat = np.zeros((data.shape[0] + 2, data.shape[1], data.shape[2])) ndat[bot, :, :] = data[bot, :, :].filled(np.nan) * down_factor ndat[1:-1, :, :] = data.filled(np.nan) ndat[top, :, :] = data[top, :, :].filled(np.nan) * up_factor # Interpolate the field and return the result with timeout(minutes=30): if gradsrc: res, pm = seapy.oavol(rx, ry, nrz[::-1, :, :], ndat[::-1, :, :], zx, zy, zz, pmap, weight, nx, ny) else: res, pm = seapy.oavol(rx, ry, nrz, ndat, zx, zy, zz, pmap, weight, nx, ny) return np.ma.masked_where(np.logical_or(mask == 0, np.abs(res) > 9e4), res, copy=False) def __interp3_vel_thread(rx, ry, rz, ra, u, v, zx, zy, zz, za, pmap, weight, nx, ny, mask): """ internal routine: 3D velocity interpolation thread for parallel interpolation """ # Put on the same grid if u.shape != v.shape: u = seapy.model.u2rho(u, fill=True) v = seapy.model.v2rho(v, fill=True) # Rotate the fields (NOTE: ROMS angle is negative relative to "true") if ra is not None: u, v = seapy.rotate(u, v, ra) # Interpolate u = __interp3_thread(rx, ry, rz, u, zx, zy, zz, pmap, weight, nx, ny, mask, _up_scaling["u"], _down_scaling["u"]) v = __interp3_thread(rx, ry, rz, v, zx, zy, zz, pmap, weight, nx, ny, mask, _up_scaling["v"], _down_scaling["v"]) # Rotate to destination (NOTE: ROMS angle is negative relative to "true") if za is not None: u, v = seapy.rotate(u, v, -za) # Return the masked data return u, v def __interp_grids(src_grid, child_grid, ncout, records=None, threads=2, nx=0, ny=0, weight=10, vmap=None, z_mask=False, pmap=None): """ internal method: Given a model file (average, history, etc.), interpolate the fields onto another gridded file. Parameters ---------- src_grid : seapy.model.grid data source (History, Average, etc. file) child_grid : seapy.model.grid output data grid ncout : netcdf output file [records] : array of the record indices to interpolate [threads] : number of processing threads [nx] : decorrelation length in grid-cells for x [ny] : decorrelation length in grid-cells for y [vmap] : variable name mapping [z_mask] : mask out depths in z-grids [pmap] : use the specified pmap rather than compute it Returns ------- None """ # If we don't have a variable map, then do a one-to-one mapping if vmap is None: vmap = dict() for k in seapy.roms.fields: vmap[k] = k # Generate a file to store the pmap information sname = getattr(src_grid, 'name', None) cname = getattr(child_grid, 'name', None) pmap_file = None if any(v is None for v in (sname, cname)) else \ sname + "_" + cname + "_pmap.npz" # Create or load the pmaps depending on if they exist if nx == 0: if hasattr(src_grid, "dm") and hasattr(child_grid, "dm"): nx = np.ceil(np.mean(src_grid.dm) / np.mean(child_grid.dm)) else: nx = 5 if ny == 0: if hasattr(src_grid, "dn") and hasattr(child_grid, "dn"): ny = np.ceil(np.mean(src_grid.dn) / np.mean(child_grid.dn)) else: ny = 5 if pmap is None: if pmap_file is not None and os.path.isfile(pmap_file): pmap = np.load(pmap_file) else: tmp = np.ma.masked_equal(src_grid.mask_rho, 0) tmp, pmaprho = seapy.oasurf(src_grid.lon_rho, src_grid.lat_rho, tmp, child_grid.lon_rho, child_grid.lat_rho, weight=weight, nx=nx, ny=ny) tmp = np.ma.masked_equal(src_grid.mask_u, 0) tmp, pmapu = seapy.oasurf(src_grid.lon_u, src_grid.lat_u, tmp, child_grid.lon_rho, child_grid.lat_rho, weight=weight, nx=nx, ny=ny) tmp = np.ma.masked_equal(src_grid.mask_v, 0) tmp, pmapv = seapy.oasurf(src_grid.lon_v, src_grid.lat_v, tmp, child_grid.lon_rho, child_grid.lat_rho, weight=weight, nx=nx, ny=ny) if pmap_file is not None: np.savez(pmap_file, pmaprho=pmaprho, pmapu=pmapu, pmapv=pmapv) pmap = {"pmaprho": pmaprho, "pmapu": pmapu, "pmapv": pmapv} # Get the time field ncsrc = seapy.netcdf(src_grid.filename) time = seapy.roms.get_timevar(ncsrc) # Interpolate the depths from the source to final grid src_depth = np.min(src_grid.depth_rho, 0) dst_depth = __interp2_thread(src_grid.lon_rho, src_grid.lat_rho, src_depth, child_grid.lon_rho, child_grid.lat_rho, pmap[ "pmaprho"], weight, nx, ny, child_grid.mask_rho) # Interpolate the scalar fields records = np.arange(0, ncsrc.variables[time].shape[0]) \ if records is None else np.atleast_1d(records) for src in vmap: dest = vmap[src] # Extra fields will probably be user tracers (biogeochemical) fld = seapy.roms.fields.get(dest, {"dims": 3}) # Only interpolate the fields we want in the destination if (dest not in ncout.variables) or ("rotate" in fld): continue if fld["dims"] == 2: # Compute the max number of hold in memory maxrecs = np.maximum(1, np.minimum(len(records), np.int(_max_memory / (child_grid.lon_rho.nbytes + src_grid.lon_rho.nbytes)))) for rn, recs in enumerate(seapy.chunker(records, maxrecs)): outr = np.s_[ rn * maxrecs:np.minimum((rn + 1) * maxrecs, len(records))] ndata = np.ma.array(Parallel(n_jobs=threads, verbose=2, max_nbytes=_max_memory) (delayed(__interp2_thread)( src_grid.lon_rho, src_grid.lat_rho, ncsrc.variables[src][i, :, :], child_grid.lon_rho, child_grid.lat_rho, pmap["pmaprho"], weight, nx, ny, child_grid.mask_rho) for i in recs), copy=False) ncout.variables[dest][outr, :, :] = ndata ncout.sync() else: maxrecs = np.maximum(1, np.minimum( len(records), np.int(_max_memory / (child_grid.lon_rho.nbytes * child_grid.n + src_grid.lon_rho.nbytes * src_grid.n)))) for rn, recs in enumerate(seapy.chunker(records, maxrecs)): outr = np.s_[ rn * maxrecs:np.minimum((rn + 1) * maxrecs, len(records))] ndata = np.ma.array(Parallel(n_jobs=threads, verbose=2, max_nbytes=_max_memory) (delayed(__interp3_thread)( src_grid.lon_rho, src_grid.lat_rho, src_grid.depth_rho, ncsrc.variables[src][i, :, :, :], child_grid.lon_rho, child_grid.lat_rho, child_grid.depth_rho, pmap["pmaprho"], weight, nx, ny, child_grid.mask_rho, up_factor=_up_scaling.get(dest, 1.0), down_factor=_down_scaling.get(dest, 1.0)) for i in recs), copy=False) if z_mask: __mask_z_grid(ndata, dst_depth, child_grid.depth_rho) ncout.variables[dest][outr, :, :, :] = ndata ncout.sync() # Rotate and Interpolate the vector fields. First, determine which # are the "u" and the "v" vmap fields try: velmap = { "u": list(vmap.keys())[list(vmap.values()).index("u")], "v": list(vmap.keys())[list(vmap.values()).index("v")]} except: warn("velocity not present in source file") return srcangle = src_grid.angle if src_grid.cgrid else None dstangle = child_grid.angle if child_grid.cgrid else None maxrecs = np.minimum(len(records), np.int(_max_memory / (2 * (child_grid.lon_rho.nbytes * child_grid.n + src_grid.lon_rho.nbytes * src_grid.n)))) for nr, recs in enumerate(seapy.chunker(records, maxrecs)): vel = Parallel(n_jobs=threads, verbose=2, max_nbytes=_max_memory)(delayed(__interp3_vel_thread)( src_grid.lon_rho, src_grid.lat_rho, src_grid.depth_rho, srcangle, ncsrc.variables[velmap["u"]][i, :, :, :], ncsrc.variables[velmap["v"]][i, :, :, :], child_grid.lon_rho, child_grid.lat_rho, child_grid.depth_rho, dstangle, pmap["pmaprho"], weight, nx, ny, child_grid.mask_rho) for i in recs) for j in range(len(vel)): vel_u = np.ma.array(vel[j][0], copy=False) vel_v = np.ma.array(vel[j][1], copy=False) if z_mask: __mask_z_grid(vel_u, dst_depth, child_grid.depth_rho) __mask_z_grid(vel_v, dst_depth, child_grid.depth_rho) if child_grid.cgrid: vel_u = seapy.model.rho2u(vel_u) vel_v = seapy.model.rho2v(vel_v) ncout.variables["u"][nr * maxrecs + j, :] = vel_u ncout.variables["v"][nr * maxrecs + j, :] = vel_v if "ubar" in ncout.variables: # Create ubar and vbar # depth = seapy.adddim(child_grid.depth_u, vel_u.shape[0]) ncout.variables["ubar"][nr * maxrecs + j, :] = \ np.sum(vel_u * child_grid.depth_u, axis=0) / \ np.sum(child_grid.depth_u, axis=0) if "vbar" in ncout.variables: # depth = seapy.adddim(child_grid.depth_v, vel_v.shape[0]) ncout.variables["vbar"][nr * maxrecs + j, :] = \ np.sum(vel_v * child_grid.depth_v, axis=0) / \ np.sum(child_grid.depth_v, axis=0) ncout.sync() # Return the pmap that was used return pmap def field2d(src_lon, src_lat, src_field, dest_lon, dest_lat, dest_mask=None, nx=0, ny=0, weight=10, threads=2, pmap=None): """ Given a 2D field with time (dimensions [time, lat, lon]), interpolate onto a new grid and return the new field. This is a helper function when needing to interpolate data within files, etc. Parameters ---------- src_lon: numpy.ndarray longitude that field is on src_lat: numpy.ndarray latitude that field is on src_field: numpy.ndarray field to interpolate dest_lon: numpy.ndarray output longitudes to interpolate to dest_lat: numpy.ndarray output latitudes to interpolate to dest_mask: numpy.ndarray, optional mask to apply to interpolated data reftime: datetime, optional: Reference time as the epoch for z-grid file nx : float, optional: decorrelation length-scale for OA (same units as source data) ny : float, optional: decorrelation length-scale for OA (same units as source data) weight : int, optional: number of points to use in weighting matrix threads : int, optional: number of processing threads pmap : numpy.ndarray, optional: use the specified pmap rather than compute it Output ------ ndarray: interpolated field on the destination grid pmap: the pmap used in the inerpolation """ if pmap is None: tmp, pmap = seapy.oasurf(src_lon, src_lat, src_lat, dest_lon, dest_lat, weight=weight, nx=nx, ny=ny) if dest_mask is None: dest_mask = np.ones(dest_lat.shape) records = np.arange(0, src_field.shape[0]) maxrecs = np.maximum(1, np.minimum(records.size, np.int(_max_memory / (dest_lon.nbytes + src_lon.nbytes)))) for rn, recs in enumerate(seapy.chunker(records, maxrecs)): nfield = np.ma.array(Parallel(n_jobs=threads, verbose=2) (delayed(__interp2_thread)( src_lon, src_lat, src_field[i, :, :], dest_lon, dest_lat, pmap, weight, nx, ny, dest_mask) for i in recs), copy=False) return nfield, pmap def field3d(src_lon, src_lat, src_depth, src_field, dest_lon, dest_lat, dest_depth, dest_mask=None, nx=0, ny=0, weight=10, threads=2, pmap=None): """ Given a 3D field with time (dimensions [time, z, lat, lon]), interpolate onto a new grid and return the new field. This is a helper function when needing to interpolate data within files, etc. Parameters ---------- src_lon: numpy.ndarray longitude that field is on src_lat: numpy.ndarray latitude that field is on srf_depth: numpy.ndarray depths of the field src_field: numpy.ndarray field to interpolate dest_lon: numpy.ndarray output longitudes to interpolate to dest_lat: numpy.ndarray output latitudes to interpolate to dest_depth: numpy.ndarray output depths to interpolate to dest_mask: numpy.ndarray, optional mask to apply to interpolated data reftime: datetime, optional: Reference time as the epoch for z-grid file nx : float, optional: decorrelation length-scale for OA (same units as source data) ny : float, optional: decorrelation length-scale for OA (same units as source data) weight : int, optional: number of points to use in weighting matrix threads : int, optional: number of processing threads pmap : numpy.ndarray, optional: use the specified pmap rather than compute it Output ------ ndarray: interpolated field on the destination grid pmap: the pmap used in the inerpolation """ if pmap is None: tmp, pmap = seapy.oasurf(src_lon, src_lat, src_lat, dest_lon, dest_lat, weight=weight, nx=nx, ny=ny) if dest_mask is None: dest_mask = np.ones(dest_lat.shape) records = np.arange(0, src_field.shape[0]) maxrecs = np.maximum(1, np.minimum(records.size, np.int(_max_memory / (dest_lon.nbytes * dest_depth.shape[0] + src_lon.nbytes * src_depth.shape[0])))) for rn, recs in enumerate(seapy.chunker(records, maxrecs)): nfield = np.ma.array(Parallel(n_jobs=threads, verbose=2) (delayed(__interp3_thread)( src_lon, src_lat, src_depth, src_field[i, :, :], dest_lon, dest_lat, dest_depth, pmap, weight, nx, ny, dest_mask, up_factor=1, down_factor=1) for i in recs), copy=False) return nfield, pmap def to_zgrid(roms_file, z_file, z_grid=None, depth=None, records=None, threads=2, reftime=None, nx=0, ny=0, weight=10, vmap=None, cdl=None, dims=2, pmap=None): """ Given an existing ROMS history or average file, create (if does not exit) a new z-grid file. Use the given z_grid or otherwise build one with the same horizontal extent and the specified depths and interpolate the ROMS fields onto the z-grid. Parameters ---------- roms_file : string, File name of src file to interpolate from z_file : string, Name of desination file to write to z_grid: (string or seapy.model.grid), optional: Name or instance of output definition depth: numpy.ndarray, optional: array of depths to use for z-level records : numpy.ndarray, optional: Record indices to interpolate threads : int, optional: number of processing threads reftime: datetime, optional: Reference time as the epoch for z-grid file nx : float, optional: decorrelation length-scale for OA (same units as source data) ny : float, optional: decorrelation length-scale for OA (same units as source data) weight : int, optional: number of points to use in weighting matrix vmap : dictionary, optional mapping source and destination variables cdl: string, optional, Use the specified CDL file as the definition for the new netCDF file. dims : int, optional number of dimensions to use for lat/lon arrays (default 2) pmap : numpy.ndarray, optional: use the specified pmap rather than compute it Returns ------- pmap : ndarray the weighting matrix computed during the interpolation """ roms_grid = seapy.model.asgrid(roms_file) ncroms = seapy.netcdf(roms_file) src_ref, time = seapy.roms.get_reftime(ncroms) if reftime is not None: src_ref = reftime records = np.arange(0, ncroms.variables[time].shape[0]) \ if records is None else np.atleast_1d(records) # Load the grid if z_grid is not None: z_grid = seapy.model.asgrid(z_grid) elif os.path.isfile(z_file): z_grid = seapy.model.asgrid(z_file) if not os.path.isfile(z_file): if z_grid is None: lat = roms_grid.lat_rho.shape[0] lon = roms_grid.lat_rho.shape[1] if depth is None: raise ValueError("depth must be specified") ncout = seapy.roms.ncgen.create_zlevel(z_file, lat, lon, len(depth), src_ref, "ROMS z-level", cdl=cdl, dims=dims) if dims == 1: ncout.variables["lat"][:] = roms_grid.lat_rho[:, 0] ncout.variables["lon"][:] = roms_grid.lon_rho[0, :] else: ncout.variables["lat"][:] = roms_grid.lat_rho ncout.variables["lon"][:] = roms_grid.lon_rho ncout.variables["depth"][:] = depth ncout.variables["mask"][:] = roms_grid.mask_rho ncout.sync() z_grid = seapy.model.grid(z_file) else: lat = z_grid.lat_rho.shape[0] lon = z_grid.lat_rho.shape[1] dims = z_grid.spatial_dims ncout = seapy.roms.ncgen.create_zlevel(z_file, lat, lon, len(z_grid.z), src_ref, "ROMS z-level", cdl=cdl, dims=dims) if dims == 1: ncout.variables["lat"][:] = z_grid.lat_rho[:, 0] ncout.variables["lon"][:] = z_grid.lon_rho[0, :] else: ncout.variables["lat"][:] = z_grid.lat_rho ncout.variables["lon"][:] = z_grid.lon_rho ncout.variables["depth"][:] = z_grid.z ncout.variables["mask"][:] = z_grid.mask_rho else: ncout = netCDF4.Dataset(z_file, "a") ncout.variables["time"][:] = netCDF4.date2num( netCDF4.num2date(ncroms.variables[time][records], ncroms.variables[time].units), ncout.variables["time"].units) ncroms.close() # Call the interpolation try: roms_grid.set_east(z_grid.east()) pmap = __interp_grids(roms_grid, z_grid, ncout, records=records, threads=threads, nx=nx, ny=ny, vmap=vmap, weight=weight, z_mask=True, pmap=pmap) except TimeoutError: print("Timeout: process is hung, deleting output.") # Delete the output file os.remove(z_file) finally: # Clean up ncout.close() return pmap def to_grid(src_file, dest_file, dest_grid=None, records=None, threads=2, reftime=None, nx=0, ny=0, weight=10, vmap=None, pmap=None): """ Given an existing model file, create (if does not exit) a new ROMS history file using the given ROMS destination grid and interpolate the ROMS fields onto the new grid. If an existing destination file is given, it is interpolated onto the specified. Parameters ---------- src_file : string, Filename of src file to interpolate from dest_file : string, Name of desination file to write to dest_grid: (string or seapy.model.grid), optional: Name or instance of output definition records : numpy.ndarray, optional: Record indices to interpolate threads : int, optional: number of processing threads reftime: datetime, optional: Reference time as the epoch for ROMS file nx : float, optional: decorrelation length-scale for OA (same units as source data) ny : float, optional: decorrelation length-scale for OA (same units as source data) weight : int, optional: number of points to use in weighting matrix vmap : dictionary, optional mapping source and destination variables pmap : numpy.ndarray, optional: use the specified pmap rather than compute it Returns ------- pmap : ndarray the weighting matrix computed during the interpolation """ src_grid = seapy.model.asgrid(src_file) if dest_grid is not None: destg = seapy.model.asgrid(dest_grid) if not os.path.isfile(dest_file): ncsrc = seapy.netcdf(src_file) src_ref, time = seapy.roms.get_reftime(ncsrc) if reftime is not None: src_ref = reftime records = np.arange(0, ncsrc.variables[time].shape[0]) \ if records is None else np.atleast_1d(records) ncout = seapy.roms.ncgen.create_ini(dest_file, eta_rho=destg.eta_rho, xi_rho=destg.xi_rho, s_rho=destg.n, reftime=src_ref, title="interpolated from " + src_file) destg.to_netcdf(ncout) ncout.variables["ocean_time"][:] = netCDF4.date2num( netCDF4.num2date(ncsrc.variables[time][records], ncsrc.variables[time].units), ncout.variables["ocean_time"].units) ncsrc.close() if os.path.isfile(dest_file): ncout = netCDF4.Dataset(dest_file, "a") if dest_grid is None: destg = seapy.model.asgrid(dest_file) # Call the interpolation try: src_grid.set_east(destg.east()) pmap = __interp_grids(src_grid, destg, ncout, records=records, threads=threads, nx=nx, ny=ny, weight=weight, vmap=vmap, pmap=pmap) except TimeoutError: print("Timeout: process is hung, deleting output.") # Delete the output file os.remove(dest_file) finally: # Clean up ncout.close() return pmap def to_clim(src_file, dest_file, dest_grid=None, records=None, clobber=False, cdl=None, threads=2, reftime=None, nx=0, ny=0, weight=10, vmap=None, pmap=None): """ Given an model output file, create (if does not exit) a new ROMS climatology file using the given ROMS destination grid and interpolate the ROMS fields onto the new grid. If an existing destination file is given, it is interpolated onto the specified. Parameters ---------- src_file : string, Filename of src file to interpolate from dest_file : string, Name of desination file to write to dest_grid: (string or seapy.model.grid), optional: Name or instance of output definition records : numpy.ndarray, optional: Record indices to interpolate clobber: bool, optional If True, clobber any existing files and recreate. If False, use the existing file definition cdl: string, optional, Use the specified CDL file as the definition for the new netCDF file. threads : int, optional: number of processing threads reftime: datetime, optional: Reference time as the epoch for climatology file nx : float, optional: decorrelation length-scale for OA (same units as source data) ny : float, optional: decorrelation length-scale for OA (same units as source data) weight : int, optional: number of points to use in weighting matrix vmap : dictionary, optional mapping source and destination variables pmap : numpy.ndarray, optional: use the specified pmap rather than compute it Returns ------- pmap : ndarray the weighting matrix computed during the interpolation """ if dest_grid is not None: destg = seapy.model.asgrid(dest_grid) src_grid = seapy.model.asgrid(src_file) ncsrc = seapy.netcdf(src_file) src_ref, time = seapy.roms.get_reftime(ncsrc) if reftime is not None: src_ref = reftime records = np.arange(0, ncsrc.variables[time].shape[0]) \ if records is None else np.atleast_1d(records) ncout = seapy.roms.ncgen.create_clim(dest_file, eta_rho=destg.ln, xi_rho=destg.lm, s_rho=destg.n, reftime=src_ref, clobber=clobber, cdl=cdl, title="interpolated from " + src_file) src_time = netCDF4.num2date(ncsrc.variables[time][records], ncsrc.variables[time].units) ncout.variables["clim_time"][:] = netCDF4.date2num( src_time, ncout.variables["clim_time"].units) ncsrc.close() else: raise AttributeError( "you must supply a destination file or a grid to make the file") # Call the interpolation try: src_grid.set_east(destg.east()) pmap = __interp_grids(src_grid, destg, ncout, records=records, threads=threads, nx=nx, ny=ny, vmap=vmap, weight=weight, pmap=pmap) except TimeoutError: print("Timeout: process is hung, deleting output.") # Delete the output file os.remove(dest_file) finally: # Clean up ncout.close() return pmap pass
ocefpaf/seapy
seapy/roms/interp.py
Python
mit
33,035
[ "Brian", "NetCDF" ]
faafebeaa7636f81d7470c62753635fb0dfc1df26189ada9c4cc4785a0f302eb
#!/usr/bin/env python import os import urllib2 import gzip import time import numpy as np import pandas as pd from itertools import izip from StringIO import StringIO from collections import defaultdict from biom import Table from lxml import etree from skbio.parse.sequences import parse_fastq, parse_fasta import americangut as ag __author__ = "Daniel McDonald" __copyright__ = "Copyright 2013, The American Gut Project" __credits__ = ["Daniel McDonald", "Adam Robbins-Pianka", "Jamie Morton", "Justine Debelius"] __license__ = "BSD" __version__ = "unversioned" __maintainer__ = "Daniel McDonald" __email__ = "mcdonadt@colorado.edu" def get_path(path): """Get a relative path to the working directory Parameters ---------- path : str A path Returns ------- str The filepath Notes ----- This method does not care if the path exists or not """ return os.path.join(ag.WORKING_DIR, path) def get_new_path(path): """Get a new relative path to the working directory Parameters ---------- path : str A path that does not exist Returns ------- str The filepath Notes ----- It is only assured that the path does not exist at the time of function evaluation. Raises ------ IOError If the path exists """ path = get_path(path) if os.path.exists(path): raise IOError('%s already exists.' % path) return path def get_existing_path(path): """Get an existing relative path to the working directory Parameters ---------- path : str A path that exists Returns ------- str The filepath Notes ----- It is only assured that the path exists at the time of function evaluation Raises ------ IOError If the path does not exist """ path = get_path(path) if not os.path.exists(path): raise IOError('%s does not exist.' % path) return path def parse_mapping_file(open_file): """return (header, [(sample_id, all_other_fields)]) """ header = open_file.readline().strip() res = [] for l in open_file: res.append(l.strip().split('\t', 1)) return (header, res) def verify_subset(table, mapping): """Returns True/False if the table is a subset""" ids = set([i[0] for i in mapping]) t_ids = set(table.ids()) return t_ids.issubset(ids) def slice_mapping_file(table, mapping): """Returns a new mapping corresponding to just the ids in the table""" t_ids = set(table.ids()) res = [] for id_, l in mapping: if id_ in t_ids: res.append('\t'.join([id_, l])) return res def check_file(f, e=IOError): """Verify a file (or directory) exists""" if not os.path.exists(f): raise e("Cannot continue! The file %s does not exist!" % f) def trim_fasta(input_fasta, output_fasta, length): """Trim FASTA sequences to a given length input_fasta: should be an open file. Every two lines should compose a complete FASTA record (header, sequence) output_fasta: should be an open file ready for writing length: what length to trim the sequences to. Sequences shorter than length will not be modified. """ # reads the FASTA file two lines at at a time # Assumptions: 1) each FASTA record is two lines # 2) There are no incomplete FASTA records for header, sequence in izip(input_fasta, input_fasta): header = header.strip() sequence = sequence.strip()[:length] output_fasta.write("%s\n%s\n" % (header, sequence)) def concatenate_files(input_files, output_file, read_chunk=10000): """Concatenate all input files and produce an output file input_fps is a list of open files output_fp is an open file ready for writing """ for infile in input_files: chunk = infile.read(read_chunk) while chunk: output_file.write(chunk) chunk = infile.read(read_chunk) def fetch_study_details(accession): """Fetch secondary accession and FASTQ details yields [(secondary_accession, fastq_url)] """ url_fmt = "http://www.ebi.ac.uk/ena/data/warehouse/" \ "filereport?accession=%(accession)s&result=read_run&" \ "fields=secondary_sample_accession,submitted_ftp" res = fetch_url(url_fmt % {'accession': accession}) for line in res.readlines()[1:]: if 'ERA371447' in line: # Corrupt sequence files were uploaded to EBI for one of the AG # rounds. Ignoring entries associated with this accession works # around the corruption continue parts = line.strip().split('\t') if len(parts) != 2: continue else: yield tuple(parts) def fetch_url(url): """Return an open file handle""" # really should use requests instead of urllib2 attempts = 0 res = None while attempts < 5: attempts += 1 try: res = urllib2.urlopen(url) except urllib2.HTTPError as e: if e.code == 500: time.sleep(5) continue else: raise if res is None: raise ValueError("Failed at fetching %s" % url) return StringIO(res.read()) def fetch_seqs_fastq(url): """Fetch a FTP item""" # not using a url_fmt here as the directory structure has potential to # be different between studies if not url.startswith('ftp://'): url = "ftp://%s" % url res = fetch_url(url) return gzip.GzipFile(fileobj=res) def fetch_metadata_xml(accession): """Fetch sample metadata""" url_fmt = "http://www.ebi.ac.uk/ena/data/view/%(accession)s&display=xml" res = fetch_url(url_fmt % {'accession': accession}) metadata = xml_to_dict(res) return metadata def xml_to_dict(xml_fp): """ Converts xml string to a dictionary Parameters ---------- xml_fp : str xml file ath Returns ------- metadata : dict dictionary where the metadata headers are keys and the values correspond participant survey results """ root = etree.parse(xml_fp).getroot() sample = root.getchildren()[0] metadata = {} identifiers = sample.find('IDENTIFIERS') barcode = identifiers.getchildren()[2].text.split(':')[-1] attributes = sample.find('SAMPLE_ATTRIBUTES') for node in attributes.iterfind('SAMPLE_ATTRIBUTE'): tag, value = node.getchildren() if value.text is None: metadata[tag.text.strip('" ').upper()] = 'no_data' else: metadata[tag.text.strip('" ').upper()] = value.text.strip('" ') description = sample.find('DESCRIPTION') metadata['Description'] = description.text.strip('" ') return barcode, metadata def from_xmls_to_mapping_file(xml_paths, mapping_fp): """ Create a mapping file from multiple xml strings Accepts a list of xml paths, reads them and converts them to a mapping file Parameters ---------- xml_paths : list, file_paths List of file paths for xml files mapping_fp : str File path for the resulting mapping file """ all_md = {} all_cols = set(['BarcodeSequence', 'LinkerPrimerSequence']) for xml_fp in xml_paths: bc, md = xml_to_dict(xml_fp) all_md[bc] = md all_cols.update(md) with open(mapping_fp, 'w') as md_f: header = list(all_cols) md_f.write('#SampleID\t') md_f.write('\t'.join(header)) md_f.write('\n') for sampleid, values in all_md.iteritems(): to_write = [values.get(k, "no_data").encode('utf-8') for k in header] to_write.insert(0, sampleid) md_f.write('\t'.join(to_write)) md_f.write('\n') def fetch_study(study_accession, base_dir): """Fetch and dump a study Grab and dump a study. If sample_accessions are specified, then only those specified samples will be fetched and dumped Parameters ---------- study_accession : str Accession ID for the study base_dir : str Path of base directory to save the fetched results Note ---- If sample_accession is None, then the entire study will be fetched """ if ag.is_test_env(): return 0 study_dir = os.path.join(base_dir, study_accession) if ag.staged_raw_data() is not None: os.symlink(ag.staged_raw_data(), study_dir) elif not os.path.exists(study_dir): os.mkdir(study_dir) new_samples = 0 for sample, fastq_url in fetch_study_details(study_accession): sample_dir = os.path.join(study_dir, sample) if not os.path.exists(sample_dir): # fetch files if it isn't already present os.mkdir(sample_dir) metadata_path = os.path.join(sample_dir, '%s.txt' % sample) fasta_path = os.path.join(sample_dir, '%s.fna' % sample) # write out fasta with open(fasta_path, 'w') as fasta_out: for id_, seq, qual in parse_fastq(fetch_seqs_fastq(fastq_url)): fasta_out.write(">%s\n%s\n" % (id_, seq)) # write mapping xml url_fmt = "http://www.ebi.ac.uk/ena/data/view/" + \ "%(accession)s&display=xml" res = fetch_url(url_fmt % {'accession': sample}) with open(metadata_path, 'w') as md_f: md_f.write(res.read()) new_samples += 1 return new_samples def count_seqs(seqs_fp, subset=None): """Could the number of FASTA records""" if subset is None: return sum(1 for line in seqs_fp if line.startswith(">")) else: subset = set(subset) count = 0 for id_, seq in parse_fasta(seqs_fp): parts = id_.split() # check if the ID is there, and handle the qiimedb suffix case if parts[0] in subset: count += 1 elif parts[0].split('.')[0] in subset: count += 1 return count def count_unique_participants(metadata_fp, criteria=None): """Count the number of unique participants""" if criteria is None: criteria = {} header = {k: i for i, k in enumerate( metadata_fp.next().strip().split('\t'))} count = set() for line in metadata_fp: line = line.strip().split('\t') keep = True for crit, val in criteria.items(): if line[header[crit]] != val: keep = False if keep: count.add(line[header['HOST_SUBJECT_ID']]) return len(count) def count_samples(metadata_fp, criteria=None): """Count the number of samples criteria : dict Header keys and values to restrict by """ if criteria is None: criteria = {} header = {k: i for i, k in enumerate( metadata_fp.next().strip().split('\t'))} count = 0 for line in metadata_fp: line = line.strip().split('\t') keep = True for crit, val in criteria.items(): if line[header[crit]] != val: keep = False if keep: count += 1 return count simple_matter_map = { 'feces': 'FECAL', 'sebum': 'SKIN', 'tongue': 'ORAL', 'skin': 'SKIN', 'mouth': 'ORAL', 'gingiva': 'ORAL', 'gingival epithelium': 'ORAL', 'nares': 'SKIN', 'skin of hand': 'SKIN', 'hand': 'SKIN', 'skin of head': 'SKIN', 'hand skin': 'SKIN', 'throat': 'ORAL', 'auricular region zone of skin': 'SKIN', 'mucosa of tongue': 'ORAL', 'mucosa of vagina': 'SKIN', 'palatine tonsil': 'ORAL', 'hard palate': 'ORAL', 'saliva': 'ORAL', 'stool': 'FECAL', 'vagina': 'SKIN', 'fossa': 'SKIN', 'buccal mucosa': 'ORAL', 'vaginal fornix': 'SKIN', 'hair follicle': 'SKIN', 'nostril': 'SKIN' } def clean_and_reformat_mapping(in_fp, out_fp, body_site_column_name, exp_acronym): """Simplify the mapping file for use in figures in_fp : input file-like object out_fp : output file-like object body_site_column_name : specify the column name for body exp_acronym : short name for the study Returns a dict containing a description of any unprocessed samples. """ errors = defaultdict(list) mapping_lines = [l.strip('\n').split('\t') for l in in_fp] header = mapping_lines[0] header_low = [x.lower() for x in header] bodysite_idx = header_low.index(body_site_column_name.lower()) country_idx = header_low.index('country') new_mapping_lines = [header[:]] new_mapping_lines[0].append('SIMPLE_BODY_SITE') new_mapping_lines[0].append('TITLE_ACRONYM') new_mapping_lines[0].append('TITLE_BODY_SITE') new_mapping_lines[0].append('HMP_SITE') for l in mapping_lines[1:]: new_line = l[:] sample_id = new_line[0] body_site = new_line[bodysite_idx] country = new_line[country_idx] # grab the body site if body_site.startswith('UBERON_'): body_site = body_site.split('_', 1)[-1].replace("_", " ") elif body_site.startswith('UBERON:'): body_site = body_site.split(':', 1)[-1] elif body_site in ['NA', 'unknown', '', 'no_data', 'None', 'Unknown', 'Unspecified']: errors[('unspecified_bodysite', body_site)].append(sample_id) continue else: raise ValueError("Cannot process: %s, %s" % (sample_id, body_site)) # remap the body site if body_site.lower() not in simple_matter_map: errors[('unknown_bodysite', body_site)].append(sample_id) continue else: body_site = simple_matter_map[body_site.lower()] if exp_acronym == 'HMP': hmp_site = 'HMP-%s' % body_site else: hmp_site = body_site # simplify the country if country.startswith('GAZ:'): new_line[country_idx] = country.split(':', 1)[-1] new_line.append(body_site) new_line.append(exp_acronym) new_line.append("%s-%s" % (exp_acronym, body_site)) new_line.append(hmp_site) new_mapping_lines.append(new_line) out_fp.write('\n'.join(['\t'.join(l) for l in new_mapping_lines])) out_fp.write('\n') return errors def add_alpha_diversity(map_, alphas): """Adds alpha diversity to the metadata Parameters ---------- map_ : DataFrame The metadata for all samples alphas : dict A dictionary keying the column name to a dataframe of the alpha diversity information loaded from the `collate_alpha.py` alpha diversity files. Returns ------- alpha_map : DataFrame A pandas data frame with the alpha diveristy map attached """ alpha_means = pd.DataFrame.from_dict({ '%s' % metric: adf.astype(float).mean(1) for metric, adf in alphas.iteritems() }) metric = sorted(alpha_means.keys())[-1] alpha_map_ = map_.join(alpha_means) keep = alpha_map_[metric].apply(lambda x: not pd.isnull(x)) alpha_map_ = alpha_map_.loc[keep] return alpha_map_ def get_single_id_lists(map_, depths): """Identifies a single sample per individual Single samples are identified based on host subject id, and then by randomly selecting samples from available samples at the highest rarefaction depth. If an individual has multiple samples, but only one above the rarefaction threshold, the sample with the higher sequencing depth is selected, and then inherited across lists. If there are two samples above the same threshold, the sample is selected randomly. Parameters ---------- map_: DataFrame A pandas dataframe where the index designates the sample ID, and columns include 'HOST_SUBJECT_ID' for the unique individual identifier, and 'DEPTH', containing the sequencing depth. depths: iterable The rarefaction depths used for analysis. Depths may be an iterable of floats or castable strings. Returns ------- single_ids : dict A dictionary keyed by rarefaction depth, where each value is a list of samples representing a single sample from each subject. """ # Determines the numebr of depths and sorts the list num_depths = len(depths) depths = sorted(depths) # Sets up the output single_ids = {depth: [] for depth in depths} single_ids['unrare'] = [] # Casts the depths column explictly to a float map_['depth'] = map_['depth'].astype(float) for hsi, subject in map_.groupby('HOST_SUBJECT_ID'): # For each depth, we check to see if there is one or more samples that # have suffecient sequences for that depth. If there is a sample # which meets the depth requirement, one is chosen at random from # the avaliable set of samples, and no additonal depths are considered for depth_id, depth in enumerate(depths[::-1]): if (subject['depth'] >= float(depth)).any(): # Chooses one sample at random id_ = np.random.choice( subject.loc[subject['depth'] >= float(depth)].index, replace=False ) single_ids[depth].append(id_) break # If a subject does not have suffecient sequences to meet the # subsampling requirements for the lowest rarefaction depth, # a sample is selected at random and included in the unrarefied list. else: # A sample does not exist at the lowest depth. However, it falls # into the full list single_ids['unrare'].append( np.random.choice(subject.index, replace=False) ) # Updates the list so lower rarefaction depths inheriet the ids at higher # depths for idx, lowest in zip(*(np.arange(num_depths, 0, -1) - 1, depths[::-1])): if idx == 0: single_ids['unrare'].extend(single_ids[depth]) else: single_ids[depths[idx - 1]].extend(single_ids[depths[idx]]) return single_ids def collapse_taxonomy(_bt, level=5): """Collapses OTUs by taxonomy Parameters ---------- _bt : biom table Table to collapse level : int, optional Level to collapse to. 0=kingdom, 1=phylum,...,5=genus, 6=species Default 5 Returns ------- biom table Collapsed biom table Citations --------- [1] http://biom-format.org/documentation/table_objects.html """ def collapse_f(id_, md): return '; '.join(md['taxonomy'][:level + 1]) collapsed = _bt.collapse(collapse_f, axis='observation', norm=False) return collapsed def collapse_full(_bt): """Collapses full biom table to median of each OTU Parameters ---------- _bt : biom table Table to collapse Returns ------- biom table Collapsed biom table, one sample containing median of each OTU, normalized. """ num_obs = len(_bt.ids(axis='observation')) table = Table(np.array( [np.median(v) for v in _bt.iter_data(axis='observation')]).reshape( (num_obs, 1)), _bt.ids(axis='observation'), ['average'], observation_metadata=_bt.metadata(axis='observation')) table.norm(inplace=True) return table
biocore/American-Gut
americangut/util.py
Python
bsd-3-clause
19,771
[ "ADF" ]
8f43ed4341aeab17ee4c53826fd3966a9031df9568e91ed8b6a5c33db120b58e
"""Tests of tools for setting up interactive IPython sessions.""" import ast from diofant.interactive.session import IntegerDivisionWrapper __all__ = () def test_IntegerDivisionWrapper(): tree = ast.parse('1/3') tree2 = ast.parse('Rational(1, 3)') dump = ast.dump(tree2) tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == dump tree = ast.parse('1 + 3') tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == ast.dump(tree) tree = ast.parse('-1/3') tree2 = ast.parse('Rational(-1, 3)') dump = ast.dump(tree2) tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == dump tree = ast.parse('2**3/7') tree2 = ast.parse('Rational(2**3, 7)') dump = ast.dump(tree2) tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == ast.dump(tree) tree = ast.parse('(3 + 5)/7') tree2 = ast.parse('Rational(3 + 5, 7)') dump = ast.dump(tree2) tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == ast.dump(tree) tree = ast.parse('2**x/3') tree_new = IntegerDivisionWrapper().visit(tree) assert ast.dump(tree_new) == ast.dump(tree)
skirpichev/omg
diofant/tests/interactive/test_ipython.py
Python
bsd-3-clause
1,238
[ "VisIt" ]
9e66c0d3a58953e499b61adbce6228534d8f4470c51e2b23ea2540c3c8955500
""" @name: PyHouse/src/Modules/Computer/Communication/_test/test_communication.py @author: D. Brian Kimmel @contact: d.briankimmel@gmail.com @copyright: 2016-2017 by D. Brian Kimmel @date: Created on May 30, 2016 @licencse: MIT License @summary: Passed all 5 tests - DBK - 2017-01-19 """ __updated__ = '2018-02-12' # Import system type stuff import xml.etree.ElementTree as ET from twisted.trial import unittest # Import PyMh files and modules. from test.xml_data import XML_LONG, TESTING_PYHOUSE from test.testing_mixin import SetupPyHouseObj from Modules.Computer.test.xml_computer import \ TESTING_COMPUTER_DIVISION from Modules.Computer.Communication.test.xml_communications import \ XML_COMMUNICATION, \ TESTING_COMMUNICATION_SECTION, \ TESTING_EMAIL_SECTION # from Modules.Core.Utilities.debug_tools import PrettyFormatAny class SetupMixin(object): """ """ def setUp(self, p_root): self.m_pyhouse_obj = SetupPyHouseObj().BuildPyHouseObj(p_root) self.m_xml = SetupPyHouseObj().BuildXml(p_root) class A0(unittest.TestCase): def setUp(self): pass def test_00_Print(self): print('Id: test_communications') class A1_Setup(SetupMixin, unittest.TestCase): def setUp(self): SetupMixin.setUp(self, ET.fromstring(XML_LONG)) def test_01_PyHouse(self): """ Be sure that the XML contains the right stuff. """ self.assertEqual(self.m_pyhouse_obj.Computer.Communication, {}) def test_02_FindXML(self): """ Be sure that the XML contains the right stuff. """ self.assertEqual(self.m_xml.root.tag, TESTING_PYHOUSE) self.assertEqual(self.m_xml.computer_div.tag, TESTING_COMPUTER_DIVISION) self.assertEqual(self.m_xml.email_sect.tag, TESTING_EMAIL_SECTION) class A2_Xml(SetupMixin, unittest.TestCase): def setUp(self): SetupMixin.setUp(self, ET.fromstring('<x />')) pass def test_01_Raw(self): l_raw = XML_COMMUNICATION # print(l_raw) self.assertEqual(l_raw[:22], '<CommunicationSection>') def test_02_Parsed(self): l_xml = ET.fromstring(XML_COMMUNICATION) # print(l_xml) self.assertEqual(l_xml.tag, TESTING_COMMUNICATION_SECTION) # ## END DBK
DBrianKimmel/PyHouse
Project/src/Modules/Computer/Communication/_test/test_communication.py
Python
mit
2,303
[ "Brian" ]
5b0b05bc5329e0372bede08633bff5321077805b40761e19c3c3f0a299ad5c2c
from future import standard_library standard_library.install_aliases() import sst import sst.actions from urllib.parse import urlparse sst.actions.set_base_url('http://localhost:%s/' % sst.DEVSERVER_PORT) # haven't visited a url yet, so all assert_url* fail sst.actions.fails( sst.actions.assert_url, 'http://localhost:%s/' % sst.DEVSERVER_PORT) sst.actions.fails( sst.actions.assert_url_contains, 'localhost') sst.actions.fails( sst.actions.assert_url_network_location, 'localhost') # now visit a url and test assertions sst.actions.go_to('%sbegin' % sst.actions.get_base_url()) sst.actions.assert_url('/begin') sst.actions.assert_url('/begin/') sst.actions.assert_url('begin/') sst.actions.assert_url('http://localhost:%s/begin' % sst.DEVSERVER_PORT) sst.actions.assert_url('http://localhost:%s/begin/' % sst.DEVSERVER_PORT) sst.actions.assert_url(urlparse('http://wrongurl/begin').path) sst.actions.fails(sst.actions.assert_url, 'http://wrongurl/begin') sst.actions.assert_url_contains('http://localhost:%s/begin' % sst.DEVSERVER_PORT) sst.actions.assert_url_contains('localhost:%s' % sst.DEVSERVER_PORT) sst.actions.assert_url_contains('.*/begin', regex=True) sst.actions.assert_url_contains('http://.*/begin', regex=True) sst.actions.assert_url_contains('.*//localhost', regex=True) sst.actions.assert_url_contains('lo[C|c]a.*host', regex=True) sst.actions.fails(sst.actions.assert_url_contains, 'foobar') sst.actions.fails(sst.actions.assert_url_contains, 'foobar', regex=True) sst.actions.assert_url_network_location('localhost:%s' % sst.DEVSERVER_PORT) sst.actions.fails(sst.actions.assert_url_network_location, 'localhost') sst.actions.fails(sst.actions.assert_url_network_location, '') # visit url with query strings and fragments, then test assertions sst.actions.go_to('/begin?query_string#fragment_id') sst.actions.assert_url( 'http://localhost:%s/begin?query_string#fragment_id' % sst.DEVSERVER_PORT) sst.actions.assert_url('/begin?query_string#fragment_id') sst.actions.fails(sst.actions.assert_url, '/begin') sst.actions.fails( sst.actions.assert_url, 'http://localhost:%s/begin' % sst.DEVSERVER_PORT)
DramaFever/sst
src/sst/selftests/assert_urls.py
Python
apache-2.0
2,179
[ "VisIt" ]
a8181dfc3128bd8b450c9bfbf7a3e66d7bcac49b8bfd36f062b3215116e07b75
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding field 'PatientInformation.notes' db.add_column('patient_patientinformation', 'notes', self.gf('django.db.models.fields.TextField')(default=''), keep_default=False) def backwards(self, orm): # Deleting field 'PatientInformation.notes' db.delete_column('patient_patientinformation', 'notes') models = { 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'patient.additionalpatientinformation': { 'Meta': {'object_name': 'AdditionalPatientInformation'}, 'alcohol': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'cigarettes': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'cooking_facilities': ('django.db.models.fields.CharField', [], {'max_length': '20'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'educational_level': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'literate': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'occupation': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'other_harmful_substances': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'psychological_stress': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'toilet_facilities': ('django.db.models.fields.CharField', [], {'max_length': '20'}) }, 'patient.familymedicalhistory': { 'HIV_status_if_known': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'Meta': {'object_name': 'FamilyMedicalHistory'}, 'chronical_renal_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'diabetes_melitus': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'epilepsy': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'haemorrhage': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'heart_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hepatitis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hypertension': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'kidney_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'liver_problems': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'malaria': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'others': ('django.db.models.fields.TextField', [], {'default': "''", 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'pelvic_backinjuries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'rhesus_d_antibodies': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'seizures': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sexually_transmitted_infection': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sickle_cell_trait': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'tuberculosis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'urinary_tract_surgeries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'patient.guardian': { 'Meta': {'object_name': 'Guardian'}, 'contact_number': ('django.db.models.fields.CharField', [], {'max_length': '15'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'educational_level': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'home_address': ('django.db.models.fields.TextField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'job': ('django.db.models.fields.CharField', [], {'max_length': '20'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'relation': ('django.db.models.fields.CharField', [], {'max_length': '2'}) }, 'patient.gynaecologicalhistory': { 'Meta': {'object_name': 'GynaecologicalHistory'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date_of_last_pap_smear': ('django.db.models.fields.DateField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'method_of_birth_control': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'result_pap_smear': ('django.db.models.fields.CharField', [], {'max_length': '2'}) }, 'patient.immunizationhistory': { 'Meta': {'object_name': 'ImmunizationHistory'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'others_injection': ('django.db.models.fields.TextField', [], {'default': "''", 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'tetanus_toxoid1': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'tetanus_toxoid2': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'tetanus_toxoid3': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'vaccination': ('django.db.models.fields.CharField', [], {'max_length': '2'}) }, 'patient.laboratorytest': { 'Meta': {'object_name': 'LaboratoryTest'}, 'blood_group': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'hemoglobin': ('django.db.models.fields.CharField', [], {'max_length': '1'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'serological_test_for_syphilis': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'urinalysis': ('django.db.models.fields.CharField', [], {'max_length': '2'}) }, 'patient.medicalhistory': { 'Meta': {'object_name': 'MedicalHistory'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'family_medical_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.FamilyMedicalHistory']"}), 'gynaecological_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.GynaecologicalHistory']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'immunization_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.ImmunizationHistory']"}), 'menstrual_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.MenstrualHistory']"}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'obstetric_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.ObstetricHistory']"}), 'past_medical_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PastMedicalHistory']"}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'present_medical_history': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PresentMedicalHistory']"}) }, 'patient.menstrualhistory': { 'Meta': {'object_name': 'MenstrualHistory'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'day_of_visit': ('django.db.models.fields.DateField', [], {}), 'expected_date_of_delivery': ('django.db.models.fields.DateField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_menstrual_periods': ('django.db.models.fields.DateField', [], {}), 'menstrual_cycle': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'poa_by_lmp': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'patient.obstetrichistory': { 'Meta': {'object_name': 'ObstetricHistory'}, 'check_if_you_have_been_miscarriages': ('django.db.models.fields.IntegerField', [], {'default': '0', 'max_length': '2'}), 'check_if_you_have_been_pregnant': ('django.db.models.fields.IntegerField', [], {'default': '0', 'max_length': '2'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}) }, 'patient.pastmedicalhistory': { 'HIV_status_if_known': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'Meta': {'object_name': 'PastMedicalHistory'}, 'chronical_renal_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'diabetes_melitus': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'epilepsy': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'haemorrhage': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'heart_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hepatitis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hypertension': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'kidney_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'liver_problems': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'malaria': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'others': ('django.db.models.fields.TextField', [], {'default': "''", 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'pelvic_backinjuries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'rhesus_d_antibodies': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'seizures': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sexually_transmitted_infection': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sickle_cell_trait': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'tuberculosis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'urinary_tract_surgeries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'patient.patientinformation': { 'Meta': {'object_name': 'PatientInformation'}, 'address': ('django.db.models.fields.TextField', [], {}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date_of_birth': ('django.db.models.fields.DateField', [], {}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'marital_status': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'notes': ('django.db.models.fields.TextField', [], {}), 'operator': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'telephone_number': ('django.db.models.fields.CharField', [], {'max_length': '15'}) }, 'patient.prescription': { 'Meta': {'object_name': 'Prescription'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name_of_prescription': ('django.db.models.fields.TextField', [], {}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}) }, 'patient.presentmedicalhistory': { 'HIV_status_if_known': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'Meta': {'object_name': 'PresentMedicalHistory'}, 'chronical_renal_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'diabetes_melitus': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'epilepsy': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'haemorrhage': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'heart_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hepatitis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hypertension': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'kidney_disease': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'liver_problems': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'malaria': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'others': ('django.db.models.fields.TextField', [], {'default': "''", 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'pelvic_backinjuries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'rhesus_d_antibodies': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'seizures': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sexually_transmitted_infection': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'sickle_cell_trait': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'tuberculosis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'urinary_tract_surgeries': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'patient.previousobstetrichistory': { 'Meta': {'object_name': 'PreviousObstetricHistory'}, 'age_of_baby': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'birth_weight': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'dob': ('django.db.models.fields.DateField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'length_of_pregnancy': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'maternal_complication': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name_of_baby': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'obstetrical_operation': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'perinatal_complication': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'periods_of_exclusive_feeding': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'sex': ('django.db.models.fields.CharField', [], {'max_length': '1'}), 'types_of_delivery': ('django.db.models.fields.CharField', [], {'max_length': '2'}) }, 'patient.previoussurgery': { 'Meta': {'object_name': 'PreviousSurgery'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'endometriosis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'fibrocystic_breasts': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'others_please_state': ('django.db.models.fields.CharField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'ovarian_cysts': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'uterine_fibroids': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'patient.report': { 'Meta': {'object_name': 'Report'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'diabetis': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hiv': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'pregnancy': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'patient.routinecheckup': { 'Meta': {'object_name': 'Routinecheckup'}, 'abdominal_changes': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'blood_pressure': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'chest_and_heart_auscultation': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'fetal_movement': ('django.db.models.fields.CharField', [], {'max_length': '300'}), 'height': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name_of_examiner': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'symptom_events': ('django.db.models.fields.CharField', [], {'max_length': '300'}), 'uterine_height': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'vaginal_examination': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'visit': ('django.db.models.fields.CharField', [], {'max_length': '2'}), 'weight': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'patient.signanaemia': { 'Meta': {'object_name': 'Signanaemia'}, 'conjunctiva': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'fingernails': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'oral_mucosa': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'others_please_state': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'pale_complexion': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'shortness_of_breath': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'tip_of_tongue': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'patient.ultrasoundscanning': { 'AC': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'BPD': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'CRL': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'FL': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'HC': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'Meta': {'object_name': 'UltrasoundScanning'}, 'amount_of_amniotic_fluid': ('django.db.models.fields.IntegerField', [], {'max_length': '10'}), 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date': ('django.db.models.fields.DateField', [], {}), 'gestation_age': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name_examiner': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'patient': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.PatientInformation']"}), 'position_of_the_baby': ('django.db.models.fields.CharField', [], {'max_length': '10'}), 'position_of_the_placenta': ('django.db.models.fields.CharField', [], {'max_length': '10'}) }, 'patient.ultrasoundscanningimage': { 'Meta': {'object_name': 'UltrasoundScanningImage'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'image': ('django.db.models.fields.files.ImageField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'us': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['patient.UltrasoundScanning']", 'null': 'True', 'blank': 'True'}) } } complete_apps = ['patient']
aazhbd/medical_info01
patient/migrations/0032_auto__add_field_patientinformation_notes.py
Python
bsd-3-clause
30,204
[ "VisIt" ]
d6d64808a6e74ba7e0c0c6dc2e4d424afd295eaa1ee9cf3381cfd85acbfb348b
# list Map scans from saved 1mm data from scipy.io import netcdf from glob import glob from datetime import datetime, timedelta import numpy as np files = glob('/data_lmt/vlbi1mm/vlbi1mm_2016-*.nc') for fname in sorted(files): try: nc = netcdf.netcdf_file(fname) v = nc.variables pgm = ''.join(v['Header.Dcs.ObsPgm'].data).strip() if pgm == 'Map': rate = v['Header.Map.ScanRate'].data * (180/np.pi) * (3600.) source = ''.join(v['Header.Source.SourceName'].data).strip() elif pgm == 'On': rate = 0 source = 'On' else: continue onum = v['Header.Dcs.ObsNum'].data time = v['Data.Sky.Time'].data duration = time[-1] - time[0] date = str(v['Header.TimePlace.UTDate'].data) year = datetime.strptime(date[:4], "%Y") fyear = float(date[4:]) dt = timedelta(days = fyear * 365) day = year + dt daystr = datetime.strftime(day, "%m/%d %H:%M UT") print "%5d %s %10s %4.0f %4.0f" % (onum, daystr, source, duration, rate) except: None
sao-eht/lmtscripts
2017/list2016maps.py
Python
mit
976
[ "NetCDF" ]
29abe5c191076c3514de4a30ffba27e8dc52a647ccb3f78d4f13d2dd8bbfae06
#!/usr/bin/env python # Copyright 2017-2021 The PySCF Developers. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # Authors: James D. McClain # Timothy Berkelbach <tim.berkelbach@gmail.com> # import numpy from functools import reduce from pyscf import lib from pyscf.lib import logger from pyscf.pbc import scf from pyscf.cc import gccsd from pyscf.cc import ccsd from pyscf.pbc.mp.kmp2 import (get_frozen_mask, get_nmo, get_nocc, padded_mo_coeff, padding_k_idx) # noqa from pyscf.pbc.cc import kintermediates as imdk from pyscf.lib.parameters import LOOSE_ZERO_TOL, LARGE_DENOM # noqa from pyscf.pbc.lib import kpts_helper DEBUG = False # # FIXME: When linear dependence is found in KHF and handled by function # pyscf.scf.addons.remove_linear_dep_, different k-point may have different # number of orbitals. # #einsum = numpy.einsum einsum = lib.einsum def energy(cc, t1, t2, eris): nkpts, nocc, nvir = t1.shape fock = eris.fock eris_oovv = eris.oovv.copy() e = 0.0 + 0j for ki in range(nkpts): e += einsum('ia,ia', fock[ki, :nocc, nocc:], t1[ki, :, :]) t1t1 = numpy.zeros(shape=t2.shape, dtype=t2.dtype) for ki in range(nkpts): ka = ki for kj in range(nkpts): #kb = kj t1t1[ki, kj, ka, :, :, :, :] = einsum('ia,jb->ijab', t1[ki, :, :], t1[kj, :, :]) tau = t2 + 2 * t1t1 e += 0.25 * numpy.dot(tau.flatten(), eris_oovv.flatten()) e /= nkpts if abs(e.imag) > 1e-4: logger.warn(cc, 'Non-zero imaginary part found in KCCSD energy %s', e) return e.real def update_amps(cc, t1, t2, eris): time0 = logger.process_clock(), logger.perf_counter() log = logger.Logger(cc.stdout, cc.verbose) nkpts, nocc, nvir = t1.shape fock = eris.fock mo_e_o = [e[:nocc] for e in eris.mo_energy] mo_e_v = [e[nocc:] + cc.level_shift for e in eris.mo_energy] # Get location of padded elements in occupied and virtual space nonzero_opadding, nonzero_vpadding = padding_k_idx(cc, kind="split") fov = fock[:, :nocc, nocc:].copy() # Get the momentum conservation array # Note: chemist's notation for momentum conserving t2(ki,kj,ka,kb), even though # integrals are in physics notation kconserv = kpts_helper.get_kconserv(cc._scf.cell, cc.kpts) tau = imdk.make_tau(cc, t2, t1, t1, kconserv) Fvv = imdk.cc_Fvv(cc, t1, t2, eris, kconserv) Foo = imdk.cc_Foo(cc, t1, t2, eris, kconserv) Fov = imdk.cc_Fov(cc, t1, t2, eris, kconserv) Woooo = imdk.cc_Woooo(cc, t1, t2, eris, kconserv) Wvvvv = imdk.cc_Wvvvv(cc, t1, t2, eris, kconserv) Wovvo = imdk.cc_Wovvo(cc, t1, t2, eris, kconserv) # Move energy terms to the other side for k in range(nkpts): Foo[k][numpy.diag_indices(nocc)] -= mo_e_o[k] Fvv[k][numpy.diag_indices(nvir)] -= mo_e_v[k] eris_ovvo = numpy.zeros(shape=(nkpts, nkpts, nkpts, nocc, nvir, nvir, nocc), dtype=t2.dtype) eris_oovo = numpy.zeros(shape=(nkpts, nkpts, nkpts, nocc, nocc, nvir, nocc), dtype=t2.dtype) eris_vvvo = numpy.zeros(shape=(nkpts, nkpts, nkpts, nvir, nvir, nvir, nocc), dtype=t2.dtype) for km, kb, ke in kpts_helper.loop_kkk(nkpts): kj = kconserv[km, ke, kb] # <mb||je> -> -<mb||ej> eris_ovvo[km, kb, ke] = -eris.ovov[km, kb, kj].transpose(0, 1, 3, 2) # <mn||je> -> -<mn||ej> # let kb = kn as a dummy variable eris_oovo[km, kb, ke] = -eris.ooov[km, kb, kj].transpose(0, 1, 3, 2) # <ma||be> -> - <be||am>* # let kj = ka as a dummy variable kj = kconserv[km, ke, kb] eris_vvvo[ke, kj, kb] = -eris.ovvv[km, kb, ke].transpose(2, 3, 1, 0).conj() # T1 equation t1new = numpy.zeros(shape=t1.shape, dtype=t1.dtype) for ka in range(nkpts): ki = ka t1new[ka] += numpy.array(fov[ka, :, :]).conj() t1new[ka] += einsum('ie,ae->ia', t1[ka], Fvv[ka]) t1new[ka] += -einsum('ma,mi->ia', t1[ka], Foo[ka]) for km in range(nkpts): t1new[ka] += einsum('imae,me->ia', t2[ka, km, ka], Fov[km]) t1new[ka] += -einsum('nf,naif->ia', t1[km], eris.ovov[km, ka, ki]) for kn in range(nkpts): ke = kconserv[km, ki, kn] t1new[ka] += -0.5 * einsum('imef,maef->ia', t2[ki, km, ke], eris.ovvv[km, ka, ke]) t1new[ka] += -0.5 * einsum('mnae,nmei->ia', t2[km, kn, ka], eris_oovo[kn, km, ke]) # T2 equation t2new = numpy.array(eris.oovv).conj() for ki, kj, ka in kpts_helper.loop_kkk(nkpts): # Chemist's notation for momentum conserving t2(ki,kj,ka,kb) kb = kconserv[ki, ka, kj] Ftmp = Fvv[kb] - 0.5 * einsum('mb,me->be', t1[kb], Fov[kb]) tmp = einsum('ijae,be->ijab', t2[ki, kj, ka], Ftmp) t2new[ki, kj, ka] += tmp #t2new[ki,kj,kb] -= tmp.transpose(0,1,3,2) Ftmp = Fvv[ka] - 0.5 * einsum('ma,me->ae', t1[ka], Fov[ka]) tmp = einsum('ijbe,ae->ijab', t2[ki, kj, kb], Ftmp) t2new[ki, kj, ka] -= tmp Ftmp = Foo[kj] + 0.5 * einsum('je,me->mj', t1[kj], Fov[kj]) tmp = einsum('imab,mj->ijab', t2[ki, kj, ka], Ftmp) t2new[ki, kj, ka] -= tmp #t2new[kj,ki,ka] += tmp.transpose(1,0,2,3) Ftmp = Foo[ki] + 0.5 * einsum('ie,me->mi', t1[ki], Fov[ki]) tmp = einsum('jmab,mi->ijab', t2[kj, ki, ka], Ftmp) t2new[ki, kj, ka] += tmp for km in range(nkpts): # Wminj # - km - kn + ka + kb = 0 # => kn = ka - km + kb kn = kconserv[ka, km, kb] t2new[ki, kj, ka] += 0.5 * einsum('mnab,mnij->ijab', tau[km, kn, ka], Woooo[km, kn, ki]) ke = km t2new[ki, kj, ka] += 0.5 * einsum('ijef,abef->ijab', tau[ki, kj, ke], Wvvvv[ka, kb, ke]) # Wmbej # - km - kb + ke + kj = 0 # => ke = km - kj + kb ke = kconserv[km, kj, kb] tmp = einsum('imae,mbej->ijab', t2[ki, km, ka], Wovvo[km, kb, ke]) # - km - kb + ke + kj = 0 # => ke = km - kj + kb # # t[i,e] => ki = ke # t[m,a] => km = ka if km == ka and ke == ki: tmp -= einsum('ie,ma,mbej->ijab', t1[ki], t1[km], eris_ovvo[km, kb, ke]) t2new[ki, kj, ka] += tmp t2new[ki, kj, kb] -= tmp.transpose(0, 1, 3, 2) t2new[kj, ki, ka] -= tmp.transpose(1, 0, 2, 3) t2new[kj, ki, kb] += tmp.transpose(1, 0, 3, 2) ke = ki tmp = einsum('ie,abej->ijab', t1[ki], eris_vvvo[ka, kb, ke]) t2new[ki, kj, ka] += tmp # P(ij) term ke = kj tmp = einsum('je,abei->ijab', t1[kj], eris_vvvo[ka, kb, ke]) t2new[ki, kj, ka] -= tmp km = ka tmp = einsum('ma,mbij->ijab', t1[ka], eris.ovoo[km, kb, ki]) t2new[ki, kj, ka] -= tmp # P(ab) term km = kb tmp = einsum('mb,maij->ijab', t1[kb], eris.ovoo[km, ka, ki]) t2new[ki, kj, ka] += tmp for ki in range(nkpts): ka = ki # Remove zero/padded elements from denominator eia = LARGE_DENOM * numpy.ones((nocc, nvir), dtype=eris.mo_energy[0].dtype) n0_ovp_ia = numpy.ix_(nonzero_opadding[ki], nonzero_vpadding[ka]) eia[n0_ovp_ia] = (mo_e_o[ki][:,None] - mo_e_v[ka])[n0_ovp_ia] t1new[ki] /= eia kconserv = kpts_helper.get_kconserv(cc._scf.cell, cc.kpts) for ki, kj, ka in kpts_helper.loop_kkk(nkpts): kb = kconserv[ki, ka, kj] # For LARGE_DENOM, see t1new update above eia = LARGE_DENOM * numpy.ones((nocc, nvir), dtype=eris.mo_energy[0].dtype) n0_ovp_ia = numpy.ix_(nonzero_opadding[ki], nonzero_vpadding[ka]) eia[n0_ovp_ia] = (mo_e_o[ki][:,None] - mo_e_v[ka])[n0_ovp_ia] ejb = LARGE_DENOM * numpy.ones((nocc, nvir), dtype=eris.mo_energy[0].dtype) n0_ovp_jb = numpy.ix_(nonzero_opadding[kj], nonzero_vpadding[kb]) ejb[n0_ovp_jb] = (mo_e_o[kj][:,None] - mo_e_v[kb])[n0_ovp_jb] eijab = eia[:, None, :, None] + ejb[:, None, :] t2new[ki, kj, ka] /= eijab time0 = log.timer_debug1('update t1 t2', *time0) return t1new, t2new def spatial2spin(tx, orbspin, kconserv): '''Convert T1/T2 of spatial orbital representation to T1/T2 of spin-orbital representation ''' if isinstance(tx, numpy.ndarray) and tx.ndim == 3: # KRCCSD t1 amplitudes return spatial2spin((tx,tx), orbspin, kconserv) elif isinstance(tx, numpy.ndarray) and tx.ndim == 7: # KRCCSD t2 amplitudes t2aa = numpy.zeros_like(tx) nkpts = t2aa.shape[2] for ki, kj, ka in kpts_helper.loop_kkk(nkpts): kb = kconserv[ki,ka,kj] t2aa[ki,kj,ka] = tx[ki,kj,ka] - tx[ki,kj,kb].transpose(0,1,3,2) return spatial2spin((t2aa,tx,t2aa), orbspin, kconserv) elif len(tx) == 2: # KUCCSD t1 t1a, t1b = tx nocc_a, nvir_a = t1a.shape[1:] nocc_b, nvir_b = t1b.shape[1:] else: # KUCCSD t2 t2aa, t2ab, t2bb = tx nocc_a, nocc_b, nvir_a, nvir_b = t2ab.shape[3:] nkpts = len(orbspin) nocc = nocc_a + nocc_b nvir = nvir_a + nvir_b idxoa = [numpy.where(orbspin[k][:nocc] == 0)[0] for k in range(nkpts)] idxob = [numpy.where(orbspin[k][:nocc] == 1)[0] for k in range(nkpts)] idxva = [numpy.where(orbspin[k][nocc:] == 0)[0] for k in range(nkpts)] idxvb = [numpy.where(orbspin[k][nocc:] == 1)[0] for k in range(nkpts)] if len(tx) == 2: # t1 t1 = numpy.zeros((nkpts,nocc,nvir), dtype=t1a.dtype) for k in range(nkpts): lib.takebak_2d(t1[k], t1a[k], idxoa[k], idxva[k]) lib.takebak_2d(t1[k], t1b[k], idxob[k], idxvb[k]) t1 = lib.tag_array(t1, orbspin=orbspin) return t1 else: t2 = numpy.zeros((nkpts,nkpts,nkpts,nocc**2,nvir**2), dtype=t2aa.dtype) for ki, kj, ka in kpts_helper.loop_kkk(nkpts): kb = kconserv[ki,ka,kj] idxoaa = idxoa[ki][:,None] * nocc + idxoa[kj] idxoab = idxoa[ki][:,None] * nocc + idxob[kj] idxoba = idxob[kj][:,None] * nocc + idxoa[ki] idxobb = idxob[ki][:,None] * nocc + idxob[kj] idxvaa = idxva[ka][:,None] * nvir + idxva[kb] idxvab = idxva[ka][:,None] * nvir + idxvb[kb] idxvba = idxvb[kb][:,None] * nvir + idxva[ka] idxvbb = idxvb[ka][:,None] * nvir + idxvb[kb] tmp2aa = t2aa[ki,kj,ka].reshape(nocc_a*nocc_a,nvir_a*nvir_a) tmp2bb = t2bb[ki,kj,ka].reshape(nocc_b*nocc_b,nvir_b*nvir_b) tmp2ab = t2ab[ki,kj,ka].reshape(nocc_a*nocc_b,nvir_a*nvir_b) lib.takebak_2d(t2[ki,kj,ka], tmp2aa, idxoaa.ravel() , idxvaa.ravel() ) lib.takebak_2d(t2[ki,kj,ka], tmp2bb, idxobb.ravel() , idxvbb.ravel() ) lib.takebak_2d(t2[ki,kj,ka], tmp2ab, idxoab.ravel() , idxvab.ravel() ) lib.takebak_2d(t2[kj,ki,kb], tmp2ab, idxoba.T.ravel(), idxvba.T.ravel()) abba = -tmp2ab lib.takebak_2d(t2[ki,kj,kb], abba, idxoab.ravel() , idxvba.T.ravel()) lib.takebak_2d(t2[kj,ki,ka], abba, idxoba.T.ravel(), idxvab.ravel() ) t2 = t2.reshape(nkpts,nkpts,nkpts,nocc,nocc,nvir,nvir) t2 = lib.tag_array(t2, orbspin=orbspin) return t2 def spin2spatial(tx, orbspin, kconserv): if tx.ndim == 3: # t1 nocc, nvir = tx.shape[1:] else: nocc, nvir = tx.shape[4:6] nkpts = len(tx) idxoa = [numpy.where(orbspin[k][:nocc] == 0)[0] for k in range(nkpts)] idxob = [numpy.where(orbspin[k][:nocc] == 1)[0] for k in range(nkpts)] idxva = [numpy.where(orbspin[k][nocc:] == 0)[0] for k in range(nkpts)] idxvb = [numpy.where(orbspin[k][nocc:] == 1)[0] for k in range(nkpts)] nocc_a = len(idxoa[0]) nocc_b = len(idxob[0]) nvir_a = len(idxva[0]) nvir_b = len(idxvb[0]) if tx.ndim == 3: # t1 t1a = numpy.zeros((nkpts,nocc_a,nvir_a), dtype=tx.dtype) t1b = numpy.zeros((nkpts,nocc_b,nvir_b), dtype=tx.dtype) for k in range(nkpts): lib.take_2d(tx[k], idxoa[k], idxva[k], out=t1a[k]) lib.take_2d(tx[k], idxob[k], idxvb[k], out=t1b[k]) return t1a, t1b else: t2aa = numpy.zeros((nkpts,nkpts,nkpts,nocc_a,nocc_a,nvir_a,nvir_a), dtype=tx.dtype) t2ab = numpy.zeros((nkpts,nkpts,nkpts,nocc_a,nocc_b,nvir_a,nvir_b), dtype=tx.dtype) t2bb = numpy.zeros((nkpts,nkpts,nkpts,nocc_b,nocc_b,nvir_b,nvir_b), dtype=tx.dtype) t2 = tx.reshape(nkpts,nkpts,nkpts,nocc**2,nvir**2) for ki, kj, ka in kpts_helper.loop_kkk(nkpts): kb = kconserv[ki,ka,kj] idxoaa = idxoa[ki][:,None] * nocc + idxoa[kj] idxoab = idxoa[ki][:,None] * nocc + idxob[kj] idxobb = idxob[ki][:,None] * nocc + idxob[kj] idxvaa = idxva[ka][:,None] * nvir + idxva[kb] idxvab = idxva[ka][:,None] * nvir + idxvb[kb] idxvbb = idxvb[ka][:,None] * nvir + idxvb[kb] lib.take_2d(t2[ki,kj,ka], idxoaa.ravel(), idxvaa.ravel(), out=t2aa[ki,kj,ka]) lib.take_2d(t2[ki,kj,ka], idxobb.ravel(), idxvbb.ravel(), out=t2bb[ki,kj,ka]) lib.take_2d(t2[ki,kj,ka], idxoab.ravel(), idxvab.ravel(), out=t2ab[ki,kj,ka]) return t2aa, t2ab, t2bb class GCCSD(gccsd.GCCSD): def __init__(self, mf, frozen=None, mo_coeff=None, mo_occ=None): assert (isinstance(mf, scf.khf.KSCF)) if not isinstance(mf, scf.kghf.KGHF): mf = scf.addons.convert_to_ghf(mf) self.kpts = mf.kpts self.khelper = kpts_helper.KptsHelper(mf.cell, mf.kpts) gccsd.GCCSD.__init__(self, mf, frozen, mo_coeff, mo_occ) @property def nkpts(self): return len(self.kpts) get_nocc = get_nocc get_nmo = get_nmo get_frozen_mask = get_frozen_mask def dump_flags(self, verbose=None): logger.info(self, '\n') logger.info(self, '******** PBC CC flags ********') gccsd.GCCSD.dump_flags(self, verbose) return self def init_amps(self, eris): time0 = logger.process_clock(), logger.perf_counter() nocc = self.nocc nvir = self.nmo - nocc nkpts = self.nkpts mo_e_o = [eris.mo_energy[k][:nocc] for k in range(nkpts)] mo_e_v = [eris.mo_energy[k][nocc:] for k in range(nkpts)] t1 = numpy.zeros((nkpts, nocc, nvir), dtype=numpy.complex128) t2 = numpy.zeros((nkpts, nkpts, nkpts, nocc, nocc, nvir, nvir), dtype=numpy.complex128) self.emp2 = 0 eris_oovv = eris.oovv.copy() # Get location of padded elements in occupied and virtual space nonzero_opadding, nonzero_vpadding = padding_k_idx(self, kind="split") kconserv = kpts_helper.get_kconserv(self._scf.cell, self.kpts) for ki, kj, ka in kpts_helper.loop_kkk(nkpts): kb = kconserv[ki, ka, kj] # For LARGE_DENOM, see t1new update above eia = LARGE_DENOM * numpy.ones((nocc, nvir), dtype=eris.mo_energy[0].dtype) n0_ovp_ia = numpy.ix_(nonzero_opadding[ki], nonzero_vpadding[ka]) eia[n0_ovp_ia] = (mo_e_o[ki][:,None] - mo_e_v[ka])[n0_ovp_ia] ejb = LARGE_DENOM * numpy.ones((nocc, nvir), dtype=eris.mo_energy[0].dtype) n0_ovp_jb = numpy.ix_(nonzero_opadding[kj], nonzero_vpadding[kb]) ejb[n0_ovp_jb] = (mo_e_o[kj][:,None] - mo_e_v[kb])[n0_ovp_jb] eijab = eia[:, None, :, None] + ejb[:, None, :] t2[ki, kj, ka] = eris_oovv[ki, kj, ka] / eijab t2 = numpy.conj(t2) self.emp2 = 0.25 * numpy.einsum('pqrijab,pqrijab', t2, eris_oovv).real self.emp2 /= nkpts logger.info(self, 'Init t2, MP2 energy = %.15g', self.emp2.real) logger.timer(self, 'init mp2', *time0) return self.emp2, t1, t2 def ccsd(self, t1=None, t2=None, eris=None, **kwargs): if eris is None: eris = self.ao2mo(self.mo_coeff) e_corr, self.t1, self.t2 = ccsd.CCSD.ccsd(self, t1, t2, eris) if getattr(eris, 'orbspin', None) is not None: self.t1 = lib.tag_array(self.t1, orbspin=eris.orbspin) self.t2 = lib.tag_array(self.t2, orbspin=eris.orbspin) return e_corr, self.t1, self.t2 update_amps = update_amps energy = energy def ao2mo(self, mo_coeff=None): nkpts = self.nkpts nmo = self.nmo mem_incore = nkpts**3 * nmo**4 * 8 / 1e6 mem_now = lib.current_memory()[0] if (mem_incore + mem_now < self.max_memory) or self.mol.incore_anyway: return _make_eris_incore(self, mo_coeff) else: raise NotImplementedError def ccsd_t(self, t1=None, t2=None, eris=None): from pyscf.pbc.cc import kccsd_t if t1 is None: t1 = self.t1 if t2 is None: t2 = self.t2 if eris is None: eris = self.ao2mo(self.mo_coeff) return kccsd_t.kernel(self, eris, t1, t2, self.verbose) def amplitudes_to_vector(self, t1, t2): return numpy.hstack((t1.ravel(), t2.ravel())) def vector_to_amplitudes(self, vec, nmo=None, nocc=None): if nocc is None: nocc = self.nocc if nmo is None: nmo = self.nmo nvir = nmo - nocc nkpts = self.nkpts nov = nkpts * nocc * nvir t1 = vec[:nov].reshape(nkpts, nocc, nvir) t2 = vec[nov:].reshape(nkpts, nkpts, nkpts, nocc, nocc, nvir, nvir) return t1, t2 def spatial2spin(self, tx, orbspin=None, kconserv=None): if orbspin is None: if getattr(self.mo_coeff[0], 'orbspin', None) is not None: orbspin = [self.mo_coeff[k].orbspin[idx] for k, idx in enumerate(self.get_frozen_mask())] else: orbspin = numpy.zeros((self.nkpts,self.nmo), dtype=int) orbspin[:,1::2] = 1 if kconserv is None: kconserv = kpts_helper.get_kconserv(self._scf.cell, self.kpts) return spatial2spin(tx, orbspin, kconserv) def spin2spatial(self, tx, orbspin=None, kconserv=None): if orbspin is None: if getattr(self.mo_coeff[0], 'orbspin', None) is not None: orbspin = [self.mo_coeff[k].orbspin[idx] for k, idx in enumerate(self.get_frozen_mask())] else: orbspin = numpy.zeros((self.nkpts,self.nmo), dtype=int) orbspin[:,1::2] = 1 if kconserv is None: kconserv = kpts_helper.get_kconserv(self._scf.cell, self.kpts) return spin2spatial(tx, orbspin, kconserv) def from_uccsd(self, t1, t2, orbspin=None): return self.spatial2spin(t1, orbspin), self.spatial2spin(t2, orbspin) def to_uccsd(self, t1, t2, orbspin=None): return spin2spatial(t1, orbspin), spin2spatial(t2, orbspin) CCSD = KCCSD = KGCCSD = GCCSD def _make_eris_incore(cc, mo_coeff=None): from pyscf.pbc import tools from pyscf.pbc.cc.ccsd import _adjust_occ log = logger.Logger(cc.stdout, cc.verbose) cput0 = (logger.process_clock(), logger.perf_counter()) eris = gccsd._PhysicistsERIs() cell = cc._scf.cell kpts = cc.kpts nkpts = cc.nkpts nocc = cc.nocc nmo = cc.nmo eris.nocc = nocc #if any(nocc != numpy.count_nonzero(cc._scf.mo_occ[k] > 0) for k in range(nkpts)): # raise NotImplementedError('Different occupancies found for different k-points') if mo_coeff is None: mo_coeff = cc.mo_coeff nao = mo_coeff[0].shape[0] dtype = mo_coeff[0].dtype moidx = get_frozen_mask(cc) nocc_per_kpt = numpy.asarray(get_nocc(cc, per_kpoint=True)) nmo_per_kpt = numpy.asarray(get_nmo(cc, per_kpoint=True)) padded_moidx = [] for k in range(nkpts): kpt_nocc = nocc_per_kpt[k] kpt_nvir = nmo_per_kpt[k] - kpt_nocc kpt_padded_moidx = numpy.concatenate((numpy.ones(kpt_nocc, dtype=numpy.bool), numpy.zeros(nmo - kpt_nocc - kpt_nvir, dtype=numpy.bool), numpy.ones(kpt_nvir, dtype=numpy.bool))) padded_moidx.append(kpt_padded_moidx) eris.mo_coeff = [] eris.orbspin = [] # Generate the molecular orbital coefficients with the frozen orbitals masked. # Each MO is tagged with orbspin, a list of 0's and 1's that give the overall # spin of each MO. # # Here we will work with two index arrays; one is for our original (small) moidx # array while the next is for our new (large) padded array. for k in range(nkpts): kpt_moidx = moidx[k] kpt_padded_moidx = padded_moidx[k] mo = numpy.zeros((nao, nmo), dtype=dtype) mo[:, kpt_padded_moidx] = mo_coeff[k][:, kpt_moidx] if getattr(mo_coeff[k], 'orbspin', None) is not None: orbspin_dtype = mo_coeff[k].orbspin[kpt_moidx].dtype orbspin = numpy.zeros(nmo, dtype=orbspin_dtype) orbspin[kpt_padded_moidx] = mo_coeff[k].orbspin[kpt_moidx] mo = lib.tag_array(mo, orbspin=orbspin) eris.orbspin.append(orbspin) # FIXME: What if the user freezes all up spin orbitals in # an RHF calculation? The number of electrons will still be # even. else: # guess orbital spin - assumes an RHF calculation assert (numpy.count_nonzero(kpt_moidx) % 2 == 0) orbspin = numpy.zeros(mo.shape[1], dtype=int) orbspin[1::2] = 1 mo = lib.tag_array(mo, orbspin=orbspin) eris.orbspin.append(orbspin) eris.mo_coeff.append(mo) # Re-make our fock MO matrix elements from density and fock AO dm = cc._scf.make_rdm1(cc.mo_coeff, cc.mo_occ) with lib.temporary_env(cc._scf, exxdiv=None): # _scf.exxdiv affects eris.fock. HF exchange correction should be # excluded from the Fock matrix. vhf = cc._scf.get_veff(cell, dm) fockao = cc._scf.get_hcore() + vhf eris.fock = numpy.asarray([reduce(numpy.dot, (mo.T.conj(), fockao[k], mo)) for k, mo in enumerate(eris.mo_coeff)]) eris.e_hf = cc._scf.energy_tot(dm=dm, vhf=vhf) eris.mo_energy = [eris.fock[k].diagonal().real for k in range(nkpts)] # Add HFX correction in the eris.mo_energy to improve convergence in # CCSD iteration. It is useful for the 2D systems since their occupied and # the virtual orbital energies may overlap which may lead to numerical # issue in the CCSD iterations. # FIXME: Whether to add this correction for other exxdiv treatments? # Without the correction, MP2 energy may be largely off the correct value. madelung = tools.madelung(cell, kpts) eris.mo_energy = [_adjust_occ(mo_e, nocc, -madelung) for k, mo_e in enumerate(eris.mo_energy)] # Get location of padded elements in occupied and virtual space. nocc_per_kpt = get_nocc(cc, per_kpoint=True) nonzero_padding = padding_k_idx(cc, kind="joint") # Check direct and indirect gaps for possible issues with CCSD convergence. mo_e = [eris.mo_energy[kp][nonzero_padding[kp]] for kp in range(nkpts)] mo_e = numpy.sort([y for x in mo_e for y in x]) # Sort de-nested array gap = mo_e[numpy.sum(nocc_per_kpt)] - mo_e[numpy.sum(nocc_per_kpt)-1] if gap < 1e-5: logger.warn(cc, 'HOMO-LUMO gap %s too small for KCCSD. ' 'May cause issues in convergence.', gap) kconserv = kpts_helper.get_kconserv(cell, kpts) if getattr(mo_coeff[0], 'orbspin', None) is None: # The bottom nao//2 coefficients are down (up) spin while the top are up (down). mo_a_coeff = [mo[:nao // 2] for mo in eris.mo_coeff] mo_b_coeff = [mo[nao // 2:] for mo in eris.mo_coeff] eri = numpy.empty((nkpts, nkpts, nkpts, nmo, nmo, nmo, nmo), dtype=numpy.complex128) fao2mo = cc._scf.with_df.ao2mo for kp, kq, kr in kpts_helper.loop_kkk(nkpts): ks = kconserv[kp, kq, kr] eri_kpt = fao2mo( (mo_a_coeff[kp], mo_a_coeff[kq], mo_a_coeff[kr], mo_a_coeff[ks]), (kpts[kp], kpts[kq], kpts[kr], kpts[ks]), compact=False) eri_kpt += fao2mo( (mo_b_coeff[kp], mo_b_coeff[kq], mo_b_coeff[kr], mo_b_coeff[ks]), (kpts[kp], kpts[kq], kpts[kr], kpts[ks]), compact=False) eri_kpt += fao2mo( (mo_a_coeff[kp], mo_a_coeff[kq], mo_b_coeff[kr], mo_b_coeff[ks]), (kpts[kp], kpts[kq], kpts[kr], kpts[ks]), compact=False) eri_kpt += fao2mo( (mo_b_coeff[kp], mo_b_coeff[kq], mo_a_coeff[kr], mo_a_coeff[ks]), (kpts[kp], kpts[kq], kpts[kr], kpts[ks]), compact=False) eri_kpt = eri_kpt.reshape(nmo, nmo, nmo, nmo) eri[kp, kq, kr] = eri_kpt else: mo_a_coeff = [mo[:nao // 2] + mo[nao // 2:] for mo in eris.mo_coeff] eri = numpy.empty((nkpts, nkpts, nkpts, nmo, nmo, nmo, nmo), dtype=numpy.complex128) fao2mo = cc._scf.with_df.ao2mo for kp, kq, kr in kpts_helper.loop_kkk(nkpts): ks = kconserv[kp, kq, kr] eri_kpt = fao2mo( (mo_a_coeff[kp], mo_a_coeff[kq], mo_a_coeff[kr], mo_a_coeff[ks]), (kpts[kp], kpts[kq], kpts[kr], kpts[ks]), compact=False) eri_kpt[(eris.orbspin[kp][:, None] != eris.orbspin[kq]).ravel()] = 0 eri_kpt[:, (eris.orbspin[kr][:, None] != eris.orbspin[ks]).ravel()] = 0 eri_kpt = eri_kpt.reshape(nmo, nmo, nmo, nmo) eri[kp, kq, kr] = eri_kpt # Check some antisymmetrized properties of the integrals if DEBUG: check_antisymm_3412(cc, cc.kpts, eri) # Antisymmetrizing (pq|rs)-(ps|rq), where the latter integral is equal to # (rq|ps); done since we aren't tracking the kpoint of orbital 's' eri = eri - eri.transpose(2, 1, 0, 5, 4, 3, 6) # Chemist -> physics notation eri = eri.transpose(0, 2, 1, 3, 5, 4, 6) # Set the various integrals eris.dtype = eri.dtype eris.oooo = eri[:, :, :, :nocc, :nocc, :nocc, :nocc].copy() / nkpts eris.ooov = eri[:, :, :, :nocc, :nocc, :nocc, nocc:].copy() / nkpts eris.ovoo = eri[:, :, :, :nocc, nocc:, :nocc, :nocc].copy() / nkpts eris.oovv = eri[:, :, :, :nocc, :nocc, nocc:, nocc:].copy() / nkpts eris.ovov = eri[:, :, :, :nocc, nocc:, :nocc, nocc:].copy() / nkpts eris.ovvv = eri[:, :, :, :nocc, nocc:, nocc:, nocc:].copy() / nkpts eris.vvvv = eri[:, :, :, nocc:, nocc:, nocc:, nocc:].copy() / nkpts log.timer('CCSD integral transformation', *cput0) return eris def check_antisymm_3412(cc, kpts, integrals): kconserv = kpts_helper.get_kconserv(cc._scf.cell, cc.kpts) nkpts = len(kpts) diff = 0.0 for kp, kq, kr in kpts_helper.loop_kkk(nkpts): ks = kconserv[kp, kr, kq] for p in range(integrals.shape[3]): for q in range(integrals.shape[4]): for r in range(integrals.shape[5]): for s in range(integrals.shape[6]): pqrs = integrals[kp, kq, kr, p, q, r, s] rspq = integrals[kq, kp, kr, q, p, r, s] cdiff = numpy.linalg.norm(pqrs - rspq).real if diff > 1e-5: print("AS diff = %.15g" % cdiff, pqrs, rspq, kp, kq, kr, ks, p, q, r, s) diff = max(diff, cdiff) print("antisymmetrization : max diff = %.15g" % diff) if diff > 1e-5: print("Energy cutoff (or cell.mesh) is not enough to converge AO integrals.") return diff def check_antisymm_12(cc, kpts, integrals): kconserv = kpts_helper.get_kconserv(cc._scf.cell, cc.kpts) nkpts = len(kpts) diff = 0.0 for kp, kq, kr in kpts_helper.loop_kkk(nkpts): ks = kconserv[kp, kr, kq] for p in range(integrals.shape[3]): for q in range(integrals.shape[4]): for r in range(integrals.shape[5]): for s in range(integrals.shape[6]): pqrs = integrals[kp, kq, kr, p, q, r, s] qprs = integrals[kq, kp, kr, q, p, r, s] cdiff = numpy.linalg.norm(pqrs + qprs).real if diff > 1e-5: print("AS diff = %.15g" % cdiff, pqrs, qprs, kp, kq, kr, ks, p, q, r, s) diff = max(diff, cdiff) print("antisymmetrization : max diff = %.15g" % diff) if diff > 1e-5: print("Energy cutoff (or cell.mesh) is not enough to converge AO integrals.") def check_antisymm_34(cc, kpts, integrals): kconserv = kpts_helper.get_kconserv(cc._scf.cell, cc.kpts) nkpts = len(kpts) diff = 0.0 for kp, kq, kr in kpts_helper.loop_kkk(nkpts): ks = kconserv[kp, kr, kq] for p in range(integrals.shape[3]): for q in range(integrals.shape[4]): for r in range(integrals.shape[5]): for s in range(integrals.shape[6]): pqrs = integrals[kp, kq, kr, p, q, r, s] pqsr = integrals[kp, kq, ks, p, q, s, r] cdiff = numpy.linalg.norm(pqrs + pqsr).real if diff > 1e-5: print("AS diff = %.15g" % cdiff, pqrs, pqsr, kp, kq, kr, ks, p, q, r, s) diff = max(diff, cdiff) print("antisymmetrization : max diff = %.15g" % diff) if diff > 1e-5: print("Energy cutoff (or cell.mesh) is not enough to converge AO integrals.") imd = imdk class _IMDS: # Identical to molecular rccsd_slow def __init__(self, cc): self.verbose = cc.verbose self.stdout = cc.stdout self.t1 = cc.t1 self.t2 = cc.t2 self.eris = cc.eris self.kconserv = cc.khelper.kconserv self.made_ip_imds = False self.made_ea_imds = False self._made_shared_2e = False self._fimd = None def _make_shared_1e(self): cput0 = (logger.process_clock(), logger.perf_counter()) log = logger.Logger(self.stdout, self.verbose) t1,t2,eris = self.t1, self.t2, self.eris kconserv = self.kconserv self.Loo = imd.Loo(t1,t2,eris,kconserv) self.Lvv = imd.Lvv(t1,t2,eris,kconserv) self.Fov = imd.cc_Fov(t1,t2,eris,kconserv) log.timer('EOM-CCSD shared one-electron intermediates', *cput0) def _make_shared_2e(self): cput0 = (logger.process_clock(), logger.perf_counter()) log = logger.Logger(self.stdout, self.verbose) t1,t2,eris = self.t1, self.t2, self.eris kconserv = self.kconserv # TODO: check whether to hold Wovov Wovvo in memory if self._fimd is None: self._fimd = lib.H5TmpFile() nkpts, nocc, nvir = t1.shape self._fimd.create_dataset('ovov', (nkpts,nkpts,nkpts,nocc,nvir,nocc,nvir), t1.dtype.char) self._fimd.create_dataset('ovvo', (nkpts,nkpts,nkpts,nocc,nvir,nvir,nocc), t1.dtype.char) # 2 virtuals self.Wovov = imd.Wovov(t1,t2,eris,kconserv, self._fimd['ovov']) self.Wovvo = imd.Wovvo(t1,t2,eris,kconserv, self._fimd['ovvo']) self.Woovv = eris.oovv log.timer('EOM-CCSD shared two-electron intermediates', *cput0) def make_ip(self, ip_partition=None): self._make_shared_1e() if self._made_shared_2e is False and ip_partition != 'mp': self._make_shared_2e() self._made_shared_2e = True cput0 = (logger.process_clock(), logger.perf_counter()) log = logger.Logger(self.stdout, self.verbose) t1,t2,eris = self.t1, self.t2, self.eris kconserv = self.kconserv nkpts, nocc, nvir = t1.shape self._fimd.create_dataset('oooo', (nkpts,nkpts,nkpts,nocc,nocc,nocc,nocc), t1.dtype.char) self._fimd.create_dataset('ooov', (nkpts,nkpts,nkpts,nocc,nocc,nocc,nvir), t1.dtype.char) self._fimd.create_dataset('ovoo', (nkpts,nkpts,nkpts,nocc,nvir,nocc,nocc), t1.dtype.char) # 0 or 1 virtuals if ip_partition != 'mp': self.Woooo = imd.Woooo(t1,t2,eris,kconserv, self._fimd['oooo']) self.Wooov = imd.Wooov(t1,t2,eris,kconserv, self._fimd['ooov']) self.Wovoo = imd.Wovoo(t1,t2,eris,kconserv, self._fimd['ovoo']) self.made_ip_imds = True log.timer('EOM-CCSD IP intermediates', *cput0) def make_ea(self, ea_partition=None): self._make_shared_1e() if self._made_shared_2e is False and ea_partition != 'mp': self._make_shared_2e() self._made_shared_2e = True cput0 = (logger.process_clock(), logger.perf_counter()) log = logger.Logger(self.stdout, self.verbose) t1,t2,eris = self.t1, self.t2, self.eris kconserv = self.kconserv nkpts, nocc, nvir = t1.shape self._fimd.create_dataset('vovv', (nkpts,nkpts,nkpts,nvir,nocc,nvir,nvir), t1.dtype.char) self._fimd.create_dataset('vvvo', (nkpts,nkpts,nkpts,nvir,nvir,nvir,nocc), t1.dtype.char) self._fimd.create_dataset('vvvv', (nkpts,nkpts,nkpts,nvir,nvir,nvir,nvir), t1.dtype.char) # 3 or 4 virtuals self.Wvovv = imd.Wvovv(t1,t2,eris,kconserv, self._fimd['vovv']) if ea_partition == 'mp' and numpy.all(t1 == 0): self.Wvvvo = imd.Wvvvo(t1,t2,eris,kconserv, self._fimd['vvvo']) else: self.Wvvvv = imd.Wvvvv(t1,t2,eris,kconserv, self._fimd['vvvv']) self.Wvvvo = imd.Wvvvo(t1,t2,eris,kconserv,self.Wvvvv, self._fimd['vvvo']) self.made_ea_imds = True log.timer('EOM-CCSD EA intermediates', *cput0) scf.kghf.KGHF.CCSD = lib.class_as_method(KGCCSD) if __name__ == '__main__': from pyscf.pbc import gto cell = gto.Cell() cell.atom=''' C 0.000000000000 0.000000000000 0.000000000000 C 1.685068664391 1.685068664391 1.685068664391 ''' cell.basis = 'gth-szv' cell.pseudo = 'gth-pade' cell.a = ''' 0.000000000, 3.370137329, 3.370137329 3.370137329, 0.000000000, 3.370137329 3.370137329, 3.370137329, 0.000000000''' cell.unit = 'B' cell.verbose = 5 cell.build() # Running HF and CCSD with 1x1x2 Monkhorst-Pack k-point mesh kmf = scf.KRHF(cell, kpts=cell.make_kpts([1,1,2]), exxdiv=None) ehf = kmf.kernel() kmf = scf.addons.convert_to_ghf(kmf) mycc = KGCCSD(kmf) ecc, t1, t2 = mycc.kernel() print(ecc - -0.155298393321855)
sunqm/pyscf
pyscf/pbc/cc/kccsd.py
Python
apache-2.0
35,158
[ "PySCF" ]
edc3e2d0c7e858d609267f1810bf7c744f05a8f079cc5bf6c8b0a10588b294d0
''' Created on Jun 2, 2011 @author: mkiyer ''' import logging import collections import os import sys import argparse from chimerascan import pysam from chimerascan.bx.cluster import ClusterTree from chimerascan.lib import config from chimerascan.lib.base import LibraryTypes, imin2 from chimerascan.lib.sam import parse_pe_reads, pair_reads, copy_read, select_best_scoring_pairs from chimerascan.lib.feature import TranscriptFeature from chimerascan.lib.transcriptome_to_genome import build_tid_transcript_map, \ build_tid_transcript_genome_map, transcript_to_genome_pos from chimerascan.lib.chimera import DiscordantTags, DISCORDANT_TAG_NAME, \ OrientationTags, ORIENTATION_TAG_NAME def annotate_multihits(bamfh, reads, tid_tx_genome_map): hits = set() any_unmapped = False for r in reads: if r.is_unmapped: any_unmapped = True continue assert r.rname in tid_tx_genome_map # use the position that is most 5' relative to genome left_tid, left_strand, left_pos = transcript_to_genome_pos(r.rname, r.pos, tid_tx_genome_map) right_tid, right_strand, right_pos = transcript_to_genome_pos(r.rname, r.aend-1, tid_tx_genome_map) tid = left_tid pos = imin2(left_pos, right_pos) hits.add((tid, pos)) #print r.qname, bamfh.getrname(r.rname), r.pos, bamfh.getrname(tid), pos for i,r in enumerate(reads): # annotate reads with 'HI', and 'IH' tags r.tags = r.tags + [("HI",i), ("IH",len(reads)), ("NH", len(hits))] return any_unmapped def map_reads_to_references(pe_reads, tid_tx_map): """ bin reads by transcript cluster and reference (tid) """ refdict = collections.defaultdict(lambda: ([], [])) clusterdict = collections.defaultdict(lambda: ([], [])) for readnum, reads in enumerate(pe_reads): for r in reads: if r.is_unmapped: continue # TODO: remove assert statement assert r.rname in tid_tx_map # add to cluster dict cluster_id = tid_tx_map[r.rname].cluster_id pairs = clusterdict[cluster_id] pairs[readnum].append(r) # add to reference dict pairs = refdict[r.rname] pairs[readnum].append(r) return refdict, clusterdict def get_genome_orientation(r, library_type): if library_type == LibraryTypes.FR_FIRSTSTRAND: if r.is_read2: return OrientationTags.FIVEPRIME else: return OrientationTags.THREEPRIME elif library_type == LibraryTypes.FR_SECONDSTRAND: if r.is_read1: return OrientationTags.FIVEPRIME else: return OrientationTags.THREEPRIME return OrientationTags.NONE def get_gene_orientation(r, library_type): if library_type == LibraryTypes.FR_UNSTRANDED: if r.is_reverse: return OrientationTags.THREEPRIME else: return OrientationTags.FIVEPRIME elif library_type == LibraryTypes.FR_FIRSTSTRAND: if r.is_read2: return OrientationTags.FIVEPRIME else: return OrientationTags.THREEPRIME elif library_type == LibraryTypes.FR_SECONDSTRAND: if r.is_read1: return OrientationTags.FIVEPRIME else: return OrientationTags.THREEPRIME logging.error("Unknown library type %s, aborting" % (library_type)) assert False def classify_unpaired_reads(reads, library_type): gene_hits_5p = [] gene_hits_3p = [] for r in reads: # this alignment is to a transcript (gene), so need # to determine whether it is 5' or 3' orientation = get_gene_orientation(r, library_type) if orientation == OrientationTags.FIVEPRIME: gene_hits_5p.append(r) else: gene_hits_3p.append(r) # add a tag to the sam file describing the read orientation and # that it is discordant r.tags = r.tags + [(DISCORDANT_TAG_NAME, DiscordantTags.DISCORDANT_GENE), (ORIENTATION_TAG_NAME, orientation)] return gene_hits_5p, gene_hits_3p def find_discordant_pairs(pe_reads, library_type): """ iterate through combinations of read1/read2 to predict valid discordant read pairs """ # classify the reads as 5' or 3' gene alignments or genome alignments r1_5p_gene_hits, r1_3p_gene_hits = \ classify_unpaired_reads(pe_reads[0], library_type) r2_5p_gene_hits, r2_3p_gene_hits = \ classify_unpaired_reads(pe_reads[1], library_type) # pair 5' and 3' gene alignments gene_pairs = [] combos = [(r1_5p_gene_hits,r2_3p_gene_hits), (r1_3p_gene_hits,r2_5p_gene_hits)] for r1_list,r2_list in combos: for r1 in r1_list: for r2 in r2_list: cr1 = copy_read(r1) cr2 = copy_read(r2) pair_reads(cr1,cr2) gene_pairs.append((cr1,cr2)) return gene_pairs def classify_read_pairs(pe_reads, max_isize, library_type, tid_tx_map): """ examines all the alignments of a single fragment and tries to find ways to pair reads together. annotates all read pairs with an integer tag corresponding to a value in the DiscordantTags class returns a tuple with the following lists: 1) pairs (r1,r2) aligning to genes (pairs may be discordant) 3) unpaired reads, if any """ # to satisfy library type reads must either be on # same strand or opposite strands concordant_tx_pairs = [] discordant_tx_pairs = [] concordant_cluster_pairs = [] discordant_cluster_pairs = [] # # first, try to pair reads that map to the same transcript, or to the # genome within the insert size range # same_strand = LibraryTypes.same_strand(library_type) refdict, clusterdict = map_reads_to_references(pe_reads, tid_tx_map) found_pair = False for tid, tid_pe_reads in refdict.iteritems(): # check if there are alignments involving both reads in a pair if len(tid_pe_reads[0]) == 0 or len(tid_pe_reads[1]) == 0: # no paired alignments exist at this reference continue for r1 in tid_pe_reads[0]: for r2 in tid_pe_reads[1]: # read strands must agree with library type strand_match = (same_strand == (r1.is_reverse == r2.is_reverse)) # these reads can be paired found_pair = True cr1 = copy_read(r1) cr2 = copy_read(r2) # this is a hit to same transcript (gene) # pair the reads if strand comparison is correct if strand_match: tags = [(DISCORDANT_TAG_NAME, DiscordantTags.CONCORDANT_TX)] concordant_tx_pairs.append((cr1,cr2)) else: # hit to same gene with wrong strand, which # could happen in certain wacky cases tags = [(DISCORDANT_TAG_NAME, DiscordantTags.DISCORDANT_STRAND_TX)] discordant_tx_pairs.append((cr1,cr2)) pair_reads(cr1,cr2,tags) # at this point, if we have not been able to find a suitable way # to pair the reads, then search within the transcript cluster if not found_pair: for cluster_id, cluster_pe_reads in clusterdict.iteritems(): # check if there are alignments involving both reads in a pair if len(cluster_pe_reads[0]) == 0 or len(cluster_pe_reads[1]) == 0: # no paired alignments in this transcript cluster continue for r1 in cluster_pe_reads[0]: for r2 in cluster_pe_reads[1]: # check strand compatibility strand_match = (same_strand == (r1.is_reverse == r2.is_reverse)) # these reads can be paired found_pair = True cr1 = copy_read(r1) cr2 = copy_read(r2) if strand_match: tags = [(DISCORDANT_TAG_NAME, DiscordantTags.CONCORDANT_GENE)] concordant_cluster_pairs.append((cr1,cr2)) else: tags = [(DISCORDANT_TAG_NAME, DiscordantTags.DISCORDANT_STRAND_GENE)] discordant_cluster_pairs.append((cr1,cr2)) pair_reads(cr1,cr2,tags) # at this point, we have tried all combinations. if any paired reads # are concordant then return them without considering discordant reads gene_pairs = [] if len(concordant_tx_pairs) > 0: gene_pairs = concordant_tx_pairs elif len(concordant_cluster_pairs) > 0: gene_pairs = concordant_cluster_pairs if len(gene_pairs) > 0: return gene_pairs, [] # if no concordant reads in transcripts, return any discordant reads # that may violate strand requirements but still remain colocalized # on the same gene/chromosome gene_pairs = [] if len(discordant_tx_pairs) > 0: gene_pairs = discordant_tx_pairs elif len(discordant_cluster_pairs) > 0: gene_pairs = discordant_cluster_pairs if len(gene_pairs) > 0: return gene_pairs, [] # # at this point, no read pairings were found so the read is # assumed to be discordant. now we can create all valid # combinations of read1/read2 as putative discordant read pairs # gene_pairs = find_discordant_pairs(pe_reads, library_type) if len(gene_pairs) > 0: # sort valid pairs by sum of alignment score and retain the best scoring # pairs gene_pairs = select_best_scoring_pairs(gene_pairs) return gene_pairs, [] # # no valid pairs could be found suggesting that these mappings are # either mapping artifacts or that the current gene annotation set # lacks annotations support this pair # return [], pe_reads def write_pe_reads(bamfh, pe_reads): for reads in pe_reads: for r in reads: bamfh.write(r) def write_pairs(bamfh, pairs): for r1,r2 in pairs: bamfh.write(r1) bamfh.write(r2) def find_discordant_fragments(input_bam_file, paired_bam_file, unmapped_bam_file, index_dir, max_isize, library_type): """ parses BAM file and categorizes reads into several groups: - concordant - discordant within gene (splicing isoforms) - discordant between different genes (chimeras) """ logging.info("Finding discordant read pair combinations") logging.debug("\tInput file: %s" % (input_bam_file)) logging.debug("\tMax insert size: '%d'" % (max_isize)) logging.debug("\tLibrary type: '%s'" % (library_type)) logging.debug("\tGene paired file: %s" % (paired_bam_file)) logging.debug("\tUnmapped file: %s" % (unmapped_bam_file)) # setup input and output files bamfh = pysam.Samfile(input_bam_file, "rb") genefh = pysam.Samfile(paired_bam_file, "wb", template=bamfh) unmappedfh = pysam.Samfile(unmapped_bam_file, "wb", template=bamfh) # read transcript features logging.debug("Reading transcript features") transcript_file = os.path.join(index_dir, config.TRANSCRIPT_FEATURE_FILE) transcripts = list(TranscriptFeature.parse(open(transcript_file))) logging.debug("Building transcript lookup tables") # build a lookup table from bam tid index to transcript object tid_tx_map = build_tid_transcript_map(bamfh, transcripts) # build a transcript to genome coordinate map tid_tx_genome_map = build_tid_transcript_genome_map(bamfh, transcripts) logging.info("Parsing reads") for pe_reads in parse_pe_reads(bamfh): # add hit index and multimap information to read tags # this function also checks for unmapped reads any_unmapped = False for reads in pe_reads: any_unmapped = (any_unmapped or annotate_multihits(bamfh, reads, tid_tx_genome_map)) if any_unmapped: # write to output as discordant reads and continue to # next fragment write_pe_reads(unmappedfh, pe_reads) continue # examine all read pairing combinations and rule out invalid pairings gene_pairs, unpaired_reads = classify_read_pairs(pe_reads, max_isize, library_type, tid_tx_map) if len(gene_pairs) > 0: write_pairs(genefh, gene_pairs) # TODO: do something with unpaired discordant reads? genefh.close() unmappedfh.close() bamfh.close() logging.info("Finished pairing reads") return config.JOB_SUCCESS def main(): logging.basicConfig(level=logging.DEBUG, format="%(asctime)s - %(name)s - %(levelname)s - %(message)s") parser = argparse.ArgumentParser() parser.add_argument('--max-fragment-length', dest="max_fragment_length", type=int, default=1000) parser.add_argument('--library', dest="library_type", default=LibraryTypes.FR_UNSTRANDED) parser.add_argument("index_dir") parser.add_argument("input_bam_file") parser.add_argument("paired_bam_file") parser.add_argument("unmapped_bam_file") args = parser.parse_args() return find_discordant_fragments(args.input_bam_file, args.paired_bam_file, args.unmapped_bam_file, args.index_dir, max_isize=args.max_fragment_length, library_type=args.library_type) if __name__ == '__main__': sys.exit(main())
Alwnikrotikz/chimerascan
chimerascan/deprecated/find_discordant_reads_v5.0.0a.py
Python
gpl-3.0
14,265
[ "pysam" ]
4cb7a84f56d71f25df2d0f0de726baba3eec9476dc53b4427302f64d840b105d
"""Reproduce results from Fig. 2 of `bib.raanes2014ext`.""" import numpy as np import dapper.mods as modelling from dapper.mods.LA import Fmat, sinusoidal_sample from dapper.mods.Lorenz96 import LPs from dapper.tools.linalg import tsvd # Burn-in allows damp*x and x+noise balance out tseq = modelling.Chronology(dt=1, dko=5, T=500, BurnIn=60, Tplot=100) Nx = 1000 Ny = 40 jj = modelling.linspace_int(Nx, Ny) Obs = modelling.partial_Id_Obs(Nx, jj) Obs['noise'] = 0.01 ################# # Noise setup # ################# # Instead of sampling model noise from sinusoidal_sample(), # we will replicate it below by a covariance matrix approach. # But, for strict equivalence, one would have to use # uniform (i.e. not Gaussian) random numbers. wnumQ = 25 sample_filename = modelling.rc.dirs.samples/('LA_Q_wnum%d.npz' % wnumQ) try: # Load pre-generated L = np.load(sample_filename)['Left'] except FileNotFoundError: # First-time use print('Did not find sample file', sample_filename, 'for experiment initialization. Generating...') NQ = 20000 # Must have NQ > (2*wnumQ+1) A = sinusoidal_sample(Nx, wnumQ, NQ) A = 1/10 * (A - A.mean(0)) / np.sqrt(NQ) Q = A.T @ A U, s, _ = tsvd(Q) L = U*np.sqrt(s) np.savez(sample_filename, Left=L) X0 = modelling.GaussRV(C=modelling.CovMat(np.sqrt(5)*L, 'Left')) ################### # Forward model # ################### damp = 0.98 Fm = Fmat(Nx, -1, 1, tseq.dt) def step(x, t, dt): assert dt == tseq.dt return x @ Fm.T Dyn = { 'M': Nx, 'model': lambda x, t, dt: damp * step(x, t, dt), 'linear': lambda x, t, dt: damp * Fm, 'noise': modelling.GaussRV(C=modelling.CovMat(L, 'Left')), } HMM = modelling.HiddenMarkovModel(Dyn, Obs, tseq, X0, LP=LPs(jj)) #################### # Suggested tuning #################### # Expected rmse.a = 0.3 # xp = EnKF('PertObs',N=30,infl=3.2) # Note that infl=1 may yield approx optimal rmse, even though then rmv << rmse. # Why is rmse so INsensitive to inflation, especially for PertObs? # Reproduce raanes'2015 "extending sqrt method to model noise": # xp = EnKF('Sqrt',fnoise_treatm='XXX',N=30,infl=1.0), # where XXX is one of: # - Stoch # - Mult-1 # - Mult-M # - Sqrt-Core # - Sqrt-Add-Z # - Sqrt-Dep # Other notes: # - Multidim. multiplicative noise incorporation # has a tendency to go awry. # The main reason is that it changes the ensemble subspace, # away from the "model" subspace. # - There are also some very strong, regular correlation # patters that arise when dt=1 (dt = c*dx). # - It also happens if X0pat does not use centering.
nansencenter/DAPPER
dapper/mods/LA/raanes2015.py
Python
mit
2,659
[ "Gaussian" ]
fe5404c83e351704ab4ec15423add8a46bf95a48b96aef54211679dd7cb8409c
# Copyright 2016 Brian Innes # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import sys import traceback from vPiP import * Vpip = vPiP.Vpip with Vpip() as p: try: p.moveTo(0, 0) p.drawTo(p.config.pixels, 0) p.drawTo(p.config.pixels, p.config.heightPixels) p.drawTo(0, p.config.heightPixels) p.drawTo(0, 0) p.moveTo(1, 1) p.drawTo(p.config.pixels - 1, 1) p.drawTo(p.config.pixels - 1, p.config.heightPixels - 1) p.drawTo(1, p.config.heightPixels - 1) p.drawTo(1, 1) p.goHome() except: exc_type, exc_value, exc_traceback = sys.exc_info() print("test1 main thread exception : %s" % exc_type) traceback.print_tb(exc_traceback, limit=2, file=sys.stdout)
brianinnes/pycupi
python/border.py
Python
apache-2.0
1,270
[ "Brian" ]
289d1be87e76277dd7232bac30570690563dac7989f241de0020dcfa4cd361e9
""" Supercell class Class to store supercells of crystals. A supercell is a lattice model of a crystal, with periodically repeating unit cells. In that framework we can 1. add/remove/substitute atoms 2. find the transformation map between two different representations of the same supercell 3. output POSCAR format (possibly other formats?) """ __author__ = 'Dallas R. Trinkle' import numpy as np import collections, copy, itertools, warnings from numbers import Integral from onsager import crystal from functools import reduce # TODO: add "parser"--read CONTCAR file, create Supercell # TODO: output PairState from Supercell class Supercell(object): """ A class that defines a Supercell of a crystal. Takes in a crystal, a supercell (3x3 integer matrix). We can identify sites as interstitial sites, and specify if we'll have solutes. """ def __init__(self, crys, super, interstitial=(), Nsolute=0, empty=False, NOSYM=False): """ Initialize our supercell to an empty supercell. :param crys: crystal object :param super: 3x3 integer matrix :param interstitial: (optional) list/tuple of indices that correspond to interstitial sites :param Nsolute: (optional) number of substitutional solute elements to consider; default=0 :param empty: (optional) designed to allow "copy" to work--skips all derived info :param NOSYM: (optional) does not do symmetry analysis (intended ONLY for testing purposes) """ self.crys = crys self.super = super.copy() self.interstitial = copy.deepcopy(interstitial) self.Nchem = crys.Nchem + Nsolute if Nsolute > 0 else crys.Nchem if empty: return # everything else that follows is "derived" from those initial parameters self.lattice = np.dot(self.crys.lattice, self.super) self.N = self.crys.N self.atomindices, self.indexatom = self.crys.atomindices, \ {ci: n for n, ci in enumerate(self.crys.atomindices)} self.chemistry = [crys.chemistry[n] if n < crys.Nchem else '' for n in range(self.Nchem + 1)] self.chemistry[-1] = 'v' self.Wyckofflist, self.Wyckoffchem = [], [] for n, (c, i) in enumerate(self.atomindices): for wset in self.Wyckofflist: if n in wset: break if len(self.Wyckofflist) == 0 or n not in wset: # grab the set of (c,i) of Wyckoff sets (next returns first that matches, None if none): indexset = next((iset for iset in self.crys.Wyckoff if (c, i) in iset), None) self.Wyckofflist.append(frozenset([self.indexatom[ci] for ci in indexset])) self.Wyckoffchem.append(self.crys.chemistry[c]) self.size, self.invsuper, self.translist, self.transdict = self.maketrans(self.super) # self.transdict = {tuple(t):n for n,t in enumerate(self.translist)} self.pos, self.occ = self.makesites(), -1 * np.ones(self.N * self.size, dtype=int) self.chemorder = [[] for n in range(self.Nchem)] if NOSYM: self.G = frozenset([crystal.GroupOp.ident([self.pos])]) else: self.G = self.gengroup() # some attributes we want to do equate, others we want deepcopy. Equate should not be modified. __copyattr__ = ('lattice', 'N', 'chemistry', 'size', 'invsuper', 'Wyckofflist', 'Wyckoffchem', 'occ', 'chemorder') __eqattr__ = ('atomindices', 'indexatom', 'translist', 'transdict', 'pos', 'G') def copy(self): """ Make a copy of the supercell; initializes, then copies over ``__copyattr__`` and ``__eqattr__``. :return: new supercell object, copy of the original """ supercopy = self.__class__(self.crys, self.super, self.interstitial, self.Nchem - self.crys.Nchem, empty=True) for attr in self.__copyattr__: setattr(supercopy, attr, copy.deepcopy(getattr(self, attr))) for attr in self.__eqattr__: setattr(supercopy, attr, getattr(self, attr)) return supercopy def __eq__(self, other): """ Return True if two supercells are equal; this means they should have the same occupancy. *and* the same ordering :param other: supercell for comparison :return: True if same crystal, supercell, occupancy, and ordering; False otherwise """ return isinstance(other, self.__class__) and np.all(self.super == other.super) and \ self.interstitial == other.interstitial and np.allclose(self.pos, other.pos) and \ np.all(self.occ == other.occ) and self.chemorder == other.chemorder def __ne__(self, other): """Inequality == not __eq__""" return not self.__eq__(other) def stoichiometry(self): """Return a string representing the current stoichiometry""" return ','.join([c + '_i({})'.format(len(l)) if n in self.interstitial else c + '({})'.format(len(l)) for n, c, l in zip(itertools.count(), self.chemistry, self.chemorder)]) def __str__(self): """Human readable version of supercell""" str = "Supercell of crystal:\n{crys}\n".format(crys=self.crys) str += "Supercell vectors:\n{}\nChemistry: ".format(self.super.T) str += self.stoichiometry() str += '\nKroger-Vink: ' + self.KrogerVink() str += '\nPositions:\n' str += '\n'.join([u.__str__() + ' ' + self.chemistry[o] for u, o in zip(self.pos, self.occ)]) str += '\nOrdering:\n' str += '\n'.join([u.__str__() + ' ' + c for c, ulist in zip(self.chemistry, self.occposlist()) for u in ulist]) return str def __mul__(self, other): """ Multiply by a GroupOp; returns a new supercell (constructed via copy). :param other: must be a GroupOp (and *should* be a GroupOp of the supercell!) :return: rotated supercell """ if not isinstance(other, crystal.GroupOp): return NotImplemented gsuper = self.copy() gsuper *= other return gsuper def __rmul__(self, other): """ Multiply by a GroupOp; returns a new supercell (constructed via copy). :param other: must be a GroupOp (and *should* be a GroupOp of the supercell!) :return: rotated supercell """ if not isinstance(other, crystal.GroupOp): return NotImplemented return self.__mul__(other) def __imul__(self, other): """ Multiply by a GroupOp, in place. :param other: must be a GroupOp (and *should* be a GroupOp of the supercell!) :return: self """ if not isinstance(other, crystal.GroupOp): return NotImplemented # This requires some careful manipulation: we need to modify (1) occ, and (2) chemorder indexmap = other.indexmap[0] gocc = self.occ.copy() for ind, gind in enumerate(indexmap): gocc[gind] = self.occ[ind] self.occ = gocc self.chemorder = [[indexmap[ind] for ind in clist] for clist in self.chemorder] return self def index(self, pos, threshold=1.): """ Return the index that corresponds to the position *closest* to pos in the supercell. Done in direct coordinates of the supercell, using periodic boundary conditions. :param pos: 3-vector :param threshold: (optional) minimum squared "distance" in supercell for a match; default=1. :return index: index of closest position """ index, dist2 = None, threshold for ind, u in enumerate(self.pos): delta = crystal.inhalf(pos - u) d2 = np.sum(delta * delta) if d2 < dist2: index, dist2 = ind, d2 return index def __getitem__(self, key): """ Index into supercell :param key: index (either an int, a slice, or a position) :return: chemical occupation at that point """ if isinstance(key, Integral) or isinstance(key, slice): return self.occ[key] if isinstance(key, np.ndarray) and key.shape == (3,): return self.occ[self.index(key)] raise TypeError('Inappropriate key {}'.format(key)) def __setitem__(self, key, value): """ Set specific composition for site; uses same indexing as __getitem__ :param key: index (either an int, a slice, or a position) :param value: chemical occupation at that point """ if isinstance(key, slice): return NotImplemented index = None if isinstance(key, Integral): index = key if isinstance(key, np.ndarray) and key.shape == (3,): index = self.index(key) self.setocc(index, value) def __sane__(self): """Return True if supercell occupation and chemorder are consistent""" occset = set() for c, clist in enumerate(self.chemorder): for ind in clist: # check that occupancy (from chemorder) is correct: if self.occ[ind] != c: return False # record as an occupied state occset.add(ind) # now make sure that every site *not* in occset is, in fact, vacant for ind, c in enumerate(self.occ): if ind not in occset: if c != -1: return False return True @staticmethod def maketrans(super): """ Takes in a supercell matrix, and returns a list of all translations of the unit cell that remain inside the supercell :param super: 3x3 integer matrix :return size: integer, corresponding to number of unit cells :return invsuper: integer matrix inverse of supercell (needs to be divided by size) :return translist: list of integer vectors (to be divided by ``size``) corresponding to unit cell positions :return transdict: dictionary of tuples and their corresponding index (inverse of trans) """ size = abs(int(np.round(np.linalg.det(super)))) if size==0: raise ZeroDivisionError('Tried to use a singular supercell.') invsuper = np.round(np.linalg.inv(super) * size).astype(int) maxN = abs(super).max() translist, transdict = [], {} for nvect in [np.array((n0, n1, n2)) for n0 in range(-maxN, maxN + 1) for n1 in range(-maxN, maxN + 1) for n2 in range(-maxN, maxN + 1)]: tv = np.dot(invsuper, nvect) % size ttup = tuple(tv) if ttup not in transdict: transdict[ttup] = len(translist) translist.append(tv) if len(translist) != size: raise ArithmeticError( 'Somehow did not generate the correct number of translations? {}!={}'.format(size, len(translist))) return size, invsuper, translist, transdict def makesites(self): """ Generate the array corresponding to the sites; the indexing is based on the translations and the atomindices in crys. These may not all be filled when the supercell is finished. :return pos: array [N*size, 3] of supercell positions in direct coordinates """ invsize = 1 / self.size basislist = [np.dot(self.invsuper, self.crys.basis[c][i]) for (c, i) in self.atomindices] return np.array([crystal.incell((t + u) * invsize) for t in self.translist for u in basislist]) def gengroup(self): """ Generate the group operations internal to the supercell :return G: set of GroupOps """ Glist = [] unittranslist = [np.dot(self.super, t) // self.size for t in self.translist] invsize = 1 / self.size for g0 in self.crys.G: Rsuper = np.dot(self.invsuper, np.dot(g0.rot, self.super)) if not np.all(Rsuper % self.size == 0): warnings.warn( 'Broken symmetry? GroupOp:\n{}\nnot a symmetry operation of supercell?\nRsuper=\n{}'.format(g0, Rsuper), RuntimeWarning, stacklevel=2) continue else: # divide out the size (in inverse super). Should still be an integer matrix (and hence, a symmetry) Rsuper //= self.size for u in unittranslist: # first, make the corresponding group operation by adding the unit cell translation: g = g0 + u # translation vector *in the supercell*; go ahead and keep it inside the supercell, too. tsuper = (np.dot(self.invsuper, g.trans) % self.size) * invsize # finally: indexmap!! indexmap = [] for R in unittranslist: for ci in self.atomindices: Rp, ci1 = self.crys.g_pos(g, R, ci) # A little confusing, but: # [n]^-1*Rp -> translation, but needs to be mod self.size # convert to a tuple, to the index into transdict # THEN multiply by self.N, and add the index of the new Wyckoff site. Whew! indexmap.append( self.transdict[tuple(np.dot(self.invsuper, Rp) % self.size)] * self.N + self.indexatom[ci1]) if len(set(indexmap)) != self.N * self.size: raise ArithmeticError('Did not produce a correct index mapping for GroupOp:\n{}'.format(g)) Glist.append(crystal.GroupOp(rot=Rsuper, cartrot=g0.cartrot, trans=tsuper, indexmap=(tuple(indexmap),))) return frozenset(Glist) def definesolute(self, c, chemistry): """ Set the name of the chemistry of chemical index c. Only works for substitutional solutes. :param c: index :param chemistry: string """ if c < self.crys.Nchem or c >= self.Nchem: raise IndexError('Trying to set the chemistry for a lattice atom / vacancy') self.chemistry[c] = chemistry def setocc(self, ind, c): """ Set the occupancy of position indexed by ind, to chemistry c. Used by all the other algorithms. :param ind: integer index :param c: chemistry index """ if c < -2 or c > self.crys.Nchem: raise IndexError('Trying to occupy with a non-defined chemistry: {} out of range'.format(c)) corig = self.occ[ind] if corig != c: if corig >= 0: # remove from chemorder list (if not vacancy) co = self.chemorder[corig] co.pop(co.index(ind)) if c >= 0: # add to chemorder list (if not vacancy) self.chemorder[c].append(ind) # finally: set the occupancy self.occ[ind] = c def fillperiodic(self, ci, Wyckoff=True): """ Occupies all of the (Wyckoff) sites corresponding to chemical index with the appropriate chemistry. :param ci: tuple of (chem, index) in crystal :param Wyckoff: (optional) if False, *only* occupy the specific tuple, but still periodically :return self: """ if __debug__: if ci not in self.indexatom: raise IndexError('Tuple {} not a corresponding atom index'.format(ci)) ind = self.indexatom[ci] indlist = next((nset for nset in self.Wyckofflist if ind in nset), None) if Wyckoff else (ind,) for i in [n * self.N + i for n in range(self.size) for i in indlist]: self.setocc(i, ci[0]) return self def occposlist(self): """ Returns a list of lists of occupied positions, in (chem)order. :return occposlist: list of lists of supercell coord. positions """ return [[self.pos[ind] for ind in clist] for clist in self.chemorder] def POSCAR(self, name=None, stoichiometry=True): """ Return a VASP-style POSCAR, returned as a string. :param name: (optional) name to use for first list :param stoichiometry: (optional) if True, append stoichiometry to name :return POSCAR: string """ POSCAR = "" if name is None else name if stoichiometry: POSCAR += " " + self.stoichiometry() POSCAR += """ 1.0 {a[0][0]:21.16f} {a[1][0]:21.16f} {a[2][0]:21.16f} {a[0][1]:21.16f} {a[1][1]:21.16f} {a[2][1]:21.16f} {a[0][2]:21.16f} {a[1][2]:21.16f} {a[2][2]:21.16f} """.format(a=self.lattice) POSCAR += ' '.join(['{}'.format(len(clist)) for clist in self.chemorder]) POSCAR += '\nDirect\n' POSCAR += '\n'.join([" {u[0]:19.16f} {u[1]:19.16f} {u[2]:19.16f}".format(u=u) for clist in self.occposlist() for u in clist]) # needs a trailing newline return POSCAR + '\n' __vacancyformat__ = "v_{sitechem}" __interstitialformat__ = "{chem}_i" __antisiteformat__ = "{chem}_{sitechem}" def defectindices(self): """ Return a dictionary that corresponds to the "defect" content of the supercell. :return defects: dictionary, keyed by defect type, with a set of indices of corresponding defects """ def adddefect(name, index): if name in defects: defects[name].add(index) else: defects[name] = set([index]) defects = {} sitechem = [self.chemistry[c] for (c, i) in self.atomindices] for wset, chem in zip(self.Wyckofflist, self.Wyckoffchem): for i in wset: if self.atomindices[i][0] in self.interstitial: for n in range(self.size): ind = n * self.N + i c = self.occ[ind] if c != -1: adddefect(self.__interstitialformat__.format(chem=self.chemistry[c]), ind) else: sc = sitechem[i] for n in range(self.size): ind = n * self.N + i c = self.occ[ind] if self.chemistry[c] != sc: name = self.__vacancyformat__.format(sitechem=sitechem[i]) \ if c == -1 else \ self.__antisiteformat__.format(chem=self.chemistry[c], sitechem=sc) adddefect(name, ind) return defects def KrogerVink(self): """ Attempt to make a "simple" string based on the defectindices, using Kroger-Vink notation. That is, we identify: vacancies, antisites, and interstitial sites, and return a string. NOTE: there is no relative charges, so this is a pseudo-KV notation. :return KV: string representation """ defects = self.defectindices() return '+'.join(["{}{}".format(len(defects[name]), name) if len(defects[name]) > 1 else name for name in sorted(defects.keys())]) def reorder(self, mapping): """ Reorder (in place) the occupied sites. Does not change the occupancies, only the ordering for "presentation". :param mapping: list of maps; will make newchemorder[c][i] = chemorder[c][mapping[c][i]] :return self: If mapping is not a proper permutation, raises ValueError. """ neworder = [[clist[cmap[i]] for i in range(len(clist))] for clist, cmap in zip(self.chemorder, mapping)] self.chemorder, oldorder = neworder, self.chemorder if not self.__sane__(): self.chemorder = oldorder raise ValueError('Mapping {} is not a proper permutation'.format(mapping)) return self def equivalencemap(self, other): """ Given the super ``other`` we want to find a group operation that transforms ``self`` into other. This is a GroupOp *along* with an index mapping of chemorder. The index mapping is to get the occposlist to match up: ``(g*self).occposlist()[c][mapping[c][i]] == other.occposlist()[c][i]`` (We can write a similar expression using chemorder, since chemorder indexes into pos). We're going to return both g and mapping. *Remember:* ``g`` does not change the presentation ordering; ``mapping`` is necessary for full equivalence. If no such equivalence, return ``None,None``. :param other: Supercell :return g: GroupOp to transform sites from ``self`` to ``other`` :return mapping: list of maps, such that (g*self).chemorder[c][mapping[c][i]] == other.chemorder[c][i] """ # 1. check that our defects even match up: selfdefects, otherdefects = self.defectindices(), other.defectindices() for k, v in selfdefects.items(): if k not in otherdefects: return None, None if len(v) != len(otherdefects[k]): return None, None for k, v in otherdefects.items(): if k not in selfdefects: return None, None if len(v) != len(selfdefects[k]): return None, None # 2. identify the shortest common set of defects: defcount = {k: len(v) for k, v in selfdefects.items()} deftype = min(defcount, key=defcount.get) # key to min value from dictionary shortset, matchset = selfdefects[deftype], otherdefects[deftype] mapping = None gocc = self.occ.copy() for g in self.G: # 3. check against the shortest list of defects: indexmap = g.indexmap[0] if any(indexmap[i] not in matchset for i in shortset): continue # 4. having checked that shortlist, check the full mapping: for ind, gind in enumerate(indexmap): gocc[gind] = self.occ[ind] if np.any(gocc != other.occ): continue # 5. we have a winner. Now it's all up to getting the mapping; done with index() gorder = [[indexmap[ind] for ind in clist] for clist in self.chemorder] mapping = [] for gclist, otherlist in zip(gorder, other.chemorder): mapping.append([gclist.index(index) for index in otherlist]) break if mapping is None: return None, mapping return g, mapping
DallasTrinkle/Onsager
onsager/supercell.py
Python
mit
22,765
[ "CRYSTAL", "VASP" ]
b82ece69acb4fd41c275e6c59cb39d159cb6eb8d141f61af7a0dfa95b92b7b59
################################ # Author : septicmk # Date : 2015/09/05 16:57:57 # FileName : visualization.py ################################ from vtkpython import * import math import pandas as pd from random import random class vtkTimerCallback(): def __init__(self): self.timer_count = 0 def execute(self,obj,event): #print self.timer_count celllist = self.dataset[self.timer_count] for i in range(len(self.actorlist)): print str(i) + " " + str(celllist[i]['pos'][0]) + " " + str(celllist[i]['pos'][1]) + " " + str(celllist[i]['pos'][2]) self.actorlist[i].SetPosition(float(celllist[i]['pos'][0]),float(celllist[i]['pos'][1]),float(celllist[i]['pos'][2])); #self.actorlist[i].SetPosition(random()*20,random()*20,random()*20) iren = obj iren.GetRenderWindow().Render() self.timer_count += 1 class Visualization: def __init__(self): ''' ''' self.cell_table = pd.read_pickle("cell_table.pkl") self.cell_table.to_csv("cell_tabel.csv") def makeCells(self): ''' using dataset to get cell list. return: A List consisting of [vtkActor] ''' cellactorlist = [] for i, row in self.cell_table.iterrows(): spheresrc = vtk.vtkSphereSource() spheresrc.SetCenter(row[u'x'],row[u'y'],row[u'z']*7) spheresrc.SetRadius(row[u'size']) spheresrc.SetPhiResolution(25) spheresrc.SetThetaResolution(25) mapper = vtk.vtkPolyDataMapper() mapper.SetInputConnection(spheresrc.GetOutputPort()) actor = vtk.vtkActor() actor.SetMapper(mapper) cellactorlist.append(actor) return cellactorlist def export2AVI(self): ''' render the scence then export it to an AVI file ''' cellactorlist = self.makeCells() # print len(cellactorlist) ren = vtk.vtkRenderer() renwin = vtk.vtkRenderWindow() renwin.AddRenderer(ren) #iren = vtk.vtkRenderWindowInteractor() #iren.SetRenderWindow(renwin) for cellactor in cellactorlist: ren.AddActor(cellactor) ren.SetBackground(0,0,0,) renwin.SetSize(400,400) #iren.Initialize() ren.ResetCamera() ren.GetActiveCamera().Zoom(0.5) renwin.Render() #iren.Start() writer = vtk.vtkAVIWriter() w2i = vtk.vtkWindowToImageFilter() w2i.SetInput(renwin) writer.SetInputConnection(w2i.GetOutputPort()) writer.SetFileName("cell_visualization.avi") writer.Start() for celllist in self.dataset: for i in range(len(cellactorlist)): cellactorlist[i].SetPosition(float(celllist[i]['pos'][0]),float(celllist[i]['pos'][1]),float(celllist[i]['pos'][2])) w2i.Modified() #writer.Write() writer.Write() writer.End() def debug(self): ''' Debug ''' cellactorlist = self.makeCells() # print len(cellactorlist) ren = vtk.vtkRenderer() renwin = vtk.vtkRenderWindow() renwin.AddRenderer(ren) iren = vtk.vtkRenderWindowInteractor() iren.SetRenderWindow(renwin) for cellactor in cellactorlist: ren.AddActor(cellactor) ren.SetBackground(0,0,0,) renwin.SetSize(400,400) ren.ResetCamera() ren.GetActiveCamera().Zoom(0.5) renwin.Render() iren.Initialize() #cb = vtkTimerCallback() #cb.actorlist = cellactorlist #cb.dataset = self.dataset #iren.AddObserver('TimerEvent', cb.execute) #timerId = iren.CreateRepeatingTimer(10) iren.Start() if __name__ == '__main__': vis = Visualization() vis.debug() #vis.export2AVI()
septicmk/MEHI
MEHI/utils/visualization.py
Python
bsd-3-clause
4,115
[ "VTK" ]
7343a45764f11ddbd953c840258377d35368f04c3dd319123d5ec9dec452b566
#! /usr/bin/env python # -*- coding: utf-8 -*- # vim:fenc=utf-8 # vim:fdm=marker # # ============================================================= # Copyright © 2018 Daniel Santiago <dpelaez@cicese.edu.mx> # Distributed under terms of the GNU/GPL license. # ============================================================= """ """ # --- import libs --- import numpy as np import datetime as dt import pandas as pd import netCDF4 as nc import scipy.signal as signal import os import csv import pickle # import tools.wdm as wdm import tools.spectra as sp # === Read Data Class === # {{{ class ReadData(object): # main folder bomm_number = 1 basepath = "/Volumes/BOMM1/dataBOMM1/data" # private methods to read data {{{ def __init__(self, date): self.date = date def __repr__(self): return f"BOMM{self.bomm_number} data at {self.date}" # parse hour line into floating def _parsedate(self, string): """Parse the date HH:MM:SS.ffffff YYYY mm dd.""" hour, dd, mm, yy = string.split() H, M, sec = hour.split(":") try: S, f = sec.split(".") except ValueError: S, f = sec, '0' return dt.datetime(int(yy), int(mm), int(dd), int(H), int(M), int(S), int(f)) # get file name from a given date def _getfilename(self, sensor, date): """Returns filename based on date, sensor, and path.""" if sensor in ["maximet"]: fmt = f"/{sensor}/%Y/%m/%d/{sensor}-%y%m%d%H.csv" elif sensor in ["rbr"]: fmt = f"/{sensor}/%Y/%m/{sensor}-%y%m%d.csv" else: fmt = f"/{sensor}/%Y/%m/%d/%H/{sensor}-%y%m%d%H%M.csv" self.filename = self.basepath + dt.datetime.strftime(date, fmt) return self.filename # read file def _readfile(self, sensor, date, columns): """This function reads the data of the original files.""" # get filename filename = self._getfilename(sensor, date) # pre-define variables time = [] obs = {v: [] for v in columns.values()} # read file # TODO: some files have lines with null bytes. Check it! with open(filename, 'r') as f: data = csv.reader(f, delimiter=',') for row in data: time.append(self._parsedate(" ".join(row[:4]))) for k, v in columns.items(): try: obs[v].append(float(row[k])) except ValueError: obs[v].append(row[k]) # convert to numpy array and add time array obs["time"] = time for k, v in obs.items(): obs[k] = np.asarray(v) return obs # new time array def _getnewtime(self, date, fs, N=600): """Returns list of datetimes of N seconds at fs sampling frequency.""" seconds = np.arange(0, N, 1/fs) return np.array([date + dt.timedelta(seconds=s) for s in seconds]) # interpolate the data def _resample(self, dic, date, fs, N=600): """This function uses pandas for an accurate resample""" # create new time array time_new = self._getnewtime(date, fs, N) # create pandas dataframe using the data in the dictionary t = dic["time"] df = pd.DataFrame({k:v for k,v in dic.items() if k not in ["time"]}, index=t) # check the number of nans n = len(t) n_nans = df.isnull().sum().max() if n_nans / n > 0.1: raise Exception(f"Number of NaNs is {n_nans:d} out of {n:d}.") # if n < 0.1*len(time_new): # raise Exception(f"More than 10% of data is missing for this file.") # drop missing values only if are less than 10 percent of the data # TODO: not more than 100 consecutive missing values df = df.dropna(how="any") # remove duplicate indices if they exist df = df[~df.index.duplicated(keep='first')] # sort data in ascending and reindex to the new time # i still dont know what is the difference between ffill/bfill l = fs if fs>=1 else None df = df.sort_index().reindex(time_new, limit=1, method="bfill").ffill() # crate new dictionary for output outdic = {c:df[c].as_matrix() for c in df} outdic["time"] = time_new return outdic # high pass filter def _butterwoth(self, x, fs, fcut): """Apply a butterworth filter before of resampling""" raise NotImplementedError # correct NULL bytes def _remove_null_bytes(self, filename): """Remove NULL bytes in file represented by '\0'.""" raise NotImplementedError # }}} # read waves method {{{ def waves(self): # parameters date = self.date sensor = "wstaff" fac = 3.5/4095 columns = {4:"ws1", 5:"ws2", 6:"ws3", 7:"ws4", 8:"ws5", 9:"ws6"} # load observed data obs = self._readfile(sensor, date, columns) # apply correction factor of 3.5/4095 for k in columns.values(): obs[k] *= fac # return data return self._resample(obs, date, fs=20, N=600) # 10-minutes blocks # }}} # read winds method {{{ def winds(self): # parameters date = self.date sensor = "anemometro" columns = {5:"U", 6:"V", 7:"W", 8:"T"} # load observed data obs = self._readfile(sensor, date, columns) # return data return self._resample(obs, date, fs=100, N=600) # 10-minutes blocks # }}} # read motion method {{{ def motion(self): # parameters date = self.date sensor = "acelerometro" columns = { 6:"surge", 7:"sway", 8:"heave", 9:"dpitch_dt", 10:"droll_dt", 11:"dyaw_dt", 13:"dvel_x", 14:"dvel_y", 15:"dvel_z", 16:"dang_x", 17:"dang_y", 18:"dang_z" } # load observed data obs = self._readfile(sensor, date, columns) # correction to match buoy frame of reference obs["sway"] *= -1 obs["heave"] *= -1 obs["droll_dt"] *= -1 obs["dyaw_dt"] *= -1 obs["dvel_y"] *= -1 obs["dvel_z"] *= -1 obs["dang_y"] *= -1 obs["dang_z"] *= -1 # return data return self._resample(obs, date, fs=100, N=600) # 10-minutes blocks # }}} # read maximet method {{{ def meteo(self): # parameters date = self.date.replace(minute=0) sensor = "maximet" columns = { 4: "uWdir", 6: "cWdir", 5: "Wspd", 7: "Patm", 8: "rhum", 9: "Tair", 11: "rain" } # load observed data obs = self._readfile(sensor, date, columns) # return data return self._resample(obs, date, fs=1, N=3600) # 60-minutes blocks # }}} # read water quality method {{{ def water(self): # parameters date = self.date.replace(hour=0, minute=0) sensor = "rbr" columns = {4:"conductivity", 5:"temperature", 11:"salinity"} # load observed data obs = self._readfile(sensor, date, columns) # return data return self._resample(obs, date, fs=1/600, N=86400) # 1-day blocks # }}} # read any sensor {{{ def read(self, sensor): """Returns data of the specified sensor or nan if file doesnt exist""" sensor_list = { 'wavestaff' : (self.waves, 20, 600), 'anemometro' : (self.winds, 100, 600), 'acelerometro' : (self.motion, 100, 600), 'maximet' : (self.meteo, 1, 3600), 'rbr' : (self.water, 1/600, 86400) } function, fs, N = sensor_list[sensor] try: # read data data = function() # if file does not exist or not valid except Exception as e: print(e) # dummy_date = dt.datetime(2017,11,17,0,0) dummy_objc = ReadData(dummy_date) data = dummy_objc.read(sensor) data["time"] = self._getnewtime(self.date, fs, N) for k in data.keys(): if k not in ["time"]: data[k] *= np.nan return data # }}} # }}} # === Write NetCDF file === # {{{ # generator of date list {{{ def dates(): """Returns a generator containing dates of bomm measurements each day.""" start = dt.datetime(2017, 11, 17) final = dt.datetime(2018, 1, 31) while start <= final: yield start start += dt.timedelta(days=1) # }}} # write water variables {{{ def write_water_group(dataset, date): """Write variables and attributes associated to water group.""" print("wat --> ", date) # get data from the given date wat = ReadData(date).read("rbr") # create group, dimensions and global attributtes water = dataset.createGroup(f"{hgrp}/water") water.createDimension("time", None) water.description = "Measurements of RBR Concerto" water.sampling_frequency = 1/600 # variable attributes units = { "time": global_time_units, "temperature": "Degrees Celsius", "salinity": "ppm", "conductivity": "mS/cm" } # create each variable for k, v in wat.items(): water.createVariable(k, "f8", "time") water[k].units = units[k] if k not in "time": water[k][:] = v else: water["time"][:] = nc.date2num(v, global_time_units) # }}} # write meteorological variables {{{ def write_meteo_group(dataset, date): """Write variables and attributes associated to meteo group.""" # create group, dimensions and global attributtes meteo = dataset.createGroup(f"{hgrp}/meteo") meteo.createDimension("time", None) meteo.description = "Measurements of Gill Maximet GMX-600" meteo.comments = "BOMM1: North mark is rotated 60 degrees counterclockwise" meteo.sampling_frequency = 1 # variable attributes units = { "time": global_time_units, "uWdir": "Azimuth in nautical convention", "cWdir": "Azimuth in nautical convention", "Wspd": "m/s", "Patm": "mbar", "rhum": "Percentage", "Tair": "Degrees Celsius", "rain": "mm/h" } # create each variable for k, v in units.items(): meteo.createVariable(k, "f8", "time") meteo[k].units = v # loop for each data seconds_per_hour = 3600 i, j = 0, seconds_per_hour for hr in range(24): # file_date = date + dt.timedelta(hours=hr) print("met --> ", file_date) # # load data met = ReadData(file_date).read("maximet") # for k, v in met.items(): if k not in "time": meteo[k][i:j] = v else: meteo["time"][i:j] = nc.date2num(v, global_time_units) # update counter i, j = j, j + seconds_per_hour # }}} # write waves variables {{{ def write_waves_group(dataset, date): """Write variables and attributes associated to waves group.""" # position of the wavestaff relative to the buoy Lx, Ly = wdm.reg_array(N=5, R=0.866, theta_0=-180) # add correction due to position of the accelerometers x_offset, y_offset, z_offset = -0.413, -0.339, 4.45 Lx += x_offset Ly += y_offset Lz = np.zeros(6) + z_offset # create group, dimensions and global attributtes waves = dataset.createGroup(f"{hgrp}/waves") waves.createDimension("time", None) waves.description = "Measurements of wavestaff wires in a pentageonal array" waves.Lx, waves.Ly, waves.Lz = Lx, Ly, Lz waves.sampling_frequency = 20 # variable attributes units = { "time": global_time_units, "ws1": "m", "ws2": "m", "ws3": "m", "ws4": "m", "ws5": "m", "ws6": "m" } # create each variable for k, v in units.items(): waves.createVariable(k, "f8", "time") waves[k].units = v # loop for each data samples_per_ten_minutes = int(600*20) i, j = 0, samples_per_ten_minutes # for hr in range(24): # for mn in range(0, 60, 10): file_date = date+dt.timedelta(hours=hr, minutes=mn) print("wav --> ", file_date) # load data wav = ReadData(file_date).read("wavestaff") # assign data to netctd variable for k, v in wav.items(): if k not in "time": waves[k][i:j] = v else: waves["time"][i:j] = nc.date2num(v, global_time_units) # update counter i, j = j, j + samples_per_ten_minutes # }}} # write wind variables {{{ def write_wind_group(dataset, date): """Write variables and attributes associated to wind group.""" # locations L = (-0.413, -0.339, 13.01) wind = dataset.createGroup(f"{hgrp}/wind") wind.createDimension("time", None) wind.description = "Measurements of sonic anemometer Gill R3100" wind.sampling_frequency = 100 wind.convention = "Cartesian: W positive up, U positive 30 ccw, V positive 120 ccw" wind.comments = "Data are rotated 30 degrees ccw from north mark" wind.L = L # variable attributes units = { "time": global_time_units, "U": "m/s", "V": "m/s", "W": "m/s", "T": "Degrees Celsius", } # create each variable for k, v in units.items(): wind.createVariable(k, "f8", "time") wind[k].units = v # loop for each data samples_per_ten_minutes = int(600*100) i, j = 0, samples_per_ten_minutes # for hr in range(24): # for mn in range(0, 60, 10): file_date = date+dt.timedelta(hours=hr, minutes=mn) print("wnd --> ", file_date) # load data wnd = ReadData(file_date).read("anemometro") # assign data to netctd variable for k, v in wnd.items(): if k not in "time": wind[k][i:j] = v else: wind["time"][i:j] = nc.date2num(v, global_time_units) # update counter i, j = j, j + samples_per_ten_minutes # }}} # write motion variables {{{ def write_motion_group(dataset, date): """Write variables and attributes associated to motion group.""" motion = dataset.createGroup(f"{hgrp}/motion") motion.createDimension("time", None) motion.description = "Measurements of Subsea MRU Ekinok2-M" motion.sampling_frequency = 100 motion.convention = "X positive towards north buoy, Y eastward and Z downward" # variable attributes units = { "time": global_time_units, "surge": "m/s^2", "sway": "m/s^2", "heave": "m/s^2", "dpitch_dt": "rad/s", "droll_dt": "rad/s", "dyaw_dt": "rad/s", "dvel_x": "m/s^2", "dvel_y": "m/s^2", "dvel_z": "m/s^2", "dang_x": "rad/s", "dang_y": "rad/s", "dang_z": "rad/s" } # create each variable for k, v in units.items(): motion.createVariable(k, "f8", "time") motion[k].units = v # loop for each data samples_per_ten_minutes = int(600*100) i, j = 0, samples_per_ten_minutes # for hr in range(24): # for mn in range(0, 60, 10): file_date = date+dt.timedelta(hours=hr, minutes=mn) print("mot --> ", file_date) # load data mot = ReadData(file_date).read("acelerometro") # assign data to netctd variable for k, v in mot.items(): if k not in "time": motion[k][i:j] = v else: motion["time"][i:j] = nc.date2num(v, global_time_units) # update counter i, j = j, j + samples_per_ten_minutes # }}} # list of writer functions {{{ def writers_list(): return (write_water_group, write_meteo_group, write_waves_group, write_wind_group, write_motion_group) # }}} # write netcdf for all data {{{ def write_netcdf(): """Write all raw data in a nice netCDF4 format.""" # global time units global_time_units = f"seconds since {next(dates())}" # netcdf filename ncfilename = f"{ReadData.basepath}/bomm.data.nc" with nc.Dataset(ncfilename, "w") as dataset: # loop for each date for date in dates(): # name of the group associated with each day hgrp = date.strftime("%Y%m%d") for func in writers_list(): func(dataset, date) print("-"*37 + "\n") # }}} # }}} # === Common useful functions === # {{{ # get index for specific date {{{ def get_index(date, fs, number_of_minutes=30): """Return group name and index for specific date.""" # group name hgrp = date.strftime("%Y%m%d") # number of samples N = int(fs * 24 * 3600) hour, minute = date.hour, date.minute # start and final index i = int(fs*hour*3600 + fs*minute*60) j = i + int(fs*number_of_minutes*60) return hgrp, (i, j) # }}} # create dictionary from motion package data {{{ def get_dictionary(group, date): """Construct motion dictionary resampled at specific sampling frequency. Args: group (obj): Group of netCDF4 variable for a specific day index (tuple): Indices corresponding to star and final analysis time. Returns: Dictionary containig all variables. """ # start and final indices fs = group.sampling_frequency hgrp, (i, j) = get_index(date, fs, number_of_minutes=30) dic = {} for k in group.variables.keys(): if k not in ["time"]: dic[k] = group[k][i:j] return dic # }}} # fancy nanmean without akward warning msg {{{ def nanmean(x): nans = np.isnan(x).nonzero()[0] if len(nans) == len(x): return np.nan else: return np.nanmean(x) # }}} # despinking function {{{ def simple_despike(x, value=1): x[abs(x) > value] = np.nan return x # }}} # }}} # === Motion correction functions === # {{{ # butterworth lowpass filter {{{ def butter_lowpass_filter(data, cutoff=2, fs=100, order=5): if cutoff is not None: b, a = signal.butter(order, cutoff/(0.5*fs), btype='low', analog=False) data_filtered = signal.filtfilt(b, a, data) return data_filtered else: return data # }}} # compute euler angles {{{ def euler_angles(mot, step=1): """Compute euler angles and smooth acceleromter signals.""" # remove nans for k, v in mot.items(): nans = np.isnan(v) if len(nans.nonzero()[0]) / len(v) < 0.1: mot[k][nans] = 0 else: raise Exception("More than 10% of invalid data") # compute pitch roll and yaw for k in ["pitch", "roll", "yaw"]: mot[k] = int_fft(mot[f"d{k}_dt"], 100, -1, 0.04) # surge = butter_lowpass_filter(mot["surge"])[::step] sway = butter_lowpass_filter(mot["sway"])[::step] heave = butter_lowpass_filter(mot["heave"])[::step] # pitch = butter_lowpass_filter(mot["pitch"])[::step] roll = butter_lowpass_filter(mot["roll"])[::step] yaw = butter_lowpass_filter(mot["yaw"])[::step] # dpitch_dt = butter_lowpass_filter(mot["dpitch_dt"])[::step] droll_dt = butter_lowpass_filter(mot["droll_dt"])[::step] dyaw_dt = butter_lowpass_filter(mot["dyaw_dt"])[::step] return surge, sway, heave, pitch, roll, yaw, dpitch_dt, droll_dt, dyaw_dt # }}} # integration in the frequency domain {{{ def fft_intdiff(signal, fs, order=-1, fcut=None): """Intergral or differentiation in frequency domain. This function performs an integration of a discrete time series in the frequency domain taking advantage of the Fourier transform properties. Depending of the argument order, this funcion also can be used to differentiate a time series. d^n u / ----- = IFFT{(iw)^n * FFT{u}} and | u dt = IFFT{FFT{u} / (iw)^n} dt^n / n Args: signal (array): Time series. fs (float): sampling frequency order (int): order of the integral or derivative * if order = 0 returns signal * if order > 0 returns n-order-derivative * if order < 0 returns n-order-integral fcut (float): cut-off frequency to filter low frequency noise in case of a an integral (order<0) and high frequency noise in case of a derivative (order>0). Returns: array: Integrated or derivated signal Note: Actually the filter is only making zeros the energy asociated to the frequencies lower (greater) than fcut when integrating (derivating). A most powerfull filter should be designed. """ nans = np.isnan(signal) if len(nans.nonzero()[0]) / len(signal) < 0.1: signal[nans] = 0 else: return signal * np.nan # if order == 0 do nothing if order == 0: return signal # TODO: check for nans if more than 10 percents # get frequency array N = len(signal) freqs = np.fft.fftfreq(N, 1/fs) # the first element of freqs array is zero, so we have # to discard it to avoid division by zero # the factor of integration is iw factor = 1j*2*np.pi*freqs[1:] # compute fft of the signal for the non-zero frequencies # and apply integration factor fft = np.zeros(len(freqs), 'complex') fft[1:] = np.fft.fft(signal)[1:] * factor**order # high pass filter for integrals if order < 0: if fcut is None: return np.fft.ifft(fft).real else: ix = abs(freqs) <= fcut fft[ix] = 0. # low pass filter for derivatives if order > 0: if fcut is None: return np.fft.ifft(fft).real else: ix = abs(freqs) >= fcut fft[ix] = 0. # returns real inverse transormed signal return np.fft.ifft(fft).real def diff_fft(signal, fs, order=-1, fcut=None): """diferentiation in the frequency domain: see `fft_intdiff`""" if order > 0: return fft_intdiff(signal, fs, order, fcut) else: raise ValueError("Order must be a positive integer") def int_fft(signal, fs, order=-1, fcut=None): """integration in the frequency domain: see `fft_intdiff`""" if order < 0: return fft_intdiff(signal, fs, order, fcut) else: raise ValueError("Order must be a negative integer") # --- }}} # velocity_correction {{{ def velocity_correction(u, v, w, mot, L=(0,0,0), fs=100, fcut=0.04): """Velocity correction. This function applies the correction of the wind speed measured by a sonic anemometer due to the buoy inertial movements The equation to perfom such correction is given by / U = T U_obs + Om x T L + T | a dt / ---v--- -----v----- -----v----- U_trans U_rot U_buoy where T is a rotation matrix given by: | cosp*cosy sinp*sinr*cosy-cosr*siny siny*sinr+sinp*cosr*cosy | T = | cosp*siny cosr*cosy+sinr*sinp*siny -sinr*cosy+cosr*siny*sinp | | -sinp cosp*sinr cosp*cosr | in which, `p` is pitch (theta), `r` is roll (phi) and `y` is yaw (psi) In the same way, the matrix of angular rate of changes is given by: | - dpdt siny + drdt cosp cosy | Omega = | dpdt cosy + drdt cosp siny | | dydt - drdt sinp | Args: u, v, w (arrays): Contains the three components of velocity. motion (dict): Dictionary containing time series of: * accelerations: surge, sway, heave * inclination rates: dpitch_dt, droll_dt, dyaw_dt * euler angles: pitch, roll, yaw L (list or tuple): Three elements, containing the relative distance of the wavestaff to the accelerometer package. fs (float): Sampling frequency of the time series fcut (float): Cut-off frequency for the low pass filter after integration of the accelerations Returns: u_real, v_real, w_real: Tuple with corrected velocity components. References: * Anctil Donelan Drennan Graber 1994, JAOT 11, 1144-1150 * Drennan Donelan Madsen Katsaros Terray Flagg 1994, JAOT 11, 1109-1116 """ # detrend signal d = lambda x: x - np.nanmean(x) # get main variables u_obs, v_obs, w_obs = u.copy(), v.copy(), w.copy() (surge, sway, heave, pitch, roll, yaw, dpitch_dt, droll_dt, dyaw_dt) = euler_angles(mot, step=1) # compute sines and cosines for each angle cp, sp = np.cos(pitch), np.sin(pitch) cr, sr = np.cos(roll), np.sin(roll) # myaw = np.arctan2(np.nanmean(np.sin(yaw)), np.nanmean(np.cos(yaw))) cy, sy = np.cos(yaw-myaw), np.sin(yaw-myaw) # compute observed velocities into earth reference frame u_trans = u_obs*cp*cy + v_obs*(sp*sr*cy - cr*sy) + w_obs*(sy*sr + sp*cr*cy) v_trans = u_obs*cp*sy + v_obs*(cr*cy + sr*sp*sy) + w_obs*(-sr*cy + cr*sy*sp) w_trans = -u_obs*sp + v_obs*cp*sr + w_obs*cp*cr # compute buoy velocity components from accelerations g = 9.8 vel_x = int_fft(surge + g*sp, fs, -1, fcut) vel_y = int_fft(sway - g*sr*cp, fs, -1, fcut) vel_z = int_fft(heave - g*cp*cr, fs, -1, fcut) # compute transformed velocities into earth reference frame u_buoy = vel_x*cp*cy + vel_y*(sp*sr*cy - cr*sy) + vel_z*(sy*sr + sp*cr*cy) v_buoy = vel_x*cp*sy + vel_y*(cr*cy + sr*sp*sy) + vel_z*(-sr*cy + cr*sy*sp) w_buoy = -vel_x*sp + vel_y*cp*sr + vel_z*cp*cr # compute transformed position of the anemometer Lx, Ly, Lz = L Lx_e = Lx*cp*cy + Ly*(sp*sr*cy - cr*sy) + Lz*(sy*sr + sp*cr*cy) Ly_e = Lx*cp*sy + Ly*(cr*cy + sr*sp*sy) + Lz*(-sr*cy + cr*sy*sp) Lz_e = -Lx*sp + Ly*cp*sr + Lz*cp*cr # compute rotation matrix components Om_x = -dpitch_dt * sy + droll_dt * cp * cy Om_y = dpitch_dt * cy + droll_dt * cp * sy Om_z = dyaw_dt - droll_dt * sp # compute the rotated values of the velocity components u_rot = (Om_y*Lz_e - Om_z*Ly_e) v_rot = -(Om_x*Lz_e - Om_z*Lx_e) w_rot = (Om_x*Ly_e - Om_y*Lx_e) # compute real surface elevation u_real = u_trans + u_rot + u_buoy v_real = v_trans + v_rot + v_buoy w_real = w_trans + w_rot + w_buoy return u_real, v_real, w_real # --- }}} # position_correction {{{ def position_correction(x, y, z, mot, fs=20, fcut=0.04): """Correcion of the surfave elevation. This function applies the correction of the surface elevation measured by the wavestaffs due to the buoy inertial movements. The equation to perfom such correction is given by / // X = T Xo + | Om x T Xo dt + T || a dt dt / // ---v--- -------v------- -----v----- x_trans x_rot x_buoy where T is a rotation matrix given by: | cosp*cosy sinp*sinr*cosy-cosr*siny siny*sinr+sinp*cosr*cosy | T = | cosp*siny cosr*cosy+sinr*sinp*siny -sinr*cosy+cosr*siny*sinp | | -sinp cosp*sinr cosp*cosr | in which, `p` is pitch (theta), `r` is roll (phi) and `y` is yaw (psi) In the same way, the matrix of angular rate of changes is given by: | - dpdt siny + drdt cosp cosy | Omega = | dpdt cosy + drdt cosp siny | | dydt - drdt sinp | Arguments: x, y, z (float): Northward, westward and upward coordinates of each wavestaff. motion (dict): Containing time series of: * accelerations: surge, sway, heave * inclination rates: dpitch_dt, droll_dt, dyaw_dt * euler angles: pitch, roll, yaw fs (float): Sampling frequency of the time series. fcut (float): Cut-off frequency for the low pass filter after integration of the accelerations. Returns: x_real, y_real, z_real: numpy array with the corrected surface elev. References: * Anctil Donelan Drennan Graber 1994, JAOT 11, 1144-1150 * Drennan Donelan Madsen Katsaros Terray Flagg 1994, JAOT 11, 1109-1116 """ # compute pitch roll and yaw (surge, sway, heave, pitch, roll, yaw, dpitch_dt, droll_dt, dyaw_dt) = euler_angles(mot, step=5) # compute sines and cosines cp, sp = np.cos(pitch), np.sin(pitch) cr, sr = np.cos(roll), np.sin(roll) cy, sy = np.cos(yaw), np.sin(yaw) # compute surface elevation transformed into the inertial frame x_trans = x*cp*cy + y*(sp*sr*cy - cr*sy) + z*(sy*sr + sp*cr*cy) y_trans = x*cp*sy + y*(cr*cy + sr*sp*sy) + z*(-sr*cy + cr*sy*sp) z_trans = -x*sp + y*cp*sr + z*cp*cr # buoy movements g = 9.8 pos_x = int_fft(surge + g*sp, fs, -2, fcut) pos_y = int_fft(sway - g*sr*cp, fs, -2, fcut) pos_z = int_fft(heave - g*cp*cr, fs, -2, fcut) # compute transformed positions into earth reference frame x_buoy = pos_x*cp*cy + pos_y*(sp*sr*cy - cr*sy) + pos_z*(sy*sr + sp*cr*cy) y_buoy = pos_x*cp*sy + pos_y*(cr*cy + sr*sp*sy) + pos_z*(-sr*cy + cr*sy*sp) z_buoy = -pos_x*sp + pos_y*cp*sr + pos_z*cp*cr # compute transformed position x_e = x*cp*cy + y*(sp*sr*cy - cr*sy) + z*(sy*sr + sp*cr*cy) y_e = x*cp*sy + y*(cr*cy + sr*sp*sy) + z*(-sr*cy + cr*sy*sp) z_e = -x*sp + y*cp*sr + z*cp*cr # compute rotation matrix components Om_x = -dpitch_dt * sy + droll_dt * cp * cy Om_y = dpitch_dt * cy + droll_dt * cp * sy Om_z = dyaw_dt - droll_dt * sp # compute the rotated values of the postion vector x_rot = int_fft((Om_y*z_e - Om_z*y_e), fs, -1, fcut) y_rot = int_fft(-(Om_x*z_e - Om_z*x_e), fs, -1, fcut) z_rot = int_fft((Om_x*y_e - Om_y*x_e), fs, -1, fcut) # compute real surface elevation x_real = x_trans + x_rot + x_buoy y_real = y_trans + y_rot + y_buoy z_real = z_trans + z_rot + z_buoy return x_real, y_real, z_real # --- }}} # }}} # === Wavestaff funcions === # {{{ # wavestaff correction {{{ def wavestaff_correction(wav, mot, Lx, Ly, Lz): """This function returns the corrected data of the wstaffs. Args: wav (dic): Dictionay with the measurements of each wavestaff. mot (dict): Dictionary with the motion packages variables Lx, Ly, Lz (array): Position of the wavestaffs Returns: (dic): Dictionary with the corrected wavestaff data. """ # compute time variation of the postion ntime = wav["ws1"].shape[0] nstaff = 6 # xx = np.zeros((ntime, nstaff)) yy = np.zeros((ntime, nstaff)) zz = np.zeros((ntime, nstaff)) # corrected = {} for i in range(nstaff): xx[:,i], yy[:,i], zz[:,i] = position_correction( Lx[i], Ly[i], Lz[i] + wav[f"ws{i+1:d}"], mot) corrected[f"ws{i+1:d}"] = zz[:,i] - np.nanmean(zz[:,i]) # return corrected # }}} # frequency spectrum {{{ def frequency_spectrum(wav, fft_params=None): """Returns the waves spectrum using Welch method.""" # length of data ntime = len(wav["ws1"]) nstaff = len(wav) # check for NANs for k, v in wav.items(): nans = np.isnan(v) if len(nans.nonzero()[0]) / len(v) < 0.1: wav[k][nans] = 0 else: raise Exception("More than 10% of invalid data") # fft parameters if fft_params is None: fft_params = { "fs": 20, # <- sampling frquency "nperseg": 3600, # <- lenght of each segment "noverlap": 1800, # <- points to overlap between segments "window": 'hann', # <- tapering window "detrend": 'linear' # <- detrend data linearly } # trim boundary of time series # NOTE: I think it is not necessary # i = int(0.5 * (ntime - 2**np.floor(np.log2(ntime)))) # compute periodiogram for each wire Pxx = np.zeros((int(fft_params["nperseg"]/2)+1, nstaff)) for j in range(nstaff): frqs, Pxx[:,j] = signal.welch(wav[f"ws{j+1:d}"], **fft_params) # returns frequency and averaged power density without first value return frqs[1:], np.nanmean(Pxx[:,1:], axis=1)[1:] # }}} # }}} # === Sonic anemometer functions === # {{{ # wind data rotation {{{ def wind_rotation(wnd, theta=np.radians(30)): """This function returns the rotated velocity components.""" U_unc = wnd["U"] * 1.0 V_unc = wnd["V"] * 1.0 U_aligned = U_unc*np.cos(theta) + V_unc*np.sin(theta) V_aligned = U_unc*np.sin(theta) - V_unc*np.cos(theta) wnd["U_rot"] = U_unc wnd["V_rot"] = V_unc wnd["U"] = U_aligned wnd["V"] = V_aligned # }}} # wind data correction {{{ def wind_correction(wnd, mot, L): """This function returns the corrected velocity components. Args: wnd (dic): Dictionary with sonic anemometer data mot (dic): Dictionary with motion sensor data L (array): Three elements array with location of sonic anemometer respect to motion sensors. """ # get data U, V, W = wnd["U"], wnd["V"], wnd["W"] # apply correction using the proper function U_real, V_real, W_real = velocity_correction(U, V, W, mot, L) return U_real, V_real, W_real # }}} # eddy correlation method {{{ def eddy_correlation_flux(U, V, W, T): """Computes momentum flux from corrected velocity components. Args: U, V, W, T (array): Array with sonic anemometer variables. Returns: tuple: x and y momentum flux and latent heat flux. References: * https://www.eol.ucar.edu/content/wind-direction-quick-reference """ # align with max variability axis (average V = 0) theta = np.arctan2(np.nanmean(V), np.nanmean(U)) #<- from U to V counterclockwise U_stream = U*np.cos(theta) + V*np.sin(theta) V_stream = -U*np.sin(theta) + V*np.cos(theta) # align with the flow to do mean W equals zero phi = np.arctan2(np.nanmean(W), np.nanmean(U_stream)) #<- from U to W counterclockwise U_proj = U_stream*np.cos(phi) + W*np.sin(phi) V_proj = V_stream.copy() W_proj = -U_stream*np.sin(phi) + W*np.cos(phi) # compute turbulent fluxes d = lambda x: signal.detrend(x, type="linear") u, v, w, T = d(U_proj), d(V_proj), d(W_proj), d(T) uw, vw, wT = np.mean(u*w), np.mean(v*w), np.mean(w*T) return uw, vw, wT # }}} # }}} if __name__ == "__main__": pass # === end of file ===
dspelaez/tools
tools/bomm.py
Python
gpl-3.0
35,771
[ "NetCDF" ]
533e58b1cc4ffc6c3a56583ea1a8848e854eb2b0c2ff30aef19eaf161d100d20
# -*- coding: utf-8 -*- """ Sahana Eden Incident Reporting Model @copyright: 2009-2014 (c) Sahana Software Foundation @license: MIT Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ __all__ = ("S3IRSModel", "S3IRSResponseModel", "irs_rheader" ) try: import json # try stdlib (Python 2.6) except ImportError: try: import simplejson as json # try external module except: import gluon.contrib.simplejson as json # fallback to pure-Python module from gluon import * from gluon.storage import Storage from ..s3 import * from s3layouts import S3AddResourceLink # Compact JSON encoding SEPARATORS = (",", ":") # ============================================================================= class S3IRSModel(S3Model): names = ("irs_icategory", "irs_ireport", "irs_ireport_person", "irs_ireport_id" ) def model(self): T = current.T db = current.db s3 = current.response.s3 settings = current.deployment_settings # Shortcuts add_components = self.add_components configure = self.configure crud_strings = s3.crud_strings define_table = self.define_table set_method = self.set_method super_link = self.super_link # --------------------------------------------------------------------- # List of Incident Categories # The keys are based on the Canadian ems.incident hierarchy, with a few extra general versions added to 'other' # The values are meant for end-users, so can be customised as-required # NB It is important that the meaning of these entries is not changed as otherwise this hurts our ability to do synchronisation # Entries can be hidden from user view in the controller. # Additional sets of 'translations' can be added to the tuples. irs_incident_type_opts = { "animalHealth.animalDieOff": T("Animal Die Off"), "animalHealth.animalFeed": T("Animal Feed"), "aviation.aircraftCrash": T("Aircraft Crash"), "aviation.aircraftHijacking": T("Aircraft Hijacking"), "aviation.airportClosure": T("Airport Closure"), "aviation.airspaceClosure": T("Airspace Closure"), "aviation.noticeToAirmen": T("Notice to Airmen"), "aviation.spaceDebris": T("Space Debris"), "civil.demonstrations": T("Demonstrations"), "civil.dignitaryVisit": T("Dignitary Visit"), "civil.displacedPopulations": T("Displaced Populations"), "civil.emergency": T("Civil Emergency"), "civil.looting": T("Looting"), "civil.publicEvent": T("Public Event"), "civil.riot": T("Riot"), "civil.volunteerRequest": T("Volunteer Request"), "crime": T("Crime"), "crime.bomb": T("Bomb"), "crime.bombExplosion": T("Bomb Explosion"), "crime.bombThreat": T("Bomb Threat"), "crime.dangerousPerson": T("Dangerous Person"), "crime.drugs": T("Drugs"), "crime.homeCrime": T("Home Crime"), "crime.illegalImmigrant": T("Illegal Immigrant"), "crime.industrialCrime": T("Industrial Crime"), "crime.poisoning": T("Poisoning"), "crime.retailCrime": T("Retail Crime"), "crime.shooting": T("Shooting"), "crime.stowaway": T("Stowaway"), "crime.terrorism": T("Terrorism"), "crime.vehicleCrime": T("Vehicle Crime"), "fire": T("Fire"), "fire.forestFire": T("Forest Fire"), "fire.hotSpot": T("Hot Spot"), "fire.industryFire": T("Industry Fire"), "fire.smoke": T("Smoke"), "fire.urbanFire": T("Urban Fire"), "fire.wildFire": T("Wild Fire"), "flood": T("Flood"), "flood.damOverflow": T("Dam Overflow"), "flood.flashFlood": T("Flash Flood"), "flood.highWater": T("High Water"), "flood.overlandFlowFlood": T("Overland Flow Flood"), "flood.tsunami": T("Tsunami"), "geophysical.avalanche": T("Avalanche"), "geophysical.earthquake": T("Earthquake"), "geophysical.lahar": T("Lahar"), "geophysical.landslide": T("Landslide"), "geophysical.magneticStorm": T("Magnetic Storm"), "geophysical.meteorite": T("Meteorite"), "geophysical.pyroclasticFlow": T("Pyroclastic Flow"), "geophysical.pyroclasticSurge": T("Pyroclastic Surge"), "geophysical.volcanicAshCloud": T("Volcanic Ash Cloud"), "geophysical.volcanicEvent": T("Volcanic Event"), "hazardousMaterial": T("Hazardous Material"), "hazardousMaterial.biologicalHazard": T("Biological Hazard"), "hazardousMaterial.chemicalHazard": T("Chemical Hazard"), "hazardousMaterial.explosiveHazard": T("Explosive Hazard"), "hazardousMaterial.fallingObjectHazard": T("Falling Object Hazard"), "hazardousMaterial.infectiousDisease": T("Infectious Disease (Hazardous Material)"), "hazardousMaterial.poisonousGas": T("Poisonous Gas"), "hazardousMaterial.radiologicalHazard": T("Radiological Hazard"), "health.infectiousDisease": T("Infectious Disease"), "health.infestation": T("Infestation"), "ice.iceberg": T("Iceberg"), "ice.icePressure": T("Ice Pressure"), "ice.rapidCloseLead": T("Rapid Close Lead"), "ice.specialIce": T("Special Ice"), "marine.marineSecurity": T("Marine Security"), "marine.nauticalAccident": T("Nautical Accident"), "marine.nauticalHijacking": T("Nautical Hijacking"), "marine.portClosure": T("Port Closure"), "marine.specialMarine": T("Special Marine"), "meteorological.blizzard": T("Blizzard"), "meteorological.blowingSnow": T("Blowing Snow"), "meteorological.drought": T("Drought"), "meteorological.dustStorm": T("Dust Storm"), "meteorological.fog": T("Fog"), "meteorological.freezingDrizzle": T("Freezing Drizzle"), "meteorological.freezingRain": T("Freezing Rain"), "meteorological.freezingSpray": T("Freezing Spray"), "meteorological.hail": T("Hail"), "meteorological.hurricane": T("Hurricane"), "meteorological.rainFall": T("Rain Fall"), "meteorological.snowFall": T("Snow Fall"), "meteorological.snowSquall": T("Snow Squall"), "meteorological.squall": T("Squall"), "meteorological.stormSurge": T("Storm Surge"), "meteorological.thunderstorm": T("Thunderstorm"), "meteorological.tornado": T("Tornado"), "meteorological.tropicalStorm": T("Tropical Storm"), "meteorological.waterspout": T("Waterspout"), "meteorological.winterStorm": T("Winter Storm"), "missingPerson": T("Missing Person"), "missingPerson.amberAlert": T("Child Abduction Emergency"), # http://en.wikipedia.org/wiki/Amber_Alert "missingPerson.missingVulnerablePerson": T("Missing Vulnerable Person"), "missingPerson.silver": T("Missing Senior Citizen"), # http://en.wikipedia.org/wiki/Silver_Alert "publicService.emergencySupportFacility": T("Emergency Support Facility"), "publicService.emergencySupportService": T("Emergency Support Service"), "publicService.schoolClosure": T("School Closure"), "publicService.schoolLockdown": T("School Lockdown"), "publicService.serviceOrFacility": T("Service or Facility"), "publicService.transit": T("Transit"), "railway.railwayAccident": T("Railway Accident"), "railway.railwayHijacking": T("Railway Hijacking"), "roadway.bridgeClosure": T("Bridge Closed"), "roadway.hazardousRoadConditions": T("Hazardous Road Conditions"), "roadway.roadwayAccident": T("Road Accident"), "roadway.roadwayClosure": T("Road Closed"), "roadway.roadwayDelay": T("Road Delay"), "roadway.roadwayHijacking": T("Road Hijacking"), "roadway.roadwayUsageCondition": T("Road Usage Condition"), "roadway.trafficReport": T("Traffic Report"), "temperature.arcticOutflow": T("Arctic Outflow"), "temperature.coldWave": T("Cold Wave"), "temperature.flashFreeze": T("Flash Freeze"), "temperature.frost": T("Frost"), "temperature.heatAndHumidity": T("Heat and Humidity"), "temperature.heatWave": T("Heat Wave"), "temperature.windChill": T("Wind Chill"), "wind.galeWind": T("Gale Wind"), "wind.hurricaneForceWind": T("Hurricane Force Wind"), "wind.stormForceWind": T("Storm Force Wind"), "wind.strongWind": T("Strong Wind"), "other.buildingCollapsed": T("Building Collapsed"), "other.peopleTrapped": T("People Trapped"), "other.powerFailure": T("Power Failure"), } # This Table defines which Categories are visible to end-users tablename = "irs_icategory" define_table(tablename, Field("code", label = T("Category"), requires = IS_IN_SET_LAZY(lambda: \ sort_dict_by_values(irs_incident_type_opts)), represent = lambda opt: \ irs_incident_type_opts.get(opt, opt)), *s3_meta_fields()) configure(tablename, list_fields = ["code"], onvalidation = self.irs_icategory_onvalidation, ) # --------------------------------------------------------------------- # Reports # This is a report of an Incident # # Incident Reports can be linked to Incidents through the event_incident_report table # # @ToDo: If not using the Events module, we could have a 'lead incident' to track duplicates? # # Porto codes #irs_incident_type_opts = { # 1100:T("Fire"), # 6102:T("Hazmat"), # 8201:T("Rescue") #} tablename = "irs_ireport" define_table(tablename, super_link("sit_id", "sit_situation"), super_link("doc_id", "doc_entity"), Field("name", label = T("Short Description"), requires = IS_NOT_EMPTY()), Field("message", "text", label = T("Message"), represent = lambda text: \ s3_truncate(text, length=48, nice=True)), Field("category", label = T("Category"), # The full set available to Admins & Imports/Exports # (users use the subset by over-riding this in the Controller) requires = IS_EMPTY_OR(IS_IN_SET_LAZY(lambda: \ sort_dict_by_values(irs_incident_type_opts))), # Use this instead if a simpler set of Options required #requires = IS_EMPTY_OR(IS_IN_SET(irs_incident_type_opts)), represent = lambda opt: \ irs_incident_type_opts.get(opt, opt)), self.hrm_human_resource_id( #readable=False, #writable=False, label = T("Reported By (Staff)") ), # Plain text field in case non-staff & don't want to clutter the PR Field("person", #readable = False, #writable = False, label = T("Reported By (Not Staff)"), #comment = (T("At/Visited Location (not virtual)")) ), Field("contact", readable = False, writable = False, label = T("Contact Details")), s3_datetime("datetime", label = T("Date/Time of Alert"), empty=False, default="now", future=0, ), s3_datetime("expiry", label = T("Expiry Date/Time"), past=0, ), self.gis_location_id(), # Very basic Impact Assessment # @ToDo: Use Stats_Impact component instead Field("affected", "integer", label=T("Number of People Affected"), represent = lambda val: val or T("unknown"), ), Field("dead", "integer", label=T("Number of People Dead"), represent = lambda val: val or T("unknown"), ), Field("injured", "integer", label=T("Number of People Injured"), represent = lambda val: val or T("unknown"), ), # Probably too much to try & capture #Field("missing", "integer", # label=T("Number of People Missing")), #Field("displaced", "integer", # label=T("Number of People Displaced")), Field("verified", "boolean", # Ushahidi-compatibility # We don't want these visible in Create forms # (we override in Update forms in controller) readable = False, writable = False, label = T("Verified?"), represent = lambda verified: \ (T("No"), T("Yes"))[verified == True] ), # @ToDo: Move this to Events? # Then add component to list_fields s3_datetime("dispatch", label = T("Date/Time of Dispatch"), future=0, # We don't want these visible in Create forms # (we override in Update forms in controller) readable = False, writable = False, ), Field("closed", "boolean", # We don't want these visible in Create forms # (we override in Update forms in controller) default = False, readable = False, writable = False, label = T("Closed?"), represent = lambda closed: \ (T("No"), T("Yes"))[closed == True] ), s3_comments(), *s3_meta_fields()) # CRUD strings ADD_INC_REPORT = T("Create Incident Report") crud_strings[tablename] = Storage( label_create = ADD_INC_REPORT, title_display = T("Incident Report Details"), title_list = T("Incident Reports"), title_update = T("Edit Incident Report"), title_upload = T("Import Incident Reports"), title_map = T("Map of Incident Reports"), label_list_button = T("List Incident Reports"), label_delete_button = T("Delete Incident Report"), msg_record_created = T("Incident Report added"), msg_record_modified = T("Incident Report updated"), msg_record_deleted = T("Incident Report deleted"), msg_list_empty = T("No Incident Reports currently registered")) # Which levels of Hierarchy are we using? levels = current.gis.get_relevant_hierarchy_levels() filter_widgets = [ S3TextFilter(["name", "message", "comments", ], label=T("Description"), comment = T("You can search by description. You may use % as wildcard. Press 'Search' without input to list all incidents."), _class="filter-search", ), S3LocationFilter("location_id", levels = levels, #hidden = True, ), S3OptionsFilter("category", #hidden = True, ), S3DateFilter("datetime", label = T("Date"), hide_time = True, #hidden = True, ), ] report_fields = ["category", "datetime", ] for level in levels: report_fields.append("location_id$%s" % level) # Resource Configuration configure(tablename, filter_widgets = filter_widgets, list_fields = ["id", "name", "category", "datetime", "location_id", #"organisation_id", "affected", "dead", "injured", "verified", "message", ], report_options = Storage(rows = report_fields, cols = report_fields, fact = [(T("Number of Incidents"), "count(id)"), (T("Total Affected"), "sum(affected)"), (T("Total Dead"), "sum(dead)"), (T("Total Injured"), "sum(injured)"), ], defaults = dict(rows = "location_id$%s" % levels[0], # Highest-level of hierarchy cols = "category", fact = "count(id)", totals = True, ) ), super_entity = ("sit_situation", "doc_entity"), ) # Components if settings.get_irs_vehicle(): # @ToDo: This workflow requires more work hr_link_table = "irs_ireport_vehicle_human_resource" else: hr_link_table = "irs_ireport_human_resource" add_components(tablename, # Tasks project_task={"link": "project_task_ireport", "joinby": "ireport_id", "key": "task_id", "actuate": "replace", "autocomplete": "name", "autodelete": False, }, # Vehicles asset_asset={"link": "irs_ireport_vehicle", "joinby": "ireport_id", "key": "asset_id", "name": "vehicle", # Dispatcher doesn't need to Add/Edit records, just Link "actuate": "link", "autocomplete": "name", "autodelete": False, }, # Human Resources hrm_human_resource={"link": hr_link_table, "joinby": "ireport_id", "key": "human_resource_id", # Dispatcher doesn't need to Add/Edit HRs, just Link "actuate": "hide", "autocomplete": "name", "autodelete": False, }, # Affected Persons pr_person={"link": "irs_ireport_person", "joinby": "ireport_id", "key": "person_id", "actuate": "link", #"actuate": "embed", #"widget": S3AddPersonWidget2(), "autodelete": False, }, ) ireport_id = S3ReusableField("ireport_id", "reference %s" % tablename, requires = IS_EMPTY_OR( IS_ONE_OF(db, "irs_ireport.id", self.irs_ireport_represent)), represent = self.irs_ireport_represent, label = T("Incident"), ondelete = "CASCADE") # Custom Methods set_method("irs", "ireport", method = "dispatch", action=self.irs_dispatch) set_method("irs", "ireport", method = "timeline", action = self.irs_timeline) set_method("irs", "ireport", method = "ushahidi", action = self.irs_ushahidi_import) if settings.has_module("fire"): create_next = URL(args=["[id]", "human_resource"]) else: create_next = URL(args=["[id]", "image"]) configure("irs_ireport", create_next = create_next, create_onaccept = self.ireport_onaccept, update_next = URL(args=["[id]", "update"]) ) # ----------------------------------------------------------- # Affected Persons tablename = "irs_ireport_person" define_table(tablename, ireport_id(), self.pr_person_id(), s3_comments(), *s3_meta_fields()) # --------------------------------------------------------------------- # Return model-global names to response.s3 # return dict(irs_ireport_id = ireport_id, irs_incident_type_opts = irs_incident_type_opts, ) # ------------------------------------------------------------------------- def defaults(self): """ Safe defaults for model-global names in case module is disabled - used by events module & legacy assess & impact modules """ ireport_id = S3ReusableField("ireport_id", "integer", readable=False, writable=False) return Storage(irs_ireport_id = ireport_id) # ------------------------------------------------------------------------- @staticmethod def irs_icategory_onvalidation(form): """ Incident Category Validation: Prevent Duplicates Done here rather than in .requires to maintain the dropdown. """ db = current.db table = db.irs_icategory category, error = IS_NOT_ONE_OF(db, "irs_icategory.code")(form.vars.code) if error: form.errors.code = error return False # ------------------------------------------------------------------------- @staticmethod def irs_ireport_represent(id, row=None): """ Represent an Incident Report via it's name """ if row: return row.name elif not id: return current.messages["NONE"] db = current.db table = db.irs_ireport r = db(table.id == id).select(table.name, limitby = (0, 1)).first() try: return r.name except: return current.messages.UNKNOWN_OPT # ------------------------------------------------------------------------- @staticmethod def ireport_onaccept(form): """ Assign the appropriate vehicle & on-shift team to the incident @ToDo: Specialist teams @ToDo: Make more generic (currently Porto-specific) """ settings = current.deployment_settings if settings.has_module("fire") and settings.has_module("vehicle"): pass else: # Not supported! return db = current.db s3db = current.s3db vars = form.vars ireport = vars.id category = vars.category if category == "1100": # Fire types = ["VUCI", "ABSC"] elif category == "6102": # Hazmat types = ["VUCI", "VCOT"] elif category == "8201": # Rescue types = ["VLCI", "ABSC"] else: types = ["VLCI"] # 1st unassigned vehicle of the matching type # @ToDo: Filter by Org/Base # @ToDo: Filter by those which are under repair (asset_log) table = s3db.irs_ireport_vehicle stable = s3db.org_site atable = s3db.asset_asset vtable = s3db.vehicle_vehicle ftable = s3db.fire_station fvtable = s3db.fire_station_vehicle for type in types: query = (atable.type == s3db.asset_types["VEHICLE"]) & \ (vtable.type == type) & \ (vtable.asset_id == atable.id) & \ (atable.deleted == False) & \ ((table.id == None) | \ (table.closed == True) | \ (table.deleted == True)) left = table.on(atable.id == table.asset_id) vehicle = db(query).select(atable.id, left=left, limitby=(0, 1)).first() if vehicle: vehicle = vehicle.id query = (vtable.asset_id == vehicle) & \ (fvtable.vehicle_id == vtable.id) & \ (ftable.id == fvtable.station_id) & \ (stable.id == ftable.site_id) site = db(query).select(stable.id, limitby=(0, 1)).first() if site: site = site.id table.insert(ireport_id=ireport, asset_id=vehicle, site_id=site) if settings.has_module("hrm"): # Assign 1st 5 human resources on-shift # @ToDo: We shouldn't assign people to vehicles automatically - this is done as people are ready # - instead we should simply assign people to the incident & then use a drag'n'drop interface to link people to vehicles # @ToDo: Filter by Base table = s3db.irs_ireport_vehicle_human_resource htable = s3db.hrm_human_resource on_shift = s3db.fire_staff_on_duty() query = on_shift & \ ((table.id == None) | \ (table.closed == True) | \ (table.deleted == True)) left = table.on(htable.id == table.human_resource_id) people = db(query).select(htable.id, left=left, limitby=(0, 5)) # @ToDo: Find Ranking person to be incident commander leader = people.first() if leader: leader = leader.id for person in people: if person.id == leader.id: table.insert(ireport_id=ireport, asset_id=vehicle, human_resource_id=person.id, incident_commander=True) else: table.insert(ireport_id=ireport, asset_id=vehicle, human_resource_id=person.id) # ------------------------------------------------------------------------- @staticmethod def irs_dispatch(r, **attr): """ Send a Dispatch notice from an Incident Report - this will be formatted as an OpenGeoSMS """ if r.representation == "html" and \ r.name == "ireport" and r.id and not r.component: T = current.T msg = current.msg record = r.record id = record.id contact = "" if record.contact: contact = "\n%s: %s" (T("Contact"), record.contact) message = "" if record.message: message = "\n%s" % record.message text = "SI#%s\n%s%s%s" % (id, record.name, contact, message) text += "\nSend help to see how to respond!" # Encode the message as an OpenGeoSMS message = msg.prepare_opengeosms(record.location_id, code="ST", map="google", text=text) # URL to redirect to after message sent url = URL(c="irs", f="ireport", args=r.id) # Create the form opts = dict( type="SMS", # @ToDo: deployment_setting subject = T("Deployment Request"), message = message, url = url, #formid = r.id ) # Pre-populate the recipients list if we can # @ToDo: Check that we have valid contact details # - slower, but useful to fail early if we need to s3db = current.s3db if current.deployment_settings.get_irs_vehicle(): # @ToDo: This workflow requires more work # - no ic defined yet in this case table = s3db.irs_ireport_vehicle_human_resource else: table = s3db.irs_ireport_human_resource htable = s3db.hrm_human_resource ptable = s3db.pr_person query = (table.ireport_id == id) & \ (table.deleted == False) & \ (table.human_resource_id == htable.id) & \ (htable.person_id == ptable.id) recipients = current.db(query).select(table.incident_commander, ptable.pe_id) if not recipients: # Provide an Autocomplete the select the person to send the notice to opts["recipient_type"] = "pr_person" elif len(recipients) == 1: # Send to this person opts["recipient"] = recipients.first()["pr_person"].pe_id else: # Send to the Incident Commander ic = False for row in recipients: if row["irs_ireport_human_resource"].incident_commander == True: opts["recipient"] = row["pr_person"].pe_id ic = True break if not ic: # Provide an Autocomplete the select the person to send the notice to opts["recipient_type"] = "pr_person" output = msg.compose(**opts) # Maintain RHeader for consistency if attr.get("rheader"): rheader = attr["rheader"](r) if rheader: output["rheader"] = rheader output["title"] = T("Send Dispatch Update") current.response.view = "msg/compose.html" return output else: raise HTTP(501, current.ERROR.BAD_METHOD) # ------------------------------------------------------------------------- @staticmethod def irs_timeline(r, **attr): """ Display the Incidents on a Simile Timeline http://www.simile-widgets.org/wiki/Reference_Documentation_for_Timeline @ToDo: Play button http://www.simile-widgets.org/wiki/Timeline_Moving_the_Timeline_via_Javascript """ if r.representation == "html" and r.name == "ireport": T = current.T db = current.db s3db = current.s3db request = current.request response = current.response s3 = response.s3 itable = s3db.doc_image dtable = s3db.doc_document # Add core Simile Code s3.scripts.append("/%s/static/scripts/simile/timeline/timeline-api.js" % request.application) # Add our control script if s3.debug: s3.scripts.append("/%s/static/scripts/S3/s3.timeline.js" % request.application) else: s3.scripts.append("/%s/static/scripts/S3/s3.timeline.min.js" % request.application) # Add our data # @ToDo: Make this the initial data & then collect extra via REST with a stylesheet # add in JS using S3.timeline.eventSource.addMany(events) where events is a [] if r.record: # Single record rows = [r.record] else: # Multiple records # @ToDo: Load all records & sort to closest in time # http://stackoverflow.com/questions/7327689/how-to-generate-a-sequence-of-future-datetimes-in-python-and-determine-nearest-d r.resource.load(limit=2000) rows = r.resource._rows data = {"dateTimeFormat": "iso8601", } now = request.utcnow tl_start = tl_end = now events = [] for row in rows: # Dates start = row.datetime or "" if start: if start < tl_start: tl_start = start if start > tl_end: tl_end = start start = start.isoformat() end = row.expiry or "" if end: if end > tl_end: tl_end = end end = end.isoformat() # Image # Just grab the first one for now query = (itable.deleted == False) & \ (itable.doc_id == row.doc_id) image = db(query).select(itable.url, limitby=(0, 1)).first() if image: image = image.url or "" # URL link = URL(args=[row.id]) events.append({"start": start, "end": end, "title": row.name, "caption": row.message or "", "description": row.message or "", "image": image or "", "link": link or "", # @ToDo: Colour based on Category (More generically: Resource or Resource Type) #"color" : "blue', }) data["events"] = events data = json.dumps(data, separators=SEPARATORS) code = "".join(( '''S3.timeline.data=''', data, ''' S3.timeline.tl_start="''', tl_start.isoformat(), '''" S3.timeline.tl_end="''', tl_end.isoformat(), '''" S3.timeline.now="''', now.isoformat(), '''" ''')) # Control our code in static/scripts/S3/s3.timeline.js s3.js_global.append(code) # Create the DIV item = DIV(_id="s3timeline", _class="s3-timeline") output = dict(item = item) # Maintain RHeader for consistency if attr.get("rheader"): rheader = attr["rheader"](r) if rheader: output["rheader"] = rheader output["title"] = T("Incident Timeline") response.view = "timeline.html" return output else: raise HTTP(501, current.ERROR.BAD_METHOD) # ------------------------------------------------------------------------- @staticmethod def irs_ushahidi_import(r, **attr): """ Import Incident Reports from Ushahidi @ToDo: Deployment setting for Ushahidi instance URL """ T = current.T auth = current.auth request = current.request response = current.response session = current.session # Method is only available to Admins system_roles = session.s3.system_roles ADMIN = system_roles.ADMIN if not auth.s3_has_role(ADMIN): auth.permission.fail() if r.representation == "html" and \ r.name == "ireport" and not r.component and not r.id: url = r.get_vars.get("url", "http://") title = T("Import Incident Reports from Ushahidi") form = FORM( TABLE( TR( TH(B("%s: " % T("URL"))), INPUT(_type="text", _name="url", _size="100", _value=url, requires=[IS_URL(), IS_NOT_EMPTY()]), TH(DIV(SPAN("*", _class="req", _style="padding-right: 5px;"))) ), TR( TD(B("%s: " % T("Ignore Errors?"))), TD(INPUT(_type="checkbox", _name="ignore_errors", _id="ignore_errors")) ), TR("", INPUT(_type="submit", _value=T("Import"))) )) rheader = DIV(P("%s: http://wiki.ushahidi.com/doku.php?id=ushahidi_api" % \ T("API is documented here")), P("%s URL: http://ushahidi.my.domain/api?task=incidents&by=all&resp=xml&limit=1000" % \ T("Example"))) output = dict(title=title, form=form, rheader=rheader) if form.accepts(request.vars, session): # "Exploit" the de-duplicator hook to count import items import_count = [0] def count_items(job, import_count=import_count): if job.tablename == "irs_ireport": import_count[0] += 1 current.s3db.configure("irs_report", deduplicate=count_items) vars = form.vars ushahidi_url = vars.url import os stylesheet = os.path.join(request.folder, "static", "formats", "ushahidi", "import.xsl") if os.path.exists(stylesheet) and ushahidi_url: ignore_errors = vars.get("ignore_errors", None) try: success = r.resource.import_xml(ushahidi_url, stylesheet=stylesheet, ignore_errors=ignore_errors) except: import sys e = sys.exc_info()[1] response.error = e else: if success: count = import_count[0] if count: response.confirmation = "%s %s" % \ (import_count[0], T("reports successfully imported.")) else: response.information = T("No reports available.") else: response.error = self.error response.view = "create.html" return output else: raise HTTP(501, current.ERROR.BAD_METHOD) # ============================================================================= class S3IRSResponseModel(S3Model): """ Tables used when responding to Incident Reports - with HRMs &/or Vehicles Currently this has code specific to Porto Firefighters @ToDo: Replace with Deployment module """ names = ("irs_ireport_human_resource", "irs_ireport_vehicle", "irs_ireport_vehicle_human_resource" ) def model(self): T = current.T db = current.db human_resource_id = self.hrm_human_resource_id ireport_id = self.irs_ireport_id define_table = self.define_table configure = self.configure settings = current.deployment_settings hrm = settings.get_hrm_show_staff() vol = settings.has_module("vol") if hrm and not vol: hrm_label = T("Staff") elif vol and not hrm: hrm_label = T("Volunteer") else: hrm_label = T("Staff/Volunteer") def response_represent(opt): if opt is None: return current.messages["NONE"] elif opt: return T("Yes") else: return T("No") # --------------------------------------------------------------------- # Staff assigned to an Incident # msg_enabled = settings.has_module("msg") tablename = "irs_ireport_human_resource" define_table(tablename, ireport_id(), # @ToDo: Limit Staff to those which are not already assigned to an Incident human_resource_id(label = hrm_label, # Simple dropdown is faster for a small team #widget=None, #comment=None, ), Field("incident_commander", "boolean", default = False, label = T("Incident Commander"), represent = lambda incident_commander: \ (T("No"), T("Yes"))[incident_commander == True]), Field("response", "boolean", default = None, label = T("Able to Respond?"), writable = msg_enabled, readable = msg_enabled, represent = response_represent, ), s3_comments("reply", label = T("Reply Message"), writable = msg_enabled, readable = msg_enabled ), *s3_meta_fields()) configure(tablename, list_fields=["id", "human_resource_id", "incident_commander", "response", "reply", ]) if not settings.has_module("vehicle"): return Storage() # --------------------------------------------------------------------- # Vehicles assigned to an Incident # asset_id = self.asset_asset_id tablename = "irs_ireport_vehicle" define_table(tablename, ireport_id(), asset_id(label = T("Vehicle"), # Limit Vehicles to those which are not already assigned to an Incident requires = self.irs_vehicle_requires, comment = S3AddResourceLink( c="vehicle", f="vehicle", label=T("Add Vehicle"), tooltip=T("If you don't see the vehicle in the list, you can add a new one by clicking link 'Add Vehicle'.")), ), s3_datetime("datetime", default = "now", future = 0, label = T("Dispatch Time"), ), self.super_link("site_id", "org_site", label = T("Fire Station"), readable = True, # Populated from fire_station_vehicle #writable = True ), self.gis_location_id(label = T("Destination"), ), Field("closed", # @ToDo: Close all assignments when Incident closed readable=False, writable=False), Field.Method("minutes", self.irs_ireport_vehicle_minutes), s3_comments(), *s3_meta_fields()) configure(tablename, extra_fields = ["datetime"]) # --------------------------------------------------------------------- # Which Staff are assigned to which Vehicle? # tablename = "irs_ireport_vehicle_human_resource" define_table(tablename, ireport_id(), # @ToDo: Limit Staff to those which are not already assigned to an Incident human_resource_id(label = hrm_label, # Simple dropdown is faster for a small team widget=None, comment=None, ), asset_id(label=T("Vehicle"), # @ToDo: Limit to Vehicles which are assigned to this Incident requires = IS_EMPTY_OR( IS_ONE_OF(db, "asset_asset.id", self.asset_represent, filterby="type", filter_opts=(1,), sort=True)), comment = S3AddResourceLink( c="vehicle", f="vehicle", label=T("Add Vehicle"), tooltip=T("If you don't see the vehicle in the list, you can add a new one by clicking link 'Add Vehicle'.")), ), Field("closed", # @ToDo: Close all assignments when Incident closed readable=False, writable=False), *s3_meta_fields()) # --------------------------------------------------------------------- # Return model-global names to s3db.* # return Storage( ) # ------------------------------------------------------------------------- @staticmethod def irs_vehicle_requires(): """ Populate the dropdown widget for responding to an Incident Report based on those vehicles which aren't already on-call """ # Vehicles are a type of Asset s3db = current.s3db table = s3db.asset_asset ltable = s3db.irs_ireport_vehicle asset_represent = s3db.asset_asset_id.represent # Filter to Vehicles which aren't already on a call # @ToDo: Filter by Org/Base # @ToDo: Filter out those which are under repair query = (table.type == s3db.asset_types["VEHICLE"]) & \ (table.deleted == False) & \ ((ltable.id == None) | \ (ltable.closed == True) | \ (ltable.deleted == True)) left = ltable.on(table.id == ltable.asset_id) requires = IS_EMPTY_OR(IS_ONE_OF(current.db(query), "asset_asset.id", asset_represent, left=left, sort=True)) return requires # ------------------------------------------------------------------------- @staticmethod def irs_ireport_vehicle_minutes(row): if hasattr(row, "irs_ireport_vehicle"): row = "irs_ireport_vehicle" if hasattr(row, "datetime") and row.datetime: return int((current.request.utcnow - row.datetime) / 60) else: return 0 # ============================================================================= def irs_rheader(r, tabs=[]): """ Resource component page header """ if r.representation == "html": if r.record is None: # List or Create form: rheader makes no sense here return None T = current.T s3db = current.s3db settings = current.deployment_settings hrm_label = T("Responder(s)") tabs = [(T("Report Details"), None), (T("Photos"), "image"), (T("Documents"), "document"), (T("Affected Persons"), "person"), ] if settings.get_irs_vehicle(): tabs.append((T("Vehicles"), "vehicle")) tabs.append((hrm_label, "human_resource")) tabs.append((T("Tasks"), "task")) if settings.has_module("msg"): tabs.append((T("Dispatch"), "dispatch")) rheader_tabs = s3_rheader_tabs(r, tabs) if r.name == "ireport": report = r.record table = r.table datetime = table.datetime.represent(report.datetime) expiry = table.datetime.represent(report.expiry) location = table.location_id.represent(report.location_id) category = table.category.represent(report.category) or "" contact = "" if report.person: if report.contact: contact = "%s (%s)" % (report.person, report.contact) else: contact = report.person elif report.contact: contact = report.contact if contact: contact = DIV(TH("%s: " % T("Contact")), TD(contact)) #create_request = A(T("Create Request"), # _class="action-btn s3_add_resource_link", # _href=URL(c="req", f="req", # args="create", # vars={"format":"popup", # "caller":"irs_ireport"}), # _title=T("Add Request")) #create_task = A(T("Create Task"), # _class="action-btn s3_add_resource_link", # _href=URL(c="project", f="task", # args="create", # vars={"format":"popup", # "caller":"irs_ireport"}), # _title=T("Create Task")) rheader = DIV(TABLE( TR( TH("%s: " % table.name.label), report.name, TH("%s: " % table.datetime.label), datetime, ), TR( TH("%s: " % table.category.label), category, TH("%s: " % table.expiry.label), expiry, ), TR( TH("%s: " % table.location_id.label), location, contact, ), TR( TH("%s: " % table.message.label), TD(report.message or "", _colspan=3), ) ), #DIV(P(), create_request, " ", create_task, P()), rheader_tabs) return rheader else: return None # END =========================================================================
devinbalkind/eden
modules/s3db/irs.py
Python
mit
56,474
[ "VisIt" ]
01ef7b4b0893e645712274456837fc61774daaf1099870ea44fc1fbcbd77756c
# # Gramps - a GTK+/GNOME based genealogy program # # Copyright (C) 2000-2007 Donald N. Allingham # Copyright (C) 2008 Brian G. Matherly # Copyright (C) 2008-2009 Gary Burton # Copyright (C) 2008 Robert Cheramy <robert@cheramy.net> # Copyright (C) 2010 Jakim Friant # Copyright (C) 2010 Nick Hall # Copyright (C) 2011 Tim G L Lyons # Copyright (C) 2012 Doug Blank <doug.blank@gmail.com> # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # "Export to GEDCOM" #------------------------------------------------------------------------- # # Standard Python Modules # #------------------------------------------------------------------------- import os import time import io #------------------------------------------------------------------------- # # GRAMPS modules # #------------------------------------------------------------------------- from gramps.gen.const import GRAMPS_LOCALE as glocale _ = glocale.translation.gettext from gramps.gen.lib import (AttributeType, ChildRefType, Citation, Date, EventRoleType, EventType, LdsOrd, NameType, PlaceType, NoteType, Person, UrlType, SrcAttributeType) from gramps.version import VERSION import gramps.plugins.lib.libgedcom as libgedcom from gramps.gen.errors import DatabaseError from gramps.gui.plug.export import WriterOptionBox from gramps.gen.updatecallback import UpdateCallback from gramps.gen.utils.file import media_path_full from gramps.gen.utils.place import conv_lat_lon from gramps.gen.constfunc import cuni from gramps.gen.utils.location import get_main_location #------------------------------------------------------------------------- # # GEDCOM tags representing attributes that may take a parameter, value or # description on the same line as the tag # #------------------------------------------------------------------------- NEEDS_PARAMETER = set( ["CAST", "DSCR", "EDUC", "IDNO", "NATI", "NCHI", "NMR", "OCCU", "PROP", "RELI", "SSN", "TITL"]) LDS_ORD_NAME = { LdsOrd.BAPTISM : 'BAPL', LdsOrd.ENDOWMENT : 'ENDL', LdsOrd.SEAL_TO_PARENTS : 'SLGC', LdsOrd.SEAL_TO_SPOUSE : 'SLGS', LdsOrd.CONFIRMATION : 'CONL', } LDS_STATUS = { LdsOrd.STATUS_BIC : "BIC", LdsOrd.STATUS_CANCELED : "CANCELED", LdsOrd.STATUS_CHILD : "CHILD", LdsOrd.STATUS_CLEARED : "CLEARED", LdsOrd.STATUS_COMPLETED : "COMPLETED", LdsOrd.STATUS_DNS : "DNS", LdsOrd.STATUS_INFANT : "INFANT", LdsOrd.STATUS_PRE_1970 : "PRE-1970", LdsOrd.STATUS_QUALIFIED : "QUALIFIED", LdsOrd.STATUS_DNS_CAN : "DNS/CAN", LdsOrd.STATUS_STILLBORN : "STILLBORN", LdsOrd.STATUS_SUBMITTED : "SUBMITTED" , LdsOrd.STATUS_UNCLEARED : "UNCLEARED", } LANGUAGES = { 'cs' : 'Czech', 'da' : 'Danish', 'nl' : 'Dutch', 'en' : 'English', 'eo' : 'Esperanto', 'fi' : 'Finnish', 'fr' : 'French', 'de' : 'German', 'hu' : 'Hungarian', 'it' : 'Italian', 'lt' : 'Latvian', 'lv' : 'Lithuanian', 'no' : 'Norwegian', 'po' : 'Polish', 'pt' : 'Portuguese', 'ro' : 'Romanian', 'sk' : 'Slovak', 'es' : 'Spanish', 'sv' : 'Swedish', 'ru' : 'Russian', } #------------------------------------------------------------------------- # # # #------------------------------------------------------------------------- MIME2GED = { "image/bmp" : "bmp", "image/gif" : "gif", "image/jpeg" : "jpeg", "image/x-pcx" : "pcx", "image/tiff" : "tiff", "audio/x-wav" : "wav" } QUALITY_MAP = { Citation.CONF_VERY_HIGH : "3", Citation.CONF_HIGH : "2", Citation.CONF_LOW : "1", Citation.CONF_VERY_LOW : "0", } #------------------------------------------------------------------------- # # sort_handles_by_id # #------------------------------------------------------------------------- def sort_handles_by_id(handle_list, handle_to_object): """ Sort a list of handles by the Gramps ID. The function that returns the object from the handle needs to be supplied so that we get the right object. """ sorted_list = [] for handle in handle_list: obj = handle_to_object(handle) if obj: data = (obj.get_gramps_id(), handle) sorted_list.append (data) sorted_list.sort() return sorted_list #------------------------------------------------------------------------- # # breakup # #------------------------------------------------------------------------- def breakup(txt, limit): """ Break a line of text into a list of strings that conform to the maximum length specified, while breaking words in the middle of a word to avoid issues with spaces. """ if limit < 1: raise ValueError("breakup: unexpected limit: %r" % limit) data = [] while len(txt) > limit: # look for non-space pair to break between # do not break within a UTF-8 byte sequence, i. e. first char >127 idx = limit while (idx>0 and (txt[idx-1].isspace() or txt[idx].isspace() or ord(txt[idx-1]) > 127)): idx -= 1 if idx == 0: #no words to break on, just break at limit anyway idx = limit data.append(txt[:idx]) txt = txt[idx:] if len(txt) > 0: data.append(txt) return data #------------------------------------------------------------------------- # # event_has_subordinate_data # may want to compare description w/ auto-generated one, and # if so, treat it same as if it were empty for this purpose # #------------------------------------------------------------------------- def event_has_subordinate_data(event, event_ref): if event and event_ref: return (event.get_description().strip() or not event.get_date_object().is_empty() or event.get_place_handle() or event.get_attribute_list() or event_ref.get_attribute_list() or event.get_note_list() or event.get_citation_list() or event.get_media_list()) else: return False #------------------------------------------------------------------------- # # GedcomWriter class # #------------------------------------------------------------------------- class GedcomWriter(UpdateCallback): """ The GEDCOM writer creates a GEDCOM file that contains the exported information from the database. It derives from UpdateCallback so that it can provide visual feedback via a progress bar if needed. """ def __init__(self, database, user, option_box=None): UpdateCallback.__init__(self, user.callback) self.total = 100 self.dbase = database self.dirname = None self.gedcom_file = None # The number of different stages other than any of the optional filters # which the write_gedcom_file method will call. self.progress_cnt = 5 self.setup(option_box) def setup(self, option_box): """ If the option_box is present (GUI interface), then we check the "private", "restrict", and "cfilter" arguments to see if we need to apply proxy databases. """ if option_box: option_box.parse_options() self.dbase = option_box.get_filtered_database(self.dbase, self) def write_gedcom_file(self, filename): """ Write the actual GEDCOM file to the specified filename. """ self.dirname = os.path.dirname (filename) self.gedcom_file = io.open(filename, "w", encoding='utf-8') self._header(filename) self._submitter() self._individuals() self._families() self._sources() self._repos() self._notes() self._writeln(0, "TRLR") self.gedcom_file.close() return True def _writeln(self, level, token, textlines="", limit=72): """ Write a line of text to the output file in the form of: LEVEL TOKEN text If the line contains newlines, it is broken into multiple lines using the CONT token. If any line is greater than the limit, it will broken into multiple lines using CONC. """ assert(token) if textlines: # break the line into multiple lines if a newline is found textlines = textlines.replace('\n\r', '\n') textlines = textlines.replace('\r', '\n') textlist = textlines.split('\n') token_level = level for text in textlist: # make it unicode so that breakup below does the right thin. text = cuni(text) if limit: prefix = cuni("\n%d CONC " % (level + 1)) txt = prefix.join(breakup(text, limit)) else: txt = text self.gedcom_file.write(cuni("%d %s %s\n" % (token_level, token, txt))) token_level = level + 1 token = "CONT" else: self.gedcom_file.write(cuni("%d %s\n" % (level, token))) def _header(self, filename): """ Write the GEDCOM header. HEADER:= n HEAD {1:1} +1 SOUR <APPROVED_SYSTEM_ID> {1:1} +2 VERS <VERSION_NUMBER> {0:1} +2 NAME <NAME_OF_PRODUCT> {0:1} +2 CORP <NAME_OF_BUSINESS> {0:1} # Not used +3 <<ADDRESS_STRUCTURE>> {0:1} # Not used +2 DATA <NAME_OF_SOURCE_DATA> {0:1} # Not used +3 DATE <PUBLICATION_DATE> {0:1} # Not used +3 COPR <COPYRIGHT_SOURCE_DATA> {0:1} # Not used +1 DEST <RECEIVING_SYSTEM_NAME> {0:1*} # Not used +1 DATE <TRANSMISSION_DATE> {0:1} +2 TIME <TIME_VALUE> {0:1} +1 SUBM @XREF:SUBM@ {1:1} +1 SUBN @XREF:SUBN@ {0:1} +1 FILE <FILE_NAME> {0:1} +1 COPR <COPYRIGHT_GEDCOM_FILE> {0:1} +1 GEDC {1:1} +2 VERS <VERSION_NUMBER> {1:1} +2 FORM <GEDCOM_FORM> {1:1} +1 CHAR <CHARACTER_SET> {1:1} +2 VERS <VERSION_NUMBER> {0:1} +1 LANG <LANGUAGE_OF_TEXT> {0:1} +1 PLAC {0:1} +2 FORM <PLACE_HIERARCHY> {1:1} +1 NOTE <GEDCOM_CONTENT_DESCRIPTION> {0:1} +2 [CONT|CONC] <GEDCOM_CONTENT_DESCRIPTION> {0:M} """ local_time = time.localtime(time.time()) (year, mon, day, hour, minutes, sec) = local_time[0:6] date_str = "%d %s %d" % (day, libgedcom.MONTH[mon], year) time_str = "%02d:%02d:%02d" % (hour, minutes, sec) rname = self.dbase.get_researcher().get_name() self._writeln(0, "HEAD") self._writeln(1, "SOUR", "Gramps") self._writeln(2, "VERS", VERSION) self._writeln(2, "NAME", "Gramps") self._writeln(1, "DATE", date_str) self._writeln(2, "TIME", time_str) self._writeln(1, "SUBM", "@SUBM@") self._writeln(1, "FILE", filename, limit=255) self._writeln(1, "COPR", 'Copyright (c) %d %s.' % (year, rname)) self._writeln(1, "GEDC") self._writeln(2, "VERS", "5.5") self._writeln(2, "FORM", 'LINEAGE-LINKED') self._writeln(1, "CHAR", "UTF-8") # write the language string if the current LANG variable # matches something we know about. lang = glocale.language[0] if lang and len(lang) >= 2: lang_code = LANGUAGES.get(lang[0:2]) if lang_code: self._writeln(1, 'LANG', lang_code) def _submitter(self): """ n @<XREF:SUBM>@ SUBM {1:1} +1 NAME <SUBMITTER_NAME> {1:1} +1 <<ADDRESS_STRUCTURE>> {0:1} +1 <<MULTIMEDIA_LINK>> {0:M} # not used +1 LANG <LANGUAGE_PREFERENCE> {0:3} # not used +1 RFN <SUBMITTER_REGISTERED_RFN> {0:1} # not used +1 RIN <AUTOMATED_RECORD_ID> {0:1} # not used +1 <<CHANGE_DATE>> {0:1} # not used """ owner = self.dbase.get_researcher() name = owner.get_name() phon = owner.get_phone() mail = owner.get_email() self._writeln(0, "@SUBM@", "SUBM") self._writeln(1, "NAME", name) # Researcher is a sub-type of LocationBase, so get_city etc. which are # used in __write_addr work fine. However, the database owner street is # stored in address, so we need to temporarily copy it into street so # __write_addr works properly owner.set_street(owner.get_address()) self.__write_addr(1, owner) if phon: self._writeln(1, "PHON", phon) if mail: self._writeln(1, "EMAIL", mail) def _individuals(self): """ Write the individual people to the gedcom file. Since people like to have the list sorted by ID value, we need to go through a sorting step. We need to reset the progress bar, otherwise, people will be confused when the progress bar is idle. """ self.reset(_("Writing individuals")) self.progress_cnt += 1 self.update(self.progress_cnt) phandles = self.dbase.iter_person_handles() sorted_list = [] for handle in phandles: person = self.dbase.get_person_from_handle(handle) if person: data = (person.get_gramps_id(), handle) sorted_list.append(data) sorted_list.sort() for data in sorted_list: self._person(self.dbase.get_person_from_handle(data[1])) def _person(self, person): """ Write out a single person. n @XREF:INDI@ INDI {1:1} +1 RESN <RESTRICTION_NOTICE> {0:1} # not used +1 <<PERSONAL_NAME_STRUCTURE>> {0:M} +1 SEX <SEX_VALUE> {0:1} +1 <<INDIVIDUAL_EVENT_STRUCTURE>> {0:M} +1 <<INDIVIDUAL_ATTRIBUTE_STRUCTURE>> {0:M} +1 <<LDS_INDIVIDUAL_ORDINANCE>> {0:M} +1 <<CHILD_TO_FAMILY_LINK>> {0:M} +1 <<SPOUSE_TO_FAMILY_LINK>> {0:M} +1 SUBM @<XREF:SUBM>@ {0:M} +1 <<ASSOCIATION_STRUCTURE>> {0:M} +1 ALIA @<XREF:INDI>@ {0:M} +1 ANCI @<XREF:SUBM>@ {0:M} +1 DESI @<XREF:SUBM>@ {0:M} +1 <<SOURCE_CITATION>> {0:M} +1 <<MULTIMEDIA_LINK>> {0:M} ,* +1 <<NOTE_STRUCTURE>> {0:M} +1 RFN <PERMANENT_RECORD_FILE_NUMBER> {0:1} +1 AFN <ANCESTRAL_FILE_NUMBER> {0:1} +1 REFN <USER_REFERENCE_NUMBER> {0:M} +2 TYPE <USER_REFERENCE_TYPE> {0:1} +1 RIN <AUTOMATED_RECORD_ID> {0:1} +1 <<CHANGE_DATE>> {0:1} """ if person is None: return self._writeln(0, "@%s@" % person.get_gramps_id(), "INDI") self._names(person) self._gender(person) self._person_event_ref('BIRT', person.get_birth_ref()) self._person_event_ref('DEAT', person.get_death_ref()) self._remaining_events(person) self._attributes(person) self._lds_ords(person, 1) self._child_families(person) self._parent_families(person) self._assoc(person, 1) self._person_sources(person) self._addresses(person) self._photos(person.get_media_list(), 1) self._url_list(person, 1) self._note_references(person.get_note_list(), 1) self._change(person.get_change_time(), 1) def _assoc(self, person, level): """ n ASSO @<XREF:INDI>@ {0:M} +1 RELA <RELATION_IS_DESCRIPTOR> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 <<SOURCE_CITATION>> {0:M} """ for ref in person.get_person_ref_list(): person = self.dbase.get_person_from_handle(ref.ref) if person: self._writeln(level, "ASSO", "@%s@" % person.get_gramps_id()) self._writeln(level+1, "RELA", ref.get_relation()) self._note_references(ref.get_note_list(), level+1) self._source_references(ref.get_citation_list(), level+1) def _note_references(self, notelist, level): """ Write out the list of note handles to the current level. We use the Gramps ID as the XREF for the GEDCOM file. """ for note_handle in notelist: note = self.dbase.get_note_from_handle(note_handle) if note: self._writeln(level, 'NOTE', '@%s@' % note.get_gramps_id()) def _names(self, person): """ Write the names associated with the person to the current level. Since nicknames in version < 3.3 are separate from the name structure, we search the attribute list to see if we can find a nickname. Because we do not know the mappings, we just take the first nickname we find, and add it to the primary name. If a nickname is present in the name structure, it has precedence """ nicknames = [ attr.get_value() for attr in person.get_attribute_list() if int(attr.get_type()) == AttributeType.NICKNAME ] if len(nicknames) > 0: nickname = nicknames[0] else: nickname = "" self._person_name(person.get_primary_name(), nickname) for name in person.get_alternate_names(): self._person_name(name, "") def _gender(self, person): """ Write out the gender of the person to the file. If the gender is not male or female, simply do not output anything. The only valid values are M (male) or F (female). So if the geneder is unknown, we output nothing. """ if person.get_gender() == Person.MALE: self._writeln(1, "SEX", "M") elif person.get_gender() == Person.FEMALE: self._writeln(1, "SEX", "F") def _lds_ords(self, obj, level): """ Simply loop through the list of LDS ordinances, and call the function that writes the LDS ordinance structure. """ for lds_ord in obj.get_lds_ord_list(): self.write_ord(lds_ord, level) def _remaining_events(self, person): """ Output all events associated with the person that are not BIRTH or DEATH events. Because all we have are event references, we have to extract the real event to discover the event type. """ for event_ref in person.get_event_ref_list(): event = self.dbase.get_event_from_handle(event_ref.ref) if not event: continue self._process_person_event(event, event_ref) self._adoption_records(person) def _process_person_event(self, event, event_ref): """ Process a person event, which is not a BIRTH or DEATH event. """ etype = int(event.get_type()) # if the event is a birth or death, skip it. if etype in (EventType.BIRTH, EventType.DEATH): return role = int(event_ref.get_role()) # if the event role is not primary, skip the event. if role != EventRoleType.PRIMARY: return val = libgedcom.PERSONALCONSTANTEVENTS.get(etype, "").strip() if val and val.strip(): if val in NEEDS_PARAMETER: if event.get_description().strip(): self._writeln(1, val, event.get_description()) else: self._writeln(1, val) else: if event_has_subordinate_data(event, event_ref): self._writeln(1, val) else: self._writeln(1, val, 'Y') if event.get_description().strip(): self._writeln(2, 'TYPE', event.get_description()) else: self._writeln(1, 'EVEN') if val.strip(): self._writeln(2, 'TYPE', val) else: self._writeln(2, 'TYPE', str(event.get_type())) descr = event.get_description() if descr: self._writeln(2, 'NOTE', "Description: " + descr) self._dump_event_stats(event, event_ref) def _adoption_records(self, person): """ Write Adoption events for each child that has been adopted. n ADOP +1 <<INDIVIDUAL_EVENT_DETAIL>> +1 FAMC @<XREF:FAM>@ +2 ADOP <ADOPTED_BY_WHICH_PARENT> """ adoptions = [] for family in [ self.dbase.get_family_from_handle(fh) for fh in person.get_parent_family_handle_list() ]: if family is None: continue for child_ref in [ ref for ref in family.get_child_ref_list() if ref.ref == person.handle ]: if child_ref.mrel == ChildRefType.ADOPTED \ or child_ref.frel == ChildRefType.ADOPTED: adoptions.append((family, child_ref.frel, child_ref.mrel)) for (fam, frel, mrel) in adoptions: self._writeln(1, 'ADOP', 'Y') self._writeln(2, 'FAMC', '@%s@' % fam.get_gramps_id()) if mrel == frel: self._writeln(3, 'ADOP', 'BOTH') elif mrel == ChildRefType.ADOPTED: self._writeln(3, 'ADOP', 'WIFE') else: self._writeln(3, 'ADOP', 'HUSB') def _attributes(self, person): """ Write out the attributes to the GEDCOM file. Since we have already looked at nicknames when we generated the names, we filter them out here. We use the GEDCOM 5.5.1 FACT command to write out attributes not built in to GEDCOM. """ # filter out the nicknames attr_list = [ attr for attr in person.get_attribute_list() if attr.get_type() != AttributeType.NICKNAME ] for attr in attr_list: attr_type = int(attr.get_type()) name = libgedcom.PERSONALCONSTANTATTRIBUTES.get(attr_type) key = str(attr.get_type()) value = attr.get_value().strip().replace('\r', ' ') if key in ("AFN", "RFN", "REFN", "_UID", "_FSFTID"): self._writeln(1, key, value) continue if key == "RESN": self._writeln(1, 'RESN') continue if name and name.strip(): self._writeln(1, name, value) elif value: self._writeln(1, 'FACT', value) self._writeln(2, 'TYPE', key) else: continue self._note_references(attr.get_note_list(), 2) self._source_references(attr.get_citation_list(), 2) def _source_references(self, citation_list, level): """ Loop through the list of citation handles, writing the information to the file. """ for citation_handle in citation_list: self._source_ref_record(level, citation_handle) def _addresses(self, person): """ Write out the addresses associated with the person as RESI events. """ for addr in person.get_address_list(): self._writeln(1, 'RESI') self._date(2, addr.get_date_object()) self.__write_addr(2, addr) if addr.get_phone(): self._writeln(2, 'PHON', addr.get_phone()) self._note_references(addr.get_note_list(), 2) self._source_references(addr.get_citation_list(), 2) def _photos(self, media_list, level): """ Loop through the list of media objects, writing the information to the file. """ for photo in media_list: self._photo(photo, level) def _child_families(self, person): """ Write the Gramps ID as the XREF for each family in which the person is listed as a child. """ # get the list of familes from the handle list family_list = [ self.dbase.get_family_from_handle(hndl) for hndl in person.get_parent_family_handle_list() ] for family in family_list: if family: self._writeln(1, 'FAMC', '@%s@' % family.get_gramps_id()) def _parent_families(self, person): """ Write the Gramps ID as the XREF for each family in which the person is listed as a parent. """ # get the list of familes from the handle list family_list = [ self.dbase.get_family_from_handle(hndl) for hndl in person.get_family_handle_list() ] for family in family_list: if family: self._writeln(1, 'FAMS', '@%s@' % family.get_gramps_id()) def _person_sources(self, person): """ Loop through the list of citations, writing the information to the file. """ for citation_handle in person.get_citation_list(): self._source_ref_record(1, citation_handle) def _url_list(self, obj, level): """ n OBJE {1:1} +1 FORM <MULTIMEDIA_FORMAT> {1:1} +1 TITL <DESCRIPTIVE_TITLE> {0:1} +1 FILE <MULTIMEDIA_FILE_REFERENCE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} """ for url in obj.get_url_list(): self._writeln(level, 'OBJE') self._writeln(level+1, 'FORM', 'URL') if url.get_description(): self._writeln(level+1, 'TITL', url.get_description()) if url.get_path(): self._writeln(level+1, 'FILE', url.get_path(), limit=255) def _families(self): """ Write out the list of families, sorting by Gramps ID. """ self.reset(_("Writing families")) self.progress_cnt += 1 self.update(self.progress_cnt) # generate a list of (GRAMPS_ID, HANDLE) pairs. This list # can then be sorted by the sort routine, which will use the # first value of the tuple as the sort key. sorted_list = sort_handles_by_id(self.dbase.get_family_handles(), self.dbase.get_family_from_handle) # loop through the sorted list, pulling of the handle. This list # has already been sorted by GRAMPS_ID for family_handle in [hndl[1] for hndl in sorted_list]: self._family(self.dbase.get_family_from_handle(family_handle)) def _family(self, family): """ n @<XREF:FAM>@ FAM {1:1} +1 RESN <RESTRICTION_NOTICE> {0:1) +1 <<FAMILY_EVENT_STRUCTURE>> {0:M} +1 HUSB @<XREF:INDI>@ {0:1} +1 WIFE @<XREF:INDI>@ {0:1} +1 CHIL @<XREF:INDI>@ {0:M} +1 NCHI <COUNT_OF_CHILDREN> {0:1} +1 SUBM @<XREF:SUBM>@ {0:M} +1 <<LDS_SPOUSE_SEALING>> {0:M} +1 REFN <USER_REFERENCE_NUMBER> {0:M} """ if family is None: return gramps_id = family.get_gramps_id() self._writeln(0, '@%s@' % gramps_id, 'FAM' ) self._family_reference('HUSB', family.get_father_handle()) self._family_reference('WIFE', family.get_mother_handle()) self._lds_ords(family, 1) self._family_events(family) self._family_attributes(family.get_attribute_list(), 1) self._family_child_list(family.get_child_ref_list()) self._source_references(family.get_citation_list(), 1) self._photos(family.get_media_list(), 1) self._note_references(family.get_note_list(), 1) self._change(family.get_change_time(), 1) def _family_child_list(self, child_ref_list): """ Write the child XREF values to the GEDCOM file. """ child_list = [ self.dbase.get_person_from_handle(cref.ref).get_gramps_id() for cref in child_ref_list] for gid in child_list: if gid is None: continue self._writeln(1, 'CHIL', '@%s@' % gid) def _family_reference(self, token, person_handle): """ Write the family reference to the file. This is either 'WIFE' or 'HUSB'. As usual, we use the Gramps ID as the XREF value. """ if person_handle: person = self.dbase.get_person_from_handle(person_handle) if person: self._writeln(1, token, '@%s@' % person.get_gramps_id()) def _family_events(self, family): """ Output the events associated with the family. Because all we have are event references, we have to extract the real event to discover the event type. """ for event_ref in family.get_event_ref_list(): event = self.dbase.get_event_from_handle(event_ref.ref) if event is None: continue self._process_family_event(event, event_ref) self._dump_event_stats(event, event_ref) def _process_family_event(self, event, event_ref): """ Process a single family event. """ etype = int(event.get_type()) val = libgedcom.FAMILYCONSTANTEVENTS.get(etype) if val: if event_has_subordinate_data(event, event_ref): self._writeln(1, val) else: self._writeln(1, val, 'Y') if event.get_type() == EventType.MARRIAGE: self._family_event_attrs(event.get_attribute_list(), 2) if event.get_description().strip() != "": self._writeln(2, 'TYPE', event.get_description()) else: self._writeln(1, 'EVEN') the_type = str(event.get_type()) if the_type: self._writeln(2, 'TYPE', the_type) descr = event.get_description() if descr: self._writeln(2, 'NOTE', "Description: " + descr) def _family_event_attrs(self, attr_list, level): """ Write the attributes associated with the family event. The only ones we really care about are FATHER_AGE and MOTHER_AGE which we translate to WIFE/HUSB AGE attributes. """ for attr in attr_list: if attr.get_type() == AttributeType.FATHER_AGE: self._writeln(level, 'HUSB') self._writeln(level+1, 'AGE', attr.get_value()) elif attr.get_type() == AttributeType.MOTHER_AGE: self._writeln(level, 'WIFE') self._writeln(level+1, 'AGE', attr.get_value()) def _family_attributes(self, attr_list, level): """ Write out the attributes associated with a family to the GEDCOM file. Since we have already looked at nicknames when we generated the names, we filter them out here. We use the GEDCOM 5.5.1 FACT command to write out attributes not built in to GEDCOM. """ for attr in attr_list: attr_type = int(attr.get_type()) name = libgedcom.FAMILYCONSTANTATTRIBUTES.get(attr_type) key = str(attr.get_type()) value = attr.get_value().replace('\r', ' ') if key in ("AFN", "RFN", "REFN", "_UID"): self._writeln(1, key, value) continue if name and name.strip(): self._writeln(1, name, value) continue else: self._writeln(1, 'FACT', value) self._writeln(2, 'TYPE', key) self._note_references(attr.get_note_list(), level+1) self._source_references(attr.get_citation_list(), level+1) def _sources(self): """ Write out the list of sources, sorting by Gramps ID. """ self.reset(_("Writing sources")) self.progress_cnt += 1 self.update(self.progress_cnt) sorted_list = sort_handles_by_id(self.dbase.get_source_handles(), self.dbase.get_source_from_handle) for (source_id, handle) in sorted_list: source = self.dbase.get_source_from_handle(handle) if source is None: continue self._writeln(0, '@%s@' % source_id, 'SOUR') if source.get_title(): self._writeln(1, 'TITL', source.get_title()) if source.get_author(): self._writeln(1, "AUTH", source.get_author()) if source.get_publication_info(): self._writeln(1, "PUBL", source.get_publication_info()) if source.get_abbreviation(): self._writeln(1, 'ABBR', source.get_abbreviation()) self._photos(source.get_media_list(), 1) for reporef in source.get_reporef_list(): self._reporef(reporef, 1) break self._note_references(source.get_note_list(), 1) self._change(source.get_change_time(), 1) def _notes(self): """ Write out the list of notes, sorting by Gramps ID. """ self.reset(_("Writing notes")) self.progress_cnt += 1 self.update(self.progress_cnt) sorted_list = sort_handles_by_id(self.dbase.get_note_handles(), self.dbase.get_note_from_handle) for note_handle in [hndl[1] for hndl in sorted_list]: note = self.dbase.get_note_from_handle(note_handle) if note is None: continue self._note_record(note) def _note_record(self, note): """ n @<XREF:NOTE>@ NOTE <SUBMITTER_TEXT> {1:1} +1 [ CONC | CONT] <SUBMITTER_TEXT> {0:M} +1 <<SOURCE_CITATION>> {0:M} +1 REFN <USER_REFERENCE_NUMBER> {0:M} +2 TYPE <USER_REFERENCE_TYPE> {0:1} +1 RIN <AUTOMATED_RECORD_ID> {0:1} +1 <<CHANGE_DATE>> {0:1} """ if note: self._writeln(0, '@%s@' % note.get_gramps_id(), 'NOTE ' + note.get()) def _repos(self): """ Write out the list of repositories, sorting by Gramps ID. REPOSITORY_RECORD:= n @<XREF:REPO>@ REPO {1:1} +1 NAME <NAME_OF_REPOSITORY> {1:1} +1 <<ADDRESS_STRUCTURE>> {0:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 REFN <USER_REFERENCE_NUMBER> {0:M} +2 TYPE <USER_REFERENCE_TYPE> {0:1} +1 RIN <AUTOMATED_RECORD_ID> {0:1} +1 <<CHANGE_DATE>> {0:1} """ self.reset(_("Writing repositories")) self.progress_cnt += 1 self.update(self.progress_cnt) sorted_list = sort_handles_by_id(self.dbase.get_repository_handles(), self.dbase.get_repository_from_handle) # GEDCOM only allows for a single repository per source for (repo_id, handle) in sorted_list: repo = self.dbase.get_repository_from_handle(handle) if repo is None: continue self._writeln(0, '@%s@' % repo_id, 'REPO' ) if repo.get_name(): self._writeln(1, 'NAME', repo.get_name()) for addr in repo.get_address_list(): self.__write_addr(1, addr) if addr.get_phone(): self._writeln(1, 'PHON', addr.get_phone()) for url in repo.get_url_list(): if int(url.get_type()) == UrlType.EMAIL: self._writeln(1, 'EMAIL', url.get_path()) elif int(url.get_type()) == UrlType.WEB_HOME: self._writeln(1, 'WWW', url.get_path()) self._note_references(repo.get_note_list(), 1) def _reporef(self, reporef, level): """ n REPO [ @XREF:REPO@ | <NULL>] {1:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 CALN <SOURCE_CALL_NUMBER> {0:M} +2 MEDI <SOURCE_MEDIA_TYPE> {0:1} """ if reporef.ref is None: return repo = self.dbase.get_repository_from_handle(reporef.ref) if repo is None: return repo_id = repo.get_gramps_id() self._writeln(level, 'REPO', '@%s@' % repo_id ) self._note_references(reporef.get_note_list(), level+1) if reporef.get_call_number(): self._writeln(level+1, 'CALN', reporef.get_call_number() ) if reporef.get_media_type(): self._writeln(level+2, 'MEDI', str(reporef.get_media_type())) def _person_event_ref(self, key, event_ref): """ Write out the BIRTH and DEATH events for the person. """ if event_ref: event = self.dbase.get_event_from_handle(event_ref.ref) if event_has_subordinate_data(event, event_ref): self._writeln(1, key) else: self._writeln(1, key, 'Y') if event.get_description().strip() != "": self._writeln(2, 'TYPE', event.get_description()) self._dump_event_stats(event, event_ref) def _change(self, timeval, level): """ CHANGE_DATE:= n CHAN {1:1} +1 DATE <CHANGE_DATE> {1:1} +2 TIME <TIME_VALUE> {0:1} +1 <<NOTE_STRUCTURE>> # not used """ self._writeln(level, 'CHAN') time_val = time.localtime(timeval) self._writeln(level+1, 'DATE', '%d %s %d' % ( time_val[2], libgedcom.MONTH[time_val[1]], time_val[0])) self._writeln(level+2, 'TIME', '%02d:%02d:%02d' % ( time_val[3], time_val[4], time_val[5])) def _dump_event_stats(self, event, event_ref): """ Write the event details for the event, using the event and event reference information. GEDCOM does not make a distinction between the two. """ dateobj = event.get_date_object() self._date(2, dateobj) if self._datewritten: # write out TIME if present times = [ attr.get_value() for attr in event.get_attribute_list() if int(attr.get_type()) == AttributeType.TIME ] # Not legal, but inserted by PhpGedView if len(times) > 0: time = times[0] self._writeln(3, 'TIME', time) place = None if event.get_place_handle(): place = self.dbase.get_place_from_handle(event.get_place_handle()) self._place(place, 2) for attr in event.get_attribute_list(): attr_type = attr.get_type() if attr_type == AttributeType.CAUSE: self._writeln(2, 'CAUS', attr.get_value()) elif attr_type == AttributeType.AGENCY: self._writeln(2, 'AGNC', attr.get_value()) for attr in event_ref.get_attribute_list(): attr_type = attr.get_type() if attr_type == AttributeType.AGE: self._writeln(2, 'AGE', attr.get_value()) elif attr_type == AttributeType.FATHER_AGE: self._writeln(2, 'HUSB') self._writeln(3, 'AGE', attr.get_value()) elif attr_type == AttributeType.MOTHER_AGE: self._writeln(2, 'WIFE') self._writeln(3, 'AGE', attr.get_value()) self._note_references(event.get_note_list(), 2) self._source_references(event.get_citation_list(), 2) self._photos(event.get_media_list(), 2) if place: self._photos(place.get_media_list(), 2) def write_ord(self, lds_ord, index): """ LDS_INDIVIDUAL_ORDINANCE:= [ n [ BAPL | CONL ] {1:1} +1 DATE <DATE_LDS_ORD> {0:1} +1 TEMP <TEMPLE_CODE> {0:1} +1 PLAC <PLACE_LIVING_ORDINANCE> {0:1} +1 STAT <LDS_BAPTISM_DATE_STATUS> {0:1} +2 DATE <CHANGE_DATE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 <<SOURCE_CITATION>> {0:M} p.39 | n ENDL {1:1} +1 DATE <DATE_LDS_ORD> {0:1} +1 TEMP <TEMPLE_CODE> {0:1} +1 PLAC <PLACE_LIVING_ORDINANCE> {0:1} +1 STAT <LDS_ENDOWMENT_DATE_STATUS> {0:1} +2 DATE <CHANGE_DATE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 <<SOURCE_CITATION>> {0:M} | n SLGC {1:1} +1 DATE <DATE_LDS_ORD> {0:1} +1 TEMP <TEMPLE_CODE> {0:1} +1 PLAC <PLACE_LIVING_ORDINANCE> {0:1} +1 FAMC @<XREF:FAM>@ {1:1} +1 STAT <LDS_CHILD_SEALING_DATE_STATUS> {0:1} +2 DATE <CHANGE_DATE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} +1 <<SOURCE_CITATION>> {0:M} ] """ self._writeln(index, LDS_ORD_NAME[lds_ord.get_type()]) self._date(index + 1, lds_ord.get_date_object()) if lds_ord.get_family_handle(): family_handle = lds_ord.get_family_handle() family = self.dbase.get_family_from_handle(family_handle) if family: self._writeln(index+1, 'FAMC', '@%s@' % family.get_gramps_id()) if lds_ord.get_temple(): self._writeln(index+1, 'TEMP', lds_ord.get_temple()) if lds_ord.get_place_handle(): self._place( self.dbase.get_place_from_handle(lds_ord.get_place_handle()), 2) if lds_ord.get_status() != LdsOrd.STATUS_NONE: self._writeln(2, 'STAT', LDS_STATUS[lds_ord.get_status()]) self._note_references(lds_ord.get_note_list(), index+1) self._source_references(lds_ord.get_citation_list(), index+1) def _date(self, level, date): """ Write the 'DATE' GEDCOM token, along with the date in GEDCOM's expected format. """ self._datewritten = True start = date.get_start_date() if start != Date.EMPTY: cal = date.get_calendar() mod = date.get_modifier() quality = date.get_quality() if mod == Date.MOD_SPAN: val = "FROM %s TO %s" % ( libgedcom.make_gedcom_date(start, cal, mod, quality), libgedcom.make_gedcom_date(date.get_stop_date(), cal, mod, quality)) elif mod == Date.MOD_RANGE: val = "BET %s AND %s" % ( libgedcom.make_gedcom_date(start, cal, mod, quality), libgedcom.make_gedcom_date(date.get_stop_date(), cal, mod, quality)) else: val = libgedcom.make_gedcom_date(start, cal, mod, quality) self._writeln(level, 'DATE', val) elif date.get_text(): self._writeln(level, 'DATE', date.get_text()) else: self._datewritten = False def _person_name(self, name, attr_nick): """ n NAME <NAME_PERSONAL> {1:1} +1 NPFX <NAME_PIECE_PREFIX> {0:1} +1 GIVN <NAME_PIECE_GIVEN> {0:1} +1 NICK <NAME_PIECE_NICKNAME> {0:1} +1 SPFX <NAME_PIECE_SURNAME_PREFIX {0:1} +1 SURN <NAME_PIECE_SURNAME> {0:1} +1 NSFX <NAME_PIECE_SUFFIX> {0:1} +1 <<SOURCE_CITATION>> {0:M} +1 <<NOTE_STRUCTURE>> {0:M} """ gedcom_name = name.get_gedcom_name() firstname = name.get_first_name().strip() surns = [] surprefs = [] for surn in name.get_surname_list(): surns.append(surn.get_surname().replace('/', '?')) if surn.get_connector(): #we store connector with the surname surns[-1] = surns[-1] + ' ' + surn.get_connector() surprefs.append(surn.get_prefix().replace('/', '?')) surname = ', '.join(surns) surprefix = ', '.join(surprefs) suffix = name.get_suffix() title = name.get_title() nick = name.get_nick_name() if nick.strip() == '': nick = attr_nick self._writeln(1, 'NAME', gedcom_name) if int(name.get_type()) == NameType.BIRTH: pass elif int(name.get_type()) == NameType.MARRIED: self._writeln(2, 'TYPE', 'married') elif int(name.get_type()) == NameType.AKA: self._writeln(2, 'TYPE', 'aka') else: self._writeln(2, 'TYPE', name.get_type().xml_str()) if firstname: self._writeln(2, 'GIVN', firstname) if surprefix: self._writeln(2, 'SPFX', surprefix) if surname: self._writeln(2, 'SURN', surname) if name.get_suffix(): self._writeln(2, 'NSFX', suffix) if name.get_title(): self._writeln(2, 'NPFX', title) if nick: self._writeln(2, 'NICK', nick) self._source_references(name.get_citation_list(), 2) self._note_references(name.get_note_list(), 2) def _source_ref_record(self, level, citation_handle): """ n SOUR @<XREF:SOUR>@ /* pointer to source record */ {1:1} +1 PAGE <WHERE_WITHIN_SOURCE> {0:1} +1 EVEN <EVENT_TYPE_CITED_FROM> {0:1} +2 ROLE <ROLE_IN_EVENT> {0:1} +1 DATA {0:1} +2 DATE <ENTRY_RECORDING_DATE> {0:1} +2 TEXT <TEXT_FROM_SOURCE> {0:M} +3 [ CONC | CONT ] <TEXT_FROM_SOURCE> {0:M} +1 QUAY <CERTAINTY_ASSESSMENT> {0:1} +1 <<MULTIMEDIA_LINK>> {0:M} ,* +1 <<NOTE_STRUCTURE>> {0:M} """ citation = self.dbase.get_citation_from_handle(citation_handle) src_handle = citation.get_reference_handle() if src_handle is None: return src = self.dbase.get_source_from_handle(src_handle) if src is None: return # Reference to the source self._writeln(level, "SOUR", "@%s@" % src.get_gramps_id()) if citation.get_page() != "": # PAGE <WHERE_WITHIN_SOURCE> can not have CONC lines. # WHERE_WITHIN_SOURCE:= {Size=1:248} # Maximize line to 248 and set limit to 248, for no line split self._writeln(level+1, 'PAGE', citation.get_page()[0:248], limit=248) conf = min(citation.get_confidence_level(), Citation.CONF_VERY_HIGH) if conf != Citation.CONF_NORMAL and conf != -1: self._writeln(level+1, "QUAY", QUALITY_MAP[conf]) if not citation.get_date_object().is_empty(): self._writeln(level+1, 'DATA') self._date(level+2, citation.get_date_object()) if len(citation.get_note_list()) > 0: note_list = [ self.dbase.get_note_from_handle(h) for h in citation.get_note_list() ] note_list = [ n for n in note_list if n.get_type() == NoteType.SOURCE_TEXT] if note_list: ref_text = note_list[0].get() else: ref_text = "" if ref_text != "" and citation.get_date_object().is_empty(): self._writeln(level+1, 'DATA') if ref_text != "": self._writeln(level+2, "TEXT", ref_text) note_list = [ self.dbase.get_note_from_handle(h) for h in citation.get_note_list() ] note_list = [ n.handle for n in note_list if n and n.get_type() != NoteType.SOURCE_TEXT] self._note_references(note_list, level+1) self._photos(citation.get_media_list(), level+1) even = None for srcattr in citation.get_attribute_list(): if str(srcattr.type) == "EVEN": even = srcattr.value self._writeln(level+1, "EVEN", even) break if even: for srcattr in citation.get_attribute_list(): if str(srcattr.type) == "EVEN:ROLE": self._writeln(level+2, "ROLE", srcattr.value) break def _photo(self, photo, level): """ n OBJE {1:1} +1 FORM <MULTIMEDIA_FORMAT> {1:1} +1 TITL <DESCRIPTIVE_TITLE> {0:1} +1 FILE <MULTIMEDIA_FILE_REFERENCE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} """ photo_obj_id = photo.get_reference_handle() photo_obj = self.dbase.get_object_from_handle(photo_obj_id) if photo_obj: mime = photo_obj.get_mime_type() form = MIME2GED.get(mime, mime) path = media_path_full(self.dbase, photo_obj.get_path()) if not os.path.isfile(path): return self._writeln(level, 'OBJE') if form: self._writeln(level+1, 'FORM', form) self._writeln(level+1, 'TITL', photo_obj.get_description()) self._writeln(level+1, 'FILE', path, limit=255) self._note_references(photo_obj.get_note_list(), level+1) def _place(self, place, level): """ PLACE_STRUCTURE:= n PLAC <PLACE_NAME> {1:1} +1 FORM <PLACE_HIERARCHY> {0:1} +1 FONE <PLACE_PHONETIC_VARIATION> {0:M} # not used +2 TYPE <PHONETIC_TYPE> {1:1} +1 ROMN <PLACE_ROMANIZED_VARIATION> {0:M} # not used +2 TYPE <ROMANIZED_TYPE> {1:1} +1 MAP {0:1} +2 LATI <PLACE_LATITUDE> {1:1} +2 LONG <PLACE_LONGITUDE> {1:1} +1 <<NOTE_STRUCTURE>> {0:M} """ if place is None: return place_name = place.get_title() self._writeln(level, "PLAC", place_name.replace('\r', ' '), limit=120) longitude = place.get_longitude() latitude = place.get_latitude() if longitude and latitude: (latitude, longitude) = conv_lat_lon(latitude, longitude, "GEDCOM") if longitude and latitude: self._writeln(level+1, "MAP") self._writeln(level+2, 'LATI', latitude) self._writeln(level+2, 'LONG', longitude) # The Gedcom standard shows that an optional address structure can # be written out in the event detail. # http://homepages.rootsweb.com/~pmcbride/gedcom/55gcch2.htm#EVENT_DETAIL location = get_main_location(self.dbase, place) street = location.get(PlaceType.STREET) locality = location.get(PlaceType.LOCALITY) city = location.get(PlaceType.CITY) state = location.get(PlaceType.STATE) country = location.get(PlaceType.COUNTRY) postal_code = place.get_code() if (street or locality or city or state or postal_code or country): self._writeln(level, "ADDR", street) if street: self._writeln(level + 1, 'ADR1', street) if locality: self._writeln(level + 1, 'ADR2', locality) if city: self._writeln(level + 1, 'CITY', city) if state: self._writeln(level + 1, 'STAE', state) if postal_code: self._writeln(level + 1, 'POST', postal_code) if country: self._writeln(level + 1, 'CTRY', country) self._note_references(place.get_note_list(), level+1) def __write_addr(self, level, addr): """ n ADDR <ADDRESS_LINE> {0:1} +1 CONT <ADDRESS_LINE> {0:M} +1 ADR1 <ADDRESS_LINE1> {0:1} (Street) +1 ADR2 <ADDRESS_LINE2> {0:1} (Locality) +1 CITY <ADDRESS_CITY> {0:1} +1 STAE <ADDRESS_STATE> {0:1} +1 POST <ADDRESS_POSTAL_CODE> {0:1} +1 CTRY <ADDRESS_COUNTRY> {0:1} This is done along the lines suggested by Tamura Jones in http://www.tamurajones.net/GEDCOMADDR.xhtml as a result of bug 6382. "GEDCOM writers should always use the structured address format, and it use it for all addresses, including the submitter address and their own corporate address." "Vendors that want their product to pass even the strictest GEDCOM validation, should include export to the old free-form format..." [This goes on to say the free-form should be an option, but we have not made it an option in Gramps]. @param level: The level number for the ADDR tag @type level: Integer @param addr: The location or address @type addr: [a super-type of] LocationBase """ if addr.get_street() or addr.get_locality() or addr.get_city() or \ addr.get_state() or addr.get_postal_code or addr.get_country(): self._writeln(level, 'ADDR', addr.get_street()) if addr.get_locality(): self._writeln(level + 1, 'CONT', addr.get_locality()) if addr.get_city(): self._writeln(level + 1, 'CONT', addr.get_city()) if addr.get_state(): self._writeln(level + 1, 'CONT', addr.get_state()) if addr.get_postal_code(): self._writeln(level + 1, 'CONT', addr.get_postal_code()) if addr.get_country(): self._writeln(level + 1, 'CONT', addr.get_country()) if addr.get_street(): self._writeln(level + 1, 'ADR1', addr.get_street()) if addr.get_locality(): self._writeln(level + 1, 'ADR2', addr.get_locality()) if addr.get_city(): self._writeln(level + 1, 'CITY', addr.get_city()) if addr.get_state(): self._writeln(level + 1, 'STAE', addr.get_state()) if addr.get_postal_code(): self._writeln(level + 1, 'POST', addr.get_postal_code()) if addr.get_country(): self._writeln(level + 1, 'CTRY', addr.get_country()) #------------------------------------------------------------------------- # # # #------------------------------------------------------------------------- def export_data(database, filename, user, option_box=None): """ External interface used to register with the plugin system. """ ret = False try: ged_write = GedcomWriter(database, user, option_box) ret = ged_write.write_gedcom_file(filename) except IOError as msg: msg2 = _("Could not create %s") % filename user.notify_error(msg2, str(msg)) except DatabaseError as msg: user.notify_db_error("%s\n%s" % (_("GEDCOM Export failed"), str(msg))) return ret
pmghalvorsen/gramps_branch
gramps/plugins/export/exportgedcom.py
Python
gpl-2.0
55,775
[ "Brian" ]
7a4bfe7e34fe46c9b11df3d09646a2225cf0976341badb047e93b7a45ac81782
# -*- coding: utf-8 -*- import vtk import xc_base import xc from miscUtils import LogMessages as lmsg import create_array_set_data __author__= "Luis C. Pérez Tato (LCPT) Ana Ortega (AO_O)" __copyright__= "Copyright 2015, LCPT AO_O" __license__= "GPL" __version__= "3.0" __email__= "l.pereztato@ciccp.es ana.Ortega@ciccp.es" def VtkDefineActorKPoint(recordGrid, renderer, radius): '''Returns a vtkActor to represent key-points in a rendering scene. It defines the scale, orientation, rendering properties, textures, ... :ivar recordGrid: unstructured grid (generic data set) to which incorporate the actor KPoint :ivar renderer: name of the renderer (lights, views, ...) to be used in the display :ivar radius: radius of the spheres to be employed in the KPoints representation ''' sphereSource= vtk.vtkSphereSource() sphereSource.SetRadius(radius) sphereSource.SetThetaResolution(5) sphereSource.SetPhiResolution(5) markKPts= vtk.vtkGlyph3D() markKPts.SetInputData(recordGrid.uGrid) markKPts.SetSourceData(sphereSource.GetOutput()) markKPts.ScalingOff() markKPts.OrientOff() mappKPts= vtk.vtkPolyDataMapper() mappKPts.SetInputData(markKPts.GetOutput()) visKPts= vtk.vtkActor() visKPts.SetMapper(mappKPts) visKPts.GetProperty().SetColor(.7, .5, .5) renderer.AddActor(visKPts) def VtkDefineActorCells(recordGrid, renderer, tipoRepr): ''' Actor for the surfaces.''' uGridMapper= vtk.vtkDataSetMapper() uGridMapper.SetInputData(recordGrid.uGrid) cellActor= vtk.vtkActor() cellActor.SetMapper(uGridMapper) cellActor.GetProperty().SetColor(1,1,0) if (tipoRepr=="points"): cellActor.GetProperty().SetRepresentationToPoints() elif(tipoRepr== "wireframe"): cellActor.GetProperty().SetRepresentationToWireframe() elif(tipoRepr== "surface"): cellActor.GetProperty().SetRepresentationToSurface() else: lmsg.error("error: "+tipoRepr+" no implementada.") renderer.AddActor(cellActor) # Actor para las celdas def VtkCargaIdsKPts(uGrid, setToDraw): etiqKPt= create_array_set_data.VtkCreaStrArraySetData(setToDraw,'pnts','nombre') uGrid.GetPointData().AddArray(etiqKPt) def VtkCargaIdsCells(uGrid, setToDraw, entTypeName): etiqCells= create_array_set_data.VtkCreaStrArraySetData(setToDraw,entTypeName,'nombre') uGrid.GetCellData().AddArray(etiqCells) def VtkDibujaIdsKPts(uGrid, setToDraw, renderer): '''Draw the point labels.''' numKPtsDI= setToDraw.getPoints.size if(numKPtsDI>0): ids= vtk.vtkIdFilter() ids.SetInput(uGrid) ids.CellIdsOff() ids.PointIdsOff() VtkCargaIdsKPts(uGrid,setToDraw) visPts= vtk.vtkSelectVisiblePoints() visPts.SetInputConnection(ids.GetOutputPort()) visPts.SetRenderer(renderer) visPts.SelectionWindowOff() #Create the mapper to display the point ids. Specify the format to # use for the labels. Also create the associated actor. ldm= vtk.vtkLabeledDataMapper() ldm.SetInputConnection(visPts.GetOutputPort()) ldm.GetLabelTextProperty().SetColor(0.1,0.1,0.1) pointLabels= vtk.vtkActor2D() pointLabels.SetMapper(ldm) renderer.AddActor2D(pointLabels) else: print "El conjunto: '",setToDraw,"' no tiene KPts." # ****** Creamos las etiquetas para las celdas ******* def VtkDibujaIdsCells(uGrid, setToDraw, entTypeName, renderer): ids= vtk.vtkIdFilter() ids.SetInput(uGrid) ids.CellIdsOff() ids.PointIdsOff() VtkCargaIdsCells(uGrid,setToDraw,entTypeName) # Dibuja las etiquetas de las líneas. cc= vtk.vtkCellCenters() cc.SetInputConnection(ids.GetOutputPort()) # Centroides de las celdas. visCells= vtk.vtkSelectVisiblePoints() visCells.SetInputConnection(cc.GetOutputPort()) visCells.SetRenderer(renderer) visCells.SelectionWindowOff() #Create the mapper to display the cell ids. Specify the format to # use for the labels. Also create the associated actor. cellMapper= vtk.vtkLabeledDataMapper() cellMapper.SetInputConnection(visCells.GetOutputPort()) cellMapper.GetLabelTextProperty().SetColor(0,0,0.9) cellLabels= vtk.vtkActor2D() cellLabels.SetMapper(cellMapper) renderer.AddActor2D(cellLabels) def VtkCargaMalla(recordGrid): kpoints= vtk.vtkPoints() # Definimos grid recordGrid.uGrid.SetPoints(kpoints) setToDraw= recordGrid.xcSet setToDraw.numerate() pnts= setToDraw.getPoints for p in pnts: kpoints.InsertPoint(p.getIdx,p.getPos.x,p.getPos.y,p.getPos.z) cellSet= setToDraw.getLines # cells are lines as default. if(recordGrid.cellType=="faces"): cellSet= setToDraw.getSurfaces elif (recordGrid.cellType=="bodies"): cellSet= setToDraw.getBodies for c in cellSet: vertices= xc_base.vector_int_to_py_list(c.getIdxVertices) vtx= vtk.vtkIdList() for vIndex in vertices: vtx.InsertNextId(vIndex) recordGrid.uGrid.InsertNextCell(c.getVtkCellType,vtx)
lcpt/xc
python_modules/postprocess/xcVtk/cad_mesh.py
Python
gpl-3.0
4,973
[ "VTK" ]
de5c572fbcf124bd7b00cc391aa12026d2b1139afba45e5ee46a30ddea66be21
""" @name: Modules/House/Family/Replink/_test/test_core.py @author: D. Brian Kimmel @contact: D.BrianKimmel@gmail.com @copyright: (c) 2020-2020 by D. Brian Kimmel @note: Created on Feb 2, 2020 @license: MIT License @summary: This Passed all 1 tests - DBK - 2019-12-29 """ __updated__ = '2020-02-02' # Import system type stuff from twisted.trial import unittest # Import PyMh files and modules. from _test.testing_mixin import SetupPyHouseObj from Modules.Core.Utilities.debug_tools import PrettyFormatAny class SetupMixin(object): """ """ def setUp(self): self.m_pyhouse_obj = SetupPyHouseObj().BuildPyHouseObj() class A0(unittest.TestCase): def test_00_Print(self): print('Id: test_setup_pyhouse') _x = PrettyFormatAny.form('_test', 'title', 190) # so it is defined when printing is cleaned up. # ## END DBK
DBrianKimmel/PyHouse
Project/src/Modules/House/Family/Reolink/_test/test_reolink_device.py
Python
mit
881
[ "Brian" ]
e341f25ea16a0794c6e52b4026568cb0e093615325f29bdc12cc196e726bbc35
import math from ClimateUtilities import * #To get the math methods routines # #All units are mks units # #ToDo: # * Add conversion factors (calories to joule,Megatons, etc.) # * Unit conversion calculating object # * Database of interesting constants (e.g energy and C # content of coal) # * Find a better way to organize database of contants, # allowing indexing,unit information and description # *Add the rest of the gases to the database, and find a # better way to index them and provide help. Note that # a printed table is more "transparent" in terms of what # data is available. Find a way of providing a similar # tabular summary of available data, and perhaps values # This applies to the planet data table as well, and perhaps # even to the table of physical constants. # # *Finish putting data into the gas database, # perhaps including Van der Waals, Shomate and Antoine # coefficients, at least in selected cases # # #-------------Basic physical constants------------------- # #The following five are the most accurate 1986 values # h = 6.626075540e-34 #Planck's constant c = 2.99792458e8 #Speed of light k =1.38065812e-23 #Boltzman thermodynamic constant sigma = 5.67051196e-8 #Stefan-Boltzman constant G = 6.67428e-11 #Gravitational constant (2006 measurements) # #-----------Thermodynamic constants------------ #Following will come out in J/(deg kmol), so #that dividing Rstar by molecular weight gives #gas constant appropriate for mks units N_avogadro = 6.022136736e23 #Avogadro's number Rstar = 1000.*k*N_avogadro #Universal gas constant # #----------Properties of gases----------------- #The following are approximate mean values #for "normal" temperatures and pressures, suitable only #for rough calculations. # #This class allows convenient access #to the basic thermodynamic properties of #a gas, and selected properties of its #solid and liquid phases. The properties #do not need to be specified in the __init__ #method, since they can be created dynamically. #We specify them anyway, and set them to None, #as a guide to the naming conventions for those #creating their own gas objects. A utility is also #available which will turn a LaTeX formatted thermodynamic table #into a Python script defining new gas objects. # # # #ToDo: *Add more documentation and help features # # *provide dictionary of properties and units. # *Add some methods or lists that make it easier # for the user to create new gas objects and insert # the data class gas: ''' A gas object stores thermodynamic data for a gas, and selected properties of its condensed phases. You can create a gas object for gas G by executing: G = gas() and then setting the attributes individually (see below for explanation of names). A collection of gas objects for common gases is provided as part of the phys module. These gas objects were not actually created "by hand" but rather using a utility script that automatically translates a LaTeX formatted table into a Python script defining the objects. Attributes of a gas object: CriticalPointT: Critical point temperature (K) CriticalPointP: Critical point pressure (Pa) TriplePointT: Triple point temperature (K) TriplePointP: Triple point pressure (Pa) L_vaporization_BoilingPoint: Latent heat of vaporization (J/kg) at boiling point. The so-called "boiling point" is the temperature at which the saturation vapor pressure equals 1 atmosphere (1.013 bar). For CO2, the "boiling point" occurs below the triple point temperature, so the condensed phase would not be a liquid. Hence, for CO2 the latent heat is given at the arbitrary reference point of 253K and 29Pa. L_vaporization_TriplePoint: Latent heat of vaporization (J/kg) at the triple point L_fusion: Latent heat of fusion (J/kg) at the triple point L_sublimation: Latent heat of sublimation (J/kg) at triple point rho_liquid_BoilingPoint Liquid phase density (kg/m**3) at the boiling point rho_liquid_TriplePoint: Liquid phase density (kg/m**3) at the triple point rho_solid: Solid phase density (kg/m**3) at (or sometimes near) the triple point cp: Gas phase specific heat (J/(kg K)), at 298K and 1 bar gamma: ratio of specific heat at constant pressure to specific heat at constant volume. (Generally stated at 298K and 1bar) MolecularWeight: Molecular weight of the dominant isotope name: Name of the gas formula: Chemical formula (e.g. 'CH4') L_vaporization: Default value to use for latent heat of vaporization. Set to triple point value, if available, else to boiling point value rho_liquid: Default value to use for liquid phase density. Set to triple point value if available otherwise set to boiling point value R: Gas constant for the individual gas. Computed from other data as Rstar/MolecularWeight, when the update() method is called Rcp: The adiabatic exponent R/cp. Computed from other data when the update() method is called. ''' #The __repr__ method allows us to print out #a help string when the user types the name #of a gas object def __repr__(self): firstline =\ 'This gas object contains thermodynamic data on %s\n'%self.formula secondline = \ 'Type \"help(gas)\" for more information\n' return firstline+secondline def __init__(self): self.CriticalPointT = None self.CriticalPointP = None self.TriplePointT = None self.TriplePointP = None self.L_vaporization_BoilingPoint = None self.L_vaporization_TriplePoint = None self.L_fusion = None self.L_sublimation = None self.rho_liquid_BoilingPoint = None self.rho_liquid_TriplePoint = None self.rho_solid = None self.cp = None self.gamma = None self.MolecularWeight = None self.name = None self.formula = None # #Default values for latent heat and liquid #density. The triple point value is set #as the default if it is available, otherwise #the boiling point values are used. self.L_vaporization= None self.rho_liquid= None # #Computed quantities # self.R = None self.Rcp = None #Function to compute derived properties def update(self): self.R = Rstar/self.MolecularWeight self.Rcp = self.R/self.cp #Set properties of individual gases # #Thermodynamic properties of dry Earth air air = gas() air.name = 'Earth Air' air.cp = 1004. air.MolecularWeight = 28.97 air.gamma = 1.4003 #------------------------ H2O = gas() H2O.CriticalPointT = 6.471000e+02 H2O.CriticalPointP = 2.210000e+07 H2O.TriplePointT = 2.731500e+02 H2O.TriplePointP = 6.110000e+02 H2O.L_vaporization_BoilingPoint = 2.255000e+06 H2O.L_vaporization_TriplePoint = 2.493000e+06 H2O.L_fusion = 3.340000e+05 H2O.L_sublimation = 2.840000e+06 H2O.rho_liquid_BoilingPoint = 9.584000e+02 H2O.rho_liquid_TriplePoint = 9.998700e+02 H2O.rho_solid = 9.170000e+02 H2O.cp = 1.847000e+03 H2O.gamma = 1.331000e+00 H2O.MolecularWeight = 1.800000e+01 H2O.name = 'Water' H2O.formula = 'H2O' H2O.L_vaporization=2.493000e+06 H2O.rho_liquid=9.998700e+02 #------------------------ CH4 = gas() CH4.CriticalPointT = 1.904400e+02 CH4.CriticalPointP = 4.596000e+06 CH4.TriplePointT = 9.067000e+01 CH4.TriplePointP = 1.170000e+04 CH4.L_vaporization_BoilingPoint = 5.100000e+05 CH4.L_vaporization_TriplePoint = 5.360000e+05 CH4.L_fusion = 5.868000e+04 CH4.L_sublimation = 5.950000e+05 CH4.rho_liquid_BoilingPoint = 4.502000e+02 CH4.rho_liquid_TriplePoint = None CH4.rho_solid = 5.093000e+02 CH4.cp = 2.195000e+03 CH4.gamma = 1.305000e+00 CH4.MolecularWeight = 1.600000e+01 CH4.name = 'Methane' CH4.formula = 'CH4' CH4.L_vaporization=5.360000e+05 CH4.rho_liquid=4.502000e+02 #------------------------ CO2 = gas() CO2.CriticalPointT = 3.042000e+02 CO2.CriticalPointP = 7.382500e+06 CO2.TriplePointT = 2.165400e+02 CO2.TriplePointP = 5.185000e+05 CO2.L_vaporization_BoilingPoint = None CO2.L_vaporization_TriplePoint = 3.970000e+05 CO2.L_fusion = 1.960000e+05 CO2.L_sublimation = 5.930000e+05 CO2.rho_liquid_BoilingPoint = 1.032000e+03 CO2.rho_liquid_TriplePoint = 1.110000e+03 CO2.rho_solid = 1.562000e+03 CO2.cp = 8.200000e+02 CO2.gamma = 1.294000e+00 CO2.MolecularWeight = 4.400000e+01 CO2.name = 'Carbon Dioxide' CO2.formula = 'CO2' CO2.L_vaporization=3.970000e+05 CO2.rho_liquid=1.110000e+03 #------------------------ N2 = gas() N2.CriticalPointT = 1.262000e+02 N2.CriticalPointP = 3.400000e+06 N2.TriplePointT = 6.314000e+01 N2.TriplePointP = 1.253000e+04 N2.L_vaporization_BoilingPoint = 1.980000e+05 N2.L_vaporization_TriplePoint = 2.180000e+05 N2.L_fusion = 2.573000e+04 N2.L_sublimation = 2.437000e+05 N2.rho_liquid_BoilingPoint = 8.086000e+02 N2.rho_liquid_TriplePoint = None N2.rho_solid = 1.026000e+03 N2.cp = 1.037000e+03 N2.gamma = 1.403000e+00 N2.MolecularWeight = 2.800000e+01 N2.name = 'Nitrogen' N2.formula = 'N2' N2.L_vaporization=2.180000e+05 N2.rho_liquid=8.086000e+02 #------------------------ O2 = gas() O2.CriticalPointT = 1.545400e+02 O2.CriticalPointP = 5.043000e+06 O2.TriplePointT = 5.430000e+01 O2.TriplePointP = 1.500000e+02 O2.L_vaporization_BoilingPoint = 2.130000e+05 O2.L_vaporization_TriplePoint = 2.420000e+05 O2.L_fusion = 1.390000e+04 O2.L_sublimation = 2.560000e+05 O2.rho_liquid_BoilingPoint = 1.141000e+03 O2.rho_liquid_TriplePoint = 1.307000e+03 O2.rho_solid = 1.351000e+03 O2.cp = 9.160000e+02 O2.gamma = 1.393000e+00 O2.MolecularWeight = 3.200000e+01 O2.name = 'Oxygen' O2.formula = 'O2' O2.L_vaporization=2.420000e+05 O2.rho_liquid=1.307000e+03 #------------------------ H2 = gas() H2.CriticalPointT = 3.320000e+01 H2.CriticalPointP = 1.298000e+06 H2.TriplePointT = 1.395000e+01 H2.TriplePointP = 7.200000e+03 H2.L_vaporization_BoilingPoint = 4.540000e+05 H2.L_vaporization_TriplePoint = None H2.L_fusion = 5.820000e+04 H2.L_sublimation = None H2.rho_liquid_BoilingPoint = 7.097000e+01 H2.rho_liquid_TriplePoint = None H2.rho_solid = 8.800000e+01 H2.cp = 1.423000e+04 H2.gamma = 1.384000e+00 H2.MolecularWeight = 2.000000e+00 H2.name = 'Hydrogen' H2.formula = 'H2' H2.L_vaporization=4.540000e+05 H2.rho_liquid=7.097000e+01 #------------------------ He = gas() He.CriticalPointT = 5.100000e+00 He.CriticalPointP = 2.280000e+05 He.TriplePointT = 2.170000e+00 He.TriplePointP = 5.070000e+03 He.L_vaporization_BoilingPoint = 2.030000e+04 He.L_vaporization_TriplePoint = None He.L_fusion = None He.L_sublimation = None He.rho_liquid_BoilingPoint = 1.249600e+02 He.rho_liquid_TriplePoint = None He.rho_solid = 2.000000e+02 He.cp = 5.196000e+03 He.gamma = 1.664000e+00 He.MolecularWeight = 4.000000e+00 He.name = 'Helium' He.formula = 'He' He.L_vaporization=2.030000e+04 He.rho_liquid=1.249600e+02 #------------------------ NH3 = gas() NH3.CriticalPointT = 4.055000e+02 NH3.CriticalPointP = 1.128000e+07 NH3.TriplePointT = 1.954000e+02 NH3.TriplePointP = 6.100000e+03 NH3.L_vaporization_BoilingPoint = 1.371000e+06 NH3.L_vaporization_TriplePoint = 1.658000e+06 NH3.L_fusion = 3.314000e+05 NH3.L_sublimation = 1.989000e+06 NH3.rho_liquid_BoilingPoint = 6.820000e+02 NH3.rho_liquid_TriplePoint = 7.342000e+02 NH3.rho_solid = 8.226000e+02 NH3.cp = 2.060000e+03 NH3.gamma = 1.309000e+00 NH3.MolecularWeight = 1.700000e+01 NH3.name = 'Ammonia' NH3.formula = 'NH3' NH3.L_vaporization=1.658000e+06 NH3.rho_liquid=7.342000e+02 #------------------------ #------------------------ #Synonym for H2O water = H2O #Make a list of all the gases # #This clever little fragment uses the fact that #Python can execute any string as a Python statement, #in order to find all the gases and build a list of them. #I don't know if there is a more straightforward way to #get a list of all the objects of a certain type, but this #works. Some of the trickery below is needed because #the dir() command returns a list of strings, which #give the names of the objects. It doesn't give the objects #themselves. gases = [] for ob in dir(): exec('isGas=isinstance('+ob+',gas)') if isGas: exec('gases.append('+ob+')') #Update all the gases for gas1 in gases: gas1.update() # # #----------------Radiation related functions------------- #Planck function (of frequency) def B(nu,T): u = min(h*nu/(k*T),500.) #To prevent overflow return (2.*h*nu**3/c**2)/(math.exp(u)-1.) # # #----------Saturation Vapor Pressure functions--------------- # #Saturation vapor pressure over ice (Smithsonian formula) # Input: Kelvin. Output: Pascal def satvpi(T): # # Compute es over ice (valid between -153 c and 0 c) # see smithsonian meteorological tables page 350 # # Original source: GFDL climate model, circa 1995 esbasi = 6107.1 tbasi = 273.16 # aa = -9.09718 *(tbasi/T-1.0) b = -3.56654 *math.log10(tbasi/T) c = 0.876793*(1.0-T/tbasi) e = math.log10(esbasi) esice = 10.**(aa+b+c+e) return .1*esice #Convert to Pascals #Saturation vapor pressure over liquid water (Smithsonian formula) # Input: Kelvin. Output: Pascal def satvpw(T): # compute es over liquid water between -20c and freezing. # see smithsonian meteorological tables page 350. # # Original source: GFDL climate model, circa 1995 esbasw = 1013246.0 tbasw = 373.16 # aa = -7.90298*(tbasw/T-1) b = 5.02808*math.log10(tbasw/T) c = -1.3816e-07*( 10.**( ((1-T/tbasw)*11.344)-1 ) ) d = 8.1328e-03*( 10.**( ((tbasw/T-1)*(-3.49149))-1) ) e = math.log10(esbasw) esh2O = 10.**(aa+b+c+d+e) return .1*esh2O #Convert to Pascals # An alternate formula for saturation vapor pressure over liquid water def satvpw_Heymsfield(T): ts=373.16 sr=3.0057166 # Vapor pressure over water. Heymsfield formula ar = ts/T br = 7.90298*(ar-1.) cr = 5.02808*math.log10(ar); dw = (1.3816E-07)*(10.**(11.344*(1.-1./ar))-1.) er = 8.1328E-03*((10.**(-(3.49149*(ar-1.))) )-1.) vp = 10.**(cr-dw+er+sr-br) vp=vp*1.0e02 return(vp) def satvpg(T): #This is the saturation vapor pressure computation used in the #GFDL climate model. It blends over from water saturation to #ice saturation as the temperature falls below 0C. if ((T-273.16) < -20.): return satvpi(T) if ( ((T-273.16) >= -20.)&((T-273.16)<=0.)): return 0.05*(273.16-T)*satvpi(T) + 0.05*(T-253.16)*satvpw(T) if ((T-273.16)>0.): return satvpw(T) #Saturation vapor pressure for any substance, computed using #the simplified form of Clausius-Clapeyron assuming the perfect #gas law and constant latent heat def satvps(T,T0,e0,MolecularWeight,LatentHeat): Rv=Rstar/MolecularWeight return e0*math.exp(-(LatentHeat/Rv)*(1./T - 1./T0)) #This example shows how to simplify the use of the simplified #saturation vapor pressure function, by setting up an object #that stores the thermodynamic data needed, so it doesn't have #to be re-entered each time. Because of the __call__ method, #once the object is created, it can be invoked like a regular #function. # #Usage example: # To set up a function e(T) that approximates the saturation # vapor presure for a substance which has a latent heat of # 2.5e6 J/kg, a molecular weight of 18 and has vapor pressure # 3589. Pa at a temperature of 300K, create the function using: # # e = satvps_function(300.,3589.,18.,2.5e6) # # and afterward you can invoke it simply as e(T), where T # is whatever temperature you want to evaluate it for. # #Alternately, satvps_function can be called with a gas object #as the first argument, e.g. # e = satvps_function(phys.CO2) # #If no other arguments are given, the latent heat of sublimation #will be used when e(T) is called for temperatures below the triple #point, and the latent heat of vaporization will be used for #temperatures above the triple point. To allow you to force #one or the other latent heats to be used, satvps_function takes #an optional second argument when the first argument is a gas #object. Thus, # e = satvps_function(phys.CO2,'ice') #will always use the latent heat of sublimation, regardless of T, #while e = satvps_function(phys.CO2,'liquid') will always use #the latent heat of vaporization. class satvps_function: def __init__(self,Gas_or_T0,e0_or_iceFlag=None,MolecularWeight=None,LatentHeat=None): #Check if the first argument is a gas object. If not, assume #that the arguments give T0, e0, etc. as numbers self.iceFlag = e0_or_iceFlag if isinstance(Gas_or_T0,gas): self.gas = Gas_or_T0 self.M = Gas_or_T0.MolecularWeight self.T0 = Gas_or_T0.TriplePointT self.e0 = Gas_or_T0.TriplePointP if self.iceFlag == 'ice': self.L = Gas_or_T0.L_sublimation elif self.iceFlag == 'liquid': self.L = Gas_or_T0.L_vaporization else: self.iceFlag = 'switch' self.M = Gas_or_T0.MolecularWeight else: self.L = LatentHeat self.M = MolecularWeight self.T0 = Gas_or_T0 self.e0 = e0_or_iceFlag def __call__(self,T): #Decide which latent heat to use if self.iceFlag == 'switch': if T<self.gas.TriplePointT: L = self.gas.L_sublimation else: L = self.gas.L_vaporization else: L = self.L return satvps(T,self.T0,self.e0,self.M,L) #Class for computing the moist adiabat for a mixture of #a condensing and noncondensing gas. # **ToDo: Add help strings and documentation # # **ToDo: The way the help strings for gas objects are # set up makes the argument help box for the # creator useless. Fix this somehow # #**ToDo: Add controls on resolution, top of atmosphere, etc. #Do we want this to return molar or mass concentration? #Maybe do both, but have result stored as an attribute # class MoistAdiabat: ''' MoistAdiabat is a class which creates a callable object used to compute the moist adiabat for a mixture consisting of a condensible gas and a noncondensing gas. The gases are specified as gas objects. By default, the condensible is water vapor and the noncondensible is modern Earth Air, if the gases are not specified. Usage: To create a function m that computes the moist adiabat for the gas Condensible mixed with the gas Noncondensible, do m = phys.MoistAdiabat(Condensible,Noncondensible) For example, to do a mixture of condensible CO2 in noncondensing N2, do m = phys.MoistAdiabat(phys.CO2,phys.N2) Once you have created the function, you give it the surface partial pressure of the noncondensible and the surface temperature when you call it, and it returns arrays consisting of pressure, temperature, molar concentration of the condensible, and mass specific concentration of the condensible. For example: p,T,molarCon,massCon = m(1.e5,300.) for a surface noncondensible pressure of 1.e5 Pascal and surface temperture of 300K. The values returned are arrays. The pressure returned is total pressure at each level (condensible plus noncondensible). By default, the compution chooses the pressure values on which to return the results. For some purposes, you might want the results specified on a list of pressures of your own choosing. The computation allows for this, by offering an interpolation option which returns the result interpolated to a pressure grid of your own choice, which is specified as an optional third argument to the function. Thus, to get the pressure values on a list consisting of [1000.,5000.,10000.] Pa, you would do: p,T,molarCon,massCon = m(1.e5,300.,[1000.,5000.,10000.]) The calculation is still done at high resolution to preserve accuracy, but the results are afterward intepolated to the grid you want using polynomial interpolation. For your convenience, the pressure returned on the left hand side is a copy of the pressure list you specified as input. ''' def __init__(self,condensible=H2O,noncon = air): self.condensible = condensible self.noncon = noncon #Set up saturation vapor pressure function self.satvp = satvps_function(condensible) #Set up thermodynamic constants self.eps = condensible.MolecularWeight/noncon.MolecularWeight self.L = condensible.L_vaporization self.Ra = noncon.R self.Rc = condensible.R self.cpa = noncon.cp self.cpc = condensible.cp #Set up derivative function for integrator def slope(logpa,logT): pa = math.exp(logpa) T = math.exp(logT) qsat = self.eps*(self.satvp(T)/pa) num = (1. + (self.L/(self.Ra*T))*qsat)*self.Ra den = self.cpa + (self.cpc + (self.L/(self.Rc*T) - 1.)*(self.L/T))*qsat return num/den self.slope = slope self.ptop = 1000. #Default top of atmosphere self.step = -.05 #Default step size for integration def __call__(self,ps,Ts,pgrid = None): #Initial conditions step = self.step #Step size for integration ptop = self.ptop #Where to stop integratoin # logpa = math.log(ps) logT = math.log(Ts) ad = integrator(self.slope,logpa,logT,step ) #Initialize lists to save results pL = [math.exp(logpa) + self.satvp(math.exp(logT))] molarConL = [self.satvp(math.exp(logT))/pL[0]] TL = [math.exp(logT)] #Integration loop p = 1.e30 #Dummy initial value, to get started while p > ptop: ans = ad.next() pa = math.exp(ans[0]) T = math.exp(ans[1]) p = pa+self.satvp(T) pL.append(p) molarConL.append(self.satvp(T)/p) TL.append(T) #Numeric.array turns lists into arrays that one #can do arithmetic on. pL = Numeric.array(pL) TL = Numeric.array(TL) molarConL = Numeric.array(molarConL) #Now compute mass specific concentration Mc = self.condensible.MolecularWeight Mnc = self.noncon.MolecularWeight Mbar = molarConL*Mc +(1.-molarConL)*Mnc qL = (Mc/Mbar)*molarConL # #The else clause below interpolates to a #specified pressure array pgrid, if desired. # interp is a class defined in ClimateUtilities #which creates a callable object which acts like #an interpolation function for the listed data give #as arguments. if pgrid == None: return pL,TL,molarConL,qL else: T1 = interp(pL,TL) mc1 = interp(pL,molarConL) q1 = interp(pL,qL) T = Numeric.array([T1(pp) for pp in pgrid]) mc = Numeric.array([mc1(pp) for pp in pgrid]) q = Numeric.array([q1(pp) for pp in pgrid]) return Numeric.array(pgrid),T, mc, q
aymeric-spiga/planets
reserve/phys.py
Python
gpl-2.0
23,846
[ "Avogadro" ]
5a44c0dd47ba128dc772bc987df17d62992363c414987dfc189c6bc5dc6595e5
from datetime import datetime from turbogears.database import PackageHub from sqlobject import * from turbogears import identity sqlhub.processConnection = connectionForURI("postgres://sweetter:sweetter@localhost/sweetter") # class YourDataClass(SQLObject): # pass # identity models. class Visit(SQLObject): """ A visit to your site """ class sqlmeta: table = 'visit' visit_key = StringCol(length=40, alternateID=True, alternateMethodName='by_visit_key') created = DateTimeCol(default=datetime.now) expiry = DateTimeCol() def lookup_visit(cls, visit_key): try: return cls.by_visit_key(visit_key) except SQLObjectNotFound: return None lookup_visit = classmethod(lookup_visit) class VisitIdentity(SQLObject): """ A Visit that is link to a User object """ class sqlmeta: table = 'visit_identity' visit_key = StringCol(length=40, alternateID=True, alternateMethodName='by_visit_key') user_id = IntCol() class Group(SQLObject): """ An ultra-simple group definition. """ # names like "Group", "Order" and "User" are reserved words in SQL # so we set the name to something safe for SQL class sqlmeta: table = 'tg_group' group_name = UnicodeCol(length=16, alternateID=True, alternateMethodName='by_group_name') display_name = UnicodeCol(length=255) created = DateTimeCol(default=datetime.now) # collection of all users belonging to this group users = RelatedJoin('User', intermediateTable='user_group', joinColumn='group_id', otherColumn='user_id') # collection of all permissions for this group permissions = RelatedJoin('Permission', joinColumn='group_id', intermediateTable='group_permission', otherColumn='permission_id') class Sweets(SQLObject): """ Users comments """ class sqlmeta: table = 'sweets' comment = UnicodeCol(length=160) created = DateTimeCol(default=datetime.now) votes = IntCol() user = ForeignKey('User',alternateMethodName='by_user_id', cascade=True) @classmethod def get_num_entries(cls, n=5): import datetime from sqlobject.sqlbuilder import * hoy = datetime.datetime.today() unasem = hoy + datetime.timedelta(days=-7) conn=cls._connection sel = conn.sqlrepr(Select((User.q.user_name,\ func.COUNT(Sweets.q.id)), AND(Sweets.q.userID == User.q.id,\ Sweets.q.created > unasem), \ groupBy=User.q.user_name, orderBy=-func.COUNT(Sweets.q.id))) try: tal = list(conn.queryAll(sel)[0:n]) except: tal = [] return tal @classmethod def get_num_entries_id(cls, uid): from sqlobject.sqlbuilder import * import sqlobject conn=cls._connection sel = conn.sqlrepr(Select((User.q.user_name,\ func.COUNT(Sweets.q.id)), \ sqlobject.AND(Sweets.q.userID == User.q.id, Sweets.q.userID == uid),\ groupBy=User.q.user_name, orderBy=-func.COUNT(Sweets.q.id))) tal = list(conn.queryAll(sel)) if len(tal) > 0: return tal[0] else: return ['', 0] class RSS(SQLObject): ''' micro planet ''' class sqlmeta: table = 'rss' user = ForeignKey('User', cascade=True) rss = UnicodeCol() tag = UnicodeCol(length=15) url = UnicodeCol() last_updated = DateTimeCol() unique = index.DatabaseIndex(user, rss, unique=True) class Followers(SQLObject): """ Relation between users """ class sqlmeta: table = 'followers' follower = ForeignKey('User', cascade=True) following = ForeignKey('User', cascade=True) unique = index.DatabaseIndex(follower, following, unique=True) class Todo(SQLObject): class sqlmeta: table = 'todo' sweetid = ForeignKey('Sweets', cascade=True) asigned = ForeignKey('User', cascade=True) doit = BoolCol() class UnvalidatedUsers (SQLObject): class sqlmeta: table = 'unvalidated_users' user = ForeignKey('User', cascade=True) key = UnicodeCol(length=20, alternateMethodName='by_key') class Recover(SQLObject): class sqlmeta: table = 'recover' user = ForeignKey('User', cascade=True) created = DateTimeCol(default=datetime.now) key = UnicodeCol(length=20, alternateMethodName='by_key') class Favorites (SQLObject): class sqlmeta: table = 'favorites' user = ForeignKey('User', cascade = True) sweet = ForeignKey('Sweets', cascade = True) unique = index.DatabaseIndex(user, sweet, unique = True) class Votes(SQLObject): class sqlmeta: table = 'votes' user = ForeignKey('User', cascade=True) sweet = ForeignKey('Sweets', cascade=True) unique = index.DatabaseIndex(user, sweet, unique=True) class Replies(SQLObject): class sqlmeta: table = "replies" sweet = ForeignKey('Sweets', cascade=True) to = ForeignKey('User', cascade=True) unique = index.DatabaseIndex(sweet, to, unique=True) class User(SQLObject): """ Reasonably basic User definition. Probably would want additional attributes. """ # names like "Group", "Order" and "User" are reserved words in SQL # so we set the name to something safe for SQL class sqlmeta: table = 'tg_user' user_name = UnicodeCol(length=20, alternateID=True, alternateMethodName='by_user_name') email_address = UnicodeCol(length=255, alternateID=True, alternateMethodName='by_email_address') url = UnicodeCol(length=255) api_key = UnicodeCol(length=32, alternateID=True) avatar = UnicodeCol(length=255) location = UnicodeCol(length=50, alternateMethodName='by_location') display_name = UnicodeCol(length=255) password = UnicodeCol(length=40) created = DateTimeCol(default=datetime.now) karma = FloatCol() nvotos = IntCol(default=0) nvotos_dia = IntCol(default=0) validated = BoolCol(default=0) # groups this user belongs to groups = RelatedJoin('Group', intermediateTable='user_group', joinColumn='user_id', otherColumn='group_id') def _get_permissions(self): perms = set() for g in self.groups: perms = perms | set(g.permissions) return perms def _set_password(self, cleartext_password): "Runs cleartext_password through the hash algorithm before saving." password_hash = identity.encrypt_password(cleartext_password) self._SO_set_password(password_hash) def set_password_raw(self, password): "Saves the password as-is to the database." self._SO_set_password(password) class Permission(SQLObject): """ A relationship that determines what each Group can do """ permission_name = UnicodeCol(length=16, alternateID=True, alternateMethodName='by_permission_name') description = UnicodeCol(length=255) groups = RelatedJoin('Group', intermediateTable='group_permission', joinColumn='permission_id', otherColumn='group_id') class Jabber(SQLObject): ''' Lista de usuarios con el jabberbot activo y sus correspondientes cuentas ''' class sqlmeta: table = 'jabber' user = ForeignKey('User', cascade=True) jabber = UnicodeCol(length=255, alternateID=True,\ alternateMethodName='by_jabber') created = DateTimeCol(default=datetime.now) validated = BoolCol(default=0) active = BoolCol(default=1) unique = index.DatabaseIndex(user, jabber, unique=True)
danigm/sweetter
sweetter/s2_to_s3/s2model.py
Python
agpl-3.0
7,917
[ "VisIt" ]
2b8edddd23d2bce33c593dc8dd8d41f17286e7ba352a0f9b21a0f706c10bb665
from Bio import ExPASy from Bio import SeqIO import numpy as np import csv AA_LETTERS = sorted("ACEDGFIHKMLNQPSRTWVY") # list all proteins in ecoli by uniprot_ID - aprse from .txt file def download_aa_dist_per_gene(UPID_list_fname, cutoff): UPID_list = [] for row in open(UPID_list_fname, 'r'): if row: UPID_list.append(row[48:54]) if cutoff > 0: UPID_list = UPID_list[0:min(cutoff, len(UPID_list))] # a dictionary containing the aa_dist for each uniprot ID UPID_to_aa_dist = {} for i, UPID in enumerate(UPID_list): print i, "\t", UPID # initialize a dictionary for amino acids frequency in each protein aa_dist = dict([(aa, 0) for aa in AA_LETTERS]) # call for aa sequence for each uniprot from swiss prot - biopython tool handle = ExPASy.get_sprot_raw(UPID) seq_record = SeqIO.read(handle, "swiss") # count frequency for each aa in each UPID # update aa_frequency in aa_dict - to avoid bugs where for example an aa seq from # swiss prot may contain weired letters such as 'X' for aa in list(seq_record): if aa in AA_LETTERS: aa_dist[aa] += 1 UPID_to_aa_dist[UPID] = np.array([aa_dist[aa] for aa in AA_LETTERS]) return UPID_to_aa_dist def load_UPID_to_aa_dist(aa_dist_by_gene_fname): input_csv = csv.reader(open(aa_dist_by_gene_fname, 'r'), delimiter='\t') input_csv.next() UPID_to_aa_dist = {} for row in input_csv: UPID = row[0] UPID_to_aa_dist[UPID] = np.array([float(x) for x in row[1:]]) return UPID_to_aa_dist def calculate_aa_dist_per_genome(UPID_to_aa_dist): genomic_aa_dist = np.zeros((1, len(AA_LETTERS))) for aa_dist in UPID_to_aa_dist.values(): genomic_aa_dist += aa_dist return genomic_aa_dist def write_to_tsv(header, dictionary, output_fname): # write output file output_csv = csv.writer(open(output_fname, 'w'), delimiter='\t') # header for output file output_csv.writerow(header) for key in dictionary.keys(): output_csv.writerow([key] + list(dictionary[key])) def calculate_aa_dist_per_proteome(proteome_fname, UPID_to_aa_dist): proteomics_csv_reader = csv.reader(open(proteome_fname, 'r'), delimiter='\t') # skip the first empty row proteomics_csv_reader.next() conditions = proteomics_csv_reader.next()[10:29] UPID_to_abundance_vectors = {} total_proteomic_aa_dist = np.zeros((len(conditions), len(AA_LETTERS))) for row in proteomics_csv_reader: if row[0]: # 19 different growth conditions UPID = row[1] UPID_to_abundance_vectors[UPID] = [float(x) for x in row[10:29]] for i, condition in enumerate(conditions): for UPID in UPID_to_aa_dist.keys(): aa_dist = UPID_to_aa_dist[UPID] if UPID in UPID_to_abundance_vectors: abundance = UPID_to_abundance_vectors[UPID] total_proteomic_aa_dist[i, :] += abundance[i] * aa_dist return total_proteomic_aa_dist def normalize_aa_dist(total_proteomic_aa_dist, conditions): total_proteomic_aa_dist_normed = a_normed = np.zeros((conditions, len(AA_LETTERS))) for i, row in enumerate(total_proteomic_aa_dist): total_proteomic_aa_dist_normed[i] = total_proteomic_aa_dist[i] / sum(total_proteomic_aa_dist[i]) return total_proteomic_aa_dist_normed if __name__ == "__main__": UPID_to_aa_dist = download_aa_dist_per_gene('all_ecoli_genes.txt',20) write_to_tsv(['UPID'] + AA_LETTERS, UPID_to_aa_dist, 'aa_dist_by_UP_ID.csv') aa_dist_genome = calculate_aa_dist_per_genome(UPID_to_aa_dist) total_proteomic_aa_dist = calculate_aa_dist_per_proteome('Ecoli_19_Conditions_Proteomics.csv', UPID_to_aa_dist) a = normalize_aa_dist(total_proteomic_aa_dist) print a
eladnoor/proteomaps
src/amino_acid_distribution/download_aa_sequences.py
Python
mit
4,068
[ "Biopython" ]
10a30ec9b648c0d787af1f9731188268d60325016dc787500861f9ce49987ae9
################################################################################ ## ## Pythonc--Python to C++ translator ## ## Copyright 2013 Zach Wegner, Matt Craighead ## ## This file is part of Pythonc. ## ## Pythonc is free software: you can redistribute it and/or modify ## it under the terms of the GNU General Public License as published by ## the Free Software Foundation, either version 3 of the License, or ## (at your option) any later version. ## ## Pythonc is distributed in the hope that it will be useful, ## but WITHOUT ANY WARRANTY; without even the implied warranty of ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the ## GNU General Public License for more details. ## ## You should have received a copy of the GNU General Public License ## along with Pythonc. If not, see <http://www.gnu.org/licenses/>. ## ################################################################################ import ast import os import sys import syntax inplace_op_table = { '__%s__' % x: '__i%s__' % x for x in ['add', 'and', 'floordiv', 'lshift', 'mod', 'mul', 'or', 'pow', 'rshift', 'sub', 'truediv', 'xor'] } class TranslateError(Exception): def __init__(self, node, msg): super().__init__('error at line %s: %s' % (node.lineno, msg)) class Transformer(ast.NodeTransformer): def __init__(self): self.statements = [] self.in_class = False self.in_function = False def generic_visit(self, node): raise TranslateError(node, 'can\'t translate %s' % node) def visit_child_list(self, node): r = [] for i in node: c = self.visit(i) if isinstance(c, list): r.extend(c) elif c is not None: r.append(c) return r def visit_Name(self, node): #assert isinstance(node.ctx, ast.Load) if node.id in ['True', 'False']: return syntax.BoolConst(node.id == 'True') elif node.id == 'None': return syntax.NoneConst() return syntax.Load(node.id) def visit_Num(self, node): if isinstance(node.n, float): raise TranslateError(node, 'Pythonc currently does not support float literals') assert isinstance(node.n, int) return syntax.IntConst(node.n) def visit_Str(self, node): assert isinstance(node.s, str) return syntax.StringConst(node.s) def visit_Bytes(self, node): assert isinstance(node.s, bytes) return syntax.BytesConst(node.s) # Unary Ops def visit_Invert(self, node): return '__invert__' def visit_Not(self, node): return '__not__' def visit_UAdd(self, node): return '__pos__' def visit_USub(self, node): return '__neg__' def visit_UnaryOp(self, node): op = self.visit(node.op) rhs = self.visit(node.operand) return syntax.UnaryOp(op, rhs) # Binary Ops def visit_Add(self, node): return '__add__' def visit_BitAnd(self, node): return '__and__' def visit_BitOr(self, node): return '__or__' def visit_BitXor(self, node): return '__xor__' def visit_Div(self, node): return '__truediv__' def visit_FloorDiv(self, node): return '__floordiv__' def visit_LShift(self, node): return '__lshift__' def visit_Mod(self, node): return '__mod__' def visit_Mult(self, node): return '__mul__' def visit_Pow(self, node): return '__pow__' def visit_RShift(self, node): return '__rshift__' def visit_Sub(self, node): return '__sub__' def visit_BinOp(self, node): op = self.visit(node.op) lhs = self.visit(node.left) rhs = self.visit(node.right) return syntax.BinaryOp(op, lhs, rhs) # Comparisons def visit_Eq(self, node): return '__eq__' def visit_NotEq(self, node): return '__ne__' def visit_Lt(self, node): return '__lt__' def visit_LtE(self, node): return '__le__' def visit_Gt(self, node): return '__gt__' def visit_GtE(self, node): return '__ge__' def visit_In(self, node): return '__contains__' def visit_NotIn(self, node): return '__ncontains__' def visit_Is(self, node): return '__is__' def visit_IsNot(self, node): return '__isnot__' def visit_Compare(self, node): assert len(node.ops) == 1 assert len(node.comparators) == 1 op = self.visit(node.ops[0]) lhs = self.visit(node.left) rhs = self.visit(node.comparators[0]) # Sigh--Python has these ordered weirdly if op in ['__contains__', '__ncontains__']: lhs, rhs = rhs, lhs return syntax.BinaryOp(op, lhs, rhs) # Bool ops def visit_And(self, node): return 'and' def visit_Or(self, node): return 'or' def visit_BoolOp(self, node): assert len(node.values) >= 2 op = self.visit(node.op) rhs = self.visit(node.values[-1]) for v in reversed(node.values[:-1]): lhs = self.visit(v) rhs = syntax.BoolOp(op, lhs, rhs) return rhs def visit_IfExp(self, node): expr = syntax.Test(self.visit(node.test)) true_expr = self.visit(node.body) false_expr = self.visit(node.orelse) return syntax.IfExp(expr, true_expr, false_expr) def visit_List(self, node): items = [self.visit(i) for i in node.elts] return syntax.List(items) def visit_Tuple(self, node): items = [self.visit(i) for i in node.elts] return syntax.Tuple(items) def visit_Dict(self, node): keys = [self.visit(i) for i in node.keys] values = [self.visit(i) for i in node.values] return syntax.Dict(keys, values) def visit_Set(self, node): items = [self.visit(i) for i in node.elts] return syntax.Set(items) def visit_Subscript(self, node): l = self.visit(node.value) if isinstance(node.slice, ast.Index): index = self.visit(node.slice.value) return syntax.Subscript(l, index) elif isinstance(node.slice, ast.Slice): [start, end, step] = [self.visit(a) if a else syntax.NoneConst() for a in [node.slice.lower, node.slice.upper, node.slice.step]] return syntax.Slice(l, start, end, step) def visit_Attribute(self, node): assert isinstance(node.ctx, ast.Load) l = self.visit(node.value) attr = syntax.Attribute(l, syntax.StringConst(node.attr)) return attr def visit_Call(self, node): fn = self.visit(node.func) if node.starargs: assert not node.args args = syntax.TupleFromIter(self.visit(node.starargs)) else: args = syntax.Tuple([self.visit(a) for a in node.args]) if node.kwargs: kwargs = self.visit(node.kwargs) else: kwargs = syntax.NullConst() if node.keywords: assert not node.kwargs keys = [syntax.StringConst(i.arg) for i in node.keywords] values = [self.visit(i.value) for i in node.keywords] kwargs = syntax.Dict(keys, values) return syntax.Call(fn, args, kwargs) def visit_Assign(self, node): # XXX will this always be unique? Should find a better # solution for this, regardless... temp = '__tuple_unpack_temp' stmts = [syntax.Store(temp, self.visit(node.value))] value = syntax.Load(temp) def assign_value(target, value): if isinstance(target, ast.Name): return [syntax.Store(target.id, value)] elif isinstance(target, ast.Tuple): stmts = [] for i, t in enumerate(target.elts): stmts += assign_value(t, syntax.Subscript(value, syntax.IntConst(i))) return stmts elif isinstance(target, ast.Attribute): base = self.visit(target.value) return [syntax.StoreAttr(base, syntax.StringConst(target.attr), value)] elif isinstance(target, ast.Subscript): assert isinstance(target.slice, ast.Index) base = self.visit(target.value) index = self.visit(target.slice.value) return [syntax.StoreSubscript(base, index, value)] else: assert False for target in reversed(node.targets): stmts += assign_value(target, value) return stmts def visit_AugAssign(self, node): op = self.visit(node.op) value = self.visit(node.value) op = inplace_op_table[op] if isinstance(node.target, ast.Name): target = node.target.id # XXX HACK: doesn't modify in place binop = syntax.BinaryOp(op, syntax.Load(target), value) return [syntax.Store(target, binop)] elif isinstance(node.target, ast.Attribute): l = self.visit(node.target.value) attr_name = syntax.StringConst(node.target.attr) attr = syntax.Attribute(l, attr_name) binop = syntax.BinaryOp(op, attr, value) return [syntax.StoreAttr(l, attr_name, binop)] elif isinstance(node.target, ast.Subscript): assert isinstance(node.target.slice, ast.Index) base = self.visit(node.target.value) index = self.visit(node.target.slice.value) old = syntax.Subscript(base, index) binop = syntax.BinaryOp(op, old, value) return [syntax.StoreSubscript(base, index, binop)] else: assert False def visit_Delete(self, node): assert len(node.targets) == 1 target = node.targets[0] assert isinstance(target, ast.Subscript) assert isinstance(target.slice, ast.Index) name = self.visit(target.value) value = self.visit(target.slice.value) return [syntax.DeleteSubscript(name, value)] def visit_If(self, node): expr = syntax.Test(self.visit(node.test)) stmts = self.visit_child_list(node.body) if node.orelse: else_block = self.visit_child_list(node.orelse) else: else_block = [] return syntax.If(expr, stmts, else_block) def visit_Break(self, node): return syntax.Break() def visit_Continue(self, node): return syntax.Continue() def visit_For(self, node): assert not node.orelse iter = self.visit(node.iter) stmts = self.visit_child_list(node.body) stmts.append(syntax.CollectGarbage(None)) if isinstance(node.target, ast.Name): target = node.target.id elif isinstance(node.target, ast.Tuple): target = [t.id for t in node.target.elts] else: assert False return syntax.For(target, iter, stmts) def visit_While(self, node): assert not node.orelse test = self.visit(node.test) test = syntax.If(syntax.Test(syntax.UnaryOp('__not__', test)), [syntax.Break()], []) stmts = [test] + self.visit_child_list(node.body) stmts.append(syntax.CollectGarbage(None)) return syntax.While(stmts) # XXX We are just flattening "with x as y:" into "y = x" (this works in some simple cases with open()). def visit_With(self, node): assert node.optional_vars expr = self.visit(node.context_expr) stmts = [syntax.Store(node.optional_vars.id, expr)] stmts += self.visit_child_list(node.body) return stmts def visit_Comprehension(self, node, comp_type): assert len(node.generators) == 1 gen = node.generators[0] assert len(gen.ifs) <= 1 if isinstance(gen.target, ast.Name): target = (gen.target.id) elif isinstance(gen.target, ast.Tuple): target = [(t.id) for t in gen.target.elts] else: assert False iter = self.visit(gen.iter) cond = None if gen.ifs: cond = self.visit(gen.ifs[0]) if comp_type == 'dict': expr = self.visit(node.key) expr2 = self.visit(node.value) else: expr = self.visit(node.elt) expr2 = None return syntax.Comprehension(comp_type, target, iter, cond, expr, expr2) def visit_ListComp(self, node): return self.visit_Comprehension(node, 'list') def visit_SetComp(self, node): return self.visit_Comprehension(node, 'set') def visit_DictComp(self, node): return self.visit_Comprehension(node, 'dict') def visit_GeneratorExp(self, node): return self.visit_Comprehension(node, 'generator') def visit_Return(self, node): if node.value is not None: expr = self.visit(node.value) self.statements.append(syntax.CollectGarbage(expr)) return syntax.Return(expr) else: return syntax.Return(None) def visit_Assert(self, node): expr = self.visit(node.test) return syntax.Assert(expr, node.lineno) def visit_Raise(self, node): assert not node.cause expr = self.visit(node.exc) return syntax.Raise(expr, node.lineno) def visit_arguments(self, node): assert not node.kwarg args = [a.arg for a in node.args] defaults = self.visit_child_list(node.defaults) if node.kwonlyargs: kwonlyargs = [a.arg for a in node.kwonlyargs] kw_defaults = self.visit_child_list(node.kw_defaults) else: kwonlyargs, kw_defaults = None, [] return syntax.Arguments(args, defaults, node.vararg, kwonlyargs, kw_defaults) def visit_FunctionDef(self, node): assert not self.in_function decorators = set() for decorator in node.decorator_list: assert isinstance(decorator, ast.Name) decorators.add(decorator.id) is_builtin = False if 'builtin' in decorators: decorators.remove('builtin') is_builtin = True assert not decorators # Set some state and recursively visit child nodes, then restore state self.in_function = True args = self.visit(node.args) body = [args] + self.visit_child_list(node.body) if not body or not isinstance(body[-1], syntax.Return): body.append(syntax.Return(None)) self.in_function = False exp_name = node.exp_name if 'exp_name' in dir(node) else None return syntax.FunctionDef(node.name, body, exp_name, is_builtin) def visit_ClassDef(self, node): assert not node.bases assert not node.keywords assert not node.starargs assert not node.kwargs assert not node.decorator_list assert not self.in_class assert not self.in_function for fn in node.body: if isinstance(fn, ast.FunctionDef): fn.exp_name = '_%s_%s' % (node.name, fn.name) self.in_class = True body = self.visit_child_list(node.body) self.in_class = False return syntax.ClassDef(node.name, body) def gen_import(self, node, name, from_names=None): if name in syntax.builtin_modules: assert not from_names module = syntax.SingletonRef('module_%s_singleton' % name) else: for d in (sys.path[0], '.'): path = '%s/%s.py' % (d, name) if os.path.exists(path): break else: raise TranslateError(node, 'cannot find %s' % path) stmts = transform(path, name == '__builtins__') path = os.path.abspath(path) module = syntax.ImportStatement(name, from_names, path, stmts) return module def visit_Import(self, node): statements = [] for name in node.names: module = self.gen_import(node, name.name) name = name.asname or name.name statements.append(syntax.Store(name, module)) return statements def visit_ImportFrom(self, node): assert not node.level assert '.' not in node.module # Empty list is a sentinel value for * if any('*' in name.name for name in node.names): assert len(node.names) == 1 from_names = [] else: from_names = [(name.name, name.asname or name.name) for name in node.names] return [self.gen_import(node, node.module, from_names=from_names)] def visit_Expr(self, node): return self.visit(node.value) def visit_Module(self, node): return self.visit_child_list(node.body) def visit_Global(self, node): return syntax.Global(node.names) def visit_Pass(self, node): pass def visit_Load(self, node): pass def visit_Store(self, node): pass def transform(path, builtin=False): with open(path) as f: text = f.read() # XXX HACK! this seems rather necessary at the moment, so the syntax # module can stay ast-module agnostic. if not builtin: text = 'from __builtins__ import *\n' + text node = ast.parse(text) return Transformer().visit(node) def compile(input_path, output_path): node = transform(input_path) syntax.write_output(node, output_path)
zwegner/pythonc
transform.py
Python
gpl-3.0
17,388
[ "VisIt" ]
af399d42c3da82e89a17768d38910f046db1eca0843528e83cde60de84fc083f
#!/usr/bin/python2 # vim: ts=4 : sts=4 : sw=4 : et : import sqlite3 import datetime import os.path import sys import wx from wx.lib.mixins.listctrl import ListCtrlAutoWidthMixin from wx.lib.mixins.listctrl import ColumnSorterMixin import version import survey import data import about galaxy_names = [ "Thustra's Eye", "In'Kar Border Region", "Ransuul's Flaming Sword", "Vulcan's Forge", "Crown of Othon", "Heart of Victorus", "House Zanathar", "Seven Ten", "Dyrathon's Retreat", "Fallen Legions of Muturon", "Indigo Sea", "Black Hole", "Core", "Muturon Encounter", "Vreenox Eclipse", "Andrometa Rising", "Falla's Embrace", "Shores of Hazeron", "Veil of Targoss", "Edge of the Rift", ] orbit_zones = [ 'Inferno Zone', 'Inner Zone', 'Habitable Zone', 'Outer Zone', 'Frigid Zone', ] body_kinds = [ 'Ringworld', 'Planet', 'Large Moon', 'Moon', 'Ring', 'Gas Giant', 'Star', ] class AutoWidthListCtrl(wx.ListCtrl, ListCtrlAutoWidthMixin): def __init__(self, parent): wx.ListCtrl.__init__(self, parent, wx.ID_ANY, style=wx.LC_REPORT) ListCtrlAutoWidthMixin.__init__(self) class SortedListCtrl(AutoWidthListCtrl, ColumnSorterMixin): def __init__(self, parent, data): AutoWidthListCtrl.__init__(self, parent) ColumnSorterMixin.__init__(self, len(data.values()[0])) self.itemDataMap = data def GetListCtrl(self): return self class ResultListCtrl(SortedListCtrl): def __init__(self, parent, data): SortedListCtrl.__init__(self, parent, data) #build the columns self.InsertColumn(0, 'name', width=140) self.InsertColumn(1, 'tl', wx.LIST_FORMAT_RIGHT, 50) self.InsertColumn(2, 'quality', wx.LIST_FORMAT_RIGHT, 60) self.InsertColumn(3, 'prev', wx.LIST_FORMAT_RIGHT, 60) self.InsertColumn(4, 'diameter', width=80) self.InsertColumn(5, 'kind', width=80) self.InsertColumn(6, 'type', width=80) self.InsertColumn(7, 'zone', width=50) self.InsertColumn(8, 'world', width=140) self.InsertColumn(9, 'system', width=140) self.InsertColumn(10, 'sector', width=140) self.InsertColumn(11, 'galaxy', width=140) self.InsertColumn(12, 'coords', width=80) #insert the data self.InsertData(data) def InsertData(self, data): items = data.items() for key, i in items: index = self.InsertStringItem(sys.maxint, i[0]) for k in range(1, len(i)): self.SetStringItem(index, k, i[k]) self.SetItemData(index, key) def SetData(self, data): self.DeleteAllItems() self.InsertData(data) self.itemDataMap = data class Menubar(wx.MenuBar): def __init__(self, parent): wx.MenuBar.__init__(self) fileMenu = wx.Menu() helpMenu = wx.Menu() fitem = fileMenu.Append(wx.ID_OPEN, 'Define DB', 'Define Database') parent.Bind(wx.EVT_MENU, parent.DefineDatabase, fitem) fitem = fileMenu.Append(wx.ID_REDO, 'Reprocess DB', 'Reprocess Database') parent.Bind(wx.EVT_MENU, parent.ReprocessDatabase, fitem) fitem = fileMenu.Append(wx.ID_CLEAR, 'Clear DB', 'Clear database') parent.Bind(wx.EVT_MENU, parent.ClearDatabase, fitem) fitem = fileMenu.Append(wx.ID_EXIT, 'Quit', 'Quit application') parent.Bind(wx.EVT_MENU, parent.OnQuit, fitem) hitem = helpMenu.Append(wx.ID_ABOUT, 'About', 'About application') parent.Bind(wx.EVT_MENU, parent.ShowAbout, hitem) self.Append(fileMenu, '&File') self.Append(helpMenu, '&Help') parent.SetMenuBar(self) class Toolbar(wx.BoxSizer): def __init__(self, parent, grandparent): wx.BoxSizer.__init__(self, wx.HORIZONTAL) #create the buttons self.add_button = wx.Button(parent, id=wx.ID_ADD, style=wx.BU_EXACTFIT) #add the buttons to the widget self.Add(self.add_button, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT) #bind the buttons to actions grandparent.Bind(wx.EVT_BUTTON, grandparent.AddFile, id=self.add_button.GetId()) class SearchControls(wx.BoxSizer): def __init__(self, parent, grandparent): wx.BoxSizer.__init__(self, wx.HORIZONTAL) resources = [ 'Air', 'Animal Carcass', 'Antiflux Particles', 'Beans', 'Bolite', 'Borexino Precipitate', 'Cheese', 'Coal', 'Cryozine', 'Crystals', 'Eggs', 'Eludium', 'Fertilizer', 'Fish', 'Fruit', 'Gems', 'Grain', 'Grapes', 'Herbs', 'Hops', 'Hydrogen', 'Ice', 'Ioplasma', 'Log', 'Lumenite', 'Magmex', 'Milk', 'Minerals', 'Myrathane', 'Natural Gas', 'Nuts', 'Oil', 'Ore', 'Phlogiston', 'Plant Fiber', 'Polytaride', 'Radioactives', 'Spices', 'Stone', 'Sunlight', 'Type A Preons', 'Type B Preons', 'Type F Preons', 'Type G Preons', 'Type K Preons', 'Type M Preons', 'Type O Preons', 'Vegetable', 'Vegetation Density', 'Vulcanite', 'Water in the Environment', ] name_l = wx.StaticText(parent, label="Name:") self.name_field = wx.ComboBox(parent, style=wx.TE_PROCESS_ENTER, choices=resources) tl_l = wx.StaticText(parent, label="Min TL:") self.tl_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) galaxy_l = wx.StaticText(parent, label="Galaxy:") self.galaxy_field = wx.ComboBox(parent, style=wx.TE_PROCESS_ENTER, choices=galaxy_names) self.orbit_field = wx.ListBox(parent, style=wx.LB_EXTENDED, choices=orbit_zones) self.body_field = wx.ListBox(parent, style=wx.LB_EXTENDED, choices=body_kinds) planet_l = wx.StaticText(parent, label="Planet:") self.planet_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) system_l = wx.StaticText(parent, label="System:") self.system_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) sector_l = wx.StaticText(parent, label="Sector:") self.sector_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) minsec_l = wx.StaticText(parent, label="Min Sec:") self.minsecx_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.minsecy_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.minsecz_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) maxsec_l = wx.StaticText(parent, label="Max Sec:") self.maxsecx_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.maxsecy_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.maxsecz_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) center_l = wx.StaticText(parent, label="Center Coords:") self.centerx_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.centery_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.centerz_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) radius_l = wx.StaticText(parent, label="Search Radius:") self.radius_field = wx.TextCtrl(parent, style=wx.TE_PROCESS_ENTER) self.reset_button = wx.Button(parent, id=wx.ID_CLEAR) self.search_button = wx.Button(parent, id=wx.ID_FIND) vbox_l = wx.BoxSizer(wx.VERTICAL) vbox_r = wx.BoxSizer(wx.VERTICAL) hbox_bodies = wx.BoxSizer(wx.HORIZONTAL) hbox_buttons = wx.BoxSizer(wx.HORIZONTAL) hbox1 = wx.BoxSizer(wx.HORIZONTAL) hbox2 = wx.BoxSizer(wx.HORIZONTAL) hbox3 = wx.BoxSizer(wx.HORIZONTAL) hbox4 = wx.BoxSizer(wx.HORIZONTAL) vbox_coords_ls = wx.BoxSizer(wx.VERTICAL) vbox_coords = wx.BoxSizer(wx.VERTICAL) vbox_radius = wx.BoxSizer(wx.VERTICAL) hbox_minsec = wx.BoxSizer(wx.HORIZONTAL) hbox_maxsec = wx.BoxSizer(wx.HORIZONTAL) hbox_center = wx.BoxSizer(wx.HORIZONTAL) hbox_radius = wx.BoxSizer(wx.HORIZONTAL) self.Add(vbox_l, proportion=3, flag=wx.EXPAND) self.Add(vbox_r, proportion=1, flag=wx.EXPAND) vbox_l.Add(hbox1, proportion=0, flag=wx.EXPAND) vbox_l.Add(hbox2, proportion=0, flag=wx.EXPAND) vbox_l.Add(hbox3, proportion=0, flag=wx.EXPAND) vbox_l.Add(hbox4, proportion=1, flag=wx.EXPAND) vbox_r.Add(hbox_bodies, proportion=1, flag=wx.EXPAND) hbox3.Add(vbox_coords_ls, proportion=0, flag=wx.LEFT, border=5) hbox3.Add(vbox_coords, proportion=1) hbox3.Add(vbox_radius, proportion=2) hbox4.Add(hbox_buttons, proportion=0, flag=wx.EXPAND) vbox_coords.Add(hbox_minsec, proportion=0, flag=wx.EXPAND) vbox_coords.Add(hbox_maxsec, proportion=0, flag=wx.EXPAND) vbox_radius.Add(hbox_center, proportion=0, flag=wx.EXPAND) vbox_radius.Add(hbox_radius, proportion=0, flag=wx.EXPAND) hbox1.Add(name_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox1.Add(self.name_field, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox1.Add(tl_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox1.Add(self.tl_field, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox1.Add(galaxy_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox1.Add(self.galaxy_field, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(planet_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(self.planet_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(system_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(self.system_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(sector_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox2.Add(self.sector_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) vbox_coords_ls.Add(minsec_l, proportion=1, flag=wx.ALIGN_LEFT|wx.TOP|wx.BOTTOM, border=5) vbox_coords_ls.Add(maxsec_l, proportion=1, flag=wx.ALIGN_LEFT|wx.TOP|wx.BOTTOM, border=5) hbox_minsec.Add(self.minsecx_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_minsec.Add(self.minsecy_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_minsec.Add(self.minsecz_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_maxsec.Add(self.maxsecx_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_maxsec.Add(self.maxsecy_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_maxsec.Add(self.maxsecz_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_center.Add(center_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_center.Add(self.centerx_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_center.Add(self.centery_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_center.Add(self.centerz_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_radius.Add(radius_l, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_radius.Add(self.radius_field, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_buttons.Add(self.reset_button, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_buttons.Add(self.search_button, proportion=0, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT, border=5) hbox_bodies.Add(self.orbit_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT|wx.EXPAND, border=5) hbox_bodies.Add(self.body_field, proportion=1, flag=wx.ALIGN_CENTER|wx.LEFT|wx.RIGHT|wx.EXPAND, border=5) #bind the search controls grandparent.Bind(wx.EVT_BUTTON, self.OnReset, id=self.reset_button.GetId()) grandparent.Bind(wx.EVT_BUTTON, grandparent.OnSearch, id=self.search_button.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.name_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.tl_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.galaxy_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.planet_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.system_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.sector_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.minsecx_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.minsecy_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.minsecz_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.maxsecx_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.maxsecy_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.maxsecz_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.centerx_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.centery_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.centerz_field.GetId()) grandparent.Bind(wx.EVT_TEXT_ENTER, grandparent.OnSearch, id=self.radius_field.GetId()) def OnReset(self, e): self.name_field.SetValue("") self.tl_field.SetValue("") self.galaxy_field.SetValue("") self.orbit_field.SetSelection(wx.NOT_FOUND) self.body_field.SetSelection(wx.NOT_FOUND) self.planet_field.SetValue("") self.system_field.SetValue("") self.sector_field.SetValue("") self.minsecx_field.SetValue("") self.minsecy_field.SetValue("") self.minsecz_field.SetValue("") self.maxsecx_field.SetValue("") self.maxsecy_field.SetValue("") self.maxsecz_field.SetValue("") self.centerx_field.SetValue("") self.centery_field.SetValue("") self.centerz_field.SetValue("") self.radius_field.SetValue("") class Galactiscan(wx.Frame): def __init__(self, *args, **kwargs): super(Galactiscan, self).__init__(*args, **kwargs) self.InitUI() def OnSearch(self, e): self.status.SetStatusText("Searching...") name = self.search_controls.name_field.GetValue() tl = self.search_controls.tl_field.GetValue() galaxy = self.search_controls.galaxy_field.GetValue() planet = self.search_controls.planet_field.GetValue() system = self.search_controls.system_field.GetValue() sector = self.search_controls.sector_field.GetValue() minsecx = self.search_controls.minsecx_field.GetValue() minsecy = self.search_controls.minsecy_field.GetValue() minsecz = self.search_controls.minsecz_field.GetValue() maxsecx = self.search_controls.maxsecx_field.GetValue() maxsecy = self.search_controls.maxsecy_field.GetValue() maxsecz = self.search_controls.maxsecz_field.GetValue() centerx = self.search_controls.centerx_field.GetValue() centery = self.search_controls.centery_field.GetValue() centerz = self.search_controls.centerz_field.GetValue() radius = self.search_controls.radius_field.GetValue() def values_from_indices(l, indices): ret = [] for i in indices: ret.append(l[i]) return ret orbits = values_from_indices(orbit_zones, self.search_controls.orbit_field.GetSelections()) bodies = values_from_indices(body_kinds, self.search_controls.body_field.GetSelections()) if name+tl+planet+system+sector != '': rows = data.find_resources(exactname=name, mintl=tl, orbit_zones=orbits, body_kinds=bodies, planet=planet, system=system, sector=sector, galaxy=galaxy, minsecx=minsecx, minsecy=minsecy, minsecz=minsecz, maxsecx=maxsecx, maxsecy=maxsecy, maxsecz=maxsecz, centerx=centerx, centery=centery, centerz=centerz, radius=radius, ) self.list.SetData(data.format_as_dict(rows)) self.status.SetStatusText("%d resources found" % len(rows)) def DefineDatabase(self, e): last_path = os.path.abspath(data.get_database_path()) last_dir, last_file = os.path.split(last_path) dialog = wx.FileDialog(self, message="Please select the file you wish to use.", style=wx.FD_SAVE, defaultDir=last_dir, defaultFile=last_file, wildcard='Database files (*.sqlite3)|*.sqlite3|All files|*', ) if dialog.ShowModal() == wx.ID_OK: path = dialog.GetPath() data.set_database_path(path) self.status.SetStatusText("Database set to %s" % path) else: self.status.SetStatusText("Database unchanged (%s)" % last_path) def AddFile(self, e): last_path = os.path.abspath(data.get_last_starmap_path()) last_dir, last_file = os.path.split(last_path) dialog = wx.FileDialog(self, message="Please select the files you wish to process.", style=wx.FD_OPEN|wx.FD_MULTIPLE|wx.FD_FILE_MUST_EXIST, defaultDir=last_dir, defaultFile=last_file, wildcard='XML files (*.xml)|*.xml|All files|*', ) if dialog.ShowModal() == wx.ID_OK: paths = dialog.GetPaths() data.set_last_starmap_path(paths[-1]) self.status.SetStatusText("Now processing %s files..." % len(paths)) count = data.add_files(paths) self.status.SetStatusText("%s surveys added" % count) else: self.status.SetStatusText("No surveys added") def ReprocessDatabase(self, e): #TODO: This is very slow; make it asynchronous and add a progress meter. self.status.SetStatusText("Reprocessing database...") count = data.add_files_from_internal_raws() if count > 0: self.status.SetStatusText("%s surveys added" % count) else: self.status.SetStatusText("No surveys added") def ClearDatabase(self, e): self.status.SetStatusText("Clearing database...") data.drop_tables() self.status.SetStatusText("Database cleared") #def OnPaste(self, e): # if not wx.TheClipboard.Open(): # #maybe it is already open, so close it and try again # wx.TheClipboard.Close() # if not wx.TheClipboard.Open(): # #give up # self.status.SetStatusText("Could not open clipboard") # return # if wx.TheClipboard.IsSupported(wx.DataFormat(wx.DF_TEXT)): # self.status.SetStatusText("Processing clipboard...") # data_object = wx.TextDataObject() # wx.TheClipboard.GetData(data_object) # count = data.add_text(data_object.GetText()) # self.status.SetStatusText("%s surveys added from clipboard" % count) # else: # self.status.SetStatusText("Text is not supported by the clipboard") # wx.TheClipboard.Close() def OnResize(self, e): #save the new dimensions wx.Config.Get().WriteInt('/window/width', e.GetSize()[0]) wx.Config.Get().WriteInt('/window/height', e.GetSize()[1]) #allow normal event code to run e.Skip() def ShowAbout(self, e): self.about.Show(True) def InitUI(self): self.SetTitle(version.fancy_name) if wx.Config.Get().HasEntry('/window/width'): size = (wx.Config.Get().ReadInt('/window/width'), wx.Config.Get().ReadInt('/window/height')) else: size = (1000, 400) self.SetSize(size) self.Bind(wx.EVT_SIZE, self.OnResize, self) #set up the menus self.menubar = Menubar(self) #set up the about window self.about = about.AboutWindow(self) #set up the panel panel = wx.Panel(self) main_vbox = wx.BoxSizer(wx.VERTICAL) panel.SetSizer(main_vbox) #add the toolbar self.toolbar = Toolbar(panel, self) main_vbox.Add(self.toolbar, proportion=0, flag=wx.TOP|wx.BOTTOM|wx.EXPAND, border=0) #the main viewing area stuff = { 0 : ('', '', '', '', '', '', '', '', '', '', '', '', ''), } self.list = ResultListCtrl(panel, stuff) main_vbox.Add(self.list, proportion=1, flag=wx.EXPAND) #add the search controls self.search_controls = SearchControls(panel, self) main_vbox.Add(self.search_controls, proportion=0, flag=wx.TOP|wx.BOTTOM|wx.EXPAND, border=0) #the status bar self.status = wx.StatusBar(panel) self.status.SetFieldsCount(1) self.status.SetStatusStyles([wx.SB_FLAT]) self.status.SetStatusText("Welcome to %s" % (version.fancy_string)) main_vbox.Add(self.status, proportion=0, flag=wx.EXPAND, border=0) self.Show(True) def OnQuit(self, e): self.Close() def main(): Galactiscan(None)
pizzasgood/galactiscan
gui.py
Python
gpl-3.0
22,558
[ "Galaxy" ]
5e21048435b5e88b7a7355998f35d07985259468b79ad2c8f2fd7d673b0a9f93
# cmdutil.py - help for command processing in mercurial # # Copyright 2005-2007 Matt Mackall <mpm@selenic.com> # # This software may be used and distributed according to the terms of the # GNU General Public License version 2 or any later version. from node import hex, nullid, nullrev, short from i18n import _ import os, sys, errno, re, tempfile import util, scmutil, templater, patch, error, templatekw, revlog, copies import match as matchmod import subrepo, context, repair, graphmod, revset, phases, obsolete, pathutil import changelog import bookmarks import lock as lockmod def parsealiases(cmd): return cmd.lstrip("^").split("|") def findpossible(cmd, table, strict=False): """ Return cmd -> (aliases, command table entry) for each matching command. Return debug commands (or their aliases) only if no normal command matches. """ choice = {} debugchoice = {} if cmd in table: # short-circuit exact matches, "log" alias beats "^log|history" keys = [cmd] else: keys = table.keys() for e in keys: aliases = parsealiases(e) found = None if cmd in aliases: found = cmd elif not strict: for a in aliases: if a.startswith(cmd): found = a break if found is not None: if aliases[0].startswith("debug") or found.startswith("debug"): debugchoice[found] = (aliases, table[e]) else: choice[found] = (aliases, table[e]) if not choice and debugchoice: choice = debugchoice return choice def findcmd(cmd, table, strict=True): """Return (aliases, command table entry) for command string.""" choice = findpossible(cmd, table, strict) if cmd in choice: return choice[cmd] if len(choice) > 1: clist = choice.keys() clist.sort() raise error.AmbiguousCommand(cmd, clist) if choice: return choice.values()[0] raise error.UnknownCommand(cmd) def findrepo(p): while not os.path.isdir(os.path.join(p, ".hg")): oldp, p = p, os.path.dirname(p) if p == oldp: return None return p def bailifchanged(repo): if repo.dirstate.p2() != nullid: raise util.Abort(_('outstanding uncommitted merge')) modified, added, removed, deleted = repo.status()[:4] if modified or added or removed or deleted: raise util.Abort(_('uncommitted changes')) ctx = repo[None] for s in sorted(ctx.substate): if ctx.sub(s).dirty(): raise util.Abort(_("uncommitted changes in subrepo %s") % s) def logmessage(ui, opts): """ get the log message according to -m and -l option """ message = opts.get('message') logfile = opts.get('logfile') if message and logfile: raise util.Abort(_('options --message and --logfile are mutually ' 'exclusive')) if not message and logfile: try: if logfile == '-': message = ui.fin.read() else: message = '\n'.join(util.readfile(logfile).splitlines()) except IOError, inst: raise util.Abort(_("can't read commit message '%s': %s") % (logfile, inst.strerror)) return message def loglimit(opts): """get the log limit according to option -l/--limit""" limit = opts.get('limit') if limit: try: limit = int(limit) except ValueError: raise util.Abort(_('limit must be a positive integer')) if limit <= 0: raise util.Abort(_('limit must be positive')) else: limit = None return limit def makefilename(repo, pat, node, desc=None, total=None, seqno=None, revwidth=None, pathname=None): node_expander = { 'H': lambda: hex(node), 'R': lambda: str(repo.changelog.rev(node)), 'h': lambda: short(node), 'm': lambda: re.sub('[^\w]', '_', str(desc)) } expander = { '%': lambda: '%', 'b': lambda: os.path.basename(repo.root), } try: if node: expander.update(node_expander) if node: expander['r'] = (lambda: str(repo.changelog.rev(node)).zfill(revwidth or 0)) if total is not None: expander['N'] = lambda: str(total) if seqno is not None: expander['n'] = lambda: str(seqno) if total is not None and seqno is not None: expander['n'] = lambda: str(seqno).zfill(len(str(total))) if pathname is not None: expander['s'] = lambda: os.path.basename(pathname) expander['d'] = lambda: os.path.dirname(pathname) or '.' expander['p'] = lambda: pathname newname = [] patlen = len(pat) i = 0 while i < patlen: c = pat[i] if c == '%': i += 1 c = pat[i] c = expander[c]() newname.append(c) i += 1 return ''.join(newname) except KeyError, inst: raise util.Abort(_("invalid format spec '%%%s' in output filename") % inst.args[0]) def makefileobj(repo, pat, node=None, desc=None, total=None, seqno=None, revwidth=None, mode='wb', modemap=None, pathname=None): writable = mode not in ('r', 'rb') if not pat or pat == '-': fp = writable and repo.ui.fout or repo.ui.fin if util.safehasattr(fp, 'fileno'): return os.fdopen(os.dup(fp.fileno()), mode) else: # if this fp can't be duped properly, return # a dummy object that can be closed class wrappedfileobj(object): noop = lambda x: None def __init__(self, f): self.f = f def __getattr__(self, attr): if attr == 'close': return self.noop else: return getattr(self.f, attr) return wrappedfileobj(fp) if util.safehasattr(pat, 'write') and writable: return pat if util.safehasattr(pat, 'read') and 'r' in mode: return pat fn = makefilename(repo, pat, node, desc, total, seqno, revwidth, pathname) if modemap is not None: mode = modemap.get(fn, mode) if mode == 'wb': modemap[fn] = 'ab' return open(fn, mode) def openrevlog(repo, cmd, file_, opts): """opens the changelog, manifest, a filelog or a given revlog""" cl = opts['changelog'] mf = opts['manifest'] msg = None if cl and mf: msg = _('cannot specify --changelog and --manifest at the same time') elif cl or mf: if file_: msg = _('cannot specify filename with --changelog or --manifest') elif not repo: msg = _('cannot specify --changelog or --manifest ' 'without a repository') if msg: raise util.Abort(msg) r = None if repo: if cl: r = repo.changelog elif mf: r = repo.manifest elif file_: filelog = repo.file(file_) if len(filelog): r = filelog if not r: if not file_: raise error.CommandError(cmd, _('invalid arguments')) if not os.path.isfile(file_): raise util.Abort(_("revlog '%s' not found") % file_) r = revlog.revlog(scmutil.opener(os.getcwd(), audit=False), file_[:-2] + ".i") return r def copy(ui, repo, pats, opts, rename=False): # called with the repo lock held # # hgsep => pathname that uses "/" to separate directories # ossep => pathname that uses os.sep to separate directories cwd = repo.getcwd() targets = {} after = opts.get("after") dryrun = opts.get("dry_run") wctx = repo[None] def walkpat(pat): srcs = [] badstates = after and '?' or '?r' m = scmutil.match(repo[None], [pat], opts, globbed=True) for abs in repo.walk(m): state = repo.dirstate[abs] rel = m.rel(abs) exact = m.exact(abs) if state in badstates: if exact and state == '?': ui.warn(_('%s: not copying - file is not managed\n') % rel) if exact and state == 'r': ui.warn(_('%s: not copying - file has been marked for' ' remove\n') % rel) continue # abs: hgsep # rel: ossep srcs.append((abs, rel, exact)) return srcs # abssrc: hgsep # relsrc: ossep # otarget: ossep def copyfile(abssrc, relsrc, otarget, exact): abstarget = pathutil.canonpath(repo.root, cwd, otarget) if '/' in abstarget: # We cannot normalize abstarget itself, this would prevent # case only renames, like a => A. abspath, absname = abstarget.rsplit('/', 1) abstarget = repo.dirstate.normalize(abspath) + '/' + absname reltarget = repo.pathto(abstarget, cwd) target = repo.wjoin(abstarget) src = repo.wjoin(abssrc) state = repo.dirstate[abstarget] scmutil.checkportable(ui, abstarget) # check for collisions prevsrc = targets.get(abstarget) if prevsrc is not None: ui.warn(_('%s: not overwriting - %s collides with %s\n') % (reltarget, repo.pathto(abssrc, cwd), repo.pathto(prevsrc, cwd))) return # check for overwrites exists = os.path.lexists(target) samefile = False if exists and abssrc != abstarget: if (repo.dirstate.normalize(abssrc) == repo.dirstate.normalize(abstarget)): if not rename: ui.warn(_("%s: can't copy - same file\n") % reltarget) return exists = False samefile = True if not after and exists or after and state in 'mn': if not opts['force']: ui.warn(_('%s: not overwriting - file exists\n') % reltarget) return if after: if not exists: if rename: ui.warn(_('%s: not recording move - %s does not exist\n') % (relsrc, reltarget)) else: ui.warn(_('%s: not recording copy - %s does not exist\n') % (relsrc, reltarget)) return elif not dryrun: try: if exists: os.unlink(target) targetdir = os.path.dirname(target) or '.' if not os.path.isdir(targetdir): os.makedirs(targetdir) if samefile: tmp = target + "~hgrename" os.rename(src, tmp) os.rename(tmp, target) else: util.copyfile(src, target) srcexists = True except IOError, inst: if inst.errno == errno.ENOENT: ui.warn(_('%s: deleted in working copy\n') % relsrc) srcexists = False else: ui.warn(_('%s: cannot copy - %s\n') % (relsrc, inst.strerror)) return True # report a failure if ui.verbose or not exact: if rename: ui.status(_('moving %s to %s\n') % (relsrc, reltarget)) else: ui.status(_('copying %s to %s\n') % (relsrc, reltarget)) targets[abstarget] = abssrc # fix up dirstate scmutil.dirstatecopy(ui, repo, wctx, abssrc, abstarget, dryrun=dryrun, cwd=cwd) if rename and not dryrun: if not after and srcexists and not samefile: util.unlinkpath(repo.wjoin(abssrc)) wctx.forget([abssrc]) # pat: ossep # dest ossep # srcs: list of (hgsep, hgsep, ossep, bool) # return: function that takes hgsep and returns ossep def targetpathfn(pat, dest, srcs): if os.path.isdir(pat): abspfx = pathutil.canonpath(repo.root, cwd, pat) abspfx = util.localpath(abspfx) if destdirexists: striplen = len(os.path.split(abspfx)[0]) else: striplen = len(abspfx) if striplen: striplen += len(os.sep) res = lambda p: os.path.join(dest, util.localpath(p)[striplen:]) elif destdirexists: res = lambda p: os.path.join(dest, os.path.basename(util.localpath(p))) else: res = lambda p: dest return res # pat: ossep # dest ossep # srcs: list of (hgsep, hgsep, ossep, bool) # return: function that takes hgsep and returns ossep def targetpathafterfn(pat, dest, srcs): if matchmod.patkind(pat): # a mercurial pattern res = lambda p: os.path.join(dest, os.path.basename(util.localpath(p))) else: abspfx = pathutil.canonpath(repo.root, cwd, pat) if len(abspfx) < len(srcs[0][0]): # A directory. Either the target path contains the last # component of the source path or it does not. def evalpath(striplen): score = 0 for s in srcs: t = os.path.join(dest, util.localpath(s[0])[striplen:]) if os.path.lexists(t): score += 1 return score abspfx = util.localpath(abspfx) striplen = len(abspfx) if striplen: striplen += len(os.sep) if os.path.isdir(os.path.join(dest, os.path.split(abspfx)[1])): score = evalpath(striplen) striplen1 = len(os.path.split(abspfx)[0]) if striplen1: striplen1 += len(os.sep) if evalpath(striplen1) > score: striplen = striplen1 res = lambda p: os.path.join(dest, util.localpath(p)[striplen:]) else: # a file if destdirexists: res = lambda p: os.path.join(dest, os.path.basename(util.localpath(p))) else: res = lambda p: dest return res pats = scmutil.expandpats(pats) if not pats: raise util.Abort(_('no source or destination specified')) if len(pats) == 1: raise util.Abort(_('no destination specified')) dest = pats.pop() destdirexists = os.path.isdir(dest) and not os.path.islink(dest) if not destdirexists: if len(pats) > 1 or matchmod.patkind(pats[0]): raise util.Abort(_('with multiple sources, destination must be an ' 'existing directory')) if util.endswithsep(dest): raise util.Abort(_('destination %s is not a directory') % dest) tfn = targetpathfn if after: tfn = targetpathafterfn copylist = [] for pat in pats: srcs = walkpat(pat) if not srcs: continue copylist.append((tfn(pat, dest, srcs), srcs)) if not copylist: raise util.Abort(_('no files to copy')) errors = 0 for targetpath, srcs in copylist: for abssrc, relsrc, exact in srcs: if copyfile(abssrc, relsrc, targetpath(abssrc), exact): errors += 1 if errors: ui.warn(_('(consider using --after)\n')) return errors != 0 def service(opts, parentfn=None, initfn=None, runfn=None, logfile=None, runargs=None, appendpid=False): '''Run a command as a service.''' def writepid(pid): if opts['pid_file']: mode = appendpid and 'a' or 'w' fp = open(opts['pid_file'], mode) fp.write(str(pid) + '\n') fp.close() if opts['daemon'] and not opts['daemon_pipefds']: # Signal child process startup with file removal lockfd, lockpath = tempfile.mkstemp(prefix='hg-service-') os.close(lockfd) try: if not runargs: runargs = util.hgcmd() + sys.argv[1:] runargs.append('--daemon-pipefds=%s' % lockpath) # Don't pass --cwd to the child process, because we've already # changed directory. for i in xrange(1, len(runargs)): if runargs[i].startswith('--cwd='): del runargs[i] break elif runargs[i].startswith('--cwd'): del runargs[i:i + 2] break def condfn(): return not os.path.exists(lockpath) pid = util.rundetached(runargs, condfn) if pid < 0: raise util.Abort(_('child process failed to start')) writepid(pid) finally: try: os.unlink(lockpath) except OSError, e: if e.errno != errno.ENOENT: raise if parentfn: return parentfn(pid) else: return if initfn: initfn() if not opts['daemon']: writepid(os.getpid()) if opts['daemon_pipefds']: lockpath = opts['daemon_pipefds'] try: os.setsid() except AttributeError: pass os.unlink(lockpath) util.hidewindow() sys.stdout.flush() sys.stderr.flush() nullfd = os.open(os.devnull, os.O_RDWR) logfilefd = nullfd if logfile: logfilefd = os.open(logfile, os.O_RDWR | os.O_CREAT | os.O_APPEND) os.dup2(nullfd, 0) os.dup2(logfilefd, 1) os.dup2(logfilefd, 2) if nullfd not in (0, 1, 2): os.close(nullfd) if logfile and logfilefd not in (0, 1, 2): os.close(logfilefd) if runfn: return runfn() def export(repo, revs, template='hg-%h.patch', fp=None, switch_parent=False, opts=None): '''export changesets as hg patches.''' total = len(revs) revwidth = max([len(str(rev)) for rev in revs]) filemode = {} def single(rev, seqno, fp): ctx = repo[rev] node = ctx.node() parents = [p.node() for p in ctx.parents() if p] branch = ctx.branch() if switch_parent: parents.reverse() prev = (parents and parents[0]) or nullid shouldclose = False if not fp and len(template) > 0: desc_lines = ctx.description().rstrip().split('\n') desc = desc_lines[0] #Commit always has a first line. fp = makefileobj(repo, template, node, desc=desc, total=total, seqno=seqno, revwidth=revwidth, mode='wb', modemap=filemode) if fp != template: shouldclose = True if fp and fp != sys.stdout and util.safehasattr(fp, 'name'): repo.ui.note("%s\n" % fp.name) if not fp: write = repo.ui.write else: def write(s, **kw): fp.write(s) write("# HG changeset patch\n") write("# User %s\n" % ctx.user()) write("# Date %d %d\n" % ctx.date()) write("# %s\n" % util.datestr(ctx.date())) if branch and branch != 'default': write("# Branch %s\n" % branch) write("# Node ID %s\n" % hex(node)) write("# Parent %s\n" % hex(prev)) if len(parents) > 1: write("# Parent %s\n" % hex(parents[1])) write(ctx.description().rstrip()) write("\n\n") for chunk, label in patch.diffui(repo, prev, node, opts=opts): write(chunk, label=label) if shouldclose: fp.close() for seqno, rev in enumerate(revs): single(rev, seqno + 1, fp) def diffordiffstat(ui, repo, diffopts, node1, node2, match, changes=None, stat=False, fp=None, prefix='', listsubrepos=False): '''show diff or diffstat.''' if fp is None: write = ui.write else: def write(s, **kw): fp.write(s) if stat: diffopts = diffopts.copy(context=0) width = 80 if not ui.plain(): width = ui.termwidth() chunks = patch.diff(repo, node1, node2, match, changes, diffopts, prefix=prefix) for chunk, label in patch.diffstatui(util.iterlines(chunks), width=width, git=diffopts.git): write(chunk, label=label) else: for chunk, label in patch.diffui(repo, node1, node2, match, changes, diffopts, prefix=prefix): write(chunk, label=label) if listsubrepos: ctx1 = repo[node1] ctx2 = repo[node2] for subpath, sub in subrepo.itersubrepos(ctx1, ctx2): tempnode2 = node2 try: if node2 is not None: tempnode2 = ctx2.substate[subpath][1] except KeyError: # A subrepo that existed in node1 was deleted between node1 and # node2 (inclusive). Thus, ctx2's substate won't contain that # subpath. The best we can do is to ignore it. tempnode2 = None submatch = matchmod.narrowmatcher(subpath, match) sub.diff(ui, diffopts, tempnode2, submatch, changes=changes, stat=stat, fp=fp, prefix=prefix) class changeset_printer(object): '''show changeset information when templating not requested.''' def __init__(self, ui, repo, patch, diffopts, buffered): self.ui = ui self.repo = repo self.buffered = buffered self.patch = patch self.diffopts = diffopts self.header = {} self.hunk = {} self.lastheader = None self.footer = None def flush(self, rev): if rev in self.header: h = self.header[rev] if h != self.lastheader: self.lastheader = h self.ui.write(h) del self.header[rev] if rev in self.hunk: self.ui.write(self.hunk[rev]) del self.hunk[rev] return 1 return 0 def close(self): if self.footer: self.ui.write(self.footer) def show(self, ctx, copies=None, matchfn=None, **props): if self.buffered: self.ui.pushbuffer() self._show(ctx, copies, matchfn, props) self.hunk[ctx.rev()] = self.ui.popbuffer(labeled=True) else: self._show(ctx, copies, matchfn, props) def _show(self, ctx, copies, matchfn, props): '''show a single changeset or file revision''' changenode = ctx.node() rev = ctx.rev() if self.ui.quiet: self.ui.write("%d:%s\n" % (rev, short(changenode)), label='log.node') return log = self.repo.changelog date = util.datestr(ctx.date()) hexfunc = self.ui.debugflag and hex or short parents = [(p, hexfunc(log.node(p))) for p in self._meaningful_parentrevs(log, rev)] # i18n: column positioning for "hg log" self.ui.write(_("changeset: %d:%s\n") % (rev, hexfunc(changenode)), label='log.changeset changeset.%s' % ctx.phasestr()) branch = ctx.branch() # don't show the default branch name if branch != 'default': # i18n: column positioning for "hg log" self.ui.write(_("branch: %s\n") % branch, label='log.branch') for bookmark in self.repo.nodebookmarks(changenode): # i18n: column positioning for "hg log" self.ui.write(_("bookmark: %s\n") % bookmark, label='log.bookmark') for tag in self.repo.nodetags(changenode): # i18n: column positioning for "hg log" self.ui.write(_("tag: %s\n") % tag, label='log.tag') if self.ui.debugflag and ctx.phase(): # i18n: column positioning for "hg log" self.ui.write(_("phase: %s\n") % _(ctx.phasestr()), label='log.phase') for parent in parents: # i18n: column positioning for "hg log" self.ui.write(_("parent: %d:%s\n") % parent, label='log.parent changeset.%s' % ctx.phasestr()) if self.ui.debugflag: mnode = ctx.manifestnode() # i18n: column positioning for "hg log" self.ui.write(_("manifest: %d:%s\n") % (self.repo.manifest.rev(mnode), hex(mnode)), label='ui.debug log.manifest') # i18n: column positioning for "hg log" self.ui.write(_("user: %s\n") % ctx.user(), label='log.user') # i18n: column positioning for "hg log" self.ui.write(_("date: %s\n") % date, label='log.date') if self.ui.debugflag: files = self.repo.status(log.parents(changenode)[0], changenode)[:3] for key, value in zip([# i18n: column positioning for "hg log" _("files:"), # i18n: column positioning for "hg log" _("files+:"), # i18n: column positioning for "hg log" _("files-:")], files): if value: self.ui.write("%-12s %s\n" % (key, " ".join(value)), label='ui.debug log.files') elif ctx.files() and self.ui.verbose: # i18n: column positioning for "hg log" self.ui.write(_("files: %s\n") % " ".join(ctx.files()), label='ui.note log.files') if copies and self.ui.verbose: copies = ['%s (%s)' % c for c in copies] # i18n: column positioning for "hg log" self.ui.write(_("copies: %s\n") % ' '.join(copies), label='ui.note log.copies') extra = ctx.extra() if extra and self.ui.debugflag: for key, value in sorted(extra.items()): # i18n: column positioning for "hg log" self.ui.write(_("extra: %s=%s\n") % (key, value.encode('string_escape')), label='ui.debug log.extra') description = ctx.description().strip() if description: if self.ui.verbose: self.ui.write(_("description:\n"), label='ui.note log.description') self.ui.write(description, label='ui.note log.description') self.ui.write("\n\n") else: # i18n: column positioning for "hg log" self.ui.write(_("summary: %s\n") % description.splitlines()[0], label='log.summary') self.ui.write("\n") self.showpatch(changenode, matchfn) def showpatch(self, node, matchfn): if not matchfn: matchfn = self.patch if matchfn: stat = self.diffopts.get('stat') diff = self.diffopts.get('patch') diffopts = patch.diffopts(self.ui, self.diffopts) prev = self.repo.changelog.parents(node)[0] if stat: diffordiffstat(self.ui, self.repo, diffopts, prev, node, match=matchfn, stat=True) if diff: if stat: self.ui.write("\n") diffordiffstat(self.ui, self.repo, diffopts, prev, node, match=matchfn, stat=False) self.ui.write("\n") def _meaningful_parentrevs(self, log, rev): """Return list of meaningful (or all if debug) parentrevs for rev. For merges (two non-nullrev revisions) both parents are meaningful. Otherwise the first parent revision is considered meaningful if it is not the preceding revision. """ parents = log.parentrevs(rev) if not self.ui.debugflag and parents[1] == nullrev: if parents[0] >= rev - 1: parents = [] else: parents = [parents[0]] return parents class changeset_templater(changeset_printer): '''format changeset information.''' def __init__(self, ui, repo, patch, diffopts, mapfile, buffered): changeset_printer.__init__(self, ui, repo, patch, diffopts, buffered) formatnode = ui.debugflag and (lambda x: x) or (lambda x: x[:12]) defaulttempl = { 'parent': '{rev}:{node|formatnode} ', 'manifest': '{rev}:{node|formatnode}', 'file_copy': '{name} ({source})', 'extra': '{key}={value|stringescape}' } # filecopy is preserved for compatibility reasons defaulttempl['filecopy'] = defaulttempl['file_copy'] self.t = templater.templater(mapfile, {'formatnode': formatnode}, cache=defaulttempl) self.cache = {} def use_template(self, t): '''set template string to use''' self.t.cache['changeset'] = t def _meaningful_parentrevs(self, ctx): """Return list of meaningful (or all if debug) parentrevs for rev. """ parents = ctx.parents() if len(parents) > 1: return parents if self.ui.debugflag: return [parents[0], self.repo['null']] if parents[0].rev() >= ctx.rev() - 1: return [] return parents def _show(self, ctx, copies, matchfn, props): '''show a single changeset or file revision''' showlist = templatekw.showlist # showparents() behaviour depends on ui trace level which # causes unexpected behaviours at templating level and makes # it harder to extract it in a standalone function. Its # behaviour cannot be changed so leave it here for now. def showparents(**args): ctx = args['ctx'] parents = [[('rev', p.rev()), ('node', p.hex())] for p in self._meaningful_parentrevs(ctx)] return showlist('parent', parents, **args) props = props.copy() props.update(templatekw.keywords) props['parents'] = showparents props['templ'] = self.t props['ctx'] = ctx props['repo'] = self.repo props['revcache'] = {'copies': copies} props['cache'] = self.cache # find correct templates for current mode tmplmodes = [ (True, None), (self.ui.verbose, 'verbose'), (self.ui.quiet, 'quiet'), (self.ui.debugflag, 'debug'), ] types = {'header': '', 'footer':'', 'changeset': 'changeset'} for mode, postfix in tmplmodes: for type in types: cur = postfix and ('%s_%s' % (type, postfix)) or type if mode and cur in self.t: types[type] = cur try: # write header if types['header']: h = templater.stringify(self.t(types['header'], **props)) if self.buffered: self.header[ctx.rev()] = h else: if self.lastheader != h: self.lastheader = h self.ui.write(h) # write changeset metadata, then patch if requested key = types['changeset'] self.ui.write(templater.stringify(self.t(key, **props))) self.showpatch(ctx.node(), matchfn) if types['footer']: if not self.footer: self.footer = templater.stringify(self.t(types['footer'], **props)) except KeyError, inst: msg = _("%s: no key named '%s'") raise util.Abort(msg % (self.t.mapfile, inst.args[0])) except SyntaxError, inst: raise util.Abort('%s: %s' % (self.t.mapfile, inst.args[0])) def show_changeset(ui, repo, opts, buffered=False): """show one changeset using template or regular display. Display format will be the first non-empty hit of: 1. option 'template' 2. option 'style' 3. [ui] setting 'logtemplate' 4. [ui] setting 'style' If all of these values are either the unset or the empty string, regular display via changeset_printer() is done. """ # options patch = None if opts.get('patch') or opts.get('stat'): patch = scmutil.matchall(repo) tmpl = opts.get('template') style = None if not tmpl: style = opts.get('style') # ui settings if not (tmpl or style): tmpl = ui.config('ui', 'logtemplate') if tmpl: try: tmpl = templater.parsestring(tmpl) except SyntaxError: tmpl = templater.parsestring(tmpl, quoted=False) else: style = util.expandpath(ui.config('ui', 'style', '')) if not (tmpl or style): return changeset_printer(ui, repo, patch, opts, buffered) mapfile = None if style and not tmpl: mapfile = style if not os.path.split(mapfile)[0]: mapname = (templater.templatepath('map-cmdline.' + mapfile) or templater.templatepath(mapfile)) if mapname: mapfile = mapname try: t = changeset_templater(ui, repo, patch, opts, mapfile, buffered) except SyntaxError, inst: raise util.Abort(inst.args[0]) if tmpl: t.use_template(tmpl) return t def finddate(ui, repo, date): """Find the tipmost changeset that matches the given date spec""" df = util.matchdate(date) m = scmutil.matchall(repo) results = {} def prep(ctx, fns): d = ctx.date() if df(d[0]): results[ctx.rev()] = d for ctx in walkchangerevs(repo, m, {'rev': None}, prep): rev = ctx.rev() if rev in results: ui.status(_("found revision %s from %s\n") % (rev, util.datestr(results[rev]))) return str(rev) raise util.Abort(_("revision matching date not found")) def increasingwindows(start, end, windowsize=8, sizelimit=512): if start < end: while start < end: yield start, min(windowsize, end - start) start += windowsize if windowsize < sizelimit: windowsize *= 2 else: while start > end: yield start, min(windowsize, start - end - 1) start -= windowsize if windowsize < sizelimit: windowsize *= 2 class FileWalkError(Exception): pass def walkfilerevs(repo, match, follow, revs, fncache): '''Walks the file history for the matched files. Returns the changeset revs that are involved in the file history. Throws FileWalkError if the file history can't be walked using filelogs alone. ''' wanted = set() copies = [] minrev, maxrev = min(revs), max(revs) def filerevgen(filelog, last): """ Only files, no patterns. Check the history of each file. Examines filelog entries within minrev, maxrev linkrev range Returns an iterator yielding (linkrev, parentlinkrevs, copied) tuples in backwards order """ cl_count = len(repo) revs = [] for j in xrange(0, last + 1): linkrev = filelog.linkrev(j) if linkrev < minrev: continue # only yield rev for which we have the changelog, it can # happen while doing "hg log" during a pull or commit if linkrev >= cl_count: break parentlinkrevs = [] for p in filelog.parentrevs(j): if p != nullrev: parentlinkrevs.append(filelog.linkrev(p)) n = filelog.node(j) revs.append((linkrev, parentlinkrevs, follow and filelog.renamed(n))) return reversed(revs) def iterfiles(): pctx = repo['.'] for filename in match.files(): if follow: if filename not in pctx: raise util.Abort(_('cannot follow file not in parent ' 'revision: "%s"') % filename) yield filename, pctx[filename].filenode() else: yield filename, None for filename_node in copies: yield filename_node for file_, node in iterfiles(): filelog = repo.file(file_) if not len(filelog): if node is None: # A zero count may be a directory or deleted file, so # try to find matching entries on the slow path. if follow: raise util.Abort( _('cannot follow nonexistent file: "%s"') % file_) raise FileWalkError("Cannot walk via filelog") else: continue if node is None: last = len(filelog) - 1 else: last = filelog.rev(node) # keep track of all ancestors of the file ancestors = set([filelog.linkrev(last)]) # iterate from latest to oldest revision for rev, flparentlinkrevs, copied in filerevgen(filelog, last): if not follow: if rev > maxrev: continue else: # Note that last might not be the first interesting # rev to us: # if the file has been changed after maxrev, we'll # have linkrev(last) > maxrev, and we still need # to explore the file graph if rev not in ancestors: continue # XXX insert 1327 fix here if flparentlinkrevs: ancestors.update(flparentlinkrevs) fncache.setdefault(rev, []).append(file_) wanted.add(rev) if copied: copies.append(copied) return wanted def walkchangerevs(repo, match, opts, prepare): '''Iterate over files and the revs in which they changed. Callers most commonly need to iterate backwards over the history in which they are interested. Doing so has awful (quadratic-looking) performance, so we use iterators in a "windowed" way. We walk a window of revisions in the desired order. Within the window, we first walk forwards to gather data, then in the desired order (usually backwards) to display it. This function returns an iterator yielding contexts. Before yielding each context, the iterator will first call the prepare function on each context in the window in forward order.''' follow = opts.get('follow') or opts.get('follow_first') if opts.get('rev'): revs = scmutil.revrange(repo, opts.get('rev')) elif follow: revs = repo.revs('reverse(:.)') else: revs = list(repo) revs.reverse() if not revs: return [] wanted = set() slowpath = match.anypats() or (match.files() and opts.get('removed')) fncache = {} change = repo.changectx # First step is to fill wanted, the set of revisions that we want to yield. # When it does not induce extra cost, we also fill fncache for revisions in # wanted: a cache of filenames that were changed (ctx.files()) and that # match the file filtering conditions. if not slowpath and not match.files(): # No files, no patterns. Display all revs. wanted = set(revs) if not slowpath and match.files(): # We only have to read through the filelog to find wanted revisions try: wanted = walkfilerevs(repo, match, follow, revs, fncache) except FileWalkError: slowpath = True # We decided to fall back to the slowpath because at least one # of the paths was not a file. Check to see if at least one of them # existed in history, otherwise simply return for path in match.files(): if path == '.' or path in repo.store: break else: return [] if slowpath: # We have to read the changelog to match filenames against # changed files if follow: raise util.Abort(_('can only follow copies/renames for explicit ' 'filenames')) # The slow path checks files modified in every changeset. # This is really slow on large repos, so compute the set lazily. class lazywantedset(object): def __init__(self): self.set = set() self.revs = set(revs) # No need to worry about locality here because it will be accessed # in the same order as the increasing window below. def __contains__(self, value): if value in self.set: return True elif not value in self.revs: return False else: self.revs.discard(value) ctx = change(value) matches = filter(match, ctx.files()) if matches: fncache[value] = matches self.set.add(value) return True return False def discard(self, value): self.revs.discard(value) self.set.discard(value) wanted = lazywantedset() class followfilter(object): def __init__(self, onlyfirst=False): self.startrev = nullrev self.roots = set() self.onlyfirst = onlyfirst def match(self, rev): def realparents(rev): if self.onlyfirst: return repo.changelog.parentrevs(rev)[0:1] else: return filter(lambda x: x != nullrev, repo.changelog.parentrevs(rev)) if self.startrev == nullrev: self.startrev = rev return True if rev > self.startrev: # forward: all descendants if not self.roots: self.roots.add(self.startrev) for parent in realparents(rev): if parent in self.roots: self.roots.add(rev) return True else: # backwards: all parents if not self.roots: self.roots.update(realparents(self.startrev)) if rev in self.roots: self.roots.remove(rev) self.roots.update(realparents(rev)) return True return False # it might be worthwhile to do this in the iterator if the rev range # is descending and the prune args are all within that range for rev in opts.get('prune', ()): rev = repo[rev].rev() ff = followfilter() stop = min(revs[0], revs[-1]) for x in xrange(rev, stop - 1, -1): if ff.match(x): wanted.discard(x) # Choose a small initial window if we will probably only visit a # few commits. limit = loglimit(opts) windowsize = 8 if limit: windowsize = min(limit, windowsize) # Now that wanted is correctly initialized, we can iterate over the # revision range, yielding only revisions in wanted. def iterate(): if follow and not match.files(): ff = followfilter(onlyfirst=opts.get('follow_first')) def want(rev): return ff.match(rev) and rev in wanted else: def want(rev): return rev in wanted for i, window in increasingwindows(0, len(revs), windowsize): nrevs = [rev for rev in revs[i:i + window] if want(rev)] for rev in sorted(nrevs): fns = fncache.get(rev) ctx = change(rev) if not fns: def fns_generator(): for f in ctx.files(): if match(f): yield f fns = fns_generator() prepare(ctx, fns) for rev in nrevs: yield change(rev) return iterate() def _makegraphfilematcher(repo, pats, followfirst): # When displaying a revision with --patch --follow FILE, we have # to know which file of the revision must be diffed. With # --follow, we want the names of the ancestors of FILE in the # revision, stored in "fcache". "fcache" is populated by # reproducing the graph traversal already done by --follow revset # and relating linkrevs to file names (which is not "correct" but # good enough). fcache = {} fcacheready = [False] pctx = repo['.'] wctx = repo[None] def populate(): for fn in pats: for i in ((pctx[fn],), pctx[fn].ancestors(followfirst=followfirst)): for c in i: fcache.setdefault(c.linkrev(), set()).add(c.path()) def filematcher(rev): if not fcacheready[0]: # Lazy initialization fcacheready[0] = True populate() return scmutil.match(wctx, fcache.get(rev, []), default='path') return filematcher def _makegraphlogrevset(repo, pats, opts, revs): """Return (expr, filematcher) where expr is a revset string built from log options and file patterns or None. If --stat or --patch are not passed filematcher is None. Otherwise it is a callable taking a revision number and returning a match objects filtering the files to be detailed when displaying the revision. """ opt2revset = { 'no_merges': ('not merge()', None), 'only_merges': ('merge()', None), '_ancestors': ('ancestors(%(val)s)', None), '_fancestors': ('_firstancestors(%(val)s)', None), '_descendants': ('descendants(%(val)s)', None), '_fdescendants': ('_firstdescendants(%(val)s)', None), '_matchfiles': ('_matchfiles(%(val)s)', None), 'date': ('date(%(val)r)', None), 'branch': ('branch(%(val)r)', ' or '), '_patslog': ('filelog(%(val)r)', ' or '), '_patsfollow': ('follow(%(val)r)', ' or '), '_patsfollowfirst': ('_followfirst(%(val)r)', ' or '), 'keyword': ('keyword(%(val)r)', ' or '), 'prune': ('not (%(val)r or ancestors(%(val)r))', ' and '), 'user': ('user(%(val)r)', ' or '), } opts = dict(opts) # follow or not follow? follow = opts.get('follow') or opts.get('follow_first') followfirst = opts.get('follow_first') and 1 or 0 # --follow with FILE behaviour depends on revs... startrev = revs[0] followdescendants = (len(revs) > 1 and revs[0] < revs[1]) and 1 or 0 # branch and only_branch are really aliases and must be handled at # the same time opts['branch'] = opts.get('branch', []) + opts.get('only_branch', []) opts['branch'] = [repo.lookupbranch(b) for b in opts['branch']] # pats/include/exclude are passed to match.match() directly in # _matchfiles() revset but walkchangerevs() builds its matcher with # scmutil.match(). The difference is input pats are globbed on # platforms without shell expansion (windows). pctx = repo[None] match, pats = scmutil.matchandpats(pctx, pats, opts) slowpath = match.anypats() or (match.files() and opts.get('removed')) if not slowpath: for f in match.files(): if follow and f not in pctx: raise util.Abort(_('cannot follow file not in parent ' 'revision: "%s"') % f) filelog = repo.file(f) if not filelog: # A zero count may be a directory or deleted file, so # try to find matching entries on the slow path. if follow: raise util.Abort( _('cannot follow nonexistent file: "%s"') % f) slowpath = True # We decided to fall back to the slowpath because at least one # of the paths was not a file. Check to see if at least one of them # existed in history - in that case, we'll continue down the # slowpath; otherwise, we can turn off the slowpath if slowpath: for path in match.files(): if path == '.' or path in repo.store: break else: slowpath = False if slowpath: # See walkchangerevs() slow path. # if follow: raise util.Abort(_('can only follow copies/renames for explicit ' 'filenames')) # pats/include/exclude cannot be represented as separate # revset expressions as their filtering logic applies at file # level. For instance "-I a -X a" matches a revision touching # "a" and "b" while "file(a) and not file(b)" does # not. Besides, filesets are evaluated against the working # directory. matchargs = ['r:', 'd:relpath'] for p in pats: matchargs.append('p:' + p) for p in opts.get('include', []): matchargs.append('i:' + p) for p in opts.get('exclude', []): matchargs.append('x:' + p) matchargs = ','.join(('%r' % p) for p in matchargs) opts['_matchfiles'] = matchargs else: if follow: fpats = ('_patsfollow', '_patsfollowfirst') fnopats = (('_ancestors', '_fancestors'), ('_descendants', '_fdescendants')) if pats: # follow() revset interprets its file argument as a # manifest entry, so use match.files(), not pats. opts[fpats[followfirst]] = list(match.files()) else: opts[fnopats[followdescendants][followfirst]] = str(startrev) else: opts['_patslog'] = list(pats) filematcher = None if opts.get('patch') or opts.get('stat'): if follow: filematcher = _makegraphfilematcher(repo, pats, followfirst) else: filematcher = lambda rev: match expr = [] for op, val in opts.iteritems(): if not val: continue if op not in opt2revset: continue revop, andor = opt2revset[op] if '%(val)' not in revop: expr.append(revop) else: if not isinstance(val, list): e = revop % {'val': val} else: e = '(' + andor.join((revop % {'val': v}) for v in val) + ')' expr.append(e) if expr: expr = '(' + ' and '.join(expr) + ')' else: expr = None return expr, filematcher def getgraphlogrevs(repo, pats, opts): """Return (revs, expr, filematcher) where revs is an iterable of revision numbers, expr is a revset string built from log options and file patterns or None, and used to filter 'revs'. If --stat or --patch are not passed filematcher is None. Otherwise it is a callable taking a revision number and returning a match objects filtering the files to be detailed when displaying the revision. """ if not len(repo): return [], None, None limit = loglimit(opts) # Default --rev value depends on --follow but --follow behaviour # depends on revisions resolved from --rev... follow = opts.get('follow') or opts.get('follow_first') possiblyunsorted = False # whether revs might need sorting if opts.get('rev'): revs = scmutil.revrange(repo, opts['rev']) # Don't sort here because _makegraphlogrevset might depend on the # order of revs possiblyunsorted = True else: if follow and len(repo) > 0: revs = repo.revs('reverse(:.)') else: revs = list(repo.changelog) revs.reverse() if not revs: return [], None, None expr, filematcher = _makegraphlogrevset(repo, pats, opts, revs) if possiblyunsorted: revs.sort(reverse=True) if expr: # Revset matchers often operate faster on revisions in changelog # order, because most filters deal with the changelog. revs.reverse() matcher = revset.match(repo.ui, expr) # Revset matches can reorder revisions. "A or B" typically returns # returns the revision matching A then the revision matching B. Sort # again to fix that. revs = matcher(repo, revs) revs.sort(reverse=True) if limit is not None: revs = revs[:limit] return revs, expr, filematcher def displaygraph(ui, dag, displayer, showparents, edgefn, getrenamed=None, filematcher=None): seen, state = [], graphmod.asciistate() for rev, type, ctx, parents in dag: char = 'o' if ctx.node() in showparents: char = '@' elif ctx.obsolete(): char = 'x' copies = None if getrenamed and ctx.rev(): copies = [] for fn in ctx.files(): rename = getrenamed(fn, ctx.rev()) if rename: copies.append((fn, rename[0])) revmatchfn = None if filematcher is not None: revmatchfn = filematcher(ctx.rev()) displayer.show(ctx, copies=copies, matchfn=revmatchfn) lines = displayer.hunk.pop(rev).split('\n') if not lines[-1]: del lines[-1] displayer.flush(rev) edges = edgefn(type, char, lines, seen, rev, parents) for type, char, lines, coldata in edges: graphmod.ascii(ui, state, type, char, lines, coldata) displayer.close() def graphlog(ui, repo, *pats, **opts): # Parameters are identical to log command ones revs, expr, filematcher = getgraphlogrevs(repo, pats, opts) revdag = graphmod.dagwalker(repo, revs) getrenamed = None if opts.get('copies'): endrev = None if opts.get('rev'): endrev = max(scmutil.revrange(repo, opts.get('rev'))) + 1 getrenamed = templatekw.getrenamedfn(repo, endrev=endrev) displayer = show_changeset(ui, repo, opts, buffered=True) showparents = [ctx.node() for ctx in repo[None].parents()] displaygraph(ui, revdag, displayer, showparents, graphmod.asciiedges, getrenamed, filematcher) def checkunsupportedgraphflags(pats, opts): for op in ["newest_first"]: if op in opts and opts[op]: raise util.Abort(_("-G/--graph option is incompatible with --%s") % op.replace("_", "-")) def graphrevs(repo, nodes, opts): limit = loglimit(opts) nodes.reverse() if limit is not None: nodes = nodes[:limit] return graphmod.nodes(repo, nodes) def add(ui, repo, match, dryrun, listsubrepos, prefix, explicitonly): join = lambda f: os.path.join(prefix, f) bad = [] oldbad = match.bad match.bad = lambda x, y: bad.append(x) or oldbad(x, y) names = [] wctx = repo[None] cca = None abort, warn = scmutil.checkportabilityalert(ui) if abort or warn: cca = scmutil.casecollisionauditor(ui, abort, repo.dirstate) for f in repo.walk(match): exact = match.exact(f) if exact or not explicitonly and f not in repo.dirstate: if cca: cca(f) names.append(f) if ui.verbose or not exact: ui.status(_('adding %s\n') % match.rel(join(f))) for subpath in sorted(wctx.substate): sub = wctx.sub(subpath) try: submatch = matchmod.narrowmatcher(subpath, match) if listsubrepos: bad.extend(sub.add(ui, submatch, dryrun, listsubrepos, prefix, False)) else: bad.extend(sub.add(ui, submatch, dryrun, listsubrepos, prefix, True)) except error.LookupError: ui.status(_("skipping missing subrepository: %s\n") % join(subpath)) if not dryrun: rejected = wctx.add(names, prefix) bad.extend(f for f in rejected if f in match.files()) return bad def forget(ui, repo, match, prefix, explicitonly): join = lambda f: os.path.join(prefix, f) bad = [] oldbad = match.bad match.bad = lambda x, y: bad.append(x) or oldbad(x, y) wctx = repo[None] forgot = [] s = repo.status(match=match, clean=True) forget = sorted(s[0] + s[1] + s[3] + s[6]) if explicitonly: forget = [f for f in forget if match.exact(f)] for subpath in sorted(wctx.substate): sub = wctx.sub(subpath) try: submatch = matchmod.narrowmatcher(subpath, match) subbad, subforgot = sub.forget(ui, submatch, prefix) bad.extend([subpath + '/' + f for f in subbad]) forgot.extend([subpath + '/' + f for f in subforgot]) except error.LookupError: ui.status(_("skipping missing subrepository: %s\n") % join(subpath)) if not explicitonly: for f in match.files(): if f not in repo.dirstate and not os.path.isdir(match.rel(join(f))): if f not in forgot: if os.path.exists(match.rel(join(f))): ui.warn(_('not removing %s: ' 'file is already untracked\n') % match.rel(join(f))) bad.append(f) for f in forget: if ui.verbose or not match.exact(f): ui.status(_('removing %s\n') % match.rel(join(f))) rejected = wctx.forget(forget, prefix) bad.extend(f for f in rejected if f in match.files()) forgot.extend(forget) return bad, forgot def duplicatecopies(repo, rev, fromrev): '''reproduce copies from fromrev to rev in the dirstate''' for dst, src in copies.pathcopies(repo[fromrev], repo[rev]).iteritems(): # copies.pathcopies returns backward renames, so dst might not # actually be in the dirstate if repo.dirstate[dst] in "nma": repo.dirstate.copy(src, dst) def commit(ui, repo, commitfunc, pats, opts): '''commit the specified files or all outstanding changes''' date = opts.get('date') if date: opts['date'] = util.parsedate(date) message = logmessage(ui, opts) # extract addremove carefully -- this function can be called from a command # that doesn't support addremove if opts.get('addremove'): scmutil.addremove(repo, pats, opts) return commitfunc(ui, repo, message, scmutil.match(repo[None], pats, opts), opts) def amend(ui, repo, commitfunc, old, extra, pats, opts): ui.note(_('amending changeset %s\n') % old) base = old.p1() wlock = lock = newid = None try: wlock = repo.wlock() lock = repo.lock() tr = repo.transaction('amend') try: # See if we got a message from -m or -l, if not, open the editor # with the message of the changeset to amend message = logmessage(ui, opts) # ensure logfile does not conflict with later enforcement of the # message. potential logfile content has been processed by # `logmessage` anyway. opts.pop('logfile') # First, do a regular commit to record all changes in the working # directory (if there are any) ui.callhooks = False currentbookmark = repo._bookmarkcurrent try: repo._bookmarkcurrent = None opts['message'] = 'temporary amend commit for %s' % old node = commit(ui, repo, commitfunc, pats, opts) finally: repo._bookmarkcurrent = currentbookmark ui.callhooks = True ctx = repo[node] # Participating changesets: # # node/ctx o - new (intermediate) commit that contains changes # | from working dir to go into amending commit # | (or a workingctx if there were no changes) # | # old o - changeset to amend # | # base o - parent of amending changeset # Update extra dict from amended commit (e.g. to preserve graft # source) extra.update(old.extra()) # Also update it from the intermediate commit or from the wctx extra.update(ctx.extra()) if len(old.parents()) > 1: # ctx.files() isn't reliable for merges, so fall back to the # slower repo.status() method files = set([fn for st in repo.status(base, old)[:3] for fn in st]) else: files = set(old.files()) # Second, we use either the commit we just did, or if there were no # changes the parent of the working directory as the version of the # files in the final amend commit if node: ui.note(_('copying changeset %s to %s\n') % (ctx, base)) user = ctx.user() date = ctx.date() # Recompute copies (avoid recording a -> b -> a) copied = copies.pathcopies(base, ctx) # Prune files which were reverted by the updates: if old # introduced file X and our intermediate commit, node, # renamed that file, then those two files are the same and # we can discard X from our list of files. Likewise if X # was deleted, it's no longer relevant files.update(ctx.files()) def samefile(f): if f in ctx.manifest(): a = ctx.filectx(f) if f in base.manifest(): b = base.filectx(f) return (not a.cmp(b) and a.flags() == b.flags()) else: return False else: return f not in base.manifest() files = [f for f in files if not samefile(f)] def filectxfn(repo, ctx_, path): try: fctx = ctx[path] flags = fctx.flags() mctx = context.memfilectx(fctx.path(), fctx.data(), islink='l' in flags, isexec='x' in flags, copied=copied.get(path)) return mctx except KeyError: raise IOError else: ui.note(_('copying changeset %s to %s\n') % (old, base)) # Use version of files as in the old cset def filectxfn(repo, ctx_, path): try: return old.filectx(path) except KeyError: raise IOError user = opts.get('user') or old.user() date = opts.get('date') or old.date() editmsg = False if not message: editmsg = True message = old.description() pureextra = extra.copy() extra['amend_source'] = old.hex() new = context.memctx(repo, parents=[base.node(), old.p2().node()], text=message, files=files, filectxfn=filectxfn, user=user, date=date, extra=extra) if editmsg: new._text = commitforceeditor(repo, new, []) newdesc = changelog.stripdesc(new.description()) if ((not node) and newdesc == old.description() and user == old.user() and date == old.date() and pureextra == old.extra()): # nothing changed. continuing here would create a new node # anyway because of the amend_source noise. # # This not what we expect from amend. return old.node() ph = repo.ui.config('phases', 'new-commit', phases.draft) try: repo.ui.setconfig('phases', 'new-commit', old.phase()) newid = repo.commitctx(new) finally: repo.ui.setconfig('phases', 'new-commit', ph) if newid != old.node(): # Reroute the working copy parent to the new changeset repo.setparents(newid, nullid) # Move bookmarks from old parent to amend commit bms = repo.nodebookmarks(old.node()) if bms: marks = repo._bookmarks for bm in bms: marks[bm] = newid marks.write() #commit the whole amend process if obsolete._enabled and newid != old.node(): # mark the new changeset as successor of the rewritten one new = repo[newid] obs = [(old, (new,))] if node: obs.append((ctx, ())) obsolete.createmarkers(repo, obs) tr.close() finally: tr.release() if (not obsolete._enabled) and newid != old.node(): # Strip the intermediate commit (if there was one) and the amended # commit if node: ui.note(_('stripping intermediate changeset %s\n') % ctx) ui.note(_('stripping amended changeset %s\n') % old) repair.strip(ui, repo, old.node(), topic='amend-backup') finally: if newid is None: repo.dirstate.invalidate() lockmod.release(lock, wlock) return newid def commiteditor(repo, ctx, subs): if ctx.description(): return ctx.description() return commitforceeditor(repo, ctx, subs) def commitforceeditor(repo, ctx, subs): edittext = [] modified, added, removed = ctx.modified(), ctx.added(), ctx.removed() if ctx.description(): edittext.append(ctx.description()) edittext.append("") edittext.append("") # Empty line between message and comments. edittext.append(_("HG: Enter commit message." " Lines beginning with 'HG:' are removed.")) edittext.append(_("HG: Leave message empty to abort commit.")) edittext.append("HG: --") edittext.append(_("HG: user: %s") % ctx.user()) if ctx.p2(): edittext.append(_("HG: branch merge")) if ctx.branch(): edittext.append(_("HG: branch '%s'") % ctx.branch()) if bookmarks.iscurrent(repo): edittext.append(_("HG: bookmark '%s'") % repo._bookmarkcurrent) edittext.extend([_("HG: subrepo %s") % s for s in subs]) edittext.extend([_("HG: added %s") % f for f in added]) edittext.extend([_("HG: changed %s") % f for f in modified]) edittext.extend([_("HG: removed %s") % f for f in removed]) if not added and not modified and not removed: edittext.append(_("HG: no files changed")) edittext.append("") # run editor in the repository root olddir = os.getcwd() os.chdir(repo.root) text = repo.ui.edit("\n".join(edittext), ctx.user()) text = re.sub("(?m)^HG:.*(\n|$)", "", text) os.chdir(olddir) if not text.strip(): raise util.Abort(_("empty commit message")) return text def commitstatus(repo, node, branch, bheads=None, opts={}): ctx = repo[node] parents = ctx.parents() if (not opts.get('amend') and bheads and node not in bheads and not [x for x in parents if x.node() in bheads and x.branch() == branch]): repo.ui.status(_('created new head\n')) # The message is not printed for initial roots. For the other # changesets, it is printed in the following situations: # # Par column: for the 2 parents with ... # N: null or no parent # B: parent is on another named branch # C: parent is a regular non head changeset # H: parent was a branch head of the current branch # Msg column: whether we print "created new head" message # In the following, it is assumed that there already exists some # initial branch heads of the current branch, otherwise nothing is # printed anyway. # # Par Msg Comment # N N y additional topo root # # B N y additional branch root # C N y additional topo head # H N n usual case # # B B y weird additional branch root # C B y branch merge # H B n merge with named branch # # C C y additional head from merge # C H n merge with a head # # H H n head merge: head count decreases if not opts.get('close_branch'): for r in parents: if r.closesbranch() and r.branch() == branch: repo.ui.status(_('reopening closed branch head %d\n') % r) if repo.ui.debugflag: repo.ui.write(_('committed changeset %d:%s\n') % (int(ctx), ctx.hex())) elif repo.ui.verbose: repo.ui.write(_('committed changeset %d:%s\n') % (int(ctx), ctx)) def revert(ui, repo, ctx, parents, *pats, **opts): parent, p2 = parents node = ctx.node() mf = ctx.manifest() if node == parent: pmf = mf else: pmf = None # need all matching names in dirstate and manifest of target rev, # so have to walk both. do not print errors if files exist in one # but not other. names = {} wlock = repo.wlock() try: # walk dirstate. m = scmutil.match(repo[None], pats, opts) m.bad = lambda x, y: False for abs in repo.walk(m): names[abs] = m.rel(abs), m.exact(abs) # walk target manifest. def badfn(path, msg): if path in names: return if path in ctx.substate: return path_ = path + '/' for f in names: if f.startswith(path_): return ui.warn("%s: %s\n" % (m.rel(path), msg)) m = scmutil.match(ctx, pats, opts) m.bad = badfn for abs in ctx.walk(m): if abs not in names: names[abs] = m.rel(abs), m.exact(abs) # get the list of subrepos that must be reverted targetsubs = sorted(s for s in ctx.substate if m(s)) m = scmutil.matchfiles(repo, names) changes = repo.status(match=m)[:4] modified, added, removed, deleted = map(set, changes) # if f is a rename, also revert the source cwd = repo.getcwd() for f in added: src = repo.dirstate.copied(f) if src and src not in names and repo.dirstate[src] == 'r': removed.add(src) names[src] = (repo.pathto(src, cwd), True) def removeforget(abs): if repo.dirstate[abs] == 'a': return _('forgetting %s\n') return _('removing %s\n') revert = ([], _('reverting %s\n')) add = ([], _('adding %s\n')) remove = ([], removeforget) undelete = ([], _('undeleting %s\n')) disptable = ( # dispatch table: # file state # action if in target manifest # action if not in target manifest # make backup if in target manifest # make backup if not in target manifest (modified, revert, remove, True, True), (added, revert, remove, True, False), (removed, undelete, None, True, False), (deleted, revert, remove, False, False), ) for abs, (rel, exact) in sorted(names.items()): mfentry = mf.get(abs) target = repo.wjoin(abs) def handle(xlist, dobackup): xlist[0].append(abs) if (dobackup and not opts.get('no_backup') and os.path.lexists(target) and abs in ctx and repo[None][abs].cmp(ctx[abs])): bakname = "%s.orig" % rel ui.note(_('saving current version of %s as %s\n') % (rel, bakname)) if not opts.get('dry_run'): util.rename(target, bakname) if ui.verbose or not exact: msg = xlist[1] if not isinstance(msg, basestring): msg = msg(abs) ui.status(msg % rel) for table, hitlist, misslist, backuphit, backupmiss in disptable: if abs not in table: continue # file has changed in dirstate if mfentry: handle(hitlist, backuphit) elif misslist is not None: handle(misslist, backupmiss) break else: if abs not in repo.dirstate: if mfentry: handle(add, True) elif exact: ui.warn(_('file not managed: %s\n') % rel) continue # file has not changed in dirstate if node == parent: if exact: ui.warn(_('no changes needed to %s\n') % rel) continue if pmf is None: # only need parent manifest in this unlikely case, # so do not read by default pmf = repo[parent].manifest() if abs in pmf and mfentry: # if version of file is same in parent and target # manifests, do nothing if (pmf[abs] != mfentry or pmf.flags(abs) != mf.flags(abs)): handle(revert, False) else: handle(remove, False) if not opts.get('dry_run'): def checkout(f): fc = ctx[f] repo.wwrite(f, fc.data(), fc.flags()) audit_path = pathutil.pathauditor(repo.root) for f in remove[0]: if repo.dirstate[f] == 'a': repo.dirstate.drop(f) continue audit_path(f) try: util.unlinkpath(repo.wjoin(f)) except OSError: pass repo.dirstate.remove(f) normal = None if node == parent: # We're reverting to our parent. If possible, we'd like status # to report the file as clean. We have to use normallookup for # merges to avoid losing information about merged/dirty files. if p2 != nullid: normal = repo.dirstate.normallookup else: normal = repo.dirstate.normal for f in revert[0]: checkout(f) if normal: normal(f) for f in add[0]: checkout(f) repo.dirstate.add(f) normal = repo.dirstate.normallookup if node == parent and p2 == nullid: normal = repo.dirstate.normal for f in undelete[0]: checkout(f) normal(f) copied = copies.pathcopies(repo[parent], ctx) for f in add[0] + undelete[0] + revert[0]: if f in copied: repo.dirstate.copy(copied[f], f) if targetsubs: # Revert the subrepos on the revert list for sub in targetsubs: ctx.sub(sub).revert(ui, ctx.substate[sub], *pats, **opts) finally: wlock.release() def command(table): '''returns a function object bound to table which can be used as a decorator for populating table as a command table''' def cmd(name, options=(), synopsis=None): def decorator(func): if synopsis: table[name] = func, list(options), synopsis else: table[name] = func, list(options) return func return decorator return cmd # a list of (ui, repo) functions called by commands.summary summaryhooks = util.hooks() # A list of state files kept by multistep operations like graft. # Since graft cannot be aborted, it is considered 'clearable' by update. # note: bisect is intentionally excluded # (state file, clearable, allowcommit, error, hint) unfinishedstates = [ ('graftstate', True, False, _('graft in progress'), _("use 'hg graft --continue' or 'hg update' to abort")), ('updatestate', True, False, _('last update was interrupted'), _("use 'hg update' to get a consistent checkout")) ] def checkunfinished(repo, commit=False): '''Look for an unfinished multistep operation, like graft, and abort if found. It's probably good to check this right before bailifchanged(). ''' for f, clearable, allowcommit, msg, hint in unfinishedstates: if commit and allowcommit: continue if repo.vfs.exists(f): raise util.Abort(msg, hint=hint) def clearunfinished(repo): '''Check for unfinished operations (as above), and clear the ones that are clearable. ''' for f, clearable, allowcommit, msg, hint in unfinishedstates: if not clearable and repo.vfs.exists(f): raise util.Abort(msg, hint=hint) for f, clearable, allowcommit, msg, hint in unfinishedstates: if clearable and repo.vfs.exists(f): util.unlink(repo.join(f))
spraints/for-example
mercurial/cmdutil.py
Python
gpl-2.0
80,076
[ "VisIt" ]
296d766851cff8d127f259673cb18544aa4af79c42b6048ea8ebafe27dab937e
# coding=utf-8 # Copyright 2022 The Google Research Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for controller.py.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import math import numpy as np import tensorflow.compat.v1 as tf from tunas import basic_specs from tunas import controller from tunas import schema class ControllerTest(tf.test.TestCase): def assertOneHot(self, array): self.assertLen(array.shape, 1) argmax = np.argmax(array) self.assertEqual(array[argmax], 1) array_copy = np.copy(array) array_copy[argmax] = 0 self.assertAllEqual(array_copy, [0]*len(array_copy)) def test_independent_sample_basic(self): structure = { 'filters': schema.OneOf([48], basic_specs.FILTERS_TAG), 'opA': schema.OneOf(['foo', 'bar', 'baz'], basic_specs.OP_TAG), 'opB': schema.OneOf(['blah', 'yatta'], basic_specs.OP_TAG), 'other': schema.OneOf(['W', 'X', 'Y', 'Z'], 'some_other_tag'), } rl_structure, dist_info = controller.independent_sample(structure) self.assertItemsEqual(structure.keys(), rl_structure.keys()) self.assertEqual( {k: v.choices for (k, v) in structure.items()}, {k: v.choices for (k, v) in rl_structure.items()}) self.assertEqual( {k: v.tag for (k, v) in structure.items()}, {k: v.tag for (k, v) in rl_structure.items()}) self.assertEqual(rl_structure['opA'].mask.shape, [3]) self.assertEqual(rl_structure['opB'].mask.shape, [2]) self.assertEqual(rl_structure['filters'].mask.shape, [1]) self.assertEqual(rl_structure['other'].mask.shape, [4]) self.evaluate(tf.global_variables_initializer()) self.assertEqual(dist_info['entropy'].shape, []) self.assertEqual(dist_info['entropy'].dtype, tf.float32) # Initially, all the logits are zero, so the entropy of a distribution with # N possible choices is -log(N). We sum up the entropies of four different # distributions, for opA, opB, filters, and other. self.assertAlmostEqual( self.evaluate(dist_info['entropy']), math.log(1) + math.log(2) + math.log(3) + math.log(4)) self.assertEqual(dist_info['sample_log_prob'].shape, []) self.assertEqual(dist_info['sample_log_prob'].dtype, tf.float32) self.assertAlmostEqual( self.evaluate(dist_info['sample_log_prob']), math.log(1) + math.log(1/2) + math.log(1/3) + math.log(1/4)) # The controller will visit the elements of 'structure' in sorted order # (based on their keys). So op_indices_0 will correspond to opA, and # op_indices_1 will correspond to opB. All variables are initialized to 0. self.assertItemsEqual( dist_info['logits_by_tag'].keys(), ['op_indices_0', 'op_indices_1', 'filters_indices_0', 'some_other_tag_0']) self.assertEqual(dist_info['logits_by_tag']['filters_indices_0'].shape, [1]) self.assertEqual(dist_info['logits_by_tag']['op_indices_0'].shape, [3]) self.assertEqual(dist_info['logits_by_tag']['op_indices_1'].shape, [2]) self.assertEqual(dist_info['logits_by_tag']['some_other_tag_0'].shape, [4]) # Repeat, but with logits grouped by path instead of tag. self.assertItemsEqual( dist_info['logits_by_path'], ['filters', 'opA', 'opB', 'other']) self.assertEqual(dist_info['logits_by_path']['filters'].shape, [1]) self.assertEqual(dist_info['logits_by_path']['opA'].shape, [3]) self.assertEqual(dist_info['logits_by_path']['opB'].shape, [2]) self.assertEqual(dist_info['logits_by_path']['other'].shape, [4]) def test_independent_sample_increase_ops_probability_1(self): structure = schema.OneOf(['foo', 'bar', 'baz'], basic_specs.OP_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_ops_probability=1.0) self.evaluate(tf.global_variables_initializer()) self.assertAllClose(self.evaluate(rl_structure.mask), [1/3, 1/3, 1/3]) self.assertEqual(self.evaluate(dist_info['sample_log_prob']), 0) def test_independent_sample_increase_ops_probability_0(self): structure = schema.OneOf(['foo', 'bar', 'baz'], basic_specs.OP_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_ops_probability=0.0) self.evaluate(tf.global_variables_initializer()) self.assertOneHot(self.evaluate(rl_structure.mask)) self.assertAlmostEqual( self.evaluate(dist_info['sample_log_prob']), math.log(1/3)) def test_independent_sample_increase_ops_does_not_affect_filters(self): structure = schema.OneOf([4, 8, 12], basic_specs.FILTERS_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_ops_probability=1.0) self.evaluate(tf.global_variables_initializer()) self.assertOneHot(self.evaluate(rl_structure.mask)) self.assertAlmostEqual( self.evaluate(dist_info['sample_log_prob']), math.log(1/3)) def test_independent_sample_increase_filters_probability_1(self): # Make sure that increase_filters does the right thing when the choices do # not appear in sorted order. structure = schema.OneOf([4, 12, 8], basic_specs.FILTERS_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_filters_probability=1.0) self.evaluate(tf.global_variables_initializer()) self.assertAllClose(self.evaluate(rl_structure.mask), [0, 1, 0]) self.assertEqual(self.evaluate(dist_info['sample_log_prob']), 0) def test_independent_sample_increase_filters_probability_1_big_space(self): # Use a large enough number of choices that we're unlikely to select the # right one by random chance. structure = schema.OneOf(list(range(100)), basic_specs.FILTERS_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_filters_probability=1.0) self.evaluate(tf.global_variables_initializer()) self.assertAllClose(self.evaluate(rl_structure.mask), [0]*99 + [1]) self.assertEqual(self.evaluate(dist_info['sample_log_prob']), 0) def test_independent_sample_increase_filters_probability_0(self): structure = schema.OneOf([4, 12, 8], basic_specs.FILTERS_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_filters_probability=0.0) self.evaluate(tf.global_variables_initializer()) self.assertOneHot(self.evaluate(rl_structure.mask)) self.assertAlmostEqual( self.evaluate(dist_info['sample_log_prob']), math.log(1/3)) def test_independent_sample_increase_ops_does_not_affect_ops(self): structure = schema.OneOf([42, 64], basic_specs.OP_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_filters_probability=1.0) self.evaluate(tf.global_variables_initializer()) self.assertOneHot(self.evaluate(rl_structure.mask)) self.assertAlmostEqual( self.evaluate(dist_info['sample_log_prob']), math.log(1/2)) def test_independent_sample_hierarchical(self): structure = schema.OneOf( [ schema.OneOf(['a', 'b', 'c'], basic_specs.OP_TAG), schema.OneOf(['d', 'e', 'f', 'g'], basic_specs.OP_TAG), ], basic_specs.OP_TAG) rl_structure, dist_info = controller.independent_sample( structure, increase_ops_probability=0, increase_filters_probability=0, hierarchical=True) tensors = { 'outer_mask': rl_structure.mask, 'entropy': dist_info['entropy'], 'sample_log_prob': dist_info['sample_log_prob'], } self.evaluate(tf.global_variables_initializer()) for _ in range(10): values = self.evaluate(tensors) if np.all(values['outer_mask'] == np.array([1, 0])): self.assertAlmostEqual(values['entropy'], math.log(2) + math.log(3)) self.assertAlmostEqual( values['sample_log_prob'], math.log(1/2) + math.log(1/3)) elif np.all(values['outer_mask'] == np.array([0, 1])): self.assertAlmostEqual(values['entropy'], math.log(2) + math.log(4)) self.assertAlmostEqual( values['sample_log_prob'], math.log(1/2) + math.log(1/4)) else: self.fail('Unexpected outer_mask: %s', values['outer_mask']) def test_independent_sample_not_hierarchical(self): structure = schema.OneOf( [ schema.OneOf(['a', 'b', 'c'], basic_specs.OP_TAG), schema.OneOf(['d', 'e', 'f', 'g'], basic_specs.OP_TAG), ], basic_specs.OP_TAG) unused_rl_structure, dist_info = controller.independent_sample( structure, increase_ops_probability=0, increase_filters_probability=0, hierarchical=False) tensors = { 'entropy': dist_info['entropy'], 'sample_log_prob': dist_info['sample_log_prob'], } self.evaluate(tf.global_variables_initializer()) for _ in range(10): values = self.evaluate(tensors) self.assertAlmostEqual( values['entropy'], math.log(2) + math.log(3) + math.log(4)) self.assertAlmostEqual( values['sample_log_prob'], math.log(1/2) + math.log(1/3) + math.log(1/4)) def test_independent_sample_temperature(self): structure = schema.OneOf(['foo', 'bar', 'baz'], basic_specs.OP_TAG) temperature = tf.placeholder_with_default( tf.constant(5.0, tf.float32), shape=(), name='temperature') rl_structure, dist_info = controller.independent_sample( structure, temperature=temperature) with self.cached_session() as sess: sess.run(tf.global_variables_initializer()) # Samples should be valid even when the temperature is set to a value # other than 1. self.assertOneHot(sess.run(rl_structure.mask)) # Before training, the sample log-probability and entropy shouldn't be # affected by the temperature, since the probabilities are initialized # to a uniform distribution. self.assertAlmostEqual( sess.run(dist_info['sample_log_prob']), math.log(1/3)) self.assertAlmostEqual(sess.run(dist_info['entropy']), math.log(3)) # The gradients should be multiplied by (1 / temperature). # The OneOf has three possible choices. The gradient for the selected one # will be positive, while the gradients for the other two will be # negative. Since the selected choice can change between steps, we compare # the max, which should always give us gradients w.r.t. the selected one. trainable_vars = tf.trainable_variables() self.assertLen(trainable_vars, 1) grad_tensors = tf.gradients(dist_info['sample_log_prob'], trainable_vars) grad1 = np.max(sess.run(grad_tensors[0], {temperature: 1.0})) grad5 = np.max(sess.run(grad_tensors[0], {temperature: 5.0})) self.assertAlmostEqual(grad1 / 5, grad5) if __name__ == '__main__': tf.disable_v2_behavior() tf.test.main()
google-research/google-research
tunas/controller_test.py
Python
apache-2.0
11,472
[ "VisIt" ]
83cdb3056ac553a61487d2bc2e741d107985b4a0f95d7e9997a4ad6b282a4f7c
# import h5py import numpy as np # from pprint import pprint # from termcolor import colored as c, cprint # from IPython.display import FileLink # from IPython import display # from tqdm import tqdm import matplotlib matplotlib.use('Agg') import matplotlib.pyplot as plt color_palette = ['#507ba6', '#f08e39', '#e0595c', '#79b8b3', '#5ca153', '#edc854', '#af7ba2', '#fe9fa9', '#9c7561', '#bbb0ac'] from scipy.signal import savgol_filter def smooth(samples, window_length=101, polyorder=3): return savgol_filter(samples, window_length=window_length, polyorder=polyorder) def smooth_ranges(samples, scale, floor=1, **kwargs): centroids = np.mean(samples, axis=1) smoothed = np.transpose(np.vstack(( np.minimum(smooth(samples[:, 0] - centroids, **kwargs), - floor), np.maximum(smooth(samples[:, 1] - centroids, **kwargs), floor) ))) return smoothed * scale + np.expand_dims(centroids, 1) def smooth_ranges_2d(xranges, yranges, aspect_ratio='equal', *args, **kwargs): smoothed_x = smooth_ranges(xranges, *args, **kwargs) smoothed_y = smooth_ranges(yranges, *args, **kwargs) if aspect_ratio == 'equal': x_centroids = np.mean(smoothed_x, axis=1) y_centroids = np.mean(smoothed_y, axis=1) half_spread = np.maximum(np.abs(smoothed_x[:, 0] - x_centroids), np.abs(smoothed_y[:, 0] - y_centroids)) return np.transpose(np.vstack(( x_centroids - half_spread, x_centroids + half_spread ))), np.transpose(np.vstack(( y_centroids - half_spread, y_centroids + half_spread ))) else: return smoothed_x, smoothed_y def plot_deep_features(deep_features, labels, **kwargs): bins = {} for logit, deep_feature in zip(labels, deep_features): label = np.argmax(logit) # print(label) try: bins[str(label)].append(list(deep_feature)) except KeyError: bins[str(label)] = [list(deep_feature)] fig = plt.figure(figsize=(5, 5)) for numeral in map(str, range(10)): try: features = np.array(bins[numeral]) except KeyError: print(numeral + " does not exist") features = [] try: x, y = np.transpose(features) except ValueError: x = []; y = [] plt.scatter( x, y, s=1, color=color_palette[int(numeral)], label=numeral ) plt.legend(loc=(1.05, 0.1), frameon=False) if 'title' in kwargs: title = kwargs['title'] else: title = 'MNIST LeNet++ with 2 Deep Features (PReLU)' plt.title(title) plt.xlabel('activation of hidden neuron 1') plt.ylabel('activation of hidden neuron 2') if 'xlim' in kwargs: plt.xlim(kwargs['xlim'][0], kwargs['xlim'][1]) if 'ylim' in kwargs: plt.ylim(kwargs['ylim'][0], kwargs['ylim'][1]) return fig def text(message, loc, xrange, yrange, horizontalalignment='right', verticalalignment='bottom', **kwargs): x = xrange[0] * (1 - loc[0]) + xrange[1] * loc[0] y = yrange[0] * (1 - loc[1]) + yrange[1] * loc[1] plt.text(x, y, message, horizontalalignment=horizontalalignment, verticalalignment=verticalalignment, **kwargs) def plot(save=False, **kwargs): if 'frame_prefix' in kwargs: frame_prefix = kwargs['frame_prefix'] else: frame_prefix = 'frame' if save and 'frame_index' in kwargs: fname = './figures/animation/' + frame_prefix + "_" + str(1000 + kwargs['frame_index'])[-3:] + '.png' plt.savefig(fname, dpi=300, bbox_inches='tight') plt.show() # plt.close(fig) elif save: fname = './figures/animation/' + title + '.png' plt.savefig(fname, dpi=300, bbox_inches='tight') plt.show() # plt.close(fig) else: plt.show()
kinshuk4/MoocX
misc/deep_learning_notes/Proj_Centroid_Loss_LeNet/LeNet_plus_centerloss/analysis.py
Python
mit
3,979
[ "NEURON" ]
160a2d9fdac477c4af4e2530a0acf01fe8f6ee3b3e3ef338bd6881f52d55b4bc
#Some functions to help analysing DUT-8 import numpy as np import sys from ase import Atoms, neighborlist import os import pickle def buildNL(mol, path='./', radii=None, save=True): #create nl if radii is None: radii = {} radii[ 'H'] = 0.30 radii[ 'C'] = 0.77 radii[ 'N'] = 0.70 radii[ 'O'] = 0.66 radii['Ni'] = 1.24 nAtoms = len(mol) if (not os.path.isfile(os.path.join(path, 'neighborList.pickle'))) or (not save): #create a list of cutoffs cutOff = [] for j in range(0,nAtoms): cutOff.append(radii[mol[j].symbol]) #initiate neighborlist neighborList = neighborlist.NeighborList(cutOff,self_interaction=False,bothways=True) neighborList.update(mol) if save: with open(os.path.join(path, 'neighborList.pickle'),'wb') as f: pickle.dump(neighborList,f) elif save: with open(os.path.join(path, 'neighborList.pickle'),'rb') as f: neighborList = pickle.load(f) print("Bond Map created") return neighborList def getBenzNiAngleList(ana, imI): """Make a list of all occurences""" if isinstance(imI, int): imI = [imI] dihedralList = [] for i in imI: dihedralList.append([]) nAtoms = len(ana.images[i]) molecule = ana.images[i] bondList = ana.all_bonds[i] relDihedrals = ana.get_dihedrals('Ni', 'Ni', 'O', 'C')[i] for dihed in relDihedrals: nextC = [ idx for idx in bondList[dihed[-1]] if molecule[idx].symbol == 'C'] assert len(nextC) == 1 attachedCs = [ idx for idx in bondList[nextC[0]] if (molecule[idx].symbol == 'C') and (idx != dihed[-1])] assert len(attachedCs) == 2 dists = [ molecule.get_distance(dihed[0], idx, mic=True) for idx in attachedCs ] if dists[0] < dists[1]: dihedralList[-1].append((dihed[0], dihed[1], attachedCs[1], attachedCs[0])) else: dihedralList[-1].append((dihed[0], dihed[1], attachedCs[0], attachedCs[1])) return dihedralList def getAlphaList(ana, imI): """Make a list of all occurences""" from itertools import combinations allIdx = ana._get_symbol_idxs(imI, 'Ni') nAtoms = len(ana.images[imI]) molecule = ana.images[imI] bondList = ana.all_bonds[imI] dihedrals = ana.get_dihedrals('Ni', 'O', 'C', 'C')[0] alphaList = [] for niIdx in allIdx: relDihedrals = [ d for d in dihedrals if d[0] == niIdx ] assert len(relDihedrals) == 4 s = set([d[-1] for d in relDihedrals]) if s not in alphaList: alphaList.append(s) r = [] for l in alphaList: r.extend(list(combinations(list(l), 2))) return [r] def checkBonds(mol, bondList, cluster=False): for iAtom, atom in enumerate(mol): bondedIdx = bondList[iAtom] bondedSym = [ mol[idx].symbol for idx in bondedIdx ] if atom.symbol == 'C': check = [ False, False, False, False ] if (set(bondedSym) == set(['C','H'])) and (len(bondedIdx) == 3): check[0] = True elif (set(bondedSym) == set(['C','H','N'])) and (len(bondedIdx) == 4): check[1] = True elif (set(bondedSym) == set(['C'])) and (len(bondedIdx) == 3): check[2] = True elif (set(bondedSym) == set(['C','O'])) and (len(bondedIdx) == 3): check[3] = True if not any(check): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) elif atom.symbol == 'H': if ((set(bondedSym) != set(['C'])) and (set(bondedSym) != set(['N']))) or (len(bondedIdx) != 1): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) elif atom.symbol == 'N': if cluster: if ((set(bondedSym) != set(['C','Ni'])) and (set(bondedSym) != set(['H','Ni'])) and (set(bondedSym) != set(['C']))) or (not len(bondedIdx) in [4,3]): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) else: if ((set(bondedSym) != set(['C','Ni'])) and (set(bondedSym) != set(['H','Ni']))) or (len(bondedIdx) != 4): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) elif atom.symbol == 'O': if (set(bondedSym) != set(['C','Ni'])) or (len(bondedIdx) != 2): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) elif atom.symbol == 'Ni': if (set(bondedSym) != set(['Ni','O','N'])) or (len(bondedIdx) != 6): raise RuntimeError("Atom {:} ({:}) bonded to {:}, these are {:}".format(iAtom, atom.symbol,str(bondedIdx),str(bondedSym))) return True
patrickmelix/Python4ChemistryTools
moffunctions.py
Python
mit
5,110
[ "ASE" ]
47546c5daeac3a03f84120bc0ddece4a2046247563164f7065c416f28fe696bc
#!/usr/bin/env python # -*- coding: utf-8 -*- """ Zappa CLI Deploy arbitrary Python programs as serverless Zappa applications. """ from __future__ import unicode_literals from __future__ import division import argcomplete import argparse import base64 import pkgutil import botocore import click import collections import hjson as json import inspect import importlib import logging import os import pkg_resources import random import re import requests import slugify import string import sys import tempfile import time import toml import yaml import zipfile from click.exceptions import ClickException from dateutil import parser from datetime import datetime,timedelta from zappa import Zappa, logger, API_GATEWAY_REGIONS from util import (check_new_version_available, detect_django_settings, detect_flask_apps, parse_s3_url, human_size) CUSTOM_SETTINGS = [ 'assume_policy', 'attach_policy', 'aws_region', 'delete_local_zip', 'delete_s3_zip', 'exclude', 'http_methods', 'integration_response_codes', 'method_header_types', 'method_response_codes', 'parameter_depth', 'role_name', 'touch', ] ## # Main Input Processing ## class ZappaCLI(object): """ ZappaCLI object is responsible for loading the settings, handling the input arguments and executing the calls to the core library. """ # CLI vargs = None command = None command_env = None # Zappa settings zappa = None zappa_settings = None load_credentials = True # Specific settings api_stage = None app_function = None aws_region = None debug = None prebuild_script = None project_name = None profile_name = None lambda_arn = None lambda_name = None lambda_description = None s3_bucket_name = None settings_file = None zip_path = None handler_path = None vpc_config = None memory_size = None use_apigateway = None lambda_handler = None django_settings = None manage_roles = True exception_handler = None environment_variables = None authorizer = None stage_name_env_pattern = re.compile('^[a-zA-Z0-9_]+$') def __init__(self): self._stage_config_overrides = {} # change using self.override_stage_config_setting(key, val) @property def stage_config(self): """ A shortcut property for settings of a stage. """ def get_stage_setting(stage, extended_stages=None): if extended_stages is None: extended_stages = [] if stage in extended_stages: raise RuntimeError(stage + " has already been extended to these settings. " "There is a circular extends within the settings file.") extended_stages.append(stage) try: stage_settings = dict(self.zappa_settings[stage].copy()) except KeyError: raise ClickException("Cannot extend settings for undefined environment '" + stage + "'.") extends_stage = self.zappa_settings[stage].get('extends', None) if not extends_stage: return stage_settings extended_settings = get_stage_setting(stage=extends_stage, extended_stages=extended_stages) extended_settings.update(stage_settings) return extended_settings settings = get_stage_setting(stage=self.api_stage) # Backwards compatible for delete_zip setting that was more explicitly named delete_local_zip if u'delete_zip' in settings: settings[u'delete_local_zip'] = settings.get(u'delete_zip') settings.update(self.stage_config_overrides) return settings @property def stage_config_overrides(self): """ Returns zappa_settings we forcefully override for the current stage set by `self.override_stage_config_setting(key, value)` """ return getattr(self, '_stage_config_overrides', {}).get(self.api_stage, {}) def override_stage_config_setting(self, key, val): """ Forcefully override a setting set by zappa_settings (for the current stage only) :param key: settings key :param val: value """ self._stage_config_overrides = getattr(self, '_stage_config_overrides', {}) self._stage_config_overrides.setdefault(self.api_stage, {})[key] = val def handle(self, argv=None): """ Main function. Parses command, load settings and dispatches accordingly. """ desc = ('Zappa - Deploy Python applications to AWS Lambda' ' and API Gateway.\n') parser = argparse.ArgumentParser(description=desc) parser.add_argument( '-v', '--version', action='version', version=pkg_resources.get_distribution("zappa").version, help='Print the zappa version' ) parser.add_argument( '-a', '--app_function', help='The WSGI application function.' ) parser.add_argument( '-s', '--settings_file', help='The path to a Zappa settings file.' ) env_parser = argparse.ArgumentParser(add_help=False) group = env_parser.add_mutually_exclusive_group() all_help = ('Execute this command for all of our defined ' 'Zappa environments.') group.add_argument('--all', action='store_true', help=all_help) group.add_argument('command_env', nargs='?') ## # Certify ## subparsers = parser.add_subparsers(title='subcommands', dest='command') cert_parser = subparsers.add_parser( 'certify', parents=[env_parser], help='Create and install SSL certificate' ) cert_parser.add_argument( '--no-cleanup', action='store_true', help=("Don't remove certificate files from /tmp during certify." " Dangerous.") ) ## # Deploy ## subparsers.add_parser( 'deploy', parents=[env_parser], help='Deploy application.' ) subparsers.add_parser('init', help='Initialize Zappa app.') ## # Package ## package_parser = subparsers.add_parser( 'package', parents=[env_parser], help='Build the application zip package locally.' ) ## # Invocation ## invoke_parser = subparsers.add_parser( 'invoke', parents=[env_parser], help='Invoke remote function.' ) invoke_parser.add_argument( '--raw', action='store_true', help=('When invoking remotely, invoke this python as a string,' ' not as a modular path.') ) invoke_parser.add_argument('command_rest') ## # Manage ## manage_parser = subparsers.add_parser( 'manage', help='Invoke remote Django manage.py commands.' ) rest_help = ("Command in the form of <env> <command>. <env> is not " "required if --all is specified") manage_parser.add_argument('--all', action='store_true', help=all_help) manage_parser.add_argument('command_rest', nargs='+', help=rest_help) ## # Rollback ## def positive_int(s): """ Ensure an arg is positive """ i = int(s) if i < 0: msg = "This argument must be positive (got {})".format(s) raise argparse.ArgumentTypeError(msg) return i rollback_parser = subparsers.add_parser( 'rollback', parents=[env_parser], help='Rollback deployed code to a previous version.' ) rollback_parser.add_argument( '-n', '--num-rollback', type=positive_int, default=0, help='The number of versions to rollback.' ) ## # Scheduling ## subparsers.add_parser( 'schedule', parents=[env_parser], help='Schedule functions to occur at regular intervals.' ) ## # Status ## status_parser = subparsers.add_parser( 'status', parents=[env_parser], help='Show deployment status and event schedules.' ) status_parser.add_argument( '--json', action='store_true', help='Returns status in JSON format.' ) # https://github.com/Miserlou/Zappa/issues/407 ## # Log Tailing ## tail_parser = subparsers.add_parser( 'tail', parents=[env_parser], help='Tail deployment logs.' ) tail_parser.add_argument( '--no-color', action='store_true', help="Don't color log tail output." ) tail_parser.add_argument( '--http', action='store_true', help='Only show HTTP requests in tail output.' ) tail_parser.add_argument( '--non-http', action='store_true', help='Only show non-HTTP requests in tail output.' ) tail_parser.add_argument( '--since', type=str, default="100000s", help="Only show lines since a certain timeframe." ) tail_parser.add_argument( '--filter', type=str, default="", help="Apply a filter pattern to the logs." ) ## # Undeploy ## undeploy_parser = subparsers.add_parser( 'undeploy', parents=[env_parser], help='Undeploy application.' ) undeploy_parser.add_argument( '--remove-logs', action='store_true', help=('Removes log groups of api gateway and lambda task' ' during the undeployment.'), ) undeploy_parser.add_argument( '-y', '--yes', action='store_true', help='Auto confirm yes.' ) ## # Unschedule ## subparsers.add_parser('unschedule', parents=[env_parser], help='Unschedule functions.') ## # Updating ## subparsers.add_parser( 'update', parents=[env_parser], help='Update deployed application.' ) argcomplete.autocomplete(parser) args = parser.parse_args(argv) self.vargs = vars(args) # Parse the input # NOTE(rmoe): Special case for manage command # The manage command can't have both command_env and command_rest # arguments. Since they are both positional arguments argparse can't # differentiate the two. This causes problems when used with --all. # (e.g. "manage --all showmigrations admin" argparse thinks --all has # been specified AND that command_env='showmigrations') # By having command_rest collect everything but --all we can split it # apart here instead of relying on argparse. if args.command == 'manage' and not self.vargs.get('all'): self.command_env = self.vargs['command_rest'].pop(0) else: self.command_env = self.vargs.get('command_env') self.command = args.command # We don't have any settings yet, so make those first! # (Settings-based interactions will fail # before a project has been initialized.) if self.command == 'init': self.init() return # Make sure there isn't a new version available if not self.vargs.get('json'): self.check_for_update() # Load and Validate Settings File self.load_settings_file(self.vargs.get('settings_file')) # Should we execute this for all environments, or just one? all_environments = self.vargs.get('all') environments = [] if all_environments: # All envs! environments = self.zappa_settings.keys() else: # Just one env. if not self.command_env: # If there's only one environment defined in the settings, # use that as the default. if len(self.zappa_settings.keys()) == 1: environments.append(self.zappa_settings.keys()[0]) else: parser.error("Please supply an environment to interact with.") else: environments.append(self.command_env) for environment in environments: try: self.dispatch_command(self.command, environment) except ClickException as e: # Discussion on exit codes: https://github.com/Miserlou/Zappa/issues/407 e.show() sys.exit(e.exit_code) def dispatch_command(self, command, environment): """ Given a command to execute and environment, execute that command. """ self.api_stage = environment if command not in ['status', 'manage']: click.echo("Calling " + click.style(command, fg="green", bold=True) + " for environment " + click.style(self.api_stage, bold=True) + ".." ) # Explicity define the app function. if self.vargs['app_function'] is not None: self.app_function = self.vargs['app_function'] # Load our settings, based on api_stage. try: self.load_settings(self.vargs['settings_file']) except ValueError as e: print("Error: {}".format(e.message)) sys.exit(-1) self.callback('settings') # Hand it off if command == 'deploy': # pragma: no cover self.deploy() if command == 'package': # pragma: no cover self.package() elif command == 'update': # pragma: no cover self.update() elif command == 'rollback': # pragma: no cover self.rollback(self.vargs['num_rollback']) elif command == 'invoke': # pragma: no cover if not self.vargs.get('command_rest'): print("Please enter the function to invoke.") return self.invoke(self.vargs['command_rest'], raw_python=self.vargs['raw']) elif command == 'manage': # pragma: no cover if not self.vargs.get('command_rest'): print("Please enter the management command to invoke.") return if not self.django_settings: print("This command is for Django projects only!") print("If this is a Django project, please define django_settings in your zappa_settings.") return command_tail = self.vargs.get('command_rest') if len(command_tail) > 1: command = " ".join(command_tail) # ex: zappa manage dev "shell --version" else: command = command_tail[0] # ex: zappa manage dev showmigrations admin self.invoke(command, command="manage") elif command == 'tail': # pragma: no cover self.tail( colorize=(not self.vargs['no_color']), http=self.vargs['http'], non_http=self.vargs['non_http'], since=self.vargs['since'], filter_pattern=self.vargs['filter'], ) elif command == 'undeploy': # pragma: no cover self.undeploy( noconfirm=self.vargs['yes'], remove_logs=self.vargs['remove_logs'] ) elif command == 'schedule': # pragma: no cover self.schedule() elif command == 'unschedule': # pragma: no cover self.unschedule() elif command == 'status': # pragma: no cover self.status(return_json=self.vargs['json']) elif command == 'certify': # pragma: no cover self.certify(no_cleanup=self.vargs['no_cleanup']) ## # The Commands ## def package(self): """ Only build the package """ # force not to delete the local zip self.override_stage_config_setting('delete_local_zip', False) # Execute the prebuild script if self.prebuild_script: self.execute_prebuild_script() # Create the Lambda Zip self.create_package() self.callback('zip') size = human_size(os.path.getsize(self.zip_path)) click.echo(click.style("Package created", fg="green", bold=True) + ": " + click.style(self.zip_path, bold=True) + " (" + size + ")") def deploy(self): """ Package your project, upload it to S3, register the Lambda function and create the API Gateway routes. """ # Execute the prebuild script if self.prebuild_script: self.execute_prebuild_script() # Make sure this isn't already deployed. deployed_versions = self.zappa.get_lambda_function_versions(self.lambda_name) if len(deployed_versions) > 0: raise ClickException("This application is " + click.style("already deployed", fg="red") + " - did you mean to call " + click.style("update", bold=True) + "?") # Make sure the necessary IAM execution roles are available if self.manage_roles: try: self.zappa.create_iam_roles() except botocore.client.ClientError: raise ClickException( click.style("Failed", fg="red") + " to " + click.style("manage IAM roles", bold=True) + "!\n" + "You may " + click.style("lack the necessary AWS permissions", bold=True) + " to automatically manage a Zappa execution role.\n" + "To fix this, see here: " + click.style("https://github.com/Miserlou/Zappa#using-custom-aws-iam-roles-and-policies", bold=True) + '\n') # Create the Lambda Zip self.create_package() self.callback('zip') # Upload it to S3 success = self.zappa.upload_to_s3( self.zip_path, self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to upload to S3. Quitting.") # If using a slim handler, upload it to S3 and tell lambda to use this slim handler zip if self.stage_config.get('slim_handler', False): # https://github.com/Miserlou/Zappa/issues/510 success = self.zappa.upload_to_s3(self.handler_path, self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to upload handler to S3. Quitting.") # Copy the project zip to the current project zip current_project_name = '{0!s}_current_project.zip'.format(self.project_name) success = self.zappa.copy_on_s3(src_file_name=self.zip_path, dst_file_name=current_project_name, bucket_name=self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to copy the zip to be the current project. Quitting.") handler_file = self.handler_path else: handler_file = self.zip_path # Fixes https://github.com/Miserlou/Zappa/issues/613 try: self.lambda_arn = self.zappa.get_lambda_function( function_name=self.lambda_name) except botocore.client.ClientError: # Register the Lambda function with that zip as the source # You'll also need to define the path to your lambda_handler code. self.lambda_arn = self.zappa.create_lambda_function( bucket=self.s3_bucket_name, s3_key=handler_file, function_name=self.lambda_name, handler=self.lambda_handler, description=self.lambda_description, vpc_config=self.vpc_config, timeout=self.timeout_seconds, memory_size=self.memory_size ) # Schedule events for this deployment self.schedule() endpoint_url = '' deployment_string = click.style("Deployment complete", fg="green", bold=True) + "!" if self.use_apigateway: # Create and configure the API Gateway template = self.zappa.create_stack_template(self.lambda_arn, self.lambda_name, self.api_key_required, self.integration_content_type_aliases, self.iam_authorization, self.authorizer, self.cors) self.zappa.update_stack(self.lambda_name, self.s3_bucket_name, wait=True) # Deploy the API! api_id = self.zappa.get_api_id(self.lambda_name) endpoint_url = self.deploy_api_gateway(api_id) deployment_string = deployment_string + ": {}".format(endpoint_url) # Create/link API key if self.api_key_required: if self.api_key is None: self.zappa.create_api_key(api_id=api_id, stage_name=self.api_stage) else: self.zappa.add_api_stage_to_api_key(api_key=self.api_key, api_id=api_id, stage_name=self.api_stage) if self.stage_config.get('touch', True): requests.get(endpoint_url) # Finally, delete the local copy our zip package if self.stage_config.get('delete_local_zip', True): self.remove_local_zip() # Remove the project zip from S3. self.remove_uploaded_zip() self.callback('post') click.echo(deployment_string) def update(self): """ Repackage and update the function code. """ # Execute the prebuild script if self.prebuild_script: self.execute_prebuild_script() # Temporary version check try: updated_time = 1472581018 function_response = self.zappa.lambda_client.get_function(FunctionName=self.lambda_name) conf = function_response['Configuration'] last_updated = parser.parse(conf['LastModified']) last_updated_unix = time.mktime(last_updated.timetuple()) except Exception as e: click.echo(click.style("Warning!", fg="red") + " Couldn't get function " + self.lambda_name + " in " + self.zappa.aws_region + " - have you deployed yet?") sys.exit(-1) if last_updated_unix <= updated_time: click.echo(click.style("Warning!", fg="red") + " You may have upgraded Zappa since deploying this application. You will need to " + click.style("redeploy", bold=True) + " for this deployment to work properly!") # Make sure the necessary IAM execution roles are available if self.manage_roles: try: self.zappa.create_iam_roles() except botocore.client.ClientError: click.echo(click.style("Failed", fg="red") + " to " + click.style("manage IAM roles", bold=True) + "!") click.echo("You may " + click.style("lack the necessary AWS permissions", bold=True) + " to automatically manage a Zappa execution role.") click.echo("To fix this, see here: " + click.style("https://github.com/Miserlou/Zappa#using-custom-aws-iam-roles-and-policies", bold=True)) sys.exit(-1) # Create the Lambda Zip, self.create_package() self.callback('zip') # Upload it to S3 success = self.zappa.upload_to_s3(self.zip_path, self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to upload project to S3. Quitting.") # If using a slim handler, upload it to S3 and tell lambda to use this slim handler zip if self.stage_config.get('slim_handler', False): # https://github.com/Miserlou/Zappa/issues/510 success = self.zappa.upload_to_s3(self.handler_path, self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to upload handler to S3. Quitting.") # Copy the project zip to the current project zip current_project_name = '{0!s}_current_project.zip'.format(self.project_name) success = self.zappa.copy_on_s3(src_file_name=self.zip_path, dst_file_name=current_project_name, bucket_name=self.s3_bucket_name) if not success: # pragma: no cover raise ClickException("Unable to copy the zip to be the current project. Quitting.") handler_file = self.handler_path else: handler_file = self.zip_path # Register the Lambda function with that zip as the source # You'll also need to define the path to your lambda_handler code. self.lambda_arn = self.zappa.update_lambda_function( self.s3_bucket_name, handler_file, self.lambda_name) # Remove the uploaded zip from S3, because it is now registered.. self.remove_uploaded_zip() # Update the configuration, in case there are changes. self.lambda_arn = self.zappa.update_lambda_configuration(lambda_arn=self.lambda_arn, function_name=self.lambda_name, handler=self.lambda_handler, description=self.lambda_description, vpc_config=self.vpc_config, timeout=self.timeout_seconds, memory_size=self.memory_size) # Finally, delete the local copy our zip package if self.stage_config.get('delete_local_zip', True): self.remove_local_zip() if self.use_apigateway: self.zappa.create_stack_template(self.lambda_arn, self.lambda_name, self.api_key_required, self.integration_content_type_aliases, self.iam_authorization, self.authorizer, self.cors) self.zappa.update_stack(self.lambda_name, self.s3_bucket_name, wait=True, update_only=True) api_id = self.zappa.get_api_id(self.lambda_name) endpoint_url = self.deploy_api_gateway(api_id) if self.stage_config.get('domain', None): endpoint_url = self.stage_config.get('domain') else: endpoint_url = None self.schedule() self.callback('post') if endpoint_url and 'https://' not in endpoint_url: endpoint_url = 'https://' + endpoint_url deployed_string = "Your updated Zappa deployment is " + click.style("live", fg='green', bold=True) + "!" if self.use_apigateway: deployed_string = deployed_string + ": " + click.style("{}".format(endpoint_url), bold=True) api_url = None if endpoint_url and 'amazonaws.com' not in endpoint_url: api_url = self.zappa.get_api_url( self.lambda_name, self.api_stage) if endpoint_url != api_url: deployed_string = deployed_string + " (" + api_url + ")" if self.stage_config.get('touch', True): if api_url: requests.get(api_url) elif endpoint_url: requests.get(endpoint_url) click.echo(deployed_string) def rollback(self, revision): """ Rollsback the currently deploy lambda code to a previous revision. """ print("Rolling back..") self.zappa.rollback_lambda_function_version( self.lambda_name, versions_back=revision) print("Done!") def tail(self, since, filter_pattern, limit=10000, keep_open=True, colorize=True, http=False, non_http=False): """ Tail this function's logs. if keep_open, do so repeatedly, printing any new logs """ try: from util import string_to_timestamp since_stamp = string_to_timestamp(since) last_since = since_stamp while True: new_logs = self.zappa.fetch_logs( self.lambda_name, start_time=since_stamp, limit=limit, filter_pattern=filter_pattern, ) new_logs = [ e for e in new_logs if e['timestamp'] > last_since ] self.print_logs(new_logs, colorize, http, non_http) if not keep_open: break if new_logs: last_since = new_logs[-1]['timestamp'] time.sleep(1) except KeyboardInterrupt: # pragma: no cover # Die gracefully try: sys.exit(0) except SystemExit: os._exit(130) def undeploy(self, noconfirm=False, remove_logs=False): """ Tear down an exiting deployment. """ if not noconfirm: # pragma: no cover confirm = raw_input("Are you sure you want to undeploy? [y/n] ") if confirm != 'y': return if self.use_apigateway: if remove_logs: self.zappa.remove_api_gateway_logs(self.lambda_name) domain_name = self.stage_config.get('domain', None) # Only remove the api key when not specified if self.api_key_required and self.api_key is None: api_id = self.zappa.get_api_id(self.lambda_name) self.zappa.remove_api_key(api_id, self.api_stage) gateway_id = self.zappa.undeploy_api_gateway( self.lambda_name, domain_name=domain_name ) self.unschedule() # removes event triggers, including warm up event. self.zappa.delete_lambda_function(self.lambda_name) if remove_logs: self.zappa.remove_lambda_function_logs(self.lambda_name) click.echo(click.style("Done", fg="green", bold=True) + "!") def schedule(self): """ Given a a list of functions and a schedule to execute them, setup up regular execution. """ events = self.stage_config.get('events', []) if events: if not isinstance(events, list): # pragma: no cover print("Events must be supplied as a list.") return for event in events: self.collision_warning(event.get('function')) if self.stage_config.get('keep_warm', True): if not events: events = [] keep_warm_rate = self.stage_config.get('keep_warm_expression', "rate(4 minutes)") events.append({'name': 'zappa-keep-warm', 'function': 'handler.keep_warm_callback', 'expression': keep_warm_rate, 'description': 'Zappa Keep Warm - {}'.format(self.lambda_name)}) if self.stage_config.get('lets_encrypt_expression'): function_response = self.zappa.lambda_client.get_function(FunctionName=self.lambda_name) conf = function_response['Configuration'] timeout = conf['Timeout'] if timeout < 60: click.echo(click.style("Unable to schedule certificate autorenewer!", fg="red", bold=True) + " Please redeploy with a " + click.style("timeout_seconds", bold=True) + " greater than 60!") else: events.append({'name': 'zappa-le-certify', 'function': 'handler.certify_callback', 'expression': self.stage_config.get('lets_encrypt_expression'), 'description': 'Zappa LE Certificate Renewer - {}'.format(self.lambda_name)}) if events: try: function_response = self.zappa.lambda_client.get_function(FunctionName=self.lambda_name) except botocore.exceptions.ClientError as e: # pragma: no cover click.echo(click.style("Function does not exist", fg="yellow") + ", please " + click.style("deploy", bold=True) + "first. Ex:" + click.style("zappa deploy {}.".format(self.api_stage), bold=True)) sys.exit(-1) print("Scheduling..") self.zappa.schedule_events( lambda_arn=function_response['Configuration']['FunctionArn'], lambda_name=self.lambda_name, events=events ) def unschedule(self): """ Given a a list of scheduled functions, tear down their regular execution. """ # Run even if events are not defined to remove previously existing ones (thus default to []). events = self.stage_config.get('events', []) if not isinstance(events, list): # pragma: no cover print("Events must be supplied as a list.") return function_arn = None try: function_response = self.zappa.lambda_client.get_function(FunctionName=self.lambda_name) function_arn = function_response['Configuration']['FunctionArn'] except botocore.exceptions.ClientError as e: # pragma: no cover raise ClickException("Function does not exist, you should deploy first. Ex: zappa deploy {}. " "Proceeding to unschedule CloudWatch based events.".format(self.api_stage)) print("Unscheduling..") self.zappa.unschedule_events( lambda_name=self.lambda_name, lambda_arn=function_arn, events=events, ) def invoke(self, function_name, raw_python=False, command=None): """ Invoke a remote function. """ # There are three likely scenarios for 'command' here: # command, which is a modular function path # raw_command, which is a string of python to execute directly # manage, which is a Django-specific management command invocation key = command if command is not None else 'command' if raw_python: command = {'raw_command': function_name} else: command = {key: function_name} # Can't use hjson import json as json response = self.zappa.invoke_lambda_function( self.lambda_name, json.dumps(command), invocation_type='RequestResponse', ) if 'LogResult' in response: print(base64.b64decode(response['LogResult'])) else: print(response) def status(self, return_json=False): """ Describe the status of the current deployment. """ def tabular_print(title, value): """ Convience function for priting formatted table items. """ click.echo('%-*s%s' % (32, click.style("\t" + title, fg='green') + ':', str(value))) return # Lambda Env Details lambda_versions = self.zappa.get_lambda_function_versions(self.lambda_name) if not lambda_versions: raise ClickException(click.style("No Lambda %s detected in %s - have you deployed yet?" % (self.lambda_name, self.zappa.aws_region), fg='red')) status_dict = collections.OrderedDict() status_dict["Lambda Versions"] = len(lambda_versions) function_response = self.zappa.lambda_client.get_function(FunctionName=self.lambda_name) conf = function_response['Configuration'] self.lambda_arn = conf['FunctionArn'] status_dict["Lambda Name"] = self.lambda_name status_dict["Lambda ARN"] = self.lambda_arn status_dict["Lambda Role ARN"] = conf['Role'] status_dict["Lambda Handler"] = conf['Handler'] status_dict["Lambda Code Size"] = conf['CodeSize'] status_dict["Lambda Version"] = conf['Version'] status_dict["Lambda Last Modified"] = conf['LastModified'] status_dict["Lambda Memory Size"] = conf['MemorySize'] status_dict["Lambda Timeout"] = conf['Timeout'] status_dict["Lambda Runtime"] = conf['Runtime'] if 'VpcConfig' in conf.keys(): status_dict["Lambda VPC ID"] = conf.get('VpcConfig', {}).get('VpcId', 'Not assigned') else: status_dict["Lambda VPC ID"] = None # Calculated statistics try: function_invocations = self.zappa.cloudwatch.get_metric_statistics( Namespace='AWS/Lambda', MetricName='Invocations', StartTime=datetime.utcnow()-timedelta(days=1), EndTime=datetime.utcnow(), Period=1440, Statistics=['Sum'], Dimensions=[{'Name': 'FunctionName', 'Value': '{}'.format(self.lambda_name)}] )['Datapoints'][0]['Sum'] except Exception as e: function_invocations = 0 try: function_errors = self.zappa.cloudwatch.get_metric_statistics( Namespace='AWS/Lambda', MetricName='Errors', StartTime=datetime.utcnow()-timedelta(days=1), EndTime=datetime.utcnow(), Period=1440, Statistics=['Sum'], Dimensions=[{'Name': 'FunctionName', 'Value': '{}'.format(self.lambda_name)}] )['Datapoints'][0]['Sum'] except Exception as e: function_errors = 0 try: error_rate = "{0:.2f}%".format(function_errors / function_invocations * 100) except: error_rate = "Error calculating" status_dict["Invocations (24h)"] = int(function_invocations) status_dict["Errors (24h)"] = int(function_errors) status_dict["Error Rate (24h)"] = error_rate # URLs if self.use_apigateway: api_url = self.zappa.get_api_url( self.lambda_name, self.api_stage) status_dict["API Gateway URL"] = api_url # Api Keys api_id = self.zappa.get_api_id(self.lambda_name) for api_key in self.zappa.get_api_keys(api_id, self.api_stage): status_dict["API Gateway x-api-key"] = api_key # There literally isn't a better way to do this. # AWS provides no way to tie a APIGW domain name to its Lambda funciton. domain_url = self.stage_config.get('domain', None) if domain_url: status_dict["Domain URL"] = 'https://' + domain_url else: status_dict["Domain URL"] = "None Supplied" # Scheduled Events event_rules = self.zappa.get_event_rules_for_lambda(lambda_arn=self.lambda_arn) status_dict["Num. Event Rules"] = len(event_rules) if len(event_rules) > 0: status_dict['Events'] = [] for rule in event_rules: event_dict = {} rule_name = rule['Name'] event_dict["Event Rule Name"] = rule_name event_dict["Event Rule Schedule"] = rule.get(u'ScheduleExpression', None) event_dict["Event Rule State"] = rule.get(u'State', None).title() event_dict["Event Rule ARN"] = rule.get(u'Arn', None) status_dict['Events'].append(event_dict) if return_json: # Putting the status in machine readable format # https://github.com/Miserlou/Zappa/issues/407 print(json.dumpsJSON(status_dict)) else: click.echo("Status for " + click.style(self.lambda_name, bold=True) + ": ") for k, v in status_dict.items(): if k == 'Events': # Events are a list of dicts for event in v: for item_k, item_v in event.items(): tabular_print(item_k, item_v) else: tabular_print(k, v) # TODO: S3/SQS/etc. type events? return True def check_stage_name(self, stage_name): """ Make sure the stage name matches the AWS-allowed pattern (calls to apigateway_client.create_deployment, will fail with error message "ClientError: An error occurred (BadRequestException) when calling the CreateDeployment operation: Stage name only allows a-zA-Z0-9_" if the pattern does not match) """ if self.stage_name_env_pattern.match(stage_name): return True raise ValueError("AWS requires stage name to match a-zA-Z0-9_") def check_environment(self, environment): """ Make sure the environment contains only strings (since putenv needs a string) """ non_strings = [] for k,v in environment.iteritems(): if not isinstance(v, basestring): non_strings.append(k) if non_strings: raise ValueError("The following environment variables are not strings: {}".format(", ".join(non_strings))) else: return True def init(self, settings_file="zappa_settings.json"): """ Initialize a new Zappa project by creating a new zappa_settings.json in a guided process. This should probably be broken up into few separate componants once it's stable. Testing these raw_inputs requires monkeypatching with mock, which isn't pretty. """ # Ensure that we don't already have a zappa_settings file. if os.path.isfile(settings_file): raise ClickException("This project is " + click.style("already initialized", fg="red", bold=True) + "!") # Ensure P2 until Lambda supports it. if sys.version_info >= (3,0): # pragma: no cover raise ClickException("Zappa curently only works with Python 2, until AWS Lambda adds Python 3 support.") # Ensure inside virtualenv. if not ( hasattr(sys, 'prefix') or hasattr(sys, 'real_prefix') or hasattr(sys, 'base_prefix') ): # pragma: no cover raise ClickException( "Zappa must be run inside of a virtual environment!\n" "Learn more about virtual environments here: http://docs.python-guide.org/en/latest/dev/virtualenvs/") # Explain system. click.echo(click.style(u"""\n███████╗ █████╗ ██████╗ ██████╗ █████╗ ╚══███╔╝██╔══██╗██╔══██╗██╔══██╗██╔══██╗ ███╔╝ ███████║██████╔╝██████╔╝███████║ ███╔╝ ██╔══██║██╔═══╝ ██╔═══╝ ██╔══██║ ███████╗██║ ██║██║ ██║ ██║ ██║ ╚══════╝╚═╝ ╚═╝╚═╝ ╚═╝ ╚═╝ ╚═╝\n""", fg='green', bold=True)) click.echo(click.style("Welcome to ", bold=True) + click.style("Zappa", fg='green', bold=True) + click.style("!\n", bold=True)) click.echo(click.style("Zappa", bold=True) + " is a system for running server-less Python web applications" " on AWS Lambda and AWS API Gateway.") click.echo("This `init` command will help you create and configure your new Zappa deployment.") click.echo("Let's get started!\n") # Create Env while True: click.echo("Your Zappa configuration can support multiple production environments, like '" + click.style("dev", bold=True) + "', '" + click.style("staging", bold=True) + "', and '" + click.style("production", bold=True) + "'.") env = raw_input("What do you want to call this environment (default 'dev'): ") or "dev" try: self.check_stage_name(env) break except ValueError: click.echo(click.style("Environment names must match a-zA-Z0-9_", fg='red')) # Create Bucket click.echo("\nYour Zappa deployments will need to be uploaded to a " + click.style("private S3 bucket", bold=True) + ".") click.echo("If you don't have a bucket yet, we'll create one for you too.") default_bucket = "zappa-" + ''.join(random.choice(string.ascii_lowercase + string.digits) for _ in range(9)) bucket = raw_input("What do you want call your bucket? (default '%s'): " % default_bucket) or default_bucket # TODO actually create bucket. # Detect Django/Flask try: # pragma: no cover import django has_django = True except ImportError as e: has_django = False try: # pragma: no cover import flask has_flask = True except ImportError as e: has_flask = False print('') # App-specific if has_django: # pragma: no cover click.echo("It looks like this is a " + click.style("Django", bold=True) + " application!") click.echo("What is the " + click.style("module path", bold=True) + " to your projects's Django settings?") django_settings = None matches = detect_django_settings() while django_settings in [None, '']: if matches: click.echo("We discovered: " + click.style(', '.join('{}'.format(i) for v, i in enumerate(matches)), bold=True)) django_settings = raw_input("Where are your project's settings? (default '%s'): " % matches[0]) or matches[0] else: click.echo("(This will likely be something like 'your_project.settings')") django_settings = raw_input("Where are your project's settings?: ") django_settings = django_settings.replace("'", "") django_settings = django_settings.replace('"', "") else: matches = None if has_flask: click.echo("It looks like this is a " + click.style("Flask", bold=True) + " application.") matches = detect_flask_apps() click.echo("What's the " + click.style("modular path", bold=True) + " to your app's function?") click.echo("This will likely be something like 'your_module.app'.") app_function = None while app_function in [None, '']: if matches: click.echo("We discovered: " + click.style(', '.join('{}'.format(i) for v, i in enumerate(matches)), bold=True)) app_function = raw_input("Where is your app's function? (default '%s'): " % matches[0]) or matches[0] else: app_function = raw_input("Where is your app's function?: ") app_function = app_function.replace("'", "") app_function = app_function.replace('"', "") # TODO: Create VPC? # Memory size? Time limit? # Domain? LE keys? Region? # 'Advanced Settings' mode? # Globalize click.echo("\nYou can optionally deploy to " + click.style("all available regions", bold=True) + " in order to provide fast global service.") click.echo("If you are using Zappa for the first time, you probably don't want to do this!") global_deployment = False while True: global_type = raw_input("Would you like to deploy this application to " + click.style("globally", bold=True) + "? (default 'n') [y/n/(p)rimary]: ") if not global_type: break if global_type.lower() in ["y", "yes", "p", "primary"]: global_deployment = True break if global_type.lower() in ["n", "no"]: global_deployment = False break if global_deployment: regions = API_GATEWAY_REGIONS if global_type.lower() in ["p", "primary"]: envs = [{env + '_' + region.replace('-', '_'): { 'aws_region': region}} for region in regions if '-1' in region] else: envs = [{env + '_' + region.replace('-', '_'): { 'aws_region': region}} for region in regions] else: region = None # assume system default envs = [{env: {}}] zappa_settings = {} for each_env in envs: # Honestly, this could be cleaner. env_name = each_env.keys()[0] env_dict = each_env[env_name] env_bucket = bucket if global_deployment: env_bucket = bucket.replace('-', '_') + '_' + env_name env_zappa_settings = { env_name: { 's3_bucket': env_bucket, } } if env_dict.has_key('aws_region'): env_zappa_settings[env_name]['aws_region'] = env_dict.get('aws_region') zappa_settings.update(env_zappa_settings) if has_django: zappa_settings[env_name]['django_settings'] = django_settings else: zappa_settings[env_name]['app_function'] = app_function import json as json # hjson is fine for loading, not fine for writing. zappa_settings_json = json.dumps(zappa_settings, sort_keys=True, indent=4) click.echo("\nOkay, here's your " + click.style("zappa_settings.js", bold=True) + ":\n") click.echo(click.style(zappa_settings_json, fg="yellow", bold=False)) confirm = raw_input("\nDoes this look " + click.style("okay", bold=True, fg="green") + "? (default 'y') [y/n]: ") or 'yes' if confirm[0] not in ['y', 'Y', 'yes', 'YES']: click.echo("" + click.style("Sorry", bold=True, fg='red') + " to hear that! Please init again.") return # Write with open("zappa_settings.json", "w") as zappa_settings_file: zappa_settings_file.write(zappa_settings_json) if global_deployment: click.echo("\n" + click.style("Done", bold=True) + "! You can also " + click.style("deploy all", bold=True) + " by executing:\n") click.echo(click.style("\t$ zappa deploy --all", bold=True)) click.echo("\nAfter that, you can " + click.style("update", bold=True) + " your application code with:\n") click.echo(click.style("\t$ zappa update --all", bold=True)) else: click.echo("\n" + click.style("Done", bold=True) + "! Now you can " + click.style("deploy", bold=True) + " your Zappa application by executing:\n") click.echo(click.style("\t$ zappa deploy %s" % env, bold=True)) click.echo("\nAfter that, you can " + click.style("update", bold=True) + " your application code with:\n") click.echo(click.style("\t$ zappa update %s" % env, bold=True)) click.echo("\nTo learn more, check out our project page on " + click.style("GitHub", bold=True) + " here: " + click.style("https://github.com/Miserlou/Zappa", fg="cyan", bold=True)) click.echo("and stop by our " + click.style("Slack", bold=True) + " channel here: " + click.style("http://bit.do/zappa", fg="cyan", bold=True)) click.echo("\nEnjoy!,") click.echo(" ~ Team " + click.style("Zappa", bold=True) + "!") return def certify(self, no_cleanup=False): """ Register or update a domain certificate for this env. """ # Give warning on --no-cleanup if no_cleanup: clean_up = False click.echo(click.style("Warning!", fg="red", bold=True) + " You are calling certify with " + click.style("--no-cleanup", bold=True) + ". Your certificate files will remain in the system temporary directory after this command executes!") else: clean_up = True # Make sure this isn't already deployed. deployed_versions = self.zappa.get_lambda_function_versions(self.lambda_name) if len(deployed_versions) == 0: raise ClickException("This application " + click.style("isn't deployed yet", fg="red") + " - did you mean to call " + click.style("deploy", bold=True) + "?") # Get install account_key to /tmp/account_key.pem account_key_location = self.stage_config.get('lets_encrypt_key') domain = self.stage_config.get('domain') cert_location = self.stage_config.get('certificate', None) cert_key_location = self.stage_config.get('certificate_key', None) cert_chain_location = self.stage_config.get('certificate_chain', None) if not domain: raise ClickException("Can't certify a domain without " + click.style("domain", fg="red", bold=True) + " configured!") if not cert_location: if not account_key_location: raise ClickException("Can't certify a domain without " + click.style("lets_encrypt_key", fg="red", bold=True) + " configured!") if account_key_location.startswith('s3://'): bucket, key_name = parse_s3_url(account_key_location) self.zappa.s3_client.download_file(bucket, key_name, '/tmp/account.key') else: from shutil import copyfile copyfile(account_key_location, '/tmp/account.key') else: if not cert_location or not cert_key_location or not cert_chain_location: raise ClickException("Can't certify a domain without " + click.style("certificate, certificate_key and certificate_chain", fg="red", bold=True) + " configured!") # Read the supplied certificates. with open(cert_location) as f: certificate_body = f.read() with open(cert_key_location) as f: certificate_private_key = f.read() with open(cert_chain_location) as f: certificate_chain = f.read() click.echo("Certifying domain " + click.style(domain, fg="green", bold=True) + "..") # Get cert and update domain. if not cert_location: from letsencrypt import get_cert_and_update_domain, cleanup cert_success = get_cert_and_update_domain( self.zappa, self.lambda_name, self.api_stage, domain, clean_up ) else: if not self.zappa.get_domain_name(domain): self.zappa.create_domain_name( domain, domain + "-Zappa-Cert", certificate_body, certificate_private_key, certificate_chain, self.lambda_name, self.api_stage ) print("Created a new domain name. Please note that it can take up to 40 minutes for this domain to be " "created and propagated through AWS, but it requires no further work on your part.") else: self.zappa.update_domain_name( domain, domain + "-Zappa-Cert", certificate_body, certificate_private_key, certificate_chain ) cert_success = True # Deliberately undocumented feature (for now, at least.) # We are giving the user the ability to shoot themselves in the foot. # _This is probably not a good idea._ # However, I am sick and tired of hitting the Let's Encrypt cert # limit while testing. if clean_up: cleanup() if cert_success: click.echo("Certificate " + click.style("updated", fg="green", bold=True) + "!") else: click.echo(click.style("Failed", fg="red", bold=True) + " to generate or install certificate! :(") click.echo("\n==============\n") shamelessly_promote() ## # Utility ## def callback(self, position): """ Allows the execution of custom code between creation of the zip file and deployment to AWS. :return: None """ callbacks = self.stage_config.get('callbacks', {}) callback = callbacks.get(position) if callback: (mod_path, cb_func_name) = callback.rsplit('.', 1) try: # Prefer callback in working directory if mod_path.count('.') >= 1: # Callback function is nested in a folder (mod_folder_path, mod_name) = mod_path.rsplit('.', 1) mod_folder_path_fragments = mod_folder_path.split('.') working_dir = os.path.join(os.getcwd(), *mod_folder_path_fragments) else: mod_name = mod_path working_dir = os.getcwd() working_dir_importer = pkgutil.get_importer(working_dir) module_ = working_dir_importer.find_module(mod_name).load_module(mod_name) except (ImportError, AttributeError): try: # Callback func might be in virtualenv module_ = importlib.import_module(mod_path) except ImportError: # pragma: no cover raise ClickException(click.style("Failed ", fg="red") + 'to ' + click.style( "import {position} callback ".format(position=position), bold=True) + 'module: "{mod_path}"'.format(mod_path=click.style(mod_path, bold=True))) if not hasattr(module_, cb_func_name): # pragma: no cover raise ClickException(click.style("Failed ", fg="red") + 'to ' + click.style( "find {position} callback ".format(position=position), bold=True) + 'function: "{cb_func_name}" '.format( cb_func_name=click.style(cb_func_name, bold=True)) + 'in module "{mod_path}"'.format(mod_path=mod_path)) cb_func = getattr(module_, cb_func_name) cb_func(self) # Call the function passing self def check_for_update(self): """ Print a warning if there's a new Zappa version available. """ try: version = pkg_resources.require("zappa")[0].version updateable = check_new_version_available(version) if updateable: click.echo(click.style("Important!", fg="yellow", bold=True) + " A new version of " + click.style("Zappa", bold=True) + " is available!") click.echo("Upgrade with: " + click.style("pip install zappa --upgrade", bold=True)) click.echo("Visit the project page on GitHub to see the latest changes: " + click.style("https://github.com/Miserlou/Zappa", bold=True)) except Exception as e: # pragma: no cover print(e) return def load_settings(self, settings_file=None, session=None): """ Load the local zappa_settings file. An existing boto session can be supplied, though this is likely for testing purposes. Returns the loaded Zappa object. """ # Ensure we're passed a valid settings file. if not settings_file: settings_file = self.get_json_or_yaml_settings() if not os.path.isfile(settings_file): raise ClickException("Please configure your zappa_settings file.") # Load up file self.load_settings_file(settings_file) # Make sure that the environments are valid names: for stage_name in self.zappa_settings.keys(): try: self.check_stage_name(stage_name) except ValueError: raise ValueError("API stage names must match a-zA-Z0-9_ ; '{0!s}' does not.".format(stage_name)) # Make sure that this environment is our settings if self.api_stage not in self.zappa_settings.keys(): raise ClickException("Please define '{0!s}' in your Zappa settings.".format(self.api_stage)) # We need a working title for this project. Use one if supplied, else cwd dirname. if 'project_name' in self.stage_config: # pragma: no cover self.project_name = self.stage_config['project_name'] else: self.project_name = slugify.slugify(os.getcwd().split(os.sep)[-1])[:15] if len(self.project_name) > 15: # pragma: no cover click.echo(click.style("Warning", fg="red", bold=True) + "! Your " + click.style("project_name", bold=True) + " may be too long to deploy! Please make it <16 characters.") # The name of the actual AWS Lambda function, ex, 'helloworld-dev' # Django's slugify doesn't replace _, but this does. self.lambda_name = slugify.slugify(self.project_name + '-' + self.api_stage) # Load environment-specific settings self.s3_bucket_name = self.stage_config.get('s3_bucket', "zappa-" + ''.join(random.choice(string.ascii_lowercase + string.digits) for _ in range(9))) self.vpc_config = self.stage_config.get('vpc_config', {}) self.memory_size = self.stage_config.get('memory_size', 512) self.app_function = self.stage_config.get('app_function', None) self.exception_handler = self.stage_config.get('exception_handler', None) self.aws_region = self.stage_config.get('aws_region', None) self.debug = self.stage_config.get('debug', True) self.prebuild_script = self.stage_config.get('prebuild_script', None) self.profile_name = self.stage_config.get('profile_name', None) self.log_level = self.stage_config.get('log_level', "DEBUG") self.domain = self.stage_config.get('domain', None) self.timeout_seconds = self.stage_config.get('timeout_seconds', 30) # Provide legacy support for `use_apigateway`, now `apigateway_enabled`. # https://github.com/Miserlou/Zappa/issues/490 # https://github.com/Miserlou/Zappa/issues/493 self.use_apigateway = self.stage_config.get('use_apigateway', True) if self.use_apigateway: self.use_apigateway = self.stage_config.get('apigateway_enabled', True) self.integration_content_type_aliases = self.stage_config.get('integration_content_type_aliases', {}) self.lambda_handler = self.stage_config.get('lambda_handler', 'handler.lambda_handler') # DEPRICATED. https://github.com/Miserlou/Zappa/issues/456 self.remote_env_bucket = self.stage_config.get('remote_env_bucket', None) self.remote_env_file = self.stage_config.get('remote_env_file', None) self.remote_env = self.stage_config.get('remote_env', None) self.settings_file = self.stage_config.get('settings_file', None) self.django_settings = self.stage_config.get('django_settings', None) self.manage_roles = self.stage_config.get('manage_roles', True) self.api_key_required = self.stage_config.get('api_key_required', False) self.api_key = self.stage_config.get('api_key') self.iam_authorization = self.stage_config.get('iam_authorization', False) self.cors = self.stage_config.get("cors", None) self.lambda_description = self.stage_config.get('lambda_description', "Zappa Deployment") self.environment_variables = self.stage_config.get('environment_variables', {}) self.check_environment(self.environment_variables) self.authorizer = self.stage_config.get('authorizer', {}) self.zappa = Zappa( boto_session=session, profile_name=self.profile_name, aws_region=self.aws_region, load_credentials=self.load_credentials ) for setting in CUSTOM_SETTINGS: if setting in self.stage_config: setting_val = self.stage_config[setting] # Read the policy file contents. if setting.endswith('policy'): with open(setting_val, 'r') as f: setting_val = f.read() setattr(self.zappa, setting, setting_val) if self.app_function: self.collision_warning(self.app_function) if self.app_function[-3:] == '.py': click.echo(click.style("Warning!", fg="red", bold=True) + " Your app_function is pointing to a " + click.style("file and not a function", bold=True) + "! It should probably be something like 'my_file.app', not 'my_file.py'!") return self.zappa def get_json_or_yaml_settings(self, settings_name="zappa_settings"): """ Return zappa_settings path as JSON or YAML (or TOML), as appropriate. """ zs_json = settings_name + ".json" zs_yaml = settings_name + ".yml" zs_toml = settings_name + ".toml" # Must have at least one if not os.path.isfile(zs_json) \ and not os.path.isfile(zs_yaml) \ and not os.path.isfile(zs_toml): raise ClickException("Please configure a zappa_settings file.") # Prefer JSON if os.path.isfile(zs_json): settings_file = zs_json elif os.path.isfile(zs_toml): settings_file = zs_toml else: settings_file = zs_yaml return settings_file def load_settings_file(self, settings_file=None): """ Load our settings file. """ if not settings_file: settings_file = self.get_json_or_yaml_settings() if not os.path.isfile(settings_file): raise ClickException("Please configure your zappa_settings file.") if '.yml' in settings_file: with open(settings_file) as yaml_file: try: self.zappa_settings = yaml.load(yaml_file) except ValueError: # pragma: no cover raise ValueError("Unable to load the Zappa settings YAML. It may be malformed.") elif '.toml' in settings_file: with open(settings_file) as toml_file: try: self.zappa_settings = toml.load(toml_file) except ValueError: # pragma: no cover raise ValueError("Unable to load the Zappa settings TOML. It may be malformed.") else: with open(settings_file) as json_file: try: self.zappa_settings = json.load(json_file) except ValueError: # pragma: no cover raise ValueError("Unable to load the Zappa settings JSON. It may be malformed.") def create_package(self): """ Ensure that the package can be properly configured, and then create it. """ # Create the Lambda zip package (includes project and virtualenvironment) # Also define the path the handler file so it can be copied to the zip # root for Lambda. current_file = os.path.dirname(os.path.abspath( inspect.getfile(inspect.currentframe()))) handler_file = os.sep.join(current_file.split(os.sep)[0:]) + os.sep + 'handler.py' # Create the zip file(s) if self.stage_config.get('slim_handler', False): # Create two zips. One with the application and the other with just the handler. # https://github.com/Miserlou/Zappa/issues/510 self.zip_path = self.zappa.create_lambda_zip( prefix=self.lambda_name, use_precompiled_packages=self.stage_config.get('use_precompiled_packages', True), exclude=self.stage_config.get('exclude', []) ) # Make sure the normal venv is not included in the handler's zip exclude = self.stage_config.get('exclude', []) cur_venv = self.zappa.get_current_venv() exclude.append(cur_venv.split('/')[-1]) self.handler_path = self.zappa.create_lambda_zip( prefix='handler_{0!s}'.format(self.lambda_name), venv=self.zappa.create_handler_venv(), handler_file=handler_file, slim_handler=True, exclude=exclude ) else: # Create a single zip that has the handler and application self.zip_path = self.zappa.create_lambda_zip( prefix=self.lambda_name, handler_file=handler_file, use_precompiled_packages=self.stage_config.get('use_precompiled_packages', True), exclude=self.stage_config.get( 'exclude', # Exclude packages already builtin to the python lambda environment # https://github.com/Miserlou/Zappa/issues/556 ["boto3", "dateutil", "botocore", "s3transfer", "six.py", "jmespath", "concurrent"]) ) # Warn if this is too large for Lambda. file_stats = os.stat(self.zip_path) if file_stats.st_size > 52428800: # pragma: no cover print('\n\nWarning: Application zip package is likely to be too large for AWS Lambda. ' 'Try setting "slim_handler" to true in your Zappa settings file.\n\n') # Throw custom setings into the zip that handles requests if self.stage_config.get('slim_handler', False): handler_zip = self.handler_path else: handler_zip = self.zip_path with zipfile.ZipFile(handler_zip, 'a') as lambda_zip: settings_s = "# Generated by Zappa\n" if self.app_function: if '.' not in self.app_function: # pragma: no cover raise ClickException("Your " + click.style("app_function", fg='red', bold=True) + " value is not a modular path." + " It needs to be in the format `" + click.style("your_module.your_app_object", bold=True) + "`.") app_module, app_function = self.app_function.rsplit('.', 1) settings_s = settings_s + "APP_MODULE='{0!s}'\nAPP_FUNCTION='{1!s}'\n".format(app_module, app_function) if self.exception_handler: settings_s += "EXCEPTION_HANDLER='{0!s}'\n".format(self.exception_handler) else: settings_s += "EXCEPTION_HANDLER=None\n" if self.debug: settings_s = settings_s + "DEBUG=True\n" else: settings_s = settings_s + "DEBUG=False\n" settings_s = settings_s + "LOG_LEVEL='{0!s}'\n".format((self.log_level)) # If we're on a domain, we don't need to define the /<<env>> in # the WSGI PATH if self.domain: settings_s = settings_s + "DOMAIN='{0!s}'\n".format((self.domain)) else: settings_s = settings_s + "DOMAIN=None\n" # Pass through remote config bucket and path if self.remote_env: settings_s = settings_s + "REMOTE_ENV='{0!s}'\n".format( self.remote_env ) # DEPRICATED. use remove_env instead elif self.remote_env_bucket and self.remote_env_file: settings_s = settings_s + "REMOTE_ENV='s3://{0!s}/{1!s}'\n".format( self.remote_env_bucket, self.remote_env_file ) # Local envs env_dict = {} if self.aws_region: env_dict['AWS_REGION'] = self.aws_region env_dict.update(dict(self.environment_variables)) # Environement variable keys can't be Unicode # https://github.com/Miserlou/Zappa/issues/604 try: env_dict = dict((k.encode('ascii'), v) for (k, v) in env_dict.items()) except Exception: # pragma: nocover raise ValueError("Environment variable keys must not be unicode.") settings_s = settings_s + "ENVIRONMENT_VARIABLES={0}\n".format( env_dict ) # We can be environment-aware settings_s = settings_s + "API_STAGE='{0!s}'\n".format((self.api_stage)) settings_s = settings_s + "PROJECT_NAME='{0!s}'\n".format((self.project_name)) if self.settings_file: settings_s = settings_s + "SETTINGS_FILE='{0!s}'\n".format((self.settings_file)) else: settings_s = settings_s + "SETTINGS_FILE=None\n" if self.django_settings: settings_s = settings_s + "DJANGO_SETTINGS='{0!s}'\n".format((self.django_settings)) else: settings_s = settings_s + "DJANGO_SETTINGS=None\n" # If slim handler, path to project zip if self.stage_config.get('slim_handler', False): settings_s += "ZIP_PATH='s3://{0!s}/{1!s}_current_project.zip'\n".format(self.s3_bucket_name, self.project_name) # AWS Events function mapping event_mapping = {} events = self.stage_config.get('events', []) for event in events: arn = event.get('event_source', {}).get('arn') function = event.get('function') if arn and function: event_mapping[arn] = function settings_s = settings_s + "AWS_EVENT_MAPPING={0!s}\n".format(event_mapping) # Authorizer config authorizer_function = self.authorizer.get('function', None) if authorizer_function: settings_s += "AUTHORIZER_FUNCTION='{0!s}'\n".format(authorizer_function) # Copy our Django app into root of our package. # It doesn't work otherwise. if self.django_settings: base = __file__.rsplit(os.sep, 1)[0] django_py = ''.join(os.path.join(base, 'ext', 'django_zappa.py')) lambda_zip.write(django_py, 'django_zappa_app.py') # Lambda requires a specific chmod temp_settings = tempfile.NamedTemporaryFile(delete=False) os.chmod(temp_settings.name, 0o644) temp_settings.write(settings_s) temp_settings.close() lambda_zip.write(temp_settings.name, 'zappa_settings.py') os.remove(temp_settings.name) def remove_local_zip(self): """ Remove our local zip file. """ if self.stage_config.get('delete_local_zip', True): try: if os.path.isfile(self.zip_path): os.remove(self.zip_path) if self.handler_path and os.path.isfile(self.handler_path): os.remove(self.handler_path) except Exception as e: # pragma: no cover sys.exit(-1) def remove_uploaded_zip(self): """ Remove the local and S3 zip file after uploading and updating. """ # Remove the uploaded zip from S3, because it is now registered.. if self.stage_config.get('delete_s3_zip', True): self.zappa.remove_from_s3(self.zip_path, self.s3_bucket_name) if self.stage_config.get('slim_handler', False): # Need to keep the project zip as the slim handler uses it. self.zappa.remove_from_s3(self.handler_path, self.s3_bucket_name) def on_exit(self): """ Cleanup after the command finishes. Always called: SystemExit, KeyboardInterrupt and any other Exception that occurs. """ if self.zip_path: self.remove_uploaded_zip() self.remove_local_zip() def print_logs(self, logs, colorize=True, http=False, non_http=False): """ Parse, filter and print logs to the console. """ for log in logs: timestamp = log['timestamp'] message = log['message'] if "START RequestId" in message: continue if "REPORT RequestId" in message: continue if "END RequestId" in message: continue if not colorize: if http: if self.is_http_log_entry(message.strip()): print("[" + str(timestamp) + "] " + message.strip()) elif non_http: if not self.is_http_log_entry(message.strip()): print("[" + str(timestamp) + "] " + message.strip()) else: print("[" + str(timestamp) + "] " + message.strip()) else: if http: if self.is_http_log_entry(message.strip()): click.echo(click.style("[", fg='cyan') + click.style(str(timestamp), bold=True) + click.style("]", fg='cyan') + self.colorize_log_entry(message.strip())) elif non_http: if not self.is_http_log_entry(message.strip()): click.echo(click.style("[", fg='cyan') + click.style(str(timestamp), bold=True) + click.style("]", fg='cyan') + self.colorize_log_entry(message.strip())) else: click.echo(click.style("[", fg='cyan') + click.style(str(timestamp), bold=True) + click.style("]", fg='cyan') + self.colorize_log_entry(message.strip())) def is_http_log_entry(self, string): """ Determines if a log entry is an HTTP-formatted log string or not. """ # Debug event filter if 'Zappa Event' in string: return False # IP address filter for token in string.replace('\t', ' ').split(' '): try: if (token.count('.') is 3 and token.replace('.', '').isnumeric()): return True except Exception: # pragma: no cover pass return False def colorize_log_entry(self, string): """ Apply various heuristics to return a colorized version of a string. If these fail, simply return the string in plaintext. """ final_string = string try: # First, do stuff in square brackets inside_squares = re.findall(r'\[([^]]*)\]', string) for token in inside_squares: if token in ['CRITICAL', 'ERROR', 'WARNING', 'DEBUG', 'INFO', 'NOTSET']: final_string = final_string.replace('[' + token + ']', click.style("[", fg='cyan') + click.style(token, fg='cyan', bold=True) + click.style("]", fg='cyan')) else: final_string = final_string.replace('[' + token + ']', click.style("[", fg='cyan') + click.style(token, bold=True) + click.style("]", fg='cyan')) # Then do quoted strings quotes = re.findall(r'"[^"]*"', string) for token in quotes: final_string = final_string.replace(token, click.style(token, fg="yellow")) # And UUIDs for token in final_string.replace('\t', ' ').split(' '): try: if token.count('-') is 4 and token.replace('-', '').isalnum(): final_string = final_string.replace(token, click.style(token, fg="magenta")) except Exception: # pragma: no cover pass # And IP addresses try: if token.count('.') is 3 and token.replace('.', '').isnumeric(): final_string = final_string.replace(token, click.style(token, fg="red")) except Exception: # pragma: no cover pass # And status codes try: if token in ['200']: final_string = final_string.replace(token, click.style(token, fg="green")) if token in ['400', '401', '403', '404', '405', '500']: final_string = final_string.replace(token, click.style(token, fg="red")) except Exception: # pragma: no cover pass # And Zappa Events try: if "Zappa Event:" in final_string: final_string = final_string.replace("Zappa Event:", click.style("Zappa Event:", bold=True, fg="green")) except Exception: # pragma: no cover pass # And dates for token in final_string.split('\t'): try: is_date = parser.parse(token) final_string = final_string.replace(token, click.style(token, fg="green")) except Exception: # pragma: no cover pass final_string = final_string.replace('\t', ' ').replace(' ', ' ') if final_string[0] != ' ': final_string = ' ' + final_string return final_string except Exception as e: # pragma: no cover return string def execute_prebuild_script(self): """ Parse and execute the prebuild_script from the zappa_settings. """ (pb_mod_path, pb_func) = self.prebuild_script.rsplit('.', 1) try: # Prefer prebuild script in working directory if pb_mod_path.count('.') >= 1: # Prebuild script func is nested in a folder (mod_folder_path, mod_name) = pb_mod_path.rsplit('.', 1) mod_folder_path_fragments = mod_folder_path.split('.') working_dir = os.path.join(os.getcwd(), *mod_folder_path_fragments) else: mod_name = pb_mod_path working_dir = os.getcwd() working_dir_importer = pkgutil.get_importer(working_dir) module_ = working_dir_importer.find_module(mod_name).load_module(mod_name) except (ImportError, AttributeError): try: # Prebuild func might be in virtualenv module_ = importlib.import_module(pb_mod_path) except ImportError: # pragma: no cover raise ClickException(click.style("Failed ", fg="red") + 'to ' + click.style( "import prebuild script ", bold=True) + 'module: "{pb_mod_path}"'.format( pb_mod_path=click.style(pb_mod_path, bold=True))) if not hasattr(module_, pb_func): # pragma: no cover raise ClickException(click.style("Failed ", fg="red") + 'to ' + click.style( "find prebuild script ", bold=True) + 'function: "{pb_func}" '.format( pb_func=click.style(pb_func, bold=True)) + 'in module "{pb_mod_path}"'.format( pb_mod_path=pb_mod_path)) prebuild_function = getattr(module_, pb_func) prebuild_function() # Call the function def collision_warning(self, item): """ Given a string, print a warning if this could collide with a Zappa core package module. Use for app functions and events. """ namespace_collisions = [ "zappa.", "wsgi.", "middleware.", "handler.", "util.", "letsencrypt.", "cli." ] for namespace_collision in namespace_collisions: if namespace_collision in item: click.echo(click.style("Warning!", fg="red", bold=True) + " You may have a namespace collision with " + click.style(item, bold=True) + "! You may want to rename that file.") def deploy_api_gateway(self, api_id): cache_cluster_enabled = self.stage_config.get('cache_cluster_enabled', False) cache_cluster_size = str(self.stage_config.get('cache_cluster_size', .5)) endpoint_url = self.zappa.deploy_api_gateway( api_id=api_id, stage_name=self.api_stage, cache_cluster_enabled=cache_cluster_enabled, cache_cluster_size=cache_cluster_size, cloudwatch_log_level=self.stage_config.get('cloudwatch_log_level', 'OFF'), cloudwatch_data_trace=self.stage_config.get('cloudwatch_data_trace', False), cloudwatch_metrics_enabled=self.stage_config.get('cloudwatch_metrics_enabled', False), ) return endpoint_url #################################################################### # Main #################################################################### def shamelessly_promote(): """ Shamelessly promote our little community. """ click.echo("Need " + click.style("help", fg='green', bold=True) + "? Found a " + click.style("bug", fg='green', bold=True) + "? Let us " + click.style("know", fg='green', bold=True) + "! :D") click.echo("File bug reports on " + click.style("GitHub", bold=True) + " here: " + click.style("https://github.com/Miserlou/Zappa", fg='cyan', bold=True)) click.echo("And join our " + click.style("Slack", bold=True) + " channel here: " + click.style("https://slack.zappa.io", fg='cyan', bold=True)) click.echo("Love!,") click.echo(" ~ Team " + click.style("Zappa", bold=True) + "!") def handle(): # pragma: no cover """ Main program execution handler. """ try: cli = ZappaCLI() sys.exit(cli.handle()) except SystemExit as e: # pragma: no cover cli.on_exit() sys.exit(e.code) except KeyboardInterrupt: # pragma: no cover cli.on_exit() sys.exit(130) except Exception as e: cli.on_exit() click.echo("Oh no! An " + click.style("error occurred", fg='red', bold=True) + "! :(") click.echo("\n==============\n") import traceback traceback.print_exc() click.echo("\n==============\n") shamelessly_promote() sys.exit(-1) if __name__ == '__main__': # pragma: no cover handle()
parroyo/Zappa
zappa/cli.py
Python
mit
87,982
[ "VisIt" ]
710c0823e03a4e6abc0a776da06a52b42cc6fc581b10446344905b97600979bd
r""" :mod:`~matplotlib.mathtext` is a module for parsing a subset of the TeX math syntax and drawing them to a matplotlib backend. For a tutorial of its usage see :ref:`sphx_glr_tutorials_text_mathtext.py`. This document is primarily concerned with implementation details. The module uses pyparsing_ to parse the TeX expression. .. _pyparsing: http://pyparsing.wikispaces.com/ The Bakoma distribution of the TeX Computer Modern fonts, and STIX fonts are supported. There is experimental support for using arbitrary fonts, but results may vary without proper tweaking and metrics for those fonts. """ from __future__ import (absolute_import, division, print_function, unicode_literals) import six import os, sys from six import unichr from math import ceil import unicodedata from warnings import warn from numpy import inf, isinf import numpy as np import pyparsing from pyparsing import (Combine, Group, Optional, Forward, Literal, OneOrMore, ZeroOrMore, ParseException, Empty, ParseResults, Suppress, oneOf, StringEnd, ParseFatalException, FollowedBy, Regex, ParserElement, QuotedString, ParseBaseException) ParserElement.enablePackrat() from matplotlib.afm import AFM from matplotlib.cbook import Bunch, get_realpath_and_stat, maxdict from matplotlib.ft2font import (FT2Image, KERNING_DEFAULT, LOAD_FORCE_AUTOHINT, LOAD_NO_HINTING) from matplotlib.font_manager import findfont, FontProperties, get_font from matplotlib._mathtext_data import (latex_to_bakoma, latex_to_standard, tex2uni, latex_to_cmex, stix_virtual_fonts) from matplotlib import get_data_path, rcParams import matplotlib.colors as mcolors import matplotlib._png as _png #################### ############################################################################## # FONTS def get_unicode_index(symbol, math=True): """get_unicode_index(symbol, [bool]) -> integer Return the integer index (from the Unicode table) of symbol. *symbol* can be a single unicode character, a TeX command (i.e. r'\\pi'), or a Type1 symbol name (i.e. 'phi'). If math is False, the current symbol should be treated as a non-math symbol. """ # for a non-math symbol, simply return its unicode index if not math: return ord(symbol) # From UTF #25: U+2212 minus sign is the preferred # representation of the unary and binary minus sign rather than # the ASCII-derived U+002D hyphen-minus, because minus sign is # unambiguous and because it is rendered with a more desirable # length, usually longer than a hyphen. if symbol == '-': return 0x2212 try:# This will succeed if symbol is a single unicode char return ord(symbol) except TypeError: pass try:# Is symbol a TeX symbol (i.e. \alpha) return tex2uni[symbol.strip("\\")] except KeyError: message = """'%(symbol)s' is not a valid Unicode character or TeX/Type1 symbol"""%locals() raise ValueError(message) def unichr_safe(index): """Return the Unicode character corresponding to the index, or the replacement character if this is a narrow build of Python and the requested character is outside the BMP.""" try: return unichr(index) except ValueError: return unichr(0xFFFD) class MathtextBackend(object): """ The base class for the mathtext backend-specific code. The purpose of :class:`MathtextBackend` subclasses is to interface between mathtext and a specific matplotlib graphics backend. Subclasses need to override the following: - :meth:`render_glyph` - :meth:`render_rect_filled` - :meth:`get_results` And optionally, if you need to use a FreeType hinting style: - :meth:`get_hinting_type` """ def __init__(self): self.width = 0 self.height = 0 self.depth = 0 def set_canvas_size(self, w, h, d): 'Dimension the drawing canvas' self.width = w self.height = h self.depth = d def render_glyph(self, ox, oy, info): """ Draw a glyph described by *info* to the reference point (*ox*, *oy*). """ raise NotImplementedError() def render_rect_filled(self, x1, y1, x2, y2): """ Draw a filled black rectangle from (*x1*, *y1*) to (*x2*, *y2*). """ raise NotImplementedError() def get_results(self, box): """ Return a backend-specific tuple to return to the backend after all processing is done. """ raise NotImplementedError() def get_hinting_type(self): """ Get the FreeType hinting type to use with this particular backend. """ return LOAD_NO_HINTING class MathtextBackendAgg(MathtextBackend): """ Render glyphs and rectangles to an FTImage buffer, which is later transferred to the Agg image by the Agg backend. """ def __init__(self): self.ox = 0 self.oy = 0 self.image = None self.mode = 'bbox' self.bbox = [0, 0, 0, 0] MathtextBackend.__init__(self) def _update_bbox(self, x1, y1, x2, y2): self.bbox = [min(self.bbox[0], x1), min(self.bbox[1], y1), max(self.bbox[2], x2), max(self.bbox[3], y2)] def set_canvas_size(self, w, h, d): MathtextBackend.set_canvas_size(self, w, h, d) if self.mode != 'bbox': self.image = FT2Image(ceil(w), ceil(h + max(d, 0))) def render_glyph(self, ox, oy, info): if self.mode == 'bbox': self._update_bbox(ox + info.metrics.xmin, oy - info.metrics.ymax, ox + info.metrics.xmax, oy - info.metrics.ymin) else: info.font.draw_glyph_to_bitmap( self.image, ox, oy - info.metrics.iceberg, info.glyph, antialiased=rcParams['text.antialiased']) def render_rect_filled(self, x1, y1, x2, y2): if self.mode == 'bbox': self._update_bbox(x1, y1, x2, y2) else: height = max(int(y2 - y1) - 1, 0) if height == 0: center = (y2 + y1) / 2.0 y = int(center - (height + 1) / 2.0) else: y = int(y1) self.image.draw_rect_filled(int(x1), y, ceil(x2), y + height) def get_results(self, box, used_characters): self.mode = 'bbox' orig_height = box.height orig_depth = box.depth ship(0, 0, box) bbox = self.bbox bbox = [bbox[0] - 1, bbox[1] - 1, bbox[2] + 1, bbox[3] + 1] self.mode = 'render' self.set_canvas_size( bbox[2] - bbox[0], (bbox[3] - bbox[1]) - orig_depth, (bbox[3] - bbox[1]) - orig_height) ship(-bbox[0], -bbox[1], box) result = (self.ox, self.oy, self.width, self.height + self.depth, self.depth, self.image, used_characters) self.image = None return result def get_hinting_type(self): from matplotlib.backends import backend_agg return backend_agg.get_hinting_flag() class MathtextBackendBitmap(MathtextBackendAgg): def get_results(self, box, used_characters): ox, oy, width, height, depth, image, characters = \ MathtextBackendAgg.get_results(self, box, used_characters) return image, depth class MathtextBackendPs(MathtextBackend): """ Store information to write a mathtext rendering to the PostScript backend. """ def __init__(self): self.pswriter = six.moves.cStringIO() self.lastfont = None def render_glyph(self, ox, oy, info): oy = self.height - oy + info.offset postscript_name = info.postscript_name fontsize = info.fontsize symbol_name = info.symbol_name if (postscript_name, fontsize) != self.lastfont: ps = """/%(postscript_name)s findfont %(fontsize)s scalefont setfont """ % locals() self.lastfont = postscript_name, fontsize self.pswriter.write(ps) ps = """%(ox)f %(oy)f moveto /%(symbol_name)s glyphshow\n """ % locals() self.pswriter.write(ps) def render_rect_filled(self, x1, y1, x2, y2): ps = "%f %f %f %f rectfill\n" % (x1, self.height - y2, x2 - x1, y2 - y1) self.pswriter.write(ps) def get_results(self, box, used_characters): ship(0, 0, box) return (self.width, self.height + self.depth, self.depth, self.pswriter, used_characters) class MathtextBackendPdf(MathtextBackend): """ Store information to write a mathtext rendering to the PDF backend. """ def __init__(self): self.glyphs = [] self.rects = [] def render_glyph(self, ox, oy, info): filename = info.font.fname oy = self.height - oy + info.offset self.glyphs.append( (ox, oy, filename, info.fontsize, info.num, info.symbol_name)) def render_rect_filled(self, x1, y1, x2, y2): self.rects.append((x1, self.height - y2, x2 - x1, y2 - y1)) def get_results(self, box, used_characters): ship(0, 0, box) return (self.width, self.height + self.depth, self.depth, self.glyphs, self.rects, used_characters) class MathtextBackendSvg(MathtextBackend): """ Store information to write a mathtext rendering to the SVG backend. """ def __init__(self): self.svg_glyphs = [] self.svg_rects = [] def render_glyph(self, ox, oy, info): oy = self.height - oy + info.offset self.svg_glyphs.append( (info.font, info.fontsize, info.num, ox, oy, info.metrics)) def render_rect_filled(self, x1, y1, x2, y2): self.svg_rects.append( (x1, self.height - y1 + 1, x2 - x1, y2 - y1)) def get_results(self, box, used_characters): ship(0, 0, box) svg_elements = Bunch(svg_glyphs = self.svg_glyphs, svg_rects = self.svg_rects) return (self.width, self.height + self.depth, self.depth, svg_elements, used_characters) class MathtextBackendPath(MathtextBackend): """ Store information to write a mathtext rendering to the text path machinery. """ def __init__(self): self.glyphs = [] self.rects = [] def render_glyph(self, ox, oy, info): oy = self.height - oy + info.offset thetext = info.num self.glyphs.append( (info.font, info.fontsize, thetext, ox, oy)) def render_rect_filled(self, x1, y1, x2, y2): self.rects.append( (x1, self.height-y2 , x2 - x1, y2 - y1)) def get_results(self, box, used_characters): ship(0, 0, box) return (self.width, self.height + self.depth, self.depth, self.glyphs, self.rects) class MathtextBackendCairo(MathtextBackend): """ Store information to write a mathtext rendering to the Cairo backend. """ def __init__(self): self.glyphs = [] self.rects = [] def render_glyph(self, ox, oy, info): oy = oy - info.offset - self.height thetext = unichr_safe(info.num) self.glyphs.append( (info.font, info.fontsize, thetext, ox, oy)) def render_rect_filled(self, x1, y1, x2, y2): self.rects.append( (x1, y1 - self.height, x2 - x1, y2 - y1)) def get_results(self, box, used_characters): ship(0, 0, box) return (self.width, self.height + self.depth, self.depth, self.glyphs, self.rects) class Fonts(object): """ An abstract base class for a system of fonts to use for mathtext. The class must be able to take symbol keys and font file names and return the character metrics. It also delegates to a backend class to do the actual drawing. """ def __init__(self, default_font_prop, mathtext_backend): """ *default_font_prop*: A :class:`~matplotlib.font_manager.FontProperties` object to use for the default non-math font, or the base font for Unicode (generic) font rendering. *mathtext_backend*: A subclass of :class:`MathTextBackend` used to delegate the actual rendering. """ self.default_font_prop = default_font_prop self.mathtext_backend = mathtext_backend self.used_characters = {} def destroy(self): """ Fix any cyclical references before the object is about to be destroyed. """ self.used_characters = None def get_kern(self, font1, fontclass1, sym1, fontsize1, font2, fontclass2, sym2, fontsize2, dpi): """ Get the kerning distance for font between *sym1* and *sym2*. *fontX*: one of the TeX font names:: tt, it, rm, cal, sf, bf or default/regular (non-math) *fontclassX*: TODO *symX*: a symbol in raw TeX form. e.g., '1', 'x' or '\\sigma' *fontsizeX*: the fontsize in points *dpi*: the current dots-per-inch """ return 0. def get_metrics(self, font, font_class, sym, fontsize, dpi, math=True): """ *font*: one of the TeX font names:: tt, it, rm, cal, sf, bf or default/regular (non-math) *font_class*: TODO *sym*: a symbol in raw TeX form. e.g., '1', 'x' or '\\sigma' *fontsize*: font size in points *dpi*: current dots-per-inch *math*: whether sym is a math character Returns an object with the following attributes: - *advance*: The advance distance (in points) of the glyph. - *height*: The height of the glyph in points. - *width*: The width of the glyph in points. - *xmin*, *xmax*, *ymin*, *ymax* - the ink rectangle of the glyph - *iceberg* - the distance from the baseline to the top of the glyph. This corresponds to TeX's definition of "height". """ info = self._get_info(font, font_class, sym, fontsize, dpi, math) return info.metrics def set_canvas_size(self, w, h, d): """ Set the size of the buffer used to render the math expression. Only really necessary for the bitmap backends. """ self.width, self.height, self.depth = ceil(w), ceil(h), ceil(d) self.mathtext_backend.set_canvas_size(self.width, self.height, self.depth) def render_glyph(self, ox, oy, facename, font_class, sym, fontsize, dpi): """ Draw a glyph at - *ox*, *oy*: position - *facename*: One of the TeX face names - *font_class*: - *sym*: TeX symbol name or single character - *fontsize*: fontsize in points - *dpi*: The dpi to draw at. """ info = self._get_info(facename, font_class, sym, fontsize, dpi) realpath, stat_key = get_realpath_and_stat(info.font.fname) used_characters = self.used_characters.setdefault( stat_key, (realpath, set())) used_characters[1].add(info.num) self.mathtext_backend.render_glyph(ox, oy, info) def render_rect_filled(self, x1, y1, x2, y2): """ Draw a filled rectangle from (*x1*, *y1*) to (*x2*, *y2*). """ self.mathtext_backend.render_rect_filled(x1, y1, x2, y2) def get_xheight(self, font, fontsize, dpi): """ Get the xheight for the given *font* and *fontsize*. """ raise NotImplementedError() def get_underline_thickness(self, font, fontsize, dpi): """ Get the line thickness that matches the given font. Used as a base unit for drawing lines such as in a fraction or radical. """ raise NotImplementedError() def get_used_characters(self): """ Get the set of characters that were used in the math expression. Used by backends that need to subset fonts so they know which glyphs to include. """ return self.used_characters def get_results(self, box): """ Get the data needed by the backend to render the math expression. The return value is backend-specific. """ result = self.mathtext_backend.get_results(box, self.get_used_characters()) self.destroy() return result def get_sized_alternatives_for_symbol(self, fontname, sym): """ Override if your font provides multiple sizes of the same symbol. Should return a list of symbols matching *sym* in various sizes. The expression renderer will select the most appropriate size for a given situation from this list. """ return [(fontname, sym)] class TruetypeFonts(Fonts): """ A generic base class for all font setups that use Truetype fonts (through FT2Font). """ def __init__(self, default_font_prop, mathtext_backend): Fonts.__init__(self, default_font_prop, mathtext_backend) self.glyphd = {} self._fonts = {} filename = findfont(default_font_prop) default_font = get_font(filename) self._fonts['default'] = default_font self._fonts['regular'] = default_font def destroy(self): self.glyphd = None Fonts.destroy(self) def _get_font(self, font): if font in self.fontmap: basename = self.fontmap[font] else: basename = font cached_font = self._fonts.get(basename) if cached_font is None and os.path.exists(basename): cached_font = get_font(basename) self._fonts[basename] = cached_font self._fonts[cached_font.postscript_name] = cached_font self._fonts[cached_font.postscript_name.lower()] = cached_font return cached_font def _get_offset(self, font, glyph, fontsize, dpi): if font.postscript_name == 'Cmex10': return ((glyph.height/64.0/2.0) + (fontsize/3.0 * dpi/72.0)) return 0. def _get_info(self, fontname, font_class, sym, fontsize, dpi, math=True): key = fontname, font_class, sym, fontsize, dpi bunch = self.glyphd.get(key) if bunch is not None: return bunch font, num, symbol_name, fontsize, slanted = \ self._get_glyph(fontname, font_class, sym, fontsize, math) font.set_size(fontsize, dpi) glyph = font.load_char( num, flags=self.mathtext_backend.get_hinting_type()) xmin, ymin, xmax, ymax = [val/64.0 for val in glyph.bbox] offset = self._get_offset(font, glyph, fontsize, dpi) metrics = Bunch( advance = glyph.linearHoriAdvance/65536.0, height = glyph.height/64.0, width = glyph.width/64.0, xmin = xmin, xmax = xmax, ymin = ymin+offset, ymax = ymax+offset, # iceberg is the equivalent of TeX's "height" iceberg = glyph.horiBearingY/64.0 + offset, slanted = slanted ) result = self.glyphd[key] = Bunch( font = font, fontsize = fontsize, postscript_name = font.postscript_name, metrics = metrics, symbol_name = symbol_name, num = num, glyph = glyph, offset = offset ) return result def get_xheight(self, fontname, fontsize, dpi): font = self._get_font(fontname) font.set_size(fontsize, dpi) pclt = font.get_sfnt_table('pclt') if pclt is None: # Some fonts don't store the xHeight, so we do a poor man's xHeight metrics = self.get_metrics(fontname, rcParams['mathtext.default'], 'x', fontsize, dpi) return metrics.iceberg xHeight = (pclt['xHeight'] / 64.0) * (fontsize / 12.0) * (dpi / 100.0) return xHeight def get_underline_thickness(self, font, fontsize, dpi): # This function used to grab underline thickness from the font # metrics, but that information is just too un-reliable, so it # is now hardcoded. return ((0.75 / 12.0) * fontsize * dpi) / 72.0 def get_kern(self, font1, fontclass1, sym1, fontsize1, font2, fontclass2, sym2, fontsize2, dpi): if font1 == font2 and fontsize1 == fontsize2: info1 = self._get_info(font1, fontclass1, sym1, fontsize1, dpi) info2 = self._get_info(font2, fontclass2, sym2, fontsize2, dpi) font = info1.font return font.get_kerning(info1.num, info2.num, KERNING_DEFAULT) / 64.0 return Fonts.get_kern(self, font1, fontclass1, sym1, fontsize1, font2, fontclass2, sym2, fontsize2, dpi) class BakomaFonts(TruetypeFonts): """ Use the Bakoma TrueType fonts for rendering. Symbols are strewn about a number of font files, each of which has its own proprietary 8-bit encoding. """ _fontmap = { 'cal' : 'cmsy10', 'rm' : 'cmr10', 'tt' : 'cmtt10', 'it' : 'cmmi10', 'bf' : 'cmb10', 'sf' : 'cmss10', 'ex' : 'cmex10' } def __init__(self, *args, **kwargs): self._stix_fallback = StixFonts(*args, **kwargs) TruetypeFonts.__init__(self, *args, **kwargs) self.fontmap = {} for key, val in six.iteritems(self._fontmap): fullpath = findfont(val) self.fontmap[key] = fullpath self.fontmap[val] = fullpath _slanted_symbols = set(r"\int \oint".split()) def _get_glyph(self, fontname, font_class, sym, fontsize, math=True): symbol_name = None font = None if fontname in self.fontmap and sym in latex_to_bakoma: basename, num = latex_to_bakoma[sym] slanted = (basename == "cmmi10") or sym in self._slanted_symbols font = self._get_font(basename) elif len(sym) == 1: slanted = (fontname == "it") font = self._get_font(fontname) if font is not None: num = ord(sym) if font is not None: gid = font.get_char_index(num) if gid != 0: symbol_name = font.get_glyph_name(gid) if symbol_name is None: return self._stix_fallback._get_glyph( fontname, font_class, sym, fontsize, math) return font, num, symbol_name, fontsize, slanted # The Bakoma fonts contain many pre-sized alternatives for the # delimiters. The AutoSizedChar class will use these alternatives # and select the best (closest sized) glyph. _size_alternatives = { '(' : [('rm', '('), ('ex', '\xa1'), ('ex', '\xb3'), ('ex', '\xb5'), ('ex', '\xc3')], ')' : [('rm', ')'), ('ex', '\xa2'), ('ex', '\xb4'), ('ex', '\xb6'), ('ex', '\x21')], '{' : [('cal', '{'), ('ex', '\xa9'), ('ex', '\x6e'), ('ex', '\xbd'), ('ex', '\x28')], '}' : [('cal', '}'), ('ex', '\xaa'), ('ex', '\x6f'), ('ex', '\xbe'), ('ex', '\x29')], # The fourth size of '[' is mysteriously missing from the BaKoMa # font, so I've ommitted it for both '[' and ']' '[' : [('rm', '['), ('ex', '\xa3'), ('ex', '\x68'), ('ex', '\x22')], ']' : [('rm', ']'), ('ex', '\xa4'), ('ex', '\x69'), ('ex', '\x23')], r'\lfloor' : [('ex', '\xa5'), ('ex', '\x6a'), ('ex', '\xb9'), ('ex', '\x24')], r'\rfloor' : [('ex', '\xa6'), ('ex', '\x6b'), ('ex', '\xba'), ('ex', '\x25')], r'\lceil' : [('ex', '\xa7'), ('ex', '\x6c'), ('ex', '\xbb'), ('ex', '\x26')], r'\rceil' : [('ex', '\xa8'), ('ex', '\x6d'), ('ex', '\xbc'), ('ex', '\x27')], r'\langle' : [('ex', '\xad'), ('ex', '\x44'), ('ex', '\xbf'), ('ex', '\x2a')], r'\rangle' : [('ex', '\xae'), ('ex', '\x45'), ('ex', '\xc0'), ('ex', '\x2b')], r'\__sqrt__' : [('ex', '\x70'), ('ex', '\x71'), ('ex', '\x72'), ('ex', '\x73')], r'\backslash': [('ex', '\xb2'), ('ex', '\x2f'), ('ex', '\xc2'), ('ex', '\x2d')], r'/' : [('rm', '/'), ('ex', '\xb1'), ('ex', '\x2e'), ('ex', '\xcb'), ('ex', '\x2c')], r'\widehat' : [('rm', '\x5e'), ('ex', '\x62'), ('ex', '\x63'), ('ex', '\x64')], r'\widetilde': [('rm', '\x7e'), ('ex', '\x65'), ('ex', '\x66'), ('ex', '\x67')], r'<' : [('cal', 'h'), ('ex', 'D')], r'>' : [('cal', 'i'), ('ex', 'E')] } for alias, target in [(r'\leftparen', '('), (r'\rightparent', ')'), (r'\leftbrace', '{'), (r'\rightbrace', '}'), (r'\leftbracket', '['), (r'\rightbracket', ']'), (r'\{', '{'), (r'\}', '}'), (r'\[', '['), (r'\]', ']')]: _size_alternatives[alias] = _size_alternatives[target] def get_sized_alternatives_for_symbol(self, fontname, sym): return self._size_alternatives.get(sym, [(fontname, sym)]) class UnicodeFonts(TruetypeFonts): """ An abstract base class for handling Unicode fonts. While some reasonably complete Unicode fonts (such as DejaVu) may work in some situations, the only Unicode font I'm aware of with a complete set of math symbols is STIX. This class will "fallback" on the Bakoma fonts when a required symbol can not be found in the font. """ use_cmex = True def __init__(self, *args, **kwargs): # This must come first so the backend's owner is set correctly if rcParams['mathtext.fallback_to_cm']: self.cm_fallback = BakomaFonts(*args, **kwargs) else: self.cm_fallback = None TruetypeFonts.__init__(self, *args, **kwargs) self.fontmap = {} for texfont in "cal rm tt it bf sf".split(): prop = rcParams['mathtext.' + texfont] font = findfont(prop) self.fontmap[texfont] = font prop = FontProperties('cmex10') font = findfont(prop) self.fontmap['ex'] = font _slanted_symbols = set(r"\int \oint".split()) def _map_virtual_font(self, fontname, font_class, uniindex): return fontname, uniindex def _get_glyph(self, fontname, font_class, sym, fontsize, math=True): found_symbol = False if self.use_cmex: uniindex = latex_to_cmex.get(sym) if uniindex is not None: fontname = 'ex' found_symbol = True if not found_symbol: try: uniindex = get_unicode_index(sym, math) found_symbol = True except ValueError: uniindex = ord('?') warn("No TeX to unicode mapping for '%s'" % sym.encode('ascii', 'backslashreplace'), MathTextWarning) fontname, uniindex = self._map_virtual_font( fontname, font_class, uniindex) new_fontname = fontname # Only characters in the "Letter" class should be italicized in 'it' # mode. Greek capital letters should be Roman. if found_symbol: if fontname == 'it': if uniindex < 0x10000: unistring = unichr(uniindex) if (not unicodedata.category(unistring)[0] == "L" or unicodedata.name(unistring).startswith("GREEK CAPITAL")): new_fontname = 'rm' slanted = (new_fontname == 'it') or sym in self._slanted_symbols found_symbol = False font = self._get_font(new_fontname) if font is not None: glyphindex = font.get_char_index(uniindex) if glyphindex != 0: found_symbol = True if not found_symbol: if self.cm_fallback: if isinstance(self.cm_fallback, BakomaFonts): warn("Substituting with a symbol from Computer Modern.", MathTextWarning) if (fontname in ('it', 'regular') and isinstance(self.cm_fallback, StixFonts)): return self.cm_fallback._get_glyph( 'rm', font_class, sym, fontsize) else: return self.cm_fallback._get_glyph( fontname, font_class, sym, fontsize) else: if fontname in ('it', 'regular') and isinstance(self, StixFonts): return self._get_glyph('rm', font_class, sym, fontsize) warn("Font '%s' does not have a glyph for '%s' [U+%x]" % (new_fontname, sym.encode('ascii', 'backslashreplace').decode('ascii'), uniindex), MathTextWarning) warn("Substituting with a dummy symbol.", MathTextWarning) fontname = 'rm' new_fontname = fontname font = self._get_font(fontname) uniindex = 0xA4 # currency character, for lack of anything better glyphindex = font.get_char_index(uniindex) slanted = False symbol_name = font.get_glyph_name(glyphindex) return font, uniindex, symbol_name, fontsize, slanted def get_sized_alternatives_for_symbol(self, fontname, sym): if self.cm_fallback: return self.cm_fallback.get_sized_alternatives_for_symbol( fontname, sym) return [(fontname, sym)] class DejaVuFonts(UnicodeFonts): use_cmex = False def __init__(self, *args, **kwargs): # This must come first so the backend's owner is set correctly if isinstance(self, DejaVuSerifFonts): self.cm_fallback = StixFonts(*args, **kwargs) else: self.cm_fallback = StixSansFonts(*args, **kwargs) self.bakoma = BakomaFonts(*args, **kwargs) TruetypeFonts.__init__(self, *args, **kwargs) self.fontmap = {} # Include Stix sized alternatives for glyphs self._fontmap.update({ 1 : 'STIXSizeOneSym', 2 : 'STIXSizeTwoSym', 3 : 'STIXSizeThreeSym', 4 : 'STIXSizeFourSym', 5 : 'STIXSizeFiveSym'}) for key, name in six.iteritems(self._fontmap): fullpath = findfont(name) self.fontmap[key] = fullpath self.fontmap[name] = fullpath def _get_glyph(self, fontname, font_class, sym, fontsize, math=True): """ Override prime symbol to use Bakoma """ if sym == r'\prime': return self.bakoma._get_glyph(fontname, font_class, sym, fontsize, math) else: # check whether the glyph is available in the display font uniindex = get_unicode_index(sym) font = self._get_font('ex') if font is not None: glyphindex = font.get_char_index(uniindex) if glyphindex != 0: return super(DejaVuFonts, self)._get_glyph('ex', font_class, sym, fontsize, math) # otherwise return regular glyph return super(DejaVuFonts, self)._get_glyph(fontname, font_class, sym, fontsize, math) class DejaVuSerifFonts(DejaVuFonts): """ A font handling class for the DejaVu Serif fonts If a glyph is not found it will fallback to Stix Serif """ _fontmap = { 'rm' : 'DejaVu Serif', 'it' : 'DejaVu Serif:italic', 'bf' : 'DejaVu Serif:weight=bold', 'sf' : 'DejaVu Sans', 'tt' : 'DejaVu Sans Mono', 'ex' : 'DejaVu Serif Display', 0 : 'DejaVu Serif', } class DejaVuSansFonts(DejaVuFonts): """ A font handling class for the DejaVu Sans fonts If a glyph is not found it will fallback to Stix Sans """ _fontmap = { 'rm' : 'DejaVu Sans', 'it' : 'DejaVu Sans:italic', 'bf' : 'DejaVu Sans:weight=bold', 'sf' : 'DejaVu Sans', 'tt' : 'DejaVu Sans Mono', 'ex' : 'DejaVu Sans Display', 0 : 'DejaVu Sans', } class StixFonts(UnicodeFonts): """ A font handling class for the STIX fonts. In addition to what UnicodeFonts provides, this class: - supports "virtual fonts" which are complete alpha numeric character sets with different font styles at special Unicode code points, such as "Blackboard". - handles sized alternative characters for the STIXSizeX fonts. """ _fontmap = { 'rm' : 'STIXGeneral', 'it' : 'STIXGeneral:italic', 'bf' : 'STIXGeneral:weight=bold', 'nonunirm' : 'STIXNonUnicode', 'nonuniit' : 'STIXNonUnicode:italic', 'nonunibf' : 'STIXNonUnicode:weight=bold', 0 : 'STIXGeneral', 1 : 'STIXSizeOneSym', 2 : 'STIXSizeTwoSym', 3 : 'STIXSizeThreeSym', 4 : 'STIXSizeFourSym', 5 : 'STIXSizeFiveSym' } use_cmex = False cm_fallback = False _sans = False def __init__(self, *args, **kwargs): TruetypeFonts.__init__(self, *args, **kwargs) self.fontmap = {} for key, name in six.iteritems(self._fontmap): fullpath = findfont(name) self.fontmap[key] = fullpath self.fontmap[name] = fullpath def _map_virtual_font(self, fontname, font_class, uniindex): # Handle these "fonts" that are actually embedded in # other fonts. mapping = stix_virtual_fonts.get(fontname) if (self._sans and mapping is None and fontname not in ('regular', 'default')): mapping = stix_virtual_fonts['sf'] doing_sans_conversion = True else: doing_sans_conversion = False if mapping is not None: if isinstance(mapping, dict): mapping = mapping.get(font_class, 'rm') # Binary search for the source glyph lo = 0 hi = len(mapping) while lo < hi: mid = (lo+hi)//2 range = mapping[mid] if uniindex < range[0]: hi = mid elif uniindex <= range[1]: break else: lo = mid + 1 if uniindex >= range[0] and uniindex <= range[1]: uniindex = uniindex - range[0] + range[3] fontname = range[2] elif not doing_sans_conversion: # This will generate a dummy character uniindex = 0x1 fontname = rcParams['mathtext.default'] # Handle private use area glyphs if (fontname in ('it', 'rm', 'bf') and uniindex >= 0xe000 and uniindex <= 0xf8ff): fontname = 'nonuni' + fontname return fontname, uniindex _size_alternatives = {} def get_sized_alternatives_for_symbol(self, fontname, sym): fixes = {'\\{': '{', '\\}': '}', '\\[': '[', '\\]': ']'} sym = fixes.get(sym, sym) alternatives = self._size_alternatives.get(sym) if alternatives: return alternatives alternatives = [] try: uniindex = get_unicode_index(sym) except ValueError: return [(fontname, sym)] fix_ups = { ord('<'): 0x27e8, ord('>'): 0x27e9 } uniindex = fix_ups.get(uniindex, uniindex) for i in range(6): font = self._get_font(i) glyphindex = font.get_char_index(uniindex) if glyphindex != 0: alternatives.append((i, unichr_safe(uniindex))) # The largest size of the radical symbol in STIX has incorrect # metrics that cause it to be disconnected from the stem. if sym == r'\__sqrt__': alternatives = alternatives[:-1] self._size_alternatives[sym] = alternatives return alternatives class StixSansFonts(StixFonts): """ A font handling class for the STIX fonts (that uses sans-serif characters by default). """ _sans = True class StandardPsFonts(Fonts): """ Use the standard postscript fonts for rendering to backend_ps Unlike the other font classes, BakomaFont and UnicodeFont, this one requires the Ps backend. """ basepath = os.path.join( get_data_path(), 'fonts', 'afm' ) fontmap = { 'cal' : 'pzcmi8a', # Zapf Chancery 'rm' : 'pncr8a', # New Century Schoolbook 'tt' : 'pcrr8a', # Courier 'it' : 'pncri8a', # New Century Schoolbook Italic 'sf' : 'phvr8a', # Helvetica 'bf' : 'pncb8a', # New Century Schoolbook Bold None : 'psyr' # Symbol } def __init__(self, default_font_prop): Fonts.__init__(self, default_font_prop, MathtextBackendPs()) self.glyphd = {} self.fonts = {} filename = findfont(default_font_prop, fontext='afm', directory=self.basepath) if filename is None: filename = findfont('Helvetica', fontext='afm', directory=self.basepath) with open(filename, 'rb') as fd: default_font = AFM(fd) default_font.fname = filename self.fonts['default'] = default_font self.fonts['regular'] = default_font self.pswriter = six.moves.cStringIO() def _get_font(self, font): if font in self.fontmap: basename = self.fontmap[font] else: basename = font cached_font = self.fonts.get(basename) if cached_font is None: fname = os.path.join(self.basepath, basename + ".afm") with open(fname, 'rb') as fd: cached_font = AFM(fd) cached_font.fname = fname self.fonts[basename] = cached_font self.fonts[cached_font.get_fontname()] = cached_font return cached_font def _get_info (self, fontname, font_class, sym, fontsize, dpi, math=True): 'load the cmfont, metrics and glyph with caching' key = fontname, sym, fontsize, dpi tup = self.glyphd.get(key) if tup is not None: return tup # Only characters in the "Letter" class should really be italicized. # This class includes greek letters, so we're ok if (fontname == 'it' and (len(sym) > 1 or not unicodedata.category(six.text_type(sym)).startswith("L"))): fontname = 'rm' found_symbol = False if sym in latex_to_standard: fontname, num = latex_to_standard[sym] glyph = chr(num) found_symbol = True elif len(sym) == 1: glyph = sym num = ord(glyph) found_symbol = True else: warn("No TeX to built-in Postscript mapping for '%s'" % sym, MathTextWarning) slanted = (fontname == 'it') font = self._get_font(fontname) if found_symbol: try: symbol_name = font.get_name_char(glyph) except KeyError: warn("No glyph in standard Postscript font '%s' for '%s'" % (font.postscript_name, sym), MathTextWarning) found_symbol = False if not found_symbol: glyph = sym = '?' num = ord(glyph) symbol_name = font.get_name_char(glyph) offset = 0 scale = 0.001 * fontsize xmin, ymin, xmax, ymax = [val * scale for val in font.get_bbox_char(glyph)] metrics = Bunch( advance = font.get_width_char(glyph) * scale, width = font.get_width_char(glyph) * scale, height = font.get_height_char(glyph) * scale, xmin = xmin, xmax = xmax, ymin = ymin+offset, ymax = ymax+offset, # iceberg is the equivalent of TeX's "height" iceberg = ymax + offset, slanted = slanted ) self.glyphd[key] = Bunch( font = font, fontsize = fontsize, postscript_name = font.get_fontname(), metrics = metrics, symbol_name = symbol_name, num = num, glyph = glyph, offset = offset ) return self.glyphd[key] def get_kern(self, font1, fontclass1, sym1, fontsize1, font2, fontclass2, sym2, fontsize2, dpi): if font1 == font2 and fontsize1 == fontsize2: info1 = self._get_info(font1, fontclass1, sym1, fontsize1, dpi) info2 = self._get_info(font2, fontclass2, sym2, fontsize2, dpi) font = info1.font return (font.get_kern_dist(info1.glyph, info2.glyph) * 0.001 * fontsize1) return Fonts.get_kern(self, font1, fontclass1, sym1, fontsize1, font2, fontclass2, sym2, fontsize2, dpi) def get_xheight(self, font, fontsize, dpi): font = self._get_font(font) return font.get_xheight() * 0.001 * fontsize def get_underline_thickness(self, font, fontsize, dpi): font = self._get_font(font) return font.get_underline_thickness() * 0.001 * fontsize ############################################################################## # TeX-LIKE BOX MODEL # The following is based directly on the document 'woven' from the # TeX82 source code. This information is also available in printed # form: # # Knuth, Donald E.. 1986. Computers and Typesetting, Volume B: # TeX: The Program. Addison-Wesley Professional. # # The most relevant "chapters" are: # Data structures for boxes and their friends # Shipping pages out (Ship class) # Packaging (hpack and vpack) # Data structures for math mode # Subroutines for math mode # Typesetting math formulas # # Many of the docstrings below refer to a numbered "node" in that # book, e.g., node123 # # Note that (as TeX) y increases downward, unlike many other parts of # matplotlib. # How much text shrinks when going to the next-smallest level. GROW_FACTOR # must be the inverse of SHRINK_FACTOR. SHRINK_FACTOR = 0.7 GROW_FACTOR = 1.0 / SHRINK_FACTOR # The number of different sizes of chars to use, beyond which they will not # get any smaller NUM_SIZE_LEVELS = 6 class FontConstantsBase(object): """ A set of constants that controls how certain things, such as sub- and superscripts are laid out. These are all metrics that can't be reliably retrieved from the font metrics in the font itself. """ # Percentage of x-height of additional horiz. space after sub/superscripts script_space = 0.05 # Percentage of x-height that sub/superscripts drop below the baseline subdrop = 0.4 # Percentage of x-height that superscripts are raised from the baseline sup1 = 0.7 # Percentage of x-height that subscripts drop below the baseline sub1 = 0.3 # Percentage of x-height that subscripts drop below the baseline when a # superscript is present sub2 = 0.5 # Percentage of x-height that sub/supercripts are offset relative to the # nucleus edge for non-slanted nuclei delta = 0.025 # Additional percentage of last character height above 2/3 of the # x-height that supercripts are offset relative to the subscript # for slanted nuclei delta_slanted = 0.2 # Percentage of x-height that supercripts and subscripts are offset for # integrals delta_integral = 0.1 class ComputerModernFontConstants(FontConstantsBase): script_space = 0.075 subdrop = 0.2 sup1 = 0.45 sub1 = 0.2 sub2 = 0.3 delta = 0.075 delta_slanted = 0.3 delta_integral = 0.3 class STIXFontConstants(FontConstantsBase): script_space = 0.1 sup1 = 0.8 sub2 = 0.6 delta = 0.05 delta_slanted = 0.3 delta_integral = 0.3 class STIXSansFontConstants(FontConstantsBase): script_space = 0.05 sup1 = 0.8 delta_slanted = 0.6 delta_integral = 0.3 class DejaVuSerifFontConstants(FontConstantsBase): pass class DejaVuSansFontConstants(FontConstantsBase): pass # Maps font family names to the FontConstantBase subclass to use _font_constant_mapping = { 'DejaVu Sans': DejaVuSansFontConstants, 'DejaVu Sans Mono': DejaVuSansFontConstants, 'DejaVu Serif': DejaVuSerifFontConstants, 'cmb10': ComputerModernFontConstants, 'cmex10': ComputerModernFontConstants, 'cmmi10': ComputerModernFontConstants, 'cmr10': ComputerModernFontConstants, 'cmss10': ComputerModernFontConstants, 'cmsy10': ComputerModernFontConstants, 'cmtt10': ComputerModernFontConstants, 'STIXGeneral': STIXFontConstants, 'STIXNonUnicode': STIXFontConstants, 'STIXSizeFiveSym': STIXFontConstants, 'STIXSizeFourSym': STIXFontConstants, 'STIXSizeThreeSym': STIXFontConstants, 'STIXSizeTwoSym': STIXFontConstants, 'STIXSizeOneSym': STIXFontConstants, # Map the fonts we used to ship, just for good measure 'Bitstream Vera Sans': DejaVuSansFontConstants, 'Bitstream Vera': DejaVuSansFontConstants, } def _get_font_constant_set(state): constants = _font_constant_mapping.get( state.font_output._get_font(state.font).family_name, FontConstantsBase) # STIX sans isn't really its own fonts, just different code points # in the STIX fonts, so we have to detect this one separately. if (constants is STIXFontConstants and isinstance(state.font_output, StixSansFonts)): return STIXSansFontConstants return constants class MathTextWarning(Warning): pass class Node(object): """ A node in the TeX box model """ def __init__(self): self.size = 0 def __repr__(self): return self.__internal_repr__() def __internal_repr__(self): return self.__class__.__name__ def get_kerning(self, next): return 0.0 def shrink(self): """ Shrinks one level smaller. There are only three levels of sizes, after which things will no longer get smaller. """ self.size += 1 def grow(self): """ Grows one level larger. There is no limit to how big something can get. """ self.size -= 1 def render(self, x, y): pass class Box(Node): """ Represents any node with a physical location. """ def __init__(self, width, height, depth): Node.__init__(self) self.width = width self.height = height self.depth = depth def shrink(self): Node.shrink(self) if self.size < NUM_SIZE_LEVELS: self.width *= SHRINK_FACTOR self.height *= SHRINK_FACTOR self.depth *= SHRINK_FACTOR def grow(self): Node.grow(self) self.width *= GROW_FACTOR self.height *= GROW_FACTOR self.depth *= GROW_FACTOR def render(self, x1, y1, x2, y2): pass class Vbox(Box): """ A box with only height (zero width). """ def __init__(self, height, depth): Box.__init__(self, 0., height, depth) class Hbox(Box): """ A box with only width (zero height and depth). """ def __init__(self, width): Box.__init__(self, width, 0., 0.) class Char(Node): """ Represents a single character. Unlike TeX, the font information and metrics are stored with each :class:`Char` to make it easier to lookup the font metrics when needed. Note that TeX boxes have a width, height, and depth, unlike Type1 and Truetype which use a full bounding box and an advance in the x-direction. The metrics must be converted to the TeX way, and the advance (if different from width) must be converted into a :class:`Kern` node when the :class:`Char` is added to its parent :class:`Hlist`. """ def __init__(self, c, state, math=True): Node.__init__(self) self.c = c self.font_output = state.font_output self.font = state.font self.font_class = state.font_class self.fontsize = state.fontsize self.dpi = state.dpi self.math = math # The real width, height and depth will be set during the # pack phase, after we know the real fontsize self._update_metrics() def __internal_repr__(self): return '`%s`' % self.c def _update_metrics(self): metrics = self._metrics = self.font_output.get_metrics( self.font, self.font_class, self.c, self.fontsize, self.dpi, self.math) if self.c == ' ': self.width = metrics.advance else: self.width = metrics.width self.height = metrics.iceberg self.depth = -(metrics.iceberg - metrics.height) def is_slanted(self): return self._metrics.slanted def get_kerning(self, next): """ Return the amount of kerning between this and the given character. Called when characters are strung together into :class:`Hlist` to create :class:`Kern` nodes. """ advance = self._metrics.advance - self.width kern = 0. if isinstance(next, Char): kern = self.font_output.get_kern( self.font, self.font_class, self.c, self.fontsize, next.font, next.font_class, next.c, next.fontsize, self.dpi) return advance + kern def render(self, x, y): """ Render the character to the canvas """ self.font_output.render_glyph( x, y, self.font, self.font_class, self.c, self.fontsize, self.dpi) def shrink(self): Node.shrink(self) if self.size < NUM_SIZE_LEVELS: self.fontsize *= SHRINK_FACTOR self.width *= SHRINK_FACTOR self.height *= SHRINK_FACTOR self.depth *= SHRINK_FACTOR def grow(self): Node.grow(self) self.fontsize *= GROW_FACTOR self.width *= GROW_FACTOR self.height *= GROW_FACTOR self.depth *= GROW_FACTOR class Accent(Char): """ The font metrics need to be dealt with differently for accents, since they are already offset correctly from the baseline in TrueType fonts. """ def _update_metrics(self): metrics = self._metrics = self.font_output.get_metrics( self.font, self.font_class, self.c, self.fontsize, self.dpi) self.width = metrics.xmax - metrics.xmin self.height = metrics.ymax - metrics.ymin self.depth = 0 def shrink(self): Char.shrink(self) self._update_metrics() def grow(self): Char.grow(self) self._update_metrics() def render(self, x, y): """ Render the character to the canvas. """ self.font_output.render_glyph( x - self._metrics.xmin, y + self._metrics.ymin, self.font, self.font_class, self.c, self.fontsize, self.dpi) class List(Box): """ A list of nodes (either horizontal or vertical). """ def __init__(self, elements): Box.__init__(self, 0., 0., 0.) self.shift_amount = 0. # An arbitrary offset self.children = elements # The child nodes of this list # The following parameters are set in the vpack and hpack functions self.glue_set = 0. # The glue setting of this list self.glue_sign = 0 # 0: normal, -1: shrinking, 1: stretching self.glue_order = 0 # The order of infinity (0 - 3) for the glue def __repr__(self): return '[%s <%.02f %.02f %.02f %.02f> %s]' % ( self.__internal_repr__(), self.width, self.height, self.depth, self.shift_amount, ' '.join([repr(x) for x in self.children])) def _determine_order(self, totals): """ A helper function to determine the highest order of glue used by the members of this list. Used by vpack and hpack. """ o = 0 for i in range(len(totals) - 1, 0, -1): if totals[i] != 0.0: o = i break return o def _set_glue(self, x, sign, totals, error_type): o = self._determine_order(totals) self.glue_order = o self.glue_sign = sign if totals[o] != 0.: self.glue_set = x / totals[o] else: self.glue_sign = 0 self.glue_ratio = 0. if o == 0: if len(self.children): warn("%s %s: %r" % (error_type, self.__class__.__name__, self), MathTextWarning) def shrink(self): for child in self.children: child.shrink() Box.shrink(self) if self.size < NUM_SIZE_LEVELS: self.shift_amount *= SHRINK_FACTOR self.glue_set *= SHRINK_FACTOR def grow(self): for child in self.children: child.grow() Box.grow(self) self.shift_amount *= GROW_FACTOR self.glue_set *= GROW_FACTOR class Hlist(List): """ A horizontal list of boxes. """ def __init__(self, elements, w=0., m='additional', do_kern=True): List.__init__(self, elements) if do_kern: self.kern() self.hpack() def kern(self): """ Insert :class:`Kern` nodes between :class:`Char` nodes to set kerning. The :class:`Char` nodes themselves determine the amount of kerning they need (in :meth:`~Char.get_kerning`), and this function just creates the linked list in the correct way. """ new_children = [] num_children = len(self.children) if num_children: for i in range(num_children): elem = self.children[i] if i < num_children - 1: next = self.children[i + 1] else: next = None new_children.append(elem) kerning_distance = elem.get_kerning(next) if kerning_distance != 0.: kern = Kern(kerning_distance) new_children.append(kern) self.children = new_children # This is a failed experiment to fake cross-font kerning. # def get_kerning(self, next): # if len(self.children) >= 2 and isinstance(self.children[-2], Char): # if isinstance(next, Char): # print "CASE A" # return self.children[-2].get_kerning(next) # elif isinstance(next, Hlist) and len(next.children) and isinstance(next.children[0], Char): # print "CASE B" # result = self.children[-2].get_kerning(next.children[0]) # print result # return result # return 0.0 def hpack(self, w=0., m='additional'): """ The main duty of :meth:`hpack` is to compute the dimensions of the resulting boxes, and to adjust the glue if one of those dimensions is pre-specified. The computed sizes normally enclose all of the material inside the new box; but some items may stick out if negative glue is used, if the box is overfull, or if a ``\\vbox`` includes other boxes that have been shifted left. - *w*: specifies a width - *m*: is either 'exactly' or 'additional'. Thus, ``hpack(w, 'exactly')`` produces a box whose width is exactly *w*, while ``hpack(w, 'additional')`` yields a box whose width is the natural width plus *w*. The default values produce a box with the natural width. """ # I don't know why these get reset in TeX. Shift_amount is pretty # much useless if we do. #self.shift_amount = 0. h = 0. d = 0. x = 0. total_stretch = [0.] * 4 total_shrink = [0.] * 4 for p in self.children: if isinstance(p, Char): x += p.width h = max(h, p.height) d = max(d, p.depth) elif isinstance(p, Box): x += p.width if not isinf(p.height) and not isinf(p.depth): s = getattr(p, 'shift_amount', 0.) h = max(h, p.height - s) d = max(d, p.depth + s) elif isinstance(p, Glue): glue_spec = p.glue_spec x += glue_spec.width total_stretch[glue_spec.stretch_order] += glue_spec.stretch total_shrink[glue_spec.shrink_order] += glue_spec.shrink elif isinstance(p, Kern): x += p.width self.height = h self.depth = d if m == 'additional': w += x self.width = w x = w - x if x == 0.: self.glue_sign = 0 self.glue_order = 0 self.glue_ratio = 0. return if x > 0.: self._set_glue(x, 1, total_stretch, "Overfull") else: self._set_glue(x, -1, total_shrink, "Underfull") class Vlist(List): """ A vertical list of boxes. """ def __init__(self, elements, h=0., m='additional'): List.__init__(self, elements) self.vpack() def vpack(self, h=0., m='additional', l=float(inf)): """ The main duty of :meth:`vpack` is to compute the dimensions of the resulting boxes, and to adjust the glue if one of those dimensions is pre-specified. - *h*: specifies a height - *m*: is either 'exactly' or 'additional'. - *l*: a maximum height Thus, ``vpack(h, 'exactly')`` produces a box whose height is exactly *h*, while ``vpack(h, 'additional')`` yields a box whose height is the natural height plus *h*. The default values produce a box with the natural width. """ # I don't know why these get reset in TeX. Shift_amount is pretty # much useless if we do. # self.shift_amount = 0. w = 0. d = 0. x = 0. total_stretch = [0.] * 4 total_shrink = [0.] * 4 for p in self.children: if isinstance(p, Box): x += d + p.height d = p.depth if not isinf(p.width): s = getattr(p, 'shift_amount', 0.) w = max(w, p.width + s) elif isinstance(p, Glue): x += d d = 0. glue_spec = p.glue_spec x += glue_spec.width total_stretch[glue_spec.stretch_order] += glue_spec.stretch total_shrink[glue_spec.shrink_order] += glue_spec.shrink elif isinstance(p, Kern): x += d + p.width d = 0. elif isinstance(p, Char): raise RuntimeError("Internal mathtext error: Char node found in Vlist.") self.width = w if d > l: x += d - l self.depth = l else: self.depth = d if m == 'additional': h += x self.height = h x = h - x if x == 0: self.glue_sign = 0 self.glue_order = 0 self.glue_ratio = 0. return if x > 0.: self._set_glue(x, 1, total_stretch, "Overfull") else: self._set_glue(x, -1, total_shrink, "Underfull") class Rule(Box): """ A :class:`Rule` node stands for a solid black rectangle; it has *width*, *depth*, and *height* fields just as in an :class:`Hlist`. However, if any of these dimensions is inf, the actual value will be determined by running the rule up to the boundary of the innermost enclosing box. This is called a "running dimension." The width is never running in an :class:`Hlist`; the height and depth are never running in a :class:`Vlist`. """ def __init__(self, width, height, depth, state): Box.__init__(self, width, height, depth) self.font_output = state.font_output def render(self, x, y, w, h): self.font_output.render_rect_filled(x, y, x + w, y + h) class Hrule(Rule): """ Convenience class to create a horizontal rule. """ def __init__(self, state, thickness=None): if thickness is None: thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) height = depth = thickness * 0.5 Rule.__init__(self, inf, height, depth, state) class Vrule(Rule): """ Convenience class to create a vertical rule. """ def __init__(self, state): thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) Rule.__init__(self, thickness, inf, inf, state) class Glue(Node): """ Most of the information in this object is stored in the underlying :class:`GlueSpec` class, which is shared between multiple glue objects. (This is a memory optimization which probably doesn't matter anymore, but it's easier to stick to what TeX does.) """ def __init__(self, glue_type, copy=False): Node.__init__(self) self.glue_subtype = 'normal' if isinstance(glue_type, six.string_types): glue_spec = GlueSpec.factory(glue_type) elif isinstance(glue_type, GlueSpec): glue_spec = glue_type else: raise ArgumentError("glue_type must be a glue spec name or instance.") if copy: glue_spec = glue_spec.copy() self.glue_spec = glue_spec def shrink(self): Node.shrink(self) if self.size < NUM_SIZE_LEVELS: if self.glue_spec.width != 0.: self.glue_spec = self.glue_spec.copy() self.glue_spec.width *= SHRINK_FACTOR def grow(self): Node.grow(self) if self.glue_spec.width != 0.: self.glue_spec = self.glue_spec.copy() self.glue_spec.width *= GROW_FACTOR class GlueSpec(object): """ See :class:`Glue`. """ def __init__(self, width=0., stretch=0., stretch_order=0, shrink=0., shrink_order=0): self.width = width self.stretch = stretch self.stretch_order = stretch_order self.shrink = shrink self.shrink_order = shrink_order def copy(self): return GlueSpec( self.width, self.stretch, self.stretch_order, self.shrink, self.shrink_order) def factory(cls, glue_type): return cls._types[glue_type] factory = classmethod(factory) GlueSpec._types = { 'fil': GlueSpec(0., 1., 1, 0., 0), 'fill': GlueSpec(0., 1., 2, 0., 0), 'filll': GlueSpec(0., 1., 3, 0., 0), 'neg_fil': GlueSpec(0., 0., 0, 1., 1), 'neg_fill': GlueSpec(0., 0., 0, 1., 2), 'neg_filll': GlueSpec(0., 0., 0, 1., 3), 'empty': GlueSpec(0., 0., 0, 0., 0), 'ss': GlueSpec(0., 1., 1, -1., 1) } # Some convenient ways to get common kinds of glue class Fil(Glue): def __init__(self): Glue.__init__(self, 'fil') class Fill(Glue): def __init__(self): Glue.__init__(self, 'fill') class Filll(Glue): def __init__(self): Glue.__init__(self, 'filll') class NegFil(Glue): def __init__(self): Glue.__init__(self, 'neg_fil') class NegFill(Glue): def __init__(self): Glue.__init__(self, 'neg_fill') class NegFilll(Glue): def __init__(self): Glue.__init__(self, 'neg_filll') class SsGlue(Glue): def __init__(self): Glue.__init__(self, 'ss') class HCentered(Hlist): """ A convenience class to create an :class:`Hlist` whose contents are centered within its enclosing box. """ def __init__(self, elements): Hlist.__init__(self, [SsGlue()] + elements + [SsGlue()], do_kern=False) class VCentered(Hlist): """ A convenience class to create a :class:`Vlist` whose contents are centered within its enclosing box. """ def __init__(self, elements): Vlist.__init__(self, [SsGlue()] + elements + [SsGlue()]) class Kern(Node): """ A :class:`Kern` node has a width field to specify a (normally negative) amount of spacing. This spacing correction appears in horizontal lists between letters like A and V when the font designer said that it looks better to move them closer together or further apart. A kern node can also appear in a vertical list, when its *width* denotes additional spacing in the vertical direction. """ height = 0 depth = 0 def __init__(self, width): Node.__init__(self) self.width = width def __repr__(self): return "k%.02f" % self.width def shrink(self): Node.shrink(self) if self.size < NUM_SIZE_LEVELS: self.width *= SHRINK_FACTOR def grow(self): Node.grow(self) self.width *= GROW_FACTOR class SubSuperCluster(Hlist): """ :class:`SubSuperCluster` is a sort of hack to get around that fact that this code do a two-pass parse like TeX. This lets us store enough information in the hlist itself, namely the nucleus, sub- and super-script, such that if another script follows that needs to be attached, it can be reconfigured on the fly. """ def __init__(self): self.nucleus = None self.sub = None self.super = None Hlist.__init__(self, []) class AutoHeightChar(Hlist): """ :class:`AutoHeightChar` will create a character as close to the given height and depth as possible. When using a font with multiple height versions of some characters (such as the BaKoMa fonts), the correct glyph will be selected, otherwise this will always just return a scaled version of the glyph. """ def __init__(self, c, height, depth, state, always=False, factor=None): alternatives = state.font_output.get_sized_alternatives_for_symbol( state.font, c) xHeight = state.font_output.get_xheight( state.font, state.fontsize, state.dpi) state = state.copy() target_total = height + depth for fontname, sym in alternatives: state.font = fontname char = Char(sym, state) # Ensure that size 0 is chosen when the text is regular sized but # with descender glyphs by subtracting 0.2 * xHeight if char.height + char.depth >= target_total - 0.2 * xHeight: break shift = 0 if state.font != 0: if factor is None: factor = (target_total) / (char.height + char.depth) state.fontsize *= factor char = Char(sym, state) shift = (depth - char.depth) Hlist.__init__(self, [char]) self.shift_amount = shift class AutoWidthChar(Hlist): """ :class:`AutoWidthChar` will create a character as close to the given width as possible. When using a font with multiple width versions of some characters (such as the BaKoMa fonts), the correct glyph will be selected, otherwise this will always just return a scaled version of the glyph. """ def __init__(self, c, width, state, always=False, char_class=Char): alternatives = state.font_output.get_sized_alternatives_for_symbol( state.font, c) state = state.copy() for fontname, sym in alternatives: state.font = fontname char = char_class(sym, state) if char.width >= width: break factor = width / char.width state.fontsize *= factor char = char_class(sym, state) Hlist.__init__(self, [char]) self.width = char.width class Ship(object): """ Once the boxes have been set up, this sends them to output. Since boxes can be inside of boxes inside of boxes, the main work of :class:`Ship` is done by two mutually recursive routines, :meth:`hlist_out` and :meth:`vlist_out`, which traverse the :class:`Hlist` nodes and :class:`Vlist` nodes inside of horizontal and vertical boxes. The global variables used in TeX to store state as it processes have become member variables here. """ def __call__(self, ox, oy, box): self.max_push = 0 # Deepest nesting of push commands so far self.cur_s = 0 self.cur_v = 0. self.cur_h = 0. self.off_h = ox self.off_v = oy + box.height self.hlist_out(box) def clamp(value): if value < -1000000000.: return -1000000000. if value > 1000000000.: return 1000000000. return value clamp = staticmethod(clamp) def hlist_out(self, box): cur_g = 0 cur_glue = 0. glue_order = box.glue_order glue_sign = box.glue_sign base_line = self.cur_v left_edge = self.cur_h self.cur_s += 1 self.max_push = max(self.cur_s, self.max_push) clamp = self.clamp for p in box.children: if isinstance(p, Char): p.render(self.cur_h + self.off_h, self.cur_v + self.off_v) self.cur_h += p.width elif isinstance(p, Kern): self.cur_h += p.width elif isinstance(p, List): # node623 if len(p.children) == 0: self.cur_h += p.width else: edge = self.cur_h self.cur_v = base_line + p.shift_amount if isinstance(p, Hlist): self.hlist_out(p) else: # p.vpack(box.height + box.depth, 'exactly') self.vlist_out(p) self.cur_h = edge + p.width self.cur_v = base_line elif isinstance(p, Box): # node624 rule_height = p.height rule_depth = p.depth rule_width = p.width if isinf(rule_height): rule_height = box.height if isinf(rule_depth): rule_depth = box.depth if rule_height > 0 and rule_width > 0: self.cur_v = baseline + rule_depth p.render(self.cur_h + self.off_h, self.cur_v + self.off_v, rule_width, rule_height) self.cur_v = baseline self.cur_h += rule_width elif isinstance(p, Glue): # node625 glue_spec = p.glue_spec rule_width = glue_spec.width - cur_g if glue_sign != 0: # normal if glue_sign == 1: # stretching if glue_spec.stretch_order == glue_order: cur_glue += glue_spec.stretch cur_g = np.round(clamp(float(box.glue_set) * cur_glue)) elif glue_spec.shrink_order == glue_order: cur_glue += glue_spec.shrink cur_g = np.round(clamp(float(box.glue_set) * cur_glue)) rule_width += cur_g self.cur_h += rule_width self.cur_s -= 1 def vlist_out(self, box): cur_g = 0 cur_glue = 0. glue_order = box.glue_order glue_sign = box.glue_sign self.cur_s += 1 self.max_push = max(self.max_push, self.cur_s) left_edge = self.cur_h self.cur_v -= box.height top_edge = self.cur_v clamp = self.clamp for p in box.children: if isinstance(p, Kern): self.cur_v += p.width elif isinstance(p, List): if len(p.children) == 0: self.cur_v += p.height + p.depth else: self.cur_v += p.height self.cur_h = left_edge + p.shift_amount save_v = self.cur_v p.width = box.width if isinstance(p, Hlist): self.hlist_out(p) else: self.vlist_out(p) self.cur_v = save_v + p.depth self.cur_h = left_edge elif isinstance(p, Box): rule_height = p.height rule_depth = p.depth rule_width = p.width if isinf(rule_width): rule_width = box.width rule_height += rule_depth if rule_height > 0 and rule_depth > 0: self.cur_v += rule_height p.render(self.cur_h + self.off_h, self.cur_v + self.off_v, rule_width, rule_height) elif isinstance(p, Glue): glue_spec = p.glue_spec rule_height = glue_spec.width - cur_g if glue_sign != 0: # normal if glue_sign == 1: # stretching if glue_spec.stretch_order == glue_order: cur_glue += glue_spec.stretch cur_g = np.round(clamp(float(box.glue_set) * cur_glue)) elif glue_spec.shrink_order == glue_order: # shrinking cur_glue += glue_spec.shrink cur_g = np.round(clamp(float(box.glue_set) * cur_glue)) rule_height += cur_g self.cur_v += rule_height elif isinstance(p, Char): raise RuntimeError("Internal mathtext error: Char node found in vlist") self.cur_s -= 1 ship = Ship() ############################################################################## # PARSER def Error(msg): """ Helper class to raise parser errors. """ def raise_error(s, loc, toks): raise ParseFatalException(s, loc, msg) empty = Empty() empty.setParseAction(raise_error) return empty class Parser(object): """ This is the pyparsing-based parser for math expressions. It actually parses full strings *containing* math expressions, in that raw text may also appear outside of pairs of ``$``. The grammar is based directly on that in TeX, though it cuts a few corners. """ _math_style_dict = dict(displaystyle=0, textstyle=1, scriptstyle=2, scriptscriptstyle=3) _binary_operators = set(''' + * - \\pm \\sqcap \\rhd \\mp \\sqcup \\unlhd \\times \\vee \\unrhd \\div \\wedge \\oplus \\ast \\setminus \\ominus \\star \\wr \\otimes \\circ \\diamond \\oslash \\bullet \\bigtriangleup \\odot \\cdot \\bigtriangledown \\bigcirc \\cap \\triangleleft \\dagger \\cup \\triangleright \\ddagger \\uplus \\lhd \\amalg'''.split()) _relation_symbols = set(''' = < > : \\leq \\geq \\equiv \\models \\prec \\succ \\sim \\perp \\preceq \\succeq \\simeq \\mid \\ll \\gg \\asymp \\parallel \\subset \\supset \\approx \\bowtie \\subseteq \\supseteq \\cong \\Join \\sqsubset \\sqsupset \\neq \\smile \\sqsubseteq \\sqsupseteq \\doteq \\frown \\in \\ni \\propto \\vdash \\dashv \\dots \\dotplus \\doteqdot'''.split()) _arrow_symbols = set(''' \\leftarrow \\longleftarrow \\uparrow \\Leftarrow \\Longleftarrow \\Uparrow \\rightarrow \\longrightarrow \\downarrow \\Rightarrow \\Longrightarrow \\Downarrow \\leftrightarrow \\longleftrightarrow \\updownarrow \\Leftrightarrow \\Longleftrightarrow \\Updownarrow \\mapsto \\longmapsto \\nearrow \\hookleftarrow \\hookrightarrow \\searrow \\leftharpoonup \\rightharpoonup \\swarrow \\leftharpoondown \\rightharpoondown \\nwarrow \\rightleftharpoons \\leadsto'''.split()) _spaced_symbols = _binary_operators | _relation_symbols | _arrow_symbols _punctuation_symbols = set(r', ; . ! \ldotp \cdotp'.split()) _overunder_symbols = set(r''' \sum \prod \coprod \bigcap \bigcup \bigsqcup \bigvee \bigwedge \bigodot \bigotimes \bigoplus \biguplus '''.split()) _overunder_functions = set( r"lim liminf limsup sup max min".split()) _dropsub_symbols = set(r'''\int \oint'''.split()) _fontnames = set("rm cal it tt sf bf default bb frak circled scr regular".split()) _function_names = set(""" arccos csc ker min arcsin deg lg Pr arctan det lim sec arg dim liminf sin cos exp limsup sinh cosh gcd ln sup cot hom log tan coth inf max tanh""".split()) _ambi_delim = set(""" | \\| / \\backslash \\uparrow \\downarrow \\updownarrow \\Uparrow \\Downarrow \\Updownarrow . \\vert \\Vert \\\\|""".split()) _left_delim = set(r"( [ \{ < \lfloor \langle \lceil".split()) _right_delim = set(r") ] \} > \rfloor \rangle \rceil".split()) def __init__(self): p = Bunch() # All forward declarations are here p.accent = Forward() p.ambi_delim = Forward() p.apostrophe = Forward() p.auto_delim = Forward() p.binom = Forward() p.bslash = Forward() p.c_over_c = Forward() p.customspace = Forward() p.end_group = Forward() p.float_literal = Forward() p.font = Forward() p.frac = Forward() p.dfrac = Forward() p.function = Forward() p.genfrac = Forward() p.group = Forward() p.int_literal = Forward() p.latexfont = Forward() p.lbracket = Forward() p.left_delim = Forward() p.lbrace = Forward() p.main = Forward() p.math = Forward() p.math_string = Forward() p.non_math = Forward() p.operatorname = Forward() p.overline = Forward() p.placeable = Forward() p.rbrace = Forward() p.rbracket = Forward() p.required_group = Forward() p.right_delim = Forward() p.right_delim_safe = Forward() p.simple = Forward() p.simple_group = Forward() p.single_symbol = Forward() p.snowflake = Forward() p.space = Forward() p.sqrt = Forward() p.stackrel = Forward() p.start_group = Forward() p.subsuper = Forward() p.subsuperop = Forward() p.symbol = Forward() p.symbol_name = Forward() p.token = Forward() p.unknown_symbol = Forward() # Set names on everything -- very useful for debugging for key, val in vars(p).items(): if not key.startswith('_'): val.setName(key) p.float_literal <<= Regex(r"[-+]?([0-9]+\.?[0-9]*|\.[0-9]+)") p.int_literal <<= Regex("[-+]?[0-9]+") p.lbrace <<= Literal('{').suppress() p.rbrace <<= Literal('}').suppress() p.lbracket <<= Literal('[').suppress() p.rbracket <<= Literal(']').suppress() p.bslash <<= Literal('\\') p.space <<= oneOf(list(self._space_widths)) p.customspace <<= (Suppress(Literal(r'\hspace')) - ((p.lbrace + p.float_literal + p.rbrace) | Error(r"Expected \hspace{n}"))) unicode_range = "\U00000080-\U0001ffff" p.single_symbol <<= Regex(r"([a-zA-Z0-9 +\-*/<>=:,.;!\?&'@()\[\]|%s])|(\\[%%${}\[\]_|])" % unicode_range) p.snowflake <<= Suppress(p.bslash) + oneOf(self._snowflake) p.symbol_name <<= (Combine(p.bslash + oneOf(list(tex2uni))) + FollowedBy(Regex("[^A-Za-z]").leaveWhitespace() | StringEnd())) p.symbol <<= (p.single_symbol | p.symbol_name).leaveWhitespace() p.apostrophe <<= Regex("'+") p.c_over_c <<= Suppress(p.bslash) + oneOf(list(self._char_over_chars)) p.accent <<= Group( Suppress(p.bslash) + oneOf(list(self._accent_map) + list(self._wide_accents)) - p.placeable ) p.function <<= Suppress(p.bslash) + oneOf(list(self._function_names)) p.start_group <<= Optional(p.latexfont) + p.lbrace p.end_group <<= p.rbrace.copy() p.simple_group <<= Group(p.lbrace + ZeroOrMore(p.token) + p.rbrace) p.required_group<<= Group(p.lbrace + OneOrMore(p.token) + p.rbrace) p.group <<= Group(p.start_group + ZeroOrMore(p.token) + p.end_group) p.font <<= Suppress(p.bslash) + oneOf(list(self._fontnames)) p.latexfont <<= Suppress(p.bslash) + oneOf(['math' + x for x in self._fontnames]) p.frac <<= Group( Suppress(Literal(r"\frac")) - ((p.required_group + p.required_group) | Error(r"Expected \frac{num}{den}")) ) p.dfrac <<= Group( Suppress(Literal(r"\dfrac")) - ((p.required_group + p.required_group) | Error(r"Expected \dfrac{num}{den}")) ) p.stackrel <<= Group( Suppress(Literal(r"\stackrel")) - ((p.required_group + p.required_group) | Error(r"Expected \stackrel{num}{den}")) ) p.binom <<= Group( Suppress(Literal(r"\binom")) - ((p.required_group + p.required_group) | Error(r"Expected \binom{num}{den}")) ) p.ambi_delim <<= oneOf(list(self._ambi_delim)) p.left_delim <<= oneOf(list(self._left_delim)) p.right_delim <<= oneOf(list(self._right_delim)) p.right_delim_safe <<= oneOf(list(self._right_delim - {'}'}) + [r'\}']) p.genfrac <<= Group( Suppress(Literal(r"\genfrac")) - (((p.lbrace + Optional(p.ambi_delim | p.left_delim, default='') + p.rbrace) + (p.lbrace + Optional(p.ambi_delim | p.right_delim_safe, default='') + p.rbrace) + (p.lbrace + p.float_literal + p.rbrace) + p.simple_group + p.required_group + p.required_group) | Error(r"Expected \genfrac{ldelim}{rdelim}{rulesize}{style}{num}{den}")) ) p.sqrt <<= Group( Suppress(Literal(r"\sqrt")) - ((Optional(p.lbracket + p.int_literal + p.rbracket, default=None) + p.required_group) | Error("Expected \\sqrt{value}")) ) p.overline <<= Group( Suppress(Literal(r"\overline")) - (p.required_group | Error("Expected \\overline{value}")) ) p.unknown_symbol<<= Combine(p.bslash + Regex("[A-Za-z]*")) p.operatorname <<= Group( Suppress(Literal(r"\operatorname")) - ((p.lbrace + ZeroOrMore(p.simple | p.unknown_symbol) + p.rbrace) | Error("Expected \\operatorname{value}")) ) p.placeable <<= ( p.snowflake # this needs to be before accent so named symbols # that are prefixed with an accent name work | p.accent # Must be before symbol as all accents are symbols | p.symbol # Must be third to catch all named symbols and single chars not in a group | p.c_over_c | p.function | p.group | p.frac | p.dfrac | p.stackrel | p.binom | p.genfrac | p.sqrt | p.overline | p.operatorname ) p.simple <<= ( p.space | p.customspace | p.font | p.subsuper ) p.subsuperop <<= oneOf(["_", "^"]) p.subsuper <<= Group( (Optional(p.placeable) + OneOrMore(p.subsuperop - p.placeable) + Optional(p.apostrophe)) | (p.placeable + Optional(p.apostrophe)) | p.apostrophe ) p.token <<= ( p.simple | p.auto_delim | p.unknown_symbol # Must be last ) p.auto_delim <<= (Suppress(Literal(r"\left")) - ((p.left_delim | p.ambi_delim) | Error("Expected a delimiter")) + Group(ZeroOrMore(p.simple | p.auto_delim)) + Suppress(Literal(r"\right")) - ((p.right_delim | p.ambi_delim) | Error("Expected a delimiter")) ) p.math <<= OneOrMore(p.token) p.math_string <<= QuotedString('$', '\\', unquoteResults=False) p.non_math <<= Regex(r"(?:(?:\\[$])|[^$])*").leaveWhitespace() p.main <<= (p.non_math + ZeroOrMore(p.math_string + p.non_math)) + StringEnd() # Set actions for key, val in vars(p).items(): if not key.startswith('_'): if hasattr(self, key): val.setParseAction(getattr(self, key)) self._expression = p.main self._math_expression = p.math def parse(self, s, fonts_object, fontsize, dpi): """ Parse expression *s* using the given *fonts_object* for output, at the given *fontsize* and *dpi*. Returns the parse tree of :class:`Node` instances. """ self._state_stack = [self.State(fonts_object, 'default', 'rm', fontsize, dpi)] self._em_width_cache = {} try: result = self._expression.parseString(s) except ParseBaseException as err: raise ValueError("\n".join([ "", err.line, " " * (err.column - 1) + "^", six.text_type(err)])) self._state_stack = None self._em_width_cache = {} self._expression.resetCache() return result[0] # The state of the parser is maintained in a stack. Upon # entering and leaving a group { } or math/non-math, the stack # is pushed and popped accordingly. The current state always # exists in the top element of the stack. class State(object): """ Stores the state of the parser. States are pushed and popped from a stack as necessary, and the "current" state is always at the top of the stack. """ def __init__(self, font_output, font, font_class, fontsize, dpi): self.font_output = font_output self._font = font self.font_class = font_class self.fontsize = fontsize self.dpi = dpi def copy(self): return Parser.State( self.font_output, self.font, self.font_class, self.fontsize, self.dpi) def _get_font(self): return self._font def _set_font(self, name): if name in ('rm', 'it', 'bf'): self.font_class = name self._font = name font = property(_get_font, _set_font) def get_state(self): """ Get the current :class:`State` of the parser. """ return self._state_stack[-1] def pop_state(self): """ Pop a :class:`State` off of the stack. """ self._state_stack.pop() def push_state(self): """ Push a new :class:`State` onto the stack which is just a copy of the current state. """ self._state_stack.append(self.get_state().copy()) def main(self, s, loc, toks): #~ print "finish", toks return [Hlist(toks)] def math_string(self, s, loc, toks): # print "math_string", toks[0][1:-1] return self._math_expression.parseString(toks[0][1:-1]) def math(self, s, loc, toks): #~ print "math", toks hlist = Hlist(toks) self.pop_state() return [hlist] def non_math(self, s, loc, toks): #~ print "non_math", toks s = toks[0].replace(r'\$', '$') symbols = [Char(c, self.get_state(), math=False) for c in s] hlist = Hlist(symbols) # We're going into math now, so set font to 'it' self.push_state() self.get_state().font = rcParams['mathtext.default'] return [hlist] def _make_space(self, percentage): # All spaces are relative to em width state = self.get_state() key = (state.font, state.fontsize, state.dpi) width = self._em_width_cache.get(key) if width is None: metrics = state.font_output.get_metrics( state.font, rcParams['mathtext.default'], 'm', state.fontsize, state.dpi) width = metrics.advance self._em_width_cache[key] = width return Kern(width * percentage) _space_widths = { r'\,' : 0.16667, # 3/18 em = 3 mu r'\thinspace' : 0.16667, # 3/18 em = 3 mu r'\/' : 0.16667, # 3/18 em = 3 mu r'\>' : 0.22222, # 4/18 em = 4 mu r'\:' : 0.22222, # 4/18 em = 4 mu r'\;' : 0.27778, # 5/18 em = 5 mu r'\ ' : 0.33333, # 6/18 em = 6 mu r'\enspace' : 0.5, # 9/18 em = 9 mu r'\quad' : 1, # 1 em = 18 mu r'\qquad' : 2, # 2 em = 36 mu r'\!' : -0.16667, # -3/18 em = -3 mu } def space(self, s, loc, toks): assert(len(toks)==1) num = self._space_widths[toks[0]] box = self._make_space(num) return [box] def customspace(self, s, loc, toks): return [self._make_space(float(toks[0]))] def symbol(self, s, loc, toks): # print "symbol", toks c = toks[0] try: char = Char(c, self.get_state()) except ValueError: raise ParseFatalException(s, loc, "Unknown symbol: %s" % c) if c in self._spaced_symbols: # iterate until we find previous character, needed for cases # such as ${ -2}$, $ -2$, or $ -2$. for i in six.moves.xrange(1, loc + 1): prev_char = s[loc-i] if prev_char != ' ': break # Binary operators at start of string should not be spaced if (c in self._binary_operators and (len(s[:loc].split()) == 0 or prev_char == '{' or prev_char in self._left_delim)): return [char] else: return [Hlist([self._make_space(0.2), char, self._make_space(0.2)] , do_kern = True)] elif c in self._punctuation_symbols: # Do not space commas between brackets if c == ',': prev_char, next_char = '', '' for i in six.moves.xrange(1, loc + 1): prev_char = s[loc - i] if prev_char != ' ': break for i in six.moves.xrange(1, len(s) - loc): next_char = s[loc + i] if next_char != ' ': break if (prev_char == '{' and next_char == '}'): return [char] # Do not space dots as decimal separators if (c == '.' and s[loc - 1].isdigit() and s[loc + 1].isdigit()): return [char] else: return [Hlist([char, self._make_space(0.2)], do_kern = True)] return [char] snowflake = symbol def unknown_symbol(self, s, loc, toks): # print "symbol", toks c = toks[0] raise ParseFatalException(s, loc, "Unknown symbol: %s" % c) _char_over_chars = { # The first 2 entries in the tuple are (font, char, sizescale) for # the two symbols under and over. The third element is the space # (in multiples of underline height) r'AA': (('it', 'A', 1.0), (None, '\\circ', 0.5), 0.0), } def c_over_c(self, s, loc, toks): sym = toks[0] state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) under_desc, over_desc, space = \ self._char_over_chars.get(sym, (None, None, 0.0)) if under_desc is None: raise ParseFatalException("Error parsing symbol") over_state = state.copy() if over_desc[0] is not None: over_state.font = over_desc[0] over_state.fontsize *= over_desc[2] over = Accent(over_desc[1], over_state) under_state = state.copy() if under_desc[0] is not None: under_state.font = under_desc[0] under_state.fontsize *= under_desc[2] under = Char(under_desc[1], under_state) width = max(over.width, under.width) over_centered = HCentered([over]) over_centered.hpack(width, 'exactly') under_centered = HCentered([under]) under_centered.hpack(width, 'exactly') return Vlist([ over_centered, Vbox(0., thickness * space), under_centered ]) _accent_map = { r'hat' : r'\circumflexaccent', r'breve' : r'\combiningbreve', r'bar' : r'\combiningoverline', r'grave' : r'\combininggraveaccent', r'acute' : r'\combiningacuteaccent', r'tilde' : r'\combiningtilde', r'dot' : r'\combiningdotabove', r'ddot' : r'\combiningdiaeresis', r'vec' : r'\combiningrightarrowabove', r'"' : r'\combiningdiaeresis', r"`" : r'\combininggraveaccent', r"'" : r'\combiningacuteaccent', r'~' : r'\combiningtilde', r'.' : r'\combiningdotabove', r'^' : r'\circumflexaccent', r'overrightarrow' : r'\rightarrow', r'overleftarrow' : r'\leftarrow', r'mathring' : r'\circ' } _wide_accents = set(r"widehat widetilde widebar".split()) # make a lambda and call it to get the namespace right _snowflake = (lambda am: [p for p in tex2uni if any(p.startswith(a) and a != p for a in am)] ) (set(_accent_map)) def accent(self, s, loc, toks): assert(len(toks)==1) state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) if len(toks[0]) != 2: raise ParseFatalException("Error parsing accent") accent, sym = toks[0] if accent in self._wide_accents: accent_box = AutoWidthChar( '\\' + accent, sym.width, state, char_class=Accent) else: accent_box = Accent(self._accent_map[accent], state) if accent == 'mathring': accent_box.shrink() accent_box.shrink() centered = HCentered([Hbox(sym.width / 4.0), accent_box]) centered.hpack(sym.width, 'exactly') return Vlist([ centered, Vbox(0., thickness * 2.0), Hlist([sym]) ]) def function(self, s, loc, toks): #~ print "function", toks self.push_state() state = self.get_state() state.font = 'rm' hlist = Hlist([Char(c, state) for c in toks[0]]) self.pop_state() hlist.function_name = toks[0] return hlist def operatorname(self, s, loc, toks): self.push_state() state = self.get_state() state.font = 'rm' # Change the font of Chars, but leave Kerns alone for c in toks[0]: if isinstance(c, Char): c.font = 'rm' c._update_metrics() self.pop_state() return Hlist(toks[0]) def start_group(self, s, loc, toks): self.push_state() # Deal with LaTeX-style font tokens if len(toks): self.get_state().font = toks[0][4:] return [] def group(self, s, loc, toks): grp = Hlist(toks[0]) return [grp] required_group = simple_group = group def end_group(self, s, loc, toks): self.pop_state() return [] def font(self, s, loc, toks): assert(len(toks)==1) name = toks[0] self.get_state().font = name return [] def is_overunder(self, nucleus): if isinstance(nucleus, Char): return nucleus.c in self._overunder_symbols elif isinstance(nucleus, Hlist) and hasattr(nucleus, 'function_name'): return nucleus.function_name in self._overunder_functions return False def is_dropsub(self, nucleus): if isinstance(nucleus, Char): return nucleus.c in self._dropsub_symbols return False def is_slanted(self, nucleus): if isinstance(nucleus, Char): return nucleus.is_slanted() return False def is_between_brackets(self, s, loc): return False def subsuper(self, s, loc, toks): assert(len(toks)==1) nucleus = None sub = None super = None # Pick all of the apostrophes out, including first apostrophes that have # been parsed as characters napostrophes = 0 new_toks = [] for tok in toks[0]: if isinstance(tok, six.string_types) and tok not in ('^', '_'): napostrophes += len(tok) elif isinstance(tok, Char) and tok.c == "'": napostrophes += 1 else: new_toks.append(tok) toks = new_toks if len(toks) == 0: assert napostrophes nucleus = Hbox(0.0) elif len(toks) == 1: if not napostrophes: return toks[0] # .asList() else: nucleus = toks[0] elif len(toks) in (2, 3): # single subscript or superscript nucleus = toks[0] if len(toks) == 3 else Hbox(0.0) op, next = toks[-2:] if op == '_': sub = next else: super = next elif len(toks) in (4, 5): # subscript and superscript nucleus = toks[0] if len(toks) == 5 else Hbox(0.0) op1, next1, op2, next2 = toks[-4:] if op1 == op2: if op1 == '_': raise ParseFatalException("Double subscript") else: raise ParseFatalException("Double superscript") if op1 == '_': sub = next1 super = next2 else: super = next1 sub = next2 else: raise ParseFatalException( "Subscript/superscript sequence is too long. " "Use braces { } to remove ambiguity.") state = self.get_state() rule_thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) xHeight = state.font_output.get_xheight( state.font, state.fontsize, state.dpi) if napostrophes: if super is None: super = Hlist([]) for i in range(napostrophes): super.children.extend(self.symbol(s, loc, ['\\prime'])) # kern() and hpack() needed to get the metrics right after extending super.kern() super.hpack() # Handle over/under symbols, such as sum or integral if self.is_overunder(nucleus): vlist = [] shift = 0. width = nucleus.width if super is not None: super.shrink() width = max(width, super.width) if sub is not None: sub.shrink() width = max(width, sub.width) if super is not None: hlist = HCentered([super]) hlist.hpack(width, 'exactly') vlist.extend([hlist, Kern(rule_thickness * 3.0)]) hlist = HCentered([nucleus]) hlist.hpack(width, 'exactly') vlist.append(hlist) if sub is not None: hlist = HCentered([sub]) hlist.hpack(width, 'exactly') vlist.extend([Kern(rule_thickness * 3.0), hlist]) shift = hlist.height vlist = Vlist(vlist) vlist.shift_amount = shift + nucleus.depth result = Hlist([vlist]) return [result] # We remove kerning on the last character for consistency (otherwise it # will compute kerning based on non-shrinked characters and may put them # too close together when superscripted) # We change the width of the last character to match the advance to # consider some fonts with weird metrics: e.g. stix's f has a width of # 7.75 and a kerning of -4.0 for an advance of 3.72, and we want to put # the superscript at the advance last_char = nucleus if isinstance(nucleus, Hlist): new_children = nucleus.children if len(new_children): # remove last kern if (isinstance(new_children[-1],Kern) and hasattr(new_children[-2], '_metrics')): new_children = new_children[:-1] last_char = new_children[-1] if hasattr(last_char, '_metrics'): last_char.width = last_char._metrics.advance # create new Hlist without kerning nucleus = Hlist(new_children, do_kern=False) else: if isinstance(nucleus, Char): last_char.width = last_char._metrics.advance nucleus = Hlist([nucleus]) # Handle regular sub/superscripts constants = _get_font_constant_set(state) lc_height = last_char.height lc_baseline = 0 if self.is_dropsub(last_char): lc_baseline = last_char.depth # Compute kerning for sub and super superkern = constants.delta * xHeight subkern = constants.delta * xHeight if self.is_slanted(last_char): superkern += constants.delta * xHeight superkern += (constants.delta_slanted * (lc_height - xHeight * 2. / 3.)) if self.is_dropsub(last_char): subkern = (3 * constants.delta - constants.delta_integral) * lc_height superkern = (3 * constants.delta + constants.delta_integral) * lc_height else: subkern = 0 if super is None: # node757 x = Hlist([Kern(subkern), sub]) x.shrink() if self.is_dropsub(last_char): shift_down = lc_baseline + constants.subdrop * xHeight else: shift_down = constants.sub1 * xHeight x.shift_amount = shift_down else: x = Hlist([Kern(superkern), super]) x.shrink() if self.is_dropsub(last_char): shift_up = lc_height - constants.subdrop * xHeight else: shift_up = constants.sup1 * xHeight if sub is None: x.shift_amount = -shift_up else: # Both sub and superscript y = Hlist([Kern(subkern),sub]) y.shrink() if self.is_dropsub(last_char): shift_down = lc_baseline + constants.subdrop * xHeight else: shift_down = constants.sub2 * xHeight # If sub and superscript collide, move super up clr = (2.0 * rule_thickness - ((shift_up - x.depth) - (y.height - shift_down))) if clr > 0.: shift_up += clr x = Vlist([x, Kern((shift_up - x.depth) - (y.height - shift_down)), y]) x.shift_amount = shift_down if not self.is_dropsub(last_char): x.width += constants.script_space * xHeight result = Hlist([nucleus, x]) return [result] def _genfrac(self, ldelim, rdelim, rule, style, num, den): state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) rule = float(rule) # If style != displaystyle == 0, shrink the num and den if style != self._math_style_dict['displaystyle']: num.shrink() den.shrink() cnum = HCentered([num]) cden = HCentered([den]) width = max(num.width, den.width) cnum.hpack(width, 'exactly') cden.hpack(width, 'exactly') vlist = Vlist([cnum, # numerator Vbox(0, thickness * 2.0), # space Hrule(state, rule), # rule Vbox(0, thickness * 2.0), # space cden # denominator ]) # Shift so the fraction line sits in the middle of the # equals sign metrics = state.font_output.get_metrics( state.font, rcParams['mathtext.default'], '=', state.fontsize, state.dpi) shift = (cden.height - ((metrics.ymax + metrics.ymin) / 2 - thickness * 3.0)) vlist.shift_amount = shift result = [Hlist([vlist, Hbox(thickness * 2.)])] if ldelim or rdelim: if ldelim == '': ldelim = '.' if rdelim == '': rdelim = '.' return self._auto_sized_delimiter(ldelim, result, rdelim) return result def genfrac(self, s, loc, toks): assert(len(toks) == 1) assert(len(toks[0]) == 6) return self._genfrac(*tuple(toks[0])) def frac(self, s, loc, toks): assert(len(toks) == 1) assert(len(toks[0]) == 2) state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) num, den = toks[0] return self._genfrac('', '', thickness, self._math_style_dict['textstyle'], num, den) def dfrac(self, s, loc, toks): assert(len(toks) == 1) assert(len(toks[0]) == 2) state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) num, den = toks[0] return self._genfrac('', '', thickness, self._math_style_dict['displaystyle'], num, den) def stackrel(self, s, loc, toks): assert(len(toks) == 1) assert(len(toks[0]) == 2) num, den = toks[0] return self._genfrac('', '', 0.0, self._math_style_dict['textstyle'], num, den) def binom(self, s, loc, toks): assert(len(toks) == 1) assert(len(toks[0]) == 2) num, den = toks[0] return self._genfrac('(', ')', 0.0, self._math_style_dict['textstyle'], num, den) def sqrt(self, s, loc, toks): #~ print "sqrt", toks root, body = toks[0] state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) # Determine the height of the body, and add a little extra to # the height so it doesn't seem cramped height = body.height - body.shift_amount + thickness * 5.0 depth = body.depth + body.shift_amount check = AutoHeightChar(r'\__sqrt__', height, depth, state, always=True) height = check.height - check.shift_amount depth = check.depth + check.shift_amount # Put a little extra space to the left and right of the body padded_body = Hlist([Hbox(thickness * 2.0), body, Hbox(thickness * 2.0)]) rightside = Vlist([Hrule(state), Fill(), padded_body]) # Stretch the glue between the hrule and the body rightside.vpack(height + (state.fontsize * state.dpi) / (100.0 * 12.0), 'exactly', depth) # Add the root and shift it upward so it is above the tick. # The value of 0.6 is a hard-coded hack ;) if root is None: root = Box(check.width * 0.5, 0., 0.) else: root = Hlist([Char(x, state) for x in root]) root.shrink() root.shrink() root_vlist = Vlist([Hlist([root])]) root_vlist.shift_amount = -height * 0.6 hlist = Hlist([root_vlist, # Root # Negative kerning to put root over tick Kern(-check.width * 0.5), check, # Check rightside]) # Body return [hlist] def overline(self, s, loc, toks): assert(len(toks)==1) assert(len(toks[0])==1) body = toks[0][0] state = self.get_state() thickness = state.font_output.get_underline_thickness( state.font, state.fontsize, state.dpi) height = body.height - body.shift_amount + thickness * 3.0 depth = body.depth + body.shift_amount # Place overline above body rightside = Vlist([Hrule(state), Fill(), Hlist([body])]) # Stretch the glue between the hrule and the body rightside.vpack(height + (state.fontsize * state.dpi) / (100.0 * 12.0), 'exactly', depth) hlist = Hlist([rightside]) return [hlist] def _auto_sized_delimiter(self, front, middle, back): state = self.get_state() if len(middle): height = max(x.height for x in middle) depth = max(x.depth for x in middle) factor = None else: height = 0 depth = 0 factor = 1.0 parts = [] # \left. and \right. aren't supposed to produce any symbols if front != '.': parts.append(AutoHeightChar(front, height, depth, state, factor=factor)) parts.extend(middle) if back != '.': parts.append(AutoHeightChar(back, height, depth, state, factor=factor)) hlist = Hlist(parts) return hlist def auto_delim(self, s, loc, toks): #~ print "auto_delim", toks front, middle, back = toks return self._auto_sized_delimiter(front, middle.asList(), back) ### ############################################################################## # MAIN class MathTextParser(object): _parser = None _backend_mapping = { 'bitmap': MathtextBackendBitmap, 'agg' : MathtextBackendAgg, 'ps' : MathtextBackendPs, 'pdf' : MathtextBackendPdf, 'svg' : MathtextBackendSvg, 'path' : MathtextBackendPath, 'cairo' : MathtextBackendCairo, 'macosx': MathtextBackendAgg, } _font_type_mapping = { 'cm' : BakomaFonts, 'dejavuserif' : DejaVuSerifFonts, 'dejavusans' : DejaVuSansFonts, 'stix' : StixFonts, 'stixsans' : StixSansFonts, 'custom' : UnicodeFonts } def __init__(self, output): """ Create a MathTextParser for the given backend *output*. """ self._output = output.lower() self._cache = maxdict(50) def parse(self, s, dpi = 72, prop = None): """ Parse the given math expression *s* at the given *dpi*. If *prop* is provided, it is a :class:`~matplotlib.font_manager.FontProperties` object specifying the "default" font to use in the math expression, used for all non-math text. The results are cached, so multiple calls to :meth:`parse` with the same expression should be fast. """ # There is a bug in Python 3.x where it leaks frame references, # and therefore can't handle this caching if prop is None: prop = FontProperties() cacheKey = (s, dpi, hash(prop)) result = self._cache.get(cacheKey) if result is not None: return result if self._output == 'ps' and rcParams['ps.useafm']: font_output = StandardPsFonts(prop) else: backend = self._backend_mapping[self._output]() fontset = rcParams['mathtext.fontset'] fontset_class = self._font_type_mapping.get(fontset.lower()) if fontset_class is not None: font_output = fontset_class(prop, backend) else: raise ValueError( "mathtext.fontset must be either 'cm', 'dejavuserif', " "'dejavusans', 'stix', 'stixsans', or 'custom'") fontsize = prop.get_size_in_points() # This is a class variable so we don't rebuild the parser # with each request. if self._parser is None: self.__class__._parser = Parser() box = self._parser.parse(s, font_output, fontsize, dpi) font_output.set_canvas_size(box.width, box.height, box.depth) result = font_output.get_results(box) self._cache[cacheKey] = result return result def to_mask(self, texstr, dpi=120, fontsize=14): """ *texstr* A valid mathtext string, e.g., r'IQ: $\\sigma_i=15$' *dpi* The dots-per-inch to render the text *fontsize* The font size in points Returns a tuple (*array*, *depth*) - *array* is an NxM uint8 alpha ubyte mask array of rasterized tex. - depth is the offset of the baseline from the bottom of the image in pixels. """ assert(self._output=="bitmap") prop = FontProperties(size=fontsize) ftimage, depth = self.parse(texstr, dpi=dpi, prop=prop) x = ftimage.as_array() return x, depth def to_rgba(self, texstr, color='black', dpi=120, fontsize=14): """ *texstr* A valid mathtext string, e.g., r'IQ: $\\sigma_i=15$' *color* Any matplotlib color argument *dpi* The dots-per-inch to render the text *fontsize* The font size in points Returns a tuple (*array*, *depth*) - *array* is an NxM uint8 alpha ubyte mask array of rasterized tex. - depth is the offset of the baseline from the bottom of the image in pixels. """ x, depth = self.to_mask(texstr, dpi=dpi, fontsize=fontsize) r, g, b, a = mcolors.to_rgba(color) RGBA = np.zeros((x.shape[0], x.shape[1], 4), dtype=np.uint8) RGBA[:, :, 0] = 255 * r RGBA[:, :, 1] = 255 * g RGBA[:, :, 2] = 255 * b RGBA[:, :, 3] = x return RGBA, depth def to_png(self, filename, texstr, color='black', dpi=120, fontsize=14): """ Writes a tex expression to a PNG file. Returns the offset of the baseline from the bottom of the image in pixels. *filename* A writable filename or fileobject *texstr* A valid mathtext string, e.g., r'IQ: $\\sigma_i=15$' *color* A valid matplotlib color argument *dpi* The dots-per-inch to render the text *fontsize* The font size in points Returns the offset of the baseline from the bottom of the image in pixels. """ rgba, depth = self.to_rgba(texstr, color=color, dpi=dpi, fontsize=fontsize) _png.write_png(rgba, filename) return depth def get_depth(self, texstr, dpi=120, fontsize=14): """ Returns the offset of the baseline from the bottom of the image in pixels. *texstr* A valid mathtext string, e.g., r'IQ: $\\sigma_i=15$' *dpi* The dots-per-inch to render the text *fontsize* The font size in points """ assert(self._output=="bitmap") prop = FontProperties(size=fontsize) ftimage, depth = self.parse(texstr, dpi=dpi, prop=prop) return depth def math_to_image(s, filename_or_obj, prop=None, dpi=None, format=None): """ Given a math expression, renders it in a closely-clipped bounding box to an image file. *s* A math expression. The math portion should be enclosed in dollar signs. *filename_or_obj* A filepath or writable file-like object to write the image data to. *prop* If provided, a FontProperties() object describing the size and style of the text. *dpi* Override the output dpi, otherwise use the default associated with the output format. *format* The output format, e.g., 'svg', 'pdf', 'ps' or 'png'. If not provided, will be deduced from the filename. """ from matplotlib import figure # backend_agg supports all of the core output formats from matplotlib.backends import backend_agg if prop is None: prop = FontProperties() parser = MathTextParser('path') width, height, depth, _, _ = parser.parse(s, dpi=72, prop=prop) fig = figure.Figure(figsize=(width / 72.0, height / 72.0)) fig.text(0, depth/height, s, fontproperties=prop) backend_agg.FigureCanvasAgg(fig) fig.savefig(filename_or_obj, dpi=dpi, format=format) return depth
jonyroda97/redbot-amigosprovaveis
lib/matplotlib/mathtext.py
Python
gpl-3.0
122,856
[ "Bowtie" ]
108e56b237b55eb6d3c1bf89d9056235ab914dc0e4ccf733b48325f44b852aff
# Copyright (C) 2010-2019 The ESPResSo project # # This file is part of ESPResSo. # # ESPResSo is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. """ Visualize a simulation box where the particles can be repositioned via the mouse and timed callbacks, and the temperature of the thermostat can be changed via the keyboard. """ import espressomd import espressomd.visualization_opengl import numpy as np required_features = [] espressomd.assert_features(required_features) print("Press u/j to change temperature") box_l = 10.0 system = espressomd.System(box_l=[box_l] * 3) visualizer = espressomd.visualization_opengl.openGLLive( system, drag_enabled=True, drag_force=100) system.time_step = 0.00001 system.cell_system.skin = 3.0 N = 50 partcls = system.part.add(pos=N * [[0, 0, 0]]) system.thermostat.set_langevin(kT=1.0, gamma=1.0, seed=42) # Callback for particle positions/velocities def spin(): partcls.pos = [[box_l * 0.5, box_l * (i + 1) / (N + 2), box_l * 0.5] for i in range(N)] partcls.v = [ [np.sin(10.0 * i / N) * 20, 0, np.cos(10.0 * i / N) * 20] for i in range(N)] # Register timed callback visualizer.register_callback(spin, interval=5000) # Callbacks to control temperature temperature = 1.0 def increaseTemp(): global temperature temperature += 0.5 system.thermostat.set_langevin(kT=temperature, gamma=1.0) print("T =", system.thermostat.get_state()[0]['kT']) def decreaseTemp(): global temperature temperature -= 0.5 if temperature > 0: system.thermostat.set_langevin(kT=temperature, gamma=1.0) print(f"T = {system.thermostat.get_state()[0]['kT']:.1f}") else: temperature = 0 system.thermostat.turn_off() print("T = 0.") # Register button callbacks visualizer.keyboard_manager.register_button( espressomd.visualization_opengl.KeyboardButtonEvent('u', espressomd.visualization_opengl.KeyboardFireEvent.Hold, increaseTemp)) visualizer.keyboard_manager.register_button( espressomd.visualization_opengl.KeyboardButtonEvent('j', espressomd.visualization_opengl.KeyboardFireEvent.Hold, decreaseTemp)) # Set initial position spin() # Start the visualizer visualizer.run(1)
espressomd/espresso
samples/visualization_interactive.py
Python
gpl-3.0
2,788
[ "ESPResSo" ]
71afcc87fc1e7212b9fa9260f54001e2315875c0a7203dbcc2779b3b6050e1c3
# (C) British Crown Copyright 2014 - 2016, Met Office # # This file is part of iris-grib. # # iris-grib is free software: you can redistribute it and/or modify it under # the terms of the GNU Lesser General Public License as published by the # Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # iris-grib is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with iris-grib. If not, see <http://www.gnu.org/licenses/>. """ Unit tests for `iris_grib.message.Section`. """ from __future__ import (absolute_import, division, print_function) from six.moves import (filter, input, map, range, zip) # noqa # Import iris_grib.tests first so that some things can be initialised before # importing anything else. import iris_grib.tests as tests import gribapi import numpy as np from iris_grib.message import Section @tests.skip_data class Test___getitem__(tests.IrisGribTest): def setUp(self): filename = tests.get_data_path(('GRIB', 'uk_t', 'uk_t.grib2')) with open(filename, 'rb') as grib_fh: self.grib_id = gribapi.grib_new_from_file(grib_fh) def test_scalar(self): section = Section(self.grib_id, None, ['Ni']) self.assertEqual(section['Ni'], 47) def test_array(self): section = Section(self.grib_id, None, ['codedValues']) codedValues = section['codedValues'] self.assertEqual(codedValues.shape, (1551,)) self.assertArrayAlmostEqual(codedValues[:3], [-1.78140259, -1.53140259, -1.28140259]) def test_typeOfFirstFixedSurface(self): section = Section(self.grib_id, None, ['typeOfFirstFixedSurface']) self.assertEqual(section['typeOfFirstFixedSurface'], 100) def test_numberOfSection(self): n = 4 section = Section(self.grib_id, n, ['numberOfSection']) self.assertEqual(section['numberOfSection'], n) def test_invalid(self): section = Section(self.grib_id, None, ['Ni']) with self.assertRaisesRegexp(KeyError, 'Nii'): section['Nii'] @tests.skip_data class Test__getitem___pdt_31(tests.IrisGribTest): def setUp(self): filename = tests.get_data_path(('GRIB', 'umukv', 'ukv_chan9.grib2')) with open(filename, 'rb') as grib_fh: self.grib_id = gribapi.grib_new_from_file(grib_fh) self.keys = ['satelliteSeries', 'satelliteNumber', 'instrumentType', 'scaleFactorOfCentralWaveNumber', 'scaledValueOfCentralWaveNumber'] def test_array(self): section = Section(self.grib_id, None, self.keys) for key in self.keys: value = section[key] self.assertIsInstance(value, np.ndarray) self.assertEqual(value.shape, (1,)) @tests.skip_data class Test_get_computed_key(tests.IrisGribTest): def test_gdt40_computed(self): fname = tests.get_data_path(('GRIB', 'gaussian', 'regular_gg.grib2')) with open(fname, 'rb') as grib_fh: self.grib_id = gribapi.grib_new_from_file(grib_fh) section = Section(self.grib_id, None, []) latitudes = section.get_computed_key('latitudes') self.assertTrue(88.55 < latitudes[0] < 88.59) if __name__ == '__main__': tests.main()
pp-mo/iris-grib
iris_grib/tests/unit/message/test_Section.py
Python
lgpl-3.0
3,573
[ "Gaussian" ]
dc4a81bf595ecf834f989e7ff989b0cf2c7f7a3002dab3a2ae52e37da05af1e3
"""Tests related to prerun part of the linter.""" import os import subprocess from typing import List import pytest from _pytest.monkeypatch import MonkeyPatch from flaky import flaky from ansiblelint import prerun from ansiblelint.constants import INVALID_PREREQUISITES_RC from ansiblelint.testing import run_ansible_lint # https://github.com/box/flaky/issues/170 @flaky(max_runs=3) # type: ignore def test_prerun_reqs_v1() -> None: """Checks that the linter can auto-install requirements v1 when found.""" cwd = os.path.realpath( os.path.join( os.path.dirname(os.path.realpath(__file__)), "..", "examples", "reqs_v1" ) ) result = run_ansible_lint("-v", ".", cwd=cwd) assert "Running ansible-galaxy role install" in result.stderr, result.stderr assert ( "Running ansible-galaxy collection install" not in result.stderr ), result.stderr assert result.returncode == 0, result @flaky(max_runs=3) # type: ignore def test_prerun_reqs_v2() -> None: """Checks that the linter can auto-install requirements v2 when found.""" cwd = os.path.realpath( os.path.join( os.path.dirname(os.path.realpath(__file__)), "..", "examples", "reqs_v2" ) ) result = run_ansible_lint("-v", ".", cwd=cwd) assert "Running ansible-galaxy role install" in result.stderr, result.stderr assert "Running ansible-galaxy collection install" in result.stderr, result.stderr assert result.returncode == 0, result def test__update_env_no_old_value_no_default_no_value(monkeypatch: MonkeyPatch) -> None: """Make sure empty value does not touch environment.""" monkeypatch.delenv("DUMMY_VAR", raising=False) prerun._update_env("DUMMY_VAR", []) assert "DUMMY_VAR" not in os.environ def test__update_env_no_old_value_no_value(monkeypatch: MonkeyPatch) -> None: """Make sure empty value does not touch environment.""" monkeypatch.delenv("DUMMY_VAR", raising=False) prerun._update_env("DUMMY_VAR", [], "a:b") assert "DUMMY_VAR" not in os.environ def test__update_env_no_default_no_value(monkeypatch: MonkeyPatch) -> None: """Make sure empty value does not touch environment.""" monkeypatch.setenv("DUMMY_VAR", "a:b") prerun._update_env("DUMMY_VAR", []) assert os.environ["DUMMY_VAR"] == "a:b" @pytest.mark.parametrize( ("value", "result"), ( (["a"], "a"), (["a", "b"], "a:b"), (["a", "b", "c"], "a:b:c"), ), ) def test__update_env_no_old_value_no_default( monkeypatch: MonkeyPatch, value: List[str], result: str ) -> None: """Values are concatenated using : as the separator.""" monkeypatch.delenv("DUMMY_VAR", raising=False) prerun._update_env("DUMMY_VAR", value) assert os.environ["DUMMY_VAR"] == result @pytest.mark.parametrize( ("default", "value", "result"), ( ("a:b", ["c"], "a:b:c"), ("a:b", ["c:d"], "a:b:c:d"), ), ) def test__update_env_no_old_value( monkeypatch: MonkeyPatch, default: str, value: List[str], result: str ) -> None: """Values are appended to default value.""" monkeypatch.delenv("DUMMY_VAR", raising=False) prerun._update_env("DUMMY_VAR", value, default) assert os.environ["DUMMY_VAR"] == result @pytest.mark.parametrize( ("old_value", "value", "result"), ( ("a:b", ["c"], "a:b:c"), ("a:b", ["c:d"], "a:b:c:d"), ), ) def test__update_env_no_default( monkeypatch: MonkeyPatch, old_value: str, value: List[str], result: str ) -> None: """Values are appended to preexisting value.""" monkeypatch.setenv("DUMMY_VAR", old_value) prerun._update_env("DUMMY_VAR", value) assert os.environ["DUMMY_VAR"] == result @pytest.mark.parametrize( ("old_value", "default", "value", "result"), ( ("", "", ["e"], "e"), ("a", "", ["e"], "a:e"), ("", "c", ["e"], "e"), ("a", "c", ["e:f"], "a:e:f"), ), ) def test__update_env( monkeypatch: MonkeyPatch, old_value: str, default: str, value: List[str], result: str, ) -> None: """Defaults are ignored when preexisting value is present.""" monkeypatch.setenv("DUMMY_VAR", old_value) prerun._update_env("DUMMY_VAR", value) assert os.environ["DUMMY_VAR"] == result def test_require_collection_wrong_version() -> None: """Tests behaviour of require_collection.""" subprocess.check_output( [ "ansible-galaxy", "collection", "install", "containers.podman", "-p", "~/.ansible/collections", ] ) with pytest.raises(SystemExit) as pytest_wrapped_e: prerun.require_collection("containers.podman", '9999.9.9') assert pytest_wrapped_e.type == SystemExit assert pytest_wrapped_e.value.code == INVALID_PREREQUISITES_RC @pytest.mark.parametrize( ("name", "version"), ( ("fake_namespace.fake_name", None), ("fake_namespace.fake_name", "9999.9.9"), ), ) def test_require_collection_missing(name: str, version: str) -> None: """Tests behaviour of require_collection, missing case.""" with pytest.raises(SystemExit) as pytest_wrapped_e: prerun.require_collection(name, version) assert pytest_wrapped_e.type == SystemExit assert pytest_wrapped_e.value.code == INVALID_PREREQUISITES_RC def test_ansible_config_get() -> None: """Check test_ansible_config_get.""" paths = prerun.ansible_config_get("COLLECTIONS_PATHS", list) assert isinstance(paths, list) assert len(paths) > 0 def test_install_collection() -> None: """Check that valid collection installs do not fail.""" prerun.install_collection("containers.podman:>=1.0") def test_install_collection_fail() -> None: """Check that invalid collection install fails.""" with pytest.raises(SystemExit) as pytest_wrapped_e: prerun.install_collection("containers.podman:>=9999.0") assert pytest_wrapped_e.type == SystemExit assert pytest_wrapped_e.value.code == INVALID_PREREQUISITES_RC
ansible/ansible-lint
test/test_prerun.py
Python
mit
6,088
[ "Galaxy" ]
001d3a83e45d18fa277b4b9c191c9d11295591229b5e9b74d2b1379a426dc6c9
# pylint: disable=missing-docstring # pylint: disable=redefined-outer-name from __future__ import absolute_import import time from logging import getLogger from django.contrib.auth.models import User from django.core.urlresolvers import reverse from lettuce import step, world from lettuce.django import django_url from courseware.courses import get_course_by_id from student.models import CourseEnrollment from xmodule import seq_module, vertical_block from xmodule.course_module import CourseDescriptor from xmodule.modulestore.django import modulestore logger = getLogger(__name__) @step('I (.*) capturing of screenshots before and after each step$') def configure_screenshots_for_all_steps(_step, action): """ A step to be used in *.feature files. Enables/disables automatic saving of screenshots before and after each step in a scenario. """ action = action.strip() if action == 'enable': world.auto_capture_screenshots = True elif action == 'disable': world.auto_capture_screenshots = False else: raise ValueError('Parameter `action` should be one of "enable" or "disable".') @world.absorb def capture_screenshot_before_after(func): """ A decorator that will take a screenshot before and after the applied function is run. Use this if you do not want to capture screenshots for each step in a scenario, but rather want to debug a single function. """ def inner(*args, **kwargs): prefix = round(time.time() * 1000) world.capture_screenshot("{}_{}_{}".format( prefix, func.func_name, 'before' )) ret_val = func(*args, **kwargs) world.capture_screenshot("{}_{}_{}".format( prefix, func.func_name, 'after' )) return ret_val return inner @step(u'The course "([^"]*)" exists$') def create_course(_step, course): # First clear the modulestore so we don't try to recreate # the same course twice # This also ensures that the necessary templates are loaded world.clear_courses() # Create the course # We always use the same org and display name, # but vary the course identifier (e.g. 600x or 191x) world.scenario_dict['COURSE'] = world.CourseFactory.create( org='edx', number=course, display_name='Test Course' ) # Add a chapter to the course to contain problems world.scenario_dict['CHAPTER'] = world.ItemFactory.create( parent_location=world.scenario_dict['COURSE'].location, category='chapter', display_name='Test Chapter', publish_item=True, # Not needed for direct-only but I'd rather the test didn't know that ) world.scenario_dict['SECTION'] = world.ItemFactory.create( parent_location=world.scenario_dict['CHAPTER'].location, category='sequential', display_name='Test Section', publish_item=True, ) @step(u'I am registered for the course "([^"]*)"$') def i_am_registered_for_the_course(step, course): # Create the course create_course(step, course) # Create the user world.create_user('robot', 'test') user = User.objects.get(username='robot') # If the user is not already enrolled, enroll the user. # TODO: change to factory CourseEnrollment.enroll(user, course_id(course)) world.log_in(username='robot', password='test') @step(u'The course "([^"]*)" has extra tab "([^"]*)"$') def add_tab_to_course(_step, course, extra_tab_name): world.ItemFactory.create( parent_location=course_location(course), category="static_tab", display_name=str(extra_tab_name)) @step(u'I am in a course$') def go_into_course(step): step.given('I am registered for the course "6.002x"') step.given('And I am logged in') step.given('And I click on View Courseware') # Do we really use these 3 w/ a different course than is in the scenario_dict? if so, why? If not, # then get rid of the override arg def course_id(course_num): return world.scenario_dict['COURSE'].id.replace(course=course_num) def course_location(course_num): return world.scenario_dict['COURSE'].location.replace(course=course_num) def section_location(course_num): return world.scenario_dict['SECTION'].location.replace(course=course_num) def visit_scenario_item(item_key): """ Go to the courseware page containing the item stored in `world.scenario_dict` under the key `item_key` """ url = django_url(reverse( 'jump_to', kwargs={ 'course_id': unicode(world.scenario_dict['COURSE'].id), 'location': unicode(world.scenario_dict[item_key].location), } )) world.browser.visit(url) def get_courses(): ''' Returns dict of lists of courses available, keyed by course.org (ie university). Courses are sorted by course.number. ''' courses = [c for c in modulestore().get_courses() if isinstance(c, CourseDescriptor)] # skip error descriptors courses = sorted(courses, key=lambda course: course.location.course) return courses def get_courseware_with_tabs(course_id): """ Given a course_id (string), return a courseware array of dictionaries for the top three levels of navigation. Same as get_courseware() except include the tabs on the right hand main navigation page. This hides the appropriate courseware as defined by the hide_from_toc field: chapter.hide_from_toc Example: [{ 'chapter_name': 'Overview', 'sections': [{ 'clickable_tab_count': 0, 'section_name': 'Welcome', 'tab_classes': [] }, { 'clickable_tab_count': 1, 'section_name': 'System Usage Sequence', 'tab_classes': ['VerticalBlock'] }, { 'clickable_tab_count': 0, 'section_name': 'Lab0: Using the tools', 'tab_classes': ['HtmlDescriptor', 'HtmlDescriptor', 'CapaDescriptor'] }, { 'clickable_tab_count': 0, 'section_name': 'Circuit Sandbox', 'tab_classes': [] }] }, { 'chapter_name': 'Week 1', 'sections': [{ 'clickable_tab_count': 4, 'section_name': 'Administrivia and Circuit Elements', 'tab_classes': ['VerticalBlock', 'VerticalBlock', 'VerticalBlock', 'VerticalBlock'] }, { 'clickable_tab_count': 0, 'section_name': 'Basic Circuit Analysis', 'tab_classes': ['CapaDescriptor', 'CapaDescriptor', 'CapaDescriptor'] }, { 'clickable_tab_count': 0, 'section_name': 'Resistor Divider', 'tab_classes': [] }, { 'clickable_tab_count': 0, 'section_name': 'Week 1 Tutorials', 'tab_classes': [] }] }, { 'chapter_name': 'Midterm Exam', 'sections': [{ 'clickable_tab_count': 2, 'section_name': 'Midterm Exam', 'tab_classes': ['VerticalBlock', 'VerticalBlock'] }] }] """ course = get_course_by_id(course_id) chapters = [chapter for chapter in course.get_children() if not chapter.hide_from_toc] courseware = [{ 'chapter_name': c.display_name_with_default_escaped, 'sections': [{ 'section_name': s.display_name_with_default_escaped, 'clickable_tab_count': len(s.get_children()) if (type(s) == seq_module.SequenceDescriptor) else 0, 'tabs': [{ 'children_count': len(t.get_children()) if (type(t) == vertical_block.VerticalBlock) else 0, 'class': t.__class__.__name__} for t in s.get_children() ] } for s in c.get_children() if not s.hide_from_toc] } for c in chapters] return courseware
proversity-org/edx-platform
lms/djangoapps/courseware/features/common.py
Python
agpl-3.0
7,864
[ "VisIt" ]
6b6bc70c083f47b5aaa01592b94f6388f47b087d65f4c9e4d487a72198c1de3e
# Copyright 2003-2008 by Leighton Pritchard. All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. # # Contact: Leighton Pritchard, Scottish Crop Research Institute, # Invergowrie, Dundee, Scotland, DD2 5DA, UK # L.Pritchard@scri.ac.uk ################################################################################ # # Thanks to Peter Cock for the impetus to write the get_features() code to # subselect Features. # ################################################################################ """FeatureSet module Provides: - FeatureSet - container for Feature objects For drawing capabilities, this module uses reportlab to draw and write the diagram: http://www.reportlab.com """ # ----------------------------------------------------------------------------- # IMPORTS # ReportLab from __future__ import print_function from reportlab.pdfbase import _fontdata from reportlab.lib import colors # GenomeDiagram from ._Feature import Feature # Builtins import re __docformat__ = "restructuredtext en" # ------------------------------------------------------------------------------ # CLASSES # ------------------------------------------------------------ # FeatureSet class FeatureSet(object): """FeatureSet object.""" def __init__(self, set_id=None, name=None, parent=None): """Create the object. Arguments: - set_id: Unique id for the set - name: String identifying the feature set """ self.parent = parent self.id = id # Unique id for the set self.next_id = 0 # counter for unique feature ids self.features = {} # Holds features, keyed by ID self.name = name # String describing the set def add_feature(self, feature, **kwargs): """Add a new feature. Arguments: - feature: Bio.SeqFeature object - kwargs: Keyword arguments for Feature. Named attributes of the Feature Add a Bio.SeqFeature object to the diagram (will be stored internally in a Feature wrapper). """ id = self.next_id # get id number f = Feature(self, id, feature) self.features[id] = f # add feature for key in kwargs: if key == "colour" or key == "color": # Deal with "colour" as a special case by also mapping to color. # If Feature.py used a python property we wouldn't need to call # set_color explicitly. However, this is important to make sure # every color gets mapped to a colors object - for example color # numbers, or strings (may not matter for PDF, but does for PNG). self.features[id].set_color(kwargs[key]) continue setattr(self.features[id], key, kwargs[key]) self.next_id += 1 # increment next id return f def del_feature(self, feature_id): """Delete a feature. Arguments: - feature_id: Unique id of the feature to delete Remove a feature from the set, indicated by its id. """ del self.features[feature_id] def set_all_features(self, attr, value): """Set an attribute of all the features. Arguments: - attr: An attribute of the Feature class - value: The value to set that attribute to Set the passed attribute of all features in the set to the passed value. """ changed = 0 for feature in self.features.values(): # If the feature has the attribute, and the value should change if hasattr(feature, attr): if getattr(feature, attr) != value: setattr(feature, attr, value) # set it to the passed value # For backwards compatibility, we support both colour and color. # As a quick hack, make "colour" set both "colour" and "color". # if attr=="colour": # self.set_all_feature("color",value) def get_features(self, attribute=None, value=None, comparator=None): """Retreive features. Arguments: - attribute: String, attribute of a Feature object - value: The value desired of the attribute - comparator: String, how to compare the Feature attribute to the passed value If no attribute or value is given, return a list of all features in the feature set. If both an attribute and value are given, then depending on the comparator, then a list of all features in the FeatureSet matching (or not) the passed value will be returned. Allowed comparators are: 'startswith', 'not', 'like'. The user is expected to make a responsible decision about which feature attributes to use with which passed values and comparator settings. """ # If no attribute or value specified, return all features if attribute is None or value is None: return list(self.features.values()) # If no comparator is specified, return all features where the attribute # value matches that passed if comparator is None: return [feature for feature in self.features.values() if getattr(feature, attribute) == value] # If the comparator is 'not', return all features where the attribute # value does not match that passed elif comparator == 'not': return [feature for feature in self.features.values() if getattr(feature, attribute) != value] # If the comparator is 'startswith', return all features where the attribute # value does not match that passed elif comparator == 'startswith': return [feature for feature in self.features.values() if getattr(feature, attribute).startswith(value)] # If the comparator is 'like', use a regular expression search to identify # features elif comparator == 'like': return [feature for feature in self.features.values() if re.search(value, getattr(feature, attribute))] # As a final option, just return an empty list return [] def get_ids(self): """Return a list of all ids for the feature set.""" return list(self.features.keys()) def range(self): """Returns the lowest and highest base (or mark) numbers as a tuple.""" lows, highs = [], [] for feature in self.features.values(): for start, end in feature.locations: lows.append(start) highs.append(end) if len(lows) != 0 and len(highs) != 0: # Default in case there is return (min(lows), max(highs)) # nothing in the set return 0, 0 def to_string(self, verbose=0): """Returns a formatted string with information about the set Arguments: - verbose: Boolean indicating whether a short (default) or complete account of the set is required """ if not verbose: # Short account only required return "%s" % self else: # Long account desired outstr = ["\n<%s: %s>" % (self.__class__, self.name)] outstr.append("%d features" % len(self.features)) for key in self.features: outstr.append("feature: %s" % self.features[key]) return "\n".join(outstr) def __len__(self): """Return the number of features in the set.""" return len(self.features) def __getitem__(self, key): """Return a feature, keyed by id.""" return self.features[key] def __str__(self): """Returns a formatted string with information about the feature set.""" outstr = ["\n<%s: %s %d features>" % (self.__class__, self.name, len(self.features))] return "\n".join(outstr) ################################################################################ # RUN AS SCRIPT ################################################################################ if __name__ == '__main__': from Bio import SeqIO genbank_entry = SeqIO.read('/data/Genomes/Bacteria/Nanoarchaeum_equitans/NC_005213.gbk', 'gb') # Test code gdfs = FeatureSet(0, 'Nanoarchaeum equitans CDS') for feature in genbank_entry.features: if feature.type == 'CDS': gdfs.add_feature(feature) # print len(gdfs) # print gdfs.get_ids() # gdfs.del_feature(560) # print gdfs.get_ids() # print gdfs.get_features() # for feature in gdfs.get_features(): # print feature.id, feature.start, feature.end # print gdfs[500]
updownlife/multipleK
dependencies/biopython-1.65/build/lib.linux-x86_64-2.7/Bio/Graphics/GenomeDiagram/_FeatureSet.py
Python
gpl-2.0
8,994
[ "Biopython" ]
5f8666ba884a35b339ccdf38ce49f2d4c7b7f6e7e561b7f949d68b8779eecbd0
#!/usr/bin/env python # -*- coding: utf-8 -*- # Copyright (c) 2014, 2015 Abhay Devasthale and Martin Raspaud # Author(s): # Martin Raspaud <martin.raspaud@smhi.se> # Adam Dybbroe <adam.dybbroe@smhi.se> # Sajid Pareeth <sajid.pareeth@fmach.it> # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. """Loader for ascat, netcdf format. The driver works for netcdf format of ASCAT soil moisture swath data downloaded from here: http://navigator.eumetsat.int/discovery/Start/DirectSearch/DetailResult.do?f%28r0%29=EO:EUM:DAT:METOP:SOMO12 rename the CONFIG file mpop/mpop/etc/metop.ascat.cfg.template to metop.cfg to read the ASCAT data """ import numpy as np from ConfigParser import ConfigParser from mpop import CONFIG_PATH import os from netCDF4 import Dataset def load(satscene): """Load ascat data. """ # Read config file content conf = ConfigParser() conf.read(os.path.join(CONFIG_PATH, satscene.fullname + ".cfg")) values = {"orbit": satscene.orbit, "satname": satscene.satname, "number": satscene.number, "instrument": satscene.instrument_name, "satellite": satscene.fullname, "time_slot": satscene.time_slot, "time": satscene.time_slot.strftime('%Y%m%d%H%M%S') } filename = os.path.join( conf.get("ascat-level2", "dir"), satscene.time_slot.strftime(conf.get("ascat-level2", "filename", raw=True)) % values) # Load data from netCDF file ds = Dataset(filename, 'r') for chn_name in satscene.channels_to_load: # Read variable corresponding to channel name data = np.ma.masked_array( ds.variables[chn_name][:], np.isnan(ds.variables[chn_name][:])) satscene[chn_name] = data lons = ds.variables['longitude'][:] lats = ds.variables['latitude'][:] # Set scene area as pyresample geometry object try: from pyresample import geometry satscene.area = geometry.SwathDefinition(lons=lons, lats=lats) except ImportError: # pyresample not available. Set lon and lats directly satscene.area = None satscene.lat = lats satscene.lon = lons
mraspaud/mpop
mpop/satin/ascat_nc.py
Python
gpl-3.0
2,879
[ "NetCDF" ]
3336db7f26cae3cc8f956409649f88c08da0a8a04a2d2dd1dd34f9a5da1270ba
#!/usr/bin/env python # -*- coding: utf-8 -*- import os from oauth2client.file import Storage from oauth2client.client import flow_from_clientsecrets from oauth2client.tools import run_flow from apiclient.discovery import build from gdcmdtools.base import BASE_INFO import httplib2 import pprint import shutil import logging logging.basicConfig() logger = logging.getLogger(__name__) logger.setLevel(logging.INFO) DICT_OF_REDIRECT_URI = { "oob": "(default) means \"urn:ietf:wg:oauth:2.0:oob\"", "local": "means \"http://localhost\"" } SCOPE = [ # if using /drive.file instead of /drive, # then the fusion table is not seen by drive.files.list() # also, drive.parents.insert() fails. 'https://www.googleapis.com/auth/drive', 'https://www.googleapis.com/auth/fusiontables', 'https://www.googleapis.com/auth/drive.scripts', 'https://www.googleapis.com/auth/userinfo.profile', 'https://www.googleapis.com/auth/userinfo.email' ] class GDAuth(object): def __init__(self, secret_file=None, if_oob=True): default_secret_file = os.path.expanduser( '~/.%s.secrets' % BASE_INFO["app"]) if secret_file is None: self.secret_file = default_secret_file else: # should reissue the credencials storage_file = os.path.expanduser('~/.%s.creds' % BASE_INFO["app"]) if os.path.isfile(storage_file): os.remove(storage_file) try: shutil.copyfile(secret_file, default_secret_file) except: logger.error('failed to copy secret file') self.secret_file = default_secret_file os.chmod(self.secret_file, 0o600) self.if_oob = if_oob def run(self): credentials = self.get_credentials() return credentials def get_credentials(self): #home_path = os.getenv("HOME") # storage_file = os.path.abspath( # '%s/.%s.creds' % (home_path,BASE_INFO["app"])) storage_file = os.path.expanduser('~/.%s.creds' % BASE_INFO["app"]) logger.debug('storage_file=%s' % storage_file) try: with open(storage_file): pass except IOError: logger.error('storage_file: %s not exists' % storage_file) # return None storage = Storage(storage_file) credentials = storage.get() # FIXME: if secret_file is given, should clean creds if credentials is None or credentials.invalid: # credentials_file = os.path.abspath( # '%s/.%s.secrets' % (home_path,BASE_INFO["app"])) credentials_file = self.secret_file #logger.debug('credentials_file=%s' % credentials_file) if self.if_oob: redirect_uri = 'urn:ietf:wg:oauth:2.0:oob' else: redirect_uri = None try: flow = flow_from_clientsecrets( credentials_file, scope=SCOPE, redirect_uri=redirect_uri) except: logger.error("failed on flow_from_clientsecrets()") return None if self.if_oob: auth_uri = flow.step1_get_authorize_url() logger.info( 'Please visit the URL in your browser: %s' % auth_uri) code = raw_input('Insert the given code: ') try: credentials = flow.step2_exchange(code) except: logger.error("failed on flow.step2_exchange()") return None storage.put(credentials) credentials.set_store(storage) else: try: credentials = tools.run_flow(flow, storage) except: logger.error("failed on oauth2client.tools.run_flow()") return None self.credentials = credentials return self.credentials def get_authorized_http(self): self.http = httplib2.Http() self.credentials.authorize(self.http) #wrapped_request = self.http.request # FIXME def _Wrapper(uri, method="GET", body=None, headers=None, **kw): logger.debug('Req: %s %s' % (uri, method)) logger.debug('Req headers:\n%s' % pprint.pformat(headers)) logger.debug('Req body:\n%s' % pprint.pformat(body)) resp, content = wrapped_request(uri, method, body, headers, **kw) logger.debug('Rsp headers:\n%s' % pprint.pformat(resp)) logger.debug('Rsp body:\n%s' % pprint.pformat(content)) return resp, content #self.http.request = _Wrapper return self.http
tienfuc/gdcmdtools
gdcmdtools/auth.py
Python
bsd-2-clause
4,840
[ "VisIt" ]
08bf06e46972be0a8f667aabad411ce8f966b2d161accd6d6ff0964613a98f50
import itertools import argparse import sys import os import errno import subprocess import winbrew import winbrew.util class InstallException(Exception): pass class InstallPlan: """ Executes a topological sort to determine the order in which to install packages. """ def __init__(self, formulas, args): self.args = args self.order = [] self.marked = set() self.temp = set() self.initial_formulas = set(formulas) self.force_rebuild = args.force_rebuild self.force_reinstall = args.force_reinstall self.force_redownload = args.force_redownload self.env = os.environ.copy() for formula in formulas: self.visit(formula) def visit(self, formula): """ Visit the node with the given name and all children in a depth-first search. """ if formula.name in self.temp: raise InstallException('circular dependency') if formula.name not in self.marked: self.temp.add(formula.name) for dep_name in itertools.chain(formula.deps, formula.build_deps): dep = winbrew.Formula.find_by_name(dep_name) self.visit(dep) self.temp.remove(formula.name) self.marked.add(formula.name) self.order.append(formula) def __iter__(self): """ Returns a list of packages to be installed in dependency-order, or throws an exception if there are circular dependencies. """ return iter(self.order) def execute(self): """ Install all packages in the install plan """ self.download() self.unpack() self.build() self.install() def download(self): for formula in self: formula.download(force=(formula in self.initial_formulas) and self.force_redownload) def unpack(self): for formula in self: formula.unpack() def build(self): for formula in self: formula.build(force=(formula in self.initial_formulas) and self.force_rebuild) def install(self): for formula in self: formula.install(force=(formula in self.initial_formulas) and self.force_reinstall) def uninstall(args): """ Uninstall a package. FIXME: Eventually, this should uninstall packages that depend on this package. For now, just nuke the installed files. """ for name in args.package: formula = winbrew.Formula.find_by_name(name) formula.uninstall(force=args.force) def test(args): """ Test a package. """ for name in args.package: formula = winbrew.Formula.find_by_name(name) formula.test() print('PASS') def listp(args): """ List package contents """ for name in args.package: formula = winbrew.Formula.find_by_name(name) print(('\n'.join(formula.manifest.files))) def update(args): """ Update by cloning formulas from the git repository. """ os.chdir(winbrew.home) cmd = ('git', 'pull') subprocess.check_call(cmd, shell=True) def download(args): """ Download a formula, but don't unpack or install it """ for name in args.package: formula = winbrew.Formula.find_by_name(name) formula.download() def clean(args): """ Clean a formula from the cache """ for name in args.package: formula = winbrew.Formula.find_by_name(name) formula.clean() def install(args): """ Install a package and dependencies. """ try: formulas = [] for i, name in enumerate(args.package): formula = winbrew.Formula.find_by_name(name) formula.parse_options(args.package[i+1:]) formulas.append(formula) plan = InstallPlan(formulas, args) plan.execute() except InstallException as e: sys.stderr.write('error: %s\n' % str(e)) sys.exit(1) def reinstall(args): """ Reinstall packages """ if args.all: args.package += [manifest.name for manifest in winbrew.Manifest.all()] args.force_reinstall = True args.force_rebuild = True args.force_redownload = True install(args) def edit(args): """ Edit a package. """ path = os.path.join(winbrew.formula_path, '%s.py' % args.name) if not os.path.exists(path): sys.stderr.write('error: file formula not found: %s\n' % args.name) sys.exit(1) editor = os.environ.get('EDITOR', 'notepad') try: subprocess.check_call((editor, path), shell=True) except subprocess.CalledProcessError as e: pass except SystemError as e: sys.stderr.write('error: %s\n' % str(e)) sys.stderr.flush() sys.exit(1) def create(args): """ Create a new package. """ base = os.path.split(args.url)[1] base = base.split('.')[0] base = base.split('-')[0] base = base.split('_')[0] name = args.name or base template = """ import winbrew class %(name)s(winbrew.Formula): url = '%(url)s' homepage = '' sha1 = '' build_deps = () deps = () def build(self): pass def install(self): pass def test(self): pass """ path = os.path.join(winbrew.formula_path, '%s.py' % name) if not os.path.exists(path): winbrew.util.mkdir_p(os.path.split(path)[0]) fd = open(path, 'w') fd.write(template % {'name': name.title(), 'url': args.url}) fd.close() args.name = name edit(args) def freeze(args): """ Output installed packages. """ print(('\n'.join([manifest.name for manifest in winbrew.Manifest.all()]))) def init(): if not os.path.exists(os.path.join(winbrew.home, '.git')): cmd = ('git', 'clone', winbrew.formula_url, winbrew.home) print((' '.join(cmd))) subprocess.check_call(cmd, shell=True) def main(): parser = argparse.ArgumentParser(prog='winbrew', description='Package installer for Windows') subparsers = parser.add_subparsers(dest='command') sub = subparsers.add_parser('create', help='create a new package') sub.add_argument('url', type=str, help='package source URL') sub.add_argument('-n', '--name', type=str, help='package name', default=None) sub = subparsers.add_parser('edit', help='edit a package') sub.add_argument('name', type=str, help='package source name') sub = subparsers.add_parser('install', help='install packages') sub.add_argument('--force-reinstall', action='store_true', help='force package reinstall (completely reinstall it)') sub.add_argument('--force-rebuild', action='store_true', help='force package rebuild (completely rebuild it)') sub.add_argument('--force-redownload', action='store_true', help='force package rebuild (completely rebuild it)') sub.add_argument('package', type=str, nargs=argparse.REMAINDER, help='packages to install') sub = subparsers.add_parser('reinstall', help='reinstall packages') sub.add_argument('--all', '-a', action='store_true', help='reinstall all packages') sub.add_argument('package', type=str, nargs=argparse.REMAINDER, help='packages to reinstall') sub = subparsers.add_parser('uninstall', help='uninstall packages') sub.add_argument('--force', '-f', action='store_true', help='force package uninstall') sub.add_argument('package', type=str, nargs='+', help='packages to uninstall') sub = subparsers.add_parser('list', help='list package contents') sub.add_argument('package', type=str, nargs='+', help='packages to list') sub = subparsers.add_parser('test', help='test packages') sub.add_argument('package', type=str, nargs=argparse.REMAINDER, help='packages to test') sub = subparsers.add_parser('freeze', help='output installed packages') sub = subparsers.add_parser('update', help='update formulas from server') sub = subparsers.add_parser('download', help='download formulas without installing them') sub.add_argument('package', type=str, nargs=argparse.REMAINDER, help='packages to download') sub = subparsers.add_parser('clean', help='clean formulas from the cache') sub.add_argument('package', type=str, nargs=argparse.REMAINDER, help='packages to clean') args = parser.parse_args() try: init() if args.command == 'create': create(args) elif args.command == 'edit': edit(args) elif args.command == 'install': install(args) elif args.command == 'reinstall': reinstall(args) elif args.command == 'uninstall': uninstall(args) elif args.command == 'update': update(args) elif args.command == 'test': test(args) elif args.command == 'list': listp(args) elif args.command == 'freeze': freeze(args) elif args.command == 'download': download(args) elif args.command == 'clean': clean(args) else: sys.stderr.write('error: unknown command') sys.exit(1) except winbrew.FormulaException as e: sys.stderr.write('error: %s\n' % str(e)) sys.stderr.flush() sys.exit(1) if __name__ == '__main__': main()
mfichman/winbrew
winbrew/execute.py
Python
mit
9,401
[ "VisIt" ]
809db27e4aedc786efee77170afa746ff93cf7db192f0dc18cae00db4815e02b
import sys, itertools, optparse optParser = optparse.OptionParser( usage = "python %prog [options] <flattened_gff_file> <sam_file> <output_file>", description= "This script counts how many reads in <sam_file> fall onto each exonic " + "part given in <flattened_gff_file> and outputs a list of counts in " + "<output_file>, for further analysis with the DEXSeq Bioconductor package. " + "(Notes: The <flattened_gff_file> should be produced with the script " + "dexseq_prepare_annotation.py). <sam_file> may be '-' to indicate standard input.", epilog = "Written by Simon Anders (sanders@fs.tum.de), European Molecular Biology " + "Laboratory (EMBL). (c) 2010. Released under the terms of the GNU General " + "Public License v3. Part of the 'DEXSeq' package." ) optParser.add_option( "-p", "--paired", type="choice", dest="paired", choices = ( "no", "yes" ), default = "no", help = "'yes' or 'no'. Indicates whether the data is paired-end (default: no)" ) optParser.add_option( "-s", "--stranded", type="choice", dest="stranded", choices = ( "yes", "no", "reverse" ), default = "yes", help = "'yes', 'no', or 'reverse'. Indicates whether the data is " + "from a strand-specific assay (default: yes ). " + "Be sure to switch to 'no' if you use a non strand-specific RNA-Seq library " + "preparation protocol. 'reverse' inverts strands and is neede for certain " + "protocols, e.g. paired-end with circularization." ) optParser.add_option( "-a", "--minaqual", type="int", dest="minaqual", default = 10, help = "skip all reads with alignment quality lower than the given " + "minimum value (default: 10)" ) if len( sys.argv ) == 1: optParser.print_help() sys.exit(1) (opts, args) = optParser.parse_args() if len( args ) != 3: sys.stderr.write( sys.argv[0] + ": Error: Please provide three arguments.\n" ) sys.stderr.write( " Call with '-h' to get usage information.\n" ) sys.exit( 1 ) try: import HTSeq except ImportError: sys.stderr.write( "Could not import HTSeq. Please install the HTSeq Python framework\n" ) sys.stderr.write( "available from http://www-huber.embl.de/users/anders/HTSeq\n" ) sys.exit(1) gff_file = args[0] sam_file = args[1] out_file = args[2] stranded = opts.stranded == "yes" or opts.stranded == "reverse" reverse = opts.stranded == "reverse" is_PE = opts.paired == "yes" minaqual = opts.minaqual if sam_file == "-": sam_file = sys.stdin # Step 1: Read in the GFF file as generated by aggregate_genes.py # and put everything into a GenomicArrayOfSets features = HTSeq.GenomicArrayOfSets( "auto", stranded=stranded ) for f in HTSeq.GFF_Reader( gff_file ): if f.type == "exonic_part": f.name = f.attr['gene_id'] + ":" + f.attr['exonic_part_number'] features[f.iv] += f # initialise counters num_reads = 0 counts = {} counts[ '_empty' ] = 0 counts[ '_ambiguous' ] = 0 counts[ '_lowaqual' ] = 0 counts[ '_notaligned' ] = 0 # put a zero for each feature ID for iv, s in features.steps(): for f in s: counts[ f.name ] = 0 #We need this little helper below: def reverse_strand( s ): if s == "+": return "-" elif s == "-": return "+" else: raise SystemError, "illegal strand" # Now go through the aligned reads if not is_PE: num_reads = 0 for a in HTSeq.SAM_Reader( sam_file ): if not a.aligned: counts[ '_notaligned' ] += 1 continue if a.aQual < minaqual: counts[ '_lowaqual' ] += 1 continue rs = set() for cigop in a.cigar: if cigop.type != "M": continue if reverse: cigop.ref_iv.strand = reverse_strand( cigop.ref_iv.strand ) for iv, s in features[cigop.ref_iv].steps( ): rs = rs.union( s ) set_of_gene_names = set( [ f.name.split(":")[0] for f in rs ] ) if len( set_of_gene_names ) == 0: counts[ '_empty' ] += 1 elif len( set_of_gene_names ) > 1: counts[ '_ambiguous' ] +=1 else: for f in rs: counts[ f.name ] += 1 num_reads += 1 if num_reads % 100000 == 0: sys.stderr.write( "%d reads processed.\n" % num_reads ) else: # paired-end num_reads = 0 for af, ar in HTSeq.pair_SAM_alignments( HTSeq.SAM_Reader( sam_file ) ): rs = set() if af and ar and not af.aligned and not ar.aligned: counts[ '_notaligned' ] += 1 continue if af and ar and not af.aQual < minaqual and ar.aQual < minaqual: counts[ '_lowaqual' ] += 1 continue if af and af.aligned and af.aQual >= minaqual and af.iv.chrom in features.chrom_vectors.keys(): for cigop in af.cigar: if cigop.type != "M": continue if reverse: cigop.ref_iv.strand = reverse_strand( cigop.ref_iv.strand ) for iv, s in features[cigop.ref_iv].steps(): rs = rs.union( s ) if ar and ar.aligned and ar.aQual >= minaqual and ar.iv.chrom in features.chrom_vectors.keys(): for cigop in ar.cigar: if cigop.type != "M": continue if not reverse: cigop.ref_iv.strand = reverse_strand( cigop.ref_iv.strand ) for iv, s in features[cigop.ref_iv].steps(): rs = rs.union( s ) set_of_gene_names = set( [ f.name.split(":")[0] for f in rs ] ) if len( set_of_gene_names ) == 0: counts[ '_empty' ] += 1 elif len( set_of_gene_names ) > 1: counts[ '_ambiguous' ] = 0 else: for f in rs: counts[ f.name ] += 1 num_reads += 1 if num_reads % 100000 == 0: sys.stderr.write( "%d reads processed.\n" % num_reads ) # Step 3: Write out the results fout = open( out_file, "w" ) for fn in sorted( counts.keys() ): fout.write( "%s\t%d\n" % ( fn, counts[fn] ) ) fout.close()
jhl667/quick_scripts
dexseq_count.py
Python
gpl-2.0
6,001
[ "Bioconductor", "HTSeq" ]
ea4ea8b40e1b2bba8057bbc9a517dfd6e5015a71c8b91d34f6f4f4fce4b0f346
# Copyright 2008 by Michiel de Hoon. All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Parser for XML results returned by NCBI's Entrez Utilities. This parser is used by the read() function in Bio.Entrez, and is not intended be used directly. """ # The question is how to represent an XML file as Python objects. Some # XML files returned by NCBI look like lists, others look like dictionaries, # and others look like a mix of lists and dictionaries. # # My approach is to classify each possible element in the XML as a plain # string, an integer, a list, a dictionary, or a structure. The latter is a # dictionary where the same key can occur multiple times; in Python, it is # represented as a dictionary where that key occurs once, pointing to a list # of values found in the XML file. # # The parser then goes through the XML and creates the appropriate Python # object for each element. The different levels encountered in the XML are # preserved on the Python side. So a subelement of a subelement of an element # is a value in a dictionary that is stored in a list which is a value in # some other dictionary (or a value in a list which itself belongs to a list # which is a value in a dictionary, and so on). Attributes encountered in # the XML are stored as a dictionary in a member .attributes of each element, # and the tag name is saved in a member .tag. # # To decide which kind of Python object corresponds to each element in the # XML, the parser analyzes the DTD referred at the top of (almost) every # XML file returned by the Entrez Utilities. This is preferred over a hand- # written solution, since the number of DTDs is rather large and their # contents may change over time. About half the code in this parser deals # wih parsing the DTD, and the other half with the XML itself. import os.path import urlparse import urllib import warnings from xml.parsers import expat # The following four classes are used to add a member .attributes to integers, # strings, lists, and dictionaries, respectively. class IntegerElement(int): def __repr__(self): text = int.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "IntegerElement(%s, attributes=%s)" % (text, repr(attributes)) class StringElement(str): def __repr__(self): text = str.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "StringElement(%s, attributes=%s)" % (text, repr(attributes)) class UnicodeElement(unicode): def __repr__(self): text = unicode.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "UnicodeElement(%s, attributes=%s)" % (text, repr(attributes)) class ListElement(list): def __repr__(self): text = list.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "ListElement(%s, attributes=%s)" % (text, repr(attributes)) class DictionaryElement(dict): def __repr__(self): text = dict.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "DictElement(%s, attributes=%s)" % (text, repr(attributes)) # A StructureElement is like a dictionary, but some of its keys can have # multiple values associated with it. These values are stored in a list # under each key. class StructureElement(dict): def __init__(self, keys): dict.__init__(self) for key in keys: dict.__setitem__(self, key, []) self.listkeys = keys def __setitem__(self, key, value): if key in self.listkeys: self[key].append(value) else: dict.__setitem__(self, key, value) def __repr__(self): text = dict.__repr__(self) try: attributes = self.attributes except AttributeError: return text return "DictElement(%s, attributes=%s)" % (text, repr(attributes)) class NotXMLError(ValueError): def __init__(self, message): self.msg = message def __str__(self): return "Failed to parse the XML data (%s). Please make sure that the input data are in XML format." % self.msg class CorruptedXMLError(ValueError): def __init__(self, message): self.msg = message def __str__(self): return "Failed to parse the XML data (%s). Please make sure that the input data are not corrupted." % self.msg class ValidationError(ValueError): """Validating parsers raise this error if the parser finds a tag in the XML that is not defined in the DTD. Non-validating parsers do not raise this error. The Bio.Entrez.read and Bio.Entrez.parse functions use validating parsers by default (see those functions for more information)""" def __init__(self, name): self.name = name def __str__(self): return "Failed to find tag '%s' in the DTD. To skip all tags that are not represented in the DTD, please call Bio.Entrez.read or Bio.Entrez.parse with validate=False." % self.name class DataHandler: home = os.path.expanduser('~') local_dtd_dir = os.path.join(home, '.biopython', 'Bio', 'Entrez', 'DTDs') del home from Bio import Entrez global_dtd_dir = os.path.join(str(Entrez.__path__[0]), "DTDs") del Entrez def __init__(self, validate): self.stack = [] self.errors = [] self.integers = [] self.strings = [] self.lists = [] self.dictionaries = [] self.structures = {} self.items = [] self.dtd_urls = [] self.validating = validate self.parser = expat.ParserCreate(namespace_separator=" ") self.parser.SetParamEntityParsing(expat.XML_PARAM_ENTITY_PARSING_ALWAYS) self.parser.XmlDeclHandler = self.xmlDeclHandler def read(self, handle): """Set up the parser and let it parse the XML results""" try: self.parser.ParseFile(handle) except expat.ExpatError, e: if self.parser.StartElementHandler: # We saw the initial <!xml declaration, so we can be sure that # we are parsing XML data. Most likely, the XML file is # corrupted. raise CorruptedXMLError(e) else: # We have not seen the initial <!xml declaration, so probably # the input data is not in XML format. raise NotXMLError(e) try: return self.object except AttributeError: if self.parser.StartElementHandler: # We saw the initial <!xml declaration, and expat didn't notice # any errors, so self.object should be defined. If not, this is # a bug. raise RuntimeError("Failed to parse the XML file correctly, possibly due to a bug in Bio.Entrez. Please contact the Biopython developers at biopython-dev@biopython.org for assistance.") else: # We did not see the initial <!xml declaration, so probably # the input data is not in XML format. raise NotXMLError("XML declaration not found") def parse(self, handle): BLOCK = 1024 while True: #Read in another block of the file... text = handle.read(BLOCK) if not text: # We have reached the end of the XML file if self.stack: # No more XML data, but there is still some unfinished # business raise CorruptedXMLError try: for record in self.object: yield record except AttributeError: if self.parser.StartElementHandler: # We saw the initial <!xml declaration, and expat # didn't notice any errors, so self.object should be # defined. If not, this is a bug. raise RuntimeError("Failed to parse the XML file correctly, possibly due to a bug in Bio.Entrez. Please contact the Biopython developers at biopython-dev@biopython.org for assistance.") else: # We did not see the initial <!xml declaration, so # probably the input data is not in XML format. raise NotXMLError("XML declaration not found") self.parser.Parse("", True) self.parser = None return try: self.parser.Parse(text, False) except expat.ExpatError, e: if self.parser.StartElementHandler: # We saw the initial <!xml declaration, so we can be sure # that we are parsing XML data. Most likely, the XML file # is corrupted. raise CorruptedXMLError(e) else: # We have not seen the initial <!xml declaration, so # probably the input data is not in XML format. raise NotXMLError(e) if not self.stack: # Haven't read enough from the XML file yet continue records = self.stack[0] if not isinstance(records, list): raise ValueError("The XML file does not represent a list. Please use Entrez.read instead of Entrez.parse") while len(records) > 1: # Then the top record is finished record = records.pop(0) yield record def xmlDeclHandler(self, version, encoding, standalone): # XML declaration found; set the handlers self.parser.StartElementHandler = self.startElementHandler self.parser.EndElementHandler = self.endElementHandler self.parser.CharacterDataHandler = self.characterDataHandler self.parser.ExternalEntityRefHandler = self.externalEntityRefHandler self.parser.StartNamespaceDeclHandler = self.startNamespaceDeclHandler def startNamespaceDeclHandler(self, prefix, un): raise NotImplementedError("The Bio.Entrez parser cannot handle XML data that make use of XML namespaces") def startElementHandler(self, name, attrs): self.content = "" if name in self.lists: object = ListElement() elif name in self.dictionaries: object = DictionaryElement() elif name in self.structures: object = StructureElement(self.structures[name]) elif name in self.items: # Only appears in ESummary name = str(attrs["Name"]) # convert from Unicode del attrs["Name"] itemtype = str(attrs["Type"]) # convert from Unicode del attrs["Type"] if itemtype=="Structure": object = DictionaryElement() elif name in ("ArticleIds", "History"): object = StructureElement(["pubmed", "medline"]) elif itemtype=="List": object = ListElement() else: object = StringElement() object.itemname = name object.itemtype = itemtype elif name in self.strings + self.errors + self.integers: self.attributes = attrs return else: # Element not found in DTD if self.validating: raise ValidationError(name) else: # this will not be stored in the record object = "" if object!="": object.tag = name if attrs: object.attributes = dict(attrs) if len(self.stack)!=0: current = self.stack[-1] try: current.append(object) except AttributeError: current[name] = object self.stack.append(object) def endElementHandler(self, name): value = self.content if name in self.errors: if value=="": return else: raise RuntimeError(value) elif name in self.integers: value = IntegerElement(value) elif name in self.strings: # Convert Unicode strings to plain strings if possible try: value = StringElement(value) except UnicodeEncodeError: value = UnicodeElement(value) elif name in self.items: self.object = self.stack.pop() if self.object.itemtype in ("List", "Structure"): return elif self.object.itemtype=="Integer" and value: value = IntegerElement(value) else: # Convert Unicode strings to plain strings if possible try: value = StringElement(value) except UnicodeEncodeError: value = UnicodeElement(value) name = self.object.itemname else: self.object = self.stack.pop() return value.tag = name if self.attributes: value.attributes = dict(self.attributes) del self.attributes current = self.stack[-1] if current!="": try: current.append(value) except AttributeError: current[name] = value def characterDataHandler(self, content): self.content += content def elementDecl(self, name, model): """This callback function is called for each element declaration: <!ELEMENT name (...)> encountered in a DTD. The purpose of this function is to determine whether this element should be regarded as a string, integer, list dictionary, structure, or error.""" if name.upper()=="ERROR": self.errors.append(name) return if name=='Item' and model==(expat.model.XML_CTYPE_MIXED, expat.model.XML_CQUANT_REP, None, ((expat.model.XML_CTYPE_NAME, expat.model.XML_CQUANT_NONE, 'Item', () ), ) ): # Special case. As far as I can tell, this only occurs in the # eSummary DTD. self.items.append(name) return # First, remove ignorable parentheses around declarations while (model[0] in (expat.model.XML_CTYPE_SEQ, expat.model.XML_CTYPE_CHOICE) and model[1] in (expat.model.XML_CQUANT_NONE, expat.model.XML_CQUANT_OPT) and len(model[3])==1): model = model[3][0] # PCDATA declarations correspond to strings if model[0] in (expat.model.XML_CTYPE_MIXED, expat.model.XML_CTYPE_EMPTY): self.strings.append(name) return # List-type elements if (model[0] in (expat.model.XML_CTYPE_CHOICE, expat.model.XML_CTYPE_SEQ) and model[1] in (expat.model.XML_CQUANT_PLUS, expat.model.XML_CQUANT_REP)): self.lists.append(name) return # This is the tricky case. Check which keys can occur multiple # times. If only one key is possible, and it can occur multiple # times, then this is a list. If more than one key is possible, # but none of them can occur multiple times, then this is a # dictionary. Otherwise, this is a structure. # In 'single' and 'multiple', we keep track which keys can occur # only once, and which can occur multiple times. single = [] multiple = [] # The 'count' function is called recursively to make sure all the # children in this model are counted. Error keys are ignored; # they raise an exception in Python. def count(model): quantifier, name, children = model[1:] if name==None: if quantifier in (expat.model.XML_CQUANT_PLUS, expat.model.XML_CQUANT_REP): for child in children: multiple.append(child[2]) else: for child in children: count(child) elif name.upper()!="ERROR": if quantifier in (expat.model.XML_CQUANT_NONE, expat.model.XML_CQUANT_OPT): single.append(name) elif quantifier in (expat.model.XML_CQUANT_PLUS, expat.model.XML_CQUANT_REP): multiple.append(name) count(model) if len(single)==0 and len(multiple)==1: self.lists.append(name) elif len(multiple)==0: self.dictionaries.append(name) else: self.structures.update({name: multiple}) def open_dtd_file(self, filename): path = os.path.join(DataHandler.global_dtd_dir, filename) try: handle = open(path, "rb") except IOError: pass else: return handle path = os.path.join(DataHandler.local_dtd_dir, filename) try: handle = open(path, "rb") except IOError: pass else: return handle return None def externalEntityRefHandler(self, context, base, systemId, publicId): """The purpose of this function is to load the DTD locally, instead of downloading it from the URL specified in the XML. Using the local DTD results in much faster parsing. If the DTD is not found locally, we try to download it. If new DTDs become available from NCBI, putting them in Bio/Entrez/DTDs will allow the parser to see them.""" urlinfo = urlparse.urlparse(systemId) #Following attribute requires Python 2.5+ #if urlinfo.scheme=='http': if urlinfo[0]=='http': # Then this is an absolute path to the DTD. url = systemId elif urlinfo[0]=='': # Then this is a relative path to the DTD. # Look at the parent URL to find the full path. url = self.dtd_urls[-1] source = os.path.dirname(url) url = os.path.join(source, systemId) self.dtd_urls.append(url) # First, try to load the local version of the DTD file location, filename = os.path.split(systemId) handle = self.open_dtd_file(filename) if not handle: # DTD is not available as a local file. Try accessing it through # the internet instead. message = """\ Unable to load DTD file %s. Bio.Entrez uses NCBI's DTD files to parse XML files returned by NCBI Entrez. Though most of NCBI's DTD files are included in the Biopython distribution, sometimes you may find that a particular DTD file is missing. While we can access the DTD file through the internet, the parser is much faster if the required DTD files are available locally. For this purpose, please download %s from %s and save it either in directory %s or in directory %s in order for Bio.Entrez to find it. Alternatively, you can save %s in the directory Bio/Entrez/DTDs in the Biopython distribution, and reinstall Biopython. Please also inform the Biopython developers about this missing DTD, by reporting a bug on http://bugzilla.open-bio.org/ or sign up to our mailing list and emailing us, so that we can include it with the next release of Biopython. Proceeding to access the DTD file through the internet... """ % (filename, filename, url, self.global_dtd_dir, self.local_dtd_dir, filename) warnings.warn(message) try: handle = urllib.urlopen(url) except IOError: raise RuntimeException("Failed to access %s at %s" % (filename, url)) parser = self.parser.ExternalEntityParserCreate(context) parser.ElementDeclHandler = self.elementDecl parser.ParseFile(handle) handle.close() self.dtd_urls.pop() return 1
BlogomaticProject/Blogomatic
opt/blog-o-matic/usr/lib/python/Bio/Entrez/Parser.py
Python
gpl-2.0
20,827
[ "Biopython" ]
8288b865d01f2e70f0ad6463bc133aa28cb80311a9fd758686f51b214f68b9fe
#coding= utf-8 class PhoneticAlgorithms(): ''' This script implements the Double Metaphone algorithm (c) 1998, 1999 by Lawrence Philips it was translated to Python from the C source written by Kevin Atkinson (http://aspell.net/metaphone/) By Andrew Collins - January 12, 2007 who claims no rights to this work http://www.atomodo.com/code/double-metaphone Tested with Pyhon 2.4.3 Updated Feb 14, 2007 - Found a typo in the 'gh' section Updated Dec 17, 2007 - Bugs fixed in 'S', 'Z', and 'J' sections. Thanks Chris Leong! Updated June 25, 2010 - several bugs fixed thanks to Nils Johnsson for a spectacular bug squashing effort. There were many cases where this function wouldn't give the same output as the original C source that were fixed by his careful attention and excellent communication. The script was also updated to use utf-8 rather than latin-1. ''' def __init__(self): pass def double_metaphone(self, st) : """ dm(string) -> (string, string or None) returns the double metaphone codes for given string - always a tuple there are no checks done on the input string, but it should be a single word or name. """ vowels = ['A', 'E', 'I', 'O', 'U', 'Y'] st = st.decode('utf-8', 'ignore') st = st.upper() # st is short for string. I usually prefer descriptive over short, but this var is used a lot! is_slavo_germanic = (st.find('W') > -1 or st.find('K') > -1 or st.find('CZ') > -1 or st.find('WITZ') > -1) length = len(st) first = 2 st = ('-') * first + st + (' ' * 5) # so we can index beyond the begining and end of the input string last = first + length -1 pos = first # pos is short for position pri = sec = '' # primary and secondary metaphone codes #skip these silent letters when at start of word if st[first:first+2] in ["GN", "KN", "PN", "WR", "PS"] : pos += 1 # Initial 'X' is pronounced 'Z' e.g. 'Xavier' if st[first] == 'X' : pri = sec = 'S' #'Z' maps to 'S' pos += 1 # main loop through chars in st while pos <= last : #print str(pos) + '\t' + st[pos] ch = st[pos] # ch is short for character # nxt (short for next characters in metaphone code) is set to a tuple of the next characters in # the primary and secondary codes and how many characters to move forward in the string. # the secondary code letter is given only when it is different than the primary. # This is just a trick to make the code easier to write and read. nxt = (None, 1) # default action is to add nothing and move to next char if ch in vowels : nxt = (None, 1) if pos == first : # all init vowels now map to 'A' nxt = ('A', 1) elif ch == 'B' : #"-mb", e.g", "dumb", already skipped over... see 'M' below if st[pos+1] == 'B' : nxt = ('P', 2) else : nxt = ('P', 1) elif ch == 'C' : # various germanic if (pos > (first + 1) and st[pos-2] not in vowels and st[pos-1:pos+2] == 'ACH' and \ (st[pos+2] not in ['I', 'E'] or st[pos-2:pos+4] in ['BACHER', 'MACHER'])) : nxt = ('K', 2) # special case 'CAESAR' elif pos == first and st[first:first+6] == 'CAESAR' : nxt = ('S', 2) elif st[pos:pos+4] == 'CHIA' : #italian 'chianti' nxt = ('K', 2) elif st[pos:pos+2] == 'CH' : # find 'michael' if pos > first and st[pos:pos+4] == 'CHAE' : nxt = ('K', 'X', 2) elif pos == first and (st[pos+1:pos+6] in ['HARAC', 'HARIS'] or \ st[pos+1:pos+4] in ["HOR", "HYM", "HIA", "HEM"]) and st[first:first+5] != 'CHORE' : nxt = ('K', 2) #germanic, greek, or otherwise 'ch' for 'kh' sound elif st[first:first+4] in ['VAN ', 'VON '] or st[first:first+3] == 'SCH' \ or st[pos-2:pos+4] in ["ORCHES", "ARCHIT", "ORCHID"] \ or st[pos+2] in ['T', 'S'] \ or ((st[pos-1] in ["A", "O", "U", "E"] or pos == first) \ and st[pos+2] in ["L", "R", "N", "M", "B", "H", "F", "V", "W", " "]) : nxt = ('K', 1) else : if pos > first : if st[first:first+2] == 'MC' : nxt = ('K', 2) else : nxt = ('X', 'K', 2) else : nxt = ('X', 2) #e.g, 'czerny' elif st[pos:pos+2] == 'CZ' and st[pos-2:pos+2] != 'WICZ' : nxt = ('S', 'X', 2) #e.g., 'focaccia' elif st[pos+1:pos+4] == 'CIA' : nxt = ('X', 3) #double 'C', but not if e.g. 'McClellan' elif st[pos:pos+2] == 'CC' and not (pos == (first +1) and st[first] == 'M') : #'bellocchio' but not 'bacchus' if st[pos+2] in ["I", "E", "H"] and st[pos+2:pos+4] != 'HU' : #'accident', 'accede' 'succeed' if (pos == (first +1) and st[first] == 'A') or \ st[pos-1:pos+4] in ['UCCEE', 'UCCES'] : nxt = ('KS', 3) #'bacci', 'bertucci', other italian else: nxt = ('X', 3) else : nxt = ('K', 2) elif st[pos:pos+2] in ["CK", "CG", "CQ"] : nxt = ('K', 'K', 2) elif st[pos:pos+2] in ["CI", "CE", "CY"] : #italian vs. english if st[pos:pos+3] in ["CIO", "CIE", "CIA"] : nxt = ('S', 'X', 2) else : nxt = ('S', 2) else : #name sent in 'mac caffrey', 'mac gregor if st[pos+1:pos+3] in [" C", " Q", " G"] : nxt = ('K', 3) else : if st[pos+1] in ["C", "K", "Q"] and st[pos+1:pos+3] not in ["CE", "CI"] : nxt = ('K', 2) else : # default for 'C' nxt = ('K', 1) elif ch == u'Ç' : nxt = ('S', 1) elif ch == 'D' : if st[pos:pos+2] == 'DG' : if st[pos+2] in ['I', 'E', 'Y'] : #e.g. 'edge' nxt = ('J', 3) else : nxt = ('TK', 2) elif st[pos:pos+2] in ['DT', 'DD'] : nxt = ('T', 2) else : nxt = ('T', 1) elif ch == 'F' : if st[pos+1] == 'F' : nxt = ('F', 2) else : nxt = ('F', 1) elif ch == 'G' : if st[pos+1] == 'H' : if pos > first and st[pos-1] not in vowels : nxt = ('K', 2) elif pos < (first + 3) : if pos == first : #'ghislane', ghiradelli if st[pos+2] == 'I' : nxt = ('J', 2) else : nxt = ('K', 2) #Parker's rule (with some further refinements) - e.g., 'hugh' elif (pos > (first + 1) and st[pos-2] in ['B', 'H', 'D'] ) \ or (pos > (first + 2) and st[pos-3] in ['B', 'H', 'D'] ) \ or (pos > (first + 3) and st[pos-4] in ['B', 'H'] ) : nxt = (None, 2) else : # e.g., 'laugh', 'McLaughlin', 'cough', 'gough', 'rough', 'tough' if pos > (first + 2) and st[pos-1] == 'U' \ and st[pos-3] in ["C", "G", "L", "R", "T"] : nxt = ('F', 2) else : if pos > first and st[pos-1] != 'I' : nxt = ('K', 2) elif st[pos+1] == 'N' : if pos == (first +1) and st[first] in vowels and not is_slavo_germanic : nxt = ('KN', 'N', 2) else : # not e.g. 'cagney' if st[pos+2:pos+4] != 'EY' and st[pos+1] != 'Y' and not is_slavo_germanic : nxt = ('N', 'KN', 2) else : nxt = ('KN', 2) # 'tagliaro' elif st[pos+1:pos+3] == 'LI' and not is_slavo_germanic : nxt = ('KL', 'L', 2) # -ges-,-gep-,-gel-, -gie- at beginning elif pos == first and (st[pos+1] == 'Y' \ or st[pos+1:pos+3] in ["ES", "EP", "EB", "EL", "EY", "IB", "IL", "IN", "IE", "EI", "ER"]) : nxt = ('K', 'J', 2) # -ger-, -gy- elif (st[pos+1:pos+2] == 'ER' or st[pos+1] == 'Y') \ and st[first:first+6] not in ["DANGER", "RANGER", "MANGER"] \ and st[pos-1] not in ['E', 'I'] and st[pos-1:pos+2] not in ['RGY', 'OGY'] : nxt = ('K', 'J', 2) # italian e.g, 'biaggi' elif st[pos+1] in ['E', 'I', 'Y'] or st[pos-1:pos+3] in ["AGGI", "OGGI"] : # obvious germanic if st[first:first+4] in ['VON ', 'VAN '] or st[first:first+3] == 'SCH' \ or st[pos+1:pos+3] == 'ET' : nxt = ('K', 2) else : # always soft if french ending if st[pos+1:pos+5] == 'IER ' : nxt = ('J', 2) else : nxt = ('J', 'K', 2) elif st[pos+1] == 'G' : nxt = ('K', 2) else : nxt = ('K', 1) elif ch == 'H' : # only keep if first & before vowel or btw. 2 vowels if (pos == first or st[pos-1] in vowels) and st[pos+1] in vowels : nxt = ('H', 2) else : # (also takes care of 'HH') nxt = (None, 1) elif ch == 'J' : # obvious spanish, 'jose', 'san jacinto' if st[pos:pos+4] == 'JOSE' or st[first:first+4] == 'SAN ' : if (pos == first and st[pos+4] == ' ') or st[first:first+4] == 'SAN ' : nxt = ('H',) else : nxt = ('J', 'H') elif pos == first and st[pos:pos+4] != 'JOSE' : nxt = ('J', 'A') # Yankelovich/Jankelowicz else : # spanish pron. of e.g. 'bajador' if st[pos-1] in vowels and not is_slavo_germanic \ and st[pos+1] in ['A', 'O'] : nxt = ('J', 'H') else : if pos == last : nxt = ('J', ' ') else : if st[pos+1] not in ["L", "T", "K", "S", "N", "M", "B", "Z"] \ and st[pos-1] not in ["S", "K", "L"] : nxt = ('J',) else : nxt = (None, ) if st[pos+1] == 'J' : nxt = nxt + (2,) else : nxt = nxt + (1,) elif ch == 'K' : if st[pos+1] == 'K' : nxt = ('K', 2) else : nxt = ('K', 1) elif ch == 'L' : if st[pos+1] == 'L' : # spanish e.g. 'cabrillo', 'gallegos' if (pos == (last - 2) and st[pos-1:pos+3] in ["ILLO", "ILLA", "ALLE"]) \ or ((st[last-1:last+1] in ["AS", "OS"] or st[last] in ["A", "O"]) \ and st[pos-1:pos+3] == 'ALLE') : nxt = ('L', '', 2) else : nxt = ('L', 2) else : nxt = ('L', 1) elif ch == 'M' : if st[pos+1:pos+4] == 'UMB' \ and (pos + 1 == last or st[pos+2:pos+4] == 'ER') \ or st[pos+1] == 'M' : nxt = ('M', 2) else : nxt = ('M', 1) elif ch == 'N' : if st[pos+1] == 'N' : nxt = ('N', 2) else : nxt = ('N', 1) elif ch == u'Ñ' : nxt = ('N', 1) elif ch == 'P' : if st[pos+1] == 'H' : nxt = ('F', 2) elif st[pos+1] in ['P', 'B'] : # also account for "campbell", "raspberry" nxt = ('P', 2) else : nxt = ('P', 1) elif ch == 'Q' : if st[pos+1] == 'Q' : nxt = ('K', 2) else : nxt = ('K', 1) elif ch == 'R' : # french e.g. 'rogier', but exclude 'hochmeier' if pos == last and not is_slavo_germanic \ and st[pos-2:pos] == 'IE' and st[pos-4:pos-2] not in ['ME', 'MA'] : nxt = ('', 'R') else : nxt = ('R',) if st[pos+1] == 'R' : nxt = nxt + (2,) else : nxt = nxt + (1,) elif ch == 'S' : # special cases 'island', 'isle', 'carlisle', 'carlysle' if st[pos-1:pos+2] in ['ISL', 'YSL'] : nxt = (None, 1) # special case 'sugar-' elif pos == first and st[first:first+5] == 'SUGAR' : nxt =('X', 'S', 1) elif st[pos:pos+2] == 'SH' : # germanic if st[pos+1:pos+5] in ["HEIM", "HOEK", "HOLM", "HOLZ"] : nxt = ('S', 2) else : nxt = ('X', 2) # italian & armenian elif st[pos:pos+3] in ["SIO", "SIA"] or st[pos:pos+4] == 'SIAN' : if not is_slavo_germanic : nxt = ('S', 'X', 3) else : nxt = ('S', 3) # german & anglicisations, e.g. 'smith' match 'schmidt', 'snider' match 'schneider' # also, -sz- in slavic language altho in hungarian it is pronounced 's' elif (pos == first and st[pos+1] in ["M", "N", "L", "W"]) or st[pos+1] == 'Z' : nxt = ('S', 'X') if st[pos+1] == 'Z' : nxt = nxt + (2,) else : nxt = nxt + (1,) elif st[pos:pos+2] == 'SC' : # Schlesinger's rule if st[pos+2] == 'H' : # dutch origin, e.g. 'school', 'schooner' if st[pos+3:pos+5] in ["OO", "ER", "EN", "UY", "ED", "EM"] : # 'schermerhorn', 'schenker' if st[pos+3:pos+5] in ['ER', 'EN'] : nxt = ('X', 'SK', 3) else : nxt = ('SK', 3) else : if pos == first and st[first+3] not in vowels and st[first+3] != 'W' : nxt = ('X', 'S', 3) else : nxt = ('X', 3) elif st[pos+2] in ['I', 'E', 'Y'] : nxt = ('S', 3) else : nxt = ('SK', 3) # french e.g. 'resnais', 'artois' elif pos == last and st[pos-2:pos] in ['AI', 'OI'] : nxt = ('', 'S', 1) else : nxt = ('S',) if st[pos+1] in ['S', 'Z'] : nxt = nxt + (2,) else : nxt = nxt + (1,) elif ch == 'T' : if st[pos:pos+4] == 'TION' : nxt = ('X', 3) elif st[pos:pos+3] in ['TIA', 'TCH'] : nxt = ('X', 3) elif st[pos:pos+2] == 'TH' or st[pos:pos+3] == 'TTH' : # special case 'thomas', 'thames' or germanic if st[pos+2:pos+4] in ['OM', 'AM'] or st[first:first+4] in ['VON ', 'VAN '] \ or st[first:first+3] == 'SCH' : nxt = ('T', 2) else : nxt = ('0', 'T', 2) elif st[pos+1] in ['T', 'D'] : nxt = ('T', 2) else : nxt = ('T', 1) elif ch == 'V' : if st[pos+1] == 'V' : nxt = ('F', 2) else : nxt = ('F', 1) elif ch == 'W' : # can also be in middle of word if st[pos:pos+2] == 'WR' : nxt = ('R', 2) elif pos == first and (st[pos+1] in vowels or st[pos:pos+2] == 'WH') : # Wasserman should match Vasserman if st[pos+1] in vowels : nxt = ('A', 'F', 1) else : nxt = ('A', 1) # Arnow should match Arnoff elif (pos == last and st[pos-1] in vowels) \ or st[pos-1:pos+5] in ["EWSKI", "EWSKY", "OWSKI", "OWSKY"] \ or st[first:first+3] == 'SCH' : nxt = ('', 'F', 1) # polish e.g. 'filipowicz' elif st[pos:pos+4] in ["WICZ", "WITZ"] : nxt = ('TS', 'FX', 4) else : # default is to skip it nxt = (None, 1) elif ch == 'X' : # french e.g. breaux nxt = (None,) if not(pos == last and (st[pos-3:pos] in ["IAU", "EAU"] \ or st[pos-2:pos] in ['AU', 'OU'])): nxt = ('KS',) if st[pos+1] in ['C', 'X'] : nxt = nxt + (2,) else : nxt = nxt + (1,) elif ch == 'Z' : # chinese pinyin e.g. 'zhao' if st[pos+1] == 'H' : nxt = ('J',) elif st[pos+1:pos+3] in ["ZO", "ZI", "ZA"] \ or (is_slavo_germanic and pos > first and st[pos-1] != 'T') : nxt = ('S', 'TS') else : nxt = ('S',) if st[pos+1] == 'Z' : nxt = nxt + (2,) else : nxt = nxt + (1,) # ---------------------------------- # --- end checking letters------ # ---------------------------------- #print str(nxt) if len(nxt) == 2 : if nxt[0] : pri += nxt[0] sec += nxt[0] pos += nxt[1] elif len(nxt) == 3 : if nxt[0] : pri += nxt[0] if nxt[1] : sec += nxt[1] pos += nxt[2] if pri == sec : return (pri, None) else : return (pri, sec) if __name__ == '__main__' : pa = PhoneticAlgorithms() words = ['tomorrow', 'tomoro', 'twomorrow', 'today', 'twoday'] for s in words: print s, ' -> ', pa.double_metaphone(s) names = {'maurice':('MRS', None),'aubrey':('APR', None),'cambrillo':('KMPRL','KMPR')\ ,'heidi':('HT', None),'katherine':('K0RN','KTRN'),'Thumbail':('0MPL','TMPL')\ ,'catherine':('K0RN','KTRN'),'richard':('RXRT','RKRT'),'bob':('PP', None)\ ,'eric':('ARK', None),'geoff':('JF','KF'),'Through':('0R','TR'), 'Schwein':('XN', 'XFN')\ ,'dave':('TF', None),'ray':('R', None),'steven':('STFN', None),'bryce':('PRS', None)\ ,'randy':('RNT', None),'bryan':('PRN', None),'Rapelje':('RPL', None)\ ,'brian':('PRN', None),'otto':('AT', None),'auto':('AT', None), 'Dallas':('TLS', None)\ , 'maisey':('MS', None), 'zhang':('JNK', None), 'Chile':('XL', None)\ ,'Jose':('HS', None), 'Arnow':('ARN','ARNF'), 'solilijs':('SLLS', None)\ , 'Parachute':('PRKT', None), 'Nowhere':('NR', None), 'Tux':('TKS', None)} for name in names.keys() : assert (pa.double_metaphone(name) == names[name]), 'For "%s" function returned %s. Should be %s.' % (name, pa.doubleMetaphone(name), names[name])
amsqr/k-Met
phonetic_algorithms.py
Python
gpl-3.0
21,699
[ "Brian" ]
ca04bf02a6f97c6a85a174765f81af6b3adfb09d7125f8eae66bf11298fe2de7
import unittest from hamcrest import * from cis.data_io.products.NCAR_NetCDF_RAF import NCAR_NetCDF_RAF from cis.test.integration.test_io.test_products.test_data_products import ProductTests from cis.test.integration_test_data import cis_test_files class TestNCAR_NetCDF_RAF(ProductTests, unittest.TestCase): def setUp(self): self.setup(cis_test_files["NCAR_NetCDF_RAF"], NCAR_NetCDF_RAF) def test_can_concatenate_files_with_different_time_stamps(self): from cis import read_data import numpy as np from cis.test.integration_test_data import valid_GASSP_station_files_with_different_timestamps,\ valid_GASSP_station_var_with_different_timestamps var = valid_GASSP_station_var_with_different_timestamps filename = valid_GASSP_station_files_with_different_timestamps data = read_data(filename, var) time_coord = data.coord(axis='T') assert_that(np.min(time_coord.data), close_to(149107 + 54690.0/86400, 1e-5)) assert_that(np.max(time_coord.data), close_to(149110 + 81330.0/86400, 1e-5)) def test_can_concatenate_aircraft_files(self): from cis import read_data from cis.test.integration_test_data import valid_GASSP_aircraft_files_with_different_timestamps,\ valid_GASSP_aircraft_var_with_different_timestamps data = read_data(valid_GASSP_aircraft_files_with_different_timestamps, valid_GASSP_aircraft_var_with_different_timestamps) time_coord = data.coord(axis='T') assert_that(len(time_coord.data), equal_to(63609)) class TestNCAR_NetCDF_RAF_with_GASSP_aux_coord(ProductTests, unittest.TestCase): def setUp(self): self.setup(cis_test_files["GASSP_aux_coord"], NCAR_NetCDF_RAF) def test_variable_wildcarding(self): # We get all of the variables from the file like this - but this isn't the same as the set defined in the # test data because they are all the same shape. These aren't. self.vars = [u'AREADIST_DMA_OPC', u'VOLDIST_DMA_OPC', u'DYNAMIC_PRESSURE', u'NUMDIST_DMA_OPC', u'PRESSURE_ALTITUDE', u'LONGITUDE', u'RELATIVE_HUMIDITY', u'AIR_TEMPERATURE', u'AIR_PRESSURE', u'TIME', u'LATITUDE'] super(TestNCAR_NetCDF_RAF_with_GASSP_aux_coord, self).test_variable_wildcarding() class TestNCAR_NetCDF_RAF_with_GASSP_aeroplane(ProductTests, unittest.TestCase): def setUp(self): self.setup(cis_test_files["GASSP_aeroplane"], NCAR_NetCDF_RAF) class TestNCAR_NetCDF_RAF_with_GASSP_ship(ProductTests, unittest.TestCase): def setUp(self): self.setup(cis_test_files["GASSP_ship"], NCAR_NetCDF_RAF) class TestNCAR_NetCDF_RAF_with_GASSP_station(ProductTests, unittest.TestCase): def setUp(self): self.setup(cis_test_files["GASSP_station"], NCAR_NetCDF_RAF) class TestNCAR_NetCDF_RAF_get_file_type_error(unittest.TestCase): def test_WHEN_file_is_GASSP_THEN_no_errors(self): from cis.test.integration_test_data import valid_GASSP_station_filename product = NCAR_NetCDF_RAF() errors = product.get_file_type_error(valid_GASSP_station_filename) assert_that(errors, is_(None), "file should be GASSP") def test_WHEN_file_is_NCAR_RAF_THEN_no_errors(self): from cis.test.integration_test_data import valid_NCAR_NetCDF_RAF_filename product = NCAR_NetCDF_RAF() errors = product.get_file_type_error(valid_NCAR_NetCDF_RAF_filename) assert_that(errors, is_(None), "file should be GASSP") def test_WHEN_file_dose_not_exist_THEN_errors(self): from cis.test.integration_test_data import invalid_filename product = NCAR_NetCDF_RAF() errors = product.get_file_type_error(invalid_filename) assert_that(errors, is_(["File does not exist"]), "file should not exist") def test_WHEN_file_is_not_NCAR_RAF_OR_GASSP_THEN_errors(self): from cis.test.integration_test_data import valid_hadgem_filename product = NCAR_NetCDF_RAF() errors = product.get_file_type_error(valid_hadgem_filename) assert_that(len(errors), is_(1), "file should not be GASSP") def test_WHEN_file_is_not_netcdf_THEN_errors(self): from cis.test.integration_test_data import valid_aeronet_filename product = NCAR_NetCDF_RAF() errors = product.get_file_type_error(valid_aeronet_filename) assert_that(len(errors), is_(2), "file should not be netcdf")
cedadev/cis
cis/test/integration/test_io/test_products/test_ncar_raf.py
Python
lgpl-3.0
4,482
[ "NetCDF" ]
82f281dbdc615a9c32c9d2c913e868357f69d1b9c5fed2c1802b2dc2cfcd1ebc
''' PipelineLncRNA.py - functions and classes for use with the lincRNA pipeline =========================================================================== ''' import re import sys import os import CGAT.GTF as GTF import CGAT.IOTools as IOTools import gzip import collections import CGAT.IndexedGenome as IndexedGenome import CGAT.IndexedFasta as IndexedFasta import CGATPipelines.Pipeline as P import CGAT.Experiment as E import sqlite3 import tempfile import string from copy import deepcopy try: import bx.intervals.io import bx.align.maf import bx.intervals import bx.interval_index_file except ImportError: # bx library not python3 compatible pass ######################################################## # gene set building ######################################################## def buildCodingGeneSet(abinitio_coding, reference, outfile): ''' takes the output from cuffcompare of a transcript assembly and filters for annotated protein coding genes. NB "pruned" refers to nomenclature in the transcript building pipeline - transcripts that appear in at least two samples. Because an abinitio assembly will often contain fragments of known transcripts and describe them as novel, the default behaviour is to produce a set that is composed of 'complete' transcripts ''' inf = IOTools.openFile(abinitio_coding) outf = gzip.open(outfile, "w") coding = {} coding["protein_coding"] = GTF.readAndIndex(GTF.iterator_filtered( GTF.iterator( IOTools.openFile( reference)), source="protein_coding"), with_value=False) for gtf in GTF.iterator(inf): if coding["protein_coding"].contains(gtf.contig, gtf.start, gtf.end): if gtf.class_code == "=": outf.write("%s\n" % str(gtf)) outf.close() def buildRefcodingGeneSet(coding_set, refcoding_set, outfile): '''takes genes from an ab initio assembly and filters a reference coding set for these genes. Allows for comparisons of known transcripts for those genes that are assembled ab initio. Does this by gene name ''' keep_genes = set() for gtf in GTF.iterator(IOTools.openFile(coding_set)): keep_genes.add(gtf.gene_name) outf = gzip.open(outfile, "w") for gtf in GTF.iterator(IOTools.openFile(refcoding_set)): if gtf.gene_name in keep_genes: outf.write("%s\n" % gtf) outf.close() def buildRefnoncodingGeneSet(reference, outfile): ''' filter the refnoncoding geneset for things that are described in ensembl as being: Ambiguous_orf Retained_intron Sense_intronic antisense Sense_overlapping Processed transcript ''' statement = ("zcat %(reference)s |" " awk '$2 == \"lincRNA\" " " || $2 == \"non_coding\" " " || $2 == \"3prime_overlapping_ncrna\" " " || $2 == \"ncRNA_host\"'" " | gzip > %(outfile)s") P.run() def buildLncRNAGeneSet(abinitio_lincrna, reference, refnoncoding, pseudogenes_gtf, numts_gtf, outfile, min_length): ''' build lncRNA gene set. In contrast to the pipeline, this lincRNA set does not contain the reference noncoding gene set. It is transcripts in the abinitio set that do not overlap at any protein coding, processed or pseudogene transcripts (exons+introns) in a reference gene set. lincRNA genes are often expressed at low level and thus the resultant transcript models are fragmentory. To avoid some double counting in downstream analyses transcripts overlapping on the same strand are merged - this does not neccessarily seem to work well if not using the reference set. Transcripts need to have a length of at least 200 bp. ''' infile_abinitio = abinitio_lincrna reference_gtf = reference refnoncoding_gtf = refnoncoding pseudogenes_gtf = pseudogenes_gtf numts_gtf = numts_gtf E.info("indexing geneset for filtering") # 17/11/2012 Jethro added Ig genes to list. # (NB 31 entries in $2 of reference.gtf.gz) # 10/12/2012 Nick added CDS. # This will then filter anything that overlaps with a CDS # NB this is the annotation for RefSeq and so requires the user to # have created a reference annotation that includes this annotation. input_sections = ("protein_coding", "processed_pseudogene", "unprocessed_pseudogene", "nonsense_mediated_decay", "retained_intron", "IG_V_gene", "IG_J_gene", "IG_C_gene", "IG_D_gene", "IG_LV_gene", "TR_V_gene", "CDS") # create a dictionary containing a separate index for each input section indices = {} for section in input_sections: indices[section] = GTF.readAndIndex( GTF.iterator_filtered(GTF.iterator( IOTools.openFile(reference_gtf)), source=section), with_value=True) E.info("built indices for %i features" % len(indices)) # add psuedogenes and numts to dictionary of indices indices["numts"] = GTF.readAndIndex( GTF.iterator(IOTools.openFile(numts_gtf)), with_value=True) E.info("added index for numts") indices["pseudogenes"] = GTF.readAndIndex( GTF.iterator(IOTools.openFile(pseudogenes_gtf)), with_value=True) E.info("added index for pseudogenes") # iterate through assembled transcripts, identify those that intersect # with indexed sections total_transcripts = set() remove_transcripts = collections.defaultdict(set) E.info("collecting genes to remove") for gtf in GTF.transcript_iterator( GTF.iterator( IOTools.openFile(infile_abinitio))): # remove those transcripts too short to be classified as lncRNAs l = sum([x.end - x.start for x in gtf]) if l < min_length: remove_transcripts[gtf[0].transcript_id].add("length") # remove transcripts where one or more exon intersects one or more # sections for section in indices.keys(): for exon in gtf: transcript_id = exon.transcript_id total_transcripts.add(transcript_id) if indices[section].contains( exon.contig, exon.start, exon.end): # check if any of the intersected intervals are on same # stand as query exon for interval in indices[section].get( exon.contig, exon.start, exon.end): # only remove transcripts where an exon is on # the same strand as the interval it # intersects if exon.strand == interval[2].strand: remove_transcripts[transcript_id].add(section) E.info("removing %i out of %i transcripts" % (len(remove_transcripts), len(total_transcripts))) # Jethro - removed the automatic retention of transcripts that # intersect known non-coding intervals regardless of # strand. Instead, any removed transcript that also intersects a # lncRNA on the same strand is now output to a separate gtf. noncoding = GTF.readAndIndex( GTF.iterator(IOTools.openFile(refnoncoding_gtf)), with_value=True) rej_gtf = os.path.join(os.path.dirname(outfile), "lncrna_removed_nc_intersect.gtf.gz") rej_gtf = IOTools.openFile(rej_gtf, "w") for gtf in GTF.transcript_iterator(GTF.iterator( IOTools.openFile(infile_abinitio))): if gtf[0].transcript_id in list(remove_transcripts.keys()): for exon in gtf: if noncoding.contains(exon.contig, exon.start, exon.end): if exon.strand in [x[2].strand for x in list(noncoding.get(exon.contig, exon.start, exon.end))]: for exon2 in IOTools.flatten(gtf): rej_gtf.write(str(exon2) + "\n") break rej_gtf.close() outf = open("lncrna_removed.tsv", "w") outf.write("transcript_id" + "\t" + "removed" + "\n") for x, y in remove_transcripts.items(): outf.write("%s\t%s\n" % (x, ",".join(y))) outf.close() # write out transcripts that are not in removed set temp = P.getTempFile(".") for entry in GTF.iterator(IOTools.openFile(infile_abinitio)): if entry.transcript_id in remove_transcripts: continue temp.write("%s\n" % str(entry)) temp.close() filename = temp.name statement = '''cat %(filename)s | cgat gtf2gtf --method=sort --sort-order=gene --log=%(outfile)s.log | gzip > %(outfile)s''' P.run() os.unlink(temp.name) def buildFilteredLncRNAGeneSet(flagged_gtf, outfile, genesets_previous, filter_se="transcripts"): ''' creates a filtered lincRNA geneset. This geneset will not include any single exon lincRNA unless they have been seen previously i.e. it overlaps a previously identified lincRNA At this point we add a flag for whether the gene is a novel lncRNA or not NB this is a large function and should be modified in the future note genesets_previous provided as a list - priority is placed on the first in the list ''' # keep single and multi exonic lncRNA separate previous_single = IndexedGenome.IndexedGenome() previous_multi = IndexedGenome.IndexedGenome() E.info("indexing previously identified lncRNA") for prev in genesets_previous: inf = IOTools.openFile(prev) for transcript in GTF.transcript_iterator(GTF.iterator(inf)): # use an indexed genome to assess novelty of lncRNA if len(transcript) > 1: for gtf in transcript: previous_multi.add(gtf.contig, gtf.start, gtf.end, [transcript[0].strand, transcript[0].gene_id]) # add single exons elif len(transcript) == 1: previous_single.add(transcript[0].contig, transcript[0].start, transcript[0].end, [transcript[0].strand, transcript[0].gene_id]) # create sets for keeping and discarding genes temp = P.getTempFile(dir=".") keep = set() known = set() novel = set() # iterate over the flagged GTF - flagged for exon status E.info("checking for overlap with previously identified sets") for transcript in GTF.transcript_iterator( GTF.iterator(IOTools.openFile(flagged_gtf))): gene_id = transcript[0].gene_id # check if there is overlap in the known sets in order to add # gene_status attribute if transcript[0].exon_status == "m": if previous_multi.contains(transcript[0].contig, min([gtf.start for gtf in transcript]), max([gtf.end for gtf in transcript])): known.add(transcript[0].gene_id) # add previous multi exonic lincRNA gene id # to known set - to avoid addin gto gtf later for gtf2 in previous_multi.get(transcript[0].contig, min([gtf.start for gtf in transcript]), max([gtf.end for gtf in transcript])): known.add(gtf2[2][1]) else: novel.add(transcript[0].gene_id) elif filter_se == "locus" and transcript[0].exon_status_locus == "m": if previous_multi.contains(transcript[0].contig, min([gtf.start for gtf in transcript]), max([gtf.end for gtf in transcript])): known.add(transcript[0].gene_id) # add previous multi exonic lincRNA gene id # to known set - to avoid addin gto gtf later for gtf2 in previous_multi.get( transcript[0].contig, min([gtf.start for gtf in transcript]), max([gtf.end for gtf in transcript])): known.add(gtf2[2][1]) else: novel.add(transcript[0].gene_id) else: continue E.info("writing filtered lncRNA geneset") E.info("writing %i assembled but known" % len(known)) E.info("writing %i assembled novel" % len(novel)) # write out ones to keep from assembled data for gtf in GTF.iterator(IOTools.openFile(flagged_gtf)): if gtf.gene_id in known and gtf.exon_status == "m": gtf.setAttribute("gene_status", "known") temp.write("%s\n" % gtf) elif gtf.gene_id in novel and gtf.exon_status == "m": gtf.setAttribute("gene_status", "novel") temp.write("%s\n" % gtf) # write out ones to keep - from previous evidence # i.e. anything single exon or anything # multi-exonic non-overlapping the assembled set # hierarchically done so add to 'done' if found as we iterate # over the previous sets done = IndexedGenome.IndexedGenome() known_count = 0 for prev in genesets_previous: inf = IOTools.openFile(prev) for gene in GTF.flat_gene_iterator(GTF.iterator(inf)): gene_id = gene[0].gene_id # dont' write out ones that we build if gene_id in known: continue elif done.contains(gene[0].contig, min([gtf.start for gtf in gene]), max([gtf.end for gtf in gene])): continue else: for gtf in gene: gtf.setAttribute("gene_status", "known") temp.write("%s\n" % gtf) known_count += 1 done.add(gene[0].contig, min([gtf.start for gtf in gene]), max( [gtf.end for gtf in gene]), gene_id) E.info("written %i from %s " % (known_count, ",".join(genesets_previous))) temp.close() filename = temp.name statement = '''cat %(filename)s | cgat gtf2gtf --method=sort --sort-order=transcript --log=%(outfile)s.log | gzip > %(outfile)s''' P.run() def buildFinalLncRNAGeneSet(filteredLncRNAGeneSet, cpc_table, outfile, filter_cpc=False, cpc_threshold=1, rename_lncRNA=False): '''filters lncRNA set based on the coding potential as output from the CPC ''' if filter_cpc: # set threshold for filtering transcripts on coding potential cpc_thresh = float(cpc_threshold) # get the transcripts that are designated as coding coding_set = set() dbh = sqlite3.connect("csvdb") cc = dbh.cursor() for transcript_id in cc.execute("SELECT transcript_id" " FROM %s" " WHERE CP_score > %f" % (cpc_table, cpc_thresh)): coding_set.add(transcript_id[0]) remove = set() outf_coding = gzip.open("gtfs/cpc_removed.gtf.gz", "w") for gtf in GTF.iterator(IOTools.openFile(filteredLncRNAGeneSet)): if gtf.transcript_id in coding_set: remove.add(gtf.gene_id) outf_coding.write("%s\n" % gtf) outf_coding.close() else: # create empty set remove = set() # get temporary file for built lncrna temp = P.getTempFile(".") # get temporary file for known lncrna temp2 = P.getTempFile(".") for gtf in GTF.iterator(IOTools.openFile(filteredLncRNAGeneSet)): if gtf.gene_id in remove: continue if gtf.transcript_id.find("TCONS") != -1: # output known and built transcripts separately temp.write("%s\n" % gtf) else: temp2.write("%s\n" % gtf) temp.close() temp2.close() filename = temp.name filename2 = temp2.name if rename_lncRNA: filename3 = P.getTempFilename(".") statement = ("cat %(filename)s |" " cgat gtf2gtf" " --method=sort --sort-order=gene" " --log=%(outfile)s.log |" " cgat gtf2gtf" " --method=renumber-genes --pattern-identifier=NONCO%%i" " --log=%(outfile)s.log |" " cgat gtf2gtf" " --method=sort --sort-order=gene" " --log=%(outfile)s.log" " > %(filename3)s;" " cat %(filename2)s %(filename3)s |" " cgat gtf2gtf" " --method=sort --sort-order=contig+gene" " --log=%(outfile)s.log |" " gzip > %(outfile)s") P.run() os.unlink(filename3) else: statement = ("cat %(filename)s %(filename2)s |" " cgat gtf2gtf" " --method=sort --sort-order=contig+gene" " --log=%(outfile)s.log |" " gzip > %(outfile)s") P.run() ######################################################## # counter classes ######################################################## class CounterExons: ''' various classes for counting features in a gtf file ''' def __init__(self, gtffile): self.gtffile = GTF.iterator(IOTools.openFile(gtffile)) def count(self): c = 0 for gtf in self.gtffile: c += 1 return c class CounterTranscripts(CounterExons): def count(self): c = 0 for transcript in GTF.transcript_iterator(self.gtffile): c += 1 return c class CounterGenes(CounterExons): def count(self): c = 0 for gtf in GTF.flat_gene_iterator(self.gtffile): c += 1 return c class CounterExonsPerTranscript(CounterExons): ''' returns the average number of exons per transcript ''' def count(self): no_exons = [] for transcript in GTF.transcript_iterator(self.gtffile): no_exons.append(len(transcript)) return float(sum(no_exons)) / len(no_exons) class CounterExonsPerGene(CounterExons): ''' returns the average number of exons per transcript ''' def count(self): no_exons = [] for gene in GTF.flat_gene_iterator(self.gtffile): no_exons.append(len(gene)) return float(sum(no_exons)) / len(no_exons) class CounterSingleExonTranscripts(CounterExons): def count(self): c = 0 for transcript in GTF.transcript_iterator(self.gtffile): if len(transcript) == 1: c += 1 return c class CounterMultiExonTranscripts(CounterExons): def count(self): c = 0 for transcript in GTF.transcript_iterator(self.gtffile): if len(transcript) > 1: c += 1 return c class CounterSingleExonGenes(CounterExons): def count(self): gene_ids = set() for gene in GTF.flat_gene_iterator(self.gtffile): if gene[0].exon_status_locus == "s": gene_ids.add(gene[0].gene_id) return len(gene_ids) class CounterMultiExonGenes(CounterExons): def count(self): # note that this approach works when there are also single # exon gtf entries from the same gene (doesn't work to use # flat_gene_iterator) gene_ids = set() for gene in GTF.flat_gene_iterator(self.gtffile): if gene[0].exon_status_locus == "m": gene_ids.add(gene[0].gene_id) return len(gene_ids) def flagExonStatus(gtf_file, outfile): ''' Adds two attributes to a gtf, the first species transcript exon status, the second specifies gene exon status. It is possible for genes to contain single-exon transcripts but not the reciprocal. ''' tmpf1 = P.getTempFilename(".") tmpf2 = P.getTempFilename(".") outf = IOTools.openFile(tmpf2, "w") # sort infile statement = ("zcat %(gtf_file)s |" " cgat gtf2gtf" " --method=sort --sort-order=gene" " --log=%(outfile)s.log" " > %(tmpf1)s") P.run() # create dictionary where key is transcript_id, # value is a list of gtf_proxy objects for gene in GTF.gene_iterator(GTF.iterator(IOTools.openFile(tmpf1))): trans_dict = collections.defaultdict(list) # load current gene into dictionary for transcript in gene: for exon in transcript: trans_dict[exon.transcript_id].append(exon) # set exon status for transcripts for transcript in trans_dict.keys(): if len(trans_dict[transcript]) == 1: exon_status = "s" else: exon_status = "m" for exon in trans_dict[transcript]: exon.setAttribute("exon_status", exon_status) # collate transcript exon status for a gene transcript_status = set() for exons in trans_dict.values(): transcript_status.update([exon.exon_status for exon in exons]) # set gene_exon_status if "m" in transcript_status: gene_exon_status = "m" else: gene_exon_status = "s" # write gene model to outfile for transcript in trans_dict.values(): for exon in transcript: exon.setAttribute("exon_status_locus", gene_exon_status) outf.write(str(exon) + "\n") outf.close() statement = ("cat %(tmpf2)s |" " cgat gtf2gtf" " --method=sort --sort-order=transcript" " --log=%(outfile)s.log |" " gzip > %(outfile)s") P.run() os.unlink(tmpf1) os.unlink(tmpf2) ############################################################# # classifying lincRNA TRANSCRIPT level relative to protein # coding transcripts ############################################################# def classifyLncRNA(lincRNA_gtf, reference, outfile, dist=2): '''Classify lincRNA in terms of their proximity to protein coding genes - creates indices for intervals on the fly - maybe should be creating additional annotations: antisense - GENE overlapping protein coding exons or introns on opposite strand antisense_upstream - GENE < Xkb from tss on opposite strand antisense_downstream - GENE < Xkb from gene end on opposite strand sense_upstream - GENE < Xkb from tss on same strand sense_downstream - GENE < Xkb from gene end on same strand intergenic - >Xkb from any protein coding gene intronic - overlaps protein coding gene intron on same strand antisense_intronic - overlaps protein coding intron on opposite strand ''' # index the reference geneset ref = {} ref["ref"] = GTF.readAndIndex( GTF.iterator(IOTools.openFile(reference)), with_value=True) # create index for intronic intervals intron = IndexedGenome.IndexedGenome() # create index for up and downstream intervals plus_up = IndexedGenome.IndexedGenome() plus_down = IndexedGenome.IndexedGenome() minus_up = IndexedGenome.IndexedGenome() minus_down = IndexedGenome.IndexedGenome() # iterate over reference transcripts and create intervals in memory outf = open("introns.bed", "w") for transcript in GTF.transcript_iterator(GTF.iterator( IOTools.openFile(reference))): start = transcript[0].end for i in range(1, len(transcript)): intron.add( transcript[i].contig, start, transcript[i].start, transcript[i].strand) start = transcript[i].end # create up and downstream intervals on plus strand if transcript[0].strand == "+": plus_up.add(transcript[0].contig, transcript[0].start - (dist * 1000), transcript[0].start, transcript[0].strand) plus_down.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[len(transcript) - 1].end + (dist * 1000), transcript[0].strand) # create up and downstream intervals on minus strand elif transcript[0].strand == "-": minus_up.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[len(transcript) - 1].end + (dist * 1000), transcript[0].strand) minus_down.add(transcript[0].contig, transcript[0].start - (dist * 1000), transcript[0].start, transcript[0].strand) else: print("WARNING: no strand") " specified for %s" % transcript[0].transcript_id # iterate over lincRNA transcripts transcript_class = {} for transcript in GTF.transcript_iterator( GTF.iterator(IOTools.openFile(lincRNA_gtf))): transcript_id = transcript[0].transcript_id for gtf in transcript: # antisense to protein coding gene if ref["ref"].contains(gtf.contig, gtf.start, gtf.end): for gtf2 in ref["ref"].get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2].strand: transcript_class[transcript_id] = "antisense" # upstream sense and antisense - if up or downstream of a protein # coding gene then that classification is prioritised over intronic # classification. upstream is prioritised over downstream # sense upstream is prioritised over antisense upstream elif plus_up.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end) and not \ intron.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end): for gtf2 in plus_up.get(gtf.contig, gtf.start, gtf.end): if gtf.strand == gtf2[2]: transcript_class[transcript_id] = "sense_upstream" elif gtf.strand != gtf2[2]: transcript_class[transcript_id] = "antisense_upstream" # and not intron.contains(transcript[0].contig, # transcript[0].start, transcript[len(transcript) -1].end): elif minus_up.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end): for gtf2 in minus_up.get(gtf.contig, gtf.start, gtf.end): if gtf.strand == gtf2[2]: transcript_class[transcript_id] = "sense_upstream" elif gtf.strand != gtf2[2]: transcript_class[transcript_id] = "antisense_upstream" # downstream sense and antisense - downstream antisense is # prioritised as less likely to be part of the coding transcript elif plus_down.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end) and not \ intron.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end): for gtf2 in plus_down.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: transcript_class[ transcript_id] = "antisense_downstream" elif gtf.strand == gtf2[2]: transcript_class[transcript_id] = "sense_downstream" elif minus_down.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end) and not \ intron.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end): for gtf2 in minus_down.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: transcript_class[ transcript_id] = "antisense_downstream" elif gtf.strand == gtf2[2]: transcript_class[transcript_id] = "sense_downstream" # intronic sense and antisense - intronic antisense is prioritised elif intron.contains(transcript[0].contig, transcript[0].start, transcript[len(transcript) - 1].end): for gtf2 in intron.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: transcript_class[transcript_id] = "antisense_intronic" elif gtf.strand == gtf2[2]: transcript_class[transcript_id] = "sense_intronic" # we have known lncRNA that overlap protein coding exons so # classify these as well elif ref["ref"].contains(gtf.contig, gtf.start, gtf.end): if gtf.gene_status == "known": transcript_class[transcript_id] = "sense_protein_coding" # catch intergenic transcripts - based on the # assumption that anything not falling into the above classes # is intergenic if transcript_id not in transcript_class: transcript_class[transcript_id] = "intergenic" outf = gzip.open(outfile, "w") outf_unclassified = gzip.open("lncrna_unclassified.gtf.gz", "w") for gtf in GTF.iterator(IOTools.openFile(lincRNA_gtf)): if gtf.transcript_id in transcript_class: gtf.source = transcript_class[gtf.transcript_id] outf.write("%s\n" % gtf) else: outf_unclassified.write("%s\n" % gtf) outf.close() ############################################################# # classifying lincRNA GENE level relative to protein coding # transcripts ############################################################# def classifyLncRNAGenes(lincRNA_gtf, reference, outfile, dist=2): # index the reference geneset ref = {} ref["ref"] = GTF.readAndIndex( GTF.iterator(IOTools.openFile(reference)), with_value=True) # create index for intronic intervals intron = IndexedGenome.IndexedGenome() # create index for up and downstream intervals plus_up = IndexedGenome.IndexedGenome() plus_down = IndexedGenome.IndexedGenome() minus_up = IndexedGenome.IndexedGenome() minus_down = IndexedGenome.IndexedGenome() # iterate over reference transcripts and create intervals in memory for transcript in GTF.transcript_iterator( GTF.iterator(IOTools.openFile(reference))): start = transcript[0].end for i in range(1, len(transcript)): intron.add( transcript[i].contig, start, transcript[i].start, transcript[i].strand) start = transcript[i].end # create up and downstream intervals on plus strand if transcript[0].strand == "+": plus_up.add(transcript[0].contig, transcript[0].start - (dist * 1000), transcript[0].start, transcript[0].strand) plus_down.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[len(transcript) - 1].end + (dist * 1000), transcript[0].strand) # create up and downstream intervals on minus strand elif transcript[0].strand == "-": minus_up.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[len(transcript) - 1].end + (dist * 1000), transcript[0].strand) minus_down.add(transcript[0].contig, transcript[0].start - (dist * 1000), transcript[0].start, transcript[0].strand) else: print(("WARNING: no strand" " specified for %s" % transcript[0].transcript_id)) # iterate over lincRNA genes outf_introns = os.path.join(os.path.dirname(outfile), "sense_intronic_removed.gtf.gz") outf_introns = gzip.open(outf_introns, "w") gene_class = {} for gtf in GTF.merged_gene_iterator(GTF.iterator( IOTools.openFile(lincRNA_gtf))): gene_id = gtf.gene_id # the first classification resolves any gene # that overlaps a gene. We don't mind whether it # overlaps protein coding gene exons or introns if ref["ref"].contains(gtf.contig, gtf.start, gtf.end): for gtf2 in ref["ref"].get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: gene_class[gene_id] = "antisense" else: gene_class[gene_id] = "sense" # remove intronic sense transcripts at this point elif intron.contains(gtf.contig, gtf.start, gtf.end): for gtf2 in intron.get(gtf.contig, gtf.start, gtf.end): if gtf.strand == gtf2[2]: outf_introns.write("%s\n" % gtf) else: gene_class[gene_id] = "antisense" # the second classification resolves sense and antisense genes up and # downstream of protein coding genes - nb having some problems with the # merged gene iterator elif plus_up.contains(gtf.contig, gtf.start, gtf.end): for gtf2 in plus_up.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: if gene_id in gene_class: continue gene_class[gene_id] = "antisense_upstream" else: if gene_id in gene_class: continue gene_class[gene_id] = "sense_upstream" elif minus_up.contains(gtf.contig, gtf.start, gtf.end): for gtf2 in minus_up.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: if gene_id in gene_class: continue gene_class[gene_id] = "antisense_upstream" else: if gene_id in gene_class: continue gene_class[gene_id] = "sense_upstream" elif plus_down.contains(gtf.contig, gtf.start, gtf.end): for gtf2 in plus_down.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: if gene_id in gene_class: continue gene_class[gene_id] = "antisense_downstream" else: if gene_id in gene_class: continue gene_class[gene_id] = "sense_downstream" elif minus_down.contains(gtf.contig, gtf.start, gtf.end): for gtf2 in minus_down.get(gtf.contig, gtf.start, gtf.end): if gtf.strand != gtf2[2]: if gene_id in gene_class: continue gene_class[gene_id] = "antisense_downstream" else: if gene_id in gene_class: continue gene_class[gene_id] = "sense_downstream" # the third classification assumes all genes have been # classified leaving intergenic genes else: gene_class[gene_id] = "intergenic" outf = gzip.open(outfile, "w") for gtf in GTF.iterator(IOTools.openFile(lincRNA_gtf)): if gtf.gene_id in gene_class: gtf.source = gene_class[gtf.gene_id] outf.write("%s\n" % gtf) outf.close() outf_introns.close() ########################################################################## ########################################################################## # An alternative method for classifying LncRNAs relative to supplied geneset ########################################################################## def write_to_temp(tempfile, interval_list, transcript, check_strand=True): if check_strand: for interval in interval_list: if interval[2][6] == transcript[0].strand: tempfile.write(transcript[0].gene_id + "\t" + str(interval[0]) + "\t" + str(interval[1]) + "\t" + str(transcript[0]) + "\t" + "\t".join(interval[2]) + "\n") else: for interval in interval_list: tempfile.write(transcript[0].gene_id + "\t" + str(interval[0]) + "\t" + str(interval[1]) + "\t" + str(transcript[0]) + "\t" + "\t".join(interval[2]) + "\n") def reClassifyLncRNAGenes(lncRNA_gtf, reference_gtf, outfile, upstr_dist=5, dstr_dist=5, wdir="."): """ This re-write of classifyLncRNAGenes() does not throw out intronic loci, but labels them as either sense-intronic or sense-overlap. It also fixes the bug that cause sense gene-models encompassing reference exons to be output as antisense. Because lncRNA boundaries intersect multiple intervals in indexes, rather than classifying each lncRNA multiple times, lncRNA strand is instead compared to a list of interval strand values, if any of these are sense, then the lncRNA is classified as sense etc. Sense-intronic: when lncRNA loci start and end are contained within a single intron. Sense-overlap: when lncRNA loci start and end are in different introns. Note that different introns do not necessarily come from different gene-models. """ # index exons in the reference gene-set ref_index = IndexedGenome.IndexedGenome() for exon in GTF.iterator(IOTools.openFile(reference_gtf)): ref_index.add(exon.contig, exon.start, exon.end, str(exon).split()) # create index for all other intervals to be classified intron = IndexedGenome.IndexedGenome() plus_up = IndexedGenome.IndexedGenome() plus_down = IndexedGenome.IndexedGenome() minus_up = IndexedGenome.IndexedGenome() minus_down = IndexedGenome.IndexedGenome() # iterate over reference transcripts and create intervals in memory ref_file = IOTools.openFile(reference_gtf) for transcript in GTF.transcript_iterator(GTF.iterator(ref_file)): start = transcript[0].end for i in range(1, len(transcript)): intron.add(transcript[i].contig, start, transcript[i].start, str(transcript[i]).split()) start = transcript[i].end # create up and downstream intervals on plus strand if transcript[0].strand == "+": plus_up.add(transcript[0].contig, transcript[0].start - (upstr_dist * 1000), transcript[0].start, str(transcript[0]).split()) plus_down.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[ len(transcript) - 1].end + (dstr_dist * 1000), str(transcript[len(transcript) - 1]).split()) # create up and downstream intervals on minus strand elif transcript[0].strand == "-": minus_up.add(transcript[0].contig, transcript[len(transcript) - 1].end, transcript[len(transcript) - 1].end + (upstr_dist * 1000), str(transcript[len(transcript) - 1]).split()) minus_down.add(transcript[0].contig, transcript[0].start - (dstr_dist * 1000), transcript[0].start, str(transcript[0]).split()) else: E.warn("WARNING: no strand specified for %s" % transcript[0].transcript_id) # create single representative transcript for each lncRNA gene_id merged_lncRNA_gtf = P.getTempFilename(wdir) to_cluster = False statement = ("zcat %(lncRNA_gtf)s |" " cgat gtf2gtf" " --method=sort --sort-order=gene" " --log=%(outfile)s.log |" " cgat gtf2gtf" " --method=merge-exons" " --log=%(outfile)s.log" " > %(merged_lncRNA_gtf)s") P.run() # create a temp directory containing the indexed intervals used to classify # the lncRNA transcripts created (for debugging purposes) # create a temporary count of # of gene_models in each category tempdir = P.getTempDir(wdir) E.info("intersecting intervals are being written to %s" % os.path.abspath(tempdir)) temp_file_names = ["sense", "sense_intronic", "sense_overlap", "antisense", "sense_downstream", "sense_upstream", "antisense_downstream", "antisense_upstream", "intergenic"] temp_files = {} temp_count = {} for handle in temp_file_names: temp_count[handle] = 0 temp_files[handle] = IOTools.openFile(os.path.join(tempdir, handle), "w") # iterate through the representative (i.e. merged) lncRNA transcripts # each lncRNA transcript is classified only once. # In situations where a lncRNA fits > 1 classification, priority is: # (sense > antisense) # & (overlap_exons > overlap_introns > downstream > upstream > intergenic) lnc_file = IOTools.openFile(merged_lncRNA_gtf) gene_class = {} # dictionary of gene_id : classification input_transcripts = 0 # keep track of # transcripts in lncRNA_gtf for transcript in GTF.transcript_iterator(GTF.iterator(lnc_file)): input_transcripts += 1 gene_id = transcript[0].gene_id strand = transcript[0].strand # create lists of indexed intervals that intersect transcript exons overlap_list = [] intron_list = [] plus_down_list = [] minus_down_list = [] plus_up_list = [] minus_up_list = [] for exon in transcript: if exon.contig in list(ref_index.mIndex.keys()): overlap_list.extend([x for x in list(ref_index.get(exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in reference exon index " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) if exon.contig in list(intron.mIndex.keys()): intron_list.extend([x for x in list(intron.get(exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in reference intron index, " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) if exon.contig in list(plus_down.mIndex.keys()): plus_down_list.extend([x for x in list(plus_down.get( exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in plus downstream index, " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) if exon.contig in list(minus_down.mIndex.keys()): minus_down_list.extend([x for x in list(minus_down.get( exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in minus downstream index, " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) if exon.contig in list(plus_up.mIndex.keys()): plus_up_list.extend([x for x in list(plus_up.get(exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in plus upstream index, " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) if exon.contig in list(minus_up.mIndex.keys()): minus_up_list.extend([x for x in list(minus_up.get(exon.contig, exon.start, exon.end))]) else: E.warn("Contig %s not in minus upstream index, " "failed to retrieve intervals for %s" % (exon.contig, exon.gene_id)) # check if any exon in lncRNA intersects an reference exon if overlap_list: # if the intersecting exons are on the same strand, # classify lncRNA as sense. if strand in [x[2][6] for x in overlap_list]: gene_class[gene_id] = "sense" write_to_temp(temp_files[gene_class[gene_id]], overlap_list, transcript) temp_count[gene_class[gene_id]] += 1 # otherwise check if lncRNA has sense overlap with a reference # intron elif intron_list and strand in [x[2][6] for x in intron_list]: last = len(transcript) - 1 start_list = [(x[0], x[1]) for x in list(intron.get( transcript[0].contig, transcript[0].start, transcript[0].start + 1)) if x[2][6] == strand] end_list = [(x[0], x[1]) for x in list(intron.get( transcript[last].contig, transcript[last].end, transcript[last].end + 1)) if x[2][6] == strand] # if start and end of transcript are within the same sense # introns, then lncRNA is classified as 'sense_intronic' if set(start_list) == set(end_list): gene_class[gene_id] = "sense_intronic" write_to_temp(temp_files[gene_class[gene_id]], intron_list, transcript) temp_count[gene_class[gene_id]] += 1 # if start/end are within different sense introns, # then lncRNA is classified as 'sense overlap' else: gene_class[gene_id] = "sense_overlap" write_to_temp(temp_files[gene_class[gene_id]], intron_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense downstream on the plus strand... elif plus_down_list and strand in [x[2][6] for x in plus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], plus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense downstream on the minus strand... elif minus_down_list and strand in [x[2][6] for x in minus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], minus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the plus strand... elif plus_up_list and strand in [x[2][6] for x in plus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the minus strand... elif minus_up_list and strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...if none of the above... classify as antisense else: gene_class[gene_id] = "antisense" write_to_temp(temp_files[gene_class[gene_id]], overlap_list, transcript, check_strand=False) temp_count[gene_class[gene_id]] += 1 # if lncRNA doesn't intersect a reference exon, # check if it overlaps a reference intron elif intron_list: if strand in [x[2][6] for x in intron_list]: last = len(transcript) - 1 start_list = [(x[0], x[1]) for x in list(intron.get( transcript[0].contig, transcript[0].start, transcript[0].start + 1)) if x[2][6] == strand] end_list = [(x[0], x[1]) for x in list(intron.get( transcript[last].contig, transcript[last].end, transcript[last].end + 1)) if x[2][6] == strand] # if start and end of transcript are within the same sense # introns, then lncRNA is classified as 'sense_intronic' if set(start_list) == set(end_list): gene_class[gene_id] = "sense_intronic" write_to_temp(temp_files[gene_class[gene_id]], intron_list, transcript) temp_count[gene_class[gene_id]] += 1 # if start/end are within different sense introns, # then lncRNA is classified as 'sense overlap' else: gene_class[gene_id] = "sense_overlap" write_to_temp(temp_files[gene_class[gene_id]], intron_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense downstream on the plus strand... elif plus_down_list and strand in [x[2][6] for x in plus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], plus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense downstream on the minus strand... elif minus_down_list and strand in [x[2][6] for x in minus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], minus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the plus strand... elif plus_up_list and strand in [x[2][6] for x in plus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream in the minus strand... elif minus_up_list and strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...if none of the above, lncRNAs intersecting introns on # the opposite strand are classified as antisense else: gene_class[gene_id] = "antisense" write_to_temp(temp_files[gene_class[gene_id]], intron_list, transcript, check_strand=False) temp_count[gene_class[gene_id]] += 1 # if lncRNA doesn't intersect reference introns or exons... # check if it's downstream on the plus strand... elif plus_down_list: # ... check if lncRNA is sense downstream... if strand in [x[2][6] for x in plus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], plus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense downstream on the minus strand... elif minus_down_list and strand in [x[2][6] for x in minus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], minus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense usptream on the plus strand... elif plus_up_list and strand in [x[2][6] for x in plus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the pluse strand... elif minus_up_list and strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # if none of the above, lncRNA is classified as # antisense_downstream else: gene_class[gene_id] = "antisense_downstream" write_to_temp(temp_files[gene_class[gene_id]], plus_down_list, transcript, check_strand=False) temp_count[gene_class[gene_id]] += 1 # check if lncRNA is downstream on the minus strand... elif minus_down_list: # check if lncRNA is sense downstream if strand in [x[2][6] for x in minus_down_list]: gene_class[gene_id] = "sense_downstream" write_to_temp(temp_files[gene_class[gene_id]], minus_down_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the plus strand... elif plus_up_list and strand in [x[2][6] for x in plus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the minus strand... elif minus_up_list and strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # if none of the above, lncRNA is classified as # antisense_downstream else: gene_class[gene_id] = "antisense_downstream" write_to_temp(temp_files[gene_class[gene_id]], minus_down_list, transcript, check_strand=False) temp_count[gene_class[gene_id]] += 1 # check if lncRNA is upstream on the plus strand... elif plus_up_list: # check if lncRNA is sense upstream... if strand in [x[2][6] for x in plus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # ...check if lncRNA is sense upstream on the plus strand... elif minus_up_list and strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # if none of the above, lncRNA is classified as # antisense upstream else: gene_class[gene_id] = "antisense_upstream" write_to_temp(temp_files[gene_class[gene_id]], plus_up_list, transcript, check_strand=False) temp_count[gene_class[gene_id]] += 1 # check if lncRNA is upstream on the minus strand... elif minus_up_list: # check if lncRNA is sense upstream... if strand in [x[2][6] for x in minus_up_list]: gene_class[gene_id] = "sense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # otherwise classify as antisense upstream else: gene_class[gene_id] = "antisense_upstream" write_to_temp(temp_files[gene_class[gene_id]], minus_up_list, transcript) temp_count[gene_class[gene_id]] += 1 # lncRNA that do not fall into any of the above categories # are classified as intergenic else: gene_class[gene_id] = "intergenic" temp_files[gene_class[gene_id]].write(str(transcript[0]) + "\n") temp_count[gene_class[gene_id]] += 1 # check that all the numbers add up E.info("Number of lncRNA loci falling into each category are as follows:") for key, value in temp_count.items(): print((key + "\t" + str(value))) total_classified = sum(temp_count.values()) E.info("Total number of lncRNA loci classified: %i" % total_classified) E.info("Total number of lncRNA loci in input gtf: %i" % input_transcripts) # sanity check: assert total_classified == input_transcripts, ( "Not all lncRNAs in input gtf were successfully classified") # close the tempfiles for handle in temp_file_names: temp_files[handle].close() # write the genes plus their classification to the outfile outf = IOTools.openFile(outfile, "w") for gtf in GTF.iterator(IOTools.openFile(lncRNA_gtf)): if gtf.gene_id in gene_class: gtf.source = gene_class[gtf.gene_id] outf.write(str(gtf) + "\n") else: E.info("Warning the gene_id %s is not classified" % gtf.gene_id) outf.close() os.unlink(merged_lncRNA_gtf) return tempdir ########################################################################## ########################################################################## ########################################################################## # Extract pairwise MAF alignments ########################################################################## # This section of the pipeline makes use of galaxy's maf_utilties (written by # Dan Blankenberg - see galaxy-dist/lib/galaxy/tools/util) # for indexing maf files and for retrieving maf blocks that # intersect gene models. # Because maf_utilities.py is not available outside of galaxy, # required functions have been copied directly (below). # These functions have not been altered in the hope that maf_utilities # will one day be available as a stand-alone module. # The following classes/functions have been lifted directly from maf_utilities: # RegionAlignment() # GenomicRegionAlignment() # SplicedAlignment() # build_maf_index_species_chromosomes() # build_maf_index() # component_overlaps_region() # chop_block_by_region() # orient_block_by_region() # iter_blocks_split_by_species() # reduce_block_by_primary_genome() # fill_region_alignment() # get_spliced_region_alignment() # get_starts_ends_fields_from_gene_bed() # iter_components_by_src() GAP_CHARS = ['-'] SRC_SPLIT_CHAR = '.' def src_split(src): fields = src.split(SRC_SPLIT_CHAR, 1) spec = fields.pop(0) if fields: chrom = fields.pop(0) else: chrom = spec return spec, chrom # an object corresponding to a reference layered alignment class RegionAlignment(object): DNA_COMPLEMENT = str.maketrans("ACGTacgt", "TGCAtgca") MAX_SEQUENCE_SIZE = sys.maxsize # Maximum length of sequence allowed def __init__(self, size, species=[]): assert size <= self.MAX_SEQUENCE_SIZE, ("Maximum length allowed for an" " individual sequence has been" " exceeded (%i > %i)." % ( size, self.MAX_SEQUENCE_SIZE)) self.size = size self.sequences = {} if not isinstance(species, list): species = [species] for spec in species: self.add_species(spec) # add a species to the alignment def add_species(self, species): # make temporary sequence files self.sequences[species] = tempfile.TemporaryFile() self.sequences[species].write("-" * self.size) # returns the names for species found in alignment, skipping names as # requested def get_species_names(self, skip=[]): if not isinstance(skip, list): skip = [skip] names = list(self.sequences.keys()) for name in skip: try: names.remove(name) except: pass return names # returns the sequence for a species def get_sequence(self, species): self.sequences[species].seek(0) return self.sequences[species].read() # returns the reverse complement of the sequence for a species def get_sequence_reverse_complement(self, species): complement = [base for base in self.get_sequence( species).translate(self.DNA_COMPLEMENT)] complement.reverse() return "".join(complement) # sets a position for a species def set_position(self, index, species, base): if len(base) != 1: raise Exception("A genomic position can only have a length of 1.") return self.set_range(index, species, base) # sets a range for a species def set_range(self, index, species, bases): if index >= self.size or index < 0: raise Exception( "Your index (%i) is out of range (0 - %i)." % (index, self.size - 1)) if len(bases) == 0: raise Exception( "A set of genomic positions can only have a positive length.") if species not in list(self.sequences.keys()): self.add_species(species) self.sequences[species].seek(index) self.sequences[species].write(bases) # Flush temp file of specified species, or all species def flush(self, species=None): if species is None: species = list(self.sequences.keys()) elif not isinstance(species, list): species = [species] for spec in species: self.sequences[spec].flush() class GenomicRegionAlignment(RegionAlignment): def __init__(self, start, end, species=[]): RegionAlignment.__init__(self, end - start, species) self.start = start self.end = end class SplicedAlignment(object): DNA_COMPLEMENT = str.maketrans("ACGTacgt", "TGCAtgca") def __init__(self, exon_starts, exon_ends, species=[]): if not isinstance(exon_starts, list): exon_starts = [exon_starts] if not isinstance(exon_ends, list): exon_ends = [exon_ends] assert len(exon_starts) == len( exon_ends), "Number of starts does not match the number of sizes." self.exons = [] for i in range(len(exon_starts)): self.exons.append( GenomicRegionAlignment(exon_starts[i], exon_ends[i], species)) # returns the names for species found in alignment, skipping names as # requested def get_species_names(self, skip=[]): if not isinstance(skip, list): skip = [skip] names = [] for exon in self.exons: for name in exon.get_species_names(skip=skip): if name not in names: names.append(name) return names # returns the sequence for a species def get_sequence(self, species): sequence = tempfile.TemporaryFile() for exon in self.exons: if species in exon.get_species_names(): sequence.write(exon.get_sequence(species)) else: sequence.write("-" * exon.size) sequence.seek(0) return sequence.read() # returns the reverse complement of the sequence for a species def get_sequence_reverse_complement(self, species): complement = [base for base in self.get_sequence( species).translate(self.DNA_COMPLEMENT)] complement.reverse() return "".join(complement) # Start and end of coding region @property def start(self): return self.exons[0].start @property def end(self): return self.exons[-1].end def build_maf_index_species_chromosomes(filename, index_species=None): species = [] species_chromosomes = {} indexes = bx.interval_index_file.Indexes() blocks = 0 try: maf_reader = bx.align.maf.Reader(open(filename)) while True: pos = maf_reader.file.tell() block = next(maf_reader) if block is None: break blocks += 1 for c in block.components: spec = c.src chrom = None if "." in spec: spec, chrom = spec.split(".", 1) if spec not in species: species.append(spec) species_chromosomes[spec] = [] if chrom and chrom not in species_chromosomes[spec]: species_chromosomes[spec].append(chrom) if index_species is None or spec in index_species: forward_strand_start = c.forward_strand_start forward_strand_end = c.forward_strand_end try: forward_strand_start = int(forward_strand_start) forward_strand_end = int(forward_strand_end) except ValueError: # start and end are not integers, can't add component # to index, goto next component continue # this likely only occurs when parse_e_rows is True? # could a species exist as only e rows? should the if forward_strand_end > forward_strand_start: # require positive length; i.e. certain lines have # start = end = 0 and cannot be indexed indexes.add(c.src, forward_strand_start, forward_strand_end, pos, max=c.src_size) except Exception as e: # most likely a bad MAF log.debug('Building MAF index on %s failed: %s' % (filename, e)) return (None, [], {}, 0) return (indexes, species, species_chromosomes, blocks) # builds and returns ( index, index_filename ) for specified maf_file def build_maf_index(maf_file, species=None): indexes, found_species, species_chromosomes, blocks = \ build_maf_index_species_chromosomes(maf_file, species) if indexes is not None: fd, index_filename = tempfile.mkstemp() out = os.fdopen(fd, 'w') indexes.write(out) out.close() return (bx.align.maf.Indexed(maf_file, index_filename=index_filename, keep_open=True, parse_e_rows=False), index_filename) return (None, None) def component_overlaps_region(c, region): if c is None: return False start, end = c.get_forward_strand_start(), c.get_forward_strand_end() if region.start >= end or region.end <= start: return False return True def chop_block_by_region(block, src, region, species=None, mincols=0): # This chopping method was designed to maintain consistency with # how start/end padding gaps have been working in Galaxy thus far: # behavior as seen when forcing blocks to be '+' relative to src # sequence (ref) and # using block.slice_by_component( ref, slice_start, slice_end ) # whether-or-not this is the 'correct' behavior is questionable, # but this will at least maintain consistency # comments welcome slice_start = block.text_size # max for the min() slice_end = 0 # min for the max() old_score = block.score # save old score for later use # We no longer assume only one occurance of src per block, so we need to # check them all for c in iter_components_by_src(block, src): if component_overlaps_region(c, region): if c.text is not None: rev_strand = False if c.strand == "-": # We want our coord_to_col coordinates to be returned from # positive stranded component rev_strand = True c = c.reverse_complement() start = max(region.start, c.start) end = min(region.end, c.end) start = c.coord_to_col(start) end = c.coord_to_col(end) if rev_strand: # need to orient slice coordinates to the original block # direction slice_len = end - start end = len(c.text) - start start = end - slice_len slice_start = min(start, slice_start) slice_end = max(end, slice_end) if slice_start < slice_end: block = block.slice(slice_start, slice_end) if block.text_size > mincols: # restore old score, may not be accurate, but it is better than 0 # for everything? block.score = old_score if species is not None: block = block.limit_to_species(species) block.remove_all_gap_columns() return block return None def orient_block_by_region(block, src, region, force_strand=None): # loop through components matching src, # make sure each of these components overlap region # cache strand for each of overlaping regions # if force_strand / region.strand not in strand cache, reverse complement # we could have 2 sequences with same src, overlapping region, on # different strands, this would cause no reverse_complementing strands = [c.strand for c in iter_components_by_src( block, src) if component_overlaps_region(c, region)] if strands and (force_strand is None and region.strand not in strands) or \ (force_strand is not None and force_strand not in strands): block = block.reverse_complement() return block # split a block into multiple blocks with all combinations of a species # appearing only once per block def iter_blocks_split_by_species(block, species=None): def __split_components_by_species(components_by_species, new_block): if components_by_species: # more species with components to add to this block components_by_species = deepcopy(components_by_species) spec_comps = components_by_species.pop(0) for c in spec_comps: newer_block = deepcopy(new_block) newer_block.add_component(deepcopy(c)) for value in \ __split_components_by_species(components_by_species, newer_block): yield value else: # no more components to add, yield this block yield new_block # divide components by species spec_dict = {} if not species: species = [] for c in block.components: spec, chrom = src_split(c.src) if spec not in spec_dict: spec_dict[spec] = [] species.append(spec) spec_dict[spec].append(c) else: for spec in species: spec_dict[spec] = [] for c in iter_components_by_src_start(block, spec): spec_dict[spec].append(c) empty_block = bx.align.Alignment(score=block.score, attributes=deepcopy( block.attributes)) # should we copy attributes? empty_block.text_size = block.text_size # call recursive function to split into each combo of spec/blocks for value in __split_components_by_species(list(spec_dict.values()), empty_block): # restore original component order sort_block_components_by_block(value, block) yield value # reduces a block to only positions exisiting in the src provided def reduce_block_by_primary_genome(block, species, chromosome, region_start): # returns ( startIndex, {species:texts} # where texts' contents are reduced to only positions existing in the # primary genome src = "%s.%s" % (species, chromosome) ref = block.get_component_by_src(src) start_offset = ref.start - region_start species_texts = {} for c in block.components: species_texts[c.src.split('.')[0]] = list(c.text) # remove locations which are gaps in the primary species, starting from # the downstream end for i in range(len(species_texts[species]) - 1, -1, -1): if species_texts[species][i] == '-': for text in list(species_texts.values()): text.pop(i) for spec, text in list(species_texts.items()): species_texts[spec] = ''.join(text) return (start_offset, species_texts) def fill_region_alignment(alignment, index, primary_species, chrom, start, end, strand='+', species=None, mincols=0, overwrite_with_gaps=True): region = bx.intervals.Interval(start, end) region.chrom = chrom region.strand = strand primary_src = "%s.%s" % (primary_species, chrom) # Order blocks overlaping this position by score, lowest first blocks = [] for block, idx, offset in \ index.get_as_iterator_with_index_and_offset(primary_src, start, end): score = float(block.score) for i in range(0, len(blocks)): if score < blocks[i][0]: blocks.insert(i, (score, idx, offset)) break else: blocks.append((score, idx, offset)) # gap_chars_tuple = tuple( GAP_CHARS ) gap_chars_str = ''.join(GAP_CHARS) # Loop through ordered blocks and layer by increasing score for block_dict in blocks: # need to handle each occurance of sequence in block seperately for block in iter_blocks_split_by_species( block_dict[1].get_at_offset(block_dict[2])): if component_overlaps_region( block.get_component_by_src(primary_src), region): block = chop_block_by_region( block, primary_src, region, species, mincols) # chop block block = orient_block_by_region( block, primary_src, region) # orient block start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start) for spec, text in list(species_texts.items()): # we should trim gaps from both sides, since these are not # positions in this species genome (sequence) text = text.rstrip(gap_chars_str) gap_offset = 0 # python2.4 doesn't accept a tuple for .startswith() while True in [text.startswith( gap_char) for gap_char in GAP_CHARS]: # while text.startswith( gap_chars_tuple ): gap_offset += 1 text = text[1:] if not text: break if text: if overwrite_with_gaps: alignment.set_range( start_offset + gap_offset, spec, text) else: for i, char in enumerate(text): if char not in GAP_CHARS: alignment.set_position( start_offset + gap_offset + i, spec, char) return alignment def get_spliced_region_alignment(index, primary_species, chrom, starts, ends, strand='+', species=None, mincols=0, overwrite_with_gaps=True): """ Returns a filled spliced region alignment for specified region with start and end lists. """ # create spliced alignment object if species is not None: alignment = SplicedAlignment(starts, ends, species) else: alignment = SplicedAlignment(starts, ends, [primary_species]) for exon in alignment.exons: fill_region_alignment(exon, index, primary_species, chrom, exon.start, exon.end, strand, species, mincols, overwrite_with_gaps) return alignment # read a GeneBed file, return list of starts, ends, raw fields def get_starts_ends_fields_from_gene_bed(line): # Starts and ends for exons starts = [] ends = [] fields = line.split() # Requires atleast 12 BED columns if len(fields) < 12: raise Exception("Not a proper 12 column BED line (%s)." % line) chrom = fields[0] tx_start = int(fields[1]) tx_end = int(fields[2]) name = fields[3] strand = fields[5] if strand != '-': strand = '+' # Default strand is + cds_start = int(fields[6]) cds_end = int(fields[7]) # Calculate and store starts and ends of coding exons region_start, region_end = cds_start, cds_end exon_starts = list(map(int, fields[11].rstrip(',\n').split(','))) exon_starts = list(map((lambda x: x + tx_start), exon_starts)) exon_ends = list(map(int, fields[10].rstrip(',').split(','))) exon_ends = list(map((lambda x, y: x + y), exon_starts, exon_ends)) for start, end in zip(exon_starts, exon_ends): start = max(start, region_start) end = min(end, region_end) if start < end: starts.append(start) ends.append(end) return (starts, ends, fields) def iter_components_by_src(block, src): for c in block.components: if c.src == src: yield c def sort_block_components_by_block(block1, block2): # orders the components in block1 by the index of the component in block2 # block1 must be a subset of block2 # occurs in-place return block1.components.sort( cmp=lambda x, y: block2.components.index(x) - block2.components.index(y)) ########################################################################## # CGAT functions for extracting MAF alignments ########################################################################## def gtfToBed12(infile, outfile, model): """ Convert a gtf file to bed12 format. """ model = "gene" outfile = IOTools.openFile(outfile, "w") for all_exons in GTF.transcript_iterator( GTF.iterator(IOTools.openFile(infile, "r"))): chrom = all_exons[0].contig # GTF.iterator returns start co-ordinates as zero-based start = str(all_exons[0].start) end = str(all_exons[len(all_exons) - 1].end) # if model == "gene": # name = all_exons[0].gene_id # elif model == "transcript": # name = all_exons[0].transcript_id name = all_exons[0].gene_id + "__" + all_exons[0].transcript_id # else: # raise ValueError( "model must either be gene or transcript" ) score = "0" strand = all_exons[0].strand thickStart = start thickEnd = end colourRGB = "0" blockCount = str(len(all_exons)) sizes = [] starts = [] for exon in all_exons: blockSize = str(exon.end - (exon.start)) sizes.append(blockSize) # start + blockStart should return a zero-based co-ordinate for the # exon start blockStart = str((exon.start) - int(start)) starts.append(str(blockStart)) blockSizes = ','.join(sizes) blockStarts = ','.join(starts) outfile.write(chrom + "\t" + start + "\t" + end + "\t" + name + "\t" + score + "\t" + strand + "\t" + thickStart + "\t" + thickEnd + "\t" + colourRGB + "\t" + blockCount + "\t" + blockSizes + "\t" + blockStarts + "\n") outfile.close() def filterMAF(infile, outfile, removed, filter_alignments=False): """ Iterates through the MAF file. If filter_alignments == int, then will remove MAF blocks for which length < int. """ inf = bx.align.maf.Reader(open(infile)) outf = bx.align.maf.Writer(open(outfile, "w")) outf_rj = bx.align.maf.Writer(open(removed, "w")) removed = 0 included = 0 if filter_alignments: for block in inf: if len([x for x in block.column_iter() if x[0] != "-"]) < \ int(filter_alignments): removed += 1 outf_rj.write(block) else: included += 1 outf.write(block) else: for block in inf: outf.write(block) outf.close() outf_rj.close() return (removed, included) def extractGeneBlocks(bedfile, maf_file, outfile, primary_species, secondary_species): """ Is based on Dan Blankenburg's interval_to_maf_merged_fasta.py Receives a bed12 containing intervals of interest, and maf containing pairwise genomic alignment. Iterates through bed intervals and outputs intervals in fasta format. See comments in maf_utilities.py: maf blocks are always extracted in a positive strand orientation relative to the src alignment, reverse complementing is then done using method AlignedSequence method get_sequence_reverse_complement. MAF file is indexed on the fly using bx.align.maf.MultiIndexed """ index, index_filename = build_maf_index(maf_file) output = IOTools.openFile(outfile, "w") regions_extracted = 0 # iterate through intervals for line_count, line in enumerate(IOTools.openFile(bedfile).readlines()): try: # retrieve exon starts & ends, plus all gtf fields starts, ends, fields = get_starts_ends_fields_from_gene_bed(line) # create spliced alignment (N.B. strand always +ve) # for pep8 spc = [primary_species, secondary_species] alignment = get_spliced_region_alignment(index, primary_species, fields[0], starts, ends, strand='+', species=spc, mincols=0, overwrite_with_gaps=False) primary_name = secondary_name = fields[3] alignment_strand = fields[5] except Exception as e: print("Error loading exon positions from input line %i: %s" % (line_count, e)) break # write the stiched sequence to outfile in the correct orientation output.write(">%s.%s\n" % (primary_species, primary_name)) if alignment_strand == "-": output.write( alignment.get_sequence_reverse_complement(primary_species)) else: output.write(alignment.get_sequence(primary_species)) output.write("\n") output.write(">%s.%s\n" % (secondary_species, secondary_name)) if alignment_strand == "-": output.write( alignment.get_sequence_reverse_complement(secondary_species)) else: output.write(alignment.get_sequence(secondary_species)) output.write("\n") regions_extracted += 1 output.close() return regions_extracted ########################################################################## ########################################################################## def complement(template): """ Generates the reverse complement of a template sequence """ # Turn the string around using slicing backward_template = template[::-1] # Create the complementary sequence from the backward template reverse_template = backward_template.translate( string.maketrans("ACTGactg", "TGACtgac")) return reverse_template def extractMAFGeneBlocks(bedfile, maf_file, genome_file, outfile, primary_species, secondary_species, keep_gaps=True): """ Is based on Dan Blankenburg's interval_to_maf_merged_fasta.py Receives a bed12 containing intervals of interest, and maf containing pairwise genomic alignment. Iterates through bed intervals and outputs intervals in fasta format. See comments in maf_utilities.py: maf blocks are always extracted in a positive strand orientation relative to the src alignment, reverse complementing is then done using method AlignedSequence method get_sequence_reverse_complement. MAF file is indexed on the fly using bx.align.maf.MultiIndexed """ index, index_filename = build_maf_index(maf_file) output = IOTools.openFile(outfile, "w") regions_extracted = 0 # iterate through intervals for line_count, line in enumerate(IOTools.openFile(bedfile).readlines()): try: # retrieve exon starts & ends, plus all gtf fields starts, ends, fields = get_starts_ends_fields_from_gene_bed(line) # create spliced alignment (N.B. strand always +ve) # for pep8 purposes spec = [primary_species, secondary_species] alignment = get_spliced_region_alignment(index, primary_species, fields[0], starts, ends, strand='+', species=spec, mincols=0, overwrite_with_gaps=False) primary_name = secondary_name = fields[3] alignment_strand = fields[5] except Exception as e: print("Error loading exon positions from input line %i: %s" % (line_count, e)) break if keep_gaps: # write the stiched sequence to outfile in the correct orientation output.write(">%s.%s\n" % (primary_species, primary_name)) if alignment_strand == "-": output.write( alignment.get_sequence_reverse_complement(primary_species)) else: output.write(alignment.get_sequence(primary_species)) output.write("\n") output.write(">%s.%s\n" % (secondary_species, secondary_name)) if alignment_strand == "-": output.write( alignment.get_sequence_reverse_complement( secondary_species)) else: output.write(alignment.get_sequence(secondary_species)) output.write("\n") else: # create indexed fasta fasta = IndexedFasta.IndexedFasta(genome_file) # retrieve exon sequence exon_list = [] for exon in alignment.exons: exon_list.append( fasta.getSequence(fields[0], "+", exon.start, exon.end)) # write the stitched sequence to outfile in the correct orientation output.write(">%s.%s\n" % (primary_species, primary_name)) if alignment_strand == "-": output.write("".join([complement(x) for x in exon_list])) else: output.write("".join([x for x in exon_list])) output.write("\n") output.write(">%s.%s\n" % (secondary_species, secondary_name)) if alignment_strand == "-": output.write( alignment.get_sequence_reverse_complement( secondary_species)) else: output.write(alignment.get_sequence(secondary_species)) output.write("\n") regions_extracted += 1 output.close() return regions_extracted ########################################################################## ########################################################################## def splitAlignedFasta(infile, out_stub, name_dict): """ Receives a fasta file containing multiple sequence alignments. Splits into multiple outfiles, each containing sequence with the same interval_id. Identifiers must be in format >species.interval_id name_dict specifies the format for the outfile identifiers """ infile = IOTools.openFile(infile).readlines() current_id = "" line_number = 0 for line in infile: line = line.rstrip() line_number += 1 if line_number == 1: current_id = line.split(".")[1] out = open(os.path.join(out_stub, current_id + ".fasta"), "w") if line_number % 2 == 1: gene_id = line.split(".")[1] if gene_id == current_id: species = line.split(".")[0] out.write(name_dict[species] + "\n") else: out.close() current_id = gene_id out = os.path.join(out_stub, current_id + ".fasta") if os.path.exists(out): raise IOError("There are two transcript with gene_id %s &" " transcript_id %s" % current_id.split("__")) else: out = open(out, "w") out.write(name_dict[line.split(".")[0]] + "\n") else: out.write(line + "\n") out.close() def removeGapsFromAlignedFasta(in_dir, out_dir, min_length=0): """ Receives a fasta file containing two or more aligned sequences, removes gaps from the reference (first) alignment in file and removes corresponding gaps intervals from subsequence sequence. Any region of sequence flanked by gaps that is smaller than a specified min length may also be removed WARNING: using this function will likely cause frame shifts in resulting sequence. """ if not out_dir.endswith("/"): out_dir = out_dir + "/" fasta_files = os.listdir(in_dir) X = 0 for fasta in fasta_files: X += 1 if X > 5: break print(fasta) print(os.path.abspath(fasta)) print(os.path.join(in_dir, fasta)) file_name = P.snip(os.path.basename(fasta), ".fasta") lines = [line.strip() for line in open(fasta).readlines()] # reference sequence name name = lines[0] # the reference sequence seq = lines[1] # return a list of start, end for ungapped alignment regions in # reference regex = re.compile("\w+") intervals = [(x.start(), x.end()) for x in regex.finditer(seq)] x = 1 for interval in intervals: outfile = "".join(file_name, "__", str(x), ".fasta") # remove intervals below specified length if interval[1] - interval[0] <= int(min_length): continue else: # remove gapped regions from reference and subsequent # alignments out = open(os.path.join(out_dir, outfile), "w") out.write(name + "\n") out.write(seq[interval[0]:interval[1]]) for line in enumerate(lines[2:], 1): if line[0] % 2 == 1: out.write(line + "\n") else: out.write(line[interval[0]:interval[1]]) out.close() x += 1 def runPhyloCSF(in_fasta, tmp_dir, outfile): """ not actually used... plus removing gaps is not a good idea """ statement = ("zcat %(in_fasta)s |" " cgat farm" " --split-at-regex='\n(\s*)\n'" " --chunk-size=1" " --output-header" " --temp-dir=%(tmp_dir)s" " --use-cluster" " --log=%(outfile)s.log" " PhyloCSF 29mammals" " --frames=3" " --removeRefGaps" " --species=%(species)s" " > %(outfile)s") def parsePhyloCSF(infile, outfile): """ Write phyloCSF result file out in a more readable format. """ outf = IOTools.openFile(outfile, "w") outf.write("gene_id\ttranscript_id\tscore\tstart\tend\n") for line in IOTools.openFile(infile).readlines(): line = line.split() gene_id_transcript_id = P.snip(os.path.basename(line[0]), ".phyloCSF") gene_id, transcript_id = gene_id_transcript_id.split("__") line_out = [gene_id, transcript_id, line[3], line[4], line[5]] outf.write("\t".join(line_out) + "\n") outf.close()
CGATOxford/CGATPipelines
obsolete/PipelineLncRNA.py
Python
mit
100,312
[ "Galaxy" ]
0d11493c36124ac0988b4365f1725d51f8fec611e850d58f1f76211c3868cb36
# vim:fileencoding=UTF-8:ts=4:sw=4:sta:et:sts=4:ai from __future__ import with_statement __license__ = 'GPL 3' __copyright__ = '2009, Kovid Goyal <kovid@kovidgoyal.net>' __docformat__ = 'restructuredtext en' from itertools import izip from calibre.customize import Plugin as _Plugin FONT_SIZES = [('xx-small', 1), ('x-small', None), ('small', 2), ('medium', 3), ('large', 4), ('x-large', 5), ('xx-large', 6), (None, 7)] class Plugin(_Plugin): fbase = 12 fsizes = [5, 7, 9, 12, 13.5, 17, 20, 22, 24] screen_size = (1600, 1200) dpi = 100 def __init__(self, *args, **kwargs): _Plugin.__init__(self, *args, **kwargs) self.width, self.height = self.screen_size fsizes = list(self.fsizes) self.fkey = list(self.fsizes) self.fsizes = [] for (name, num), size in izip(FONT_SIZES, fsizes): self.fsizes.append((name, num, float(size))) self.fnames = dict((name, sz) for name, _, sz in self.fsizes if name) self.fnums = dict((num, sz) for _, num, sz in self.fsizes if num) self.width_pts = self.width * 72./self.dpi self.height_pts = self.height * 72./self.dpi # Input profiles {{{ class InputProfile(Plugin): author = 'Kovid Goyal' supported_platforms = set(['windows', 'osx', 'linux']) can_be_disabled = False type = _('Input profile') name = 'Default Input Profile' short_name = 'default' # Used in the CLI so dont use spaces etc. in it description = _('This profile tries to provide sane defaults and is useful ' 'if you know nothing about the input document.') class SonyReaderInput(InputProfile): name = 'Sony Reader' short_name = 'sony' description = _('This profile is intended for the SONY PRS line. ' 'The 500/505/600/700 etc.') screen_size = (584, 754) dpi = 168.451 fbase = 12 fsizes = [7.5, 9, 10, 12, 15.5, 20, 22, 24] class SonyReader300Input(SonyReaderInput): name = 'Sony Reader 300' short_name = 'sony300' description = _('This profile is intended for the SONY PRS 300.') dpi = 200 class SonyReader900Input(SonyReaderInput): author = 'John Schember' name = 'Sony Reader 900' short_name = 'sony900' description = _('This profile is intended for the SONY PRS-900.') screen_size = (584, 978) class MSReaderInput(InputProfile): name = 'Microsoft Reader' short_name = 'msreader' description = _('This profile is intended for the Microsoft Reader.') screen_size = (480, 652) dpi = 96 fbase = 13 fsizes = [10, 11, 13, 16, 18, 20, 22, 26] class MobipocketInput(InputProfile): name = 'Mobipocket Books' short_name = 'mobipocket' description = _('This profile is intended for the Mobipocket books.') # Unfortunately MOBI books are not narrowly targeted, so this information is # quite likely to be spurious screen_size = (600, 800) dpi = 96 fbase = 18 fsizes = [14, 14, 16, 18, 20, 22, 24, 26] class HanlinV3Input(InputProfile): name = 'Hanlin V3' short_name = 'hanlinv3' description = _('This profile is intended for the Hanlin V3 and its clones.') # Screen size is a best guess screen_size = (584, 754) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class HanlinV5Input(HanlinV3Input): name = 'Hanlin V5' short_name = 'hanlinv5' description = _('This profile is intended for the Hanlin V5 and its clones.') # Screen size is a best guess screen_size = (584, 754) dpi = 200 class CybookG3Input(InputProfile): name = 'Cybook G3' short_name = 'cybookg3' description = _('This profile is intended for the Cybook G3.') # Screen size is a best guess screen_size = (600, 800) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class CybookOpusInput(InputProfile): author = 'John Schember' name = 'Cybook Opus' short_name = 'cybook_opus' description = _('This profile is intended for the Cybook Opus.') # Screen size is a best guess screen_size = (600, 800) dpi = 200 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class KindleInput(InputProfile): name = 'Kindle' short_name = 'kindle' description = _('This profile is intended for the Amazon Kindle.') # Screen size is a best guess screen_size = (525, 640) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class IlliadInput(InputProfile): name = 'Illiad' short_name = 'illiad' description = _('This profile is intended for the Irex Illiad.') screen_size = (760, 925) dpi = 160.0 fbase = 12 fsizes = [7.5, 9, 10, 12, 15.5, 20, 22, 24] class IRexDR1000Input(InputProfile): author = 'John Schember' name = 'IRex Digital Reader 1000' short_name = 'irexdr1000' description = _('This profile is intended for the IRex Digital Reader 1000.') # Screen size is a best guess screen_size = (1024, 1280) dpi = 160 fbase = 16 fsizes = [12, 14, 16, 18, 20, 22, 24] class IRexDR800Input(InputProfile): author = 'Eric Cronin' name = 'IRex Digital Reader 800' short_name = 'irexdr800' description = _('This profile is intended for the IRex Digital Reader 800.') screen_size = (768, 1024) dpi = 160 fbase = 16 fsizes = [12, 14, 16, 18, 20, 22, 24] class NookInput(InputProfile): author = 'John Schember' name = 'Nook' short_name = 'nook' description = _('This profile is intended for the B&N Nook.') # Screen size is a best guess screen_size = (600, 800) dpi = 167 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] input_profiles = [InputProfile, SonyReaderInput, SonyReader300Input, SonyReader900Input, MSReaderInput, MobipocketInput, HanlinV3Input, HanlinV5Input, CybookG3Input, CybookOpusInput, KindleInput, IlliadInput, IRexDR1000Input, IRexDR800Input, NookInput] input_profiles.sort(cmp=lambda x,y:cmp(x.name.lower(), y.name.lower())) # }}} class OutputProfile(Plugin): author = 'Kovid Goyal' supported_platforms = set(['windows', 'osx', 'linux']) can_be_disabled = False type = _('Output profile') name = 'Default Output Profile' short_name = 'default' # Used in the CLI so dont use spaces etc. in it description = _('This profile tries to provide sane defaults and is useful ' 'if you want to produce a document intended to be read at a ' 'computer or on a range of devices.') #: The image size for comics comic_screen_size = (584, 754) #: If True the MOBI renderer on the device supports MOBI indexing supports_mobi_indexing = False #: If True output should be optimized for a touchscreen interface touchscreen = False touchscreen_news_css = '' #: A list of extra (beyond CSS 2.1) modules supported by the device #: Format is a cssutils profile dictionary (see iPad for example) extra_css_modules = [] #: If True, the date is appended to the title of downloaded news periodical_date_in_title = True #: Characters used in jackets and catalogs ratings_char = u'*' empty_ratings_char = u' ' #: Unsupported unicode characters to be replaced during preprocessing unsupported_unicode_chars = [] #: Number of ems that the left margin of a blockquote is rendered as mobi_ems_per_blockquote = 1.0 #: Special periodical formatting needed in EPUB epub_periodical_format = None @classmethod def tags_to_string(cls, tags): from xml.sax.saxutils import escape return escape(', '.join(tags)) class iPadOutput(OutputProfile): name = 'iPad' short_name = 'ipad' description = _('Intended for the iPad and similar devices with a ' 'resolution of 768x1024') screen_size = (768, 1024) comic_screen_size = (768, 1024) dpi = 132.0 extra_css_modules = [ { 'name':'webkit', 'props': { '-webkit-border-bottom-left-radius':'{length}', '-webkit-border-bottom-right-radius':'{length}', '-webkit-border-top-left-radius':'{length}', '-webkit-border-top-right-radius':'{length}', '-webkit-border-radius': r'{border-width}(\s+{border-width}){0,3}|inherit', }, 'macros': {'border-width': '{length}|medium|thick|thin'} } ] ratings_char = u'\u2605' # filled star empty_ratings_char = u'\u2606' # hollow star touchscreen = True # touchscreen_news_css {{{ touchscreen_news_css = u''' /* hr used in articles */ .article_articles_list { width:18%; } .article_link { color: #593f29; font-style: italic; } .article_next { -webkit-border-top-right-radius:4px; -webkit-border-bottom-right-radius:4px; font-style: italic; width:32%; } .article_prev { -webkit-border-top-left-radius:4px; -webkit-border-bottom-left-radius:4px; font-style: italic; width:32%; } .article_sections_list { width:18%; } .articles_link { font-weight: bold; } .sections_link { font-weight: bold; } .caption_divider { border:#ccc 1px solid; } .touchscreen_navbar { background:#c3bab2; border:#ccc 0px solid; border-collapse:separate; border-spacing:1px; margin-left: 5%; margin-right: 5%; page-break-inside:avoid; width: 90%; -webkit-border-radius:4px; } .touchscreen_navbar td { background:#fff; font-family:Helvetica; font-size:80%; /* UI touchboxes use 8px padding */ padding: 6px; text-align:center; } .touchscreen_navbar td a:link { color: #593f29; text-decoration: none; } /* Index formatting */ .publish_date { text-align:center; } .divider { border-bottom:1em solid white; border-top:1px solid gray; } hr.caption_divider { border-color:black; border-style:solid; border-width:1px; } /* Feed summary formatting */ .article_summary { display:inline-block; padding-bottom:0.5em; } .feed { font-family:sans-serif; font-weight:bold; font-size:larger; } .feed_link { font-style: italic; } .feed_next { -webkit-border-top-right-radius:4px; -webkit-border-bottom-right-radius:4px; font-style: italic; width:40%; } .feed_prev { -webkit-border-top-left-radius:4px; -webkit-border-bottom-left-radius:4px; font-style: italic; width:40%; } .feed_title { text-align: center; font-size: 160%; } .feed_up { font-weight: bold; width:20%; } .summary_headline { font-weight:bold; text-align:left; } .summary_byline { text-align:left; font-family:monospace; } .summary_text { text-align:left; } ''' # }}} class iPad3Output(iPadOutput): screen_size = comic_screen_size = (2048, 1536) dpi = 264.0 name = 'iPad 3' short_name = 'ipad3' description = _('Intended for the iPad 3 and similar devices with a ' 'resolution of 1536x2048') class TabletOutput(iPadOutput): name = 'Tablet' short_name = 'tablet' description = _('Intended for generic tablet devices, does no resizing of images') screen_size = (10000, 10000) comic_screen_size = (10000, 10000) class SamsungGalaxy(TabletOutput): name = 'Samsung Galaxy' short_name = 'galaxy' description = _('Intended for the Samsung Galaxy and similar tablet devices with ' 'a resolution of 600x1280') screen_size = comic_screen_size = (600, 1280) class NookHD(TabletOutput): name = 'Nook HD+' short_name = 'nook_hd_plus' description = _('Intended for the Nook HD+ and similar tablet devices with ' 'a resolution of 1280x1920') screen_size = comic_screen_size = (1280, 1920) class SonyReaderOutput(OutputProfile): name = 'Sony Reader' short_name = 'sony' description = _('This profile is intended for the SONY PRS line. ' 'The 500/505/600/700 etc.') screen_size = (590, 775) dpi = 168.451 fbase = 12 fsizes = [7.5, 9, 10, 12, 15.5, 20, 22, 24] unsupported_unicode_chars = [u'\u201f', u'\u201b'] epub_periodical_format = 'sony' #periodical_date_in_title = False class KoboReaderOutput(OutputProfile): name = 'Kobo Reader' short_name = 'kobo' description = _('This profile is intended for the Kobo Reader.') screen_size = (536, 710) comic_screen_size = (536, 710) dpi = 168.451 fbase = 12 fsizes = [7.5, 9, 10, 12, 15.5, 20, 22, 24] class SonyReader300Output(SonyReaderOutput): author = 'John Schember' name = 'Sony Reader 300' short_name = 'sony300' description = _('This profile is intended for the SONY PRS-300.') dpi = 200 class SonyReader900Output(SonyReaderOutput): author = 'John Schember' name = 'Sony Reader 900' short_name = 'sony900' description = _('This profile is intended for the SONY PRS-900.') screen_size = (600, 999) comic_screen_size = screen_size class GenericEink(SonyReaderOutput): name = 'Generic e-ink' short_name = 'generic_eink' description = _('Suitable for use with any e-ink device') epub_periodical_format = None class GenericEinkLarge(GenericEink): name = 'Generic e-ink large' short_name = 'generic_eink_large' description = _('Suitable for use with any large screen e-ink device') screen_size = (600, 999) comic_screen_size = screen_size class JetBook5Output(OutputProfile): name = 'JetBook 5-inch' short_name = 'jetbook5' description = _('This profile is intended for the 5-inch JetBook.') screen_size = (480, 640) dpi = 168.451 class SonyReaderLandscapeOutput(SonyReaderOutput): name = 'Sony Reader Landscape' short_name = 'sony-landscape' description = _('This profile is intended for the SONY PRS line. ' 'The 500/505/700 etc, in landscape mode. Mainly useful ' 'for comics.') screen_size = (784, 1012) comic_screen_size = (784, 1012) class MSReaderOutput(OutputProfile): name = 'Microsoft Reader' short_name = 'msreader' description = _('This profile is intended for the Microsoft Reader.') screen_size = (480, 652) dpi = 96 fbase = 13 fsizes = [10, 11, 13, 16, 18, 20, 22, 26] class MobipocketOutput(OutputProfile): name = 'Mobipocket Books' short_name = 'mobipocket' description = _('This profile is intended for the Mobipocket books.') # Unfortunately MOBI books are not narrowly targeted, so this information is # quite likely to be spurious screen_size = (600, 800) dpi = 96 fbase = 18 fsizes = [14, 14, 16, 18, 20, 22, 24, 26] class HanlinV3Output(OutputProfile): name = 'Hanlin V3' short_name = 'hanlinv3' description = _('This profile is intended for the Hanlin V3 and its clones.') # Screen size is a best guess screen_size = (584, 754) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class HanlinV5Output(HanlinV3Output): name = 'Hanlin V5' short_name = 'hanlinv5' description = _('This profile is intended for the Hanlin V5 and its clones.') dpi = 200 class CybookG3Output(OutputProfile): name = 'Cybook G3' short_name = 'cybookg3' description = _('This profile is intended for the Cybook G3.') # Screen size is a best guess screen_size = (600, 800) comic_screen_size = (600, 757) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class CybookOpusOutput(SonyReaderOutput): author = 'John Schember' name = 'Cybook Opus' short_name = 'cybook_opus' description = _('This profile is intended for the Cybook Opus.') # Screen size is a best guess dpi = 200 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] epub_periodical_format = None class KindleOutput(OutputProfile): name = 'Kindle' short_name = 'kindle' description = _('This profile is intended for the Amazon Kindle.') # Screen size is a best guess screen_size = (525, 640) dpi = 168.451 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] supports_mobi_indexing = True periodical_date_in_title = False empty_ratings_char = u'\u2606' ratings_char = u'\u2605' mobi_ems_per_blockquote = 2.0 @classmethod def tags_to_string(cls, tags): return u'%s <br/><span style="color:white">%s</span>' % (', '.join(tags), 'ttt '.join(tags)+'ttt ') class KindleDXOutput(OutputProfile): name = 'Kindle DX' short_name = 'kindle_dx' description = _('This profile is intended for the Amazon Kindle DX.') # Screen size is a best guess screen_size = (744, 1022) dpi = 150.0 comic_screen_size = (771, 1116) #comic_screen_size = (741, 1022) supports_mobi_indexing = True periodical_date_in_title = False empty_ratings_char = u'\u2606' ratings_char = u'\u2605' mobi_ems_per_blockquote = 2.0 @classmethod def tags_to_string(cls, tags): return u'%s <br/><span style="color: white">%s</span>' % (', '.join(tags), 'ttt '.join(tags)+'ttt ') class KindlePaperWhiteOutput(KindleOutput): name = 'Kindle PaperWhite' short_name = 'kindle_pw' description = _('This profile is intended for the Amazon Kindle PaperWhite') # Screen size is a best guess screen_size = (658, 940) dpi = 212.0 comic_screen_size = screen_size class KindleFireOutput(KindleDXOutput): name = 'Kindle Fire' short_name = 'kindle_fire' description = _('This profile is intended for the Amazon Kindle Fire.') screen_size = (570, 1016) dpi = 169.0 comic_screen_size = (570, 1016) @classmethod def tags_to_string(cls, tags): # The idiotic fire doesn't obey the color:white directive from xml.sax.saxutils import escape return escape(', '.join(tags)) class IlliadOutput(OutputProfile): name = 'Illiad' short_name = 'illiad' description = _('This profile is intended for the Irex Illiad.') screen_size = (760, 925) comic_screen_size = (760, 925) dpi = 160.0 fbase = 12 fsizes = [7.5, 9, 10, 12, 15.5, 20, 22, 24] class IRexDR1000Output(OutputProfile): author = 'John Schember' name = 'IRex Digital Reader 1000' short_name = 'irexdr1000' description = _('This profile is intended for the IRex Digital Reader 1000.') # Screen size is a best guess screen_size = (1024, 1280) comic_screen_size = (996, 1241) dpi = 160 fbase = 16 fsizes = [12, 14, 16, 18, 20, 22, 24] class IRexDR800Output(OutputProfile): author = 'Eric Cronin' name = 'IRex Digital Reader 800' short_name = 'irexdr800' description = _('This profile is intended for the IRex Digital Reader 800.') # Screen size is a best guess screen_size = (768, 1024) comic_screen_size = (768, 1024) dpi = 160 fbase = 16 fsizes = [12, 14, 16, 18, 20, 22, 24] class NookOutput(OutputProfile): author = 'John Schember' name = 'Nook' short_name = 'nook' description = _('This profile is intended for the B&N Nook.') # Screen size is a best guess screen_size = (600, 730) comic_screen_size = (584, 730) dpi = 167 fbase = 16 fsizes = [12, 12, 14, 16, 18, 20, 22, 24] class NookColorOutput(NookOutput): name = 'Nook Color' short_name = 'nook_color' description = _('This profile is intended for the B&N Nook Color.') screen_size = (600, 900) comic_screen_size = (594, 900) dpi = 169 class BambookOutput(OutputProfile): author = 'Li Fanxi' name = 'Sanda Bambook' short_name = 'bambook' description = _('This profile is intended for the Sanda Bambook.') # Screen size is for full screen display screen_size = (580, 780) # Comic size is for normal display comic_screen_size = (540, 700) dpi = 168.451 fbase = 12 fsizes = [10, 12, 14, 16] class PocketBook900Output(OutputProfile): author = 'Chris Lockfort' name = 'PocketBook Pro 900' short_name = 'pocketbook_900' description = _('This profile is intended for the PocketBook Pro 900 series of devices.') screen_size = (810, 1180) dpi = 150.0 comic_screen_size = screen_size class PocketBookPro912Output(OutputProfile): author = 'Daniele Pizzolli' name = 'PocketBook Pro 912' short_name = 'pocketbook_pro_912' description = _('This profile is intended for the PocketBook Pro 912 series of devices.') # According to http://download.pocketbook-int.com/user-guides/E_Ink/912/User_Guide_PocketBook_912(EN).pdf screen_size = (825, 1200) dpi = 155.0 comic_screen_size = screen_size output_profiles = [OutputProfile, SonyReaderOutput, SonyReader300Output, SonyReader900Output, MSReaderOutput, MobipocketOutput, HanlinV3Output, HanlinV5Output, CybookG3Output, CybookOpusOutput, KindleOutput, iPadOutput, iPad3Output, KoboReaderOutput, TabletOutput, SamsungGalaxy, SonyReaderLandscapeOutput, KindleDXOutput, IlliadOutput, NookHD, IRexDR1000Output, IRexDR800Output, JetBook5Output, NookOutput, BambookOutput, NookColorOutput, PocketBook900Output, PocketBookPro912Output, GenericEink, GenericEinkLarge, KindleFireOutput, KindlePaperWhiteOutput] output_profiles.sort(cmp=lambda x,y:cmp(x.name.lower(), y.name.lower()))
sss/calibre-at-bzr
src/calibre/customize/profiles.py
Python
gpl-3.0
25,766
[ "Galaxy" ]
331363d05f7792ffa6e66f2f8ba7589f59faa07fdeddb0036ff1bcc4996d89d5
# -*- coding: utf-8 -*- ## ## This file is part of Invenio. ## Copyright (C) 2011 CERN. ## ## Invenio is free software; you can redistribute it and/or ## modify it under the terms of the GNU General Public License as ## published by the Free Software Foundation; either version 2 of the ## License, or (at your option) any later version. ## ## Invenio is distributed in the hope that it will be useful, but ## WITHOUT ANY WARRANTY; without even the implied warranty of ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU ## General Public License for more details. ## ## You should have received a copy of the GNU General Public License ## along with Invenio; if not, write to the Free Software Foundation, Inc., ## 59 Temple Place, Suite 330, Boston, MA 02111-1307, USA. """Bibauthorid Web Interface Logic and URL handler.""" # pylint: disable=W0105 # pylint: disable=C0301 # pylint: disable=W0613 from cgi import escape from copy import deepcopy from pprint import pformat try: from invenio.jsonutils import json, CFG_JSON_AVAILABLE except: CFG_JSON_AVAILABLE = False json = None from invenio.bibauthorid_config import CLAIMPAPER_ADMIN_ROLE from invenio.bibauthorid_config import CLAIMPAPER_USER_ROLE #from invenio.bibauthorid_config import EXTERNAL_CLAIMED_RECORDS_KEY from invenio.config import CFG_SITE_LANG from invenio.config import CFG_SITE_URL from invenio.config import CFG_SITE_NAME from invenio.config import CFG_INSPIRE_SITE #from invenio.config import CFG_SITE_SECURE_URL from invenio.webpage import page, pageheaderonly, pagefooteronly from invenio.messages import gettext_set_language #, wash_language from invenio.template import load from invenio.webinterface_handler import wash_urlargd, WebInterfaceDirectory from invenio.session import get_session from invenio.urlutils import redirect_to_url from invenio.webuser import getUid, page_not_authorized, collect_user_info, set_user_preferences from invenio.webuser import email_valid_p, emailUnique from invenio.webuser import get_email_from_username, get_uid_from_email, isUserSuperAdmin from invenio.access_control_admin import acc_find_user_role_actions from invenio.access_control_admin import acc_get_user_roles, acc_get_role_id from invenio.search_engine import perform_request_search, sort_records from invenio.search_engine_utils import get_fieldvalues import invenio.bibauthorid_webapi as webapi import invenio.bibauthorid_config as bconfig from invenio.bibauthorid_frontinterface import get_bibrefrec_name_string from invenio.bibauthorid_frontinterface import update_personID_names_string_set from pprint import pformat TEMPLATE = load('bibauthorid') class WebInterfaceBibAuthorIDPages(WebInterfaceDirectory): """ Handle /person pages and AJAX requests Supplies the methods /person/<string> /person/action /person/welcome /person/search /person/you -> /person/<string> /person/export /person/claimstub """ _exports = ['', 'action', 'welcome', 'search', 'you', 'export', 'tickets_admin', 'claimstub'] def __init__(self, person_id=None): """ Constructor of the web interface. @param person_id: The identifier of a user. Can be one of: - a bibref: e.g. "100:1442,155" - a person id: e.g. "14" - a canonical id: e.g. "Ellis_J_1" @type person_id: string @return: will return an empty object if the identifier is of wrong type @rtype: None (if something is not right) """ pid = -1 is_bibref = False is_canonical_id = False self.adf = self.__init_call_dispatcher() if (not isinstance(person_id, str)) or (not person_id): self.person_id = pid return None if person_id.count(":") and person_id.count(","): is_bibref = True elif webapi.is_valid_canonical_id(person_id): is_canonical_id = True if is_bibref and pid > -2: bibref = person_id table, ref, bibrec = None, None, None if not bibref.count(":"): pid = -2 if not bibref.count(","): pid = -2 try: table = bibref.split(":")[0] ref = bibref.split(":")[1].split(",")[0] bibrec = bibref.split(":")[1].split(",")[1] except IndexError: pid = -2 try: table = int(table) ref = int(ref) bibrec = int(bibrec) except (ValueError, TypeError): pid = -2 if pid == -1: try: pid = int(webapi.get_person_id_from_paper(person_id)) except (ValueError, TypeError): pid = -1 else: pid = -1 elif is_canonical_id: try: pid = int(webapi.get_person_id_from_canonical_id(person_id)) except (ValueError, TypeError): pid = -1 else: try: pid = int(person_id) except ValueError: pid = -1 self.person_id = pid def __call__(self, req, form): ''' Serve the main person page. Will use the object's person id to get a person's information. @param req: Apache Request Object @type req: Apache Request Object @param form: Parameters sent via GET or POST request @type form: dict @return: a full page formatted in HTML @return: string ''' self._session_bareinit(req) argd = wash_urlargd(form, {'ln': (str, CFG_SITE_LANG), 'verbose': (int, 0), 'ticketid': (int, -1), 'open_claim': (str, None)}) ln = argd['ln'] # ln = wash_language(argd['ln']) rt_ticket_id = argd['ticketid'] req.argd = argd #needed for perform_req_search session = get_session(req) ulevel = self.__get_user_role(req) uid = getUid(req) if self.person_id < 0: return redirect_to_url(req, "%s/person/search" % (CFG_SITE_URL)) if isUserSuperAdmin({'uid': uid}): ulevel = 'admin' no_access = self._page_access_permission_wall(req, [self.person_id]) if no_access: return no_access try: pinfo = session["personinfo"] except KeyError: pinfo = dict() session['personinfo'] = pinfo if 'open_claim' in argd and argd['open_claim']: pinfo['claim_in_process'] = True elif "claim_in_process" in pinfo and pinfo["claim_in_process"]: pinfo['claim_in_process'] = True else: pinfo['claim_in_process'] = False uinfo = collect_user_info(req) uinfo['precached_viewclaimlink'] = pinfo['claim_in_process'] set_user_preferences(uid, uinfo) pinfo['ulevel'] = ulevel if self.person_id != -1: pinfo["claimpaper_admin_last_viewed_pid"] = self.person_id pinfo["ln"] = ln if not "ticket" in pinfo: pinfo["ticket"] = [] if rt_ticket_id: pinfo["admin_requested_ticket_id"] = rt_ticket_id session.save() content = '' for part in ['optional_menu', 'ticket_box', 'personid_info', 'tabs', 'footer']: content += self.adf[part][ulevel](req, form, ln) title = self.adf['title'][ulevel](req, form, ln) body = TEMPLATE.tmpl_person_detail_layout(content) metaheaderadd = self._scripts() self._clean_ticket(req) return page(title=title, metaheaderadd=metaheaderadd, body=body, req=req, language=ln) def _page_access_permission_wall(self, req, req_pid=None, req_level=None): ''' Display an error page if user not authorized to use the interface. @param req: Apache Request Object for session management @type req: Apache Request Object @param req_pid: Requested person id @type req_pid: int @param req_level: Request level required for the page @type req_level: string ''' session = get_session(req) uid = getUid(req) pinfo = session["personinfo"] uinfo = collect_user_info(req) if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) is_authorized = True pids_to_check = [] if not bconfig.AID_ENABLED: return page_not_authorized(req, text=_("Fatal: Author ID capabilities are disabled on this system.")) if req_level and 'ulevel' in pinfo and pinfo["ulevel"] != req_level: return page_not_authorized(req, text=_("Fatal: You are not allowed to access this functionality.")) if req_pid and not isinstance(req_pid, list): pids_to_check = [req_pid] elif req_pid and isinstance(req_pid, list): pids_to_check = req_pid if (not (uinfo['precached_usepaperclaim'] or uinfo['precached_usepaperattribution']) and 'ulevel' in pinfo and not pinfo["ulevel"] == "admin"): is_authorized = False if is_authorized and not webapi.user_can_view_CMP(uid): is_authorized = False if is_authorized and 'ticket' in pinfo: for tic in pinfo["ticket"]: if 'pid' in tic: pids_to_check.append(tic['pid']) if pids_to_check and is_authorized: user_pid = webapi.get_pid_from_uid(uid) if not uinfo['precached_usepaperattribution']: if user_pid[1]: user_pid = user_pid[0][0] else: user_pid = -1 if (not user_pid in pids_to_check and 'ulevel' in pinfo and not pinfo["ulevel"] == "admin"): is_authorized = False elif (user_pid in pids_to_check and 'ulevel' in pinfo and not pinfo["ulevel"] == "admin"): for tic in list(pinfo["ticket"]): if not tic["pid"] == user_pid: pinfo['ticket'].remove(tic) if not is_authorized: return page_not_authorized(req, text=_("Fatal: You are not allowed to access this functionality.")) else: return "" def _session_bareinit(self, req): ''' Initializes session personinfo entry if none exists @param req: Apache Request Object @type req: Apache Request Object ''' session = get_session(req) uid = getUid(req) ulevel = self.__get_user_role(req) if isUserSuperAdmin({'uid': uid}): ulevel = 'admin' try: pinfo = session["personinfo"] pinfo['ulevel'] = ulevel if "claimpaper_admin_last_viewed_pid" not in pinfo: pinfo["claimpaper_admin_last_viewed_pid"] = -2 if 'ln' not in pinfo: pinfo["ln"] = 'en' if 'ticket' not in pinfo: pinfo["ticket"] = [] session.save() except KeyError: pinfo = dict() session['personinfo'] = pinfo pinfo['ulevel'] = ulevel pinfo["claimpaper_admin_last_viewed_pid"] = -2 pinfo["ln"] = 'en' pinfo["ticket"] = [] session.save() def _lookup(self, component, path): """ This handler parses dynamic URLs: - /person/1332 shows the page of person 1332 - /person/100:5522,1431 shows the page of the person identified by the table:bibref,bibrec pair """ if not component in self._exports: return WebInterfaceBibAuthorIDPages(component), path def __init_call_dispatcher(self): ''' Initialization of call dispacher dictionary @return: call dispatcher dictionary @rtype: dict ''' #author_detail_functions adf = dict() adf['title'] = dict() adf['optional_menu'] = dict() adf['ticket_box'] = dict() adf['tabs'] = dict() adf['footer'] = dict() adf['personid_info'] = dict() adf['ticket_dispatch'] = dict() adf['ticket_commit'] = dict() adf['title']['guest'] = self._generate_title_guest adf['title']['user'] = self._generate_title_user adf['title']['admin'] = self._generate_title_admin adf['optional_menu']['guest'] = self._generate_optional_menu_guest adf['optional_menu']['user'] = self._generate_optional_menu_user adf['optional_menu']['admin'] = self._generate_optional_menu_admin adf['ticket_box']['guest'] = self._generate_ticket_box_guest adf['ticket_box']['user'] = self._generate_ticket_box_user adf['ticket_box']['admin'] = self._generate_ticket_box_admin adf['personid_info']['guest'] = self._generate_person_info_box_guest adf['personid_info']['user'] = self._generate_person_info_box_user adf['personid_info']['admin'] = self._generate_person_info_box_admin adf['tabs']['guest'] = self._generate_tabs_guest adf['tabs']['user'] = self._generate_tabs_user adf['tabs']['admin'] = self._generate_tabs_admin adf['footer']['guest'] = self._generate_footer_guest adf['footer']['user'] = self._generate_footer_user adf['footer']['admin'] = self._generate_footer_admin adf['ticket_dispatch']['guest'] = self._ticket_dispatch_user adf['ticket_dispatch']['user'] = self._ticket_dispatch_user adf['ticket_dispatch']['admin'] = self._ticket_dispatch_admin adf['ticket_commit']['guest'] = self._ticket_commit_guest adf['ticket_commit']['user'] = self._ticket_commit_user adf['ticket_commit']['admin'] = self._ticket_commit_admin return adf def _generate_title_guest(self, req, form, ln): ''' Generate the title for a guest user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' if self.person_id: return 'Attribute papers for: ' + str(webapi.get_person_redirect_link(self.person_id)) else: return 'Attribute papers' def _generate_title_user(self, req, form, ln): ''' Generate the title for a regular user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' if self.person_id: return 'Attribute papers (user interface) for: ' + str(webapi.get_person_redirect_link(self.person_id)) else: return 'Attribute papers' def _generate_title_admin(self, req, form, ln): ''' Generate the title for an admin user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' if self.person_id: return 'Attribute papers (administrator interface) for: ' + str(webapi.get_person_redirect_link(self.person_id)) else: return 'Attribute papers' def _generate_optional_menu_guest(self, req, form, ln): ''' Generate the menu for a guest user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' argd = wash_urlargd(form, {'ln': (str, CFG_SITE_LANG), 'verbose': (int, 0)}) menu = TEMPLATE.tmpl_person_menu() if "verbose" in argd and argd["verbose"] > 0: session = get_session(req) pinfo = session['personinfo'] menu += "\n<pre>" + pformat(pinfo) + "</pre>\n" return menu def _generate_optional_menu_user(self, req, form, ln): ''' Generate the menu for a regular user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' argd = wash_urlargd(form, {'ln': (str, CFG_SITE_LANG), 'verbose': (int, 0)}) menu = TEMPLATE.tmpl_person_menu() if "verbose" in argd and argd["verbose"] > 0: session = get_session(req) pinfo = session['personinfo'] menu += "\n<pre>" + pformat(pinfo) + "</pre>\n" return menu def _generate_optional_menu_admin(self, req, form, ln): ''' Generate the title for an admin user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' argd = wash_urlargd(form, {'ln': (str, CFG_SITE_LANG), 'verbose': (int, 0)}) menu = TEMPLATE.tmpl_person_menu_admin() if "verbose" in argd and argd["verbose"] > 0: session = get_session(req) pinfo = session['personinfo'] menu += "\n<pre>" + pformat(pinfo) + "</pre>\n" return menu def _generate_ticket_box_guest(self, req, form, ln): ''' Generate the semi-permanent info box for a guest user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' session = get_session(req) pinfo = session['personinfo'] ticket = pinfo['ticket'] pendingt = [] donet = [] for t in ticket: if 'execution_result' in t: if t['execution_result'] == True: donet.append(t) else: pendingt.append(t) if len(pendingt) == 1: message = 'There is ' + str(len(pendingt)) + ' transaction in progress.' else: message = 'There are ' + str(len(pendingt)) + ' transactions in progress.' teaser = 'Claim in process!' if len(pendingt) == 0: box = "" else: box = TEMPLATE.tmpl_ticket_box(teaser, message) if len(donet) > 0: teaser = 'Success!' if len(donet) == 1: message = str(len(donet)) + ' transaction successfully executed.' else: message = str(len(donet)) + ' transactions successfully executed.' box = box + TEMPLATE.tmpl_notification_box(message, teaser) return box def _generate_ticket_box_user(self, req, form, ln): ''' Generate the semi-permanent info box for a regular user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' return self._generate_ticket_box_guest(req, form, ln) def _generate_ticket_box_admin(self, req, form, ln): ''' Generate the semi-permanent info box for an admin user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' return self._generate_ticket_box_guest(req, form, ln) def _generate_person_info_box_guest(self, req, form, ln): ''' Generate the name info box for a guest user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' return self._generate_person_info_box_admin(req, form, ln) def _generate_person_info_box_user(self, req, form, ln): ''' Generate the name info box for a regular user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' return self._generate_person_info_box_admin(req, form, ln) def _generate_person_info_box_admin(self, req, form, ln): ''' Generate the name info box for an admin user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' names = webapi.get_person_names_from_id(self.person_id) box = TEMPLATE.tmpl_admin_person_info_box(ln, person_id=self.person_id, names=names) return box def _generate_tabs_guest(self, req, form, ln): ''' Generate the tabs content for a guest user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' session = get_session(req) # uid = getUid(req) pinfo = session["personinfo"] if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) links = [] # ['delete', 'commit','del_entry','commit_entry'] tabs = ['records', 'repealed', 'review'] verbiage_dict = {'confirmed': 'Papers', 'repealed': _('Papers removed from this profile'), 'review': _('Papers in need of review'), 'tickets': _('Open Tickets'), 'data': _('Data'), 'confirmed_ns': _('Papers of this Person'), 'repealed_ns': _('Papers _not_ of this Person'), 'review_ns': _('Papers in need of review'), 'tickets_ns': _('Tickets for this Person'), 'data_ns': _('Additional Data for this Person')} buttons_verbiage_dict = {'mass_buttons': {'no_doc_string': _('Sorry, there are currently no documents to be found in this category.'), 'b_confirm': _('Yes, those papers are by this person.'), 'b_repeal': _('No, those papers are not by this person'), 'b_to_others': _('Assign to other person'), 'b_forget': _('Forget decision')}, 'record_undecided': {'alt_confirm': _('Confirm!'), 'confirm_text': _('Yes, this paper is by this person.'), 'alt_repeal': _('Rejected!'), 'repeal_text': _('No, this paper is <i>not</i> by this person'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_confirmed': {'alt_confirm': _('Confirmed.'), 'confirm_text': _('Marked as this person\'s paper'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repeal!'), 'repeal_text': _('But it\'s <i>not</i> this person\'s paper.'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_repealed': {'alt_confirm': _('Confirm!'), 'confirm_text': _('But it <i>is</i> this person\'s paper.'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repealed'), 'repeal_text': _('Marked as not this person\'s paper'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}} return self._generate_tabs_admin(req, form, ln, show_tabs=tabs, ticket_links=links, show_reset_button=False, open_tickets=[], verbiage_dict=verbiage_dict, buttons_verbiage_dict=buttons_verbiage_dict) def _generate_tabs_user(self, req, form, ln): ''' Generate the tabs content for a regular user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string ''' session = get_session(req) uid = getUid(req) pinfo = session['personinfo'] if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) links = ['delete', 'del_entry'] tabs = ['records', 'repealed', 'review', 'tickets'] if pinfo["claimpaper_admin_last_viewed_pid"] == webapi.get_pid_from_uid(uid)[0][0]: verbiage_dict = {'confirmed': _('Your papers'), 'repealed': _('Not your papers'), 'review': _('Papers in need of review'), 'tickets': _('Your tickets'), 'data': _('Data'), 'confirmed_ns': _('Your papers'), 'repealed_ns': _('Not your papers'), 'review_ns': _('Papers in need of review'), 'tickets_ns': _('Your tickets'), 'data_ns': _('Additional Data for this Person')} buttons_verbiage_dict = {'mass_buttons': {'no_doc_string': _('Sorry, there are currently no documents to be found in this category.'), 'b_confirm': _('These are mine!'), 'b_repeal': _('These are not mine!'), 'b_to_others': _('It\'s not mine, but I know whose it is!'), 'b_forget': _('Forget decision')}, 'record_undecided': {'alt_confirm': _('Mine!'), 'confirm_text': _('This is my paper!'), 'alt_repeal': _('Not mine!'), 'repeal_text': _('This is not my paper!'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_confirmed': {'alt_confirm': _('Not Mine.'), 'confirm_text': _('Marked as my paper!'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget assignment decision'), 'alt_repeal': _('Not Mine!'), 'repeal_text': _('But this is mine!'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_repealed': {'alt_confirm': _('Mine!'), 'confirm_text': _('But this is my paper!'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision!'), 'alt_repeal': _('Not Mine!'), 'repeal_text': _('Marked as not your paper.'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}} else: verbiage_dict = {'confirmed': _('Papers'), 'repealed': _('Papers removed from this profile'), 'review': _('Papers in need of review'), 'tickets': _('Your tickets'), 'data': _('Data'), 'confirmed_ns': _('Papers of this Person'), 'repealed_ns': _('Papers _not_ of this Person'), 'review_ns': _('Papers in need of review'), 'tickets_ns': _('Tickes you created about this person'), 'data_ns': _('Additional Data for this Person')} buttons_verbiage_dict = {'mass_buttons': {'no_doc_string': _('Sorry, there are currently no documents to be found in this category.'), 'b_confirm': _('Yes, those papers are by this person.'), 'b_repeal': _('No, those papers are not by this person'), 'b_to_others': _('Assign to other person'), 'b_forget': _('Forget decision')}, 'record_undecided': {'alt_confirm': _('Confirm!'), 'confirm_text': _('Yes, this paper is by this person.'), 'alt_repeal': _('Rejected!'), 'repeal_text': _('No, this paper is <i>not</i> by this person'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_confirmed': {'alt_confirm': _('Confirmed.'), 'confirm_text': _('Marked as this person\'s paper'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repeal!'), 'repeal_text': _('But it\'s <i>not</i> this person\'s paper.'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_repealed': {'alt_confirm': _('Confirm!'), 'confirm_text': _('But it <i>is</i> this person\'s paper.'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repealed'), 'repeal_text': _('Marked as not this person\'s paper'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}} session = get_session(req) uid = getUid(req) open_tickets = webapi.get_person_request_ticket(self.person_id) tickets = [] for t in open_tickets: owns = False for row in t[0]: if row[0] == 'uid-ip' and row[1].split('||')[0] == str(uid): owns = True if owns: tickets.append(t) return self._generate_tabs_admin(req, form, ln, show_tabs=tabs, ticket_links=links, open_tickets=tickets, verbiage_dict=verbiage_dict, buttons_verbiage_dict=buttons_verbiage_dict) def _generate_tabs_admin(self, req, form, ln, show_tabs=['records', 'repealed', 'review', 'comments', 'tickets', 'data'], open_tickets=None, ticket_links=['delete', 'commit', 'del_entry', 'commit_entry'], verbiage_dict=None, buttons_verbiage_dict=None, show_reset_button=True): ''' Generate the tabs content for an admin user @param req: Apache Request Object @type req: Apache Request Object @param form: POST/GET variables of the request @type form: dict @param ln: language to show this page in @type ln: string @param show_tabs: list of tabs to display @type show_tabs: list of strings @param ticket_links: list of links to display @type ticket_links: list of strings @param verbiage_dict: language for the elements @type verbiage_dict: dict @param buttons_verbiage_dict: language for the buttons @type buttons_verbiage_dict: dict ''' session = get_session(req) personinfo = {} records = [] try: personinfo = session["personinfo"] except KeyError: return "" if 'ln' in personinfo: ln = personinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) if not verbiage_dict: verbiage_dict = self._get_default_verbiage_dicts_for_admin(req) if not buttons_verbiage_dict: buttons_verbiage_dict = self._get_default_buttons_verbiage_dicts_for_admin(req) all_papers = webapi.get_papers_by_person_id(self.person_id, ext_out=True) for paper in all_papers: records.append({'recid': paper[0], 'bibref': paper[1], 'flag': paper[2], 'authorname': paper[3], 'authoraffiliation': paper[4], 'paperdate': paper[5], 'rt_status': paper[6], 'paperexperiment': paper[7]}) rejected_papers = [row for row in records if row['flag'] < -1] rest_of_papers = [row for row in records if row['flag'] >= -1] review_needed = webapi.get_review_needing_records(self.person_id) if len(review_needed) < 1: if 'review' in show_tabs: show_tabs.remove('review') rt_tickets = None if open_tickets == None: open_tickets = webapi.get_person_request_ticket(self.person_id) else: if len(open_tickets) < 1: if 'tickets' in show_tabs: show_tabs.remove('tickets') if "admin_requested_ticket_id" in personinfo: rt_tickets = personinfo["admin_requested_ticket_id"] # Send data to template function tabs = TEMPLATE.tmpl_admin_tabs(ln, person_id=self.person_id, rejected_papers=rejected_papers, rest_of_papers=rest_of_papers, review_needed=review_needed, rt_tickets=rt_tickets, open_rt_tickets=open_tickets, show_tabs=show_tabs, ticket_links=ticket_links, verbiage_dict=verbiage_dict, buttons_verbiage_dict=buttons_verbiage_dict, show_reset_button=show_reset_button) return tabs def _get_default_verbiage_dicts_for_admin(self, req): session = get_session(req) personinfo = {} try: personinfo = session["personinfo"] except KeyError: return "" if 'ln' in personinfo: ln = personinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) verbiage_dict = {'confirmed': _('Papers'), 'repealed': _('Papers removed from this profile'), 'review': _('Papers in need of review'), 'tickets': _('Tickets'), 'data': _('Data'), 'confirmed_ns': _('Papers of this Person'), 'repealed_ns': _('Papers _not_ of this Person'), 'review_ns': _('Papers in need of review'), 'tickets_ns': _('Request Tickets'), 'data_ns': _('Additional Data for this Person')} return verbiage_dict def _get_default_buttons_verbiage_dicts_for_admin(self, req): session = get_session(req) personinfo = {} try: personinfo = session["personinfo"] except KeyError: return "" if 'ln' in personinfo: ln = personinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) buttons_verbiage_dict = {'mass_buttons': {'no_doc_string': _('Sorry, there are currently no documents to be found in this category.'), 'b_confirm': _('Yes, those papers are by this person.'), 'b_repeal': _('No, those papers are not by this person'), 'b_to_others': _('Assign to other person'), 'b_forget': _('Forget decision')}, 'record_undecided': {'alt_confirm': _('Confirm!'), 'confirm_text': _('Yes, this paper is by this person.'), 'alt_repeal': _('Rejected!'), 'repeal_text': _('No, this paper is <i>not</i> by this person'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_confirmed': {'alt_confirm': _('Confirmed.'), 'confirm_text': _('Marked as this person\'s paper'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repeal!'), 'repeal_text': _('But it\'s <i>not</i> this person\'s paper.'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}, 'record_repealed': {'alt_confirm': _('Confirm!'), 'confirm_text': _('But it <i>is</i> this person\'s paper.'), 'alt_forget': _('Forget decision!'), 'forget_text': _('Forget decision.'), 'alt_repeal': _('Repealed'), 'repeal_text': _('Marked as not this person\'s paper'), 'to_other_text': _('Assign to another person'), 'alt_to_other': _('To other person!')}} return buttons_verbiage_dict def _generate_footer_guest(self, req, form, ln): return self._generate_footer_admin(req, form, ln) def _generate_footer_user(self, req, form, ln): return self._generate_footer_admin(req, form, ln) def _generate_footer_admin(self, req, form, ln): return TEMPLATE.tmpl_invenio_search_box() def _ticket_dispatch_guest(self, req): ''' Takes care of the ticket when in guest mode ''' return self._ticket_dispatch_user(req) def _ticket_dispatch_user(self, req): ''' Takes care of the ticket when in user and guest mode ''' session = get_session(req) uid = getUid(req) pinfo = session["personinfo"] # ulevel = pinfo["ulevel"] ticket = pinfo["ticket"] bibref_check_required = self._ticket_review_bibref_check(req) if bibref_check_required: return bibref_check_required for t in ticket: t['status'] = webapi.check_transaction_permissions(uid, t['bibref'], t['pid'], t['action']) session.save() return self._ticket_final_review(req) def _ticket_dispatch_admin(self, req): ''' Takes care of the ticket when in administrator mode ''' return self._ticket_dispatch_user(req) def _ticket_review_bibref_check(self, req): ''' checks if some of the transactions on the ticket are needing a review. If it's the case prompts the user to select the right bibref ''' session = get_session(req) pinfo = session["personinfo"] ticket = pinfo["ticket"] if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) if ("bibref_check_required" in pinfo and pinfo["bibref_check_required"] and "bibref_check_reviewed_bibrefs" in pinfo): for rbibreft in pinfo["bibref_check_reviewed_bibrefs"]: if not rbibreft.count("||") or not rbibreft.count(","): continue rpid, rbibref = rbibreft.split("||") rrecid = rbibref.split(",")[1] rpid = webapi.wash_integer_id(rpid) for ticket_update in [row for row in ticket if (row['bibref'] == str(rrecid) and row['pid'] == rpid)]: ticket_update["bibref"] = rbibref del(ticket_update["incomplete"]) for ticket_remove in [row for row in ticket if ('incomplete' in row)]: ticket.remove(ticket_remove) if ("bibrefs_auto_assigned" in pinfo): del(pinfo["bibrefs_auto_assigned"]) if ("bibrefs_to_confirm" in pinfo): del(pinfo["bibrefs_to_confirm"]) del(pinfo["bibref_check_reviewed_bibrefs"]) pinfo["bibref_check_required"] = False session.save() return "" else: bibrefs_auto_assigned = {} bibrefs_to_confirm = {} needs_review = [] # if ("bibrefs_auto_assigned" in pinfo # and pinfo["bibrefs_auto_assigned"]): # bibrefs_auto_assigned = pinfo["bibrefs_auto_assigned"] # # if ("bibrefs_to_confirm" in pinfo # and pinfo["bibrefs_to_confirm"]): # bibrefs_to_confirm = pinfo["bibrefs_to_confirm"] for transaction in ticket: if not webapi.is_valid_bibref(transaction['bibref']): transaction['incomplete'] = True needs_review.append(transaction) if not needs_review: pinfo["bibref_check_required"] = False session.save() return "" for transaction in needs_review: recid = webapi.wash_integer_id(transaction['bibref']) if recid < 0: continue #this doesn't look like a recid--discard! pid = transaction['pid'] if ((pid in bibrefs_auto_assigned and 'bibrecs' in bibrefs_auto_assigned[pid] and recid in bibrefs_auto_assigned[pid]['bibrecs']) or (pid in bibrefs_to_confirm and 'bibrecs' in bibrefs_to_confirm[pid] and recid in bibrefs_to_confirm[pid]['bibrecs'])): continue # we already assessed those bibrefs. fctptr = webapi.get_possible_bibrefs_from_pid_bibrec bibrec_refs = fctptr(pid, [recid]) person_name = webapi.get_most_frequent_name_from_pid(pid) for brr in bibrec_refs: if len(brr[1]) == 1: if not pid in bibrefs_auto_assigned: bibrefs_auto_assigned[pid] = { 'person_name': person_name, 'canonical_id': "TBA", 'bibrecs': {brr[0]: brr[1]}} else: bibrefs_auto_assigned[pid]['bibrecs'][brr[0]] = brr[1] else: if not brr[1]: tmp = webapi.get_bibrefs_from_bibrecs([brr[0]]) try: brr[1] = tmp[0][1] except IndexError: continue # No bibrefs on record--discard if not pid in bibrefs_to_confirm: bibrefs_to_confirm[pid] = { 'person_name': person_name, 'canonical_id': "TBA", 'bibrecs': {brr[0]: brr[1]}} else: bibrefs_to_confirm[pid]['bibrecs'][brr[0]] = brr[1] if bibrefs_to_confirm or bibrefs_auto_assigned: pinfo["bibref_check_required"] = True baa = deepcopy(bibrefs_auto_assigned) btc = deepcopy(bibrefs_to_confirm) for pid in baa: for rid in baa[pid]['bibrecs']: baa[pid]['bibrecs'][rid] = [] for pid in btc: for rid in btc[pid]['bibrecs']: btc[pid]['bibrecs'][rid] = [] pinfo["bibrefs_auto_assigned"] = baa pinfo["bibrefs_to_confirm"] = btc else: pinfo["bibref_check_required"] = False session.save() if 'external_first_entry' in pinfo and pinfo['external_first_entry']: del(pinfo["external_first_entry"]) pinfo['external_first_entry_skip_review'] = True session.save() return "" # don't bother the user the first time body = TEMPLATE.tmpl_bibref_check(bibrefs_auto_assigned, bibrefs_to_confirm) body = TEMPLATE.tmpl_person_detail_layout(body) metaheaderadd = self._scripts(kill_browser_cache=True) title = _("Submit Attribution Information") return page(title=title, metaheaderadd=metaheaderadd, body=body, req=req, language=ln) def _ticket_final_review(self, req): ''' displays the user what can/cannot finally be done, leaving the option of kicking some transactions from the ticket before commit ''' session = get_session(req) uid = getUid(req) userinfo = collect_user_info(uid) pinfo = session["personinfo"] ulevel = pinfo["ulevel"] ticket = pinfo["ticket"] ticket = [row for row in ticket if not "execution_result" in row] skip_checkout_page = True upid = -1 user_first_name = "" user_first_name_sys = False user_last_name = "" user_last_name_sys = False user_email = "" user_email_sys = False if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) if ("external_firstname" in userinfo and userinfo["external_firstname"]): user_first_name = userinfo["external_firstname"] user_first_name_sys = True elif "user_first_name" in pinfo and pinfo["user_first_name"]: user_first_name = pinfo["user_first_name"] if ("external_familyname" in userinfo and userinfo["external_familyname"]): user_last_name = userinfo["external_familyname"] user_last_name_sys = True elif "user_last_name" in pinfo and pinfo["user_last_name"]: user_last_name = pinfo["user_last_name"] if ("email" in userinfo and not userinfo["email"] == "guest"): user_email = userinfo["email"] user_email_sys = True elif "user_email" in pinfo and pinfo["user_email"]: user_email = pinfo["user_email"] pinfo["user_first_name"] = user_first_name pinfo["user_first_name_sys"] = user_first_name_sys pinfo["user_last_name"] = user_last_name pinfo["user_last_name_sys"] = user_last_name_sys pinfo["user_email"] = user_email pinfo["user_email_sys"] = user_email_sys if "upid" in pinfo and pinfo["upid"]: upid = pinfo["upid"] else: dbpid = webapi.get_pid_from_uid(uid) if dbpid and dbpid[1]: if dbpid[0] and not dbpid[0] == -1: upid = dbpid[0][0] pinfo["upid"] = upid session.save() if not (user_first_name or user_last_name or user_email): skip_checkout_page = False if [row for row in ticket if row["status"] in ["denied", "warning_granted", "warning_denied"]]: skip_checkout_page = False if 'external_first_entry_skip_review' in pinfo and pinfo['external_first_entry_skip_review']: del(pinfo["external_first_entry_skip_review"]) skip_checkout_page = True session.save() if (not ticket or skip_checkout_page or ("checkout_confirmed" in pinfo and pinfo["checkout_confirmed"] and "checkout_faulty_fields" in pinfo and not pinfo["checkout_faulty_fields"])): self.adf['ticket_commit'][ulevel](req) if "checkout_confirmed" in pinfo: del(pinfo["checkout_confirmed"]) if "checkout_faulty_fields" in pinfo: del(pinfo["checkout_faulty_fields"]) if "bibref_check_required" in pinfo: del(pinfo["bibref_check_required"]) # if "user_ticket_comments" in pinfo: # del(pinfo["user_ticket_comments"]) session.save() return self._ticket_dispatch_end(req) for tt in list(ticket): if not 'bibref' in tt or not 'pid' in tt: del(ticket[tt]) continue tt['authorname_rec'] = get_bibrefrec_name_string(tt['bibref']) tt['person_name'] = webapi.get_most_frequent_name_from_pid(tt['pid']) mark_yours = [] mark_not_yours = [] if upid >= 0: mark_yours = [row for row in ticket if (str(row["pid"]) == str(upid) and row["action"] in ["to_other_person", "confirm"])] mark_not_yours = [row for row in ticket if (str(row["pid"]) == str(upid) and row["action"] in ["repeal", "reset"])] mark_theirs = [row for row in ticket if ((not str(row["pid"]) == str(upid)) and row["action"] in ["to_other_person", "confirm"])] mark_not_theirs = [row for row in ticket if ((not str(row["pid"]) == str(upid)) and row["action"] in ["repeal", "reset"])] session.save() body = TEMPLATE.tmpl_ticket_final_review(req, mark_yours, mark_not_yours, mark_theirs, mark_not_theirs) body = TEMPLATE.tmpl_person_detail_layout(body) metaheaderadd = self._scripts(kill_browser_cache=True) title = _("Please review your actions") #body = body + '<pre>' + pformat(pinfo) + '</pre>' return page(title=title, metaheaderadd=metaheaderadd, body=body, req=req, language=ln) def _ticket_commit_admin(self, req): ''' Actual execution of the ticket transactions ''' self._clean_ticket(req) session = get_session(req) uid = getUid(req) pinfo = session["personinfo"] ticket = pinfo["ticket"] userinfo = {'uid-ip': "%s||%s" % (uid, req.remote_ip)} if "user_ticket_comments" in pinfo: userinfo['comments'] = pinfo["user_ticket_comments"] if "user_first_name" in pinfo: userinfo['firstname'] = pinfo["user_first_name"] if "user_last_name" in pinfo: userinfo['lastname'] = pinfo["user_last_name"] if "user_email" in pinfo: userinfo['email'] = pinfo["user_email"] pids_to_update = set() for t in ticket: t['execution_result'] = webapi.execute_action(t['action'], t['pid'], t['bibref'], uid, pids_to_update, userinfo['uid-ip'], str(userinfo)) update_personID_names_string_set(pids_to_update) session.save() def _ticket_commit_user(self, req): ''' Actual execution of the ticket transactions ''' self._clean_ticket(req) session = get_session(req) uid = getUid(req) pinfo = session["personinfo"] ticket = pinfo["ticket"] ok_tickets = [] userinfo = {'uid-ip': "%s||%s" % (uid, req.remote_ip)} if "user_ticket_comments" in pinfo: userinfo['comments'] = pinfo["user_ticket_comments"] if "user_first_name" in pinfo: userinfo['firstname'] = pinfo["user_first_name"] if "user_last_name" in pinfo: userinfo['lastname'] = pinfo["user_last_name"] if "user_email" in pinfo: userinfo['email'] = pinfo["user_email"] pids_to_update = set() for t in list(ticket): if t['status'] in ['granted', 'warning_granted']: t['execution_result'] = webapi.execute_action(t['action'], t['pid'], t['bibref'], uid, pids_to_update, userinfo['uid-ip'], str(userinfo)) ok_tickets.append(t) ticket.remove(t) update_personID_names_string_set(pids_to_update) if ticket: webapi.create_request_ticket(userinfo, ticket) if CFG_INSPIRE_SITE and ok_tickets: webapi.send_user_commit_notification_email(userinfo, ok_tickets) for t in ticket: t['execution_result'] = True ticket[:] = ok_tickets session.save() def _ticket_commit_guest(self, req): ''' Actual execution of the ticket transactions ''' self._clean_ticket(req) session = get_session(req) pinfo = session["personinfo"] uid = getUid(req) userinfo = {'uid-ip': "userid: %s (from %s)" % (uid, req.remote_ip)} if "user_ticket_comments" in pinfo: if pinfo["user_ticket_comments"]: userinfo['comments'] = pinfo["user_ticket_comments"] else: userinfo['comments'] = "No comments submitted." if "user_first_name" in pinfo: userinfo['firstname'] = pinfo["user_first_name"] if "user_last_name" in pinfo: userinfo['lastname'] = pinfo["user_last_name"] if "user_email" in pinfo: userinfo['email'] = pinfo["user_email"] ticket = pinfo['ticket'] webapi.create_request_ticket(userinfo, ticket) for t in ticket: t['execution_result'] = True session.save() def _ticket_dispatch_end(self, req): ''' The ticket dispatch is finished, redirect to the original page of origin or to the last_viewed_pid ''' session = get_session(req) pinfo = session["personinfo"] if 'claim_in_process' in pinfo: pinfo['claim_in_process'] = False uinfo = collect_user_info(req) uinfo['precached_viewclaimlink'] = True uid = getUid(req) set_user_preferences(uid, uinfo) if "referer" in pinfo and pinfo["referer"]: referer = pinfo["referer"] del(pinfo["referer"]) session.save() return redirect_to_url(req, referer) return redirect_to_url(req, "%s/person/%s?open_claim=True" % (CFG_SITE_URL, webapi.get_person_redirect_link( pinfo["claimpaper_admin_last_viewed_pid"]))) def _clean_ticket(self, req): ''' Removes from a ticket the transactions with an execution_result flag ''' session = get_session(req) pinfo = session["personinfo"] ticket = pinfo["ticket"] for t in list(ticket): if 'execution_result' in t: ticket.remove(t) session.save() def __get_user_role(self, req): ''' Determines whether a user is guest, user or admin ''' minrole = 'guest' role = 'guest' if not req: return minrole uid = getUid(req) if not isinstance(uid, int): return minrole admin_role_id = acc_get_role_id(CLAIMPAPER_ADMIN_ROLE) user_role_id = acc_get_role_id(CLAIMPAPER_USER_ROLE) user_roles = acc_get_user_roles(uid) if admin_role_id in user_roles: role = 'admin' elif user_role_id in user_roles: role = 'user' if role == 'guest' and webapi.is_external_user(uid): role = 'user' return role def __user_is_authorized(self, req, action): ''' Determines if a given user is authorized to perform a specified action @param req: Apache Request Object @type req: Apache Request Object @param action: the action the user wants to perform @type action: string @return: True if user is allowed to perform the action, False if not @rtype: boolean ''' if not req: return False if not action: return False else: action = escape(action) uid = getUid(req) if not isinstance(uid, int): return False if uid == 0: return False allowance = [i[1] for i in acc_find_user_role_actions({'uid': uid}) if i[1] == action] if allowance: return True return False def _scripts(self, kill_browser_cache=False): ''' Returns html code to be included in the meta header of the html page. The actual code is stored in the template. @return: html formatted Javascript and CSS inclusions for the <head> @rtype: string ''' return TEMPLATE.tmpl_meta_includes(kill_browser_cache) def _check_user_fields(self, req, form): argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG), 'user_first_name': (str, None), 'user_last_name': (str, None), 'user_email': (str, None), 'user_comments': (str, None)}) session = get_session(req) pinfo = session["personinfo"] ulevel = pinfo["ulevel"] skip_checkout_faulty_fields = False if ulevel in ['user', 'admin']: skip_checkout_faulty_fields = True if not ("user_first_name_sys" in pinfo and pinfo["user_first_name_sys"]): if "user_first_name" in argd: if not argd["user_first_name"] and not skip_checkout_faulty_fields: pinfo["checkout_faulty_fields"].append("user_first_name") else: pinfo["user_first_name"] = escape(argd["user_first_name"]) if not ("user_last_name_sys" in pinfo and pinfo["user_last_name_sys"]): if "user_last_name" in argd: if not argd["user_last_name"] and not skip_checkout_faulty_fields: pinfo["checkout_faulty_fields"].append("user_last_name") else: pinfo["user_last_name"] = escape(argd["user_last_name"]) if not ("user_email_sys" in pinfo and pinfo["user_email_sys"]): if "user_email" in argd: if (not argd["user_email"] or not email_valid_p(argd["user_email"])): pinfo["checkout_faulty_fields"].append("user_email") else: pinfo["user_email"] = escape(argd["user_email"]) if (ulevel == "guest" and emailUnique(argd["user_email"]) > 0): pinfo["checkout_faulty_fields"].append("user_email_taken") if "user_comments" in argd: if argd["user_comments"]: pinfo["user_ticket_comments"] = escape(argd["user_comments"]) else: pinfo["user_ticket_comments"] = "" session.save() def action(self, req, form): ''' Initial step in processing of requests: ticket generation/update. Also acts as action dispatcher for interface mass action requests Valid mass actions are: - confirm: confirm assignments to a person - repeal: repeal assignments from a person - reset: reset assignments of a person - cancel: clean the session (erase tickets and so on) - to_other_person: assign a document from a person to another person @param req: Apache Request Object @type req: Apache Request Object @param form: Parameters sent via GET or POST request @type form: dict @return: a full page formatted in HTML @return: string ''' self._session_bareinit(req) argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG), 'pid': (int, None), 'confirm': (str, None), 'repeal': (str, None), 'reset': (str, None), 'cancel': (str, None), 'cancel_stage': (str, None), 'bibref_check_submit': (str, None), 'checkout': (str, None), 'checkout_continue_claiming': (str, None), 'checkout_submit': (str, None), 'checkout_remove_transaction': (str, None), 'to_other_person': (str, None), 'cancel_search_ticket': (str, None), 'user_first_name': (str, None), 'user_last_name': (str, None), 'user_email': (str, None), 'user_comments': (str, None), 'claim': (str, None), 'cancel_rt_ticket': (str, None), 'commit_rt_ticket': (str, None), 'rt_id': (int, None), 'rt_action': (str, None), 'selection': (list, []), 'set_canonical_name': (str, None), 'canonical_name': (str, None)}) ln = argd['ln'] # ln = wash_language(argd['ln']) pid = None action = None bibrefs = None session = get_session(req) uid = getUid(req) pinfo = session["personinfo"] ulevel = pinfo["ulevel"] ticket = pinfo["ticket"] tempticket = [] if not "ln" in pinfo: pinfo["ln"] = ln session.save() if 'confirm' in argd and argd['confirm']: action = 'confirm' elif 'repeal' in argd and argd['repeal']: action = 'repeal' elif 'reset' in argd and argd['reset']: action = 'reset' elif 'bibref_check_submit' in argd and argd['bibref_check_submit']: action = 'bibref_check_submit' elif 'cancel' in argd and argd['cancel']: action = 'cancel' elif 'cancel_stage' in argd and argd['cancel_stage']: action = 'cancel_stage' elif 'cancel_search_ticket' in argd and argd['cancel_search_ticket']: action = 'cancel_search_ticket' elif 'checkout' in argd and argd['checkout']: action = 'checkout' elif 'checkout_submit' in argd and argd['checkout_submit']: action = 'checkout_submit' elif ('checkout_remove_transaction' in argd and argd['checkout_remove_transaction']): action = 'checkout_remove_transaction' elif ('checkout_continue_claiming' in argd and argd['checkout_continue_claiming']): action = "checkout_continue_claiming" elif 'cancel_rt_ticket' in argd and argd['cancel_rt_ticket']: action = 'cancel_rt_ticket' elif 'commit_rt_ticket' in argd and argd['commit_rt_ticket']: action = 'commit_rt_ticket' elif 'to_other_person' in argd and argd['to_other_person']: action = 'to_other_person' elif 'claim' in argd and argd['claim']: action = 'claim' elif 'set_canonical_name' in argd and argd['set_canonical_name']: action = 'set_canonical_name' no_access = self._page_access_permission_wall(req, pid) if no_access and not action in ["claim"]: return no_access if action in ['to_other_person', 'claim']: if 'selection' in argd and len(argd['selection']) > 0: bibrefs = argd['selection'] else: return self._error_page(req, ln, "Fatal: cannot create ticket without any bibrefrec") if action == 'claim': return self._ticket_open_claim(req, bibrefs, ln) else: return self._ticket_open_assign_to_other_person(req, bibrefs, form) if action in ["cancel_stage"]: if 'bibref_check_required' in pinfo: del(pinfo['bibref_check_required']) if 'bibrefs_auto_assigned' in pinfo: del(pinfo['bibrefs_auto_assigned']) if 'bibrefs_to_confirm' in pinfo: del(pinfo['bibrefs_to_confirm']) for tt in [row for row in ticket if 'incomplete' in row]: ticket.remove(tt) session.save() return self._ticket_dispatch_end(req) if action in ["checkout_submit"]: pinfo["checkout_faulty_fields"] = [] self._check_user_fields(req, form) if not ticket: pinfo["checkout_faulty_fields"].append("tickets") if pinfo["checkout_faulty_fields"]: pinfo["checkout_confirmed"] = False else: pinfo["checkout_confirmed"] = True session.save() return self.adf['ticket_dispatch'][ulevel](req) #return self._ticket_final_review(req) if action in ["checkout_remove_transaction"]: bibref = argd['checkout_remove_transaction'] if webapi.is_valid_bibref(bibref): for rmt in [row for row in ticket if row["bibref"] == bibref]: ticket.remove(rmt) pinfo["checkout_confirmed"] = False session.save() return self.adf['ticket_dispatch'][ulevel](req) #return self._ticket_final_review(req) if action in ["checkout_continue_claiming"]: pinfo["checkout_faulty_fields"] = [] self._check_user_fields(req, form) return self._ticket_dispatch_end(req) if (action in ['bibref_check_submit'] or (not action and "bibref_check_required" in pinfo and pinfo["bibref_check_required"])): if not action in ['bibref_check_submit']: if "bibref_check_reviewed_bibrefs" in pinfo: del(pinfo["bibref_check_reviewed_bibrefs"]) session.save() return self.adf['ticket_dispatch'][ulevel](req) pinfo["bibref_check_reviewed_bibrefs"] = [] add_rev = pinfo["bibref_check_reviewed_bibrefs"].append if ("bibrefs_auto_assigned" in pinfo or "bibrefs_to_confirm" in pinfo): person_reviews = [] if ("bibrefs_auto_assigned" in pinfo and pinfo["bibrefs_auto_assigned"]): person_reviews.append(pinfo["bibrefs_auto_assigned"]) if ("bibrefs_to_confirm" in pinfo and pinfo["bibrefs_to_confirm"]): person_reviews.append(pinfo["bibrefs_to_confirm"]) for ref_review in person_reviews: for person_id in ref_review: for bibrec in ref_review[person_id]["bibrecs"]: rec_grp = "bibrecgroup%s" % bibrec elements = [] if rec_grp in form: if isinstance(form[rec_grp], str): elements.append(form[rec_grp]) elif isinstance(form[rec_grp], list): elements += form[rec_grp] else: continue for element in elements: test = element.split("||") if test and len(test) > 1 and test[1]: tref = test[1] + "," + str(bibrec) tpid = webapi.wash_integer_id(test[0]) if (webapi.is_valid_bibref(tref) and tpid > -1): add_rev(element + "," + str(bibrec)) session.save() return self.adf['ticket_dispatch'][ulevel](req) if not action: return self._error_page(req, ln, "Fatal: cannot create ticket if no action selected.") if action in ['confirm', 'repeal', 'reset']: if 'pid' in argd: pid = argd['pid'] else: return self._error_page(req, ln, "Fatal: cannot create ticket without a person id!") if 'selection' in argd and len(argd['selection']) > 0: bibrefs = argd['selection'] else: if pid == -3: return self._error_page(req, ln, "Fatal: Please select a paper to assign to the new person first!") else: return self._error_page(req, ln, "Fatal: cannot create ticket without any paper selected!") if 'rt_id' in argd and argd['rt_id']: rt_id = argd['rt_id'] for b in bibrefs: self._cancel_transaction_from_rt_ticket(rt_id, pid, action, b) #create temporary ticket if pid == -3: pid = webapi.create_new_person(uid) for bibref in bibrefs: tempticket.append({'pid': pid, 'bibref': bibref, 'action': action}) #check if ticket targets (bibref for pid) are already in ticket for t in tempticket: for e in list(ticket): if e['pid'] == t['pid'] and e['bibref'] == t['bibref']: ticket.remove(e) ticket.append(t) if 'search_ticket' in pinfo: del(pinfo['search_ticket']) #start ticket processing chain pinfo["claimpaper_admin_last_viewed_pid"] = pid session.save() return self.adf['ticket_dispatch'][ulevel](req) # return self.perform(req, form) elif action in ['cancel']: self.__session_cleanup(req) # return self._error_page(req, ln, # "Not an error! Session cleaned! but " # "redirect to be implemented") return self._ticket_dispatch_end(req) elif action in ['cancel_search_ticket']: if 'search_ticket' in pinfo: del(pinfo['search_ticket']) session.save() if "claimpaper_admin_last_viewed_pid" in pinfo: pid = pinfo["claimpaper_admin_last_viewed_pid"] return redirect_to_url(req, "/person/%s" % webapi.get_person_redirect_link(pid)) return self.search(req, form) elif action in ['checkout']: return self.adf['ticket_dispatch'][ulevel](req) #return self._ticket_final_review(req) elif action in ['cancel_rt_ticket', 'commit_rt_ticket']: if 'selection' in argd and len(argd['selection']) > 0: bibref = argd['selection'] else: return self._error_page(req, ln, "Fatal: cannot cancel unknown ticket") if 'pid' in argd and argd['pid'] > -1: pid = argd['pid'] else: return self._error_page(req, ln, "Fatal: cannot cancel unknown ticket") if action == 'cancel_rt_ticket': if 'rt_id' in argd and argd['rt_id'] and 'rt_action' in argd and argd['rt_action']: rt_id = argd['rt_id'] rt_action = argd['rt_action'] if 'selection' in argd and len(argd['selection']) > 0: bibrefs = argd['selection'] else: return self._error_page(req, ln, "Fatal: no bibref") for b in bibrefs: self._cancel_transaction_from_rt_ticket(rt_id, pid, rt_action, b) return redirect_to_url(req, "/person/%s" % webapi.get_person_redirect_link(pid)) return self._cancel_rt_ticket(req, bibref[0], pid) elif action == 'commit_rt_ticket': return self._commit_rt_ticket(req, bibref[0], pid) elif action == 'set_canonical_name': if 'pid' in argd and argd['pid'] > -1: pid = argd['pid'] else: return self._error_page(req, ln, "Fatal: cannot set canonical name to unknown person") if 'canonical_name' in argd and argd['canonical_name']: cname = argd['canonical_name'] else: return self._error_page(req, ln, "Fatal: cannot set a custom canonical name without a suggestion") uid = getUid(req) userinfo = "%s||%s" % (uid, req.remote_ip) webapi.update_person_canonical_name(pid, cname, userinfo) return redirect_to_url(req, "/person/%s" % webapi.get_person_redirect_link(pid)) else: return self._error_page(req, ln, "Fatal: What were I supposed to do?") def _ticket_open_claim(self, req, bibrefs, ln): ''' Generate page to let user choose how to proceed @param req: Apache Request Object @type req: Apache Request Object @param bibrefs: list of record IDs to perform an action on @type bibrefs: list of int @param ln: language to display the page in @type ln: string ''' session = get_session(req) uid = getUid(req) uinfo = collect_user_info(req) pinfo = session["personinfo"] if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) no_access = self._page_access_permission_wall(req) session.save() pid = -1 search_enabled = True if not no_access and uinfo["precached_usepaperclaim"]: tpid = webapi.get_pid_from_uid(uid) if tpid and tpid[0] and tpid[1] and tpid[0][0]: pid = tpid[0][0] if (not no_access and "claimpaper_admin_last_viewed_pid" in pinfo and pinfo["claimpaper_admin_last_viewed_pid"]): names = webapi.get_person_names_from_id(pinfo["claimpaper_admin_last_viewed_pid"]) names = sorted([i for i in names], key=lambda k: k[1], reverse=True) if len(names) > 0: if len(names[0]) > 0: last_viewed_pid = [pinfo["claimpaper_admin_last_viewed_pid"], names[0][0]] else: last_viewed_pid = False else: last_viewed_pid = False else: last_viewed_pid = False if no_access: search_enabled = False pinfo["referer"] = uinfo["referer"] session.save() body = TEMPLATE.tmpl_open_claim(bibrefs, pid, last_viewed_pid, search_enabled=search_enabled) body = TEMPLATE.tmpl_person_detail_layout(body) title = _('Claim this paper') metaheaderadd = self._scripts(kill_browser_cache=True) return page(title=title, metaheaderadd=metaheaderadd, body=body, req=req, language=ln) def _ticket_open_assign_to_other_person(self, req, bibrefs, form): ''' Initializes search to find a person to attach the selected records to @param req: Apache request object @type req: Apache request object @param bibrefs: list of record IDs to consider @type bibrefs: list of int @param form: GET/POST request parameters @type form: dict ''' session = get_session(req) pinfo = session["personinfo"] pinfo["search_ticket"] = dict() search_ticket = pinfo["search_ticket"] search_ticket['action'] = 'confirm' search_ticket['bibrefs'] = bibrefs session.save() return self.search(req, form) def comments(self, req, form): return "" def _cancel_rt_ticket(self, req, tid, pid): ''' deletes an RT ticket ''' webapi.delete_request_ticket(pid, tid) return redirect_to_url(req, "/person/%s" % webapi.get_person_redirect_link(str(pid))) def _cancel_transaction_from_rt_ticket(self, tid, pid, action, bibref): ''' deletes a transaction from an rt ticket ''' webapi.delete_transaction_from_request_ticket(pid, tid, action, bibref) def _commit_rt_ticket(self, req, bibref, pid): ''' Commit of an rt ticket: creates a real ticket and commits. ''' session = get_session(req) pinfo = session["personinfo"] ulevel = pinfo["ulevel"] ticket = pinfo["ticket"] open_rt_tickets = webapi.get_person_request_ticket(pid) tic = [a for a in open_rt_tickets if str(a[1]) == str(bibref)] if len(tic) > 0: tic = tic[0][0] #create temporary ticket tempticket = [] for t in tic: if t[0] in ['confirm', 'repeal']: tempticket.append({'pid': pid, 'bibref': t[1], 'action': t[0]}) #check if ticket targets (bibref for pid) are already in ticket for t in tempticket: for e in list(ticket): if e['pid'] == t['pid'] and e['bibref'] == t['bibref']: ticket.remove(e) ticket.append(t) session.save() #start ticket processing chain webapi.delete_request_ticket(pid, bibref) return self.adf['ticket_dispatch'][ulevel](req) def _error_page(self, req, ln=CFG_SITE_LANG, message=None, intro=True): ''' Create a page that contains a message explaining the error. @param req: Apache Request Object @type req: Apache Request Object @param ln: language @type ln: string @param message: message to be displayed @type message: string ''' body = [] _ = gettext_set_language(ln) if not message: message = "No further explanation available. Sorry." if intro: body.append(_("<p>We're sorry. An error occurred while " "handling your request. Please find more information " "below:</p>")) body.append("<p><strong>%s</strong></p>" % message) return page(title=_("Notice"), body="\n".join(body), description="%s - Internal Error" % CFG_SITE_NAME, keywords="%s, Internal Error" % CFG_SITE_NAME, language=ln, req=req) def __session_cleanup(self, req): ''' Cleans the session from all bibauthorid specific settings and with that cancels any transaction currently in progress. @param req: Apache Request Object @type req: Apache Request Object ''' session = get_session(req) try: pinfo = session["personinfo"] except KeyError: return if "ticket" in pinfo: pinfo['ticket'] = [] if "search_ticket" in pinfo: pinfo['search_ticket'] = dict() # clear up bibref checker if it's done. if ("bibref_check_required" in pinfo and not pinfo["bibref_check_required"]): if 'bibrefs_to_confirm' in pinfo: del(pinfo['bibrefs_to_confirm']) if "bibrefs_auto_assigned" in pinfo: del(pinfo["bibrefs_auto_assigned"]) del(pinfo["bibref_check_required"]) if "checkout_confirmed" in pinfo: del(pinfo["checkout_confirmed"]) if "checkout_faulty_fields" in pinfo: del(pinfo["checkout_faulty_fields"]) #pinfo['ulevel'] = ulevel # pinfo["claimpaper_admin_last_viewed_pid"] = -1 pinfo["admin_requested_ticket_id"] = -1 session.save() def _generate_search_ticket_box(self, req): ''' Generate the search ticket to remember a pending search for Person entities in an attribution process @param req: Apache request object @type req: Apache request object ''' session = get_session(req) pinfo = session["personinfo"] search_ticket = None if 'ln' in pinfo: ln = pinfo["ln"] else: ln = CFG_SITE_LANG _ = gettext_set_language(ln) if 'search_ticket' in pinfo: search_ticket = pinfo['search_ticket'] if not search_ticket: return '' else: teaser = _('Person search for assignment in progress!') message = _('You are searching for a person to assign the following papers:') return TEMPLATE.tmpl_search_ticket_box(teaser, message, search_ticket) def search(self, req, form, is_fallback=False, fallback_query='', fallback_title='', fallback_message=''): ''' Function used for searching a person based on a name with which the function is queried. @param req: Apache Request Object @type req: Apache Request Object @param form: Parameters sent via GET or POST request @type form: dict @return: a full page formatted in HTML @return: string ''' self._session_bareinit(req) session = get_session(req) no_access = self._page_access_permission_wall(req) new_person_link = False if no_access: return no_access pinfo = session["personinfo"] search_ticket = None if 'search_ticket' in pinfo: search_ticket = pinfo['search_ticket'] if "ulevel" in pinfo: if pinfo["ulevel"] == "admin": new_person_link = True body = '' if search_ticket: body = body + self._generate_search_ticket_box(req) max_num_show_papers = 5 argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG), 'verbose': (int, 0), 'q': (str, None)}) ln = argd['ln'] # ln = wash_language(argd['ln']) query = None recid = None nquery = None search_results = None title = "Person Search" if 'q' in argd: if argd['q']: query = escape(argd['q']) if is_fallback and fallback_query: query = fallback_query if query: authors = [] if query.count(":"): try: left, right = query.split(":") try: recid = int(left) nquery = str(right) except (ValueError, TypeError): try: recid = int(right) nquery = str(left) except (ValueError, TypeError): recid = None nquery = query except ValueError: recid = None nquery = query else: nquery = query sorted_results = webapi.search_person_ids_by_name(nquery) for index, results in enumerate(sorted_results): pid = results[0] # authorpapers = webapi.get_papers_by_person_id(pid, -1) # authorpapers = sorted(authorpapers, key=itemgetter(0), # reverse=True) if index < bconfig.PERSON_SEARCH_RESULTS_SHOW_PAPERS_PERSON_LIMIT: authorpapers = [[paper] for paper in sort_records(None, [i[0] for i in webapi.get_papers_by_person_id(pid, -1)], sort_field="year", sort_order="a")] else: authorpapers = [['Not retrieved to increase performances.']] if (recid and not (str(recid) in [row[0] for row in authorpapers])): continue authors.append([results[0], results[1], authorpapers[0:max_num_show_papers], len(authorpapers)]) search_results = authors if recid and (len(search_results) == 1) and not is_fallback: return redirect_to_url(req, "/person/%s" % search_results[0][0]) body = body + TEMPLATE.tmpl_author_search(query, search_results, search_ticket, author_pages_mode=True, fallback_mode=is_fallback, fallback_title=fallback_title, fallback_message=fallback_message, new_person_link=new_person_link) if not is_fallback: body = TEMPLATE.tmpl_person_detail_layout(body) return page(title=title, metaheaderadd=self._scripts(kill_browser_cache=True), body=body, req=req, language=ln) def claimstub(self, req, form): ''' Generate stub page before claiming process @param req: Apache request object @type req: Apache request object @param form: GET/POST request params @type form: dict ''' argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG), 'person': (str, '')}) ln = argd['ln'] # ln = wash_language(argd['ln']) _ = gettext_set_language(ln) person = '-1' if 'person' in argd and argd['person']: person = argd['person'] session = get_session(req) try: pinfo = session["personinfo"] if pinfo['ulevel'] == 'admin': return redirect_to_url(req, '%s/person/%s?open_claim=True' % (CFG_SITE_URL, person)) except KeyError: pass if bconfig.BIBAUTHORID_UI_SKIP_ARXIV_STUB_PAGE: return redirect_to_url(req, '%s/person/%s?open_claim=True' % (CFG_SITE_URL, person)) body = TEMPLATE.tmpl_claim_stub(person) pstr = 'Person ID missing or invalid' if person != '-1': pstr = person title = _('You are going to claim papers for: %s' % pstr) return page(title=title, metaheaderadd=self._scripts(kill_browser_cache=True), body=body, req=req, language=ln) def welcome(self, req, form): ''' Generate SSO landing/welcome page @param req: Apache request object @type req: Apache request object @param form: GET/POST request params @type form: dict ''' uid = getUid(req) self._session_bareinit(req) argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG)}) ln = argd['ln'] # ln = wash_language(argd['ln']) _ = gettext_set_language(ln) if uid == 0: return page_not_authorized(req, text=_("This page in not accessible directly.")) title_message = _('Welcome!') # start continuous writing to the browser... req.content_type = "text/html" req.send_http_header() ssl_param = 0 if req.is_https(): ssl_param = 1 req.write(pageheaderonly(req=req, title=title_message, language=ln, secure_page_p=ssl_param)) req.write(TEMPLATE.tmpl_welcome_start()) body = "" if CFG_INSPIRE_SITE: body = TEMPLATE.tmpl_welcome_arxiv() else: body = TEMPLATE.tmpl_welcome() req.write(body) # now do what will take time... pid = webapi.arxiv_login(req) #session must be read after webapi.arxiv_login did it's stuff session = get_session(req) pinfo = session["personinfo"] pinfo["claimpaper_admin_last_viewed_pid"] = pid session.save() link = TEMPLATE.tmpl_welcome_link() req.write(link) req.write("<br><br>") uinfo = collect_user_info(req) arxivp = [] if 'external_arxivids' in uinfo and uinfo['external_arxivids']: try: for i in uinfo['external_arxivids'].split(';'): arxivp.append(i) except (IndexError, KeyError): pass req.write(TEMPLATE.tmpl_welcome_arXiv_papers(arxivp)) if CFG_INSPIRE_SITE: #logs arXive logins, for debug purposes. dbg = ('uinfo= ' + str(uinfo) + '\npinfo= ' + str(pinfo) + '\nreq= ' + str(req) + '\nsession= ' + str(session)) userinfo = "%s||%s" % (uid, req.remote_ip) webapi.insert_log(userinfo, pid, 'arXiv_login', 'dbg', '', comment=dbg) req.write(TEMPLATE.tmpl_welcome_end()) req.write(pagefooteronly(req=req)) def tickets_admin(self, req, form): ''' Generate SSO landing/welcome page @param req: Apache request object @type req: Apache request object @param form: GET/POST request params @type form: dict ''' self._session_bareinit(req) no_access = self._page_access_permission_wall(req, req_level='admin') if no_access: return no_access tickets = webapi.get_persons_with_open_tickets_list() tickets = list(tickets) for t in list(tickets): tickets.remove(t) tickets.append([webapi.get_most_frequent_name_from_pid(int(t[0])), webapi.get_person_redirect_link(t[0]), t[0], t[1]]) body = TEMPLATE.tmpl_tickets_admin(tickets) body = TEMPLATE.tmpl_person_detail_layout(body) title = 'Open RT tickets' return page(title=title, metaheaderadd=self._scripts(), body=body, req=req) def export(self, req, form): ''' Generate JSONized export of Person data @param req: Apache request object @type req: Apache request object @param form: GET/POST request params @type form: dict ''' argd = wash_urlargd( form, {'ln': (str, CFG_SITE_LANG), 'request': (str, None), 'userid': (str, None)}) if not CFG_JSON_AVAILABLE: return "500_json_not_found__install_package" # session = get_session(req) request = None userid = None if "userid" in argd and argd['userid']: userid = argd['userid'] else: return "404_user_not_found" if "request" in argd and argd['request']: request = argd["request"] # find user from ID user_email = get_email_from_username(userid) if user_email == userid: return "404_user_not_found" uid = get_uid_from_email(user_email) uinfo = collect_user_info(uid) # find person by uid pid = webapi.get_pid_from_uid(uid) # find papers py pid that are confirmed through a human. papers = webapi.get_papers_by_person_id(pid, 2) # filter by request param, e.g. arxiv if not request: return "404__no_filter_selected" if not request in bconfig.VALID_EXPORT_FILTERS: return "500_filter_invalid" if request == "arxiv": query = "(recid:" query += " OR recid:".join(papers) query += ") AND 037:arxiv" db_docs = perform_request_search(p=query) nickmail = "" nickname = "" db_arxiv_ids = [] try: nickname = uinfo["nickname"] except KeyError: pass if not nickname: try: nickmail = uinfo["email"] except KeyError: nickmail = user_email nickname = nickmail db_arxiv_ids = get_fieldvalues(db_docs, "037__a") construct = {"nickname": nickname, "claims": ";".join(db_arxiv_ids)} jsondmp = json.dumps(construct) signature = webapi.sign_assertion("arXiv", jsondmp) construct["digest"] = signature return json.dumps(construct) index = __call__ me = welcome you = welcome # pylint: enable=C0301 # pylint: enable=W0613
robk5uj/invenio
modules/bibauthorid/lib/bibauthorid_webinterface.py
Python
gpl-2.0
99,247
[ "ADF" ]
fb57e4f7b214b71ed7f50fd59cf1c3d5c6042113cd824ee728052d22648446fb
# # This source file is part of appleseed. # Visit http://appleseedhq.net/ for additional information and resources. # # This software is released under the MIT license. # # Copyright (c) 2016 Haggi Krey, The appleseedhq Organization # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. # import logging import pymel.core as pm import maya.OpenMayaMPx as OpenMayaMPx import sys log = logging.getLogger("mtapLogger") def binMeshTranslatorOpts(parent, action, initialSettings, resultCallback): useTransform = True oneFilePerMesh = False createProxies = True proxyRes = 0.1 exportDir = "" if initialSettings is not None and len(initialSettings) > 0: #oneFilePerMesh=0;createProxies=1;proxyRes=0.1;exportDir=;createProxies=1 opts = initialSettings.split(";") for opt in opts: name, value = opt.split("=") if name == "oneFilePerMesh": oneFilePerMesh = int(value) if name == "createProxies": createProxies = int(value) if name == "useTransform": useTransform = int(value) if name == "proxyRes": proxyRes = float(proxyRes) if action == "post": pm.setParent(parent) with pm.columnLayout(adj = True): pm.checkBox("MSH_OPTS_DOTRANSFORM", label = "Use Transform", v=useTransform) pm.checkBox("MSH_OPTS_ONEFILE", label = "One File Per Mesh", v=oneFilePerMesh) pm.checkBox("MSH_OPTS_DOPROX", label = "Create ProxyFiles", v=createProxies) pm.floatFieldGrp("MSH_OPTS_PROXPERC", label="Proxy Resolution", v1 = proxyRes) if action == "query": resultOptions = "" oneFilePerMesh = pm.checkBox("MSH_OPTS_ONEFILE", query=True, v=True) resultOptions += "oneFilePerMesh={0}".format(int(oneFilePerMesh)) doProx = pm.checkBox("MSH_OPTS_DOPROX", query=True, v=True) resultOptions += ";createProxies={0}".format(int(doProx)) proxyRes = pm.floatFieldGrp("MSH_OPTS_PROXPERC", query=True, v1 = True) resultOptions += ";proxyRes={0}".format(proxyRes) doTransform = pm.checkBox("MSH_OPTS_DOTRANSFORM", query=True, v=True) resultOptions += ";useTransform={0}".format(int(doTransform)) melCmd = '{0} "{1}"'.format(resultCallback,resultOptions) pm.mel.eval(melCmd) return 1 def binMeshTranslatorWrite(fileName, optionString, accessMode): exportPath = fileName createProxies = False proxyRes = 0.1 all = False oneFilePerMesh = False useTransform = False # the very first sign is a ; so the first element cannot be split again, no idea why opts = optionString.split(";") for opt in opts: try: name, value = opt.split("=") if name == "oneFilePerMesh": oneFilePerMesh = int(value) if name == "createProxies": createProxies = int(value) if name == "useTransform": useTransform = int(value) if name == "proxyRes": proxyRes = float(proxyRes) except: pass if accessMode == "selected": selection = [] for object in pm.ls(sl=True): selection.extend(object.getChildren(ad=True, type="mesh")) if len(selection) == 0: raise pm.binMeshWriterCmd(selection, path=exportPath, doProxy=createProxies, percentage=proxyRes, doTransform=useTransform, oneFilePerMesh=oneFilePerMesh) if accessMode == "all": pm.binMeshWriterCmd(path=exportPath, doProxy=createProxies, percentage=proxyRes, doTransform=useTransform, all=True, oneFilePerMesh=oneFilePerMesh) return True def binMeshTranslatorRead(fileName, optionString, accessMode): importPath = fileName createProxies = False proxyRes = 0.1 # the very first sign is a ; so the first element cannot be split again, no idea why opts = optionString.split(";") for opt in opts: try: name, value = opt.split("=") if name == "createProxies": createProxies = int(value) if name == "proxyRes": proxyRes = float(proxyRes) except: pass pm.binMeshReaderCmd(path=importPath) return True def binMeshCheckAndCreateShadingGroup(shadingGroup): try: shadingGroup = pm.PyNode(shadingGroup) except: shader = pm.shadingNode("appleseedSurfaceShader", asShader=True) shadingGroup = pm.sets(renderable=True, noSurfaceShader=True, empty=True, name=shadingGroup) shader.outColor >> shadingGroup.surfaceShader # I'd prefer to use the connected polyshape directly, but because of the connections in a multi shader assignenment # I do not get a directo connection from the creator node to the polymesh but it goes to some groupId nodes what makes # it a bit complicated to search for the first connected mesh in the API. So I simply call the script with the creator node # and let the python script search for the mesh. def listConnections(node, allList, meshList): for con in node.outputs(sh=True): if not con in allList: allList.append(con) if con.type() == 'mesh': meshList.append(con) else: listConnections(con, allList, meshList) def getConnectedPolyShape(creatorShape): try: creatorShape = pm.PyNode(creatorShape) except: return None meshList = [] allList = [] listConnections(creatorShape, allList, meshList) return meshList # perFaceAssingments contains a double list, one face id list for every shading group def binMeshAssignShader(creatorShape = None, shadingGroupList=[], perFaceAssingments=[]): if not creatorShape: return if pm.PyNode(creatorShape).type() != "mtap_standinMeshNode": log.error("binMeshAssignShader: Node {0} is not a creator shape".format(creatorShape)) return polyShapeList = getConnectedPolyShape(creatorShape) for polyShape in polyShapeList: for index, shadingGroup in enumerate(shadingGroupList): binMeshCheckAndCreateShadingGroup(shadingGroup) assignments = perFaceAssingments[index] print assignments faceSelection = [] for polyId in assignments: faceSelection.append(polyId) fs = polyShape.f[faceSelection] pm.sets(shadingGroup, e=True, forceElement=str(fs))
haggi/appleseed-maya
module/scripts/appleseed_maya/binmeshtranslator.py
Python
mit
7,523
[ "VisIt" ]
62b90ea684f2a4e53f4e4e71f9ffd956895e2760d8648d8017f1577be1918e43
# Copyright (C) 2020 # Max Planck Institute for Polymer Research & JGU Mainz # Copyright (C) 2012,2013,2015,2016 # Max Planck Institute for Polymer Research # Copyright (C) 2008,2009,2010,2011 # Max-Planck-Institute for Polymer Research & Fraunhofer SCAI # # This file is part of ESPResSo++. # # ESPResSo++ is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ESPResSo++ is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. r""" ********************* espressopp.VerletList ********************* .. function:: espressopp.VerletList(system, cutoff, exclusionlist, useBuffers, useSOA) :param system: :param cutoff: :param exclusionlist: (default: []) :param useBuffers: Whether particle neighbors are buffered to improve rebuild times. (default: True) :param useSOA: Whether the alternative structure of arrays form is used for buffers. (default: False) :type system: :type cutoff: :type exclusionlist: :type useBuffers: :type useSOA: .. function:: espressopp.VerletList.exclude(exclusionlist) :param exclusionlist: :type exclusionlist: :rtype: .. function:: espressopp.VerletList.getAllPairs() :rtype: .. function:: espressopp.VerletList.localSize() :rtype: .. function:: espressopp.VerletList.totalSize() :rtype: """ from espressopp import pmi import _espressopp import espressopp from espressopp.esutil import cxxinit class VerletListLocal(_espressopp.VerletList): def __init__(self, system, cutoff, exclusionlist=[], useBuffers=True, useSOA=False): if pmi.workerIsActive(): if (exclusionlist == []): # rebuild list in constructor cxxinit(self, _espressopp.VerletList, system, cutoff, True, useBuffers, useSOA) else: # do not rebuild list in constructor cxxinit(self, _espressopp.VerletList, system, cutoff, False, useBuffers, useSOA) # add exclusions for pair in exclusionlist: pid1, pid2 = pair self.cxxclass.exclude(self, pid1, pid2) # now rebuild list with exclusions self.cxxclass.rebuild(self) def totalSize(self): if pmi.workerIsActive(): return self.cxxclass.totalSize(self) def localSize(self): if pmi.workerIsActive(): return self.cxxclass.localSize(self) def exclude(self, exclusionlist): """ Each processor takes the broadcasted exclusion list and adds it to its list. """ if pmi.workerIsActive(): for pair in exclusionlist: pid1, pid2 = pair self.cxxclass.exclude(self, pid1, pid2) # rebuild list with exclusions self.cxxclass.rebuild(self) def getAllPairs(self): if pmi.workerIsActive(): pairs=[] npairs=self.localSize() for i in xrange(npairs): pair=self.cxxclass.getPair(self, i+1) pairs.append(pair) return pairs if pmi.isController: class VerletList(object): __metaclass__ = pmi.Proxy pmiproxydefs = dict( cls = 'espressopp.VerletListLocal', pmiproperty = [ 'builds' ], pmicall = [ 'totalSize', 'exclude', 'connect', 'disconnect', 'getVerletCutoff', 'resetTimers' ], pmiinvoke = [ 'getAllPairs','getTimers' ] )
govarguz/espressopp
src/VerletList.py
Python
gpl-3.0
3,985
[ "ESPResSo" ]
c3b13c55888a10ef6604455b13366bf73593f6d929ed3209a901f89b89dcd0e7
#-*- coding:UTF-8 -*- #! /usr/bin/python import getpass,sys from spider import renrenspider version = "0.3" if __name__ == "__main__": email=raw_input('请输入用户名:') password=getpass.getpass('请输入密码:') renrenspider=renrenspider(email,password) renrenspider.login() mode=999 while(mode!='000'): mode=raw_input('请输入操作代码:') if(mode=='120'): content=raw_input('请输入状态内容:') renrenspider.publish(content) if(mode=='200'): content=raw_input('请输入要访问的ID:') renrenspider.visit(content) if(mode=='100'): renrenspider.feed(renrenspider.file) renrenspider.show() sys.exit()
jamesliu96/renren
main.py
Python
mit
667
[ "VisIt" ]
7773c0221435d18f64a21bb228efc87509044e0edc5cc74e89b9a4bc93d26628
from django.db import transaction from django.db.models.signals import post_save from django.dispatch import receiver from django.utils import timezone from edc_registration.models import RegisteredSubject from edc_appointment.models import Appointment from edc_constants.constants import ( FEMALE, SCHEDULED, SCREENED, CONSENTED, FAILED_ELIGIBILITY, ALIVE, OFF_STUDY, ON_STUDY) from edc_visit_schedule.models.visit_definition import VisitDefinition from edc_identifier.subject.classes import InfantIdentifier from tshilo_dikotla.constants import INFANT from .maternal_consent import MaternalConsent from .maternal_ultrasound_initial import MaternalUltraSoundInitial from .antenatal_enrollment import AntenatalEnrollment from .maternal_eligibility import MaternalEligibility from .maternal_eligibility_loss import MaternalEligibilityLoss from .maternal_off_study import MaternalOffStudy from .maternal_visit import MaternalVisit from .maternal_labour_del import MaternalLabourDel from .potential_call import PotentialCall @receiver(post_save, weak=False, dispatch_uid="maternal_eligibility_on_post_save") def maternal_eligibility_on_post_save(sender, instance, raw, created, using, **kwargs): """Creates/Updates RegisteredSubject and creates or deletes MaternalEligibilityLoss If participant is consented, does nothing * If registered subject does not exist, it will be created and some attrs updated from the MaternalEligibility; * If registered subject already exists will update some attrs from the MaternalEligibility; * If registered subject and consent already exist, does nothing. Note: This is the ONLY place RegisteredSubject is created for mothers in this project.""" if not raw: if isinstance(instance, MaternalEligibility) and not kwargs.get('update_fields'): if not instance.is_eligible: try: maternal_eligibility_loss = MaternalEligibilityLoss.objects.get( maternal_eligibility_id=instance.id) maternal_eligibility_loss.report_datetime = instance.report_datetime maternal_eligibility_loss.reason_ineligible = instance.ineligibility maternal_eligibility_loss.user_modified = instance.user_modified maternal_eligibility_loss.save() except MaternalEligibilityLoss.DoesNotExist: MaternalEligibilityLoss.objects.create( maternal_eligibility_id=instance.id, report_datetime=instance.report_datetime, reason_ineligible=instance.ineligibility, user_created=instance.user_created, user_modified=instance.user_modified) else: MaternalEligibilityLoss.objects.filter(maternal_eligibility_id=instance.id).delete() try: registered_subject = RegisteredSubject.objects.get( screening_identifier=instance.eligibility_id, subject_type='maternal') MaternalConsent.objects.get(registered_subject=registered_subject) except RegisteredSubject.DoesNotExist: registered_subject = create_maternal_registered_subject(instance) instance.registered_subject = registered_subject instance.save() except MaternalConsent.DoesNotExist: registered_subject = update_maternal_registered_subject(registered_subject, instance) registered_subject.save() def create_maternal_registered_subject(instance): return RegisteredSubject.objects.create( created=instance.created, first_name='Mother', gender=FEMALE, registration_status=SCREENED, screening_datetime=instance.report_datetime, screening_identifier=instance.eligibility_id, screening_age_in_years=instance.age_in_years, subject_type='maternal', user_created=instance.user_created) def update_maternal_registered_subject(registered_subject, instance): registered_subject.first_name = 'Mother' registered_subject.gender = FEMALE registered_subject.registration_status = SCREENED registered_subject.screening_datetime = instance.report_datetime registered_subject.screening_identifier = instance.eligibility_id registered_subject.screening_age_in_years = instance.age_in_years registered_subject.subject_type = 'maternal' registered_subject.user_modified = instance.user_modified return registered_subject @receiver(post_save, weak=False, dispatch_uid="maternal_consent_on_post_save") def maternal_consent_on_post_save(sender, instance, raw, created, using, **kwargs): """Update maternal_eligibility consented flag and consent fields on registered subject.""" if not raw: if isinstance(instance, MaternalConsent): maternal_eligibility = MaternalEligibility.objects.get( registered_subject=instance.registered_subject) maternal_eligibility.is_consented = True maternal_eligibility.save(update_fields=['is_consented']) instance.registered_subject.registration_datetime = instance.consent_datetime instance.registered_subject.registration_status = CONSENTED instance.registered_subject.subject_identifier = instance.subject_identifier instance.registered_subject.initials = instance.initials instance.registered_subject.last_name = instance.last_name instance.registered_subject.identity = instance.identity instance.registered_subject.dob = instance.dob instance.registered_subject.subject_consent_id = instance.id instance.registered_subject.subject_consent_id = instance.pk instance.registered_subject.save() @receiver(post_save, weak=False, dispatch_uid="ineligible_take_off_study") def ineligible_take_off_study(sender, instance, raw, created, using, **kwargs): """If not is_eligible, creates the 1000M visit and sets to off study.""" if not raw: try: if not instance.is_eligible and not instance.pending_ultrasound: report_datetime = instance.report_datetime visit_definition = VisitDefinition.objects.get(code=instance.off_study_visit_code) appointment = Appointment.objects.get( registered_subject=instance.registered_subject, visit_definition=visit_definition) maternal_visit = MaternalVisit.objects.get(appointment=appointment) if maternal_visit.reason != FAILED_ELIGIBILITY: maternal_visit.reason = FAILED_ELIGIBILITY maternal_visit.study_status = OFF_STUDY maternal_visit.save() except MaternalVisit.DoesNotExist: MaternalVisit.objects.create( appointment=appointment, report_datetime=report_datetime, survival_status=ALIVE, study_status=OFF_STUDY, reason=FAILED_ELIGIBILITY) except AttributeError as e: pass # if 'is_eligible' not in str(e) and 'off_study_visit_code' not in str(e): # raise # except VisitDefinition.DoesNotExist: # pass # except Appointment.DoesNotExist: # pass def put_back_on_study_from_failed_eligibility(instance): """Attempts to change the 1000M maternal visit back to scheduled from off study.""" with transaction.atomic(): try: visit_definition = VisitDefinition.objects.get(code='1000M') appointment = Appointment.objects.get( registered_subject=instance.registered_subject, visit_definition=visit_definition) maternal_visit = MaternalVisit.objects.get( appointment=appointment) maternal_visit.study_status = ON_STUDY maternal_visit.reason = SCHEDULED maternal_visit.save() except MaternalVisit.DoesNotExist: MaternalVisit.objects.create( appointment=appointment, report_datetime=instance.report_datetime, survival_status=ALIVE, study_status=ON_STUDY, reason=SCHEDULED) except VisitDefinition.DoesNotExist: pass except Appointment.DoesNotExist: pass @receiver(post_save, weak=False, dispatch_uid="eligible_put_back_on_study") def eligible_put_back_on_study(sender, instance, raw, created, using, **kwargs): """changes the 1000M visit to scheduled from off study if is_eligible.""" if not raw: try: if isinstance(instance, AntenatalEnrollment) and (instance.pending_ultrasound or instance.is_eligible): MaternalOffStudy.objects.get( maternal_visit__appointment__registered_subject=instance.registered_subject) except AttributeError as e: if 'is_eligible' not in str(e) and 'registered_subject' not in str(e): raise except MaternalOffStudy.DoesNotExist: put_back_on_study_from_failed_eligibility(instance) @receiver(post_save, weak=False, dispatch_uid="maternal_ultrasound_delivery_initial_on_post_save") def maternal_ultrasound_delivery_initial_on_post_save(sender, instance, raw, created, using, **kwargs): """Update antenatal enrollment to indicate if eligibility is passed on not based on ultra sound form results.""" if not raw: if isinstance(instance, MaternalUltraSoundInitial) or isinstance(instance, MaternalLabourDel): # re-save antenatal enrollment record to recalculate eligibility antenatal_enrollment = instance.antenatal_enrollment antenatal_enrollment.pending_ultrasound = False antenatal_enrollment.save() @receiver(post_save, weak=False, dispatch_uid='create_infant_identifier_on_labour_delivery') def create_infant_identifier_on_labour_delivery(sender, instance, raw, created, using, **kwargs): """Creates an identifier for the registered infant. RegisteredSubject.objects.create( is called by InfantIdentifier Only one infant per mother is allowed.""" if not raw and created: if isinstance(instance, MaternalLabourDel): if instance.live_infants_to_register == 1: maternal_registered_subject = instance.registered_subject maternal_consent = MaternalConsent.objects.get( registered_subject=maternal_registered_subject) maternal_ultrasound = MaternalUltraSoundInitial.objects.get( maternal_visit__appointment__registered_subject=instance.registered_subject) with transaction.atomic(): infant_identifier = InfantIdentifier( maternal_identifier=maternal_registered_subject.subject_identifier, study_site=maternal_consent.study_site, birth_order=0, live_infants=int(maternal_ultrasound.number_of_gestations), live_infants_to_register=instance.live_infants_to_register, user=instance.user_created) RegisteredSubject.objects.using(using).create( subject_identifier=infant_identifier.get_identifier(), registration_datetime=instance.delivery_datetime, subject_type=INFANT, user_created=instance.user_created, created=timezone.now(), first_name='No Name', initials=None, registration_status='DELIVERED', relative_identifier=maternal_consent.subject_identifier, study_site=maternal_consent.study_site) @receiver(post_save, weak=False, dispatch_uid='create_potential_calls_on_post_save') def create_potential_calls_on_post_save(sender, instance, raw, created, using, **kwargs): if not raw: if isinstance(instance, Appointment): try: PotentialCall.objects.get( visit_code=instance.visit_definition.code, identity=instance.registered_subject.identity, subject_identifier=instance.registered_subject.subject_identifier, first_name=instance.registered_subject.first_name, last_name=instance.registered_subject.last_name, initials=instance.registered_subject.initials, gender=instance.registered_subject.gender, dob=instance.registered_subject.dob) except PotentialCall.DoesNotExist: PotentialCall.objects.create( approximate_date=instance.appt_datetime.date(), visit_code=instance.visit_definition.code, identity=instance.registered_subject.identity, subject_identifier=instance.registered_subject.subject_identifier, first_name=instance.registered_subject.first_name, last_name=instance.registered_subject.last_name, initials=instance.registered_subject.initials, gender=instance.registered_subject.gender, dob=instance.registered_subject.dob, consented=True)
TshepangRas/tshilo-dikotla
td_maternal/models/signals.py
Python
gpl-2.0
13,723
[ "VisIt" ]
0a6771b1be3d50b0f6e91901a3dba56445dbb9a68ca4936963b47e3b2ec0a046
# -*- coding: utf-8 -*- import sys import math from pylab import * try: import moose except ImportError: print("ERROR: Could not import moose. Please add the directory containing moose.py in your PYTHONPATH") import sys sys.exit(1) from moose.utils import * # for BSplineFill class AchSyn_STG(moose.SynChan): """Acetylcholine graded synapse""" def __init__(self, *args): moose.SynChan.__init__(self,*args) self.Ek = -80e-3 # V # For event based synapses, I had a strength of 5e-6 S # to compensate for event-based, # but for the original graded synapses, 5e-9 S is correct. self.Gbar = 5e-9 # S # set weight on connecting the network self.tau1 = 100e-3 # s # this is Vpre dependent (see below) self.tau2 = 0.0 # single first order equation Vth = -35e-3 # V Delta = 5e-3 # V ######## Graded synapse activation inhsyntable = moose.Interpol(self.path+"/graded_table") graded = moose.Mstring(self.path+'/graded') graded.value = 'True' mgblock = moose.Mstring(self.path+'/mgblockStr') mgblock.value = 'False' # also needs a synhandler moosesynhandler = moose.SimpleSynHandler(self.path+'/handler') # connect the SimpleSynHandler or the STDPSynHandler to the SynChan (double exp) moose.connect( moosesynhandler, 'activationOut', self, 'activation' ) # ds/dt = s_inf/tau - s/tau = A - Bs # where A=s_inf/tau is activation, B is 1/tau # Fill up the activation and tau tables # Graded synapse tau inhtautable = moose.Interpol(self.path+"/tau_table") inhtautable.xmin = -70e-3 # V inhtautable.xmax = 0e-3 # V tau = [self.tau1] # at -70 mV tau.extend( [self.tau1*(1. - 1./(1+math.exp((Vth-vm)/Delta))) \ for vm in arange(-70e-3,0.00001e-3,70e-3/1000.)] ) inhtautable.vector = array(tau) inhtautable.connect("lookupOut",self,"setTau1") # Graded synapse activation inhsyntable.xmin = -70e-3 # V inhsyntable.xmax = 0e-3 # V act = [0.0] # at -70 mV act.extend( [1/(1+math.exp((Vth-vm)/Delta)) \ for vm in arange(-70e-3,0.00001e-3,70e-3/1000.)] ) act = array(act) / array(tau) # element-wise division # NOTE: A = s_inf/tau inhsyntable.vector = array(act) inhsyntable.connect("lookupOut",self,"activation")
BhallaLab/moose-examples
neuroml/lobster_pyloric/synapses/AchSyn_STG.py
Python
gpl-2.0
2,461
[ "MOOSE" ]
03e4f701aa82b182aab47a6e01c16956395589398e603fcad72b2cfd1da5f182
#!/usr/env/python """ rock_weathering.py CellLab-CTS model that simulates the weathering of rock to saprolite around a network of fractures. Created (and translated from earlier code by) by Greg Tucker, Jul 2015 """ from __future__ import print_function import time import numpy as np from landlab import RasterModelGrid from landlab.components.cellular_automata.celllab_cts import Transition, CAPlotter from landlab.components.cellular_automata.raster_cts import RasterCTS from landlab.components.fracture_grid.fracture_grid import make_frac_grid import matplotlib from landlab.io.netcdf import write_netcdf def setup_transition_list(): """ Creates and returns a list of Transition() objects to represent the grain-by-grain transformation of bedrock to saprolite. Returns ------- xn_list : list of Transition objects List of objects that encode information about the link-state transitions. Notes ----- Weathering here is treated very simply: a bedrock particle adjacent to a saprolite particle has a specified probability (rate) of weathering to saprolite; in other words, a rock-saprolite pair can turn into a saprolite-saprolite pair. The states and transitions are as follows: Pair state Transition to Process Rate (cells/s) ========== ============= ======= ============== 0 (0-0) 1 (0-1) 0.5 2 (1-0) 0.5 1 (0-1) 3 (1-1) 1.0 2 (1-0) 3 (1-1) 1.0 3 (1-1) (none) - """ # Create an empty transition list xn_list = [] # Append two transitions to the list. # Note that the arguments to the Transition() object constructor are: # - Tuple representing starting pair state # (left/bottom cell, right/top cell, orientation) # - Tuple representing new pair state # (left/bottom cell, right/top cell, orientation) # - Transition rate (cells per time step, in this case 1 sec) # - Name for transition xn_list.append( Transition((0,1,0), (1,1,0), 1., 'weathering') ) xn_list.append( Transition((1,0,0), (1,1,0), 1., 'weathering') ) return xn_list def main(): # INITIALIZE # User-defined parameters nr = 200 # number of rows in grid nc = 200 # number of columns in grid plot_interval = 0.05 # time interval for plotting (unscaled) run_duration = 5.0 # duration of run (unscaled) report_interval = 10.0 # report interval, in real-time seconds frac_spacing = 10 # average fracture spacing, nodes outfilename = 'wx' # name for netCDF files # Remember the clock time, and calculate when we next want to report # progress. current_real_time = time.time() next_report = current_real_time + report_interval # Counter for output files time_slice = 0 # Create grid mg = RasterModelGrid(nr, nc, 1.0) # Make the boundaries be walls mg.set_closed_boundaries_at_grid_edges(True, True, True, True) # Set up the states and pair transitions. ns_dict = { 0 : 'rock', 1 : 'saprolite' } xn_list = setup_transition_list() # Create the node-state array and attach it to the grid. # (Note use of numpy's uint8 data type. This saves memory AND allows us # to write output to a netCDF3 file; netCDF3 does not handle the default # 64-bit integer type) node_state_grid = mg.add_zeros('node', 'node_state_map', dtype=np.uint8) node_state_grid[:] = make_frac_grid(frac_spacing, model_grid=mg) # Create the CA model ca = RasterCTS(mg, ns_dict, xn_list, node_state_grid) # Set up the color map rock_color = (0.8, 0.8, 0.8) sap_color = (0.4, 0.2, 0) clist = [rock_color, sap_color] my_cmap = matplotlib.colors.ListedColormap(clist) # Create a CAPlotter object for handling screen display ca_plotter = CAPlotter(ca, cmap=my_cmap) # Plot the initial grid ca_plotter.update_plot() # Output the initial grid to file write_netcdf((outfilename+str(time_slice)+'.nc'), mg, #format='NETCDF3_64BIT', names='node_state_map') # RUN current_time = 0.0 while current_time < run_duration: # Once in a while, print out simulation and real time to let the user # know that the sim is running ok current_real_time = time.time() if current_real_time >= next_report: print('Current sim time', current_time, '(', 100 * current_time/run_duration, '%)') next_report = current_real_time + report_interval # Run the model forward in time until the next output step ca.run(current_time+plot_interval, ca.node_state, plot_each_transition=False) current_time += plot_interval # Plot the current grid ca_plotter.update_plot() # Output the current grid to a netCDF file time_slice += 1 write_netcdf((outfilename+str(time_slice)+'.nc'), mg, #format='NETCDF3_64BIT', names='node_state_map') # FINALIZE # Plot ca_plotter.finalize() # If user runs this file, activate the main() function if __name__ == "__main__": main()
decvalts/landlab
landlab/components/cellular_automata/examples/rock_weathering.py
Python
mit
5,558
[ "NetCDF" ]
b0a2aecacbbb07ea42c462b7a68243473a81d9f580d065ff9768d2c4eabdf18a
# ---------------------------------------------------------------------------- # Copyright (c) 2013--, scikit-bio development team. # # Distributed under the terms of the Modified BSD License. # # The full license is in the file COPYING.txt, distributed with this software. # ---------------------------------------------------------------------------- import hashlib import inspect from types import FunctionType from ._decorator import experimental def resolve_key(obj, key): """Resolve key given an object and key.""" if callable(key): return key(obj) elif hasattr(obj, 'metadata'): return obj.metadata[key] raise TypeError("Could not resolve key %r. Key must be callable or %s must" " have `metadata` attribute." % (key, obj.__class__.__name__)) def make_sentinel(name): return type(name, (), { '__repr__': lambda s: name, '__str__': lambda s: name, '__class__': None })() def find_sentinels(function, sentinel): params = inspect.signature(function).parameters return [name for name, param in params.items() if param.default is sentinel] class MiniRegistry(dict): def __call__(self, name): """Act as a decorator to register functions with self""" def decorator(func): self[name] = func return func return decorator def copy(self): """Useful for inheritance""" return self.__class__(super(MiniRegistry, self).copy()) def formatted_listing(self): """Produce an RST list with descriptions.""" if len(self) == 0: return "\tNone" else: return "\n".join(["\t%r\n\t %s" % (name, self[name].__doc__.split("\n")[0]) for name in sorted(self)]) def interpolate(self, obj, name): """Inject the formatted listing in the second blank line of `name`.""" f = getattr(obj, name) f2 = FunctionType(f.__code__, f.__globals__, name=f.__name__, argdefs=f.__defaults__, closure=f.__closure__) # Conveniently the original docstring is on f2, not the new ones if # inheritence is happening. I have no idea why. t = f2.__doc__.split("\n\n") t.insert(2, self.formatted_listing()) f2.__doc__ = "\n\n".join(t) setattr(obj, name, f2) def chunk_str(s, n, char): """Insert `char` character every `n` characters in string `s`. Canonically pronounced "chunkster". """ # Modified from http://stackoverflow.com/a/312464/3776794 if n < 1: raise ValueError( "Cannot split string into chunks with n=%d. n must be >= 1." % n) return char.join((s[i:i+n] for i in range(0, len(s), n))) @experimental(as_of="0.4.0") def cardinal_to_ordinal(n): """Return ordinal string version of cardinal int `n`. Parameters ---------- n : int Cardinal to convert to ordinal. Must be >= 0. Returns ------- str Ordinal version of cardinal `n`. Raises ------ ValueError If `n` is less than 0. Notes ----- This function can be useful when writing human-readable error messages. Examples -------- >>> from skbio.util import cardinal_to_ordinal >>> cardinal_to_ordinal(0) '0th' >>> cardinal_to_ordinal(1) '1st' >>> cardinal_to_ordinal(2) '2nd' >>> cardinal_to_ordinal(3) '3rd' """ # Taken and modified from http://stackoverflow.com/a/20007730/3776794 # Originally from http://codegolf.stackexchange.com/a/4712 by Gareth if n < 0: raise ValueError("Cannot convert negative integer %d to ordinal " "string." % n) return "%d%s" % (n, "tsnrhtdd"[(n//10 % 10 != 1)*(n % 10 < 4)*n % 10::4]) @experimental(as_of="0.4.0") def safe_md5(open_file, block_size=2 ** 20): """Computes an md5 sum without loading the file into memory Parameters ---------- open_file : file object open file handle to the archive to compute the checksum. It must be open as a binary file block_size : int, optional size of the block taken per iteration Returns ------- md5 : md5 object from the hashlib module object with the loaded file Notes ----- This method is based on the answers given in: http://stackoverflow.com/a/1131255/379593 Examples -------- >>> from io import BytesIO >>> from skbio.util import safe_md5 >>> fd = BytesIO(b"foo bar baz") # open file like object >>> x = safe_md5(fd) >>> x.hexdigest() 'ab07acbb1e496801937adfa772424bf7' >>> fd.close() """ md5 = hashlib.md5() data = True while data: data = open_file.read(block_size) if data: md5.update(data) return md5 @experimental(as_of="0.4.0") def find_duplicates(iterable): """Find duplicate elements in an iterable. Parameters ---------- iterable : iterable Iterable to be searched for duplicates (i.e., elements that are repeated). Returns ------- set Repeated elements in `iterable`. """ # modified from qiita.qiita_db.util.find_repeated # https://github.com/biocore/qiita # see licenses/qiita.txt seen, repeated = set(), set() for e in iterable: if e in seen: repeated.add(e) else: seen.add(e) return repeated
gregcaporaso/scikit-bio
skbio/util/_misc.py
Python
bsd-3-clause
5,575
[ "scikit-bio" ]
5a51c810f798e1d0b6fcd90f137dd3586158da236c00fa8c22bde18f17bbe4b1
# Docstrings for generated ufuncs # # The syntax is designed to look like the function add_newdoc is being # called from numpy.lib, but in this file add_newdoc puts the # docstrings in a dictionary. This dictionary is used in # generate_ufuncs.py to generate the docstrings for the ufuncs in # scipy.special at the C level when the ufuncs are created at compile # time. from __future__ import division, print_function, absolute_import docdict = {} def get(name): return docdict.get(name) def add_newdoc(place, name, doc): docdict['.'.join((place, name))] = doc add_newdoc("scipy.special", "sph_harm", r""" sph_harm(m, n, theta, phi) Compute spherical harmonics. .. math:: Y^m_n(\theta,\phi) = \sqrt{\frac{2n+1}{4\pi}\frac{(n-m)!}{(n+m)!}} e^{i m \theta} P^m_n(\cos(\phi)) Parameters ---------- m : int ``|m| <= n``; the order of the harmonic. n : int where `n` >= 0; the degree of the harmonic. This is often called ``l`` (lower case L) in descriptions of spherical harmonics. theta : float [0, 2*pi]; the azimuthal (longitudinal) coordinate. phi : float [0, pi]; the polar (colatitudinal) coordinate. Returns ------- y_mn : complex float The harmonic :math:`Y^m_n` sampled at `theta` and `phi` Notes ----- There are different conventions for the meaning of input arguments `theta` and `phi`. We take `theta` to be the azimuthal angle and `phi` to be the polar angle. It is common to see the opposite convention - that is `theta` as the polar angle and `phi` as the azimuthal angle. References ---------- .. [1] Digital Library of Mathematical Functions, 14.30. http://dlmf.nist.gov/14.30 """) add_newdoc("scipy.special", "_ellip_harm", """ Internal function, use `ellip_harm` instead. """) add_newdoc("scipy.special", "_ellip_norm", """ Internal function, use `ellip_norm` instead. """) add_newdoc("scipy.special", "_lambertw", """ Internal function, use `lambertw` instead. """) add_newdoc("scipy.special", "airy", """ airy(z) Airy functions and their derivatives. Parameters ---------- z : float or complex Argument. Returns ------- Ai, Aip, Bi, Bip Airy functions Ai and Bi, and their derivatives Aip and Bip Notes ----- The Airy functions Ai and Bi are two independent solutions of y''(x) = x y. """) add_newdoc("scipy.special", "airye", """ airye(z) Exponentially scaled Airy functions and their derivatives. Scaling:: eAi = Ai * exp(2.0/3.0*z*sqrt(z)) eAip = Aip * exp(2.0/3.0*z*sqrt(z)) eBi = Bi * exp(-abs((2.0/3.0*z*sqrt(z)).real)) eBip = Bip * exp(-abs((2.0/3.0*z*sqrt(z)).real)) Parameters ---------- z : float or complex Argument. Returns ------- eAi, eAip, eBi, eBip Airy functions Ai and Bi, and their derivatives Aip and Bip """) add_newdoc("scipy.special", "bdtr", """ bdtr(k, n, p) Binomial distribution cumulative distribution function. Sum of the terms 0 through `k` of the Binomial probability density. :: y = sum(nCj p**j (1-p)**(n-j), j=0..k) Parameters ---------- k, n : int Terms to include p : float Probability Returns ------- y : float Sum of terms """) add_newdoc("scipy.special", "bdtrc", """ bdtrc(k, n, p) Binomial distribution survival function. Sum of the terms k+1 through `n` of the Binomial probability density :: y = sum(nCj p**j (1-p)**(n-j), j=k+1..n) Parameters ---------- k, n : int Terms to include p : float Probability Returns ------- y : float Sum of terms """) add_newdoc("scipy.special", "bdtri", """ bdtri(k, n, y) Inverse function to `bdtr` vs. `p` Finds probability `p` such that for the cumulative binomial probability ``bdtr(k, n, p) == y``. """) add_newdoc("scipy.special", "bdtrik", """ bdtrik(y, n, p) Inverse function to `bdtr` vs `k` """) add_newdoc("scipy.special", "bdtrin", """ bdtrin(k, y, p) Inverse function to `bdtr` vs `n` """) add_newdoc("scipy.special", "binom", """ binom(n, k) Binomial coefficient """) add_newdoc("scipy.special", "btdtria", """ btdtria(p, b, x) Inverse of `btdtr` vs `a` """) add_newdoc("scipy.special", "btdtrib", """ btdtria(a, p, x) Inverse of `btdtr` vs `b` """) add_newdoc("scipy.special", "bei", """ bei(x) Kelvin function bei """) add_newdoc("scipy.special", "beip", """ beip(x) Derivative of the Kelvin function `bei` """) add_newdoc("scipy.special", "ber", """ ber(x) Kelvin function ber. """) add_newdoc("scipy.special", "berp", """ berp(x) Derivative of the Kelvin function `ber` """) add_newdoc("scipy.special", "besselpoly", r""" besselpoly(a, lmb, nu) Weighted integral of a Bessel function. .. math:: \int_0^1 x^\lambda J_\nu(2 a x) \, dx where :math:`J_\nu` is a Bessel function and :math:`\lambda=lmb`, :math:`\nu=nu`. """) add_newdoc("scipy.special", "beta", """ beta(a, b) Beta function. :: beta(a, b) = gamma(a) * gamma(b) / gamma(a+b) """) add_newdoc("scipy.special", "betainc", """ betainc(a, b, x) Incomplete beta integral. Compute the incomplete beta integral of the arguments, evaluated from zero to `x`:: gamma(a+b) / (gamma(a)*gamma(b)) * integral(t**(a-1) (1-t)**(b-1), t=0..x). Notes ----- The incomplete beta is also sometimes defined without the terms in gamma, in which case the above definition is the so-called regularized incomplete beta. Under this definition, you can get the incomplete beta by multiplying the result of the scipy function by beta(a, b). """) add_newdoc("scipy.special", "betaincinv", """ betaincinv(a, b, y) Inverse function to beta integral. Compute `x` such that betainc(a, b, x) = y. """) add_newdoc("scipy.special", "betaln", """ betaln(a, b) Natural logarithm of absolute value of beta function. Computes ``ln(abs(beta(a, b)))``. """) add_newdoc("scipy.special", "boxcox", """ boxcox(x, lmbda) Compute the Box-Cox transformation. The Box-Cox transformation is:: y = (x**lmbda - 1) / lmbda if lmbda != 0 log(x) if lmbda == 0 Returns `nan` if ``x < 0``. Returns `-inf` if ``x == 0`` and ``lmbda < 0``. Parameters ---------- x : array_like Data to be transformed. lmbda : array_like Power parameter of the Box-Cox transform. Returns ------- y : array Transformed data. Notes ----- .. versionadded:: 0.14.0 Examples -------- >>> from scipy.special import boxcox >>> boxcox([1, 4, 10], 2.5) array([ 0. , 12.4 , 126.09110641]) >>> boxcox(2, [0, 1, 2]) array([ 0.69314718, 1. , 1.5 ]) """) add_newdoc("scipy.special", "boxcox1p", """ boxcox1p(x, lmbda) Compute the Box-Cox transformation of 1 + `x`. The Box-Cox transformation computed by `boxcox1p` is:: y = ((1+x)**lmbda - 1) / lmbda if lmbda != 0 log(1+x) if lmbda == 0 Returns `nan` if ``x < -1``. Returns `-inf` if ``x == -1`` and ``lmbda < 0``. Parameters ---------- x : array_like Data to be transformed. lmbda : array_like Power parameter of the Box-Cox transform. Returns ------- y : array Transformed data. Notes ----- .. versionadded:: 0.14.0 Examples -------- >>> from scipy.special import boxcox1p >>> boxcox1p(1e-4, [0, 0.5, 1]) array([ 9.99950003e-05, 9.99975001e-05, 1.00000000e-04]) >>> boxcox1p([0.01, 0.1], 0.25) array([ 0.00996272, 0.09645476]) """) add_newdoc("scipy.special", "inv_boxcox", """ inv_boxcox(y, lmbda) Compute the inverse of the Box-Cox transformation. Find ``x`` such that:: y = (x**lmbda - 1) / lmbda if lmbda != 0 log(x) if lmbda == 0 Parameters ---------- y : array_like Data to be transformed. lmbda : array_like Power parameter of the Box-Cox transform. Returns ------- x : array Transformed data. Notes ----- .. versionadded:: 0.16.0 Examples -------- >>> from scipy.special import boxcox, inv_boxcox >>> y = boxcox([1, 4, 10], 2.5) >>> inv_boxcox(y, 2.5) array([1., 4., 10.]) """) add_newdoc("scipy.special", "inv_boxcox1p", """ inv_boxcox1p(y, lmbda) Compute the inverse of the Box-Cox transformation. Find ``x`` such that:: y = ((1+x)**lmbda - 1) / lmbda if lmbda != 0 log(1+x) if lmbda == 0 Parameters ---------- y : array_like Data to be transformed. lmbda : array_like Power parameter of the Box-Cox transform. Returns ------- x : array Transformed data. Notes ----- .. versionadded:: 0.16.0 Examples -------- >>> from scipy.special import boxcox1p, inv_boxcox1p >>> y = boxcox1p([1, 4, 10], 2.5) >>> inv_boxcox1p(y, 2.5) array([1., 4., 10.]) """) add_newdoc("scipy.special", "btdtr", """ btdtr(a, b, x) Cumulative beta distribution. Returns the area from zero to `x` under the beta density function:: gamma(a+b)/(gamma(a)*gamma(b)))*integral(t**(a-1) (1-t)**(b-1), t=0..x) See Also -------- betainc """) add_newdoc("scipy.special", "btdtri", """ btdtri(a, b, p) p-th quantile of the beta distribution. This is effectively the inverse of `btdtr` returning the value of `x` for which ``btdtr(a, b, x) = p`` See Also -------- betaincinv """) add_newdoc("scipy.special", "cbrt", """ cbrt(x) Cube root of `x` """) add_newdoc("scipy.special", "chdtr", """ chdtr(v, x) Chi square cumulative distribution function Returns the area under the left hand tail (from 0 to `x`) of the Chi square probability density function with `v` degrees of freedom:: 1/(2**(v/2) * gamma(v/2)) * integral(t**(v/2-1) * exp(-t/2), t=0..x) """) add_newdoc("scipy.special", "chdtrc", """ chdtrc(v, x) Chi square survival function Returns the area under the right hand tail (from `x` to infinity) of the Chi square probability density function with `v` degrees of freedom:: 1/(2**(v/2) * gamma(v/2)) * integral(t**(v/2-1) * exp(-t/2), t=x..inf) """) add_newdoc("scipy.special", "chdtri", """ chdtri(v, p) Inverse to `chdtrc` Returns the argument x such that ``chdtrc(v, x) == p``. """) add_newdoc("scipy.special", "chdtriv", """ chdtri(p, x) Inverse to `chdtr` vs `v` Returns the argument v such that ``chdtr(v, x) == p``. """) add_newdoc("scipy.special", "chndtr", """ chndtr(x, df, nc) Non-central chi square cumulative distribution function """) add_newdoc("scipy.special", "chndtrix", """ chndtrix(p, df, nc) Inverse to `chndtr` vs `x` """) add_newdoc("scipy.special", "chndtridf", """ chndtridf(x, p, nc) Inverse to `chndtr` vs `df` """) add_newdoc("scipy.special", "chndtrinc", """ chndtrinc(x, df, p) Inverse to `chndtr` vs `nc` """) add_newdoc("scipy.special", "cosdg", """ cosdg(x) Cosine of the angle `x` given in degrees. """) add_newdoc("scipy.special", "cosm1", """ cosm1(x) cos(x) - 1 for use when `x` is near zero. """) add_newdoc("scipy.special", "cotdg", """ cotdg(x) Cotangent of the angle `x` given in degrees. """) add_newdoc("scipy.special", "dawsn", """ dawsn(x) Dawson's integral. Computes:: exp(-x**2) * integral(exp(t**2), t=0..x). References ---------- .. [1] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "ellipe", """ ellipe(m) Complete elliptic integral of the second kind This function is defined as .. math:: E(m) = \\int_0^{\\pi/2} [1 - m \\sin(t)^2]^{1/2} dt Parameters ---------- m : array_like Defines the parameter of the elliptic integral. Returns ------- E : ndarray Value of the elliptic integral. See Also -------- ellipkm1 : Complete elliptic integral of the first kind, near `m` = 1 ellipk : Complete elliptic integral of the first kind ellipkinc : Incomplete elliptic integral of the first kind ellipeinc : Incomplete elliptic integral of the second kind """) add_newdoc("scipy.special", "ellipeinc", """ ellipeinc(phi, m) Incomplete elliptic integral of the second kind This function is defined as .. math:: E(\\phi, m) = \\int_0^{\\phi} [1 - m \\sin(t)^2]^{1/2} dt Parameters ---------- phi : array_like amplitude of the elliptic integral. m : array_like parameter of the elliptic integral. Returns ------- E : ndarray Value of the elliptic integral. See Also -------- ellipkm1 : Complete elliptic integral of the first kind, near `m` = 1 ellipk : Complete elliptic integral of the first kind ellipkinc : Incomplete elliptic integral of the first kind ellipe : Complete elliptic integral of the second kind """) add_newdoc("scipy.special", "ellipj", """ ellipj(u, m) Jacobian elliptic functions Calculates the Jacobian elliptic functions of parameter `m` between 0 and 1, and real `u`. Parameters ---------- m, u Parameters Returns ------- sn, cn, dn, ph The returned functions:: sn(u|m), cn(u|m), dn(u|m) The value ``ph`` is such that if ``u = ellik(ph, m)``, then ``sn(u|m) = sin(ph)`` and ``cn(u|m) = cos(ph)``. """) add_newdoc("scipy.special", "ellipkm1", """ ellipkm1(p) Complete elliptic integral of the first kind around `m` = 1 This function is defined as .. math:: K(p) = \\int_0^{\\pi/2} [1 - m \\sin(t)^2]^{-1/2} dt where `m = 1 - p`. Parameters ---------- p : array_like Defines the parameter of the elliptic integral as `m` = 1 - p. Returns ------- K : ndarray Value of the elliptic integral. See Also -------- ellipk : Complete elliptic integral of the first kind ellipkinc : Incomplete elliptic integral of the first kind ellipe : Complete elliptic integral of the second kind ellipeinc : Incomplete elliptic integral of the second kind """) add_newdoc("scipy.special", "ellipkinc", """ ellipkinc(phi, m) Incomplete elliptic integral of the first kind This function is defined as .. math:: K(\\phi, m) = \\int_0^{\\phi} [1 - m \\sin(t)^2]^{-1/2} dt Parameters ---------- phi : array_like amplitude of the elliptic integral m : array_like parameter of the elliptic integral Returns ------- K : ndarray Value of the elliptic integral Notes ----- This function is also called ``F(phi, m)``. See Also -------- ellipkm1 : Complete elliptic integral of the first kind, near `m` = 1 ellipk : Complete elliptic integral of the first kind ellipe : Complete elliptic integral of the second kind ellipeinc : Incomplete elliptic integral of the second kind """) add_newdoc("scipy.special", "entr", r""" entr(x) Elementwise function for computing entropy. .. math:: \text{entr}(x) = \begin{cases} - x \log(x) & x > 0 \\ 0 & x = 0 \\ -\infty & \text{otherwise} \end{cases} Parameters ---------- x : ndarray Input array. Returns ------- res : ndarray The value of the elementwise entropy function at the given points `x`. See Also -------- kl_div, rel_entr Notes ----- This function is concave. .. versionadded:: 0.14.0 """) add_newdoc("scipy.special", "erf", """ erf(z) Returns the error function of complex argument. It is defined as ``2/sqrt(pi)*integral(exp(-t**2), t=0..z)``. Parameters ---------- x : ndarray Input array. Returns ------- res : ndarray The values of the error function at the given points `x`. See Also -------- erfc, erfinv, erfcinv Notes ----- The cumulative of the unit normal distribution is given by ``Phi(z) = 1/2[1 + erf(z/sqrt(2))]``. References ---------- .. [1] http://en.wikipedia.org/wiki/Error_function .. [2] Milton Abramowitz and Irene A. Stegun, eds. Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical Tables. New York: Dover, 1972. http://www.math.sfu.ca/~cbm/aands/page_297.htm .. [3] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "erfc", """ erfc(x) Complementary error function, 1 - erf(x). References ---------- .. [1] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "erfi", """ erfi(z) Imaginary error function, -i erf(i z). Notes ----- .. versionadded:: 0.12.0 References ---------- .. [1] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "erfcx", """ erfcx(x) Scaled complementary error function, exp(x^2) erfc(x). Notes ----- .. versionadded:: 0.12.0 References ---------- .. [1] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "eval_jacobi", """ eval_jacobi(n, alpha, beta, x, out=None) Evaluate Jacobi polynomial at a point. """) add_newdoc("scipy.special", "eval_sh_jacobi", """ eval_sh_jacobi(n, p, q, x, out=None) Evaluate shifted Jacobi polynomial at a point. """) add_newdoc("scipy.special", "eval_gegenbauer", """ eval_gegenbauer(n, alpha, x, out=None) Evaluate Gegenbauer polynomial at a point. """) add_newdoc("scipy.special", "eval_chebyt", """ eval_chebyt(n, x, out=None) Evaluate Chebyshev T polynomial at a point. This routine is numerically stable for `x` in ``[-1, 1]`` at least up to order ``10000``. """) add_newdoc("scipy.special", "eval_chebyu", """ eval_chebyu(n, x, out=None) Evaluate Chebyshev U polynomial at a point. """) add_newdoc("scipy.special", "eval_chebys", """ eval_chebys(n, x, out=None) Evaluate Chebyshev S polynomial at a point. """) add_newdoc("scipy.special", "eval_chebyc", """ eval_chebyc(n, x, out=None) Evaluate Chebyshev C polynomial at a point. """) add_newdoc("scipy.special", "eval_sh_chebyt", """ eval_sh_chebyt(n, x, out=None) Evaluate shifted Chebyshev T polynomial at a point. """) add_newdoc("scipy.special", "eval_sh_chebyu", """ eval_sh_chebyu(n, x, out=None) Evaluate shifted Chebyshev U polynomial at a point. """) add_newdoc("scipy.special", "eval_legendre", """ eval_legendre(n, x, out=None) Evaluate Legendre polynomial at a point. """) add_newdoc("scipy.special", "eval_sh_legendre", """ eval_sh_legendre(n, x, out=None) Evaluate shifted Legendre polynomial at a point. """) add_newdoc("scipy.special", "eval_genlaguerre", """ eval_genlaguerre(n, alpha, x, out=None) Evaluate generalized Laguerre polynomial at a point. """) add_newdoc("scipy.special", "eval_laguerre", """ eval_laguerre(n, x, out=None) Evaluate Laguerre polynomial at a point. """) add_newdoc("scipy.special", "eval_hermite", """ eval_hermite(n, x, out=None) Evaluate Hermite polynomial at a point. """) add_newdoc("scipy.special", "eval_hermitenorm", """ eval_hermitenorm(n, x, out=None) Evaluate normalized Hermite polynomial at a point. """) add_newdoc("scipy.special", "exp1", """ exp1(z) Exponential integral E_1 of complex argument z :: integral(exp(-z*t)/t, t=1..inf). """) add_newdoc("scipy.special", "exp10", """ exp10(x) 10**x """) add_newdoc("scipy.special", "exp2", """ exp2(x) 2**x """) add_newdoc("scipy.special", "expi", """ expi(x) Exponential integral Ei Defined as:: integral(exp(t)/t, t=-inf..x) See `expn` for a different exponential integral. """) add_newdoc('scipy.special', 'expit', """ expit(x) Expit ufunc for ndarrays. The expit function, also known as the logistic function, is defined as expit(x) = 1/(1+exp(-x)). It is the inverse of the logit function. Parameters ---------- x : ndarray The ndarray to apply expit to element-wise. Returns ------- out : ndarray An ndarray of the same shape as x. Its entries are expit of the corresponding entry of x. Notes ----- As a ufunc expit takes a number of optional keyword arguments. For more information see `ufuncs <http://docs.scipy.org/doc/numpy/reference/ufuncs.html>`_ .. versionadded:: 0.10.0 """) add_newdoc("scipy.special", "expm1", """ expm1(x) exp(x) - 1 for use when `x` is near zero. """) add_newdoc("scipy.special", "expn", """ expn(n, x) Exponential integral E_n Returns the exponential integral for integer `n` and non-negative `x` and `n`:: integral(exp(-x*t) / t**n, t=1..inf). """) add_newdoc("scipy.special", "exprel", r""" exprel(x) Relative error exponential, (exp(x)-1)/x, for use when `x` is near zero. Parameters ---------- x : ndarray Input array. Returns ------- res : ndarray Output array. See Also -------- expm1 .. versionadded:: 0.17.0 """) add_newdoc("scipy.special", "fdtr", """ fdtr(dfn, dfd, x) F cumulative distribution function Returns the area from zero to `x` under the F density function (also known as Snedcor's density or the variance ratio density). This is the density of X = (unum/dfn)/(uden/dfd), where unum and uden are random variables having Chi square distributions with dfn and dfd degrees of freedom, respectively. """) add_newdoc("scipy.special", "fdtrc", """ fdtrc(dfn, dfd, x) F survival function Returns the complemented F distribution function. """) add_newdoc("scipy.special", "fdtri", """ fdtri(dfn, dfd, p) Inverse to `fdtr` vs x Finds the F density argument `x` such that ``fdtr(dfn, dfd, x) == p``. """) add_newdoc("scipy.special", "fdtridfd", """ fdtridfd(dfn, p, x) Inverse to `fdtr` vs dfd Finds the F density argument dfd such that ``fdtr(dfn, dfd, x) == p``. """) add_newdoc("scipy.special", "fdtridfn", """ fdtridfn(p, dfd, x) Inverse to `fdtr` vs dfn finds the F density argument dfn such that ``fdtr(dfn, dfd, x) == p``. """) add_newdoc("scipy.special", "fresnel", """ fresnel(z) Fresnel sin and cos integrals Defined as:: ssa = integral(sin(pi/2 * t**2), t=0..z) csa = integral(cos(pi/2 * t**2), t=0..z) Parameters ---------- z : float or complex array_like Argument Returns ------- ssa, csa Fresnel sin and cos integral values """) add_newdoc("scipy.special", "gamma", """ gamma(z) Gamma function The gamma function is often referred to as the generalized factorial since ``z*gamma(z) = gamma(z+1)`` and ``gamma(n+1) = n!`` for natural number *n*. """) add_newdoc("scipy.special", "gammainc", """ gammainc(a, x) Incomplete gamma function Defined as:: 1 / gamma(a) * integral(exp(-t) * t**(a-1), t=0..x) `a` must be positive and `x` must be >= 0. """) add_newdoc("scipy.special", "gammaincc", """ gammaincc(a, x) Complemented incomplete gamma integral Defined as:: 1 / gamma(a) * integral(exp(-t) * t**(a-1), t=x..inf) = 1 - gammainc(a, x) `a` must be positive and `x` must be >= 0. """) add_newdoc("scipy.special", "gammainccinv", """ gammainccinv(a, y) Inverse to `gammaincc` Returns `x` such that ``gammaincc(a, x) == y``. """) add_newdoc("scipy.special", "gammaincinv", """ gammaincinv(a, y) Inverse to `gammainc` Returns `x` such that ``gammainc(a, x) = y``. """) add_newdoc("scipy.special", "gammaln", """ gammaln(z) Performs a logarithmic transformation of the values of the gamma function in one of two ways, depending on the input `z`: 1) `z` is not complex (i.e. `z` is a purely real number *or* it is array_like and contains purely real elements) The natural logarithm of the absolute value of gamma(z) is computed. Thus, it is defined as: ln(abs(gamma(z))) 2) `z` is complex (i.e. `z` is a complex number *or* it is array_like and contains at least one complex element) The natural logarithm of gamma(z) is computed. Thus, it is defined as: ln((gamma(z)) See Also -------- gammasgn """) add_newdoc("scipy.special", "gammasgn", """ gammasgn(x) Sign of the gamma function. See Also -------- gammaln """) add_newdoc("scipy.special", "gdtr", """ gdtr(a, b, x) Gamma distribution cumulative density function. Returns the integral from zero to `x` of the gamma probability density function:: a**b / gamma(b) * integral(t**(b-1) exp(-at), t=0..x). The arguments `a` and `b` are used differently here than in other definitions. """) add_newdoc("scipy.special", "gdtrc", """ gdtrc(a, b, x) Gamma distribution survival function. Integral from `x` to infinity of the gamma probability density function. See Also -------- gdtr, gdtri """) add_newdoc("scipy.special", "gdtria", """ gdtria(p, b, x, out=None) Inverse of `gdtr` vs a. Returns the inverse with respect to the parameter `a` of ``p = gdtr(a, b, x)``, the cumulative distribution function of the gamma distribution. Parameters ---------- p : array_like Probability values. b : array_like `b` parameter values of `gdtr(a, b, x)`. `b` is the "shape" parameter of the gamma distribution. x : array_like Nonnegative real values, from the domain of the gamma distribution. out : ndarray, optional If a fourth argument is given, it must be a numpy.ndarray whose size matches the broadcast result of `a`, `b` and `x`. `out` is then the array returned by the function. Returns ------- a : ndarray Values of the `a` parameter such that `p = gdtr(a, b, x)`. `1/a` is the "scale" parameter of the gamma distribution. See Also -------- gdtr : CDF of the gamma distribution. gdtrib : Inverse with respect to `b` of `gdtr(a, b, x)`. gdtrix : Inverse with respect to `x` of `gdtr(a, b, x)`. Examples -------- First evaluate `gdtr`. >>> from scipy.special import gdtr, gdtria >>> p = gdtr(1.2, 3.4, 5.6) >>> print(p) 0.94378087442 Verify the inverse. >>> gdtria(p, 3.4, 5.6) 1.2 """) add_newdoc("scipy.special", "gdtrib", """ gdtrib(a, p, x, out=None) Inverse of `gdtr` vs b. Returns the inverse with respect to the parameter `b` of ``p = gdtr(a, b, x)``, the cumulative distribution function of the gamma distribution. Parameters ---------- a : array_like `a` parameter values of `gdtr(a, b, x)`. `1/a` is the "scale" parameter of the gamma distribution. p : array_like Probability values. x : array_like Nonnegative real values, from the domain of the gamma distribution. out : ndarray, optional If a fourth argument is given, it must be a numpy.ndarray whose size matches the broadcast result of `a`, `b` and `x`. `out` is then the array returned by the function. Returns ------- b : ndarray Values of the `b` parameter such that `p = gdtr(a, b, x)`. `b` is the "shape" parameter of the gamma distribution. See Also -------- gdtr : CDF of the gamma distribution. gdtria : Inverse with respect to `a` of `gdtr(a, b, x)`. gdtrix : Inverse with respect to `x` of `gdtr(a, b, x)`. Examples -------- First evaluate `gdtr`. >>> from scipy.special import gdtr, gdtrib >>> p = gdtr(1.2, 3.4, 5.6) >>> print(p) 0.94378087442 Verify the inverse. >>> gdtrib(1.2, p, 5.6) 3.3999999999723882 """) add_newdoc("scipy.special", "gdtrix", """ gdtrix(a, b, p, out=None) Inverse of `gdtr` vs x. Returns the inverse with respect to the parameter `x` of ``p = gdtr(a, b, x)``, the cumulative distribution function of the gamma distribution. This is also known as the p'th quantile of the distribution. Parameters ---------- a : array_like `a` parameter values of `gdtr(a, b, x)`. `1/a` is the "scale" parameter of the gamma distribution. b : array_like `b` parameter values of `gdtr(a, b, x)`. `b` is the "shape" parameter of the gamma distribution. p : array_like Probability values. out : ndarray, optional If a fourth argument is given, it must be a numpy.ndarray whose size matches the broadcast result of `a`, `b` and `x`. `out` is then the array returned by the function. Returns ------- x : ndarray Values of the `x` parameter such that `p = gdtr(a, b, x)`. See Also -------- gdtr : CDF of the gamma distribution. gdtria : Inverse with respect to `a` of `gdtr(a, b, x)`. gdtrib : Inverse with respect to `b` of `gdtr(a, b, x)`. Examples -------- First evaluate `gdtr`. >>> from scipy.special import gdtr, gdtrix >>> p = gdtr(1.2, 3.4, 5.6) >>> print(p) 0.94378087442 Verify the inverse. >>> gdtrix(1.2, 3.4, p) 5.5999999999999996 """) add_newdoc("scipy.special", "hankel1", """ hankel1(v, z) Hankel function of the first kind Parameters ---------- v : float Order z : float or complex Argument """) add_newdoc("scipy.special", "hankel1e", """ hankel1e(v, z) Exponentially scaled Hankel function of the first kind Defined as:: hankel1e(v, z) = hankel1(v, z) * exp(-1j * z) Parameters ---------- v : float Order z : complex Argument """) add_newdoc("scipy.special", "hankel2", """ hankel2(v, z) Hankel function of the second kind Parameters ---------- v : float Order z : complex Argument """) add_newdoc("scipy.special", "hankel2e", """ hankel2e(v, z) Exponentially scaled Hankel function of the second kind Defined as:: hankel1e(v, z) = hankel1(v, z) * exp(1j * z) Parameters ---------- v : float Order z : complex Argument """) add_newdoc("scipy.special", "huber", r""" huber(delta, r) Huber loss function. .. math:: \text{huber}(\delta, r) = \begin{cases} \infty & \delta < 0 \\ \frac{1}{2}r^2 & 0 \le \delta, | r | \le \delta \\ \delta ( |r| - \frac{1}{2}\delta ) & \text{otherwise} \end{cases} Parameters ---------- delta : ndarray Input array, indicating the quadratic vs. linear loss changepoint. r : ndarray Input array, possibly representing residuals. Returns ------- res : ndarray The computed Huber loss function values. Notes ----- This function is convex in r. .. versionadded:: 0.15.0 """) add_newdoc("scipy.special", "hyp1f1", """ hyp1f1(a, b, x) Confluent hypergeometric function 1F1(a, b; x) """) add_newdoc("scipy.special", "hyp1f2", """ hyp1f2(a, b, c, x) Hypergeometric function 1F2 and error estimate Returns ------- y Value of the function err Error estimate """) add_newdoc("scipy.special", "hyp2f0", """ hyp2f0(a, b, x, type) Hypergeometric function 2F0 in y and an error estimate The parameter `type` determines a convergence factor and can be either 1 or 2. Returns ------- y Value of the function err Error estimate """) add_newdoc("scipy.special", "hyp2f1", """ hyp2f1(a, b, c, z) Gauss hypergeometric function 2F1(a, b; c; z). """) add_newdoc("scipy.special", "hyp3f0", """ hyp3f0(a, b, c, x) Hypergeometric function 3F0 in y and an error estimate Returns ------- y Value of the function err Error estimate """) add_newdoc("scipy.special", "hyperu", """ hyperu(a, b, x) Confluent hypergeometric function U(a, b, x) of the second kind """) add_newdoc("scipy.special", "i0", """ i0(x) Modified Bessel function of order 0 """) add_newdoc("scipy.special", "i0e", """ i0e(x) Exponentially scaled modified Bessel function of order 0. Defined as:: i0e(x) = exp(-abs(x)) * i0(x). """) add_newdoc("scipy.special", "i1", """ i1(x) Modified Bessel function of order 1 """) add_newdoc("scipy.special", "i1e", """ i1e(x) Exponentially scaled modified Bessel function of order 1. Defined as:: i1e(x) = exp(-abs(x)) * i1(x) """) add_newdoc("scipy.special", "it2i0k0", """ it2i0k0(x) Integrals related to modified Bessel functions of order 0 Returns ------- ii0 ``integral((i0(t)-1)/t, t=0..x)`` ik0 ``int(k0(t)/t, t=x..inf)`` """) add_newdoc("scipy.special", "it2j0y0", """ it2j0y0(x) Integrals related to Bessel functions of order 0 Returns ------- ij0 ``integral((1-j0(t))/t, t=0..x)`` iy0 ``integral(y0(t)/t, t=x..inf)`` """) add_newdoc("scipy.special", "it2struve0", """ it2struve0(x) Integral related to Struve function of order 0 Returns ------- i ``integral(H0(t)/t, t=x..inf)`` """) add_newdoc("scipy.special", "itairy", """ itairy(x) Integrals of Airy functions Calculates the integral of Airy functions from 0 to `x` Returns ------- Apt, Bpt Integrals for positive arguments Ant, Bnt Integrals for negative arguments """) add_newdoc("scipy.special", "iti0k0", """ iti0k0(x) Integrals of modified Bessel functions of order 0 Returns simple integrals from 0 to `x` of the zeroth order modified Bessel functions `i0` and `k0`. Returns ------- ii0, ik0 """) add_newdoc("scipy.special", "itj0y0", """ itj0y0(x) Integrals of Bessel functions of order 0 Returns simple integrals from 0 to `x` of the zeroth order Bessel functions `j0` and `y0`. Returns ------- ij0, iy0 """) add_newdoc("scipy.special", "itmodstruve0", """ itmodstruve0(x) Integral of the modified Struve function of order 0 Returns ------- i ``integral(L0(t), t=0..x)`` """) add_newdoc("scipy.special", "itstruve0", """ itstruve0(x) Integral of the Struve function of order 0 Returns ------- i ``integral(H0(t), t=0..x)`` """) add_newdoc("scipy.special", "iv", """ iv(v, z) Modified Bessel function of the first kind of real order Parameters ---------- v Order. If `z` is of real type and negative, `v` must be integer valued. z Argument. """) add_newdoc("scipy.special", "ive", """ ive(v, z) Exponentially scaled modified Bessel function of the first kind Defined as:: ive(v, z) = iv(v, z) * exp(-abs(z.real)) """) add_newdoc("scipy.special", "j0", """ j0(x) Bessel function the first kind of order 0 """) add_newdoc("scipy.special", "j1", """ j1(x) Bessel function of the first kind of order 1 """) add_newdoc("scipy.special", "jn", """ jn(n, x) Bessel function of the first kind of integer order `n`. Notes ----- `jn` is an alias of `jv`. """) add_newdoc("scipy.special", "jv", """ jv(v, z) Bessel function of the first kind of real order `v` """) add_newdoc("scipy.special", "jve", """ jve(v, z) Exponentially scaled Bessel function of order `v` Defined as:: jve(v, z) = jv(v, z) * exp(-abs(z.imag)) """) add_newdoc("scipy.special", "k0", """ k0(x) Modified Bessel function K of order 0 Modified Bessel function of the second kind (sometimes called the third kind) of order 0. """) add_newdoc("scipy.special", "k0e", """ k0e(x) Exponentially scaled modified Bessel function K of order 0 Defined as:: k0e(x) = exp(x) * k0(x). """) add_newdoc("scipy.special", "k1", """ i1(x) Modified Bessel function of the first kind of order 1 """) add_newdoc("scipy.special", "k1e", """ k1e(x) Exponentially scaled modified Bessel function K of order 1 Defined as:: k1e(x) = exp(x) * k1(x) """) add_newdoc("scipy.special", "kei", """ kei(x) Kelvin function ker """) add_newdoc("scipy.special", "keip", """ keip(x) Derivative of the Kelvin function kei """) add_newdoc("scipy.special", "kelvin", """ kelvin(x) Kelvin functions as complex numbers Returns ------- Be, Ke, Bep, Kep The tuple (Be, Ke, Bep, Kep) contains complex numbers representing the real and imaginary Kelvin functions and their derivatives evaluated at `x`. For example, kelvin(x)[0].real = ber x and kelvin(x)[0].imag = bei x with similar relationships for ker and kei. """) add_newdoc("scipy.special", "ker", """ ker(x) Kelvin function ker """) add_newdoc("scipy.special", "kerp", """ kerp(x) Derivative of the Kelvin function ker """) add_newdoc("scipy.special", "kl_div", r""" kl_div(x, y) Elementwise function for computing Kullback-Leibler divergence. .. math:: \mathrm{kl\_div}(x, y) = \begin{cases} x \log(x / y) - x + y & x > 0, y > 0 \\ y & x = 0, y \ge 0 \\ \infty & \text{otherwise} \end{cases} Parameters ---------- x : ndarray First input array. y : ndarray Second input array. Returns ------- res : ndarray Output array. See Also -------- entr, rel_entr Notes ----- This function is non-negative and is jointly convex in `x` and `y`. .. versionadded:: 0.14.0 """) add_newdoc("scipy.special", "kn", """ kn(n, x) Modified Bessel function of the second kind of integer order `n` Returns the modified Bessel function of the second kind for integer order `n` at real `z`. These are also sometimes called functions of the third kind, Basset functions, or Macdonald functions. Parameters ---------- n : array_like of int Order of Bessel functions (floats will truncate with a warning) z : array_like of float Argument at which to evaluate the Bessel functions Returns ------- out : ndarray The results See Also -------- kv : Same function, but accepts real order and complex argument kvp : Derivative of this function Examples -------- Plot the function of several orders for real input: >>> from scipy.special import kn >>> import matplotlib.pyplot as plt >>> x = np.linspace(0, 5, 1000) >>> for N in range(6): ... plt.plot(x, kn(N, x), label='$K_{}(x)$'.format(N)) >>> plt.ylim(0, 10) >>> plt.legend() >>> plt.title(r'Modified Bessel function of the second kind $K_n(x)$') >>> plt.show() Calculate for a single value at multiple orders: >>> kn([4, 5, 6], 1) array([ 44.23241585, 360.9605896 , 3653.83831186]) """) add_newdoc("scipy.special", "kolmogi", """ kolmogi(p) Inverse function to kolmogorov Returns y such that ``kolmogorov(y) == p``. """) add_newdoc("scipy.special", "kolmogorov", """ kolmogorov(y) Complementary cumulative distribution function of Kolmogorov distribution Returns the complementary cumulative distribution function of Kolmogorov's limiting distribution (Kn* for large n) of a two-sided test for equality between an empirical and a theoretical distribution. It is equal to the (limit as n->infinity of the) probability that sqrt(n) * max absolute deviation > y. """) add_newdoc("scipy.special", "kv", r""" kv(v, z) Modified Bessel function of the second kind of real order `v` Returns the modified Bessel function of the second kind for real order `v` at complex `z`. These are also sometimes called functions of the third kind, Basset functions, or Macdonald functions. Parameters ---------- v : array_like of float Order of Bessel functions z : array_like of complex Argument at which to evaluate the Bessel functions Returns ------- out : ndarray The results. Note that input must be of complex type to get complex output, e.g. ``kv(3, -2+0j)`` instead of ``kv(3, -2)``. See Also -------- kvp : Derivative of this function Examples -------- Plot the function of several orders for real input: >>> from scipy.special import kv >>> import matplotlib.pyplot as plt >>> x = np.linspace(0, 5, 1000) >>> for N in np.linspace(0, 6, 5): ... plt.plot(x, kv(N, x), label='$K_{{{}}}(x)$'.format(N)) >>> plt.ylim(0, 10) >>> plt.legend() >>> plt.title(r'Modified Bessel function of the second kind $K_\nu(x)$') >>> plt.show() Calculate for a single value at multiple orders: >>> kv([4, 4.5, 5], 1+2j) array([ 0.1992+2.3892j, 2.3493+3.6j , 7.2827+3.8104j]) """) add_newdoc("scipy.special", "kve", """ kve(v, z) Exponentially scaled modified Bessel function of the second kind. Returns the exponentially scaled, modified Bessel function of the second kind (sometimes called the third kind) for real order `v` at complex `z`:: kve(v, z) = kv(v, z) * exp(z) """) add_newdoc("scipy.special", "log1p", """ log1p(x) Calculates log(1+x) for use when `x` is near zero """) add_newdoc('scipy.special', 'logit', """ logit(x) Logit ufunc for ndarrays. The logit function is defined as logit(p) = log(p/(1-p)). Note that logit(0) = -inf, logit(1) = inf, and logit(p) for p<0 or p>1 yields nan. Parameters ---------- x : ndarray The ndarray to apply logit to element-wise. Returns ------- out : ndarray An ndarray of the same shape as x. Its entries are logit of the corresponding entry of x. Notes ----- As a ufunc logit takes a number of optional keyword arguments. For more information see `ufuncs <http://docs.scipy.org/doc/numpy/reference/ufuncs.html>`_ .. versionadded:: 0.10.0 """) add_newdoc("scipy.special", "lpmv", """ lpmv(m, v, x) Associated legendre function of integer order. Parameters ---------- m : int Order v : float Degree. x : float Argument. Must be ``|x| <= 1``. Returns ------- res : float The value of the function. See Also -------- lpmn : Similar, but computes values for all orders 0..m and degrees 0..n. clpmn : Similar to `lpmn` but allows a complex argument. Notes ----- It is possible to extend the domain of this function to all complex m, v, x, but this is not yet implemented. """) add_newdoc("scipy.special", "mathieu_a", """ mathieu_a(m, q) Characteristic value of even Mathieu functions Returns the characteristic value for the even solution, ``ce_m(z, q)``, of Mathieu's equation. """) add_newdoc("scipy.special", "mathieu_b", """ mathieu_b(m, q) Characteristic value of odd Mathieu functions Returns the characteristic value for the odd solution, ``se_m(z, q)``, of Mathieu's equation. """) add_newdoc("scipy.special", "mathieu_cem", """ mathieu_cem(m, q, x) Even Mathieu function and its derivative Returns the even Mathieu function, ``ce_m(x, q)``, of order `m` and parameter `q` evaluated at `x` (given in degrees). Also returns the derivative with respect to `x` of ce_m(x, q) Parameters ---------- m Order of the function q Parameter of the function x Argument of the function, *given in degrees, not radians* Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "mathieu_modcem1", """ mathieu_modcem1(m, q, x) Even modified Mathieu function of the first kind and its derivative Evaluates the even modified Mathieu function of the first kind, ``Mc1m(x, q)``, and its derivative at `x` for order `m` and parameter `q`. Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "mathieu_modcem2", """ mathieu_modcem2(m, q, x) Even modified Mathieu function of the second kind and its derivative Evaluates the even modified Mathieu function of the second kind, Mc2m(x, q), and its derivative at `x` (given in degrees) for order `m` and parameter `q`. Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "mathieu_modsem1", """ mathieu_modsem1(m, q, x) Odd modified Mathieu function of the first kind and its derivative Evaluates the odd modified Mathieu function of the first kind, Ms1m(x, q), and its derivative at `x` (given in degrees) for order `m` and parameter `q`. Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "mathieu_modsem2", """ mathieu_modsem2(m, q, x) Odd modified Mathieu function of the second kind and its derivative Evaluates the odd modified Mathieu function of the second kind, Ms2m(x, q), and its derivative at `x` (given in degrees) for order `m` and parameter q. Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "mathieu_sem", """ mathieu_sem(m, q, x) Odd Mathieu function and its derivative Returns the odd Mathieu function, se_m(x, q), of order `m` and parameter `q` evaluated at `x` (given in degrees). Also returns the derivative with respect to `x` of se_m(x, q). Parameters ---------- m Order of the function q Parameter of the function x Argument of the function, *given in degrees, not radians*. Returns ------- y Value of the function yp Value of the derivative vs x """) add_newdoc("scipy.special", "modfresnelm", """ modfresnelm(x) Modified Fresnel negative integrals Returns ------- fm Integral ``F_-(x)``: ``integral(exp(-1j*t*t), t=x..inf)`` km Integral ``K_-(x)``: ``1/sqrt(pi)*exp(1j*(x*x+pi/4))*fp`` """) add_newdoc("scipy.special", "modfresnelp", """ modfresnelp(x) Modified Fresnel positive integrals Returns ------- fp Integral ``F_+(x)``: ``integral(exp(1j*t*t), t=x..inf)`` kp Integral ``K_+(x)``: ``1/sqrt(pi)*exp(-1j*(x*x+pi/4))*fp`` """) add_newdoc("scipy.special", "modstruve", """ modstruve(v, x) Modified Struve function Returns the modified Struve function Lv(x) of order `v` at `x`, `x` must be positive unless `v` is an integer. """) add_newdoc("scipy.special", "nbdtr", """ nbdtr(k, n, p) Negative binomial cumulative distribution function Returns the sum of the terms 0 through `k` of the negative binomial distribution:: sum((n+j-1)Cj p**n (1-p)**j, j=0..k). In a sequence of Bernoulli trials this is the probability that k or fewer failures precede the nth success. """) add_newdoc("scipy.special", "nbdtrc", """ nbdtrc(k, n, p) Negative binomial survival function Returns the sum of the terms k+1 to infinity of the negative binomial distribution. """) add_newdoc("scipy.special", "nbdtri", """ nbdtri(k, n, y) Inverse of `nbdtr` vs `p` Finds the argument p such that ``nbdtr(k, n, p) = y``. """) add_newdoc("scipy.special", "nbdtrik", """ nbdtrik(y, n, p) Inverse of `nbdtr` vs `k` Finds the argument k such that ``nbdtr(k, n, p) = y``. """) add_newdoc("scipy.special", "nbdtrin", """ nbdtrin(k, y, p) Inverse of `nbdtr` vs `n` Finds the argument `n` such that ``nbdtr(k, n, p) = y``. """) add_newdoc("scipy.special", "ncfdtr", """ ncfdtr(dfn, dfd, nc, f) Cumulative distribution function of the non-central F distribution. Parameters ---------- dfn : array_like Degrees of freedom of the numerator sum of squares. Range (0, inf). dfd : array_like Degrees of freedom of the denominator sum of squares. Range (0, inf). nc : array_like Noncentrality parameter. Should be in range (0, 1e4). f : array_like Quantiles, i.e. the upper limit of integration. Returns ------- cdf : float or ndarray The calculated CDF. If all inputs are scalar, the return will be a float. Otherwise it will be an array. See Also -------- ncdfdtri : Inverse CDF (iCDF) of the non-central F distribution. ncdfdtridfd : Calculate dfd, given CDF and iCDF values. ncdfdtridfn : Calculate dfn, given CDF and iCDF values. ncdfdtrinc : Calculate noncentrality parameter, given CDF, iCDF, dfn, dfd. Examples -------- >>> from scipy import special >>> from scipy import stats >>> import matplotlib.pyplot as plt Plot the CDF of the non-central F distribution, for nc=0. Compare with the F-distribution from scipy.stats: >>> x = np.linspace(-1, 8, num=500) >>> dfn = 3 >>> dfd = 2 >>> ncf_stats = stats.f.cdf(x, dfn, dfd) >>> ncf_special = special.ncfdtr(dfn, dfd, 0, x) >>> fig = plt.figure() >>> ax = fig.add_subplot(111) >>> ax.plot(x, ncf_stats, 'b-', lw=3) >>> ax.plot(x, ncf_special, 'r-') >>> plt.show() """) add_newdoc("scipy.special", "ncfdtri", """ ncfdtri(p, dfn, dfd, nc) Inverse cumulative distribution function of the non-central F distribution. See `ncfdtr` for more details. """) add_newdoc("scipy.special", "ncfdtridfd", """ ncfdtridfd(p, f, dfn, nc) Calculate degrees of freedom (denominator) for the noncentral F-distribution. See `ncfdtr` for more details. """) add_newdoc("scipy.special", "ncfdtridfn", """ ncfdtridfn(p, f, dfd, nc) Calculate degrees of freedom (numerator) for the noncentral F-distribution. See `ncfdtr` for more details. """) add_newdoc("scipy.special", "ncfdtrinc", """ ncfdtrinc(p, f, dfn, dfd) Calculate non-centrality parameter for non-central F distribution. See `ncfdtr` for more details. """) add_newdoc("scipy.special", "nctdtr", """ nctdtr(df, nc, t) Cumulative distribution function of the non-central `t` distribution. Parameters ---------- df : array_like Degrees of freedom of the distribution. Should be in range (0, inf). nc : array_like Noncentrality parameter. Should be in range (-1e6, 1e6). t : array_like Quantiles, i.e. the upper limit of integration. Returns ------- cdf : float or ndarray The calculated CDF. If all inputs are scalar, the return will be a float. Otherwise it will be an array. See Also -------- nctdtrit : Inverse CDF (iCDF) of the non-central t distribution. nctdtridf : Calculate degrees of freedom, given CDF and iCDF values. nctdtrinc : Calculate non-centrality parameter, given CDF iCDF values. Examples -------- >>> from scipy import special >>> from scipy import stats >>> import matplotlib.pyplot as plt Plot the CDF of the non-central t distribution, for nc=0. Compare with the t-distribution from scipy.stats: >>> x = np.linspace(-5, 5, num=500) >>> df = 3 >>> nct_stats = stats.t.cdf(x, df) >>> nct_special = special.nctdtr(df, 0, x) >>> fig = plt.figure() >>> ax = fig.add_subplot(111) >>> ax.plot(x, nct_stats, 'b-', lw=3) >>> ax.plot(x, nct_special, 'r-') >>> plt.show() """) add_newdoc("scipy.special", "nctdtridf", """ nctdtridf(p, nc, t) Calculate degrees of freedom for non-central t distribution. See `nctdtr` for more details. Parameters ---------- p : array_like CDF values, in range (0, 1]. nc : array_like Noncentrality parameter. Should be in range (-1e6, 1e6). t : array_like Quantiles, i.e. the upper limit of integration. """) add_newdoc("scipy.special", "nctdtrinc", """ nctdtrinc(df, p, t) Calculate non-centrality parameter for non-central t distribution. See `nctdtr` for more details. Parameters ---------- df : array_like Degrees of freedom of the distribution. Should be in range (0, inf). p : array_like CDF values, in range (0, 1]. t : array_like Quantiles, i.e. the upper limit of integration. """) add_newdoc("scipy.special", "nctdtrit", """ nctdtrit(df, nc, p) Inverse cumulative distribution function of the non-central t distribution. See `nctdtr` for more details. Parameters ---------- df : array_like Degrees of freedom of the distribution. Should be in range (0, inf). nc : array_like Noncentrality parameter. Should be in range (-1e6, 1e6). p : array_like CDF values, in range (0, 1]. """) add_newdoc("scipy.special", "ndtr", """ ndtr(x) Gaussian cumulative distribution function Returns the area under the standard Gaussian probability density function, integrated from minus infinity to `x`:: 1/sqrt(2*pi) * integral(exp(-t**2 / 2), t=-inf..x) """) add_newdoc("scipy.special", "nrdtrimn", """ nrdtrimn(p, x, std) Calculate mean of normal distribution given other params. Parameters ---------- p : array_like CDF values, in range (0, 1]. x : array_like Quantiles, i.e. the upper limit of integration. std : array_like Standard deviation. Returns ------- mn : float or ndarray The mean of the normal distribution. See Also -------- nrdtrimn, ndtr """) add_newdoc("scipy.special", "nrdtrisd", """ nrdtrisd(p, x, mn) Calculate standard deviation of normal distribution given other params. Parameters ---------- p : array_like CDF values, in range (0, 1]. x : array_like Quantiles, i.e. the upper limit of integration. mn : float or ndarray The mean of the normal distribution. Returns ------- std : array_like Standard deviation. See Also -------- nrdtristd, ndtr """) add_newdoc("scipy.special", "log_ndtr", """ log_ndtr(x) Logarithm of Gaussian cumulative distribution function Returns the log of the area under the standard Gaussian probability density function, integrated from minus infinity to `x`:: log(1/sqrt(2*pi) * integral(exp(-t**2 / 2), t=-inf..x)) """) add_newdoc("scipy.special", "ndtri", """ ndtri(y) Inverse of `ndtr` vs x Returns the argument x for which the area under the Gaussian probability density function (integrated from minus infinity to `x`) is equal to y. """) add_newdoc("scipy.special", "obl_ang1", """ obl_ang1(m, n, c, x) Oblate spheroidal angular function of the first kind and its derivative Computes the oblate spheroidal angular function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "obl_ang1_cv", """ obl_ang1_cv(m, n, c, cv, x) Oblate spheroidal angular function obl_ang1 for precomputed characteristic value Computes the oblate spheroidal angular function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "obl_cv", """ obl_cv(m, n, c) Characteristic value of oblate spheroidal function Computes the characteristic value of oblate spheroidal wave functions of order `m`, `n` (n>=m) and spheroidal parameter `c`. """) add_newdoc("scipy.special", "obl_rad1", """ obl_rad1(m, n, c, x) Oblate spheroidal radial function of the first kind and its derivative Computes the oblate spheroidal radial function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "obl_rad1_cv", """ obl_rad1_cv(m, n, c, cv, x) Oblate spheroidal radial function obl_rad1 for precomputed characteristic value Computes the oblate spheroidal radial function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "obl_rad2", """ obl_rad2(m, n, c, x) Oblate spheroidal radial function of the second kind and its derivative. Computes the oblate spheroidal radial function of the second kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "obl_rad2_cv", """ obl_rad2_cv(m, n, c, cv, x) Oblate spheroidal radial function obl_rad2 for precomputed characteristic value Computes the oblate spheroidal radial function of the second kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pbdv", """ pbdv(v, x) Parabolic cylinder function D Returns (d, dp) the parabolic cylinder function Dv(x) in d and the derivative, Dv'(x) in dp. Returns ------- d Value of the function dp Value of the derivative vs x """) add_newdoc("scipy.special", "pbvv", """ pbvv(v, x) Parabolic cylinder function V Returns the parabolic cylinder function Vv(x) in v and the derivative, Vv'(x) in vp. Returns ------- v Value of the function vp Value of the derivative vs x """) add_newdoc("scipy.special", "pbwa", """ pbwa(a, x) Parabolic cylinder function W Returns the parabolic cylinder function W(a, x) in w and the derivative, W'(a, x) in wp. .. warning:: May not be accurate for large (>5) arguments in a and/or x. Returns ------- w Value of the function wp Value of the derivative vs x """) add_newdoc("scipy.special", "pdtr", """ pdtr(k, m) Poisson cumulative distribution function Returns the sum of the first `k` terms of the Poisson distribution: sum(exp(-m) * m**j / j!, j=0..k) = gammaincc( k+1, m). Arguments must both be positive and `k` an integer. """) add_newdoc("scipy.special", "pdtrc", """ pdtrc(k, m) Poisson survival function Returns the sum of the terms from k+1 to infinity of the Poisson distribution: sum(exp(-m) * m**j / j!, j=k+1..inf) = gammainc( k+1, m). Arguments must both be positive and `k` an integer. """) add_newdoc("scipy.special", "pdtri", """ pdtri(k, y) Inverse to `pdtr` vs m Returns the Poisson variable `m` such that the sum from 0 to `k` of the Poisson density is equal to the given probability `y`: calculated by gammaincinv(k+1, y). `k` must be a nonnegative integer and `y` between 0 and 1. """) add_newdoc("scipy.special", "pdtrik", """ pdtrik(p, m) Inverse to `pdtr` vs k Returns the quantile k such that ``pdtr(k, m) = p`` """) add_newdoc("scipy.special", "poch", """ poch(z, m) Rising factorial (z)_m The Pochhammer symbol (rising factorial), is defined as:: (z)_m = gamma(z + m) / gamma(z) For positive integer `m` it reads:: (z)_m = z * (z + 1) * ... * (z + m - 1) """) add_newdoc("scipy.special", "pro_ang1", """ pro_ang1(m, n, c, x) Prolate spheroidal angular function of the first kind and its derivative Computes the prolate spheroidal angular function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pro_ang1_cv", """ pro_ang1_cv(m, n, c, cv, x) Prolate spheroidal angular function pro_ang1 for precomputed characteristic value Computes the prolate spheroidal angular function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pro_cv", """ pro_cv(m, n, c) Characteristic value of prolate spheroidal function Computes the characteristic value of prolate spheroidal wave functions of order `m`, `n` (n>=m) and spheroidal parameter `c`. """) add_newdoc("scipy.special", "pro_rad1", """ pro_rad1(m, n, c, x) Prolate spheroidal radial function of the first kind and its derivative Computes the prolate spheroidal radial function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pro_rad1_cv", """ pro_rad1_cv(m, n, c, cv, x) Prolate spheroidal radial function pro_rad1 for precomputed characteristic value Computes the prolate spheroidal radial function of the first kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pro_rad2", """ pro_rad2(m, n, c, x) Prolate spheroidal radial function of the secon kind and its derivative Computes the prolate spheroidal radial function of the second kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pro_rad2_cv", """ pro_rad2_cv(m, n, c, cv, x) Prolate spheroidal radial function pro_rad2 for precomputed characteristic value Computes the prolate spheroidal radial function of the second kind and its derivative (with respect to `x`) for mode parameters m>=0 and n>=m, spheroidal parameter `c` and ``|x| < 1.0``. Requires pre-computed characteristic value. Returns ------- s Value of the function sp Value of the derivative vs x """) add_newdoc("scipy.special", "pseudo_huber", r""" pseudo_huber(delta, r) Pseudo-Huber loss function. .. math:: \mathrm{pseudo\_huber}(\delta, r) = \delta^2 \left( \sqrt{ 1 + \left( \frac{r}{\delta} \right)^2 } - 1 \right) Parameters ---------- delta : ndarray Input array, indicating the soft quadratic vs. linear loss changepoint. r : ndarray Input array, possibly representing residuals. Returns ------- res : ndarray The computed Pseudo-Huber loss function values. Notes ----- This function is convex in :math:`r`. .. versionadded:: 0.15.0 """) add_newdoc("scipy.special", "psi", """ psi(z) Digamma function The derivative of the logarithm of the gamma function evaluated at `z` (also called the digamma function). """) add_newdoc("scipy.special", "radian", """ radian(d, m, s) Convert from degrees to radians Returns the angle given in (d)egrees, (m)inutes, and (s)econds in radians. """) add_newdoc("scipy.special", "rel_entr", r""" rel_entr(x, y) Elementwise function for computing relative entropy. .. math:: \mathrm{rel\_entr}(x, y) = \begin{cases} x \log(x / y) & x > 0, y > 0 \\ 0 & x = 0, y \ge 0 \\ \infty & \text{otherwise} \end{cases} Parameters ---------- x : ndarray First input array. y : ndarray Second input array. Returns ------- res : ndarray Output array. See Also -------- entr, kl_div Notes ----- This function is jointly convex in x and y. .. versionadded:: 0.14.0 """) add_newdoc("scipy.special", "rgamma", """ rgamma(z) Gamma function inverted Returns ``1/gamma(x)`` """) add_newdoc("scipy.special", "round", """ round(x) Round to nearest integer Returns the nearest integer to `x` as a double precision floating point result. If `x` ends in 0.5 exactly, the nearest even integer is chosen. """) add_newdoc("scipy.special", "shichi", """ shichi(x) Hyperbolic sine and cosine integrals Returns ------- shi ``integral(sinh(t)/t, t=0..x)`` chi ``eul + ln x + integral((cosh(t)-1)/t, t=0..x)`` where ``eul`` is Euler's constant. """) add_newdoc("scipy.special", "sici", """ sici(x) Sine and cosine integrals Returns ------- si ``integral(sin(t)/t, t=0..x)`` ci ``eul + ln x + integral((cos(t) - 1)/t, t=0..x)`` where ``eul`` is Euler's constant. """) add_newdoc("scipy.special", "sindg", """ sindg(x) Sine of angle given in degrees """) add_newdoc("scipy.special", "smirnov", """ smirnov(n, e) Kolmogorov-Smirnov complementary cumulative distribution function Returns the exact Kolmogorov-Smirnov complementary cumulative distribution function (Dn+ or Dn-) for a one-sided test of equality between an empirical and a theoretical distribution. It is equal to the probability that the maximum difference between a theoretical distribution and an empirical one based on `n` samples is greater than e. """) add_newdoc("scipy.special", "smirnovi", """ smirnovi(n, y) Inverse to `smirnov` Returns ``e`` such that ``smirnov(n, e) = y``. """) add_newdoc("scipy.special", "spence", """ spence(x) Dilogarithm integral Returns the dilogarithm integral:: -integral(log t / (t-1), t=1..x) """) add_newdoc("scipy.special", "stdtr", """ stdtr(df, t) Student t distribution cumulative density function Returns the integral from minus infinity to t of the Student t distribution with df > 0 degrees of freedom:: gamma((df+1)/2)/(sqrt(df*pi)*gamma(df/2)) * integral((1+x**2/df)**(-df/2-1/2), x=-inf..t) """) add_newdoc("scipy.special", "stdtridf", """ stdtridf(p, t) Inverse of `stdtr` vs df Returns the argument df such that stdtr(df, t) is equal to `p`. """) add_newdoc("scipy.special", "stdtrit", """ stdtrit(df, p) Inverse of `stdtr` vs `t` Returns the argument `t` such that stdtr(df, t) is equal to `p`. """) add_newdoc("scipy.special", "struve", """ struve(v, x) Struve function Computes the struve function Hv(x) of order `v` at `x`, `x` must be positive unless `v` is an integer. """) add_newdoc("scipy.special", "tandg", """ tandg(x) Tangent of angle x given in degrees. """) add_newdoc("scipy.special", "tklmbda", """ tklmbda(x, lmbda) Tukey-Lambda cumulative distribution function """) add_newdoc("scipy.special", "wofz", """ wofz(z) Faddeeva function Returns the value of the Faddeeva function for complex argument:: exp(-z**2)*erfc(-i*z) References ---------- .. [1] Steven G. Johnson, Faddeeva W function implementation. http://ab-initio.mit.edu/Faddeeva """) add_newdoc("scipy.special", "xlogy", """ xlogy(x, y) Compute ``x*log(y)`` so that the result is 0 if ``x = 0``. Parameters ---------- x : array_like Multiplier y : array_like Argument Returns ------- z : array_like Computed x*log(y) Notes ----- .. versionadded:: 0.13.0 """) add_newdoc("scipy.special", "xlog1py", """ xlog1py(x, y) Compute ``x*log1p(y)`` so that the result is 0 if ``x = 0``. Parameters ---------- x : array_like Multiplier y : array_like Argument Returns ------- z : array_like Computed x*log1p(y) Notes ----- .. versionadded:: 0.13.0 """) add_newdoc("scipy.special", "y0", """ y0(x) Bessel function of the second kind of order 0 Returns the Bessel function of the second kind of order 0 at `x`. """) add_newdoc("scipy.special", "y1", """ y1(x) Bessel function of the second kind of order 1 Returns the Bessel function of the second kind of order 1 at `x`. """) add_newdoc("scipy.special", "yn", """ yn(n, x) Bessel function of the second kind of integer order Returns the Bessel function of the second kind of integer order `n` at `x`. """) add_newdoc("scipy.special", "yv", """ yv(v, z) Bessel function of the second kind of real order Returns the Bessel function of the second kind of real order `v` at complex `z`. """) add_newdoc("scipy.special", "yve", """ yve(v, z) Exponentially scaled Bessel function of the second kind of real order Returns the exponentially scaled Bessel function of the second kind of real order `v` at complex `z`:: yve(v, z) = yv(v, z) * exp(-abs(z.imag)) """) add_newdoc("scipy.special", "zeta", """ zeta(x, q) Hurwitz zeta function The Riemann zeta function of two arguments (also known as the Hurwitz zeta function). This function is defined as .. math:: \\zeta(x, q) = \\sum_{k=0}^{\\infty} 1 / (k+q)^x, where ``x > 1`` and ``q > 0``. See also -------- zetac """) add_newdoc("scipy.special", "zetac", """ zetac(x) Riemann zeta function minus 1. This function is defined as .. math:: \\zeta(x) = \\sum_{k=2}^{\\infty} 1 / k^x, where ``x > 1``. See Also -------- zeta """) add_newdoc("scipy.special", "_struve_asymp_large_z", """ _struve_asymp_large_z(v, z, is_h) Internal function for testing `struve` & `modstruve` Evaluates using asymptotic expansion Returns ------- v, err """) add_newdoc("scipy.special", "_struve_power_series", """ _struve_power_series(v, z, is_h) Internal function for testing `struve` & `modstruve` Evaluates using power series Returns ------- v, err """) add_newdoc("scipy.special", "_struve_bessel_series", """ _struve_bessel_series(v, z, is_h) Internal function for testing `struve` & `modstruve` Evaluates using Bessel function series Returns ------- v, err """)
Shaswat27/scipy
scipy/special/add_newdocs.py
Python
bsd-3-clause
74,473
[ "Gaussian" ]
1501cf4f0ed7a28ccf93326976a4becce0dd1931c0fa038910868f9d05eca9ee
''' sbclearn (c) University of Manchester 2017 sbclearn is licensed under the MIT License. To view a copy of this license, visit <http://opensource.org/licenses/MIT/>. @author: neilswainston ''' # pylint: disable=invalid-name # pylint: disable=no-member # pylint: disable=ungrouped-imports import sys import numpy as np import pandas as pd from sbclearn.ccs import chem from sbclearn.utils.validator import k_fold_cross_valid def get_data(filename): '''Gets data.''' df = pd.read_csv(filename) x_data = np.array([chem.get_fingerprint(smiles, radius=8) for smiles in df.SMILES]) return x_data, df.CCS def main(args): '''main method.''' x_data, y_data = get_data(args[0]) results = k_fold_cross_valid((x_data, y_data)) sbclearn.plot(results, 'Prediction of ccs') if __name__ == '__main__': main(sys.argv[1:])
neilswainston/development-py
synbiochemdev/sbclearn/ccs/ccs_learn.py
Python
mit
879
[ "VisIt" ]
7ab384eb9a84278c96f8c3ffdb23b62af46dbcceca192174833551714081417c
####################################### # pyGPGO examples # hyperpost: shows posterior distribution of hyperparameters # for a Gaussian Process example ####################################### import numpy as np from pyGPGO.surrogates.GaussianProcessMCMC import GaussianProcessMCMC from pyGPGO.covfunc import matern32 if __name__ == '__main__': np.random.seed(1337) sexp = matern32() gp = GaussianProcessMCMC(sexp, niter=2000, init='MAP', step=None) X = np.linspace(0, 6, 7)[:, None] y = np.sin(X).flatten() gp.fit(X, y) gp.posteriorPlot()
hawk31/pyGPGO
examples/hyperpost.py
Python
mit
570
[ "Gaussian" ]
8c8c3c1a57c93ab689ccbca37962af665842fb1f59bcfed53b110872846232bf
# # @BEGIN LICENSE # # Psi4: an open-source quantum chemistry software package # # Copyright (c) 2007-2022 The Psi4 Developers. # # The copyrights for code used from other parties are included in # the corresponding files. # # This file is part of Psi4. # # Psi4 is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, version 3. # # Psi4 is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License along # with Psi4; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # # @END LICENSE # """ | Database (Truhlar) of hydrogen-transfer barrier height reactions. | Geometries from Truhlar and coworkers at site http://t1.chem.umn.edu/misc/database_group/database_therm_bh/raw_geom.cgi (broken link). | Reference energies from Zhao et al. JPCA, 109 2012-2018 (2005) doi: 10.1021/jp045141s [in supporting information]. - **cp** ``'off'`` - **rlxd** ``'off'`` - **subset** - ``'small'`` - ``'large'`` """ import re import qcdb # <<< HTBH Database Module >>> dbse = 'HTBH' isOS = 'true' # <<< Database Members >>> HRXN = range(1, 39) HRXN_SM = ['5', '6', '9', '10', '23', '24'] HRXN_LG = ['13', '14', '33', '34', '37', '38'] # <<< Chemical Systems Involved >>> RXNM = {} # reaction matrix of reagent contributions per reaction ACTV = {} # order of active reagents per reaction ACTV['%s-%s' % (dbse, 1)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HCl' ), '%s-%s-reagent' % (dbse, 'HHClts') ] RXNM['%s-%s' % (dbse, 1)] = dict(zip(ACTV['%s-%s' % (dbse, 1)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 2)] = ['%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'Cl' ), '%s-%s-reagent' % (dbse, 'HHClts') ] RXNM['%s-%s' % (dbse, 2)] = dict(zip(ACTV['%s-%s' % (dbse, 2)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 3)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'OHH2ts') ] RXNM['%s-%s' % (dbse, 3)] = dict(zip(ACTV['%s-%s' % (dbse, 3)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 4)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'H2O' ), '%s-%s-reagent' % (dbse, 'OHH2ts') ] RXNM['%s-%s' % (dbse, 4)] = dict(zip(ACTV['%s-%s' % (dbse, 4)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 5)] = ['%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'CH3H2ts') ] RXNM['%s-%s' % (dbse, 5)] = dict(zip(ACTV['%s-%s' % (dbse, 5)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 6)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'CH3H2ts') ] RXNM['%s-%s' % (dbse, 6)] = dict(zip(ACTV['%s-%s' % (dbse, 6)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 7)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'OHCH4ts') ] RXNM['%s-%s' % (dbse, 7)] = dict(zip(ACTV['%s-%s' % (dbse, 7)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 8)] = ['%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'H2O' ), '%s-%s-reagent' % (dbse, 'OHCH4ts') ] RXNM['%s-%s' % (dbse, 8)] = dict(zip(ACTV['%s-%s' % (dbse, 8)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 9)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'HH2ts') ] RXNM['%s-%s' % (dbse, 9)] = dict(zip(ACTV['%s-%s' % (dbse, 9)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 10)] = ['%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'HH2ts') ] RXNM['%s-%s' % (dbse, 10)] = dict(zip(ACTV['%s-%s' % (dbse, 10)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 11)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'NH3' ), '%s-%s-reagent' % (dbse, 'OHNH3ts') ] RXNM['%s-%s' % (dbse, 11)] = dict(zip(ACTV['%s-%s' % (dbse, 11)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 12)] = ['%s-%s-reagent' % (dbse, 'H2O' ), '%s-%s-reagent' % (dbse, 'NH2' ), '%s-%s-reagent' % (dbse, 'OHNH3ts') ] RXNM['%s-%s' % (dbse, 12)] = dict(zip(ACTV['%s-%s' % (dbse, 12)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 13)] = ['%s-%s-reagent' % (dbse, 'HCl' ), '%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'HClCH3ts') ] RXNM['%s-%s' % (dbse, 13)] = dict(zip(ACTV['%s-%s' % (dbse, 13)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 14)] = ['%s-%s-reagent' % (dbse, 'Cl' ), '%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'HClCH3ts') ] RXNM['%s-%s' % (dbse, 14)] = dict(zip(ACTV['%s-%s' % (dbse, 14)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 15)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'C2H6' ), '%s-%s-reagent' % (dbse, 'OHC2H6ts') ] RXNM['%s-%s' % (dbse, 15)] = dict(zip(ACTV['%s-%s' % (dbse, 15)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 16)] = ['%s-%s-reagent' % (dbse, 'H2O' ), '%s-%s-reagent' % (dbse, 'C2H5' ), '%s-%s-reagent' % (dbse, 'OHC2H6ts') ] RXNM['%s-%s' % (dbse, 16)] = dict(zip(ACTV['%s-%s' % (dbse, 16)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 17)] = ['%s-%s-reagent' % (dbse, 'F' ), '%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'FH2ts') ] RXNM['%s-%s' % (dbse, 17)] = dict(zip(ACTV['%s-%s' % (dbse, 17)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 18)] = ['%s-%s-reagent' % (dbse, 'HF' ), '%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'FH2ts') ] RXNM['%s-%s' % (dbse, 18)] = dict(zip(ACTV['%s-%s' % (dbse, 18)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 19)] = ['%s-%s-reagent' % (dbse, 'O' ), '%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'OHCH3ts') ] RXNM['%s-%s' % (dbse, 19)] = dict(zip(ACTV['%s-%s' % (dbse, 19)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 20)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'OHCH3ts') ] RXNM['%s-%s' % (dbse, 20)] = dict(zip(ACTV['%s-%s' % (dbse, 20)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 21)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'PH3' ), '%s-%s-reagent' % (dbse, 'HPH3ts') ] RXNM['%s-%s' % (dbse, 21)] = dict(zip(ACTV['%s-%s' % (dbse, 21)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 22)] = ['%s-%s-reagent' % (dbse, 'PH2' ), '%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'HPH3ts') ] RXNM['%s-%s' % (dbse, 22)] = dict(zip(ACTV['%s-%s' % (dbse, 22)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 23)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'OHHts') ] RXNM['%s-%s' % (dbse, 23)] = dict(zip(ACTV['%s-%s' % (dbse, 23)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 24)] = ['%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'O' ), '%s-%s-reagent' % (dbse, 'OHHts') ] RXNM['%s-%s' % (dbse, 24)] = dict(zip(ACTV['%s-%s' % (dbse, 24)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 25)] = ['%s-%s-reagent' % (dbse, 'H' ), '%s-%s-reagent' % (dbse, 'H2S' ), '%s-%s-reagent' % (dbse, 'HH2Sts') ] RXNM['%s-%s' % (dbse, 25)] = dict(zip(ACTV['%s-%s' % (dbse, 25)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 26)] = ['%s-%s-reagent' % (dbse, 'H2' ), '%s-%s-reagent' % (dbse, 'HS' ), '%s-%s-reagent' % (dbse, 'HH2Sts') ] RXNM['%s-%s' % (dbse, 26)] = dict(zip(ACTV['%s-%s' % (dbse, 26)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 27)] = ['%s-%s-reagent' % (dbse, 'O' ), '%s-%s-reagent' % (dbse, 'HCl' ), '%s-%s-reagent' % (dbse, 'OHClts') ] RXNM['%s-%s' % (dbse, 27)] = dict(zip(ACTV['%s-%s' % (dbse, 27)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 28)] = ['%s-%s-reagent' % (dbse, 'OH' ), '%s-%s-reagent' % (dbse, 'Cl' ), '%s-%s-reagent' % (dbse, 'OHClts') ] RXNM['%s-%s' % (dbse, 28)] = dict(zip(ACTV['%s-%s' % (dbse, 28)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 29)] = ['%s-%s-reagent' % (dbse, 'NH2' ), '%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'CH3NH2ts') ] RXNM['%s-%s' % (dbse, 29)] = dict(zip(ACTV['%s-%s' % (dbse, 29)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 30)] = ['%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'NH' ), '%s-%s-reagent' % (dbse, 'CH3NH2ts') ] RXNM['%s-%s' % (dbse, 30)] = dict(zip(ACTV['%s-%s' % (dbse, 30)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 31)] = ['%s-%s-reagent' % (dbse, 'NH2' ), '%s-%s-reagent' % (dbse, 'C2H5' ), '%s-%s-reagent' % (dbse, 'NH2C2H5ts') ] RXNM['%s-%s' % (dbse, 31)] = dict(zip(ACTV['%s-%s' % (dbse, 31)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 32)] = ['%s-%s-reagent' % (dbse, 'C2H6' ), '%s-%s-reagent' % (dbse, 'NH' ), '%s-%s-reagent' % (dbse, 'NH2C2H5ts') ] RXNM['%s-%s' % (dbse, 32)] = dict(zip(ACTV['%s-%s' % (dbse, 32)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 33)] = ['%s-%s-reagent' % (dbse, 'C2H6' ), '%s-%s-reagent' % (dbse, 'NH2' ), '%s-%s-reagent' % (dbse, 'C2H6NH2ts') ] RXNM['%s-%s' % (dbse, 33)] = dict(zip(ACTV['%s-%s' % (dbse, 33)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 34)] = ['%s-%s-reagent' % (dbse, 'NH3' ), '%s-%s-reagent' % (dbse, 'C2H5' ), '%s-%s-reagent' % (dbse, 'C2H6NH2ts') ] RXNM['%s-%s' % (dbse, 34)] = dict(zip(ACTV['%s-%s' % (dbse, 34)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 35)] = ['%s-%s-reagent' % (dbse, 'NH2' ), '%s-%s-reagent' % (dbse, 'CH4' ), '%s-%s-reagent' % (dbse, 'NH2CH4ts') ] RXNM['%s-%s' % (dbse, 35)] = dict(zip(ACTV['%s-%s' % (dbse, 35)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 36)] = ['%s-%s-reagent' % (dbse, 'CH3' ), '%s-%s-reagent' % (dbse, 'NH3' ), '%s-%s-reagent' % (dbse, 'NH2CH4ts') ] RXNM['%s-%s' % (dbse, 36)] = dict(zip(ACTV['%s-%s' % (dbse, 36)], [-1, -1, +1])) ACTV['%s-%s' % (dbse, 37)] = ['%s-%s-reagent' % (dbse, 'C5H8' ), '%s-%s-reagent' % (dbse, 'C5H8ts') ] RXNM['%s-%s' % (dbse, 37)] = dict(zip(ACTV['%s-%s' % (dbse, 37)], [-1, +1])) ACTV['%s-%s' % (dbse, 38)] = ['%s-%s-reagent' % (dbse, 'C5H8' ), '%s-%s-reagent' % (dbse, 'C5H8ts') ] RXNM['%s-%s' % (dbse, 38)] = dict(zip(ACTV['%s-%s' % (dbse, 38)], [-1, +1])) # <<< Reference Values [kcal/mol] >>> BIND = {} BIND['%s-%s' % (dbse, 1)] = 5.7 BIND['%s-%s' % (dbse, 2)] = 8.7 BIND['%s-%s' % (dbse, 3)] = 5.1 BIND['%s-%s' % (dbse, 4)] = 21.2 BIND['%s-%s' % (dbse, 5)] = 12.1 BIND['%s-%s' % (dbse, 6)] = 15.3 BIND['%s-%s' % (dbse, 7)] = 6.7 BIND['%s-%s' % (dbse, 8)] = 19.6 BIND['%s-%s' % (dbse, 9)] = 9.6 BIND['%s-%s' % (dbse, 10)] = 9.6 BIND['%s-%s' % (dbse, 11)] = 3.2 BIND['%s-%s' % (dbse, 12)] = 12.7 BIND['%s-%s' % (dbse, 13)] = 1.7 BIND['%s-%s' % (dbse, 14)] = 7.9 BIND['%s-%s' % (dbse, 15)] = 3.4 BIND['%s-%s' % (dbse, 16)] = 19.9 BIND['%s-%s' % (dbse, 17)] = 1.8 BIND['%s-%s' % (dbse, 18)] = 33.4 BIND['%s-%s' % (dbse, 19)] = 13.7 BIND['%s-%s' % (dbse, 20)] = 8.1 BIND['%s-%s' % (dbse, 21)] = 3.1 BIND['%s-%s' % (dbse, 22)] = 23.2 BIND['%s-%s' % (dbse, 23)] = 10.7 BIND['%s-%s' % (dbse, 24)] = 13.1 BIND['%s-%s' % (dbse, 25)] = 3.5 BIND['%s-%s' % (dbse, 26)] = 17.3 BIND['%s-%s' % (dbse, 27)] = 9.8 BIND['%s-%s' % (dbse, 28)] = 10.4 BIND['%s-%s' % (dbse, 29)] = 8.0 BIND['%s-%s' % (dbse, 30)] = 22.4 BIND['%s-%s' % (dbse, 31)] = 7.5 BIND['%s-%s' % (dbse, 32)] = 18.3 BIND['%s-%s' % (dbse, 33)] = 10.4 BIND['%s-%s' % (dbse, 34)] = 17.4 BIND['%s-%s' % (dbse, 35)] = 14.5 BIND['%s-%s' % (dbse, 36)] = 17.8 BIND['%s-%s' % (dbse, 37)] = 38.4 BIND['%s-%s' % (dbse, 38)] = 38.4 # <<< Comment Lines >>> TAGL = {} TAGL['%s-%s' % (dbse, 1)] = '{ H + HCl <-- [HHCl] } --> H2 + Cl' TAGL['%s-%s' % (dbse, 2)] = 'H + HCl <-- { [HHCl] --> H2 + Cl }' TAGL['%s-%s' % (dbse, 3)] = '{ OH + H2 <-- [OHH2] } --> H + H2O' TAGL['%s-%s' % (dbse, 4)] = 'OH + HCl <-- { [OHH2] --> H + H2O }' TAGL['%s-%s' % (dbse, 5)] = '{ CH3 + H2 <-- [CH3H2] } --> H + CH4' TAGL['%s-%s' % (dbse, 6)] = 'CH3 + H2 <-- { [CH3H2] --> H + CH4 }' TAGL['%s-%s' % (dbse, 7)] = '{ OH + CH4 <-- [OHCH4] } --> CH3 + H2O' TAGL['%s-%s' % (dbse, 8)] = 'OH + CH4 <-- { [OHCH4] --> CH3 + H2O }' TAGL['%s-%s' % (dbse, 9)] = '{ H + H2 <-- [HH2] } --> H2 + H' TAGL['%s-%s' % (dbse, 10)] = 'H + H2 <-- { [HH2] -- >H2 + H }' TAGL['%s-%s' % (dbse, 11)] = '{ OH + NH3 <-- [OHNH3] } --> H2O + NH2' TAGL['%s-%s' % (dbse, 12)] = 'OH + NH3 <-- { [OHNH3] --> H2O + NH2 }' TAGL['%s-%s' % (dbse, 13)] = '{ HCl + CH3 <-- [HClCH3] } --> Cl + CH4' TAGL['%s-%s' % (dbse, 14)] = 'HCl + CH3 <-- { [HClCH3] --> Cl + CH4 }' TAGL['%s-%s' % (dbse, 15)] = '{ OH + C2H6 <-- [OHC2H6] } --> H2O + C2H5' TAGL['%s-%s' % (dbse, 16)] = 'OH + C2H6 <-- { [OHC2H6] --> H2O + C2H5 }' TAGL['%s-%s' % (dbse, 17)] = '{ F + H2 <-- [FH2] } --> HF + H' TAGL['%s-%s' % (dbse, 18)] = 'F + H2 <-- { [FH2] --> HF + H}' TAGL['%s-%s' % (dbse, 19)] = '{ O + CH4 <-- [OHCH3] } --> OH + CH3' TAGL['%s-%s' % (dbse, 20)] = 'O + CH4 <-- { [OHCH3] --> OH + CH3 }' TAGL['%s-%s' % (dbse, 21)] = '{ H + PH3 <-- [HPH3] } --> PH2 + H2' TAGL['%s-%s' % (dbse, 22)] = 'H + PH3 <-- { [HPH3] --> PH2 + H2 }' TAGL['%s-%s' % (dbse, 23)] = '{ H + OH <-- [OHH] } --> H2 + O' TAGL['%s-%s' % (dbse, 24)] = 'H + OH <-- { [OHH] --> H2 + O }' TAGL['%s-%s' % (dbse, 25)] = '{ H + H2S <-- [HH2S] } --> H2 + HS' TAGL['%s-%s' % (dbse, 26)] = 'H + H2S <-- { [HH2S] --> H2 + HS}' TAGL['%s-%s' % (dbse, 27)] = '{ O + HCl <-- [OHCl] } --> OH + Cl' TAGL['%s-%s' % (dbse, 28)] = 'O + HCl <-- { [OHCl] --> OH + Cl}' TAGL['%s-%s' % (dbse, 29)] = '{ NH2 + CH3 <-- [CH3NH2] } --> CH4 + NH' TAGL['%s-%s' % (dbse, 30)] = 'NH2 + CH3 <-- { [CH3NH2] --> CH4 + NH }' TAGL['%s-%s' % (dbse, 31)] = '{ NH2 + C2H5 <-- [NH2C2H5] } --> C2H6 + NH' TAGL['%s-%s' % (dbse, 32)] = 'NH2 + C2H5 <-- { [NH2C2H5] --> C2H6 + NH }' TAGL['%s-%s' % (dbse, 33)] = '{ C2H6 + NH2 <-- [C2H6NH2] } --> NH3 + C2H5' TAGL['%s-%s' % (dbse, 34)] = 'C2H6 + NH2 <-- { [C2H6NH2] --> NH3 + C2H5 }' TAGL['%s-%s' % (dbse, 35)] = '{ NH2 + CH4 <-- [NH2CH4] } --> CH3 + NH3' TAGL['%s-%s' % (dbse, 36)] = 'NH2 + CH4 <-- { [NH2CH4] --> CH3 + NH3 }' TAGL['%s-%s' % (dbse, 37)] = '{ C5H8 <-- [C5H8] } --> C5H8' TAGL['%s-%s' % (dbse, 38)] = 'C5H8 <-- { [C5H8] --> C5H8 }' TAGL['%s-%s-reagent' % (dbse, 'C2H5' )] = 'C2H5' TAGL['%s-%s-reagent' % (dbse, 'C2H6' )] = 'Ethane' TAGL['%s-%s-reagent' % (dbse, 'C2H6NH2ts' )] = 'Transition state of C2H6 + NH2 <--> NH3 + C2H5' TAGL['%s-%s-reagent' % (dbse, 'C5H8' )] = 's-trans cis-C5H8' TAGL['%s-%s-reagent' % (dbse, 'C5H8ts' )] = 'Transition state of s-trans cis-C5H8 <--> s-trans cis C5H8' TAGL['%s-%s-reagent' % (dbse, 'CH3' )] = 'CH3' TAGL['%s-%s-reagent' % (dbse, 'CH3H2ts' )] = 'Transition state of CH3 + H2 <--> H + CH4' TAGL['%s-%s-reagent' % (dbse, 'CH3NH2ts' )] = 'Transition state of CH3 + NH2 <--> CH4 + NH' TAGL['%s-%s-reagent' % (dbse, 'CH4' )] = 'Methane' TAGL['%s-%s-reagent' % (dbse, 'Cl' )] = 'Chlorine atom' TAGL['%s-%s-reagent' % (dbse, 'F' )] = 'Fluorine atom' TAGL['%s-%s-reagent' % (dbse, 'FH2ts' )] = 'Transition state of F + H2 <--> HF + H' TAGL['%s-%s-reagent' % (dbse, 'H' )] = 'Hydrogen atom' TAGL['%s-%s-reagent' % (dbse, 'H2' )] = 'Hydrogen molecule' TAGL['%s-%s-reagent' % (dbse, 'H2O' )] = 'Water' TAGL['%s-%s-reagent' % (dbse, 'H2S' )] = 'Hydrogen Sulfide' TAGL['%s-%s-reagent' % (dbse, 'HCl' )] = 'Hydrogen Chloride' TAGL['%s-%s-reagent' % (dbse, 'HClCH3ts' )] = 'Transition state of HCl + CH3 <--> Cl + CH4' TAGL['%s-%s-reagent' % (dbse, 'HHClts' )] = 'Transition state of H + HCl <--> H2 + Cl' TAGL['%s-%s-reagent' % (dbse, 'HF' )] = 'Hydrogen Fluoride' TAGL['%s-%s-reagent' % (dbse, 'HH2Sts' )] = 'Transition state of H + H2S <--> H2 + HS' TAGL['%s-%s-reagent' % (dbse, 'HH2ts' )] = 'Transition state of H + H2 <--> H2 + H' TAGL['%s-%s-reagent' % (dbse, 'NH' )] = 'NH' TAGL['%s-%s-reagent' % (dbse, 'HPH3ts' )] = 'Transition state of H + PH3 <--> PH2 + H2' TAGL['%s-%s-reagent' % (dbse, 'NH2' )] = 'NH2' TAGL['%s-%s-reagent' % (dbse, 'NH2C2H5ts' )] = 'Transition state of C2H5 + NH2 <--> NH + C2H6' TAGL['%s-%s-reagent' % (dbse, 'NH2CH4ts' )] = 'Transition state of CH4 + NH2 <--> NH3 + CH3' TAGL['%s-%s-reagent' % (dbse, 'NH3' )] = 'Ammonia' TAGL['%s-%s-reagent' % (dbse, 'O' )] = 'Oxygen atom' TAGL['%s-%s-reagent' % (dbse, 'OH' )] = 'OH' TAGL['%s-%s-reagent' % (dbse, 'OHC2H6ts' )] = 'Transition state of C2H6 + OH <--> H2O + C2H5' TAGL['%s-%s-reagent' % (dbse, 'OHCH3ts' )] = 'Transition state of O + CH4 <--> OH + CH3' TAGL['%s-%s-reagent' % (dbse, 'OHCH4ts' )] = 'Transition state of OH + CH4 <--> CH3 + H2O' TAGL['%s-%s-reagent' % (dbse, 'OHClts' )] = 'Transition state of O + HCl <--> OH + Cl' TAGL['%s-%s-reagent' % (dbse, 'OHH2ts' )] = 'Transition state of OH + H2 <--> H + H2O' TAGL['%s-%s-reagent' % (dbse, 'OHHts' )] = 'Transition state of OH + H <--> H2 + O' TAGL['%s-%s-reagent' % (dbse, 'OHNH3ts' )] = 'Transition state of OH + NH3 <--> NH2 + H2O' TAGL['%s-%s-reagent' % (dbse, 'PH2' )] = 'PH2' TAGL['%s-%s-reagent' % (dbse, 'PH3' )] = 'Phosphine' TAGL['%s-%s-reagent' % (dbse, 'HS' )] = 'HS' # <<< Geometry Specification Strings >>> GEOS = {} GEOS['%s-%s-reagent' % (dbse, 'C2H5')] = qcdb.Molecule(""" 0 2 C 0.00550995 -0.00307714 -0.77443959 C 0.00550995 -0.00307714 0.71569982 H 0.00550995 -1.01684444 1.11670108 H 0.37964525 0.84547158 -1.32730429 H -0.88217468 0.49798042 1.12141209 H 0.87299475 0.52193057 1.11660682 H -0.50718726 -0.77526005 -1.32801142 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C2H6')] = qcdb.Molecule(""" 0 1 C 0.00000020 -0.00000013 -0.76309187 C 0.00000020 -0.00000013 0.76309163 H 0.00000020 -1.01606691 1.15831231 H -0.87903844 -0.50959541 -1.15830943 H -0.87994508 0.50802887 1.15831013 H 0.87993813 0.50804049 1.15830883 H -0.00180313 1.01606605 -1.15830975 H 0.88084363 -0.50646996 -1.15830912 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C2H6NH2ts')] = qcdb.Molecule(""" 0 2 C -1.48570000 -0.44815600 -0.00001900 C -0.50504200 0.70174000 0.00002900 N 1.86516100 -0.34016700 -0.00005700 H -1.35419300 -1.07650500 -0.88050300 H -1.35415900 -1.07661100 0.88038500 H -2.51702500 -0.08617300 0.00002500 H -0.52222400 1.31611800 -0.89721800 H -0.52220500 1.31602900 0.89733800 H 0.66504700 0.14796100 -0.00003400 H 2.24664400 0.15971700 -0.80480600 H 2.24643900 0.15913300 0.80515100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C5H8')] = qcdb.Molecule(""" 0 1 C -2.05563800 -0.61227200 0.00000700 C -1.23109600 0.64044800 0.00004900 C 0.10563400 0.73427300 0.00002600 C 1.05755500 -0.37440700 -0.00004400 C 2.38358300 -0.19893600 -0.00003600 H -2.70508500 -0.64159700 0.87713200 H -2.70512900 -0.64150800 -0.87708900 H -1.45133200 -1.51607900 -0.00005500 H -1.79366500 1.56758600 0.00010300 H 0.54575600 1.72564300 0.00006400 H 0.66526200 -1.38324200 -0.00010500 H 3.06468900 -1.03771900 -0.00008800 H 2.81927500 0.79228500 0.00002300 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'C5H8ts')] = qcdb.Molecule(""" 0 1 C -1.29962300 -0.90485300 -0.02015500 C -1.20594700 0.50581700 -0.01341400 C 0.00000000 1.18336100 0.15330100 C 1.20594800 0.50581400 -0.01342200 C 1.29962600 -0.90485100 -0.02014700 H 2.16879700 -1.32754900 -0.51569700 H 1.03204100 -1.45438500 0.87316600 H 2.03713000 1.08558300 -0.39850400 H 0.00000100 2.26291300 0.08590500 H -2.03713300 1.08558700 -0.39848100 H -2.16879600 -1.32754000 -0.51571600 H -0.00001100 -1.18194200 -0.52080800 H -1.03205900 -1.45439400 0.87315800 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3')] = qcdb.Molecule(""" 0 2 C 0.00000000 0.00000000 -0.00000000 H 0.00000000 0.00000000 1.07731727 H -0.00000000 0.93298412 -0.53865863 H 0.00000000 -0.93298412 -0.53865863 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3H2ts')] = qcdb.Molecule(""" 0 2 C 0.00000000 0.26481300 0.00000000 H 1.05342900 0.51666800 0.00000000 H -0.52662700 0.51702500 0.91225000 H -0.52662700 0.51702500 -0.91225000 H -0.00026000 -1.11777100 0.00000000 H 0.00008400 -2.02182500 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH3NH2ts')] = qcdb.Molecule(""" 0 3 C -1.19957700 -0.01112600 -0.00003000 N 1.40071500 0.12986200 0.00001500 H -1.42666000 -0.51293200 0.93305700 H -1.41990700 -0.59138200 -0.88814300 H -1.52023700 1.02280600 -0.04578300 H 0.18892600 0.12689600 0.00100100 H 1.57033800 -0.88766700 -0.00005300 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'CH4')] = qcdb.Molecule(""" 0 1 C 0.00000000 0.00000000 0.00000000 H 0.00000000 1.08744517 0.00000000 H -0.51262657 -0.36248173 0.88789526 H -0.51262657 -0.36248173 -0.88789526 H 1.02525314 -0.36248173 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'Cl')] = qcdb.Molecule(""" 0 2 Cl 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'F')] = qcdb.Molecule(""" 0 2 F 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'FH2ts')] = qcdb.Molecule(""" 0 2 H 0.14656800 -1.12839000 0.00000000 F 0.00000000 0.33042200 0.00000000 H -0.14656800 -1.84541000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'H')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'H2')] = qcdb.Molecule(""" 0 1 H 0.00000000 0.00000000 0.00000000 H 0.74187646 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'H2O')] = qcdb.Molecule(""" 0 1 O 0.00000000 0.00000000 -0.06555155 H 0.00000000 -0.75670946 0.52017534 H 0.00000000 0.75670946 0.52017534 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'H2S')] = qcdb.Molecule(""" 0 1 S 0.00000000 0.00000000 0.10251900 H 0.00000000 0.96624900 -0.82015400 H 0.00000000 -0.96624900 -0.82015400 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HCl')] = qcdb.Molecule(""" 0 1 Cl 0.00000000 0.00000000 0.00000000 H 1.27444789 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HClCH3ts')] = qcdb.Molecule(""" 0 2 C 0.24411700 0.59991600 1.70242300 H -0.67559700 0.27848200 2.17293900 H 0.35191000 1.66378600 1.53767200 H 1.14068600 0.06578700 1.98782200 H 0.05716300 0.13997300 0.39711200 Cl -0.13758000 -0.33809000 -0.95941600 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HHClts')] = qcdb.Molecule(""" 0 2 H 0.00048000 -1.34062700 0.00000000 Cl 0.00000000 0.20325200 0.00000000 H -0.00048000 -2.11465900 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HF')] = qcdb.Molecule(""" 0 1 F 0.00000000 0.00000000 0.00000000 H 0.91538107 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HH2Sts')] = qcdb.Molecule(""" 0 2 H 1.26209700 -0.22009700 0.00000000 S 0.00000000 0.22315300 0.00000000 H -0.50057600 -1.11544500 0.00000000 H -0.76152100 -2.23491300 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HH2ts')] = qcdb.Molecule(""" 0 2 H 0.00000000 0.00000000 0.00000000 H 0.00000000 0.00000000 0.92947400 H 0.00000000 0.00000000 -0.92947400 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'NH')] = qcdb.Molecule(""" 0 3 N 0.00000000 0.00000000 0.00000000 H 1.03673136 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HPH3ts')] = qcdb.Molecule(""" 0 2 P 0.21742900 0.00008800 -0.11124900 H 0.24660900 1.03466800 0.85216400 H 0.26266100 -1.02505800 0.86162300 H -1.26641800 -0.01095200 -0.15062600 H -2.50429000 0.00002800 0.10557500 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'NH2')] = qcdb.Molecule(""" 0 2 N 0.00000000 0.00000000 -0.08007491 H 0.00000000 -0.80231373 0.55629442 H 0.00000000 0.80231373 0.55629442 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'NH2C2H5ts')] = qcdb.Molecule(""" 0 3 C -1.39498400 -0.44966100 0.00070300 C -0.43574600 0.71406300 0.00202700 N 1.92757000 -0.37835200 0.00303600 H -1.20008700 -1.12095100 -0.83568700 H -1.32209500 -1.02788400 0.92177300 H -2.42871300 -0.10535200 -0.08933400 H -0.41768800 1.30848200 -0.90720100 H -0.44112700 1.32909500 0.89746700 H 0.82850100 0.18059300 -0.02856100 H 2.47259200 0.49807300 0.00391000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'NH2CH4ts')] = qcdb.Molecule(""" 0 2 C -1.26075000 -0.00000600 0.01229100 N 1.31325500 -0.00000500 -0.13678200 H -1.58398700 0.90853800 -0.48474400 H -1.46367200 -0.00457300 1.07730200 H -1.58474800 -0.90388000 -0.49270000 H 0.04310800 -0.00006400 -0.15169200 H 1.48045900 0.80557700 0.46775100 H 1.48055700 -0.80552400 0.46780800 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'NH3')] = qcdb.Molecule(""" 0 1 N 0.00000000 0.00000000 0.11289000 H 0.00000000 0.93802400 -0.26340900 H 0.81235300 -0.46901200 -0.26340900 H -0.81235300 -0.46901200 -0.26340900 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'O')] = qcdb.Molecule(""" 0 3 O 0.00000000 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OH')] = qcdb.Molecule(""" 0 2 O 0.00000000 0.00000000 0.00000000 H 0.96889819 0.00000000 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHC2H6ts')] = qcdb.Molecule(""" 0 2 C 1.45833400 -0.44636500 0.02547800 C 0.46942300 0.69742200 -0.02749300 O -1.85303700 -0.31465900 -0.05305500 H 1.30176400 -1.06107900 0.91073700 H 1.36658500 -1.08618900 -0.85111800 H 2.48224500 -0.06687900 0.05715000 H 0.47106900 1.32544300 0.86103700 H 0.53352400 1.30349500 -0.92856000 H -0.63023200 0.20781600 -0.07846500 H -2.26720700 0.38832100 0.46575100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHCH3ts')] = qcdb.Molecule(""" 0 3 C 0.00029000 -1.14228900 0.00000000 H -1.05595700 -1.38473500 0.00000000 H 0.52016700 -1.40738900 0.91244700 H 0.52016700 -1.40738900 -0.91244700 H 0.01156000 0.16009900 0.00000000 O 0.00029000 1.36164300 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHCH4ts')] = qcdb.Molecule(""" 0 2 C -1.21148700 0.00796800 0.00040700 O 1.29396500 -0.10869400 0.00013300 H 0.00947600 -0.11802000 0.00279900 H -1.52552900 -0.23325000 1.01007000 H -1.43066500 1.03323300 -0.27808200 H -1.55271000 -0.71011400 -0.73770200 H 1.41663600 0.84989400 -0.00059100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHClts')] = qcdb.Molecule(""" 0 3 Cl 0.01882000 -0.81730100 0.00000000 H -0.47048800 0.56948000 0.00000000 O 0.01882000 1.66557900 0.00000000 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHH2ts')] = qcdb.Molecule(""" 0 2 O -0.30106400 -0.10804900 -0.00000800 H -0.42794500 0.85156900 0.00001600 H 1.01548600 -0.10036700 0.00011900 H 1.82096800 0.11318700 -0.00007300 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHHts')] = qcdb.Molecule(""" 0 3 H 0.00000000 0.00000000 -0.86028700 O 0.00000000 0.00000000 0.32902400 H 0.00000000 0.00000000 -1.77190500 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'OHNH3ts')] = qcdb.Molecule(""" 0 2 N -1.15081600 -0.04393200 -0.10255900 O 1.17918600 -0.09269600 -0.01029000 H -1.30318500 -0.54763800 0.76657100 H -1.33891300 0.93580800 0.09185400 H -0.03068700 -0.15383400 -0.35318400 H 1.29500900 0.81475300 0.29499100 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'PH2')] = qcdb.Molecule(""" 0 2 P 0.00000000 0.00000000 -0.11565700 H 1.02013000 0.00000000 0.86742700 H -1.02013000 0.00000000 0.86742700 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'PH3')] = qcdb.Molecule(""" 0 1 P 0.00000000 0.00000000 0.12641100 H 1.19133900 0.00000000 -0.63205600 H -0.59566900 -1.03173000 -0.63205600 H -0.59566900 1.03173000 -0.63205600 units angstrom """) GEOS['%s-%s-reagent' % (dbse, 'HS')] = qcdb.Molecule(""" 0 2 S 0.00000000 0.00000000 0.00000000 H 1.34020229 0.00000000 0.00000000 units angstrom """) ######################################################################### # <<< Supplementary Quantum Chemical Results >>> DATA = {} DATA['NUCLEAR REPULSION ENERGY'] = {} DATA['NUCLEAR REPULSION ENERGY']['HTBH-H-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HCl-reagent' ] = 7.05875275 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HHClts-reagent' ] = 10.39163823 DATA['NUCLEAR REPULSION ENERGY']['HTBH-H2-reagent' ] = 0.71329559 DATA['NUCLEAR REPULSION ENERGY']['HTBH-Cl-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OH-reagent' ] = 4.36931115 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHH2ts-reagent' ] = 10.73785396 DATA['NUCLEAR REPULSION ENERGY']['HTBH-H2O-reagent' ] = 9.19771594 DATA['NUCLEAR REPULSION ENERGY']['HTBH-CH3-reagent' ] = 9.69236444 DATA['NUCLEAR REPULSION ENERGY']['HTBH-CH3H2ts-reagent' ] = 15.32861238 DATA['NUCLEAR REPULSION ENERGY']['HTBH-CH4-reagent' ] = 13.46695412 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHCH4ts-reagent' ] = 37.11882096 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HH2ts-reagent' ] = 1.42332440 DATA['NUCLEAR REPULSION ENERGY']['HTBH-NH3-reagent' ] = 11.97232339 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHNH3ts-reagent' ] = 37.13900482 DATA['NUCLEAR REPULSION ENERGY']['HTBH-NH2-reagent' ] = 7.56429116 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HClCH3ts-reagent' ] = 46.25151943 DATA['NUCLEAR REPULSION ENERGY']['HTBH-C2H6-reagent' ] = 42.29535986 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHC2H6ts-reagent' ] = 76.62129511 DATA['NUCLEAR REPULSION ENERGY']['HTBH-C2H5-reagent' ] = 36.98165035 DATA['NUCLEAR REPULSION ENERGY']['HTBH-F-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['HTBH-FH2ts-reagent' ] = 6.11540453 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HF-reagent' ] = 5.20285489 DATA['NUCLEAR REPULSION ENERGY']['HTBH-O-reagent' ] = 0.00000000 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHCH3ts-reagent' ] = 30.91033235 DATA['NUCLEAR REPULSION ENERGY']['HTBH-PH3-reagent' ] = 17.63061432 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HPH3ts-reagent' ] = 21.01063452 DATA['NUCLEAR REPULSION ENERGY']['HTBH-PH2-reagent' ] = 11.46498480 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHHts-reagent' ] = 6.15505787 DATA['NUCLEAR REPULSION ENERGY']['HTBH-H2S-reagent' ] = 12.94849742 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HH2Sts-reagent' ] = 16.45756641 DATA['NUCLEAR REPULSION ENERGY']['HTBH-HS-reagent' ] = 6.31758012 DATA['NUCLEAR REPULSION ENERGY']['HTBH-OHClts-reagent' ] = 38.62988868 DATA['NUCLEAR REPULSION ENERGY']['HTBH-CH3NH2ts-reagent' ] = 33.45955425 DATA['NUCLEAR REPULSION ENERGY']['HTBH-NH-reagent' ] = 3.57299934 DATA['NUCLEAR REPULSION ENERGY']['HTBH-NH2C2H5ts-reagent' ] = 71.85720179 DATA['NUCLEAR REPULSION ENERGY']['HTBH-C2H6NH2ts-reagent' ] = 78.78495055 DATA['NUCLEAR REPULSION ENERGY']['HTBH-NH2CH4ts-reagent' ] = 39.42842411 DATA['NUCLEAR REPULSION ENERGY']['HTBH-C5H8-reagent' ] = 155.81524012 DATA['NUCLEAR REPULSION ENERGY']['HTBH-C5H8ts-reagent' ] = 164.93671263
psi4/psi4
psi4/share/psi4/databases/HTBH.py
Python
lgpl-3.0
38,476
[ "Psi4" ]
4aeb5d604659f87df3055e2f3220d09fa00e52261285c84341e21b8e49deef3c
""" local path implementation. """ from __future__ import with_statement from contextlib import contextmanager import sys, os, re, atexit, io import py from py._path import common from py._path.common import iswin32, fspath from stat import S_ISLNK, S_ISDIR, S_ISREG from os.path import abspath, normcase, normpath, isabs, exists, isdir, isfile, islink, dirname if sys.version_info > (3,0): def map_as_list(func, iter): return list(map(func, iter)) else: map_as_list = map class Stat(object): def __getattr__(self, name): return getattr(self._osstatresult, "st_" + name) def __init__(self, path, osstatresult): self.path = path self._osstatresult = osstatresult @property def owner(self): if iswin32: raise NotImplementedError("XXX win32") import pwd entry = py.error.checked_call(pwd.getpwuid, self.uid) return entry[0] @property def group(self): """ return group name of file. """ if iswin32: raise NotImplementedError("XXX win32") import grp entry = py.error.checked_call(grp.getgrgid, self.gid) return entry[0] def isdir(self): return S_ISDIR(self._osstatresult.st_mode) def isfile(self): return S_ISREG(self._osstatresult.st_mode) def islink(self): st = self.path.lstat() return S_ISLNK(self._osstatresult.st_mode) class PosixPath(common.PathBase): def chown(self, user, group, rec=0): """ change ownership to the given user and group. user and group may be specified by a number or by a name. if rec is True change ownership recursively. """ uid = getuserid(user) gid = getgroupid(group) if rec: for x in self.visit(rec=lambda x: x.check(link=0)): if x.check(link=0): py.error.checked_call(os.chown, str(x), uid, gid) py.error.checked_call(os.chown, str(self), uid, gid) def readlink(self): """ return value of a symbolic link. """ return py.error.checked_call(os.readlink, self.strpath) def mklinkto(self, oldname): """ posix style hard link to another name. """ py.error.checked_call(os.link, str(oldname), str(self)) def mksymlinkto(self, value, absolute=1): """ create a symbolic link with the given value (pointing to another name). """ if absolute: py.error.checked_call(os.symlink, str(value), self.strpath) else: base = self.common(value) # with posix local paths '/' is always a common base relsource = self.__class__(value).relto(base) reldest = self.relto(base) n = reldest.count(self.sep) target = self.sep.join(('..', )*n + (relsource, )) py.error.checked_call(os.symlink, target, self.strpath) def getuserid(user): import pwd if not isinstance(user, int): user = pwd.getpwnam(user)[2] return user def getgroupid(group): import grp if not isinstance(group, int): group = grp.getgrnam(group)[2] return group FSBase = not iswin32 and PosixPath or common.PathBase class LocalPath(FSBase): """ object oriented interface to os.path and other local filesystem related information. """ class ImportMismatchError(ImportError): """ raised on pyimport() if there is a mismatch of __file__'s""" sep = os.sep class Checkers(common.Checkers): def _stat(self): try: return self._statcache except AttributeError: try: self._statcache = self.path.stat() except py.error.ELOOP: self._statcache = self.path.lstat() return self._statcache def dir(self): return S_ISDIR(self._stat().mode) def file(self): return S_ISREG(self._stat().mode) def exists(self): return self._stat() def link(self): st = self.path.lstat() return S_ISLNK(st.mode) def __init__(self, path=None, expanduser=False): """ Initialize and return a local Path instance. Path can be relative to the current directory. If path is None it defaults to the current working directory. If expanduser is True, tilde-expansion is performed. Note that Path instances always carry an absolute path. Note also that passing in a local path object will simply return the exact same path object. Use new() to get a new copy. """ if path is None: self.strpath = py.error.checked_call(os.getcwd) else: try: path = fspath(path) except TypeError: raise ValueError("can only pass None, Path instances " "or non-empty strings to LocalPath") if expanduser: path = os.path.expanduser(path) self.strpath = abspath(path) def __hash__(self): return hash(self.strpath) def __eq__(self, other): s1 = fspath(self) try: s2 = fspath(other) except TypeError: return False if iswin32: s1 = s1.lower() try: s2 = s2.lower() except AttributeError: return False return s1 == s2 def __ne__(self, other): return not (self == other) def __lt__(self, other): return fspath(self) < fspath(other) def __gt__(self, other): return fspath(self) > fspath(other) def samefile(self, other): """ return True if 'other' references the same file as 'self'. """ other = fspath(other) if not isabs(other): other = abspath(other) if self == other: return True if iswin32: return False # there is no samefile return py.error.checked_call( os.path.samefile, self.strpath, other) def remove(self, rec=1, ignore_errors=False): """ remove a file or directory (or a directory tree if rec=1). if ignore_errors is True, errors while removing directories will be ignored. """ if self.check(dir=1, link=0): if rec: # force remove of readonly files on windows if iswin32: self.chmod(0o700, rec=1) py.error.checked_call(py.std.shutil.rmtree, self.strpath, ignore_errors=ignore_errors) else: py.error.checked_call(os.rmdir, self.strpath) else: if iswin32: self.chmod(0o700) py.error.checked_call(os.remove, self.strpath) def computehash(self, hashtype="md5", chunksize=524288): """ return hexdigest of hashvalue for this file. """ try: try: import hashlib as mod except ImportError: if hashtype == "sha1": hashtype = "sha" mod = __import__(hashtype) hash = getattr(mod, hashtype)() except (AttributeError, ImportError): raise ValueError("Don't know how to compute %r hash" %(hashtype,)) f = self.open('rb') try: while 1: buf = f.read(chunksize) if not buf: return hash.hexdigest() hash.update(buf) finally: f.close() def new(self, **kw): """ create a modified version of this path. the following keyword arguments modify various path parts:: a:/some/path/to/a/file.ext xx drive xxxxxxxxxxxxxxxxx dirname xxxxxxxx basename xxxx purebasename xxx ext """ obj = object.__new__(self.__class__) if not kw: obj.strpath = self.strpath return obj drive, dirname, basename, purebasename,ext = self._getbyspec( "drive,dirname,basename,purebasename,ext") if 'basename' in kw: if 'purebasename' in kw or 'ext' in kw: raise ValueError("invalid specification %r" % kw) else: pb = kw.setdefault('purebasename', purebasename) try: ext = kw['ext'] except KeyError: pass else: if ext and not ext.startswith('.'): ext = '.' + ext kw['basename'] = pb + ext if ('dirname' in kw and not kw['dirname']): kw['dirname'] = drive else: kw.setdefault('dirname', dirname) kw.setdefault('sep', self.sep) obj.strpath = normpath( "%(dirname)s%(sep)s%(basename)s" % kw) return obj def _getbyspec(self, spec): """ see new for what 'spec' can be. """ res = [] parts = self.strpath.split(self.sep) args = filter(None, spec.split(',') ) append = res.append for name in args: if name == 'drive': append(parts[0]) elif name == 'dirname': append(self.sep.join(parts[:-1])) else: basename = parts[-1] if name == 'basename': append(basename) else: i = basename.rfind('.') if i == -1: purebasename, ext = basename, '' else: purebasename, ext = basename[:i], basename[i:] if name == 'purebasename': append(purebasename) elif name == 'ext': append(ext) else: raise ValueError("invalid part specification %r" % name) return res def dirpath(self, *args, **kwargs): """ return the directory path joined with any given path arguments. """ if not kwargs: path = object.__new__(self.__class__) path.strpath = dirname(self.strpath) if args: path = path.join(*args) return path return super(LocalPath, self).dirpath(*args, **kwargs) def join(self, *args, **kwargs): """ return a new path by appending all 'args' as path components. if abs=1 is used restart from root if any of the args is an absolute path. """ sep = self.sep strargs = [fspath(arg) for arg in args] strpath = self.strpath if kwargs.get('abs'): newargs = [] for arg in reversed(strargs): if isabs(arg): strpath = arg strargs = newargs break newargs.insert(0, arg) for arg in strargs: arg = arg.strip(sep) if iswin32: # allow unix style paths even on windows. arg = arg.strip('/') arg = arg.replace('/', sep) strpath = strpath + sep + arg obj = object.__new__(self.__class__) obj.strpath = normpath(strpath) return obj def open(self, mode='r', ensure=False, encoding=None): """ return an opened file with the given mode. If ensure is True, create parent directories if needed. """ if ensure: self.dirpath().ensure(dir=1) if encoding: return py.error.checked_call(io.open, self.strpath, mode, encoding=encoding) return py.error.checked_call(open, self.strpath, mode) def _fastjoin(self, name): child = object.__new__(self.__class__) child.strpath = self.strpath + self.sep + name return child def islink(self): return islink(self.strpath) def check(self, **kw): if not kw: return exists(self.strpath) if len(kw) == 1: if "dir" in kw: return not kw["dir"] ^ isdir(self.strpath) if "file" in kw: return not kw["file"] ^ isfile(self.strpath) return super(LocalPath, self).check(**kw) _patternchars = set("*?[" + os.path.sep) def listdir(self, fil=None, sort=None): """ list directory contents, possibly filter by the given fil func and possibly sorted. """ if fil is None and sort is None: names = py.error.checked_call(os.listdir, self.strpath) return map_as_list(self._fastjoin, names) if isinstance(fil, py.builtin._basestring): if not self._patternchars.intersection(fil): child = self._fastjoin(fil) if exists(child.strpath): return [child] return [] fil = common.FNMatcher(fil) names = py.error.checked_call(os.listdir, self.strpath) res = [] for name in names: child = self._fastjoin(name) if fil is None or fil(child): res.append(child) self._sortlist(res, sort) return res def size(self): """ return size of the underlying file object """ return self.stat().size def mtime(self): """ return last modification time of the path. """ return self.stat().mtime def copy(self, target, mode=False, stat=False): """ copy path to target. If mode is True, will copy copy permission from path to target. If stat is True, copy permission, last modification time, last access time, and flags from path to target. """ if self.check(file=1): if target.check(dir=1): target = target.join(self.basename) assert self!=target copychunked(self, target) if mode: copymode(self.strpath, target.strpath) if stat: copystat(self, target) else: def rec(p): return p.check(link=0) for x in self.visit(rec=rec): relpath = x.relto(self) newx = target.join(relpath) newx.dirpath().ensure(dir=1) if x.check(link=1): newx.mksymlinkto(x.readlink()) continue elif x.check(file=1): copychunked(x, newx) elif x.check(dir=1): newx.ensure(dir=1) if mode: copymode(x.strpath, newx.strpath) if stat: copystat(x, newx) def rename(self, target): """ rename this path to target. """ target = fspath(target) return py.error.checked_call(os.rename, self.strpath, target) def dump(self, obj, bin=1): """ pickle object into path location""" f = self.open('wb') try: py.error.checked_call(py.std.pickle.dump, obj, f, bin) finally: f.close() def mkdir(self, *args): """ create & return the directory joined with args. """ p = self.join(*args) py.error.checked_call(os.mkdir, fspath(p)) return p def write_binary(self, data, ensure=False): """ write binary data into path. If ensure is True create missing parent directories. """ if ensure: self.dirpath().ensure(dir=1) with self.open('wb') as f: f.write(data) def write_text(self, data, encoding, ensure=False): """ write text data into path using the specified encoding. If ensure is True create missing parent directories. """ if ensure: self.dirpath().ensure(dir=1) with self.open('w', encoding=encoding) as f: f.write(data) def write(self, data, mode='w', ensure=False): """ write data into path. If ensure is True create missing parent directories. """ if ensure: self.dirpath().ensure(dir=1) if 'b' in mode: if not py.builtin._isbytes(data): raise ValueError("can only process bytes") else: if not py.builtin._istext(data): if not py.builtin._isbytes(data): data = str(data) else: data = py.builtin._totext(data, sys.getdefaultencoding()) f = self.open(mode) try: f.write(data) finally: f.close() def _ensuredirs(self): parent = self.dirpath() if parent == self: return self if parent.check(dir=0): parent._ensuredirs() if self.check(dir=0): try: self.mkdir() except py.error.EEXIST: # race condition: file/dir created by another thread/process. # complain if it is not a dir if self.check(dir=0): raise return self def ensure(self, *args, **kwargs): """ ensure that an args-joined path exists (by default as a file). if you specify a keyword argument 'dir=True' then the path is forced to be a directory path. """ p = self.join(*args) if kwargs.get('dir', 0): return p._ensuredirs() else: p.dirpath()._ensuredirs() if not p.check(file=1): p.open('w').close() return p def stat(self, raising=True): """ Return an os.stat() tuple. """ if raising == True: return Stat(self, py.error.checked_call(os.stat, self.strpath)) try: return Stat(self, os.stat(self.strpath)) except KeyboardInterrupt: raise except Exception: return None def lstat(self): """ Return an os.lstat() tuple. """ return Stat(self, py.error.checked_call(os.lstat, self.strpath)) def setmtime(self, mtime=None): """ set modification time for the given path. if 'mtime' is None (the default) then the file's mtime is set to current time. Note that the resolution for 'mtime' is platform dependent. """ if mtime is None: return py.error.checked_call(os.utime, self.strpath, mtime) try: return py.error.checked_call(os.utime, self.strpath, (-1, mtime)) except py.error.EINVAL: return py.error.checked_call(os.utime, self.strpath, (self.atime(), mtime)) def chdir(self): """ change directory to self and return old current directory """ try: old = self.__class__() except py.error.ENOENT: old = None py.error.checked_call(os.chdir, self.strpath) return old @contextmanager def as_cwd(self): """ return context manager which changes to current dir during the managed "with" context. On __enter__ it returns the old dir. """ old = self.chdir() try: yield old finally: old.chdir() def realpath(self): """ return a new path which contains no symbolic links.""" return self.__class__(os.path.realpath(self.strpath)) def atime(self): """ return last access time of the path. """ return self.stat().atime def __repr__(self): return 'local(%r)' % self.strpath def __str__(self): """ return string representation of the Path. """ return self.strpath def chmod(self, mode, rec=0): """ change permissions to the given mode. If mode is an integer it directly encodes the os-specific modes. if rec is True perform recursively. """ if not isinstance(mode, int): raise TypeError("mode %r must be an integer" % (mode,)) if rec: for x in self.visit(rec=rec): py.error.checked_call(os.chmod, str(x), mode) py.error.checked_call(os.chmod, self.strpath, mode) def pypkgpath(self): """ return the Python package path by looking for the last directory upwards which still contains an __init__.py. Return None if a pkgpath can not be determined. """ pkgpath = None for parent in self.parts(reverse=True): if parent.isdir(): if not parent.join('__init__.py').exists(): break if not isimportable(parent.basename): break pkgpath = parent return pkgpath def _ensuresyspath(self, ensuremode, path): if ensuremode: s = str(path) if ensuremode == "append": if s not in sys.path: sys.path.append(s) else: if s != sys.path[0]: sys.path.insert(0, s) def pyimport(self, modname=None, ensuresyspath=True): """ return path as an imported python module. If modname is None, look for the containing package and construct an according module name. The module will be put/looked up in sys.modules. if ensuresyspath is True then the root dir for importing the file (taking __init__.py files into account) will be prepended to sys.path if it isn't there already. If ensuresyspath=="append" the root dir will be appended if it isn't already contained in sys.path. if ensuresyspath is False no modification of syspath happens. """ if not self.check(): raise py.error.ENOENT(self) pkgpath = None if modname is None: pkgpath = self.pypkgpath() if pkgpath is not None: pkgroot = pkgpath.dirpath() names = self.new(ext="").relto(pkgroot).split(self.sep) if names[-1] == "__init__": names.pop() modname = ".".join(names) else: pkgroot = self.dirpath() modname = self.purebasename self._ensuresyspath(ensuresyspath, pkgroot) __import__(modname) mod = sys.modules[modname] if self.basename == "__init__.py": return mod # we don't check anything as we might # we in a namespace package ... too icky to check modfile = mod.__file__ if modfile[-4:] in ('.pyc', '.pyo'): modfile = modfile[:-1] elif modfile.endswith('$py.class'): modfile = modfile[:-9] + '.py' if modfile.endswith(os.path.sep + "__init__.py"): if self.basename != "__init__.py": modfile = modfile[:-12] try: issame = self.samefile(modfile) except py.error.ENOENT: issame = False if not issame: raise self.ImportMismatchError(modname, modfile, self) return mod else: try: return sys.modules[modname] except KeyError: # we have a custom modname, do a pseudo-import mod = py.std.types.ModuleType(modname) mod.__file__ = str(self) sys.modules[modname] = mod try: py.builtin.execfile(str(self), mod.__dict__) except: del sys.modules[modname] raise return mod def sysexec(self, *argv, **popen_opts): """ return stdout text from executing a system child process, where the 'self' path points to executable. The process is directly invoked and not through a system shell. """ from subprocess import Popen, PIPE argv = map_as_list(str, argv) popen_opts['stdout'] = popen_opts['stderr'] = PIPE proc = Popen([str(self)] + argv, **popen_opts) stdout, stderr = proc.communicate() ret = proc.wait() if py.builtin._isbytes(stdout): stdout = py.builtin._totext(stdout, sys.getdefaultencoding()) if ret != 0: if py.builtin._isbytes(stderr): stderr = py.builtin._totext(stderr, sys.getdefaultencoding()) raise py.process.cmdexec.Error(ret, ret, str(self), stdout, stderr,) return stdout def sysfind(cls, name, checker=None, paths=None): """ return a path object found by looking at the systems underlying PATH specification. If the checker is not None it will be invoked to filter matching paths. If a binary cannot be found, None is returned Note: This is probably not working on plain win32 systems but may work on cygwin. """ if isabs(name): p = py.path.local(name) if p.check(file=1): return p else: if paths is None: if iswin32: paths = py.std.os.environ['Path'].split(';') if '' not in paths and '.' not in paths: paths.append('.') try: systemroot = os.environ['SYSTEMROOT'] except KeyError: pass else: paths = [re.sub('%SystemRoot%', systemroot, path) for path in paths] else: paths = py.std.os.environ['PATH'].split(':') tryadd = [] if iswin32: tryadd += os.environ['PATHEXT'].split(os.pathsep) tryadd.append("") for x in paths: for addext in tryadd: p = py.path.local(x).join(name, abs=True) + addext try: if p.check(file=1): if checker: if not checker(p): continue return p except py.error.EACCES: pass return None sysfind = classmethod(sysfind) def _gethomedir(cls): try: x = os.environ['HOME'] except KeyError: try: x = os.environ["HOMEDRIVE"] + os.environ['HOMEPATH'] except KeyError: return None return cls(x) _gethomedir = classmethod(_gethomedir) #""" #special class constructors for local filesystem paths #""" def get_temproot(cls): """ return the system's temporary directory (where tempfiles are usually created in) """ return py.path.local(py.std.tempfile.gettempdir()) get_temproot = classmethod(get_temproot) def mkdtemp(cls, rootdir=None): """ return a Path object pointing to a fresh new temporary directory (which we created ourself). """ import tempfile if rootdir is None: rootdir = cls.get_temproot() return cls(py.error.checked_call(tempfile.mkdtemp, dir=str(rootdir))) mkdtemp = classmethod(mkdtemp) def make_numbered_dir(cls, prefix='session-', rootdir=None, keep=3, lock_timeout = 172800): # two days """ return unique directory with a number greater than the current maximum one. The number is assumed to start directly after prefix. if keep is true directories with a number less than (maxnum-keep) will be removed. """ if rootdir is None: rootdir = cls.get_temproot() nprefix = normcase(prefix) def parse_num(path): """ parse the number out of a path (if it matches the prefix) """ nbasename = normcase(path.basename) if nbasename.startswith(nprefix): try: return int(nbasename[len(nprefix):]) except ValueError: pass # compute the maximum number currently in use with the # prefix lastmax = None while True: maxnum = -1 for path in rootdir.listdir(): num = parse_num(path) if num is not None: maxnum = max(maxnum, num) # make the new directory try: udir = rootdir.mkdir(prefix + str(maxnum+1)) except py.error.EEXIST: # race condition: another thread/process created the dir # in the meantime. Try counting again if lastmax == maxnum: raise lastmax = maxnum continue break # put a .lock file in the new directory that will be removed at # process exit if lock_timeout: lockfile = udir.join('.lock') mypid = os.getpid() if hasattr(lockfile, 'mksymlinkto'): lockfile.mksymlinkto(str(mypid)) else: lockfile.write(str(mypid)) def try_remove_lockfile(): # in a fork() situation, only the last process should # remove the .lock, otherwise the other processes run the # risk of seeing their temporary dir disappear. For now # we remove the .lock in the parent only (i.e. we assume # that the children finish before the parent). if os.getpid() != mypid: return try: lockfile.remove() except py.error.Error: pass atexit.register(try_remove_lockfile) # prune old directories if keep: for path in rootdir.listdir(): num = parse_num(path) if num is not None and num <= (maxnum - keep): lf = path.join('.lock') try: t1 = lf.lstat().mtime t2 = lockfile.lstat().mtime if not lock_timeout or abs(t2-t1) < lock_timeout: continue # skip directories still locked except py.error.Error: pass # assume that it means that there is no 'lf' try: path.remove(rec=1) except KeyboardInterrupt: raise except: # this might be py.error.Error, WindowsError ... pass # make link... try: username = os.environ['USER'] #linux, et al except KeyError: try: username = os.environ['USERNAME'] #windows except KeyError: username = 'current' src = str(udir) dest = src[:src.rfind('-')] + '-' + username try: os.unlink(dest) except OSError: pass try: os.symlink(src, dest) except (OSError, AttributeError, NotImplementedError): pass return udir make_numbered_dir = classmethod(make_numbered_dir) def copymode(src, dest): """ copy permission from src to dst. """ py.std.shutil.copymode(src, dest) def copystat(src, dest): """ copy permission, last modification time, last access time, and flags from src to dst.""" py.std.shutil.copystat(str(src), str(dest)) def copychunked(src, dest): chunksize = 524288 # half a meg of bytes fsrc = src.open('rb') try: fdest = dest.open('wb') try: while 1: buf = fsrc.read(chunksize) if not buf: break fdest.write(buf) finally: fdest.close() finally: fsrc.close() def isimportable(name): if name and (name[0].isalpha() or name[0] == '_'): name = name.replace("_", '') return not name or name.isalnum()
cvegaj/ElectriCERT
venv3/lib/python3.6/site-packages/py/_path/local.py
Python
gpl-3.0
33,568
[ "VisIt" ]
868c013b7ba2377ece21834286fb5165fd571a86e080ab71038e3ad160b41592
from __future__ import print_function import random import time from numpy import random as nprand import moose def make_network(): size = 1024 timestep = 0.2 runtime = 100.0 delayMin = timestep delayMax = 4 weightMax = 0.02 Vmax = 1.0 thresh = 0.2 tau = 1 # Range of tau tau0 = 0.5 # minimum tau refr = 0.3 refr0 = 0.2 connectionProbability = 0.1 random.seed( 123 ) nprand.seed( 456 ) t0 = time.time() clock = moose.element( '/clock' ) network = moose.IntFire( 'network', size, 1 ); network.vec.bufferTime = [delayMax * 2] * size moose.le( '/network' ) network.vec.numSynapses = [1] * size # Interesting. This fails because we haven't yet allocated # the synapses. I guess it is fair to avoid instances of objects that # don't have allocations. #synapse = moose.element( '/network/synapse' ) sv = moose.vec( '/network/synapse' ) print('before connect t = ', time.time() - t0) mid = moose.connect( network, 'spikeOut', sv, 'addSpike', 'Sparse') print('after connect t = ', time.time() - t0) #print mid.destFields m2 = moose.element( mid ) m2.setRandomConnectivity( connectionProbability, 5489 ) print('after setting connectivity, t = ', time.time() - t0) network.vec.Vm = [(Vmax*random.random()) for r in range(size)] network.vec.thresh = thresh network.vec.refractoryPeriod = [( refr0 + refr * random.random()) for r in range( size) ] network.vec.tau = [(tau0 + tau*random.random()) for r in range(size)] numSynVec = network.vec.numSynapses print('Middle of setup, t = ', time.time() - t0) numTotSyn = sum( numSynVec ) for item in network.vec: neuron = moose.element( item ) neuron.synapse.delay = [ (delayMin + random.random() * delayMax) for r in range( len( neuron.synapse ) ) ] neuron.synapse.weight = nprand.rand( len( neuron.synapse ) ) * weightMax print('after setup, t = ', time.time() - t0, ", numTotSyn = ", numTotSyn) """ netvec = network.vec for i in range( size ): synvec = netvec[i].synapse.vec synvec.weight = [ (random.random() * weightMax) for r in range( synvec.len )] synvec.delay = [ (delayMin + random.random() * delayMax) for r in range( synvec.len )] """ #moose.useClock( 9, '/postmaster', 'process' ) moose.useClock( 0, '/network', 'process' ) moose.setClock( 0, timestep ) moose.setClock( 9, timestep ) t1 = time.time() moose.reinit() print('reinit time t = ', time.time() - t1) network.vec.Vm = [(Vmax*random.random()) for r in range(size)] print('setting Vm , t = ', time.time() - t1) t1 = time.time() print('starting') moose.start(runtime) print('runtime, t = ', time.time() - t1) print('Vm100:103', network.vec.Vm[100:103]) print('Vm900:903', network.vec.Vm[900:903]) print('weights 100:', network.vec[100].synapse.delay[0:5]) print('weights 900:', network.vec[900].synapse.delay[0:5]) make_network()
subhacom/moose-core
tests/python/mpi/recurrentIntFire.py
Python
gpl-3.0
2,818
[ "MOOSE", "NEURON" ]
18e8976ed824a5c9f86b35936321a52699b0a7bd0581c75e889e8d3566e3b70d
#!/usr/bin/env python import numpy import scipy.io.wavfile import scipy.fftpack import scipy.signal import defs WINDOWSIZE = defs.ZEROPADDING_FACTOR * defs.BUFFER_WINDOWSIZE ### convenience functions def amplitude2db(power): return 20.0 * scipy.log10( power ) def db2amplitude(db): return 10.0**(db/20.0) def hertz2bin(freq, sample_rate): return freq*(WINDOWSIZE/2+1) / (float(sample_rate)/2) def bin2hertz(bin_number, sample_rate): return bin_number * (sample_rate/2) / (float(WINDOWSIZE)/2+1) ### file IO def get_buffers_from_file(wav_filename, num_buffers=None, bins=None): sample_rate, data_unnormalized = scipy.io.wavfile.read(wav_filename) windowsize = defs.BUFFER_WINDOWSIZE hopsize = defs.HOPSIZE if bins is not None: windowsize = bins hopsize = hopsize if num_buffers: data_unnormalized = data_unnormalized[0:( windowsize + (num_buffers-1) * hopsize)] data = data_unnormalized / float(numpy.iinfo(data_unnormalized.dtype).max) # split into overlapping windows window_buffers = [] for window_index in range( (len(data)/hopsize - windowsize/hopsize)+1): index_start = window_index*hopsize index_end = window_index*hopsize + windowsize window = data[ index_start : index_end ] window_buffers.append(window) return window_buffers, sample_rate def get_long_buffer_from_file(wav_filename, num_buffers=None, bins=None): sample_rate, data_unnormalized = scipy.io.wavfile.read(wav_filename) windowsize = defs.LONG_WINDOWSIZE data_unnormalized = data_unnormalized[0:( windowsize + (num_buffers-1) * 1)] data = data_unnormalized / float(numpy.iinfo(data_unnormalized.dtype).max) # split into overlapping windows return data, sample_rate ### FFT stuff def stft_amplitude(window_buffer, zeropadding=defs.ZEROPADDING_FACTOR): #window_function = scipy.signal.gaussian(len(window_buffer), # len(window_buffer)/8) #window_function = scipy.signal.get_window("hanning", # len(window_buffer)) window_function = scipy.signal.get_window("hamming", len(window_buffer)) buf = window_buffer*window_function N = zeropadding*len(buf) fft = scipy.fftpack.fft(buf, N) fft_abs = abs(fft[:N/2+1]) ### see test-normalization.py fft_normalized = fft_abs / (sum(window_function)/2) return fft_normalized def fft_amplitude(window_buffer, sample_rate): #seconds = numpy.arange(0, len(window_buffer)) / float(sample_rate) #a = -10.0 #window_function = numpy.exp(seconds * a) zeropadding = 2 window_function = scipy.signal.get_window("hamming", len(window_buffer)) buf = window_buffer*window_function #import pylab #pylab.plot(buf) #pylab.show() N = zeropadding*len(buf) fft = scipy.fftpack.fft(buf, N) fft_abs = abs(fft[:N/2+1]) fft_normalized = fft_abs / (sum(window_function)/2) return fft_normalized
gperciva/artifastring
research/mode-detect/stft.py
Python
gpl-3.0
2,992
[ "Gaussian" ]
01aef76705b0d6f9177b6276e7f27afccaae13d3a2d56e1e449d2421ce9c53af
#!/usr/bin/env python ######################################################################## # $HeadURL$ # File : dirac-admin-get-job-pilots # Author : Stuart Paterson ######################################################################## """ Retrieve info about pilots that have matched a given Job """ __RCSID__ = "$Id$" from DIRAC.Core.Base import Script Script.setUsageMessage( '\n'.join( [ __doc__.split( '\n' )[1], 'Usage:', ' %s [option|cfgfile] ... JobID' % Script.scriptName, 'Arguments:', ' JobID: DIRAC ID of the Job' ] ) ) Script.parseCommandLine( ignoreErrors = True ) args = Script.getPositionalArgs() if len( args ) < 1: Script.showHelp() from DIRAC import exit as DIRACExit from DIRAC.Interfaces.API.DiracAdmin import DiracAdmin diracAdmin = DiracAdmin() exitCode = 0 errorList = [] for job in args: try: job = int( job ) except Exception, x: errorList.append( ( job, 'Expected integer for jobID' ) ) exitCode = 2 continue result = diracAdmin.getJobPilots( job ) if not result['OK']: errorList.append( ( job, result['Message'] ) ) exitCode = 2 for error in errorList: print "ERROR %s: %s" % error DIRACExit( exitCode )
Sbalbp/DIRAC
Interfaces/scripts/dirac-admin-get-job-pilots.py
Python
gpl-3.0
1,367
[ "DIRAC" ]
d31f7860f163cb57fc9b6cb58cfc052824f7643f1ccc58cb5eda97e18de37eb3
# -*- coding: utf-8 -*- from __future__ import division, print_function, absolute_import """ ZNCC using Pyramids """ __author__ = "Per-Erik Forssén" __copyright__ = "Copyright 2013, Per-Erik Forssén" __license__ = "GPL" __email__ = "perfo@isy.liu.se" import logging logger = logging.getLogger() import numpy as np def gaussian_kernel(gstd): """Generate odd sized truncated Gaussian The generated filter kernel has a cutoff at $3\sigma$ and is normalized to sum to 1 Parameters ------------- gstd : float Standard deviation of filter Returns ------------- g : ndarray Array with kernel coefficients """ Nc = np.ceil(gstd*3)*2+1 x = np.linspace(-(Nc-1)/2,(Nc-1)/2,Nc,endpoint=True) g = np.exp(-.5*((x/gstd)**2)) g = g/np.sum(g) return g def subsample(time_series, downsample_factor): """Subsample with Gaussian prefilter The prefilter will have the filter size $\sigma_g=.5*ssfactor$ Parameters -------------- time_series : ndarray Input signal downsample_factor : float Downsampling factor Returns -------------- ts_out : ndarray The downsampled signal """ Ns = np.int(np.floor(np.size(time_series)/downsample_factor)) g = gaussian_kernel(0.5*downsample_factor) ts_blur = np.convolve(time_series,g,'same') ts_out = np.zeros((Ns,1), dtype='float64') for k in range(0,Ns): cpos = (k+.5)*downsample_factor-.5 cfrac = cpos-np.floor(cpos) cind = np.floor(cpos) if cfrac>0: ts_out[k]=ts_blur[cind]*(1-cfrac)+ts_blur[cind+1]*cfrac else: ts_out[k]=ts_blur[cind] return ts_out def upsample(time_series, scaling_factor): """Upsample using linear interpolation The function uses replication of the value at edges Parameters -------------- time_series : ndarray Input signal scaling_factor : float The factor to upsample with Returns -------------- ts_out : ndarray The upsampled signal """ Ns0 = np.size(time_series) Ns = np.int(np.floor(np.size(time_series)*scaling_factor)) ts_out = np.zeros((Ns,1), dtype='float64') for k in range(0,Ns): cpos = int(np.min([Ns0-1,np.max([0.,(k+0.5)/scaling_factor-0.5])])) cfrac = cpos-np.floor(cpos) cind = int(np.floor(cpos)) #print "cpos=%f cfrac=%f cind=%d", (cpos,cfrac,cind) if cfrac>0: ts_out[k]=time_series[cind]*(1-cfrac)+time_series[cind+1]*cfrac else: ts_out[k]=time_series[cind] return ts_out def do_binning(time_series,factor): Ns = np.size(time_series) // factor ts_out = np.zeros((Ns,1), dtype='float64') for k in range(0,Ns): ts_out[k]=0 for l in range(0,factor): ts_out[k] += time_series[k*factor+l] ts_out[k] /= factor return ts_out def create_pyramid(time_series,octaves): pyr_out = [time_series ] for k in range(0,octaves): pyr_out.append(do_binning(pyr_out[-1],2)) return pyr_out def zncc(ts1,ts2): """Zero mean normalised cross-correlation (ZNCC) This function does ZNCC of two signals, ts1 and ts2 Normalisation by very small values is avoided by doing max(nmin,nvalue) Parameters -------------- ts1 : ndarray Input signal 1 to be aligned with ts2 : ndarray Input signal 2 Returns -------------- best_shift : float The best shift of *ts1* to align it with *ts2* ts_out : ndarray The correlation result """ # Output is the same size as ts1 Ns1 = np.size(ts1) Ns2 = np.size(ts2) ts_out = np.zeros((Ns1,1), dtype='float64') ishift = int(np.floor(Ns2/2)) # origin of ts2 t1m = np.mean(ts1) t2m = np.mean(ts2) for k in range(0,Ns1): lstart = np.int(ishift-k) if lstart<0 : lstart=0 lend = np.int(ishift-k+Ns2) imax = np.int(np.min([Ns2,Ns1-k+ishift])) if lend>imax : lend=imax csum = 0 ts1sum = 0 ts1sum2 = 0 ts2sum = 0 ts2sum2 = 0 Nterms = lend-lstart for l in range(lstart,lend): csum += ts1[k+l-ishift]*ts2[l] ts1sum += ts1[k+l-ishift] ts1sum2 += ts1[k+l-ishift]*ts1[k+l-ishift] ts2sum += ts2[l] ts2sum2 += ts2[l]*ts2[l] ts1sum2 = np.max([t1m*t1m*100,ts1sum2])-ts1sum*ts1sum/Nterms ts2sum2 = np.max([t2m*t2m*100,ts2sum2])-ts2sum*ts2sum/Nterms #ts_out[k]=csum/np.sqrt(ts1sum2*ts2sum2) ts_out[k]=(csum-2.0*ts1sum*ts2sum/Nterms+ts1sum*ts2sum/Nterms/Nterms)/np.sqrt(ts1sum2*ts2sum2) best_shift = np.argmax(ts_out)-ishift return best_shift, ts_out def refine_correlation(ts1,ts2,shift_guess): """Refine a rough guess of shift by evaluating ZNCC for similar values Shifts of *ts1* are tested in the range [-2:2] Refine a rough guess of shift, by trying neighbouring ZNCC values in the range [-2:2] Parameters ---------------- ts1 : list_like The first timeseries ts2 : list_like The seconds timeseries shift_guess : float The guess to start from Returns --------------- best_shift : float The best shift of those tested ts_out : ndarray Computed correlation values """ Ns1 = np.size(ts1) Ns2 = np.size(ts2) ts_out = np.zeros((5,1)) ishift = int(np.floor(Ns2/2)) # origin of ts2 k_offset = shift_guess-2+ishift # Try shifts starting with this one t1m = np.mean(ts1) t2m = np.mean(ts2) for k in range(0,5): km = k+k_offset lstart = np.int(ishift-km) if lstart<0 : lstart=0 lend = np.int(ishift-km+Ns2) imax = np.int(np.min([Ns2,Ns1-km+ishift])) if lend>imax : lend=imax csum = 0 ts1sum = 0 ts1sum2 = 0 ts2sum = 0 ts2sum2 = 0 Nterms = lend-lstart for l in range(lstart,lend): csum += ts1[km+l-ishift]*ts2[l] ts1sum += ts1[km+l-ishift] ts1sum2 += ts1[km+l-ishift]*ts1[km+l-ishift] ts2sum += ts2[l] ts2sum2 += ts2[l]*ts2[l] ts1sum2 = np.max([t1m*t1m*100,ts1sum2])-ts1sum*ts1sum/Nterms ts2sum2 = np.max([t2m*t2m*100,ts2sum2])-ts2sum*ts2sum/Nterms #ts_out[k]=csum/np.sqrt(ts1sum2*ts2sum2) ts_out[k]=(csum-2.0*ts1sum*ts2sum/Nterms+ts1sum*ts2sum/Nterms/Nterms)/np.sqrt(ts1sum2*ts2sum2) best_shift = np.argmax(ts_out)+k_offset-ishift return best_shift, ts_out def find_shift_pyr(ts1,ts2,nlevels): """ Find shift that best aligns two time series The shift that aligns the timeseries ts1 with ts2. This is sought using zero mean normalized cross correlation (ZNCC) in a coarse to fine search with an octave pyramid on nlevels levels. Parameters ---------------- ts1 : list_like The first timeseries ts2 : list_like The seconds timeseries nlevels : int Number of levels in pyramid Returns ---------------- ts1_shift : float How many samples to shift ts1 to align with ts2 """ pyr1 = create_pyramid(ts1,nlevels) pyr2 = create_pyramid(ts2,nlevels) logger.debug("pyramid size = %d" % len(pyr1)) logger.debug("size of first element %d " % np.size(pyr1[0])) logger.debug("size of last element %d " % np.size(pyr1[-1])) ishift, corrfn = zncc(pyr1[-1],pyr2[-1]) for k in range(1,nlevels+1): ishift, corrfn = refine_correlation(pyr1[-k-1],pyr2[-k-1],ishift*2) return ishift
spillai/crisp
crisp/znccpyr.py
Python
gpl-3.0
7,934
[ "Gaussian" ]
cc4fe3741522a97c11ace4f098c5ff7b4bf2fa5c49145f524685981bd59c5128