Add files using upload-large-folder tool
Browse filesThis view is limited to 50 files because it contains too many changes.
See raw diff
- .gitattributes +68 -0
- 09FPT4oBgHgl3EQfTzT7/content/tmp_files/2301.13055v1.pdf.txt +1308 -0
- 09FPT4oBgHgl3EQfTzT7/content/tmp_files/load_file.txt +0 -0
- 0NE0T4oBgHgl3EQfuAEL/vector_store/index.pkl +3 -0
- 0dE0T4oBgHgl3EQfdQAz/content/2301.02373v1.pdf +3 -0
- 0dE0T4oBgHgl3EQfdQAz/vector_store/index.pkl +3 -0
- 2dAyT4oBgHgl3EQfPvZl/vector_store/index.faiss +3 -0
- 39AyT4oBgHgl3EQfP_aH/vector_store/index.faiss +3 -0
- 39AyT4oBgHgl3EQfP_aH/vector_store/index.pkl +3 -0
- 39AzT4oBgHgl3EQf9f54/content/2301.01920v1.pdf +3 -0
- 39AzT4oBgHgl3EQf9f54/vector_store/index.faiss +3 -0
- 39AzT4oBgHgl3EQf9f54/vector_store/index.pkl +3 -0
- 4dE2T4oBgHgl3EQf6Qjc/vector_store/index.pkl +3 -0
- 5NAzT4oBgHgl3EQf9v7Q/content/2301.01925v1.pdf +3 -0
- 5NAzT4oBgHgl3EQf9v7Q/vector_store/index.faiss +3 -0
- 5NAzT4oBgHgl3EQf9v7Q/vector_store/index.pkl +3 -0
- 5NAzT4oBgHgl3EQffvy-/content/tmp_files/2301.01458v1.pdf.txt +1303 -0
- 5NAzT4oBgHgl3EQffvy-/content/tmp_files/load_file.txt +0 -0
- 5NE6T4oBgHgl3EQflhFb/content/2301.06150v1.pdf +3 -0
- 5NE6T4oBgHgl3EQflhFb/vector_store/index.faiss +3 -0
- 5dFJT4oBgHgl3EQfkywG/vector_store/index.faiss +3 -0
- 5tAyT4oBgHgl3EQf2fk_/content/2301.00751v1.pdf +3 -0
- 8tE0T4oBgHgl3EQfwgFY/content/2301.02633v1.pdf +3 -0
- 8tE0T4oBgHgl3EQfwgFY/vector_store/index.faiss +3 -0
- 8tE0T4oBgHgl3EQfwgFY/vector_store/index.pkl +3 -0
- BNE4T4oBgHgl3EQfFAx2/vector_store/index.faiss +3 -0
- BNE4T4oBgHgl3EQfFAx2/vector_store/index.pkl +3 -0
- D9E2T4oBgHgl3EQfogh1/content/tmp_files/2301.04019v1.pdf.txt +2460 -0
- D9E2T4oBgHgl3EQfogh1/content/tmp_files/load_file.txt +0 -0
- D9FKT4oBgHgl3EQfZi4o/content/tmp_files/2301.11803v1.pdf.txt +2097 -0
- D9FKT4oBgHgl3EQfZi4o/content/tmp_files/load_file.txt +0 -0
- DdE1T4oBgHgl3EQf-Abs/vector_store/index.pkl +3 -0
- DdE5T4oBgHgl3EQfUQ9g/content/tmp_files/2301.05542v1.pdf.txt +0 -0
- DdE5T4oBgHgl3EQfUQ9g/content/tmp_files/load_file.txt +0 -0
- F9E4T4oBgHgl3EQfHQxB/content/2301.04901v1.pdf +3 -0
- F9E4T4oBgHgl3EQfHQxB/vector_store/index.pkl +3 -0
- FtE1T4oBgHgl3EQf-waO/content/tmp_files/2301.03573v1.pdf.txt +0 -0
- FtE1T4oBgHgl3EQf-waO/content/tmp_files/load_file.txt +0 -0
- GNAzT4oBgHgl3EQfi_3N/vector_store/index.faiss +3 -0
- GdAyT4oBgHgl3EQffPg-/content/tmp_files/2301.00335v1.pdf.txt +0 -0
- GdAyT4oBgHgl3EQffPg-/content/tmp_files/load_file.txt +0 -0
- GtE0T4oBgHgl3EQfRQCY/content/tmp_files/2301.02205v1.pdf.txt +678 -0
- GtE0T4oBgHgl3EQfRQCY/content/tmp_files/load_file.txt +389 -0
- HdE0T4oBgHgl3EQfRgBm/content/tmp_files/2301.02208v1.pdf.txt +1183 -0
- HdE0T4oBgHgl3EQfRgBm/content/tmp_files/load_file.txt +0 -0
- HtE5T4oBgHgl3EQfWg9Q/content/tmp_files/load_file.txt +220 -0
- J9FIT4oBgHgl3EQfZytY/vector_store/index.faiss +3 -0
- JNE2T4oBgHgl3EQfUgdI/content/2301.03813v1.pdf +3 -0
- JNE2T4oBgHgl3EQfUgdI/vector_store/index.pkl +3 -0
- JNE4T4oBgHgl3EQfIgz1/content/2301.04914v1.pdf +3 -0
.gitattributes
CHANGED
|
@@ -15422,3 +15422,71 @@ jNFJT4oBgHgl3EQfXSyN/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -tex
|
|
| 15422 |
0tFRT4oBgHgl3EQfkzf9/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15423 |
INAzT4oBgHgl3EQfjf2_/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15424 |
89AzT4oBgHgl3EQfgvxw/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 15422 |
0tFRT4oBgHgl3EQfkzf9/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15423 |
INAzT4oBgHgl3EQfjf2_/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15424 |
89AzT4oBgHgl3EQfgvxw/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15425 |
+
ndE3T4oBgHgl3EQf7Asa/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15426 |
+
SNE2T4oBgHgl3EQfCAY8/content/2301.03608v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15427 |
+
5NAzT4oBgHgl3EQf9v7Q/content/2301.01925v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15428 |
+
htAyT4oBgHgl3EQfXvc6/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15429 |
+
5NE6T4oBgHgl3EQflhFb/content/2301.06150v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15430 |
+
SNE2T4oBgHgl3EQfCAY8/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15431 |
+
5tAyT4oBgHgl3EQf2fk_/content/2301.00751v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15432 |
+
idFJT4oBgHgl3EQfWizT/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15433 |
+
uNE5T4oBgHgl3EQfLQ6L/content/2301.05472v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15434 |
+
gdE0T4oBgHgl3EQfXgBN/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15435 |
+
adFAT4oBgHgl3EQf4h70/content/2301.08727v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15436 |
+
b9AyT4oBgHgl3EQf-PqC/content/2301.00889v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15437 |
+
LNE3T4oBgHgl3EQfYAr5/content/2301.04485v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15438 |
+
RtFJT4oBgHgl3EQfKyxj/content/2301.11466v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15439 |
+
VtE4T4oBgHgl3EQfng0j/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15440 |
+
gdE0T4oBgHgl3EQfXgBN/content/2301.02293v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15441 |
+
39AzT4oBgHgl3EQf9f54/content/2301.01920v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15442 |
+
dNFAT4oBgHgl3EQfYx1Q/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15443 |
+
ddFST4oBgHgl3EQfEzgN/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15444 |
+
b9AyT4oBgHgl3EQfi_hp/content/2301.00406v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15445 |
+
dtFJT4oBgHgl3EQf_i1w/content/2301.11695v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15446 |
+
_tA0T4oBgHgl3EQfPf_J/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15447 |
+
nNFIT4oBgHgl3EQfuCsf/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15448 |
+
nNFIT4oBgHgl3EQfuCsf/content/2301.11341v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15449 |
+
b9E2T4oBgHgl3EQfFgZ2/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15450 |
+
XdE3T4oBgHgl3EQfbwqk/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15451 |
+
5NAzT4oBgHgl3EQf9v7Q/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15452 |
+
uNE5T4oBgHgl3EQfLQ6L/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15453 |
+
zNAyT4oBgHgl3EQf0vni/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15454 |
+
n9E_T4oBgHgl3EQf8Byb/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15455 |
+
0dE0T4oBgHgl3EQfdQAz/content/2301.02373v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15456 |
+
2dAyT4oBgHgl3EQfPvZl/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15457 |
+
RtFJT4oBgHgl3EQfKyxj/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15458 |
+
39AzT4oBgHgl3EQf9f54/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15459 |
+
m9E5T4oBgHgl3EQfHw6d/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15460 |
+
rtAyT4oBgHgl3EQfz_l6/content/2301.00710v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15461 |
+
J9FIT4oBgHgl3EQfZytY/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15462 |
+
BNE4T4oBgHgl3EQfFAx2/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15463 |
+
xdE5T4oBgHgl3EQfMw71/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15464 |
+
5NE6T4oBgHgl3EQflhFb/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15465 |
+
39AyT4oBgHgl3EQfP_aH/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15466 |
+
btFLT4oBgHgl3EQfYS80/content/2301.12064v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15467 |
+
JNE2T4oBgHgl3EQfUgdI/content/2301.03813v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15468 |
+
8tE0T4oBgHgl3EQfwgFY/content/2301.02633v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15469 |
+
O9AzT4oBgHgl3EQfIfuL/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15470 |
+
eNE1T4oBgHgl3EQfeQRR/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15471 |
+
eNE2T4oBgHgl3EQfbQcn/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15472 |
+
8tE0T4oBgHgl3EQfwgFY/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15473 |
+
m9E5T4oBgHgl3EQfHw6d/content/2301.05443v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15474 |
+
p9AzT4oBgHgl3EQfAvo4/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15475 |
+
5dFJT4oBgHgl3EQfkywG/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15476 |
+
ndE1T4oBgHgl3EQfhgRQ/content/2301.03241v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15477 |
+
JNE4T4oBgHgl3EQfIgz1/content/2301.04914v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15478 |
+
cNAzT4oBgHgl3EQfnf3Z/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15479 |
+
stE1T4oBgHgl3EQfjgQE/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15480 |
+
VdE0T4oBgHgl3EQf2wKz/content/2301.02717v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15481 |
+
ndE1T4oBgHgl3EQfhgRQ/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15482 |
+
GNAzT4oBgHgl3EQfi_3N/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15483 |
+
StA0T4oBgHgl3EQfD_-h/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15484 |
+
bdFRT4oBgHgl3EQfRzcI/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15485 |
+
LdAzT4oBgHgl3EQfyv4r/content/2301.01757v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15486 |
+
rtAyT4oBgHgl3EQfz_l6/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15487 |
+
zjlab/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15488 |
+
adFAT4oBgHgl3EQf4h70/vector_store/index.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15489 |
+
aNFPT4oBgHgl3EQfvTWR/content/2301.13159v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15490 |
+
zjlab/vector_store/index_kw.faiss filter=lfs diff=lfs merge=lfs -text
|
| 15491 |
+
F9E4T4oBgHgl3EQfHQxB/content/2301.04901v1.pdf filter=lfs diff=lfs merge=lfs -text
|
| 15492 |
+
QdAyT4oBgHgl3EQfU_c5/content/2301.00134v1.pdf filter=lfs diff=lfs merge=lfs -text
|
09FPT4oBgHgl3EQfTzT7/content/tmp_files/2301.13055v1.pdf.txt
ADDED
|
@@ -0,0 +1,1308 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
Theoretical model of membrane protrusions driven by curved active proteins
|
| 2 |
+
Yoav Ravid 1,∗, Samo Peniˇc 2, Yuko Mimori-Kiyosue,3, Shiro Suetsugu,4,5,6, Aleˇs Igliˇc 2, and Nir S. Gov 1,∗
|
| 3 |
+
1Department of Chemical and Biological Physics, Weizmann Institute of Science, Rehovot, Israel
|
| 4 |
+
2Laboratory of Physics, Faculty of Electrical Engineering, University of Ljubljana, Ljubljana, Slovenia
|
| 5 |
+
3Laboratory for Molecular and Cellular Dynamics,
|
| 6 |
+
RIKEN Center for Biosystems Dynamics Research,
|
| 7 |
+
Minatojima-minaminachi, Chuo-ku, Kobe, Hyogo 650-0047, Japan
|
| 8 |
+
4Division of Biological Science, Graduate School of Science and Technology,
|
| 9 |
+
Nara Institute of Science and Technology 8916-5, Takayama, Ikoma, Nara, 630-0192, Japan
|
| 10 |
+
5 Data Science Center, Nara Institute of Science and Technology, Ikoma 630-0192, Japan
|
| 11 |
+
6 Center for Digital Green-innovation, Nara Institute of Science and Technology, Ikoma 630-0192, Japan
|
| 12 |
+
Eukaryotic cells intrinsically change their shape, by changing the composition of their membrane
|
| 13 |
+
and by restructuring their underlying cytoskeleton. We present here further studies and extensions
|
| 14 |
+
of a minimal physical model, describing a closed vesicle with mobile curved membrane protein
|
| 15 |
+
complexes. The cytoskeletal forces describe the protrusive force due to actin polymerization which is
|
| 16 |
+
recruited to the membrane by the curved protein complexes. We characterize the phase diagrams of
|
| 17 |
+
this model, as function of the magnitude of the active forces, nearest-neighbor protein interactions
|
| 18 |
+
and the proteins’ spontaneous curvature. It was previously shown that this model can explain the
|
| 19 |
+
formation of lamellipodia-like flat protrusions, and here we explore the regimes where the model can
|
| 20 |
+
also give rise to filopodia-like tubular protrusions. We extend the simulation with curved components
|
| 21 |
+
of both convex and concave species, where we find the formation of complex ruffled clusters, as well
|
| 22 |
+
as internalized invaginations that resemble the process of endocytosis and macropinocytosis. We
|
| 23 |
+
alter the force model representing the cytoskeleton to simulate the effects of bundled instead of
|
| 24 |
+
branched structure, resulting in shapes which resemble filopodia.
|
| 25 |
+
Keywords: Cell membrane, Curved inclusions, Monte-Carlo simulations, Closed vesicle shapes, Cell motility, Filopodia
|
| 26 |
+
I.
|
| 27 |
+
INTRODUCTION
|
| 28 |
+
Cells in our body have different shapes depending on their function, and they control their shapes by exerting
|
| 29 |
+
forces on the flexible plasma membrane [1]. These forces are mostly due to the underlying cytoskeleton, dominated
|
| 30 |
+
by the cortical actin network. The actin polymerization near the membrane exerts protrusive forces that can give
|
| 31 |
+
rise to cellular protrusions, such as filopodia and lamellipodia [2]. The control of the actin polymerization in space
|
| 32 |
+
and time is provided by a host of proteins that nucleate actin polymerization where and when it is needed, and
|
| 33 |
+
are in turn controlled by different signalling cascades. One mechanism for controlling the spatial pattern of actin
|
| 34 |
+
polymerization on the membrane, is to couple the actin nucleation to curved membrane components (CMCs), that are
|
| 35 |
+
both bending locally the membrane and are sensitive to the local membrane curvature (such as BAR domain proteins
|
| 36 |
+
[3]). This coupling was shown theoretically to give rise to positive and negative feedbacks [4], that can result in pattern
|
| 37 |
+
formation in both the spatial distribution of the actin nucleators (recruited by the CMCs) and the membrane shape.
|
| 38 |
+
This coupling between curvature and active protrusive forces was explored for a limited regime of parameters in [5].
|
| 39 |
+
Experimental evidence for this coupling between CMC and protrusive forces has been accumulated in the context of
|
| 40 |
+
lamellipodia [6, 7] and filopodia [8–14] formation.
|
| 41 |
+
A summary of the vesicle shapes that we found in [5] are shown in Fig.1, explored as function of temperature and
|
| 42 |
+
CMC density (Fig.1A). The main phases which were identified are [15]:
|
| 43 |
+
• Diffused CMC-gas phase, where CMC are dispersed as entropy dominates over bending and binding energies.
|
| 44 |
+
• Budded phase, where binding and bending leads to CMC forming hemispherical clusters at the CMC spontaneous
|
| 45 |
+
curvature.
|
| 46 |
+
• Flattened ”pancake” phase, where the active forces push the CMC outwards, leading to a large CMC cluster along
|
| 47 |
+
the rim, with two flat bare membrane disc regions. Low temperature is required to prevent lateral membrane
|
| 48 |
+
fluctuations and thermal diffusion of the CMC from breaking up the rim cluster.
|
| 49 |
+
The pancake phase is quite dynamic, and tends to form ”ruffles” along the edges. With insufficient density of CMC,
|
| 50 |
+
there is a ”two-arc” phase with multiple flat edges connected by elongated membrane (Fig.1B). If the CMC density if
|
| 51 |
+
high, the excess CMC form pearled structures along the rim of the pancake (Fig.1C).
|
| 52 |
+
arXiv:2301.13055v1 [cond-mat.soft] 30 Jan 2023
|
| 53 |
+
|
| 54 |
+
2
|
| 55 |
+
When the active force is weak or zero (passive CMC), at low temperatures the system is phase-separated into
|
| 56 |
+
energy-minimizing ”pearled necklace” of CMC clusters, each at the CMC spontaneous curvature (Fig.1D). When the
|
| 57 |
+
force is strong and the CMC have low spontaneous curvature (flat), there is a phase of highly elongated ”tubular”
|
| 58 |
+
vesicles, where CMC caps apply large forces that pull membrane tethers (tubular protrusions) (fig.1E).
|
| 59 |
+
Here we expand the analysis of the coupling between the spontaneous curvature of the CMC and protrusive forces,
|
| 60 |
+
by exploring the patterns that form as function of the natural parameters that the cell can manipulate, such as the
|
| 61 |
+
strength of the actin-driven force, the binding strength between the CMCs and the spontaneous curvature of the
|
| 62 |
+
CMCs. By gaining a fuller understanding of the space of shapes that this coupling can produce, we are able to explore
|
| 63 |
+
two more complex configurations: a mixture of two CMCs of different intrinsic curvatures, and CMCs that induce
|
| 64 |
+
aligned active forces which model the effects of actin bundling[16]. These more complex systems, can be compared to
|
| 65 |
+
important biological phenomena, such as endocytosis[17] and filopodia.
|
| 66 |
+
II.
|
| 67 |
+
THE MODEL
|
| 68 |
+
We follow the same coarse-grained continuum model used previously [5] and [18], where the physics of the cell shape
|
| 69 |
+
is described by differential geometry and very few energy components [1, 19]. The lipid bilayer membrane is modeled
|
| 70 |
+
as a 2D flexible sheet, with zero spontaneous curvature, except where there are CMCs. Each CMC on the membrane
|
| 71 |
+
surface represents a complex of proteins that have a specific spontaneous curvature. The energy of the surface is
|
| 72 |
+
modeled by the Helfrich hamiltonian
|
| 73 |
+
Hbending =
|
| 74 |
+
��
|
| 75 |
+
κ
|
| 76 |
+
2 (C1 + C2 − C0φ)2
|
| 77 |
+
(1)
|
| 78 |
+
which penalizes deviation of the shape, given by the local curvatures C1 and C2, from a preferred local shape, determined
|
| 79 |
+
by the CMC relative lateral density φ and the CMC’s preferred membrane curvature C0. To simulate, we discretize
|
| 80 |
+
the system as a closed vesicle described by a graph V, E (vertices and edges respectively) with vertices representing
|
| 81 |
+
small area patches of either bare lipid bilayer or CMC. Note that the simulation does not have an intrinsic length
|
| 82 |
+
scale, however the edge length has to represent lengths larger than tens of nanometers for the coarse-grained model to
|
| 83 |
+
be physically valid. We therefore obtain the following discretized energy
|
| 84 |
+
E =
|
| 85 |
+
�
|
| 86 |
+
i∈V
|
| 87 |
+
κ
|
| 88 |
+
2 (2h(i) − ρiC0)2 A(i) +
|
| 89 |
+
�
|
| 90 |
+
⟨i,j⟩∈E
|
| 91 |
+
−wρiρj +
|
| 92 |
+
�
|
| 93 |
+
i∈V
|
| 94 |
+
wad θ (zi − z0)
|
| 95 |
+
(2)
|
| 96 |
+
where ρi = 1 for a CMC vertex and ρi = 0 for a bare vertex, such that the overall density of CMC is given by
|
| 97 |
+
ρ = �
|
| 98 |
+
i∈V ρi/N, where N = 4502 is the total number of vertices in our simulations. The first term is a discretized
|
| 99 |
+
version of the bending energy (Eq.1), κ is the bending modulus, h(i) is the mean curvature calculated at each vertex
|
| 100 |
+
h = (C1 + C2)/2, C0 is the spontaneous curvature of a CMC, and A(i) is the area assigned to the vertex. The second
|
| 101 |
+
term is the CMC-CMC nearest-neighbor binding energy, going over the edges ⟨i, j⟩, where w is the binding energy per
|
| 102 |
+
bond. The third term is adhesion energy of the membrane to a flat rigid surface located at z = z0, which applies to
|
| 103 |
+
all the nodes that are within a distance of ℓmin from this surface. The membrane is prevented from moving below
|
| 104 |
+
z0 − ℓmin.
|
| 105 |
+
This energy model is used in a Monte-Carlo (MC) simulation Trisurf-ng, described in [5], where random movement
|
| 106 |
+
of vertices and bond flips of edges are accepted if they lower the energy or according to a Boltzmann probability:
|
| 107 |
+
P = exp (−∆E − Wi) where Wi represents the work done by the active forces on each node that contains a CMC, as
|
| 108 |
+
follows
|
| 109 |
+
Wi = −f ˆn(i) · δ⃗xi
|
| 110 |
+
(3)
|
| 111 |
+
where ˆn(i) is the local outwards normal unit vector, and δ⃗xi is the vertex displacement.
|
| 112 |
+
The shift in the locations of the vertices are limited such that the length of each edge remains within this range:
|
| 113 |
+
ℓmin < ℓ < ℓmax. The edge length and adhesion surface constraints are enforced by rejecting any MC moves which
|
| 114 |
+
violate them. In a passive system this would lead to thermal equilibrium, but the active work term is unbounded
|
| 115 |
+
from below, so the system is out of equilibrium. The MC simulation does not have time-scale, as it does not include
|
| 116 |
+
the hydrodynamic flows and dissipative processes that determine the relaxation time-scales of the membrane shape
|
| 117 |
+
changes. It does allow us to follow the shape dynamics by evolving the system along decreasing energy gradients, so
|
| 118 |
+
the trajectory in shape space is correctly described.
|
| 119 |
+
The parameters in the model, used in this paper, are given in table I. All the energies in the model are in units of
|
| 120 |
+
kBT (κ, w), while the external force f is in units of kBT/ℓmin.
|
| 121 |
+
|
| 122 |
+
3
|
| 123 |
+
In addition, we implement optional models of inhibition of the force on the CMC by neighbors, based on [20] which
|
| 124 |
+
shows different protein species can inhibit the activity of polymerization, inhibiting the actin recruitment and thus
|
| 125 |
+
force on the CMCs. We implement a proportional inhibition, where an active (1) and inhibiting (2) CMC species exist
|
| 126 |
+
f prop
|
| 127 |
+
i
|
| 128 |
+
= f
|
| 129 |
+
1
|
| 130 |
+
Nneighbors
|
| 131 |
+
�
|
| 132 |
+
⟨i,j⟩
|
| 133 |
+
�
|
| 134 |
+
1 − ρ(2)
|
| 135 |
+
j
|
| 136 |
+
�
|
| 137 |
+
(4)
|
| 138 |
+
We also implement a disabling inhibition, where any inhibiting CMC species completely disables the force on it’s
|
| 139 |
+
neighbors.
|
| 140 |
+
f dis
|
| 141 |
+
i
|
| 142 |
+
= f
|
| 143 |
+
�
|
| 144 |
+
⟨i,j⟩
|
| 145 |
+
�
|
| 146 |
+
1 − ρ(2)
|
| 147 |
+
j
|
| 148 |
+
�
|
| 149 |
+
(5)
|
| 150 |
+
In biological filopodia, the actin filament are known to bundle by cross-lining proteins [21]. Our model does not
|
| 151 |
+
have a true representation of the cytoskeleton structure, but we can simulate this bundling by adding an alignment to
|
| 152 |
+
the force on the active CMCs, since the shared internal actin bundle would apply a force in the same direction. This is
|
| 153 |
+
added as an Vicsek-like interaction [22]
|
| 154 |
+
ˆf = ˆni + s �
|
| 155 |
+
r ˆnj
|
| 156 |
+
|ˆni + s �
|
| 157 |
+
r ˆnj|
|
| 158 |
+
(6)
|
| 159 |
+
The direction of force on CMC vertex i ˆfi is a weighted average of the normal direction plus a contribution from all the
|
| 160 |
+
vertices j a distance r from the vertex i with a weight of s, normalized. This replaces the ˆn(i) term in the work term
|
| 161 |
+
i.e. the unmediated local normal. This is superficially similar to the normal Vicsek model [22], where self-propelled
|
| 162 |
+
particles similarly align their direction with neighbors, producing flocking behavior, but here the CMCs/particles are
|
| 163 |
+
connected to each other and embedded in a 2D flexible sheet, and we use force in a MC simulation instead of velocity
|
| 164 |
+
in a Langevin simulation.
|
| 165 |
+
III.
|
| 166 |
+
MATERIALS AND METHODS
|
| 167 |
+
A.
|
| 168 |
+
Computational Methods
|
| 169 |
+
The simulations were run using trisurf-ng [5] version fb86a41 (”Modeled trisurf” branch) (see X) with a tape file
|
| 170 |
+
modified from the available default with the different physical parameters (see I), and additional simulation running
|
| 171 |
+
parameters of nshell=30, mcsweeps=50,000-200,000, iterations=100-1,000 (depending on the desired time resolution).
|
| 172 |
+
Each simulation with a set of parameters was ran independently (”embarrassingly parallel”), which took about two
|
| 173 |
+
weeks to finish, with occasional restarts and expansion of the space limits (nxmax). The resulting VTU files were
|
| 174 |
+
viewed and colored in ParaView, but further analysis and graph generation were done by separate python scripts.
|
| 175 |
+
B.
|
| 176 |
+
Experimental Methods
|
| 177 |
+
The cell culture and lattice light sheet microscopic observation U-251 cells were obtained from the Japanese Collection
|
| 178 |
+
of Research Bioresources Cell Bank. The IRSp53 knockout (KO) cells were generated by the CRISPR/Cas9 system, as
|
| 179 |
+
described previously [23]. The guide RNA targeting the first exon of IRSp53 (CCATGGCGATGAAGTTCCGG) was
|
| 180 |
+
designed using the server http://crispr.mit.edu and inserted into the pX330 vector [23]. After transfection, the cells
|
| 181 |
+
were cloned by monitoring the GFP fluorescence from the reporter plasmid pCAG-EGxxFP with the IRSp53 genome
|
| 182 |
+
fragment using a fluorescence-activated cell sorter [FACSAria (BD)] [24]. The expression of GFP or GFP-IRSp53
|
| 183 |
+
in the IRSp53 knockout cells was performed by the retrovirus-mediated gene transfer, as described previously [24].
|
| 184 |
+
All cell lines were cultured in high glucose DMEM (Thermo Fisher Scientific) supplemented with 10% bovine calf
|
| 185 |
+
serum (Thermo Fischer Scientific) and 1% penicillin-streptomycin solution (Thermo Fischer Scientific) and stored in
|
| 186 |
+
an incubator at 37oC in 5% CO2 and humidified conditions. The cells were seeded on coverslips and then imaged with
|
| 187 |
+
the Lattice light-sheet microscope built in the Mimori-Kiyosue laboratory at RIKEN Center for Biosystems Dynamics
|
| 188 |
+
Research following the design of the Betzig laboratory [25] as described previously [26].
|
| 189 |
+
|
| 190 |
+
4
|
| 191 |
+
IV.
|
| 192 |
+
FORCE-BINDING STRENGTH PHASE DIAGRAM
|
| 193 |
+
In [5] the phases of the vesicle with active CMC, were mostly explored as function of temperature and global density
|
| 194 |
+
of CMC. However, the cell can more easily modify other parameters, such as the strength of the protrusive forces
|
| 195 |
+
produced by actin polymerization and the binding strength between neighboring CMC. The rate of actin polymerization
|
| 196 |
+
recruited to the CMC can be controlled by the cell through various proteins [27–29]. The effective binding strength
|
| 197 |
+
between the neighboring CMC can similarly depend on the lateral concentration and character of the proteins that
|
| 198 |
+
form the CMC [7], as well as on the type of lipids between the CMC [30]. The cell can modify these internal parameters
|
| 199 |
+
spontaneously or in response to external signals.
|
| 200 |
+
We scan over the force f and binding strength w parameters plane (Fig.2A), with the other parameters of the model
|
| 201 |
+
having the following constant values: The bending modulus is taken to be κ = 20KBT, which is a typical value for
|
| 202 |
+
lipid bilayers. The spontaneous curvature of the CMC is taken to be C0 = 1ℓ−1
|
| 203 |
+
min, representing highly curved objects on
|
| 204 |
+
the membrane. The CMC density is ρ = 10%, which is sufficient to form the pancake shapes that require a complete
|
| 205 |
+
circular cluster of CMC along the vesicle rim [5].
|
| 206 |
+
We find that the simulated vesicles can be divided into several distinct phases: gas phase, budded phase, pancake
|
| 207 |
+
phase, and pearling phase. In addition there are more ambiguous, and possibly transient, elongated and mixed phases
|
| 208 |
+
(Fig.2A). In order to distinguish between these phases, we use four measures that characterize the vesicle shape and
|
| 209 |
+
the CMC cluster organization:
|
| 210 |
+
• Mean cluster size ⟨N⟩
|
| 211 |
+
• 1st eigenvalue of the Gyration tensor λ2
|
| 212 |
+
1
|
| 213 |
+
• 2nd eigenvalue of the Gyration tensor λ2
|
| 214 |
+
2
|
| 215 |
+
• Length of CMC-bare membrane boundary ℓp
|
| 216 |
+
The mean cluster size is averaged over all the CMC clusters, each cluster i having a size Ni of vertices
|
| 217 |
+
⟨N⟩ =
|
| 218 |
+
�
|
| 219 |
+
i Ni
|
| 220 |
+
�
|
| 221 |
+
i 1 = Nvertex
|
| 222 |
+
Nclusters
|
| 223 |
+
We plot this measure (Fig.2B), extracted after the simulation reaches its steady-state regime, where the measures do
|
| 224 |
+
not change on average (see SI). we see that it allows to clearly distinguish the gas phase, which has small cluster sizes
|
| 225 |
+
(yellow line in Fig.2A denotes ⟨N⟩ = 1.5). However, it is rather poor at separating the condensed phases, which all
|
| 226 |
+
have large clusters but differ greatly in their morphology and cluster organization. This is due to the dependence
|
| 227 |
+
of this measure on the number of clusters, which gives large weight to small single-vertex clusters. This makes this
|
| 228 |
+
measure too noisy to distinguish between the other phases, except for the gas phase which mostly contains single-vertex
|
| 229 |
+
clusters.
|
| 230 |
+
We therefore use morphological measures in order to clearly distinguish between the different phases where the
|
| 231 |
+
CMCs are condensed in large clusters. The morphology of the vesicle is quantified by the eigenvalues of the gyration
|
| 232 |
+
tensor λ2
|
| 233 |
+
i . The gyration tensor [31] is defined as the average over all the vertices, with respect to the center of mass
|
| 234 |
+
(similar to the moment of inertia tensor for equal-mass vertices)
|
| 235 |
+
RG ij = ⟨rirj⟩ = 1
|
| 236 |
+
N
|
| 237 |
+
�
|
| 238 |
+
vertices
|
| 239 |
+
�
|
| 240 |
+
�
|
| 241 |
+
x2 xy xz
|
| 242 |
+
xy y2 yz
|
| 243 |
+
zx yz z2
|
| 244 |
+
�
|
| 245 |
+
�
|
| 246 |
+
This can be visualized by a unique ellipsoid which has the same gyration tensor
|
| 247 |
+
xT R−1
|
| 248 |
+
G x = (x · e1)2
|
| 249 |
+
λ2
|
| 250 |
+
1
|
| 251 |
+
+ (x · e2)2
|
| 252 |
+
λ2
|
| 253 |
+
2
|
| 254 |
+
+ (x · e3)2
|
| 255 |
+
λ2
|
| 256 |
+
1
|
| 257 |
+
= 3
|
| 258 |
+
The eigenvectors ei of the gyration tensor are the directions of the semi-axes of the equivalent ellipsoid and the
|
| 259 |
+
eigenvalues are their length squared divided by 3, ordered by their size: λ2
|
| 260 |
+
1 ≤ λ2
|
| 261 |
+
2 ≤ λ2
|
| 262 |
+
3. The first eigenvalue λ1
|
| 263 |
+
essentially gives how thin is the ellipsoid, and is low for both pancake and highly elongated (linear) shapes. The
|
| 264 |
+
second eigenvalue λ2 is large for the pancake shape (as it is roughly equal to the largest eigenvalue λ2 ∼ λ3), but is
|
| 265 |
+
minimized for elongated shapes, where it similar to the value of the smallest eigenvalue, λ2 ∼ λ1. In Fig.2C,d we plot
|
| 266 |
+
the eigenvalues λ2
|
| 267 |
+
1, λ2
|
| 268 |
+
2, respectively. We find that the phase of pancake shapes is distinguished by the lowest λ2
|
| 269 |
+
1 (green
|
| 270 |
+
and dashed green-light blue lines in Fig.2A), indicating its flatness.
|
| 271 |
+
|
| 272 |
+
5
|
| 273 |
+
We identify a new phase of elongated shapes, which is distinguished by the lowest values of λ2
|
| 274 |
+
2 (between the light
|
| 275 |
+
blue and dashed green-light blue lines in Fig.2A). These elongated phases are somewhat similar to the ”two-arc” phase
|
| 276 |
+
found in [5], which appeared when there are not enough CMCs to form a complete circular cluster along the flat vesicle
|
| 277 |
+
rim. However, here we do have enough CMC to form a complete circular cluster, as shown in the ”flat” regime. The
|
| 278 |
+
origin of the elongated shapes as w increases beyond the ”flat” phase is due to the formation of transient or stable
|
| 279 |
+
pearling clusters. These cluster effectively sequester enough CMC to prevent the formation of the complete circular
|
| 280 |
+
cluster, leading to two curved regions that collect the CMC and stretch the vesicle due to the active forces. The CMC
|
| 281 |
+
clusters have the shape of flat arcs near the boundary with the ”flat” phase, while closer to the ”pearling” phase the
|
| 282 |
+
clusters are pearled and localized near the curved tips of the vesicle.
|
| 283 |
+
While the ”core” of the phases distinguished by λ2
|
| 284 |
+
1,2 is clear, the edges are much less sharp, due to lack of statistics,
|
| 285 |
+
long evolution time, and the fact that intermediate shapes do exist. There is also no obvious normalization: The
|
| 286 |
+
volume changes greatly, and the area is only approximately conserved. For our Nvertex = 4,502 The flat phase is found
|
| 287 |
+
around λ2
|
| 288 |
+
1 < 50, and the elongated phases is found around 80 < λ2
|
| 289 |
+
2 < 150.
|
| 290 |
+
Finally, we wish to distinguish the phases where the CMCs form pearled clusters. The most outstanding property of
|
| 291 |
+
the pearled clusters is that they phase-separate between the CMC and the bare membrane, as also predicted within
|
| 292 |
+
the theory of self-assembly [5]. We therefore measure the average length of the CMC-bare membrane boundary ¯ℓp, per
|
| 293 |
+
CMC, for all clusters larger than 1 (see SI section 1, Fig.S1)
|
| 294 |
+
¯ℓp =
|
| 295 |
+
�ℓpi
|
| 296 |
+
Ni
|
| 297 |
+
�
|
| 298 |
+
Ni>1
|
| 299 |
+
The phase with pearling clusters is distinguished by having very low ¯ℓp < 0.375 (Fig.2E). We find that this measure
|
| 300 |
+
identifies the pearled clusters both in the pearling and in the elongated phases (red dotted line in Fig.2A). In addition,
|
| 301 |
+
a contour of this measure allows us to separate the mixed phase, where the CMC are in both buds and pearled clusters,
|
| 302 |
+
from the phase that contains only buds (red solid line ¯ℓp <= 1.875 in Fig.2A,E).
|
| 303 |
+
Note that we do not know if these phases are necessarily the absolute steady-states of the system in the limit of
|
| 304 |
+
infinite time. The system might be trapped in a local meta-stable configuration due to dynamical barriers that would
|
| 305 |
+
require unreasonably long simulations for them to escape. For example, in the regime of low force f and large binding
|
| 306 |
+
strength w, the global minimum energy configuration should have all the CMC in a single pearled cluster, but during
|
| 307 |
+
the merging of the pearled clusters into a single cluster they have to overcome bending energy barriers that hinder this
|
| 308 |
+
process [32]. In other regimes, such as the elongated phase, we do not know if a stationary steady-state even exists,
|
| 309 |
+
since the presence of active forces may induce a constantly changing configurations. In the SI section 2 we give a
|
| 310 |
+
simple analytic calculation that gives reasonably well the transition line between the pearled and flat phases, which
|
| 311 |
+
are the main stable condensed phases in this phase diagram (Figs.S2,S3).
|
| 312 |
+
The evolution of a handful of chosen simulations are shown in Fig.3, showing flat, elongated-flat, elongated-pearling,
|
| 313 |
+
and pearling phases. All the simulations begin in a disordered uniform distribution of the CMC on the spherical vesicle,
|
| 314 |
+
but in all of them we find that buds form rather quickly (Fig.3B(i)-E(i)). In the budded phase this configuration
|
| 315 |
+
simply remains stable and does not evolve significantly. It takes longer time for the larger clusters of the flat rim, arcs
|
| 316 |
+
and pearls to form. The transition lines separating two different vesicle phases, obtained from our simulations, are not
|
| 317 |
+
precise, and one can obtain either one of the vesicle shapes close to these lines (Fig.3A).
|
| 318 |
+
To conclude, by exploring the f − w phase diagram, we demonstrate the competition between the protein binding
|
| 319 |
+
which drives the formation of pearled clusters, and the active force that drives the formation of arc-like clusters at
|
| 320 |
+
the edge of flat protrusion. This competition is highlighted in the new phases of vesicle morphologies that we found,
|
| 321 |
+
namely the elongated two-arcs and the elongated-pearled phases. The pearling phase appears for large enough values
|
| 322 |
+
of w, as follows also from the theory of self-assembly [5].
|
| 323 |
+
V.
|
| 324 |
+
FORCE-SPONTANEOUS CURVATURE PHASE DIAGRAM
|
| 325 |
+
We now proceed to explore the interplay between the active force and the spontaneous curvature of the CMC in
|
| 326 |
+
determining the morphology of the vesicle. We chose the parameters for a new set of simulations such that we are in
|
| 327 |
+
the flat phase when the CMC are highly curved: ρ = 20%, κ = 28.5, w = 2. The resulting phase diagram is shown in
|
| 328 |
+
Fig4A.
|
| 329 |
+
We find several phases: budded phase, flat phase, elongated (arcs) phase and highly-elongated (tubes) phase. Here
|
| 330 |
+
the boundaries between the different phases were drawn by eye, due to relative sparse scan over the parameters, and the
|
| 331 |
+
self-evident boundaries (Fig.4A). In this parameter regime, we do not find any pearled phase, with the budded phase
|
| 332 |
+
remaining stable due to the bending energy barrier that prevents buds merging (note that the bending modulus is
|
| 333 |
+
larger here), and lower relative w. Similar to the force-binding strength system (Fig.2A), where the budded and pearled
|
| 334 |
+
|
| 335 |
+
6
|
| 336 |
+
phases exist for low active force, we also find that as the active force is increased the budded phase is destabilized to
|
| 337 |
+
form the flat phase (Fig.4A).
|
| 338 |
+
The flat phase is destabilized as the spontaneous curvature decreases due to the following mechanism: as C0 decreases
|
| 339 |
+
the thickness of the rim cluster increases, which means that there are not enough CMC to complete a circular cluster
|
| 340 |
+
around the edge of the flat shape. The morphology then changes into local arc-like clusters that pull the vesicle into
|
| 341 |
+
elongated shapes. The elongation of these vesicles depends on the magnitude of the active force.
|
| 342 |
+
The main feature of this phase diagram is the appearance of the highly-elongated tubular phase, where the entire
|
| 343 |
+
vesicle is stretch into a several tubes that are pulled by CMC clusters at their tips. We can theoretically estimate
|
| 344 |
+
the location of the phase transition line, above which a vesicle will become highly-elongated, by comparing the force
|
| 345 |
+
exerted by the active CMC cluster and the restoring force of the emerging membrane tube due to bending (Fig.4B).
|
| 346 |
+
A hemispherical CMC cap with radius r = 2/C0 minimizes the bending energy (Eq.1): E ∝
|
| 347 |
+
�
|
| 348 |
+
1
|
| 349 |
+
r1 + 1
|
| 350 |
+
r2 − C0
|
| 351 |
+
�2
|
| 352 |
+
, and
|
| 353 |
+
maximizes the pulling force (since adding any more CMCs to the cluster, beyond the hemisphere, adds force in the
|
| 354 |
+
opposite direction). The total pulling force of this hemispherical cluster is given by
|
| 355 |
+
Fpull = f ·
|
| 356 |
+
1
|
| 357 |
+
2
|
| 358 |
+
����
|
| 359 |
+
geometry
|
| 360 |
+
· 2π(2/C0)2
|
| 361 |
+
s0
|
| 362 |
+
�
|
| 363 |
+
��
|
| 364 |
+
�
|
| 365 |
+
#vertices
|
| 366 |
+
(7)
|
| 367 |
+
where s0 is the area per vertex, and 2πr2/s0 is the number of CMC in the cluster. This hemispherical cap pulls a tube
|
| 368 |
+
with the same radius from the main vesicle body. Note the extra factor of 1/2 due to the hemispherical shape of the
|
| 369 |
+
cup, compared to the calculation done for a flat cluster of active proteins in [5].
|
| 370 |
+
Assuming the restoring force is dominated by the bending energy of the membrane tube, it is given by (Eq.1) [5]
|
| 371 |
+
Frestore = κ
|
| 372 |
+
2
|
| 373 |
+
2π
|
| 374 |
+
(2/C0)
|
| 375 |
+
(8)
|
| 376 |
+
The highly elongated shape is initiated when the pulling force is greater than this restoring force, so the critical value
|
| 377 |
+
is given by equating Eqs.7,8, which gives
|
| 378 |
+
f = AC3
|
| 379 |
+
0
|
| 380 |
+
(9)
|
| 381 |
+
where A is a constant determined by the constant parameters of the simulation (bending modulus and average area
|
| 382 |
+
per vertex). Plotting this simple cubic relation in Fig.4A (blue solid line, where we fit the value of A), shows a good
|
| 383 |
+
agreement with the observed boundary of the regime of the highly-elongated tubular shapes on the phase diagram.
|
| 384 |
+
Note however that the shapes of the vesicles at the transition to the tubular phase are not always simple cylindrical
|
| 385 |
+
tubes with hemispherical clusters at their tips (Fig.4A), as the analytic model assumes (Fig.4B).
|
| 386 |
+
To conclude this section, we have shown that active CMC give rise to flat protrusions when they are highly curved.
|
| 387 |
+
Tubular protrusions can form for weakly curved active CMC, while for highly curved CMC the active force needed
|
| 388 |
+
to produce such slender protrusions increases extremely fast. In the next sections we explore how slender tubular
|
| 389 |
+
protrusions can be produced with highly curved active proteins, by either changing the effective curvature of the CMC
|
| 390 |
+
cluster, or by increasing the effective pulling force of the cluster.
|
| 391 |
+
VI.
|
| 392 |
+
MULTIPLE CURVATURE
|
| 393 |
+
Real cells have many species of membrane protein of both convex and concave intrinsic curvature. While these
|
| 394 |
+
membrane proteins have distinct curvatures, the effective curvature of a cluster of CMC may depend on the composition
|
| 395 |
+
of the cluster, if it contains CMC of different spontaneous curvatures. In order to form clusters of mixed curvatures,
|
| 396 |
+
we explore vesicles that contain CMC of different curvatures (concave and convex), that bind to each other equally. If
|
| 397 |
+
the two CMC types bind only to their own kind, they form separate clusters on the vesicle, and their coupling with
|
| 398 |
+
each other due to curvature alone is rather weak (see SI). The convex CMC maintain their activity, as in the previous
|
| 399 |
+
sections, while the concave CMC is passive.
|
| 400 |
+
In Fig.4C(i) we show snapshots of the steady-state shapes of the vesicles that contain 10% passive concave CMC, i.e.
|
| 401 |
+
a CMC species with C−
|
| 402 |
+
0 < 0 and f − = 0, in addition to convex CMCs (ρ+ = 10%, f = 0.5, and C+
|
| 403 |
+
0 = 0.8). Both
|
| 404 |
+
types of CMC have the same binding strength w = 2, which binds both types equally, leading to strong mixing of the
|
| 405 |
+
two CMC types. For weakly curved concave CMC (C−
|
| 406 |
+
0 = −0.001) the flat phase remains stable (Fig.4C(i6)), driven by
|
| 407 |
+
the convex active CMC. As the concave CMC become more curved (Fig.4C(i) from right to left) the circular cluster at
|
| 408 |
+
the rim of the flat shape breaks up, and highly elongated shapes appear (Fig.4C(i2,i3)).
|
| 409 |
+
|
| 410 |
+
7
|
| 411 |
+
These shapes can be explained by mapping the vesicles in Fig.4C(i) on the phase diagram (Fig.4A). For each
|
| 412 |
+
simulation, we calculate the average spontaneous curvature of the CMC clusters: C0,eff =
|
| 413 |
+
�
|
| 414 |
+
C+
|
| 415 |
+
0 + C−
|
| 416 |
+
0
|
| 417 |
+
�
|
| 418 |
+
/2, as well as
|
| 419 |
+
the average pulling force per CMC: feff = f/2. In Fig.4D we plot the typical dashed outline of the vesicles from
|
| 420 |
+
Fig.4C(i) on the phase diagram according to these effective parameters C0,eff, feff. Most vesicles match the shape
|
| 421 |
+
of the phase to which they are mapped in this way. The only exception is the vesicle with the most concave CMCs
|
| 422 |
+
(and effective C0,eff = 0), which is not in the shape of highly-elongated tubes, as suggested by the calculated average
|
| 423 |
+
parameters, but fits better the arcs phase. This phenomena is due to the concave CMCs phase-separating into internal
|
| 424 |
+
”sacks” of concave-enriched clusters (Fig. 5Ai), which results in an effective removal of these concave CMC from
|
| 425 |
+
determining the outer shape of the vesicle. To take this into account, we calculate the effective mean curvature of the
|
| 426 |
+
CMCs while removing the concave CMC that are contained in the internalized sacks. This is done by including in the
|
| 427 |
+
calculation of the average curvature only concave CMCs which are connected to at least one convex CMC. Using this
|
| 428 |
+
revised average spontaneous curvature, we plot the locations of the vesicles on the phase diagram (full snapshots),
|
| 429 |
+
and find that except for the most curved concave CMC (A1), the locations of the other vesicles is minimally affected.
|
| 430 |
+
For the case A1, we find that indeed the formations of large sacks of concave CMC, push the vesicle into the arcs
|
| 431 |
+
regime, compatible with its revised location on the phase diagram. The phase separation of the passive concave CMC
|
| 432 |
+
into sacks is driven by the minimization of the total bending energy. The highly elongated tubes cost a high bending
|
| 433 |
+
energy of the bare membrane: in Fig.4C(i2) the average bending energy of the bare membrane is ∼ 25KBT, while in
|
| 434 |
+
the flatter shapes after the phase separation (Fig.4C(i1)) the average bending energy of the bare membrane drops to
|
| 435 |
+
∼ 17KBT.
|
| 436 |
+
In addition to the overall vesicle shape in the system of mixed curvatures, we are interested in the character of the
|
| 437 |
+
CMC clusters. We find that concave and convex CMCs create complex mixed clusters with a ”coral”- or ”sponge”-like
|
| 438 |
+
texture (Fig.4C and close up in Fig. 5Aii). The texture of these clusters seems similar to the membrane ruffles observed
|
| 439 |
+
in [20] behind the leading edge of motile cells. In this work, the ruffles were attributed to the interaction between
|
| 440 |
+
concave and convex membrane proteins, that are also involved in the recruitment of the actin polymerization. It was
|
| 441 |
+
furthermore proposed in [20] that the pattern of ruffles observed in these cells is determined by the interaction between
|
| 442 |
+
a concave membrane protein that inhibits the actin polymerization, which is recruited by the convex CMC. Motivated
|
| 443 |
+
by this proposed mechanism, we explored the resulting shapes of the vesicle and CMC clusters when the concave
|
| 444 |
+
CMCs inhibit the active force exerted by the convex CMCs. We tested two possibilities: inhibition that is proportional
|
| 445 |
+
to the number of concave neighbors (Eq.4, Fig. 4C(ii)), and full inhibition with even one concave neighbor (Eq.5, Fig.
|
| 446 |
+
4C(iii)). In both cases we find that the effective force is reduced, and that the resulting shapes correspond very well to
|
| 447 |
+
their locations on the phase diagram (Fig.4D). The shapes obtained for full inhibition (Fig. 4C(iii)) are very similar
|
| 448 |
+
to those for a vesicle with a mixture of passive CMC (see SI section 3, Fig.S4). Regarding the comparison with the
|
| 449 |
+
experiments [20], we conclude from the model that the ruffle texture of the CMC clusters does not crucially depend
|
| 450 |
+
on the inhibitory interaction between the two CMC types, but rather on their spontaneous curvatures and binding
|
| 451 |
+
interaction.
|
| 452 |
+
Let us now focus on the phase-separated sacks of highly curved concave CMC, which form within the mixed clusters
|
| 453 |
+
(Fig.5). We observed that the neck that connects the sacks to the outer part of the cluster is much narrower when
|
| 454 |
+
the convex CMC exert outwards protrusive forces (compare Fig.5(Aii) and (Cii)). We quantified the area of the
|
| 455 |
+
narrowest part of the neck in Fig.5B,D for the active and passive convex CMC, respectively. The necks are naturally
|
| 456 |
+
narrower for more highly curved concave CMC. The active convex CMC, which push the membrane outwards, exert
|
| 457 |
+
an effective pressure force that squeezes the neck into a narrower radius. Note that for the narrowest necks, we are
|
| 458 |
+
clearly at the limit of the spatial resolution of the simulation. We do not allow membrane fission, and therefore can
|
| 459 |
+
not describe the process of detachment of such sacks as internalized vesicles [33], as occurs in cells during endocytosis
|
| 460 |
+
and macropinocytosis [34].
|
| 461 |
+
In Fig.5E,F we show the dynamics of the cluster formation, whereby a patch of passive concave CMC (blues) increase
|
| 462 |
+
in size, while its rim is populated by active convex CMC (red). In these images the surrounding bare membrane is
|
| 463 |
+
rendered to be invisible. These simulated dynamics resemble those calculated by another model of macropinocytic
|
| 464 |
+
cups [35], which was based on reaction-diffusion dynamics coupled to active forces.
|
| 465 |
+
Finally, when the two CMC types bind exclusively to their own kind, they form separate clusters, with very limited
|
| 466 |
+
coupling between them (see SI section 4, Fig.S5).
|
| 467 |
+
VII.
|
| 468 |
+
FORCE ALIGNMENT
|
| 469 |
+
As we show in Fig.4A, when the highly curved CMC induce a protrusive force that is directed at the outwards
|
| 470 |
+
normal, we require an extremely large force in order for the highly elongated tubes to form. However, cells initiate
|
| 471 |
+
slender, tube-like filopodia protrusions using highly curved membrane proteins, such as IRsp53 [8–10, 12–14], in
|
| 472 |
+
agreement with theoretical calculations [36]. Within the slender filopodia in cells, the actin filaments are organized into
|
| 473 |
+
|
| 474 |
+
8
|
| 475 |
+
a cross-linked bundle, which efficiently directs the forces of all the polymerizing actin filaments along the protrusion’s
|
| 476 |
+
axis. The actin nucleators at the tip of the filopodia are different from those at the leading edge of the flat lamellipodia
|
| 477 |
+
[14, 21, 37], and initiate the growth of parallel actin filaments that form the bundle at the filopodia core. In our model,
|
| 478 |
+
since we do not explicitly describe the actin filaments organization, we can only describe the effects of the bundling on
|
| 479 |
+
the forces exerted on the membrane. To simulate this kind of bundling, we add an alignment term of a Vicsek-like
|
| 480 |
+
interaction [22], which aligns the forces exerted on the membrane by each CMC that is bound in a cluster
|
| 481 |
+
ˆfi = ˆni + s �
|
| 482 |
+
r ˆnj
|
| 483 |
+
|ˆni + s �
|
| 484 |
+
r ˆnj|
|
| 485 |
+
(10)
|
| 486 |
+
The direction of the active force exerted on each CMC vertex i, ˆfi, is a weighted average of the local outwards normal
|
| 487 |
+
direction (ˆni) and a contribution from all the vertices j within a distance r from the vertex i (and in the same connected
|
| 488 |
+
cluster), with a weight of s.
|
| 489 |
+
In Fig.6A we plot typical steady-state snapshots of the vesicle shape and CMC clusters, as function of the strength
|
| 490 |
+
and range of the alignment interaction of Eq.10. We observe a rather sharp transition from flat shapes for short-range
|
| 491 |
+
alignment (r < 10) to shapes containing thin tube-like protrusions for long-range alignment. As function of the
|
| 492 |
+
parameter s we find only weak dependence: at very small values of s and r = 10, we find that the weak alignment
|
| 493 |
+
is sufficient to increase the net pulling force of the CMC clusters, such that they break the circular rim of the flat
|
| 494 |
+
shape (Fig.4B(iii)). The resulting shape, with ”paddle”-like protrusions, resembles the ”arcs” phase we found in Fig.4
|
| 495 |
+
between the flat and tubes phases. At higher values of s this paddles phase changes to tubes, due to the stronger
|
| 496 |
+
alignment leading to a larger net pulling force.
|
| 497 |
+
At these larger interaction strength the vesicle produces thin, finger-like clusters with a small bulbous ”head” and an
|
| 498 |
+
elongated ”sleeve” (Fig.6B(ii)). This shape allows the CMC to satisfy their spontaneous curvature, with a spherical tip
|
| 499 |
+
that has a radius of rtip = 2/C0, while the sleeve has a thinner radius of rsleeve = 1/C0. Such a cluster configuration
|
| 500 |
+
is stable due to the alignment of the active forces along the tube axis (perpendicular to the membrane along the
|
| 501 |
+
sleeve, Fig.6B(ii)). Once these elongated clusters form, they exert a large pulling force on the remaining membrane,
|
| 502 |
+
thereby pulling elongated bare-membrane tubes behind them. The membrane tube can have a larger radius than the
|
| 503 |
+
radius of the tubular CMC cluster, as it balances the pulling force with the restoring force due to bending energy. The
|
| 504 |
+
alignment of the forces means that the entire CMC cluster pulls along the protrusion axis (Fig.6B(ii)), exerting a
|
| 505 |
+
much larger total force than was possible using purely normal forces at the tip, thereby forming tubes at values of
|
| 506 |
+
the force per protein that are much lower than predicted by Eq.9 and Fig.4A. Smaller clusters that only contain the
|
| 507 |
+
hemispherical tip (such as Fig.6B(i)), do not grow tube-like protrusions, even though their net pulling force is larger
|
| 508 |
+
by up to a factor of 2 compared to normal-force CMC, due to alignment (compare Fig.6B(i) to Fig.4B and Eq.7).
|
| 509 |
+
In Fig.7A we plot the time progression of a vesicle with aligned-force CMC. We observe that initially localized
|
| 510 |
+
hemispherical buds form rapidly. These buds then coalesce to form larger clusters that grow into the typical shape
|
| 511 |
+
of bulbous tip with a thinner tubular part behind it. The size and total force of each of the clusters are plotted as
|
| 512 |
+
function of time, with each point size indicating the cluster size, and its y-axis coordinate giving its total active force,
|
| 513 |
+
respectively. Note that clusters that contain patches of ”trapped” bare membrane undergo large force fluctuations
|
| 514 |
+
(blue and yellow points, largest two clusters shown on the right of Fig.7A). These fluctuations arise from loss of global
|
| 515 |
+
alignment over the entire CMC cluster, due to the bare membrane patch that allows the alignment to change, especially
|
| 516 |
+
between the protrusion tip and the tubular part.
|
| 517 |
+
In Fig.7B we compare the finger-like protrusions that form due to highly curved aligned-force CMC, with the tubular
|
| 518 |
+
shapes that form due to weakly curved normal-force CMC (Fig.4A). The main difference is that the aligned-force
|
| 519 |
+
protrusions are much more stable compared to the tubes formed by the much smaller clusters of normal-force CMC.
|
| 520 |
+
The normal-force CMC undergo frequent fission and coalescence events, that correspond to tubes shrinking and
|
| 521 |
+
regrowing. These differences in dynamics can be seen in the SI movies S1,S2.
|
| 522 |
+
VIII.
|
| 523 |
+
VESICLES WITH BOTH NORMAL AND ALIGNED-FORCE CMC, ADHERED TO A FLAT
|
| 524 |
+
SUBSTRATE
|
| 525 |
+
We simulate a vesicle with a mixture of CMCs (ρ = 5% of each type), both highly curved and convex, one type with
|
| 526 |
+
normal force and the other with strongly aligned force (r = 15, s = 1). Our initial state of the vesicle is obtained by
|
| 527 |
+
letting the vesicle spread over a flat adhesive substrate, while it contains only normal-force CMC. Then, at a time
|
| 528 |
+
where the vesicle is partially spread (time 0 in Fig.8A), we convert randomly half of the CMC to aligned-force behavior.
|
| 529 |
+
We chose an adhesion strength wad = 0.25 (Eq.2), which gives a well-spread vesicle when containing only normal-force
|
| 530 |
+
CMC [18].
|
| 531 |
+
In Fig.8A we show two simulations: one with universal binding between the normal and aligned-force CMCs, and
|
| 532 |
+
the other with exclusive binding, such that normal-normal and aligned-aligned CMC bind to their own type exclusively.
|
| 533 |
+
|
| 534 |
+
9
|
| 535 |
+
In these examples we see that the rim cluster forms and drives strong spreading of the vesicle, as expected [18]. The
|
| 536 |
+
aligned-force CMC (labeled in yellow) aggregate to form a single filopodia-like protrusion, which is able to recruit into
|
| 537 |
+
it also normal-force CMC (labeled in red). This filopodia is highly dynamic, undergoing periods of attachment to the
|
| 538 |
+
rim cluster, and to the adhesive substrate, as well as detachments from the substrate. The filopodia is observed to
|
| 539 |
+
attach and detach from the rim cluster, leading to meandering motion. When the two types bind exclusively, they
|
| 540 |
+
form segregated clusters along the rim, with the aligned-force clusters protruding slightly more outwards compared to
|
| 541 |
+
the normal-force clusters. The dynamics of this system can be seen in SI movie S3.
|
| 542 |
+
In Fig.8B we show the evolution of the segregation factor in the simulations, which is defined as
|
| 543 |
+
S = 2 · Prob (CMC neighbor is of the same type) − 1
|
| 544 |
+
(11)
|
| 545 |
+
This segregation factor is equal to 0 for well-mixed clusters (where the probability to have a neighbor CMC of the
|
| 546 |
+
same type is equal to 1/2), and it is equal to 1 for complete phase-separation of the types. In the main panels we give
|
| 547 |
+
the segregation factor per cluster for the simulations shown in Fig.8A. The insets show the average of 4 independent
|
| 548 |
+
simulations, which converge to a value of about S = 0.25 for the universal binding and S = 0.9 for the exclusive
|
| 549 |
+
binding. In the universal case, we can see that the segregation is strongest in the filopodia, so the segergation factor
|
| 550 |
+
for the large rim cluster jumps up or down, when the filopodia protrusion cluster attaches or detaches respectively.
|
| 551 |
+
The protrusion cluster is more segregated (S ≈ 0.25), since its tip is enriched with aligned-force CMCs that drive its
|
| 552 |
+
formation, while the rim cluster is nearly perfectly mixed (S ≈ 0). For the exclusive binding, the segregation is high
|
| 553 |
+
both in the filopodia protrusion and in the rim cluster, so it does not change when the filopodia attach or detach from
|
| 554 |
+
the rim.
|
| 555 |
+
Note that along the adhered vesicle rim, the regions of aligned-force CMC protrude slightly more than the normal-
|
| 556 |
+
force regions (Fig.8A, exclusive). This is enhanced when the normal-force CMC are disabled, so that they do not exert
|
| 557 |
+
any active force, as shown in Fig.S6.
|
| 558 |
+
IX.
|
| 559 |
+
COMPARISON WITH EXPERIMENTS
|
| 560 |
+
We can now compare some of our theoretical results to experimental observations, published and new.
|
| 561 |
+
A.
|
| 562 |
+
Membrane shapes driven by branched actin polymerization
|
| 563 |
+
The active protrusive forces in our model are representative of actin polymerization activity near the cell membrane.
|
| 564 |
+
When the actin polymerization is nucleated by proteins that induce branched actin networks (such as WASP, WAVE
|
| 565 |
+
[38–40]), it is more natural to describe the force as a local pressure on the membrane, which therefore acts towards the
|
| 566 |
+
outwards normal.
|
| 567 |
+
The variety of shapes we obtained in our model (Figs.2,3), range from flat lamellipodia-like shapes, to cylindrical
|
| 568 |
+
filopodia, to pearling-like protrusions. Some of these new elongated shapes can be compared with elongated global cell
|
| 569 |
+
shapes, observed in living cells [41].
|
| 570 |
+
B.
|
| 571 |
+
Membrane shapes driven by bundled actin polymerization
|
| 572 |
+
The introduction of alignment in the forces exerted by the CMC represents in our model the case of proteins that
|
| 573 |
+
nucleate parallel actin bundles, such as VASP and Formins [10, 12, 21]. Our model has demonstrated previously that
|
| 574 |
+
curved proteins that apply normal forces, induce the formation of flattened, lamellipodia-like protrusions [5, 18]. Here
|
| 575 |
+
we show that curved proteins that induce polymerization of bundled actin (aligned-force in our model), naturally give
|
| 576 |
+
rise to filopodia-like protrusions (Figs.6,7). This result fits the observation of highly curved convex-shaped proteins
|
| 577 |
+
such as IRSp53 in both the leading edge of lamellipodia [7, 42] and in filopodia [2], where the actin organization is
|
| 578 |
+
very different due to the different type of actin nucleators [38, 43]. Note that the combination of convex curvature, and
|
| 579 |
+
nucleators of bundled actin, can form filopodia even without the explicit presence of I-BAR proteins (such as IRSp53)
|
| 580 |
+
[44, 45].
|
| 581 |
+
Note that protrusions of similar shapes to our aligned-force protrusions, which have a bulbous tip and a slender
|
| 582 |
+
neck (Figs.6,7), were theoretically predicted to form by anisotropic CMC, even without force [46]. Similar thin tubes
|
| 583 |
+
with bulbous tips are observed in cellular nanotubes [47] and in filopodia [48]. Since many curved proteins, such as
|
| 584 |
+
IRSp53 are anisotropic in their intrinsic shape, it will be interesting to extend our work in the future to include such
|
| 585 |
+
anisotropy.
|
| 586 |
+
|
| 587 |
+
10
|
| 588 |
+
Finally, our simulations of an adhered vesicle (Fig.8) indicate that the filopodia protrusions can undergo attachment
|
| 589 |
+
and detachment from the substrate, resembling such motion observed in experiments [14]. In addition, when we
|
| 590 |
+
mixed the aligned-force and normal-force CMC with exclusive binding between them, we obtained their segregated
|
| 591 |
+
organization along the rim of the adhered vesicle. This is reminiscent of the observations of segregated regions of
|
| 592 |
+
bundled actin and branched actin nucleators along the rim of cellular protrusions extending on adhered substrates
|
| 593 |
+
[37, 49–51]. As in the experiments, the clusters of aligned-force CMC along the rim slightly protrude, as they exert
|
| 594 |
+
a higher local force on the membrane rim, compared to the normal-force CMC. These small protrusions have been
|
| 595 |
+
termed ”spikes” and ”microspikes” along the edge of lamellipodia in cells [45, 50, 52].
|
| 596 |
+
In Fig.9 we show images illustrating the dynamics of filopodia in cells, using lattice light-sheet microscopy, which is
|
| 597 |
+
capable of the high spatial and temporal resolution necessary to view the dynamics of the thin filopodia [53]. The
|
| 598 |
+
curved membrane protein IRSp53 is fluorescently labeled in green (GFP-IRSp53), while the actin filaments are labeled
|
| 599 |
+
in red (mCherry-lifeact). We observe in the experiments several features that are captured by the theoretical model:
|
| 600 |
+
The filopodia are highly dynamic, both at the cell rim and along its dorsal surface (Fig.9A-D), as we also see in the
|
| 601 |
+
model (Fig.8). The filopodia in the experiments migrate on the cell surface, merge with other filopodia, and undergo
|
| 602 |
+
attachments and detachments from the surface (see SI movies 5-8), as we also see in the simulations (SI movies 3 and
|
| 603 |
+
4). Our assumption in the model of uniform adhesion along the membrane, and along the filopodia, agrees with some
|
| 604 |
+
observations [48, 54], and we can add more complex adhesion models in the future if needed. Note that in the cells we
|
| 605 |
+
observe an additional retraction motion that is driven by myosin-II contractile forces, which we do not have in our
|
| 606 |
+
current model.
|
| 607 |
+
The highly curved IRSp53 is observed to aggregate strongly at the tips of the filopodia, while along the lower parts
|
| 608 |
+
of the protrusion its aggregation is more fragmented (Fig.9E,F). This fits with the shapes that we obtained in the
|
| 609 |
+
model (Fig.6B,8A). Furthermore, our simulations of mixtures of aligned-force and normal-force CMC indicate that
|
| 610 |
+
while the aligned-force CMC are essential for forming the filopodia protrusions and occupy its tip region, there can be
|
| 611 |
+
significant amount of normal-force CMC along the lower part of the filpodia. Since the normal-force CMC correspond
|
| 612 |
+
to branched-actin nucleators, this result suggests that along the lower part of filopodia we may expect to find proteins
|
| 613 |
+
such as WAVE, which are usually associated with the leading edge of the lamellipodia. This prediction is supported by
|
| 614 |
+
some experimental observations of WAVE proteins [55], Arp2/3 complexes [56], and small lamellipodia-like protrusions,
|
| 615 |
+
along filopodia shafts [57].
|
| 616 |
+
C.
|
| 617 |
+
Membrane shapes driven by mixtures of passive concave and active convex CMC
|
| 618 |
+
Our mixtures of CMC of opposite curvatures (Figs.4C,5) gives rise to membrane shapes that resemble in their
|
| 619 |
+
texture the ruffles observed in cells [20]. In addition, we find that when the passive concave component is highly
|
| 620 |
+
curved, we observe a phase separation within the CMC clusters, whereby the concave CMC forms an internalized
|
| 621 |
+
spherical invagination. These invaginations are then squeezed at their base by the active forces induced by the convex
|
| 622 |
+
CMC, and the calculated membrane shape dynamics resembles the process of actin-dependent endycytosis [17, 58–60]
|
| 623 |
+
and macropinocytosis [34, 61–63].
|
| 624 |
+
Note that there is some experimental evidence that the internalized membrane, corresponding to our concave CMC
|
| 625 |
+
region, do indeed contain concave membrane components, such as BAR proteins [64]. In addition, there are examples
|
| 626 |
+
where the internalized region contains membrane components that interact with the convex proteins that recruit actin
|
| 627 |
+
and form the squeezing at the narrow neck. In [59] the internalized activated integrins and associated proteins, bind to
|
| 628 |
+
the actin which is nucleated at the neck, recruited there by IRSp53 (convex) proteins. In our model we show that such
|
| 629 |
+
a direct interaction is necessary for robust formation of the internalized sacks with the recruited convex proteins at the
|
| 630 |
+
neck.
|
| 631 |
+
X.
|
| 632 |
+
DISCUSSION
|
| 633 |
+
In this study we greatly extend our theoretical understanding of the space of membrane shapes that are produced
|
| 634 |
+
by curved membrane protein complexes (CMC) that exert active protrusive forces on the membrane [15]. We started
|
| 635 |
+
by mapping the phases as function of the magnitude of the active force and attractive nearest-neighbor interaction
|
| 636 |
+
strength of CMCs (Fig.2A), demonstrating the competition between these two terms: systems dominated by the
|
| 637 |
+
binding interactions tend to have the equilibrium (pearled) shapes of the CMC clusters. The active forces tend to
|
| 638 |
+
break-up the pearled clusters, and induce the formation of either elongated or flat pancake-like membrane shapes.
|
| 639 |
+
Similarly we exposed the phase diagram in terms of the active force and the CMC spontaneous curvature (Fig.4A),
|
| 640 |
+
whereby highly curved CMC induce flattened vesicle shapes, while less curved CMC induce elongated tubular shapes.
|
| 641 |
+
Note that in these studies the protrusive force applied by each CMC is towards the local outwards normal.
|
| 642 |
+
|
| 643 |
+
11
|
| 644 |
+
Based on these results we further explored systems where highly curved active CMC could induce tubular protrusions.
|
| 645 |
+
We tested two possible scenarios: In the first one, the effective curvature of the CMC cluster is reduced by mixing
|
| 646 |
+
two types of CMC of opposite curvatures, such that a tubular protrusion forms with a rather flat CMC cluster at its
|
| 647 |
+
tip (Fig.4C,D). In the second, the net protrusive force of the CMC cluster is increased by introducing an alignment
|
| 648 |
+
interaction that tends to align the forces exerted by CMC that are bound within the same cluster (Fig.6). This
|
| 649 |
+
alignment is found to stabilize long tubular CMC clusters, since the aligned active forces act along the tube axis and
|
| 650 |
+
do not act to expand the tube, unlike the case of normal protrusive forces.
|
| 651 |
+
We found that that mixtures of CMC of opposite curvatures, specifically passive concave and active convex, lead
|
| 652 |
+
to formation of clusters with complex textures that resemble ruffles on cell membranes (Figs.4C,5). In addition, we
|
| 653 |
+
found in these systems the formation of internalized invaginations, where the convex active CMC form a narrow neck,
|
| 654 |
+
resembling endocytosis and macropinocytosis in cells.
|
| 655 |
+
To conclude, the results presented in this work expand out theoretical understanding of membrane shapes and
|
| 656 |
+
dynamics driven by intrinsic (spontaneous) curvature of membrane components and cytoskeletal active forces. Some
|
| 657 |
+
of these shapes resemble observed membrane dynamics in living cells, suggesting that this coupling between curved
|
| 658 |
+
membrane proteins and cytoskeleton forces gives rise to these biological phenomena. Many of the features that we
|
| 659 |
+
found, such as the ruffles and the internalized invaginations by mixing CMC of different curvatures, remain to be
|
| 660 |
+
further explored in future theoretical studies. In addition, future studies will explore the dynamics of the membranes
|
| 661 |
+
when the CMC have anisotropic spontaneous curvature, and also in the presence of contractile forces.
|
| 662 |
+
Conflict of Interest Statement
|
| 663 |
+
The authors declare that the research was conducted in the absence of any commercial or financial relationships
|
| 664 |
+
that could be construed as a potential conflict of interest.
|
| 665 |
+
Author Contributions
|
| 666 |
+
YR and NG developed the theoretical model; SP and AI developed the software; YR and NG conceived, designed
|
| 667 |
+
and implemented the analysis of the model, and prepared the manuscript. YK and SS cultured and imaged the cells.
|
| 668 |
+
The manuscript was edited by all the authors.
|
| 669 |
+
Funding
|
| 670 |
+
NG is the incumbent of the Lee and William Abramowitz Professorial Chair of Biophysics, and acknowledges support
|
| 671 |
+
by the Ben May Center for Theory and Computation, and the Israel Science Foundation (Grant No. 207/22). AI and
|
| 672 |
+
SM were supported by the Slovenian Research Agency (ARRS) through the Grants No. J3-3066 and J2-4447 and
|
| 673 |
+
Programme No. P2-0232. YK and SS was supported by grants from the JSPS (KAKENHI JP20H03252, JP20KK0341,
|
| 674 |
+
and JP21H05047) and JST CREST (JPMJCR1863) to SS and Takeda Science Foundation, a Grant-in-Aid for
|
| 675 |
+
Challenging Exploratory Research (KAKENHI No. 20K20379), and JST CREST (JPMJCR1863) to YK.
|
| 676 |
+
Acknowledgments
|
| 677 |
+
NG is the incumbent of the Lee and William Abramowitz Professorial Chair of Biophysics. This research is made
|
| 678 |
+
possible in part by the historic generosity of the Harold Perlman Family.
|
| 679 |
+
Supplemental Data
|
| 680 |
+
The SI text, figures, and movies are also available from the Box drive.
|
| 681 |
+
Data Availability Statement
|
| 682 |
+
The code for generating the simulations of this study can be found in the GitHub repository of YR, which is taken
|
| 683 |
+
and modified off the GitBlit repository of SP. Reconstruction of the initial simulation folders are also available from
|
| 684 |
+
|
| 685 |
+
12
|
| 686 |
+
the Box drive. Further data or code requests will be happily fulfilled by YR.
|
| 687 |
+
[1] F. Frey and T. Idema, Soft matter 17, 3533 (2021), ISSN 1744-6848.
|
| 688 |
+
[2] P. K. Mattila and P. Lappalainen, Nature Reviews Molecular Cell Biology 9, 446 (2008), ISSN 14710072.
|
| 689 |
+
[3] M. Simunovic, G. A. Voth, A. Callan-Jones, and P. Bassereau, Trends Cell Biol. 2015 (2015).
|
| 690 |
+
[4] N. Gov, Philosophical Transactions of the Royal Society B: Biological Sciences 373, 20170115 (2018).
|
| 691 |
+
[5] M. Foˇsnariˇc, S. Peniˇc, A. Igliˇc, V. Kralj-Igliˇc, M. Drab, and N. S. Gov, Soft Matter 15, 5319 (2019), ISSN 17446848,
|
| 692 |
+
1812.01460.
|
| 693 |
+
[6] I. Begemann, T. Saha, L. Lamparter, I. Rathmann, D. Grill, L. Golbach, C. Rasch, U. Keller, B. Trappmann, M. Matis,
|
| 694 |
+
et al., Nature Physics 15, 848 (2019).
|
| 695 |
+
[7] A. Pipathsouk, R. M. Brunetti, J. P. Town, B. R. Graziano, A. Breuer, P. A. Pellett, K. Marchuk, N.-H. T. Tran, M. F.
|
| 696 |
+
Krummel, D. Stamou, et al., Journal of Cell Biology 220, e202003086 (2021).
|
| 697 |
+
[8] G. Scita, S. Confalonieri, P. Lappalainen, and S. Suetsugu, Trends in cell biology 18, 52 (2008).
|
| 698 |
+
[9] S. Ahmed, W. I. Goh, and W. Bu, in Seminars in cell & developmental biology (Elsevier, 2010), vol. 21, pp. 350–356.
|
| 699 |
+
[10] F. Vaggi, A. Disanza, F. Milanesi, P. P. Di Fiore, E. Menna, M. Matteoli, N. S. Gov, G. Scita, and A. Ciliberto, PLoS
|
| 700 |
+
computational biology 7, e1002088 (2011).
|
| 701 |
+
[11] G. Mancinelli, L. Lamparter, G. Nosov, T. Saha, A. Pawluchin, R. Kurre, C. Rasch, M. Ebrahimkutty, J. Klingauf, and
|
| 702 |
+
M. Galic, Proceedings of the National Academy of Sciences 118, e2106921118 (2021).
|
| 703 |
+
[12] F.-C. Tsai, J. M. Henderson, Z. Jarin, E. Kremneva, Y. Senju, J. Pernier, O. Mikhajlov, J. Manzi, K. Kogan, C. L.
|
| 704 |
+
Clainche, et al., Science Advances 8, eabp8677 (2022), https://www.science.org/doi/pdf/10.1126/sciadv.abp8677, URL
|
| 705 |
+
https://www.science.org/doi/abs/10.1126/sciadv.abp8677.
|
| 706 |
+
[13] S. Fox, A. Tran, L. Trinkle-Mulcahy, and J. W. Copeland, Journal of Biological Chemistry 298 (2022).
|
| 707 |
+
[14] S. Y. Lee, T. Fujioka, M. Osuga, T. Nishimura, and S. Suetsugu, in Plasma Membrane Shaping (Elsevier, 2023), pp.
|
| 708 |
+
245–263.
|
| 709 |
+
[15] M. Drab, R. K. Sadhu, Y. Ravid, A. Igliˇc, V. Kralj-Igliˇc, and N. S. Gov, Plasma Membrane Shaping pp. 415–429 (2023).
|
| 710 |
+
[16] H. Mellor, Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1803, 191 (2010).
|
| 711 |
+
[17] G. J. Doherty and H. T. McMahon, Annual review of biochemistry 78, 857 (2009).
|
| 712 |
+
[18] R. K. Sadhu, S. Peniˇc, A. Igliˇc, and N. S. Gov, European Physical Journal Plus 136, 495 (2021), ISSN 21905444, 2101.00313.
|
| 713 |
+
[19] N. S. Gov, V. Kralj-Igliˇc, R. K. Sadhu, L. Mesarec, and A. Igliˇc, in Plasma Membrane Shaping (Elsevier, 2023), pp. 393–413.
|
| 714 |
+
[20] E. Sitarska, S. D. Almeida, M. S. Beckwith, J. Stopp, Y. Schwab, M. Sixt, A. Kreshuk, A. Erzberger, and A. Diz-Mu˜noz,
|
| 715 |
+
bioRxiv p. 2021.03.26.437199 (2021).
|
| 716 |
+
[21] J. Faix and K. Rottner, Current Opinion in Cell Biology 18, 18 (2006), ISSN 09550674.
|
| 717 |
+
[22] T. Vicsek and A. Zafeiris, Physics reports 517, 71 (2012).
|
| 718 |
+
[23] D. Mashiko, Y. Fujihara, Y. Satouh, H. Miyata, A. Isotani, and M. Ikawa, Scientific reports 3, 1 (2013).
|
| 719 |
+
[24] K. Hanawa-Suetsugu, Y. Itoh, M. Ab Fatah, T. Nishimura, K. Takemura, K. Takeshita, S. Kubota, N. Miyazaki, W. N. I.
|
| 720 |
+
Wan Mohamad Noor, T. Inaba, et al., Nature communications 10, 1 (2019).
|
| 721 |
+
[25] B.-C. Chen, W. R. Legant, K. Wang, L. Shao, D. E. Milkie, M. W. Davidson, C. Janetopoulos, X. S. Wu, J. A. Hammer III,
|
| 722 |
+
Z. Liu, et al., Science 346, 1257998 (2014).
|
| 723 |
+
[26] T. Nishimura, T. Oyama, H. T. Hu, T. Fujioka, K. Hanawa-Suetsugu, K. Ikeda, S. Yamada, H. Kawana, D. Saigusa,
|
| 724 |
+
H. Ikeda, et al., Developmental cell 56, 842 (2021).
|
| 725 |
+
[27] M. D. Welch and R. D. Mullins, Annual review of cell and developmental biology 18, 247 (2002).
|
| 726 |
+
[28] M.-F. Carlier and D. Pantaloni, Journal of Biological Chemistry 282, 23005 (2007).
|
| 727 |
+
[29] K. G. Campellone and M. D. Welch, Nature reviews Molecular cell biology 11, 237 (2010).
|
| 728 |
+
[30] K. Bohinc, V. Kralj-Igliˇc, and S. May, The Journal of chemical physics 119, 7435 (2003).
|
| 729 |
+
[31] D. N. Theodorou and U. W. Suter, Macromolecules 18, 1206 (1985).
|
| 730 |
+
[32] G. Golani, N. Ariotti, R. G. Parton, and M. M. Kozlov, Developmental Cell 48, 523 (2019), ISSN 15345807.
|
| 731 |
+
[33] S. Peniˇc, L. Mesarec, M. Foˇsnariˇc, L. Mr´owczy´nska, H. H¨agerstrand, V. Kralj-Igliˇc, and A. Igliˇc, Frontiers in Physics 8, 342
|
| 732 |
+
(2020).
|
| 733 |
+
[34] R. R. Kay, Cells & Development 168, 203713 (2021).
|
| 734 |
+
[35] N. Saito and S. Sawai, Iscience 24, 103087 (2021).
|
| 735 |
+
[36] L. Mesarec, W. G´o´zd´z, V. K. Igliˇc, S. Kralj, and A. Igliˇc, Colloids and Surfaces B: Biointerfaces 141, 132 (2016).
|
| 736 |
+
[37] J. Faix and K. Rottner, Journal of Cell Science 135, jcs259226 (2022).
|
| 737 |
+
[38] J. V. Small, T. Stradal, E. Vignal, and K. Rottner, Trends in cell biology 12, 112 (2002).
|
| 738 |
+
[39] T. Takenawa and S. Suetsugu, Nature reviews Molecular cell biology 8, 37 (2007).
|
| 739 |
+
[40] K. Rottner and M. Schaks, Current opinion in cell biology 56, 53 (2019).
|
| 740 |
+
[41] S. Suetsugu, K. Murayama, A. Sakamoto, K. Hanawa-Suetsugu, A. Seto, T. Oikawa, C. Mishima, M. Shirouzu, T. Takenawa,
|
| 741 |
+
and S. Yokoyama, Journal of Biological Chemistry 281, 35347 (2006).
|
| 742 |
+
[42] A. Pawluchin and M. Galic, Frontiers in Cell and Developmental Biology 10 (2022), ISSN 2296-634X, URL https:
|
| 743 |
+
//www.frontiersin.org/articles/10.3389/fcell.2022.1080995.
|
| 744 |
+
[43] M. Krause and A. Gautreau, Nature reviews Molecular cell biology 15, 577 (2014).
|
| 745 |
+
|
| 746 |
+
13
|
| 747 |
+
parameter
|
| 748 |
+
units
|
| 749 |
+
Fig.1,[5]
|
| 750 |
+
Fig.2
|
| 751 |
+
Fig.4A
|
| 752 |
+
Fig.4C
|
| 753 |
+
Fig.6
|
| 754 |
+
Fig.7
|
| 755 |
+
Fig.8
|
| 756 |
+
f
|
| 757 |
+
KBT/ℓmin
|
| 758 |
+
1
|
| 759 |
+
0 − 1.2 0 − 0.5
|
| 760 |
+
0.5
|
| 761 |
+
0.2
|
| 762 |
+
0.2, 0.5
|
| 763 |
+
0.5
|
| 764 |
+
w
|
| 765 |
+
KBT
|
| 766 |
+
1
|
| 767 |
+
0 − 4.8
|
| 768 |
+
2
|
| 769 |
+
2
|
| 770 |
+
2
|
| 771 |
+
2
|
| 772 |
+
2
|
| 773 |
+
κ
|
| 774 |
+
KBT
|
| 775 |
+
20*
|
| 776 |
+
20
|
| 777 |
+
28.5
|
| 778 |
+
28.5
|
| 779 |
+
28.5
|
| 780 |
+
28.5
|
| 781 |
+
28.5
|
| 782 |
+
ρ
|
| 783 |
+
1
|
| 784 |
+
0%-20%
|
| 785 |
+
10%
|
| 786 |
+
20%
|
| 787 |
+
10%, 10%
|
| 788 |
+
20%
|
| 789 |
+
20%,
|
| 790 |
+
10%, 10%
|
| 791 |
+
C0
|
| 792 |
+
1/ℓmin
|
| 793 |
+
1(0)
|
| 794 |
+
1
|
| 795 |
+
0.8
|
| 796 |
+
-0.75 − 0, 0.8
|
| 797 |
+
0.4
|
| 798 |
+
0.4, 0.1
|
| 799 |
+
0.8
|
| 800 |
+
TABLE I: The values of the model parameters used in the simulations, in the different figures. The energy units are KBT = 1,
|
| 801 |
+
which define the scale of f, w, κ, and the length units are ℓmin = 1, which define the scale of the vertex lattice, the force, and
|
| 802 |
+
spontaneous curvature.
|
| 803 |
+
[44] S. K¨uhn, C. Erdmann, F. Kage, J. Block, L. Schwenkmezger, A. Steffen, K. Rottner, and M. Geyer, Nature communications
|
| 804 |
+
6, 1 (2015).
|
| 805 |
+
[45] T. Pokrant, J. I. Hein, S. K¨orber, A. Disanza, A. Pich, G. Scita, K. Rottner, and J. Faix, Proceedings of the National
|
| 806 |
+
Academy of Sciences 120, e2217437120 (2023).
|
| 807 |
+
[46] N. Bobrovska, W. G´o´zd´z, V. Kralj-Igliˇc, and A. Igliˇc, PloS one 8, e73941 (2013).
|
| 808 |
+
[47] K. Schara, V. Janˇsa, V. ˇSuˇstar, D. Dolinar, J. I. Pavliˇc, M. Lokar, V. Kralj-Igliˇc, P. Veraniˇc, and A. Igliˇc, Cellular &
|
| 809 |
+
molecular biology letters 14, 636 (2009).
|
| 810 |
+
[48] M. Miihkinen, M. L. Gr¨onloh, A. Popovi´c, H. Vihinen, E. Jokitalo, B. T. Goult, J. Ivaska, and G. Jacquemet, Cell reports
|
| 811 |
+
36, 109716 (2021).
|
| 812 |
+
[49] C. S. Cohan, E. A. Welnhofer, L. Zhao, F. Matsumura, and S. Yamashiro, Cell motility and the cytoskeleton 48, 109 (2001).
|
| 813 |
+
[50] J. Damiano-Guercio, L. Kurzawa, J. Mueller, G. Dimchev, M. Schaks, M. Nemethova, T. Pokrant, S. Br¨uhmann, J. Linkner,
|
| 814 |
+
L. Blanchoin, et al., Elife 9 (2020).
|
| 815 |
+
[51] F. Kage, H. D¨oring, M. Mietkowska, M. Schaks, F. Gr¨uner, S. Stahnke, A. Steffen, M. M¨usken, T. E. Stradal, and K. Rottner,
|
| 816 |
+
Journal of Cell Science 135, jcs260364 (2022).
|
| 817 |
+
[52] S. A. Koestler, S. Auinger, M. Vinzenz, K. Rottner, and J. V. Small, Nature cell biology 10, 306 (2008).
|
| 818 |
+
[53] Y. Mimori-Kiyosue, in Plasma Membrane Shaping (Elsevier, 2023), pp. 357–374.
|
| 819 |
+
[54] Y. Tu, K. Pal, J. Austin, and X. Wang, Current Biology 32, 4386 (2022).
|
| 820 |
+
[55] M. Nozumi, H. Nakagawa, H. Miki, T. Takenawa, and S. Miyamoto, Journal of cell science 116, 239 (2003).
|
| 821 |
+
[56] S. A. Johnston, J. P. Bramble, C. L. Yeung, P. M. Mendes, and L. M. Machesky, BMC cell biology 9, 1 (2008).
|
| 822 |
+
[57] C. Lebrand, E. W. Dent, G. A. Strasser, L. M. Lanier, M. Krause, T. M. Svitkina, G. G. Borisy, and F. B. Gertler, Neuron
|
| 823 |
+
42, 37 (2004).
|
| 824 |
+
[58] O. L. Mooren, B. J. Galletta, and J. A. Cooper, Annual review of biochemistry 81, 661 (2012).
|
| 825 |
+
[59] P. Moreno-Layseca, N. Z. J¨antti, R. Godbole, C. Sommer, G. Jacquemet, H. Al-Akhrass, J. R. Conway, P. Kronqvist, R. E.
|
| 826 |
+
Kallionp¨a¨a, L. Oliveira-Ferrer, et al., Nature cell biology 23, 1073 (2021).
|
| 827 |
+
[60] C. Kaplan, S. J. Kenny, X. Chen, J. Sch¨oneberg, E. Sitarska, A. Diz-Mu˜noz, M. Akamatsu, K. Xu, and D. G. Drubin,
|
| 828 |
+
Molecular Biology of the Cell 33, ar50 (2022).
|
| 829 |
+
[61] S. L. Sønder, S. C. H¨ager, A. S. B. Heitmann, L. B. Frankel, C. Dias, A. C. Simonsen, and J. Nylandsted, Science Advances
|
| 830 |
+
7, eabg1969 (2021).
|
| 831 |
+
[62] S. Mylvaganam, S. A. Freeman, and S. Grinstein, Current Biology 31, R619 (2021).
|
| 832 |
+
[63] J. Lutton, P. Paschke, C. Munn, J. S. King, R. Kay, T. Bretschneider, et al., bioRxiv (2022).
|
| 833 |
+
[64] M. V. Baranov, R. A. Olea, and G. van den Bogaart, Trends in cell biology 29, 727 (2019).
|
| 834 |
+
|
| 835 |
+
14
|
| 836 |
+
FIG. 1: Phases of vesicle shapes driven by curved active CMC, as obtained in [5]. (A) Phase diagram in the temperature-density
|
| 837 |
+
plane: mixed (gas), budded, and flattened (pancake). The gas phase is dominated by entropy, hence appears at either high
|
| 838 |
+
temperatures or low densities. The pancake phase is dominated by having favorable binding and bending energy, where the
|
| 839 |
+
active forces are all radial and stabilize the flat shape. This phase requires large stable CMC cluster, and so can only appear at
|
| 840 |
+
low temperatures. The budded phase appears between the two other phases. At a CMC density that is lower than the minimal
|
| 841 |
+
value needed for a closed circular rim, the pancake shape changes to B) a two-arcs phase, while when the CMC concentration is
|
| 842 |
+
very high the pancake forms pearled extensions that contain the surplus CMC (C). There are two other phases in different
|
| 843 |
+
regimes: (D) The pearling phase appears at higher CMC density, where most of the CMC aggregate into long necklace-like
|
| 844 |
+
clusters that minimize the protein-protein binding energy (phase-separation of CMC), and (E) highly-elongated (tubular) phase
|
| 845 |
+
for flat CMCs, where large CMC caps can exert a strong force that pulls out elongated tubes. Pictures taken from [5] Figs.4c,7d,
|
| 846 |
+
and SI.
|
| 847 |
+
|
| 848 |
+
(A)
|
| 849 |
+
2
|
| 850 |
+
1.5
|
| 851 |
+
Mixed
|
| 852 |
+
I
|
| 853 |
+
Budded
|
| 854 |
+
0.5
|
| 855 |
+
Pancake
|
| 856 |
+
4
|
| 857 |
+
6
|
| 858 |
+
8
|
| 859 |
+
10
|
| 860 |
+
12
|
| 861 |
+
14
|
| 862 |
+
16
|
| 863 |
+
p[%]15
|
| 864 |
+
FIG. 2: Force-binding strength plane. (A) Phase diagram as function of f and w, with: κ = 20, C0 = 1, and ρ = 10%. The
|
| 865 |
+
different phases are indicated by their names, and a typical snapshot of the vesicle after a long simulation is shown. The
|
| 866 |
+
transition lines between the phases were drawn according to the measures shown in the bottom panels. The gas and buds phase
|
| 867 |
+
is separated by mean cluster size ⟨N⟩ = 1.5 (yellow solid line), as obtained from (B). The green line denotes the boundary of the
|
| 868 |
+
flat phase, obtained approximately from a contour of the first (small) gyration eigenvalue λ2
|
| 869 |
+
1, which is minimal for flat shapes
|
| 870 |
+
(C). The light blue line denotes the boundary of the elongated shapes, roughly following a contour of the second (intermediate)
|
| 871 |
+
gyration eigenvalue λ2
|
| 872 |
+
2 (D). The transition line between the buds and mixed phases is given by a contour of CMC perimeter
|
| 873 |
+
length (¯ℓp = 1.875, red solid line), extracted from (E). Finally, the pearling phase transition line (red dotted line) is drawn along
|
| 874 |
+
the contour of small CMC perimeter length (¯ℓp = 0.375), from (E). In panels (B-E) we plot heatmaps of the following quantities:
|
| 875 |
+
(B) Mean cluster size for clusters smaller than 10, ⟨N⟩ > 10 (C) first (small) gyration eigenvalue λ2
|
| 876 |
+
1, (D) second (intermediate)
|
| 877 |
+
gyration eigenvalue λ2
|
| 878 |
+
2, (E) Mean CMC cluster perimeter length (excluding isolated CMC) ¯ℓ.
|
| 879 |
+
|
| 880 |
+
Elongated
|
| 881 |
+
Mixed16
|
| 882 |
+
FIG. 3: Evolution of the MC simulation at four different points (B-E) denoted on the phase diagram (A) (Fig.2A). (B): f=0.8,
|
| 883 |
+
w=1.6, (C): f=0.8, w=2.88, (D): f=0.8, w=3.20, and (E): f=0.4, w=4.16. The MC time-steps shown in the snapshots are: (i) 10,
|
| 884 |
+
(ii) 50 (ii) and (iii) 200, and the final time-step (299) is shown on the phase diagram (A). At time (i), all simulations are in the
|
| 885 |
+
budded state. At time (ii), arc and pearling clusters begin to form, favoring arcs for large forces and pearling for large binding
|
| 886 |
+
strength. At time (iii), the vesicles are close to their final steady-state shapes. The flat simulation (B) generates several arcs
|
| 887 |
+
in stage (ii), which coalesce to form a circular stable rim. The pearling simulation (E) generates pearling clusters (ii) which
|
| 888 |
+
coalesce into a few larger clusters (coarsening). In contrast, the elongated simulations generate both arcs and pearled clusters at
|
| 889 |
+
the intermediate stage (ii). These arc-like clusters are sufficient stretch the vesicle, even in (D), to give rise to the final elongated
|
| 890 |
+
phase.
|
| 891 |
+
|
| 892 |
+
Ci
|
| 893 |
+
D i
|
| 894 |
+
11
|
| 895 |
+
Bi
|
| 896 |
+
ili
|
| 897 |
+
Ei
|
| 898 |
+
ili17
|
| 899 |
+
FIG. 4: (A) Phase diagram in the force-spontaneous curvature plane, using the parameters: ρ = 20%, κ = 28.5, w = 2. The
|
| 900 |
+
different phases are denoted by their typical shapes, and the thin colored transition lines were drawn by hand (yellow, red and
|
| 901 |
+
green). With no or weak force, we find a budded phase. As the force is increased, we find for the high spontaneous curvature
|
| 902 |
+
the flat phase. As the spontaneous curvature is reduced, the flat phase is observed to give way to an ”arcs” phase, which is
|
| 903 |
+
finally replaced by a highly-elongated tubular phase. The thick blue line denotes the theoretical calculation for the transition
|
| 904 |
+
line that bounds the tubes phase, which is a cubic equation: f = AC3
|
| 905 |
+
0 (Eq.9), where we use: A ≈ 10.6. This equation is derived
|
| 906 |
+
from the force balance shown schematically in (B). (C) Typical steady-state snapshots of simulations with a mixture of CMC:
|
| 907 |
+
active convex CMC (C0 = 0.8, f = 0.5, ρ = 10%), and passive concave CMCs (ρ = 10%) with different concave curvatures
|
| 908 |
+
C−
|
| 909 |
+
0 (along the x-axis). We show here three cases: i) no inhibition of the active convex CMC, ii) proportional inhibition, where
|
| 910 |
+
the force exerted by a convex CMC is proportional to number of non-concave neighbors, and iii) disabling interaction, where
|
| 911 |
+
the convex CMC do not exert any force if they have a concave neighbor. (D) Mapping of the vesicles shown in (C) to their
|
| 912 |
+
respective locations in the force-spontaneous curvature phase diagram (A), using the average force and spontaneous curvature of
|
| 913 |
+
the mixture (dashed outlines). The snapshots are shown at shifted locations, according to the effective curvature when we take
|
| 914 |
+
into account the phase-separation of the concave CMC, into internalized sacks. These shifts in locations are most dramatic for
|
| 915 |
+
1i,1ii,2ii,1iii,2iii (indicated by arrows), which places the vesicles in a phase which is appropriate for their shapes.
|
| 916 |
+
|
| 917 |
+
2
|
| 918 |
+
Flat
|
| 919 |
+
SO
|
| 920 |
+
ubes
|
| 921 |
+
Arcs
|
| 922 |
+
Buds
|
| 923 |
+
Flat
|
| 924 |
+
5i
|
| 925 |
+
61
|
| 926 |
+
2ii
|
| 927 |
+
Tubes
|
| 928 |
+
3ii
|
| 929 |
+
4ii
|
| 930 |
+
511
|
| 931 |
+
61l
|
| 932 |
+
1ili
|
| 933 |
+
Arcs
|
| 934 |
+
2ili
|
| 935 |
+
5ili.
|
| 936 |
+
Buds
|
| 937 |
+
6ili
|
| 938 |
+
3ill18
|
| 939 |
+
FIG. 5: Mixed clusters can precipitate internal sacks, which are composed almost entirely of the concave (passive) CMC, when
|
| 940 |
+
the concave CMCs are highly curved C0 = −0.75, −0.6. This is shown in A(i,ii),C(i,ii) for a system with and without active
|
| 941 |
+
force, respectively. This internal sack is connected to the outside by a thin neck, or ”hole”, shown in A(iii) and C(iii). The
|
| 942 |
+
cross-sectional area of the hole was measured by computing the area of the polygon made from the hole edge, which was picked
|
| 943 |
+
by hand (vertices). A histogram of the simulated hole sizes is shown for the system with and without active force respectively
|
| 944 |
+
(B,D). It is clear that the hole size is smaller in systems with force (B), such that it is in the limit of the simulation resolution.
|
| 945 |
+
The holes are also larger as the spontaneous curvature of the passive concave CMC is smaller. The insets of B,D show typical
|
| 946 |
+
examples of sacks (light blue nodes) connected to the outer part of the cluster (blue nodes) through the neck region (grey
|
| 947 |
+
shading). (E) and (F): Snapshots showing the formation of a sack for the system with active force (A), from the initial random
|
| 948 |
+
state. In (E) we show the cluster viewed from outside of the vesicle (where the bare membrane is rendered invisible), looking
|
| 949 |
+
down on the patch that forms the sack, while in (F) we show the same process viewed from within the vesicle, where we see
|
| 950 |
+
clearly the final invagination.
|
| 951 |
+
|
| 952 |
+
Aii
|
| 953 |
+
A ili
|
| 954 |
+
curvature: -0.75
|
| 955 |
+
curvature: -0.6
|
| 956 |
+
Ai
|
| 957 |
+
B
|
| 958 |
+
10
|
| 959 |
+
5
|
| 960 |
+
20
|
| 961 |
+
25C
|
| 962 |
+
10
|
| 963 |
+
15
|
| 964 |
+
20
|
| 965 |
+
25
|
| 966 |
+
c i
|
| 967 |
+
c ii
|
| 968 |
+
cili
|
| 969 |
+
LO
|
| 970 |
+
15
|
| 971 |
+
20
|
| 972 |
+
25 0
|
| 973 |
+
10
|
| 974 |
+
15
|
| 975 |
+
20
|
| 976 |
+
50
|
| 977 |
+
Hole area
|
| 978 |
+
Hole area
|
| 979 |
+
0219
|
| 980 |
+
FIG. 6: (A) Vesicle steady-state shapes as function of the strength (s) and range (r) of the Vicsek-like alignment interaction
|
| 981 |
+
(Eq.10)(ρ = 20%,κ = 28.5,C0 = 0.4,w = 2,f = 0.2). Interaction radius smaller than 10 leads to a flat phase. Above an interaction
|
| 982 |
+
radius of 10, the system transitions from a flat to a tubes phase. In between the flat and elongated tubes phases, we find a phase
|
| 983 |
+
with ”paddle”-like clusters. The tubular phase is characterized by CMC clusters that are mostly finger-like with a bulbous tip
|
| 984 |
+
and a tubular sleeve, which often stretch a membrane tube behind them. (B) Snapshots of CMC clusters, with the active forces
|
| 985 |
+
indicated by the arrows, and the colormap indicating the dot product of the local force and local outwards normal. In the tubes
|
| 986 |
+
phase (s = 0.75, r = 15) we show in (i) an example of a hemispherical cluster, which is not able to pull an elongated protrusion.
|
| 987 |
+
In (ii) (top) we show an example of a CMC cluster that contains a tubular sleeve, which increases the net pulling force above
|
| 988 |
+
the threshold to pull a membrane tube. Note that at the sleeve base the alignment is weak due to the bare membrane boundary.
|
| 989 |
+
This effect is also shown in (iii) (bottom), where a small patch of bare membrane is trapped between the cluster tip and the
|
| 990 |
+
sleeve, leading to formation of two different alignment domains within the same cluster. Finally, in (iv) we show an example of
|
| 991 |
+
the paddle cluster (s = 0.1, r = 10), where the weak alignment interaction gives rise to shapes similar to the regular arc-like
|
| 992 |
+
clusters (Fig.4A), elongated by the non-normal force.
|
| 993 |
+
|
| 994 |
+
Tube
|
| 995 |
+
Paddle
|
| 996 |
+
Flat
|
| 997 |
+
iv
|
| 998 |
+
120
|
| 999 |
+
FIG. 7: (A) Dynamics of the formation of the tubular phase, driven by strong alignment interactions (ρ = 20%, κ = 28.5, C0 =
|
| 1000 |
+
0.4, w = 2, f = 0.2, s = 0.75, r = 15). Each circle represents a CMC-cluster at different MC time (x axis), the y axis represents
|
| 1001 |
+
the total force exerted by the cluster. The circle size represents the size of the CMC cluster (see sidebar). Color gives a persistent
|
| 1002 |
+
”identity” to each cluster, which last until fusion or fission. On the top right is a snapshot of the vesicle in the last time step.
|
| 1003 |
+
The four largest cluster are highlighted, and also shown on the right of the panel. Below the x-axis, we give snapshots of the
|
| 1004 |
+
vesicle. The rapid initial formation of buds is seen followed by slower fusion of clusters to form elongated protrusions. Two
|
| 1005 |
+
of the final large clusters, the bud and one of the elongated tube, are relatively stable, while the other two elongated clusters
|
| 1006 |
+
have wildly oscillating force. We can see on the right that the fluctuating cluster incorporates a few bare membrane vertices
|
| 1007 |
+
(Fig. 6B,iii). (B) The dynamics of tube formation due to aligned force with highly curved CMCs (top, s = 0.5, r = 30, f = 0.2,
|
| 1008 |
+
C0 = 0.4) compared to formation due to shallow (weakly curved) CMCs with normal force (bottom, f = 0.5, C0 = 0.1). The
|
| 1009 |
+
tubes of the latter are more dynamic and less stable than clusters of the former. This is also seen on the right panel, which
|
| 1010 |
+
shows the total force on the largest clusters, which is far less noisy for the former.
|
| 1011 |
+
|
| 1012 |
+
50
|
| 1013 |
+
Sizes
|
| 1014 |
+
40
|
| 1015 |
+
2
|
| 1016 |
+
30
|
| 1017 |
+
4
|
| 1018 |
+
8
|
| 1019 |
+
20
|
| 1020 |
+
16
|
| 1021 |
+
32
|
| 1022 |
+
10
|
| 1023 |
+
64
|
| 1024 |
+
128
|
| 1025 |
+
256
|
| 1026 |
+
20
|
| 1027 |
+
40
|
| 1028 |
+
60
|
| 1029 |
+
80
|
| 1030 |
+
100
|
| 1031 |
+
120
|
| 1032 |
+
140
|
| 1033 |
+
timestep
|
| 1034 |
+
75
|
| 1035 |
+
50
|
| 1036 |
+
25
|
| 1037 |
+
0
|
| 1038 |
+
200
|
| 1039 |
+
400
|
| 1040 |
+
75
|
| 1041 |
+
50
|
| 1042 |
+
25
|
| 1043 |
+
0
|
| 1044 |
+
200
|
| 1045 |
+
40021
|
| 1046 |
+
FIG. 8: A: Initial progress of simulation with normal-force CMCs (red) and aligned-force CMCs (yellow), in universal binding
|
| 1047 |
+
(top) and type-exclusive binding (bottom), from the side and above (ρalign = 10%, ρnormal = 10%, κ = 28.5, C0 = 0.8, w = 2,
|
| 1048 |
+
f = 0.5, s = 0, 1, r = 15, wad = 0.25). CMCs in the rim drive the spreading of the vesicle on the surface, while some aligned-force
|
| 1049 |
+
CMCs aggregate into a bulb-and-sleeve cluster which drives the formation of a filopodia-like protrusion. This protrusion can
|
| 1050 |
+
attach to the rim cluster and then adhere to the substrate, while it can also detach from the substrate, and consequently also from
|
| 1051 |
+
the rim cluster. B: Evolution of the segregation factor in the simulations (Eq.11). The colored lines give the segregation factor
|
| 1052 |
+
for each cluster, with the cluster size indicated by the line thickness. In the inset we give the average of the total segregation
|
| 1053 |
+
factor for 4 independent simulations. In the universal binding simulation we can see the fliopodia-like cluster repeatedly attach
|
| 1054 |
+
and detach from the rim cluster. The rim cluster is mostly mixed for this case, while the protrusion is much more segregated, as
|
| 1055 |
+
its tip is enriched with aligned-force CMCs.
|
| 1056 |
+
|
| 1057 |
+
0.4
|
| 1058 |
+
1.00
|
| 1059 |
+
1.00
|
| 1060 |
+
0.2
|
| 1061 |
+
0.75
|
| 1062 |
+
0.75
|
| 1063 |
+
factor
|
| 1064 |
+
0.0
|
| 1065 |
+
0.8
|
| 1066 |
+
0.50
|
| 1067 |
+
time 0
|
| 1068 |
+
50
|
| 1069 |
+
100 150 200 250
|
| 1070 |
+
0.50
|
| 1071 |
+
segregation t
|
| 1072 |
+
0.6
|
| 1073 |
+
detachments -
|
| 1074 |
+
0.25
|
| 1075 |
+
0.25
|
| 1076 |
+
0.4
|
| 1077 |
+
0
|
| 1078 |
+
50
|
| 1079 |
+
100
|
| 1080 |
+
150
|
| 1081 |
+
200
|
| 1082 |
+
250
|
| 1083 |
+
time
|
| 1084 |
+
0.00
|
| 1085 |
+
0.00
|
| 1086 |
+
Rim cluster
|
| 1087 |
+
0.25
|
| 1088 |
+
-0.25
|
| 1089 |
+
-0.50
|
| 1090 |
+
-0.50
|
| 1091 |
+
0
|
| 1092 |
+
50
|
| 1093 |
+
100
|
| 1094 |
+
150
|
| 1095 |
+
200
|
| 1096 |
+
250
|
| 1097 |
+
0
|
| 1098 |
+
50
|
| 1099 |
+
100
|
| 1100 |
+
150
|
| 1101 |
+
200
|
| 1102 |
+
250
|
| 1103 |
+
time
|
| 1104 |
+
time22
|
| 1105 |
+
FIG. 9: Movements of IRSp53-localized cellular protrusions. (A, B) The adhesion (A) and apical (B) plane section of the
|
| 1106 |
+
three-dimensional images of an IRSp53-knockout U251 glioblastoma cell expressing GFP-IRSp53 (green) and mCherry-lifeact
|
| 1107 |
+
(red). In (A) and (B), the region for the ∼ 2 µm thick xz section projection is indicated by the cyan dotted rectangle. (C) The
|
| 1108 |
+
xz section of the region of (A). The white lines indicate the plane in (A,B). The yellow line, which was set in the proximity
|
| 1109 |
+
of the surface plane of the cell, indicates the line for the kymograph. (D) The kymograph of the cell surface as indicated in
|
| 1110 |
+
the yellow line in (C), along with the annotation of the representative motion of the IRSp53. (E-F) The xy and xz sections at
|
| 1111 |
+
the regions that are marked in (A,B), from the periphery (E), the middle (F), and the center (G). The plane parallel to the
|
| 1112 |
+
plasma membrane was sectioned and the regions that were projected xy and xz sections each others were marked in cyan dotted
|
| 1113 |
+
rectangles. Arrows indicate the protrusions. The scale bar, 10 µm (A-D), 2 µm (E-G), and 50 sec (D).
|
| 1114 |
+
|
| 1115 |
+
xz section
|
| 1116 |
+
apical plane
|
| 1117 |
+
moving to
|
| 1118 |
+
the center (E)
|
| 1119 |
+
moving to
|
| 1120 |
+
the periphery (F)
|
| 1121 |
+
adhesion plane
|
| 1122 |
+
apical plane
|
| 1123 |
+
merging (G)Supplementary Material
|
| 1124 |
+
S-1.
|
| 1125 |
+
CALCULATION OF THE PERIMETER OF CMC CLUSTERS
|
| 1126 |
+
The CMC-bare membrane boundary is measured by summing the dual of the edges between the cluster and bare
|
| 1127 |
+
membrane. These are the edges in the voronoi lattice, connecting the mid-section of each edge to the circumcenter of
|
| 1128 |
+
the adjacent triangles i.e. the center of the inscribing circle (see figure S-1). Partitioning each triangle between its
|
| 1129 |
+
vertices is already used in the calculation of the curvature [1].
|
| 1130 |
+
S-2.
|
| 1131 |
+
ANALYTICAL CALCULATION OF THE FLAT-PEARLING PHASE TRANSITION LINE
|
| 1132 |
+
We can make a rough analytical estimation for the flat-pearling transition by equating the active work and energy of
|
| 1133 |
+
the flat phase from a mixed phase to the energy of the pearling phase (Fig. S-2). In the flat phase, moving the active
|
| 1134 |
+
CMCs outwards from the radius of the sphere rp to the larger radius of the flattened disc rf results in work. The
|
| 1135 |
+
pearling phase has binding advantage because all CMC vertices are connected, with −w per edge, while the flat rim
|
| 1136 |
+
has large interface (boundary perimeter length) where CMCs vertices neighbor bare membrane vertices, whose edge
|
| 1137 |
+
does not contribute. The pearling phase has a bending disadvantage due to the bare membrane body, which is roughly
|
| 1138 |
+
spherical with an energy of 8πκ, compare to the flat phase where the bare membrane is in two flat discs with no
|
| 1139 |
+
bending energy (both the pearling and rim clusters are curved to fit the CMCs, so they do not have bending energy).
|
| 1140 |
+
− (rf − rp) F = −w (χp − χf) + 8πκ
|
| 1141 |
+
(S-1)
|
| 1142 |
+
The radius difference ∆r = rf − rp (Fig. S-2), and the number of CMC-CMC bonds χp, χf in the pearling and
|
| 1143 |
+
flat phases respectively, are dependant on the geometry of the phases, so they should be very weakly dependant on
|
| 1144 |
+
the specific model parameters. Therefore ∆r and χp − χf do not depend on w, f, κ, and we end up having a linear
|
| 1145 |
+
relation between f and w along the transition line in the f, w phase diagram. In the force-binding strength (f − w)
|
| 1146 |
+
system, we take the values for these geometric quantities from simulations and draw the resulting line on the phase
|
| 1147 |
+
diagram (Fig. S-3, green line), which qualitatively matches the behavior of the transition observed in the simulations.
|
| 1148 |
+
S-3.
|
| 1149 |
+
MIXED CURVATURE CMC CLUSTERS
|
| 1150 |
+
The concave and convex CMCs generate a wavelike pattern, but analyzing it in terms of wavenumber is difficult,
|
| 1151 |
+
since the clusters are part of an irregular, triangulated surface. The undulations of the CMCs in the mixed clusters are
|
| 1152 |
+
essentially independent of C0, and f, as shown in Fig.S-4. Note that we are at the limit of the mesh resolution for
|
| 1153 |
+
these undulations. We have yet to be able to compare this to the experimental results in [2].
|
| 1154 |
+
S-4.
|
| 1155 |
+
MIXED CURVATURE WITH EXCLUSIVE BINDING
|
| 1156 |
+
The mixed curvature system (Fig. 4c in the main text) was also simulated using exclusive binding, i.e. only
|
| 1157 |
+
same-curvature CMCs bind together (Fig.S-5). The result is that the two CMCs types form separated aggregates,
|
| 1158 |
+
with the active convex CMCs aggregating along the rim and forming the flat phase. The passive concave CMC form
|
| 1159 |
+
separated clusters of different shapes, depending on their spontaneous curvature. Highly concave CMCs (C−
|
| 1160 |
+
0 ≤ −0.45)
|
| 1161 |
+
aggregate into internal pearling clusters, that do not affect the flat global phase. The shallower concave CMCs
|
| 1162 |
+
(C−
|
| 1163 |
+
0 ≥ −0.3) aggregate into large, shallow bowl-like patches.
|
| 1164 |
+
In some cases, these concave aggregates are able to form with convex CMC along their rim, since their curvatures
|
| 1165 |
+
complement each other (see for example at C−
|
| 1166 |
+
0 = −0.3). Since the convex active CMC along the rim of the concave
|
| 1167 |
+
cluster apply protrusive forces, they end up forming together a ”cup”-like protrusion. When the force is inhibited,
|
| 1168 |
+
this aggregation occurs, but it is not elongated as a protrusion (compare ”None” with ”Disable” at C−
|
| 1169 |
+
0 = −0.3 in
|
| 1170 |
+
Fig.S-5). Other than that, inhibition doesn’t appear to significantly affect the results in Fig.S-5, since there is no
|
| 1171 |
+
significant contact between the two CMC types. These shapes, in the form of open bowls, resemble early stages of
|
| 1172 |
+
macropinocytosis [3, 4], but do not evolve to induce closure of the ”mouth”, as we observed when the convex and
|
| 1173 |
+
concave CMC had direct interactions (Fig.5 in the main text).
|
| 1174 |
+
arXiv:2301.13055v1 [cond-mat.soft] 30 Jan 2023
|
| 1175 |
+
|
| 1176 |
+
2
|
| 1177 |
+
parameter
|
| 1178 |
+
units
|
| 1179 |
+
Fig.S-3
|
| 1180 |
+
Fig.S-4
|
| 1181 |
+
Fig.S-5
|
| 1182 |
+
Fig.S-6
|
| 1183 |
+
movie 1,2 movie 3,4
|
| 1184 |
+
f
|
| 1185 |
+
KBT/ℓmin 0 − 1.2
|
| 1186 |
+
0.5, 0
|
| 1187 |
+
0.5
|
| 1188 |
+
0.5
|
| 1189 |
+
0.2, 0.5
|
| 1190 |
+
0.5
|
| 1191 |
+
w
|
| 1192 |
+
KBT
|
| 1193 |
+
0 − 0.48
|
| 1194 |
+
2
|
| 1195 |
+
2
|
| 1196 |
+
2
|
| 1197 |
+
2
|
| 1198 |
+
2
|
| 1199 |
+
κ
|
| 1200 |
+
KBT
|
| 1201 |
+
20
|
| 1202 |
+
28.5
|
| 1203 |
+
28.5
|
| 1204 |
+
28.5
|
| 1205 |
+
28.5
|
| 1206 |
+
28.5
|
| 1207 |
+
ρ
|
| 1208 |
+
1
|
| 1209 |
+
10%
|
| 1210 |
+
10%, 10%
|
| 1211 |
+
10%, 10%
|
| 1212 |
+
10%, 10%
|
| 1213 |
+
20%
|
| 1214 |
+
10%, 10%
|
| 1215 |
+
C0
|
| 1216 |
+
1/ℓmin
|
| 1217 |
+
1
|
| 1218 |
+
-0.6 − 0, 0.8 -0.75 − 0, 0.8
|
| 1219 |
+
0.8
|
| 1220 |
+
0.4,0.1
|
| 1221 |
+
0.8
|
| 1222 |
+
TABLE I: The values of the model parameters used in the simulations in the different figures. The energy units are KBT = 1,
|
| 1223 |
+
which define the scale of f, w, κ, and the length units are ℓmin = 1, which define the scale of the vertex lattice, the force, and
|
| 1224 |
+
spontaneous curvature.
|
| 1225 |
+
S-5.
|
| 1226 |
+
VESICLES WITH BOTH NORMAL AND ALIGNED-FORCE CMC, ADHERED TO A FLAT
|
| 1227 |
+
SUBSTRATE
|
| 1228 |
+
In Fig.S-6 we show the dynamics of the vesicle that contains the mixture of aligned-force (yellow) and normal-force
|
| 1229 |
+
(red) CMC, which have exclusive binding interactions between them (see Fig.8 in the main text). At time t = 250
|
| 1230 |
+
we turned off the normal-force CMC, keeping only the aligned-force CMC active. We find that the adhered area
|
| 1231 |
+
shape changes, with the rim regions that contain the curved passive (red) CMC retract into the vesicle, while the
|
| 1232 |
+
aligned-force regions protrude more prominently along the adhered rim.
|
| 1233 |
+
Movies
|
| 1234 |
+
• Movie-S1 Aligned-force simulation of the formation of filopodia-like tubular protrusions (corresponding to
|
| 1235 |
+
Fig.7B), with parameters κ = 28.5, f = 0.2, w = 2, C0 = 0.4, ρ = 20%, s = 0.5, r = 30
|
| 1236 |
+
• Movie-S2 Normal force simulation, in the regime of tubes shapes (corresponding to Fig.7B), with parameters
|
| 1237 |
+
κ = 28.5, f = 0.5, w = 2, C0 = 0.1, ρ = 20%
|
| 1238 |
+
• Movie-S3 Adhered, universal-binding between normal-force CMCs (red) and aligned-force CMCs (yellow),
|
| 1239 |
+
corresponding to Fig.8A. Parameters used: κ = 28.5, f = 0.5, w = 2, wad = 0.25, C0 = 0.8, ρn = 10%, ρa =
|
| 1240 |
+
10%, s = 1, r = 15
|
| 1241 |
+
• Movie-S4 Adhered, exclusive-binding between normal-force CMCs (red) and aligned-force CMCs (yellow),
|
| 1242 |
+
corresponding to Fig.8A. Parameters used: κ = 28.5, f = 0.5, w = 2, wad = 0.25, C0 = 0.8, ρn = 10%, ρa =
|
| 1243 |
+
10%, s = 1, r = 15
|
| 1244 |
+
• Movie-S5. The 3D movie of the cell in Figure 9A
|
| 1245 |
+
• Movie-S6. The movie of the XY and XZ section for Figure 9E
|
| 1246 |
+
• Movie-S7. The movie of the XY and XZ section for Figure 9F
|
| 1247 |
+
• Movie-S8. The movie of the XY and XZ section for Figure 9G
|
| 1248 |
+
[1] G. Gompper and D. M. Kroll, in Statistical Mechanics of Membranes and Surfaces (WORLD SCIENTIFIC, 2004), pp.
|
| 1249 |
+
359–426.
|
| 1250 |
+
[2] E. Sitarska, S. D. Almeida, M. S. Beckwith, J. Stopp, Y. Schwab, M. Sixt, A. Kreshuk, A. Erzberger, and A. Diz-Mu˜noz,
|
| 1251 |
+
bioRxiv p. 2021.03.26.437199 (2021).
|
| 1252 |
+
[3] D. M. Veltman, T. D. Williams, G. Bloomfield, B.-C. Chen, E. Betzig, R. H. Insall, and R. R. Kay, Elife 5, e20085 (2016).
|
| 1253 |
+
[4] R. R. Kay, Cells & Development 168, 203713 (2021).
|
| 1254 |
+
|
| 1255 |
+
3
|
| 1256 |
+
FIG. S-1: Sketch of the boundary of connected clusters: for each edge between the cluster and the outside, a line is drawn from
|
| 1257 |
+
the middle to the center each of the adjacent triangles. We ignore the single-clusters (dashed line)
|
| 1258 |
+
FIG. S-2: Schematic description of the transition between flat and pearling phases, from an initially mixed, spherical phase (at
|
| 1259 |
+
the center). Bare membrane is in white, and CMCs in red, and mixed composition in pink. The flat transition result in all
|
| 1260 |
+
CMCs moving from the surface of the sphere to the rim of a flat disc, which has a larger radius ∆r. Due to active force f,
|
| 1261 |
+
this generates work W = −f∆r. The bending energy of the CMCs on the rim and in the pearling clusters is assumed to be
|
| 1262 |
+
approximately 0, but the spherical body of bare membrane in the pearling phase has a bending energy of a closed sphere: 8πκ,
|
| 1263 |
+
while it is zero for the flat discs of bare membrane in the flat phase (since they are flat). Finally, the number of CMC-CMC
|
| 1264 |
+
bonds in the pearling phase χp is larger than in the flat phase χf, since in the flat phase it is reduced due to the large boundary
|
| 1265 |
+
between the rim cluster the the flat bare membrane discs.
|
| 1266 |
+
|
| 1267 |
+
f△r
|
| 1268 |
+
8πK4
|
| 1269 |
+
FIG. S-3: Phase diagram of the force-binding strength system, with an analytically-derived transition line for the pearling-flat
|
| 1270 |
+
transition (green line, Eq.S-1).
|
| 1271 |
+
FIG. S-4: The undulation of a CMC cluster with (A) highly concave (−0.6) active CMC (B) with shallow concave (−0.001)
|
| 1272 |
+
CMC and disabled force. The size and shape of the clusters is very different, but the peaks and troughs patterning due to CMC
|
| 1273 |
+
shape is at the limit of the mesh resolution for both.
|
| 1274 |
+
|
| 1275 |
+
20
|
| 1276 |
+
12
|
| 1277 |
+
longai
|
| 1278 |
+
04
|
| 1279 |
+
96
|
| 1280 |
+
88
|
| 1281 |
+
Buds
|
| 1282 |
+
80
|
| 1283 |
+
72
|
| 1284 |
+
64
|
| 1285 |
+
56
|
| 1286 |
+
48
|
| 1287 |
+
earlino
|
| 1288 |
+
40
|
| 1289 |
+
32
|
| 1290 |
+
24
|
| 1291 |
+
16
|
| 1292 |
+
08(A)
|
| 1293 |
+
(B)5
|
| 1294 |
+
FIG. S-5: Active convex and passive concave system (red and blue, respectively), with binding between same type only. As in
|
| 1295 |
+
the universal binding case, the suppressive and disabling inhibition do not have any strong effects, since the types are separated.
|
| 1296 |
+
Simulations with C−
|
| 1297 |
+
0 ≤ −0.3 are draw semi-transparent. In all cases, the convex CMCs aggregate in a rim, making the vesicle
|
| 1298 |
+
flat, and concave CMCs aggregate in pearling for C−
|
| 1299 |
+
0 < −0.3, bowl-like patches for C−
|
| 1300 |
+
0 > −0.3, and both for C−
|
| 1301 |
+
0 = −0.3.
|
| 1302 |
+
|
| 1303 |
+
6
|
| 1304 |
+
FIG. S-6: Overview of an adhered vesicle with a mixture of aligned-force (yellow) and normal-force (red) CMC, which have
|
| 1305 |
+
exclusive binding interactions between them (see Fig.8 in the main text). At time t = 250 the force is disabled for the
|
| 1306 |
+
normal-force CMCs, leaving only the aligned-force CMCs active. The original simulation is given on the top (times 0 − 100),
|
| 1307 |
+
and the simulation after the normal-force has been disabled is at the bottom.
|
| 1308 |
+
|
09FPT4oBgHgl3EQfTzT7/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
0NE0T4oBgHgl3EQfuAEL/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:beabefade3125d84a32d15e2b9fc837cb1044190f5b318f594916eb9fa231501
|
| 3 |
+
size 214946
|
0dE0T4oBgHgl3EQfdQAz/content/2301.02373v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:db72da4bbfb9f0d8a3d0ae04393ab17426d2817636ab4f29e318013574f4cabc
|
| 3 |
+
size 1149364
|
0dE0T4oBgHgl3EQfdQAz/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:54741b01aec35316ade50059c52a02816abc01076ae445bf14328db55c400663
|
| 3 |
+
size 186207
|
2dAyT4oBgHgl3EQfPvZl/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:5b0691c3b4953c66d1153295e3811421d5c59f50bb7589729f0aae8e3bc30def
|
| 3 |
+
size 1900589
|
39AyT4oBgHgl3EQfP_aH/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:ea35ba6b678140d8ebeb07e626c992184d5014c7127e80d24683d4cb2f2e5e14
|
| 3 |
+
size 3604525
|
39AyT4oBgHgl3EQfP_aH/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:1e30d6c9669d24faaa686d7924d702a60b89aa8667c1ed57a2a07a9f980e6db8
|
| 3 |
+
size 132178
|
39AzT4oBgHgl3EQf9f54/content/2301.01920v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:8cf47c369078df06d4e69d5ccae0231442a4bca44db6fcb9e71c6716e95d2904
|
| 3 |
+
size 306215
|
39AzT4oBgHgl3EQf9f54/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:65a05b1787ac794377798a8398327e570abdf122146c6cfc697677275d864ab7
|
| 3 |
+
size 1572909
|
39AzT4oBgHgl3EQf9f54/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:4ccd548c9d9e059c261856e6078b911bae8fd472fb363334bada74058cd639b9
|
| 3 |
+
size 57417
|
4dE2T4oBgHgl3EQf6Qjc/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:f6fb507d0f141987111733433b7e6747d0e0675b2a45e16b9128e49ae06d4fa2
|
| 3 |
+
size 239529
|
5NAzT4oBgHgl3EQf9v7Q/content/2301.01925v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:a542b4fb2a66e02de76930b25c0d209f9b56fb0c2f29b337130c787dfa33b75b
|
| 3 |
+
size 234699
|
5NAzT4oBgHgl3EQf9v7Q/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:63b5bbe9606650596034fcd5c3eea9182790f9b45bc85d99a97d59b367b393ef
|
| 3 |
+
size 2555949
|
5NAzT4oBgHgl3EQf9v7Q/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:50c45b4aef8cdf65eadf09d716eca6cace1ad2f136b5343af77a4b174311c815
|
| 3 |
+
size 85246
|
5NAzT4oBgHgl3EQffvy-/content/tmp_files/2301.01458v1.pdf.txt
ADDED
|
@@ -0,0 +1,1303 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
An improved hybrid regularization approach for extreme
|
| 2 |
+
learning machine
|
| 3 |
+
Liangjuan Zhou
|
| 4 |
+
School of Mathematics, Hunan University
|
| 5 |
+
Changsha, China
|
| 6 |
+
Wei Miao∗
|
| 7 |
+
miaow@hnu.edu.cn
|
| 8 |
+
School of Mathematics, Hunan University
|
| 9 |
+
Changsha, China
|
| 10 |
+
ABSTRACT
|
| 11 |
+
Extreme learning machine (ELM) is a network model that arbitrarily
|
| 12 |
+
initializes the first hidden layer and can be computed speedily.
|
| 13 |
+
In order to improve the classification performance of ELM, a ℓ2
|
| 14 |
+
and ℓ0.5 regularization ELM model (ℓ2-ℓ0.5-ELM) is proposed in
|
| 15 |
+
this paper. An iterative optimization algorithm of the fixed point
|
| 16 |
+
contraction mapping is applied to solve the ℓ2-ℓ0.5-ELM model. The
|
| 17 |
+
convergence and sparsity of the proposed method are discussed
|
| 18 |
+
and analyzed under reasonable assumptions. The performance of
|
| 19 |
+
the proposed ℓ2-ℓ0.5-ELM method is compared with BP, SVM, ELM,
|
| 20 |
+
ℓ0.5-ELM, ℓ1-ELM, ℓ2-ELM and ℓ2-ℓ1ELM, the results show that the
|
| 21 |
+
prediction accuracy, sparsity, and stability of the ℓ2-ℓ0.5-ELM are
|
| 22 |
+
better than the other 7 models.
|
| 23 |
+
CCS CONCEPTS
|
| 24 |
+
• Mathematics of computing → Convex optimization; • Com-
|
| 25 |
+
puting methodologies → Regularization.
|
| 26 |
+
KEYWORDS
|
| 27 |
+
High-dimensional data, Sparsity, Hybird regularization, Dimension-
|
| 28 |
+
ality reduction
|
| 29 |
+
ACM Reference Format:
|
| 30 |
+
Liangjuan Zhou and Wei Miao. 2022. An improved hybrid regularization
|
| 31 |
+
approach for extreme learning machine. In 2022 4th International Conference
|
| 32 |
+
on Advanced Information Science and System (AISS 2022), November 25–27,
|
| 33 |
+
2022, Sanya, China. ACM, New York, NY, USA, 7 pages. https://doi.org/10.
|
| 34 |
+
1145/3573834.3574501
|
| 35 |
+
1
|
| 36 |
+
INTRODUCTION
|
| 37 |
+
Feedforward neural networks(FNNs), as one of the most frequently
|
| 38 |
+
used neural networks which can be defined mathematically as:
|
| 39 |
+
𝐺𝑁 (𝑥𝑖) =
|
| 40 |
+
𝑁
|
| 41 |
+
∑︁
|
| 42 |
+
𝑖=1
|
| 43 |
+
𝛽𝑖𝑔(⟨𝜔𝑖,𝑥𝑖⟩ + 𝑏𝑖),
|
| 44 |
+
where 𝑥𝑖 = (𝑥𝑖1,𝑥𝑖2, . . . ,𝑥𝑖𝑝) ∈ R𝑝 is the input, 𝑏𝑖 is the bias and 𝑔
|
| 45 |
+
is the activation function. ⟨𝜔𝑖,𝑥𝑖⟩ = �𝑝
|
| 46 |
+
𝑗=1 𝜔𝑖𝑗𝑥𝑖𝑗 is the euclidean
|
| 47 |
+
∗Both authors contributed equally to this research.
|
| 48 |
+
Permission to make digital or hard copies of all or part of this work for personal or
|
| 49 |
+
classroom use is granted without fee provided that copies are not made or distributed
|
| 50 |
+
for profit or commercial advantage and that copies bear this notice and the full citation
|
| 51 |
+
on the first page. Copyrights for components of this work owned by others than ACM
|
| 52 |
+
must be honored. Abstracting with credit is permitted. To copy otherwise, or republish,
|
| 53 |
+
to post on servers or to redistribute to lists, requires prior specific permission and/or a
|
| 54 |
+
fee. Request permissions from permissions@acm.org.
|
| 55 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 56 |
+
© 2022 Association for Computing Machinery.
|
| 57 |
+
ACM ISBN 978-1-4503-9793-3/22/11...$15.00
|
| 58 |
+
https://doi.org/10.1145/3573834.3574501
|
| 59 |
+
inner product, 𝜔𝑖 = (𝜔𝑖1,𝜔𝑖2, . . . ,𝜔𝑖𝑝) ∈ R𝑝 are the weights con-
|
| 60 |
+
necting the input and the 𝑖-th hidden node, and 𝛽𝑖 ∈ R are the
|
| 61 |
+
weights connecting the 𝑖-th hidden and output node. In terms of
|
| 62 |
+
the traditional learning algorithm of FNNs, all parameters in the
|
| 63 |
+
network need to be adjusted based on specific tasks. A classical
|
| 64 |
+
learning method is the backpropagation (BP) algorithm, which is
|
| 65 |
+
mainly solved by gradient descent:
|
| 66 |
+
min
|
| 67 |
+
𝜔𝑖,𝛽𝑖,𝑏𝑖
|
| 68 |
+
𝑛
|
| 69 |
+
∑︁
|
| 70 |
+
𝑖=1
|
| 71 |
+
∥𝑡𝑖 − 𝐺𝑁 (𝑥𝑖)∥2
|
| 72 |
+
2,
|
| 73 |
+
where (𝑥𝑖,𝑡𝑖)(𝑖 = 1, 2, . . . ,𝑛) denotes the training samples. How-
|
| 74 |
+
ever, a randomized learner model, different to the traditional learn-
|
| 75 |
+
ing of FNNs, called as Extreme learning machine(ELM) and related
|
| 76 |
+
algorithms were proposed by Huang[10]. In the ELM model, 𝜔𝑖 and
|
| 77 |
+
𝑏𝑖 are randomly assigned without training, so only 𝛽𝑖 needs to be
|
| 78 |
+
trained. Set T = [𝑡1,𝑡2, . . . ,𝑡𝑛] and
|
| 79 |
+
H =
|
| 80 |
+
|
| 81 |
+
𝑔(⟨𝜔1,𝑥1⟩ + 𝑏1)
|
| 82 |
+
. . .
|
| 83 |
+
𝑔(⟨𝜔𝑁,𝑥1⟩ + 𝑏𝑁 )
|
| 84 |
+
...
|
| 85 |
+
. . .
|
| 86 |
+
...
|
| 87 |
+
𝑔(⟨𝜔1,𝑥𝑛⟩ + 𝑏1)
|
| 88 |
+
. . .
|
| 89 |
+
𝑔(⟨𝜔𝑁,𝑥𝑛⟩ + 𝑏𝑁 )
|
| 90 |
+
|
| 91 |
+
,
|
| 92 |
+
(1)
|
| 93 |
+
once the input weights and biases are specified randomly with uni-
|
| 94 |
+
form distribution in [−𝑐,𝑐], the hidden output matrix remains un-
|
| 95 |
+
changed during the training phase. Accordingly, the output weights
|
| 96 |
+
could be written by utilizing the least squares method:
|
| 97 |
+
min
|
| 98 |
+
𝛽 ∈R𝑁
|
| 99 |
+
�
|
| 100 |
+
∥H𝛽 − T∥2
|
| 101 |
+
2
|
| 102 |
+
�
|
| 103 |
+
,
|
| 104 |
+
(2)
|
| 105 |
+
the solution to model (2) could be written as 𝛽 = H†T, where H†
|
| 106 |
+
is the Moore–Penrose generalized inverse of hidden output matrix
|
| 107 |
+
H[14].
|
| 108 |
+
The theoretical basis for the general approximation capability of
|
| 109 |
+
ELM networks has been proposed and established by Igelnik[11] ,
|
| 110 |
+
where the range of randomly allocated input weights and biases
|
| 111 |
+
are data related and assigned in a constructive mode. Consequently,
|
| 112 |
+
the scope of parameters in the algorithm implementation should
|
| 113 |
+
be carefully estimated for diverse datasets. On the other hand,
|
| 114 |
+
considering the sparsity of the output parameter 𝛽 for many high-
|
| 115 |
+
dimensional data, Cao et al.[4] proposed a ℓ1 regular ELM model
|
| 116 |
+
based on the sparsity of the ℓ1 regularization term, which takes the
|
| 117 |
+
following form:
|
| 118 |
+
min
|
| 119 |
+
𝛽 ∈R𝑁
|
| 120 |
+
� 1
|
| 121 |
+
2 ∥H𝛽 − T∥2
|
| 122 |
+
2 + 𝜆∥𝛽∥1
|
| 123 |
+
�
|
| 124 |
+
,
|
| 125 |
+
(3)
|
| 126 |
+
where 𝜆 > 0 is a regularization parameter and 𝛽 is the output
|
| 127 |
+
coefficient calculated by iteration. This model is called the Lasso
|
| 128 |
+
model, and has been studied by many scholars in recent years [15].
|
| 129 |
+
arXiv:2301.01458v1 [math.OC] 4 Jan 2023
|
| 130 |
+
|
| 131 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 132 |
+
Zhou and Miao.
|
| 133 |
+
For the model (2), Fan et al. [8] added a ℓ0.5 regularization term
|
| 134 |
+
to the ELM model, based on the solution generated by ℓ0.5 is sparser
|
| 135 |
+
than the ℓ1 regularization term [16], and the model is defined as
|
| 136 |
+
follows:
|
| 137 |
+
min
|
| 138 |
+
𝛽 ∈R𝑁
|
| 139 |
+
� 1
|
| 140 |
+
2 ∥H𝛽 − T∥2
|
| 141 |
+
2 + 𝜆∥𝛽∥0.5
|
| 142 |
+
�
|
| 143 |
+
,
|
| 144 |
+
(4)
|
| 145 |
+
where 𝜆 > 0 is a regularization parameter, the model can be solved
|
| 146 |
+
by the iterative semi-threshold algorithm [16].
|
| 147 |
+
The other regularization model for model (2) was about the ℓ2
|
| 148 |
+
regularization term (ℓ2-ELM) [5]:
|
| 149 |
+
min
|
| 150 |
+
𝛽 ∈R𝑁
|
| 151 |
+
� 1
|
| 152 |
+
2 ∥H𝛽 − T∥2
|
| 153 |
+
2 + 𝜇∥𝛽∥2
|
| 154 |
+
2
|
| 155 |
+
�
|
| 156 |
+
,
|
| 157 |
+
(5)
|
| 158 |
+
where 𝜇 is a regularization parameter, and when the expression
|
| 159 |
+
H𝑇 H+𝜇I is invertible after choosing the parameter 𝜇, then the solu-
|
| 160 |
+
tion of the model (5) can be written as 𝛽 = (H𝑇 H + 𝜇I)−1I)−1H𝑇 T.
|
| 161 |
+
Hai et al.[9] proposed a ℓ2-ℓ1-ELM hybrid model by integrating
|
| 162 |
+
the sparsity of the ℓ1 regularization term and the stability of the ℓ2
|
| 163 |
+
regularization term as follows:
|
| 164 |
+
min
|
| 165 |
+
𝛽 ∈R𝑁
|
| 166 |
+
� 1
|
| 167 |
+
2 ∥H𝛽 − T∥2
|
| 168 |
+
2 + 𝜆(𝛾∥𝛽∥1 + 𝜀∥𝛽∥2
|
| 169 |
+
2)
|
| 170 |
+
�
|
| 171 |
+
,
|
| 172 |
+
(6)
|
| 173 |
+
where 𝜆 ≥ 0, 𝛾 ≥ 0 and 𝜀 ≥ 0 are regularization parameters. In-
|
| 174 |
+
spired by the ℓ2-ℓ1-ELM model, according to Xu et al.[17], they
|
| 175 |
+
found that the sparsity of the solution of the ℓ𝑝 (𝑝 ∈ (0, 1)) regular-
|
| 176 |
+
ization term: when 0 < 𝑝 < 0.5, there is no significant difference in
|
| 177 |
+
the sparse effect of ℓ𝑝; when 0.5 < 𝑝 < 1, the smaller 𝑝, the better
|
| 178 |
+
the sparse effect, so the ℓ0.5 regularization term can be used as a
|
| 179 |
+
representative element of ℓ𝑝 (𝑝 ∈ (0, 1)); Therefore, we propose the
|
| 180 |
+
ℓ2-ℓ0.5-ELM model by combining the stability of ℓ2 regularization
|
| 181 |
+
term and the sparsity of ℓ0.5 which is sparser than ℓ1, the new
|
| 182 |
+
model is described as:
|
| 183 |
+
min
|
| 184 |
+
𝛽 ∈R𝑁
|
| 185 |
+
� 1
|
| 186 |
+
2 ∥H𝛽 − T∥2
|
| 187 |
+
2 + 𝜆(𝛾∥𝛽∥0.5 + 𝜀∥𝛽∥2
|
| 188 |
+
2)
|
| 189 |
+
�
|
| 190 |
+
,
|
| 191 |
+
(7)
|
| 192 |
+
where the parameters have the same meaning as the expression
|
| 193 |
+
of (6). The thought of adding ℓ0.5 and ℓ2 penalties simultaneously in
|
| 194 |
+
the optimization model could be found in classification [2, 6]. This
|
| 195 |
+
study mainly establishes an iterative algorithm and studies some
|
| 196 |
+
properties of randomized learner model as Hai[9]. In particular, we
|
| 197 |
+
integrate the features of ELM and propose an iterative strategy for
|
| 198 |
+
solving the hybrid model (7). The main contributions of this paper
|
| 199 |
+
can be summarized as follows:
|
| 200 |
+
(i) The whole model is a non-convex, non-smooth and non-
|
| 201 |
+
Lipschitz optimization problem due to the existence of ℓ0.5 norm.
|
| 202 |
+
We propose a new algorithm called as an ℓ2-ℓ0.5-ELM algorithm.
|
| 203 |
+
This algorithm is proved to be effective by analyzing the sum mini-
|
| 204 |
+
mization problem of two convex functions with certain characteris-
|
| 205 |
+
tics.
|
| 206 |
+
(ii) The key theoretical properties such as convergence, sparsity
|
| 207 |
+
are derived to guarantee the feasibility of the proposed method.
|
| 208 |
+
(iii) Numerous experiments were carried out, including some
|
| 209 |
+
UCI datasets collected from experts and intelligent systems fields,
|
| 210 |
+
gene datasets and ORL face image datasets. Experimental results
|
| 211 |
+
show that the better performance of the proposed ℓ2- ℓ0.5-ELM
|
| 212 |
+
algorithm.
|
| 213 |
+
The rest of this paper is organized as follows. Section 2 reviews
|
| 214 |
+
some basic concepts and theories. Section 3 demonstrates the itera-
|
| 215 |
+
tive method by a fixed point equation and proposes a algorithm for
|
| 216 |
+
ℓ2 - ℓ0.5-ELM model. In Section 4, some theoretical results about
|
| 217 |
+
convergence and sparsity are analyzed. In Section 5, experimental
|
| 218 |
+
results on UCI datasets, gene datasets and ORL face image datasets
|
| 219 |
+
are shown. The conclusion is drawn in Section 6.
|
| 220 |
+
2
|
| 221 |
+
PRELIMINARIES
|
| 222 |
+
In this section, we present some fundamental concepts and con-
|
| 223 |
+
vex optimization theorems primarily. Initially, it is about the half-
|
| 224 |
+
thresholding function[16]. 𝒫(𝜆,𝑡) : R → R, 𝜆 > 0, which can be
|
| 225 |
+
written as:
|
| 226 |
+
𝒫(𝜆,𝑡) =
|
| 227 |
+
� 2
|
| 228 |
+
3𝑡
|
| 229 |
+
�
|
| 230 |
+
1 + cos
|
| 231 |
+
� 2(𝜋−𝜙 (𝑡))
|
| 232 |
+
3
|
| 233 |
+
��
|
| 234 |
+
|𝑡| > 3
|
| 235 |
+
4𝜆
|
| 236 |
+
2
|
| 237 |
+
3
|
| 238 |
+
0
|
| 239 |
+
|𝑡| ≤ 3
|
| 240 |
+
4𝜆
|
| 241 |
+
2
|
| 242 |
+
3
|
| 243 |
+
,
|
| 244 |
+
(8)
|
| 245 |
+
where 𝜙(𝑡) = arccos
|
| 246 |
+
�
|
| 247 |
+
𝜆
|
| 248 |
+
8 ( |𝑡 |
|
| 249 |
+
3 )− 3
|
| 250 |
+
2
|
| 251 |
+
�
|
| 252 |
+
, 𝜋 = 3.14, and then the corre-
|
| 253 |
+
sponding half-thresholding operator half(𝜆, 𝛽) : R𝑁 → R𝑁 acts
|
| 254 |
+
component-wise as:
|
| 255 |
+
[half(𝜆, 𝛽)]𝑖 = 𝒫(𝜆, 𝛽𝑖).
|
| 256 |
+
(9)
|
| 257 |
+
Next, we introduce one key characteristic of the half-thresholding
|
| 258 |
+
operator [7, 16]:
|
| 259 |
+
∥half(𝜆,𝑡) − half(𝜆,𝑡 ′)∥ ≤ ∥𝑡 − 𝑡 ′∥.
|
| 260 |
+
(10)
|
| 261 |
+
Another crucial notion of convex optimization is the proximity
|
| 262 |
+
operator [12]:
|
| 263 |
+
prox𝜑𝛽 = arg min
|
| 264 |
+
�
|
| 265 |
+
∥𝑢 − 𝛽∥2
|
| 266 |
+
2 + 𝜑(𝑢)
|
| 267 |
+
�
|
| 268 |
+
,
|
| 269 |
+
where𝜙 is a real-valued convex function on R𝑁 . A primary property
|
| 270 |
+
of the proximity operator is drawn in Proposition 1[7], which will
|
| 271 |
+
be utilized to prove our major result.
|
| 272 |
+
Proposition 1. Let 𝜑 be a real-valued convex function on R𝑁 .
|
| 273 |
+
Suppose 𝜓 (·) = 𝜑 + 𝜌
|
| 274 |
+
2 ∥ · ∥2
|
| 275 |
+
2 + ⟨·,𝑢⟩ + 𝜎, where 𝑢 ∈ R𝑁 , 𝜌 ∈ [0, ∞),
|
| 276 |
+
𝜎 ∈ R, then
|
| 277 |
+
prox𝜓 𝛽 = prox𝜑/(1+𝜌) ((𝛽 − 𝑢)/(1 + 𝜌)).
|
| 278 |
+
(11)
|
| 279 |
+
3
|
| 280 |
+
SOLUTION: FIXED POINT ITERATIVE
|
| 281 |
+
ALGORITHM FOR THE MODEL
|
| 282 |
+
For the ELM, the output matrix H is a bounded linear operator from
|
| 283 |
+
R𝑁 to R𝑚 owing to the activation function 𝑔(·) ∈ (0, 1), which is
|
| 284 |
+
finite. In order to further improve the accuracy and sparsity, we
|
| 285 |
+
employ the regularization model (7) to estimate the output weights
|
| 286 |
+
of the network. We define concisely as:
|
| 287 |
+
𝑝𝛾,𝜀 = 𝛾∥𝛽∥0.5 + 𝜀∥𝛽∥2
|
| 288 |
+
2,
|
| 289 |
+
where 𝜀, 𝛾 ≥ 0, 𝑝𝛾,𝜀 : R𝑁 → [0, ∞). Then the model (7) can be
|
| 290 |
+
redefined as
|
| 291 |
+
min
|
| 292 |
+
𝛽 ∈R𝑁
|
| 293 |
+
� 1
|
| 294 |
+
2 ∥H𝛽 − T∥2
|
| 295 |
+
2 + 𝜆𝑝𝛾,𝜀
|
| 296 |
+
�
|
| 297 |
+
.
|
| 298 |
+
(12)
|
| 299 |
+
Furthermore, we introduce the following Lemma and Theorem
|
| 300 |
+
which will be utilized to solve our model:
|
| 301 |
+
|
| 302 |
+
An improved hybrid regularization approach for extreme learning machine
|
| 303 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 304 |
+
Lemma 1. For all 𝜆 > 0 and 𝛽 ∈ R𝑁 ,the half-thresholding operator
|
| 305 |
+
(8) can be described as:
|
| 306 |
+
half(𝜆, 𝛽) = arg min
|
| 307 |
+
𝑢
|
| 308 |
+
� 1
|
| 309 |
+
2 ∥𝑢 − 𝛽∥2
|
| 310 |
+
2 + 𝜆∥𝑢∥0.5
|
| 311 |
+
�
|
| 312 |
+
.
|
| 313 |
+
Lemma 2. For all 𝜆
|
| 314 |
+
>
|
| 315 |
+
0,𝛾
|
| 316 |
+
≥
|
| 317 |
+
0,𝜀
|
| 318 |
+
≥
|
| 319 |
+
0 and 𝛽
|
| 320 |
+
∈
|
| 321 |
+
R𝑁 ,
|
| 322 |
+
half(
|
| 323 |
+
𝜆𝛾
|
| 324 |
+
1+2𝜀𝜆,
|
| 325 |
+
𝛽
|
| 326 |
+
1+2𝜀𝜆 ) is the proximity operator of 𝜆𝑝𝛾,𝜀 (𝛽).
|
| 327 |
+
Theorem 1. Let 𝜆 > 0, 𝛾 ≥ 0, 𝜀 ≥ 0 and 𝛿 ∈ (0, ∞). Then 𝛽 is
|
| 328 |
+
a minimizer of function (12) if and only if it meets the fixed point
|
| 329 |
+
equation:
|
| 330 |
+
𝛽 = half
|
| 331 |
+
�
|
| 332 |
+
𝛿𝜆𝛾
|
| 333 |
+
1 + 2𝜀𝜆𝛿 , (I − 𝛿H𝑇 H)𝛽 − 𝛿H𝑇 T
|
| 334 |
+
1 + 2𝜀𝜆𝛿
|
| 335 |
+
�
|
| 336 |
+
,
|
| 337 |
+
(13)
|
| 338 |
+
where the unit operator I : R𝑁 → R𝑁 , the definition of H is shown
|
| 339 |
+
in (1), and H𝑇 represents the adjoint of H.
|
| 340 |
+
Moreover, from the property of the proximity operator, we can
|
| 341 |
+
drive a precise statement for the Lipschitz constant of a contractive
|
| 342 |
+
map and the corresponding theorem as follows.
|
| 343 |
+
Theorem 2. Set 𝜆 > 0,𝛾 ≥ 0,𝜀 ≥ 0 and 𝛿 ∈ (0, ∞). Suppose that
|
| 344 |
+
there exist two positive constants 𝜅0 and 𝜅, such that the norm of the
|
| 345 |
+
output matrix H shown in (1) of the hidden layer is finite by them,
|
| 346 |
+
namely 𝜅0 ≤ ∥H𝑇 H∥2 ≤ 𝜅, Thus 𝛽 is a minimizer of (12) if and
|
| 347 |
+
only if it is a fixed point of the Lipchitz map Γ : R𝑁 → R𝑁 , that is,
|
| 348 |
+
𝛽 = Γ𝛽 where
|
| 349 |
+
Γ𝛽 = half
|
| 350 |
+
�
|
| 351 |
+
𝛿𝜆𝛾
|
| 352 |
+
1 + 2𝜀𝜆𝛿 , (I − 𝛿H𝑇 H)𝛽 + 𝛿H𝑇 T
|
| 353 |
+
1 + 2𝜀𝜆𝛿
|
| 354 |
+
�
|
| 355 |
+
.
|
| 356 |
+
(14)
|
| 357 |
+
Selecting𝛿 =
|
| 358 |
+
2
|
| 359 |
+
𝜅0+𝜅 , the Lipschitz constant is finite by𝑞 = 1− 2𝜅0
|
| 360 |
+
𝜅 + 𝜅0
|
| 361 |
+
≤
|
| 362 |
+
1. In particular, if 𝜅0 > 0, we can get Γ is a contractive map.
|
| 363 |
+
Theorem 1 and Theorem 2 illustrate that the problem of ℓ2-ℓ0.5-
|
| 364 |
+
ELM can be described as a fixed point algorithm. Furthermore, the
|
| 365 |
+
next theorem will introduce the iterative procedure of the ℓ2-ℓ0.5-
|
| 366 |
+
ELM.
|
| 367 |
+
Theorem 3. Suppose that 𝜅0 and 𝜅 are positive constants, such
|
| 368 |
+
that the norm of the output matrix H shown in (1) of the hidden
|
| 369 |
+
layer is finite by them, namely, 𝜅0 ≤ ∥H𝑇 H∥2 ≤ 𝜅, and the sequence
|
| 370 |
+
{𝛽}∞
|
| 371 |
+
𝑙=0 ⊆ R𝑁 is described iteratively as
|
| 372 |
+
𝛽𝑙 = half
|
| 373 |
+
�
|
| 374 |
+
𝛿𝜆𝛾
|
| 375 |
+
1 + 2𝜀𝜆𝛿 , (I − 𝛿H𝑁 H)𝛽𝑙−1 − 𝛿H𝑇 T
|
| 376 |
+
1 + 2𝜀𝜆𝛿
|
| 377 |
+
�
|
| 378 |
+
,
|
| 379 |
+
(15)
|
| 380 |
+
where 𝑙 = 1, 2, 3, . . . , 𝜆 > 0,𝜀 > 0,𝛾 ≥ 0 and 𝛿 =
|
| 381 |
+
2
|
| 382 |
+
𝜅+𝜅0 . Thus {𝛽𝑙 }∞
|
| 383 |
+
𝑙=0
|
| 384 |
+
strongly converges the minimizer of model (10) in spite of the choice
|
| 385 |
+
of 𝛽0.
|
| 386 |
+
Remark 1. It is not difficult to obtain from the proof of Theorem 3.
|
| 387 |
+
∥𝛽𝑙 − 𝛽∗∥2 ≤
|
| 388 |
+
𝜅 + 𝜅0
|
| 389 |
+
𝜅0(𝜅 + 𝜅0 + 4𝜀𝜆)
|
| 390 |
+
�𝜅 − 𝜅0
|
| 391 |
+
𝜅 + 𝜅0
|
| 392 |
+
�𝑙
|
| 393 |
+
∥H𝑇 T∥2.
|
| 394 |
+
Therefore, for each 𝜉 > 0, if
|
| 395 |
+
𝜅 + 𝜅0
|
| 396 |
+
𝜅0(𝜅 + 𝜅0 + 4𝜀𝜆)
|
| 397 |
+
�𝜅 − 𝜅0
|
| 398 |
+
𝜅 + 𝜅0
|
| 399 |
+
�𝑙
|
| 400 |
+
∥𝛽1 − 𝛽0∥2 < 𝜉.
|
| 401 |
+
namely,
|
| 402 |
+
𝑙 >
|
| 403 |
+
log
|
| 404 |
+
� ∥𝛽1−𝛽0 ∥2(𝜅+𝜅0)
|
| 405 |
+
𝜉𝜅0(𝜅+𝜅0+4𝜀𝜆)
|
| 406 |
+
�
|
| 407 |
+
log
|
| 408 |
+
� 𝜅+𝜅0
|
| 409 |
+
𝜅−𝜅0
|
| 410 |
+
�
|
| 411 |
+
,
|
| 412 |
+
thus
|
| 413 |
+
∥𝛽𝑙 − 𝛽∗∥2 < 𝜉.
|
| 414 |
+
As a conclusion, the complete ℓ2-ℓ0.5-ELM algorithm is given in
|
| 415 |
+
Algorithm 1 which integrates the result of Theorem 3 and Remark
|
| 416 |
+
1. Next section, we want give some properties of our proposed
|
| 417 |
+
algorithm.
|
| 418 |
+
Algorithm 1: the algorithm for ℓ2-ℓ0.5-ELM model
|
| 419 |
+
Input:Given
|
| 420 |
+
a
|
| 421 |
+
set
|
| 422 |
+
of
|
| 423 |
+
training
|
| 424 |
+
samples
|
| 425 |
+
𝒻
|
| 426 |
+
=
|
| 427 |
+
�
|
| 428 |
+
(𝑥𝑗,𝑡𝑗) : 𝑥𝑗 ∈ R𝑝,𝑡𝑗 ∈ R𝑚, 𝑗 = 1, 2, . . . ,𝑛
|
| 429 |
+
�,
|
| 430 |
+
activation
|
| 431 |
+
func-
|
| 432 |
+
tion 𝑔, hidden node number 𝑁, the related regularization
|
| 433 |
+
parameters 𝜆 > 0, 𝛾 ≥ 0, 𝜀 ≥ 0, the corresponding parameter 𝛿,
|
| 434 |
+
and an acceptable error 𝜉.
|
| 435 |
+
Step 1: Randomly assign a proper scope for input weight 𝜔𝑖 and
|
| 436 |
+
bias 𝑏𝑖 (𝑖 = 1, 2, . . . , 𝑁)
|
| 437 |
+
Step 2: Compute the hidden layer output matrix H;
|
| 438 |
+
Step
|
| 439 |
+
3:
|
| 440 |
+
Set
|
| 441 |
+
𝛽0
|
| 442 |
+
=
|
| 443 |
+
(0, 0, . . . , 0),
|
| 444 |
+
𝛽1
|
| 445 |
+
=
|
| 446 |
+
half(
|
| 447 |
+
𝛿𝜆𝛾
|
| 448 |
+
1 + 2𝜀𝜆𝛿 , (I − 𝛿H𝑇 H)𝛽0 + 𝛿H𝑇 T
|
| 449 |
+
1 + 2𝜀𝜆𝛿
|
| 450 |
+
), and 𝑙𝑚𝑎𝑥 be a minimal
|
| 451 |
+
positive integer but larger than
|
| 452 |
+
log
|
| 453 |
+
� ∥𝛽1 − 𝛽0∥2(𝜅 + 𝜅0)
|
| 454 |
+
𝜉𝜅0(𝜅 + 𝜅0 + 4𝜀𝜆)
|
| 455 |
+
�
|
| 456 |
+
log
|
| 457 |
+
� 𝜅+𝜅0
|
| 458 |
+
𝜅−𝜅0
|
| 459 |
+
�
|
| 460 |
+
.
|
| 461 |
+
Step 4: For 𝑙 = 1 : 𝑙𝑚𝑎𝑥
|
| 462 |
+
if 𝑙 ≥ 𝑙𝑚𝑎𝑥, stop;
|
| 463 |
+
else 𝑙 := 𝑙 + 1 and update the 𝛽 as follows: 𝛽𝑙+1 =
|
| 464 |
+
half(
|
| 465 |
+
𝛿𝜆𝛾
|
| 466 |
+
1 + 2𝜀𝜆𝛿 , (I − 𝛿H𝑇 H)𝛽𝑙 + 𝛿H𝑇 T
|
| 467 |
+
1 + 2𝜀𝜆𝛿
|
| 468 |
+
).
|
| 469 |
+
repeat Step 4, until that the desired output weight is ^𝛽 = 𝛽𝑚𝑎𝑥.
|
| 470 |
+
Output: Return the output weights ^𝛽;
|
| 471 |
+
4
|
| 472 |
+
SOME CHARACTERISTICS FOR ℓ2-ℓ0.5-ELM
|
| 473 |
+
For the new section, we want to discuss and analyze some key
|
| 474 |
+
characteristics of the estimator regarding ℓ2-ℓ0.5-ELM, such as the
|
| 475 |
+
convergence and sparsity.
|
| 476 |
+
Theorem 4. 𝛽𝑙 strongly converges to the minimum value 𝛽∗ of
|
| 477 |
+
the minimization problem
|
| 478 |
+
min
|
| 479 |
+
𝛽 ∈R𝑁
|
| 480 |
+
� 1
|
| 481 |
+
2 ∥H𝛽 − T∥2
|
| 482 |
+
2 + 𝜆𝑝𝛾𝜀 (𝛽)
|
| 483 |
+
�
|
| 484 |
+
as 𝑙 → ∞.
|
| 485 |
+
𝛽0.5 in the ℓ2-ℓ0.5-ELM is a highly significant part of the sparsity
|
| 486 |
+
of the solution. Thus, we set the Theorem 5 as follows.
|
| 487 |
+
Theorem 5. Suppose 𝜆
|
| 488 |
+
>
|
| 489 |
+
0,𝛾
|
| 490 |
+
>
|
| 491 |
+
0, then the support of
|
| 492 |
+
half(
|
| 493 |
+
𝜆𝛾
|
| 494 |
+
1+2𝜀𝜆,
|
| 495 |
+
𝛽
|
| 496 |
+
1+2𝜀𝜆 ) is finite for any 𝛽 ∈ R𝑁 . Particularly, 𝛽∗ and 𝛽𝑙
|
| 497 |
+
are all finitely supported.
|
| 498 |
+
If the regularization parameters 𝜆 and 𝛾 are fixed as some con-
|
| 499 |
+
stant values, then 𝛽∗ and 𝛽𝑙 have only a few finite nonzero coeffi-
|
| 500 |
+
cients, and hence the solution to (12) is sparse.
|
| 501 |
+
|
| 502 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 503 |
+
Zhou and Miao.
|
| 504 |
+
Table 1: Details of the 6 datasets
|
| 505 |
+
Dataset
|
| 506 |
+
Type
|
| 507 |
+
Sapmple
|
| 508 |
+
Feature
|
| 509 |
+
Catagory
|
| 510 |
+
Austrian
|
| 511 |
+
UCI
|
| 512 |
+
690
|
| 513 |
+
14
|
| 514 |
+
2
|
| 515 |
+
Ionosphere
|
| 516 |
+
UCI
|
| 517 |
+
151
|
| 518 |
+
34
|
| 519 |
+
2
|
| 520 |
+
Balance
|
| 521 |
+
UCL
|
| 522 |
+
625
|
| 523 |
+
4
|
| 524 |
+
3
|
| 525 |
+
colon
|
| 526 |
+
gene
|
| 527 |
+
62
|
| 528 |
+
2000
|
| 529 |
+
2
|
| 530 |
+
DLBCL
|
| 531 |
+
gene
|
| 532 |
+
77
|
| 533 |
+
7129
|
| 534 |
+
2
|
| 535 |
+
ORL
|
| 536 |
+
image
|
| 537 |
+
400
|
| 538 |
+
10304
|
| 539 |
+
40
|
| 540 |
+
5
|
| 541 |
+
PERFORMANCE EVALUATION
|
| 542 |
+
In the new section, a succession of experiments, containing some
|
| 543 |
+
UCI benchmark datasets[9] and gene data, are carried out to demon-
|
| 544 |
+
strate the performance of the proposed ℓ2-ℓ0.5-ELM method. All
|
| 545 |
+
the experiments are performed in the Mac Pycharm environment
|
| 546 |
+
running on Quad-Core Intel Core i5, CPU (8 GB 2133 MHz LPDDR3)
|
| 547 |
+
processor with the speed of 1.40GHz. The activation function of
|
| 548 |
+
networks used in the experiments is taken as sigmoid function
|
| 549 |
+
𝑔(𝑥) = 1/(1 + 𝑒−𝑥).
|
| 550 |
+
The ℓ2-ℓ0.5-ELM model is compared with seven other models:
|
| 551 |
+
BP, SVM, ELM, ℓ2-ℓ1-ELM, ℓ2-ELM, ℓ1-ELM, ℓ0.5-ELM. BP includes
|
| 552 |
+
only one hidden layer and output layer, and all parameters are
|
| 553 |
+
trained by back-propagation algorithm; ℓ1-ELM and ℓ0.5-ELM are
|
| 554 |
+
the simplified forms of ℓ2-ℓ1-ELM and ℓ2-ℓ0.5-ELM, respectively.
|
| 555 |
+
The activation function is defined as: 𝑔(𝑥) = 1/(1 + 𝑒−𝑥).
|
| 556 |
+
In order to check the algorithm for ℓ2-ℓ0.5-ELM model, three real
|
| 557 |
+
classification datasets from the UCI machine learning repository
|
| 558 |
+
are considered. The basic information of each dataset is shown in
|
| 559 |
+
Table 1. The average of 30 experimental validations was used as
|
| 560 |
+
the final result. For these datasets, the sample size is fixed, but each
|
| 561 |
+
sample is randomly assigned as training or testing data.
|
| 562 |
+
5.1
|
| 563 |
+
Performance for UCI datasets
|
| 564 |
+
To validate the performance of the proposed ℓ2-ℓ0.5-ELM model,
|
| 565 |
+
three types of real classification datasets were used for the experi-
|
| 566 |
+
ments, including UCI[3], gene expression, and ORL face datasets.
|
| 567 |
+
The UCI machine learning repository (2013UCI) contains three
|
| 568 |
+
datasets: Austrian Credit Approval(Austrian), Ionosphere, and Bal-
|
| 569 |
+
ance Scale(Balance). The gene expression datasets contain colon[1]
|
| 570 |
+
and DLBCL[13], both of which are binary datasets. Moreover, the
|
| 571 |
+
ORL face dataset includes 400 images divided into 40 categories.
|
| 572 |
+
Each category contains 10 images with different facial details and
|
| 573 |
+
each image size is 112 × 92. The detail information of all datasets
|
| 574 |
+
are summarized in Table 1. In addition, these data were obtained
|
| 575 |
+
from different application fields, and it is hoped that the ℓ2-ℓ0.5-
|
| 576 |
+
ELM model can be analyzed from multiple perspectives by using
|
| 577 |
+
these data from different backgrounds.
|
| 578 |
+
We repeat 30 trials and take the averages as the final results
|
| 579 |
+
on account of reducing the random error. And the regularization
|
| 580 |
+
parameters are used to control the trade-off between the error and
|
| 581 |
+
the penalty. For Austrian dataset, take the parameters ( ℓ2-ℓ0.5-ELM,
|
| 582 |
+
ℓ2-ℓ1-ELM : 𝜆 = 0.8,𝛾 = 0.1,𝜀 = 0.9) and for Ionosphere dataset,
|
| 583 |
+
take ( ℓ2-ℓ0.5-ELM, ℓ2-ℓ1-ELM : 𝜆 = 0.9,𝛾 = 0.05,𝜀 = 0.9) and
|
| 584 |
+
Balance Scale dataset, ( ℓ2-ℓ0.5-ELM : 𝜆 = 0.8,𝛾 = 1,𝜀 = 1, for ℓ2-ℓ1-
|
| 585 |
+
ELM : 𝜆 = 0.005,𝛾 = 0.5,𝜀 = 0.5), we set the acceptable error 𝜉 =
|
| 586 |
+
Table 2: Performance comparison of 8 models on 3 different
|
| 587 |
+
datasets
|
| 588 |
+
Datasets
|
| 589 |
+
Methods
|
| 590 |
+
Times(s)
|
| 591 |
+
Remaining Nodes
|
| 592 |
+
Accuracy(% ± %)
|
| 593 |
+
Austrain
|
| 594 |
+
BP
|
| 595 |
+
2.1751
|
| 596 |
+
600
|
| 597 |
+
72.58 ± 13.57
|
| 598 |
+
SVM
|
| 599 |
+
0.0448
|
| 600 |
+
—
|
| 601 |
+
79.14 ± 1.98
|
| 602 |
+
ELM
|
| 603 |
+
0.0588
|
| 604 |
+
600
|
| 605 |
+
65.37 ± 3.08
|
| 606 |
+
ℓ0.5-ELM
|
| 607 |
+
5.8542
|
| 608 |
+
48.5
|
| 609 |
+
82.76 ± 0.00
|
| 610 |
+
ℓ1-ELM
|
| 611 |
+
8.1648
|
| 612 |
+
118.5
|
| 613 |
+
81.38 ± 0.00
|
| 614 |
+
ℓ2-ELM
|
| 615 |
+
8.2735
|
| 616 |
+
600
|
| 617 |
+
80.36 ± 0.00
|
| 618 |
+
ℓ2-ℓ1-ELM
|
| 619 |
+
10.041
|
| 620 |
+
492.5
|
| 621 |
+
81.38 ± 0.00
|
| 622 |
+
ℓ2-ℓ0.5-ELM
|
| 623 |
+
7.5875
|
| 624 |
+
118.5
|
| 625 |
+
82.76 ± 0.00
|
| 626 |
+
Ionosphere
|
| 627 |
+
BP
|
| 628 |
+
2.1751
|
| 629 |
+
600
|
| 630 |
+
72.58 ± 13.57
|
| 631 |
+
SVM
|
| 632 |
+
0.0108
|
| 633 |
+
–
|
| 634 |
+
86.51 ± 2.09
|
| 635 |
+
ELM
|
| 636 |
+
0.0003
|
| 637 |
+
600
|
| 638 |
+
91.55 ± 2.78
|
| 639 |
+
ℓ0.5-ELM
|
| 640 |
+
0.0487
|
| 641 |
+
29.5
|
| 642 |
+
96.96 ± 0.00
|
| 643 |
+
ℓ1-ELM
|
| 644 |
+
5.4755
|
| 645 |
+
115.9
|
| 646 |
+
97.24 ± 1.06
|
| 647 |
+
ℓ2-ELM
|
| 648 |
+
0.0520
|
| 649 |
+
600
|
| 650 |
+
96.05 ± 1.57
|
| 651 |
+
ℓ2-ℓ1-ELM
|
| 652 |
+
4.4093
|
| 653 |
+
437.5
|
| 654 |
+
96.84 ± 0.98
|
| 655 |
+
ℓ2-ℓ0.5-ELM
|
| 656 |
+
0.0569
|
| 657 |
+
193
|
| 658 |
+
98.01 ± 0.00
|
| 659 |
+
Balance
|
| 660 |
+
BP
|
| 661 |
+
4.3814
|
| 662 |
+
600
|
| 663 |
+
59.99 ± 25.26
|
| 664 |
+
SVM
|
| 665 |
+
0.0215
|
| 666 |
+
–
|
| 667 |
+
88.63 ± 1.86
|
| 668 |
+
EL,M
|
| 669 |
+
0.0008
|
| 670 |
+
600
|
| 671 |
+
50.72 ± 6.66
|
| 672 |
+
ℓ0.5-ELM
|
| 673 |
+
0.1285
|
| 674 |
+
23.3
|
| 675 |
+
90.55 ± 0.00
|
| 676 |
+
ℓ1-ELM
|
| 677 |
+
6.5074
|
| 678 |
+
42.9
|
| 679 |
+
90.47 ± 1.66
|
| 680 |
+
ℓ2-ELM
|
| 681 |
+
0.1579
|
| 682 |
+
600
|
| 683 |
+
90.55 ± 0.00
|
| 684 |
+
ℓ2-ℓ1-ELM
|
| 685 |
+
6.8678
|
| 686 |
+
246.4
|
| 687 |
+
90.10 ± 1.35
|
| 688 |
+
ℓ2-ℓ0.5-ELM
|
| 689 |
+
0.0974
|
| 690 |
+
52.7
|
| 691 |
+
90.91 ± 0.00
|
| 692 |
+
0.0001, 0.001, 0.0001 respectively. The number of hidden nodes in
|
| 693 |
+
the experiments is 600. Table 2 shows the running time, the number
|
| 694 |
+
of nodes retained, and the accuracy of the test for each dataset for
|
| 695 |
+
the eight models (the standard deviation is kept to 4 significant
|
| 696 |
+
digits, 0.00 in the table indicates a standard deviation of less than
|
| 697 |
+
10−4). These indices are used to measure the sparsity, stability and
|
| 698 |
+
effectiveness of the proposed method. The corresponding figures
|
| 699 |
+
on testing are shown as follows.
|
| 700 |
+
From the results of 1-3, we can see that the accuracy of the ELM
|
| 701 |
+
model is lower than all the regularized ELM models. The standard
|
| 702 |
+
deviation of the ELM model is higher than that of other regularized
|
| 703 |
+
ELM models, which indicates that the stability of the ELM model is
|
| 704 |
+
lower. The accuracy of the ℓ2-ℓ0.5-ELM model at all nodes can be
|
| 705 |
+
compared with other regularized ELM models, and the accuracy at
|
| 706 |
+
most hidden nodes is higher than other comparable regularized ELM
|
| 707 |
+
models. This indicates that the ℓ2-ℓ0.5-ELM model has consistently
|
| 708 |
+
good classification prediction. In terms of the standard deviation
|
| 709 |
+
of different nodes, the ℓ2-ℓ0.5-ELM model is lower than the other
|
| 710 |
+
compared models, indicating that the classification accuracy of this
|
| 711 |
+
method is more stable.
|
| 712 |
+
We can see the performance of ℓ2-ℓ0.5-ELM in detail and draw
|
| 713 |
+
the following conclusions:
|
| 714 |
+
(i) In 3 datasets, the classification accuracy of the regularized
|
| 715 |
+
ELM methods (ℓ2-ℓ0.5-ELM, ℓ0.5-ELM, ℓ2-ℓ1-ELM, ℓ1-ELM, ℓ2-ELM)
|
| 716 |
+
are significantly higher than that of the BP, SVM and ELM methods,
|
| 717 |
+
indicating that the regularized ELM methods have better general-
|
| 718 |
+
ization performance, and the classification accuracy of ℓ2-ℓ0.5-ELM
|
| 719 |
+
methods is higher than that of other compared regularized ELM
|
| 720 |
+
methods.
|
| 721 |
+
(ii) From the perspective of the number of remaining hidden
|
| 722 |
+
nodes, ℓ0.5-ELM has the lowest number of hidden nodes. It is shown
|
| 723 |
+
|
| 724 |
+
An improved hybrid regularization approach for extreme learning machine
|
| 725 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 726 |
+
200
|
| 727 |
+
300
|
| 728 |
+
400
|
| 729 |
+
500
|
| 730 |
+
600
|
| 731 |
+
700
|
| 732 |
+
800
|
| 733 |
+
900
|
| 734 |
+
1000 1100 1200
|
| 735 |
+
Number of Hidden Nodes
|
| 736 |
+
0.50
|
| 737 |
+
0.55
|
| 738 |
+
0.60
|
| 739 |
+
0.65
|
| 740 |
+
0.70
|
| 741 |
+
0.75
|
| 742 |
+
0.80
|
| 743 |
+
0.85
|
| 744 |
+
0.90
|
| 745 |
+
0.95
|
| 746 |
+
1.00
|
| 747 |
+
Testing accuracy
|
| 748 |
+
ELM
|
| 749 |
+
l0.5
|
| 750 |
+
l1
|
| 751 |
+
l2
|
| 752 |
+
l2l1
|
| 753 |
+
l2l0.5
|
| 754 |
+
200
|
| 755 |
+
300
|
| 756 |
+
400
|
| 757 |
+
500
|
| 758 |
+
600
|
| 759 |
+
700
|
| 760 |
+
800
|
| 761 |
+
900
|
| 762 |
+
1000 1100 1200
|
| 763 |
+
Number of Hidden Nodes
|
| 764 |
+
0.000
|
| 765 |
+
0.002
|
| 766 |
+
0.004
|
| 767 |
+
0.006
|
| 768 |
+
0.008
|
| 769 |
+
0.010
|
| 770 |
+
0.012
|
| 771 |
+
0.014
|
| 772 |
+
0.016
|
| 773 |
+
0.018
|
| 774 |
+
0.020
|
| 775 |
+
0.022
|
| 776 |
+
0.024
|
| 777 |
+
0.026
|
| 778 |
+
0.028
|
| 779 |
+
0.030
|
| 780 |
+
SDs of Testing
|
| 781 |
+
ELM
|
| 782 |
+
l0.5
|
| 783 |
+
l1
|
| 784 |
+
l2
|
| 785 |
+
l2l1
|
| 786 |
+
l2l0.5
|
| 787 |
+
Figure 1: Performance comparison of 6 models in the Austrian dataset
|
| 788 |
+
200
|
| 789 |
+
300
|
| 790 |
+
400
|
| 791 |
+
500
|
| 792 |
+
600
|
| 793 |
+
700
|
| 794 |
+
800
|
| 795 |
+
900
|
| 796 |
+
1000 1100 1200
|
| 797 |
+
Number of Hidden Nodes
|
| 798 |
+
0.60
|
| 799 |
+
0.62
|
| 800 |
+
0.64
|
| 801 |
+
0.66
|
| 802 |
+
0.68
|
| 803 |
+
0.70
|
| 804 |
+
0.72
|
| 805 |
+
0.74
|
| 806 |
+
0.76
|
| 807 |
+
0.78
|
| 808 |
+
0.80
|
| 809 |
+
0.82
|
| 810 |
+
0.84
|
| 811 |
+
0.86
|
| 812 |
+
0.88
|
| 813 |
+
0.90
|
| 814 |
+
0.92
|
| 815 |
+
0.94
|
| 816 |
+
0.96
|
| 817 |
+
0.98
|
| 818 |
+
1.00
|
| 819 |
+
Testing accuracy
|
| 820 |
+
ELM
|
| 821 |
+
l0.5
|
| 822 |
+
l1
|
| 823 |
+
l2
|
| 824 |
+
l2l1
|
| 825 |
+
l2l0.5
|
| 826 |
+
200
|
| 827 |
+
300
|
| 828 |
+
400
|
| 829 |
+
500
|
| 830 |
+
600
|
| 831 |
+
700
|
| 832 |
+
800
|
| 833 |
+
900
|
| 834 |
+
1000 1100 1200
|
| 835 |
+
Number of Hidden Nodes
|
| 836 |
+
-0.01
|
| 837 |
+
0.00
|
| 838 |
+
0.01
|
| 839 |
+
0.02
|
| 840 |
+
0.03
|
| 841 |
+
0.04
|
| 842 |
+
0.05
|
| 843 |
+
0.06
|
| 844 |
+
SDs of Testing
|
| 845 |
+
ELM
|
| 846 |
+
l0.5
|
| 847 |
+
l1
|
| 848 |
+
l2
|
| 849 |
+
l2l1
|
| 850 |
+
l2l0.5
|
| 851 |
+
Figure 2: Performance comparison of 6 models in the Ionosphere dataset
|
| 852 |
+
200
|
| 853 |
+
300
|
| 854 |
+
400
|
| 855 |
+
500
|
| 856 |
+
600
|
| 857 |
+
700
|
| 858 |
+
800
|
| 859 |
+
900
|
| 860 |
+
1000 1100 1200
|
| 861 |
+
Number of Hidden Nodes
|
| 862 |
+
0.35
|
| 863 |
+
0.40
|
| 864 |
+
0.45
|
| 865 |
+
0.50
|
| 866 |
+
0.55
|
| 867 |
+
0.60
|
| 868 |
+
0.65
|
| 869 |
+
0.70
|
| 870 |
+
0.75
|
| 871 |
+
0.80
|
| 872 |
+
0.85
|
| 873 |
+
0.90
|
| 874 |
+
0.95
|
| 875 |
+
1.00
|
| 876 |
+
Testing accuracy
|
| 877 |
+
ELM
|
| 878 |
+
l0.5
|
| 879 |
+
l1
|
| 880 |
+
l2
|
| 881 |
+
l2l1
|
| 882 |
+
l2l0.5
|
| 883 |
+
200
|
| 884 |
+
300
|
| 885 |
+
400
|
| 886 |
+
500
|
| 887 |
+
600
|
| 888 |
+
700
|
| 889 |
+
800
|
| 890 |
+
900
|
| 891 |
+
1000 1100 1200
|
| 892 |
+
Number of Hidden Nodes
|
| 893 |
+
-0.005
|
| 894 |
+
0.000
|
| 895 |
+
0.005
|
| 896 |
+
0.010
|
| 897 |
+
0.015
|
| 898 |
+
0.020
|
| 899 |
+
0.025
|
| 900 |
+
0.030
|
| 901 |
+
0.035
|
| 902 |
+
0.040
|
| 903 |
+
0.045
|
| 904 |
+
0.050
|
| 905 |
+
0.055
|
| 906 |
+
0.060
|
| 907 |
+
0.065
|
| 908 |
+
0.070
|
| 909 |
+
0.075
|
| 910 |
+
0.080
|
| 911 |
+
0.085
|
| 912 |
+
0.090
|
| 913 |
+
0.095
|
| 914 |
+
0.100
|
| 915 |
+
SDs of Testing
|
| 916 |
+
ELM
|
| 917 |
+
l0.5
|
| 918 |
+
l1
|
| 919 |
+
l2
|
| 920 |
+
l2l1
|
| 921 |
+
l2l0.5
|
| 922 |
+
Figure 3: Performance comparison of 6 models in the Balance dataset
|
| 923 |
+
that the ℓ0.5 or ℓ1-regularization term is beneficial to enhance the
|
| 924 |
+
sparsity of the hidden nodes of the model. Compared with the ℓ2-
|
| 925 |
+
ℓ1-ELM model, the ℓ2-ℓ0.5-ELM model adds the ℓ0.5 regularization
|
| 926 |
+
term to the model, which has a sparser solution and thus a better
|
| 927 |
+
generalization ability.
|
| 928 |
+
(iii) From the perspective of algorithm running time, the ELM
|
| 929 |
+
model runs in the shortest time (the ELM model can obtain the
|
| 930 |
+
analytic solution directly without iterative computation). In com-
|
| 931 |
+
parison, the SVM model runs faster than all ELM methods with
|
| 932 |
+
regularity. Secondly, for the 5 regularized ELM models, the models
|
| 933 |
+
with ℓ0.5 regularization terms (ℓ0.5-ELM, ℓ2-ℓ0.5-ELM) are faster
|
| 934 |
+
than the models with ℓ1 regularization terms (ℓ1-ELM, ℓ2- ℓ1-ELM).
|
| 935 |
+
5.2
|
| 936 |
+
Performance for gene datasets
|
| 937 |
+
In this section, the performance of the ℓ2-ℓ0.5-ELM model is vali-
|
| 938 |
+
dated using the colon and DLBCL data. The training and testing sets
|
| 939 |
+
of each dataset were experimented in the ratio of 1 : 1. The regular-
|
| 940 |
+
ization parameters are set as follows, colon data: (ℓ2-ℓ0.5-ELM and
|
| 941 |
+
ℓ2-ℓ1-ELM : 𝜆 = 0.09,𝛾 = 0.9,𝜀 = 0.9), DLBCL data: (ℓ2-ℓ0.5-ELM
|
| 942 |
+
and ℓ2-ℓ1-ELM : 𝜆 = 0.005,𝛾 = 0.5,𝜀 = 0.5); and 𝜉 = 0.001. Each
|
| 943 |
+
dataset was repeatedly run 30 times, and the average was taken as
|
| 944 |
+
the final result. As shown in Table 3.
|
| 945 |
+
It can be demonstrated that the prediction accuracy of the single-
|
| 946 |
+
layer BP network is very low and does not capture the features of
|
| 947 |
+
|
| 948 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 949 |
+
Zhou and Miao.
|
| 950 |
+
200
|
| 951 |
+
300
|
| 952 |
+
400
|
| 953 |
+
500
|
| 954 |
+
600
|
| 955 |
+
700
|
| 956 |
+
800
|
| 957 |
+
900
|
| 958 |
+
1000 1100 1200
|
| 959 |
+
Number of Hidden Nodes
|
| 960 |
+
0.72
|
| 961 |
+
0.73
|
| 962 |
+
0.74
|
| 963 |
+
0.75
|
| 964 |
+
0.76
|
| 965 |
+
0.77
|
| 966 |
+
0.78
|
| 967 |
+
0.79
|
| 968 |
+
0.80
|
| 969 |
+
0.81
|
| 970 |
+
0.82
|
| 971 |
+
0.83
|
| 972 |
+
0.84
|
| 973 |
+
0.85
|
| 974 |
+
0.86
|
| 975 |
+
0.87
|
| 976 |
+
0.88
|
| 977 |
+
0.89
|
| 978 |
+
Testing accuracy
|
| 979 |
+
ELM
|
| 980 |
+
l0.5
|
| 981 |
+
l1
|
| 982 |
+
l2
|
| 983 |
+
l2l1
|
| 984 |
+
l2l0.5
|
| 985 |
+
200
|
| 986 |
+
300
|
| 987 |
+
400
|
| 988 |
+
500
|
| 989 |
+
600
|
| 990 |
+
700
|
| 991 |
+
800
|
| 992 |
+
900
|
| 993 |
+
1000 1100 1200
|
| 994 |
+
Number of Hidden Nodes
|
| 995 |
+
0.000
|
| 996 |
+
0.005
|
| 997 |
+
0.010
|
| 998 |
+
0.015
|
| 999 |
+
0.020
|
| 1000 |
+
0.025
|
| 1001 |
+
0.030
|
| 1002 |
+
SDs of Testing
|
| 1003 |
+
ELM
|
| 1004 |
+
l0.5
|
| 1005 |
+
l1
|
| 1006 |
+
l2
|
| 1007 |
+
l2l1
|
| 1008 |
+
l2l0.5
|
| 1009 |
+
Figure 4: Performance comparison of 6 models in colon dataset
|
| 1010 |
+
Table 3: Performance comparison of 8 models in 2 gene
|
| 1011 |
+
datasets
|
| 1012 |
+
Datasets
|
| 1013 |
+
Methods
|
| 1014 |
+
Times(s)
|
| 1015 |
+
Remaining Nodes
|
| 1016 |
+
Accuracy(% ± %)
|
| 1017 |
+
colon
|
| 1018 |
+
BP
|
| 1019 |
+
22.2641
|
| 1020 |
+
1000.0
|
| 1021 |
+
55.52 ± 9.15
|
| 1022 |
+
SVM
|
| 1023 |
+
0.0358
|
| 1024 |
+
–
|
| 1025 |
+
77.5 ± 7.28
|
| 1026 |
+
ELM
|
| 1027 |
+
0.0056
|
| 1028 |
+
1000.0
|
| 1029 |
+
83.02 ± 1.92
|
| 1030 |
+
ℓ0.5-ELM
|
| 1031 |
+
0.0829
|
| 1032 |
+
370.5
|
| 1033 |
+
75.00 ± 0.00
|
| 1034 |
+
ℓ1-ELM
|
| 1035 |
+
0.0488
|
| 1036 |
+
974.5
|
| 1037 |
+
84.79 ± 2.22
|
| 1038 |
+
ℓ2-ELM
|
| 1039 |
+
0.0815
|
| 1040 |
+
1000.0
|
| 1041 |
+
84.17 ± 2.20
|
| 1042 |
+
ℓ2-ℓ1-ELM
|
| 1043 |
+
0.0401
|
| 1044 |
+
1000.0
|
| 1045 |
+
83.96 ± 2.24
|
| 1046 |
+
ℓ2-ℓ0.5-ELM
|
| 1047 |
+
0.0879
|
| 1048 |
+
877.0
|
| 1049 |
+
87.50 ± 0.00
|
| 1050 |
+
DLBCL
|
| 1051 |
+
BP
|
| 1052 |
+
122.3174
|
| 1053 |
+
1000.0
|
| 1054 |
+
57.24 ± 12.55
|
| 1055 |
+
SVM
|
| 1056 |
+
0.0968
|
| 1057 |
+
–
|
| 1058 |
+
87.24 ± 5.98
|
| 1059 |
+
ELM
|
| 1060 |
+
0.0060
|
| 1061 |
+
786.0
|
| 1062 |
+
89.90 ± 5.98
|
| 1063 |
+
ℓ0.5-ELM
|
| 1064 |
+
5.2214
|
| 1065 |
+
242.0
|
| 1066 |
+
91.43 ± 0.00
|
| 1067 |
+
ℓ1-ELM
|
| 1068 |
+
18.2957
|
| 1069 |
+
188.5
|
| 1070 |
+
89.05 ± 5.12
|
| 1071 |
+
ℓ2-ELM
|
| 1072 |
+
5.2324
|
| 1073 |
+
764.0
|
| 1074 |
+
89.51 ± 5.48
|
| 1075 |
+
ℓ2-ℓ1-ELM
|
| 1076 |
+
15.5286
|
| 1077 |
+
431.5
|
| 1078 |
+
89.62 ± 6.10
|
| 1079 |
+
ℓ2-ℓ0.5-ELM
|
| 1080 |
+
5.4519
|
| 1081 |
+
575.5
|
| 1082 |
+
91.43 ± 0.00
|
| 1083 |
+
the data very well. It can also be found that the prediction accu-
|
| 1084 |
+
racy of the ℓ2-ℓ0.5-ELM model is slightly higher than that of the
|
| 1085 |
+
other methods. The standard deviations of the accuracy of the ELM
|
| 1086 |
+
methods with ℓ0.5 regularization are much smaller than those of
|
| 1087 |
+
BP, SVM, and ELM, indicating that the ELM model variants with
|
| 1088 |
+
ℓ0.5 regularization terms can improve the stability of the solutions;
|
| 1089 |
+
The number of hidden nodes in the ℓ0.5-ELM and ℓ1-ELM models
|
| 1090 |
+
is smaller, that is, the sparsity of these two regularization terms is
|
| 1091 |
+
the strongest, indicating that the addition of ℓ0.5 or ℓ1 regularization
|
| 1092 |
+
terms in the ELM model enhances the sparsity of the model, while
|
| 1093 |
+
the number of hidden nodes in the ℓ2-ELM model is 1000. The
|
| 1094 |
+
number of nodes in the ℓ2-ELM model is 1000, indicating that the
|
| 1095 |
+
ℓ2-regularization term has no sparse effect on the model. The ℓ2
|
| 1096 |
+
norm is used to increase the stability of the model by penalizing
|
| 1097 |
+
oversized regularization parameters. This makes the ℓ2-ℓ0.5-ELM
|
| 1098 |
+
sparser and model stable, and thus obtains better generalization
|
| 1099 |
+
ability.
|
| 1100 |
+
From the perspective of algorithm running time, it can be seen
|
| 1101 |
+
that the ELM model has the shortest running time (the ELM model
|
| 1102 |
+
can obtain the analytical solution directly without iterative solving).
|
| 1103 |
+
In contrast, the SVM model runs faster than all ELM methods with
|
| 1104 |
+
regularization.
|
| 1105 |
+
Further, we use the colon data to verify the effect of different
|
| 1106 |
+
number of hidden nodes (200, 400, 600, 800, 1000, 1200) on the sta-
|
| 1107 |
+
bility of the ELM correlation model. We perform 30 experiments
|
| 1108 |
+
for each hidden node and calculate the ELM, ℓ2-ℓ0.5-ELM, ℓ0.5-ELM,
|
| 1109 |
+
ℓ2-ℓ1-ELM, ℓ1-ELM, ℓ2-ELM for the test set accuracy and standard
|
| 1110 |
+
deviation as shown in Figure 4. The test accuracy of ℓ2-ℓ0.5-ELM at
|
| 1111 |
+
all nodes can be compared with all regularized ELM models, while
|
| 1112 |
+
the accuracy at most hidden nodes is higher than other models.
|
| 1113 |
+
The standard deviation of ℓ2-ℓ0.5-ELM model is lower than other
|
| 1114 |
+
regularized ELM models.
|
| 1115 |
+
5.3
|
| 1116 |
+
Performance for ORL face dataset
|
| 1117 |
+
The ORL face dataset is used for experimental validation. The num-
|
| 1118 |
+
ber of hidden nodes for the experiment is 1000. The average of
|
| 1119 |
+
30 experiments is used as the final result. Since the original im-
|
| 1120 |
+
age has high dimensionality, we preprocess each image by using
|
| 1121 |
+
the (2𝐷)2PCA[18] dimensionality reduction technique. And the
|
| 1122 |
+
training set and test set are in the ratio of 7 : 3. The values of the
|
| 1123 |
+
regular parameters set in the experiment are as follows: ℓ0.5-ELM
|
| 1124 |
+
and ℓ1-ELM (𝛾 = 0.05,𝜀 = 0), ℓ2-ELM (𝛾 = 0,𝜀 = 0.5), ℓ2 -ℓ1-ELM,
|
| 1125 |
+
ℓ2-ℓ0.5-ELM(𝛾 = 0.05,𝜀 = 0.5); 𝜆 = 0.001 and 𝜀 = 0.0001 are cho-
|
| 1126 |
+
sen in all experiments. This experiment validates the performance
|
| 1127 |
+
of the model in terms of accuracy and standard deviation. The re-
|
| 1128 |
+
sults are shown in Table 4. From the table, it can be seen that the
|
| 1129 |
+
Table 4: Performance comparison of 8 models in ORL face
|
| 1130 |
+
dataset
|
| 1131 |
+
Methods
|
| 1132 |
+
Accuracy(%)
|
| 1133 |
+
BP
|
| 1134 |
+
31.00 ± 4.90
|
| 1135 |
+
SVM
|
| 1136 |
+
71.53 ± 2.12
|
| 1137 |
+
ELM
|
| 1138 |
+
70.58 ± 2.95
|
| 1139 |
+
ℓ0.5-ELM
|
| 1140 |
+
71.00 ± 2.34
|
| 1141 |
+
ℓ1-ELM
|
| 1142 |
+
70.85 ± 2.86
|
| 1143 |
+
ℓ2-ELM
|
| 1144 |
+
71.17 ± 2.47
|
| 1145 |
+
ℓ2-ℓ1-ELM
|
| 1146 |
+
70.58 ± 2.87
|
| 1147 |
+
ℓ2-ℓ0.5-ELM
|
| 1148 |
+
71.67 ± 2.34
|
| 1149 |
+
|
| 1150 |
+
An improved hybrid regularization approach for extreme learning machine
|
| 1151 |
+
AISS 2022, November 25–27, 2022, Sanya, China
|
| 1152 |
+
Table 5: Performance comparison of 6 models in ORL face dataset
|
| 1153 |
+
Nodes
|
| 1154 |
+
ELM
|
| 1155 |
+
ℓ0.5-ELM
|
| 1156 |
+
ℓ1-ELM
|
| 1157 |
+
ℓ2-ELM
|
| 1158 |
+
ℓ2-ℓ1-ELM
|
| 1159 |
+
ℓ2-ℓ0.5-ELM
|
| 1160 |
+
500
|
| 1161 |
+
52.92±3.04
|
| 1162 |
+
66.10±2.55
|
| 1163 |
+
60.00 ±1.77
|
| 1164 |
+
62.63± 2.38
|
| 1165 |
+
59.25 ±2.32
|
| 1166 |
+
65.83 ± 2.46
|
| 1167 |
+
1500
|
| 1168 |
+
76.08±0.73
|
| 1169 |
+
77.00±0.93
|
| 1170 |
+
76.33 ±0.67
|
| 1171 |
+
76.75± 0.75
|
| 1172 |
+
76.33 ±0.76
|
| 1173 |
+
77.20 ±0.93
|
| 1174 |
+
2000
|
| 1175 |
+
78.25±2.00
|
| 1176 |
+
78.73±2.45
|
| 1177 |
+
78.33 ±2.08
|
| 1178 |
+
78.63± 2.18
|
| 1179 |
+
78.33 ±2.08
|
| 1180 |
+
78.83 ±2.45
|
| 1181 |
+
2500
|
| 1182 |
+
79.58±3.49
|
| 1183 |
+
79.74±3.36
|
| 1184 |
+
79.67 ±3.44
|
| 1185 |
+
79.21±3.29
|
| 1186 |
+
79.63 ±3.44
|
| 1187 |
+
79.76 ± 3.26
|
| 1188 |
+
3000
|
| 1189 |
+
81.50±1.98
|
| 1190 |
+
81.55±2.69
|
| 1191 |
+
81.42 ±2.07
|
| 1192 |
+
81.45±2.39
|
| 1193 |
+
81.42 ±2.07
|
| 1194 |
+
81.58 ± 2.68
|
| 1195 |
+
3500
|
| 1196 |
+
81.17±1.81
|
| 1197 |
+
81.13±2.22
|
| 1198 |
+
81.17 ±1.87
|
| 1199 |
+
81.17±1.89
|
| 1200 |
+
81.17 ±1.87
|
| 1201 |
+
81.25 ± 2.12
|
| 1202 |
+
4000
|
| 1203 |
+
82.00±1.81
|
| 1204 |
+
82.00±1.67
|
| 1205 |
+
81.92 ±1.74
|
| 1206 |
+
81.96±1.64
|
| 1207 |
+
81.92 ±1.74
|
| 1208 |
+
82.08 ± 1.65
|
| 1209 |
+
mean
|
| 1210 |
+
75.22±9.12
|
| 1211 |
+
77.16±5.33
|
| 1212 |
+
76.21 ±7.00
|
| 1213 |
+
76.62±6.21
|
| 1214 |
+
76.08 ±7.24
|
| 1215 |
+
77.26 ± 5.32
|
| 1216 |
+
accuracy of the ℓ2-ℓ0.5-ELM model (which is slightly higher than
|
| 1217 |
+
the SVM model) is slightly higher than all other models tested.
|
| 1218 |
+
Further, we verify the effect of different values of hidden nodes
|
| 1219 |
+
on the prediction accuracy. The number of hidden nodes chosen in
|
| 1220 |
+
the experiment is 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000.
|
| 1221 |
+
The results are shown in Table 5, which show that the test accu-
|
| 1222 |
+
racy of ℓ2-ℓ0.5-ELM model is higher than the other comparative
|
| 1223 |
+
ELM models. The test accuracy of the ELM model fluctuates the
|
| 1224 |
+
most with the changing of the number of hidden nodes, i.e., the
|
| 1225 |
+
selection of different nodes has the greatest impact on it, indicating
|
| 1226 |
+
that the ELM model is less stable in high-dimensional data. In con-
|
| 1227 |
+
trast, the standard deviations of all the regularized ELM methods
|
| 1228 |
+
(5.33, 7.00, 6.21, 7.24, 5.32) are lower than those of the ELM meth-
|
| 1229 |
+
ods, indicating that the stability of the ELM model is improved by
|
| 1230 |
+
adding the regularization term. ELM methods, indicating that the
|
| 1231 |
+
stability of the proposed method is better than the other 5 compared
|
| 1232 |
+
to ELM methods.
|
| 1233 |
+
6
|
| 1234 |
+
CONCLUSION
|
| 1235 |
+
In order to further improve the stability and generalization of the
|
| 1236 |
+
ELM model, this paper proposes a ℓ2-ℓ0.5-ELM model by combin-
|
| 1237 |
+
ing the ℓ0.5 and the ℓ2 regularization term. The iterative algorithm
|
| 1238 |
+
is applied to solve the model with a fixed points algorithm. The
|
| 1239 |
+
convergence and sparsity of this algorithm are proved. Moreover,
|
| 1240 |
+
the proposed ℓ2-ℓ0.5-ELM model is compared with BP, SVM, ELM,
|
| 1241 |
+
ℓ0.5-ELM, ℓ1-ELM, ℓ2-ELM and ℓ2-ELM. ℓ2-ℓ1-ELM models. Experi-
|
| 1242 |
+
mental comparisons on several datasets (UCI dataset, gene dataset,
|
| 1243 |
+
ORL face dataset) show that the ℓ2-ℓ0.5-ELM method outperforms
|
| 1244 |
+
the other 7 models in terms of prediction accuracy and stability
|
| 1245 |
+
on these data. Therefore, the model can be improved as follows:
|
| 1246 |
+
the information of previously computed nodes is not used in the
|
| 1247 |
+
computation of different hidden nodes, and it can be learned from
|
| 1248 |
+
the incremental learning point of view, which can reduce the com-
|
| 1249 |
+
putation time to a certain extent.
|
| 1250 |
+
REFERENCES
|
| 1251 |
+
[1] U. Alon, N. Barkai, D. A. Notterman, K. Gish, S. Ybarra, D. Mack, and A. J. Levine.
|
| 1252 |
+
1999. Broad patterns of gene expression revealed by clustering analysis of tumor
|
| 1253 |
+
and normal colon tissues probed by oligonucleotide arrays. 96, 12 (1999), 6745–
|
| 1254 |
+
6750.
|
| 1255 |
+
[2] Hai Hui Huang A B and Yong Liang C. 2018. Hybrid 𝐿1/2+2 method for gene
|
| 1256 |
+
selection in the Cox proportional hazards model. Computer Methods and Programs
|
| 1257 |
+
in Biomedicine 164 (2018), 65–73.
|
| 1258 |
+
[3] K. Bache and M. Lichman. 2013. UCI machine learning repository. (2013).
|
| 1259 |
+
[4] Feilong Cao, Yuanpeng Tan, and Miaomiao Cai. 2014. Sparse algorithms of
|
| 1260 |
+
random weight networks and applications. Expert Systems with Applications 41,
|
| 1261 |
+
5 (2014), 2457–2462.
|
| 1262 |
+
[5] Feilong Cao, Dianhui Wang, Houying Zhu, and Yuguang Wang. 2016. An itera-
|
| 1263 |
+
tive learning algorithm for feedforward neural networks with random weights.
|
| 1264 |
+
Information Sciences 328 (2016), 546–557.
|
| 1265 |
+
[6] G. C. Cawley and Nlc Talbot. 2006. Gene selection in cancer classification using
|
| 1266 |
+
sparse logistic regression with Bayesian regularization. Oxford University Press
|
| 1267 |
+
(2006).
|
| 1268 |
+
[7] Patrick L. Combettes and Valérie R. Wajs. 2005. Signal recovery by proximal
|
| 1269 |
+
forward-backward splitting. Multiscale Model. Simul. 4 (2005), 1168–1200.
|
| 1270 |
+
[8] Qinwei Fan, Lei Niu, and Qian Kang. 2020. Regression and multiclass classification
|
| 1271 |
+
using sparse extreme learning machine via smoothing group 𝐿1/2 regularizer.
|
| 1272 |
+
IEEE Access 8 (2020), 191482–191494.
|
| 1273 |
+
[9] Hailiang, Ye, Feilong, Cao, Dianhui, and Wang. [n. d.]. A hybrid regularization
|
| 1274 |
+
approach for random vector functional-link networks - ScienceDirect. Expert
|
| 1275 |
+
Systems with Applications 140 ([n. d.]), 112912–112912.
|
| 1276 |
+
[10] Guang-Bin Huang, Qin-Yu Zhu, and Chee-Kheong Siew. 2006. Extreme learning
|
| 1277 |
+
machine: theory and applications. Neurocomputing 70, 1 (2006), 489–501.
|
| 1278 |
+
[11] B. Igelnik and Y. H. Pao. 1995. Stochastic choice of basis functions in adaptive
|
| 1279 |
+
function approximation and the functional-link net. IEEE Trans Neural Netw 6, 6
|
| 1280 |
+
(1995), 1320–1329.
|
| 1281 |
+
[12] Charles Micchelli, Lixin Shen, and Yuesheng Xu. 2011. Proximity algorithms for
|
| 1282 |
+
image models: denoising. Inverse Problems 27 (03 2011), 045009.
|
| 1283 |
+
[13] A. Rosenwald, G. Wright, W. C. Chan, J. M. Connors, E. Campo, R. I. Fisher, R. D.
|
| 1284 |
+
Gascoyne, H. K. Muller-Hermelink, E. B. Smeland, and J. M. Giltnane. 2011. The
|
| 1285 |
+
use of molecular profiling to predict survival after chemotherapy for diffuse
|
| 1286 |
+
large-B-cell lymphoma. New England Journal of Medicine 346, 25 (2011), 1937.
|
| 1287 |
+
[14] W.F. Schmidt, M.A. Kraaijveld, and R.P.W. Duin. 1992.
|
| 1288 |
+
Feedforward neural
|
| 1289 |
+
networks with random weights. (1992), 1–4.
|
| 1290 |
+
[15] Robert Tibshirani. 2011. Regression shrinkage and selection via the lasso: a retro-
|
| 1291 |
+
spective. Journal of the Royal Statistical Society: Series B (Statistical Methodology)
|
| 1292 |
+
73, 3 (2011), 267–288.
|
| 1293 |
+
[16] Zongben Xu, Xiangyu Chang, Fengmin Xu, and Hai Zhang. 2012. 𝐿1/2 regular-
|
| 1294 |
+
ization: a thresholding representation theory and a fast solver. IEEE Transac-
|
| 1295 |
+
tions on Neural Networks and Learning Systems 23, 7 (2012), 1013–1027. https:
|
| 1296 |
+
//doi.org/10.1109/TNNLS.2012.2197412
|
| 1297 |
+
[17] Zong-Ben Xu, Hai-Liang Guo, Yao Wang, and Hai Zhang. 2012. Representative
|
| 1298 |
+
of 𝐿1/2 regularization among 𝐿𝑞 (0 < 𝑞 ≤ 1) regularizations: an experimental
|
| 1299 |
+
study based on phase diagram. Acta Automatica Sinica 38, 7 (2012), 1225–1228.
|
| 1300 |
+
[18] Daoqiang Zhang and Zhi-Hua Zhou. 2005. (2D)2PCA: Two-directional two-
|
| 1301 |
+
dimensional PCA for efficient face representation and recognition. Neurocom-
|
| 1302 |
+
puting 69, 1 (2005), 224–231.
|
| 1303 |
+
|
5NAzT4oBgHgl3EQffvy-/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
5NE6T4oBgHgl3EQflhFb/content/2301.06150v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:9fef1677046b2a312a589bbd35c6fc0da21781ecf895dec3b75925919ea719b2
|
| 3 |
+
size 594263
|
5NE6T4oBgHgl3EQflhFb/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:f94e60c2e2f56c51918a1d062847d72e7a3c8aba635b37f6336375c0f16a29b3
|
| 3 |
+
size 6029357
|
5dFJT4oBgHgl3EQfkywG/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:47514ca2a9094ee84929f023419aa2bd8efbc03778eb575718fc7e4f76792f3a
|
| 3 |
+
size 3211309
|
5tAyT4oBgHgl3EQf2fk_/content/2301.00751v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:e99a11bddf86ddb786e4970140d61a2679534619ab775198e163795faf6ca217
|
| 3 |
+
size 637742
|
8tE0T4oBgHgl3EQfwgFY/content/2301.02633v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:626ddf71600516aecb5cff64488791940c9fea908b757c2613b351ec3386d909
|
| 3 |
+
size 152485
|
8tE0T4oBgHgl3EQfwgFY/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:d42d133246a5f7d86810f1ceecb695928f46472e1980dc713d385237fda50338
|
| 3 |
+
size 1376301
|
8tE0T4oBgHgl3EQfwgFY/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:d0e5fcad3f379b480c30d1c3441bee0f4b0fc7c90d2812ff4ff8845e7009766c
|
| 3 |
+
size 54415
|
BNE4T4oBgHgl3EQfFAx2/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:f594e20c913eb693a3dc18a16ca0d4d7c97c347a29adb8d88d13d489fe27aaa9
|
| 3 |
+
size 7864365
|
BNE4T4oBgHgl3EQfFAx2/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:870b6012fd477f4dcaffe50173e55a6a5d311410b36cd36edeb30f3335655cb8
|
| 3 |
+
size 260496
|
D9E2T4oBgHgl3EQfogh1/content/tmp_files/2301.04019v1.pdf.txt
ADDED
|
@@ -0,0 +1,2460 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 2 |
+
1
|
| 3 |
+
FGAHOI: Fine-Grained Anchors for
|
| 4 |
+
Human-Object Interaction Detection
|
| 5 |
+
Shuailei Ma, Yuefeng Wang, Shanze Wang, and Ying Wei
|
| 6 |
+
Abstract—Human-Object Interaction (HOI), as an important problem in computer vision, requires locating the human-object pair and
|
| 7 |
+
identifying the interactive relationships between them. The HOI instance has a greater span in spatial, scale, and task than the
|
| 8 |
+
individual object instance, making its detection more susceptible to noisy backgrounds. To alleviate the disturbance of noisy
|
| 9 |
+
backgrounds on HOI detection, it is necessary to consider the input image information to generate fine-grained anchors which are then
|
| 10 |
+
leveraged to guide the detection of HOI instances. However, it is challenging for the following reasons. 𝑖) how to extract pivotal features
|
| 11 |
+
from the images with complex background information is still an open question. 𝑖𝑖) how to semantically align the extracted features and
|
| 12 |
+
query embeddings is also a difficult issue. In this paper, a novel end-to-end transformer-based framework (FGAHOI) is proposed to
|
| 13 |
+
alleviate the above problems. FGAHOI comprises three dedicated components namely, multi-scale sampling (MSS), hierarchical
|
| 14 |
+
spatial-aware merging (HSAM) and task-aware merging mechanism (TAM). MSS extracts features of humans, objects and
|
| 15 |
+
interaction areas from noisy backgrounds for HOI instances of various scales. HSAM and TAM semantically align and merge the
|
| 16 |
+
extracted features and query embeddings in the hierarchical spatial and task perspectives in turn. In the meanwhile, a novel training
|
| 17 |
+
strategy Stage-wise Training Strategy is designed to reduce the training pressure caused by overly complex tasks done by FGAHOI.
|
| 18 |
+
In addition, we propose two ways to measure the difficulty of HOI detection and a novel dataset, 𝑖.𝑒., HOI-SDC for the two challenges
|
| 19 |
+
(Uneven Distributed Area in Human-Object Pairs and Long Distance Visual Modeling of Human-Object Pairs) of HOI instances
|
| 20 |
+
detection. Experiments are conducted on three benchmarks: HICO-DET, HOI-SDC and V-COCO. Our model outperforms the
|
| 21 |
+
state-of-the-art HOI detection methods, and the extensive ablations reveal the merits of our proposed contribution. The code is
|
| 22 |
+
available at https://github.com/xiaomabufei/FGAHOI.
|
| 23 |
+
Index Terms—Human-Object Interaction, FGAHOI, Fine-Grained Anchors, Noisy Background, Semantically Aligning.
|
| 24 |
+
!
|
| 25 |
+
1
|
| 26 |
+
INTRODUCTION
|
| 27 |
+
H
|
| 28 |
+
UMAN-Object
|
| 29 |
+
interaction
|
| 30 |
+
(HOI)
|
| 31 |
+
detection,
|
| 32 |
+
as
|
| 33 |
+
a
|
| 34 |
+
downstream task of object detection [1], [2], [3], [4],
|
| 35 |
+
[5], has recently received increasing attention due to its
|
| 36 |
+
great application potential. For successful HOI detection, it
|
| 37 |
+
needs to have the ability to understand human activities
|
| 38 |
+
which are abstracted as a set of <human, object, action>
|
| 39 |
+
triplets in this task, requiring a much deeper understanding
|
| 40 |
+
for the semantic information of visual scenes. Without HOI
|
| 41 |
+
detection, machines can only interpret images as collections
|
| 42 |
+
of object bounding boxes, i.e., AI systems can only pick up
|
| 43 |
+
information such as ’A man is on the bike’ or ’A bike is in
|
| 44 |
+
the corner’, but not ’A man rides a bike’.
|
| 45 |
+
Spanning the past and the present, the existing HOI
|
| 46 |
+
detection approaches [6], [7], [8], [9], [10], [11], [12], [13],
|
| 47 |
+
[14], [15], [16], [17], [18], [19], [20], [21] tend to fall into
|
| 48 |
+
two categories, namely two-stage and one-stage methods.
|
| 49 |
+
Conventional two-stage methods [7], [8], [10], [12], [13],
|
| 50 |
+
[14], [18], [20], [22], [23], [24], [25], as an intuitive approach,
|
| 51 |
+
detect human and object instances by leveraging the off-the-
|
| 52 |
+
•
|
| 53 |
+
Shuailei Ma, Yuefeng Wang are with College of Information Science and
|
| 54 |
+
Engineering, Northeastern University, Shenyang, China, 110819.
|
| 55 |
+
E-mail: {xiaomabufei, wangyuefeng0203} @gmail.com
|
| 56 |
+
•
|
| 57 |
+
Shanze Wang is with Changsha Hisense Intelligent System Research
|
| 58 |
+
Institute Co., Ltd. and Information Technology R&D Innovation Center of
|
| 59 |
+
Peking University, Shaoxing, China.
|
| 60 |
+
E-mail: szgg0099@gmail.com
|
| 61 |
+
•
|
| 62 |
+
Ying Wei is the corresponding author, with College of Information Science
|
| 63 |
+
and Engineering, Northeastern University, Shenyang, China, 110819.
|
| 64 |
+
E-mail: weiying@ise.neu.edu.cn
|
| 65 |
+
Manuscript received October 26, 2022; revised January 10, 2023.
|
| 66 |
+
FGAHOI
|
| 67 |
+
Low Level
|
| 68 |
+
Middle Level
|
| 69 |
+
High Level
|
| 70 |
+
Fine-Grained
|
| 71 |
+
Anchors
|
| 72 |
+
Attention Weights
|
| 73 |
+
Fig. 1: FGAHOI leverages the query embeddings and multi-
|
| 74 |
+
scale features to generate fine-grained anchors and the
|
| 75 |
+
corresponding weights for HOI instances of diverse scales.
|
| 76 |
+
Then, they guide the decoder to aid key semantic infor-
|
| 77 |
+
mation of HOI instances to the content embeddings and
|
| 78 |
+
translate the content embeddings to HOI embeddings for
|
| 79 |
+
predicting all elements of the HOI instances.
|
| 80 |
+
shelf object detector [1], [3], [4], utilizing the visual features
|
| 81 |
+
extracted from the located areas to recognize action classes.
|
| 82 |
+
To fully leverage the visual features, several methods [7],
|
| 83 |
+
[10], [14], [20], [22], [23], [24], [25] separately extract vi-
|
| 84 |
+
sual features of human-object pairs and spatial information
|
| 85 |
+
from the located area in a multi-stream architecture, fusing
|
| 86 |
+
them in a post-fusion strategy. In the meanwhile, several
|
| 87 |
+
approaches [8], [10], [20], [23], [24] employ the existing pose
|
| 88 |
+
arXiv:2301.04019v1 [cs.CV] 8 Jan 2023
|
| 89 |
+
|
| 90 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 91 |
+
2
|
| 92 |
+
estimation methods, such as [26], [27], [28] to extract pose
|
| 93 |
+
information and fuse it with other features to predict the
|
| 94 |
+
action class. In addition, some works [8], [12], [13], [18],
|
| 95 |
+
[29] leverage the graph neural network to extract complex
|
| 96 |
+
semantic relationship between humans and objects. How-
|
| 97 |
+
ever, the difficulties encountered in the two-stage approach
|
| 98 |
+
lie mainly in the effective fusion of human-object pairs and
|
| 99 |
+
complex semantic information. Besides, owing to the limita-
|
| 100 |
+
tions of the fixed detector and some other components (pose
|
| 101 |
+
estimation etc.), the two-stage method can only achieve a
|
| 102 |
+
sub-optimal solution.
|
| 103 |
+
To achieve high efficiency, one-stage approaches [6], [9],
|
| 104 |
+
[11], [15], [17], [21], [30], [31] which utilize interaction points
|
| 105 |
+
between the human-object pairs to simultaneously predict
|
| 106 |
+
human and object offset vectors and action classes, are
|
| 107 |
+
proposed to detect human-object pairs and recognize inter-
|
| 108 |
+
active relationships in parallel. However, when the human
|
| 109 |
+
and object in the image are far apart from each other, these
|
| 110 |
+
methods are disturbed by ambiguous semantic features.
|
| 111 |
+
The one-stage methods do not achieve much attention until
|
| 112 |
+
the appearance of the Detection Transformer (DETR) [32]
|
| 113 |
+
and QPIC [19] applies it for HOI detection. Then, plenty
|
| 114 |
+
of transformer-based works [6], [9], [16], [17], [33] attempt
|
| 115 |
+
to solve the HOI detection with different encoder-decoder
|
| 116 |
+
structures and backbone models.
|
| 117 |
+
In comparison to object instances, HOI instances have
|
| 118 |
+
a greater span of spatial, scale and task. In most HOI
|
| 119 |
+
instances, there is a certain distance between human and
|
| 120 |
+
objects and their scale varies enormously. Compared with
|
| 121 |
+
simple object classification, it is necessary to consider more
|
| 122 |
+
information between human-object pairs rather than the
|
| 123 |
+
features of humans and objects for interaction classification.
|
| 124 |
+
Therefore, the detection is more susceptible to distractions
|
| 125 |
+
from noisy backgrounds. However, most recent works [19],
|
| 126 |
+
[33] use object detection frameworks [32], [34] directly for
|
| 127 |
+
HOI detection by simply adding the interaction classifica-
|
| 128 |
+
tion head, ignoring these problems. Inspired by [34] which
|
| 129 |
+
leverages the reference points to guide the decoding pro-
|
| 130 |
+
cess, we propose to leverage fine-grained anchors to guide
|
| 131 |
+
the detection of HOI instances and protect it from noisy
|
| 132 |
+
backgrounds. To generate fine-grained anchors for kinds
|
| 133 |
+
of HOI instances, it is obviously necessary to consider the
|
| 134 |
+
input image features. There are, however, two inevitable
|
| 135 |
+
challenges that arise as a result of this. 𝑖) it is difficult to
|
| 136 |
+
extract pivotal features from the images which contain noisy
|
| 137 |
+
background information. 𝑖𝑖) how to semantically align and
|
| 138 |
+
merge the extracted features with query embeddings is also
|
| 139 |
+
an open question.
|
| 140 |
+
In this paper, we propose a novel transformer-based
|
| 141 |
+
model for HOI detection, i.e., FGAHOI: Fine-Grained An-
|
| 142 |
+
chors for Human-Object Interaction Detection (as shown in
|
| 143 |
+
Fig.1). FGAHOI leverages the multi-scale sampling mech-
|
| 144 |
+
anism (MSS) to extract pivotal features from images with
|
| 145 |
+
noisy background information for variable HOI instances.
|
| 146 |
+
Based on the sampling strategy and initial anchor gener-
|
| 147 |
+
ated by the corresponding query embedding, MSS could
|
| 148 |
+
extract hierarchical spatial features of human, object and the
|
| 149 |
+
interaction region for each HOI instance. Besides, the hi-
|
| 150 |
+
erarchical spatial-aware (HSAM) and task-aware merging
|
| 151 |
+
mechanism (TAM) are utilized to semantically align and
|
| 152 |
+
merge the extracted features with the query embeddings.
|
| 153 |
+
HSAM merges the extracted features in the hierarchical
|
| 154 |
+
spatial perspective according to the cross-attention between
|
| 155 |
+
the features and the query embeddings. Meanwhile, the
|
| 156 |
+
extracted features are aligned towards the query embed-
|
| 157 |
+
dings, according to the cross-attention weights of the merg-
|
| 158 |
+
ing process. Thereafter, TAM leverages the switches which
|
| 159 |
+
dynamically switch ON and OFF to merge the input features
|
| 160 |
+
and query embeddings in the task perspective.
|
| 161 |
+
According to experiment results, we investigate that it
|
| 162 |
+
is difficult of the end-to-end training approach to allow the
|
| 163 |
+
transformer-based models to achieve optimal performance
|
| 164 |
+
when more complex task requirements are required. In-
|
| 165 |
+
spired by the stage-wise training [35], [36] for LTR [37], we
|
| 166 |
+
propose a novel stage-wise training strategy for FGAHOI.
|
| 167 |
+
During the training process, we add the important compo-
|
| 168 |
+
nents of the model in turn to clarify the training direction
|
| 169 |
+
of the model at each stage, so as to maximize the savings in
|
| 170 |
+
the training cost of the model.
|
| 171 |
+
To the best of our knowledge, there are no measurements
|
| 172 |
+
for the difficulty of detecting HOI instances. We investigate
|
| 173 |
+
that two difficulties lie in the detection of human-object
|
| 174 |
+
pairs, 𝑖.𝑒., Uneven Distributed Area in Human-Object
|
| 175 |
+
Pairs and Long Distance Visual Modeling of Human-
|
| 176 |
+
Object Pairs. In this paper, we propose two measurements
|
| 177 |
+
and a novel dataset (HOI-SDC) for these two challenges.
|
| 178 |
+
HOI-SDC eliminates the influence of other factors (Too few
|
| 179 |
+
training samples of some HOI categories, too tricky interac-
|
| 180 |
+
tion actions, et.al.) on the model training and focuses on the
|
| 181 |
+
model for these two difficult challenges. Our contributions
|
| 182 |
+
can be summarized fourfold:
|
| 183 |
+
•
|
| 184 |
+
We propose a novel transformer-based human-object
|
| 185 |
+
interaction detector (FGAHOI) which leverages input
|
| 186 |
+
features to generate fine-grained anchors for pro-
|
| 187 |
+
tecting the detection of HOI instances from noisy
|
| 188 |
+
backgrounds.
|
| 189 |
+
•
|
| 190 |
+
We propose a novel training strategy where each
|
| 191 |
+
component of the model is trained in turn to clar-
|
| 192 |
+
ify the training direction at each stage, in order to
|
| 193 |
+
maximize the training cost savings.
|
| 194 |
+
•
|
| 195 |
+
We propose two ways to measure the difficulty of
|
| 196 |
+
HOI detection and a dataset, 𝑖.𝑒., HOI-SDC for the
|
| 197 |
+
two challenges (Uneven Distributed Area in Human-
|
| 198 |
+
Object Pairs and Long Distance Visual Modeling of
|
| 199 |
+
Human-Object Pairs) of detecting HOI instances.
|
| 200 |
+
•
|
| 201 |
+
Our extensive experiments on three benchmarks:
|
| 202 |
+
HICO-DET
|
| 203 |
+
[38],
|
| 204 |
+
HOI-SDC
|
| 205 |
+
and
|
| 206 |
+
V-COCO
|
| 207 |
+
[39],
|
| 208 |
+
demonstrate the effectiveness of the proposed FGA-
|
| 209 |
+
HOI. Specifically, FGAHOI outperforms all existing
|
| 210 |
+
state-of-the-art methods by a large margin.
|
| 211 |
+
2
|
| 212 |
+
RELATED WORKS
|
| 213 |
+
Two-stage HOI Detection Approaches: The two-stage HOI
|
| 214 |
+
detection approaches [7], [8], [10], [12], [13], [14], [18], [20],
|
| 215 |
+
[22], [23], [24], [25], [29] employ the off-the-shelf object de-
|
| 216 |
+
tector [1], [3], [4] to localize humans and objects. Afterwards,
|
| 217 |
+
the features of backbone networks inside the human and
|
| 218 |
+
objects regions are cropped. Part of the two-stage meth-
|
| 219 |
+
ods [8], [12], [13], [18], [29] treat the human and objects
|
| 220 |
+
feature as nodes and employ graph neural networks [40]
|
| 221 |
+
|
| 222 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 223 |
+
3
|
| 224 |
+
Encoder
|
| 225 |
+
Content Embeddings
|
| 226 |
+
…
|
| 227 |
+
Initial Anchor
|
| 228 |
+
…
|
| 229 |
+
Positional Encoding
|
| 230 |
+
Human Box
|
| 231 |
+
Object box/Class
|
| 232 |
+
Human Box
|
| 233 |
+
Object box/Class
|
| 234 |
+
Verb Class
|
| 235 |
+
Verb Class
|
| 236 |
+
HOI
|
| 237 |
+
Detection
|
| 238 |
+
Head
|
| 239 |
+
Decoder
|
| 240 |
+
Task-Aware
|
| 241 |
+
Merging
|
| 242 |
+
Dynamic
|
| 243 |
+
Switch On/Off
|
| 244 |
+
…
|
| 245 |
+
Positional
|
| 246 |
+
Embeddings
|
| 247 |
+
Multi-Scale
|
| 248 |
+
Sampling Strategy
|
| 249 |
+
Multi-Scale
|
| 250 |
+
Features
|
| 251 |
+
Hierarchical Spatial-Aware
|
| 252 |
+
Merging
|
| 253 |
+
Fig. 2: This figure illustrates the overall structure of FGAHOI. FGAHOI utilizes a hierarchical backbone and a deformable
|
| 254 |
+
encoder to extract the semantic features in a multi-scale approach. In the decoding phrase, FGAHOI leverages the multi-
|
| 255 |
+
scale sampling, hierarchical spatial-aware merging and task-aware merging mechanism to align input features with
|
| 256 |
+
query embeddings and assist the generation of fine-grained anchors for the translation of HOI embeddings. At the back
|
| 257 |
+
end of the pipeline, HOI detector leverages the HOI embeddings and initial anchor to predict all elements of the HOI
|
| 258 |
+
instances.
|
| 259 |
+
to predict action classes. The other part of the two-stage
|
| 260 |
+
approach [7], [10], [14], [20], [22], [23], [24], [25] leverages
|
| 261 |
+
multi-stream networks to extract diverse information from
|
| 262 |
+
cropped regions, such as human features, object features,
|
| 263 |
+
spatial information and human pose information. Then,
|
| 264 |
+
the information is fused to predict the action in a post-
|
| 265 |
+
fusion strategy. Two-stage methods mainly concentrate on
|
| 266 |
+
predicting the action class in the second stage. Nevertheless,
|
| 267 |
+
the quality of cropped features from the first stage cannot
|
| 268 |
+
be guaranteed in most cases, so the method cannot achieve
|
| 269 |
+
an optimal solution. More importantly, integrating semantic
|
| 270 |
+
information of human-object pairs requires massive time
|
| 271 |
+
and computing resources.
|
| 272 |
+
One-stage HOI Detection Approaches: The traditional one-
|
| 273 |
+
stage approaches [9], [11], [15], [31] use interaction points
|
| 274 |
+
or union regions to detect human-object pairs and identify
|
| 275 |
+
interactive action classes in parallel. However, these meth-
|
| 276 |
+
ods which and are hampered by distant human-object pairs,
|
| 277 |
+
require a gathering and pairing process. With the creation of
|
| 278 |
+
DETR [32], one-stage approaches have become the current
|
| 279 |
+
mainstream. QPIC [19] converts the object detection head
|
| 280 |
+
of DETR into an interaction detection head to predict HOI
|
| 281 |
+
instance directly. HOITrans [17] combines transformer [41]
|
| 282 |
+
and CNN [42] to straightly predict HOI instances from the
|
| 283 |
+
query embeddings. AS-Net [6] and HOTR [9] each propose a
|
| 284 |
+
two-branch transformer method that consists of an instance
|
| 285 |
+
decoder and an interaction decoder to predict the boxes
|
| 286 |
+
and action classes in parallel. CDN [16] proposes a cascade
|
| 287 |
+
disentangling decoder to decode action classes. QAHOI [33]
|
| 288 |
+
directly combines Swin Transformer [43] and deformable
|
| 289 |
+
DETR [34] to predict HOI instances.
|
| 290 |
+
Anchor-Based Object Detection Transformer: Deformable
|
| 291 |
+
DETR [34] first introduces the reference point concept,
|
| 292 |
+
where the sampling offset is predicted by each reference
|
| 293 |
+
point to perform deformable cross-attention. To facilitate
|
| 294 |
+
extreme region discrimination, Conditional DETR [44] re-
|
| 295 |
+
formulates the attention operation and rebuilt positional
|
| 296 |
+
queries based on reference points. Anchor DETR [45] pro-
|
| 297 |
+
poses to explicitly capitalize on the spatial prior during
|
| 298 |
+
cross-attention and box regression by utilizing a predefined
|
| 299 |
+
2D anchor point [𝑐𝑥, 𝑐𝑦]. DAB-DETR [46] extends such a
|
| 300 |
+
2D concept to a 4D anchor box [𝑐𝑥, 𝑐𝑦, 𝑤, ℎ] and proposed
|
| 301 |
+
to refine it layer-by-layer. SAM-DETR [47] proposes directly
|
| 302 |
+
updating content embeddings by extracting salient points
|
| 303 |
+
from image features. In this paper, we propose a novel
|
| 304 |
+
decoding process for HOI detection. The alignment and fine-
|
| 305 |
+
grained anchor generation is proposed to align the multi-
|
| 306 |
+
scale features with HOI query embeddings and generate
|
| 307 |
+
fine-grained anchors for the diverse HOI instances with
|
| 308 |
+
variable spatial distribution, scales and tasks. Then, the fine-
|
| 309 |
+
grained anchors guide the deformable attention process in
|
| 310 |
+
aiding key information to query embeddings from noisy
|
| 311 |
+
backgrounds.
|
| 312 |
+
3
|
| 313 |
+
PROPOSED METHOD
|
| 314 |
+
In Sec.3.1, we show the overall architecture of FGAHOI.
|
| 315 |
+
Then, we describe the multi-scale feature extractor in Sec.3.2.
|
| 316 |
+
We introduce the multi-scale sampling strategy in Sec.3.3.1.
|
| 317 |
+
The hierarchical spatial-aware, task-aware merging mech-
|
| 318 |
+
anism and the decoding process is proposed in Sec.3.3.2,
|
| 319 |
+
Sec.3.3.3 and Sec.3.3.4, respectively. In Sec.3.4, we present
|
| 320 |
+
the architecture of the HOI detection head. In Sec.3.5, the
|
| 321 |
+
stage-wise training strategy, loss calculation and inference
|
| 322 |
+
process is illustrated.
|
| 323 |
+
3.1
|
| 324 |
+
Overall Architecture
|
| 325 |
+
The overall architecture of our proposed FGAHOI is illus-
|
| 326 |
+
trated in Fig 2. For a given image 𝑥 ∈ R𝐻×𝑊 ×3, FGAHOI
|
| 327 |
+
firstly uses a hierarchical backbone network to extract the
|
| 328 |
+
multi-scale features Z𝑖
|
| 329 |
+
∈ R
|
| 330 |
+
𝐻
|
| 331 |
+
4×2𝑖 × 𝑊
|
| 332 |
+
4×2𝑖 ×2𝑖𝐶𝑠, 𝑖
|
| 333 |
+
= 1, 2, 3. The
|
| 334 |
+
multi-scale features are then projected from dimension C𝑠
|
| 335 |
+
to dimension C𝑑 by using 1×1 convolution. After being
|
| 336 |
+
flattened out, the multi-scale features are concatenated to
|
| 337 |
+
N𝑠 vectors with C𝑑 dimensions. Afterwards, along with
|
| 338 |
+
|
| 339 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 340 |
+
4
|
| 341 |
+
supplementary positional encoding 𝑝 ∈ R𝑁𝑠×𝐶𝑑, the multi-
|
| 342 |
+
scale features are sent into the deformable transformer en-
|
| 343 |
+
coder which consists of a set of stacked deformable encoder
|
| 344 |
+
layers to encode semantic features. The encoded semantic
|
| 345 |
+
features 𝑀 ∈ R𝑁𝑠×𝐶𝑑 are then acquired. In the decoding
|
| 346 |
+
process, the content 𝐶 and positional 𝑃 embeddings are both
|
| 347 |
+
a set of learnable vectors {𝑣𝑖 | 𝑣𝑖 ∈ R𝑐𝑑}𝑁𝑞
|
| 348 |
+
𝑖=1. The positional
|
| 349 |
+
embeddings 𝑃 first generate the initial anchor 𝐴 ∈ R𝑁𝑞×2
|
| 350 |
+
according to a linear layer. The positional 𝑃, content 𝐶
|
| 351 |
+
embeddings, inital anchor 𝐴 and encoded features 𝑀 are
|
| 352 |
+
simultaneously sent into the decoder 𝐹𝑑𝑒𝑐𝑜𝑑𝑒𝑟 (·, ·, ·, ·) which
|
| 353 |
+
is a set of stacked decoder layers. In every decoder layer,
|
| 354 |
+
the initial anchor first leverages the multi-scale sampling
|
| 355 |
+
strategy to sample the multi-scale features corresponding
|
| 356 |
+
to the content embeddings. The sampled features assist
|
| 357 |
+
the generation of fine-grained anchors and corresponding
|
| 358 |
+
attention weights through the hierarchical spatial-aware
|
| 359 |
+
and task-aware merging mechanism. The HOI embeddings
|
| 360 |
+
𝐻 = {ℎ𝑖 | ℎ𝑖 ∈ R𝑐𝑑}𝑁𝑞
|
| 361 |
+
𝑖=1 are translated from the query embed-
|
| 362 |
+
dings 𝑄 through the fine-grained anchors, attention weights
|
| 363 |
+
and the deformable attention. The HOI embeddings 𝐻 are
|
| 364 |
+
acquired as 𝐻 = 𝐹𝑑𝑒𝑐𝑜𝑑𝑒𝑟 (𝑀, 𝑃, 𝐶, 𝐴). Eventually, the HOI
|
| 365 |
+
detector leverages the HOI embeddings 𝐻 and initial anchor
|
| 366 |
+
to predict the HOI instances < 𝑏ℎ, 𝑏𝑜, 𝑐𝑜, 𝑐𝑣 >, where 𝑏ℎ, 𝑏𝑜,
|
| 367 |
+
𝑐𝑜 and 𝑐𝑣 stands for the human box coordinate (𝑥, 𝑦, 𝑤, ℎ),
|
| 368 |
+
object box coordinate, object class and verb class, respec-
|
| 369 |
+
tively.
|
| 370 |
+
3.2
|
| 371 |
+
Multi-Scale Features Extractor
|
| 372 |
+
High-quality visual features are a prerequisite for successful
|
| 373 |
+
HOI detection. For extracting the multi-scale features with
|
| 374 |
+
long-range semantic information, FGAHOI leverages the
|
| 375 |
+
multi-scale feature extractor which consists of a hierarchical
|
| 376 |
+
backbone network and a deformable transformer encoder to
|
| 377 |
+
extract features, the folumation is as Equation.1:
|
| 378 |
+
𝑀 = 𝐹𝑒𝑛𝑐𝑜𝑑𝑒𝑟 (𝐹𝑓 𝑙𝑎𝑡𝑡𝑒𝑛(𝜙(𝑥)), 𝑝, 𝑠, 𝑟, 𝑙)
|
| 379 |
+
∈ R𝑁𝑠×𝐶𝑑,
|
| 380 |
+
(1)
|
| 381 |
+
where 𝐹𝑒𝑛𝑐𝑜𝑑𝑒𝑟 (·), 𝐹𝑓 𝑙𝑎𝑡𝑡𝑒𝑛(·) and 𝜙(·) denotes the encoder,
|
| 382 |
+
flatten operation and backbone network, respectively. 𝑝 is
|
| 383 |
+
the position encoding, 𝑠 is the spatial shape of the multi-
|
| 384 |
+
scale features, 𝑟 stands for the valid ratios and 𝑙 represents
|
| 385 |
+
the level index corresponding the multi-scale features. The
|
| 386 |
+
hierarchical backbone network is flexible and can be com-
|
| 387 |
+
posed of any convolutional neural network [42], [48], [49],
|
| 388 |
+
[50] and transformer backbone network [43], [51], [52], [53],
|
| 389 |
+
[54], [55], [56], [57]. However, CNN is poor at capturing
|
| 390 |
+
non-local semantic features like the relationships between
|
| 391 |
+
humans and objects. In this paper, we mainly use Swin
|
| 392 |
+
Transformer tiny and large version [43] to enhance the
|
| 393 |
+
ability of feature extractor for extracting long-range features.
|
| 394 |
+
3.3
|
| 395 |
+
Why FGAHOI Decodes Better?
|
| 396 |
+
During the decoding process, the fine-grained anchors can
|
| 397 |
+
be regarded as a positional prior to let decoder focus on
|
| 398 |
+
the region of interest, directly guiding the decoder to aid
|
| 399 |
+
semantic information to the content embeddings which are
|
| 400 |
+
used to predict all elements of the HOI instances. Therefore,
|
| 401 |
+
fine-grained anchors play the following two crucial roles in
|
| 402 |
+
HOI detection. 𝑖) Fine-grained anchors directly determine
|
| 403 |
+
whether the information gained from input features to
|
| 404 |
+
content embeddings is instance-critical or noisy background
|
| 405 |
+
information. 𝑖𝑖) Fine-grained anchors determine the quality
|
| 406 |
+
of alignment between the query embeddings and multi-
|
| 407 |
+
scale features of input scenarios. Both are crucial factors for
|
| 408 |
+
the quality of decoding results. The existing methods [33],
|
| 409 |
+
[34] directly utilize the query embedding to generate fine-
|
| 410 |
+
grained anchors based on the initial anchor, without consid-
|
| 411 |
+
ering the multi-scale features of the input scenarios and the
|
| 412 |
+
semantic alignment between the query embedding and the
|
| 413 |
+
input features at all. Our FGAHOI proposes a novel fine-
|
| 414 |
+
grained anchors generator which consists of multi-scale
|
| 415 |
+
sampling, hierarchical spatial-aware merging and task-
|
| 416 |
+
aware merging mechanism (as shown in Fig.3). The gen-
|
| 417 |
+
erator adequately leverages the initial anchor, multi-scale
|
| 418 |
+
features and query embeddings for generating suitable fine-
|
| 419 |
+
grained anchors for diverse input scenarios and aligning
|
| 420 |
+
semantic information between different input scenarios and
|
| 421 |
+
query embeddings. The formulation of FGAHOI decoding
|
| 422 |
+
process is as follows:
|
| 423 |
+
𝐻 = Defattn(Task(Hier Spatial({𝑥𝑖
|
| 424 |
+
𝑠}, 𝐶𝑢), 𝐶𝑢), 𝑀, 𝐶𝑢),
|
| 425 |
+
(2)
|
| 426 |
+
where 𝐶𝑢 is the content embeddings updated by the po-
|
| 427 |
+
sitional embeddings, Defattn represents the deformable at-
|
| 428 |
+
tention, 𝑥𝑖
|
| 429 |
+
𝑠 represents the sampled features of the 𝑖-th level
|
| 430 |
+
features. 𝑀 is the encoded input features.
|
| 431 |
+
3.3.1
|
| 432 |
+
Multi-Scale Sampling Mechanism
|
| 433 |
+
The HOI instances contained in the input scenarios usually
|
| 434 |
+
vary in size, where some instances taking up most of the
|
| 435 |
+
area in the input scenarios and others occupying perhaps
|
| 436 |
+
only a few pixels. Our FGAHOI aims at detecting all in-
|
| 437 |
+
stances in the scene, regardless of the size. Therefore, when
|
| 438 |
+
using the initial anchor to sample the multi-scale features,
|
| 439 |
+
for shallow features mainly used to detect instances of small
|
| 440 |
+
size, the sampling strategy only samples a small range of
|
| 441 |
+
features around the initial anchor. In contrast, for deep
|
| 442 |
+
features mainly used to detect instances of large size, the
|
| 443 |
+
sampling strategy samples a large range of features around
|
| 444 |
+
the initial anchor. As shown in Fig.3 (b), in the generator, the
|
| 445 |
+
encoded features are first reshaped to the original shape.
|
| 446 |
+
Based on the initial anchor, generator leverages the sam-
|
| 447 |
+
pling strategy to sample multi-scale features as follows:
|
| 448 |
+
𝑥𝑖
|
| 449 |
+
𝑠 =𝐹𝑠𝑎𝑚𝑝𝑙𝑒( 𝑟𝑒𝑠ℎ𝑎𝑝𝑒(𝑀)𝑖, 𝐴, 𝑠𝑖𝑧𝑒𝑖, 𝑏𝑖𝑙𝑖𝑛𝑒𝑎𝑟 ),
|
| 450 |
+
(3)
|
| 451 |
+
where 𝑠𝑖𝑧𝑒𝑖 (𝑖 = 0, 1, 2) denotes the sampling size of the 𝑖-th
|
| 452 |
+
level features. 𝑀 is the encoded input features. 𝐴 is the ini-
|
| 453 |
+
tial anchor. Inspired by [58], we utilize bilinear interpolation
|
| 454 |
+
in the sampling strategy.
|
| 455 |
+
3.3.2
|
| 456 |
+
Hierarchical Spatial-Aware Merging Mechanism
|
| 457 |
+
In order to better utilize the hierarchical spatial informa-
|
| 458 |
+
tion of sampled features for aligning content embeddings
|
| 459 |
+
with the sampled features, we propose a novel hierarchical
|
| 460 |
+
spatial-aware merging mechanism (HSAM) which utilizes
|
| 461 |
+
the content embeddings to extract hierarchical spatial in-
|
| 462 |
+
formation and merge the sampled features, as shown in
|
| 463 |
+
Fig.3 (c). The content embeddings are first updated by the
|
| 464 |
+
positional embeddings and multi-head self-attention mech-
|
| 465 |
+
anism as follows:
|
| 466 |
+
𝐶𝑢 = 𝐶 + 𝐹MHA
|
| 467 |
+
�
|
| 468 |
+
(𝐶 + 𝑃)𝑊𝑞, (𝐶 + 𝑃)𝑊 𝑘, 𝐶𝑊 𝑣�
|
| 469 |
+
,
|
| 470 |
+
(4)
|
| 471 |
+
|
| 472 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 473 |
+
5
|
| 474 |
+
Multi-Scale Sampling Strategy
|
| 475 |
+
Src Shape
|
| 476 |
+
Anchor
|
| 477 |
+
Sampling
|
| 478 |
+
Low
|
| 479 |
+
High
|
| 480 |
+
Middle
|
| 481 |
+
Positional
|
| 482 |
+
Embeddings
|
| 483 |
+
Multi-Head
|
| 484 |
+
Self-Attention
|
| 485 |
+
Add & Norm
|
| 486 |
+
Deformable
|
| 487 |
+
Multi-Head
|
| 488 |
+
Cross-Attention
|
| 489 |
+
FFN
|
| 490 |
+
Add & Norm
|
| 491 |
+
Add & Norm
|
| 492 |
+
Encoded Multi-Scale Features
|
| 493 |
+
Alignment &
|
| 494 |
+
Fine-Grained
|
| 495 |
+
Anchor Generation
|
| 496 |
+
Query
|
| 497 |
+
Embeddings
|
| 498 |
+
(������������ , ������������ )
|
| 499 |
+
V
|
| 500 |
+
K
|
| 501 |
+
Q
|
| 502 |
+
V
|
| 503 |
+
Fined-grained
|
| 504 |
+
Anchors
|
| 505 |
+
Initial Anchor
|
| 506 |
+
Attention
|
| 507 |
+
Weights
|
| 508 |
+
0
|
| 509 |
+
Updated
|
| 510 |
+
Content
|
| 511 |
+
Embeddings
|
| 512 |
+
Fine-grained
|
| 513 |
+
Anchors
|
| 514 |
+
Corresponding
|
| 515 |
+
Attention Weights
|
| 516 |
+
Linear
|
| 517 |
+
Linear
|
| 518 |
+
SoftMax
|
| 519 |
+
Generation of Fine-Grained Anchors
|
| 520 |
+
Reshape
|
| 521 |
+
Reshape
|
| 522 |
+
(b)
|
| 523 |
+
(a)
|
| 524 |
+
(d)
|
| 525 |
+
(e)
|
| 526 |
+
Hierarchical Spatial-Aware
|
| 527 |
+
Merging Mechanism
|
| 528 |
+
Middle
|
| 529 |
+
Multi-Head
|
| 530 |
+
Attention
|
| 531 |
+
Flatten
|
| 532 |
+
Low
|
| 533 |
+
High
|
| 534 |
+
Multi-Head Attention
|
| 535 |
+
CAT
|
| 536 |
+
Positional
|
| 537 |
+
Embeddings
|
| 538 |
+
Content
|
| 539 |
+
Embeddings
|
| 540 |
+
…
|
| 541 |
+
Task-Aware Merging Mechanism
|
| 542 |
+
Dynamic
|
| 543 |
+
Switch On/Off
|
| 544 |
+
Cross-Attn[(
|
| 545 |
+
,
|
| 546 |
+
]
|
| 547 |
+
Linear
|
| 548 |
+
Linear
|
| 549 |
+
RELU
|
| 550 |
+
Normalize
|
| 551 |
+
Updated
|
| 552 |
+
Content
|
| 553 |
+
Embeddings
|
| 554 |
+
,
|
| 555 |
+
)
|
| 556 |
+
(c)
|
| 557 |
+
Middle
|
| 558 |
+
Low
|
| 559 |
+
High
|
| 560 |
+
Merge
|
| 561 |
+
Features
|
| 562 |
+
Fig. 3: The architecture of FGAHOI’s decoder. (a) Illustration of FGAHOI’s decoding process. (b) Illustration of Multi-
|
| 563 |
+
scale sampling mechanism. (c) Illustration of Hierarchical spatial-aware merging mechanism. (d) Illustration of Task-aware
|
| 564 |
+
merging mechanism. (e) Generation process of fine-grained anchors and the corresponding attention weights.
|
| 565 |
+
where 𝑊𝑞, 𝑊 𝑘 and 𝑊 𝑣 denotes the parameter matrices
|
| 566 |
+
for query, key and value in the self-attention mechanism,
|
| 567 |
+
respectively. 𝐹MHA(·) is the multi-head attention mechanism.
|
| 568 |
+
𝐶 and 𝑃 represents the content and position embeddings,
|
| 569 |
+
respectively. Then, the updated content embeddings are
|
| 570 |
+
leveraged to merge the sampled features, the formulation
|
| 571 |
+
is as follows:
|
| 572 |
+
𝑥𝑖
|
| 573 |
+
𝑚 = 𝐹concat
|
| 574 |
+
�head1, . . . , headNH
|
| 575 |
+
� 𝑊𝑂,
|
| 576 |
+
where headn = Softmax
|
| 577 |
+
�
|
| 578 |
+
(𝐶𝑢𝑊𝑞
|
| 579 |
+
n ) · (𝑥𝑖
|
| 580 |
+
𝑠𝑊 𝑘
|
| 581 |
+
n )𝑇
|
| 582 |
+
√𝑑𝑘
|
| 583 |
+
�
|
| 584 |
+
(𝑥𝑖
|
| 585 |
+
𝑠𝑊 𝑣
|
| 586 |
+
n ).
|
| 587 |
+
(5)
|
| 588 |
+
Where 𝑥𝑖
|
| 589 |
+
𝑚 represents the merged features of the 𝑖-th level
|
| 590 |
+
sampled features. 𝐶𝑢 is the content embeddings updated
|
| 591 |
+
by the positional embeddings. 𝑊𝑂 denotes the parameter
|
| 592 |
+
matrices for multi-head concatenation. 𝑊𝑞
|
| 593 |
+
𝑛 , 𝑊 𝑘
|
| 594 |
+
𝑛 and 𝑊 𝑣
|
| 595 |
+
𝑛
|
| 596 |
+
denote the parameter matrices for query, key and value of
|
| 597 |
+
n-th attention head. 𝐹concat is the concatenating operation.
|
| 598 |
+
𝑑𝑘 =
|
| 599 |
+
𝑁ℎ𝑑
|
| 600 |
+
𝑁𝐻 , 𝑁ℎ𝑑 is the hidden dimensions, and 𝑁𝐻 is the
|
| 601 |
+
number of attention head.
|
| 602 |
+
Following the merging of the sampled features at each
|
| 603 |
+
scale based on spatial information, the merged features at
|
| 604 |
+
each scale are first concatenated together as follows:
|
| 605 |
+
𝑋𝑚 = 𝐹concat({𝑥𝑖
|
| 606 |
+
𝑚}𝑖=0,1,2) ∈ R𝐵×𝑁𝑞×𝑁𝐿×𝑁ℎ𝑑,
|
| 607 |
+
(6)
|
| 608 |
+
where 𝑁𝐿 is the number of multi-scale, 𝑥𝑖
|
| 609 |
+
𝑚 represents the
|
| 610 |
+
merged features of the 𝑖-th level sampled features, 𝑋𝑚 is the
|
| 611 |
+
concatenated multi-scale features and merged by the scale-
|
| 612 |
+
aware merging mechanism as follows:
|
| 613 |
+
𝑋𝑢 = 𝐹concat (head1, . . . , headh) 𝑊𝑂,
|
| 614 |
+
where headn = Softmax
|
| 615 |
+
�
|
| 616 |
+
(𝐶𝑢𝑊𝑞
|
| 617 |
+
n ) · (𝑋𝑚𝑊 𝑘
|
| 618 |
+
n )𝑇
|
| 619 |
+
√𝑑𝑘
|
| 620 |
+
�
|
| 621 |
+
(𝑋𝑚𝑊 𝑣
|
| 622 |
+
n ).
|
| 623 |
+
(7)
|
| 624 |
+
Where 𝑋𝑢 is the merged multi-scale features for updating
|
| 625 |
+
the content embeddings.
|
| 626 |
+
3.3.3
|
| 627 |
+
Task-Aware Merging Mechanism
|
| 628 |
+
Considering diverse HOI instances, the task-aware merging
|
| 629 |
+
mechanism is proposed to fuse the merged multi-scale
|
| 630 |
+
features and content embeddings and align the content
|
| 631 |
+
embeddings with the merged feature in the task-aware
|
| 632 |
+
perspective, as shown in Fig.3 (e). It leverages the merged
|
| 633 |
+
multi-scale features and content embeddings to generate
|
| 634 |
+
dynamic switch for selecting suitable channel in the merging
|
| 635 |
+
process. Content embedding and multi-scale information
|
| 636 |
+
after fusion are first stitched together, the formulation is as
|
| 637 |
+
follows:
|
| 638 |
+
𝑋 = 𝐹𝑠𝑡𝑎𝑐𝑘 (𝐶𝑢, 𝑋𝑢) ∈ R𝐵×𝑁𝑞×(2×𝑁ℎ𝑑).
|
| 639 |
+
(8)
|
| 640 |
+
Where 𝐶𝑢 is the content embeddings updated by the posi-
|
| 641 |
+
tional embeddings, 𝑋𝑢 is the merged multi-scale features.
|
| 642 |
+
Thereafter, we use cross-attention mechanism to update
|
| 643 |
+
these as follows:
|
| 644 |
+
𝑋𝑠𝑤𝑖𝑡𝑐ℎ = 𝐹concat (head1, . . . , headh) 𝑊𝑂,
|
| 645 |
+
where headn = Softmax
|
| 646 |
+
�
|
| 647 |
+
(𝐶𝑢𝑊𝑞
|
| 648 |
+
n ) · (𝑋𝑊 𝑘
|
| 649 |
+
n )𝑇
|
| 650 |
+
√𝑑𝑘
|
| 651 |
+
�
|
| 652 |
+
(𝑋𝑊 𝑣
|
| 653 |
+
n ).
|
| 654 |
+
(9)
|
| 655 |
+
|
| 656 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 657 |
+
6
|
| 658 |
+
TABLE 1: Instance statistics of two difficulties. We quantify all the instances in the HAKE-HOI [20] dataset according to
|
| 659 |
+
two newly proposed metrics and divide them into ten intervals.
|
| 660 |
+
Dataset
|
| 661 |
+
IMI
|
| 662 |
+
IMI0
|
| 663 |
+
IMI1
|
| 664 |
+
IMI2
|
| 665 |
+
IMI3
|
| 666 |
+
IMI4
|
| 667 |
+
IMI5
|
| 668 |
+
IMI6
|
| 669 |
+
IMI7
|
| 670 |
+
IMI8
|
| 671 |
+
IMI9
|
| 672 |
+
HAKE-HOI
|
| 673 |
+
num𝐴𝑅
|
| 674 |
+
104243
|
| 675 |
+
65499
|
| 676 |
+
44303
|
| 677 |
+
31241
|
| 678 |
+
21982
|
| 679 |
+
11888
|
| 680 |
+
4670
|
| 681 |
+
1818
|
| 682 |
+
598
|
| 683 |
+
168
|
| 684 |
+
num𝐿𝑅
|
| 685 |
+
424
|
| 686 |
+
1243
|
| 687 |
+
1784
|
| 688 |
+
3043
|
| 689 |
+
8668
|
| 690 |
+
70191
|
| 691 |
+
83314
|
| 692 |
+
79427
|
| 693 |
+
34017
|
| 694 |
+
4299
|
| 695 |
+
SDC Train
|
| 696 |
+
num𝐴𝑅
|
| 697 |
+
62526
|
| 698 |
+
30235
|
| 699 |
+
16346
|
| 700 |
+
12013
|
| 701 |
+
10269
|
| 702 |
+
11189
|
| 703 |
+
4223
|
| 704 |
+
1540
|
| 705 |
+
423
|
| 706 |
+
139
|
| 707 |
+
num𝐿𝑅
|
| 708 |
+
177
|
| 709 |
+
515
|
| 710 |
+
874
|
| 711 |
+
1656
|
| 712 |
+
5208
|
| 713 |
+
48798
|
| 714 |
+
38517
|
| 715 |
+
29544
|
| 716 |
+
20265
|
| 717 |
+
3349
|
| 718 |
+
SDC Test
|
| 719 |
+
num𝐴𝑅
|
| 720 |
+
24737
|
| 721 |
+
0
|
| 722 |
+
0
|
| 723 |
+
0
|
| 724 |
+
0
|
| 725 |
+
0
|
| 726 |
+
0
|
| 727 |
+
0
|
| 728 |
+
0
|
| 729 |
+
0
|
| 730 |
+
num𝐿𝑅
|
| 731 |
+
153
|
| 732 |
+
415
|
| 733 |
+
464
|
| 734 |
+
834
|
| 735 |
+
2704
|
| 736 |
+
20167
|
| 737 |
+
0
|
| 738 |
+
0
|
| 739 |
+
0
|
| 740 |
+
0
|
| 741 |
+
Then, the generated information is utilized to gain the
|
| 742 |
+
dynamic switch for merging, the formulation is as follows:
|
| 743 |
+
𝑆𝑤𝑖𝑡𝑐ℎ𝛾 = 𝐹𝑛𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒(𝐹𝑚𝑙𝑝(𝑋𝑠𝑤𝑖𝑡𝑐ℎ))𝛾 ∈ R𝐵×𝑁𝑞×2×2,
|
| 744 |
+
(10)
|
| 745 |
+
where 𝑆𝑤𝑖𝑡𝑐ℎ𝛾 is the dynamic switch for 𝛾-th dimension
|
| 746 |
+
of the merged features. 𝐹ℎ𝑠𝑖𝑔𝑚𝑜𝑖𝑑(·) and 𝐹𝑚𝑙𝑝(·) denote the
|
| 747 |
+
hard sigmoid and feed forward network which consists of
|
| 748 |
+
two linear layers and one Relu activation layer, respectively.
|
| 749 |
+
Inspired by [59], the merging mechanism is designed as
|
| 750 |
+
follows:
|
| 751 |
+
𝑈𝛾 = 𝐹𝑀 𝑎𝑥{𝑆𝑤𝑖𝑡𝑐ℎ𝛾
|
| 752 |
+
𝑖,0 ⊙ 𝑋𝛾
|
| 753 |
+
𝑢 + 𝑆𝑤𝑖𝑡𝑐ℎ𝛾
|
| 754 |
+
𝑖,1}𝑖=0,1 + 𝐶𝛾
|
| 755 |
+
𝑢 ,
|
| 756 |
+
(11)
|
| 757 |
+
where 𝑈𝛾 is 𝛾-th features of content embeddings updated by
|
| 758 |
+
the merged multi-scale features. 𝐹𝑀 𝑎𝑥 is the max operation.
|
| 759 |
+
…
|
| 760 |
+
Linear
|
| 761 |
+
Linear
|
| 762 |
+
MLP
|
| 763 |
+
MLP
|
| 764 |
+
Object Class
|
| 765 |
+
Action Class
|
| 766 |
+
Human Box
|
| 767 |
+
Object Box
|
| 768 |
+
HOI Instances
|
| 769 |
+
<Human/Object Boxes, Object
|
| 770 |
+
Class, Action Class>
|
| 771 |
+
Initial Anchor
|
| 772 |
+
HOI
|
| 773 |
+
Embeddings
|
| 774 |
+
Fig. 4: The prediction process of the HOI detection head. See
|
| 775 |
+
sec 3.4 for more details.
|
| 776 |
+
3.3.4
|
| 777 |
+
Decoding with Fine-Grained Anchor
|
| 778 |
+
As shown in Fig.3 (e), the updated content embeddings
|
| 779 |
+
are used to generate fine-grained anchors and attention
|
| 780 |
+
weights. According to the linear layer, reshape operation
|
| 781 |
+
and softmax function, the formulation is as follows:
|
| 782 |
+
A = 𝐹𝑙𝑖𝑛&𝑟𝑒𝑠(𝑈) ∈ R𝐵×𝑁𝑞×𝑁𝐻 ×𝑁𝐿×𝑁A×2,
|
| 783 |
+
(12)
|
| 784 |
+
W = 𝐹𝑙𝑖𝑛&𝑟𝑒𝑠&𝑠𝑜 𝑓 𝑡 (𝑈) ∈ R𝐵×𝑁𝑞×𝑁𝐻 ×𝑁𝐿×𝑁A,
|
| 785 |
+
(13)
|
| 786 |
+
As shown in Fig.3 (a), the fine-grained anchors and at-
|
| 787 |
+
tention weights are utilized to aid semantic features from
|
| 788 |
+
the encoded features of the input scenarios to the content
|
| 789 |
+
embeddings, the formulation is as follows:
|
| 790 |
+
P𝑞 =
|
| 791 |
+
𝑁𝐻
|
| 792 |
+
∑︁
|
| 793 |
+
𝑛=1
|
| 794 |
+
𝑾𝑛
|
| 795 |
+
� 𝑁𝐿
|
| 796 |
+
∑︁
|
| 797 |
+
𝑙=1
|
| 798 |
+
𝑁A
|
| 799 |
+
∑︁
|
| 800 |
+
𝑘=1
|
| 801 |
+
W𝑙
|
| 802 |
+
𝑛𝑞𝑘 · 𝑾′
|
| 803 |
+
𝑛𝒙𝒍 �
|
| 804 |
+
A𝑙
|
| 805 |
+
𝑛𝑞𝑘
|
| 806 |
+
��
|
| 807 |
+
,
|
| 808 |
+
(14)
|
| 809 |
+
where P𝑞 is the extracted semantic information used for
|
| 810 |
+
translating 𝑞-th content to HOI embeddings. A𝑙
|
| 811 |
+
𝑛𝑞𝑘 and
|
| 812 |
+
W𝑙
|
| 813 |
+
𝑛𝑞𝑘 represent the 𝑘-th fine-grained anchors and corre-
|
| 814 |
+
sponding attention weights of the 𝑛-th attention head for
|
| 815 |
+
the 𝑞-th query embedding. Both 𝑊𝑛 and 𝑊 ′
|
| 816 |
+
𝑛 are parameter
|
| 817 |
+
matrices of the 𝑛-th attention head. 𝑁A is the number of
|
| 818 |
+
fine-grained anchors of each scale in one attention head.
|
| 819 |
+
3.4
|
| 820 |
+
HOI Detection Head
|
| 821 |
+
FGAHOI leverages a simple HOI detection head to predict
|
| 822 |
+
all elements of HOI instances. As shown in Fig.4, the detec-
|
| 823 |
+
tion head utilizes the HOI embeddings and the initial anchor
|
| 824 |
+
to localize the human and object boxes. In this process, each
|
| 825 |
+
initial anchor acts as the base point for the bounding boxes
|
| 826 |
+
of the corresponding pair of a human and an object, the
|
| 827 |
+
formulation is as follows:
|
| 828 |
+
𝑏ℎ = 𝐹𝑚𝑙𝑝(𝐻)[· · · , : 2] + 𝑖𝑛𝑖𝑡𝑖𝑎𝑙 𝑎𝑛𝑐ℎ𝑜𝑟
|
| 829 |
+
∈ R𝑁𝑞×4,
|
| 830 |
+
(15)
|
| 831 |
+
𝑏𝑜 = 𝐹𝑚𝑙𝑝(𝐻)[· · · , : 2] + 𝑖𝑛𝑖𝑡𝑖𝑎𝑙 𝑎𝑛𝑐ℎ𝑜𝑟
|
| 832 |
+
∈ R𝑁𝑞×4,
|
| 833 |
+
(16)
|
| 834 |
+
𝑐𝑜 = 𝐹𝑙𝑖𝑛𝑒𝑎𝑟 (𝐻)
|
| 835 |
+
∈ R𝑁𝑞×𝑛𝑢𝑚𝑜,
|
| 836 |
+
(17)
|
| 837 |
+
𝑐𝑣 = 𝐹𝑙𝑖𝑛𝑒𝑎𝑟 (𝐻)
|
| 838 |
+
∈ R𝑁𝑞×𝑛𝑢𝑚𝑣,
|
| 839 |
+
(18)
|
| 840 |
+
where 𝐹𝑚𝑙𝑝 denotes the feed forward network consists of
|
| 841 |
+
three linear layers and three relu activation layers. 𝐹𝑙𝑖𝑛𝑒𝑎𝑟
|
| 842 |
+
stands for the linear layer. 𝑛𝑢𝑚𝑜 and 𝑛𝑢𝑚𝑣 are the number
|
| 843 |
+
of object and action classes, respectively. 𝐻 denotes the HOI
|
| 844 |
+
embeddings.
|
| 845 |
+
3.5
|
| 846 |
+
Training and Inference
|
| 847 |
+
3.5.1
|
| 848 |
+
Stage-wise Training
|
| 849 |
+
Inspired by the stage-wise training approach [35], [36] which
|
| 850 |
+
decouples feature learning and classifier learning into two
|
| 851 |
+
independent stages for LTR [37], we propose a novel stage-
|
| 852 |
+
wise training strategy for FGAHOI. We start by training
|
| 853 |
+
the base network (FGAHOI without any merging mecha-
|
| 854 |
+
nism) in an end-to-end manner. We then add the merging
|
| 855 |
+
mechanism in turn to the trained base network for another
|
| 856 |
+
short period of training. In this phrase, the parameters
|
| 857 |
+
of the trained base network are leveraged as pretrained
|
| 858 |
+
parameters and no parameters are fixed during the training
|
| 859 |
+
process.
|
| 860 |
+
|
| 861 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 862 |
+
7
|
| 863 |
+
ride, fly, sit_on, exit,
|
| 864 |
+
direct airplane
|
| 865 |
+
ride, straddle, run,
|
| 866 |
+
hold, race horse
|
| 867 |
+
lasso cow
|
| 868 |
+
carry handbag
|
| 869 |
+
wear backpack
|
| 870 |
+
hold, stand_under umbrella
|
| 871 |
+
ride, race, run
|
| 872 |
+
straddle, hold horse
|
| 873 |
+
fly, pull
|
| 874 |
+
kite
|
| 875 |
+
sail, ride, sit_on,
|
| 876 |
+
stand_on, drive boat
|
| 877 |
+
race, turn, ride, sit on,
|
| 878 |
+
straddle, hold motorcycle
|
| 879 |
+
wear tie
|
| 880 |
+
scratch, walk,
|
| 881 |
+
pet, train dog
|
| 882 |
+
ride, sit on,
|
| 883 |
+
drive, board bus
|
| 884 |
+
carry, wear, hold
|
| 885 |
+
backpack
|
| 886 |
+
serve, hit sports_ball
|
| 887 |
+
swing tennis_racket
|
| 888 |
+
direct, inspect, ride,
|
| 889 |
+
sit on, fly airplane
|
| 890 |
+
type on, read,
|
| 891 |
+
hold laptop
|
| 892 |
+
sit on couch
|
| 893 |
+
brush_with, hold
|
| 894 |
+
toothbrush
|
| 895 |
+
kick, block, hit,
|
| 896 |
+
inspect, dribble
|
| 897 |
+
sports_ball
|
| 898 |
+
stand_on, ride, jump,
|
| 899 |
+
hold skateboard
|
| 900 |
+
ride, fly, sit_on, exit,
|
| 901 |
+
direct airplane
|
| 902 |
+
ride, straddle, run,
|
| 903 |
+
hold, race horse
|
| 904 |
+
lasso cow
|
| 905 |
+
carry handbag
|
| 906 |
+
wear backpack
|
| 907 |
+
hold, stand_under umbrella
|
| 908 |
+
ride, race, run
|
| 909 |
+
straddle, hold horse
|
| 910 |
+
fly, pull
|
| 911 |
+
kite
|
| 912 |
+
sail, ride, sit_on,
|
| 913 |
+
stand_on, drive boat
|
| 914 |
+
race, turn, ride, sit on,
|
| 915 |
+
straddle, hold motorcycle
|
| 916 |
+
wear tie
|
| 917 |
+
scratch, walk,
|
| 918 |
+
pet, train dog
|
| 919 |
+
ride, sit on,
|
| 920 |
+
drive, board bus
|
| 921 |
+
carry, wear, hold
|
| 922 |
+
backpack
|
| 923 |
+
serve, hit sports_ball
|
| 924 |
+
swing tennis_racket
|
| 925 |
+
direct, inspect, ride,
|
| 926 |
+
sit on, fly airplane
|
| 927 |
+
type on, read,
|
| 928 |
+
hold laptop
|
| 929 |
+
sit on couch
|
| 930 |
+
brush_with, hold
|
| 931 |
+
toothbrush
|
| 932 |
+
kick, block, hit,
|
| 933 |
+
inspect, dribble
|
| 934 |
+
sports_ball
|
| 935 |
+
stand_on, ride, jump,
|
| 936 |
+
hold skateboard
|
| 937 |
+
Fig. 5: Visualization of HOI detection. Humans and objects are represented by pink and blue bounding boxes respectively,
|
| 938 |
+
and interactions are marked by grey lines linking the box centers. Kindly refer to Sec. 5.6.1 for more details.
|
| 939 |
+
(a)
|
| 940 |
+
(b)
|
| 941 |
+
(c)
|
| 942 |
+
catch sport ball
|
| 943 |
+
watch
|
| 944 |
+
bird
|
| 945 |
+
kick
|
| 946 |
+
sports ball
|
| 947 |
+
hit sport
|
| 948 |
+
ball
|
| 949 |
+
fly kite
|
| 950 |
+
hit sport
|
| 951 |
+
ball
|
| 952 |
+
wear tie
|
| 953 |
+
swing
|
| 954 |
+
tennis_racket
|
| 955 |
+
sit_on
|
| 956 |
+
toilet
|
| 957 |
+
hold
|
| 958 |
+
surfboard
|
| 959 |
+
ride skateboard
|
| 960 |
+
ride skateboard
|
| 961 |
+
carry surfboard
|
| 962 |
+
ride surfboard
|
| 963 |
+
ride surfboard
|
| 964 |
+
ride surfboard
|
| 965 |
+
ride surfboard
|
| 966 |
+
ride surfboard
|
| 967 |
+
flip
|
| 968 |
+
skateboard
|
| 969 |
+
catch sport ball
|
| 970 |
+
watch
|
| 971 |
+
bird
|
| 972 |
+
kick
|
| 973 |
+
sports ball
|
| 974 |
+
hit sport
|
| 975 |
+
ball
|
| 976 |
+
fly kite
|
| 977 |
+
hit sport
|
| 978 |
+
ball
|
| 979 |
+
wear tie
|
| 980 |
+
swing
|
| 981 |
+
tennis_racket
|
| 982 |
+
sit_on
|
| 983 |
+
toilet
|
| 984 |
+
hold
|
| 985 |
+
surfboard
|
| 986 |
+
ride skateboard
|
| 987 |
+
carry surfboard
|
| 988 |
+
ride surfboard
|
| 989 |
+
ride surfboard
|
| 990 |
+
flip
|
| 991 |
+
skateboard
|
| 992 |
+
(a)
|
| 993 |
+
(b)
|
| 994 |
+
(c)
|
| 995 |
+
catch sport ball
|
| 996 |
+
watch
|
| 997 |
+
bird
|
| 998 |
+
kick
|
| 999 |
+
sports ball
|
| 1000 |
+
hit sport
|
| 1001 |
+
ball
|
| 1002 |
+
fly kite
|
| 1003 |
+
hit sport
|
| 1004 |
+
ball
|
| 1005 |
+
wear tie
|
| 1006 |
+
swing
|
| 1007 |
+
tennis_racket
|
| 1008 |
+
sit_on
|
| 1009 |
+
toilet
|
| 1010 |
+
hold
|
| 1011 |
+
surfboard
|
| 1012 |
+
ride skateboard
|
| 1013 |
+
carry surfboard
|
| 1014 |
+
ride surfboard
|
| 1015 |
+
ride surfboard
|
| 1016 |
+
flip
|
| 1017 |
+
skateboard
|
| 1018 |
+
Fig. 6: (a) illustrates the excellent long-range visual mod-
|
| 1019 |
+
elling capabilities. (b) demonstrates remarkable robustness.
|
| 1020 |
+
(c) shows the superior capabilities for identifying small HOI
|
| 1021 |
+
instances. Kindly refer to Sec. 5.6.1 for more details.
|
| 1022 |
+
3.5.2
|
| 1023 |
+
Loss Calculation
|
| 1024 |
+
Inspired by the set-based training process of HOI-Trans
|
| 1025 |
+
[17], QPIC [19], CDN [16] and QAHOI [33], we first use
|
| 1026 |
+
the bipartite matching with the Hungarian algorithm to
|
| 1027 |
+
match each ground truth with its best-matching prediction.
|
| 1028 |
+
For subsequent back-propagation, a loss is then established
|
| 1029 |
+
between the matched predictions and the matching ground
|
| 1030 |
+
truths. The folumation is as follows:
|
| 1031 |
+
𝐿 = 𝜆𝑜𝐿𝑜
|
| 1032 |
+
𝑐 + 𝜆𝑣 𝐿𝑣
|
| 1033 |
+
𝑐 +
|
| 1034 |
+
∑︁
|
| 1035 |
+
𝑘 ∈(ℎ,𝑜)
|
| 1036 |
+
�
|
| 1037 |
+
𝜆𝑏𝐿𝑘
|
| 1038 |
+
𝑏 + 𝜆𝐺𝐼𝑜𝑈 𝐿𝑘
|
| 1039 |
+
𝐺𝐼𝑜𝑈
|
| 1040 |
+
�
|
| 1041 |
+
,
|
| 1042 |
+
(19)
|
| 1043 |
+
where 𝐿𝑜
|
| 1044 |
+
𝑐 and 𝐿𝑣
|
| 1045 |
+
𝑐 represent the object class and action class
|
| 1046 |
+
loss, respectively. We utilize the modified focal loss function
|
| 1047 |
+
[60] and sigmoid focal loss function [61] for 𝐿𝑣
|
| 1048 |
+
𝑐 and 𝐿𝑜
|
| 1049 |
+
𝑐,
|
| 1050 |
+
respectively. 𝐿𝑏 is the box regression loss and consists of the
|
| 1051 |
+
𝐿1 Loss. 𝐿𝐺𝐼𝑂𝑈 denotes the intersection-over-union loss, the
|
| 1052 |
+
same as the function in QPIC [19]. 𝜆𝑜, 𝜆𝑣, 𝜆𝑏 and 𝜆𝐺𝐼𝑜𝑈 are
|
| 1053 |
+
the hyper parameters for adjusting the weights of each loss.
|
| 1054 |
+
3.5.3
|
| 1055 |
+
Inference
|
| 1056 |
+
The inference process is to composite the output of the HOI
|
| 1057 |
+
detection head to form HOI triplets. Formally, the 𝑖-th out-
|
| 1058 |
+
put prediction is generated as < 𝑏ℎ
|
| 1059 |
+
𝑖 , 𝑏𝑜
|
| 1060 |
+
𝑖 , 𝑎𝑟𝑔𝑚𝑎𝑥𝑘𝑐ℎ𝑜𝑖
|
| 1061 |
+
𝑖
|
| 1062 |
+
(𝑘) >.
|
| 1063 |
+
The HOI triplet score 𝑐ℎ𝑜𝑖
|
| 1064 |
+
𝑖
|
| 1065 |
+
combined by the scores of action
|
| 1066 |
+
𝑐𝑣
|
| 1067 |
+
𝑖 and object 𝑐𝑜
|
| 1068 |
+
𝑖 classification, formularized as 𝑐ℎ𝑜𝑖
|
| 1069 |
+
𝑖
|
| 1070 |
+
= 𝑐𝑣
|
| 1071 |
+
𝑖 · 𝑐𝑜
|
| 1072 |
+
𝑖 .
|
| 1073 |
+
4
|
| 1074 |
+
PROPOSED DATASET
|
| 1075 |
+
There are two main difficulties existing with human-object
|
| 1076 |
+
pairs. 𝑖) Uneven size distribution of human and objects in
|
| 1077 |
+
human-object pairs. 𝑖𝑖) Excessive distance between person
|
| 1078 |
+
and object in human-object pairs. To the best of our knowl-
|
| 1079 |
+
edge, there are no relevant metrics to measure these two
|
| 1080 |
+
difficulties. In this paper, we propose two metrics 𝐴𝑅 and
|
| 1081 |
+
𝐿𝑅 for measuring these two difficulties. Then two novel
|
| 1082 |
+
challenges corresponding to these two difficulties are pro-
|
| 1083 |
+
posed. In addition, we propose a novel Set for these Double
|
| 1084 |
+
Challenges (HOI-SDC). The data is selected from HAKE-
|
| 1085 |
+
HOI [20] which is re-split from HAKE [62] and provides
|
| 1086 |
+
110K+ images. HAKE-HOI has 117 action classes, 80 object
|
| 1087 |
+
classes and 520 HOI categories.
|
| 1088 |
+
|
| 1089 |
+
CB福CREERSBK2
|
| 1090 |
+
M
|
| 1091 |
+
WITDBWEJOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 1092 |
+
8
|
| 1093 |
+
FGAHOI
|
| 1094 |
+
QAHOI
|
| 1095 |
+
FGAHOI
|
| 1096 |
+
QAHOI
|
| 1097 |
+
FGAHOI
|
| 1098 |
+
QAHOI
|
| 1099 |
+
Fine-Grained
|
| 1100 |
+
Anchors #1
|
| 1101 |
+
Fine-Grained
|
| 1102 |
+
Anchors #2
|
| 1103 |
+
Fine-Grained
|
| 1104 |
+
Anchors #3
|
| 1105 |
+
Fine-Grained
|
| 1106 |
+
Anchors #4
|
| 1107 |
+
Fine-Grained
|
| 1108 |
+
Anchors #5
|
| 1109 |
+
Fine-Grained
|
| 1110 |
+
Anchors #6
|
| 1111 |
+
Fine-Grained
|
| 1112 |
+
Anchors #7
|
| 1113 |
+
Fine-Grained
|
| 1114 |
+
Anchors #8
|
| 1115 |
+
HOI
|
| 1116 |
+
Instance
|
| 1117 |
+
Hold
|
| 1118 |
+
Sport Ball
|
| 1119 |
+
Ride
|
| 1120 |
+
Motorcycle
|
| 1121 |
+
Fly Kite
|
| 1122 |
+
Fig. 7: Comparison of fine-grained anchors between FGAHOI and QAHOI. We visualize the fine-grained anchors
|
| 1123 |
+
corresponding to all attention heads and the corresponding attention weights, where the shades of colors correspond
|
| 1124 |
+
to the magnitude of the weights. Obviously, FGAHOI is more accurate in focusing on humans, objects and interaction
|
| 1125 |
+
areas. Kindly refer to Sec. 5.6.2 for more details.
|
| 1126 |
+
4.1
|
| 1127 |
+
HOI-UDA
|
| 1128 |
+
We propose a novel measurement for the challenge of
|
| 1129 |
+
Uneven Distributed Area in Human-Object Pairs, the
|
| 1130 |
+
formulation is as follow:
|
| 1131 |
+
𝐴𝑅 = 𝐴𝑟𝑒𝑎ℎ · 𝐴𝑟𝑒𝑎𝑜
|
| 1132 |
+
𝐴𝑟𝑒𝑎2
|
| 1133 |
+
ℎ𝑜𝑖
|
| 1134 |
+
,
|
| 1135 |
+
(20)
|
| 1136 |
+
where 𝐴𝑟𝑒𝑎ℎ, 𝐴𝑟𝑒𝑎𝑜 and 𝐴𝑟𝑒𝑎ℎ𝑜𝑖 denote the area of human,
|
| 1137 |
+
object and HOI instances, respectively (as shown in Fig.8
|
| 1138 |
+
(a)). We quantify all the instances in the HAKE-HOI into ten
|
| 1139 |
+
intervals and count the number of instances of each interval
|
| 1140 |
+
in the second and fifth row of Table.1. To better evaluate the
|
| 1141 |
+
ability of the model to detect HOI for human-object pairs
|
| 1142 |
+
with uneven distributed areas, we specially select 24737
|
| 1143 |
+
HOI instances of IMIUDA
|
| 1144 |
+
0
|
| 1145 |
+
in testing set.
|
| 1146 |
+
4.2
|
| 1147 |
+
HOI-LDVM
|
| 1148 |
+
A novel measurement for the challenge of Long Distance
|
| 1149 |
+
Visual Modeling of Human-Object Pairs is proposed in
|
| 1150 |
+
Eq.21.
|
| 1151 |
+
𝐿𝑅 = 𝐿ℎ + 𝐿𝑜
|
| 1152 |
+
𝐿ℎ𝑜𝑖
|
| 1153 |
+
,
|
| 1154 |
+
(21)
|
| 1155 |
+
where 𝐿ℎ, 𝐿𝑜 and 𝐿ℎ𝑜𝑖 denote the size we define of human,
|
| 1156 |
+
object and HOI instances, respectively (as shown in Fig.8
|
| 1157 |
+
(b)). The instances are quantified in the third and sixth row
|
| 1158 |
+
of Table.1. To better evaluate the ability of the model to de-
|
| 1159 |
+
tect HOI for human-object pairs with with long distance, we
|
| 1160 |
+
specially select 24737 HOI instances of IMILDVM
|
| 1161 |
+
0
|
| 1162 |
+
∼ IMILDVM
|
| 1163 |
+
6
|
| 1164 |
+
in testing set.
|
| 1165 |
+
4.3
|
| 1166 |
+
HOI-SDC
|
| 1167 |
+
In order to avoid the training process of the model being
|
| 1168 |
+
influenced by a portion of HOI classes with a very small
|
| 1169 |
+
number of instances, we remove some of the HOI classes
|
| 1170 |
+
containing a very small number of instances and HOI
|
| 1171 |
+
classes with no interaction from the training Set for the
|
| 1172 |
+
Double Challenge. Finally, there are total 321 HOI classes,
|
| 1173 |
+
|
| 1174 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 1175 |
+
9
|
| 1176 |
+
TABLE 2: Performance comparison with the state-of-the-art methods on the HICO-DET dataset. ’V’, ’S’, ’P’ and ’L’ represent
|
| 1177 |
+
the visual feature, spatial feature, human pose feature and language feature respectively. Fine-tuned Detection means the
|
| 1178 |
+
parameter of the model is pre-trained on the MS-COCO dataset. Backbone with ’*’ and ’+’ means that they are pre-trained
|
| 1179 |
+
on ImageNet-22K with 384×384 input resolution. QAHOI(R) represents that the results are reproduced on the same machine
|
| 1180 |
+
with our model. Kindly refer to Sec. 5.4.1 for more details.
|
| 1181 |
+
Architecture
|
| 1182 |
+
Method
|
| 1183 |
+
Backbone
|
| 1184 |
+
Fine-tuned
|
| 1185 |
+
Feature
|
| 1186 |
+
Default (↑)
|
| 1187 |
+
Known Object (↑)
|
| 1188 |
+
Full
|
| 1189 |
+
Rare
|
| 1190 |
+
Non-Rare
|
| 1191 |
+
Full
|
| 1192 |
+
Rare
|
| 1193 |
+
Non-Rare
|
| 1194 |
+
Two-Stage Methods
|
| 1195 |
+
Multi-stream
|
| 1196 |
+
No-Frill [23]
|
| 1197 |
+
ResNet-152
|
| 1198 |
+
|
| 1199 |
+
A+S+P
|
| 1200 |
+
17.18
|
| 1201 |
+
12.17
|
| 1202 |
+
18.08
|
| 1203 |
+
-
|
| 1204 |
+
-
|
| 1205 |
+
-
|
| 1206 |
+
PMFNet [24]
|
| 1207 |
+
ResNet-50-FPN
|
| 1208 |
+
|
| 1209 |
+
A+S
|
| 1210 |
+
17.46
|
| 1211 |
+
15.65
|
| 1212 |
+
18.00
|
| 1213 |
+
20.34
|
| 1214 |
+
17.47
|
| 1215 |
+
21.20
|
| 1216 |
+
ACP [25]
|
| 1217 |
+
ResNet-101
|
| 1218 |
+
|
| 1219 |
+
A+S+L
|
| 1220 |
+
21.96
|
| 1221 |
+
16.43
|
| 1222 |
+
23.62
|
| 1223 |
+
-
|
| 1224 |
+
-
|
| 1225 |
+
-
|
| 1226 |
+
PD-Net [10]
|
| 1227 |
+
ResNet-152
|
| 1228 |
+
|
| 1229 |
+
A+S+P+L
|
| 1230 |
+
22.37
|
| 1231 |
+
17.61
|
| 1232 |
+
23.79
|
| 1233 |
+
26.86
|
| 1234 |
+
21.70
|
| 1235 |
+
28.44
|
| 1236 |
+
VCL [7]
|
| 1237 |
+
ResNet-50
|
| 1238 |
+
|
| 1239 |
+
A+S
|
| 1240 |
+
23.63
|
| 1241 |
+
17.21
|
| 1242 |
+
25.55
|
| 1243 |
+
25.98
|
| 1244 |
+
19.12
|
| 1245 |
+
28.03
|
| 1246 |
+
Graph-Based
|
| 1247 |
+
RPNN [8]
|
| 1248 |
+
ResNet-50
|
| 1249 |
+
|
| 1250 |
+
A+P
|
| 1251 |
+
17.35
|
| 1252 |
+
12.78
|
| 1253 |
+
18.71
|
| 1254 |
+
-
|
| 1255 |
+
-
|
| 1256 |
+
-
|
| 1257 |
+
VSGNet [13]
|
| 1258 |
+
ResNet-152
|
| 1259 |
+
|
| 1260 |
+
A+S
|
| 1261 |
+
19.80
|
| 1262 |
+
16.05
|
| 1263 |
+
20.91
|
| 1264 |
+
-
|
| 1265 |
+
-
|
| 1266 |
+
-
|
| 1267 |
+
DRG [12]
|
| 1268 |
+
ResNet-50-FPN
|
| 1269 |
+
|
| 1270 |
+
A+S+L
|
| 1271 |
+
24.53
|
| 1272 |
+
19.47
|
| 1273 |
+
26.04
|
| 1274 |
+
27.98
|
| 1275 |
+
23.14
|
| 1276 |
+
29.43
|
| 1277 |
+
SCG [18]
|
| 1278 |
+
ResNet-50-FPN
|
| 1279 |
+
|
| 1280 |
+
A+S
|
| 1281 |
+
31.33
|
| 1282 |
+
24.72
|
| 1283 |
+
33.31
|
| 1284 |
+
34.37
|
| 1285 |
+
27.18
|
| 1286 |
+
36.50
|
| 1287 |
+
One-Stage Methods
|
| 1288 |
+
Interaction points
|
| 1289 |
+
IP-Net [15]
|
| 1290 |
+
ResNet-50-FPN
|
| 1291 |
+
|
| 1292 |
+
A
|
| 1293 |
+
19.56
|
| 1294 |
+
12.79
|
| 1295 |
+
21.58
|
| 1296 |
+
22.05
|
| 1297 |
+
15.77
|
| 1298 |
+
23.92
|
| 1299 |
+
PPDM [31]
|
| 1300 |
+
Hourglass-104
|
| 1301 |
+
|
| 1302 |
+
A
|
| 1303 |
+
21.73
|
| 1304 |
+
13.78
|
| 1305 |
+
24.10
|
| 1306 |
+
24.58
|
| 1307 |
+
16.65
|
| 1308 |
+
26.84
|
| 1309 |
+
GGNet [11]
|
| 1310 |
+
Hourglass-104
|
| 1311 |
+
|
| 1312 |
+
A
|
| 1313 |
+
23.47
|
| 1314 |
+
16.48
|
| 1315 |
+
25.60
|
| 1316 |
+
27.36
|
| 1317 |
+
20.23
|
| 1318 |
+
29.48
|
| 1319 |
+
Transformer-Based
|
| 1320 |
+
HOITrans [17]
|
| 1321 |
+
ResNet-101
|
| 1322 |
+
|
| 1323 |
+
A
|
| 1324 |
+
26.60
|
| 1325 |
+
19.15
|
| 1326 |
+
28.54
|
| 1327 |
+
29.1
|
| 1328 |
+
20.98
|
| 1329 |
+
31.57
|
| 1330 |
+
HOTR [9]
|
| 1331 |
+
ResNet-50
|
| 1332 |
+
|
| 1333 |
+
A
|
| 1334 |
+
23.46
|
| 1335 |
+
16.21
|
| 1336 |
+
25.65
|
| 1337 |
+
-
|
| 1338 |
+
-
|
| 1339 |
+
-
|
| 1340 |
+
ResNet-50
|
| 1341 |
+
|
| 1342 |
+
A
|
| 1343 |
+
25.10
|
| 1344 |
+
17.34
|
| 1345 |
+
27.42
|
| 1346 |
+
-
|
| 1347 |
+
-
|
| 1348 |
+
-
|
| 1349 |
+
AS-Net [6]
|
| 1350 |
+
ResNet-50
|
| 1351 |
+
|
| 1352 |
+
A
|
| 1353 |
+
24.40
|
| 1354 |
+
22.39
|
| 1355 |
+
25.01
|
| 1356 |
+
27.41
|
| 1357 |
+
25.44
|
| 1358 |
+
28.00
|
| 1359 |
+
ResNet-50
|
| 1360 |
+
|
| 1361 |
+
A
|
| 1362 |
+
28.87
|
| 1363 |
+
24.25
|
| 1364 |
+
30.25
|
| 1365 |
+
31.74
|
| 1366 |
+
27.07
|
| 1367 |
+
33.14
|
| 1368 |
+
QPIC [19]
|
| 1369 |
+
ResNet-50
|
| 1370 |
+
|
| 1371 |
+
A
|
| 1372 |
+
29.07
|
| 1373 |
+
21.85
|
| 1374 |
+
31.23
|
| 1375 |
+
31.68
|
| 1376 |
+
24.14
|
| 1377 |
+
33.93
|
| 1378 |
+
ResNet-50
|
| 1379 |
+
|
| 1380 |
+
A
|
| 1381 |
+
24.21
|
| 1382 |
+
17.51
|
| 1383 |
+
26.21
|
| 1384 |
+
-
|
| 1385 |
+
-
|
| 1386 |
+
-
|
| 1387 |
+
QAHOI [33]
|
| 1388 |
+
Swin-Tiny
|
| 1389 |
+
|
| 1390 |
+
A
|
| 1391 |
+
28.47
|
| 1392 |
+
22.44
|
| 1393 |
+
30.27
|
| 1394 |
+
30.99
|
| 1395 |
+
24.83
|
| 1396 |
+
32.84
|
| 1397 |
+
Swin-Large∗
|
| 1398 |
+
+
|
| 1399 |
+
|
| 1400 |
+
A
|
| 1401 |
+
35.78
|
| 1402 |
+
29.80
|
| 1403 |
+
37.56
|
| 1404 |
+
37.59
|
| 1405 |
+
31.66
|
| 1406 |
+
39.36
|
| 1407 |
+
QAHOI (R)
|
| 1408 |
+
Swin-Tiny
|
| 1409 |
+
|
| 1410 |
+
A
|
| 1411 |
+
27.67
|
| 1412 |
+
20.22
|
| 1413 |
+
29.69
|
| 1414 |
+
30.06
|
| 1415 |
+
22.95
|
| 1416 |
+
32.18
|
| 1417 |
+
Swin-Large∗
|
| 1418 |
+
+
|
| 1419 |
+
|
| 1420 |
+
A
|
| 1421 |
+
35.43
|
| 1422 |
+
29.22
|
| 1423 |
+
37.29
|
| 1424 |
+
37.23
|
| 1425 |
+
31.01
|
| 1426 |
+
39.09
|
| 1427 |
+
FGAHOI
|
| 1428 |
+
Swin-Tiny
|
| 1429 |
+
|
| 1430 |
+
A
|
| 1431 |
+
29.94
|
| 1432 |
+
22.24
|
| 1433 |
+
32.24
|
| 1434 |
+
32.48
|
| 1435 |
+
24.16
|
| 1436 |
+
34.97
|
| 1437 |
+
Swin-Large∗
|
| 1438 |
+
+
|
| 1439 |
+
|
| 1440 |
+
A
|
| 1441 |
+
37.18
|
| 1442 |
+
30.71
|
| 1443 |
+
39.11
|
| 1444 |
+
38.93
|
| 1445 |
+
31.93
|
| 1446 |
+
41.02
|
| 1447 |
+
74 object classes and 93 action classes. The training and
|
| 1448 |
+
testing set contain 37,155 and 9,666 images, respectively. The
|
| 1449 |
+
detailed distribution of HOI instances is shown in Table.1.
|
| 1450 |
+
(b)
|
| 1451 |
+
(a)
|
| 1452 |
+
������������������������������������������������������������
|
| 1453 |
+
������������������������������������������������������������
|
| 1454 |
+
������������������������������������������������������������������������������������
|
| 1455 |
+
������������������������
|
| 1456 |
+
������������������������
|
| 1457 |
+
������������������������������������������������
|
| 1458 |
+
Fig. 8: Proposed metrics for the difficulties existing with HOI
|
| 1459 |
+
instances. (a) Metric for uneven size distribution of humans
|
| 1460 |
+
and objects. (b) Metric for excessive distance between person
|
| 1461 |
+
and object. Kindly refer to Sec. 4.1 and 4.2 for more details.
|
| 1462 |
+
5
|
| 1463 |
+
EXPERIMENTS
|
| 1464 |
+
5.1
|
| 1465 |
+
Dataset
|
| 1466 |
+
Experiments are conducted on three HOI datasets: HICO-
|
| 1467 |
+
DET [38], V-COCO [39] and HOI-SDC dataset
|
| 1468 |
+
HICO-DET [38] has 80 object classes, 117 action classes
|
| 1469 |
+
and 600 HOI classes. HICO-DET offers 47,776 images with
|
| 1470 |
+
TABLE 3: Performance comparison with the state-of-the-art
|
| 1471 |
+
methods on the HOI-SDC dataset. Kindly refer to Sec. 5.4.2
|
| 1472 |
+
for more details.
|
| 1473 |
+
Dataset
|
| 1474 |
+
Backbone
|
| 1475 |
+
Method
|
| 1476 |
+
mAProle (↑)
|
| 1477 |
+
HOI-SDC
|
| 1478 |
+
Swin-Tiny
|
| 1479 |
+
QAHOI
|
| 1480 |
+
19.55
|
| 1481 |
+
Swin-Tiny
|
| 1482 |
+
Baseline
|
| 1483 |
+
21.18
|
| 1484 |
+
Swin-Tiny
|
| 1485 |
+
+HSAM
|
| 1486 |
+
21.91
|
| 1487 |
+
Swin-Tiny
|
| 1488 |
+
+TAM
|
| 1489 |
+
21.84
|
| 1490 |
+
Swin-Tiny
|
| 1491 |
+
FGAHOI
|
| 1492 |
+
22.25
|
| 1493 |
+
151,276 HOI instances, including 38,118 images with 117,871
|
| 1494 |
+
annotated instances of human-object pairs in the training set
|
| 1495 |
+
and 9658 images with 33,405 annotated instances of human-
|
| 1496 |
+
object pairs in the testing set. According to the number
|
| 1497 |
+
of these HOI classes, the 600 HOI classes in the dataset
|
| 1498 |
+
are grouped into three categories: Full (all HOI classes),
|
| 1499 |
+
Rare (138 classes with fewer than ten instances) and Non-
|
| 1500 |
+
Rare (462 classes with more than ten instances). Following
|
| 1501 |
+
HICO [63], we consider two different evaluation settings
|
| 1502 |
+
(the results are shown in Table.2: (1) Known object settings:
|
| 1503 |
+
For each HOI category (such as ’flying a kite’), the detection
|
| 1504 |
+
is only evaluated on the images that contain the target object
|
| 1505 |
+
category (such as ’kite’). The difficulty lies in the local-
|
| 1506 |
+
|
| 1507 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 1508 |
+
10
|
| 1509 |
+
TABLE 4: Performance comparison with the state-of-the-art
|
| 1510 |
+
methods on the V-COCO dataset. Kindly refer to Sec. 5.4.3
|
| 1511 |
+
for more details.
|
| 1512 |
+
Method
|
| 1513 |
+
AP𝑆1
|
| 1514 |
+
role (↑)
|
| 1515 |
+
AP𝑆2
|
| 1516 |
+
role (↑)
|
| 1517 |
+
Two-stage Method
|
| 1518 |
+
VSG-Net
|
| 1519 |
+
51.8
|
| 1520 |
+
57.0
|
| 1521 |
+
PD-Net
|
| 1522 |
+
52.0
|
| 1523 |
+
-
|
| 1524 |
+
ACP
|
| 1525 |
+
53.2
|
| 1526 |
+
-
|
| 1527 |
+
One-stage Method
|
| 1528 |
+
HOITrans
|
| 1529 |
+
52.9
|
| 1530 |
+
-
|
| 1531 |
+
AS-Net
|
| 1532 |
+
53.9
|
| 1533 |
+
-
|
| 1534 |
+
HOTR
|
| 1535 |
+
55.2
|
| 1536 |
+
64.4
|
| 1537 |
+
DIRV
|
| 1538 |
+
56.1
|
| 1539 |
+
-
|
| 1540 |
+
QAHOI(R-50)
|
| 1541 |
+
58.2
|
| 1542 |
+
58.7
|
| 1543 |
+
FGAHOI(R-50)
|
| 1544 |
+
59.0
|
| 1545 |
+
59.3
|
| 1546 |
+
FGAHOI(Swin-T)
|
| 1547 |
+
60.5
|
| 1548 |
+
61.2
|
| 1549 |
+
ization of HOI (e.g. human-kite pairs) and distinguishing
|
| 1550 |
+
the interaction (e.g. ’flying’). (2) Default setting: For each
|
| 1551 |
+
HOI category, the detection is evaluated on the whole test
|
| 1552 |
+
set, including images containing and without target object
|
| 1553 |
+
categories. This is a more challenging setting because we
|
| 1554 |
+
also need to distinguish background images (such as images
|
| 1555 |
+
without ’kite’).
|
| 1556 |
+
V-COCO [39] contains 80 different object classes and
|
| 1557 |
+
29 action categories and is developed from the MS-COCO
|
| 1558 |
+
dataset, which includes 4,946 images for the test subset,
|
| 1559 |
+
2,533 images for the train subset and 2,867 images for the
|
| 1560 |
+
validation subset. The objects are divided into two types:
|
| 1561 |
+
“object” and “instrument”.
|
| 1562 |
+
5.2
|
| 1563 |
+
Metric
|
| 1564 |
+
Following the standard evaluation [21], [39], we use role
|
| 1565 |
+
mean average precious to evaluate the predicted HOI in-
|
| 1566 |
+
stances. A detected bounding box is considered a true
|
| 1567 |
+
positive for object detection if it overlaps with a ground
|
| 1568 |
+
truth bounding box of the same class with an intersection
|
| 1569 |
+
greater than union (𝐼𝑂𝑈) greater than 0.5. In HOI detection,
|
| 1570 |
+
we need to predict human-object pairs. The human-object
|
| 1571 |
+
pairs whose human overlap 𝐼𝑂𝑈ℎ and object overlap 𝐼𝑂𝑈𝑜
|
| 1572 |
+
both exceed 0.5, i.e., min (𝐼𝑂𝑈ℎ, 𝐼𝑂𝑈𝑜) > 0.5 are declared
|
| 1573 |
+
a true positive (as shown in Fig 9). Specifically, for HICO-
|
| 1574 |
+
DET, besides the full set of 600 HOI classes, the role mAP
|
| 1575 |
+
over a rare set of 138 HOI classes that have less than 10
|
| 1576 |
+
training instances and a non-rare set of the other 462 HOI
|
| 1577 |
+
classes are also reported. Furthermore, we report the role
|
| 1578 |
+
mAP of two scenarios for V-COCO: scenario 1 includes the
|
| 1579 |
+
cases even without any objects (for the four action categories
|
| 1580 |
+
of body motions), while scenario 2 ignores these cases. For
|
| 1581 |
+
HOI-SDC, we report the role mean average precision for the
|
| 1582 |
+
full set of 321 HOI classes.
|
| 1583 |
+
5.3
|
| 1584 |
+
Implementation Details
|
| 1585 |
+
The Visual Feature Extractor consists of Swin Transformer
|
| 1586 |
+
and a deformable transformer encoder. For Swin-Tiny and
|
| 1587 |
+
Swin-Large, the dimensions of the feature maps in the first
|
| 1588 |
+
stage are set to 𝐶𝑠 = 96 and 𝐶𝑠 = 192, respectively. We pre-
|
| 1589 |
+
train Swin-Tiny on the ImageNet-1k dataset. Swin-Large is
|
| 1590 |
+
first pre-trained on the ImageNet-22k dataset and finetuned
|
| 1591 |
+
Fig. 9: The human-object pairs with human overlap 𝐼𝑂𝑈ℎ
|
| 1592 |
+
and object overlap 𝐼𝑂𝑈𝑜 both exceeding 0.5 are declared as
|
| 1593 |
+
true positives. Kindly refer to Sec. 5.2 for more details.
|
| 1594 |
+
on the ImageNet-1k dataset. Then the weights are used
|
| 1595 |
+
to fine-tune the FGAHOI for the HOI detection task. The
|
| 1596 |
+
number of both encoder and decoder layers are set to 6
|
| 1597 |
+
(𝑁𝐿𝑎𝑦𝑒𝑟 = 6). The number of query embeddings is set to 300
|
| 1598 |
+
(𝑁𝑞 = 300), and the hidden dimension of embeddings in the
|
| 1599 |
+
transformer is set to 256 (𝐶𝑑 = 256). In the post-processing
|
| 1600 |
+
phase, the first 100 HOI instances are selected according
|
| 1601 |
+
to object confidence, and we use 𝛿=0.5 to filter the HOI
|
| 1602 |
+
instances by the combined 𝐼𝑂𝑈. Following Deformable-
|
| 1603 |
+
DETR [34], the AdamW [64] optimizer is used. The learning
|
| 1604 |
+
rates of the extractor and the other components are set to
|
| 1605 |
+
10−5 and 10−4, respectively. We use 8 RTX 3090 to train the
|
| 1606 |
+
model (QAHOI & FGAHOI) with Swin-Tiny. For the model
|
| 1607 |
+
with Swin-Large∗
|
| 1608 |
+
+, we use 16 RTX 3090 to train them. For
|
| 1609 |
+
HICO-DET and HOI-SDC, we train the base network for
|
| 1610 |
+
150 epochs and carry out the learning rate drop from the
|
| 1611 |
+
120th epoch at the first stage of training. For subsequent
|
| 1612 |
+
training, we trained the model for 40 epochs, with a learning
|
| 1613 |
+
rate drop at the 15th epoch. For V-COCO dataset, we train
|
| 1614 |
+
the base network for 90 epochs and drop the learning rate
|
| 1615 |
+
from 60th epoch at the first stage of training. For subsequent
|
| 1616 |
+
training, we trained the model for 30 epochs, with a learning
|
| 1617 |
+
rate drop at the 10th epoch.
|
| 1618 |
+
5.4
|
| 1619 |
+
Comparison with State-of-the-Arts
|
| 1620 |
+
5.4.1
|
| 1621 |
+
HICO-DET
|
| 1622 |
+
We compare FGAHOI with the state-of-the-art two-stage
|
| 1623 |
+
and one-stage methods on the HICO-DET dataset and
|
| 1624 |
+
report the results in Table.1. FGAHOI outperforms both
|
| 1625 |
+
state-of-the-art methods. In contrast to the state-of-the-art
|
| 1626 |
+
two-stage method SCG [18], FGAHOI with Swin-Large*+
|
| 1627 |
+
backbone exceeds an especially significant gain of 5.85 mAP
|
| 1628 |
+
in default full setting, 5.99 mAP in default rare setting, 5.8
|
| 1629 |
+
mAP in default non-rare setting, 4.56 mAP in known object
|
| 1630 |
+
full setting, 4.75 mAP in known rare settings and 4.52 mAP
|
| 1631 |
+
in known object non-rare setting. For a fair comparison, we
|
| 1632 |
+
used the same machine for the reproduction of the QAHOI
|
| 1633 |
+
(as shown in Table.2 QAHOI(R)). In comparison to the state-
|
| 1634 |
+
of-the-art one-stage method QAHOI, FGAHOI exceeds it
|
| 1635 |
+
in all settings for all backbone networks. For Swin-Tiny
|
| 1636 |
+
backbone network, FGAHOI exceeds an especially signifi-
|
| 1637 |
+
cant gain of 2.27 mAP in default full setting, 2.02 mAP in
|
| 1638 |
+
default rare setting, 2.55 mAP in default non-rare setting,
|
| 1639 |
+
2.42 mAP in known object full setting, 1.11 mAP in known
|
| 1640 |
+
rare settings and 2.79 mAP in known object non-rare setting.
|
| 1641 |
+
In addition, FGAHOI with Swin-Large*+ backbone exceeds
|
| 1642 |
+
an especially significant gain of 1.75 mAP in default full
|
| 1643 |
+
|
| 1644 |
+
OU
|
| 1645 |
+
IOU.
|
| 1646 |
+
Ground-truth label
|
| 1647 |
+
Prediction boxesJOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 1648 |
+
11
|
| 1649 |
+
TABLE 5: Comparison on ten intervals of the two proposed challenges. We divide the HICO-DET dataset into ten intervals
|
| 1650 |
+
based on each of the two challenges and compare the performance of QAHOI and FGAHOI on each interval. Kindly refer
|
| 1651 |
+
to Sec. 5.5 for more details.
|
| 1652 |
+
Challenge
|
| 1653 |
+
Method
|
| 1654 |
+
Backbone
|
| 1655 |
+
mAProle (↑)
|
| 1656 |
+
IMI0
|
| 1657 |
+
IMI1
|
| 1658 |
+
IMI2
|
| 1659 |
+
IMI3
|
| 1660 |
+
IMI4
|
| 1661 |
+
IMI5
|
| 1662 |
+
IMI6
|
| 1663 |
+
IMI7
|
| 1664 |
+
IMI8
|
| 1665 |
+
IMI9
|
| 1666 |
+
UDA
|
| 1667 |
+
QAHOI
|
| 1668 |
+
Swin-Tiny
|
| 1669 |
+
16.35
|
| 1670 |
+
24.72
|
| 1671 |
+
29.24
|
| 1672 |
+
34.79
|
| 1673 |
+
38.70
|
| 1674 |
+
46.21
|
| 1675 |
+
53.13
|
| 1676 |
+
47.60
|
| 1677 |
+
58.66
|
| 1678 |
+
60.19
|
| 1679 |
+
Swin-Large∗
|
| 1680 |
+
+
|
| 1681 |
+
20.53
|
| 1682 |
+
33.58
|
| 1683 |
+
41.11
|
| 1684 |
+
45.41
|
| 1685 |
+
45.44
|
| 1686 |
+
56.43
|
| 1687 |
+
56.25
|
| 1688 |
+
63.53
|
| 1689 |
+
71.12
|
| 1690 |
+
75.08
|
| 1691 |
+
FGAHOI
|
| 1692 |
+
Swin-Tiny
|
| 1693 |
+
19.74
|
| 1694 |
+
29.85
|
| 1695 |
+
32.20
|
| 1696 |
+
39.46
|
| 1697 |
+
40.54
|
| 1698 |
+
48.55
|
| 1699 |
+
51.32
|
| 1700 |
+
46.50
|
| 1701 |
+
66.44
|
| 1702 |
+
78.17
|
| 1703 |
+
Swin-Large∗
|
| 1704 |
+
+
|
| 1705 |
+
23.69
|
| 1706 |
+
35.85
|
| 1707 |
+
42.51
|
| 1708 |
+
50.50
|
| 1709 |
+
46.89
|
| 1710 |
+
56.95
|
| 1711 |
+
56.33
|
| 1712 |
+
63.04
|
| 1713 |
+
75.70
|
| 1714 |
+
79.42
|
| 1715 |
+
LDVM
|
| 1716 |
+
QAHOI
|
| 1717 |
+
Swin-Tiny
|
| 1718 |
+
1.33
|
| 1719 |
+
4.43
|
| 1720 |
+
2.57
|
| 1721 |
+
5.00
|
| 1722 |
+
8.06
|
| 1723 |
+
17.87
|
| 1724 |
+
22.81
|
| 1725 |
+
29.25
|
| 1726 |
+
34.03
|
| 1727 |
+
42.29
|
| 1728 |
+
Swin-Large∗
|
| 1729 |
+
+
|
| 1730 |
+
0.82
|
| 1731 |
+
4.08
|
| 1732 |
+
2.56
|
| 1733 |
+
7.53
|
| 1734 |
+
11.42
|
| 1735 |
+
22.87
|
| 1736 |
+
30.94
|
| 1737 |
+
41.38
|
| 1738 |
+
45.31
|
| 1739 |
+
60.15
|
| 1740 |
+
FGAHOI
|
| 1741 |
+
Swin-Tiny
|
| 1742 |
+
2.50
|
| 1743 |
+
4.15
|
| 1744 |
+
3.34
|
| 1745 |
+
7.58
|
| 1746 |
+
9.83
|
| 1747 |
+
21.61
|
| 1748 |
+
27.64
|
| 1749 |
+
33.07
|
| 1750 |
+
38.31
|
| 1751 |
+
45.07
|
| 1752 |
+
Swin-Large∗
|
| 1753 |
+
+
|
| 1754 |
+
1.44
|
| 1755 |
+
4.32
|
| 1756 |
+
4.57
|
| 1757 |
+
7.81
|
| 1758 |
+
11.82
|
| 1759 |
+
24.92
|
| 1760 |
+
32.50
|
| 1761 |
+
43.66
|
| 1762 |
+
47.26
|
| 1763 |
+
60.55
|
| 1764 |
+
TABLE 6: We carefully ablate each of the constituent component of FGAHOI. The middle results denote the role mAP. The
|
| 1765 |
+
results in the top right corner represent the performance improvement compared to QAHOI. The results in the bottom
|
| 1766 |
+
right corner represent the performance improvement compared to the baseline. Kindly refer to Sec. 5.7.1 for more details.
|
| 1767 |
+
Method
|
| 1768 |
+
Merging Mechanism
|
| 1769 |
+
Default
|
| 1770 |
+
Known Object
|
| 1771 |
+
Hierarchical Spatial-Aware
|
| 1772 |
+
Task-Aware
|
| 1773 |
+
Full ↑
|
| 1774 |
+
Rare ↑
|
| 1775 |
+
Non-Rare ↑
|
| 1776 |
+
Full ↑
|
| 1777 |
+
Rare ↑
|
| 1778 |
+
Non-Rare ↑
|
| 1779 |
+
QAHOI
|
| 1780 |
+
-
|
| 1781 |
+
-
|
| 1782 |
+
27.67
|
| 1783 |
+
20.22
|
| 1784 |
+
29.69
|
| 1785 |
+
30.06
|
| 1786 |
+
22.95
|
| 1787 |
+
32.18
|
| 1788 |
+
FGAHOI
|
| 1789 |
+
|
| 1790 |
+
|
| 1791 |
+
28.45( +0.78 )
|
| 1792 |
+
(
|
| 1793 |
+
-
|
| 1794 |
+
)
|
| 1795 |
+
21.07( +0.85 )
|
| 1796 |
+
(
|
| 1797 |
+
-
|
| 1798 |
+
)
|
| 1799 |
+
30.66( +0.97 )
|
| 1800 |
+
(
|
| 1801 |
+
-
|
| 1802 |
+
)
|
| 1803 |
+
31.08( +1.02 )
|
| 1804 |
+
(
|
| 1805 |
+
-
|
| 1806 |
+
)
|
| 1807 |
+
24.02( +1.01 )
|
| 1808 |
+
(
|
| 1809 |
+
-
|
| 1810 |
+
)
|
| 1811 |
+
33.19( +1.07 )
|
| 1812 |
+
(
|
| 1813 |
+
-
|
| 1814 |
+
)
|
| 1815 |
+
|
| 1816 |
+
|
| 1817 |
+
29.60( +1.93 )
|
| 1818 |
+
( +1.15 )
|
| 1819 |
+
22.39( +2.17 )
|
| 1820 |
+
( +1.32 )
|
| 1821 |
+
31.76( +2.07 )
|
| 1822 |
+
( +1.10 )
|
| 1823 |
+
32.07( +2.01 )
|
| 1824 |
+
( +0.99 )
|
| 1825 |
+
24.48( +1.53 )
|
| 1826 |
+
( +0.46 )
|
| 1827 |
+
34.34( +2.16 )
|
| 1828 |
+
( +1.15 )
|
| 1829 |
+
|
| 1830 |
+
|
| 1831 |
+
29.32( +1.65 )
|
| 1832 |
+
( +0.87 )
|
| 1833 |
+
22.34( +2.12 )
|
| 1834 |
+
( +1.27 )
|
| 1835 |
+
31.41( +1.72 )
|
| 1836 |
+
( +0.75)
|
| 1837 |
+
31.81( +1.75 )
|
| 1838 |
+
( +0.73)
|
| 1839 |
+
24.30( +1.35 )
|
| 1840 |
+
( +0.28)
|
| 1841 |
+
34.05( +1.87 )
|
| 1842 |
+
( +0.86)
|
| 1843 |
+
|
| 1844 |
+
|
| 1845 |
+
29.94( +2.27 )
|
| 1846 |
+
( +1.49 )
|
| 1847 |
+
22.24( +2.02 )
|
| 1848 |
+
( +1.17 )
|
| 1849 |
+
32.24( +2.55 )
|
| 1850 |
+
( +1.58 )
|
| 1851 |
+
32.48( +2.42 )
|
| 1852 |
+
( +1.40 )
|
| 1853 |
+
24.16( +1.21 )
|
| 1854 |
+
( +0.14 )
|
| 1855 |
+
34.97( +2.79 )
|
| 1856 |
+
( +1.78 )
|
| 1857 |
+
setting, 1.49 mAP in default rare setting, 1.82 mAP in default
|
| 1858 |
+
non-rare setting, 1.7 mAP in known object full setting, 0.92
|
| 1859 |
+
mAP in known rare settings and 1.93 mAP in known object
|
| 1860 |
+
non-rare setting.
|
| 1861 |
+
5.4.2
|
| 1862 |
+
HOI-SDC
|
| 1863 |
+
On the dataset we propose, 𝑖.𝑒., HOI-SDC, we compare
|
| 1864 |
+
FGAHOI with QAHOI and ablate each component of FGA-
|
| 1865 |
+
HOI (As shown in Table.3). The backbone is set to Swin-Tiny.
|
| 1866 |
+
The baseline exceeds QAHOI an especially significant gain
|
| 1867 |
+
of 1.63 mAP. HSAM and TAM improve a significant gain
|
| 1868 |
+
of 0.73 and 0.66 mAP, respectively. Benefit from the MSS,
|
| 1869 |
+
HSAM and TAM, FGAHOI achieve 22.25 mAP on HOI-
|
| 1870 |
+
SDC.
|
| 1871 |
+
5.4.3
|
| 1872 |
+
V-COCO
|
| 1873 |
+
We compare FGAHOI with the state-of-the-art methods
|
| 1874 |
+
on V-COCO dataset and report the results in Table.4. In
|
| 1875 |
+
comparison to QAHOI, FGAHOI only exceeds a small
|
| 1876 |
+
margin. This phenomenon is mainly caused by too little
|
| 1877 |
+
training data in the dataset. We investigate that FGAHOI
|
| 1878 |
+
cannot adequately perform when the training data is not
|
| 1879 |
+
sufficient due to the complex task requirements. In addition,
|
| 1880 |
+
we investigate the transformer backbone is still superior to
|
| 1881 |
+
CNN backbone in this case.
|
| 1882 |
+
5.5
|
| 1883 |
+
Sensitivity Analysis for UDA and LDVM
|
| 1884 |
+
According to the two proposed challenges, we divide the
|
| 1885 |
+
HICO-DET into ten intervals. At each intervals, we compare
|
| 1886 |
+
FGAHOI and QAHOI with Swin-Tiny, Large∗
|
| 1887 |
+
+ backbone,
|
| 1888 |
+
respectively (As shown in Table.5). When compared be-
|
| 1889 |
+
tween each interval of UDA and LDVM, we investigate
|
| 1890 |
+
that the difficulty of HOI detection decreases as the interval
|
| 1891 |
+
level increases. This justifies the original design. Thus, it
|
| 1892 |
+
is imperative to consider ability of the model to address
|
| 1893 |
+
these two challenges when proposing novel frameworks for
|
| 1894 |
+
HOI detection. In the comparison between FGAHOI and
|
| 1895 |
+
QAHOI, the results demonstrate that FGAHOI has better
|
| 1896 |
+
capability for uneven distributed area and long distance
|
| 1897 |
+
visual modeling of human-object pairs.
|
| 1898 |
+
5.6
|
| 1899 |
+
Qualitative Analysis
|
| 1900 |
+
5.6.1
|
| 1901 |
+
Visualized Results
|
| 1902 |
+
In order to demonstrate our model, several representative
|
| 1903 |
+
HOI predictions are visualized. As shown in Fig.5, our
|
| 1904 |
+
model can pinpoint HOI instances from noisy backgrounds
|
| 1905 |
+
and excels at detecting various complicated HOIs, including
|
| 1906 |
+
one object interacting with different humans, one human
|
| 1907 |
+
engaging in multiple interactions with various objects, mul-
|
| 1908 |
+
tiple interactions within a single pair, and multiple humans
|
| 1909 |
+
engaging in various interactions with various objects. In
|
| 1910 |
+
addition, our model is good at long-range visual modelling,
|
| 1911 |
+
withstanding the impacts of hostile environments and small
|
| 1912 |
+
target identification. Fig.6 (a) illustrates that FGAHOI has
|
| 1913 |
+
excellent long-range visual modelling capabilities and can
|
| 1914 |
+
accurately identify interactions between human-object pairs
|
| 1915 |
+
far from each other. As Fig.6 (b) shows, our model has
|
| 1916 |
+
|
| 1917 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 1918 |
+
12
|
| 1919 |
+
text_on cell_phone
|
| 1920 |
+
talk_on cell_phone
|
| 1921 |
+
eat orange
|
| 1922 |
+
open book
|
| 1923 |
+
cut with knife
|
| 1924 |
+
repair hair_drier
|
| 1925 |
+
hold hotdog
|
| 1926 |
+
hop_on elephant
|
| 1927 |
+
kick sports_ball
|
| 1928 |
+
hold cup
|
| 1929 |
+
carry handbag
|
| 1930 |
+
jump skateboard
|
| 1931 |
+
hold cup
|
| 1932 |
+
drink with cup
|
| 1933 |
+
text_on cell_phone
|
| 1934 |
+
talk_on cell_phone
|
| 1935 |
+
eat orange
|
| 1936 |
+
open book
|
| 1937 |
+
cut with knife
|
| 1938 |
+
repair hair_drier
|
| 1939 |
+
hold hotdog
|
| 1940 |
+
hop_on elephant
|
| 1941 |
+
kick sports_ball
|
| 1942 |
+
hold cup
|
| 1943 |
+
carry handbag
|
| 1944 |
+
jump skateboard
|
| 1945 |
+
hold cup
|
| 1946 |
+
drink with cup
|
| 1947 |
+
(a)
|
| 1948 |
+
(b)
|
| 1949 |
+
(c)
|
| 1950 |
+
Level_0
|
| 1951 |
+
Level_0
|
| 1952 |
+
Level_1
|
| 1953 |
+
Level_1
|
| 1954 |
+
Level_2
|
| 1955 |
+
Level_2
|
| 1956 |
+
Low
|
| 1957 |
+
High
|
| 1958 |
+
Read
|
| 1959 |
+
Laptop
|
| 1960 |
+
Read
|
| 1961 |
+
Laptop
|
| 1962 |
+
Low
|
| 1963 |
+
High
|
| 1964 |
+
Read
|
| 1965 |
+
Laptop
|
| 1966 |
+
Exit
|
| 1967 |
+
Airplane
|
| 1968 |
+
Sit on
|
| 1969 |
+
Airplane
|
| 1970 |
+
Hold
|
| 1971 |
+
Horse
|
| 1972 |
+
Ride
|
| 1973 |
+
Horse
|
| 1974 |
+
Fly Kite
|
| 1975 |
+
(a)
|
| 1976 |
+
(b)
|
| 1977 |
+
(c)
|
| 1978 |
+
Level_0
|
| 1979 |
+
Level_1
|
| 1980 |
+
Level_2
|
| 1981 |
+
Low
|
| 1982 |
+
High
|
| 1983 |
+
Read
|
| 1984 |
+
Laptop
|
| 1985 |
+
Exit
|
| 1986 |
+
Airplane
|
| 1987 |
+
Sit on
|
| 1988 |
+
Airplane
|
| 1989 |
+
Hold
|
| 1990 |
+
Horse
|
| 1991 |
+
Ride
|
| 1992 |
+
Horse
|
| 1993 |
+
Fly Kite
|
| 1994 |
+
Fig. 10: Visualization of fine-grained anchors in the decoding phase, Level 0, Level 1 and Level 2 represent the features
|
| 1995 |
+
at different scales respectively, the color of the blue dots from light to dark represents the degrees of attention of the fine-
|
| 1996 |
+
grained anchors and red dots represent the positions of interest of fine-grained anchors in current scale features. Kindly
|
| 1997 |
+
refer to Sec. 5.6.2 for more details.
|
| 1998 |
+
outstanding robustness and can effectively resist disruption
|
| 1999 |
+
from harsh environmental factors, including blurring, block-
|
| 2000 |
+
ing and glare. Fig.6 (c) demonstrates the superior capabili-
|
| 2001 |
+
ties of FGAHOI to identify small HOI instances.
|
| 2002 |
+
5.6.2
|
| 2003 |
+
What do the fine-grained anchors look at?
|
| 2004 |
+
As shown in Fig.7, we compare the fine-grained anchors of
|
| 2005 |
+
FGAHOI and QAHOI. First two HOI instances (𝑖.𝑒, hold
|
| 2006 |
+
sport ball and ride motorcycles) exhibit that FGAHOI could
|
| 2007 |
+
better focus on humans, objects and the interaction areas
|
| 2008 |
+
rather than noisy backgrounds. The fourth head of FGAHOI
|
| 2009 |
+
still focuses on the HOI instance, while QAHOI focuses
|
| 2010 |
+
on the background. When detecting instance with a long
|
| 2011 |
+
distance between human and object, FGAHOI could focus
|
| 2012 |
+
on the right position, while QAHOI is like a chicken with its
|
| 2013 |
+
head cut off (As shown in the last HOI instance).
|
| 2014 |
+
To exhibit the effectiveness of the fine-grained anchors
|
| 2015 |
+
for identifying HOI instances and demonstrate the working
|
| 2016 |
+
mechanism of fine-grained anchors, we visualize the fine-
|
| 2017 |
+
grained anchors of the feature maps at different scales in
|
| 2018 |
+
the decoding phase. In Fig.10 (a), we visualize the instances
|
| 2019 |
+
of two different humans and one object. As shown in Fig.10
|
| 2020 |
+
(b), even for exactly the same human-object pair, the areas
|
| 2021 |
+
of focus vary from one interaction to another. In Fig.10 (c),
|
| 2022 |
+
|
| 2023 |
+
IS人
|
| 2024 |
+
D2MVAD2MVAD2MVAD2MVAJOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 2025 |
+
13
|
| 2026 |
+
text_on cell_phone
|
| 2027 |
+
talk_on cell_phone
|
| 2028 |
+
eat orange
|
| 2029 |
+
ride bicycle
|
| 2030 |
+
cut with knife
|
| 2031 |
+
repair hair_drier
|
| 2032 |
+
hold hotdog
|
| 2033 |
+
hop_on elephant
|
| 2034 |
+
kick sports_ball
|
| 2035 |
+
hold cup
|
| 2036 |
+
carry handbag
|
| 2037 |
+
jump skateboard
|
| 2038 |
+
hold cup
|
| 2039 |
+
drink with cup
|
| 2040 |
+
text_on cell_phone
|
| 2041 |
+
talk_on cell_phone
|
| 2042 |
+
eat orange
|
| 2043 |
+
ride bicycle
|
| 2044 |
+
cut with knife
|
| 2045 |
+
repair hair_drier
|
| 2046 |
+
hold hotdog
|
| 2047 |
+
hop_on elephant
|
| 2048 |
+
kick sports_ball
|
| 2049 |
+
hold cup
|
| 2050 |
+
carry handbag
|
| 2051 |
+
jump skateboard
|
| 2052 |
+
hold cup
|
| 2053 |
+
drink with cup
|
| 2054 |
+
Fig. 11: Visualization of several representative interactive actions and the corresponding fine-grained anchors. We only
|
| 2055 |
+
visualize a single representative interactive action for one human-object pair. Kindly refer to Sec. 5.6.2 for more details.
|
| 2056 |
+
we show two instances contain short and long distance
|
| 2057 |
+
between humans and objects, respectively. We investigate
|
| 2058 |
+
that the fine-grained anchors of low level feature map focus
|
| 2059 |
+
on small and fine-grained areas. They play a major role in
|
| 2060 |
+
detecting close range and small HOI instances. The fine-
|
| 2061 |
+
grained anchors of high level feature maps focus on large
|
| 2062 |
+
and coarse-grained areas. It is necessary for detecting long
|
| 2063 |
+
distance and large HOI instances.
|
| 2064 |
+
In order to explore what the fine-grained anchors focus
|
| 2065 |
+
on, we visualize several representative actions in Fig.11.
|
| 2066 |
+
Visualization shows that fine-grained anchors could con-
|
| 2067 |
+
centrate attention precisely on the location where the in-
|
| 2068 |
+
teractive action is generated. For example, the fine-grained
|
| 2069 |
+
anchors mainly focus on the hand for ’text on cell phone’,
|
| 2070 |
+
the mouth for ’eat orange’ and the ear and the mouth
|
| 2071 |
+
for ’talk on cell phone’. For ’kick sports ball’, ’jump skate-
|
| 2072 |
+
board’ and ’hop on elephant’, central areas of interest are
|
| 2073 |
+
around legs and feet, while fine-grained anchors primarily
|
| 2074 |
+
focuses on hands for ’carry handbag’, ’repair hair drier’,
|
| 2075 |
+
’hold cup’, ’hold hotdog’ and ’cut with kinfe’.
|
| 2076 |
+
5.7
|
| 2077 |
+
Ablation Study
|
| 2078 |
+
In this subsection, a set of experiments are designed to
|
| 2079 |
+
clearly understand the contribution of each of the con-
|
| 2080 |
+
stituent components of the proposed methodology: Merg-
|
| 2081 |
+
ing mechanism, Multi-Scale Sampling Strategy and Stage-
|
| 2082 |
+
wise Training Strategy. We conducted all experiments on
|
| 2083 |
+
the HICO-DET dataset.
|
| 2084 |
+
5.7.1
|
| 2085 |
+
Ablating FGAHOI Components
|
| 2086 |
+
To study the contribution of each of the merging mecha-
|
| 2087 |
+
nisms in FGAHOI, we design careful ablation experiments
|
| 2088 |
+
in Table.6. To ensure a fair comparison, the sampling sizes
|
| 2089 |
+
are all set to [1, 3, 5]. For the baseline which does not lever-
|
| 2090 |
+
ages the hierarchical spatial-aware and task-aware merging
|
| 2091 |
+
mechanism, we use the average and direct summation op-
|
| 2092 |
+
eration to merge the sampled features and connect embed-
|
| 2093 |
+
dings. For the results in the table, the middle results denote
|
| 2094 |
+
the role mAP, the results in the top right corner represent
|
| 2095 |
+
the performance improvement compared to QAHOI and the
|
| 2096 |
+
results in the bottom right corner represent the performance
|
| 2097 |
+
improvement compared to the baseline. In comparison to
|
| 2098 |
+
row 1 (QAHOI), row 2 adds the multi-scale sampling
|
| 2099 |
+
strategy. The results demonstrate that adding the sampling
|
| 2100 |
+
strategy improves the ability of the model to detect HOI
|
| 2101 |
+
instances. The row 3 and 4 show that both hierarchical
|
| 2102 |
+
spatial-aware and task-aware merging mechanism make
|
| 2103 |
+
an essential contribution to the success of FGAHOI. The
|
| 2104 |
+
hierarchical spatial-aware merging mechanism, combined
|
| 2105 |
+
with the task-aware merging mechanism performs better
|
| 2106 |
+
together (row 5) than using either of them separately (row 3
|
| 2107 |
+
and 4). Thus, each component in FGAHOI has a critical role
|
| 2108 |
+
to play in HOI detection.
|
| 2109 |
+
5.7.2
|
| 2110 |
+
Sensitivity Analysis On Multi-Scale Sampling Sizes
|
| 2111 |
+
Our multi-scale sampling strategy samples multi-scale fea-
|
| 2112 |
+
tures according to the pre-determined sampling sizes. We
|
| 2113 |
+
vary different sampling sizes to conduct the sensitivity
|
| 2114 |
+
|
| 2115 |
+
EJOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 2116 |
+
14
|
| 2117 |
+
analysis for the sampling strategy and report the results
|
| 2118 |
+
in Table.7. We find that the sampling strategy is relatively
|
| 2119 |
+
stable. Changes in sampling sizes do not have a significant
|
| 2120 |
+
impact on the performance of FGAHOI. However, there is
|
| 2121 |
+
still a slight degradation in the performance of FGAHOI as
|
| 2122 |
+
the sample size increases. We investigate that as the sample
|
| 2123 |
+
size increases, too many background features around the
|
| 2124 |
+
fine-grained anchors are sampled, resulting in contamina-
|
| 2125 |
+
tion of the sampled features and thus the performance of
|
| 2126 |
+
the model suffers. Hence, for validation, we set the sampling
|
| 2127 |
+
sizes to [1, 3, 5] in all our experiments, which is a sweet spot
|
| 2128 |
+
that balances performance.
|
| 2129 |
+
TABLE 7: Comparison between different sampling sizes.
|
| 2130 |
+
Smpling Size
|
| 2131 |
+
Default
|
| 2132 |
+
Known Object
|
| 2133 |
+
Full
|
| 2134 |
+
Rare
|
| 2135 |
+
Non-Rare
|
| 2136 |
+
Full
|
| 2137 |
+
Rare
|
| 2138 |
+
Non-Rare
|
| 2139 |
+
[ 1, 3, 5 ]
|
| 2140 |
+
29.94
|
| 2141 |
+
22.24
|
| 2142 |
+
32.24
|
| 2143 |
+
32.48
|
| 2144 |
+
24.16
|
| 2145 |
+
34.97
|
| 2146 |
+
[ 3, 5, 7 ]
|
| 2147 |
+
29.72
|
| 2148 |
+
23.03
|
| 2149 |
+
31.72
|
| 2150 |
+
32.33
|
| 2151 |
+
25.67
|
| 2152 |
+
34.30
|
| 2153 |
+
[ 5, 7, 9 ]
|
| 2154 |
+
29.65
|
| 2155 |
+
22.64
|
| 2156 |
+
31.74
|
| 2157 |
+
32.55
|
| 2158 |
+
25.64
|
| 2159 |
+
34.62
|
| 2160 |
+
5.7.3
|
| 2161 |
+
Training Strategies
|
| 2162 |
+
As shown in Table.8, we leverage the stage-wise and end-
|
| 2163 |
+
to-end training strategy to train FGAHOI, respectively. In
|
| 2164 |
+
the end-to-end training strategy, we train FGAHOI for 150
|
| 2165 |
+
epochs and the learning rate drop is carried out at the
|
| 2166 |
+
120th epoch. The stage-wise training strategy promotes 5.96
|
| 2167 |
+
mAP for default full setting, 4.61 for default rare, 6.36 for
|
| 2168 |
+
default non-rare, 6.04 for known object full, 4.65 for known
|
| 2169 |
+
object rare and 6.46 mAP for known object non-rare setting.
|
| 2170 |
+
In comparison to the end-to-end training strategy, we in-
|
| 2171 |
+
vestigate that the stage-wise training strategy reduces the
|
| 2172 |
+
learning difficulty of the FGAHOI and clarify the learning
|
| 2173 |
+
direction of the model by emphasizing it to learn what it
|
| 2174 |
+
needs at each stage.
|
| 2175 |
+
TABLE 8: Comparison between Stage-Wise and End-to-End
|
| 2176 |
+
training approach.
|
| 2177 |
+
Training Strategy
|
| 2178 |
+
Default
|
| 2179 |
+
Known Object
|
| 2180 |
+
Full
|
| 2181 |
+
Rare
|
| 2182 |
+
Non-Rare
|
| 2183 |
+
Full
|
| 2184 |
+
Rare
|
| 2185 |
+
Non-Rare
|
| 2186 |
+
Stage-Wise
|
| 2187 |
+
29.94
|
| 2188 |
+
22.24
|
| 2189 |
+
32.24
|
| 2190 |
+
32.48
|
| 2191 |
+
24.16
|
| 2192 |
+
34.97
|
| 2193 |
+
End-to-End
|
| 2194 |
+
23.98
|
| 2195 |
+
17.63
|
| 2196 |
+
25.88
|
| 2197 |
+
26.44
|
| 2198 |
+
19.51
|
| 2199 |
+
28.51
|
| 2200 |
+
6
|
| 2201 |
+
CONCLUSION
|
| 2202 |
+
In this paper, we propose a novel transformer-based human-
|
| 2203 |
+
object interaction detector (FGAHOI) which leverages the
|
| 2204 |
+
input features to generate fine-grained anchors for protect-
|
| 2205 |
+
ing the detection of HOI instances from noisy backgrounds.
|
| 2206 |
+
We propose a novel training strategy where each component
|
| 2207 |
+
of the model is trained sequentially to clarify the training
|
| 2208 |
+
direction at each stage, for maximizing the savings of the
|
| 2209 |
+
training cost. We propose two novel metrics and a novel
|
| 2210 |
+
dataset, 𝑖.𝑒., HOI-SDC for the two challenges (Uneven Dis-
|
| 2211 |
+
tributed Area in Human-Object Pairs and Long Distance
|
| 2212 |
+
Visual Modeling of Human-Object Pairs) of detecting HOI
|
| 2213 |
+
instances. Our extensive experiments on three benchmarks:
|
| 2214 |
+
HICO-DET, HOI-SDC and V-COCO, demonstrate the effec-
|
| 2215 |
+
tiveness of the proposed FGAHOI. Specifically, FGAHOI
|
| 2216 |
+
outperforms all existing state-of-the-art methods by a large
|
| 2217 |
+
margin.
|
| 2218 |
+
ACKNOWLEDGMENTS
|
| 2219 |
+
This work is supported by National Natural Science Foun-
|
| 2220 |
+
dation of China (grant No.61871106 and No.61370152),
|
| 2221 |
+
Key R&D projects of Liaoning Province, China (grant
|
| 2222 |
+
No.2020JH2/10100029), and the Open Project Program
|
| 2223 |
+
Foundation of the Key Laboratory of Opto-Electronics In-
|
| 2224 |
+
formation Processing, Chinese Academy of Sciences (OEIP-
|
| 2225 |
+
O-202002).
|
| 2226 |
+
REFERENCES
|
| 2227 |
+
[1]
|
| 2228 |
+
R. Girshick, “Fast r-cnn,” in Proceedings of the IEEE international
|
| 2229 |
+
conference on computer vision, pp. 1440–1448, 2015.
|
| 2230 |
+
[2]
|
| 2231 |
+
Z. Li and F. Zhou, “Fssd: feature fusion single shot multibox
|
| 2232 |
+
detector,” arXiv preprint arXiv:1712.00960, 2017.
|
| 2233 |
+
[3]
|
| 2234 |
+
S. Ren, K. He, R. Girshick, and J. Sun, “Faster r-cnn: Towards real-
|
| 2235 |
+
time object detection with region proposal networks,” Advances in
|
| 2236 |
+
neural information processing systems, vol. 28, 2015.
|
| 2237 |
+
[4]
|
| 2238 |
+
R. Girshick, J. Donahue, T. Darrell, and J. Malik, “Rich feature hier-
|
| 2239 |
+
archies for accurate object detection and semantic segmentation,”
|
| 2240 |
+
in Proceedings of the IEEE conference on computer vision and pattern
|
| 2241 |
+
recognition, pp. 580–587, 2014.
|
| 2242 |
+
[5]
|
| 2243 |
+
J. Redmon, S. Divvala, R. Girshick, and A. Farhadi, “You only look
|
| 2244 |
+
once: Unified, real-time object detection,” in Proceedings of the IEEE
|
| 2245 |
+
conference on computer vision and pattern recognition, pp. 779–788,
|
| 2246 |
+
2016.
|
| 2247 |
+
[6]
|
| 2248 |
+
M. Chen, Y. Liao, S. Liu, Z. Chen, F. Wang, and C. Qian, “Refor-
|
| 2249 |
+
mulating hoi detection as adaptive set prediction,” in Proceedings of
|
| 2250 |
+
the IEEE/CVF Conference on Computer Vision and Pattern Recognition,
|
| 2251 |
+
pp. 9004–9013, 2021.
|
| 2252 |
+
[7]
|
| 2253 |
+
Z. Hou, X. Peng, Y. Qiao, and D. Tao, “Visual compositional learn-
|
| 2254 |
+
ing for human-object interaction detection,” in European Conference
|
| 2255 |
+
on Computer Vision, pp. 584–600, Springer, 2020.
|
| 2256 |
+
[8]
|
| 2257 |
+
P. Zhou and M. Chi, “Relation parsing neural network for human-
|
| 2258 |
+
object interaction detection,” in Proceedings of the IEEE/CVF Inter-
|
| 2259 |
+
national Conference on Computer Vision, pp. 843–851, 2019.
|
| 2260 |
+
[9]
|
| 2261 |
+
B. Kim, J. Lee, J. Kang, E.-S. Kim, and H. J. Kim, “Hotr: End-
|
| 2262 |
+
to-end human-object interaction detection with transformers,” in
|
| 2263 |
+
Proceedings of the IEEE/CVF Conference on Computer Vision and
|
| 2264 |
+
Pattern Recognition, pp. 74–83, 2021.
|
| 2265 |
+
[10] X. Zhong, C. Ding, X. Qu, and D. Tao, “Polysemy deciphering net-
|
| 2266 |
+
work for robust human–object interaction detection,” International
|
| 2267 |
+
Journal of Computer Vision, vol. 129, no. 6, pp. 1910–1929, 2021.
|
| 2268 |
+
[11] X. Zhong, X. Qu, C. Ding, and D. Tao, “Glance and gaze: Inferring
|
| 2269 |
+
action-aware points for one-stage human-object interaction detec-
|
| 2270 |
+
tion,” in Proceedings of the IEEE/CVF Conference on Computer Vision
|
| 2271 |
+
and Pattern Recognition, pp. 13234–13243, 2021.
|
| 2272 |
+
[12] C. Gao, J. Xu, Y. Zou, and J.-B. Huang, “Drg: Dual relation graph
|
| 2273 |
+
for human-object interaction detection,” in European Conference on
|
| 2274 |
+
Computer Vision, pp. 696–712, Springer, 2020.
|
| 2275 |
+
[13] O. Ulutan, A. Iftekhar, and B. S. Manjunath, “Vsgnet: Spatial
|
| 2276 |
+
attention network for detecting human object interactions using
|
| 2277 |
+
graph convolutions,” in Proceedings of the IEEE/CVF conference on
|
| 2278 |
+
computer vision and pattern recognition, pp. 13617–13626, 2020.
|
| 2279 |
+
[14] C. Gao, Y. Zou, and J.-B. Huang, “ican: Instance-centric attention
|
| 2280 |
+
network for human-object interaction detection,” arXiv preprint
|
| 2281 |
+
arXiv:1808.10437, 2018.
|
| 2282 |
+
[15] T. Wang, T. Yang, M. Danelljan, F. S. Khan, X. Zhang, and J. Sun,
|
| 2283 |
+
“Learning human-object interaction detection using interaction
|
| 2284 |
+
points,” in Proceedings of the IEEE/CVF Conference on Computer
|
| 2285 |
+
Vision and Pattern Recognition, pp. 4116–4125, 2020.
|
| 2286 |
+
[16] A. Zhang, Y. Liao, S. Liu, M. Lu, Y. Wang, C. Gao, and X. Li, “Min-
|
| 2287 |
+
ing the benefits of two-stage and one-stage hoi detection,” Ad-
|
| 2288 |
+
vances in Neural Information Processing Systems, vol. 34, pp. 17209–
|
| 2289 |
+
17220, 2021.
|
| 2290 |
+
[17] C. Zou, B. Wang, Y. Hu, J. Liu, Q. Wu, Y. Zhao, B. Li, C. Zhang,
|
| 2291 |
+
C. Zhang, Y. Wei, et al., “End-to-end human object interaction
|
| 2292 |
+
detection with hoi transformer,” in Proceedings of the IEEE/CVF
|
| 2293 |
+
conference on computer vision and pattern recognition, pp. 11825–
|
| 2294 |
+
11834, 2021.
|
| 2295 |
+
|
| 2296 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 2297 |
+
15
|
| 2298 |
+
[18] F. Z. Zhang, D. Campbell, and S. Gould, “Spatially condi-
|
| 2299 |
+
tioned graphs for detecting human-object interactions,” in Proceed-
|
| 2300 |
+
ings of the IEEE/CVF International Conference on Computer Vision,
|
| 2301 |
+
pp. 13319–13327, 2021.
|
| 2302 |
+
[19] M. Tamura, H. Ohashi, and T. Yoshinaga, “Qpic: Query-based
|
| 2303 |
+
pairwise human-object interaction detection with image-wide con-
|
| 2304 |
+
textual information,” in Proceedings of the IEEE/CVF Conference on
|
| 2305 |
+
Computer Vision and Pattern Recognition, pp. 10410–10419, 2021.
|
| 2306 |
+
[20] Y.-L. Li, S. Zhou, X. Huang, L. Xu, Z. Ma, H.-S. Fang, Y. Wang, and
|
| 2307 |
+
C. Lu, “Transferable interactiveness knowledge for human-object
|
| 2308 |
+
interaction detection,” in Proceedings of the IEEE/CVF Conference on
|
| 2309 |
+
Computer Vision and Pattern Recognition, pp. 3585–3594, 2019.
|
| 2310 |
+
[21] G. Gkioxari, R. Girshick, P. Doll´ar, and K. He, “Detecting and
|
| 2311 |
+
recognizing human-object interactions,” in Proceedings of the IEEE
|
| 2312 |
+
conference on computer vision and pattern recognition, pp. 8359–8367,
|
| 2313 |
+
2018.
|
| 2314 |
+
[22] Y.-W. Chao, Y. Liu, X. Liu, H. Zeng, and J. Deng, “Learning to
|
| 2315 |
+
detect human-object interactions,” in 2018 ieee winter conference on
|
| 2316 |
+
applications of computer vision (wacv), pp. 381–389, IEEE, 2018.
|
| 2317 |
+
[23] T. Gupta, A. Schwing, and D. Hoiem, “No-frills human-object
|
| 2318 |
+
interaction detection: Factorization, layout encodings, and training
|
| 2319 |
+
techniques,” in Proceedings of the IEEE/CVF International Conference
|
| 2320 |
+
on Computer Vision, pp. 9677–9685, 2019.
|
| 2321 |
+
[24] B. Wan, D. Zhou, Y. Liu, R. Li, and X. He, “Pose-aware multi-
|
| 2322 |
+
level feature network for human object interaction detection,” in
|
| 2323 |
+
Proceedings of the IEEE/CVF International Conference on Computer
|
| 2324 |
+
Vision, pp. 9469–9478, 2019.
|
| 2325 |
+
[25] A. Bansal, S. S. Rambhatla, A. Shrivastava, and R. Chellappa, “De-
|
| 2326 |
+
tecting human-object interactions via functional generalization,”
|
| 2327 |
+
in Proceedings of the AAAI Conference on Artificial Intelligence, vol. 34,
|
| 2328 |
+
pp. 10460–10469, 2020.
|
| 2329 |
+
[26] H.-S. Fang, Y. Xu, W. Wang, X. Liu, and S.-C. Zhu, “Learning pose
|
| 2330 |
+
grammar to encode human body configuration for 3d pose estima-
|
| 2331 |
+
tion,” in Proceedings of the AAAI conference on artificial intelligence,
|
| 2332 |
+
vol. 32, 2018.
|
| 2333 |
+
[27] H.-S. Fang, G. Lu, X. Fang, J. Xie, Y.-W. Tai, and C. Lu, “Weakly
|
| 2334 |
+
and semi supervised human body part parsing via pose-guided
|
| 2335 |
+
knowledge transfer,” arXiv preprint arXiv:1805.04310, 2018.
|
| 2336 |
+
[28] Y. Xiu, J. Li, H. Wang, Y. Fang, and C. Lu, “Pose flow: Efficient
|
| 2337 |
+
online pose tracking,” arXiv preprint arXiv:1802.00977, 2018.
|
| 2338 |
+
[29] S. Qi, W. Wang, B. Jia, J. Shen, and S.-C. Zhu, “Learning human-
|
| 2339 |
+
object interactions by graph parsing neural networks,” in Proceed-
|
| 2340 |
+
ings of the European conference on computer vision (ECCV), pp. 401–
|
| 2341 |
+
417, 2018.
|
| 2342 |
+
[30] B. Kim, T. Choi, J. Kang, and H. J. Kim, “Uniondet: Union-level
|
| 2343 |
+
detector towards real-time human-object interaction detection,”
|
| 2344 |
+
in European Conference on Computer Vision, pp. 498–514, Springer,
|
| 2345 |
+
2020.
|
| 2346 |
+
[31] Y. Liao, S. Liu, F. Wang, Y. Chen, C. Qian, and J. Feng, “Ppdm:
|
| 2347 |
+
Parallel point detection and matching for real-time human-object
|
| 2348 |
+
interaction detection,” in Proceedings of the IEEE/CVF Conference on
|
| 2349 |
+
Computer Vision and Pattern Recognition, pp. 482–490, 2020.
|
| 2350 |
+
[32] N. Carion, F. Massa, G. Synnaeve, N. Usunier, A. Kirillov, and
|
| 2351 |
+
S. Zagoruyko, “End-to-end object detection with transformers,” in
|
| 2352 |
+
European conference on computer vision, pp. 213–229, Springer, 2020.
|
| 2353 |
+
[33] J. Chen and K. Yanai, “Qahoi: Query-based anchors for human-
|
| 2354 |
+
object interaction detection,” arXiv preprint arXiv:2112.08647, 2021.
|
| 2355 |
+
[34] X. Zhu, W. Su, L. Lu, B. Li, X. Wang, and J. Dai, “Deformable detr:
|
| 2356 |
+
Deformable transformers for end-to-end object detection,” arXiv
|
| 2357 |
+
preprint arXiv:2010.04159, 2020.
|
| 2358 |
+
[35] Y. Bengio, P. Lamblin, D. Popovici, and H. Larochelle, “Greedy
|
| 2359 |
+
layer-wise training of deep networks,” Advances in neural informa-
|
| 2360 |
+
tion processing systems, vol. 19, 2006.
|
| 2361 |
+
[36] G. E. Hinton, S. Osindero, and Y.-W. Teh, “A fast learning al-
|
| 2362 |
+
gorithm for deep belief nets,” Neural computation, vol. 18, no. 7,
|
| 2363 |
+
pp. 1527–1554, 2006.
|
| 2364 |
+
[37] B. Kang, S. Xie, M. Rohrbach, Z. Yan, A. Gordo, J. Feng, and
|
| 2365 |
+
Y. Kalantidis, “Decoupling representation and classifier for long-
|
| 2366 |
+
tailed recognition,” arXiv preprint arXiv:1910.09217, 2019.
|
| 2367 |
+
[38] Y.-W. Chao, Y. Liu, X. Liu, H. Zeng, and J. Deng, “Learning to
|
| 2368 |
+
detect human-object interactions,” in 2018 ieee winter conference on
|
| 2369 |
+
applications of computer vision (wacv), pp. 381–389, IEEE, 2018.
|
| 2370 |
+
[39] S. Gupta and J. Malik, “Visual semantic role labeling,” arXiv e-
|
| 2371 |
+
prints, 2015.
|
| 2372 |
+
[40] F. Scarselli, M. Gori, A. C. Tsoi, M. Hagenbuchner, and G. Mon-
|
| 2373 |
+
fardini, “The graph neural network model,” IEEE transactions on
|
| 2374 |
+
neural networks, vol. 20, no. 1, pp. 61–80, 2008.
|
| 2375 |
+
[41] A. Vaswani, N. Shazeer, N. Parmar, J. Uszkoreit, L. Jones, A. N.
|
| 2376 |
+
Gomez, Ł. Kaiser, and I. Polosukhin, “Attention is all you need,”
|
| 2377 |
+
Advances in neural information processing systems, vol. 30, 2017.
|
| 2378 |
+
[42] Y. LeCun, Y. Bengio, et al., “Convolutional networks for images,
|
| 2379 |
+
speech, and time series,” The handbook of brain theory and neural
|
| 2380 |
+
networks, vol. 3361, no. 10, p. 1995, 1995.
|
| 2381 |
+
[43] Z. Liu, Y. Lin, Y. Cao, H. Hu, Y. Wei, Z. Zhang, S. Lin, and B. Guo,
|
| 2382 |
+
“Swin transformer: Hierarchical vision transformer using shifted
|
| 2383 |
+
windows,” in Proceedings of the IEEE/CVF International Conference
|
| 2384 |
+
on Computer Vision, pp. 10012–10022, 2021.
|
| 2385 |
+
[44] X. Chen, F. Wei, G. Zeng, and J. Wang, “Conditional detr v2:
|
| 2386 |
+
Efficient detection transformer with box queries,” arXiv preprint
|
| 2387 |
+
arXiv:2207.08914, 2022.
|
| 2388 |
+
[45] Y. Wang, X. Zhang, T. Yang, and J. Sun, “Anchor detr: Query
|
| 2389 |
+
design for transformer-based detector,” in Proceedings of the AAAI
|
| 2390 |
+
conference on artificial intelligence, vol. 36, pp. 2567–2575, 2022.
|
| 2391 |
+
[46] S. Liu, F. Li, H. Zhang, X. Yang, X. Qi, H. Su, J. Zhu, and L. Zhang,
|
| 2392 |
+
“Dab-detr: Dynamic anchor boxes are better queries for detr,”
|
| 2393 |
+
arXiv preprint arXiv:2201.12329, 2022.
|
| 2394 |
+
[47] G. Zhang, Z. Luo, Y. Yu, K. Cui, and S. Lu, “Accelerating detr
|
| 2395 |
+
convergence via semantic-aligned matching,” in Proceedings of the
|
| 2396 |
+
IEEE/CVF Conference on Computer Vision and Pattern Recognition,
|
| 2397 |
+
pp. 949–958, 2022.
|
| 2398 |
+
[48] K. He, X. Zhang, S. Ren, and J. Sun, “Deep residual learning for
|
| 2399 |
+
image recognition,” in Proceedings of the IEEE conference on computer
|
| 2400 |
+
vision and pattern recognition, pp. 770–778, 2016.
|
| 2401 |
+
[49] F. Iandola, M. Moskewicz, S. Karayev, R. Girshick, T. Darrell, and
|
| 2402 |
+
K. Keutzer, “Densenet: Implementing efficient convnet descriptor
|
| 2403 |
+
pyramids,” arXiv preprint arXiv:1404.1869, 2014.
|
| 2404 |
+
[50] A. Newell, K. Yang, and J. Deng, “Stacked hourglass networks for
|
| 2405 |
+
human pose estimation,” in European conference on computer vision,
|
| 2406 |
+
pp. 483–499, Springer, 2016.
|
| 2407 |
+
[51] X. Dong, J. Bao, D. Chen, W. Zhang, N. Yu, L. Yuan, D. Chen, and
|
| 2408 |
+
B. Guo, “Cswin transformer: A general vision transformer back-
|
| 2409 |
+
bone with cross-shaped windows,” in Proceedings of the IEEE/CVF
|
| 2410 |
+
Conference on Computer Vision and Pattern Recognition, pp. 12124–
|
| 2411 |
+
12134, 2022.
|
| 2412 |
+
[52] J. Yang, C. Li, P. Zhang, X. Dai, B. Xiao, L. Yuan, and J. Gao, “Focal
|
| 2413 |
+
self-attention for local-global interactions in vision transformers,”
|
| 2414 |
+
arXiv preprint arXiv:2107.00641, 2021.
|
| 2415 |
+
[53] Z. Xia, X. Pan, S. Song, L. E. Li, and G. Huang, “Vision transformer
|
| 2416 |
+
with deformable attention,” in Proceedings of the IEEE/CVF Con-
|
| 2417 |
+
ference on Computer Vision and Pattern Recognition, pp. 4794–4803,
|
| 2418 |
+
2022.
|
| 2419 |
+
[54] H. Wu, B. Xiao, N. Codella, M. Liu, X. Dai, L. Yuan, and L. Zhang,
|
| 2420 |
+
“Cvt: Introducing convolutions to vision transformers,” in Proceed-
|
| 2421 |
+
ings of the IEEE/CVF International Conference on Computer Vision,
|
| 2422 |
+
pp. 22–31, 2021.
|
| 2423 |
+
[55] A. Dosovitskiy, L. Beyer, A. Kolesnikov, D. Weissenborn, X. Zhai,
|
| 2424 |
+
T. Unterthiner, M. Dehghani, M. Minderer, G. Heigold, S. Gelly,
|
| 2425 |
+
et al., “An image is worth 16x16 words: Transformers for image
|
| 2426 |
+
recognition at scale,” arXiv preprint arXiv:2010.11929, 2020.
|
| 2427 |
+
[56] C.-F. Chen, R. Panda, and Q. Fan, “Regionvit: Regional-to-local
|
| 2428 |
+
attention for vision transformers,” arXiv preprint arXiv:2106.02689,
|
| 2429 |
+
2021.
|
| 2430 |
+
[57] Y. Wang, R. Huang, S. Song, Z. Huang, and G. Huang, “Not all
|
| 2431 |
+
images are worth 16x16 words: Dynamic transformers for efficient
|
| 2432 |
+
image recognition,” Advances in Neural Information Processing Sys-
|
| 2433 |
+
tems, vol. 34, pp. 11960–11973, 2021.
|
| 2434 |
+
[58] K. He, G. Gkioxari, P. Doll´ar, and R. Girshick, “Mask r-cnn,” in
|
| 2435 |
+
Proceedings of the IEEE international conference on computer vision,
|
| 2436 |
+
pp. 2961–2969, 2017.
|
| 2437 |
+
[59] X. Dai, Y. Chen, B. Xiao, D. Chen, M. Liu, L. Yuan, and L. Zhang,
|
| 2438 |
+
“Dynamic head: Unifying object detection heads with attentions,”
|
| 2439 |
+
in Proceedings of the IEEE/CVF conference on computer vision and
|
| 2440 |
+
pattern recognition, pp. 7373–7382, 2021.
|
| 2441 |
+
[60] H. Law and J. Deng, “Cornernet: Detecting objects as paired
|
| 2442 |
+
keypoints,” in Proceedings of the European conference on computer
|
| 2443 |
+
vision (ECCV), pp. 734–750, 2018.
|
| 2444 |
+
[61] T.-Y. Lin, P. Goyal, R. Girshick, K. He, and P. Doll´ar, “Focal loss
|
| 2445 |
+
for dense object detection,” in Proceedings of the IEEE international
|
| 2446 |
+
conference on computer vision, pp. 2980–2988, 2017.
|
| 2447 |
+
[62] Y.-L. Li, L. Xu, X. Liu, X. Huang, Y. Xu, S. Wang, H.-S. Fang,
|
| 2448 |
+
Z. Ma, M. Chen, and C. Lu, “Pastanet: Toward human activity
|
| 2449 |
+
knowledge engine,” in Proceedings of the IEEE/CVF Conference on
|
| 2450 |
+
Computer Vision and Pattern Recognition, pp. 382–391, 2020.
|
| 2451 |
+
|
| 2452 |
+
JOURNAL OF LATEX CLASS FILES, VOL. 14, NO. 10, JANUARY 2023
|
| 2453 |
+
16
|
| 2454 |
+
[63] Y.-W. Chao, Z. Wang, Y. He, J. Wang, and J. Deng, “Hico: A
|
| 2455 |
+
benchmark for recognizing human-object interactions in images,”
|
| 2456 |
+
in Proceedings of the IEEE international conference on computer vision,
|
| 2457 |
+
pp. 1017–1025, 2015.
|
| 2458 |
+
[64] I. Loshchilov and F. Hutter, “Decoupled weight decay regulariza-
|
| 2459 |
+
tion,” arXiv preprint arXiv:1711.05101, 2017.
|
| 2460 |
+
|
D9E2T4oBgHgl3EQfogh1/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
D9FKT4oBgHgl3EQfZi4o/content/tmp_files/2301.11803v1.pdf.txt
ADDED
|
@@ -0,0 +1,2097 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
Asymptotics in an Asymptotic CFT
|
| 2 |
+
Lucas Schepersa1 and Daniel C. Thompsona,b2
|
| 3 |
+
a Department of Physics, Swansea University,
|
| 4 |
+
Swansea SA2 8PP, United Kingdom
|
| 5 |
+
b Theoretische Natuurkunde, Vrije Universiteit Brussel,
|
| 6 |
+
& The International Solvay Institutes, Pleinlaan 2, B-1050 Brussels, Belgium
|
| 7 |
+
Abstract
|
| 8 |
+
In this work we illustrate the resurgent structure of the λ-deformation; a two-
|
| 9 |
+
dimensional integrable quantum field theory that has an RG flow with an SU(N)k
|
| 10 |
+
Wess-Zumino-Witten conformal fixed point in the UV. To do so we use modern
|
| 11 |
+
matched asymptotic techniques applied to the thermodynamic Bethe ansatz formu-
|
| 12 |
+
lation to compute the free energy to 38 perturbative orders in an expansion of large
|
| 13 |
+
applied chemical potential. We find numerical evidence for factorial asymptotic be-
|
| 14 |
+
haviour with both alternating and non-alternating character which we match to
|
| 15 |
+
an analytic expression. A curiosity of the system is that it exhibits the Cheshire
|
| 16 |
+
Cat phenomenon with the leading non-alternating factorial growth vanishing when
|
| 17 |
+
k divides N. The ambiguities associated to Borel resummation of this series are
|
| 18 |
+
suggestive of non-perturbative contributions.
|
| 19 |
+
This is verified with an analytic
|
| 20 |
+
study of the TBA system demonstrating a cancellation between perturbative and
|
| 21 |
+
non-perturbative ambiguities.
|
| 22 |
+
1lucas.schepers@swansea.ac.uk
|
| 23 |
+
2daniel.c.thompson@swansea.ac.uk
|
| 24 |
+
arXiv:2301.11803v1 [hep-th] 27 Jan 2023
|
| 25 |
+
|
| 26 |
+
1
|
| 27 |
+
Introduction
|
| 28 |
+
A complete understanding of the strong coupling dynamics of four dimensional asymp-
|
| 29 |
+
totically free (AF) non-supersymmetric gauge theory, i.e. QCD, remains elusive. To
|
| 30 |
+
gain a foothold we may turn to simplified toy models. One strategy is to reduce the
|
| 31 |
+
dimensionality of the problem considering instead two dimensional quantum field the-
|
| 32 |
+
ories with similar RG behaviour. In the special case of integrable QFTs, an infinite set
|
| 33 |
+
of symmetries completely determine the exact S-matrix [1] providing a powerful toolkit
|
| 34 |
+
that can be used to tackle non-perturbative questions. An early success of this approach
|
| 35 |
+
was the calculation of the exact ratio of the mass gap to cut-off of AF integrable QFTs
|
| 36 |
+
theories [2–5].
|
| 37 |
+
More recently, techniques in integrable models have been used to elucidate even
|
| 38 |
+
deeper questions of the nature of perturbation theory. Typically, perturbation theory is
|
| 39 |
+
asymptotic in nature with perturbative coefficients growing factorially. The programme
|
| 40 |
+
of resurgence asserts that this breakdown of convergence signals the need to include
|
| 41 |
+
non-perturbative physics. Even more strongly, ambiguities inherent in resummations of
|
| 42 |
+
asymptotic perturbative expansions should be cancelled by compensating ambiguities
|
| 43 |
+
in a non-perturbative sector. For a modern overview of resurgence from a physics view
|
| 44 |
+
point see e.g. [6]. Again, integrable two-dimensional models provide an ideal test bed
|
| 45 |
+
for resurgence.
|
| 46 |
+
In semi-classical approaches [7–12], an adiabatic compactification of two-dimension
|
| 47 |
+
models is used to obtain a quantum mechanics which can be probed to large perturbative
|
| 48 |
+
orders. In these cases, two-dimensional finite Euclidean action configurations, known as
|
| 49 |
+
unitons1 are shown to precisely resolve the semi-classical ambiguities of the perturbative
|
| 50 |
+
sector. Whilst intriguing, such approaches intrinsically disregard degrees of freedom in
|
| 51 |
+
compactification restricting to the lowest KK sector. Alongside this features of renorm-
|
| 52 |
+
alisation group are disregarded in the truncation to Quantum Mechanics. Given these
|
| 53 |
+
limitations, one thus prompted to ask if the resurgence paradigm can be established in
|
| 54 |
+
a fully two-dimensional setting.
|
| 55 |
+
A breakthrough was the work of Volin [13, 14], recently refined in [15, 16] (see also the
|
| 56 |
+
recent papers [17–25]), in addressing the Thermodynamic Bethe Ansatz (TBA) system
|
| 57 |
+
that determines free energy in a large chemical potential. By comparing two scaling
|
| 58 |
+
limits, it is possible to reduce the complicated integral TBA equation to a (complicated)
|
| 59 |
+
set of algebraic equations that fix unknown coefficients in an ansatz for a perturbative
|
| 60 |
+
expansion (in the chemical potential or other more refined coupling). This allows access
|
| 61 |
+
to sufficient order in perturbation theory to reveal factorial divergence of perturbative
|
| 62 |
+
coefficients.
|
| 63 |
+
Although we cannot identify an instanton or other semi-classical non-perturbative
|
| 64 |
+
saddle in the TBA approach, we can find a matching ambiguity using a different method.
|
| 65 |
+
[26] showed that it is possible to solve the TBA equations using a transseries. A critical
|
| 66 |
+
step in their solution is an arbitrary choice of branch cut which introduces an ambiguity
|
| 67 |
+
of the transseries. Although this approach, due to its computational difficulty, cannot
|
| 68 |
+
be executed to large orders, it does exhibit a non-perturbative ambiguity that matches
|
| 69 |
+
the ambiguity of the large-order behaviour found in the perturbative sector.
|
| 70 |
+
In this note we will adopt this toolbox to study the resurgent structure of a theory
|
| 71 |
+
that exhibits a different renormalisation group dynamic. We consider a theory in which
|
| 72 |
+
the UV is not Gaussian but instead is described by a non-trivial interacting conformal
|
| 73 |
+
fixed point. The theory we will consider, known as the λ-model [27, 28], is realised as a
|
| 74 |
+
flow away from an SU(N)k Wess-Zumino-Witten (WZW) model driven at leading order
|
| 75 |
+
by a certain current-current bilinear. The IR of the theory is the principal chiral model,
|
| 76 |
+
expressed in non-Abelian T-dual coordinates, and accordingly is gapped. Whilst this
|
| 77 |
+
1Unlike instantons, unitons are not topologically protected.
|
| 78 |
+
1
|
| 79 |
+
|
| 80 |
+
marginally relevant deformation breaks conformality and the full affine symmetry of the
|
| 81 |
+
WZW current algebra, it does preserve an infinite symmetry associated to integrablity.
|
| 82 |
+
At the quantum level the exact S-matrix is known (based on symmetry grounds pre-
|
| 83 |
+
dating the Lagrangian description) [29, 30] and has been shown to match the λ-model
|
| 84 |
+
Lagrangian using a light cone lattice discretisation and Quantum Inverse Scattering [31].
|
| 85 |
+
The goal of this note is to match the perturbative ambiguity to that of the transseries
|
| 86 |
+
the new context of a λ-model. The outline is as follows: Section 2 provides a more in-
|
| 87 |
+
depth discussion of the λ-model as we consider its RG flow in more detail and present
|
| 88 |
+
its exact S-matrix. In Section 3, we review the recent techniques to perturbatively solve
|
| 89 |
+
TBA equation [13–16] that determine free energy.
|
| 90 |
+
Introducing a special coupling γ
|
| 91 |
+
in Section 3.4 results in a clean (i.e. log-free) series for the λ-model. We analyse its
|
| 92 |
+
asymptotic behaviour in Section 4 and compute the leading ambiguity. This ambiguity
|
| 93 |
+
is matched by a transseries calculation in Section 5. A particularly eye-catching result
|
| 94 |
+
is that the leading UV ambiguity disappears when N divides k. We wrap up with ideas
|
| 95 |
+
for future research in Section 6.
|
| 96 |
+
2
|
| 97 |
+
The λ-Model
|
| 98 |
+
In this section we outline the salient properties of the two-dimensional integrable QFT
|
| 99 |
+
that we are considering: the λ-deformed model. Classically, the λ-model provides a
|
| 100 |
+
Lagrangian interpolation between the conformal Wess-Zumino-Witten (WZW) model
|
| 101 |
+
for a Lie-group G [32] and the principal chiral model (PCM) (written in non-Abelian
|
| 102 |
+
T-dual variables). Remarkably this theory is integrable for all values of the eponymous
|
| 103 |
+
interpolating parameter λ related to the level, k, of WZW and the radius, r, of the PCM
|
| 104 |
+
by
|
| 105 |
+
λ =
|
| 106 |
+
k
|
| 107 |
+
k + r2 .
|
| 108 |
+
(1)
|
| 109 |
+
Whilst the λ-model for the restricted case of G = SU(2) was first proposed long ago
|
| 110 |
+
[29, 33, 34], the pioneering work of Sfetsos [27] in constructing the general theory has
|
| 111 |
+
prompted extensive recent development (for reviews see [35, 36]). The λ-model has been
|
| 112 |
+
extended to Z2 graded symmetric spaces [27, 37] where it constitutes an interpolation
|
| 113 |
+
between a G/H gauged WZW (representing the coset CFT) and the (non-abelian T-dual
|
| 114 |
+
of) the principal chiral model on G/H and even to Z4 graded super-cosets relevant to
|
| 115 |
+
the construction of the AdS5 × S5 superstring [38] underpinned by an elegant quantum
|
| 116 |
+
group at root-of-unity symmetry structure. In this string theory context, λ-deformation
|
| 117 |
+
is in fact marginal, and the world sheet theory can be viewed as a σ-model in some
|
| 118 |
+
target space super-gravity background [39–41]. Here however we will be considering the
|
| 119 |
+
simpler bosonic case for which the λ-deformation does not define a CFT but rather a
|
| 120 |
+
relevant RG flow from a WZW fixed point in the UV to the dualised PCM the IR [28,
|
| 121 |
+
42, 43]. A series of papers [44–48] have shown how the λ-model is actually part of a wide
|
| 122 |
+
tapestry of integrable deformed models linked by (analytically continued) Poisson-Lie
|
| 123 |
+
T-duality transformations.
|
| 124 |
+
2.1
|
| 125 |
+
Lagrangian Construction
|
| 126 |
+
First we sketch the construction of the non-abelian T-dual of the PCM using the Buscher
|
| 127 |
+
procedure [49] as it informs the construction of the λ-model. We start with the action
|
| 128 |
+
2
|
| 129 |
+
|
| 130 |
+
of the PCM for a group valued field ˜g 2
|
| 131 |
+
SPCM[˜g] = − r2
|
| 132 |
+
4π
|
| 133 |
+
�
|
| 134 |
+
d2σ Tr
|
| 135 |
+
�
|
| 136 |
+
˜g−1∂+˜g˜g−1∂−˜g
|
| 137 |
+
�
|
| 138 |
+
,
|
| 139 |
+
(2)
|
| 140 |
+
and downgrade the left symmetry ˜g → h−1˜g to a gauge symmetry by introducing a
|
| 141 |
+
gauge connection transforming as A → h−1dh + h−1Ah and replacing derivatives to
|
| 142 |
+
covariant derivatives d → D = d + A. This yields the gauged PCM action which we
|
| 143 |
+
denote as SgPCM[˜g, A]. To ensure that the gauged theory is actually equivalent to the
|
| 144 |
+
ungauged theory (at least in trivial topology which we assume throughout) we enforce
|
| 145 |
+
that the connection is flat (i.e. the gauge field is pure gauge). This is implemented by
|
| 146 |
+
introducing a Lagrange-multiplier term, − Tr(νF+−), to the Lagrangian. Integrating
|
| 147 |
+
out the field ν enforces that the field strength F+− vanishes and we recover the original
|
| 148 |
+
PCM after gauge-fixing ˜g = 1. However, if instead we integrate out the gauge fields A,
|
| 149 |
+
after gauge fixing ˜g = 1, we obtain the non-abelian T-dual model in which the field ν
|
| 150 |
+
becomes the fundamental field.
|
| 151 |
+
The construction of the λ-model by Sfetsos [27] is achieved through a modification of
|
| 152 |
+
this Buscher procedure. Instead of adding a Lagrange multiplier term, we add a gauged
|
| 153 |
+
WZW term. Recall that the WZW model is given by
|
| 154 |
+
SWZW,k[g] = − k
|
| 155 |
+
2π
|
| 156 |
+
�
|
| 157 |
+
Σ
|
| 158 |
+
d2σ Tr
|
| 159 |
+
�
|
| 160 |
+
g−1∂µgg−1∂µg
|
| 161 |
+
�
|
| 162 |
+
− ik
|
| 163 |
+
6��
|
| 164 |
+
�
|
| 165 |
+
M3
|
| 166 |
+
Tr
|
| 167 |
+
�
|
| 168 |
+
g−1dg
|
| 169 |
+
�3 ,
|
| 170 |
+
(3)
|
| 171 |
+
in which g is extended to a 3-manifold M3 with boundary ∂(M3) = Σ.
|
| 172 |
+
Standard
|
| 173 |
+
arguments [32] ensure that the path integral is well-defined (independent of choice of
|
| 174 |
+
extension) provided that k is appropriately quantised, and in particular for G = SU(N)
|
| 175 |
+
which we assume henceforth, k ∈ Z. In this sector we gauge the diagonal symmetry
|
| 176 |
+
g → h−1gh leading to a gauged WZW model action SgWZW,k[g, A] [50, 51].
|
| 177 |
+
To construct the λ-model we combine a gauged PCM and a gauged WZW model:
|
| 178 |
+
Sλ,k[g, ˜g, A] = SgPCM[˜g, A] + SgWZW[g, A] .
|
| 179 |
+
(4)
|
| 180 |
+
Notice that the two models are coupled through the fact that they are gauged by the
|
| 181 |
+
same gauge field. The Sfetsos procedure is concluded by gauge fixing ˜g = 1 and integ-
|
| 182 |
+
rating out the gauge field A using its on-shell value
|
| 183 |
+
A+ = λ(1 − λAdg)−1R+ ,
|
| 184 |
+
A− = −λ(1 − λAdg−1)−1L− ,
|
| 185 |
+
(5)
|
| 186 |
+
where we defined R± = ∂±gg−1 and L± = g−1∂±g and the adjoint action AdgX =
|
| 187 |
+
gXg−1. Integrating out the gauge field then yields the action
|
| 188 |
+
Sλ,k[g] = SWZW,k[g] + kλ
|
| 189 |
+
π
|
| 190 |
+
�
|
| 191 |
+
Σ
|
| 192 |
+
d2σ Tr
|
| 193 |
+
�
|
| 194 |
+
R+(1 − λAdg)−1L−
|
| 195 |
+
�
|
| 196 |
+
.
|
| 197 |
+
(6)
|
| 198 |
+
Though not vital for what follows we note that the equation of motion can be understood
|
| 199 |
+
as a zero-curvature condition on the Lax connection [27, 52]
|
| 200 |
+
L±(z) = −
|
| 201 |
+
2
|
| 202 |
+
1 + λ
|
| 203 |
+
A±
|
| 204 |
+
1 ∓ z ,
|
| 205 |
+
(7)
|
| 206 |
+
in which A± are evaluated with the on-shell values eq. (5) and z ∈ C is a spectral
|
| 207 |
+
parameter. This is the starting point of establishing the classical integrability of the
|
| 208 |
+
theory. Further to this one requires strong integrability i.e. that the conserved charges
|
| 209 |
+
built from the monodromy of this Lax are in involution. This is ensured provided that
|
| 210 |
+
the Poisson algebra of the spatial component of the Lax has a particular r-s Maillet form
|
| 211 |
+
as was demonstrated for the λ-model, and its generalisations, in [47, 53, 54].
|
| 212 |
+
2We use light cone coordinates σ± = 1
|
| 213 |
+
2 (t ± x). Derivatives with respect to light cone coordinates
|
| 214 |
+
are denoted by ∂±.
|
| 215 |
+
3
|
| 216 |
+
|
| 217 |
+
2.2
|
| 218 |
+
Renormalisation
|
| 219 |
+
The parameter λ given by eq. (1) varies from 0 to 1 and we shall now discuss what
|
| 220 |
+
happens in each of those limits. At a quantum level the parameter λ undergoes an RG
|
| 221 |
+
flow [28, 42, 43] given by (to all orders in λ and leading in 1
|
| 222 |
+
k)
|
| 223 |
+
µdλ
|
| 224 |
+
dµ = β(λ) = −2N
|
| 225 |
+
k
|
| 226 |
+
�
|
| 227 |
+
λ
|
| 228 |
+
1 + λ
|
| 229 |
+
�2
|
| 230 |
+
= −β1λ2 − β2λ3 + O(λ4) .
|
| 231 |
+
(8)
|
| 232 |
+
The leading order behaviour, which shall be relevant later, is given by
|
| 233 |
+
β1 = 2N
|
| 234 |
+
k ,
|
| 235 |
+
β2 = −4N
|
| 236 |
+
k .
|
| 237 |
+
(9)
|
| 238 |
+
There is an evident UV fixed point at λ = 0, corresponding to the undeformed WZW
|
| 239 |
+
model. In the vicinity of this λ ≈ 0, or k ≪ r2, we obtain a current-current deformation
|
| 240 |
+
of the WZW model:
|
| 241 |
+
Sλ,k[g] = SWZW,k[g] + λ
|
| 242 |
+
�
|
| 243 |
+
Σ
|
| 244 |
+
d2σ Tr (R+L−) + O(λ2) ,
|
| 245 |
+
(10)
|
| 246 |
+
This, however, is not a marginal deformation (cf. marginal ones [55]), but relevant as it
|
| 247 |
+
moves away from the WZW theory located in the UV.
|
| 248 |
+
To understand the IR regime as λ → 1, we can force k → ∞. If the group element
|
| 249 |
+
is expanded as g = 1 + i
|
| 250 |
+
kνata, the action SgWZW,k reduces to the Lagrange multiplier
|
| 251 |
+
term − Tr(νF+−). Thus in this limit the Sfetsos procedure reduces to the non-Abelian
|
| 252 |
+
T-dualisation Buscher procedure described above. Hence, in this IR limit, we recover the
|
| 253 |
+
non-abelian T-dual of the PCM. Further into the deep IR, one thus anticipates (as with
|
| 254 |
+
the PCM) that the dimensionless parameter λ is transmuted into a mass gap mediated
|
| 255 |
+
through a cut-off Λ.
|
| 256 |
+
2.3
|
| 257 |
+
Quantum Integrability
|
| 258 |
+
Not only is the theory classical integrable, it remains so at the quantum level. The
|
| 259 |
+
existence of higher spin conserved currents ensure that the scattering matrix of the
|
| 260 |
+
theory factorises, and can be fully determined with the 2-to-2 particle scattering matrix
|
| 261 |
+
the fundamental building block. The S-matrix for the SU(N) λ-model was constructed
|
| 262 |
+
many years ago [56] from an algebraic perspective, and was related directly to the
|
| 263 |
+
Lagrangian description for the SU(2) case in [29] by matching the free energy obtained
|
| 264 |
+
by Lagrangian perturbation theory and by S-matrix TBA techniques. Following the
|
| 265 |
+
introduction of the Lagrangian description λ-model by Sfetsos [27] for SU(N) the exact
|
| 266 |
+
S-matrix was conjectured [52] for general ranks. This conjecture was substantiated by
|
| 267 |
+
Appadu et al. [31] in which the form of the S-matrix was ‘derived’ by the Quantum
|
| 268 |
+
Inverse Scattering Method (i.e. a latticed version of the theory that takes the form of a
|
| 269 |
+
spin chain such from the QFT particle states are obtained as excitations over the ground
|
| 270 |
+
state in a continuum limit)3. Rather than present the full details of the S-matrix (for
|
| 271 |
+
which see [52]) we can give a schematic understanding somewhat mirroring the Sfetsos
|
| 272 |
+
procedure.
|
| 273 |
+
3This QISM is in fact rather non-trivial as the δ′(σ) non-ultra-local terms in the fundamental Poisson
|
| 274 |
+
bracket preclude a simple application of QISM. Instead what is proposed is a modification of the
|
| 275 |
+
λ-model, that lies in the same universality class, to which QISM can be applied.
|
| 276 |
+
This provides a
|
| 277 |
+
description as a spin-k XXX spin chain with alternating inhomogeneities.
|
| 278 |
+
This idea was expanded
|
| 279 |
+
to a two-parameter integrable λ-type model [57] realised as a spin-k XXZ spin chain with alternating
|
| 280 |
+
inhomogeneities.
|
| 281 |
+
4
|
| 282 |
+
|
| 283 |
+
We start with the SU(N) principal chiral model which has in particular an SU(N)L×
|
| 284 |
+
SU(N)R global symmetry. The fundamental particles are massive and transform in fun-
|
| 285 |
+
damental antisymmetric tensor representations of the global symmetry. The scattering
|
| 286 |
+
depends kinematically only on the rapidity difference θ of the particles4. Reflecting this
|
| 287 |
+
global symmetry, the S-matrix of these fundamental excitations has a schematic tensor
|
| 288 |
+
form (suppressing explicit representation labels)
|
| 289 |
+
SPCM(θ) = X(θ)S(θ) ⊗ S(θ) ,
|
| 290 |
+
(11)
|
| 291 |
+
where X(θ) is an overall scalar dressing factor to ensure all S-matrix axioms are obeyed,
|
| 292 |
+
and the S(θ) factors are separately SU(N) invariant (in fact invariant under a larger
|
| 293 |
+
Yangian symmetry). Recalling that in the Sfetsos procedure the left acting SU(N)L
|
| 294 |
+
symmetry was gauged, it is natural that the left hand block of the tensor product of eq.
|
| 295 |
+
(11) is modified in the λ-theory and indeed this is the case with
|
| 296 |
+
Sλ(θ) = Xk(θ)Sk(θ) ⊗ S(θ) .
|
| 297 |
+
(12)
|
| 298 |
+
Here Sk(θ) is a block [56] that furnishes a quantum group symmetry at the q2(k+N) = 1
|
| 299 |
+
root of unity taken in Restricted-Solid-On-Solid (RSOS) picture representing the scat-
|
| 300 |
+
tering of kink degrees of freedom.
|
| 301 |
+
Given knowledge of the exact S-matrix, the Thermodynamic Bethe Ansatz yields
|
| 302 |
+
a set of rather complicated coupled-integral equations can be used to determine the
|
| 303 |
+
free-energy of the theory. Solving these is quite formidable especially as the S-matrix is
|
| 304 |
+
non-diagonal. A powerful simplification is achieved by exposing the system to a chemical
|
| 305 |
+
potential h for a U(1) charge such that only certain particles condense and contribute
|
| 306 |
+
to the ground state. When the charge is chosen appropriately (as the one defined by
|
| 307 |
+
a highest weight of a rank N/2 antisymmetric representation [31]) then only a single
|
| 308 |
+
particle of maximal charge contributes and the TBA system simplifies to a single integral
|
| 309 |
+
equation determined by the identical scattering of this particle.
|
| 310 |
+
In this case, the scattering “matrix” reduces to a simple phase factor S(θ) that
|
| 311 |
+
governs transmission and reflection.
|
| 312 |
+
It shall prove useful in this case to define the
|
| 313 |
+
scattering kernel of this reduced S-matrix by
|
| 314 |
+
K(θ) =
|
| 315 |
+
1
|
| 316 |
+
2πi
|
| 317 |
+
d
|
| 318 |
+
dθ log S(θ) ,
|
| 319 |
+
(13)
|
| 320 |
+
and its Fourier transform
|
| 321 |
+
K(ω) =
|
| 322 |
+
� ∞
|
| 323 |
+
−∞
|
| 324 |
+
dθ eiωθK(θ) .
|
| 325 |
+
(14)
|
| 326 |
+
As a consequence of Hermitian analyticity on the reduced S-matrix, both K(θ) and its
|
| 327 |
+
Fourier transform are symmetric functions. Explicitly we have that the relevant kernel
|
| 328 |
+
is given by [57]
|
| 329 |
+
1 − K(ω) =
|
| 330 |
+
sinh2(πω/2)
|
| 331 |
+
sinh(πω) sinh(πκω) exp(πκω) ,
|
| 332 |
+
(15)
|
| 333 |
+
where κ =
|
| 334 |
+
k
|
| 335 |
+
N . In what follows, it shall prove useful to write the Fourier transform of
|
| 336 |
+
the scattering kernel as a Wiener-Hopf (WH) decomposition
|
| 337 |
+
1 − K(ω) =
|
| 338 |
+
1
|
| 339 |
+
G+(ω)G−(ω) ,
|
| 340 |
+
(16)
|
| 341 |
+
where G−(ω) = G+(−ω), and G+(ω) is analytic in the Upper Half Plane (UHP) and
|
| 342 |
+
normalised such that G+(2is) = 1 + O
|
| 343 |
+
�
|
| 344 |
+
1
|
| 345 |
+
s
|
| 346 |
+
�
|
| 347 |
+
. Explicitly G+(ω) is given by
|
| 348 |
+
G+(ω) =
|
| 349 |
+
√
|
| 350 |
+
4κ
|
| 351 |
+
Γ(1 − iω/2)2
|
| 352 |
+
Γ(1 − iω)Γ(1 − iκω) exp (ibω − iκω log(−iω)) ,
|
| 353 |
+
(17)
|
| 354 |
+
4The mass shell is related to rapidity by p0 = m cosh θ and p1 = m sinh θ.
|
| 355 |
+
5
|
| 356 |
+
|
| 357 |
+
with
|
| 358 |
+
b = κ(1 − log(κ)) − log(2) .
|
| 359 |
+
(18)
|
| 360 |
+
3
|
| 361 |
+
TBA Techniques
|
| 362 |
+
Polyakov and Wiegmann [58–60] showed in the 80s that it is possible to compute the free
|
| 363 |
+
energy of an integrable system with a chemical potential h turned on using a thermody-
|
| 364 |
+
namic Bethe ansatz (TBA) technique. Using these techniques, Hasenfratz, Niedermayer
|
| 365 |
+
and Maggiore [2, 3] showed in 19905 that it is possible to calculate the mass gap in
|
| 366 |
+
integrable models by comparing the result from TBA with conventional Lagrangian
|
| 367 |
+
pertubation theory. Building from this we will will apply, in section 3.4, the techniques
|
| 368 |
+
pioneered by [13–16] to extract an expansion for the free energy of λ-model in
|
| 369 |
+
1
|
| 370 |
+
h the
|
| 371 |
+
large order behaviour of which we will study extensively in section 4.
|
| 372 |
+
3.1
|
| 373 |
+
Free Energy
|
| 374 |
+
To present the TBA equations we will specialise to the case described above in which we
|
| 375 |
+
introduce a chemical potential h such that only a single particle dominates the ensemble
|
| 376 |
+
at large h.6 With K(θ) the appropriate scattering kernel, the TBA equations determine
|
| 377 |
+
the density distribution of states, χ(θ), via
|
| 378 |
+
m cosh(θ) = χ(θ) −
|
| 379 |
+
� B
|
| 380 |
+
−B
|
| 381 |
+
K(θ − θ′)χ(θ′)dθ′ ,
|
| 382 |
+
θ2 < B2 ,
|
| 383 |
+
(19)
|
| 384 |
+
from which the charge and energy density follow
|
| 385 |
+
e = m
|
| 386 |
+
� −B
|
| 387 |
+
B
|
| 388 |
+
χ(θ) cosh(θ) dθ
|
| 389 |
+
2π ,
|
| 390 |
+
ρ =
|
| 391 |
+
� −B
|
| 392 |
+
B
|
| 393 |
+
χ(θ) dθ
|
| 394 |
+
2π .
|
| 395 |
+
(20)
|
| 396 |
+
A critical complexity of this system is that the occupied states lie within a Fermi surface
|
| 397 |
+
specified by B, which is however a function of h (with large B corresponding to large
|
| 398 |
+
h). Supposing that we have calculated the energy density, thought of as a function of
|
| 399 |
+
the charge density e = e(ρ), then we can reconstruct a free energy density, F(h), from
|
| 400 |
+
a Legendre transform:
|
| 401 |
+
ρ = −F′(h) ,
|
| 402 |
+
F(h) − F(0) = e(ρ) − ρh .
|
| 403 |
+
(21)
|
| 404 |
+
3.2
|
| 405 |
+
Resolvent Approach
|
| 406 |
+
It will prove useful to recast the integral equation that determines χ(θ) in terms of a
|
| 407 |
+
resolvent function defined by
|
| 408 |
+
R(θ) =
|
| 409 |
+
� B
|
| 410 |
+
−B
|
| 411 |
+
χ(θ′)
|
| 412 |
+
θ − θ′ dθ′.
|
| 413 |
+
(22)
|
| 414 |
+
5This computation was intially performed for the O(N) model, but was later also completed for
|
| 415 |
+
Gross-Neveu models [4, 5] and PCM models [61, 62].
|
| 416 |
+
6That we can reduce the TBA system to involve just one species of particle from the fundamental
|
| 417 |
+
representation singled out by the applied chemical potential is of course an assumption that makes the
|
| 418 |
+
problem readily tractable. One anticipates that states of higher mass and higher charge are energetically
|
| 419 |
+
disfavoured, but properly speaking this assumption ought to be proven starting from a complete nested
|
| 420 |
+
TBA system (which we do not attempt here).
|
| 421 |
+
6
|
| 422 |
+
|
| 423 |
+
The resolvent is analytical everywhere except around the interval [−B, B] where it has
|
| 424 |
+
an ambiguity given by
|
| 425 |
+
χ(θ) = − 1
|
| 426 |
+
2πi
|
| 427 |
+
�
|
| 428 |
+
R+(θ) − R−(θ)
|
| 429 |
+
�
|
| 430 |
+
,
|
| 431 |
+
(23)
|
| 432 |
+
where we use the short hand notation R±(θ) = R(θ ± iϵ). Suppose that the kernel can
|
| 433 |
+
be cast in terms of some operator O as K(θ) =
|
| 434 |
+
1
|
| 435 |
+
2πiO 1
|
| 436 |
+
θ, then the eq. (19) is equivalent
|
| 437 |
+
to a Riemann-Hilbert problem
|
| 438 |
+
R+(θ) − R−(θ) + OR(θ) = −2πim cosh θ .
|
| 439 |
+
(24)
|
| 440 |
+
A determination of R(θ) is then equivalent to solving the TBA system and once known
|
| 441 |
+
the charge density is immediately extracted as
|
| 442 |
+
ρ = − 1
|
| 443 |
+
2π Resθ=∞R(θ) .
|
| 444 |
+
(25)
|
| 445 |
+
We briefly now review the approach of [13–15] which does so by considering ansatz
|
| 446 |
+
solutions for the resolvent in two limits (the edge and bulk) and matching them to fix
|
| 447 |
+
all undetermined coefficients.
|
| 448 |
+
3.2.1
|
| 449 |
+
Edge Ansatz
|
| 450 |
+
We begin first with the edge limit in which the weak coupling limit B → ∞ is taken
|
| 451 |
+
whilst keeping an edge coordinate z = 2(θ −B) fixed and small. This evidently scales to
|
| 452 |
+
large θ and hence probes the properties of χ(θ) around the vicinity of the Fermi energy,
|
| 453 |
+
B. This limit is best studied by considering the Laplace transform of the resolvent (22)
|
| 454 |
+
given by
|
| 455 |
+
R(z) =
|
| 456 |
+
� ∞
|
| 457 |
+
0
|
| 458 |
+
�R(s)e−szds ,
|
| 459 |
+
�R(s) =
|
| 460 |
+
1
|
| 461 |
+
2πi
|
| 462 |
+
� i∞+δ
|
| 463 |
+
−i∞+δ
|
| 464 |
+
eszR(z)dz .
|
| 465 |
+
(26)
|
| 466 |
+
Note at large B the energy density is related to this Laplace transformation by
|
| 467 |
+
e = meB
|
| 468 |
+
4π
|
| 469 |
+
�R(1/2) .
|
| 470 |
+
(27)
|
| 471 |
+
The key result of [15, 16] is that in the edge limit the Laplace transformed resolvent
|
| 472 |
+
has the following form
|
| 473 |
+
�R(s) = meBΦ(s)Φ
|
| 474 |
+
� 1
|
| 475 |
+
2
|
| 476 |
+
�
|
| 477 |
+
2
|
| 478 |
+
�
|
| 479 |
+
1
|
| 480 |
+
s + 1/2 + Q(s)
|
| 481 |
+
�
|
| 482 |
+
,
|
| 483 |
+
Φ(s) = G+(2is) ,
|
| 484 |
+
(28)
|
| 485 |
+
where G+(s) is the WH decomposition (16) of the (Fourier transformed) scattering
|
| 486 |
+
kernel and Q(s) is a series in large s and a perturbative expansion in
|
| 487 |
+
1
|
| 488 |
+
B of the form
|
| 489 |
+
Q(s) = 1
|
| 490 |
+
Bs
|
| 491 |
+
∞
|
| 492 |
+
�
|
| 493 |
+
m,n=0
|
| 494 |
+
Qn,m
|
| 495 |
+
Bm+nsn .
|
| 496 |
+
(29)
|
| 497 |
+
It should be noted that the coefficients Qn,m may still depend on log B.
|
| 498 |
+
3.2.2
|
| 499 |
+
Bulk Ansatz
|
| 500 |
+
In the bulk limit we let B → ∞ and θ → ∞ but we keep u = θ/B fixed, we are hence
|
| 501 |
+
studying the regime where θ is in the bulk, between 0 and B. The precise form of the
|
| 502 |
+
7
|
| 503 |
+
|
| 504 |
+
Bulk ansatz depends on the model. For the λ-model, we shall take the same bulk ansatz
|
| 505 |
+
for the Gross-Neveu model [15], which is given by
|
| 506 |
+
R(u) =
|
| 507 |
+
∞
|
| 508 |
+
�
|
| 509 |
+
n=1
|
| 510 |
+
∞
|
| 511 |
+
�
|
| 512 |
+
m=0
|
| 513 |
+
n+m
|
| 514 |
+
�
|
| 515 |
+
k=0
|
| 516 |
+
cn,m,k
|
| 517 |
+
ue(k+1)
|
| 518 |
+
Bm+n(u2 − 1)n
|
| 519 |
+
�
|
| 520 |
+
log u − 1
|
| 521 |
+
1 + u
|
| 522 |
+
�k
|
| 523 |
+
,
|
| 524 |
+
(30)
|
| 525 |
+
where e(k) is 0 if k is even and 1 if k is odd.The bulk ansatz can be motivated by
|
| 526 |
+
constructing it using functions that are analytic outside the interval [−B, B], where
|
| 527 |
+
they have a logarithmic branch cut.7 This is precisely the analytic structure demanded
|
| 528 |
+
by eqs. (22) and (23).
|
| 529 |
+
3.3
|
| 530 |
+
Matching
|
| 531 |
+
If we re-expand the bulk ansatz (30) in an edge regime where z = 2(θ − B) is fixed, we
|
| 532 |
+
should recover the expansion in the edge regime given by (28). Here a miraculous feature
|
| 533 |
+
occurs: upon comparing expansions order by order in large B, then order by order in
|
| 534 |
+
large z (which is small s) and then in log(z), we can solve for all the coefficients cn,m,k
|
| 535 |
+
and Qn,m. One peculiarity of the procedure is that we perform this matching only for
|
| 536 |
+
the regular terms of the expansion z−n (n ≥ 0), while we disregard all divergent terms
|
| 537 |
+
zn (n > 0). Using a desktop PC, over the course of a week, we solved the system up
|
| 538 |
+
to 38 orders. Once this calculation is completed, we compute e and ρ. Using equations
|
| 539 |
+
(28) and (25) we can express ρ and e in terms of the coefficients by
|
| 540 |
+
e = m2e2BΦ(1/2)2
|
| 541 |
+
8π
|
| 542 |
+
�
|
| 543 |
+
1 +
|
| 544 |
+
∞
|
| 545 |
+
�
|
| 546 |
+
m=1
|
| 547 |
+
1
|
| 548 |
+
Bm
|
| 549 |
+
m−1
|
| 550 |
+
�
|
| 551 |
+
n=0
|
| 552 |
+
2n+1Qn,m−1−n
|
| 553 |
+
�
|
| 554 |
+
,
|
| 555 |
+
ρ = 2π
|
| 556 |
+
∞
|
| 557 |
+
�
|
| 558 |
+
m=0
|
| 559 |
+
c1,m,0
|
| 560 |
+
Bm .
|
| 561 |
+
(31)
|
| 562 |
+
Explicitly the first few coefficients required to determine up to order B−2 are given by
|
| 563 |
+
c1,0,0 = 4√κ ,
|
| 564 |
+
c1,1,0 = −2κ3/2 ,
|
| 565 |
+
c1,2,0 = 1
|
| 566 |
+
2κ3/2(2 − κ − 4 log 2 + 4κ log(2B/κ)) ,
|
| 567 |
+
Q0,0 = 0 ,
|
| 568 |
+
Q1,0 = 0 ,
|
| 569 |
+
Q0,1 = κ
|
| 570 |
+
4 .
|
| 571 |
+
(32)
|
| 572 |
+
The last step is to calculate the quantity
|
| 573 |
+
e
|
| 574 |
+
ρ2 as an expansion in B the first terms of
|
| 575 |
+
which are
|
| 576 |
+
8κ
|
| 577 |
+
π
|
| 578 |
+
e
|
| 579 |
+
ρ2 = 1 + κ
|
| 580 |
+
B + κ
|
| 581 |
+
B2
|
| 582 |
+
�
|
| 583 |
+
1 − log(2) + κ
|
| 584 |
+
2 + κ log(2B/κ)
|
| 585 |
+
�
|
| 586 |
+
+ O(B−3) .
|
| 587 |
+
(33)
|
| 588 |
+
As this result depends on log(B), it is convenient to define a new effective coupling γ in
|
| 589 |
+
terms of which the perturbative expansion is free from logarithms as we shall do in the
|
| 590 |
+
next section.
|
| 591 |
+
3.4
|
| 592 |
+
Perturbative result
|
| 593 |
+
Before introducing the log-free coupling, we show our results are consistent with those
|
| 594 |
+
of [31], which determines the mass gap of this theory. Using standard TBA techniques,
|
| 595 |
+
7This is different from the PCM bulk ansatz which also has a square root branch cut along the
|
| 596 |
+
interval [−B, B].
|
| 597 |
+
8
|
| 598 |
+
|
| 599 |
+
they find an expansion for the free energy given by
|
| 600 |
+
F(h) − F(0) = −2h2κ
|
| 601 |
+
π
|
| 602 |
+
�
|
| 603 |
+
1 − 2κα + 2κα2�
|
| 604 |
+
2 + κ + log 4 + +2κ log κ + 2κ log α
|
| 605 |
+
�
|
| 606 |
+
− 8κ2α3 log(α)
|
| 607 |
+
�
|
| 608 |
+
(−2 + 2κ + log 4 + 2κ log(κ) + κ log(α)
|
| 609 |
+
�
|
| 610 |
+
+ O(α3)
|
| 611 |
+
�
|
| 612 |
+
.
|
| 613 |
+
(34)
|
| 614 |
+
The coupling α is here defined by
|
| 615 |
+
1
|
| 616 |
+
α = 2 log
|
| 617 |
+
�
|
| 618 |
+
2h
|
| 619 |
+
m
|
| 620 |
+
�
|
| 621 |
+
8κ
|
| 622 |
+
π
|
| 623 |
+
�
|
| 624 |
+
.
|
| 625 |
+
(35)
|
| 626 |
+
By using the Legendre transformation (21) we can compute the total energy e from eq.
|
| 627 |
+
(34). Doing so, we obtain the expression
|
| 628 |
+
8κ
|
| 629 |
+
π
|
| 630 |
+
e
|
| 631 |
+
ρ2 =1 + 2ακ − 2κα2(2κ log(ακ) − κ − 2 + log(4))+
|
| 632 |
+
8κ2α3�
|
| 633 |
+
κ log2(α) + (log(α) − 1)(−2 log(4) + 2κ log(κ))
|
| 634 |
+
�
|
| 635 |
+
+ O
|
| 636 |
+
�
|
| 637 |
+
α4�
|
| 638 |
+
.
|
| 639 |
+
(36)
|
| 640 |
+
From eq. (33), it follows that
|
| 641 |
+
e
|
| 642 |
+
ρ2 = χ0 + O(α) where χ0 =
|
| 643 |
+
π
|
| 644 |
+
8κ. Therefore to leading
|
| 645 |
+
order we have h = ∂e
|
| 646 |
+
∂ρ = 2χ0ρ, which leads to ρ = 4hκ
|
| 647 |
+
π . Looking at eq. (35), we should
|
| 648 |
+
thus define a coupling by
|
| 649 |
+
1
|
| 650 |
+
α = 2 log
|
| 651 |
+
�
|
| 652 |
+
ρ
|
| 653 |
+
m
|
| 654 |
+
�
|
| 655 |
+
2π
|
| 656 |
+
κ
|
| 657 |
+
�
|
| 658 |
+
.
|
| 659 |
+
(37)
|
| 660 |
+
This defines α in terms of B. Inverting the relation and substituting into the series (33)
|
| 661 |
+
recovers precisely the expansion (36), providing an important consistency check for our
|
| 662 |
+
programme.
|
| 663 |
+
We now take inspiration from the Gross-Neveu treatment of [15] to create a series
|
| 664 |
+
expansions for
|
| 665 |
+
e
|
| 666 |
+
ρ2 that is log-free. This is appropriate because we have that to leading
|
| 667 |
+
order ∆F ∼ −h2 + O(α), which leads to a coupling defined by8
|
| 668 |
+
1
|
| 669 |
+
γ + ξ log γ = log 2πρ
|
| 670 |
+
m/c ,
|
| 671 |
+
ξ = β2
|
| 672 |
+
β2
|
| 673 |
+
1
|
| 674 |
+
= − k
|
| 675 |
+
N = −κ .
|
| 676 |
+
(38)
|
| 677 |
+
One could demand that the right hand side be log 2πρ
|
| 678 |
+
ΛMS , where ΛMS is the cut-off in
|
| 679 |
+
the minimal subtraction scheme. To achieve this one has to tune the constant c = cMS
|
| 680 |
+
such that cMSΛMS = m. A key outcome of [31] determines that cMS = e3/2N −1/2.
|
| 681 |
+
However, we shall exercise the freedom to pick a c of our own choosing,
|
| 682 |
+
c = 2−κΓ(κ)
|
| 683 |
+
π
|
| 684 |
+
,
|
| 685 |
+
(39)
|
| 686 |
+
such that resulting expressions appear considerably simplified. This leads to an expan-
|
| 687 |
+
sion that is log-free in the coupling, given by
|
| 688 |
+
8κ
|
| 689 |
+
π
|
| 690 |
+
e
|
| 691 |
+
ρ2 =
|
| 692 |
+
∞
|
| 693 |
+
�
|
| 694 |
+
n=0
|
| 695 |
+
anγn = 1 + κγ + κ
|
| 696 |
+
2 [2 − κ]γ2+
|
| 697 |
+
κ
|
| 698 |
+
2
|
| 699 |
+
�
|
| 700 |
+
3 − 5κ + 2κ2�
|
| 701 |
+
γ3 + κ
|
| 702 |
+
8
|
| 703 |
+
�
|
| 704 |
+
3(8 − ζ(3)) − 61κ + 52κ2 − 15κ3�
|
| 705 |
+
γ4+
|
| 706 |
+
κ
|
| 707 |
+
12
|
| 708 |
+
�
|
| 709 |
+
90 − 18ζ(3) + κ(33ζ(3) − 288) + 355κ2 − 203κ3 + 46κ4�
|
| 710 |
+
γ5+
|
| 711 |
+
κ
|
| 712 |
+
32
|
| 713 |
+
�
|
| 714 |
+
45(16 − 4ζ(3) − ζ(5)) + 2κ(259ζ(3) − 1338) + 1
|
| 715 |
+
3κ2(12274 − 1329ζ(3))
|
| 716 |
+
− 3285κ3 + 1412κ4 − 787κ5
|
| 717 |
+
3
|
| 718 |
+
�
|
| 719 |
+
γ6 + O(γ7) .
|
| 720 |
+
(40)
|
| 721 |
+
8This is in contrast to the PCM calculation where the free energy has a structure ∆F ∼ − h2
|
| 722 |
+
α +O(α0),
|
| 723 |
+
which leads to a coupling 1
|
| 724 |
+
γ + (ξ − 1) log γ ∝ log ρ.
|
| 725 |
+
9
|
| 726 |
+
|
| 727 |
+
Figure 1: Left to right, for κ = 0.98, 1 and 1.02, the Borel-Pad´e-poles in the ζ-plane.
|
| 728 |
+
Evident are singularities at ζ = ±2, with the positive pole removed for κ = 1.
|
| 729 |
+
In the next Section we shall explore this perturbative expansion further.
|
| 730 |
+
4
|
| 731 |
+
Asymptotic Analysis
|
| 732 |
+
In this Section, we will quantitatively analyse the 38 orders of the perturbative series
|
| 733 |
+
obtained in the previous Section. The goal shall be to compute an asymptotic formula
|
| 734 |
+
for the growth of the coefficients as a function of κ. After obtaining such a formula, we
|
| 735 |
+
can compute its Borel ambiguity, which can later be compared against an ambiguity of
|
| 736 |
+
a transseries.
|
| 737 |
+
As the perturbative series can readily be seen to exhibit factorial growth, as a first
|
| 738 |
+
step to resummation we introduce the Borel transform
|
| 739 |
+
B
|
| 740 |
+
�8κ
|
| 741 |
+
π
|
| 742 |
+
e
|
| 743 |
+
ρ
|
| 744 |
+
2�
|
| 745 |
+
≡
|
| 746 |
+
∞
|
| 747 |
+
�
|
| 748 |
+
n=0
|
| 749 |
+
an
|
| 750 |
+
n! ζn .
|
| 751 |
+
(41)
|
| 752 |
+
This series has a finite radius of convergence but typically has either, or both, poles
|
| 753 |
+
and branch cuts. The pole/branch point closest to the origin in the ζ plane is governed
|
| 754 |
+
by the leading asymptotic behaviour.
|
| 755 |
+
Of course, numerically one does not have all
|
| 756 |
+
orders with which to establish this Borel transformation, rather only a finite number
|
| 757 |
+
of coefficients an for n < N say. Here the Borel-Pad´e method can be employed: we
|
| 758 |
+
compute BN[ 8κ
|
| 759 |
+
π
|
| 760 |
+
e
|
| 761 |
+
ρ
|
| 762 |
+
2] = �N
|
| 763 |
+
n=0
|
| 764 |
+
an
|
| 765 |
+
n! ζn = P (ζ)
|
| 766 |
+
Q(ζ) + O(ζ)N+1 in which P and Q are polynomials
|
| 767 |
+
in ζ of degree N/2. This results in a picture in which an accumulation of poles (i.e.
|
| 768 |
+
zeros of Q) is indicative of a branch point. We perform this numerically for various
|
| 769 |
+
values of κ and generically we find evidence of branch points at ζ = ±2 whose location
|
| 770 |
+
is independent of κ except that for κ ∈ Z>0 the pole in the positive axis is removed -
|
| 771 |
+
see Figure 1. Pole/ branch points in the negative real axis of the Borel plane indicate
|
| 772 |
+
contributions to an of alternating sign whereas the contributions to an that result in
|
| 773 |
+
poles on the positive axis would have the same sign. Here the analysis indicates that we
|
| 774 |
+
have both. With 38 perturbative coefficients this analysis should only be regarded as
|
| 775 |
+
indicative but is sufficient to inform an educated guess as to the asymptotic behaviour
|
| 776 |
+
of the an which we will robustly verify below.
|
| 777 |
+
Motivated by the Borel-Pad´e analysis we assume the coefficients grow, to leading
|
| 778 |
+
approximation, as
|
| 779 |
+
an ≈ A+Γ(n + 1)/Sn + A−Γ(n + 1)/(−S)n + O(n−1) .
|
| 780 |
+
(42)
|
| 781 |
+
A first verification is to establish the factor S which can be done noting that
|
| 782 |
+
g+,n :=
|
| 783 |
+
a2n
|
| 784 |
+
2n(2n − 1)a2n−2
|
| 785 |
+
≈ 1
|
| 786 |
+
S2 ,
|
| 787 |
+
g−,n :=
|
| 788 |
+
a2n+1
|
| 789 |
+
2n(2n − 1)a2n−1
|
| 790 |
+
≈ 1
|
| 791 |
+
S2 .
|
| 792 |
+
(43)
|
| 793 |
+
10
|
| 794 |
+
|
| 795 |
+
4
|
| 796 |
+
2
|
| 797 |
+
-2
|
| 798 |
+
2
|
| 799 |
+
4
|
| 800 |
+
.4
|
| 801 |
+
-24
|
| 802 |
+
2
|
| 803 |
+
-2
|
| 804 |
+
2
|
| 805 |
+
4
|
| 806 |
+
4
|
| 807 |
+
.24
|
| 808 |
+
2
|
| 809 |
+
-2
|
| 810 |
+
2
|
| 811 |
+
4
|
| 812 |
+
.4
|
| 813 |
+
-2Figure 2: The series g+,n (left) and g−,n (right) given by eq. (43) displayed for κ = 0.6.
|
| 814 |
+
Circle markers indicate the raw data, square markers the second Richardson transform-
|
| 815 |
+
ation with accelerated convergence. The final values of the second Richardson transform
|
| 816 |
+
differ by 0.11% and 0.05% respectively from the expected value 1
|
| 817 |
+
4.
|
| 818 |
+
We find, see Figure 2, that the series g±,n converge to 1
|
| 819 |
+
4, independent of κ thus estab-
|
| 820 |
+
lishing S = 2 in accordance with the expectation from the Borel-Pad´e analysis.
|
| 821 |
+
Having established the factorially growing character of the perturbative series, we
|
| 822 |
+
now propose a more refined ansatz for the an. Our central claim can be summarised
|
| 823 |
+
by stating that the perturbative series has coefficients that have a leading large order
|
| 824 |
+
behaviour as
|
| 825 |
+
an ≈ A+
|
| 826 |
+
2n
|
| 827 |
+
∞
|
| 828 |
+
�
|
| 829 |
+
l=0
|
| 830 |
+
β+
|
| 831 |
+
l Γ(n + a+ − l) +
|
| 832 |
+
A−
|
| 833 |
+
(−2)n
|
| 834 |
+
∞
|
| 835 |
+
�
|
| 836 |
+
l=0
|
| 837 |
+
β−
|
| 838 |
+
l Γ(n + a− − l) ,
|
| 839 |
+
(44)
|
| 840 |
+
where we normalise β±
|
| 841 |
+
0 = 1 and the first few coefficients are
|
| 842 |
+
a± = ∓2κ ,
|
| 843 |
+
A± = 8±1
|
| 844 |
+
π
|
| 845 |
+
sin(∓κ)Γ(±κ)
|
| 846 |
+
Γ(∓κ) = −
|
| 847 |
+
8±1
|
| 848 |
+
Γ(∓κ)Γ(1 ∓ κ) ,
|
| 849 |
+
β−
|
| 850 |
+
1 = −β−
|
| 851 |
+
2 = −4κ .
|
| 852 |
+
(45)
|
| 853 |
+
To support these claims, we shall define the auxiliary series
|
| 854 |
+
cn =
|
| 855 |
+
2n
|
| 856 |
+
Γ(n + 1)an ,
|
| 857 |
+
(46)
|
| 858 |
+
to take care of the leading factorial and geometric growth. We project to the alternating
|
| 859 |
+
and non-alternating parts of the series by considering
|
| 860 |
+
f ±
|
| 861 |
+
k = c2k ± c2k−1 ,
|
| 862 |
+
(47)
|
| 863 |
+
which have asymptotics
|
| 864 |
+
f ±
|
| 865 |
+
n = 2A±(2n)a±−1�
|
| 866 |
+
1 + O
|
| 867 |
+
� 1
|
| 868 |
+
n
|
| 869 |
+
��
|
| 870 |
+
,
|
| 871 |
+
(48)
|
| 872 |
+
such that the sequences
|
| 873 |
+
σ±
|
| 874 |
+
n = 1 + n log f ±
|
| 875 |
+
n+1
|
| 876 |
+
f ±
|
| 877 |
+
n
|
| 878 |
+
,
|
| 879 |
+
(49)
|
| 880 |
+
converge to a±. With a± determined one can then directly consider the asymptotics of
|
| 881 |
+
f ± to establish A±. Figure 3 illustrates the convergence of this procedure for a fixed
|
| 882 |
+
11
|
| 883 |
+
|
| 884 |
+
+.n
|
| 885 |
+
0.30r
|
| 886 |
+
0.28
|
| 887 |
+
O
|
| 888 |
+
0.26
|
| 889 |
+
boo
|
| 890 |
+
0.24
|
| 891 |
+
0.22
|
| 892 |
+
0.20
|
| 893 |
+
5
|
| 894 |
+
10
|
| 895 |
+
15
|
| 896 |
+
0
|
| 897 |
+
20g-,n
|
| 898 |
+
0.30r
|
| 899 |
+
0.28
|
| 900 |
+
0.26
|
| 901 |
+
0000000
|
| 902 |
+
口
|
| 903 |
+
0.24
|
| 904 |
+
口
|
| 905 |
+
0.22
|
| 906 |
+
口
|
| 907 |
+
0.20
|
| 908 |
+
5
|
| 909 |
+
10
|
| 910 |
+
15
|
| 911 |
+
0Figure 3: The series σ−
|
| 912 |
+
n (left) converges to a− using (49). Using eq. (48) we display
|
| 913 |
+
(right) the sequence that converges to A−. Circle markers indicate the raw data, square
|
| 914 |
+
markers the second Richardson transformation. For both, we display results for κ = 0.9.
|
| 915 |
+
The second Richardson transform converge to the expected results given by eq (45) up
|
| 916 |
+
to errors of 0.011% and 0.00068% respectively.
|
| 917 |
+
Figure 4: The second Richardson transformation of the sequences (49) (left) and (48)
|
| 918 |
+
(right) to determine a± and A± as functions of κ. a+, A+ are indicated by red crosses
|
| 919 |
+
and a−, A+ by blue points with solid lines showing the analytic formula of eq. (45).
|
| 920 |
+
value of κ, and Figure 4 establishes the functional form of these coefficients for various
|
| 921 |
+
values of κ.
|
| 922 |
+
A methodological subtlety is that, from empirical observation, the contributions from
|
| 923 |
+
the alternating sector, i.e.
|
| 924 |
+
A− (and associated subleading terms), are dominant for
|
| 925 |
+
κ > 0 over those of the non-alternating A+ sector. Thus to extract the non-alternating
|
| 926 |
+
contributions we first establish the leading alternating contribution as described above
|
| 927 |
+
and then repeat the process working instead with a new series in which the leading
|
| 928 |
+
alternating contribution has been subtracted. However, when κ becomes sufficiently
|
| 929 |
+
large, the sub-leading alternating contribution becomes comparable to that of the leading
|
| 930 |
+
non-alternating contribution. This limits the reliability of determination numerically of
|
| 931 |
+
the A+, a+ coefficients to small values of κ. However, these coefficients can be more
|
| 932 |
+
readily verified by continuing to the κ < 0 regime where they are more dominant.
|
| 933 |
+
Having determined in this fashion the leading contributions to an, these can then be
|
| 934 |
+
subtracted from the data, the analysis repeated mutatis mutandis, to determine the sub-
|
| 935 |
+
leading βk coefficients (and again for similar reasons to the above the β−
|
| 936 |
+
k coefficients are
|
| 937 |
+
more readily extracted). Figure 5 gives the numerical form of β−
|
| 938 |
+
1 and β−
|
| 939 |
+
2 as a function
|
| 940 |
+
of κ indicating a linear relationship.
|
| 941 |
+
It becomes somewhat challenging to extract further subleading contributions from
|
| 942 |
+
the data available. However, one can consider defining a new series, ˜an, comprised by
|
| 943 |
+
taking the data set and subtracting the already established asymptotic form of eq. (45).
|
| 944 |
+
12
|
| 945 |
+
|
| 946 |
+
n
|
| 947 |
+
2.00
|
| 948 |
+
1.95
|
| 949 |
+
1.90
|
| 950 |
+
O
|
| 951 |
+
1.85
|
| 952 |
+
1.80
|
| 953 |
+
666660
|
| 954 |
+
口
|
| 955 |
+
1.75
|
| 956 |
+
口
|
| 957 |
+
口
|
| 958 |
+
1.70
|
| 959 |
+
1.65
|
| 960 |
+
1.60
|
| 961 |
+
0
|
| 962 |
+
5
|
| 963 |
+
10
|
| 964 |
+
15A.
|
| 965 |
+
-0.08r
|
| 966 |
+
-0.10
|
| 967 |
+
-0.12
|
| 968 |
+
-0.14
|
| 969 |
+
-0.16
|
| 970 |
+
5
|
| 971 |
+
10
|
| 972 |
+
15
|
| 973 |
+
20
|
| 974 |
+
0a at
|
| 975 |
+
4
|
| 976 |
+
2
|
| 977 |
+
K
|
| 978 |
+
.3
|
| 979 |
+
-2
|
| 980 |
+
2
|
| 981 |
+
3
|
| 982 |
+
-264A- A+
|
| 983 |
+
-2
|
| 984 |
+
2
|
| 985 |
+
-6
|
| 986 |
+
8Figure 5: The sub-leading coefficient β−
|
| 987 |
+
1 (left) and β−
|
| 988 |
+
2 (right) for various values of κ.
|
| 989 |
+
Shown is the terminal value of the second Richardson Transformation of the sequence
|
| 990 |
+
that gives β−
|
| 991 |
+
n constructed from fn after subtraction of leading alternating and non-
|
| 992 |
+
alternating asymptotics.
|
| 993 |
+
Grey lines correspond to β−
|
| 994 |
+
1
|
| 995 |
+
= −4κ and β−
|
| 996 |
+
2
|
| 997 |
+
= +4κ.
|
| 998 |
+
A
|
| 999 |
+
noticeable drift in β−
|
| 1000 |
+
2 for larger values of κ suggests pollution from further sub-dominant
|
| 1001 |
+
terms contributing at this order of perturbation theory.
|
| 1002 |
+
Figure 6: After subtracting the leading alternating and non-alternating contributions,
|
| 1003 |
+
we again perform a Borel-Pad´e computation for κ = −0.75 (left) and κ = 0.4 (right).
|
| 1004 |
+
This seems to suggest that there is no longer a Borel singularity at ζ = 2, but instead
|
| 1005 |
+
finding one at ζ = 4.
|
| 1006 |
+
Using the Borel-Pad´e again to this subtracted series produces some evidence, see Figure
|
| 1007 |
+
6, of a compelling feature. Instead of poles at ζ = ±2, as would be anticipated should
|
| 1008 |
+
the ansatz (44), one finds that leading positive pole appears to be at ζ = +4. The
|
| 1009 |
+
interpretation here is that the subtraction has removed the entire non-alternating terms
|
| 1010 |
+
with behaviour 2−n, suggesting that all fluctuations β+
|
| 1011 |
+
n>0 = 0 and the next contribution
|
| 1012 |
+
comes with twice the “action” 4−n.
|
| 1013 |
+
This behaviour is in accordance with the Parisi-’t Hooft conjecture [63–65]; the
|
| 1014 |
+
leading poles in the Borel plane at ζ = ±2 lie at integer values and the values of
|
| 1015 |
+
a± = ∓2κ = ±2ξ are as expected (see [15]).9
|
| 1016 |
+
The pole at ζ = +2 is accordingly
|
| 1017 |
+
interpreted as an IR renormalon.
|
| 1018 |
+
A similar procedure of subtraction (removing the
|
| 1019 |
+
IR renormalon) used above (in Figure 6) was performed in [26] to expose new Borel
|
| 1020 |
+
renormalon poles that were not in accordance with Parisi-’t Hooft in cases including e.g.
|
| 1021 |
+
the Gross-Neveu model. Here however, Figure 6 indicates that the next most proximate
|
| 1022 |
+
IR renormalon pole is found in a location that are consistent with Parisi-’t Hooft.
|
| 1023 |
+
9We thank M Mari˜no and T Reis for illuminating us on this point.
|
| 1024 |
+
13
|
| 1025 |
+
|
| 1026 |
+
β1-
|
| 1027 |
+
K
|
| 1028 |
+
0.5
|
| 1029 |
+
1.0
|
| 1030 |
+
1.5
|
| 1031 |
+
2.0
|
| 1032 |
+
2.5
|
| 1033 |
+
3.0
|
| 1034 |
+
-2
|
| 1035 |
+
-4
|
| 1036 |
+
-6
|
| 1037 |
+
-8
|
| 1038 |
+
-10
|
| 1039 |
+
.12β2
|
| 1040 |
+
12
|
| 1041 |
+
10
|
| 1042 |
+
8
|
| 1043 |
+
6
|
| 1044 |
+
4
|
| 1045 |
+
2
|
| 1046 |
+
0.5
|
| 1047 |
+
1.0
|
| 1048 |
+
1.5
|
| 1049 |
+
2.0
|
| 1050 |
+
2.5
|
| 1051 |
+
3.02
|
| 1052 |
+
.2
|
| 1053 |
+
2
|
| 1054 |
+
6
|
| 1055 |
+
22
|
| 1056 |
+
2
|
| 1057 |
+
65
|
| 1058 |
+
Transseries and Ambiguity Cancellation
|
| 1059 |
+
In this section we compute the leading ambiguity of
|
| 1060 |
+
e
|
| 1061 |
+
ρ2 in two different ways. First,
|
| 1062 |
+
we calculate the Borel ambiguity of the large order behaviour of the perturbative sector
|
| 1063 |
+
established in 4. This is compared against an approach which solves the TBA system
|
| 1064 |
+
in terms of a transseries.
|
| 1065 |
+
5.1
|
| 1066 |
+
Borel resummation and Large Order Perturbative Ambigu-
|
| 1067 |
+
ity
|
| 1068 |
+
Naively, one could try to resum the original asymptotic series by performing a Laplace
|
| 1069 |
+
transform on the Borel transform (41)
|
| 1070 |
+
1
|
| 1071 |
+
γ
|
| 1072 |
+
� ∞
|
| 1073 |
+
0
|
| 1074 |
+
B
|
| 1075 |
+
�8κ
|
| 1076 |
+
π
|
| 1077 |
+
e
|
| 1078 |
+
ρ2
|
| 1079 |
+
�
|
| 1080 |
+
e−ζ/γdζ = 1
|
| 1081 |
+
γ
|
| 1082 |
+
� ∞
|
| 1083 |
+
0
|
| 1084 |
+
∞
|
| 1085 |
+
�
|
| 1086 |
+
n=0
|
| 1087 |
+
an
|
| 1088 |
+
n! ζne−ζ/γ ≃
|
| 1089 |
+
∞
|
| 1090 |
+
�
|
| 1091 |
+
n=0
|
| 1092 |
+
anγn = 8κ
|
| 1093 |
+
π
|
| 1094 |
+
e
|
| 1095 |
+
ρ2 .
|
| 1096 |
+
(50)
|
| 1097 |
+
However, as we have seen, the Borel transform B
|
| 1098 |
+
�
|
| 1099 |
+
8κ
|
| 1100 |
+
π
|
| 1101 |
+
e
|
| 1102 |
+
ρ2
|
| 1103 |
+
�
|
| 1104 |
+
generically has singularities
|
| 1105 |
+
along the positive real axis obstructing the contour of this integral. Therefore, we shall
|
| 1106 |
+
introduce a directional Borel resummation given by
|
| 1107 |
+
Sθ
|
| 1108 |
+
�8κ
|
| 1109 |
+
π
|
| 1110 |
+
e
|
| 1111 |
+
ρ2
|
| 1112 |
+
�
|
| 1113 |
+
= 1
|
| 1114 |
+
γ
|
| 1115 |
+
� eiθ∞
|
| 1116 |
+
0
|
| 1117 |
+
B
|
| 1118 |
+
�8κ
|
| 1119 |
+
π
|
| 1120 |
+
e
|
| 1121 |
+
ρ2
|
| 1122 |
+
�
|
| 1123 |
+
e−ζ/γdζ .
|
| 1124 |
+
(51)
|
| 1125 |
+
This procedure results, when integrating along a line without singularities, in a finite
|
| 1126 |
+
answer, which however, depends on the sign of θ, i.e.
|
| 1127 |
+
there is an ambiguity in the
|
| 1128 |
+
resummation of the perturbative series. This ambiguity, which is a Stokes phenomenon,
|
| 1129 |
+
is studied by considering S+ϵ − S−ϵ. This can be done analytically by using, instead of
|
| 1130 |
+
the numerically obtained results, a series whose coefficients are exactly the asymptotic
|
| 1131 |
+
form an given by eq. (44) for all values of n:
|
| 1132 |
+
(S+ϵ − S−ϵ)
|
| 1133 |
+
�8κ
|
| 1134 |
+
π
|
| 1135 |
+
e
|
| 1136 |
+
ρ2
|
| 1137 |
+
�
|
| 1138 |
+
(γ) = 2πiA+
|
| 1139 |
+
� 2
|
| 1140 |
+
γ
|
| 1141 |
+
�a+
|
| 1142 |
+
e−2/γ
|
| 1143 |
+
∞
|
| 1144 |
+
�
|
| 1145 |
+
k=0
|
| 1146 |
+
β+
|
| 1147 |
+
k
|
| 1148 |
+
�γ
|
| 1149 |
+
2
|
| 1150 |
+
�k
|
| 1151 |
+
= −
|
| 1152 |
+
16πi
|
| 1153 |
+
Γ(−κ)Γ(1 − κ)
|
| 1154 |
+
�γ
|
| 1155 |
+
2
|
| 1156 |
+
�2κ
|
| 1157 |
+
e−2/γ[1 + O(γ)] .
|
| 1158 |
+
(52)
|
| 1159 |
+
Similarly, across the negative real axis we find a leading ambiguity given by
|
| 1160 |
+
(Sπ+ϵ − Sπ−ϵ)
|
| 1161 |
+
�8κ
|
| 1162 |
+
π
|
| 1163 |
+
e
|
| 1164 |
+
ρ2
|
| 1165 |
+
�
|
| 1166 |
+
(γ) = 2πiA−
|
| 1167 |
+
�
|
| 1168 |
+
− 2
|
| 1169 |
+
γ
|
| 1170 |
+
�a−
|
| 1171 |
+
e2/γ
|
| 1172 |
+
∞
|
| 1173 |
+
�
|
| 1174 |
+
k=0
|
| 1175 |
+
β−
|
| 1176 |
+
k
|
| 1177 |
+
�
|
| 1178 |
+
− z
|
| 1179 |
+
2
|
| 1180 |
+
�k
|
| 1181 |
+
= −
|
| 1182 |
+
πi
|
| 1183 |
+
4Γ(κ)Γ(1 + κ)
|
| 1184 |
+
�
|
| 1185 |
+
−γ
|
| 1186 |
+
2
|
| 1187 |
+
�−2κ
|
| 1188 |
+
e2/γ[1 + O(γ)] .
|
| 1189 |
+
(53)
|
| 1190 |
+
In these expressions we note the presence of an exponentially small parameter, √qγ =
|
| 1191 |
+
�
|
| 1192 |
+
2
|
| 1193 |
+
γ
|
| 1194 |
+
�2κ
|
| 1195 |
+
e−2/κ (the square root is for convenience later) characteristic of non-perturbative
|
| 1196 |
+
physics. The main thrust of the modern resurgence paradigm is that physical quantities,
|
| 1197 |
+
here e/ρ2, should be understood as a transseries, i.e. an expansion in √qγ whose terms
|
| 1198 |
+
are each formal (asymptotic) series in γ. It is critical that whilst resummation may
|
| 1199 |
+
be ambiguous when applied to any individual term in this (here the perturbative √qγ0
|
| 1200 |
+
sector), taken altogether the final result is non-ambiguous. In particular, and this goes
|
| 1201 |
+
back to the pioneering work of Bogomol’nyi and Zinn-Justin [66–69], the ambiguity
|
| 1202 |
+
of this perturbative sector should be compensated by a leading order ambiguity in an
|
| 1203 |
+
appropriate non-perturbative sector. In the next section we shall verify that such an
|
| 1204 |
+
ambiguity cancellation does take place.
|
| 1205 |
+
14
|
| 1206 |
+
|
| 1207 |
+
5.2
|
| 1208 |
+
Transseries and Leading Non-Perturbative Ambiguity
|
| 1209 |
+
In this series we shall apply a different type of analysis to the TBA equations which
|
| 1210 |
+
results in a transseries solution. The starting point shall be a reformulation of the TBA
|
| 1211 |
+
system as an integral equation for an auxiliary function u(ω),
|
| 1212 |
+
u(ω) = i
|
| 1213 |
+
ω +
|
| 1214 |
+
1
|
| 1215 |
+
2πi
|
| 1216 |
+
� ∞
|
| 1217 |
+
−∞
|
| 1218 |
+
dω′ e2iBω′ϱ(ω′)u(ω′)
|
| 1219 |
+
ω′ + ω + iδ
|
| 1220 |
+
,
|
| 1221 |
+
(54)
|
| 1222 |
+
where
|
| 1223 |
+
ϱ(ω) = 1 − iω
|
| 1224 |
+
1 + iω
|
| 1225 |
+
G−(ω)
|
| 1226 |
+
G+(ω) ,
|
| 1227 |
+
(55)
|
| 1228 |
+
together with the boundary condition
|
| 1229 |
+
u(i) = m
|
| 1230 |
+
2heB G+(i)
|
| 1231 |
+
G+(0) .
|
| 1232 |
+
(56)
|
| 1233 |
+
Having established the function u, the free energy is given by
|
| 1234 |
+
∆F(h) = − 1
|
| 1235 |
+
2π h2u(i)G−(0)2
|
| 1236 |
+
�
|
| 1237 |
+
1 −
|
| 1238 |
+
1
|
| 1239 |
+
2πi
|
| 1240 |
+
� ∞
|
| 1241 |
+
−∞
|
| 1242 |
+
dω e2iωBu(ω)ϱ(ω)
|
| 1243 |
+
ω − i
|
| 1244 |
+
�
|
| 1245 |
+
.
|
| 1246 |
+
(57)
|
| 1247 |
+
We will now apply to the λ-model the techniques pioneered by [26] to solve this re-
|
| 1248 |
+
cursively order by order in a perturbative parameter and a non-perturbative parameter.
|
| 1249 |
+
The idea is to move the integration contour of the integral equation (54) into the UHP
|
| 1250 |
+
so that it envelops all the branch cuts and poles in the UHP. The Sine-Gordon model is
|
| 1251 |
+
special as it only has poles but no branch cut. This was studied in [70] and gives rise to
|
| 1252 |
+
a convergent rather than asymptotic expansion. However, in the case of the λ-deformed
|
| 1253 |
+
model, we are dealing with both poles and a branch cut along the imagine axis of ρ(ω).
|
| 1254 |
+
To separate it from the poles, we slightly move the cut away from the imaginary axis
|
| 1255 |
+
to the ray C± = {ξeiθ|θ = π
|
| 1256 |
+
2 ± δ}. By deforming the integration contour we isolate the
|
| 1257 |
+
contributions coming from the discontinuity over the cut and the residues at the poles
|
| 1258 |
+
(see Figure 7). As explained in [26] the choice of moving the branch cut to C+ or C− is
|
| 1259 |
+
arbitrary and and gives rise to a leading non-perturbative ambiguity. Letting ϱn,± be
|
| 1260 |
+
the residues at x = xn with the cut moved to C±, after this contour pulling eq. (54)
|
| 1261 |
+
becomes
|
| 1262 |
+
u(ix) = 1
|
| 1263 |
+
x +
|
| 1264 |
+
1
|
| 1265 |
+
2πi
|
| 1266 |
+
� ∞e±iϵ
|
| 1267 |
+
0
|
| 1268 |
+
dx′ e−2Bx′u(ix′)δϱ(ix′)
|
| 1269 |
+
x′ + x
|
| 1270 |
+
+
|
| 1271 |
+
�
|
| 1272 |
+
n
|
| 1273 |
+
e−2Bxnunϱn,±
|
| 1274 |
+
xn + x
|
| 1275 |
+
,
|
| 1276 |
+
(58)
|
| 1277 |
+
where un ≡ u(ixn) and δϱ is the discontinuity over the cut10.
|
| 1278 |
+
From the WH-decomposition (17), we evaluate ϱ(ω) using (55) as
|
| 1279 |
+
ϱ(ω) = −ω + i
|
| 1280 |
+
ω − i
|
| 1281 |
+
Γ
|
| 1282 |
+
� iω
|
| 1283 |
+
2 + 1
|
| 1284 |
+
�2 Γ(1 − iω)Γ(1 − iκω)
|
| 1285 |
+
Γ
|
| 1286 |
+
�
|
| 1287 |
+
1 − iω
|
| 1288 |
+
2
|
| 1289 |
+
�2 Γ(iω + 1)Γ(iκω + 1)
|
| 1290 |
+
e−2ibωeiκω(log(iω)+log(−iω)) .
|
| 1291 |
+
(59)
|
| 1292 |
+
For generic values of κ, this has poles on the positive real axis at ω = ixn = iµn with
|
| 1293 |
+
µ = 2 with residues given by
|
| 1294 |
+
ϱn,± =
|
| 1295 |
+
Res
|
| 1296 |
+
x=xn±iϵ ϱ(ix) = −2ie2n(2b±iπκ−2κ log(2n))n2n + 1
|
| 1297 |
+
2n − 1
|
| 1298 |
+
((2n)!)2
|
| 1299 |
+
(n!)4
|
| 1300 |
+
Γ(1 + 2nκ)
|
| 1301 |
+
Γ(1 − 2nκ) .
|
| 1302 |
+
(60)
|
| 1303 |
+
However, when κ is rational some of these poles are removed.
|
| 1304 |
+
Suppose we express
|
| 1305 |
+
κ ≡
|
| 1306 |
+
k
|
| 1307 |
+
N = p/q as a reduced fraction with p, q coprime integers (i.e. q = N/gcd(N, k)),
|
| 1308 |
+
10For the discontinuity function, we use the convention δρ(ω) = ρ(ω(1 − iϵ) − ρ(ω(1 + iϵ)).
|
| 1309 |
+
15
|
| 1310 |
+
|
| 1311 |
+
ω
|
| 1312 |
+
C−
|
| 1313 |
+
C
|
| 1314 |
+
ϱ−
|
| 1315 |
+
1
|
| 1316 |
+
ϱ−
|
| 1317 |
+
2
|
| 1318 |
+
ϱ−
|
| 1319 |
+
3
|
| 1320 |
+
ω
|
| 1321 |
+
C+
|
| 1322 |
+
C
|
| 1323 |
+
ϱ+
|
| 1324 |
+
1
|
| 1325 |
+
ϱ+
|
| 1326 |
+
2
|
| 1327 |
+
ϱ+
|
| 1328 |
+
3
|
| 1329 |
+
Figure 7: The contour C = (−∞, ∞) is deformed into either of two ways. The branch
|
| 1330 |
+
cut, represented by the curvy line is moved to either the ray C+ or C−. In those cases
|
| 1331 |
+
respectively, the contour is deformed into C+ or C−. In both cases we pick up residues
|
| 1332 |
+
ϱ±
|
| 1333 |
+
n , but their values differ by the branch cut discontinuity.
|
| 1334 |
+
then the set of poles are located at x ∈ 2N\qN (rather than x ∈ 2N). Hence, the residue
|
| 1335 |
+
ϱn,± evaluates to zero if 2n ∈ 2N ∩ qN, i.e. 2n is a multiple of q. In particular, when
|
| 1336 |
+
k is an integer multiple of a half, i.e. q = 1 or q = 2, all poles are removed entirely.
|
| 1337 |
+
If ϱ1 = 0, then ϱn = 0 for all n; in what follows we shall consider only the case where
|
| 1338 |
+
ϱ1 ̸= 0 which is most relevant to our discussion.
|
| 1339 |
+
The discontinuity function is given by
|
| 1340 |
+
δϱ(ix) = 2ix + 1
|
| 1341 |
+
x − 1e2bxe−2κx log x sin(κπx)Γ(1 − x/2)2Γ(1 + x)Γ(1 + κx)
|
| 1342 |
+
Γ(1 + x/2)2Γ(1 − x)Γ(1 − κx) .
|
| 1343 |
+
(61)
|
| 1344 |
+
Notice this has simple poles at x = 2n, which have residues that vanish for κ half-integer.
|
| 1345 |
+
Lastly we shall need11
|
| 1346 |
+
ϱ(i ± 0) = 8e2b∓iπκ Γ(1 + κ)
|
| 1347 |
+
Γ(1 − κ) = 8
|
| 1348 |
+
πκe2b∓iπκΓ(1 + κ)2 sin(πκ) .
|
| 1349 |
+
(62)
|
| 1350 |
+
Following again [26], the integral equation (58) is simplified by the introduction of
|
| 1351 |
+
P(η, v) given by
|
| 1352 |
+
e−2Bxδϱ(ix) = −2ive−ηP(η, v) ,
|
| 1353 |
+
(63)
|
| 1354 |
+
with a change of variables (x, B) → (η, v):
|
| 1355 |
+
1
|
| 1356 |
+
v + a log v = 2B ,
|
| 1357 |
+
x = vη .
|
| 1358 |
+
(64)
|
| 1359 |
+
Here, a is a constant determined by demanding that P(η, v) is regular in v with, in
|
| 1360 |
+
particular, no log(v) terms. From eq. (61), we have that δϱ(ix) ∝ e˜ax log x � dnxn,
|
| 1361 |
+
where ˜a = −2κ, therefore this determines ˜a = a. This yields an expansion of P(η, v)
|
| 1362 |
+
given by
|
| 1363 |
+
P(η, v) = d1,0η + vη2(d2,0 + d2,1 log(η)) + O(v2) ,
|
| 1364 |
+
d1,0 = πκ ,
|
| 1365 |
+
d2,0 = 2πκ(1 + (1 − γE − log(κ))κ − log(2)) ,
|
| 1366 |
+
d2,1 = −2πκ2 .
|
| 1367 |
+
(65)
|
| 1368 |
+
With the introduction of an integral operator
|
| 1369 |
+
I[f](η) = − v
|
| 1370 |
+
π
|
| 1371 |
+
� ∞
|
| 1372 |
+
0
|
| 1373 |
+
dη′ e−η′P(η′, v)f(η′)
|
| 1374 |
+
η + η′
|
| 1375 |
+
,
|
| 1376 |
+
(66)
|
| 1377 |
+
11Because we are assuming that κ is not integer, ϱ(i±0) is non-zero. If κ < 0, then ϱ(i±0) generically
|
| 1378 |
+
has a finite ambiguity.
|
| 1379 |
+
16
|
| 1380 |
+
|
| 1381 |
+
after this change of variables, eq. (58) can be written as
|
| 1382 |
+
u(η) = u(η) + I[u](η) ,
|
| 1383 |
+
(67)
|
| 1384 |
+
in which the ‘seed’ solution is given as
|
| 1385 |
+
u(η) = 1
|
| 1386 |
+
vη + 1
|
| 1387 |
+
v
|
| 1388 |
+
�
|
| 1389 |
+
n
|
| 1390 |
+
e−2Bvηnunϱn,±
|
| 1391 |
+
ηn + η
|
| 1392 |
+
.
|
| 1393 |
+
(68)
|
| 1394 |
+
The formal solution obtained by iteration is thus presented as
|
| 1395 |
+
u(η) =
|
| 1396 |
+
∞
|
| 1397 |
+
�
|
| 1398 |
+
l=0
|
| 1399 |
+
Il[u](η) ≡ J [u](η) .
|
| 1400 |
+
(69)
|
| 1401 |
+
To determine the unknown coefficients un = u(ηn) we evaluate eq.(67) at η = ηn =
|
| 1402 |
+
µn/v and define In[f] ≡ I[f](η = ηn) to obtain
|
| 1403 |
+
un = 1
|
| 1404 |
+
µn + In[u] + 1
|
| 1405 |
+
µ
|
| 1406 |
+
�
|
| 1407 |
+
m
|
| 1408 |
+
e−2Bvηnumϱm,±
|
| 1409 |
+
m + n
|
| 1410 |
+
.
|
| 1411 |
+
(70)
|
| 1412 |
+
Here we have made a slight adaptation compared to [26] to suit the locations of the poles
|
| 1413 |
+
at xn = µn (with µ = 2) (cf. the Gross-Neveu model for which xn = 2n+1
|
| 1414 |
+
Υ
|
| 1415 |
+
for some
|
| 1416 |
+
constant Υ). To treat the exponentially small contributions coming from the residue
|
| 1417 |
+
term we introduce the small parameter
|
| 1418 |
+
q = e−2Bµ = e−µ/vv−µa .
|
| 1419 |
+
(71)
|
| 1420 |
+
Both the seed and formal solution, and the unkown values un, admit expansion in q
|
| 1421 |
+
u(η) =
|
| 1422 |
+
�
|
| 1423 |
+
s=1
|
| 1424 |
+
u(s)(η)qs ,
|
| 1425 |
+
u(η) =
|
| 1426 |
+
�
|
| 1427 |
+
u(s)(η)qs ,
|
| 1428 |
+
un =
|
| 1429 |
+
�
|
| 1430 |
+
s=0
|
| 1431 |
+
u(s)
|
| 1432 |
+
n qs .
|
| 1433 |
+
(72)
|
| 1434 |
+
As the operator J does not introduce factors of q we can construct the full solution
|
| 1435 |
+
order by order in q noting u(s)(η) = J [u(s)](η). Using (68) one finds that the first few
|
| 1436 |
+
terms12 of the seed solution are given by
|
| 1437 |
+
u(0) = 1
|
| 1438 |
+
vη ,
|
| 1439 |
+
u(1) = ϱ1,±u(0)
|
| 1440 |
+
1
|
| 1441 |
+
vη + µ ,
|
| 1442 |
+
u(2) = ϱ1,±u(1)
|
| 1443 |
+
1
|
| 1444 |
+
vη + µ + ϱ2,±u(0)
|
| 1445 |
+
2
|
| 1446 |
+
vη + 2µ .
|
| 1447 |
+
(74)
|
| 1448 |
+
Applying the q-expansion to eq. (70) we have that
|
| 1449 |
+
u(0)
|
| 1450 |
+
n
|
| 1451 |
+
= J [u(0)](ηn) = 1
|
| 1452 |
+
µn + In[J [ 1
|
| 1453 |
+
vη ]] ,
|
| 1454 |
+
u(1)
|
| 1455 |
+
n
|
| 1456 |
+
= In[J [u(1)]] + 1
|
| 1457 |
+
µ
|
| 1458 |
+
ϱ1,±u(0)
|
| 1459 |
+
1
|
| 1460 |
+
1 + n
|
| 1461 |
+
.
|
| 1462 |
+
(75)
|
| 1463 |
+
Let us assume that ϱ1,± ̸= 0 (i.e. κ is not half-integer), such that these two expressions
|
| 1464 |
+
are governing the leading behaviour. Suppose now we work formally13 to leading order
|
| 1465 |
+
12For n ≥ 1, we have in general
|
| 1466 |
+
u(n)(η) =
|
| 1467 |
+
n
|
| 1468 |
+
�
|
| 1469 |
+
m=1
|
| 1470 |
+
ϱm,±u(n−m)
|
| 1471 |
+
m
|
| 1472 |
+
vη + µm
|
| 1473 |
+
.
|
| 1474 |
+
(73)
|
| 1475 |
+
13i.e. ignoring that q is exponentially smaller than higher order polynomial terms in v.
|
| 1476 |
+
17
|
| 1477 |
+
|
| 1478 |
+
in v and leading order in q . Because each application of I carries a factor v, to leading
|
| 1479 |
+
order it is sufficient to consider only the identity operator J = 1+. . . which results in14
|
| 1480 |
+
u(0)
|
| 1481 |
+
n
|
| 1482 |
+
= 1
|
| 1483 |
+
µn −
|
| 1484 |
+
v
|
| 1485 |
+
nπµd1,0 + O(v2) ,
|
| 1486 |
+
u(1)
|
| 1487 |
+
n
|
| 1488 |
+
=
|
| 1489 |
+
ϱ1,±
|
| 1490 |
+
µ2(n + 1) −
|
| 1491 |
+
d1,0ϱ1,±
|
| 1492 |
+
µ2π(n + 1)v + O(v2) .
|
| 1493 |
+
(76)
|
| 1494 |
+
The leading orders of u(η) are obtained by
|
| 1495 |
+
u(η) =
|
| 1496 |
+
�
|
| 1497 |
+
u(0) + I[u(0)] + O(v)
|
| 1498 |
+
�
|
| 1499 |
+
+ q
|
| 1500 |
+
�
|
| 1501 |
+
u(1) + I[u(1)] + O(v2)
|
| 1502 |
+
�
|
| 1503 |
+
+ O(q2) .
|
| 1504 |
+
(77)
|
| 1505 |
+
To implement the boundary condition that relates the chemical potential h to q, v,
|
| 1506 |
+
we will need
|
| 1507 |
+
u(i) = u
|
| 1508 |
+
�
|
| 1509 |
+
η = 1
|
| 1510 |
+
v
|
| 1511 |
+
�
|
| 1512 |
+
=
|
| 1513 |
+
�
|
| 1514 |
+
1 − d1,0
|
| 1515 |
+
π v + O(v2)
|
| 1516 |
+
�
|
| 1517 |
+
+
|
| 1518 |
+
qϱ1,±
|
| 1519 |
+
µ(1 + µ)
|
| 1520 |
+
�
|
| 1521 |
+
1 − d1,0v
|
| 1522 |
+
π
|
| 1523 |
+
+ O(v2)
|
| 1524 |
+
�
|
| 1525 |
+
+ O(q2) .
|
| 1526 |
+
(78)
|
| 1527 |
+
The next step is to do the Legendre transform and calculate
|
| 1528 |
+
e
|
| 1529 |
+
ρ2 from ∆F. This can
|
| 1530 |
+
then be used to compare against the perturbative calculation. The same procedure of
|
| 1531 |
+
resolving the cut away from the poles of ρ and deforming the contour appropriately
|
| 1532 |
+
yields
|
| 1533 |
+
∆F(h) = − h2
|
| 1534 |
+
2π u(i)G+(0)2
|
| 1535 |
+
�
|
| 1536 |
+
1 + v2
|
| 1537 |
+
π
|
| 1538 |
+
� e−ηP(η, v)u(η)
|
| 1539 |
+
ηv − 1
|
| 1540 |
+
dη
|
| 1541 |
+
− e−2Bϱ(i ± ϵ)u(i) −
|
| 1542 |
+
�
|
| 1543 |
+
n≥1
|
| 1544 |
+
qnϱn,±un
|
| 1545 |
+
µn − 1
|
| 1546 |
+
�
|
| 1547 |
+
.
|
| 1548 |
+
(79)
|
| 1549 |
+
The leading orders of eq. (79) are given by
|
| 1550 |
+
∆F(h) = − G+(0)2h
|
| 1551 |
+
2π
|
| 1552 |
+
�
|
| 1553 |
+
1 − 2d10
|
| 1554 |
+
π v + O(v2)
|
| 1555 |
+
�
|
| 1556 |
+
×
|
| 1557 |
+
�
|
| 1558 |
+
1 − ρ(i ± ϵ)q1/µ +
|
| 1559 |
+
2ρ1,±
|
| 1560 |
+
µ(1 − µ2)q − 2ρ1,±ρ(i ± ϵ)
|
| 1561 |
+
µ(1 + µ)
|
| 1562 |
+
q1+1/µ + O(q2)
|
| 1563 |
+
�
|
| 1564 |
+
.
|
| 1565 |
+
(80)
|
| 1566 |
+
The first step of the Legendre transform is to relate h to the parameters q and v. This
|
| 1567 |
+
is done by substituting the expansion (78) for u(i) into the boundary condition (56)
|
| 1568 |
+
which, for µ = 2, gives
|
| 1569 |
+
h =
|
| 1570 |
+
mG+(i)
|
| 1571 |
+
12πG+(0)q−1/4�
|
| 1572 |
+
π + d1,0v + O(v2)
|
| 1573 |
+
��
|
| 1574 |
+
6 − ρ1,±q + O(q2)
|
| 1575 |
+
�
|
| 1576 |
+
.
|
| 1577 |
+
(81)
|
| 1578 |
+
As a consequence ρ = − d∆F
|
| 1579 |
+
dh
|
| 1580 |
+
is given by
|
| 1581 |
+
ρ = G+(i)G+(0)m
|
| 1582 |
+
12π2
|
| 1583 |
+
�
|
| 1584 |
+
π − d1,0v + O(v2)
|
| 1585 |
+
��
|
| 1586 |
+
6q−1/4 + ρ1,±q3/4 + O(q7/4)
|
| 1587 |
+
�
|
| 1588 |
+
,
|
| 1589 |
+
(82)
|
| 1590 |
+
from which we obtain
|
| 1591 |
+
e
|
| 1592 |
+
ρ2 as a series in v and q:
|
| 1593 |
+
e
|
| 1594 |
+
ρ2 =
|
| 1595 |
+
1
|
| 1596 |
+
6G+(0)2
|
| 1597 |
+
�
|
| 1598 |
+
π + 2d1,0v + O(v2)
|
| 1599 |
+
��
|
| 1600 |
+
3 + 3ρ(i + ±ϵ)q1/2 + ρ1,±q + O(q3/2)
|
| 1601 |
+
�
|
| 1602 |
+
.
|
| 1603 |
+
(83)
|
| 1604 |
+
14The small v limit can be taken also in the integral:
|
| 1605 |
+
I
|
| 1606 |
+
� 1
|
| 1607 |
+
vη
|
| 1608 |
+
�
|
| 1609 |
+
(ηn) = − v
|
| 1610 |
+
π
|
| 1611 |
+
� ∞
|
| 1612 |
+
0
|
| 1613 |
+
eη′d1,0η
|
| 1614 |
+
vη′ + nµ = − v
|
| 1615 |
+
π
|
| 1616 |
+
� ∞
|
| 1617 |
+
0
|
| 1618 |
+
�
|
| 1619 |
+
eη′d1,0
|
| 1620 |
+
nµ
|
| 1621 |
+
+ O(v)
|
| 1622 |
+
�
|
| 1623 |
+
= − vd1,0
|
| 1624 |
+
nπµ + O(v2) .
|
| 1625 |
+
18
|
| 1626 |
+
|
| 1627 |
+
We will now write this expansion in terms of the coupling (38) used in the previous
|
| 1628 |
+
Sections. Let us introduce a parameter exponentially small in γ, analogous to q being
|
| 1629 |
+
exponentially small in v, given by qγ = e−4/γ(γ/2)4κ. We use (38) to write v as a series
|
| 1630 |
+
in γ and qγ. Substituting this series for v (and q = q(v)) into (83), we arrive at
|
| 1631 |
+
8κ
|
| 1632 |
+
π
|
| 1633 |
+
e
|
| 1634 |
+
ρ2 =
|
| 1635 |
+
�
|
| 1636 |
+
1 + κγ + O(γ2)
|
| 1637 |
+
�
|
| 1638 |
+
− 8e∓iπκ Γ(κ)
|
| 1639 |
+
Γ(−κ)q1/2
|
| 1640 |
+
γ
|
| 1641 |
+
(1 + O(γ))
|
| 1642 |
+
+ 23−4κe∓2iπκ Γ(2κ)
|
| 1643 |
+
Γ(−2κ)qγ(1 + O(γ)) .
|
| 1644 |
+
(84)
|
| 1645 |
+
We see that the first two coefficient of the perturbative series match precisely with eq.
|
| 1646 |
+
(40). The presence of transseries parameters qγ = e−4/γ(γ/2)4κ provides concrete pre-
|
| 1647 |
+
dictions of the resurgent structure of the perturbative series. In particular, we compute
|
| 1648 |
+
the ambiguity of the transseries (84) due to the difference in result if the branch cut is
|
| 1649 |
+
left or right of the poles. To leading order in qγ and γ, it is given by
|
| 1650 |
+
8κ
|
| 1651 |
+
π
|
| 1652 |
+
�� e
|
| 1653 |
+
ρ2
|
| 1654 |
+
�
|
| 1655 |
+
−
|
| 1656 |
+
−
|
| 1657 |
+
� e
|
| 1658 |
+
ρ2
|
| 1659 |
+
�
|
| 1660 |
+
+
|
| 1661 |
+
�
|
| 1662 |
+
=
|
| 1663 |
+
16πi
|
| 1664 |
+
Γ(−κ)Γ(1 − κ)
|
| 1665 |
+
�γ
|
| 1666 |
+
2
|
| 1667 |
+
�2κ
|
| 1668 |
+
e−2/γ .
|
| 1669 |
+
(85)
|
| 1670 |
+
This is exactly the same ambiguity as obtained through the asymptotic analysis of our
|
| 1671 |
+
perturbative calculation - see eq. (52). We thus observe that the Borel-ambiguity of
|
| 1672 |
+
the perturbative series can be cancelled precisely by an ambiguity of a transmonomial.
|
| 1673 |
+
Therefore, the large order non-perturbative behaviour is unambiguous up to the order
|
| 1674 |
+
considered. This mirrors the fabled BZJJ ambiguity cancellation [66–69] in a field theory
|
| 1675 |
+
context.
|
| 1676 |
+
The analysis above only finds a source of the leading ambiguity on the positive
|
| 1677 |
+
real axis of the Borel plane. However, we can do a similar analysis to recover the Borel
|
| 1678 |
+
branch singularity on the negative real axis. The critical modification of the programme,
|
| 1679 |
+
as realised by [15], is to deform the contour of the integral equation (54) into the lower
|
| 1680 |
+
half plane, instead of the upper half plan. The critical analytic data is then given by the
|
| 1681 |
+
branch cut and residues at the negative imaginary axis. In the lower half plane, ϱ(−ix)
|
| 1682 |
+
has residues at xn = 2n + 1 and at ˜xn := n
|
| 1683 |
+
κ. However, as the latter set of residues is
|
| 1684 |
+
unambiguous with respect to the branch cut, they do not contribute15. One subtlety
|
| 1685 |
+
when using this approach arises when computing u(i). Deforming the contour of eq.
|
| 1686 |
+
(54) to an envelopment of the negative imaginary axis picks up a residue at ω = −i,
|
| 1687 |
+
which introduces a contribution of u(−i)ρ(−i ± ϵ)q not present in the analysis above.
|
| 1688 |
+
We will not present a detailed derivation as it is similar to the one above. Rather, we
|
| 1689 |
+
can report that the final result is a transseries with a leading ambiguity given by
|
| 1690 |
+
8κ
|
| 1691 |
+
π
|
| 1692 |
+
�� e
|
| 1693 |
+
ρ2
|
| 1694 |
+
�
|
| 1695 |
+
−
|
| 1696 |
+
−
|
| 1697 |
+
� e
|
| 1698 |
+
ρ2
|
| 1699 |
+
�
|
| 1700 |
+
+
|
| 1701 |
+
�
|
| 1702 |
+
= −
|
| 1703 |
+
πi
|
| 1704 |
+
4Γ(κ)Γ(1 + κ)
|
| 1705 |
+
�
|
| 1706 |
+
−γ
|
| 1707 |
+
2
|
| 1708 |
+
�−2κ
|
| 1709 |
+
e2/γ .
|
| 1710 |
+
(86)
|
| 1711 |
+
This precisely matches the ambiguity of the perturbative sector around the negative real
|
| 1712 |
+
axis found in eq. (53).
|
| 1713 |
+
6
|
| 1714 |
+
Discussion
|
| 1715 |
+
In this note, we have studied the λ-model and brought it into the fold of resurgent
|
| 1716 |
+
analysis of [13–15, 26]. The model is particularly interesting, because, distinct from
|
| 1717 |
+
previously considered models, it has a interacting CFT fixed point in the UV.
|
| 1718 |
+
15They would be part of a transseries solution, but as they are unambiguous, they are not of interest
|
| 1719 |
+
to us currently. As a further side remark, when choosing κ < 0, along the positive imaginary axis ϱ(ix)
|
| 1720 |
+
also has such unambiguous residues at x = n
|
| 1721 |
+
κ .
|
| 1722 |
+
19
|
| 1723 |
+
|
| 1724 |
+
We have found a perturbative series for the energy density at finite chemical poten-
|
| 1725 |
+
tial of the λ-model in Section 3.4 and identified with numerical techniques its asymp-
|
| 1726 |
+
totic form in Section 4.
|
| 1727 |
+
A key feature is that the Borel resummation of the large
|
| 1728 |
+
order behaviour is ambiguous when taken along either the positive or negative real axis.
|
| 1729 |
+
These ambiguities are exactly compensated/cancelled by a further ambiguity in a non-
|
| 1730 |
+
perturbative sector of a transseries solution in Section 5. These cancellations provide the
|
| 1731 |
+
λ-model with a robustly defined foundation which may serve as a paradigmatic example
|
| 1732 |
+
for other theories with asymptotic CFT behaviour.
|
| 1733 |
+
Of particular note is that the leading ambiguity on the positive axis (and associated
|
| 1734 |
+
features in the Borel plane) vanishes for κ ∈ Z>0, i.e. when the WZW level k divides
|
| 1735 |
+
the rank N of the gauge group SU(N). This is reminiscent of Cheshire-cat resurgence
|
| 1736 |
+
[71–74] in which the full glory of resurgence only becomes apparent as you deform away
|
| 1737 |
+
from certain special points at which it truncates.
|
| 1738 |
+
Let us finish with some broader questions to ponder following the analysis of the
|
| 1739 |
+
λ-model that we hope might stimulate further investigations on the topic:
|
| 1740 |
+
• An interesting feature of the WZW CFT that defines the UV of the λ model is
|
| 1741 |
+
that it exhibits level-rank duality [75]. It would be valuable to understand the
|
| 1742 |
+
extent to which this property constrains, or is encapsulated, in the form of the
|
| 1743 |
+
transseries that defines the λ-model.
|
| 1744 |
+
• In a QFT it is sometimes possible to directly link poles/branch points in the
|
| 1745 |
+
Borel plane to finite action non-pertubative saddle configurations. Remarkably,
|
| 1746 |
+
this can be done even in theories without instantons. In a series of paper [9, 11,
|
| 1747 |
+
12] finite action ‘uniton’ configurations of 1+1d integrable QFTs were matched
|
| 1748 |
+
to Borel poles of a quantum mechanics that followed by dimensional reduction
|
| 1749 |
+
with twisted boundary conditions (akin to a chemical potential as deployed here).
|
| 1750 |
+
This poses a natural question: can the features of the Borel plane we have found
|
| 1751 |
+
here via TBA methods be related to some finite action saddles? Conversely, given
|
| 1752 |
+
the knowledge of such uniton configurations, what do they imply for the TBA
|
| 1753 |
+
method? Achieving this would serve to put the semi-classical approaches of [9, 11,
|
| 1754 |
+
12] on a surer-footing in quantum field theory.
|
| 1755 |
+
• On the other hand there are a class of ambiguities which don’t (yet at least) have an
|
| 1756 |
+
interpretation as semi-classical saddles. Instead they are renormalon ambiguities
|
| 1757 |
+
associated to certain classes of Feynman diagrams. In [18, 76] it was shown how
|
| 1758 |
+
to construct such a series of diagrams which source the renormalon ambiguities in
|
| 1759 |
+
1/N expansion of the O(N) vector model, the Gross-Neveu and the SU(N) PCM.
|
| 1760 |
+
It would be interesting to investigate if there are diagrams that are responsible for
|
| 1761 |
+
the ambiguities in the λ-models.
|
| 1762 |
+
• The landscape of integrable models in two dimensions has been vastly expanded
|
| 1763 |
+
in recent years through variants of this λ-model, and the related Yang-Baxter σ-
|
| 1764 |
+
models. It could be rewarding to deploy similar technique across this landscape
|
| 1765 |
+
included e.g. to models with multiple deformation parameters or theories based
|
| 1766 |
+
on cosets rather than group manifolds.
|
| 1767 |
+
• In [57] the Quantum Inverse Scattering Method was applied to give a direct quant-
|
| 1768 |
+
isation of the λ-models as a continuum limit of a spin k Heisenberg spin-chain with
|
| 1769 |
+
inhomogeneities. The parameter that governs the in-homogeneity becomes a mass.
|
| 1770 |
+
Although the ground state of the system is quite a complicated Fermi sea, one can
|
| 1771 |
+
identify holes as certain particle excitations. After taking the continuum limit,
|
| 1772 |
+
one can obtain a TBA system for these excitations matching that of the QFT.
|
| 1773 |
+
An exciting question is if the above resurgent structure can be given a similar ab
|
| 1774 |
+
initio derivation within the QISM framework.
|
| 1775 |
+
20
|
| 1776 |
+
|
| 1777 |
+
Acknowledgements
|
| 1778 |
+
DCT is supported by The Royal Society through a University Research FellowshipGen-
|
| 1779 |
+
eralised Dualities in String Theory and Holography URF 150185 and in part by STFC
|
| 1780 |
+
grant ST/P00055X/1 as well as by the FWO-Vlaanderen through the project G006119N
|
| 1781 |
+
and Vrije Universiteit Brussel through the Strategic Research Program “High-Energy
|
| 1782 |
+
Physics”. LS is supported by a PhD studentship from The Royal Society and the grant
|
| 1783 |
+
RF\ERE\210269. For the purpose of open access, the authors have applied a Creative
|
| 1784 |
+
Commons Attribution (CC BY) licence to any Author Accepted Manuscript version
|
| 1785 |
+
arising. We thank M Mari˜no and T Reis for helpful comments on a draft and I Aniceto
|
| 1786 |
+
for comments relating to this project.
|
| 1787 |
+
References
|
| 1788 |
+
[1]
|
| 1789 |
+
Al B Zamolodchikov. ‘Exact two-particle S-matrix of quantum sine-Gordon solitons’.
|
| 1790 |
+
Communications in Mathematical Physics 55.2 (1977), pp. 183–186.
|
| 1791 |
+
[2]
|
| 1792 |
+
Peter Hasenfratz, Michele Maggiore and Ferenc Niedermayer. ‘The exact mass gap
|
| 1793 |
+
of the O(3) and O(4) non-linear σ-models in d = 2’. Physics Letters B 245.3-4
|
| 1794 |
+
(1990), pp. 522–528.
|
| 1795 |
+
[3]
|
| 1796 |
+
Peter Hasenfratz and Ferenc Niedermayer. ‘The exact mass gap of the O(N) σ-
|
| 1797 |
+
model for arbitrary N ≥ 3 in d = 2’. Physics Letters B 245.3-4 (1990), pp. 529–
|
| 1798 |
+
532.
|
| 1799 |
+
[4]
|
| 1800 |
+
P. Forgacs, F. Niedermayer and P. Weisz. ‘The Exact mass gap of the Gross-Neveu
|
| 1801 |
+
model. 1. The Thermodynamic Bethe ansatz’. Nucl. Phys. B 367 (1991), pp. 123–
|
| 1802 |
+
143. doi: 10.1016/0550-3213(91)90044-X.
|
| 1803 |
+
[5]
|
| 1804 |
+
P. Forgacs, F. Niedermayer and P. Weisz. ‘The Exact mass gap of the Gross-
|
| 1805 |
+
Neveu model. 2. The 1/N expansion’. Nucl. Phys. B 367 (1991), pp. 144–157. doi:
|
| 1806 |
+
10.1016/0550-3213(91)90045-Y.
|
| 1807 |
+
[6]
|
| 1808 |
+
Inˆes Aniceto, Gok¸ce Ba¸sar and Ricardo Schiappa. ‘A Primer on Resurgent Trans-
|
| 1809 |
+
series and Their Asymptotics’. Phys. Rept. 809 (2019), pp. 1–135. doi: 10.1016/
|
| 1810 |
+
j.physrep.2019.02.003. arXiv: 1802.10441 [hep-th].
|
| 1811 |
+
[7]
|
| 1812 |
+
Gerald V Dunne and Mithat ¨Unsal. ‘Resurgence and trans-series in Quantum Field
|
| 1813 |
+
Theory: the CPN−1 model’. JHEP 11 (2012), p. 170. doi: 10.1007/JHEP11(2012)
|
| 1814 |
+
170. arXiv: 1210.2423 [hep-th].
|
| 1815 |
+
[8]
|
| 1816 |
+
Aleksey Cherman, Daniele Dorigoni, Gerald V. Dunne and Mithat ¨Unsal. ‘Resur-
|
| 1817 |
+
gence in Quantum Field Theory: Nonperturbative Effects in the Principal Chiral
|
| 1818 |
+
Model’. Phys. Rev. Lett. 112 (2014), p. 021601. doi: 10.1103/PhysRevLett.112.
|
| 1819 |
+
021601. arXiv: 1308.0127 [hep-th].
|
| 1820 |
+
[9]
|
| 1821 |
+
Aleksey Cherman, Daniele Dorigoni and Mithat Unsal. ‘Decoding perturbation
|
| 1822 |
+
theory using resurgence: Stokes phenomena, new saddle points and Lefschetz
|
| 1823 |
+
thimbles’. JHEP 10 (2015), p. 056. doi: 10 . 1007 / JHEP10(2015 ) 056. arXiv:
|
| 1824 |
+
1403.1277 [hep-th].
|
| 1825 |
+
[10]
|
| 1826 |
+
Gerald V. Dunne and Mithat Unsal. ‘Resurgence and Dynamics of O(N) and
|
| 1827 |
+
Grassmannian Sigma Models’. JHEP 09 (2015), p. 199. doi: 10.1007/JHEP09(2015)
|
| 1828 |
+
199. arXiv: 1505.07803 [hep-th].
|
| 1829 |
+
[11]
|
| 1830 |
+
Saskia Demulder, Daniele Dorigoni and Daniel C. Thompson. ‘Resurgence in η-
|
| 1831 |
+
deformed Principal Chiral Models’. JHEP 07 (2016), p. 088. doi: 10 . 1007 /
|
| 1832 |
+
JHEP07(2016)088. arXiv: 1604.07851 [hep-th].
|
| 1833 |
+
21
|
| 1834 |
+
|
| 1835 |
+
[12]
|
| 1836 |
+
Lucas Schepers and Daniel C. Thompson. ‘Resurgence in the bi-Yang-Baxter
|
| 1837 |
+
model’. Nucl. Phys. B 964 (2021), p. 115308. doi: 10.1016/j.nuclphysb.2021.
|
| 1838 |
+
115308. arXiv: 2007.03683 [hep-th].
|
| 1839 |
+
[13]
|
| 1840 |
+
Dmytro Volin. ‘From the mass gap in O(N) to the non-Borel-summability in
|
| 1841 |
+
O(3) and O(4) sigma-models’. Phys. Rev. D 81 (2010), p. 105008. doi: 10.1103/
|
| 1842 |
+
PhysRevD.81.105008. arXiv: 0904.2744 [hep-th].
|
| 1843 |
+
[14]
|
| 1844 |
+
Dmytro Volin. ‘Quantum integrability and functional equations: Applications to
|
| 1845 |
+
the spectral problem of AdS/CFT and two-dimensional sigma models’. Journal of
|
| 1846 |
+
Physics A: Mathematical and Theoretical 44.12 (2011), p. 124003. arXiv: 1003.
|
| 1847 |
+
4725 [hep-th].
|
| 1848 |
+
[15]
|
| 1849 |
+
Marcos Mari˜no and Tom´as Reis. ‘Renormalons in integrable field theories’. JHEP
|
| 1850 |
+
04 (2020), p. 160. doi: 10.1007/JHEP04(2020)160. arXiv: 1909.12134 [hep-th].
|
| 1851 |
+
[16]
|
| 1852 |
+
Marcos Mari˜no and Tom´as Reis. ‘Resurgence for superconductors’ (May 2019).
|
| 1853 |
+
doi: 10.1088/1742-5468/ab4802. arXiv: 1905.09569 [hep-th].
|
| 1854 |
+
[17]
|
| 1855 |
+
Marcos Mari˜no and Tom´as Reis. ‘A new renormalon in two dimensions’. JHEP 07
|
| 1856 |
+
(2020), p. 216. doi: 10.1007/JHEP07(2020)216. arXiv: 1912.06228 [hep-th].
|
| 1857 |
+
[18]
|
| 1858 |
+
Marcos Marino, Ramon Miravitllas and Tomas Reis. ‘Testing the Bethe ansatz
|
| 1859 |
+
with large N renormalons’. Eur. Phys. J. ST 230.12-13 (2021), pp. 2641–2666.
|
| 1860 |
+
doi: 10.1140/epjs/s11734-021-00252-4. arXiv: 2102.03078 [hep-th].
|
| 1861 |
+
[19]
|
| 1862 |
+
Zoltan Bajnok, Janos Balog, Arpad Hegedus and Istvan Vona. ‘Instanton effects
|
| 1863 |
+
vs resurgence in the O(3) sigma model’. Phys. Lett. B 829 (2022), p. 137073. doi:
|
| 1864 |
+
10.1016/j.physletb.2022.137073. arXiv: 2112.11741 [hep-th].
|
| 1865 |
+
[20]
|
| 1866 |
+
Zoltan Bajnok and Romuald A. Janik. ‘OPE coefficients and the mass-gap from
|
| 1867 |
+
the integrable scattering description of 2D CFT’s’. JHEP 11 (2022), p. 128. doi:
|
| 1868 |
+
10.1007/JHEP11(2022)128. arXiv: 2209.10393 [hep-th].
|
| 1869 |
+
[21]
|
| 1870 |
+
Zoltan Bajnok, Janos Balog, Arpad Hegedus and Istvan Vona. ‘Running coupling
|
| 1871 |
+
and non-perturbative corrections for O(N) free energy and for disk capacitor’.
|
| 1872 |
+
JHEP 09 (2022), p. 001. doi: 10.1007/JHEP09(2022)001. arXiv: 2204.13365
|
| 1873 |
+
[hep-th].
|
| 1874 |
+
[22]
|
| 1875 |
+
Zolt´an Bajnok, J´anos Balog and Istv´an Vona. ‘Analytic resurgence in the O(4)
|
| 1876 |
+
model’. JHEP 04 (2022), p. 043. doi: 10.1007/JHEP04(2022)043. arXiv: 2111.
|
| 1877 |
+
15390 [hep-th].
|
| 1878 |
+
[23]
|
| 1879 |
+
Michael C. Abbott, Zolt´an Bajnok, J´anos Balog, ´Arp´ad Heged´us and Saeedeh
|
| 1880 |
+
Sadeghian. ‘Resurgence in the O(4) sigma model’. JHEP 05 (2021), p. 253. doi:
|
| 1881 |
+
10.1007/JHEP05(2021)253. arXiv: 2011.12254 [hep-th].
|
| 1882 |
+
[24]
|
| 1883 |
+
Michael C. Abbott, Zolt´an Bajnok, J´anos Balog and ´Arp´ad Heged´us. ‘From per-
|
| 1884 |
+
turbative to non-perturbative in the O (4) sigma model’. Phys. Lett. B 818 (2021),
|
| 1885 |
+
p. 136369. doi: 10.1016/j.physletb.2021.136369. arXiv: 2011.09897 [hep-th].
|
| 1886 |
+
[25]
|
| 1887 |
+
Zoltan Bajnok, Janos Balog and Istvan Vona. ‘The full analytic trans-series in
|
| 1888 |
+
integrable field theories’ (Dec. 2022). arXiv: 2212.09416 [hep-th].
|
| 1889 |
+
[26]
|
| 1890 |
+
Marcos Marino, Ramon Miravitllas and Tomas Reis. ‘New renormalons from ana-
|
| 1891 |
+
lytic trans-series’ (Nov. 2021). arXiv: 2111.11951 [hep-th].
|
| 1892 |
+
[27]
|
| 1893 |
+
Konstadinos Sfetsos. ‘Integrable interpolations: From exact CFTs to non-Abelian
|
| 1894 |
+
T-duals’. Nucl. Phys. B 880 (2014), pp. 225–246. doi: 10.1016/j.nuclphysb.
|
| 1895 |
+
2014.01.004. arXiv: 1312.4560 [hep-th].
|
| 1896 |
+
22
|
| 1897 |
+
|
| 1898 |
+
[28]
|
| 1899 |
+
Konstadinos Sfetsos and Konstadinos Siampos. ‘Gauged WZW-type theories and
|
| 1900 |
+
the all-loop anisotropic non-Abelian Thirring model’. Nucl. Phys. B 885 (2014),
|
| 1901 |
+
pp. 583–599. doi: 10.1016/j.nuclphysb.2014.06.012. arXiv: 1405.7803
|
| 1902 |
+
[hep-th].
|
| 1903 |
+
[29]
|
| 1904 |
+
Jonathan M. Evans and Timothy J. Hollowood. ‘Integrable theories that are
|
| 1905 |
+
asymptotically CFT’. Nucl. Phys. B 438 (1995), pp. 469–490. doi: 10.1016/0550-
|
| 1906 |
+
3213(94)00473-R. arXiv: hep-th/9407113.
|
| 1907 |
+
[30]
|
| 1908 |
+
Jonathan M. Evans and Timothy J. Hollowood. ‘Exact results for integrable
|
| 1909 |
+
asymptotically - free field theories’. Nucl. Phys. B Proc. Suppl. 45.1 (1996). Ed. by
|
| 1910 |
+
G. Mussardo, S. Randjbar-Daemi and H. Saleur, pp. 130–139. doi: 10.1016/0920-
|
| 1911 |
+
5632(95)00622-2. arXiv: hep-th/9508141.
|
| 1912 |
+
[31]
|
| 1913 |
+
Calan Appadu, Timothy J. Hollowood and Dafydd Price. ‘Quantum Inverse Scat-
|
| 1914 |
+
tering and the Lambda Deformed Principal Chiral Model’. J. Phys. A 50.30 (2017),
|
| 1915 |
+
p. 305401. doi: 10.1088/1751-8121/aa7958. arXiv: 1703.06699 [hep-th].
|
| 1916 |
+
[32]
|
| 1917 |
+
Edward Witten. ‘Non-abelian bosonization in two dimensions’. Bosonization. World
|
| 1918 |
+
Scientific, 1994, pp. 201–218.
|
| 1919 |
+
[33]
|
| 1920 |
+
J. Balog, P. Forgacs, Z. Horvath and L. Palla. ‘A New family of SU(2) symmetric
|
| 1921 |
+
integrable sigma models’. Phys. Lett. B 324 (1994). Ed. by D. Lust and G. Weigt,
|
| 1922 |
+
pp. 403–408. doi: 10.1016/0370-2693(94)90213-5. arXiv: hep-th/9307030.
|
| 1923 |
+
[34]
|
| 1924 |
+
Konstadinos Sfetsos. ‘Gauged WZW models and nonAbelian duality’. Phys. Rev.
|
| 1925 |
+
D 50 (1994), pp. 2784–2798. doi: 10.1103/PhysRevD.50.2784. arXiv: hep-
|
| 1926 |
+
th/9402031.
|
| 1927 |
+
[35]
|
| 1928 |
+
Daniel C. Thompson. ‘An Introduction to Generalised Dualities and their Applic-
|
| 1929 |
+
ations to Holography and Integrability’. PoS CORFU2018 (2019). Ed. by Kon-
|
| 1930 |
+
stantinos Anagnostopoulos et al., p. 099. doi: 10.22323/1.347.0099. arXiv:
|
| 1931 |
+
1904.11561 [hep-th].
|
| 1932 |
+
[36]
|
| 1933 |
+
Ben Hoare. ‘Integrable deformations of sigma models’. J. Phys. A 55.9 (2022),
|
| 1934 |
+
p. 093001. doi: 10.1088/1751-8121/ac4a1e. arXiv: 2109.14284 [hep-th].
|
| 1935 |
+
[37]
|
| 1936 |
+
Timothy J. Hollowood, J. Luis Miramontes and David M. Schmidtt. ‘Integrable
|
| 1937 |
+
Deformations of Strings on Symmetric Spaces’. JHEP 11 (2014), p. 009. doi:
|
| 1938 |
+
10.1007/JHEP11(2014)009. arXiv: 1407.2840 [hep-th].
|
| 1939 |
+
[38]
|
| 1940 |
+
Timothy J. Hollowood, J.Luis Miramontes and David M. Schmidtt. ‘An Integrable
|
| 1941 |
+
Deformation of the AdS5 × S5 Superstring’. J. Phys. A 47.49 (2014), p. 495402.
|
| 1942 |
+
doi: 10.1088/1751-8113/47/49/495402. arXiv: 1409.1538 [hep-th].
|
| 1943 |
+
[39]
|
| 1944 |
+
Konstantinos Sfetsos and Daniel C. Thompson. ‘Spacetimes for λ-deformations’.
|
| 1945 |
+
JHEP 12 (2014), p. 164. doi: 10.1007/JHEP12(2014)164. arXiv: 1410.1886
|
| 1946 |
+
[hep-th].
|
| 1947 |
+
[40]
|
| 1948 |
+
Saskia Demulder, Konstantinos Sfetsos and Daniel C. Thompson. ‘Integrable λ-
|
| 1949 |
+
deformations: Squashing Coset CFTs and AdS5 × S5’. JHEP 07 (2015), p. 019.
|
| 1950 |
+
doi: 10.1007/JHEP07(2015)019. arXiv: 1504.02781 [hep-th].
|
| 1951 |
+
[41]
|
| 1952 |
+
Riccardo Borsato and Linus Wulff. ‘Target space supergeometry of η and λ-
|
| 1953 |
+
deformed strings’. JHEP 10 (2016), p. 045. doi: 10.1007/JHEP10(2016)045.
|
| 1954 |
+
arXiv: 1608.03570 [hep-th].
|
| 1955 |
+
[42]
|
| 1956 |
+
Arkady A. Tseytlin. ‘On A ’Universal’ class of WZW type conformal models’.
|
| 1957 |
+
Nucl. Phys. B 418 (1994), pp. 173–194. doi: 10.1016/0550-3213(94)90243-7.
|
| 1958 |
+
arXiv: hep-th/9311062.
|
| 1959 |
+
23
|
| 1960 |
+
|
| 1961 |
+
[43]
|
| 1962 |
+
Calan Appadu and Timothy J. Hollowood. ‘Beta function of k deformed AdS5
|
| 1963 |
+
× S5 string theory’. JHEP 11 (2015), p. 095. doi: 10.1007/JHEP11(2015)095.
|
| 1964 |
+
arXiv: 1507.05420 [hep-th].
|
| 1965 |
+
[44]
|
| 1966 |
+
Ctirad Klimˇc´ık. ‘Poisson–Lie T-duals of the bi-Yang–Baxter models’. Phys. Lett.
|
| 1967 |
+
B 760 (2016), pp. 345–349. doi: 10.1016/j.physletb.2016.06.077. arXiv:
|
| 1968 |
+
1606.03016 [hep-th].
|
| 1969 |
+
[45]
|
| 1970 |
+
B. Hoare and A. A. Tseytlin. ‘On integrable deformations of superstring sigma
|
| 1971 |
+
models related to AdSn ×Sn supercosets’. Nucl. Phys. B 897 (2015), pp. 448–478.
|
| 1972 |
+
doi: 10.1016/j.nuclphysb.2015.06.001. arXiv: 1504.07213 [hep-th].
|
| 1973 |
+
[46]
|
| 1974 |
+
Konstantinos Sfetsos, Konstantinos Siampos and Daniel C. Thompson. ‘Gener-
|
| 1975 |
+
alised integrable λ - and η-deformations and their relation’. Nucl. Phys. B 899
|
| 1976 |
+
(2015), pp. 489–512. doi: 10.1016/j.nuclphysb.2015.08.015. arXiv: 1506.
|
| 1977 |
+
05784 [hep-th].
|
| 1978 |
+
[47]
|
| 1979 |
+
Benoit Vicedo. ‘Deformed integrable σ-models, classical R-matrices and classical
|
| 1980 |
+
exchange algebra on Drinfel’d doubles’. J. Phys. A 48.35 (2015), p. 355203. doi:
|
| 1981 |
+
10.1088/1751-8113/48/35/355203. arXiv: 1504.06303 [hep-th].
|
| 1982 |
+
[48]
|
| 1983 |
+
Ctirad Klimˇc´ık. ‘η and λ deformations as E -models’. Nucl. Phys. B 900 (2015),
|
| 1984 |
+
pp. 259–272. doi: 10.1016/j.nuclphysb.2015.09.011. arXiv: 1508.05832
|
| 1985 |
+
[hep-th].
|
| 1986 |
+
[49]
|
| 1987 |
+
T. H. Buscher. ‘Path Integral Derivation of Quantum Duality in Nonlinear Sigma
|
| 1988 |
+
Models’. Phys. Lett. B 201 (1988), pp. 466–472. doi: 10.1016/0370-2693(88)
|
| 1989 |
+
90602-8.
|
| 1990 |
+
[50]
|
| 1991 |
+
K. Gawedzki and A. Kupiainen. ‘G/h Conformal Field Theory from Gauged WZW
|
| 1992 |
+
Model’. Phys. Lett. B 215 (1988), pp. 119–123. doi: 10.1016/0370-2693(88)
|
| 1993 |
+
91081-7.
|
| 1994 |
+
[51]
|
| 1995 |
+
Edward Witten. ‘On Holomorphic factorization of WZW and coset models’. Com-
|
| 1996 |
+
mun. Math. Phys. 144 (1992), pp. 189–212. doi: 10.1007/BF02099196.
|
| 1997 |
+
[52]
|
| 1998 |
+
Timothy J. Hollowood, J. Luis Miramontes and David M. Schmidtt. ‘S-Matrices
|
| 1999 |
+
and Quantum Group Symmetry of k-Deformed Sigma Models’. J. Phys. A 49.46
|
| 2000 |
+
(2016), p. 465201. doi: 10.1088/1751-8113/49/46/465201. arXiv: 1506.06601
|
| 2001 |
+
[hep-th].
|
| 2002 |
+
[53]
|
| 2003 |
+
Georgios Itsios, Konstantinos Sfetsos, Konstantinos Siampos and Alessandro Tor-
|
| 2004 |
+
rielli. ‘The classical Yang–Baxter equation and the associated Yangian symmetry
|
| 2005 |
+
of gauged WZW-type theories’. Nucl. Phys. B 889 (2014), pp. 64–86. doi: 10.
|
| 2006 |
+
1016/j.nuclphysb.2014.10.004. arXiv: 1409.0554 [hep-th].
|
| 2007 |
+
[54]
|
| 2008 |
+
George Georgiou, Konstantinos Sfetsos and Konstantinos Siampos. ‘Strong in-
|
| 2009 |
+
tegrability of λ-deformed models’. Nucl. Phys. B 952 (2020), p. 114923. doi:
|
| 2010 |
+
10.1016/j.nuclphysb.2020.114923. arXiv: 1911.07859 [hep-th].
|
| 2011 |
+
[55]
|
| 2012 |
+
S. F. Hassan and Ashoke Sen. ‘Marginal deformations of WZNW and coset models
|
| 2013 |
+
from O(d,d) transformation’. Nucl. Phys. B 405 (1993), pp. 143–165. doi: 10.
|
| 2014 |
+
1016/0550-3213(93)90429-S. arXiv: hep-th/9210121.
|
| 2015 |
+
[56]
|
| 2016 |
+
C Ahn, D Bernard and A LeClair. ‘Fractional supersymmetries in perturbed coset
|
| 2017 |
+
CFTs and integrable soliton theory’. Nuclear Physics B 346.2-3 (1990), pp. 409–
|
| 2018 |
+
439.
|
| 2019 |
+
[57]
|
| 2020 |
+
Calan Appadu, Timothy J. Hollowood, Dafydd Price and Daniel C. Thompson.
|
| 2021 |
+
‘Quantum Anisotropic Sigma and Lambda Models as Spin Chains’. J. Phys. A
|
| 2022 |
+
51.40 (2018), p. 405401. doi: 10.1088/1751-8121/aadc6d. arXiv: 1802.06016
|
| 2023 |
+
[hep-th].
|
| 2024 |
+
24
|
| 2025 |
+
|
| 2026 |
+
[58]
|
| 2027 |
+
A Polyakov and Paul B Wiegmann. ‘Theory of nonabelian Goldstone bosons in
|
| 2028 |
+
two dimensions’. Physics Letters B 131.1-3 (1983), pp. 121–126.
|
| 2029 |
+
[59]
|
| 2030 |
+
Alexander M Polyakov and PB Wiegmann. ‘Goldstone fields in two dimensions
|
| 2031 |
+
with multivalued actions’. Physics Letters B 141.3-4 (1984), pp. 223–228.
|
| 2032 |
+
[60]
|
| 2033 |
+
PB Wiegmann. ‘Exact solution of the O(3) nonlinear two-dimensional sigma-
|
| 2034 |
+
model’. JETP Letters 41.2 (1985), pp. 95–100.
|
| 2035 |
+
[61]
|
| 2036 |
+
J. Balog, S. Naik, F. Niedermayer and P. Weisz. ‘Exact mass gap of the chiral
|
| 2037 |
+
SU(n) x SU(n) model’. Phys. Rev. Lett. 69 (1992), pp. 873–876. doi: 10.1103/
|
| 2038 |
+
PhysRevLett.69.873.
|
| 2039 |
+
[62]
|
| 2040 |
+
Timothy J. Hollowood. ‘The Exact mass gaps of the principal chiral models’. Phys.
|
| 2041 |
+
Lett. B 329 (1994), pp. 450–456. doi: 10.1016/0370-2693(94)91089-8. arXiv:
|
| 2042 |
+
hep-th/9402084.
|
| 2043 |
+
[63]
|
| 2044 |
+
G. Parisi. ‘On Infrared Divergences’. Nucl. Phys. B 150 (1979), pp. 163–172. doi:
|
| 2045 |
+
10.1016/0550-3213(79)90298-0.
|
| 2046 |
+
[64]
|
| 2047 |
+
G. Parisi. ‘Singularities of the Borel Transform in Renormalizable Theories’. Phys.
|
| 2048 |
+
Lett. B 76 (1978), pp. 65–66. doi: 10.1016/0370-2693(78)90101-6.
|
| 2049 |
+
[65]
|
| 2050 |
+
Gerard ’t Hooft. ‘Can We Make Sense Out of Quantum Chromodynamics?’ Sub-
|
| 2051 |
+
nucl. Ser. 15 (1979). Ed. by Antonino Zichichi, p. 943.
|
| 2052 |
+
[66]
|
| 2053 |
+
EB Bogomolny. ‘Calculation of instanton-anti-instanton contributions in quantum
|
| 2054 |
+
mechanics’. Physics Letters B 91.3-4 (1980), pp. 431–435.
|
| 2055 |
+
[67]
|
| 2056 |
+
J. Zinn-Justin and U.D. Jentschura. ‘Multi-instantons and exact results I: Con-
|
| 2057 |
+
jectures, WKB expansions, and instanton interactions’. Annals Phys. 313 (2004),
|
| 2058 |
+
pp. 197–267. doi: 10.1016/j.aop.2004.04.004. arXiv: quant-ph/0501136.
|
| 2059 |
+
[68]
|
| 2060 |
+
J. Zinn-Justin and U.D. Jentschura. ‘Multi-instantons and exact results II: Specific
|
| 2061 |
+
cases, higher-order effects, and numerical calculations’. Annals Phys. 313 (2004),
|
| 2062 |
+
pp. 269–325. doi: 10.1016/j.aop.2004.04.003. arXiv: quant-ph/0501137.
|
| 2063 |
+
[69]
|
| 2064 |
+
Jean Zinn-Justin. ‘Perturbation Series at Large Orders in Quantum Mechanics
|
| 2065 |
+
and Field Theories: Application to the Problem of Resummation’. Phys. Rept. 70
|
| 2066 |
+
(1981), p. 109. doi: 10.1016/0370-1573(81)90016-8.
|
| 2067 |
+
[70]
|
| 2068 |
+
Alexei B. Zamolodchikov. ‘Mass scale in the sine-Gordon model and its reductions’.
|
| 2069 |
+
Int. J. Mod. Phys. A 10 (1995), pp. 1125–1150. doi: 10.1142/S0217751X9500053X.
|
| 2070 |
+
[71]
|
| 2071 |
+
Daniele Dorigoni and Philip Glass. ‘The grin of Cheshire cat resurgence from
|
| 2072 |
+
supersymmetric localization’. SciPost Physics 4.2 (2018), p. 012.
|
| 2073 |
+
[72]
|
| 2074 |
+
Daniele Dorigoni and Philip Glass. ‘Picard-Lefschetz decomposition and Cheshire
|
| 2075 |
+
Cat resurgence in 3D N = 2 field theories’. Journal of High Energy Physics 2019.12
|
| 2076 |
+
(2019), pp. 1–40.
|
| 2077 |
+
[73]
|
| 2078 |
+
Can Koz¸caz, Tin Sulejmanpasic, Yuya Tanizaki and Mithat ¨Unsal. ‘Cheshire Cat
|
| 2079 |
+
resurgence, Self-resurgence and Quasi-Exact Solvable Systems’. Commun. Math.
|
| 2080 |
+
Phys. 364.3 (2018), pp. 835–878. doi: 10.1007/s00220- 018- 3281- y. arXiv:
|
| 2081 |
+
1609.06198 [hep-th].
|
| 2082 |
+
[74]
|
| 2083 |
+
Syo Kamata, Tatsuhiro Misumi, Naohisa Sueishi and Mithat ¨Unsal. ‘Exact-WKB
|
| 2084 |
+
analysis for SUSY and quantum deformed potentials: Quantum mechanics with
|
| 2085 |
+
Grassmann fields and Wess-Zumino terms’ (Nov. 2021). arXiv: 2111.05922 [hep-th].
|
| 2086 |
+
[75]
|
| 2087 |
+
Stephen G. Naculich and Howard J. Schnitzer. ‘Duality Between SU(N)k and
|
| 2088 |
+
SU(k)N WZW Models’. Nucl. Phys. B 347 (1990), pp. 687–742. doi: 10.1016/
|
| 2089 |
+
0550-3213(90)90380-V.
|
| 2090 |
+
25
|
| 2091 |
+
|
| 2092 |
+
[76]
|
| 2093 |
+
Lorenzo Di Pietro, Marcos Mari˜no, Giacomo Sberveglieri and Marco Serone. ‘Re-
|
| 2094 |
+
surgence and 1/N Expansion in Integrable Field Theories’. JHEP 10 (2021), p. 166.
|
| 2095 |
+
doi: 10.1007/JHEP10(2021)166. arXiv: 2108.02647 [hep-th].
|
| 2096 |
+
26
|
| 2097 |
+
|
D9FKT4oBgHgl3EQfZi4o/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
DdE1T4oBgHgl3EQf-Abs/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:c78210b91bd907702ac2071c284b7dd233aa36bb850ae753ae158d36975ea5f1
|
| 3 |
+
size 167437
|
DdE5T4oBgHgl3EQfUQ9g/content/tmp_files/2301.05542v1.pdf.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
DdE5T4oBgHgl3EQfUQ9g/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
F9E4T4oBgHgl3EQfHQxB/content/2301.04901v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:d25df5f2a017ce78ef7118056a1f5d77188bd45ff6b498708456553465282715
|
| 3 |
+
size 1111783
|
F9E4T4oBgHgl3EQfHQxB/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:e509fa701b1390ac8592bbe2aa7b84964cedacf34dacaf4fe2652d79cdfdef32
|
| 3 |
+
size 185772
|
FtE1T4oBgHgl3EQf-waO/content/tmp_files/2301.03573v1.pdf.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
FtE1T4oBgHgl3EQf-waO/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
GNAzT4oBgHgl3EQfi_3N/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:589220eedb7a6d99990fe7a7cd08d203545b818d8a9d124332c506bb2f9e801c
|
| 3 |
+
size 3932205
|
GdAyT4oBgHgl3EQffPg-/content/tmp_files/2301.00335v1.pdf.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
GdAyT4oBgHgl3EQffPg-/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
GtE0T4oBgHgl3EQfRQCY/content/tmp_files/2301.02205v1.pdf.txt
ADDED
|
@@ -0,0 +1,678 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
arXiv:2301.02205v1 [math.LO] 5 Jan 2023
|
| 2 |
+
The logic with unsharp implication and negation
|
| 3 |
+
Ivan Chajda and Helmut L¨anger
|
| 4 |
+
Abstract
|
| 5 |
+
It is well-known that intuitionistic logics can be formalized by means of Brouwe-
|
| 6 |
+
rian semilattices, i.e. relatively pseudocomplemented semilattices. Then the logical
|
| 7 |
+
connective implication is considered to be the relative pseudocomplement and con-
|
| 8 |
+
junction is the semilattice operation meet.
|
| 9 |
+
If the Brouwerian semilattice has a
|
| 10 |
+
bottom element 0 then the relative pseudocomplement with respect to 0 is called
|
| 11 |
+
the pseudocomplement and it is considered as the connective negation in this logic.
|
| 12 |
+
Our idea is to consider an arbitrary meet-semilattice with 0 satisfying only the
|
| 13 |
+
Ascending Chain Condition, which is trivially satisfied in finite semilattices, and
|
| 14 |
+
introduce the connective negation x0 as the set of all maximal elements z satis-
|
| 15 |
+
fying x ∧ z = 0 and the connective implication x → y as the set of all maximal
|
| 16 |
+
elements z satisfying x∧z ≤ y. Such a negation and implication is “unsharp” since
|
| 17 |
+
it assigns to one entry x or to two entries x and y belonging to the semilattice,
|
| 18 |
+
respectively, a subset instead of an element of the semilattice. Surprisingly, this
|
| 19 |
+
kind of negation and implication, respectively, still shares a number of properties
|
| 20 |
+
of these connectives in intuitionistic logic, in particular the derivation rule Modus
|
| 21 |
+
Ponens. Moreover, unsharp negation and unsharp implication can be characterized
|
| 22 |
+
by means of five, respectively seven simple axioms. Several examples are presented.
|
| 23 |
+
The concepts of a deductive system and of a filter are introduced as well as the
|
| 24 |
+
congruence determined by such a filter. We finally describe certain relationships
|
| 25 |
+
between these concepts.
|
| 26 |
+
AMS Subject Classification: 03G10, 03G25, 03B60, 06A12, 06D20
|
| 27 |
+
Keywords: Semilattice, Brouwerian semilattice, Heyting algebra, intuitionistic logic,
|
| 28 |
+
unsharp negation, unsharp implication, deductive system, filter, congruence
|
| 29 |
+
1
|
| 30 |
+
Introduction
|
| 31 |
+
Intuitionistic logic is usually algebraically formalized by means of Brouwerian semilat-
|
| 32 |
+
tices, i.e. semilattices (S, ∧, ∗) where ∗ denotes relative pseudocomplementation which is
|
| 33 |
+
considered as the connective implication, see [1], [2], [12], [15] and [16]. If (S, ∧, ∗) has a 0
|
| 34 |
+
then x∗0 is the pseudocomplement of x usually denoted by x∗ and considered as negation
|
| 35 |
+
of x in this logic. If (S, ∧, ∗, 0) is even a lattice then it is called a Heyting algebra, see [14]
|
| 36 |
+
and [17]. For posets the concept of pseudocomplementation was extended and studied
|
| 37 |
+
by the authors in [4] and [5].
|
| 38 |
+
It is well-known that every Brouwerian lattice (or Heyting algebra) is distributive.The
|
| 39 |
+
concept of relative pseudocomplementation was extended by the first author to non-
|
| 40 |
+
distributive lattices under the name sectional pseudocomplementation, see [3] and [9].
|
| 41 |
+
1
|
| 42 |
+
|
| 43 |
+
Hence a kind of non-distributive intuitionistic logic can be created on sectionally pseu-
|
| 44 |
+
docomplemented lattices.
|
| 45 |
+
In their previous papers [6] and [8] the authors showed that some important logics can
|
| 46 |
+
be based also on posets that need not be lattices. An example of such a logic is the
|
| 47 |
+
logic of quantum mechanics based on orthomodular posets, see e.g. [6], [10], [11] and
|
| 48 |
+
[18]. It is evident that in this case some logical connectives such that disjunction or
|
| 49 |
+
conjunction may be only partial operations or, as pointed out by the authors in [8] and
|
| 50 |
+
[7], they may be be considered in an “unsharp version”, i.e. their result need not be a
|
| 51 |
+
single element but may be a subset of the poset in question. Thus also the connective
|
| 52 |
+
implication is created in this way as “unsharp”. For “unsharpness” see also [13]. This
|
| 53 |
+
motivated us to study a variant of intuitionistic logic based on lattices that need neither
|
| 54 |
+
be relatively pseudocomplemented nor even sectionally pseudocomplemented where the
|
| 55 |
+
connective implication is unsharp.
|
| 56 |
+
2
|
| 57 |
+
Preliminaries
|
| 58 |
+
In the following we identify singletons with their unique element, i.e. we will write x
|
| 59 |
+
instead of {x}. Moreover, all posets considered in the sequel are assumed to satisfy the
|
| 60 |
+
Ascending Chain Condition which we will abbreviate by ACC. This implies that every
|
| 61 |
+
element lies under a maximal one. Of course, every finite poset satisfies the ACC. Let
|
| 62 |
+
(P, ≤) be a poset, b ∈ P and A, B ⊆ P. By Max A we will denote the set of all maximal
|
| 63 |
+
elements of A. We define
|
| 64 |
+
A ≤ B if a ≤ b for all a ∈ A and all b ∈ B,
|
| 65 |
+
A ≤1 B if for every a ∈ A there exists some b ∈ B with a ≤ b,
|
| 66 |
+
A ≈1 B if A ≤1 B and B ≤1 A.
|
| 67 |
+
The relation ≤1 is a quasiorder relation on 2P and ≈1 an equivalence relation on 2P. It
|
| 68 |
+
is easy to see that A ≤1 Max B provided A ⊆ B and that A ≤1 b is equivalent to A ≤ b.
|
| 69 |
+
Let S = (S, ∧) be an arbitrary meet-semilattice and A, B ⊆ S. We define
|
| 70 |
+
A ∧ B := {a ∧ b | a ∈ A, b ∈ B}.
|
| 71 |
+
3
|
| 72 |
+
Unsharp negation
|
| 73 |
+
Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC, a ∈ S and A ⊆ S. We
|
| 74 |
+
define
|
| 75 |
+
a0 := Max{x ∈ S|a ∧ x = 0}.
|
| 76 |
+
Hence 0 is a unary operator on the meet-semilattice (S, ∧, 0) with 0 satisfying the ACC
|
| 77 |
+
which assigns to every element x ∈ S the non-void subset x0 ⊆ S. The element a is called
|
| 78 |
+
sharp if a00 = a. Moreover, we define
|
| 79 |
+
A0 := Max{x ∈ S|A ∧ x = 0}.
|
| 80 |
+
We are going to prove the following properties of the operator 0 for every meet-semilattice
|
| 81 |
+
with 0 satisfying the ACC.
|
| 82 |
+
2
|
| 83 |
+
|
| 84 |
+
Theorem 3.1. Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and
|
| 85 |
+
a, b ∈ S. Then the following holds:
|
| 86 |
+
(i) a0 is an antichain,
|
| 87 |
+
(ii) a ≤1 a00,
|
| 88 |
+
(iii) a ≤ b implies b0 ≤1 a0,
|
| 89 |
+
(iv) 00 = Max S,
|
| 90 |
+
(v) a ∧ a0 = 0,
|
| 91 |
+
(vi) if S is bounded then 00 = 1 and 10 = 0,
|
| 92 |
+
(vii) a ∧ 00 ≈1 a,
|
| 93 |
+
(viii) a ∧ (a ∧ b)0 ≈1 a ∧ b0.
|
| 94 |
+
Proof.
|
| 95 |
+
(i) This is clear.
|
| 96 |
+
(ii) We have a ∈ {x ∈ S | a0 ∧ x = 0}.
|
| 97 |
+
(iii) If a ≤ b then {x ∈ S | b ∧ x = 0} ⊆ {x ∈ S | a ∧ x = 0}.
|
| 98 |
+
(iv) and (v) follow directly from the definition of a0.
|
| 99 |
+
(vi) If S is bounded then according to (iv)
|
| 100 |
+
00 = Max S = 1,
|
| 101 |
+
10 = Max{x ∈ S | 1 ∧ x = 0} = Max{0} = 0.
|
| 102 |
+
(vii) According to (iv) we have a ≤1 Max S = 00 and hence a ≤1 a ∧ 00 ≤ a.
|
| 103 |
+
(viii) Everyone of the following statements implies the next one:
|
| 104 |
+
(a ∧ b) ∧ (a ∧ b)0 = 0,
|
| 105 |
+
b ∧
|
| 106 |
+
�
|
| 107 |
+
a ∧ (a ∧ b)0�
|
| 108 |
+
= 0,
|
| 109 |
+
a ∧ (a ∧ b)0 ≤1 b0,
|
| 110 |
+
a ∧ (a ∧ b)0 ≤1 a ∧ b0.
|
| 111 |
+
From a ∧ b ≤ b we conclude b0 ≤1 (a ∧ b)0 according to (iii) and hence a ∧ b0 ≤1
|
| 112 |
+
a ∧ (a ∧ b)0.
|
| 113 |
+
From (iii) of Theorem 3.1 there follows immediately x0 ∧ y0 ≤ (x ∧ y)0.
|
| 114 |
+
Example 3.2. Consider the meet-semilattice visualized in Fig. 1:
|
| 115 |
+
3
|
| 116 |
+
|
| 117 |
+
0
|
| 118 |
+
a
|
| 119 |
+
b
|
| 120 |
+
c
|
| 121 |
+
Fig. 1
|
| 122 |
+
Meet-semilattice
|
| 123 |
+
We have
|
| 124 |
+
a = {b, c}0 = a00,
|
| 125 |
+
00 = {a, b, c},
|
| 126 |
+
a ∧ (a ∧ b)0 = a ∧ 00 = a ∧ {a, b, c} = {0, a} = a ∧ {a, c} = a ∧ b0
|
| 127 |
+
in accordance with (ii), (iv) and (viii) of Theorem 3.1, respectively.
|
| 128 |
+
Example 3.3. Consider the modular lattice L depicted in Fig. 2:
|
| 129 |
+
0
|
| 130 |
+
a
|
| 131 |
+
b
|
| 132 |
+
c
|
| 133 |
+
d
|
| 134 |
+
e
|
| 135 |
+
f
|
| 136 |
+
g
|
| 137 |
+
h
|
| 138 |
+
1
|
| 139 |
+
Fig. 2
|
| 140 |
+
Modular lattice
|
| 141 |
+
We have
|
| 142 |
+
a00 = {g, h}0 = a,
|
| 143 |
+
f 00 = {b, c}0 = f,
|
| 144 |
+
a0 ∧ e0 = {g, h} ∧ d = d ̸= {g, h} = a0 = (a ∧ e)0.
|
| 145 |
+
Hence a and f are sharp and the equality x0 ∧ y0 = (x ∧ y)0 does not hold in general. In
|
| 146 |
+
L from Figure 2 we have
|
| 147 |
+
e0 = d and d0 = e.
|
| 148 |
+
Since e ∧ d = 0 and e ∨ d = 1, {0, d, e, 1} is a complemented lattice.
|
| 149 |
+
If a0 is a singleton, it need not be a complement of a, even if the semilattice is a lattice.
|
| 150 |
+
E.g., consider the four-element lattice with atoms a and b and with an additional greatest
|
| 151 |
+
element 1. Then a0 = b, but a ∨ b ̸= 1, i.e., a0 is not a complement of a.
|
| 152 |
+
For every cardinal number n let Mn = (Mn, ∨, ∧) denote the bounded modular lattice of
|
| 153 |
+
length 2 having n atoms.
|
| 154 |
+
The situation from Figure 2 can be generalized as follows.
|
| 155 |
+
4
|
| 156 |
+
|
| 157 |
+
Remark 3.4. Every element of a direct product of a Boolean algebra and an arbitrary
|
| 158 |
+
number of lattices Mn (possibly different n) is sharp.
|
| 159 |
+
This follows immediately from the fact that every element of a Boolean algebra and every
|
| 160 |
+
element of the lattice Mn is sharp.
|
| 161 |
+
However, if the lattice L is not a direct product of two-element lattices and various Mn
|
| 162 |
+
then the assertion of Remark 3.4 need not hold, see the following example.
|
| 163 |
+
Example 3.5. Consider the lattice visualized in Fig. 3:
|
| 164 |
+
0
|
| 165 |
+
a
|
| 166 |
+
b
|
| 167 |
+
c
|
| 168 |
+
d
|
| 169 |
+
e
|
| 170 |
+
f
|
| 171 |
+
g
|
| 172 |
+
1
|
| 173 |
+
Fig. 3
|
| 174 |
+
Lattice
|
| 175 |
+
We have
|
| 176 |
+
a00 = {b, c}0 = f ̸= a,
|
| 177 |
+
a000 = f 0 = {b, c} = a0,
|
| 178 |
+
b00 = {c, f}0 = b,
|
| 179 |
+
(a0 ∧ b0)00 = ({b, c} ∧ {c, f})00 = {0, c}00 = {b, f}0 = c ̸= {0, c} = a0 ∧ b0,
|
| 180 |
+
(c0 ∧ f 0)00 = ({b, f} ∧ {b, c})00 = {0, b}00 = {c, f}0 = b ̸= {0, b} = e0 ∧ f 0.
|
| 181 |
+
Hence a is not sharp, b is sharp and the equality (x0 ∧ y0)00 = x0 ∧ y0 does not hold in
|
| 182 |
+
general.
|
| 183 |
+
We are going to show that the operator 0 can be characterized by means of four simple
|
| 184 |
+
conditions.
|
| 185 |
+
Theorem 3.6. Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and 0 a
|
| 186 |
+
unary operator on S. Then the following are equivalent:
|
| 187 |
+
(i) x0 = Max{y ∈ S | x ∧ y = 0} for all x ∈ S,
|
| 188 |
+
(ii) the operator 0 satisfies the following conditions:
|
| 189 |
+
(P1) x0 is an antichain,
|
| 190 |
+
5
|
| 191 |
+
|
| 192 |
+
(P2) x ∧ 00 ≈1 x,
|
| 193 |
+
(P3) x ∧ x0 ≈ 0,
|
| 194 |
+
(P4) x ∧ (x ∧ y)0 ≈1 x ∧ y0.
|
| 195 |
+
Proof.
|
| 196 |
+
(i) ⇒ (ii):
|
| 197 |
+
This follows from Theorem 3.1.
|
| 198 |
+
(ii) ⇒ (i):
|
| 199 |
+
If x ∧ y = 0 then according to (P2) and (P4) we have
|
| 200 |
+
y ≈1 y ∧ 00 = y ∧ (x ∧ y)0 = y ∧ (y ∧ x)0 ≈1 y ∧ x0 ≤1 x0
|
| 201 |
+
and hence y ≤1 x0. Conversely, if y ≤1 x0 then according to (P3) we have
|
| 202 |
+
x ∧ y ≤1 x ∧ x0 = 0
|
| 203 |
+
and hence x ∧ y = 0. This shows that x ∧ y = 0 is equivalent to y ≤1 x0. We conclude
|
| 204 |
+
Max{y ∈ S | x ∧ y = 0} = Max{y ∈ S | y ≤1 x0} = x0.
|
| 205 |
+
The last equality can be seen as follows. Let z ∈ Max{y ∈ S | y ≤1 x0}. Then z ≤1 x0,
|
| 206 |
+
i.e. there exists some u ∈ x0 with z ≤ u. We have u ≤1 x0. Now z < u would imply
|
| 207 |
+
z /∈ Max{y ∈ S | y ≤1 x0}, a contradiction. This shows z = u ∈ x0. Conversely, assume
|
| 208 |
+
z ∈ x0. Then z ≤1 x0. If z /∈ Max{y ∈ S | y ≤1 x0} then there would exist some u ∈ S
|
| 209 |
+
with z < u ≤1 x0 and hence there would exist some w ∈ x0 with z < u ≤ w contradicting
|
| 210 |
+
(P1). This shows z ∈ Max{y ∈ S | y ≤1 x0}.
|
| 211 |
+
4
|
| 212 |
+
Unsharp implication
|
| 213 |
+
Now we extend the operation of relative pseudocomplementation to arbitrary meet-
|
| 214 |
+
semilattices with 0 satisfying the ACC as follows: Let S = (S, ∧, 0) be a meet-semilattice
|
| 215 |
+
with 0 satisfying the ACC, a, b ∈ S and A, B ⊆ S. We define
|
| 216 |
+
a → b := Max{x ∈ S | a ∧ x ≤ b}.
|
| 217 |
+
Thus → is a binary operator on S assigning to every pair (x, y) ∈ S2 the non-void subset
|
| 218 |
+
x → y ⊆ S. It is evident that
|
| 219 |
+
x0 = x → 0 for each x ∈ S.
|
| 220 |
+
Moreover, we define
|
| 221 |
+
A → B := Max{x ∈ S | A ∧ x ≤ B}.
|
| 222 |
+
Example 4.1. The “operation table” of the operator → in the meet-semilattice of Figure 1
|
| 223 |
+
looks as follows (we write abc instead of {a, b, c} and so on):
|
| 224 |
+
→
|
| 225 |
+
0
|
| 226 |
+
a
|
| 227 |
+
b
|
| 228 |
+
c
|
| 229 |
+
0
|
| 230 |
+
abc
|
| 231 |
+
abc
|
| 232 |
+
abc
|
| 233 |
+
abc
|
| 234 |
+
a
|
| 235 |
+
bc
|
| 236 |
+
abc
|
| 237 |
+
bc
|
| 238 |
+
ab
|
| 239 |
+
b
|
| 240 |
+
ac
|
| 241 |
+
ac
|
| 242 |
+
abc
|
| 243 |
+
ac
|
| 244 |
+
c
|
| 245 |
+
ab
|
| 246 |
+
ab
|
| 247 |
+
ab
|
| 248 |
+
abc
|
| 249 |
+
6
|
| 250 |
+
|
| 251 |
+
Example 4.2. The “operation table” of the operator → in the meet-semilattice of Figure 3
|
| 252 |
+
looks as follows (we write bc instead of {b, c} and so on):
|
| 253 |
+
→
|
| 254 |
+
0
|
| 255 |
+
a
|
| 256 |
+
b
|
| 257 |
+
c
|
| 258 |
+
d
|
| 259 |
+
e
|
| 260 |
+
f
|
| 261 |
+
g
|
| 262 |
+
1
|
| 263 |
+
0
|
| 264 |
+
1
|
| 265 |
+
1
|
| 266 |
+
1
|
| 267 |
+
1
|
| 268 |
+
1
|
| 269 |
+
1
|
| 270 |
+
1
|
| 271 |
+
1
|
| 272 |
+
1
|
| 273 |
+
a
|
| 274 |
+
bc
|
| 275 |
+
1
|
| 276 |
+
bc
|
| 277 |
+
bc
|
| 278 |
+
1
|
| 279 |
+
1
|
| 280 |
+
1
|
| 281 |
+
1
|
| 282 |
+
1
|
| 283 |
+
b
|
| 284 |
+
cf
|
| 285 |
+
cf
|
| 286 |
+
1
|
| 287 |
+
cf
|
| 288 |
+
cf
|
| 289 |
+
1
|
| 290 |
+
cf
|
| 291 |
+
1
|
| 292 |
+
1
|
| 293 |
+
c
|
| 294 |
+
bf
|
| 295 |
+
bf
|
| 296 |
+
bf
|
| 297 |
+
1
|
| 298 |
+
bf
|
| 299 |
+
1
|
| 300 |
+
bf
|
| 301 |
+
1
|
| 302 |
+
1
|
| 303 |
+
d
|
| 304 |
+
bc
|
| 305 |
+
g
|
| 306 |
+
bc
|
| 307 |
+
bc
|
| 308 |
+
1
|
| 309 |
+
g
|
| 310 |
+
1
|
| 311 |
+
g
|
| 312 |
+
1
|
| 313 |
+
e
|
| 314 |
+
0
|
| 315 |
+
f
|
| 316 |
+
b
|
| 317 |
+
c
|
| 318 |
+
f
|
| 319 |
+
1
|
| 320 |
+
f
|
| 321 |
+
1
|
| 322 |
+
1
|
| 323 |
+
f
|
| 324 |
+
bc
|
| 325 |
+
g
|
| 326 |
+
bc
|
| 327 |
+
bc
|
| 328 |
+
dg
|
| 329 |
+
g
|
| 330 |
+
1
|
| 331 |
+
g
|
| 332 |
+
1
|
| 333 |
+
g
|
| 334 |
+
0
|
| 335 |
+
f
|
| 336 |
+
b
|
| 337 |
+
c
|
| 338 |
+
f
|
| 339 |
+
ef
|
| 340 |
+
f
|
| 341 |
+
1
|
| 342 |
+
1
|
| 343 |
+
1
|
| 344 |
+
0
|
| 345 |
+
a
|
| 346 |
+
b
|
| 347 |
+
c
|
| 348 |
+
d
|
| 349 |
+
e
|
| 350 |
+
f
|
| 351 |
+
g
|
| 352 |
+
1
|
| 353 |
+
The following properties of the binary operator → can be proved.
|
| 354 |
+
Theorem 4.3. Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and
|
| 355 |
+
a, b, c ∈ S. Then the following holds:
|
| 356 |
+
(i) a → b is an antichain,
|
| 357 |
+
(ii) a ≤ b implies a → b = Max S,
|
| 358 |
+
(iii) b ∈ Max S implies b ∈ a → b,
|
| 359 |
+
(iv) b ≤1 a → b,
|
| 360 |
+
(v) a ≤1 (a → b) → b,
|
| 361 |
+
(vi) a ≤ b implies c → a ≤1 c → b and b → c ≤1 a → c.
|
| 362 |
+
(vii) a ∧ (a → b) ≈1 a ∧ b,
|
| 363 |
+
(viii) a → (b ∧ c) ≈1 (a → b) ∧ (a → c),
|
| 364 |
+
(ix) (a → b) ∧ b ≈1 b,
|
| 365 |
+
(x) if S is bounded then 1 → b = b,
|
| 366 |
+
(xi) a ∧ (b → b) ≈1 a,
|
| 367 |
+
(xii) if S is bounded then a → b = 1 if and only if a ≤ b,
|
| 368 |
+
(xiii) b ≤1 a → (a ∧ b).
|
| 369 |
+
Proof.
|
| 370 |
+
(i) This is clear.
|
| 371 |
+
(ii), (iv), (x), (xii) and (xiii) follow immediately from the definition of →.
|
| 372 |
+
(iii) If b ∈ Max S then because of a∧b ≤ b we have b ∈ Max{x ∈ S | a∧x ≤ b} = a → b.
|
| 373 |
+
(v) Since a ∧ x ≤ b for all x ∈ a → b we have a ∧ (a → b) ≤ b, i.e. (a → b) ∧ a ≤ b.
|
| 374 |
+
7
|
| 375 |
+
|
| 376 |
+
(vi) If a ≤ b then
|
| 377 |
+
{x ∈ S | c ∧ x ≤ a} ⊆ {x ∈ S | c ∧ x ≤ b},
|
| 378 |
+
{x ∈ S | b ∧ x ≤ c} ⊆ {x ∈ S | a ∧ x ≤ c}.
|
| 379 |
+
(vii) We have a ∧ x ≤ b and hence a ∧ x ≤ a ∧ b for all x ∈ a → b and hence a ∧ b ≤1
|
| 380 |
+
a ∧ (a → b) ≤ a ∧ b according to (iv).
|
| 381 |
+
(viii) According to (vii) we have a → (b ∧ c) ≤1 (a → b) ∧ (a → c). Conversely, assume
|
| 382 |
+
d ∈ a → b and e ∈ a → c. Then a∧d ≤ b and a∧e ≤ c and hence a∧(d∧e) ≤ b∧c
|
| 383 |
+
which implies d ∧ e ≤1 a → (b ∧ c). This shows (a → b) ∧ (a → c) ≤1 a → (b ∧ c).
|
| 384 |
+
(ix) We have b ≤1 a → b according to (iv) and hence b ≤1 (a → b) ∧ b ≤ b.
|
| 385 |
+
(xi) According to (ii) we have a ≤1 Max S = b → b and hence a ≤1 a ∧ (b → b) ≤ a.
|
| 386 |
+
From Theorem 4.3 it is evident that the binary operator → shares properties of the
|
| 387 |
+
logical connective implication in intuitionistic logic despite the fact that it is unsharp,
|
| 388 |
+
i.e. for x, y ∈ S the result of x → y need not be a singleton.
|
| 389 |
+
Hence it extends the
|
| 390 |
+
intuitionistic logic based on a Heyting algebra (L, ∨, ∧, ∗, 0) where again ∨ formalizes
|
| 391 |
+
disjunction, ∧ formalizes conjunction, but now → formalizes unsharp implication and 0
|
| 392 |
+
formalizes unsharp negation.
|
| 393 |
+
Example 4.4. Consider the modular lattice visualized in Fig. 4:
|
| 394 |
+
0
|
| 395 |
+
a
|
| 396 |
+
b
|
| 397 |
+
c
|
| 398 |
+
d
|
| 399 |
+
e
|
| 400 |
+
f
|
| 401 |
+
1
|
| 402 |
+
Fig. 4
|
| 403 |
+
Modular lattice
|
| 404 |
+
Then
|
| 405 |
+
e ≤1 {d, e} = {e, f} → e = (d → e) → e,
|
| 406 |
+
d ∧ (d → e) = d ∧ {e, f} = c = d ∧ e,
|
| 407 |
+
(d → e) ∧ e = {e, f} ∧ e = {c, e} ≈1 e
|
| 408 |
+
in accordance with (v), (vii) and (ix) of Theorem 4.3, respectively.
|
| 409 |
+
8
|
| 410 |
+
|
| 411 |
+
Remark 4.5. It is easy to see that the operation ∧ and the operator → are related by
|
| 412 |
+
so-called unsharp adjointness, i.e.
|
| 413 |
+
a ∧ b ≤ c if and only if a ≤1 b → c.
|
| 414 |
+
Since the operation ∧ is associative, commutative and monotone, it can be considered as
|
| 415 |
+
a t-norm. Thus the semilattice (S, ∧, →) endowed with the operator → is an unsharply
|
| 416 |
+
residuated semilattice. Moreover, by (viii) of Theorem 4.3 we have
|
| 417 |
+
a ∧ (a → b) ≈1 a ∧ b
|
| 418 |
+
showing that (S, ∧, →) satisfies divisibility.
|
| 419 |
+
Similarly as for the unary operator 0 we can characterize the binary operator → on a
|
| 420 |
+
meet-semilattice with 0 satisfying the ACC as follows.
|
| 421 |
+
Theorem 4.6. Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and → a
|
| 422 |
+
binary operator on S. Then the following are equivalent:
|
| 423 |
+
(i) x → y = Max{z ∈ S | x ∧ z ≤ y} for all x, y ∈ S,
|
| 424 |
+
(ii) The operator → satisfies the following conditions:
|
| 425 |
+
(R1) x → y is an antichain,
|
| 426 |
+
(R2) x ∧ (x → y) ≈1 x ∧ y,
|
| 427 |
+
(R3) (x → y) ∧ y ≈1 y,
|
| 428 |
+
(R4) x → (y ∧ z) ≈1 (x → y) ∧ (x → z),
|
| 429 |
+
(R5) x ∧ (y → y) ≈1 x,
|
| 430 |
+
(R6) y ≤ z implies x → y ≤1 x → z.
|
| 431 |
+
Proof.
|
| 432 |
+
(i) ⇒ (ii):
|
| 433 |
+
This follows from Theorem 4.3.
|
| 434 |
+
(ii) ⇒ (i):
|
| 435 |
+
If x ∧ z ≤ y then according to (R3), (R5), (R4) and (R6) we have
|
| 436 |
+
z ≈1 (x → z) ∧ z ≤1 x ��� z ≈1 (x → x) ∧ (x → z) ≈1 x → (x ∧ z) ≤1 x → y
|
| 437 |
+
and hence z ≤1 x → y. Conversely, if z ≤1 x → y then according to (R2) we have
|
| 438 |
+
x ∧ z ≤1 x ∧ (x → y) ≈1 x ∧ y ≤ y
|
| 439 |
+
and hence x∧z ≤ y. This shows that x∧z ≤ y is equivalent to z ≤1 x → y. We conclude
|
| 440 |
+
Max{z ∈ S | x ∧ z ≤ y} = Max{z ∈ S | z ≤1 x → y} = x → y.
|
| 441 |
+
The last equality can be seen as follows. Let u ∈ Max{z ∈ S | z ≤1 x → y}. Then
|
| 442 |
+
u ≤1 x → y, i.e. there exists some v ∈ x → y with u ≤ v. We have v ≤1 x → y.
|
| 443 |
+
Now u < v would imply u /∈ Max{z ∈ S | z ≤1 x → y}, a contradiction.
|
| 444 |
+
This
|
| 445 |
+
shows u = v ∈ x → y.
|
| 446 |
+
Conversely, assume u ∈ x → y.
|
| 447 |
+
Then u ≤1 x → y.
|
| 448 |
+
If
|
| 449 |
+
u /∈ Max{z ∈ S | z ≤1 x → y} then there would exist some v ∈ S with u < v ≤1 x → y
|
| 450 |
+
and hence there would exist some w ∈ x → y with u < v ≤ w contradicting (R1). This
|
| 451 |
+
shows u ∈ Max{z ∈ S | z ≤1 x → y}.
|
| 452 |
+
9
|
| 453 |
+
|
| 454 |
+
Example 4.7. Consider the lattice from Figure 4. Then
|
| 455 |
+
d ∧ (d → e) = d ∧ {e, f} = c = d ∧ e,
|
| 456 |
+
(d → e) ∧ e = e ∧ e = e,
|
| 457 |
+
d → (e ∧ f) = d → c = {e, f} ≈1 {c, e, f} = {e, f} ∧ {e, f} = (d → e) ∧ (d → f)
|
| 458 |
+
in accordance with (R2), (R3) and (R4), respectively.
|
| 459 |
+
5
|
| 460 |
+
Deductive systems
|
| 461 |
+
It is well-known that the connective implication in intuitionistic logic is closely related
|
| 462 |
+
to the so-called deductive systems in the corresponding Brouwerian semilattice. In what
|
| 463 |
+
follows we show that a certain modification of the concept of a deductive system plays a
|
| 464 |
+
similar role for logics with unsharp implication. We define
|
| 465 |
+
Definition 5.1. A deductive system of a meet-semilattice S = (S, ∧, 0) with 0 satisfying
|
| 466 |
+
the ACC is a subset D of S satisfying the following conditions for x, y ∈ S:
|
| 467 |
+
(D1) (Max S) ∩ D ̸= ∅,
|
| 468 |
+
(D2) x ∈ D and (x → y) ∩ D ̸= ∅ imply y ∈ D.
|
| 469 |
+
Recall that a filter of a meet-semilattice S = (S, ∧) is a non-empty subset F of S satisfying
|
| 470 |
+
the following conditions for x, y ∈ S:
|
| 471 |
+
(F1) x, y ∈ F implies x ∧ y ∈ F,
|
| 472 |
+
(F2) x ∈ F and x ≤ y imply y ∈ F.
|
| 473 |
+
It is clear that if S is finite then all filters of S are given by the sets [x) := {y ∈ S | x ≤ y},
|
| 474 |
+
x ∈ S, and hence the poset of all filters of S is dually isomorphic to S and therefore a
|
| 475 |
+
join-semilattice where [x) ∨ [y) = [x ∧ y) for all x, y ∈ S.
|
| 476 |
+
For every non-empty subset A of the universe of a meet-semilattice (S, ∧) we define a
|
| 477 |
+
binary relation Θ(A) on S as follows:
|
| 478 |
+
(x, y) ∈ Θ(A) if there exists some a ∈ A with x ∧ a = y ∧ a.
|
| 479 |
+
Although the following result is known, for the reader’s convenience we present the proof.
|
| 480 |
+
Lemma 5.2. Let S = (S, ∧, 1) be a meet-semilattice with 1 and Φ ∈ Con S. Then the
|
| 481 |
+
following holds:
|
| 482 |
+
(i) [1]Φ is an filter of S,
|
| 483 |
+
(ii) Θ([1]Φ) ⊆ Φ.
|
| 484 |
+
Proof.
|
| 485 |
+
(i) (F1) If a, b ∈ [1]Φ then a ∧ b ∈ [1 ∧ 1]Φ = [1]Φ.
|
| 486 |
+
10
|
| 487 |
+
|
| 488 |
+
(F2) If a ∈ [1]Φ, b ∈ S and a ≤ b then b = 1 ∧ b ∈ [a ∧ b]Φ = [a]Φ = [1]Φ.
|
| 489 |
+
This shows that [1]Φ is a filter of S.
|
| 490 |
+
(ii) If (a, b) ∈ Θ([1]Φ) then there exists some c ∈ [1]Φ with a ∧ c = b ∧ c whence
|
| 491 |
+
a = a ∧ 1 Φ a ∧ c = b ∧ c Φ b ∧ 1 = b
|
| 492 |
+
which shows (a, b) ∈ Φ.
|
| 493 |
+
Although our definition of a deductive system differs from that known for relatively
|
| 494 |
+
pseudocomplemented semilattices, we are still able to prove the following relationships
|
| 495 |
+
between the concepts mentioned before.
|
| 496 |
+
Theorem 5.3. Let S = (S, ∧, 0, 1) be a bounded meet-semilattice satisfying the ACC and
|
| 497 |
+
D a non-empty subset of S. Then the following are equivalent:
|
| 498 |
+
(i) D a deductive system of S,
|
| 499 |
+
(ii) D is an filter of S,
|
| 500 |
+
(iii) Θ(D) ∈ Con S and D = [1]
|
| 501 |
+
�
|
| 502 |
+
Θ(D)
|
| 503 |
+
�
|
| 504 |
+
.
|
| 505 |
+
Proof.
|
| 506 |
+
(i) ⇒ (ii):
|
| 507 |
+
(F2) Assume a ∈ D, b ∈ S and a ≤ b.
|
| 508 |
+
Then a → b = Max S because of (ii) of
|
| 509 |
+
Theorem 4.3. According to (D1) we have (a → b) ∩ D = Max S ∩ D ̸= ∅ and hence
|
| 510 |
+
b ∈ D by (D2).
|
| 511 |
+
(F1) Let a, b ∈ D. Then by (xiii) of Theorem 4.3 we have b ≤1 a → (a ∧ b). Hence there
|
| 512 |
+
exists some c ∈ a → (a ∧ b) with b ≤ c. Now (F2) implies c ∈ D and therefore
|
| 513 |
+
�
|
| 514 |
+
a → (a ∧ b)
|
| 515 |
+
�
|
| 516 |
+
∩ D ̸= ∅ from which we conclude a ∧ b ∈ D by (D2).
|
| 517 |
+
(ii) ⇒ (iii):
|
| 518 |
+
Evidently, Θ(D) is reflexive and symmetric. Let (a, b), (b, c) ∈ Θ(D). Then there exist
|
| 519 |
+
d, e ∈ D with a ∧ d = b ∧ d and b ∧ e = c ∧ e. Because of (F1) we conclude d ∧ e ∈ D.
|
| 520 |
+
Now
|
| 521 |
+
a ∧ (d ∧ e) = (a ∧ d) ∧ e = (b ∧ d) ∧ e = (b ∧ e) ∧ d = (c ∧ e) ∧ d = c ∧ (d ∧ e)
|
| 522 |
+
which yields (a, c) ∈ Θ(D), i.e. Θ(D) is transitive. Further, if f ∈ S then
|
| 523 |
+
(a ∧ f) ∧ d = (a ∧ d) ∧ f = (b ∧ d) ∧ f = (b ∧ f) ∧ d
|
| 524 |
+
showing (a ∧ f, b ∧ f) ∈ Θ(D).
|
| 525 |
+
Hence Θ(D) ∈ Con S.
|
| 526 |
+
If a ∈ D then because of
|
| 527 |
+
a ∧ a = a = 1 ∧ a we have a ∈ [1]
|
| 528 |
+
�
|
| 529 |
+
Θ(D)
|
| 530 |
+
�
|
| 531 |
+
showing D ⊆ [1]
|
| 532 |
+
�
|
| 533 |
+
Θ(D)
|
| 534 |
+
�
|
| 535 |
+
. Conversely, assume
|
| 536 |
+
a ∈ [1]
|
| 537 |
+
�
|
| 538 |
+
Θ(D)
|
| 539 |
+
�
|
| 540 |
+
. Then there exists some b ∈ D with a ∧ b = 1 ∧ b. This implies b ≤ a
|
| 541 |
+
wherefrom we conclude a ∈ D by (F2) showing [1]
|
| 542 |
+
�
|
| 543 |
+
Θ(D)
|
| 544 |
+
�
|
| 545 |
+
⊆ D.
|
| 546 |
+
(iii) ⇒ (i):
|
| 547 |
+
11
|
| 548 |
+
|
| 549 |
+
(D1) If a ∈ D then, since S satisfies the ACC, there exists some b ∈ Max S with a ≤ b
|
| 550 |
+
and hence
|
| 551 |
+
b = 1 ∧ b ∈ [a ∧ b]
|
| 552 |
+
�
|
| 553 |
+
Θ(D)
|
| 554 |
+
�
|
| 555 |
+
= [a]
|
| 556 |
+
�
|
| 557 |
+
Θ(D)
|
| 558 |
+
�
|
| 559 |
+
= [1]
|
| 560 |
+
�
|
| 561 |
+
Θ(D)
|
| 562 |
+
�
|
| 563 |
+
= D.
|
| 564 |
+
(D2) If a ∈ D, b ∈ S and (a → b) ∩ D ̸= ∅ then there exists some c ∈ D with c ∈ a → b
|
| 565 |
+
and hence a ∧ c ≤ b whence
|
| 566 |
+
b = 1∧1∧b ∈ [a∧c∧b]
|
| 567 |
+
�
|
| 568 |
+
Θ(D)
|
| 569 |
+
�
|
| 570 |
+
= [a∧c]
|
| 571 |
+
�
|
| 572 |
+
Θ(D)
|
| 573 |
+
�
|
| 574 |
+
= [1∧1]
|
| 575 |
+
�
|
| 576 |
+
Θ(D)
|
| 577 |
+
�
|
| 578 |
+
= [1]
|
| 579 |
+
�
|
| 580 |
+
Θ(D)
|
| 581 |
+
�
|
| 582 |
+
= D.
|
| 583 |
+
It is well known that for a filter F of a relatively pseudocomplemented semilattice we
|
| 584 |
+
have (a, b) ∈ Θ(F) if and only if a → b ∈ F and b → a ∈ F. However, we can modify
|
| 585 |
+
this result also for an arbitrary meet-semilattice with 0 satisfying the ACC provided our
|
| 586 |
+
unsharp implication is considered.
|
| 587 |
+
Proposition 5.4. Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC, F
|
| 588 |
+
a filter of S and a, b ∈ S. Then the following are equivalent:
|
| 589 |
+
(i) (a, b) ∈ Θ(F),
|
| 590 |
+
(ii) (a → b) ∩ F ̸= ∅ and (b → a) ∩ F ̸= ∅.
|
| 591 |
+
Proof.
|
| 592 |
+
(i) ⇒ (ii):
|
| 593 |
+
There exists some c ∈ F with a ∧ c = b ∧ c. Hence a ∧ c ≤ b and b ∧ c ≤ a and therefore
|
| 594 |
+
there exists some d ∈ a → b with c ≤ d and some e ∈ b → a with c ≤ e. Because of (F2)
|
| 595 |
+
we conclude d, e ∈ F showing (ii).
|
| 596 |
+
(ii) ⇒ (i):
|
| 597 |
+
Let c ∈ (a → b)∩F and d ∈ (b → a)∩F. Then c∧d ∈ F by (F1), a∧c ≤ b and b∧d ≤ a.
|
| 598 |
+
Hence
|
| 599 |
+
a ∧ (c ∧ d) = (a ∧ c) ∧ (c ∧ d) ≤ b ∧ (c ∧ d) = (b ∧ d) ∧ (c ∧ d) ≤ a ∧ (c ∧ d),
|
| 600 |
+
i.e. a ∧ (c ∧ d) = b ∧ (c ∧ d) showing (i).
|
| 601 |
+
Conclusion
|
| 602 |
+
Although the implication within the logic based on the structure (S, ∧, 0, →) is unsharp,
|
| 603 |
+
i.e. x → y may be a subset I of S which need not be a singleton, it has its logical meaning.
|
| 604 |
+
Namely, we ask that x → y is the maximal element c of S satisfying x ∧ c ≤ y (where ∧
|
| 605 |
+
denotes conjunction). And for each c ∈ I this is satisfied. Moreover, the elements of I
|
| 606 |
+
are mutually incomparable. Thus we have no need to prefer one of them with respect to
|
| 607 |
+
others. However, the expression
|
| 608 |
+
x ∧ (x → y) ≤ y
|
| 609 |
+
is nothing else than the derivation rule Modus Ponens (both in classical as well as in
|
| 610 |
+
non-classical logic) since it properly says that the truth value of y cannot be less than
|
| 611 |
+
the truth value of the conjunction x ∧ (x → y) of x and the implication x → y. Hence,
|
| 612 |
+
despite of the fact of unsharpness, such a logic is sound although it is derived from an
|
| 613 |
+
arbitrary meet-semilattice with 0 satisfying the ACC.
|
| 614 |
+
12
|
| 615 |
+
|
| 616 |
+
References
|
| 617 |
+
[1] L. E. J. Brouwer, De onbetrouwbaarheid der logische principes. Tijdschrift Wijs-
|
| 618 |
+
begeerte 2 (1908), 152–158.
|
| 619 |
+
[2] L. E. J. Brouwer, Intuitionism and formalism. Bull. Amer. Math. Soc. 20 (1913),
|
| 620 |
+
81–96.
|
| 621 |
+
[3] I. Chajda, An extension of relative pseudocomplementation to non-distributive lat-
|
| 622 |
+
tices. Acta Sci. Math. (Szeged) 69 (2003), 491–496.
|
| 623 |
+
[4] I. Chajda, Pseudocomplemented and Stone posets. Acta Univ. Palack. Olomuc. Fac.
|
| 624 |
+
Rerum Natur. Math. 51 (2012), 29–34.
|
| 625 |
+
[5] I. Chajda and H. L¨anger, Algebras describing pseudocomplemented, relatively pseu-
|
| 626 |
+
docomplemented and sectionally pseudocomplemented posets. Symmetry 13 (2021),
|
| 627 |
+
753 (17 pp.)
|
| 628 |
+
[6] I. Chajda and H. L¨anger, Implication in finite posets with pseudocomplemented
|
| 629 |
+
sections. Soft Computing 26 (2022), 5945–5953.
|
| 630 |
+
[7] I. Chajda and H. L¨anger, The logic of orthomodular posets of finite height. Log. J.
|
| 631 |
+
IGPL 30 (2022), 143–154.
|
| 632 |
+
[8] I. Chajda and H. L¨anger, Operator residuation in orthomodular posets of finite
|
| 633 |
+
height. Fuzzy Sets Systems (submitted).
|
| 634 |
+
[9] I. Chajda, H. L¨anger and J. Paseka, Sectionally pseudocomplemented posets. Order
|
| 635 |
+
38 (2021), 527–546.
|
| 636 |
+
[10] D. Fazio, A. Ledda and F. Paoli, On Finch’s conditions for the completion of ortho-
|
| 637 |
+
modular posets. Found. Sci. (2020), https://doi.org/10.1007/s10699-020-09702-z.
|
| 638 |
+
[11] P. D. Finch, On orthomodular posets. J. Austral. Math. Soc. 11 (1970), 57–62.
|
| 639 |
+
[12] O. Frink, Pseudo-complements in semi-lattices. Duke Math. J. 29 (1962), 505–514.
|
| 640 |
+
[13] R. Giuntini and H. Greuling, Toward a formal language for unsharp properties.
|
| 641 |
+
Found. Phys. 19 (1989), 931–945.
|
| 642 |
+
[14] A. Heyting, Die formalen Regeln der intuitionistischen Logik. Sitzungsber. Akad.
|
| 643 |
+
Berlin 1930, 42–56.
|
| 644 |
+
[15] P. K¨ohler, Brouwerian semilattices: the lattice of total subalgebras. Banach Center
|
| 645 |
+
Publ. 9 (1982), 47–56.
|
| 646 |
+
[16] A. Monteiro, Axiomes ind´ependants pour les alg`ebres de Brouwer. Rev. Un. Mat.
|
| 647 |
+
Argentina 17 (1955), 149–160.
|
| 648 |
+
[17] L. Monteiro, Les alg`ebres de Heyting et de Lukasiewicz trivalentes. Notre Dame J.
|
| 649 |
+
Formal Logic 11 (1970), 453–466.
|
| 650 |
+
[18] P. Pt´ak and S. Pulmannov´a, Orthomodular Structures as Quantum Logics. Kluwer,
|
| 651 |
+
Dordrecht 1991. ISBN 0-7923-1207-4.
|
| 652 |
+
13
|
| 653 |
+
|
| 654 |
+
Authors’ addresses:
|
| 655 |
+
Ivan Chajda
|
| 656 |
+
Palack´y University Olomouc
|
| 657 |
+
Faculty of Science
|
| 658 |
+
Department of Algebra and Geometry
|
| 659 |
+
17. listopadu 12
|
| 660 |
+
771 46 Olomouc
|
| 661 |
+
Czech Republic
|
| 662 |
+
ivan.chajda@upol.cz
|
| 663 |
+
Helmut L¨anger
|
| 664 |
+
TU Wien
|
| 665 |
+
Faculty of Mathematics and Geoinformation
|
| 666 |
+
Institute of Discrete Mathematics and Geometry
|
| 667 |
+
Wiedner Hauptstraße 8-10
|
| 668 |
+
1040 Vienna
|
| 669 |
+
Austria, and
|
| 670 |
+
Palack´y University Olomouc
|
| 671 |
+
Faculty of Science
|
| 672 |
+
Department of Algebra and Geometry
|
| 673 |
+
17. listopadu 12
|
| 674 |
+
771 46 Olomouc
|
| 675 |
+
Czech Republic
|
| 676 |
+
helmut.laenger@tuwien.ac.at
|
| 677 |
+
14
|
| 678 |
+
|
GtE0T4oBgHgl3EQfRQCY/content/tmp_files/load_file.txt
ADDED
|
@@ -0,0 +1,389 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
filepath=/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf,len=388
|
| 2 |
+
page_content='arXiv:2301.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 3 |
+
page_content='02205v1 [math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 4 |
+
page_content='LO] 5 Jan 2023 The logic with unsharp implication and negation Ivan Chajda and Helmut L¨anger Abstract It is well-known that intuitionistic logics can be formalized by means of Brouwe- rian semilattices, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 5 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 6 |
+
page_content=' relatively pseudocomplemented semilattices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 7 |
+
page_content=' Then the logical connective implication is considered to be the relative pseudocomplement and con- junction is the semilattice operation meet.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 8 |
+
page_content=' If the Brouwerian semilattice has a bottom element 0 then the relative pseudocomplement with respect to 0 is called the pseudocomplement and it is considered as the connective negation in this logic.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 9 |
+
page_content=' Our idea is to consider an arbitrary meet-semilattice with 0 satisfying only the Ascending Chain Condition, which is trivially satisfied in finite semilattices, and introduce the connective negation x0 as the set of all maximal elements z satis- fying x ∧ z = 0 and the connective implication x → y as the set of all maximal elements z satisfying x∧z ≤ y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 10 |
+
page_content=' Such a negation and implication is “unsharp” since it assigns to one entry x or to two entries x and y belonging to the semilattice, respectively, a subset instead of an element of the semilattice.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 11 |
+
page_content=' Surprisingly, this kind of negation and implication, respectively, still shares a number of properties of these connectives in intuitionistic logic, in particular the derivation rule Modus Ponens.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 12 |
+
page_content=' Moreover, unsharp negation and unsharp implication can be characterized by means of five, respectively seven simple axioms.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 13 |
+
page_content=' Several examples are presented.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 14 |
+
page_content=' The concepts of a deductive system and of a filter are introduced as well as the congruence determined by such a filter.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 15 |
+
page_content=' We finally describe certain relationships between these concepts.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 16 |
+
page_content=' AMS Subject Classification: 03G10, 03G25, 03B60, 06A12, 06D20 Keywords: Semilattice, Brouwerian semilattice, Heyting algebra, intuitionistic logic, unsharp negation, unsharp implication, deductive system, filter, congruence 1 Introduction Intuitionistic logic is usually algebraically formalized by means of Brouwerian semilat- tices, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 17 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 18 |
+
page_content=' semilattices (S, ∧, ∗) where ∗ denotes relative pseudocomplementation which is considered as the connective implication, see [1], [2], [12], [15] and [16].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 19 |
+
page_content=' If (S, ∧, ∗) has a 0 then x∗0 is the pseudocomplement of x usually denoted by x∗ and considered as negation of x in this logic.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 20 |
+
page_content=' If (S, ∧, ∗, 0) is even a lattice then it is called a Heyting algebra, see [14] and [17].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 21 |
+
page_content=' For posets the concept of pseudocomplementation was extended and studied by the authors in [4] and [5].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 22 |
+
page_content=' It is well-known that every Brouwerian lattice (or Heyting algebra) is distributive.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 23 |
+
page_content='The concept of relative pseudocomplementation was extended by the first author to non- distributive lattices under the name sectional pseudocomplementation, see [3] and [9].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 24 |
+
page_content=' 1 Hence a kind of non-distributive intuitionistic logic can be created on sectionally pseu- docomplemented lattices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 25 |
+
page_content=' In their previous papers [6] and [8] the authors showed that some important logics can be based also on posets that need not be lattices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 26 |
+
page_content=' An example of such a logic is the logic of quantum mechanics based on orthomodular posets, see e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 27 |
+
page_content='g.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 28 |
+
page_content=' [6], [10], [11] and [18].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 29 |
+
page_content=' It is evident that in this case some logical connectives such that disjunction or conjunction may be only partial operations or, as pointed out by the authors in [8] and [7], they may be be considered in an “unsharp version”, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 30 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 31 |
+
page_content=' their result need not be a single element but may be a subset of the poset in question.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 32 |
+
page_content=' Thus also the connective implication is created in this way as “unsharp”.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 33 |
+
page_content=' For “unsharpness” see also [13].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 34 |
+
page_content=' This motivated us to study a variant of intuitionistic logic based on lattices that need neither be relatively pseudocomplemented nor even sectionally pseudocomplemented where the connective implication is unsharp.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 35 |
+
page_content=' 2 Preliminaries In the following we identify singletons with their unique element, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 36 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 37 |
+
page_content=' we will write x instead of {x}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 38 |
+
page_content=' Moreover, all posets considered in the sequel are assumed to satisfy the Ascending Chain Condition which we will abbreviate by ACC.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 39 |
+
page_content=' This implies that every element lies under a maximal one.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 40 |
+
page_content=' Of course, every finite poset satisfies the ACC.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 41 |
+
page_content=' Let (P, ≤) be a poset, b ∈ P and A, B ⊆ P.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 42 |
+
page_content=' By Max A we will denote the set of all maximal elements of A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 43 |
+
page_content=' We define A ≤ B if a ≤ b for all a ∈ A and all b ∈ B, A ≤1 B if for every a ∈ A there exists some b ∈ B with a ≤ b, A ≈1 B if A ≤1 B and B ≤1 A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 44 |
+
page_content=' The relation ≤1 is a quasiorder relation on 2P and ≈1 an equivalence relation on 2P.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 45 |
+
page_content=' It is easy to see that A ≤1 Max B provided A ⊆ B and that A ≤1 b is equivalent to A ≤ b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 46 |
+
page_content=' Let S = (S, ∧) be an arbitrary meet-semilattice and A, B ⊆ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 47 |
+
page_content=' We define A ∧ B := {a ∧ b | a ∈ A, b ∈ B}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 48 |
+
page_content=' 3 Unsharp negation Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC, a ∈ S and A ⊆ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 49 |
+
page_content=' We define a0 := Max{x ∈ S|a ∧ x = 0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 50 |
+
page_content=' Hence 0 is a unary operator on the meet-semilattice (S, ∧, 0) with 0 satisfying the ACC which assigns to every element x ∈ S the non-void subset x0 ⊆ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 51 |
+
page_content=' The element a is called sharp if a00 = a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 52 |
+
page_content=' Moreover, we define A0 := Max{x ∈ S|A ∧ x = 0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 53 |
+
page_content=' We are going to prove the following properties of the operator 0 for every meet-semilattice with 0 satisfying the ACC.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 54 |
+
page_content=' 2 Theorem 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 55 |
+
page_content='1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 56 |
+
page_content=' Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and a, b ∈ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 57 |
+
page_content=' Then the following holds: (i) a0 is an antichain, (ii) a ≤1 a00, (iii) a ≤ b implies b0 ≤1 a0, (iv) 00 = Max S, (v) a ∧ a0 = 0, (vi) if S is bounded then 00 = 1 and 10 = 0, (vii) a ∧ 00 ≈1 a, (viii) a ∧ (a ∧ b)0 ≈1 a ∧ b0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 58 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 59 |
+
page_content=' (i) This is clear.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 60 |
+
page_content=' (ii) We have a ∈ {x ∈ S | a0 ∧ x = 0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 61 |
+
page_content=' (iii) If a ≤ b then {x ∈ S | b ∧ x = 0} ⊆ {x ∈ S | a ∧ x = 0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 62 |
+
page_content=' (iv) and (v) follow directly from the definition of a0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 63 |
+
page_content=' (vi) If S is bounded then according to (iv) 00 = Max S = 1, 10 = Max{x ∈ S | 1 ∧ x = 0} = Max{0} = 0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 64 |
+
page_content=' (vii) According to (iv) we have a ≤1 Max S = 00 and hence a ≤1 a ∧ 00 ≤ a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 65 |
+
page_content=' (viii) Everyone of the following statements implies the next one: (a ∧ b) ∧ (a ∧ b)0 = 0, b ∧ � a ∧ (a ∧ b)0� = 0, a ∧ (a ∧ b)0 ≤1 b0, a ∧ (a ∧ b)0 ≤1 a ∧ b0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 66 |
+
page_content=' From a ∧ b ≤ b we conclude b0 ≤1 (a ∧ b)0 according to (iii) and hence a ∧ b0 ≤1 a ∧ (a ∧ b)0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 67 |
+
page_content=' From (iii) of Theorem 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 68 |
+
page_content='1 there follows immediately x0 ∧ y0 ≤ (x ∧ y)0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 69 |
+
page_content=' Example 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 70 |
+
page_content='2.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 71 |
+
page_content=' Consider the meet-semilattice visualized in Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 72 |
+
page_content=' 1: 3 0 a b c Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 73 |
+
page_content=' 1 Meet-semilattice We have a = {b, c}0 = a00, 00 = {a, b, c}, a ∧ (a ∧ b)0 = a ∧ 00 = a ∧ {a, b, c} = {0, a} = a ∧ {a, c} = a ∧ b0 in accordance with (ii), (iv) and (viii) of Theorem 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 74 |
+
page_content='1, respectively.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 75 |
+
page_content=' Example 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 76 |
+
page_content='3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 77 |
+
page_content=' Consider the modular lattice L depicted in Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 78 |
+
page_content=' 2: 0 a b c d e f g h 1 Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 79 |
+
page_content=' 2 Modular lattice We have a00 = {g, h}0 = a, f 00 = {b, c}0 = f, a0 ∧ e0 = {g, h} ∧ d = d ̸= {g, h} = a0 = (a ∧ e)0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 80 |
+
page_content=' Hence a and f are sharp and the equality x0 ∧ y0 = (x ∧ y)0 does not hold in general.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 81 |
+
page_content=' In L from Figure 2 we have e0 = d and d0 = e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 82 |
+
page_content=' Since e ∧ d = 0 and e ∨ d = 1, {0, d, e, 1} is a complemented lattice.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 83 |
+
page_content=' If a0 is a singleton, it need not be a complement of a, even if the semilattice is a lattice.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 84 |
+
page_content=' E.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 85 |
+
page_content='g.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 86 |
+
page_content=', consider the four-element lattice with atoms a and b and with an additional greatest element 1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 87 |
+
page_content=' Then a0 = b, but a ∨ b ̸= 1, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 88 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 89 |
+
page_content=', a0 is not a complement of a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 90 |
+
page_content=' For every cardinal number n let Mn = (Mn, ∨, ∧) denote the bounded modular lattice of length 2 having n atoms.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 91 |
+
page_content=' The situation from Figure 2 can be generalized as follows.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 92 |
+
page_content=' 4 Remark 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 93 |
+
page_content='4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 94 |
+
page_content=' Every element of a direct product of a Boolean algebra and an arbitrary number of lattices Mn (possibly different n) is sharp.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 95 |
+
page_content=' This follows immediately from the fact that every element of a Boolean algebra and every element of the lattice Mn is sharp.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 96 |
+
page_content=' However, if the lattice L is not a direct product of two-element lattices and various Mn then the assertion of Remark 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 97 |
+
page_content='4 need not hold, see the following example.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 98 |
+
page_content=' Example 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 99 |
+
page_content='5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 100 |
+
page_content=' Consider the lattice visualized in Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 101 |
+
page_content=' 3: 0 a b c d e f g 1 Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 102 |
+
page_content=' 3 Lattice We have a00 = {b, c}0 = f ̸= a, a000 = f 0 = {b, c} = a0, b00 = {c, f}0 = b, (a0 ∧ b0)00 = ({b, c} ∧ {c, f})00 = {0, c}00 = {b, f}0 = c ̸= {0, c} = a0 ∧ b0, (c0 ∧ f 0)00 = ({b, f} ∧ {b, c})00 = {0, b}00 = {c, f}0 = b ̸= {0, b} = e0 ∧ f 0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 103 |
+
page_content=' Hence a is not sharp, b is sharp and the equality (x0 ∧ y0)00 = x0 ∧ y0 does not hold in general.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 104 |
+
page_content=' We are going to show that the operator 0 can be characterized by means of four simple conditions.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 105 |
+
page_content=' Theorem 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 106 |
+
page_content='6.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 107 |
+
page_content=' Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and 0 a unary operator on S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 108 |
+
page_content=' Then the following are equivalent: (i) x0 = Max{y ∈ S | x ∧ y = 0} for all x ∈ S, (ii) the operator 0 satisfies the following conditions: (P1) x0 is an antichain, 5 (P2) x ∧ 00 ≈1 x, (P3) x ∧ x0 ≈ 0, (P4) x ∧ (x ∧ y)0 ≈1 x ∧ y0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 109 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 110 |
+
page_content=' (i) ⇒ (ii): This follows from Theorem 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 111 |
+
page_content='1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 112 |
+
page_content=' (ii) ⇒ (i): If x ∧ y = 0 then according to (P2) and (P4) we have y ≈1 y ∧ 00 = y ∧ (x ∧ y)0 = y ∧ (y ∧ x)0 ≈1 y ∧ x0 ≤1 x0 and hence y ≤1 x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 113 |
+
page_content=' Conversely, if y ≤1 x0 then according to (P3) we have x ∧ y ≤1 x ∧ x0 = 0 and hence x ∧ y = 0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 114 |
+
page_content=' This shows that x ∧ y = 0 is equivalent to y ≤1 x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 115 |
+
page_content=' We conclude Max{y ∈ S | x ∧ y = 0} = Max{y ∈ S | y ≤1 x0} = x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 116 |
+
page_content=' The last equality can be seen as follows.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 117 |
+
page_content=' Let z ∈ Max{y ∈ S | y ≤1 x0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 118 |
+
page_content=' Then z ≤1 x0, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 119 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 120 |
+
page_content=' there exists some u ∈ x0 with z ≤ u.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 121 |
+
page_content=' We have u ≤1 x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 122 |
+
page_content=' Now z < u would imply z /∈ Max{y ∈ S | y ≤1 x0}, a contradiction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 123 |
+
page_content=' This shows z = u ∈ x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 124 |
+
page_content=' Conversely, assume z ∈ x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 125 |
+
page_content=' Then z ≤1 x0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 126 |
+
page_content=' If z /∈ Max{y ∈ S | y ≤1 x0} then there would exist some u ∈ S with z < u ≤1 x0 and hence there would exist some w ∈ x0 with z < u ≤ w contradicting (P1).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 127 |
+
page_content=' This shows z ∈ Max{y ∈ S | y ≤1 x0}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 128 |
+
page_content=' 4 Unsharp implication Now we extend the operation of relative pseudocomplementation to arbitrary meet- semilattices with 0 satisfying the ACC as follows: Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC, a, b ∈ S and A, B ⊆ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 129 |
+
page_content=' We define a → b := Max{x ∈ S | a ∧ x ≤ b}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 130 |
+
page_content=' Thus → is a binary operator on S assigning to every pair (x, y) ∈ S2 the non-void subset x → y ⊆ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 131 |
+
page_content=' It is evident that x0 = x → 0 for each x ∈ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 132 |
+
page_content=' Moreover, we define A → B := Max{x ∈ S | A ∧ x ≤ B}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 133 |
+
page_content=' Example 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 134 |
+
page_content='1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 135 |
+
page_content=' The “operation table” of the operator → in the meet-semilattice of Figure 1 looks as follows (we write abc instead of {a, b, c} and so on): → 0 a b c 0 abc abc abc abc a bc abc bc ab b ac ac abc ac c ab ab ab abc 6 Example 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 136 |
+
page_content='2.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 137 |
+
page_content=' The “operation table” of the operator → in the meet-semilattice of Figure 3 looks as follows (we write bc instead of {b,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 138 |
+
page_content=' c} and so on): → 0 a b c d e f g 1 0 1 1 1 1 1 1 1 1 1 a bc 1 bc bc 1 1 1 1 1 b cf cf 1 cf cf 1 cf 1 1 c bf bf bf 1 bf 1 bf 1 1 d bc g bc bc 1 g 1 g 1 e 0 f b c f 1 f 1 1 f bc g bc bc dg g 1 g 1 g 0 f b c f ef f 1 1 1 0 a b c d e f g 1 The following properties of the binary operator → can be proved.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 139 |
+
page_content=' Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 140 |
+
page_content='3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 141 |
+
page_content=' Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and a, b, c ∈ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 142 |
+
page_content=' Then the following holds: (i) a → b is an antichain, (ii) a ≤ b implies a → b = Max S, (iii) b ∈ Max S implies b ∈ a → b, (iv) b ≤1 a → b, (v) a ≤1 (a → b) → b, (vi) a ≤ b implies c → a ≤1 c → b and b → c ≤1 a → c.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 143 |
+
page_content=' (vii) a ∧ (a → b) ≈1 a ∧ b, (viii) a → (b ∧ c) ≈1 (a → b) ∧ (a → c), (ix) (a → b) ∧ b ≈1 b, (x) if S is bounded then 1 → b = b, (xi) a ∧ (b → b) ≈1 a, (xii) if S is bounded then a → b = 1 if and only if a ≤ b, (xiii) b ≤1 a → (a ∧ b).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 144 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 145 |
+
page_content=' (i) This is clear.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 146 |
+
page_content=' (ii), (iv), (x), (xii) and (xiii) follow immediately from the definition of →.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 147 |
+
page_content=' (iii) If b ∈ Max S then because of a∧b ≤ b we have b ∈ Max{x ∈ S | a∧x ≤ b} = a → b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 148 |
+
page_content=' (v) Since a ∧ x ≤ b for all x ∈ a → b we have a ∧ (a → b) ≤ b, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 149 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 150 |
+
page_content=' (a → b) ∧ a ≤ b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 151 |
+
page_content=' 7 (vi) If a ≤ b then {x ∈ S | c ∧ x ≤ a} ⊆ {x ∈ S | c ∧ x ≤ b}, {x ∈ S | b ∧ x ≤ c} ⊆ {x ∈ S | a ∧ x ≤ c}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 152 |
+
page_content=' (vii) We have a ∧ x ≤ b and hence a ∧ x ≤ a ∧ b for all x ∈ a → b and hence a ∧ b ≤1 a ∧ (a → b) ≤ a ∧ b according to (iv).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 153 |
+
page_content=' (viii) According to (vii) we have a → (b ∧ c) ≤1 (a → b) ∧ (a → c).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 154 |
+
page_content=' Conversely, assume d ∈ a → b and e ∈ a → c.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 155 |
+
page_content=' Then a∧d ≤ b and a∧e ≤ c and hence a∧(d∧e) ≤ b∧c which implies d ∧ e ≤1 a → (b ∧ c).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 156 |
+
page_content=' This shows (a → b) ∧ (a → c) ≤1 a → (b ∧ c).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 157 |
+
page_content=' (ix) We have b ≤1 a → b according to (iv) and hence b ≤1 (a → b) ∧ b ≤ b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 158 |
+
page_content=' (xi) According to (ii) we have a ≤1 Max S = b → b and hence a ≤1 a ∧ (b → b) ≤ a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 159 |
+
page_content=' From Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 160 |
+
page_content='3 it is evident that the binary operator → shares properties of the logical connective implication in intuitionistic logic despite the fact that it is unsharp, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 161 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 162 |
+
page_content=' for x, y ∈ S the result of x → y need not be a singleton.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 163 |
+
page_content=' Hence it extends the intuitionistic logic based on a Heyting algebra (L, ∨, ∧, ∗, 0) where again ∨ formalizes disjunction, ∧ formalizes conjunction, but now → formalizes unsharp implication and 0 formalizes unsharp negation.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 164 |
+
page_content=' Example 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 165 |
+
page_content='4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 166 |
+
page_content=' Consider the modular lattice visualized in Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 167 |
+
page_content=' 4: 0 a b c d e f 1 Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 168 |
+
page_content=' 4 Modular lattice Then e ≤1 {d, e} = {e, f} → e = (d → e) → e, d ∧ (d → e) = d ∧ {e, f} = c = d ∧ e, (d → e) ∧ e = {e, f} ∧ e = {c, e} ≈1 e in accordance with (v), (vii) and (ix) of Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 169 |
+
page_content='3, respectively.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 170 |
+
page_content=' 8 Remark 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 171 |
+
page_content='5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 172 |
+
page_content=' It is easy to see that the operation ∧ and the operator → are related by so-called unsharp adjointness, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 173 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 174 |
+
page_content=' a ∧ b ≤ c if and only if a ≤1 b → c.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 175 |
+
page_content=' Since the operation ∧ is associative, commutative and monotone, it can be considered as a t-norm.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 176 |
+
page_content=' Thus the semilattice (S, ∧, →) endowed with the operator → is an unsharply residuated semilattice.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 177 |
+
page_content=' Moreover, by (viii) of Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 178 |
+
page_content='3 we have a ∧ (a → b) ≈1 a ∧ b showing that (S, ∧, →) satisfies divisibility.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 179 |
+
page_content=' Similarly as for the unary operator 0 we can characterize the binary operator → on a meet-semilattice with 0 satisfying the ACC as follows.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 180 |
+
page_content=' Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 181 |
+
page_content='6.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 182 |
+
page_content=' Let (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC and → a binary operator on S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 183 |
+
page_content=' Then the following are equivalent: (i) x → y = Max{z ∈ S | x ∧ z ≤ y} for all x, y ∈ S, (ii) The operator → satisfies the following conditions: (R1) x → y is an antichain, (R2) x ∧ (x → y) ≈1 x ∧ y, (R3) (x → y) ∧ y ≈1 y, (R4) x → (y ∧ z) ≈1 (x → y) ∧ (x → z), (R5) x ∧ (y → y) ≈1 x, (R6) y ≤ z implies x → y ≤1 x → z.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 184 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 185 |
+
page_content=' (i) ⇒ (ii): This follows from Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 186 |
+
page_content='3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 187 |
+
page_content=' (ii) ⇒ (i): If x ∧ z ≤ y then according to (R3), (R5), (R4) and (R6) we have z ≈1 (x → z) ∧ z ≤1 x → z ≈1 (x → x) ∧ (x → z) ≈1 x → (x ∧ z) ≤1 x → y and hence z ≤1 x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 188 |
+
page_content=' Conversely, if z ≤1 x → y then according to (R2) we have x ∧ z ≤1 x ∧ (x → y) ≈1 x ∧ y ≤ y and hence x∧z ≤ y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 189 |
+
page_content=' This shows that x∧z ≤ y is equivalent to z ≤1 x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 190 |
+
page_content=' We conclude Max{z ∈ S | x ∧ z ≤ y} = Max{z ∈ S | z ≤1 x → y} = x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 191 |
+
page_content=' The last equality can be seen as follows.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 192 |
+
page_content=' Let u ∈ Max{z ∈ S | z ≤1 x → y}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 193 |
+
page_content=' Then u ≤1 x → y, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 194 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 195 |
+
page_content=' there exists some v ∈ x → y with u ≤ v.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 196 |
+
page_content=' We have v ≤1 x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 197 |
+
page_content=' Now u < v would imply u /∈ Max{z ∈ S | z ≤1 x → y}, a contradiction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 198 |
+
page_content=' This shows u = v ∈ x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 199 |
+
page_content=' Conversely, assume u ∈ x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 200 |
+
page_content=' Then u ≤1 x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 201 |
+
page_content=' If u /∈ Max{z ∈ S | z ≤1 x → y} then there would exist some v ∈ S with u < v ≤1 x → y and hence there would exist some w ∈ x → y with u < v ≤ w contradicting (R1).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 202 |
+
page_content=' This shows u ∈ Max{z ∈ S | z ≤1 x → y}.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 203 |
+
page_content=' 9 Example 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 204 |
+
page_content='7.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 205 |
+
page_content=' Consider the lattice from Figure 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 206 |
+
page_content=' Then d ∧ (d → e) = d ∧ {e, f} = c = d ∧ e, (d → e) ∧ e = e ∧ e = e, d → (e ∧ f) = d → c = {e, f} ≈1 {c, e, f} = {e, f} ∧ {e, f} = (d → e) ∧ (d → f) in accordance with (R2), (R3) and (R4), respectively.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 207 |
+
page_content=' 5 Deductive systems It is well-known that the connective implication in intuitionistic logic is closely related to the so-called deductive systems in the corresponding Brouwerian semilattice.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 208 |
+
page_content=' In what follows we show that a certain modification of the concept of a deductive system plays a similar role for logics with unsharp implication.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 209 |
+
page_content=' We define Definition 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 210 |
+
page_content='1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 211 |
+
page_content=' A deductive system of a meet-semilattice S = (S, ∧, 0) with 0 satisfying the ACC is a subset D of S satisfying the following conditions for x, y ∈ S: (D1) (Max S) ∩ D ̸= ∅, (D2) x ∈ D and (x → y) ∩ D ̸= ∅ imply y ∈ D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 212 |
+
page_content=' Recall that a filter of a meet-semilattice S = (S, ∧) is a non-empty subset F of S satisfying the following conditions for x, y ∈ S: (F1) x, y ∈ F implies x ∧ y ∈ F, (F2) x ∈ F and x ≤ y imply y ∈ F.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 213 |
+
page_content=' It is clear that if S is finite then all filters of S are given by the sets [x) := {y ∈ S | x ≤ y}, x ∈ S, and hence the poset of all filters of S is dually isomorphic to S and therefore a join-semilattice where [x) ∨ [y) = [x ∧ y) for all x, y ∈ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 214 |
+
page_content=' For every non-empty subset A of the universe of a meet-semilattice (S, ∧) we define a binary relation Θ(A) on S as follows: (x, y) ∈ Θ(A) if there exists some a ∈ A with x ∧ a = y ∧ a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 215 |
+
page_content=' Although the following result is known, for the reader’s convenience we present the proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 216 |
+
page_content=' Lemma 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 217 |
+
page_content='2.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 218 |
+
page_content=' Let S = (S, ∧, 1) be a meet-semilattice with 1 and Φ ∈ Con S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 219 |
+
page_content=' Then the following holds: (i) [1]Φ is an filter of S, (ii) Θ([1]Φ) ⊆ Φ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 220 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 221 |
+
page_content=' (i) (F1) If a, b ∈ [1]Φ then a ∧ b ∈ [1 ∧ 1]Φ = [1]Φ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 222 |
+
page_content=' 10 (F2) If a ∈ [1]Φ, b ∈ S and a ≤ b then b = 1 ∧ b ∈ [a ∧ b]Φ = [a]Φ = [1]Φ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 223 |
+
page_content=' This shows that [1]Φ is a filter of S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 224 |
+
page_content=' (ii) If (a, b) ∈ Θ([1]Φ) then there exists some c ∈ [1]Φ with a ∧ c = b ∧ c whence a = a ∧ 1 Φ a ∧ c = b ∧ c Φ b ∧ 1 = b which shows (a, b) ∈ Φ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 225 |
+
page_content=' Although our definition of a deductive system differs from that known for relatively pseudocomplemented semilattices, we are still able to prove the following relationships between the concepts mentioned before.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 226 |
+
page_content=' Theorem 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 227 |
+
page_content='3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 228 |
+
page_content=' Let S = (S, ∧, 0, 1) be a bounded meet-semilattice satisfying the ACC and D a non-empty subset of S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 229 |
+
page_content=' Then the following are equivalent: (i) D a deductive system of S, (ii) D is an filter of S, (iii) Θ(D) ∈ Con S and D = [1] � Θ(D) � .' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 230 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 231 |
+
page_content=' (i) ⇒ (ii): (F2) Assume a ∈ D, b ∈ S and a ≤ b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 232 |
+
page_content=' Then a → b = Max S because of (ii) of Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 233 |
+
page_content='3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 234 |
+
page_content=' According to (D1) we have (a → b) ∩ D = Max S ∩ D ̸= ∅ and hence b ∈ D by (D2).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 235 |
+
page_content=' (F1) Let a, b ∈ D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 236 |
+
page_content=' Then by (xiii) of Theorem 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 237 |
+
page_content='3 we have b ≤1 a → (a ∧ b).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 238 |
+
page_content=' Hence there exists some c ∈ a → (a ∧ b) with b ≤ c.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 239 |
+
page_content=' Now (F2) implies c ∈ D and therefore � a → (a ∧ b) � ∩ D ̸= ∅ from which we conclude a ∧ b ∈ D by (D2).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 240 |
+
page_content=' (ii) ⇒ (iii): Evidently, Θ(D) is reflexive and symmetric.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 241 |
+
page_content=' Let (a, b), (b, c) ∈ Θ(D).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 242 |
+
page_content=' Then there exist d, e ∈ D with a ∧ d = b ∧ d and b ∧ e = c ∧ e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 243 |
+
page_content=' Because of (F1) we conclude d ∧ e ∈ D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 244 |
+
page_content=' Now a ∧ (d ∧ e) = (a ∧ d) ∧ e = (b ∧ d) ∧ e = (b ∧ e) ∧ d = (c ∧ e) ∧ d = c ∧ (d ∧ e) which yields (a, c) ∈ Θ(D), i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 245 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 246 |
+
page_content=' Θ(D) is transitive.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 247 |
+
page_content=' Further, if f ∈ S then (a ∧ f) ∧ d = (a ∧ d) ∧ f = (b ∧ d) ∧ f = (b ∧ f) ∧ d showing (a ∧ f, b ∧ f) ∈ Θ(D).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 248 |
+
page_content=' Hence Θ(D) ∈ Con S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 249 |
+
page_content=' If a ∈ D then because of a ∧ a = a = 1 ∧ a we have a ∈ [1] � Θ(D) � showing D ⊆ [1] � Θ(D) � .' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 250 |
+
page_content=' Conversely, assume a ∈ [1] � Θ(D) � .' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 251 |
+
page_content=' Then there exists some b ∈ D with a ∧ b = 1 ∧ b.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 252 |
+
page_content=' This implies b ≤ a wherefrom we conclude a ∈ D by (F2) showing [1] � Θ(D) � ⊆ D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 253 |
+
page_content=' (iii) ⇒ (i): 11 (D1) If a ∈ D then, since S satisfies the ACC, there exists some b ∈ Max S with a ≤ b and hence b = 1 ∧ b ∈ [a ∧ b] � Θ(D) � = [a] � Θ(D) � = [1] � Θ(D) � = D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 254 |
+
page_content=' (D2) If a ∈ D, b ∈ S and (a → b) ∩ D ̸= ∅ then there exists some c ∈ D with c ∈ a → b and hence a ∧ c ≤ b whence b = 1∧1∧b ∈ [a∧c∧b] � Θ(D) � = [a∧c] � Θ(D) � = [1∧1] � Θ(D) � = [1] � Θ(D) � = D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 255 |
+
page_content=' It is well known that for a filter F of a relatively pseudocomplemented semilattice we have (a, b) ∈ Θ(F) if and only if a → b ∈ F and b → a ∈ F.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 256 |
+
page_content=' However, we can modify this result also for an arbitrary meet-semilattice with 0 satisfying the ACC provided our unsharp implication is considered.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 257 |
+
page_content=' Proposition 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 258 |
+
page_content='4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 259 |
+
page_content=' Let S = (S, ∧, 0) be a meet-semilattice with 0 satisfying the ACC, F a filter of S and a, b ∈ S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 260 |
+
page_content=' Then the following are equivalent: (i) (a, b) ∈ Θ(F), (ii) (a → b) ∩ F ̸= ∅ and (b → a) ∩ F ̸= ∅.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 261 |
+
page_content=' Proof.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 262 |
+
page_content=' (i) ⇒ (ii): There exists some c ∈ F with a ∧ c = b ∧ c.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 263 |
+
page_content=' Hence a ∧ c ≤ b and b ∧ c ≤ a and therefore there exists some d ∈ a → b with c ≤ d and some e ∈ b → a with c ≤ e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 264 |
+
page_content=' Because of (F2) we conclude d, e ∈ F showing (ii).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 265 |
+
page_content=' (ii) ⇒ (i): Let c ∈ (a → b)∩F and d ∈ (b → a)∩F.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 266 |
+
page_content=' Then c∧d ∈ F by (F1), a∧c ≤ b and b∧d ≤ a.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 267 |
+
page_content=' Hence a ∧ (c ∧ d) = (a ∧ c) ∧ (c ∧ d) ≤ b ∧ (c ∧ d) = (b ∧ d) ∧ (c ∧ d) ≤ a ∧ (c ∧ d), i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 268 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 269 |
+
page_content=' a ∧ (c ∧ d) = b ∧ (c ∧ d) showing (i).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 270 |
+
page_content=' Conclusion Although the implication within the logic based on the structure (S, ∧, 0, →) is unsharp, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 271 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 272 |
+
page_content=' x → y may be a subset I of S which need not be a singleton, it has its logical meaning.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 273 |
+
page_content=' Namely, we ask that x → y is the maximal element c of S satisfying x ∧ c ≤ y (where ∧ denotes conjunction).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 274 |
+
page_content=' And for each c ∈ I this is satisfied.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 275 |
+
page_content=' Moreover, the elements of I are mutually incomparable.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 276 |
+
page_content=' Thus we have no need to prefer one of them with respect to others.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 277 |
+
page_content=' However, the expression x ∧ (x → y) ≤ y is nothing else than the derivation rule Modus Ponens (both in classical as well as in non-classical logic) since it properly says that the truth value of y cannot be less than the truth value of the conjunction x ∧ (x → y) of x and the implication x → y.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 278 |
+
page_content=' Hence, despite of the fact of unsharpness, such a logic is sound although it is derived from an arbitrary meet-semilattice with 0 satisfying the ACC.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 279 |
+
page_content=' 12 References [1] L.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 280 |
+
page_content=' E.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 281 |
+
page_content=' J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 282 |
+
page_content=' Brouwer, De onbetrouwbaarheid der logische principes.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 283 |
+
page_content=' Tijdschrift Wijs- begeerte 2 (1908), 152–158.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 284 |
+
page_content=' [2] L.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 285 |
+
page_content=' E.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 286 |
+
page_content=' J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 287 |
+
page_content=' Brouwer, Intuitionism and formalism.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 288 |
+
page_content=' Bull.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 289 |
+
page_content=' Amer.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 290 |
+
page_content=' Math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 291 |
+
page_content=' Soc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 292 |
+
page_content=' 20 (1913), 81–96.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 293 |
+
page_content=' [3] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 294 |
+
page_content=' Chajda, An extension of relative pseudocomplementation to non-distributive lat- tices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 295 |
+
page_content=' Acta Sci.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 296 |
+
page_content=' Math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 297 |
+
page_content=' (Szeged) 69 (2003), 491–496.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 298 |
+
page_content=' [4] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 299 |
+
page_content=' Chajda, Pseudocomplemented and Stone posets.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 300 |
+
page_content=' Acta Univ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 301 |
+
page_content=' Palack.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 302 |
+
page_content=' Olomuc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 303 |
+
page_content=' Fac.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 304 |
+
page_content=' Rerum Natur.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 305 |
+
page_content=' Math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 306 |
+
page_content=' 51 (2012), 29–34.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 307 |
+
page_content=' [5] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 308 |
+
page_content=' Chajda and H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 309 |
+
page_content=' L¨anger, Algebras describing pseudocomplemented, relatively pseu- docomplemented and sectionally pseudocomplemented posets.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 310 |
+
page_content=' Symmetry 13 (2021), 753 (17 pp.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 311 |
+
page_content=') [6] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 312 |
+
page_content=' Chajda and H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 313 |
+
page_content=' L¨anger, Implication in finite posets with pseudocomplemented sections.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 314 |
+
page_content=' Soft Computing 26 (2022), 5945–5953.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 315 |
+
page_content=' [7] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 316 |
+
page_content=' Chajda and H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 317 |
+
page_content=' L¨anger, The logic of orthomodular posets of finite height.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 318 |
+
page_content=' Log.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 319 |
+
page_content=' J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 320 |
+
page_content=' IGPL 30 (2022), 143–154.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 321 |
+
page_content=' [8] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 322 |
+
page_content=' Chajda and H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 323 |
+
page_content=' L¨anger, Operator residuation in orthomodular posets of finite height.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 324 |
+
page_content=' Fuzzy Sets Systems (submitted).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 325 |
+
page_content=' [9] I.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 326 |
+
page_content=' Chajda, H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 327 |
+
page_content=' L¨anger and J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 328 |
+
page_content=' Paseka, Sectionally pseudocomplemented posets.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 329 |
+
page_content=' Order 38 (2021), 527–546.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 330 |
+
page_content=' [10] D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 331 |
+
page_content=' Fazio, A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 332 |
+
page_content=' Ledda and F.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 333 |
+
page_content=' Paoli, On Finch’s conditions for the completion of ortho- modular posets.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 334 |
+
page_content=' Found.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 335 |
+
page_content=' Sci.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 336 |
+
page_content=' (2020), https://doi.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 337 |
+
page_content='org/10.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 338 |
+
page_content='1007/s10699-020-09702-z.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 339 |
+
page_content=' [11] P.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 340 |
+
page_content=' D.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 341 |
+
page_content=' Finch, On orthomodular posets.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 342 |
+
page_content=' J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 343 |
+
page_content=' Austral.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 344 |
+
page_content=' Math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 345 |
+
page_content=' Soc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 346 |
+
page_content=' 11 (1970), 57–62.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 347 |
+
page_content=' [12] O.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 348 |
+
page_content=' Frink, Pseudo-complements in semi-lattices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 349 |
+
page_content=' Duke Math.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 350 |
+
page_content=' J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 351 |
+
page_content=' 29 (1962), 505–514.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 352 |
+
page_content=' [13] R.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 353 |
+
page_content=' Giuntini and H.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 354 |
+
page_content=' Greuling, Toward a formal language for unsharp properties.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 355 |
+
page_content=' Found.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 356 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 357 |
+
page_content=' 19 (1989), 931–945.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 358 |
+
page_content=' [14] A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 359 |
+
page_content=' Heyting, Die formalen Regeln der intuitionistischen Logik.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 360 |
+
page_content=' Sitzungsber.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 361 |
+
page_content=' Akad.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 362 |
+
page_content=' Berlin 1930, 42–56.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 363 |
+
page_content=' [15] P.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 364 |
+
page_content=' K¨ohler, Brouwerian semilattices: the lattice of total subalgebras.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 365 |
+
page_content=' Banach Center Publ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 366 |
+
page_content=' 9 (1982), 47–56.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 367 |
+
page_content=' [16] A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 368 |
+
page_content=' Monteiro, Axiomes ind´ependants pour les alg`ebres de Brouwer.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 369 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 370 |
+
page_content=' Un.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 371 |
+
page_content=' Mat.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 372 |
+
page_content=' Argentina 17 (1955), 149–160.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 373 |
+
page_content=' [17] L.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 374 |
+
page_content=' Monteiro, Les alg`ebres de Heyting et de Lukasiewicz trivalentes.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 375 |
+
page_content=' Notre Dame J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 376 |
+
page_content=' Formal Logic 11 (1970), 453–466.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 377 |
+
page_content=' [18] P.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 378 |
+
page_content=' Pt´ak and S.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 379 |
+
page_content=' Pulmannov´a, Orthomodular Structures as Quantum Logics.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 380 |
+
page_content=' Kluwer, Dordrecht 1991.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 381 |
+
page_content=' ISBN 0-7923-1207-4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 382 |
+
page_content=' 13 Authors’ addresses: Ivan Chajda Palack´y University Olomouc Faculty of Science Department of Algebra and Geometry 17.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 383 |
+
page_content=' listopadu 12 771 46 Olomouc Czech Republic ivan.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 384 |
+
page_content='chajda@upol.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 385 |
+
page_content='cz Helmut L¨anger TU Wien Faculty of Mathematics and Geoinformation Institute of Discrete Mathematics and Geometry Wiedner Hauptstraße 8-10 1040 Vienna Austria, and Palack´y University Olomouc Faculty of Science Department of Algebra and Geometry 17.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 386 |
+
page_content=' listopadu 12 771 46 Olomouc Czech Republic helmut.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 387 |
+
page_content='laenger@tuwien.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 388 |
+
page_content='ac.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
| 389 |
+
page_content='at 14' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/GtE0T4oBgHgl3EQfRQCY/content/2301.02205v1.pdf'}
|
HdE0T4oBgHgl3EQfRgBm/content/tmp_files/2301.02208v1.pdf.txt
ADDED
|
@@ -0,0 +1,1183 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
Do Users Want Platform Moderation or Individual Control?
|
| 2 |
+
Examining the Role of Third-Person Effects and Free Speech
|
| 3 |
+
Support in Shaping Moderation Preferences
|
| 4 |
+
Shagun Jhaver, Amy Zhang
|
| 5 |
+
Online platforms employ commercial content moderators and use automated systems to identify and remove
|
| 6 |
+
the most blatantly inappropriate content for all users. They also provide moderation settings that let users
|
| 7 |
+
personalize their preferences for which posts they want to avoid seeing. This study presents the results of a
|
| 8 |
+
nationally representative survey of 984 US adults. We examine how users would prefer for three categories of
|
| 9 |
+
norm-violating content (hate speech, sexually explicit content, and violent content) to be regulated.
|
| 10 |
+
Specifically, we analyze whether users prefer platforms to remove such content for all users or leave it up to
|
| 11 |
+
each user to decide if and how much they want to moderate it. We explore the influence of presumed effects
|
| 12 |
+
on others (PME3) and support for freedom of expression on user attitudes, the two critical factors identified
|
| 13 |
+
as relevant for social media censorship attitudes by prior literature, about this choice. We find perceived
|
| 14 |
+
negative effects on others and free speech support as significant predictors of preference for having personal
|
| 15 |
+
moderation settings over platform-directed moderation for regulating each speech category. Our findings
|
| 16 |
+
show that platform governance initiatives need to account for both the actual and perceived media effects of
|
| 17 |
+
norm-violating speech categories to increase user satisfaction. Our analysis also suggests that people do not
|
| 18 |
+
see personal moderation tools as an infringement on others’ free speech but as a means to assert greater
|
| 19 |
+
agency to shape their social media feeds.
|
| 20 |
+
And then there were what I'll call the technolibertarians. For them, MUD rapists were of
|
| 21 |
+
course assholes, but the presence of assholes on the system was a technical inevitability, like
|
| 22 |
+
noise on a phone line, and best dealt with not through repressive social disciplinary
|
| 23 |
+
mechanisms but through the timely deployment of defensive software tools. Some asshole
|
| 24 |
+
blasting violent, graphic language at you? Don't whine to the authorities about it – hit the
|
| 25 |
+
@gag command and the asshole's statements will be blocked from your screen (and only
|
| 26 |
+
yours). It's simple, it's effective, and it censors no one. – Excerpt from “A Rape in Cyberspace”
|
| 27 |
+
by Julian Dibbell [7]
|
| 28 |
+
Introduction
|
| 29 |
+
With the emergence of social media sites and their widespread use by people to
|
| 30 |
+
communicate with one another, companies like Facebook, Twitter, and YouTube have
|
| 31 |
+
become the new governors of digital expression. At the same time, individuals who use
|
| 32 |
+
these sites can also actively shape governance in various ways. For example, they may flag
|
| 33 |
+
posts that violate community policy, downvote inappropriate posts, serve as volunteer
|
| 34 |
+
moderators, engage in counter-speech, or configure moderation settings to automate
|
| 35 |
+
inappropriate post removals. We are therefore moving towards a “pluralist model of
|
| 36 |
+
speech regulation [1],” in which speech must be regulated in a multi-stakeholder fashion –
|
| 37 |
+
legislative entities enforce online speech laws, and platform operators set up governance
|
| 38 |
+
regimes of acceptable content. However, users themselves can also intervene against
|
| 39 |
+
content perceived as problematic.
|
| 40 |
+
|
| 41 |
+
This move to a pluralist model is occurring against recent controversies over platforms’
|
| 42 |
+
moderation decisions [32, 47] and growing media, policymakers, and public calls to better
|
| 43 |
+
regulate their content [51]. In response, platforms have begun investing more resources
|
| 44 |
+
into improving how inappropriate posts are detected and removed from their sites. We
|
| 45 |
+
focus in this article on platforms’ offering of personal moderation tools that let end-users
|
| 46 |
+
configure content moderation of the posts they see to align with their content preferences.
|
| 47 |
+
We are primarily concerned with tools offered by platforms such as Instagram and Twitch
|
| 48 |
+
that let users specify their sensitivity to specific topical categories such as sexually explicit
|
| 49 |
+
content and hate speech. Configuring such tools lets users have the moderation system
|
| 50 |
+
operate in alignment with their tastes and thresholds. From the perspective of platforms, a
|
| 51 |
+
tactical consequence of offering personal moderation tools is that the obligation of making
|
| 52 |
+
hard moderation decisions, the concomitant responsibility of making mistakes with them,
|
| 53 |
+
and the cognitive labor of making the correct configurations are passed over to the users.
|
| 54 |
+
Therefore, it is vital that we understand how users consider the choice between platform
|
| 55 |
+
versus personal moderation.
|
| 56 |
+
Our research responds to calls by governance scholars to conduct more survey-based
|
| 57 |
+
research to understand users’ perspectives on moderation interventions by different
|
| 58 |
+
regulatory actors [8, 41]. So far, we have little knowledge of how end-users perceive being
|
| 59 |
+
given self-regulating authority through personal moderation tools. We do not know the
|
| 60 |
+
situations in which users prefer to have a choice in shaping moderation and when they
|
| 61 |
+
would instead prefer the platforms manage it for every user – and the different factors that
|
| 62 |
+
shape these preferences.
|
| 63 |
+
Informed by the third-person effects (TPE) hypothesis, we fill this gap by examining users’
|
| 64 |
+
preferences in the context of three norm-violating speech categories that have been studied
|
| 65 |
+
in prior literature: (1) Hate speech; (2) Sexually explicit content; and (3) Violent content.
|
| 66 |
+
Previous research has shown that perceptions of the effects of media messages on others
|
| 67 |
+
predict censorship attitudes [42, 44]. We examine the role that third-person effects [6] play
|
| 68 |
+
in shaping user attitudes about deploying platform-enacted versus personal moderation
|
| 69 |
+
tools.
|
| 70 |
+
We also connect our findings to the scholarship on understanding public attitudes toward
|
| 71 |
+
freedom of expression and its consequences. Free speech is a core constitutional right
|
| 72 |
+
highly valued by many Americans. However, the introduction of personal moderation tools
|
| 73 |
+
offers affordances that complicate the question of preserving free speech – users may
|
| 74 |
+
configure tools to avoid specific content categories. Still, others may continue to see the
|
| 75 |
+
same content, thereby preventing infringement of online expressions. However, if most
|
| 76 |
+
users choose to deploy these tools, specific content categories would have significantly
|
| 77 |
+
reduced visibility. Therefore, we analyze how users’ support for freedom of expression
|
| 78 |
+
shapes their notion of different moderation approaches.
|
| 79 |
+
Understanding the public views on the platform and user-enacted interventions can
|
| 80 |
+
stimulate debates about the roles and strategies of various regulatory actors. It can also
|
| 81 |
+
speak to calls for evidence-based policymaking [30, 40] by clarifying how the public
|
| 82 |
+
understands moderation practices and identifying the gaps between policy and public
|
| 83 |
+
demands [36, 37, 41]. Given the rapid introduction of new moderation strategies by the
|
| 84 |
+
|
| 85 |
+
platforms, especially personal moderation tools, independent academic assessments of
|
| 86 |
+
users’ attitudes on their deployment are vital. Platforms can also benefit from such
|
| 87 |
+
research by understanding end-users' acceptance or rejection of various regulatory
|
| 88 |
+
practices and the factors that shape those perspectives. Further, examinations of the public
|
| 89 |
+
perception of free speech within the context of online activity may also shape attempts to
|
| 90 |
+
protect free speech in the long run.
|
| 91 |
+
Literature Review and Hypotheses
|
| 92 |
+
The Perceptual Component of the TPE
|
| 93 |
+
Since Davison [6] first argued that individuals perceive media’s impact on the attitudes and
|
| 94 |
+
behaviors of others to be greater than it is on themselves, many studies have shown this
|
| 95 |
+
discrepancy to be consistent across a range of contexts [49] such as political ads [16, 38],
|
| 96 |
+
news stories [39] and social media use [46]. This hypothesis, termed by Davison as the
|
| 97 |
+
third-person effect (TPE) [6], has become a widely applied perspective to explain public
|
| 98 |
+
opinion on the media censorship [19-21, 33]. The TPE hypothesis has two major
|
| 99 |
+
components – the perceptual and behavioral components [18]. The perceptual component
|
| 100 |
+
predicts that presumed media effects on others (PME3) tend to be greater than perceived
|
| 101 |
+
media effects on self (PME1). In the context of social media messages’ influence, the
|
| 102 |
+
perceptual component of TPE predicts that participants will consider others to be more
|
| 103 |
+
negatively influenced by each category of norm-violating speech than themselves. We,
|
| 104 |
+
therefore, raise the following hypothesis:
|
| 105 |
+
H1: For each norm-violating speech category, participants will perceive a greater effect of
|
| 106 |
+
that speech on others than on themselves.
|
| 107 |
+
The Behavioral Component of the TPE
|
| 108 |
+
The behavioral component of the TPE argues that when individuals perceive the greater
|
| 109 |
+
impact of media messages on others than on themselves, they will take remedial actions to
|
| 110 |
+
mitigate the perceived harmful effects [20]. Davison [6] described the phenomenon of
|
| 111 |
+
censorship as one of the most interesting behavioral consequences of third-person
|
| 112 |
+
perception. Prior research on TPE consequences shows that it leads to censorship support
|
| 113 |
+
[15, 19, 44], and the effects are particularly salient when persuasive attempts may include
|
| 114 |
+
socially undesirable effects [28]. In studying TPE effects on censorship attitudes, some
|
| 115 |
+
researchers have examined the consequences of the other-self perceptual disparity in
|
| 116 |
+
media effects (DME = PME3 – PME1). In contrast, others have focused on the perceived
|
| 117 |
+
media impact on others (PME3) [42]. Examining past research data on TPE consequences,
|
| 118 |
+
Chung and Moon [5] concluded that the media’s presumed effect on others (PME3) is a
|
| 119 |
+
stronger predictor of censorship attitudes than the other-self disparity in the perceived
|
| 120 |
+
media effects. We, therefore, choose PME3 as our primary predictor variable and raise the
|
| 121 |
+
following hypothesis:
|
| 122 |
+
H2: For each speech category, the perceived effects of that speech on others will be
|
| 123 |
+
positively related to support for the platform’s banning of that category.
|
| 124 |
+
|
| 125 |
+
Researchers of TPE have long been curious about the potential behaviors that could result
|
| 126 |
+
from the perceived media impact on others. In addition to censorship support, prior
|
| 127 |
+
studies have interrogated behavioral outcomes such as engaging in political action [10, 43,
|
| 128 |
+
50], disseminating opposing information [3, 17], and exposing apparent biases [2, 29]. In
|
| 129 |
+
the context of online content moderation, Jang and Kim found that people with a greater
|
| 130 |
+
level of third-person perception were more likely to support media literacy interventions
|
| 131 |
+
to address fake news [22]. We add to previous efforts to surface the different types of
|
| 132 |
+
behavioral consequences of TPE by examining its impact on users’ support for having
|
| 133 |
+
personal moderation settings to moderate norm-violating content. Since such
|
| 134 |
+
configurations are also a form of regulation, prior TPE research suggests that PME3 would
|
| 135 |
+
predict support for them [19, 42]. The following hypothesis thus can be raised:
|
| 136 |
+
H3: For each speech category, the perceived effects of that speech on others will be
|
| 137 |
+
positively related to support for having personal moderation tools to regulate the speech of
|
| 138 |
+
that category.
|
| 139 |
+
Platform-enacted moderation and personal configurations to self-moderate content are
|
| 140 |
+
different ways to regulate norm-violating speech. However, while platform-enacted
|
| 141 |
+
moderation censors content platform-wide, personal moderation tools allow users to
|
| 142 |
+
adjust whether and how much norm-violating speech they are willing to encounter
|
| 143 |
+
personally. Prior literature generally predicts that TPE would lead to support for
|
| 144 |
+
censorship attitudes [5, 19]. However, it does not guide how people will react to a choice
|
| 145 |
+
between letting platforms handle a specific content category and allowing users to specify
|
| 146 |
+
their moderation preferences for that category. We, therefore, ask the following research
|
| 147 |
+
question:
|
| 148 |
+
RQ1: For each speech category, how do its perceived effects on others relate to support for
|
| 149 |
+
the platform’s banning of that category versus support for having personal moderation
|
| 150 |
+
tools regulate it?
|
| 151 |
+
Support for Freedom of Speech
|
| 152 |
+
Discussions about the benefits of moderation measures are always intertwined with the
|
| 153 |
+
issue of freedom of speech. In the United States, the constitution protects the right to free
|
| 154 |
+
expression as a fundamental human right. However, platforms are private parties. Section
|
| 155 |
+
230 of the Communications Decency Act of 1996 provides them the legislative freedom to
|
| 156 |
+
police their users as they see fit while not being held accountable for errors or oversights
|
| 157 |
+
[13, 34]. Additionally, experts have shown that despite Americans’ support for freedom of
|
| 158 |
+
expression generally, their tolerance for hate speech is low [12, 48, 52]. Thus, people’s
|
| 159 |
+
acceptance of free speech in the abstract may not automatically imply their tolerance for
|
| 160 |
+
opposing expressions [20]. Examining how much people's support for free speech affects
|
| 161 |
+
their opinions about varied moderation strategies may help us better understand this
|
| 162 |
+
discrepancy in the context of social media platforms.
|
| 163 |
+
Support for free speech and attitudes toward content moderation have been linked in
|
| 164 |
+
previous studies. For instance, Naab et al. showed that people who commit to freedom of
|
| 165 |
+
expression are less likely to support restrictive actions by Facebook moderators [36]. Guo
|
| 166 |
+
|
| 167 |
+
and Johnson showed that a lack of support for freedom of speech predicts support for
|
| 168 |
+
government regulation of sexist hate speech [20]. However, they did not find that the
|
| 169 |
+
former could predict supportive attitudes toward platform censorship. Jang and Kim
|
| 170 |
+
suggested that support for free expression decreases support for regulating fake news
|
| 171 |
+
despite the existence of third-person effects [22]. Overall, this body of research indicates
|
| 172 |
+
that participants’ support for platform regulation will decline as free speech support
|
| 173 |
+
increases. We, therefore, raise the following hypotheses:
|
| 174 |
+
H4: For each speech category, participants’ support for freedom of expression will be
|
| 175 |
+
negatively related to their support for the platform’s banning of that category.
|
| 176 |
+
While prior research provides guidance on the expected relationship between free speech
|
| 177 |
+
support and support for platform-enacted moderation, the literature on personal
|
| 178 |
+
moderation tools is scarce. It does not offer any direct guidance on the relationship
|
| 179 |
+
between support for free speech and support for having personal moderation tools.
|
| 180 |
+
However, there is some prior work that speaks to related issues. For example, Naab et al.
|
| 181 |
+
did not find a relationship between users’ commitment to free speech and their intention to
|
| 182 |
+
engage in corrective actions such as rebuking the comment author or reporting the
|
| 183 |
+
comment [36]. It is unclear whether that finding would apply to our context since
|
| 184 |
+
deploying personal moderation tools is a restrictive action, not a corrective action. Its
|
| 185 |
+
expected costs (e.g., setting up once for personal moderation v/s reporting every
|
| 186 |
+
inappropriate post; experiencing retaliation when engaging in counter-speech v/s private
|
| 187 |
+
post removals for personal moderation) are also lower. Riedl et al. conducted a survey that
|
| 188 |
+
showed that individuals’ support for free speech does not increase their assumed self-
|
| 189 |
+
responsibility to intervene against problematic comments [41]. However, they did not
|
| 190 |
+
specify to the survey takers what type of responsibility they should carry out. Besides, in
|
| 191 |
+
our study context, users may not consider personal moderation tools an obligation.
|
| 192 |
+
On the one hand, support for free speech values should reduce support for restrictive
|
| 193 |
+
actions of any kind. But on the other hand, people may perceive personal moderation tools
|
| 194 |
+
as simply having a greater agency to shape what they see and not an infringement on the
|
| 195 |
+
free speech of others. In this way, personal moderation tools allow a distinction between
|
| 196 |
+
freedom of speech and the obligation to be heard. To clarify the direction of this
|
| 197 |
+
relationship, we ask the following research question:
|
| 198 |
+
RQ2: Does participants’ support for freedom of expression relate to their support for
|
| 199 |
+
having personal moderation tools?
|
| 200 |
+
When faced with a choice between letting platforms handle a certain content category and
|
| 201 |
+
allowing users to specify their moderation preferences, we expect the latter to be perceived
|
| 202 |
+
as more free speech preserving. It lets users decide whether and how many content
|
| 203 |
+
removals should occur instead of allowing platforms to handle those same decisions
|
| 204 |
+
unilaterally. We, therefore, raise the following hypothesis:
|
| 205 |
+
|
| 206 |
+
H5: For each speech category, participants’ support for freedom of expression will be
|
| 207 |
+
related to greater support for having personal moderation tools to moderate that category
|
| 208 |
+
than their support for the platform’s banning of that category.
|
| 209 |
+
Methods
|
| 210 |
+
Our study was considered exempt from review by the University of Washington IRB. We
|
| 211 |
+
recruited participants through Lucid,1 a survey company that provides researchers access
|
| 212 |
+
to nationally representative samples. Our inclusion criterion for the survey participants
|
| 213 |
+
was all adult internet users in the US. We paid participants through the Lucid system.
|
| 214 |
+
We designed our survey questions to test the hypotheses identified in the previous section
|
| 215 |
+
and adapted survey instruments from relevant prior literature to test some measures. We
|
| 216 |
+
describe these measures in more detail below. To increase the validity of the survey, we
|
| 217 |
+
sought feedback on an early draft of the survey questionnaire from other students at the
|
| 218 |
+
authors’ institutions. Nine students who were not involved with the project responded to
|
| 219 |
+
our request and provided feedback on the wording of the questions and survey flow, which
|
| 220 |
+
we incorporated into the final survey design. We also piloted the survey with a small subset
|
| 221 |
+
of the sample (27 participants). During this field test, we included this open-ended
|
| 222 |
+
question at three different points in the survey: “Do you have any feedback on any of the
|
| 223 |
+
questions so far? For example, is any question unclear or ambiguous? Please list the
|
| 224 |
+
question and describe your challenge with answering it.” At the end of the survey, we also
|
| 225 |
+
asked, “Overall, how can we improve this survey from the perspective of survey takers? Do
|
| 226 |
+
you have any other thoughts or feedback for us? Please describe.” Results from this survey
|
| 227 |
+
pretest resulted in another round of iteration before our questionnaire reached the desired
|
| 228 |
+
quality.
|
| 229 |
+
Our survey questionnaire consisted of three blocks containing similar questions about hate
|
| 230 |
+
speech, sexually explicit content, and violent posts. To counter the effects of the order of
|
| 231 |
+
presentation on survey results, we counterbalanced the order in which question blocks
|
| 232 |
+
related to the three content categories were shown to the participants. At the beginning of
|
| 233 |
+
each block, we specified the norm-violating category that the following questions related to
|
| 234 |
+
and defined that category. We used the following definitions:
|
| 235 |
+
• Hate speech: “Hate speech includes speech that is dehumanizing, stereotyping, or
|
| 236 |
+
insulting, on the basis of identity markers such as race/ethnicity, gender, sexual
|
| 237 |
+
orientation, religion, etc.”
|
| 238 |
+
• Violent content: “Violent content includes threats to commit violence, glorifying
|
| 239 |
+
violence or celebrating suffering, depictions of violence that are gratuitous or gory,
|
| 240 |
+
and animal abuse.”
|
| 241 |
+
|
| 242 |
+
1 https://lucidtheorem.com
|
| 243 |
+
|
| 244 |
+
• Sexually explicit content: “Sexually explicit content includes content showing sexual
|
| 245 |
+
activity, offering or requesting sexual activity, female nipples (except breastfeeding,
|
| 246 |
+
health, and acts of protest), nudity showing genitals, and sexually explicit language.”
|
| 247 |
+
The above definitions were inspired by the language provided by the Facebook site when
|
| 248 |
+
reporting any post under the category of hate speech, violence, and nudity, respectively.
|
| 249 |
+
We administered the survey online using the survey software package Qualtrics. We
|
| 250 |
+
launched the survey on November 29, 2022. Table 1 presents the demographic details of
|
| 251 |
+
our final sample after data cleaning and compares it with the demographics of the adult US
|
| 252 |
+
internet population [45].
|
| 253 |
+
Table 1: Demographic Profile of the US Survey
|
| 254 |
+
|
| 255 |
+
Authors’ study, US survey
|
| 256 |
+
Nov 2022 (%)
|
| 257 |
+
American Community Survey,
|
| 258 |
+
US sample 2021 (%)
|
| 259 |
+
Age:
|
| 260 |
+
|
| 261 |
+
|
| 262 |
+
18-29
|
| 263 |
+
18.7
|
| 264 |
+
17.4
|
| 265 |
+
30-49
|
| 266 |
+
40.1
|
| 267 |
+
29.5
|
| 268 |
+
50-64
|
| 269 |
+
23.7
|
| 270 |
+
25.6
|
| 271 |
+
65+
|
| 272 |
+
17.4
|
| 273 |
+
27.3
|
| 274 |
+
Gender:
|
| 275 |
+
|
| 276 |
+
|
| 277 |
+
Male
|
| 278 |
+
48.2
|
| 279 |
+
48.6
|
| 280 |
+
Female
|
| 281 |
+
51.8
|
| 282 |
+
51.4
|
| 283 |
+
Race/Ethnicity:
|
| 284 |
+
|
| 285 |
+
|
| 286 |
+
White
|
| 287 |
+
73.5
|
| 288 |
+
68.3
|
| 289 |
+
Black
|
| 290 |
+
12.2
|
| 291 |
+
9.3
|
| 292 |
+
Other
|
| 293 |
+
14.3
|
| 294 |
+
22.4
|
| 295 |
+
Hispanic:
|
| 296 |
+
|
| 297 |
+
|
| 298 |
+
Yes
|
| 299 |
+
4.5
|
| 300 |
+
13.7
|
| 301 |
+
Education:
|
| 302 |
+
|
| 303 |
+
|
| 304 |
+
High school or less
|
| 305 |
+
31.4
|
| 306 |
+
33.5
|
| 307 |
+
Some college
|
| 308 |
+
24.4
|
| 309 |
+
33.3
|
| 310 |
+
College+
|
| 311 |
+
43.3
|
| 312 |
+
33.1
|
| 313 |
+
Measures
|
| 314 |
+
Perceived Influence on Self and Others
|
| 315 |
+
For each norm-violating speech category, we asked the participants to estimate the
|
| 316 |
+
influence of that category on the self and others. In each case, we asked two questions:
|
| 317 |
+
“Seeing <speech category> posts on social media has a powerful influence on my attitudes.”
|
| 318 |
+
and “Seeing <speech category> posts on social media has a powerful influence on my
|
| 319 |
+
behaviors.” The response categories ranged on a 7-point Likert-type scale from 1 (strongly
|
| 320 |
+
disagree) to 7 (strongly agree). These two items were averaged to create a measure of the
|
| 321 |
+
perceived influence of each speech category on the self (Hate speech: M=3.89, SD=1.91,
|
| 322 |
+
a=.84; Violent speech: M=3.78, SD=1.87, a=.81; Sexually explicit speech: M=3.55, SD=1.89,
|
| 323 |
+
|
| 324 |
+
a=.87). We asked another two questions replacing only the word “my” with “other
|
| 325 |
+
people’s” and averaged the responses to create an index of the perceived influence of each
|
| 326 |
+
speech category on others (Hate speech: M=5.28, SD=1.46, a=.92; Violent speech: M=5.19,
|
| 327 |
+
SD=1.40, a=.91; Sexually explicit speech: M=4.99, SD=1.46, a=.93).
|
| 328 |
+
Support for Freedom of Speech
|
| 329 |
+
We used items developed by Guo and Johnson to measure support for freedom of speech
|
| 330 |
+
[20]. Participants rated these four statements on a Likert-type scale ranging from 1
|
| 331 |
+
(strongly disagree) to 7 (strongly agree): (1) In general, I support the First Amendment, (2)
|
| 332 |
+
Freedom of expression is essential to democracy, (3) Democracy works best when citizens
|
| 333 |
+
communicate in an unregulated marketplace of ideas, and (4) Even extreme viewpoints
|
| 334 |
+
deserve to be voiced in society. We included the First Amendment statement2 in the first
|
| 335 |
+
question to clarify its meaning. We formed an index for free speech support using the
|
| 336 |
+
means of these four items (M=5.43, SD=1.15, a=.80).
|
| 337 |
+
Dependent Variables Related to Moderation
|
| 338 |
+
Support for platform-enacted moderation of each speech category was operationalized by
|
| 339 |
+
asking participants to rate the following statement: “I support social media platforms
|
| 340 |
+
taking down any posts they consider to be <speech category> so that no users can see
|
| 341 |
+
them.” The responses for this statement ranged on a 7-point Likert-type scale, where
|
| 342 |
+
1=“strongly disagree” and 7=“strongly agree.”
|
| 343 |
+
For operationalizing support for having personal moderation tools for each category, we
|
| 344 |
+
showed participants an example of a personal moderation feature where every user can
|
| 345 |
+
decide the extent to which they want the <speech category> content filtered out (see Fig.
|
| 346 |
+
1). We asked participants to rate their support for providing this kind of setting to all users
|
| 347 |
+
on a Likert-type scale ranging from 1 (strongly disagree) to 7 (strongly agree).
|
| 348 |
+
|
| 349 |
+
2 The First Amendment to the United States Constitution states: "Congress shall make no
|
| 350 |
+
law respecting an establishment of religion, or prohibiting the free exercise thereof; or
|
| 351 |
+
abridging the freedom of speech, or of the press; or the right of the people peaceably to
|
| 352 |
+
assemble, and to petition the Government for a redress of grievances.”
|
| 353 |
+
|
| 354 |
+
|
| 355 |
+
Figure 1: Survey question asking participants to rate their support for platforms providing
|
| 356 |
+
personal moderation feature
|
| 357 |
+
In addition to these two measures, we also operationalized choosing platform-enacted
|
| 358 |
+
moderation v/s personal moderation for each speech category by asking respondents a
|
| 359 |
+
binary question: ‘Given a choice between platform-wide moderation and a "Choose your
|
| 360 |
+
moderation settings" feature to handle <speech category> posts, which would you prefer to
|
| 361 |
+
have?’ The response categories included: (1) Platform-wide moderation: Platforms should
|
| 362 |
+
have the power to remove all posts they identify as <speech category> across the platform
|
| 363 |
+
or (2) "Choose your moderation settings" feature: Each user should be allowed to configure
|
| 364 |
+
the extent to which <speech category> posts should be removed for them. We note that the
|
| 365 |
+
“Choose you moderation settings” feature enables a range of choices – from “no
|
| 366 |
+
moderation” to “a range of moderation.” Thus, users who desired neither platform-wide
|
| 367 |
+
nor personal moderation to remove any posts for them could select this feature and
|
| 368 |
+
configure it at the “no moderation” level.
|
| 369 |
+
|
| 370 |
+
The below example shows a feature where every user can decide for themselves
|
| 371 |
+
the extentto whichtheywantsexuallyexplicit contentfiltered out.
|
| 372 |
+
Chooseyourmoderationsettings:
|
| 373 |
+
Filteroutsexuallyexplicitpostsbasedonthelevelyouselect:
|
| 374 |
+
Alittle
|
| 375 |
+
Some
|
| 376 |
+
More
|
| 377 |
+
Alotof
|
| 378 |
+
No moderation
|
| 379 |
+
moderation
|
| 380 |
+
moderation
|
| 381 |
+
moderation
|
| 382 |
+
moderation
|
| 383 |
+
Onlythemostsexuallyexplicitpostswillberemovedatthislevel.
|
| 384 |
+
I support platforms providing this kind of setting to all users
|
| 385 |
+
O Strongly disagree
|
| 386 |
+
O Disagree
|
| 387 |
+
OSomewhatdisagree
|
| 388 |
+
ONeitheragree nordisagree
|
| 389 |
+
O Somewhatagree
|
| 390 |
+
O Agree
|
| 391 |
+
O Strongly agree
|
| 392 |
+
Figure 2: Frequency of participants’ responses to survey questions about support for platform-
|
| 393 |
+
wide and personal moderation, measured in percentage.
|
| 394 |
+
Control Variables
|
| 395 |
+
Prior research has shown that socio-demographic variables are related to TPE and free
|
| 396 |
+
speech and attitude towards media regulation [19, 26, 27, 31]. Further, social media use
|
| 397 |
+
has also been associated with individuals’ perceptions of harmful content and their
|
| 398 |
+
interventions against such [24, 25, 35, 53]. Therefore, we controlled for age, education,
|
| 399 |
+
gender, race, political affiliation (1 = “very liberal”, 7= “very conservative”), and social
|
| 400 |
+
media use of each respondent. We operationalized the frequency of social media use by
|
| 401 |
+
following recommendations by Ernala et al. [9] and prompting participants to respond to
|
| 402 |
+
the question, ‘In the past week, on average, approximately how much time PER DAY have
|
| 403 |
+
you spent actively using any social media?
|
| 404 |
+
Results
|
| 405 |
+
Our results show that 72.8%, 73.1%, and 66.2% of participants at least somewhat agreed
|
| 406 |
+
that platforms should ban hate speech, violent content, and sexually explicit content,
|
| 407 |
+
respectively. Further, 69.9%, 72.6%, and 72.1% of participants at least somewhat agreed
|
| 408 |
+
that platforms should offer personal moderation tools to let end-users regulate hate
|
| 409 |
+
speech, violent content, and sexually explicit content, respectively.
|
| 410 |
+
|
| 411 |
+
Statistics
|
| 412 |
+
Strongly disagree
|
| 413 |
+
Disagree
|
| 414 |
+
Somewhatdisagree
|
| 415 |
+
Personal ModerationofSexuallyExplicitContent
|
| 416 |
+
I Neither agree nor disagree
|
| 417 |
+
Somewhatagree
|
| 418 |
+
lAgree
|
| 419 |
+
IStronglyagree
|
| 420 |
+
PlatformBanofSexualyExplicitContent
|
| 421 |
+
Personal ModerationofViolentContent
|
| 422 |
+
PlatformBanofViolentContent
|
| 423 |
+
PersonalModerationofHateSpeech
|
| 424 |
+
PlatformBanofHateSpeech
|
| 425 |
+
0
|
| 426 |
+
20
|
| 427 |
+
40
|
| 428 |
+
60
|
| 429 |
+
80
|
| 430 |
+
100
|
| 431 |
+
Percentage of ParticipantsIn line with research on the third-person effects, H1 predicted that for each norm-violating
|
| 432 |
+
content category, participants would perceive the effects of that category on others to be
|
| 433 |
+
stronger than on themselves. We ran a paired t-test and found the perceived effects on
|
| 434 |
+
others significantly stronger than on oneself for each category (see Table 2). Thus, our
|
| 435 |
+
results support H1.
|
| 436 |
+
Table 2: Mean, standard deviations, standard errors of participants’ perceived effects of hate
|
| 437 |
+
speech, violent content, and sexually explicit content on others and self, and t-test results
|
| 438 |
+
comparing perceived effects on others and self for each speech category (N = 993). *** denotes
|
| 439 |
+
p < .001
|
| 440 |
+
|
| 441 |
+
|
| 442 |
+
M
|
| 443 |
+
SD
|
| 444 |
+
SE
|
| 445 |
+
t
|
| 446 |
+
Cohen’s d
|
| 447 |
+
Hate speech
|
| 448 |
+
Effects on others
|
| 449 |
+
5.28
|
| 450 |
+
1.46
|
| 451 |
+
.05
|
| 452 |
+
25.37***
|
| 453 |
+
.805
|
| 454 |
+
Effects on self
|
| 455 |
+
3.89
|
| 456 |
+
1.91
|
| 457 |
+
.06
|
| 458 |
+
Violent
|
| 459 |
+
content
|
| 460 |
+
Effects on others
|
| 461 |
+
5.19
|
| 462 |
+
1.40
|
| 463 |
+
.05
|
| 464 |
+
25.44***
|
| 465 |
+
.807
|
| 466 |
+
Effects on self
|
| 467 |
+
3.77
|
| 468 |
+
1.87
|
| 469 |
+
.06
|
| 470 |
+
Sexually
|
| 471 |
+
explicit
|
| 472 |
+
content
|
| 473 |
+
Effects on others
|
| 474 |
+
4.99
|
| 475 |
+
1.46
|
| 476 |
+
.05
|
| 477 |
+
25.81***
|
| 478 |
+
.819
|
| 479 |
+
Effects on self
|
| 480 |
+
3.55
|
| 481 |
+
1.88
|
| 482 |
+
.06
|
| 483 |
+
|
| 484 |
+
Support for Platform Ban
|
| 485 |
+
We computed hierarchical linear regression to test our hypotheses 2 and 4. For each of the
|
| 486 |
+
three norm-violating categories, we created a model where the participant’s support for
|
| 487 |
+
banning that category served as the dependent variable. In Step 1 of the three regression
|
| 488 |
+
models, we included the control variables age, gender, education, race, political affiliation,
|
| 489 |
+
and social media use. In Step 2, we introduced the independent variables PME3 (perceived
|
| 490 |
+
effects on others) for that category and support for free speech (Table 3).
|
| 491 |
+
Table 3: Hierarchical multiple regression analyses predicting support for platforms' banning
|
| 492 |
+
of hate speech, violent content, and sexually explicit content (N = 983)
|
| 493 |
+
Independent Variable
|
| 494 |
+
Support
|
| 495 |
+
for
|
| 496 |
+
platform ban of
|
| 497 |
+
hate speech (β)
|
| 498 |
+
Support
|
| 499 |
+
for
|
| 500 |
+
platform ban of
|
| 501 |
+
violent content
|
| 502 |
+
(β)
|
| 503 |
+
Support
|
| 504 |
+
for
|
| 505 |
+
platform ban of
|
| 506 |
+
sexually explicit
|
| 507 |
+
content (β)
|
| 508 |
+
|
| 509 |
+
Step 1
|
| 510 |
+
|
| 511 |
+
|
| 512 |
+
|
| 513 |
+
Age
|
| 514 |
+
.119***
|
| 515 |
+
.055
|
| 516 |
+
.102**
|
| 517 |
+
Gender (Female)
|
| 518 |
+
.127***
|
| 519 |
+
.167***
|
| 520 |
+
.153***
|
| 521 |
+
Race (White)
|
| 522 |
+
.018
|
| 523 |
+
.013
|
| 524 |
+
-.059
|
| 525 |
+
Educationa
|
| 526 |
+
-.008
|
| 527 |
+
.039
|
| 528 |
+
-.022
|
| 529 |
+
Political affiliationb
|
| 530 |
+
-.156***
|
| 531 |
+
-.09**
|
| 532 |
+
.019
|
| 533 |
+
Social media usec
|
| 534 |
+
.022
|
| 535 |
+
.013
|
| 536 |
+
.019
|
| 537 |
+
R2
|
| 538 |
+
.093***
|
| 539 |
+
.065***
|
| 540 |
+
.05***
|
| 541 |
+
Step 2
|
| 542 |
+
|
| 543 |
+
|
| 544 |
+
|
| 545 |
+
Support for free speech
|
| 546 |
+
-.101***
|
| 547 |
+
-.039
|
| 548 |
+
-.006
|
| 549 |
+
Perceived effects of hate speech on others
|
| 550 |
+
.476***
|
| 551 |
+
-
|
| 552 |
+
-
|
| 553 |
+
Perceived effects of violent content on others
|
| 554 |
+
-
|
| 555 |
+
.397***
|
| 556 |
+
-
|
| 557 |
+
Perceived effects of sexually explicit content
|
| 558 |
+
on others
|
| 559 |
+
-
|
| 560 |
+
-
|
| 561 |
+
.391***
|
| 562 |
+
R2 change
|
| 563 |
+
.215
|
| 564 |
+
.15***
|
| 565 |
+
.149***
|
| 566 |
+
Total R2
|
| 567 |
+
.307***
|
| 568 |
+
.215***
|
| 569 |
+
.199***
|
| 570 |
+
**p < .01, ***p < .001 (t test for β, two-tailed; F test for R2, two-tailed).
|
| 571 |
+
a0= Less than secondary education; 1= Secondary education or more.
|
| 572 |
+
b1= Strong Democrat, 7= Strong Republican.
|
| 573 |
+
c1= Less than 10 minutes per day, 6= More than 3 hours per day.
|
| 574 |
+
β = standardized beta from the full model (final beta controlling for all variables in the model).
|
| 575 |
+
For each norm-violating speech category, the regression models show significant
|
| 576 |
+
influences of the participants' perceived effects of that category on others (PME3) on their
|
| 577 |
+
support for platform ban of that category (Model 1: hate speech – β = .476, p < .001; Model
|
| 578 |
+
|
| 579 |
+
2: violent content – β = .397, p < .001; Model 3: sexually explicit content – β = .391, p <
|
| 580 |
+
.001), supporting H2.
|
| 581 |
+
Greater support for free speech significantly negatively influences support for platform ban
|
| 582 |
+
of hate speech (β = -.101, p < .001). It does not, however, influence support for platform ban
|
| 583 |
+
of violent content (β = -.039, p > .05) or sexually explicit content (β = -.006, p > .05). Thus,
|
| 584 |
+
H4 is only partially supported.
|
| 585 |
+
Support for Personal Moderation
|
| 586 |
+
We computed hierarchical linear regression to test our hypothesis 3 and answer RQ 2. For
|
| 587 |
+
each of the three norm-violating categories, we created a model where the participant’s
|
| 588 |
+
support for having personal moderation tools to regulate that category served as the
|
| 589 |
+
dependent variable. In Step 1 of the three regression models, we included the control
|
| 590 |
+
variables age, gender, education, race, political affiliation, and social media use. In Step 2,
|
| 591 |
+
we introduced the independent variables PME3 (perceived effects on others) for that
|
| 592 |
+
category and support for free speech (Table 4).
|
| 593 |
+
Table 4: Hierarchical multiple regression analyses predicting support for using personal
|
| 594 |
+
moderation tools (PMT) to regulate hate speech, violent content, and sexually explicit content
|
| 595 |
+
(N = 983)
|
| 596 |
+
Independent Variable
|
| 597 |
+
Support
|
| 598 |
+
for
|
| 599 |
+
PMT
|
| 600 |
+
to
|
| 601 |
+
regulate
|
| 602 |
+
hate
|
| 603 |
+
speech (β)
|
| 604 |
+
Support for PMT
|
| 605 |
+
to
|
| 606 |
+
regulate
|
| 607 |
+
violent content
|
| 608 |
+
(β)
|
| 609 |
+
Support for PMT
|
| 610 |
+
to
|
| 611 |
+
regulate
|
| 612 |
+
sexually explicit
|
| 613 |
+
content (β)
|
| 614 |
+
Step 1
|
| 615 |
+
|
| 616 |
+
|
| 617 |
+
|
| 618 |
+
Age
|
| 619 |
+
.014
|
| 620 |
+
-.017
|
| 621 |
+
-.010
|
| 622 |
+
Gender (Female)
|
| 623 |
+
-.016
|
| 624 |
+
.019
|
| 625 |
+
-.016
|
| 626 |
+
Race (White)
|
| 627 |
+
-.019
|
| 628 |
+
-.007
|
| 629 |
+
.08*
|
| 630 |
+
Educationa
|
| 631 |
+
-.018
|
| 632 |
+
.022
|
| 633 |
+
.003
|
| 634 |
+
Political affiliationb
|
| 635 |
+
-.019
|
| 636 |
+
-.049
|
| 637 |
+
-.074*
|
| 638 |
+
Social media usec
|
| 639 |
+
.051
|
| 640 |
+
.057
|
| 641 |
+
.086**
|
| 642 |
+
R2
|
| 643 |
+
.009
|
| 644 |
+
.013
|
| 645 |
+
.027***
|
| 646 |
+
Step 2
|
| 647 |
+
|
| 648 |
+
|
| 649 |
+
|
| 650 |
+
|
| 651 |
+
Support for free speech
|
| 652 |
+
.173***
|
| 653 |
+
.195***
|
| 654 |
+
.224***
|
| 655 |
+
Perceived effects of hate speech on others
|
| 656 |
+
.224***
|
| 657 |
+
-
|
| 658 |
+
-
|
| 659 |
+
Perceived effects of violent content on others
|
| 660 |
+
-
|
| 661 |
+
.187***
|
| 662 |
+
-
|
| 663 |
+
Perceived effects of sexually explicit content
|
| 664 |
+
on others
|
| 665 |
+
-
|
| 666 |
+
-
|
| 667 |
+
.225***
|
| 668 |
+
R2 change
|
| 669 |
+
.087
|
| 670 |
+
.081
|
| 671 |
+
.111
|
| 672 |
+
Total R2
|
| 673 |
+
.096***
|
| 674 |
+
.095***
|
| 675 |
+
.138***
|
| 676 |
+
*p < .05, **p < .01, ***p < .001 (t test for β, two-tailed; F test for R2, two-tailed).
|
| 677 |
+
a0= Less than secondary education; 1= Secondary education or more.
|
| 678 |
+
b1= Strong Democrat, 7= Strong Republican.
|
| 679 |
+
c1= Less than 10 minutes per day, 6= More than 3 hours per day.
|
| 680 |
+
β = standardized beta from the full model (final beta controlling for all variables in the model).
|
| 681 |
+
For each norm-violating speech category, the regression models show significant
|
| 682 |
+
influences of the participants' perceived effects of that category on others (PME3) on their
|
| 683 |
+
support for using personal moderation tools to regulate that category (Model 4: hate
|
| 684 |
+
speech – β = .224, p < .001; Model 5: violent content – β = .187, p < .001; Model 6: sexually
|
| 685 |
+
explicit content – β = .225, p < .001), supporting H4.
|
| 686 |
+
Greater support for free speech has a significant positive influence on participants’ support
|
| 687 |
+
for using personal moderation tools to regulate each norm-violating category (Model 4:
|
| 688 |
+
hate speech – β = .173, p < .001; Model 5: violent content – β = .195, p < .001; Model 6:
|
| 689 |
+
sexually explicit content – β = .224, p < .001). This answers our RQ 2.
|
| 690 |
+
|
| 691 |
+
|
| 692 |
+
Choosing Between Platform-wide Moderation and Personal
|
| 693 |
+
Moderation
|
| 694 |
+
|
| 695 |
+
Figure 3: Percentage of participants preferring platform-wide ban or personal moderation to
|
| 696 |
+
regulate hate speech, violent content, and sexually explicit content
|
| 697 |
+
Given a choice between platform-wide moderation and a personal moderation tool to
|
| 698 |
+
regulate hate speech, violent content, and sexually explicit content, 52.4%, 52%, and 55.3%
|
| 699 |
+
of participants, respectively, chose the personal moderation tool. This finding suggests that
|
| 700 |
+
more participants prefer autonomy over moderation than delegating it to platforms as they
|
| 701 |
+
see fit.
|
| 702 |
+
We created binomial logistic regression models to test our hypothesis 5 and answer RQ 1.
|
| 703 |
+
For each of the three norm-violating categories, we created a model where the participants’
|
| 704 |
+
binary choice between platform-wide moderation and personal moderation to handle that
|
| 705 |
+
category served as the dependent variable. In Step 1 of the three regression models, we
|
| 706 |
+
included the control variables age, gender, education, race, political affiliation, and social
|
| 707 |
+
media use. In Step 2, we introduced the independent variables PME3 (perceived effects on
|
| 708 |
+
others) for that category and support for free speech. For each model, we used the Box-
|
| 709 |
+
Tidwell procedure [4, 11] to check the assumption of linearity in the logit and found in each
|
| 710 |
+
case that our continuous variable support for free speech was not linearly related to the
|
| 711 |
+
logit of the dependent variable. To address this, we split this variable into two ordinal
|
| 712 |
+
categories – high and low, recoding each entry for this variable based on whether it
|
| 713 |
+
exceeded the median value. Rerunning the Box-Tidwell procedure with this transformed
|
| 714 |
+
support for the free speech categorical variable, we found all remaining continuous
|
| 715 |
+
|
| 716 |
+
Statistics
|
| 717 |
+
Prefer platform-wide ban
|
| 718 |
+
Preferpersonalmoderation
|
| 719 |
+
Sexually explicit content
|
| 720 |
+
Violent content
|
| 721 |
+
Hate speech
|
| 722 |
+
0
|
| 723 |
+
10
|
| 724 |
+
20
|
| 725 |
+
30
|
| 726 |
+
40
|
| 727 |
+
50
|
| 728 |
+
60
|
| 729 |
+
Percentage of Participantsindependent variables in each model to be linearly related to the logit of the dependent
|
| 730 |
+
variable. We next present these models' binomial logistic regression results (Table 5).
|
| 731 |
+
Table 5: Binomial logistic regression analyses predicting support for using personal
|
| 732 |
+
moderation tools (PMT) over platform-wide ban to regulate hate speech, violent content, and
|
| 733 |
+
sexually explicit content (N = 984)
|
| 734 |
+
Independent Variable
|
| 735 |
+
Support
|
| 736 |
+
for
|
| 737 |
+
PMT
|
| 738 |
+
over
|
| 739 |
+
platform ban to
|
| 740 |
+
regulate
|
| 741 |
+
hate
|
| 742 |
+
speech,
|
| 743 |
+
Odds
|
| 744 |
+
Ratio
|
| 745 |
+
Support for PMT
|
| 746 |
+
over
|
| 747 |
+
platform
|
| 748 |
+
ban to regulate
|
| 749 |
+
violent content,
|
| 750 |
+
Odds Ratio
|
| 751 |
+
Support for PMT
|
| 752 |
+
over
|
| 753 |
+
platform
|
| 754 |
+
ban to regulate
|
| 755 |
+
violent content,
|
| 756 |
+
Odds Ratio
|
| 757 |
+
Step 1
|
| 758 |
+
|
| 759 |
+
|
| 760 |
+
|
| 761 |
+
Age
|
| 762 |
+
.986**
|
| 763 |
+
.992
|
| 764 |
+
.994
|
| 765 |
+
Gender (Female)
|
| 766 |
+
.790
|
| 767 |
+
.655**
|
| 768 |
+
.674**
|
| 769 |
+
Race (White)
|
| 770 |
+
1.107
|
| 771 |
+
1.313
|
| 772 |
+
1.203
|
| 773 |
+
Educationa
|
| 774 |
+
.934
|
| 775 |
+
.870
|
| 776 |
+
.981
|
| 777 |
+
Political affiliationb
|
| 778 |
+
1.163***
|
| 779 |
+
1.118***
|
| 780 |
+
1.074*
|
| 781 |
+
Social media usec
|
| 782 |
+
.990
|
| 783 |
+
1.071
|
| 784 |
+
1.091*
|
| 785 |
+
Nagelkerke R2
|
| 786 |
+
.066***
|
| 787 |
+
.066***
|
| 788 |
+
.045***
|
| 789 |
+
Step 2
|
| 790 |
+
|
| 791 |
+
|
| 792 |
+
|
| 793 |
+
Support for free speechd
|
| 794 |
+
2.703***
|
| 795 |
+
2.239****
|
| 796 |
+
1.969***
|
| 797 |
+
Perceived effects of hate speech on others
|
| 798 |
+
.735***
|
| 799 |
+
-
|
| 800 |
+
-
|
| 801 |
+
Perceived effects of violent content on others
|
| 802 |
+
-
|
| 803 |
+
.752***
|
| 804 |
+
-
|
| 805 |
+
Perceived effects of sexually explicit content
|
| 806 |
+
on others
|
| 807 |
+
-
|
| 808 |
+
-
|
| 809 |
+
.857**
|
| 810 |
+
Total Nagelkerke R2
|
| 811 |
+
.165***
|
| 812 |
+
.138***
|
| 813 |
+
.087***
|
| 814 |
+
*p < .05, **p < .01, ***p < .001 (t test for β, two-tailed; Omnibus Tests of Model Coefficients for R2).
|
| 815 |
+
|
| 816 |
+
a0= Less than secondary education; 1= Secondary education or more.
|
| 817 |
+
b1= Strong Democrat, 7= Strong Republican.
|
| 818 |
+
c1= Less than 10 minutes per day, 6= More than 3 hours per day.
|
| 819 |
+
d0= low, 1=high.
|
| 820 |
+
odds ratio = exp(β) from full model.
|
| 821 |
+
For each norm-violating speech category, the regression models show significant
|
| 822 |
+
influences of the participants' perceived effects of that category on others (PME3) on their
|
| 823 |
+
choice of using personal moderation tools over platform-enacted bans to regulate that
|
| 824 |
+
category. Increasing PME3 was associated with a decreased likelihood of choosing personal
|
| 825 |
+
moderation tools over platform bans (Model 7: hate speech – exp(β) = .735, p < .001; Model
|
| 826 |
+
8: violent content – exp(β) = .752, p < .001; Model 9: sexually explicit content – exp(β) =
|
| 827 |
+
.857, p < .01). This answers our RQ 1.
|
| 828 |
+
Higher support for free speech has a significant positive influence on participants’ support
|
| 829 |
+
for using personal moderation tools over platform-enacted bans to regulate each norm-
|
| 830 |
+
violating category. Participants who showed high support for free speech have 2.703,
|
| 831 |
+
2.239, and 1.969 times higher odds of choosing personal moderation tools over platform-
|
| 832 |
+
enacted bans to regulate hate speech, violent content, and sexually explicit content,
|
| 833 |
+
respectively. Thus, H5 is supported.
|
| 834 |
+
Discussion
|
| 835 |
+
In recent years, the debates surrounding the censorship of inappropriate content on social
|
| 836 |
+
media have surfaced more and more due to the increasing essentiality of social media in
|
| 837 |
+
political discourse and growing controversies over how platforms regulate [13, 14]. The
|
| 838 |
+
purpose of this study was to measure public attitudes regarding two important forms of
|
| 839 |
+
social media regulation: platform-wide moderation, which lets platforms unilaterally make
|
| 840 |
+
moderation decisions for every user, and personal moderation, which empowers users to
|
| 841 |
+
decide for themselves how they would like to regulate different content categories by
|
| 842 |
+
adjusting their moderation settings. Third-person effects (TPE) are commonly used in
|
| 843 |
+
examining people’s attitudes towards censorship and related behaviors or behavioral
|
| 844 |
+
intentions [6, 18]. The present research extends the TPE research to managing hate speech,
|
| 845 |
+
violent content, and sexually explicit content on social media.
|
| 846 |
+
We explored the presumed negative effects of each type of content on self (PME1) and
|
| 847 |
+
others (PME3). The results produced strong support for the TPE hypothesis. As expected,
|
| 848 |
+
participants perceived the social media hate speech, violent content, and sexually explicit
|
| 849 |
+
content to have a greater influence on others than on themselves. We also examined how
|
| 850 |
+
PME3 and support for free speech affected participants’ consequent censorial behavior. In
|
| 851 |
+
each case, we found that the perceived effects on others (PME3) predicted participants’
|
| 852 |
+
support for both platform-wide moderation and personal moderation. This is a
|
| 853 |
+
theoretically significant finding of this study since it helps advance TPE research by
|
| 854 |
+
|
| 855 |
+
showing that perceived effects on others play an essential role in triggering censorial
|
| 856 |
+
behavior. Given a choice between the platform and personal moderation, PME3 predicted
|
| 857 |
+
support for platform moderation in each case. This finding indicates that when users
|
| 858 |
+
perceive the adverse effects of a content category on the public, they desire platforms to
|
| 859 |
+
take site-wide actions on that content rather than regulate it for themselves.
|
| 860 |
+
Further, the relationship between support for free speech and support for platform-wide
|
| 861 |
+
moderation received only partial support. While the connection is significant and negative
|
| 862 |
+
for hate speech, it is not significant for violent and sexually explicit content. This result is in
|
| 863 |
+
line with the mixed findings for free speech support as a predictor of supportive attitudes
|
| 864 |
+
towards platform censorship observed in prior literature [20]. On the other hand, we found
|
| 865 |
+
that support for free speech predicted support for the use of personal moderation for
|
| 866 |
+
regulating each inappropriate speech category. This suggests that people may perceive
|
| 867 |
+
personal moderation tools as not an infringement on the free speech of others but simply
|
| 868 |
+
having a greater agency to shape what they see. This is further bolstered by our finding that
|
| 869 |
+
given a choice between the platform and personal moderation, support for free speech
|
| 870 |
+
predicts support for personal moderation in each case.
|
| 871 |
+
Other significant effects, less central to the hypotheses being tested, also were found. We
|
| 872 |
+
found that age was positively related to support for platform moderation of hate speech
|
| 873 |
+
and sexually explicit content, but not violent content. Females supported platform
|
| 874 |
+
moderation of each speech category more than males. Democrats were more likely than
|
| 875 |
+
Republicans to support platform moderation of hate speech and violent content, but not
|
| 876 |
+
sexually explicit content. Regarding support for personal moderation, race, political
|
| 877 |
+
affiliation, and social media use were significant predictors for the sexually explicit content
|
| 878 |
+
category; however, no control variables significantly predicted personal moderation of hate
|
| 879 |
+
speech or violent content.
|
| 880 |
+
The evidence presented here has important implications for how platforms govern their
|
| 881 |
+
sites. We show that part of the reason the public supports moderation of norm-violating
|
| 882 |
+
categories such as pornography and war violence is that it overestimates these categories’
|
| 883 |
+
effects on others. Therefore, company-wide moderation decisions and public debates
|
| 884 |
+
concerning free speech and its limitations, must recognize and account for third-person
|
| 885 |
+
effects. It also points to an urgent need to measure the actual media effects as opposed to
|
| 886 |
+
the perceived media effects of different content types. We have noticed that even during
|
| 887 |
+
our interview studies on online harms, participants tend to advocate for specific
|
| 888 |
+
moderation initiatives based on their perceptions of what others might need. To arrive at
|
| 889 |
+
an accurate needs-gathering, scholars must focus on understanding the perspectives of
|
| 890 |
+
online content on users themselves – a topic on which they are an expert – rather than the
|
| 891 |
+
abstract others whose actual needs may considerably differ.
|
| 892 |
+
Several limitations of this study should be recognized. The survey design prohibited us
|
| 893 |
+
from exploring the motivations for specific perceptions in depth. Furthermore, we cannot
|
| 894 |
+
make conclusive statements about causal relations as a cross-sectional study. We asked
|
| 895 |
+
participants to respond to questions about speech categories that could be broadly
|
| 896 |
+
interpreted. We chose this instead of presenting a specific instance of each speech category
|
| 897 |
+
to increase the generalizability of our findings. Still, different users may have different
|
| 898 |
+
|
| 899 |
+
perceptions of what counts as hate speech, violent content, or sexually explicit content.
|
| 900 |
+
Prior moderation research has recognized this as a complex challenge in the social media
|
| 901 |
+
regulation [23]. We provided definitions of each speech category in the survey to clarify the
|
| 902 |
+
scope of each category to our participants. Nevertheless, further research on user
|
| 903 |
+
perceptions of stimulus-based designs that present preselected instances of each norm-
|
| 904 |
+
violating speech category to participants would provide valuable insights. We did not
|
| 905 |
+
ground our survey questions in a specific platform to increase the generalizability of our
|
| 906 |
+
results. Studies focused on particular social media sites can uncover whether attitudes
|
| 907 |
+
towards specific platforms influence users’ perceptions of moderation actions.
|
| 908 |
+
References
|
| 909 |
+
[1] Jack M Balkin. 2017. Free speech in the algorithmic society: Big data, private
|
| 910 |
+
governance, and new school speech regulation. UCDL Rev., 51 (2017), 1149.
|
| 911 |
+
[2] Matthew Barnidge and Hernando Rojas. 2014. Hostile Media Perceptions, Presumed
|
| 912 |
+
Media Influence, and Political Talk: Expanding the Corrective Action Hypothesis.
|
| 913 |
+
International
|
| 914 |
+
Journal
|
| 915 |
+
of
|
| 916 |
+
Public
|
| 917 |
+
Opinion
|
| 918 |
+
Research,
|
| 919 |
+
26,
|
| 920 |
+
2
|
| 921 |
+
(2014),
|
| 922 |
+
135-156.
|
| 923 |
+
https://doi.org/10.1093/ijpor/edt032
|
| 924 |
+
[3] Uli Bernhard and Marco Dohle. 2015. Corrective or Confirmative Actions? Political
|
| 925 |
+
Online Participation as a Consequence of Presumed Media Influences in Election
|
| 926 |
+
Campaigns. Journal of Information Technology & Politics, 12, 3 (2015/07/03 2015), 285-
|
| 927 |
+
302. https://doi.org/10.1080/19331681.2015.1048918
|
| 928 |
+
[4] G. E. P. Box and Paul W. Tidwell. 1962. Transformation of the Independent Variables.
|
| 929 |
+
Technometrics,
|
| 930 |
+
4,
|
| 931 |
+
4
|
| 932 |
+
(1962/11/01
|
| 933 |
+
1962),
|
| 934 |
+
531-550.
|
| 935 |
+
https://www.tandfonline.com/doi/abs/10.1080/00401706.1962.10490038
|
| 936 |
+
[5] Sungeun Chung and Shin-Il Moon. 2016. Is the Third-Person Effect Real? a Critical
|
| 937 |
+
Examination of Rationales, Testing Methods, and Previous Findings of the Third-Person
|
| 938 |
+
Effect on Censorship Attitudes. Human Communication Research, 42, 2 (2016), 312-337.
|
| 939 |
+
https://doi.org/10.1111/hcre.12078
|
| 940 |
+
[6] W. Phillips Davison. 1983. The Third-Person Effect in Communication. Public Opinion
|
| 941 |
+
Quarterly, 47, 1 (1983), 1-15. https://doi.org/10.1086/268763
|
| 942 |
+
[7] Julian Dibbell. 1994. A rape in cyberspace or how an evil clown, a Haitian trickster
|
| 943 |
+
spirit, two wizards, and a cast of dozens turned a database into a society. Ann. Surv. Am. L.
|
| 944 |
+
(1994), 471-471.
|
| 945 |
+
[8] Sabine A. Einwiller and Sora Kim. 2020. How Online Content Providers Moderate User-
|
| 946 |
+
Generated Content to Prevent Harmful Online Communication: An Analysis of Policies and
|
| 947 |
+
Their
|
| 948 |
+
Implementation.
|
| 949 |
+
Policy
|
| 950 |
+
&
|
| 951 |
+
Internet,
|
| 952 |
+
12,
|
| 953 |
+
2
|
| 954 |
+
(2020),
|
| 955 |
+
184-206.
|
| 956 |
+
https://onlinelibrary.wiley.com/doi/abs/10.1002/poi3.239
|
| 957 |
+
[9] Sindhu Kiranmai Ernala, Moira Burke, Alex Leavitt and Nicole B. Ellison. 2020. How
|
| 958 |
+
Well Do People Report Time Spent on Facebook? An Evaluation of Established Survey
|
| 959 |
+
Questions with Recommendations. In Proceedings of the Proceedings of the 2020 CHI
|
| 960 |
+
Conference on Human Factors in Computing Systems (Honolulu, HI, USA, 2020). Association
|
| 961 |
+
for Computing Machinery. https://doi.org/10.1145/3313831.3376435
|
| 962 |
+
[10] Lauren Feldman, P. Sol Hart, Anthony Leiserowitz, Edward Maibach and Connie Roser-
|
| 963 |
+
Renouf. 2017. Do Hostile Media Perceptions Lead to Action? The Role of Hostile Media
|
| 964 |
+
|
| 965 |
+
Perceptions, Political Efficacy, and Ideology in Predicting Climate Change Activism.
|
| 966 |
+
Communication
|
| 967 |
+
Research,
|
| 968 |
+
44,
|
| 969 |
+
8
|
| 970 |
+
(2017),
|
| 971 |
+
1099-1124.
|
| 972 |
+
https://journals.sagepub.com/doi/abs/10.1177/0093650214565914
|
| 973 |
+
[11] John Fox Applied regression analysis and generalized linear models. Sage Publications,
|
| 974 |
+
2015.
|
| 975 |
+
[12] James L. Gibson and Richard D. Bingham. 1982. On the Conceptualization and
|
| 976 |
+
Measurement of Political Tolerance. American Political Science Review, 76, 3 (1982), 603-
|
| 977 |
+
620.
|
| 978 |
+
https://www.cambridge.org/core/article/on-the-conceptualization-and-
|
| 979 |
+
measurement-of-political-tolerance/579D03FF1A6041C6DB3DD6CB1FBC98E1
|
| 980 |
+
[13] Tarleton Gillespie. 2017. Governance of and by platforms. Sage handbook of social
|
| 981 |
+
media (2017).
|
| 982 |
+
[14] Tarleton Gillespie Custodians of the Internet: Platforms, content moderation, and the
|
| 983 |
+
hidden decisions that shape social media. Yale University Press, 2018.
|
| 984 |
+
[15] Guy J. Golan and Stephen A. Banning. 2008. Exploring a Link Between the Third-Person
|
| 985 |
+
Effect and the Theory of Reasoned Action:Beneficial Ads and Social Expectations. American
|
| 986 |
+
Behavioral
|
| 987 |
+
Scientist,
|
| 988 |
+
52,
|
| 989 |
+
2
|
| 990 |
+
(2008),
|
| 991 |
+
208-224.
|
| 992 |
+
https://journals.sagepub.com/doi/abs/10.1177/0002764208321352
|
| 993 |
+
[16] Guy J. Golan, Stephen A. Banning and Lisa Lundy. 2008. Likelihood to Vote, Candidate
|
| 994 |
+
Choice, and the Third-Person Effect:Behavioral Implications of Political Advertising in the
|
| 995 |
+
2004 Presidential Election. American Behavioral Scientist, 52, 2 (2008), 278-290.
|
| 996 |
+
https://journals.sagepub.com/doi/abs/10.1177/0002764208321356
|
| 997 |
+
[17] Guy J. Golan and Joon Soo Lim Third-Person Effect of ISIS's Recruitment Propaganda:
|
| 998 |
+
Online Political Self-Efficacy and Social Media Activism, 2016.
|
| 999 |
+
[18] ALBERT GUNTHER. 1991. What We Think Others Think:Cause and Consequence in the
|
| 1000 |
+
Third-Person
|
| 1001 |
+
Effect.
|
| 1002 |
+
Communication
|
| 1003 |
+
Research,
|
| 1004 |
+
18,
|
| 1005 |
+
3
|
| 1006 |
+
(1991),
|
| 1007 |
+
355-372.
|
| 1008 |
+
https://journals.sagepub.com/doi/abs/10.1177/009365091018003004
|
| 1009 |
+
[19] Albert C. Gunther. 2006. Overrating the X-Rating: The Third-Person Perception and
|
| 1010 |
+
Support for Censorship of Pornography. Journal of Communication, 45, 1 (2006), 27-38.
|
| 1011 |
+
https://doi.org/10.1111/j.1460-2466.1995.tb00712.x
|
| 1012 |
+
[20] Lei Guo and Brett G. Johnson. 2020. Third-Person Effect and Hate Speech Censorship
|
| 1013 |
+
on
|
| 1014 |
+
Facebook.
|
| 1015 |
+
Social
|
| 1016 |
+
Media
|
| 1017 |
+
+
|
| 1018 |
+
Society,
|
| 1019 |
+
6,
|
| 1020 |
+
2
|
| 1021 |
+
(2020),
|
| 1022 |
+
2056305120923003.
|
| 1023 |
+
https://journals.sagepub.com/doi/abs/10.1177/2056305120923003
|
| 1024 |
+
[21] CYNTHIA HOFFNER, MARTHA BUCHANAN, JOEL DAVID ANDERSON, LISA A. HUBBS,
|
| 1025 |
+
STACY K. KAMIGAKI, LAURA KOWALCZYK, ANGELA PASTOREK, RICHARD S. PLOTKIN and
|
| 1026 |
+
KELSEY J. SILBERG. 1999. Support for Censorship of Television Violence:The Role of the
|
| 1027 |
+
Third-Person Effect and News Exposure. Communication Research, 26, 6 (1999), 726-742.
|
| 1028 |
+
https://journals.sagepub.com/doi/abs/10.1177/009365099026006004
|
| 1029 |
+
[22] S. Mo Jang and Joon K. Kim. 2018. Third person effects of fake news: Fake news
|
| 1030 |
+
regulation and media literacy interventions. Computers in Human Behavior, 80
|
| 1031 |
+
(2018/03/01/
|
| 1032 |
+
2018),
|
| 1033 |
+
295-302.
|
| 1034 |
+
https://www.sciencedirect.com/science/article/pii/S0747563217306726
|
| 1035 |
+
[23] Shagun Jhaver, Larry Chan and Amy Bruckman. 2018. The View from the Other Side:
|
| 1036 |
+
The Border Between Controversial Speech and Harassment on Kotaku in Action. First
|
| 1037 |
+
Monday, 23, 2 (2018). http://firstmonday.org/ojs/index.php/fm/article/view/8232
|
| 1038 |
+
[24] Anja Kalch and Teresa K Naab. 2017. Replying, disliking, flagging: How users engage
|
| 1039 |
+
with uncivil and impolite comments on news sites (2017).
|
| 1040 |
+
|
| 1041 |
+
[25] Kate Kenski, Kevin Coe and Stephen A. Rains. 2020. Perceptions of Uncivil Discourse
|
| 1042 |
+
Online: An Examination of Types and Predictors. Communication Research, 47, 6 (2020),
|
| 1043 |
+
795-814. https://journals.sagepub.com/doi/abs/10.1177/0093650217699933
|
| 1044 |
+
[26] Jennifer L. Lambe. 2002. Dimensions of censorship: Reconceptualizing public
|
| 1045 |
+
willingness to censor. Communication Law and Policy, 7 (2002), 187-235.
|
| 1046 |
+
[27] Francis L. F. Lee. 2009. The Prevention Effect of Third-Person Perception: A Study on
|
| 1047 |
+
the Perceived and Actual Influence of Polls. Mass Communication and Society, 13, 1
|
| 1048 |
+
(2009/12/24 2009), 87-110. https://doi.org/10.1080/15205430802635672
|
| 1049 |
+
[28] Joon Soo Lim. 2017. The Third-Person Effect of Online Advertising of Cosmetic
|
| 1050 |
+
Surgery: A Path Model for Predicting Restrictive Versus Corrective Actions. Journalism &
|
| 1051 |
+
Mass
|
| 1052 |
+
Communication
|
| 1053 |
+
Quarterly,
|
| 1054 |
+
94,
|
| 1055 |
+
4
|
| 1056 |
+
(2017),
|
| 1057 |
+
972-993.
|
| 1058 |
+
https://journals.sagepub.com/doi/abs/10.1177/1077699016687722
|
| 1059 |
+
[29] Joon Soo Lim and Guy J. Golan. 2011. Social Media Activism in Response to the
|
| 1060 |
+
Influence of Political Parody Videos on YouTube. Communication Research, 38, 5 (2011),
|
| 1061 |
+
710-727. https://journals.sagepub.com/doi/abs/10.1177/0093650211405649
|
| 1062 |
+
[30] Sonia Livingstone. 2013. ‘Knowledge enhancement’: the risks and opportunities of
|
| 1063 |
+
evidence-based policy (2013).
|
| 1064 |
+
[31] Ven-hwei Lo and Chingching Chang. 2006. Knowledge about the Gulf Wars:A
|
| 1065 |
+
Theoretical Model of Learning from the News. Harvard International Journal of
|
| 1066 |
+
Press/Politics,
|
| 1067 |
+
11,
|
| 1068 |
+
3
|
| 1069 |
+
(2006),
|
| 1070 |
+
135-155.
|
| 1071 |
+
https://journals.sagepub.com/doi/abs/10.1177/1081180X06289582
|
| 1072 |
+
[32] J. Nathan Matias. 2016. Going dark: Social factors in collective action against platform
|
| 1073 |
+
operators in the Reddit blackout. City, 2016.
|
| 1074 |
+
[33] DOUGLAS M. McLEOD, WILLIAM P. EVELAND and AMY I. NATHANSON. 1997. Support
|
| 1075 |
+
for Censorship of Violent and Misogynic Rap Lyrics:An Analysis of the Third-Person Effect.
|
| 1076 |
+
Communication
|
| 1077 |
+
Research,
|
| 1078 |
+
24,
|
| 1079 |
+
2
|
| 1080 |
+
(1997),
|
| 1081 |
+
153-174.
|
| 1082 |
+
https://journals.sagepub.com/doi/abs/10.1177/009365097024002003
|
| 1083 |
+
[34] Ben Medeiros. 2017. Platform (Non-)Intervention and the “Marketplace” Paradigm for
|
| 1084 |
+
Speech Regulation. Social Media + Society, 3, 1 (2017), 2056305117691997.
|
| 1085 |
+
https://journals.sagepub.com/doi/abs/10.1177/2056305117691997
|
| 1086 |
+
[35] Teresa K Naab, Anja Kalch and Tino GK Meitz. 2018. Flagging uncivil user comments:
|
| 1087 |
+
Effects of intervention information, type of victim, and response comments on bystander
|
| 1088 |
+
behavior.
|
| 1089 |
+
New
|
| 1090 |
+
Media
|
| 1091 |
+
&
|
| 1092 |
+
Society,
|
| 1093 |
+
20,
|
| 1094 |
+
2
|
| 1095 |
+
(2018),
|
| 1096 |
+
777-795.
|
| 1097 |
+
https://journals.sagepub.com/doi/abs/10.1177/1461444816670923
|
| 1098 |
+
[36] Teresa K. Naab, Thorsten Naab and Jonas Brandmeier. 2021. Uncivil User Comments
|
| 1099 |
+
Increase Users’ Intention to Engage in Corrective Actions and Their Support for
|
| 1100 |
+
Authoritative Restrictive Actions. Journalism & Mass Communication Quarterly, 98, 2
|
| 1101 |
+
(2021), 566-588. https://journals.sagepub.com/doi/abs/10.1177/1077699019886586
|
| 1102 |
+
[37] Hye-Jin Paek, Jennifer L. Lambe and Douglas M. McLeod. 2008. Antecedents to Support
|
| 1103 |
+
for Content Restrictions. Journalism & Mass Communication Quarterly, 85, 2 (2008), 273-
|
| 1104 |
+
290. https://journals.sagepub.com/doi/abs/10.1177/107769900808500204
|
| 1105 |
+
[38] Hye-Jin Paek, Zhongdang Pan, Ye Sun, Joseph Abisaid and Debra Houden. 2005. The
|
| 1106 |
+
Third-Person Perception as Social Judgment:An Exploration of Social Distance and
|
| 1107 |
+
Uncertainty in Perceived Effects of Political Attack Ads. Communication Research, 32, 2
|
| 1108 |
+
(2005), 143-170. https://journals.sagepub.com/doi/abs/10.1177/0093650204273760
|
| 1109 |
+
|
| 1110 |
+
[39] Vincent Price and David Tewksbury. 1996. Measuring the Third-Person Effect of News:
|
| 1111 |
+
The Impact of Question Order, Contrast and Knowledge. International Journal of Public
|
| 1112 |
+
Opinion Research, 8, 2 (1996), 120-141. https://doi.org/10.1093/ijpor/8.2.120
|
| 1113 |
+
[40] Manuel Puppis and Hilde Van den Bulck. 2019. Introduction: Media Policy and Media
|
| 1114 |
+
Policy
|
| 1115 |
+
Research.
|
| 1116 |
+
Springer
|
| 1117 |
+
International
|
| 1118 |
+
Publishing,
|
| 1119 |
+
City,
|
| 1120 |
+
2019.
|
| 1121 |
+
https://doi.org/10.1007/978-3-030-16065-4_1
|
| 1122 |
+
[41] Martin J. Riedl, Teresa K. Naab, Gina M. Masullo, Pablo Jost and Marc Ziegele. 2021.
|
| 1123 |
+
Who is responsible for interventions against problematic comments? Comparing user
|
| 1124 |
+
attitudes in Germany and the United States. Policy & Internet (2021).
|
| 1125 |
+
[42] Martin J. Riedl, Kelsey N. Whipple and Ryan Wallace. 2021. Antecedents of support for
|
| 1126 |
+
social media content moderation and platform regulation: the role of presumed effects on
|
| 1127 |
+
self
|
| 1128 |
+
and
|
| 1129 |
+
others.
|
| 1130 |
+
Information,
|
| 1131 |
+
Communication
|
| 1132 |
+
&
|
| 1133 |
+
Society
|
| 1134 |
+
(2021),
|
| 1135 |
+
1-18.
|
| 1136 |
+
https://doi.org/10.1080/1369118X.2021.1874040
|
| 1137 |
+
[43] Hernando Rojas. 2010. “Corrective” Actions in the Public Sphere: How Perceptions of
|
| 1138 |
+
Media and Media Effects Shape Political Behaviors. International Journal of Public Opinion
|
| 1139 |
+
Research, 22, 3 (2010), 343-363. https://doi.org/10.1093/ijpor/edq018
|
| 1140 |
+
[44] Hernando Rojas, Dhavan V. Shah and Ronald J. Faber. 1996. For the Good of Others:
|
| 1141 |
+
Censorship and the Third-person Effect. International Journal of Public Opinion Research, 8,
|
| 1142 |
+
2 (1996), 163-186. https://doi.org/10.1093/ijpor/8.2.163
|
| 1143 |
+
[45] Steven Ruggles, Sarah Flood, Ronald Goeken, Megan Schouweiler and Matthew Sobek.
|
| 1144 |
+
2022. IPUMS USA, Minneapolis, MN. https://doi.org/10.18128/D010.V12.0
|
| 1145 |
+
[46] Valarie Schweisberger, Jennifer Billinson and T. Makana Chock. 2014. Facebook, the
|
| 1146 |
+
Third-Person Effect, and the Differential Impact Hypothesis*. Journal of Computer-Mediated
|
| 1147 |
+
Communication, 19, 3 (2014), 403-413. https://doi.org/10.1111/jcc4.12061
|
| 1148 |
+
[47] Steve Stecklow. 2018. Why Facebook is losing the war on hate speech in Myanmar.
|
| 1149 |
+
Thomson
|
| 1150 |
+
Reuters,
|
| 1151 |
+
City,
|
| 1152 |
+
2018.
|
| 1153 |
+
https://www.reuters.com/investigates/special-
|
| 1154 |
+
report/myanmar-facebook-hate/
|
| 1155 |
+
[48] John L Sullivan, James Piereson and George E Marcus Political tolerance and American
|
| 1156 |
+
democracy. University of Chicago Press, 1993.
|
| 1157 |
+
[49] Ye Sun, Zhongdang Pan and Lijiang Shen. 2008. Understanding the Third-Person
|
| 1158 |
+
Perception: Evidence From a Meta-Analysis. Journal of Communication, 58, 2 (2008), 280-
|
| 1159 |
+
300. https://doi.org/10.1111/j.1460-2466.2008.00385.x
|
| 1160 |
+
[50] Ran Wei, Stella C. Chia and Ven-Hwei Lo. 2011. Third-person Effect and Hostile Media
|
| 1161 |
+
Perception Influences on Voter Attitudes toward Polls in the 2008 U.S. Presidential
|
| 1162 |
+
Election. International Journal of Public Opinion Research, 23, 2 (2011), 169-190.
|
| 1163 |
+
https://doi.org/10.1093/ijpor/edq044
|
| 1164 |
+
[51] Mark Williams, Michelle Butler, Anna Jurek-Loughrey and Sakir Sezer. 2021. Offensive
|
| 1165 |
+
communications: exploring the challenges involved in policing social media. Contemporary
|
| 1166 |
+
Social
|
| 1167 |
+
Science,
|
| 1168 |
+
16,
|
| 1169 |
+
2
|
| 1170 |
+
(2021/03/15
|
| 1171 |
+
2021),
|
| 1172 |
+
227-240.
|
| 1173 |
+
https://doi.org/10.1080/21582041.2018.1563305
|
| 1174 |
+
[52] David A Yalof and Kenneth Dautrich The First Amendment and the media in the court of
|
| 1175 |
+
public opinion. Cambridge University Press, 2002.
|
| 1176 |
+
[53] Marc Ziegele, Teresa K Naab and Pablo Jost. 2020. Lonely together? Identifying the
|
| 1177 |
+
determinants of collective corrective action against uncivil comments. New Media & Society,
|
| 1178 |
+
22,
|
| 1179 |
+
5
|
| 1180 |
+
(2020),
|
| 1181 |
+
731-751.
|
| 1182 |
+
https://journals.sagepub.com/doi/abs/10.1177/1461444819870130
|
| 1183 |
+
|
HdE0T4oBgHgl3EQfRgBm/content/tmp_files/load_file.txt
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
HtE5T4oBgHgl3EQfWg9Q/content/tmp_files/load_file.txt
ADDED
|
@@ -0,0 +1,220 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
filepath=/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf,len=219
|
| 2 |
+
page_content='arXiv:2301.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 3 |
+
page_content='05559v1 [quant-ph] 11 Jan 2023 Supercurrent and Electromotive force generations by the Berry connection from many-body wave functions Hiroyasu Koizumi Division of Quantum Condensed Matter Physics, Center for Computational Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8577, Japan E-mail: koizumi.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 4 |
+
page_content='hiroyasu.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 5 |
+
page_content='fn@u.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 6 |
+
page_content='tsukuba.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 7 |
+
page_content='ac.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 8 |
+
page_content='jp January 2023 Abstract.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 9 |
+
page_content=' The velocity field composed of the electromagnetic field vector potential and the Berry connection from many-body wave functions explains supercurrent generation, Faraday’s law for the electromotive force (EMF) generation, and other EMF generations whose origins are not electromagnetism.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 10 |
+
page_content=' An example calculation for the EMF from the Berry connection is performed using a model for the cuprate superconductivity.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 11 |
+
page_content=' 1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 12 |
+
page_content=' Introduction The Berry phase first discovered in the context of the adiabatic approximation now prevails in various fields of physics [1, 2].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 13 |
+
page_content=' In particular, it is now an indispensable mathematical tool to detect topological defects in quantum wave functions [3].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 14 |
+
page_content=' Recently, the Berry connection from many-body wave functions was defined and its usefulness to calculate supercurrent is demonstrated [4].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 15 |
+
page_content=' A salient feature of such a formalism is that it provides a vector potential directly related to the velocity field for electric current.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 16 |
+
page_content=' In the present work, we consider the supercurrent and electromotive force (EMF) generations based on the same formalism [4, 5].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 17 |
+
page_content=' The EMF is expressed using a non-irrotational ‘electric field’, Eirrot, whose origin may not be a real electric field.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 18 |
+
page_content=' It is defined as E = � C Enon−irrot · dr (1) where C is a closed electric circuit.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 19 |
+
page_content=' This EMF appears due to various causes, such as chemical reactions in batters or temperature differences in metals.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 20 |
+
page_content=' One of the important EMF generation mechanisms is the Faraday’s law of magnetic induction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 21 |
+
page_content=' It is expressed as a total time-derivative of a magnetic flux of the magnetic field B E = − d dt � S B · dS (2) Supercurrent and EMF by Berry connection 2 where S is a surface whose circumference is C.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 22 |
+
page_content=' This EMF formula is often called the “flux rule”, since � S B · dS is the magnetic flux through the surface S;' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 23 |
+
page_content=' it has been claimed curious since it is composed of two different fundamental equations in classical theory [6], i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 24 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 25 |
+
page_content=', the Faraday’s law of induction and the Lorentz force.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 26 |
+
page_content=' The curiosity is increased by the fact that one of them is an equation for fields only, and the other includes particles and is an equation for a force on a particle.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 27 |
+
page_content=' This peculiarity disappears in quantum theory using the vector potential A that is more fundamental than the magnetic field B [7, 8, 9], and the wave function makes the velocity of a particle a velocity field [10].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 28 |
+
page_content=' Then, the two contributions in the “flux rule” are connected by the duality that a U(1) phase factor added on a wave function describes a whole system motion, and also plays the role of the vector potential when it is transferred into the Hamiltonian [11].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 29 |
+
page_content=' In the present work, we extend the above vector potential and velocity field approach for the electric current generation to cases where the vector potential of the Berry connection from many-body wave functions appears [4].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 30 |
+
page_content=' We show that the EMF generation other than the electromagnetic field origin, such as those due to chemical reactions or temperature gradients can be expressed by it.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 31 |
+
page_content=' The organization of the present work is as follows: we explain the velocity field appearing from the Berry connection from many-body wave functions in Section 2.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 32 |
+
page_content=' We reexamine the Faraday’s EMF generation formula using the velocity field from the electromagnetic vector potential in Section 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 33 |
+
page_content=' We examine the EMF generation by the Berry connection in Section 4, and an example calculation is performed for the Nernst effect in Section 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 34 |
+
page_content=' Lastly, we conclude the present work by mentioning implications of the present new theory in Section 6.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 35 |
+
page_content=' 2.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 36 |
+
page_content=' The velocity field from the Berry connection form many-body wave functions and supercurrent generation The key ingredient in the present work is the Berry connection from many-body wave functions for electrons given by AMB Ψ (r)= 1 ℏρ(r)Re �� dσ1dx2 · · ·dxNΨ∗(r,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 37 |
+
page_content=' σ1,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 38 |
+
page_content=' · · · ,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 39 |
+
page_content=' xN)(−iℏ∇)Ψ(r,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 40 |
+
page_content=' σ1,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 41 |
+
page_content=' · · · ,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 42 |
+
page_content=' xN) � (3) where N is the total number of electrons in the system,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 43 |
+
page_content=' ‘Re’ denotes the real part,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 44 |
+
page_content=' Ψ is the total wave function,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 45 |
+
page_content=' xi collectively stands for the coordinate ri and the spin σi of the ith electron,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 46 |
+
page_content=' −iℏ∇ is the Schr¨odinger’s momentum operator for the coordinate vector r,' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 47 |
+
page_content=' and ρ(r) is the number density calculated from Ψ.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 48 |
+
page_content=' This Berry connection is obtained by regarding r as the “adiabatic parameter”[1].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 49 |
+
page_content=' Let us consider the electron system whose kinetic energy operator in the Schr¨odinger Supercurrent and EMF by Berry connection 3 representation is given by ˆT = − N � j=1 ℏ2 2me ∇2 j (4) where me is the electron mass.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 50 |
+
page_content=' For convenience, we also use the following χ defined as χ(r) = −2 � r 0 AMB Ψ (r′) · dr′ (5) and express the many-electron wave function Ψ as Ψ(x1, · · · , xN) = exp � − i 2 N � j=1 χ(rj) � Ψ0(x1, · · · , xN) (6) Then, Ψ0 = Ψ exp � i 2 �N j=1 χ(rj) � is a currentless wave function for the current operator associated with ˆT in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 51 |
+
page_content=' (4) since the contribution from Ψ and that from exp � i 2 �N j=1 χ(rj) � cancel out.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 52 |
+
page_content=' In other words, a wave function is given as a product of a currentless one, Ψ0, and the factor for the current exp � − i 2 �N j=1 χ(rj) � .' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 53 |
+
page_content=' The total wave function Ψ must be a single-valued function of coordinates.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 54 |
+
page_content=' This makes χ as an angular variable that satisfies some periodicity.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 55 |
+
page_content=' This periodicity gives rise to non-trivial topological integer as will be explained, shortly.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 56 |
+
page_content=' When electromagnetic field is included, the kinetic energy operator becomes ˆT ′ = N � j=1 1 2me (−iℏ∇j − qA)2 (7) where q = −e is the electron charge, and A is the electromagnetic field vector potential.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 57 |
+
page_content=' The magnetic field is given by B = ∇ × A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 58 |
+
page_content=' In the following, we will use the same expression, Ψ, for the total wave function.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 59 |
+
page_content=' Then, the current density for Ψ is given by j = −eρv (8) with the velocity field v given by v = e me � A − ℏ 2e∇χ � = e me A + ℏ me AMB Ψ (9) The current density in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 60 |
+
page_content=' (8) is known to give rise to the Meissner effect if it is a stable one due to the fact that it explicitly depends on A [10].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 61 |
+
page_content=' For the stable current case, ∇χ compensates the gauge ambiguity in A and makes v in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 62 |
+
page_content=' (9) gauge invariant.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 63 |
+
page_content=' If the Meissner effect is realize, the magnetic filed is expelled from the bulk of a superconductor [10].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 64 |
+
page_content=' Then, the flux quantization is observed for magnetic flux through Supercurrent and EMF by Berry connection 4 a loop C that goes through the bulk of a ring-shaped superconductor � S B · dS = � C A · dr = ℏ 2e � C ∇χ · dr = h 2ewC[χ] (10) where wC[χ] is the topological integer ‘winding number’ defined by wC[χ] = 1 2π � C ∇χ · dr (11) According to Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 65 |
+
page_content=' (9), the presence of non-zero wC[χ] means the existence of the stable velocity field that satisfies � C v · dr = h 2me wC[χ] (12) In superconductors, the quantized flux persists.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 66 |
+
page_content=' This means that the condition d dtwC[χ] = 0 (13) is realized.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 67 |
+
page_content=' In normal metals, the time-derivative of the velocity field is often expressed as dv dt = −1 τ v (14) using a relaxation time approximation, where τ is the relaxation time.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 68 |
+
page_content=' Combination of this with Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 69 |
+
page_content=' (12) yields τ d dtwC[χ] = −wC[χ] (15) If the condition in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 70 |
+
page_content=' (13) with nonzero wC[χ] is realized, Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 71 |
+
page_content=' (15) means that τ must be ∞, i.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 72 |
+
page_content='e.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 73 |
+
page_content=', an infinite conductivity, or zero resistivity is realized.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 74 |
+
page_content=' 3.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 75 |
+
page_content=' The vorticity field from the vector potential A and Faraday’s flux rule In this section, we consider the case where non-trivial AMB Ψ is absent.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 76 |
+
page_content=' When AMB Ψ is trivial, it satisfies ∇ × AMB Ψ = 0 (16) Thus, by applying ∇× on the both sides of Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 77 |
+
page_content=' (9) ∇ × v = e me B (17) is obtained.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 78 |
+
page_content=' Taking the total time-derivative of the above yields ∇ × dv dt = e me ∂tB + e me (v · ∇)B (18) Supercurrent and EMF by Berry connection 5 where the total time-derivative of the field B is the Eulerian time-derivative given by dB dt = ∂tB + (v · ∇)B (19) Integrating Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 79 |
+
page_content=' (18) over the surface S, we have � C dv dt · dr = e me � S ∂tB · dS + e me � S (v · ∇)B · dS (20) where the Stokes theorem is used to convert the surface integral to the line integral.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 80 |
+
page_content=' Noting that the electromotive force for an electron is given by E = 1 −e � C d(mev) dt dr (21) where −e is the electron charge and me is the electron mass, the following relation is obtained E = − � S ∂tB · dS − � S (v · ∇)B · dS (22) This is equal to the Faraday’s formula in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 81 |
+
page_content=' (2).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 82 |
+
page_content=' In the situation where the circuit C moves with a constant velocity v0, we have the following relation (v0 · ∇)B = ∇ × (B × v0) + v0(∇ · B) = ∇ × (B × v0) (23) due to the fact that B satisfies ∇ · B = 0 [12].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 83 |
+
page_content=' As a consequence, the well-known EMF formula E = − � S ∂tB · dS + � C (v0 × B) · dr (24) is obtained.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 84 |
+
page_content=' The first term in it is attributed to the Faraday’s law of induction, and the second to the Lorentz force.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 85 |
+
page_content=' This formula is composed of two different fundamental equations in classical theory [6].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 86 |
+
page_content=' However, in the quantum mechanical formalism, two contributions stem from a single relation in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 87 |
+
page_content=' (9).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 88 |
+
page_content=' 4.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 89 |
+
page_content=' The EMF generation by the Berry connection The velocity field in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 90 |
+
page_content=' (9) contains the vector potential AMB Ψ in addition to the electromagnetic vector potential A.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 91 |
+
page_content=' Just like A, AMB Ψ will also give rise to the EMF.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 92 |
+
page_content=' We now consider a general case where the Berry connection arises from a set of states {Ψj} and given by AMB = � j pjAMB Ψj (25) where pj’s are probabilities satisfy � j pj = 1 (26) and AMB Ψj is obtained from Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 93 |
+
page_content=' (3) by replacing Ψ with Ψj.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 94 |
+
page_content=' Supercurrent and EMF by Berry connection 6 We express AMB using the following density matrix ˆd = � j pj|Ψj⟩⟨Ψj| (27) where the operator ˆAMB is defined through the relation ⟨Ψj| ˆAMB|Ψj⟩ = AMB Ψj (28) From now on, we allow the time-dependence in Ψj.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 95 |
+
page_content=' When Ψj is time-dependent, AMB Ψj is also time-dependent.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 96 |
+
page_content=' The distribution probability pj can be also time and coordinate dependent.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 97 |
+
page_content=' Using the density operator ˆd and the operator ˆAMB, the vector potential from the Berry connection is given by AMB = tr � ˆd ˆAMB� (29) We define BMB by BMB = ∇ × AMB (30) Then, the EMF from the Berry connection is given by EMB = −ℏ e � S ∂tBMB · dS − ℏ e � S (v · ∇)BMB · dS (31) The first term in the right hand side can arise from the time-dependence of pj.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 98 |
+
page_content=' This means that if pj varies with time due to chemical reactions, photo excitations, or etc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 99 |
+
page_content=' it will give rise to the EMF.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 100 |
+
page_content=' The second term will arise if the temperature depends on the coordinate, T(r), and pj contains the Boltzmann factor exp(− Ej kBT(r)), where Ej is the energy for the state Ψj.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 101 |
+
page_content=' It also arises when pj depends on the coordinate due, for example, to the concentration gradient of chemical spices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 102 |
+
page_content=' Now we consider the case where the circuit moves with a constant vector v0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 103 |
+
page_content=' The circuit in this case should be regarded as a region of the system which flows due to the flow existing in the system.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 104 |
+
page_content=' Such a motion may arise from a temperature gradient or concentration gradient in the system.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 105 |
+
page_content=' In this case, we have the following relation, (v · ∇)BMB = −∇ × (v0 × BMB) (32) due to the fact that ∇ · BMB = ∇ · (∇ × AMB) = 0.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 106 |
+
page_content=' The equation (31) can be cast into the following form EMB = −ℏ e � C � ∂tAMB − v0 × (∇ × AMB) � dr (33) that only contains AMB.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 107 |
+
page_content=' However, the above formula may not be convenient to use due to the fact that AMB contains topological singularities.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 108 |
+
page_content=' A convenient one may be the following EMB = −ℏ e d dt � S BMB · dS (34) where B in the Faraday’s law in Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 109 |
+
page_content=' (2) is replaced by BMB.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 110 |
+
page_content=' Supercurrent and EMF by Berry connection 7 5.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 111 |
+
page_content=' Nernst effect In this section, we examine the Nernst effect observed in cuprate superconductors [13, 14, 15].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 112 |
+
page_content=' We examine this phenomenon using Eq.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 113 |
+
page_content=' (34).' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 114 |
+
page_content=' A theory of superconductivity in the cuprate predicts the appearance of spin-vortices in the CuO2 plane around doped holes that become small polarons [16, 17, 18].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 115 |
+
page_content=' The spin-vortices generate the vector potential AMB = −1 2∇χ (35) where χ is an angular variable with period 2π.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 116 |
+
page_content=' This angular variable appears due to the requirement that the wave function to be a single-valued function of coordinates in the situation where itinerant motion of electrons around the small polaron hole is a spin-twisting one.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 117 |
+
page_content=' We can decompose χ as a sum over spin-vortices χ = Nh � j=1 χj (36) where χj is a contribution form the jth small polaron hole, and Nh is the total number of holes that become small polarons.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 118 |
+
page_content=' Each χj is characterized by its winding number wj = 1 2π � Cj ∇χj · dr (37) where Cj is a loop that only encircles the center of the jth spin-vortex.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 119 |
+
page_content=' We can assume wj to be +1 or −1;' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 120 |
+
page_content=' only odd integers are allowed due to the spin-twisting motion.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 121 |
+
page_content=' The numbers ±1 are favorable from the energetic point of view.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 122 |
+
page_content=' C(t) v0 x y Ly C(t+Δt) v0 x0+ Δt x0 Figure 1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 123 |
+
page_content=' A schematic picture for the EMF appearing from the Berry connection generated by spin-vortices.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 124 |
+
page_content=' The Berry connection creates the vector potential proportional to ∇χ, which creates vortices (loop currents) denoted by circles with arrows.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 125 |
+
page_content=' We consider two loops C(t) and C(t + ∆t), where t and t + ∆t denote two times with interval ∆t.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 126 |
+
page_content=' The loop moves with velocity v0 in the x-direction due to the temperature gradient in that direction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 127 |
+
page_content=' A constant magnetic field is applied in the z- direction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 128 |
+
page_content=' A voltage is generated across the y-direction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 129 |
+
page_content=' The sample exists 0 ≤ y ≤ Ly.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 130 |
+
page_content=' The left edge of the loop at time t is x0 and that at time t + ∆t is x0 + v0∆t.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 131 |
+
page_content=' Supercurrent and EMF by Berry connection 8 Let us consider the situation depicted in Fig.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 132 |
+
page_content=' 1.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 133 |
+
page_content=' We neglect the contribution from A assuming that it is small.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 134 |
+
page_content=' The EMF generated across the sample in the y-direction is given by EMB = − ℏ e 1 ∆t �� S(t+∆t) BMB · dS − � S(t) BMB · dS � = − ℏ e 1 ∆t �� C(t+∆t) AMB · dr − � C(t) AMB · dr � = ℏ e 1 ∆t � ∆C AMB · dr (38) where S(t+∆t) and S(t) are surfaces in the xy-plane with circumferences C(t+∆t) and C(t), respectively;' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 135 |
+
page_content=' ∆C is the loop encircling the area x0 ≤ x ≤ x0 + v0∆t, 0 ≤ y ≤ Ly, with the counterclockwise direction.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 136 |
+
page_content=' We approximate � ∆C AMB · dr by � ∆C AMB · dr = − 1 2 � ∆C ∇χ · dr ≈ − 1 22π(nm − na)Lyv0∆t (39) where nm and na are average densities of wj = 1 (‘meron’) and wj = −1 (‘antimeron’) vortices, respectively.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 137 |
+
page_content=' Thus, nmLyv0∆t and naLyv0∆t are expected numbers of wj = 1 and wj = −1 vortices within the loop ∆C, respectively.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 138 |
+
page_content=' From Eqs.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 139 |
+
page_content=' (38) and (38), the approximate EMB is given by EMB ≈ hv0 2e (na − nm)Ly (40) Thus, the electric field generated by EMB in the y-direction is given by Ey ≈ hv0 2e (na − nm) (41) In our previous work, na is denoted as nd indicting that it yields a diamagnetic current, and nm as np indicting that it yields a paramagnetic current [17, 18].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 140 |
+
page_content=' Using nd and np, the Nernst signal is obtained as eN = Ey |∂xT| = hv0(nd − np) 2e|∂xT| (42) The same formula was obtained previously for the situation where spin-vortices move by the temperature gradient [17, 18].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 141 |
+
page_content=' Here, the situation is different;' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 142 |
+
page_content=' the spin-vortices do not move, but the electron system affected by ∇χ moves.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 143 |
+
page_content=' Considering that the small polaron movement is negligible at low temperature, the present situation is more realistic than the previous one.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 144 |
+
page_content=' The temperature dependence is the same as the one that qualitatively explains the experimental result [18].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 145 |
+
page_content=' Note that experiments indicating the presence of loop currents different from ordinary Abrikosov vortices [19] in the cuprate [20, 21].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 146 |
+
page_content=' The present result indicates that the observed Nernst can be explained by the presence of spin-vortex-induced loop currents.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 147 |
+
page_content=' Supercurrent and EMF by Berry connection 9 6.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 148 |
+
page_content=' Concluding remarks Since the EMF by the Berry connection is not the electromagnetic field origin, it may be more appropriate to call it the Berry-connection motive force (BCMF) given by F BMF = −eEMB = ℏ d dt � S BMB · dS (43) The BCMF will arise from quantum mechanical dynamics of particles other than electrons;' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 149 |
+
page_content=' for example, from proton dynamics, through chemical reactions.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 150 |
+
page_content=' The non- trivial Berry phase effect has been predicted [22], and observed in the hydrogen transfer reactions [23].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 151 |
+
page_content=' Quantum mechanical effects are important in such reactions due to the relatively light mass of protons [24, 25].' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 152 |
+
page_content=' It is known that the EMF generated by the proton pumps is a very important chemical process in biological systems, and the Berry- connection motive force may play some roles in the working of the proton pumps.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 153 |
+
page_content=' It may be also useful to invent high performance batteries.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 154 |
+
page_content=' References [1] Berry M V 1984 Proc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 155 |
+
page_content=' Roy.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 156 |
+
page_content=' Soc.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 157 |
+
page_content=' London Ser.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 158 |
+
page_content=' A 391 45 [2] Bohm A, Mostafazadeh A, Koizumi H, Niu Q and Zwanziger J 2003 The Geometric Phase in Quantum Systems (Springer) [3] Chiu C K, Teo J C Y, Schnyder A P and Ryu S 2016 Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 159 |
+
page_content=' Mod.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 160 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 161 |
+
page_content=' 88(3) 035005 URL https://link.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 162 |
+
page_content='aps.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 163 |
+
page_content='org/doi/10.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 164 |
+
page_content='1103/RevModPhys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 165 |
+
page_content='88.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 166 |
+
page_content='035005 [4] Koizumi H 2022 Physics Letters A 450 128367 ISSN 0375-9601 URL https://www.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 167 |
+
page_content='sciencedirect.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 168 |
+
page_content='com/science/article/pii/S0375960122004492 [5] Koizumi H 2022 arXiv:2211.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 169 |
+
page_content='08759 [cond-mat.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 170 |
+
page_content='supr-con] [6] Feynman R P, Leighton R B and Sands M 1963 The Feynman Lectures on Physics vol 2 (Addison- Wesley) [7] Aharonov Y and Bohm D 1959 Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 171 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 172 |
+
page_content=' 115 167 [8] Tonomura A, Matsuda T, Suzuki R, Fukuhara A, Osakabe N, Umezaki H, Endo J, Shinagawa K, Sugita Y and Fujiwara H 1982 Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 173 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 174 |
+
page_content=' Lett.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 175 |
+
page_content=' 48 1443 [9] Tonomura A, Osakabe N, Matsuda T, Kawasaki T, Endo J, Yano S and Yamada H 1986 Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 176 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 177 |
+
page_content=' Lett.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 178 |
+
page_content=' 56(8) 792–795 URL https://link.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 179 |
+
page_content='aps.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 180 |
+
page_content='org/doi/10.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 181 |
+
page_content='1103/PhysRevLett.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 182 |
+
page_content='56.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 183 |
+
page_content='792 [10] London F 1950 Superfluids vol 1 (New York: Wiley) [11] Koizumi H 2017 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 184 |
+
page_content=' Supercond.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 185 |
+
page_content=' Nov.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 186 |
+
page_content=' Magn.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 187 |
+
page_content=' 30 3345–3349 [12] Jackson J D 1998 Classical Electrodynamics (Wiley) [13] Xu Z A, Ong N P, Wang Y, Kakeshita T and Uchida S 2000 Nature 406 486 [14] Wang Y, Li L, Naughton M J, Gu G D, Uchida S and Ong N P 2005 Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 188 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 189 |
+
page_content=' Lett.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 190 |
+
page_content=' 95 247002 [15] Daou R, Chang J, LeBoeuf D, Cyr-Choiniere O, Laliberte F, Doiron-Leyraud N, Ramshaw B J, Liang R, Bonn D A, Hardy W N and Taillefer L 2010 Nature 463 519–522 URL http://dx.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 191 |
+
page_content='doi.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 192 |
+
page_content='org/10.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 193 |
+
page_content='1038/nature08716 [16] Koizumi H 2009 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 194 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 195 |
+
page_content=' Chem.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 196 |
+
page_content=' A 113 3997 [17] Koizumi H 2011 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 197 |
+
page_content=' Supercond.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 198 |
+
page_content=' Nov.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 199 |
+
page_content=' Magn.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 200 |
+
page_content=' 24 1997 [18] Hidekata R and Koizumi H 2011 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 201 |
+
page_content=' Supercond.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 202 |
+
page_content=' Nov.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 203 |
+
page_content=' Magn.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 204 |
+
page_content=' 24 2253 [19] Abrikosov A A 1957 Sov.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 205 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 206 |
+
page_content=' JETP 5 1174 [20] Xia J, Schemm E, Deutscher G, Kivelson S A, Bonn D A, Hardy W H, Liang R, Siemons W, Koster G, Fejer M M and Kapitulnik A 2008 Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 207 |
+
page_content=' Rev.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 208 |
+
page_content=' Lett.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 209 |
+
page_content=' 100 127002 [21] He R H, Hashimoto M, Karapetyan H, Koralek J D, Hinton J P, Testaud J P, Nathan V, Yoshida Supercurrent and EMF by Berry connection 10 Y, Yao H, Tanaka K, Meevasana W, Moore R G, Lu D H, Mo S K, Ishikado M, Eisaki H, andT P Devereaux Z H, Kivelson S A, Orenstein J, Kapitulnik A and Shen Z X [22] Mead C A and Truhlar D 1979 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 210 |
+
page_content=' Chem.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 211 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 212 |
+
page_content=' 70 2284 [23] Yuan D, Guan Y, Chen W, Zhao H, Yu S, Luo C, Tan Y, Xie T, Wang X, Sun Z, Zhang D H and Yang X 2018 Science 362 1289–1293 ISSN 0036-8075 URL https://science.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 213 |
+
page_content='sciencemag.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 214 |
+
page_content='org/content/362/6420/1289 [24] Kuppermann A and Schatz G C 1975 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 215 |
+
page_content=' Chem.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 216 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 217 |
+
page_content=' 62 62 2502 [25] Elkowitz A B and Wyatt R E 1975 J.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 218 |
+
page_content=' Chem.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 219 |
+
page_content=' Phys.' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
| 220 |
+
page_content=' 62 2504' metadata={'source': '/home/zjlab/wf/langchain-ChatGLM/knowledge_base/HtE5T4oBgHgl3EQfWg9Q/content/2301.05559v1.pdf'}
|
J9FIT4oBgHgl3EQfZytY/vector_store/index.faiss
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:132a6edb129b513f30724124878b926c135e78944cc50e45e3efc3f13d447c44
|
| 3 |
+
size 1966125
|
JNE2T4oBgHgl3EQfUgdI/content/2301.03813v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:a7b824d81b6e36753365507f03eb135d67316ec1f345d3013dbf71afed332235
|
| 3 |
+
size 197918
|
JNE2T4oBgHgl3EQfUgdI/vector_store/index.pkl
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:42d6a0f2c90977ccc27e01a908ef07e724adc6bcfa0aa1516f2d65ce4d90d72c
|
| 3 |
+
size 78405
|
JNE4T4oBgHgl3EQfIgz1/content/2301.04914v1.pdf
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:05d1c94bf7d6c6c8448b5f066db7b3540a2696be853c9544b2fb7b1aa2028f3c
|
| 3 |
+
size 495741
|