diff --git "a/test.rs" "b/test.rs" new file mode 100644--- /dev/null +++ "b/test.rs" @@ -0,0 +1,15099 @@ +use rand::prelude::*; + +/// A `Struct` for dealing with the randomised part of sub-sampling. +pub struct SubSampler { + /// Number of bases to sub-sample down to. + pub target_total_bases: u64, + /// Random seed to use for sub-sampling. If `None` is used, then the random number generator + /// will be seeded by the operating system. + pub seed: Option, +} + +impl SubSampler { + /// Returns a vector of indices for elements in `v`, but shuffled. + /// + /// # Note + /// + /// If the file has more than 4,294,967,296 reads, this function's behaviour is undefined. + /// + /// # Example + /// + /// ```rust + /// let v: Vec = vec![55, 1]; + /// let sampler = SubSampler { + /// target_total_bases: 100, + /// seed: None, + /// }; + /// let mut num_times_shuffled = 0; + /// let iterations = 500; + /// for _ in 0..iterations { + /// let idxs = sampler.shuffled_indices(&v); + /// if idxs == vec![1, 0] { + /// num_times_shuffled += 1; + /// } + /// } + /// // chances of shuffling the same way 100 times in a row is 3.054936363499605e-151 + /// assert!(num_times_shuffled > 0 && num_times_shuffled < iterations) + /// ``` + fn shuffled_indices(&self, v: &[T]) -> Vec { + let mut indices: Vec = (0..v.len() as u32).collect(); + let mut rng = match self.seed { + Some(s) => rand_pcg::Pcg64::seed_from_u64(s), + None => rand_pcg::Pcg64::seed_from_u64(random()), + }; + + indices.shuffle(&mut rng); + indices + } + + /// Sub-samples `lengths` to the desired `target_total_bases` specified in the `SubSampler` and + /// returns the indices for the reads that were selected. + /// + /// # Example + /// + /// ```rust + /// let v: Vec = vec![50, 50, 50]; + /// let sampler = SubSampler { + /// target_total_bases: 100, + /// seed: Some(1), + /// }; + /// let actual = sampler.indices(&v); + /// + /// assert_eq!(actual.len(), 3); + /// assert!(actual[1]); + /// assert!(actual[2]); + /// assert!(actual[3]); + /// ``` + pub fn indices(&self, lengths: &[u32]) -> (Vec, usize) { + let mut indices = self.shuffled_indices(lengths).into_iter(); + let mut to_keep: Vec = vec![false; lengths.len()]; + let mut total_bases_kept: u64 = 0; + + let mut nb_reads_to_keep = 0; + while total_bases_kept < self.target_total_bases { + let idx = match indices.next() { + Some(i) => i as usize, + None => break, + }; + to_keep[idx] = true; + total_bases_kept += u64::from(lengths[idx.to_owned()]); + nb_reads_to_keep += 1; + } + + (to_keep, nb_reads_to_keep) + } +} + +#[cfg(test)] +mod tests { + use super::*; + + #[test] + fn shuffled_indices_for_empty_vector_returns_empty() { + let v: Vec = Vec::new(); + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let actual = sampler.shuffled_indices(&v); + + assert!(actual.is_empty()) + } + + #[test] + fn shuffled_indices_for_vector_len_one_returns_zero() { + let v: Vec = vec![55]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let actual = sampler.shuffled_indices(&v); + let expected: Vec = vec![0]; + + assert_eq!(actual, expected) + } + + #[test] + fn shuffled_indices_for_vector_len_two_does_shuffle() { + let v: Vec = vec![55, 1]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let mut num_times_shuffled = 0; + let iterations = 500; + for _ in 0..iterations { + let idxs = sampler.shuffled_indices(&v); + if idxs == vec![1, 0] { + num_times_shuffled += 1; + } + } + + // chances of shuffling the same way 100 times in a row is 3.054936363499605e-151 + assert!(num_times_shuffled > 0 && num_times_shuffled < iterations) + } + + #[test] + fn shuffled_indices_with_seed_produces_same_ordering() { + let v: Vec = vec![55, 1, 8]; + let sampler1 = SubSampler { + target_total_bases: 100, + seed: Some(1), + }; + + let sampler2 = SubSampler { + target_total_bases: 100, + seed: Some(1), + }; + let idxs1 = sampler1.shuffled_indices(&v); + let idxs2 = sampler2.shuffled_indices(&v); + + for i in 0..idxs1.len() { + assert_eq!(idxs1[i], idxs2[i]) + } + } + + #[test] + fn subsample_empty_lengths_returns_empty() { + let v: Vec = Vec::new(); + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let (_, nb_select) = sampler.indices(&v); + + assert_eq!(nb_select, 0) + } + + #[test] + fn subsample_one_length_target_zero_returns_empty() { + let v: Vec = Vec::new(); + let sampler = SubSampler { + target_total_bases: 0, + seed: None, + }; + + let (_, nb_select) = sampler.indices(&v); + + assert_eq!(nb_select, 0); + } + + #[test] + fn subsample_one_length_less_than_target_returns_zero() { + let v: Vec = vec![5]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let (actual, nb_select) = sampler.indices(&v); + + assert_eq!(nb_select, 1); + assert!(actual[0]) + } + + #[test] + fn subsample_one_length_greater_than_target_returns_zero() { + let v: Vec = vec![500]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let (actual, nb_select) = sampler.indices(&v); + + assert_eq!(nb_select, 1); + assert!(actual[0]) + } + + #[test] + fn subsample_three_lengths_sum_greater_than_target_returns_two() { + let v: Vec = vec![50, 50, 50]; + let sampler = SubSampler { + target_total_bases: 100, + seed: Some(1), + }; + + let (actual, nb_select) = sampler.indices(&v); + + assert_eq!(nb_select, 2); + assert!(!actual[0]); + assert!(actual[1]); + assert!(actual[2]); + } + + #[test] + fn subsample_three_lengths_sum_less_than_target_returns_three() { + let v: Vec = vec![5, 5, 5]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let (actual, _) = sampler.indices(&v); + let expected = vec![true; 3]; + + assert_eq!(actual, expected); + } + + #[test] + fn subsample_three_lengths_sum_equal_target_returns_three() { + let v: Vec = vec![25, 25, 50]; + let sampler = SubSampler { + target_total_bases: 100, + seed: None, + }; + + let (actual, _) = sampler.indices(&v); + let expected = vec![true; 3]; + + assert_eq!(actual, expected); + } + + #[test] + fn subsample_three_lengths_all_greater_than_target_returns_two() { + let v: Vec = vec![500, 500, 500]; + let sampler = SubSampler { + target_total_bases: 100, + seed: Some(1), + }; + + let (actual, nb_select) = sampler.indices(&v); + println!("{:?}", actual); + + assert_eq!(nb_select, 1); + assert!(!actual[0]); + assert!(!actual[1]); + assert!(actual[2]); + } +} +#![allow(clippy::redundant_clone)] // due to a structopt problem +use std::io::stdout; + +use anyhow::{Context, Result}; +use fern::colors::{Color, ColoredLevelConfig}; +use log::{debug, error, info}; +use structopt::StructOpt; + +pub use crate::cli::Cli; +pub use crate::fastx::Fastx; +pub use crate::subsampler::SubSampler; + +mod cli; +mod fastx; +mod subsampler; + +/// Sets up the logging based on whether you want verbose logging or not. If `verbose` is `false` +/// then info, warning, and error messages will be printed. If `verbose` is `true` then debug +/// messages will also be printed. +/// +/// # Errors +/// Will error if `fern` fails to apply the logging setup. +fn setup_logger(verbose: bool) -> Result<(), fern::InitError> { + let colors = ColoredLevelConfig::new() + .warn(Color::Yellow) + .debug(Color::Magenta) + .error(Color::Red) + .trace(Color::Green); + + let log_level = if verbose { + log::LevelFilter::Debug + } else { + log::LevelFilter::Info + }; + + fern::Dispatch::new() + .format(move |out, message, record| { + out.finish(format_args!( + "{}[{}][{}] {}", + chrono::Local::now().format("[%Y-%m-%d][%H:%M:%S]"), + record.target(), + colors.color(record.level()), + message + )) + }) + .level(log_level) + .chain(std::io::stderr()) + .apply()?; + Ok(()) +} + +fn main() -> Result<()> { + let args: Cli = Cli::from_args(); + setup_logger(args.verbose).context("Failed to setup the logger")?; + debug!("{:?}", args); + + args.validate_input_output_combination()?; + let is_illumina = args.input.len() == 2; + if is_illumina { + info!("Two input files given. Assuming paired Illumina...") + } + + let input_fastx = Fastx::from_path(&args.input[0]); + + let mut output_handle = match args.output.len() { + 0 => match args.output_type { + None => Box::new(stdout()), + Some(fmt) => niffler::basic::get_writer(Box::new(stdout()), fmt, args.compress_level)?, + }, + _ => { + let out_fastx = Fastx::from_path(&args.output[0]); + out_fastx + .create(args.compress_level, args.output_type) + .context("unable to create the first output file")? + } + }; + + let target_total_bases: u64 = args.genome_size * args.coverage; + info!( + "Target number of bases to subsample to is: {}", + target_total_bases + ); + + info!("Gathering read lengths..."); + let mut read_lengths = input_fastx + .read_lengths() + .context("unable to gather read lengths for the first input file")?; + + if is_illumina { + let second_input_fastx = Fastx::from_path(&args.input[1]); + let expected_num_reads = read_lengths.len(); + info!("Gathering read lengths for second input file..."); + let mate_lengths = second_input_fastx + .read_lengths() + .context("unable to gather read lengths for the second input file")?; + + if mate_lengths.len() != expected_num_reads { + error!("First input has {} reads, but the second has {} reads. Paired Illumina files are assumed to have the same number of reads. The results of this subsample may not be as expected now.", expected_num_reads, read_lengths.len()); + std::process::exit(1); + } else { + info!( + "Both input files have the same number of reads ({}) 👍", + expected_num_reads + ); + } + // add the paired read lengths to the existing lengths + for (i, len) in mate_lengths.iter().enumerate() { + read_lengths[i] += len; + } + } + info!("{} reads detected", read_lengths.len()); + + let subsampler = SubSampler { + target_total_bases, + seed: args.seed, + }; + + let (reads_to_keep, nb_reads_to_keep) = subsampler.indices(&read_lengths); + if is_illumina { + info!("Keeping {} reads from each input", nb_reads_to_keep); + } else { + info!("Keeping {} reads", nb_reads_to_keep); + } + debug!("Indices of reads being kept:\n{:?}", reads_to_keep); + + let mut total_kept_bases = + input_fastx.filter_reads_into(&reads_to_keep, nb_reads_to_keep, &mut output_handle)? as u64; + + // repeat the same process for the second input fastx (if illumina) + if is_illumina { + let second_input_fastx = Fastx::from_path(&args.input[1]); + let second_out_fastx = Fastx::from_path(&args.output[1]); + let mut second_output_handle = second_out_fastx + .create(args.compress_level, args.output_type) + .context("unable to create the second output file")?; + + total_kept_bases += second_input_fastx.filter_reads_into( + &reads_to_keep, + nb_reads_to_keep, + &mut second_output_handle, + )? as u64; + } + + let actual_covg = total_kept_bases / args.genome_size; + info!("Actual coverage of kept reads is {:.2}x", actual_covg); + + info!("Done 🎉"); + + Ok(()) +} +use crate::cli::CompressionExt; +use needletail::errors::ParseErrorKind::EmptyFile; +use needletail::parse_fastx_file; +use std::fs::File; +use std::io::{BufWriter, Write}; +use std::path::{Path, PathBuf}; +use thiserror::Error; + +/// A collection of custom errors relating to the working with files for this package. +#[derive(Error, Debug)] +pub enum FastxError { + /// Indicates that the file is not one of the allowed file types as specified by [`FileType`](#filetype). + #[error("File type of {0} is not fasta or fastq")] + UnknownFileType(String), + + /// Indicates that the specified input file could not be opened/read. + #[error("Read error")] + ReadError { + source: needletail::errors::ParseError, + }, + + /// Indicates that a sequence record could not be parsed. + #[error("Failed to parse record")] + ParseError { + source: needletail::errors::ParseError, + }, + + /// Indicates that the specified output file could not be created. + #[error("Output file could not be created")] + CreateError { source: std::io::Error }, + + /// Indicates and error trying to create the compressor + #[error(transparent)] + CompressOutputError(#[from] niffler::Error), + + /// Indicates that some indices we expected to find in the input file weren't found. + #[error("Some expected indices were not in the input file")] + IndicesNotFound, + + /// Indicates that writing to the output file failed. + #[error("Could not write to output file")] + WriteError { source: anyhow::Error }, +} + +/// A `Struct` used for seamlessly dealing with either compressed or uncompressed fasta/fastq files. +#[derive(Debug, PartialEq)] +pub struct Fastx { + /// The path for the file. + path: PathBuf, +} + +impl Fastx { + /// Create a `Fastx` object from a `std::path::Path`. + /// + /// # Example + /// + /// ```rust + /// let path = std::path::Path::new("input.fa.gz"); + /// let fastx = Fastx::from_path(path); + /// ``` + pub fn from_path(path: &Path) -> Self { + Fastx { + path: path.to_path_buf(), + } + } + /// Create the file associated with this `Fastx` object for writing. + /// + /// # Errors + /// If the file cannot be created then an `Err` containing a variant of [`FastxError`](#fastxerror) is + /// returned. + /// + /// # Example + /// + /// ```rust + /// let path = std::path::Path::new("output.fa"); + /// let fastx = Fastx{ path }; + /// { // this scoping means the file handle is closed afterwards. + /// let file_handle = fastx.create(6, None)?; + /// write!(file_handle, ">read1\nACGT\n")? + /// } + /// ``` + pub fn create( + &self, + compression_lvl: niffler::compression::Level, + compression_fmt: Option, + ) -> Result, FastxError> { + let file = File::create(&self.path).map_err(|source| FastxError::CreateError { source })?; + let file_handle = Box::new(BufWriter::new(file)); + let fmt = match compression_fmt { + None => niffler::Format::from_path(&self.path), + Some(f) => f, + }; + niffler::get_writer(file_handle, fmt, compression_lvl) + .map_err(FastxError::CompressOutputError) + } + + /// Returns a vector containing the lengths of all the reads in the file. + /// + /// # Errors + /// If the file cannot be opened or there is an issue parsing any records then an + /// `Err` containing a variant of [`FastxError`](#fastxerror) is returned. + /// + /// # Example + /// + /// ```rust + /// let text = "@read1\nACGT\n+\n!!!!\n@read2\nG\n+\n!"; + /// let mut file = tempfile::Builder::new().suffix(".fq").tempfile().unwrap(); + /// file.write_all(text.as_bytes()).unwrap(); + /// let fastx = Fastx{ file.path() }; + /// let actual = fastx.read_lengths().unwrap(); + /// let expected: Vec = vec![4, 1]; + /// assert_eq!(actual, expected) + /// ``` + pub fn read_lengths(&self) -> Result, FastxError> { + let mut read_lengths: Vec = vec![]; + let mut reader = match parse_fastx_file(&self.path) { + Ok(rdr) => rdr, + Err(e) if e.kind == EmptyFile => return Ok(read_lengths), + Err(source) => return Err(FastxError::ReadError { source }), + }; + + while let Some(record) = reader.next() { + match record { + Ok(rec) => read_lengths.push(rec.num_bases() as u32), + Err(err) => return Err(FastxError::ParseError { source: err }), + } + } + Ok(read_lengths) + } + + /// Writes reads, with indices contained within `reads_to_keep`, to the specified handle + /// `write_to`. + /// + /// # Errors + /// This function could raise an `Err` instance of [`FastxError`](#fastxerror) in the following + /// circumstances: + /// - If the file (of `self`) cannot be opened. + /// - If writing to `write_to` fails. + /// - If, after iterating through all reads in the file, there is still elements left in + /// `reads_to_keep`. *Note: in this case, this function still writes all reads where indices + /// were found in the file.* + /// + /// # Example + /// + /// ```rust + /// let text = "@read1\nACGT\n+\n!!!!\n@read2\nCCCC\n+\n$$$$\n"; + /// let mut input = tempfile::Builder::new().suffix(".fastq").tempfile().unwrap(); + /// input.write_all(text.as_bytes()).unwrap(); + /// let fastx = Fastx::from_path(input.path()).unwrap(); + /// let mut reads_to_keep: Vec = vec![false, true]); + /// let output = Builder::new().suffix(".fastq").tempfile().unwrap(); + /// let output_fastx = Fastx::from_path(output.path()).unwrap(); + /// { + /// let mut out_fh = output_fastx.create().unwrap(); + /// let filter_result = fastx.filter_reads_into(&mut reads_to_keep, 1, &mut out_fh); + /// assert!(filter_result.is_ok()); + /// } + /// let actual = std::fs::read_to_string(output).unwrap(); + /// let expected = "@read2\nCCCC\n+\n$$$$\n"; + /// assert_eq!(actual, expected) + /// ``` + pub fn filter_reads_into( + &self, + reads_to_keep: &[bool], + nb_reads_keep: usize, + write_to: &mut T, + ) -> Result { + let mut total_len = 0; + let mut reader = + parse_fastx_file(&self.path).map_err(|source| FastxError::ReadError { source })?; + let mut read_idx: usize = 0; + let mut nb_reads_written = 0; + + while let Some(record) = reader.next() { + match record { + Err(source) => return Err(FastxError::ParseError { source }), + Ok(rec) if reads_to_keep[read_idx] => { + total_len += rec.num_bases(); + rec.write(write_to, None) + .map_err(|err| FastxError::WriteError { + source: anyhow::Error::from(err), + })?; + nb_reads_written += 1; + if nb_reads_keep == nb_reads_written { + break; + } + } + Ok(_) => (), + } + + read_idx += 1; + } + + if nb_reads_written == nb_reads_keep { + Ok(total_len) + } else { + Err(FastxError::IndicesNotFound) + } + } +} + +#[cfg(test)] +mod tests { + use super::*; + use std::any::Any; + use std::io::{Read, Write}; + use std::path::Path; + use tempfile::Builder; + + #[test] + fn fastx_from_fasta() { + let path = Path::new("data/my.fa"); + + let actual = Fastx::from_path(path); + let expected = Fastx { + path: path.to_path_buf(), + }; + + assert_eq!(actual, expected) + } + + #[test] + fn create_invalid_output_file_raises_error() { + let path = Path::new("invalid/out/path.fq"); + + let actual = Fastx::from_path(path) + .create(niffler::Level::Eight, None) + .err() + .unwrap(); + let expected = FastxError::CreateError { + source: std::io::Error::new( + std::io::ErrorKind::Other, + String::from("No such file or directory (os error 2)"), + ), + }; + + assert_eq!(actual.type_id(), expected.type_id()) + } + + #[test] + fn create_valid_output_file_and_can_write_to_it() { + let file = Builder::new().suffix(".fastq").tempfile().unwrap(); + let mut writer = Fastx::from_path(file.path()) + .create(niffler::Level::Eight, None) + .unwrap(); + + let actual = writer.write(b"foo\nbar"); + + assert!(actual.is_ok()) + } + + #[test] + fn create_valid_compressed_output_file_and_can_write_to_it() { + let file = Builder::new().suffix(".fastq.gz").tempfile().unwrap(); + let mut writer = Fastx::from_path(file.path()) + .create(niffler::Level::Four, None) + .unwrap(); + + let actual = writer.write(b"foo\nbar"); + + assert!(actual.is_ok()) + } + + #[test] + fn get_read_lengths_for_empty_fasta_returns_empty_vector() { + let text = ""; + let mut file = Builder::new().suffix(".fa").tempfile().unwrap(); + file.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(file.path()); + + let actual = fastx.read_lengths().unwrap(); + let expected: Vec = Vec::new(); + + assert_eq!(actual, expected) + } + + #[test] + fn get_read_lengths_for_fasta() { + let text = ">read1\nACGT\n>read2\nG"; + let mut file = Builder::new().suffix(".fa").tempfile().unwrap(); + file.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(file.path()); + + let actual = fastx.read_lengths().unwrap(); + let expected: Vec = vec![4, 1]; + + assert_eq!(actual, expected) + } + + #[test] + fn get_read_lengths_for_fastq() { + let text = "@read1\nACGT\n+\n!!!!\n@read2\nG\n+\n!"; + let mut file = Builder::new().suffix(".fq").tempfile().unwrap(); + file.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(file.path()); + + let actual = fastx.read_lengths().unwrap(); + let expected: Vec = vec![4, 1]; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_reads_empty_indices_no_output() { + let text = "@read1\nACGT\n+\n!!!!"; + let mut input = Builder::new().suffix(".fastq").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![false]; + let output = Builder::new().suffix(".fastq").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 0, &mut out_fh); + + assert!(filter_result.is_ok()); + + let mut actual = String::new(); + output.into_file().read_to_string(&mut actual).unwrap(); + let expected = String::new(); + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fastq_reads_one_index_matches_only_read() { + let text = "@read1\nACGT\n+\n!!!!\n"; + let mut input = Builder::new().suffix(".fastq").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![true]; + let output = Builder::new().suffix(".fastq").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 1, &mut out_fh); + assert!(filter_result.is_ok()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = text; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fasta_reads_one_index_matches_only_read() { + let text = ">read1\nACGT\n"; + let mut input = Builder::new().suffix(".fa").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![true]; + let output = Builder::new().suffix(".fa").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 1, &mut out_fh); + assert!(filter_result.is_ok()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = text; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fastq_reads_one_index_matches_one_of_two_reads() { + let text = "@read1\nACGT\n+\n!!!!\n@read2\nCCCC\n+\n$$$$\n"; + let mut input = Builder::new().suffix(".fastq").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![false, true]; + let output = Builder::new().suffix(".fastq").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 1, &mut out_fh); + assert!(filter_result.is_ok()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = "@read2\nCCCC\n+\n$$$$\n"; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fastq_reads_two_indices_matches_first_and_last_reads() { + let text = "@read1\nACGT\n+\n!!!!\n@read2\nCCCC\n+\n$$$$\n@read3\nA\n+\n$\n"; + let mut input = Builder::new().suffix(".fastq").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![true, false, true]; + let output = Builder::new().suffix(".fastq").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 2, &mut out_fh); + assert!(filter_result.is_ok()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = "@read1\nACGT\n+\n!!!!\n@read3\nA\n+\n$\n"; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fasta_reads_one_index_out_of_range() { + let text = ">read1 length=4\nACGT\n>read2\nCCCC\n"; + let mut input = Builder::new().suffix(".fa").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![true, false, true]; + let output = Builder::new().suffix(".fa").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 2, &mut out_fh); + assert!(filter_result.is_err()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = ">read1 length=4\nACGT\n"; + + assert_eq!(actual, expected) + } + + #[test] + fn filter_fastq_reads_one_index_out_of_range() { + let text = "@read1 length=4\nACGT\n+\n!!!!\n@read2\nC\n+\n^\n"; + let mut input = Builder::new().suffix(".fq").tempfile().unwrap(); + input.write_all(text.as_bytes()).unwrap(); + let fastx = Fastx::from_path(input.path()); + let reads_to_keep: Vec = vec![true, false, true]; + let output = Builder::new().suffix(".fq").tempfile().unwrap(); + let output_fastx = Fastx::from_path(output.path()); + { + let mut out_fh = output_fastx.create(niffler::Level::Four, None).unwrap(); + let filter_result = fastx.filter_reads_into(&reads_to_keep, 2, &mut out_fh); + assert!(filter_result.is_err()); + } + + let actual = std::fs::read_to_string(output).unwrap(); + let expected = "@read1 length=4\nACGT\n+\n!!!!\n"; + + assert_eq!(actual, expected) + } +} +use regex::Regex; +use std::ffi::{OsStr, OsString}; +use std::ops::{Div, Mul}; +use std::path::{Path, PathBuf}; +use std::str::FromStr; +use structopt::StructOpt; +use thiserror::Error; + +/// Randomly subsample reads to a specified coverage. +#[derive(Debug, StructOpt)] +#[structopt()] +pub struct Cli { + /// The fast{a,q} file(s) to subsample. + /// + /// For paired Illumina you may either pass this flag twice `-i r1.fq -i r2.fq` or give two + /// files consecutively `-i r1.fq r2.fq`. + #[structopt( + short = "i", + long = "input", + parse(try_from_os_str = check_path_exists), + multiple = true, + required = true + )] + pub input: Vec, + + /// Output filepath(s); stdout if not present. + /// + /// For paired Illumina you may either pass this flag twice `-o o1.fq -o o2.fq` or give two + /// files consecutively `-o o1.fq o2.fq`. NOTE: The order of the pairs is assumed to be the + /// same as that given for --input. This option is required for paired input. + #[structopt(short = "o", long = "output", parse(from_os_str), multiple = true)] + pub output: Vec, + + /// Genome size to calculate coverage with respect to. e.g., 4.3kb, 7Tb, 9000, 4.1MB + #[structopt(short = "g", long = "genome-size")] + pub genome_size: GenomeSize, + + /// The desired coverage to sub-sample the reads to. + #[structopt(short = "c", long = "coverage", value_name = "FLOAT")] + pub coverage: Coverage, + + /// Random seed to use. + #[structopt(short = "s", long = "seed", value_name = "INT")] + pub seed: Option, + + /// Switch on verbosity. + #[structopt(short)] + pub verbose: bool, + + /// u: uncompressed; b: Bzip2; g: Gzip; l: Lzma + /// + /// Rasusa will attempt to infer the output compression format automatically from the filename + /// extension. This option is used to override that. If writing to stdout, the default is + /// uncompressed + #[structopt(short = "O", long, value_name = "u|b|g|l", parse(try_from_str = parse_compression_format), possible_values = &["u", "b", "g", "l"], case_insensitive=true, hide_possible_values = true)] + pub output_type: Option, + + /// Compression level to use if compressing output + #[structopt(short = "l", long, parse(try_from_str = parse_level), default_value="6", value_name = "1-9")] + pub compress_level: niffler::Level, +} + +impl Cli { + /// Checks there is a valid and equal number of `--input` and `--output` arguments given. + /// + /// # Errors + /// A [`CliError::BadInputOutputCombination`](#clierror) is returned for the following: + /// - Either `--input` or `--output` are passed more than twice + /// - An unequal number of `--input` and `--output` are passed. The only exception to + /// this is if one `--input` and zero `--output` are passed, in which case, the output + /// will be sent to STDOUT. + pub fn validate_input_output_combination(&self) -> Result<(), CliError> { + let out_len = self.output.len(); + let in_len = self.input.len(); + + if in_len > 2 { + let msg = String::from("Got more than 2 files for input."); + return Err(CliError::BadInputOutputCombination(msg)); + } + if out_len > 2 { + let msg = String::from("Got more than 2 files for output."); + return Err(CliError::BadInputOutputCombination(msg)); + } + match (in_len as isize - out_len as isize) as isize { + diff if diff == 1 && in_len == 1 => Ok(()), + diff if diff != 0 => Err(CliError::BadInputOutputCombination(format!( + "Got {} --input but {} --output", + in_len, out_len + ))), + _ => Ok(()), + } + } +} + +/// A collection of custom errors relating to the command line interface for this package. +#[derive(Error, Debug, PartialEq)] +pub enum CliError { + /// Indicates that a string cannot be parsed into a [`MetricSuffix`](#metricsuffix). + #[error("{0} is not a valid metric suffix")] + InvalidMetricSuffix(String), + + /// Indicates that a string cannot be parsed into a [`GenomeSize`](#genomesize). + #[error("{0} is not a valid genome size. Valid forms include 4gb, 3000, 8.7Kb etc.")] + InvalidGenomeSizeString(String), + + /// Indicates that a string cannot be parsed into a [`Coverage`](#coverage). + #[error("{0} is not a valid coverage string. Coverage must be either an integer or a float and can end with an optional 'x' character")] + InvalidCoverageValue(String), + + /// Indicates that a string cannot be parsed into a [`CompressionFormat`](#compressionformat). + #[error("{0} is not a valid output format")] + InvalidCompression(String), + + /// Indicates a bad combination of input and output files was passed. + #[error("Bad combination of input and output files: {0}")] + BadInputOutputCombination(String), +} + +/// A metric suffix is a unit suffix used to indicate the multiples of (in this case) base pairs. +/// For instance, the metric suffix 'Kb' refers to kilobases. Therefore, 6.9kb means 6900 base pairs. +#[derive(PartialEq, Debug)] +enum MetricSuffix { + Base, + Kilo, + Mega, + Giga, + Tera, +} + +impl FromStr for MetricSuffix { + type Err = CliError; + + /// Parses a string into a `MetricSuffix`. + /// + /// # Example + /// ```rust + /// let s = "5.5mb"; + /// let metric_suffix = MetricSuffix::from_str(s); + /// + /// assert_eq!(metric_suffix, MetricSuffix::Mega) + /// ``` + fn from_str(suffix: &str) -> Result { + let suffix_lwr = suffix.to_lowercase(); + let metric_suffix = match suffix_lwr.as_str() { + s if "b".contains(s) => MetricSuffix::Base, + s if "kb".contains(s) => MetricSuffix::Kilo, + s if "mb".contains(s) => MetricSuffix::Mega, + s if "gb".contains(s) => MetricSuffix::Giga, + s if "tb".contains(s) => MetricSuffix::Tera, + _ => { + return Err(CliError::InvalidMetricSuffix(suffix.to_string())); + } + }; + Ok(metric_suffix) + } +} + +/// Allow for multiplying a `f64` by a `MetricSuffix`. +/// +/// # Example +/// +/// ```rust +/// let metric_suffix = MetricSuffix::Mega; +/// let x: f64 = 5.5; +/// +/// assert_eq!(x * metric_suffix, 5_500_000) +/// ``` +impl Mul for f64 { + type Output = Self; + + fn mul(self, rhs: MetricSuffix) -> Self::Output { + match rhs { + MetricSuffix::Base => self, + MetricSuffix::Kilo => self * 1_000.0, + MetricSuffix::Mega => self * 1_000_000.0, + MetricSuffix::Giga => self * 1_000_000_000.0, + MetricSuffix::Tera => self * 1_000_000_000_000.0, + } + } +} + +/// An object for collecting together methods for working with the genome size parameter for this +/// package. +#[derive(Debug, PartialOrd, PartialEq, Copy, Clone)] +pub struct GenomeSize(u64); + +/// Allow for comparison of a `u64` and a `GenomeSize`. +/// +/// # Example +/// +/// ```rust +/// assert!(GenomeSize(10) == 10) +/// ``` +impl PartialEq for GenomeSize { + fn eq(&self, other: &u64) -> bool { + self.0 == *other + } +} + +impl FromStr for GenomeSize { + type Err = CliError; + + /// Parses a string into a `GenomeSize`. + /// + /// # Example + /// ```rust + /// let s = "5.5mb"; + /// let genome_size = GenomeSize::from_str(s); + /// + /// assert_eq!(genome_size, GenomeSize(5_500_000)) + /// ``` + fn from_str(s: &str) -> Result { + let text = s.to_lowercase(); + let re = Regex::new(r"(?P[0-9]*\.?[0-9]+)(?P\w*)$").unwrap(); + let captures = match re.captures(text.as_str()) { + Some(cap) => cap, + None => { + return Err(CliError::InvalidGenomeSizeString(s.to_string())); + } + }; + let size = captures + .name("size") + .unwrap() + .as_str() + .parse::() + .unwrap(); + let metric_suffix = MetricSuffix::from_str(captures.name("sfx").unwrap().as_str())?; + + Ok(GenomeSize((size * metric_suffix) as u64)) + } +} + +/// Allow for multiplying a `GenomeSize` by a [`Coverage`](#coverage). +/// +/// # Example +/// +/// ```rust +/// let genome_size = GenomeSize(100); +/// let covg = Coverage(5); +/// +/// assert_eq!(genome_size * covg, 500) +/// ``` +impl Mul for GenomeSize { + type Output = u64; + + fn mul(self, rhs: Coverage) -> Self::Output { + (self.0 as f32 * rhs.0) as u64 + } +} + +/// Allow for dividing a `u64` by a `GenomeSize`. +/// +/// # Example +/// +/// ```rust +/// let x: u64 = 210; +/// let size = GenomeSize(200); +/// +/// let actual = x / size; +/// let expected = 1.05; +/// +/// assert_eq!(actual, expected) +/// ``` +impl Div for u64 { + type Output = f64; + + fn div(self, rhs: GenomeSize) -> Self::Output { + (self as f64) / (rhs.0 as f64) + } +} + +/// An object for collecting together methods for working with the coverage parameter for this +/// package. +#[derive(Debug, PartialOrd, PartialEq, Copy, Clone)] +pub struct Coverage(f32); + +/// Allow for comparison of a `f32` and a `Coverage`. +/// +/// # Example +/// +/// ```rust +/// assert!(Coverage(10) == 10.0) +/// ``` +impl PartialEq for Coverage { + fn eq(&self, other: &f32) -> bool { + self.0 == *other + } +} + +impl FromStr for Coverage { + type Err = CliError; + + /// Parses a string into a `Coverage`. + /// + /// # Example + /// ```rust + /// let s = "100x"; + /// let covg = Coverage::from_str(s); + /// + /// assert_eq!(covg, Coverage(100)) + /// ``` + fn from_str(s: &str) -> Result { + let re = Regex::new(r"^(?P[0-9]*\.?[0-9]+)(?i)x?$").unwrap(); + let captures = match re.captures(s) { + Some(cap) => cap, + None => { + return Err(CliError::InvalidCoverageValue(s.to_string())); + } + }; + Ok(Coverage( + captures + .name("covg") + .unwrap() + .as_str() + .parse::() + .unwrap(), + )) + } +} + +/// Allow for multiplying a `Coverage` by a [`GenomeSize`](#genomesize). +/// +/// # Example +/// +/// ```rust +/// let covg = Coverage(5); +/// let genome_size = GenomeSize(100); +/// +/// assert_eq!(covg * genome_size, 500) +/// ``` +impl Mul for Coverage { + type Output = u64; + + fn mul(self, rhs: GenomeSize) -> Self::Output { + (self.0 * (rhs.0 as f32)) as u64 + } +} + +pub trait CompressionExt { + fn from_path + ?Sized>(p: &S) -> Self; +} + +impl CompressionExt for niffler::compression::Format { + /// Attempts to infer the compression type from the file extension. If the extension is not + /// known, then Uncompressed is returned. + fn from_path + ?Sized>(p: &S) -> Self { + let path = Path::new(p); + match path.extension().map(|s| s.to_str()) { + Some(Some("gz")) => Self::Gzip, + Some(Some("bz") | Some("bz2")) => Self::Bzip, + Some(Some("lzma")) => Self::Lzma, + _ => Self::No, + } + } +} + +fn parse_compression_format(s: &str) -> Result { + match s { + "b" | "B" => Ok(niffler::Format::Bzip), + "g" | "G" => Ok(niffler::Format::Gzip), + "l" | "L" => Ok(niffler::Format::Lzma), + "u" | "U" => Ok(niffler::Format::No), + _ => Err(CliError::InvalidCompression(s.to_string())), + } +} +/// A utility function that allows the CLI to error if a path doesn't exist +fn check_path_exists + ?Sized>(s: &S) -> Result { + let path = PathBuf::from(s); + if path.exists() { + Ok(path) + } else { + Err(OsString::from(format!("{:?} does not exist", path))) + } +} + +/// A utility function to validate compression level is in allowed range +#[allow(clippy::redundant_clone)] +fn parse_level(s: &str) -> Result { + let lvl = match s.parse::() { + Ok(1) => niffler::Level::One, + Ok(2) => niffler::Level::Two, + Ok(3) => niffler::Level::Three, + Ok(4) => niffler::Level::Four, + Ok(5) => niffler::Level::Five, + Ok(6) => niffler::Level::Six, + Ok(7) => niffler::Level::Seven, + Ok(8) => niffler::Level::Eight, + Ok(9) => niffler::Level::Nine, + _ => return Err(format!("Compression level {} not in the range 1-9", s)), + }; + Ok(lvl) +} + +#[cfg(test)] +mod tests { + use super::*; + + const ERROR: f32 = f32::EPSILON; + + #[test] + fn no_args_given_raises_error() { + let passed_args = vec!["rasusa"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::MissingRequiredArgument; + + assert_eq!(actual, expected) + } + + #[test] + fn no_input_file_given_raises_error() { + let passed_args = vec!["rasusa", "-c", "30", "-g", "3mb"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::MissingRequiredArgument; + + assert_eq!(actual, expected) + } + + #[test] + fn no_coverage_given_raises_error() { + let passed_args = vec!["rasusa", "-i", "in.fq", "-g", "3mb"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::MissingRequiredArgument; + + assert_eq!(actual, expected) + } + + #[test] + fn invalid_coverage_given_raises_error() { + let passed_args = vec!["rasusa", "-i", "in.fq", "-g", "3mb", "-c", "foo"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::ValueValidation; + + assert_eq!(actual, expected) + } + + #[test] + fn no_genome_size_given_raises_error() { + let passed_args = vec!["rasusa", "-i", "in.fq", "-c", "5"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::MissingRequiredArgument; + + assert_eq!(actual, expected) + } + + #[test] + fn invalid_genome_size_given_raises_error() { + let passed_args = vec!["rasusa", "-i", "in.fq", "-c", "5", "-g", "8jb"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::ValueValidation; + + assert_eq!(actual, expected) + } + + #[test] + fn invalid_seed_given_raises_error() { + let passed_args = vec!["rasusa", "-i", "in.fq", "-c", "5", "-g", "8mb", "-s", "foo"]; + let args: Result = Cli::from_iter_safe(passed_args); + + let actual = args.unwrap_err().kind; + let expected = clap::ErrorKind::ValueValidation; + + assert_eq!(actual, expected) + } + + #[test] + fn all_valid_args_parsed_as_expected() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", + "-i", + infile, + "-c", + "5", + "-g", + "8mb", + "-s", + "88", + "-o", + "my/output/file.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + assert_eq!(args.input[0], PathBuf::from_str(infile).unwrap()); + assert_eq!(args.coverage, Coverage(5.0)); + assert_eq!(args.genome_size, GenomeSize(8_000_000)); + assert_eq!(args.seed, Some(88)); + assert_eq!( + args.output[0], + PathBuf::from_str("my/output/file.fq").unwrap() + ) + } + + #[test] + fn all_valid_args_with_two_inputs_parsed_as_expected() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", + "-i", + infile, + infile, + "-c", + "5", + "-g", + "8mb", + "-s", + "88", + "-o", + "my/output/file.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let expected_input = vec![ + PathBuf::from_str(infile).unwrap(), + PathBuf::from_str(infile).unwrap(), + ]; + assert_eq!(args.input, expected_input); + assert_eq!(args.coverage, Coverage(5.0)); + assert_eq!(args.genome_size, GenomeSize(8_000_000)); + assert_eq!(args.seed, Some(88)); + assert_eq!( + args.output[0], + PathBuf::from_str("my/output/file.fq").unwrap() + ) + } + + #[test] + fn all_valid_args_with_two_inputs_using_flag_twice_parsed_as_expected() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", + "-i", + infile, + "-i", + infile, + "-c", + "5", + "-g", + "8mb", + "-s", + "88", + "-o", + "my/output/file.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let expected_input = vec![ + PathBuf::from_str(infile).unwrap(), + PathBuf::from_str(infile).unwrap(), + ]; + assert_eq!(args.input, expected_input); + assert_eq!(args.coverage, Coverage(5.0)); + assert_eq!(args.genome_size, GenomeSize(8_000_000)); + assert_eq!(args.seed, Some(88)); + assert_eq!( + args.output[0], + PathBuf::from_str("my/output/file.fq").unwrap() + ) + } + + #[test] + fn three_inputs_raises_error() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", + "-i", + infile, + "-i", + infile, + "-i", + infile, + "-c", + "5", + "-g", + "8mb", + "-s", + "88", + "-o", + "my/output/file.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual: CliError = args.validate_input_output_combination().unwrap_err(); + let expected = + CliError::BadInputOutputCombination(String::from("Got more than 2 files for input.")); + + assert_eq!(actual, expected) + } + + #[test] + fn three_outputs_raises_error() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", + "-i", + infile, + "-i", + infile, + "-c", + "5", + "-g", + "8mb", + "-s", + "88", + "-o", + "my/output/file.fq", + "-o", + "out.fq", + "-o", + "out.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual: CliError = args.validate_input_output_combination().unwrap_err(); + let expected = + CliError::BadInputOutputCombination(String::from("Got more than 2 files for output.")); + + assert_eq!(actual, expected) + } + + #[test] + fn one_input_no_output_is_ok() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec!["rasusa", "-i", infile, "-c", "5", "-g", "8mb", "-s", "88"]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual = args.validate_input_output_combination(); + + assert!(actual.is_ok()) + } + + #[test] + fn two_inputs_one_output_raises_error() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", "-i", infile, "-i", infile, "-c", "5", "-g", "8mb", "-s", "88", "-o", + "out.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual: CliError = args.validate_input_output_combination().unwrap_err(); + let expected = + CliError::BadInputOutputCombination(String::from("Got 2 --input but 1 --output")); + + assert_eq!(actual, expected) + } + + #[test] + fn one_input_two_outputs_raises_error() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", "-i", infile, "-c", "5", "-g", "8mb", "-s", "88", "-o", "out.fq", "-o", + "out.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual: CliError = args.validate_input_output_combination().unwrap_err(); + let expected = + CliError::BadInputOutputCombination(String::from("Got 1 --input but 2 --output")); + + assert_eq!(actual, expected) + } + + #[test] + fn two_input_two_outputs_is_ok() { + let infile = "tests/cases/r1.fq.gz"; + let passed_args = vec![ + "rasusa", "-i", infile, "-i", infile, "-c", "5", "-g", "8mb", "-s", "88", "-o", + "out.fq", "-o", "out.fq", + ]; + let args = Cli::from_iter_safe(passed_args).unwrap(); + + let actual = args.validate_input_output_combination(); + + assert!(actual.is_ok()) + } + + #[test] + fn float_multiply_with_base_unit() { + let actual = 4.5 * MetricSuffix::Base; + let expected = 4.5; + + let diff = (actual.abs() - expected).abs(); + assert!(diff < f64::EPSILON) + } + + #[test] + fn integer_only_returns_integer() { + let actual = GenomeSize::from_str("6").unwrap(); + let expected = 6; + + assert_eq!(actual, expected); + } + + #[test] + fn float_only_returns_integer() { + let actual = GenomeSize::from_str("6.5").unwrap(); + let expected = 6; + + assert_eq!(actual, expected); + } + + #[test] + fn int_and_suffix_returns_multiplied_int() { + let actual = GenomeSize::from_str("5mb").unwrap(); + let expected = 5_000_000; + + assert_eq!(actual, expected); + } + + #[test] + fn float_and_suffix_returns_multiplied_float_as_int() { + let actual = GenomeSize::from_str("5.4kB").unwrap(); + let expected = 5_400; + + assert_eq!(actual, expected); + } + + #[test] + fn float_without_leading_int_and_suffix_returns_multiplied_float_as_int() { + let actual = GenomeSize::from_str(".77G").unwrap(); + let expected = 770_000_000; + + assert_eq!(actual, expected); + } + + #[test] + fn int_and_tera_suffix_returns_multiplied_int() { + let actual = GenomeSize::from_str("7TB").unwrap(); + let expected = 7_000_000_000_000; + + assert_eq!(actual, expected); + } + + #[test] + fn int_and_base_suffix_returns_int_without_scaling() { + let actual = GenomeSize::from_str("7B").unwrap(); + let expected = 7; + + assert_eq!(actual, expected); + } + + #[test] + fn invalid_suffix_returns_err() { + let genome_size = String::from(".77uB"); + let actual = GenomeSize::from_str(genome_size.as_str()).unwrap_err(); + let expected = CliError::InvalidMetricSuffix(String::from("ub")); + + assert_eq!(actual, expected); + } + + #[test] + fn empty_string_returns_error() { + let actual = GenomeSize::from_str("").unwrap_err(); + let expected = CliError::InvalidGenomeSizeString(String::from("")); + + assert_eq!(actual, expected); + } + + #[test] + fn suffix_with_no_size_returns_error() { + let actual = GenomeSize::from_str("gb"); + + assert!(actual.is_err()); + } + + #[test] + fn int_coverage_returns_float() { + let actual = Coverage::from_str("56").unwrap(); + let expected = 56.0; + + assert!((expected - actual.0).abs() < ERROR) + } + + #[test] + fn float_coverage_returns_float() { + let actual = Coverage::from_str("56.6").unwrap(); + let expected = 56.6; + + assert!((expected - actual.0).abs() < ERROR) + } + + #[test] + fn empty_coverage_returns_err() { + let coverage = String::from(""); + + let actual = Coverage::from_str(coverage.as_str()).unwrap_err(); + let expected = CliError::InvalidCoverageValue(coverage); + + assert_eq!(actual, expected) + } + + #[test] + fn non_number_coverage_returns_err() { + let coverage = String::from("foo"); + + let actual = Coverage::from_str(coverage.as_str()).unwrap_err(); + let expected = CliError::InvalidCoverageValue(coverage); + + assert_eq!(actual, expected) + } + + #[test] + fn zero_coverage_returns_zero() { + let actual = Coverage::from_str("0").unwrap(); + let expected = 0.0; + + assert!((expected - actual.0).abs() < ERROR) + } + + #[test] + fn int_ending_in_x_coverage_returns_float() { + let actual = Coverage::from_str("1X").unwrap(); + let expected = 1.0; + + assert!((expected - actual.0).abs() < ERROR) + } + + #[test] + fn float_ending_in_x_coverage_returns_float() { + let actual = Coverage::from_str("1.9X").unwrap(); + let expected = 1.9; + + assert!((expected - actual.0).abs() < ERROR) + } + + #[test] + fn mega_suffix_from_string() { + let actual = MetricSuffix::from_str("MB").unwrap(); + let expected = MetricSuffix::Mega; + + assert_eq!(actual, expected) + } + + #[test] + fn kilo_suffix_from_string() { + let actual = MetricSuffix::from_str("kB").unwrap(); + let expected = MetricSuffix::Kilo; + + assert_eq!(actual, expected) + } + + #[test] + fn giga_suffix_from_string() { + let actual = MetricSuffix::from_str("Gb").unwrap(); + let expected = MetricSuffix::Giga; + + assert_eq!(actual, expected) + } + + #[test] + fn tera_suffix_from_string() { + let actual = MetricSuffix::from_str("tb").unwrap(); + let expected = MetricSuffix::Tera; + + assert_eq!(actual, expected) + } + + #[test] + fn base_suffix_from_string() { + let actual = MetricSuffix::from_str("B").unwrap(); + let expected = MetricSuffix::Base; + + assert_eq!(actual, expected) + } + + #[test] + fn empty_string_is_base_metric_suffix() { + let suffix = String::from(""); + let actual = MetricSuffix::from_str(suffix.as_str()).unwrap(); + let expected = MetricSuffix::Base; + + assert_eq!(actual, expected) + } + + #[test] + fn invalid_suffix_raises_error() { + let suffix = String::from("ub"); + let actual = MetricSuffix::from_str(suffix.as_str()).unwrap_err(); + let expected = CliError::InvalidMetricSuffix(suffix); + + assert_eq!(actual, expected) + } + + #[test] + fn multiply_genome_size_by_coverage() { + let genome_size = GenomeSize::from_str("4.2kb").unwrap(); + let covg = Coverage::from_str("11.7866").unwrap(); + + let actual = genome_size * covg; + let expected: u64 = 49_503; + + assert_eq!(actual, expected) + } + + #[test] + fn multiply_coverage_by_genome_size() { + let genome_size = GenomeSize::from_str("4.2kb").unwrap(); + let covg = Coverage::from_str("11.7866").unwrap(); + + let actual = covg * genome_size; + let expected: u64 = 49_503; + + assert_eq!(actual, expected) + } + + #[test] + fn divide_u64_by_genome_size() { + let x: u64 = 210; + let size = GenomeSize(200); + + let actual = x / size; + let expected = 1.05; + + let diff = (actual.abs() - expected).abs(); + assert!(diff < f64::EPSILON) + } + + #[test] + fn compression_format_from_str() { + let mut s = "B"; + assert_eq!(parse_compression_format(s).unwrap(), niffler::Format::Bzip); + + s = "g"; + assert_eq!(parse_compression_format(s).unwrap(), niffler::Format::Gzip); + + s = "l"; + assert_eq!(parse_compression_format(s).unwrap(), niffler::Format::Lzma); + + s = "U"; + assert_eq!(parse_compression_format(s).unwrap(), niffler::Format::No); + + s = "a"; + assert_eq!( + parse_compression_format(s).unwrap_err(), + CliError::InvalidCompression(s.to_string()) + ); + } + + #[test] + fn test_in_compress_range() { + assert!(parse_level("1").is_ok()); + assert!(parse_level("9").is_ok()); + assert!(parse_level("0").is_err()); + assert!(parse_level("10").is_err()); + assert!(parse_level("f").is_err()); + assert!(parse_level("5.5").is_err()); + assert!(parse_level("-3").is_err()); + } + + #[test] + fn compression_format_from_path() { + assert_eq!(niffler::Format::from_path("foo.gz"), niffler::Format::Gzip); + assert_eq!( + niffler::Format::from_path(Path::new("foo.gz")), + niffler::Format::Gzip + ); + assert_eq!(niffler::Format::from_path("baz"), niffler::Format::No); + assert_eq!(niffler::Format::from_path("baz.fq"), niffler::Format::No); + assert_eq!( + niffler::Format::from_path("baz.fq.bz2"), + niffler::Format::Bzip + ); + assert_eq!( + niffler::Format::from_path("baz.fq.bz"), + niffler::Format::Bzip + ); + assert_eq!( + niffler::Format::from_path("baz.fq.lzma"), + niffler::Format::Lzma + ); + } +} +use assert_cmd::prelude::*; +// Add methods on commands +use predicates::prelude::*; +use std::process::Command; // Run programs // Used for writing assertions + +#[test] +fn input_file_doesnt_exist() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec!["-i", "file/doesnt/exist.fa", "-g", "5mb", "-c", "20"]); + cmd.assert() + .failure() + .stderr(predicate::str::contains("does not exist")); + + Ok(()) +} + +#[test] +fn output_file_in_nonexistant_dir() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/file1.fq.gz", + "-g", + "5mb", + "-c", + "20", + "-o", + "dir/doesnt/exists/out.fq.gz", + ]); + cmd.assert() + .failure() + .stderr(predicate::str::contains("No such file")); + + Ok(()) +} + +#[test] +fn valid_inputs_raises_no_errors() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/file1.fq.gz", + "-g", + "5mb", + "-c", + "20", + ]); + + cmd.assert().success(); + + Ok(()) +} + +#[test] +fn input_and_output_filetypes_different_raises_no_errors() -> Result<(), Box> +{ + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/file1.fq.gz", + "-g", + "5mb", + "-c", + "20", + "-o", + "/tmp/out.fasta", + ]); + + cmd.assert().success(); + + Ok(()) +} + +#[test] +fn invalid_input_and_output_combination_raises_error() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/file1.fq.gz", + "-g", + "5mb", + "-c", + "20", + "-o", + "/tmp/out.fasta", + "-o", + "/tmp/out2.fq", + ]); + + cmd.assert() + .failure() + .stderr(predicate::str::contains("Got 1 --input but 2 --output")); + + Ok(()) +} + +#[test] +fn unequal_number_of_reads_raises_error() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/file1.fq.gz", + "tests/cases/r2.fq.gz", + "-g", + "5mb", + "-c", + "20", + "-o", + "/tmp/out.fq", + "-o", + "/tmp/out2.fq", + ]); + + cmd.assert().failure().stderr(predicate::str::contains( + "Illumina files are assumed to have the same number of reads", + )); + + Ok(()) +} + +#[test] +fn two_valid_illumina_inputs_suceeds() -> Result<(), Box> { + let mut cmd = Command::main_binary()?; + cmd.args(vec![ + "-i", + "tests/cases/r1.fq.gz", + "tests/cases/r2.fq.gz", + "-g", + "4", + "-c", + "2", + "-o", + "/tmp/out.fq", + "-o", + "/tmp/out2.fq", + ]); + + cmd.assert().success(); + + Ok(()) +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* std use */ +use std::clone::Clone; +use std::collections::{HashMap, HashSet}; + +/* crate use */ +use petgraph::graph::NodeIndex; + +/* project use */ +use crate::filter; +use crate::io; +use filter::Filter; + +// read_a strand read_a strand length +type LineType = (String, char, String, char, u64); +// read_a strand leng_a read_b strand len_b position len_containment +type ContainmentType = (String, char, u64, String, char, u64, u64, u64); + +type Graph = petgraph::Graph<(String, u64), LineType>; + +pub struct Gfa1 { + keep_internal: bool, + keep_containment: bool, + graph: Graph, + containments: HashMap<(String, u64), ContainmentType>, + test_containment: filter::Containment, + test_internalmatch: filter::InternalMatch, + node2index: HashMap<(String, u64), petgraph::graph::NodeIndex>, +} + +impl Gfa1 { + pub fn new(keep_internal: bool, keep_containment: bool, internal_threshold: f64) -> Self { + Gfa1 { + keep_internal, + keep_containment, + graph: Graph::new(), + containments: HashMap::new(), + test_containment: filter::Containment::new(internal_threshold), + test_internalmatch: filter::InternalMatch::new(internal_threshold), + node2index: HashMap::new(), + } + } + + pub fn add(&mut self, record: &dyn io::MappingRecord) { + if self.test_internalmatch.run(&*record) { + self.add_internalmatch(record); + } else if self.test_containment.run(&*record) { + self.add_containment(record); + } else { + self.add_dovetails(record); + } + } + + fn add_containment(&mut self, record: &dyn io::MappingRecord) { + if record.strand() == '+' { + if record.begin_a() <= record.begin_b() && record.len_to_end_a() < record.len_to_end_b() + { + // B contain A + self.containments.insert( + (record.read_a(), record.length_a()), + ( + record.read_b(), + '+', + record.length_b(), + record.read_a(), + '+', + record.length_a(), + record.begin_b(), + record.length(), + ), + ); + } else if record.begin_a() >= record.begin_b() + && record.len_to_end_a() > record.len_to_end_b() + { + // A contain B + self.containments.insert( + (record.read_b(), record.length_b()), + ( + record.read_a(), + '+', + record.length_a(), + record.read_b(), + '+', + record.length_b(), + record.begin_a(), + record.length(), + ), + ); + } else { + println!( + "Containment Record not managed {:?} {:?}", + record.read_a(), + record.read_b() + ); + } + } else if record.begin_a() <= record.len_to_end_b() + && record.len_to_end_a() < record.begin_b() + { + // B contain A + self.containments.insert( + (record.read_a(), record.length_a()), + ( + record.read_b(), + '+', + record.length_b(), + record.read_a(), + '-', + record.length_a(), + record.begin_b(), + record.length(), + ), + ); + } else if record.begin_a() >= record.len_to_end_b() + && record.len_to_end_a() > record.begin_b() + { + // A contain B + self.containments.insert( + (record.read_b(), record.length_b()), + ( + record.read_a(), + '+', + record.length_a(), + record.read_b(), + '-', + record.length_b(), + record.begin_a(), + record.length(), + ), + ); + } else { + println!( + "Containment Record not managed {:?} {:?}", + record.read_a(), + record.read_b() + ); + } + } + + fn add_internalmatch(&mut self, record: &dyn io::MappingRecord) { + if self.keep_internal { + self.add_dovetails(record); + } + } + + fn add_dovetails(&mut self, record: &dyn io::MappingRecord) { + let node_a = self.add_node((record.read_a(), record.length_a())); + let node_b = self.add_node((record.read_b(), record.length_b())); + + if record.strand() == '+' { + if record.begin_a() > record.begin_b() { + // A overlap B + self.add_edge( + node_a, + node_b, + (record.read_a(), '+', record.read_b(), '+', record.length()), + ); + } else { + // B overlap A + self.add_edge( + node_b, + node_a, + (record.read_b(), '+', record.read_a(), '+', record.length()), + ); + } + } else if record.begin_a() > record.len_to_end_a() { + if record.begin_a() > record.len_to_end_b() { + // A overlap B + self.add_edge( + node_a, + node_b, + (record.read_a(), '+', record.read_b(), '-', record.length()), + ); + } else { + // B overlap Af + self.add_edge( + node_b, + node_a, + (record.read_b(), '+', record.read_a(), '-', record.length()), + ); + } + } else if (record.length_a() - record.begin_a()) > record.end_b() { + // A overlap B + self.add_edge( + node_a, + node_b, + (record.read_a(), '-', record.read_b(), '+', record.length()), + ); + } else { + // B overlap A + self.add_edge( + node_b, + node_a, + (record.read_b(), '-', record.read_a(), '+', record.length()), + ); + } + } + + pub fn write(&mut self, writer: &mut W) { + if !self.keep_containment { + let remove_key: Vec<((String, u64), ContainmentType)> = + self.containments.drain().collect(); + for (key, _) in remove_key { + let index = self.add_node(key.clone()); + self.graph.remove_node(index); + } + } + + writer + .write_all(b"H\tVN:Z:1.0\n") + .expect("Error durring gfa1 write"); + + let mut writed = HashSet::new(); + for (read_a, _, len_a, read_b, _, len_b, _, _) in self.containments.values() { + if !writed.contains(&(read_a, len_a)) { + writer + .write_fmt(format_args!("S\t{}\t*\tLN:i:{}\n", read_a, len_a)) + .expect("Error durring gfa1 write"); + + writed.insert((read_a, len_a)); + } + + if !writed.contains(&(read_b, len_b)) { + writer + .write_fmt(format_args!("S\t{}\t*\tLN:i:{}\n", read_b, len_b)) + .expect("Error durring gfa1 write"); + writed.insert((read_b, len_b)); + } + } + + for node in self.graph.node_indices() { + if self.graph.neighbors_undirected(node).count() != 0 { + let segment = self.graph.node_weight(node).unwrap(); + if writed.contains(&(&segment.0, &segment.1)) { + continue; + } + + writer + .write_fmt(format_args!("S\t{}\t*\tLN:i:{}\n", segment.0, segment.1)) + .expect("Error durring gfa1 write"); + } + } + + for edge in self.graph.edge_references() { + writer + .write_fmt(format_args!( + "L\t{}\t{}\t{}\t{}\t{}M\n", + edge.weight().0, + edge.weight().1, + edge.weight().2, + edge.weight().3, + edge.weight().4 + )) + .expect("Error durring gfa1 write"); + } + + for value in self.containments.values() { + writer + .write_fmt(format_args!( + "C\t{}\t{}\t{}\t{}\t{}\t{}M\n", + value.0, value.1, value.3, value.4, value.6, value.7 + )) + .expect("Error durring gfa1 write"); + } + } + + fn add_node(&mut self, node: (String, u64)) -> petgraph::graph::NodeIndex { + let graph = &mut self.graph; + *self + .node2index + .entry(node) + .or_insert_with_key(|n| graph.add_node(n.clone())) + } + + fn add_edge(&mut self, node_a: NodeIndex, node_b: NodeIndex, new_edge: LineType) { + if let Some(e) = self.graph.find_edge(node_a, node_b) { + if self.graph.edge_weight(e).unwrap().4 < new_edge.4 { + self.graph.update_edge(node_a, node_b, new_edge); + } + } else { + self.graph.add_edge(node_a, node_b, new_edge); + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +pub mod gfa1; +pub use self::gfa1::Gfa1; +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local use */ +use crate::io; + +/* standard use */ +use std::cmp::min; + +#[derive(Debug, Clone, Deserialize, Serialize)] +pub struct Record { + pub read_a: String, + pub length_a: u64, + pub begin_a: u64, + pub end_a: u64, + pub strand: char, + pub read_b: String, + pub length_b: u64, + pub begin_b: u64, + pub end_b: u64, + pub nb_match_base: u64, + pub nb_base: u64, + pub mapping_quality: u64, + pub sam_field: Vec, + pub position: (u64, u64), +} + +impl io::MappingRecord for Record { + fn read_a(&self) -> String { + self.read_a.clone() + } + + fn length_a(&self) -> u64 { + self.length_a + } + + fn begin_a(&self) -> u64 { + self.begin_a + } + + fn end_a(&self) -> u64 { + self.end_a + } + + fn strand(&self) -> char { + self.strand + } + + fn read_b(&self) -> String { + self.read_b.clone() + } + + fn length_b(&self) -> u64 { + self.length_b + } + + fn begin_b(&self) -> u64 { + self.begin_b + } + + fn end_b(&self) -> u64 { + self.end_b + } + + fn position(&self) -> (u64, u64) { + self.position + } + + fn set_position(&mut self, p: (u64, u64)) { + self.position = p; + } + + fn length(&self) -> u64 { + min(self.end_a - self.begin_a, self.end_b - self.begin_b) + } + + fn len_to_end_a(&self) -> u64 { + self.length_a - self.end_a + } + + fn len_to_end_b(&self) -> u64 { + self.length_b - self.end_b + } + + fn set_read_a(&mut self, new_name: String) { + self.read_a = new_name; + } + fn set_read_b(&mut self, new_name: String) { + self.read_b = new_name; + } +} + +type RecordInner = ( + String, + u64, + u64, + u64, + char, + String, + u64, + u64, + u64, + u64, + u64, + Vec, +); + +pub struct Records<'a, R: 'a + std::io::Read> { + inner: csv::DeserializeRecordsIter<'a, R, RecordInner>, +} + +impl<'a, R: std::io::Read> Iterator for Records<'a, R> { + type Item = csv::Result; + + fn next(&mut self) -> Option> { + let position = self.inner.reader().position().byte(); + self.inner.next().map(|res| { + res.map( + |( + read_a, + length_a, + begin_a, + end_a, + strand, + read_b, + length_b, + begin_b, + end_b, + nb_match_base, + nb_base, + mapping_quality_and_sam, + )| { + let mapping_quality = mapping_quality_and_sam[0].parse::().unwrap(); + + let sam_field = if mapping_quality_and_sam.len() > 1 { + mapping_quality_and_sam[1..].to_vec() + } else { + Vec::new() + }; + + let new_position = self.inner.reader().position().byte(); + Record { + read_a, + length_a, + begin_a, + end_a, + strand, + read_b, + length_b, + begin_b, + end_b, + nb_match_base, + nb_base, + mapping_quality, + sam_field, + position: (position, new_position), + } + }, + ) + }) + } +} + +pub struct Reader { + inner: csv::Reader, +} + +impl Reader { + pub fn new(reader: R) -> Self { + Reader { + inner: csv::ReaderBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .flexible(true) + .from_reader(reader), + } + } + + /// Iterate over all records. + pub fn records(&mut self) -> Records { + Records { + inner: self.inner.deserialize(), + } + } +} + +#[derive(Debug)] +pub struct Writer { + inner: csv::Writer, +} + +impl Writer { + /// Write to a given writer. + pub fn new(writer: W) -> Self { + Writer { + inner: csv::WriterBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .flexible(true) + .from_writer(writer), + } + } + + /// Write a given GFF record. + pub fn write(&mut self, record: &Record) -> csv::Result { + let buffer: Vec = Vec::new(); + let mut wrapper = csv::WriterBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .flexible(true) + .from_writer(buffer); + + wrapper.serialize(( + &record.read_a, + record.length_a, + record.begin_a, + record.end_a, + record.strand, + &record.read_b, + record.length_b, + record.begin_b, + record.end_b, + record.nb_match_base, + record.nb_base, + record.mapping_quality, + &record.sam_field, + ))?; + + let nb_bytes = wrapper.into_inner().unwrap().len() as u64; + + self.inner.serialize(( + &record.read_a, + record.length_a, + record.begin_a, + record.end_a, + record.strand, + &record.read_b, + record.length_b, + record.begin_b, + record.end_b, + record.nb_match_base, + record.nb_base, + record.mapping_quality, + &record.sam_field, + ))?; + + Ok(nb_bytes) + } +} + +#[cfg(test)] +mod test { + + use super::*; + + const PAF_FILE: &'static [u8] = b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255 +"; + + const PAF_SAM_FIELD_FILE: &'static [u8] = + b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255\tam:I:5 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255\ttest:B:true\tam:I:5 +"; + + const READ_A: &'static [&str; 2] = &["1", "1"]; + const LENGTH_A: &'static [u64; 2] = &[12000, 12000]; + const BEGIN_A: &'static [u64; 2] = &[20, 5500]; + const END_A: &'static [u64; 2] = &[4500, 10000]; + const STRAND: &'static [char; 2] = &['-', '-']; + const READ_B: &'static [&str; 2] = &["2", "3"]; + const LENGTH_B: &'static [u64; 2] = &[10000, 10000]; + const BEGIN_B: &'static [u64; 2] = &[5500, 0]; + const END_B: &'static [u64; 2] = &[10000, 4500]; + const NB_MATCH_BASE: &'static [u64; 2] = &[4500, 4500]; + const NB_BASE: &'static [u64; 2] = &[4500, 4500]; + const MAPPING_QUALITY: &'static [u64; 2] = &[255, 255]; + + #[test] + fn read() { + let mut reader = Reader::new(PAF_FILE); + + let sam_field: [Vec; 2] = [Vec::new(), Vec::new()]; + + for (i, r) in reader.records().enumerate() { + let record = r.unwrap(); + + assert_eq!(record.read_a, READ_A[i]); + assert_eq!(record.length_a, LENGTH_A[i]); + assert_eq!(record.begin_a, BEGIN_A[i]); + assert_eq!(record.end_a, END_A[i]); + assert_eq!(record.strand, STRAND[i]); + assert_eq!(record.read_b, READ_B[i]); + assert_eq!(record.length_b, LENGTH_B[i]); + assert_eq!(record.begin_b, BEGIN_B[i]); + assert_eq!(record.end_b, END_B[i]); + assert_eq!(record.nb_match_base, NB_MATCH_BASE[i]); + assert_eq!(record.nb_base, NB_BASE[i]); + assert_eq!(record.mapping_quality, MAPPING_QUALITY[i]); + assert_eq!(record.sam_field, sam_field[i]); + } + } + + #[test] + fn read_sam_field() { + let mut reader = Reader::new(PAF_SAM_FIELD_FILE); + + let sam_field = &[vec!["am:I:5"], vec!["test:B:true", "am:I:5"]]; + + for (i, r) in reader.records().enumerate() { + let record = r.unwrap(); + + assert_eq!(record.read_a, READ_A[i]); + assert_eq!(record.length_a, LENGTH_A[i]); + assert_eq!(record.begin_a, BEGIN_A[i]); + assert_eq!(record.end_a, END_A[i]); + assert_eq!(record.strand, STRAND[i]); + assert_eq!(record.read_b, READ_B[i]); + assert_eq!(record.length_b, LENGTH_B[i]); + assert_eq!(record.begin_b, BEGIN_B[i]); + assert_eq!(record.end_b, END_B[i]); + assert_eq!(record.nb_match_base, NB_MATCH_BASE[i]); + assert_eq!(record.nb_base, NB_BASE[i]); + assert_eq!(record.mapping_quality, MAPPING_QUALITY[i]); + assert_eq!(record.sam_field, sam_field[i]); + } + } + + #[test] + fn write() { + let mut reader = Reader::new(PAF_FILE); + let mut writer = Writer::new(vec![]); + for r in reader.records() { + writer + .write(&r.ok().expect("Error reading record")) + .ok() + .expect("Error writing record"); + } + assert_eq!(writer.inner.into_inner().unwrap(), PAF_FILE); + } + + #[test] + fn write_sam_field() { + let mut reader = Reader::new(PAF_SAM_FIELD_FILE); + let mut writer = Writer::new(vec![]); + for r in reader.records() { + writer + .write(&r.ok().expect("Error reading record")) + .ok() + .expect("Error writing record"); + } + assert_eq!(writer.inner.into_inner().unwrap(), PAF_SAM_FIELD_FILE); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +pub mod gfa; +pub mod m4; +pub mod paf; + +pub trait MappingRecord { + fn read_a(&self) -> String; + fn length_a(&self) -> u64; + fn begin_a(&self) -> u64; + fn end_a(&self) -> u64; + fn strand(&self) -> char; + fn read_b(&self) -> String; + fn length_b(&self) -> u64; + fn begin_b(&self) -> u64; + fn end_b(&self) -> u64; + fn position(&self) -> (u64, u64); + fn set_position(&mut self, p: (u64, u64)); + + fn length(&self) -> u64; + + fn len_to_end_a(&self) -> u64; + fn len_to_end_b(&self) -> u64; + + fn set_read_a(&mut self, new_name: String); + fn set_read_b(&mut self, new_name: String); +} + +pub enum MappingFormat { + Paf, + M4, +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* local use */ +use crate::io; + +/* standard use */ +use std::cmp::min; + +#[derive(Debug, Clone, Deserialize, Serialize)] +pub struct Record { + pub read_a: String, + pub read_b: String, + pub error: f64, + pub shared_min_mers: u64, + pub strand_a: char, + pub begin_a: u64, + pub end_a: u64, + pub length_a: u64, + pub strand_b: char, + pub begin_b: u64, + pub end_b: u64, + pub length_b: u64, + pub position: (u64, u64), +} + +impl io::MappingRecord for Record { + fn read_a(&self) -> String { + self.read_a.clone() + } + + fn length_a(&self) -> u64 { + self.length_a + } + + fn begin_a(&self) -> u64 { + self.begin_a + } + + fn end_a(&self) -> u64 { + self.end_a + } + + fn strand(&self) -> char { + if self.strand_a == self.strand_b { + '+' + } else { + '-' + } + } + + fn read_b(&self) -> String { + self.read_b.clone() + } + + fn length_b(&self) -> u64 { + self.length_b + } + + fn begin_b(&self) -> u64 { + self.begin_b + } + + fn end_b(&self) -> u64 { + self.end_b + } + + fn position(&self) -> (u64, u64) { + self.position + } + + fn set_position(&mut self, p: (u64, u64)) { + self.position = p; + } + + fn length(&self) -> u64 { + min(self.end_a - self.begin_a, self.end_b - self.begin_b) + } + + fn len_to_end_a(&self) -> u64 { + self.length_a - self.end_a + } + fn len_to_end_b(&self) -> u64 { + self.length_b - self.end_b + } + + fn set_read_a(&mut self, new_name: String) { + self.read_a = new_name; + } + fn set_read_b(&mut self, new_name: String) { + self.read_b = new_name; + } +} + +type RecordInner = ( + String, + String, + f64, + u64, + char, + u64, + u64, + u64, + char, + u64, + u64, + u64, +); + +pub struct Records<'a, R: 'a + std::io::Read> { + inner: csv::DeserializeRecordsIter<'a, R, RecordInner>, +} + +impl<'a, R: std::io::Read> Iterator for Records<'a, R> { + type Item = csv::Result; + + fn next(&mut self) -> Option> { + let position = self.inner.reader().position().byte(); + self.inner.next().map(|res| { + res.map( + |( + read_a, + read_b, + error, + shared_min_mers, + strand_a, + begin_a, + end_a, + length_a, + strand_b, + begin_b, + end_b, + length_b, + )| { + let new_position = self.inner.reader().position().byte(); + + Record { + read_a, + read_b, + error, + shared_min_mers, + strand_a, + begin_a, + end_a, + length_a, + strand_b, + begin_b, + end_b, + length_b, + position: (position, new_position), + } + }, + ) + }) + } +} + +pub struct Reader { + inner: csv::Reader, +} + +impl Reader { + pub fn new(reader: R) -> Self { + Reader { + inner: csv::ReaderBuilder::new() + .delimiter(b' ') + .has_headers(false) + .flexible(true) + .from_reader(reader), + } + } + + /// Iterate over all records. + pub fn records(&mut self) -> Records { + Records { + inner: self.inner.deserialize(), + } + } +} + +#[derive(Debug)] +pub struct Writer { + inner: csv::Writer, +} + +impl Writer { + /// Write to a given writer. + pub fn new(writer: W) -> Self { + Writer { + inner: csv::WriterBuilder::new() + .delimiter(b' ') + .has_headers(false) + .flexible(true) + .from_writer(writer), + } + } + + /// Write a given Blasr m4 record. + pub fn write(&mut self, record: &Record) -> csv::Result { + let buffer: Vec = Vec::new(); + let mut wrapper = csv::WriterBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .flexible(true) + .from_writer(buffer); + + wrapper.serialize(( + &record.read_a, + &record.read_b, + record.error, + record.shared_min_mers, + record.strand_a, + record.begin_a, + record.end_a, + record.length_a, + record.strand_b, + record.begin_b, + record.end_b, + record.length_b, + ))?; + + let nb_bytes = wrapper.into_inner().unwrap().len() as u64; + + self.inner.serialize(( + &record.read_a, + &record.read_b, + record.error, + record.shared_min_mers, + record.strand_a, + record.begin_a, + record.end_a, + record.length_a, + record.strand_b, + record.begin_b, + record.end_b, + record.length_b, + ))?; + + Ok(nb_bytes) + } +} + +#[cfg(test)] +mod test { + + use super::*; + + const M4_FILE: &'static [u8] = b"1 2 0.1 2 0 100 450 1000 0 550 900 1000 +1 3 0.1 2 0 550 900 1000 0 100 450 1000 +"; + + const READ_A: &'static [&str; 2] = &["1", "1"]; + const READ_B: &'static [&str; 2] = &["2", "3"]; + const ERROR: &'static [f64; 2] = &[0.1, 0.1]; + const SHARED_MIN_MERS: &'static [u64; 2] = &[2, 2]; + const STRAND_A: &'static [char; 2] = &['0', '0']; + const STRAND_B: &'static [char; 2] = &['0', '0']; + const BEGIN_A: &'static [u64; 2] = &[100, 550]; + const END_A: &'static [u64; 2] = &[450, 900]; + const LENGTH_A: &'static [u64; 2] = &[1000, 1000]; + const BEGIN_B: &'static [u64; 2] = &[550, 100]; + const END_B: &'static [u64; 2] = &[900, 450]; + const LENGTH_B: &'static [u64; 2] = &[1000, 1000]; + + #[test] + fn read() { + let mut reader = Reader::new(M4_FILE); + + for (i, r) in reader.records().enumerate() { + let record = r.unwrap(); + + assert_eq!(record.read_a, READ_A[i]); + assert_eq!(record.read_b, READ_B[i]); + assert_eq!(record.error, ERROR[i]); + assert_eq!(record.shared_min_mers, SHARED_MIN_MERS[i]); + assert_eq!(record.strand_a, STRAND_A[i]); + assert_eq!(record.begin_a, BEGIN_A[i]); + assert_eq!(record.end_a, END_A[i]); + assert_eq!(record.length_a, LENGTH_A[i]); + assert_eq!(record.strand_b, STRAND_B[i]); + assert_eq!(record.begin_b, BEGIN_B[i]); + assert_eq!(record.end_b, END_B[i]); + assert_eq!(record.length_b, LENGTH_B[i]); + } + } + + #[test] + fn write() { + let mut reader = Reader::new(M4_FILE); + let mut writer = Writer::new(vec![]); + for r in reader.records() { + writer + .write(&r.ok().expect("Error reading record")) + .ok() + .expect("Error writing record"); + } + + assert_eq!(writer.inner.into_inner().unwrap(), M4_FILE); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* standard use */ +use std::io; +use std::io::{BufReader, BufWriter}; + +pub fn get_input(input_name: &str) -> (Box, niffler::compression::Format) { + match input_name { + "-" => niffler::get_reader(Box::new(BufReader::new(io::stdin()))) + .expect("File is probably empty"), + _ => niffler::from_path(input_name).expect("File is probably empty"), + } +} + +pub fn choose_compression( + input_compression: niffler::compression::Format, + compression_set: bool, + compression_value: &str, +) -> niffler::compression::Format { + if !compression_set { + return input_compression; + } + + match compression_value { + "gzip" => niffler::compression::Format::Gzip, + "bzip2" => niffler::compression::Format::Bzip, + "lzma" => niffler::compression::Format::Lzma, + _ => niffler::compression::Format::No, + } +} + +pub fn get_output(output_name: &str, format: niffler::compression::Format) -> Box { + match output_name { + "-" => niffler::get_writer( + Box::new(BufWriter::new(io::stdout())), + format, + niffler::compression::Level::One, + ) + .unwrap(), + _ => niffler::to_path(output_name, format, niffler::compression::Level::One).unwrap(), + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* project use */ +use crate::filter; +use crate::io; + +use crate::cli::Filters; + +pub struct Keep { + filters: Vec>, + internal_threshold: f64, +} + +impl Keep { + pub fn new( + internal_match: f64, + matches: &std::collections::HashMap, + ) -> Self { + let filters = Vec::new(); + let mut k = Keep { + filters, + internal_threshold: internal_match, + }; + + if let Some(keep) = matches.get("keep") { + k.generate(keep); + } + + k + } +} + +impl Filters for Keep { + fn pass(&self, r: &dyn io::MappingRecord) -> bool { + if self.filters.is_empty() { + true + } else { + self.filters.iter().all(|x| x.run(r)) + } + } + + fn internal_match(&self) -> f64 { + self.internal_threshold + } + + fn add_filter(&mut self, f: Box) { + self.filters.push(f); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* project use */ +use crate::filter; +use crate::io; + +use crate::cli::Filters; + +pub struct Drop { + filters: Vec>, + internal_threshold: f64, +} + +impl Drop { + pub fn new( + internal_match: f64, + matches: &std::collections::HashMap, + ) -> Self { + let filters = Vec::new(); + let mut d = Drop { + filters, + internal_threshold: internal_match, + }; + + if let Some(drop) = matches.get("drop") { + d.generate(drop); + } + + d + } +} + +impl Filters for Drop { + fn pass(&self, r: &dyn io::MappingRecord) -> bool { + if self.filters.is_empty() { + true + } else { + !self.filters.iter().any(|x| x.run(r)) + } + } + + fn internal_match(&self) -> f64 { + self.internal_threshold + } + + fn add_filter(&mut self, f: Box) { + self.filters.push(f); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* project use */ +use crate::generator; +use crate::io; + +pub struct Modifier { + modifiers: Vec>, +} + +impl Modifier { + pub fn new( + internal_match: f64, + matches: &std::collections::HashMap, + ) -> Self { + let mut modifiers: Vec> = Vec::new(); + + if let Some(m) = matches.get("rename") { + if m.is_present("input") { + modifiers.push(Box::new(generator::Renaming::new( + m.value_of("input").unwrap(), + true, + ))); + } else if m.is_present("output") { + modifiers.push(Box::new(generator::Renaming::new( + m.value_of("output").unwrap(), + false, + ))); + } + } + + if let Some(m) = matches.get("gfa") { + modifiers.push(Box::new(generator::Gfa1::new( + m.value_of("output").unwrap().to_string(), + m.is_present("internalmatch"), + m.is_present("containment"), + internal_match, + ))) + } + + Modifier { modifiers } + } + + pub fn pass(&mut self, r: &mut dyn io::MappingRecord) { + for m in self.modifiers.iter_mut() { + m.run(r); + } + } + + pub fn write(&mut self) { + for m in self.modifiers.iter_mut() { + m.write(); + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crates use */ +use clap::{App, Arg}; + +pub fn get_keep<'a>() -> App<'a> { + App::new("keep") + .setting(clap::AppSettings::AllowExternalSubcommands) + .about("fpa keep only mapping match this constraints") + .arg( + Arg::new("containment") + .short('c') + .long("containment") + .about("Keep only containment mapping"), + ) + .arg( + Arg::new("internalmatch") + .short('i') + .long("internalmatch") + .about("Keep only internal mapping"), + ) + .arg( + Arg::new("dovetail") + .short('d') + .long("dovetail") + .about("Keep only dovetail mapping"), + ) + .arg( + Arg::new("length_lower") + .short('l') + .long("length-lower") + .takes_value(true) + .about("Keep only mapping with length lower than value"), + ) + .arg( + Arg::new("length_upper") + .short('L') + .long("length-upper") + .takes_value(true) + .about("Keep only mapping with length upper than value"), + ) + .arg( + Arg::new("name_match") + .short('n') + .long("name-match") + .takes_value(true) + .about("Keep only mapping where one reads match with regex"), + ) + .arg( + Arg::new("same_name") + .short('m') + .long("same-name") + .about("Keep only mapping where reads have same name"), + ) + .arg( + Arg::new("sequence_length_lower") + .short('s') + .long("sequence-length-lower") + .takes_value(true) + .about("Keep only mapping where one reads have length lower than value"), + ) + .arg( + Arg::new("sequence_length_upper") + .short('S') + .long("sequence-length-upper") + .takes_value(true) + .about("Keep only mapping where one reads have length upper than value"), + ) +} + +pub fn get_drop<'a>() -> clap::App<'a> { + App::new("drop") + .setting(clap::AppSettings::AllowExternalSubcommands) + .about("fpa drop mapping match this constraints") + .arg( + Arg::new("containment") + .short('c') + .long("containment") + .about("Drop containment mapping"), + ) + .arg( + Arg::new("internalmatch") + .short('i') + .long("internalmatch") + .about("Drop internal mapping"), + ) + .arg( + Arg::new("dovetail") + .short('d') + .long("dovetail") + .about("Drop dovetail mapping"), + ) + .arg( + Arg::new("length_lower") + .short('l') + .long("length-lower") + .takes_value(true) + .about("Drop mapping with length lower than value"), + ) + .arg( + Arg::new("length_upper") + .short('L') + .long("length-upper") + .takes_value(true) + .about("Drop mapping with length upper than value"), + ) + .arg( + Arg::new("name_match") + .short('n') + .long("name-match") + .takes_value(true) + .about("Drop mapping where one reads match with regex"), + ) + .arg( + Arg::new("same_name") + .short('m') + .long("same-name") + .about("Drop mapping where reads have same name"), + ) + .arg( + Arg::new("sequence_length_lower") + .short('s') + .long("sequence-length-lower") + .takes_value(true) + .about("Drop mapping where one reads have length lower than value"), + ) + .arg( + Arg::new("sequence_length_upper") + .short('S') + .long("sequence-length-upper") + .takes_value(true) + .about("Drop mapping where one reads have length upper than value"), + ) +} + +pub fn get_rename<'a>() -> clap::App<'a> { + App::new("rename") + .setting(clap::AppSettings::AllowExternalSubcommands) + .about("fpa rename reads with name you chose or with incremental counter") + .arg( + Arg::new("input") + .short('i') + .long("input") + .takes_value(true) + .about("Rename reads with value in path passed as parameter"), + ) + .arg( + Arg::new("output") + .short('o') + .long("output") + .takes_value(true) + .about("Write rename table in path passed as parameter"), + ) +} + +pub fn get_index<'a>() -> clap::App<'a> { + App::new("index") + .setting(clap::AppSettings::AllowExternalSubcommands) + .about("fpa generate a index of mapping passing filter") + .arg( + Arg::new("filename") + .short('f') + .long("filename") + .takes_value(true) + .display_order(108) + .about("Write index of mapping passing filter in path passed as parameter"), + ) + .arg( + Arg::new("type") + .short('t') + .long("type") + .takes_value(true) + .default_value("both") + .possible_values(&["query", "target", "both"]) + .about( + "Type of index, only reference read when it's query, target or both of them", + ), + ) +} + +pub fn get_gfa<'a>() -> clap::App<'a> { + App::new("gfa") + .setting(clap::AppSettings::AllowExternalSubcommands) + .about("fpa generate a overlap graph in gfa1 format with mapping passing filter") + .arg( + Arg::new("output") + .short('o') + .long("output") + .required(true) + .takes_value(true) + .about( + "Write mapping passing filter in gfa1 graph format in path passed as parameter", + ), + ) + .arg( + Arg::new("containment") + .short('c') + .long("containment") + .about("Keep containment overlap"), + ) + .arg( + Arg::new("internalmatch") + .short('i') + .long("internalmatch") + .about("Keep internal match overlap"), + ) +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* project use */ +use crate::filter; +use crate::io; + +/* local use */ +pub mod subcommand; +pub use self::subcommand::*; + +pub mod drop; +pub use self::drop::Drop; + +pub mod keep; +pub use self::keep::Keep; + +pub mod modifier; +pub use self::modifier::*; + +/* crates use */ +use clap::{App, Arg, ArgMatches}; + +pub fn app<'a>() -> App<'a> { + App::new("fpa") + .version("0.5.1 Sandslash") + .author("Pierre Marijon ") + .about("fpa take long read mapping information and filter them") + .arg(Arg::new("input") + .short('i') + .long("input") + .default_value("-") + .about("Path to input file, use '-' for stdin") + ) + .arg(Arg::new("output") + .short('o') + .long("output") + .default_value("-") + .about("Path to output file, use '-' for stdout") + ) + + .arg(Arg::new("internal-match-threshold") + .takes_value(true) + .long("internal-threshold") + .default_value("0.8") + .about("A match is internal match if overhang length > match length * internal threshold this option set internal match") + ) + .arg(Arg::new("compression-out") + .short('z') + .takes_value(true) + .long("compression-out") + .possible_values(&["gzip", "bzip2", "lzma", "no"]) + .about("Output compression format, the input compression format is chosen by default") + ) + .arg(Arg::new("format") + .short('F') + .long("format") + .takes_value(true) + .about("Force the format used") + .possible_values(&["paf", "m4"]) + ) + .subcommand(subcommand::get_keep()) + .subcommand(subcommand::get_drop()) + .subcommand(subcommand::get_rename()) + .subcommand(subcommand::get_index()) + .subcommand(subcommand::get_gfa()) +} + +pub fn get_subcmd(app: &mut App) -> std::collections::HashMap { + let basic_cli = vec![ + "fpa".to_string(), + "-i".to_string(), + "foo".to_string(), + "-o".to_string(), + "bar".to_string(), + ]; + let mut sub2matches = std::collections::HashMap::new(); + + let mut cli: Vec = std::env::args().collect(); + loop { + /* parse cli */ + let matches = app + .try_get_matches_from_mut(cli) + .unwrap_or_else(|e| e.exit()); + + let (name, sub) = match matches.subcommand() { + Some((n, s)) => (n, s), + None => break, + }; + + sub2matches.insert(name.to_string(), sub.clone()); + + let (subname, subsub) = match sub.subcommand() { + Some((n, s)) => (n, s), + None => break, + }; + + if subsub.values_of("").is_none() { + break; + } + + /* rebuild a new cli*/ + cli = basic_cli.clone(); + cli.push(subname.to_string()); + cli.extend(subsub.values_of("").unwrap().map(|x| x.to_string())); + } + + sub2matches +} + +pub trait Filters { + fn pass(&self, r: &dyn io::MappingRecord) -> bool; + + fn internal_match(&self) -> f64; + + fn add_filter(&mut self, f: Box); + + fn generate(&mut self, m: &clap::ArgMatches) { + let internal_match = self.internal_match(); + if m.is_present("containment") { + self.add_filter(Box::new(filter::Containment::new(internal_match))); + } + + if m.is_present("internalmatch") { + self.add_filter(Box::new(filter::InternalMatch::new(internal_match))); + } + + if m.is_present("dovetail") { + self.add_filter(Box::new(filter::Dovetails::new(internal_match))); + } + + if let Some(length_lower) = m.value_of("length_lower") { + self.add_filter(Box::new(filter::Length::new( + length_lower.parse::().unwrap(), + std::cmp::Ordering::Less, + ))); + } + + if let Some(length_lower) = m.value_of("length_upper") { + self.add_filter(Box::new(filter::Length::new( + length_lower.parse::().unwrap(), + std::cmp::Ordering::Greater, + ))); + } + + if let Some(name_match) = m.value_of("name_match") { + self.add_filter(Box::new(filter::NameMatch::new(name_match))); + } + + if m.is_present("same_name") { + self.add_filter(Box::new(filter::SameName::new())); + } + + if let Some(sequence_length_lower) = m.value_of("sequence_length_lower") { + self.add_filter(Box::new(filter::SequenceLength::new( + sequence_length_lower.parse::().unwrap(), + std::cmp::Ordering::Less, + ))); + } + + if let Some(sequence_length_lower) = m.value_of("sequence_length_upper") { + self.add_filter(Box::new(filter::SequenceLength::new( + sequence_length_lower.parse::().unwrap(), + std::cmp::Ordering::Greater, + ))); + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +#[derive(Clone, Debug, PartialEq)] +pub enum WorkOnWichPart { + Query, + Target, + Both, +} + +impl From<&str> for WorkOnWichPart { + fn from(index_type: &str) -> Self { + match index_type { + "query" => WorkOnWichPart::Query, + "target" => WorkOnWichPart::Target, + "both" => WorkOnWichPart::Both, + _ => WorkOnWichPart::Both, + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* std use */ +use std::collections::HashMap; +use std::fs::File; +use std::path::Path; + +/* project use */ +use crate::generator; +use crate::io; + +pub struct Renaming { + file_rename_path: String, + rename_table: HashMap, + index: u64, + index_mode: bool, +} + +impl Renaming { + pub fn new(file_rename_path: &str, in_file: bool) -> Self { + if in_file { + if !Path::new(file_rename_path).exists() { + panic!("Rename file not exist") + } + + let mut table = HashMap::new(); + let mut reader = csv::ReaderBuilder::new() + .has_headers(false) + .from_reader(File::open(file_rename_path).unwrap()); + + for result in reader.records() { + let record = result.expect("Error during parse of renaming file"); + table.insert(record[0].to_string(), record[1].to_string()); + } + + Renaming { + file_rename_path: file_rename_path.to_string(), + rename_table: table, + index: 0, + index_mode: false, + } + } else { + Renaming { + file_rename_path: file_rename_path.to_string(), + rename_table: HashMap::new(), + index: 1, + index_mode: true, + } + } + } + + fn run_index(&self, r: &mut dyn io::MappingRecord) { + if self.rename_table.contains_key(&r.read_a()) { + let key = r.read_a(); + r.set_read_a(self.rename_table.get(&key).unwrap().to_string()); + } + + if self.rename_table.contains_key(&r.read_b()) { + let key = r.read_b(); + r.set_read_b(self.rename_table.get(&key).unwrap().to_string()); + } + } + + fn run_no_index(&mut self, r: &mut dyn io::MappingRecord) { + let mut key = r.read_a(); + if !self.rename_table.contains_key(&key) { + self.rename_table.insert(r.read_a(), self.index.to_string()); + self.index += 1; + } + + r.set_read_a(self.rename_table.get(&key).unwrap().to_string()); + + key = r.read_b(); + if !self.rename_table.contains_key(&key) { + self.rename_table.insert(r.read_b(), self.index.to_string()); + self.index += 1; + } + r.set_read_b(self.rename_table.get(&key).unwrap().to_string()); + } +} + +impl generator::Modifier for Renaming { + fn run(&mut self, r: &mut dyn io::MappingRecord) { + if self.index_mode { + self.run_no_index(r); + } else { + self.run_index(r); + } + } + + fn write(&mut self) { + if self.index != 0 { + let mut writer = csv::Writer::from_path(&self.file_rename_path) + .expect("Can't create file to write renaming file"); + + for (key, val) in &self.rename_table { + writer + .write_record(&[key, val]) + .expect("Error durring write renaming file"); + } + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +use crate::io; + +pub trait Modifier { + fn run(&mut self, r: &mut dyn io::MappingRecord); + + fn write(&mut self); +} + +pub mod renaming; +pub use self::renaming::Renaming; + +pub mod indexing; +pub use self::indexing::Indexing; + +pub mod gfa; +pub use self::gfa::Gfa1; +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* std use */ +use std::collections::HashMap; + +/* project use */ +use crate::generator; +use crate::io; +use crate::type_def::WorkOnWichPart; + +pub struct Indexing { + index_type: WorkOnWichPart, + file_index_path: String, + index_table: HashMap>, +} + +impl Indexing { + pub fn new(file_index_path: &str, index_type: &str) -> Self { + Indexing { + file_index_path: file_index_path.to_string(), + index_type: WorkOnWichPart::from(index_type), + index_table: HashMap::new(), + } + } + + pub fn empty() -> Self { + Indexing { + file_index_path: "".to_string(), + index_type: WorkOnWichPart::Both, + index_table: HashMap::new(), + } + } + + fn run_both(&mut self, r: &mut dyn io::MappingRecord) { + self.index_table + .entry(r.read_a()) + .or_insert_with(Vec::new) + .push(r.position()); + if r.read_a() != r.read_b() { + self.index_table + .entry(r.read_b()) + .or_insert_with(Vec::new) + .push(r.position()); + } + } + + fn run_query(&mut self, r: &mut dyn io::MappingRecord) { + self.index_table + .entry(r.read_a()) + .or_insert_with(Vec::new) + .push(r.position()); + } + + fn run_target(&mut self, r: &mut dyn io::MappingRecord) { + self.index_table + .entry(r.read_b()) + .or_insert_with(Vec::new) + .push(r.position()); + } +} + +impl generator::Modifier for Indexing { + fn run(&mut self, r: &mut dyn io::MappingRecord) { + if self.file_index_path.is_empty() { + return; + } + + match self.index_type { + WorkOnWichPart::Both => self.run_both(r), + WorkOnWichPart::Query => self.run_query(r), + WorkOnWichPart::Target => self.run_target(r), + } + } + + fn write(&mut self) { + if self.file_index_path.is_empty() { + return; + } + + let mut writer = csv::Writer::from_path(&self.file_index_path) + .expect("Can't create file to write index"); + + for (key, val) in &self.index_table { + let mut iterator = val.iter(); + let mut position = *iterator.next().unwrap(); + + let mut positions: Vec<(u64, u64)> = Vec::new(); + for v in iterator { + if v.0 - position.1 > 1 { + positions.push(position); + position = *v; + } else { + position.1 = v.1; + } + } + positions.push(position); + + let positions_str = positions + .iter() + .map(|x| x.0.to_string() + ":" + &x.1.to_string()) + .collect::>() + .join(";"); + writer + .write_record(&[key, &positions_str]) + .expect("Error durring write index file"); + } + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* std use */ + +/* crate use */ + +/* projet use */ +use crate::generator; +use crate::io; + +pub struct Gfa1 { + gfa_path: String, + gfa_object: io::gfa::Gfa1, +} + +impl Gfa1 { + pub fn new( + gfa_path: String, + keep_internal: bool, + keep_containment: bool, + internal_threshold: f64, + ) -> Self { + Gfa1 { + gfa_path, + gfa_object: io::gfa::Gfa1::new(keep_internal, keep_containment, internal_threshold), + } + } +} + +impl generator::Modifier for Gfa1 { + fn run(&mut self, r: &mut dyn io::MappingRecord) { + self.gfa_object.add(r); + } + + fn write(&mut self) { + let mut writer = std::io::BufWriter::new( + std::fs::File::create(&self.gfa_path).expect("Can't create gfa ou"), + ); + self.gfa_object.write(&mut writer); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +/* standard use */ + +pub struct Dovetails { + internal_threshold: f64, +} + +impl Dovetails { + pub fn new(internal_threshold: f64) -> Self { + Dovetails { internal_threshold } + } +} + +impl filter::Filter for Dovetails { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + !filter::InternalMatch::new(self.internal_threshold).run(r) + && !filter::Containment::new(self.internal_threshold).run(r) + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 20000, + begin_a: 15000, + end_a: 20000, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 0, + end_b: 15000, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let nm = Dovetails::new(0.8); + + assert_eq!(nm.run(&*RECORD), true); + } + + #[test] + fn negatif() { + let nm = Dovetails::new(0.8); + + assert_ne!(nm.run(&*RECORD), false); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +pub struct Length { + length_threshold: u64, + ordering: std::cmp::Ordering, +} + +impl Length { + pub fn new(length_threshold: u64, ord: std::cmp::Ordering) -> Self { + Length { + length_threshold, + ordering: ord, + } + } +} + +impl filter::Filter for Length { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + r.length().cmp(&self.length_threshold) == self.ordering + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 5000, + begin_a: 0, + end_a: 5000, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 5000, + end_b: 10000, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let mut nm = Length::new(5001, std::cmp::Ordering::Less); + + assert_eq!(nm.run(&*RECORD), true); + + nm = Length::new(5001, std::cmp::Ordering::Greater); + + assert_eq!(nm.run(&*RECORD), false); + } + + #[test] + fn negatif() { + let mut nm = Length::new(5001, std::cmp::Ordering::Less); + + assert_ne!(nm.run(&*RECORD), false); + + nm = Length::new(5001, std::cmp::Ordering::Greater); + + assert_ne!(nm.run(&*RECORD), true); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +/* standard use */ + +pub struct NameMatch { + regex: regex::Regex, +} + +impl NameMatch { + pub fn new(regex: &str) -> Self { + NameMatch { + regex: regex::Regex::new(regex).expect("Error in regex build"), + } + } +} + +impl filter::Filter for NameMatch { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + self.regex.is_match(&r.read_a()) || self.regex.is_match(&r.read_b()) + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 20000, + begin_a: 1, + end_a: 19999, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 1, + end_b: 19999, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let nm = NameMatch::new("read_1"); + + assert_eq!(nm.run(&*RECORD), true); + } + + #[test] + fn negatif() { + let nm = NameMatch::new("read_1"); + + assert_ne!(nm.run(&*RECORD), false); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +use crate::io; + +pub trait Filter { + fn run(&self, r: &dyn io::MappingRecord) -> bool; +} + +pub mod length; +pub use self::length::Length; + +pub mod dovetails; +pub use self::dovetails::Dovetails; + +pub mod containment; +pub use self::containment::Containment; + +pub mod internalmatch; +pub use self::internalmatch::InternalMatch; + +pub mod samename; +pub use self::samename::SameName; + +pub mod namematch; +pub use self::namematch::NameMatch; + +pub mod sequence_length; +pub use self::sequence_length::SequenceLength; +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +/* standard use */ +use std::cmp::{max, min}; + +pub struct InternalMatch { + internal_threshold: f64, +} + +impl InternalMatch { + pub fn new(internal_threshold: f64) -> Self { + InternalMatch { internal_threshold } + } +} + +impl filter::Filter for InternalMatch { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + let overhang = if r.strand() == '+' { + min(r.begin_a(), r.begin_b()) + min(r.length_a() - r.end_a(), r.length_b() - r.end_b()) + } else { + min(r.begin_a(), r.length_b() - r.end_b()) + min(r.begin_b(), r.length_a() - r.end_a()) + }; + + let maplen = max(r.end_a() - r.begin_a(), r.end_b() - r.begin_b()); + + overhang > min(1000, (maplen as f64 * self.internal_threshold) as u64) + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 20000, + begin_a: 500, + end_a: 1000, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 5000, + end_b: 5500, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let nm = InternalMatch::new(0.8); + + assert_eq!(nm.run(&*RECORD), true); + } + + #[test] + fn negatif() { + let nm = InternalMatch::new(0.8); + + assert_ne!(nm.run(&*RECORD), false); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +/* standard use */ + +pub struct Containment { + internal_threshold: f64, +} + +impl Containment { + pub fn new(internal_threshold: f64) -> Self { + Containment { internal_threshold } + } +} + +impl filter::Filter for Containment { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + if filter::InternalMatch::new(self.internal_threshold).run(r) { + return false; + } + + (r.strand() == '+' + && r.begin_a() <= r.begin_b() + && r.length_a() - r.end_a() < r.length_b() - r.end_b()) + || (r.strand() == '-' + && r.begin_a() <= r.length_b() - r.end_b() + && r.length_a() - r.end_a() < r.begin_b()) + || (r.strand() == '+' + && r.begin_a() >= r.begin_b() + && r.length_a() - r.end_a() > r.length_b() - r.end_b()) + || (r.strand() == '-' + && r.begin_a() >= r.length_b() - r.end_b() + && r.length_a() - r.end_a() > r.begin_b()) + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 5000, + begin_a: 0, + end_a: 5000, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 5000, + end_b: 10000, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let nm = Containment::new(0.8); + + assert_eq!(nm.run(&*RECORD), true); + } + + #[test] + fn negatif() { + let nm = Containment::new(0.8); + + assert_ne!(nm.run(&*RECORD), false); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +pub struct SequenceLength { + length_threshold: u64, + ordering: std::cmp::Ordering, +} + +impl SequenceLength { + pub fn new(length_threshold: u64, ord: std::cmp::Ordering) -> Self { + SequenceLength { + length_threshold, + ordering: ord, + } + } +} + +impl filter::Filter for SequenceLength { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + r.length_a().cmp(&self.length_threshold) == self.ordering + || r.length_b().cmp(&self.length_threshold) == self.ordering + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 5000, + begin_a: 0, + end_a: 5000, + strand: '+', + read_b: "read_2".to_string(), + length_b: 20000, + begin_b: 5000, + end_b: 10000, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let mut nm = SequenceLength::new(5001, std::cmp::Ordering::Less); + + assert_eq!(nm.run(&*RECORD), true); + + nm = SequenceLength::new(20001, std::cmp::Ordering::Greater); + + assert_eq!(nm.run(&*RECORD), false); + } + + #[test] + fn negatif() { + let mut nm = SequenceLength::new(5001, std::cmp::Ordering::Less); + + assert_ne!(nm.run(&*RECORD), false); + + nm = SequenceLength::new(20001, std::cmp::Ordering::Greater); + + assert_ne!(nm.run(&*RECORD), true); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +/* project use */ +use crate::filter; +use crate::io; + +/* standard use */ + +pub struct SameName {} + +impl SameName { + pub fn new() -> Self { + SameName {} + } +} + +impl filter::Filter for SameName { + fn run(&self, r: &dyn io::MappingRecord) -> bool { + r.read_a() == r.read_b() + } +} + +#[cfg(test)] +mod test { + + use super::*; + use filter::Filter; + + lazy_static! { + static ref RECORD: io::paf::Record = { + io::paf::Record { + read_a: "read_1".to_string(), + length_a: 5000, + begin_a: 0, + end_a: 5000, + strand: '+', + read_b: "read_1".to_string(), + length_b: 20000, + begin_b: 5000, + end_b: 10000, + nb_match_base: 500, + nb_base: 500, + mapping_quality: 255, + sam_field: Vec::new(), + position: (0, 50), + } + }; + } + + #[test] + fn positif() { + let nm = SameName::new(); + + assert_eq!(nm.run(&*RECORD), true); + } + + #[test] + fn negatif() { + let nm = SameName::new(); + + assert_ne!(nm.run(&*RECORD), false); + } +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +#[macro_use] +extern crate serde_derive; + +#[cfg(test)] +#[macro_use] +extern crate lazy_static; + +/* project mod */ +mod cli; +mod file; +mod filter; +mod generator; +mod io; +mod type_def; + +use cli::Filters; +use generator::Modifier; +use io::MappingRecord; + +fn main() { + let mut app = cli::app(); + let matches = app + .try_get_matches_from_mut(std::env::args()) + .unwrap_or_else(|e| e.exit()); + + let subcmd = cli::get_subcmd(&mut app); + + /* Manage input and output file */ + let (input, compression) = file::get_input(matches.value_of("input").unwrap()); + + let format = if matches.is_present("format") { + match matches.value_of("format").unwrap() { + "paf" => io::MappingFormat::Paf, + "m4" => io::MappingFormat::M4, + _ => io::MappingFormat::Paf, + } + } else { + io::MappingFormat::Paf + }; + + let out_compression = file::choose_compression( + compression, + matches.is_present("compression-out"), + matches.value_of("compression-out").unwrap_or("no"), + ); + + let output: std::io::BufWriter> = std::io::BufWriter::new( + file::get_output(matches.value_of("output").unwrap(), out_compression), + ); + + let internal_match_threshold = matches + .value_of("internal-match-threshold") + .unwrap() + .parse::() + .unwrap(); + + match format { + io::MappingFormat::Paf => paf(input, output, internal_match_threshold, subcmd), + io::MappingFormat::M4 => m4(input, output, internal_match_threshold, subcmd), + } +} + +fn paf( + input: Box, + output: std::io::BufWriter>, + internal_match_threshold: f64, + subcmd: std::collections::HashMap, +) { + let mut writer = io::paf::Writer::new(output); + let mut reader = io::paf::Reader::new(input); + let drop = cli::Drop::new(internal_match_threshold, &subcmd); + let keep = cli::Keep::new(internal_match_threshold, &subcmd); + let mut modifier = cli::Modifier::new(internal_match_threshold, &subcmd); + + let mut index = if let Some(m) = subcmd.get("index") { + generator::Indexing::new(m.value_of("filename").unwrap(), m.value_of("type").unwrap()) + } else { + generator::Indexing::empty() + }; + + let mut position = 0; + for result in reader.records() { + let mut record = result.expect("Trouble during read of input mapping"); + + // keep + if !keep.pass(&record) { + continue; + } + + // drop + if !drop.pass(&record) { + continue; + } + + // modifier + modifier.pass(&mut record); + + let new_position = position + + writer + .write(&record) + .expect("Trouble during write of output"); + + record.set_position((position, new_position)); + + index.run(&mut record); + + position = new_position; + } + + // close modifier + modifier.write(); + + index.write(); +} + +fn m4( + input: Box, + output: std::io::BufWriter>, + internal_match_threshold: f64, + subcmd: std::collections::HashMap, +) { + let mut writer = io::m4::Writer::new(output); + let mut reader = io::m4::Reader::new(input); + let drop = cli::Drop::new(internal_match_threshold, &subcmd); + let keep = cli::Keep::new(internal_match_threshold, &subcmd); + let mut modifier = cli::Modifier::new(internal_match_threshold, &subcmd); + + let mut index = if let Some(m) = subcmd.get("index") { + generator::Indexing::new(m.value_of("filename").unwrap(), m.value_of("type").unwrap()) + } else { + generator::Indexing::empty() + }; + + let mut position = 0; + for result in reader.records() { + let mut record = result.expect("Trouble during read of input mapping"); + + // keep + if !keep.pass(&record) { + continue; + } + + // drop + if !drop.pass(&record) { + continue; + } + + // modifier + modifier.pass(&mut record); + + let new_position = position + + writer + .write(&record) + .expect("Trouble during write of output"); + + record.set_position((position, new_position)); + + index.run(&mut record); + + position = new_position; + } + + // close modifier + modifier.write(); + + index.write(); +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/// Yacrd use overlap between reads, to detect 'good' and 'bad' region, +/// a region with coverage over the threshold is 'good' others are 'bad'. +/// If read has a 'bad' region in middle this reads is mark as 'Chimeric'. +/// If the ratio of 'bad' region length on total read length is larger than threshold this reads is marked as 'Not_covered'. + +/// Yacrd can make some other actions: +/// - filter: for sequence or overlap file, record with reads marked as Chimeric or NotCovered isn't written in the output +/// - extract: for sequence or overlap file, record contains reads marked as Chimeric or NotCovered is written in the output +/// - split: for sequence file bad region in the middle of reads are removed, NotCovered read is removed +/// - scrubb: for sequence file all bad region are removed, NotCovered read is removed +#[derive(clap::Parser, Debug)] +#[clap( + version = "1.0.0 Magby", + author = "Pierre Marijon ", + name = "yacrd" +)] +pub struct Command { + /// path to input file overlap (.paf|.m4|.mhap) or yacrd report (.yacrd), format is autodetected and compression input is allowed (gz|bzip2|lzma) + #[clap(short = 'i', long = "input")] + pub input: String, + + /// path output file + #[clap(short = 'o', long = "output")] + pub output: String, + + /// number of thread use by yacrd, 0 mean all threads available, default 1 + #[clap(short = 't', long = "thread")] + pub threads: Option, + + /// if coverage reach this value region is marked as bad + #[clap(short = 'c', long = "coverage", default_value = "0")] + pub coverage: u64, + + /// if the ratio of bad region length on total length is lower than this value, read is marked as NotCovered + #[clap(short = 'n', long = "not-coverage", default_value = "0.8")] + pub not_coverage: f64, + + /// Control the size of the buffer used to read paf file + #[clap(long = "read-buffer-size", default_value = "8192")] + pub buffer_size: usize, + + /// yacrd switches to 'ondisk' mode which will reduce memory usage but increase computation time. The value passed as a parameter is used as a prefix for the temporary files created by yacrd. Be careful if the prefix contains path separators (`/` for unix or `\\` for windows) this folder will be deleted + #[clap(short = 'd', long = "ondisk")] + pub ondisk: Option, + + /// with the default value yacrd in 'ondisk' mode use around 1 GBytes, you can increase to reduce runtime but increase memory usage + #[clap(long = "ondisk-buffer-size", default_value = "64000000")] + pub ondisk_buffer_size: String, + + #[clap(subcommand)] + pub subcmd: Option, +} + +#[derive(clap::Parser, Debug)] +pub enum SubCommand { + /// All bad region of read is removed + #[clap()] + Scrubb(Scrubb), + + /// Record mark as chimeric or NotCovered is filter + #[clap()] + Filter(Filter), + + /// Record mark as chimeric or NotCovered is extract + #[clap()] + Extract(Extract), + + /// Record mark as chimeric or NotCovered is split + #[clap()] + Split(Split), +} + +#[derive(clap::Parser, Debug)] +pub struct Scrubb { + /// path to sequence input (fasta|fastq), compression is autodetected (none|gzip|bzip2|lzma) + #[clap(short = 'i', long = "input", required = true)] + pub input: String, + + /// path to output file, format and compression of input is preserved + #[clap(short = 'o', long = "output", required = true)] + pub output: String, +} + +#[derive(clap::Parser, Debug)] +pub struct Filter { + /// path to sequence input (fasta|fastq), compression is autodetected (none|gzip|bzip2|lzma) + #[clap(short = 'i', long = "input", required = true)] + pub input: String, + + /// path to output file, format and compression of input is preserved + #[clap(short = 'o', long = "output", required = true)] + pub output: String, +} + +#[derive(clap::Parser, Debug)] +pub struct Extract { + /// path to sequence input (fasta|fastq), compression is autodetected (none|gzip|bzip2|lzma) + #[clap(short = 'i', long = "input", required = true)] + pub input: String, + + /// path to output file, format and compression of input is preserved + #[clap(short = 'o', long = "output", required = true)] + pub output: String, +} + +#[derive(clap::Parser, Debug)] +pub struct Split { + /// path to sequence input (fasta|fastq), compression is autodetected (none|gzip|bzip2|lzma) + #[clap(short = 'i', long = "input", required = true)] + pub input: String, + + /// path to output file, format and compression of input is preserved + #[clap(short = 'o', long = "output", required = true)] + pub output: String, +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, bail, Context, Result}; +use log::error; + +/* local use */ +use crate::editor; +use crate::error; +use crate::stack; +use crate::util; + +pub fn scrubbing( + input_path: &str, + output_path: &str, + badregions: &mut dyn stack::BadPart, + not_covered: f64, + buffer_size: usize, +) -> Result<()> { + let (input, compression) = util::read_file(input_path, buffer_size)?; + let output = util::write_file(output_path, compression, buffer_size)?; + + match util::get_file_type(input_path) { + Some(util::FileType::Fasta) => fasta(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Fastq) => fastq(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Paf) => bail!(error::Error::CantRunOperationOnFile { + operation: "scrubbing".to_string(), + filetype: util::FileType::Paf, + filename: input_path.to_string() + }), + Some(util::FileType::M4) => bail!(error::Error::CantRunOperationOnFile { + operation: "scrubbing".to_string(), + filetype: util::FileType::M4, + filename: input_path.to_string() + }), + Some(util::FileType::Yacrd) => bail!(error::Error::CantRunOperationOnFile { + operation: "scrubbing".to_string(), + filetype: util::FileType::Yacrd, + filename: input_path.to_string() + }), + None | Some(util::FileType::YacrdOverlap) => { + bail!(error::Error::UnableToDetectFileFormat { + filename: input_path.to_string() + }) + } + }; + + Ok(()) +} + +fn fasta( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fasta::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fasta::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fasta, + })?; + + let (badregion, length) = badregions.get_bad_part(record.name())?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotCovered { + continue; + } else if badregion.is_empty() { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } else { + let mut poss = vec![0]; + for interval in badregion { + poss.push(interval.0); + poss.push(interval.1); + } + + if poss.last() != Some(&(*length as u32)) { + poss.push(*length as u32); + }; + + let iter = if poss[0] == 0 && poss[1] == 0 { + &poss[2..] + } else { + &poss[..] + }; + + for pos in iter.chunks_exact(2) { + if pos[0] as usize > record.sequence().len() + || pos[1] as usize > record.sequence().len() + { + error!("For read {} scrubb position is larger than read, it's strange check your data. For this read, this split position and next are ignore.", record.name()); + break; + } + + writer + .write_record(&noodles::fasta::Record::new( + noodles::fasta::record::Definition::new( + &format!("{}_{}_{}", record.name(), pos[0], pos[1]), + None, + ), + noodles::fasta::record::Sequence::from( + record.sequence().as_ref()[(pos[0] as usize)..(pos[1] as usize)] + .to_vec(), + ), + )) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + } + + Ok(()) +} + +fn fastq( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fastq::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fastq::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fastq, + })?; + + let (badregion, length) = badregions.get_bad_part( + std::str::from_utf8(record.name())? + .split_ascii_whitespace() + .next() + .unwrap(), + )?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotCovered { + continue; + } else if badregion.is_empty() { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fastq, + })?; + } else { + let mut sequence_description = std::str::from_utf8(record.name())?.splitn(2, ' '); + let name = sequence_description.next().unwrap(); + let description = sequence_description.next(); + + let mut poss = vec![0]; + for interval in badregion { + poss.push(interval.0); + poss.push(interval.1); + } + + if poss.last() != Some(&(*length as u32)) { + poss.push(*length as u32); + }; + + let iter = if poss[0] == 0 && poss[1] == 0 { + &poss[2..] + } else { + &poss[..] + }; + + for pos in iter.chunks_exact(2) { + if pos[0] as usize > record.sequence().len() + || pos[1] as usize > record.sequence().len() + { + error!("For read {} scrubb position is larger than read, it's strange check your data. For this read, this split position and next are ignore.", name); + break; + } + + writer + .write_record(&noodles::fastq::Record::new( + match description { + Some(desc) => format!("{}_{}_{} {}", name, pos[0], pos[1], desc), + None => format!("{}_{}_{}", name, pos[0], pos[1]), + } + .as_bytes(), + record.sequence()[(pos[0] as usize)..(pos[1] as usize)].to_vec(), + record.quality_scores()[(pos[0] as usize)..(pos[1] as usize)].to_vec(), + )) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + } + + Ok(()) +} + +#[cfg(test)] +mod tests { + use super::*; + + use crate::stack::BadPart; + + use crate::reads2ovl; + use crate::reads2ovl::Reads2Ovl; + + const FASTA_FILE: &'static [u8] = b">1 +ACTGGGGGGACTGGGGGGACTG +>2 +ACTG +>3 +ACTG +"; + + const FASTA_FILE_SCRUBBED: &'static [u8] = b">1_0_4 +ACTG +>1_9_13 +ACTG +>1_18_22 +ACTG +>2 +ACTG +>3 +ACTG +"; + + #[test] + fn fasta_keep_begin_end() -> () { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (0, 4)).unwrap(); + ovlst.add_overlap("1".to_string(), (9, 13)).unwrap(); + ovlst.add_overlap("1".to_string(), (18, 22)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fasta(FASTA_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTA_FILE_SCRUBBED, &output[..]); + } + + const FASTA_FILE_SCRUBBED2: &'static [u8] = b">1_4_18 +GGGGGACTGGGGGG +>2 +ACTG +>3 +ACTG +"; + + #[test] + fn fasta_keep_middle() -> () { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (4, 18)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fasta(FASTA_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTA_FILE_SCRUBBED2, &output[..]); + } + + const FASTQ_FILE: &'static [u8] = b"@1 +ACTGGGGGGACTGGGGGGACTG ++ +?????????????????????? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + const FASTQ_FILE_SCRUBBED: &'static [u8] = b"@1_0_4 +ACTG ++ +???? +@1_9_13 +ACTG ++ +???? +@1_18_22 +ACTG ++ +???? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + #[test] + fn fastq_keep_begin_end() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (0, 4)).unwrap(); + ovlst.add_overlap("1".to_string(), (9, 13)).unwrap(); + ovlst.add_overlap("1".to_string(), (18, 22)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fastq(FASTQ_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTQ_FILE_SCRUBBED, &output[..]); + } + + const FASTQ_FILE_SCRUBBED2: &[u8] = b"@1_4_18 +GGGGGACTGGGGGG ++ +?????????????? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + #[test] + fn fastq_keep_middle() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (4, 18)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fastq(FASTQ_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTQ_FILE_SCRUBBED2, &output[..]); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, bail, Context, Result}; + +/* local use */ +use crate::editor; +use crate::error; +use crate::stack; +use crate::util; + +pub fn filter( + input_path: &str, + output_path: &str, + badregions: &mut dyn stack::BadPart, + not_covered: f64, + buffer_size: usize, +) -> Result<()> { + let (input, compression) = util::read_file(input_path, buffer_size)?; + let output = util::write_file(output_path, compression, buffer_size)?; + + match util::get_file_type(input_path) { + Some(util::FileType::Fasta) => fasta(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Fastq) => fastq(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Paf) => paf(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::M4) => m4(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Yacrd) => bail!(error::Error::CantRunOperationOnFile { + operation: "scrubbing".to_string(), + filetype: util::FileType::Yacrd, + filename: input_path.to_string() + }), + None | Some(util::FileType::YacrdOverlap) => { + bail!(error::Error::UnableToDetectFileFormat { + filename: input_path.to_string() + }) + } + } + + Ok(()) +} + +fn fasta( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fasta::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fasta::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fasta, + })?; + + let (badregion, length) = badregions.get_bad_part(record.name())?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + + Ok(()) +} + +pub fn fastq( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fastq::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fastq::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fastq, + })?; + + let (badregion, length) = badregions.get_bad_part( + std::str::from_utf8(record.name())? + .split_ascii_whitespace() + .next() + .unwrap(), + )?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fastq, + })?; + } + } + + Ok(()) +} + +pub fn paf( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = csv::ReaderBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .from_reader(input); + let mut writer = csv::WriterBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .from_writer(output); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Paf, + })?; + + let id_a = record[0].to_string(); + let id_b = record[5].to_string(); + + let (badregion, length) = badregions.get_bad_part(&id_a)?; + let rtype_a = editor::type_of_read(*length, badregion, not_covered); + + let (badregion, length) = badregions.get_bad_part(&id_b)?; + let rtype_b = editor::type_of_read(*length, badregion, not_covered); + + if rtype_a == editor::ReadType::NotBad && rtype_b == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Paf, + })?; + } + } + + Ok(()) +} + +pub fn m4( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = csv::ReaderBuilder::new() + .delimiter(b' ') + .has_headers(false) + .from_reader(input); + let mut writer = csv::WriterBuilder::new() + .delimiter(b' ') + .has_headers(false) + .from_writer(output); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::M4, + })?; + + let id_a = record[0].to_string(); + let id_b = record[1].to_string(); + + let (badregion, length) = badregions.get_bad_part(&id_a)?; + let rtype_a = editor::type_of_read(*length, badregion, not_covered); + + let (badregion, length) = badregions.get_bad_part(&id_b)?; + let rtype_b = editor::type_of_read(*length, badregion, not_covered); + + if rtype_a == editor::ReadType::NotBad && rtype_b == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::M4, + })?; + } + } + + Ok(()) +} + +#[cfg(test)] +mod tests { + use super::*; + + use crate::stack::BadPart; + + use crate::reads2ovl; + use crate::reads2ovl::Reads2Ovl; + + const FASTA_FILE: &'static [u8] = b">1 +ACTG +>2 +ACTG +>3 +ACTG +"; + + const FASTA_FILE_FILTRED: &'static [u8] = b">2 +ACTG +>3 +ACTG +"; + + #[test] + fn fasta_file() -> () { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fasta(FASTA_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTA_FILE_FILTRED, &output[..]); + } + + const FASTQ_FILE: &'static [u8] = b"@1 +ACTG ++ +???? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + const FASTQ_FILE_FILTRED: &'static [u8] = b"@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + #[test] + fn fastq_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fastq(FASTQ_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTQ_FILE_FILTRED, &output[..]); + } + + const PAF_FILE: &'static [u8] = b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255 +"; + + const PAF_FILE_FILTRED: &'static [u8] = b""; + + #[test] + fn paf_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + paf(PAF_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(PAF_FILE_FILTRED, &output[..]); + } + + const M4_FILE: &'static [u8] = b"1 2 0.1 2 0 100 450 1000 0 550 900 1000 +1 3 0.1 2 0 550 900 1000 0 100 450 1000 +"; + + const M4_FILE_FILTRED: &'static [u8] = b""; + + #[test] + fn m4_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + m4(M4_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(M4_FILE_FILTRED, &output[..]); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, bail, Context, Result}; + +/* local use */ +use crate::editor; +use crate::error; +use crate::stack; +use crate::util; + +pub fn extract( + input_path: &str, + output_path: &str, + badregions: &mut dyn stack::BadPart, + not_covered: f64, + buffer_size: usize, +) -> Result<()> { + let (input, compression) = util::read_file(input_path, buffer_size)?; + let output = util::write_file(output_path, compression, buffer_size)?; + + match util::get_file_type(input_path) { + Some(util::FileType::Fasta) => fasta(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Fastq) => fastq(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Paf) => paf(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::M4) => m4(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Yacrd) => bail!(error::Error::CantRunOperationOnFile { + operation: "scrubbing".to_string(), + filetype: util::FileType::Yacrd, + filename: input_path.to_string() + }), + None | Some(util::FileType::YacrdOverlap) => { + bail!(error::Error::UnableToDetectFileFormat { + filename: input_path.to_string() + }) + } + } + + Ok(()) +} + +fn fasta( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fasta::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fasta::Writer::new(std::io::BufWriter::new(output)); + + let records = reader.records(); + + for result in records { + println!("PROUT"); + + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fasta, + })?; + + let (badregion, length) = badregions.get_bad_part(record.name())?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype != editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + + Ok(()) +} + +fn fastq( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fastq::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fastq::Writer::new(std::io::BufWriter::new(output)); + + let records = reader.records(); + + for result in records { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fastq, + })?; + + let (badregion, length) = badregions.get_bad_part( + std::str::from_utf8(record.name())? + .split_ascii_whitespace() + .next() + .unwrap(), + )?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype != editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fastq, + })?; + } + } + + Ok(()) +} + +fn paf( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = csv::ReaderBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .from_reader(input); + let mut writer = csv::WriterBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .from_writer(output); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Paf, + })?; + + let id_a = record[0].to_string(); + let id_b = record[5].to_string(); + + let (badregion, length) = badregions.get_bad_part(&id_a)?; + let rtype_a = editor::type_of_read(*length, badregion, not_covered); + + let (badregion, length) = badregions.get_bad_part(&id_b)?; + let rtype_b = editor::type_of_read(*length, badregion, not_covered); + + if rtype_a != editor::ReadType::NotBad || rtype_b != editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Paf, + })?; + } + } + + Ok(()) +} + +fn m4( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = csv::ReaderBuilder::new() + .delimiter(b' ') + .has_headers(false) + .from_reader(input); + let mut writer = csv::WriterBuilder::new() + .delimiter(b' ') + .has_headers(false) + .from_writer(output); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::M4, + })?; + + let id_a = record[0].to_string(); + let id_b = record[1].to_string(); + + let (badregion, length) = badregions.get_bad_part(&id_a)?; + let rtype_a = editor::type_of_read(*length, badregion, not_covered); + + let (badregion, length) = badregions.get_bad_part(&id_b)?; + let rtype_b = editor::type_of_read(*length, badregion, not_covered); + + if rtype_a != editor::ReadType::NotBad || rtype_b != editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::M4, + })?; + } + } + + Ok(()) +} + +#[cfg(test)] +mod tests { + use super::*; + + use crate::stack::BadPart; + + use crate::reads2ovl; + use crate::reads2ovl::Reads2Ovl; + + const FASTA_FILE: &'static [u8] = b">1 +ACTG +>2 +ACTG +>3 +ACTG +"; + + const FASTA_FILE_EXTRACTED: &'static [u8] = b">1 +ACTG +"; + + #[test] + fn fasta_file() -> () { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fasta(FASTA_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTA_FILE_EXTRACTED, &output[..]); + } + + const FASTQ_FILE: &'static [u8] = b"@1 +ACTG ++ +???? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + const FASTQ_FILE_EXTRACTED: &'static [u8] = b"@1 +ACTG ++ +???? +"; + + #[test] + fn fastq_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fastq(FASTQ_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTQ_FILE_EXTRACTED, &output[..]); + } + + const PAF_FILE: &'static [u8] = b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255 +"; + + const PAF_FILE_EXTRACTED: &'static [u8] = + b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255 +"; + + #[test] + fn paf_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + paf(PAF_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(PAF_FILE_EXTRACTED, &output[..]); + } + + const M4_FILE: &'static [u8] = b"1 2 0.1 2 0 100 450 1000 0 550 900 1000 +1 3 0.1 2 0 550 900 1000 0 100 450 1000 +"; + + const M4_FILE_EXTRACTED: &'static [u8] = b"1 2 0.1 2 0 100 450 1000 0 550 900 1000 +1 3 0.1 2 0 550 900 1000 0 100 450 1000 +"; + + #[test] + fn m4_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 1000); + ovlst.add_overlap("1".to_string(), (10, 490)).unwrap(); + ovlst.add_overlap("1".to_string(), (510, 1000)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + m4(M4_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(M4_FILE_EXTRACTED, &output[..]); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, bail, Context, Result}; +use log::error; + +/* local use */ +use crate::editor; +use crate::error; +use crate::stack; +use crate::util; + +pub fn split( + input_path: &str, + output_path: &str, + badregions: &mut dyn stack::BadPart, + not_covered: f64, + buffer_size: usize, +) -> Result<()> { + let (input, compression) = util::read_file(input_path, buffer_size)?; + let output = util::write_file(output_path, compression, buffer_size)?; + + match util::get_file_type(input_path) { + Some(util::FileType::Fasta) => fasta(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Fastq) => fastq(input, output, badregions, not_covered) + .with_context(|| anyhow!("Filename: {}", input_path.to_string()))?, + Some(util::FileType::Paf) => bail!(error::Error::CantRunOperationOnFile { + operation: "split".to_string(), + filetype: util::FileType::Paf, + filename: input_path.to_string() + }), + Some(util::FileType::M4) => bail!(error::Error::CantRunOperationOnFile { + operation: "split".to_string(), + filetype: util::FileType::M4, + filename: input_path.to_string() + }), + Some(util::FileType::Yacrd) => bail!(error::Error::CantRunOperationOnFile { + operation: "split".to_string(), + filetype: util::FileType::Yacrd, + filename: input_path.to_string() + }), + None | Some(util::FileType::YacrdOverlap) => { + bail!(error::Error::UnableToDetectFileFormat { + filename: input_path.to_string() + }) + } + }; + + Ok(()) +} + +fn fasta( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fasta::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fasta::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fasta, + })?; + + let (badregion, length) = badregions.get_bad_part(record.name())?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotCovered { + continue; + } else if rtype == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } else { + let mut poss = vec![0]; + for interval in badregion { + if interval.0 == 0 || interval.1 == *length as u32 { + continue; + } + + poss.push(interval.0); + poss.push(interval.1); + } + poss.push(*length as u32); + + for pos in poss.chunks(2) { + if pos[0] as usize > record.sequence().len() + || pos[1] as usize > record.sequence().len() + { + error!("For read {} split position is larger than read, it's strange check your data. For this read, this split position and next are ignore.", record.name()); + break; + } + + writer + .write_record(&noodles::fasta::Record::new( + noodles::fasta::record::Definition::new( + &format!("{}_{}_{}", record.name(), pos[0], pos[1]), + None, + ), + noodles::fasta::record::Sequence::from( + record.sequence().as_ref()[(pos[0] as usize)..(pos[1] as usize)] + .to_vec(), + ), + )) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + } + + Ok(()) +} + +fn fastq( + input: R, + output: W, + badregions: &mut dyn stack::BadPart, + not_covered: f64, +) -> Result<()> +where + R: std::io::Read, + W: std::io::Write, +{ + let mut reader = noodles::fastq::Reader::new(std::io::BufReader::new(input)); + let mut writer = noodles::fastq::Writer::new(std::io::BufWriter::new(output)); + + for result in reader.records() { + let record = result.with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Fastq, + })?; + + let (badregion, length) = badregions.get_bad_part( + std::str::from_utf8(record.name())? + .split_ascii_whitespace() + .next() + .unwrap(), + )?; + + let rtype = editor::type_of_read(*length, badregion, not_covered); + + if rtype == editor::ReadType::NotCovered { + continue; + } else if rtype == editor::ReadType::NotBad { + writer + .write_record(&record) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fastq, + })?; + } else { + let mut sequence_description = std::str::from_utf8(record.name())?.splitn(2, ' '); + let name = sequence_description.next().unwrap(); + let description = sequence_description.next(); + + let mut poss = vec![0]; + for interval in badregion { + if interval.0 == 0 || interval.1 == *length as u32 { + continue; + } + + poss.push(interval.0); + poss.push(interval.1); + } + poss.push(*length as u32); + + for pos in poss.chunks(2) { + if pos[0] as usize > record.sequence().len() + || pos[1] as usize > record.sequence().len() + { + error!("For read {} split position is larger than read, it's strange check your data. For this read, this split position and next are ignore.", std::str::from_utf8(record.name())?); + break; + } + + writer + .write_record(&noodles::fastq::Record::new( + match description { + Some(desc) => format!("{}_{}_{} {}", name, pos[0], pos[1], desc), + None => format!("{}_{}_{}", name, pos[0], pos[1]), + } + .as_bytes(), + record.sequence()[(pos[0] as usize)..(pos[1] as usize)].to_vec(), + record.quality_scores()[(pos[0] as usize)..(pos[1] as usize)].to_vec(), + )) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Fasta, + })?; + } + } + } + + Ok(()) +} + +#[cfg(test)] +mod tests { + use super::*; + + use crate::stack::BadPart; + + use crate::reads2ovl; + use crate::reads2ovl::Reads2Ovl; + + const FASTA_FILE: &'static [u8] = b">1 +ACTGGGGGGACTGGGGGGACTG +>2 +ACTG +>3 +ACTG +"; + + const FASTA_FILE_SPLITED: &'static [u8] = b">1_0_13 +ACTGGGGGGACTG +>1_18_22 +ACTG +>2 +ACTG +>3 +ACTG +"; + + #[test] + fn fasta_file() -> () { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (9, 13)).unwrap(); + ovlst.add_overlap("1".to_string(), (18, 22)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fasta(FASTA_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTA_FILE_SPLITED, &output[..]); + } + + const FASTQ_FILE: &'static [u8] = b"@1 +ACTGGGGGGACTGGGGGGACTG ++ +?????????????????????? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + const FASTQ_FILE_FILTRED: &'static [u8] = b"@1_0_13 +ACTGGGGGGACTG ++ +????????????? +@1_18_22 +ACTG ++ +???? +@2 +ACTG ++ +???? +@3 +ACTG ++ +???? +"; + + #[test] + fn fastq_file() { + let mut ovlst = reads2ovl::FullMemory::new(8192); + + ovlst.add_length("1".to_string(), 22); + ovlst.add_overlap("1".to_string(), (9, 13)).unwrap(); + ovlst.add_overlap("1".to_string(), (18, 22)).unwrap(); + + let mut stack = stack::FromOverlap::new(Box::new(ovlst), 0); + + stack.compute_all_bad_part(); + + let mut output: Vec = Vec::new(); + fastq(FASTQ_FILE, &mut output, &mut stack, 0.8).unwrap(); + + assert_eq!(FASTQ_FILE_FILTRED, &output[..]); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local mod */ +pub mod extract; +pub mod filter; +pub mod scrubbing; +pub mod split; + +/* stuff declare in submod need to be accessible from mod level */ +pub use self::extract::*; +pub use self::filter::*; +pub use self::scrubbing::*; +pub use self::split::*; + +/* crate use */ +use anyhow::{Context, Result}; + +/* local use */ +use crate::error; +use crate::util; + +#[derive(Debug, PartialEq)] +pub enum ReadType { + Chimeric, + NotCovered, + NotBad, +} + +impl Eq for ReadType {} + +impl ReadType { + pub fn as_str(&self) -> &'static str { + match self { + ReadType::Chimeric => "Chimeric", + ReadType::NotCovered => "NotCovered", + ReadType::NotBad => "NotBad", + } + } +} + +pub fn report( + read: &str, + length: usize, + badregions: &[(u32, u32)], + not_covered: f64, + out: &mut W, +) -> Result<()> +where + W: std::io::Write, +{ + let readtype = type_of_read(length, badregions, not_covered); + writeln!( + out, + "{}\t{}\t{}\t{}", + readtype.as_str(), + read, + length, + bad_region_format(badregions) + ) + .with_context(|| error::Error::WritingErrorNoFilename { + format: util::FileType::Yacrd, + }) +} + +pub fn type_of_read(length: usize, badregions: &[(u32, u32)], not_covered: f64) -> ReadType { + let bad_region_len = badregions.iter().fold(0, |acc, x| acc + (x.1 - x.0)); + + if bad_region_len as f64 / length as f64 > not_covered { + return ReadType::NotCovered; + } + + let mut middle_gap = badregions + .iter() + .filter(|x| x.0 != 0 && x.1 != length as u32); + if middle_gap.next().is_some() { + return ReadType::Chimeric; + } + + ReadType::NotBad +} + +fn bad_region_format(bads: &[(u32, u32)]) -> String { + bads.iter() + .map(|b| format!("{},{},{}", b.1 - b.0, b.0, b.1)) + .collect::>() + .join(";") +} + +#[cfg(test)] +mod tests { + use super::*; + + #[test] + fn read_type_assignation() { + let a = (vec![(0, 10), (990, 1000)], 1000); + let b = (vec![(0, 10), (90, 1000)], 1000); + let c = (vec![(0, 10), (490, 510), (990, 1000)], 1000); + let d = (vec![(990, 1000)], 1000); + let e = (vec![(0, 10)], 1000); + let f = (vec![(490, 510)], 1000); + + assert_eq!(ReadType::NotBad, type_of_read(a.1, &a.0, 0.8)); + assert_eq!(ReadType::NotCovered, type_of_read(b.1, &b.0, 0.8)); + assert_eq!(ReadType::Chimeric, type_of_read(c.1, &c.0, 0.8)); + assert_eq!(ReadType::NotBad, type_of_read(d.1, &d.0, 0.8)); + assert_eq!(ReadType::NotBad, type_of_read(e.1, &e.0, 0.8)); + assert_eq!(ReadType::Chimeric, type_of_read(f.1, &f.0, 0.8)); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use clap::Parser; + +/* mod declaration*/ +mod cli; +mod editor; +mod error; +mod io; +mod reads2ovl; +mod stack; +mod util; + +fn main() -> Result<()> { + env_logger::init(); + + let params = cli::Command::parse(); + + /* Get bad region of reads */ + let mut reads2badregion: Box = + if Some(util::FileType::Yacrd) == util::get_file_type(¶ms.input) { + /* Read bad part from yacrd report */ + Box::new(stack::FromReport::new(¶ms.input)?) + } else { + /* Get bad part from overlap */ + let mut reads2ovl: Box = match params.ondisk.clone() { + Some(on_disk_path) => Box::new(reads2ovl::OnDisk::new( + on_disk_path, + util::str2u64(¶ms.ondisk_buffer_size)?, + params.buffer_size, + )), + None => Box::new(reads2ovl::FullMemory::new(params.buffer_size)), + }; + + reads2ovl.init(¶ms.input)?; + + Box::new(stack::FromOverlap::new(reads2ovl, params.coverage)) + }; + + /* Write report */ + let raw_out = Box::new(std::io::BufWriter::new( + std::fs::File::create(¶ms.output).with_context(|| error::Error::CantWriteFile { + filename: params.output.clone(), + })?, + )); + + let mut out = niffler::get_writer( + raw_out, + niffler::compression::Format::No, + niffler::compression::Level::One, + )?; + + rayon::ThreadPoolBuilder::new() + .num_threads(params.threads.unwrap_or(1usize)) + .build_global()?; + reads2badregion.compute_all_bad_part(); + + for read in reads2badregion.get_reads() { + let (bads, len) = reads2badregion.get_bad_part(&read)?; + editor::report(&read, *len, bads, params.not_coverage, &mut out) + .with_context(|| anyhow!("Filename: {}", ¶ms.output))?; + } + + /* Run post operation on read or overlap */ + match params.subcmd { + Some(cli::SubCommand::Scrubb(s)) => editor::scrubbing( + &s.input, + &s.output, + &mut *reads2badregion, + params.not_coverage, + params.buffer_size, + )?, + Some(cli::SubCommand::Filter(f)) => editor::filter( + &f.input, + &f.output, + &mut *reads2badregion, + params.not_coverage, + params.buffer_size, + )?, + Some(cli::SubCommand::Extract(e)) => editor::extract( + &e.input, + &e.output, + &mut *reads2badregion, + params.not_coverage, + params.buffer_size, + )?, + Some(cli::SubCommand::Split(s)) => editor::split( + &s.input, + &s.output, + &mut *reads2badregion, + params.not_coverage, + params.buffer_size, + )?, + None => (), + }; + + if let Some(on_disk_path) = params.ondisk { + let path = std::path::PathBuf::from(on_disk_path); + if path.is_dir() { + remove_dir_all::remove_dir_all(&path).with_context(|| anyhow!("We failed to remove file {:?}, yacrd finish analysis but temporary file isn't removed", path.clone()))?; + } + + if let Some(parent_path) = path.parent() { + if path.is_dir() { + remove_dir_all::remove_dir_all(parent_path).with_context(|| { + error::Error::PathDestruction { + path: parent_path.to_path_buf(), + } + })?; + } + } + } + + Ok(()) +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; + +/* local use */ +use crate::error; + +#[derive(Debug, PartialEq)] +pub enum FileType { + Fasta, + Fastq, + Yacrd, + Paf, + M4, + YacrdOverlap, +} + +pub fn get_file_type(filename: &str) -> Option { + if filename.contains(".m4") || filename.contains(".mhap") { + Some(FileType::M4) + } else if filename.contains(".paf") { + Some(FileType::Paf) + } else if filename.contains(".yacrd") { + Some(FileType::Yacrd) + } else if filename.contains(".fastq") || filename.contains(".fq") { + Some(FileType::Fastq) + } else if filename.contains(".fasta") || filename.contains(".fa") { + Some(FileType::Fasta) + } else if filename.contains(".yovl") { + Some(FileType::YacrdOverlap) + } else { + None + } +} + +pub fn read_file( + filename: &str, + buffer_size: usize, +) -> Result<(Box, niffler::compression::Format)> { + let raw_in = Box::new(std::io::BufReader::with_capacity( + buffer_size, + std::fs::File::open(filename).with_context(|| error::Error::CantReadFile { + filename: filename.to_string(), + })?, + )); + + niffler::get_reader(raw_in) + .with_context(|| anyhow!("Error in compression detection of file {}", filename)) +} + +pub fn write_file( + filename: &str, + compression: niffler::compression::Format, + buffer_size: usize, +) -> Result> { + let raw_out = Box::new(std::io::BufWriter::with_capacity( + buffer_size, + std::fs::File::create(filename).with_context(|| error::Error::CantWriteFile { + filename: filename.to_string(), + })?, + )); + + let output = niffler::get_writer(raw_out, compression, niffler::compression::Level::One)?; + + Ok(output) +} + +pub fn str2usize(val: &str) -> Result { + val.parse::().with_context(|| { + anyhow!( + "Error during parsing of number from string {:?} in usize", + val + ) + }) +} + +pub fn str2u32(val: &str) -> Result { + val.parse::().with_context(|| { + anyhow!( + "Error during parsing of number from string {:?} in u32", + val + ) + }) +} + +pub fn str2u64(val: &str) -> Result { + val.parse::().with_context(|| { + anyhow!( + "Error during parsing of number from string {:?} in u64", + val + ) + }) +} + +#[cfg(test)] +mod tests { + use super::*; + + mod str2usize { + use super::*; + + #[test] + fn failed() { + match str2usize("2,5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2usize('2,5') return {}", a), + } + + match str2usize("2.5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2usize('2.5') return {}", a), + } + } + + #[test] + fn succeeded() { + match str2usize("2") { + Ok(a) => assert!(true, "Value {}", a), + Err(e) => assert!(false, "str2usize('2') return {}", e), + } + } + } + + mod str2u32 { + use super::*; + + #[test] + fn failed() { + match str2u32("2,5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2u32('2,5') return {}", a), + } + + match str2u32("2.5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2u32('2.5') return {}", a), + } + } + + #[test] + fn succeeded() { + match str2u32("2") { + Ok(a) => assert!(true, "Value {}", a), + Err(e) => assert!(false, "str2u32('2') return {}", e), + } + } + } + + mod str2u64 { + use super::*; + + #[test] + fn failed() { + match str2u64("2,5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2u64('2,5') return {}", a), + } + + match str2u64("2.5") { + Err(e) => assert!(true, "Error message {:?}", e), + Ok(a) => assert!(false, "str2u64('2.5') return {}", a), + } + } + + #[test] + fn succeeded() { + match str2u64("2") { + Ok(a) => assert!(true, "Value {}", a), + Err(e) => assert!(false, "str2u64('2') return {}", e), + } + } + } + + mod file_type { + use super::*; + + #[test] + fn m4() { + assert_eq!(Some(FileType::M4), get_file_type("test.m4")); + } + + #[test] + fn m4_with_other_ext() { + assert_eq!(Some(FileType::M4), get_file_type("test.m4.other_ext")); + } + + #[test] + fn m4_with_nopoint() { + assert_eq!(None, get_file_type("m4.other_ext")); + } + + #[test] + fn mhap() { + assert_eq!(Some(FileType::M4), get_file_type("test.mhap")); + } + + #[test] + fn mhap_with_other_ext() { + assert_eq!(Some(FileType::M4), get_file_type("test.mhap.other_ext")); + } + + #[test] + fn mhap_with_nopoint() { + assert_eq!(None, get_file_type("mhap.other_ext")); + } + + #[test] + fn paf() { + assert_eq!(Some(FileType::Paf), get_file_type("test.paf")); + } + + #[test] + fn paf_with_other_ext() { + assert_eq!(Some(FileType::Paf), get_file_type("test.paf.other_ext")); + } + + #[test] + fn paf_with_nopoint() { + assert_eq!(None, get_file_type("paf.other_ext")); + } + + #[test] + fn fasta() { + assert_eq!(Some(FileType::Fasta), get_file_type("test.fasta")); + } + + #[test] + fn fasta_with_other_ext() { + assert_eq!(Some(FileType::Fasta), get_file_type("test.fasta.other_ext")); + } + + #[test] + fn fasta_with_nopoint() { + assert_eq!(None, get_file_type("fasta.other_ext")); + } + + #[test] + fn fa() { + assert_eq!(Some(FileType::Fasta), get_file_type("test.fa")); + } + + #[test] + fn fa_with_other_ext() { + assert_eq!(Some(FileType::Fasta), get_file_type("test.fa.other_ext")); + } + + #[test] + fn fa_with_nopoint() { + assert_eq!(None, get_file_type("fa.other_ext")); + } + + #[test] + fn fastq() { + assert_eq!(Some(FileType::Fastq), get_file_type("test.fastq")); + } + + #[test] + fn fastq_with_other_ext() { + assert_eq!(Some(FileType::Fastq), get_file_type("test.fastq.other_ext")); + } + + #[test] + fn fastq_with_nopoint() { + assert_eq!(None, get_file_type("fastq.other_ext")); + } + + #[test] + fn fq() { + assert_eq!(Some(FileType::Fastq), get_file_type("test.fq")); + } + + #[test] + fn fq_with_other_ext() { + assert_eq!(Some(FileType::Fastq), get_file_type("test.fq.other_ext")); + } + + #[test] + fn fq_with_nopoint() { + assert_eq!(None, get_file_type("fq.other_ext")); + } + + #[test] + fn yacrd_overlap() { + assert_eq!(Some(FileType::YacrdOverlap), get_file_type("test.yovl")); + } + + #[test] + fn yacrd_overlap_with_other_ext() { + assert_eq!( + Some(FileType::YacrdOverlap), + get_file_type("test.yovl.other_ext") + ); + } + + #[test] + fn yacrd_overlap_with_nopoint() { + assert_eq!(None, get_file_type("yovl.other_ext")); + } + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, bail, Context, Result}; + +/* local mod */ +pub mod fullmemory; +pub mod ondisk; + +/* stuff declare in submod need to be accessible from mod level */ +pub use self::fullmemory::*; +pub use self::ondisk::*; + +/* std use */ +pub use self::fullmemory::*; + +/* local use */ +use crate::error; +use crate::io; +use crate::util; + +pub type MapReads2Ovl = rustc_hash::FxHashMap, usize)>; + +pub trait Reads2Ovl { + fn init(&mut self, filename: &str) -> Result<()> { + self.sub_init(filename) + } + + fn sub_init(&mut self, filename: &str) -> Result<()> { + let (input, _) = util::read_file(filename, self.read_buffer_size())?; + + match util::get_file_type(filename) { + Some(util::FileType::Paf) => self + .init_paf(input) + .with_context(|| anyhow!("Filename: {}", filename.to_string()))?, + Some(util::FileType::M4) => self + .init_m4(input) + .with_context(|| anyhow!("Filename: {}", filename.to_string()))?, + Some(util::FileType::Fasta) => bail!(error::Error::CantRunOperationOnFile { + operation: "overlap parsing".to_string(), + filetype: util::FileType::Fasta, + filename: filename.to_string() + }), + Some(util::FileType::Fastq) => bail!(error::Error::CantRunOperationOnFile { + operation: "overlap parsing".to_string(), + filetype: util::FileType::Fastq, + filename: filename.to_string() + }), + Some(util::FileType::Yacrd) => bail!(error::Error::CantRunOperationOnFile { + operation: "overlap parsing".to_string(), + filetype: util::FileType::Yacrd, + filename: filename.to_string() + }), + None | Some(util::FileType::YacrdOverlap) => { + bail!(error::Error::UnableToDetectFileFormat { + filename: filename.to_string() + }) + } + } + + Ok(()) + } + + fn init_paf(&mut self, input: Box) -> Result<()> { + let mut reader = csv::ReaderBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .flexible(true) + .from_reader(input); + + let mut rec = csv::StringRecord::new(); + + while reader.read_record(&mut rec).unwrap() { + let record: io::PafRecord = + rec.deserialize(None) + .with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::Paf, + })?; + + let id_a = record.read_a.to_string(); + let id_b = record.read_b.to_string(); + + let len_a = record.length_a; + let len_b = record.length_b; + + let ovl_a = (record.begin_a, record.end_a); + let ovl_b = (record.begin_b, record.end_b); + + self.add_overlap_and_length(id_a, ovl_a, len_a)?; + self.add_overlap_and_length(id_b, ovl_b, len_b)?; + } + + Ok(()) + } + + fn init_m4(&mut self, input: Box) -> Result<()> { + let mut reader = csv::ReaderBuilder::new() + .delimiter(b' ') + .has_headers(false) + .flexible(true) + .from_reader(input); + + let mut rec = csv::StringRecord::new(); + + while reader.read_record(&mut rec).unwrap() { + let record: io::M4Record = + rec.deserialize(None) + .with_context(|| error::Error::ReadingErrorNoFilename { + format: util::FileType::M4, + })?; + + let id_a = record.read_a.to_string(); + let id_b = record.read_b.to_string(); + + let len_a = record.length_a; + let len_b = record.length_b; + + let ovl_a = (record.begin_a, record.end_a); + let ovl_b = (record.begin_b, record.end_b); + + self.add_overlap_and_length(id_a, ovl_a, len_a)?; + self.add_overlap_and_length(id_b, ovl_b, len_b)?; + } + + Ok(()) + } + + fn get_overlaps(&mut self, new: &mut MapReads2Ovl) -> bool; + + fn overlap(&self, id: &str) -> Result>; + fn length(&self, id: &str) -> usize; + + fn add_overlap(&mut self, id: String, ovl: (u32, u32)) -> Result<()>; + fn add_length(&mut self, id: String, ovl: usize); + + fn add_overlap_and_length(&mut self, id: String, ovl: (u32, u32), length: usize) -> Result<()>; + + fn get_reads(&self) -> rustc_hash::FxHashSet; + + fn read_buffer_size(&self) -> usize; +} + +#[cfg(test)] +mod tests { + use super::*; + + use std::io::Write; + + extern crate tempfile; + + const PAF_FILE: &'static [u8] = b"1\t12000\t20\t4500\t-\t2\t10000\t5500\t10000\t4500\t4500\t255 +1\t12000\t5500\t10000\t-\t3\t10000\t0\t4500\t4500\t4500\t255 +"; + + const M4_FILE: &'static [u8] = b"1 2 0.1 2 0 20 4500 12000 0 5500 10000 10000 +1 3 0.1 2 0 5500 10000 12000 0 0 4500 10000 +"; + + #[test] + fn paf() { + let mut paf = tempfile::Builder::new() + .suffix(".paf") + .tempfile() + .expect("Can't create tmpfile"); + + paf.as_file_mut() + .write_all(PAF_FILE) + .expect("Error durring write of paf in temp file"); + + let mut ovl = FullMemory::new(8192); + + ovl.init(paf.into_temp_path().to_str().unwrap()) + .expect("Error in overlap init"); + + assert_eq!( + ["1".to_string(), "2".to_string(), "3".to_string(),] + .iter() + .cloned() + .collect::>(), + ovl.get_reads() + ); + + assert_eq!(vec![(20, 4500), (5500, 10000)], ovl.overlap("1").unwrap()); + assert_eq!(vec![(5500, 10000)], ovl.overlap("2").unwrap()); + assert_eq!(vec![(0, 4500)], ovl.overlap("3").unwrap()); + } + + #[test] + fn m4() { + let mut m4 = tempfile::Builder::new() + .suffix(".m4") + .tempfile() + .expect("Can't create tmpfile"); + + m4.as_file_mut() + .write_all(M4_FILE) + .expect("Error durring write of m4 in temp file"); + + let mut ovl = FullMemory::new(8192); + + ovl.init(m4.into_temp_path().to_str().unwrap()) + .expect("Error in overlap init"); + + assert_eq!( + ["1".to_string(), "2".to_string(), "3".to_string(),] + .iter() + .cloned() + .collect::>(), + ovl.get_reads() + ); + + assert_eq!(vec![(20, 4500), (5500, 10000)], ovl.overlap("1").unwrap()); + assert_eq!(vec![(5500, 10000)], ovl.overlap("2").unwrap()); + assert_eq!(vec![(0, 4500)], ovl.overlap("3").unwrap()); + } +} +/* + Copyright (c) 2019 Pierre Marijon + + Permission is hereby granted, free of charge, to any person obtaining a copy + of this software and associated documentation files (the "Software"), to deal + in the Software without restriction, including without limitation the rights + to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + copies of the Software, and to permit persons to whom the Software is + furnished to do so, subject to the following conditions: + + The above copyright notice and this permission notice shall be included in all + copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* crate use */ +use anyhow::Result; + +/* local use */ +use crate::reads2ovl; + +pub struct FullMemory { + reads2ovl: reads2ovl::MapReads2Ovl, + no_overlap: Vec<(u32, u32)>, + read_buffer_size: usize, +} + +impl FullMemory { + pub fn new(read_buffer_size: usize) -> Self { + FullMemory { + reads2ovl: rustc_hash::FxHashMap::default(), + no_overlap: Vec::new(), + read_buffer_size, + } + } +} + +impl reads2ovl::Reads2Ovl for FullMemory { + fn get_overlaps(&mut self, new: &mut reads2ovl::MapReads2Ovl) -> bool { + std::mem::swap(&mut self.reads2ovl, new); + + true + } + + fn overlap(&self, id: &str) -> Result> { + if let Some((vec, _)) = self.reads2ovl.get(&id.to_string()) { + Ok(vec.to_vec()) + } else { + Ok(self.no_overlap.to_vec()) + } + } + + fn length(&self, id: &str) -> usize { + if let Some((_, len)) = self.reads2ovl.get(&id.to_string()) { + *len + } else { + 0 + } + } + + fn add_overlap(&mut self, id: String, ovl: (u32, u32)) -> Result<()> { + self.reads2ovl + .entry(id) + .or_insert((Vec::new(), 0)) + .0 + .push(ovl); + + Ok(()) + } + + fn add_length(&mut self, id: String, length: usize) { + self.reads2ovl.entry(id).or_insert((Vec::new(), 0)).1 = length; + } + + fn add_overlap_and_length(&mut self, id: String, ovl: (u32, u32), length: usize) -> Result<()> { + if let Some(value) = self.reads2ovl.get_mut(&id) { + value.0.push(ovl); + } else { + self.reads2ovl.insert(id, (vec![ovl], length)); + } + + Ok(()) + } + + fn get_reads(&self) -> rustc_hash::FxHashSet { + self.reads2ovl.keys().map(|x| x.to_string()).collect() + } + + fn read_buffer_size(&self) -> usize { + self.read_buffer_size + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use log::info; + +/* local use */ +use crate::error; +use crate::reads2ovl; + +pub struct OnDisk { + reads2ovl: rustc_hash::FxHashMap>, + reads2len: rustc_hash::FxHashMap, + db: sled::Db, + number_of_value: u64, + buffer_size: u64, + read_buffer_size: usize, +} + +#[derive(Debug, Clone, serde::Deserialize)] +struct OnDiskRecord { + _begin: u32, + _end: u32, +} + +impl OnDisk { + pub fn new(on_disk_path: String, buffer_size: u64, read_buffer_size: usize) -> Self { + let path = std::path::PathBuf::from(on_disk_path.clone()); + + if let Some(parent) = path.parent() { + std::fs::create_dir_all(parent) + .with_context(|| error::Error::PathCreation { path }) + .unwrap(); + } + + let db = sled::Config::default() + .path(on_disk_path) + .open() + .with_context(|| error::Error::OnDiskOpen) + .unwrap(); + + OnDisk { + reads2ovl: rustc_hash::FxHashMap::default(), + reads2len: rustc_hash::FxHashMap::default(), + db, + number_of_value: 0, + buffer_size, + read_buffer_size, + } + } + + fn clean_buffer(&mut self) -> Result<()> { + info!( + "Clear cache, number of value in cache is {}", + self.number_of_value + ); + + let mut batch = sled::Batch::default(); + + for (key, vs) in self.reads2ovl.drain() { + let new_val: Vec<(u32, u32)> = match self + .db + .get(key.as_bytes()) + .with_context(|| error::Error::OnDiskReadDatabase)? + { + Some(x) => { + let mut orig: Vec<(u32, u32)> = bincode::deserialize(&x) + .with_context(|| error::Error::OnDiskDeserializeVec)?; + orig.extend(vs); + orig + } + None => vs.to_vec(), + }; + + batch.insert( + key.as_bytes(), + bincode::serialize(&new_val).with_context(|| error::Error::OnDiskSerializeVec)?, + ); + } + + self.db + .apply_batch(batch) + .with_context(|| error::Error::OnDiskBatchApplication)?; + + self.db + .flush() + .with_context(|| error::Error::OnDiskBatchApplication)?; + + self.number_of_value = 0; + + Ok(()) + } + + fn _overlap(&self, id: &str) -> Result> { + bincode::deserialize( + &self + .db + .get(id.as_bytes()) + .with_context(|| error::Error::OnDiskReadDatabase)? + .unwrap(), + ) + .with_context(|| error::Error::OnDiskDeserializeVec) + } +} + +impl reads2ovl::Reads2Ovl for OnDisk { + fn init(&mut self, filename: &str) -> Result<()> { + self.sub_init(filename)?; + + self.clean_buffer() + .with_context(|| anyhow!("Error durring creation of tempory file"))?; + self.number_of_value = 0; + + Ok(()) + } + + fn get_overlaps(&mut self, new: &mut reads2ovl::MapReads2Ovl) -> bool { + let mut tmp = rustc_hash::FxHashMap::default(); + + if self.reads2len.is_empty() { + std::mem::swap(&mut tmp, new); + return true; + } + + let mut remove_reads = Vec::with_capacity(self.buffer_size as usize); + + for (k, v) in self.reads2len.iter().take(self.buffer_size as usize) { + remove_reads.push(k.clone()); + tmp.insert(k.clone(), (self._overlap(k).unwrap(), *v)); + } + + for k in remove_reads { + self.reads2len.remove(&k); + } + + std::mem::swap(&mut tmp, new); + false + } + + fn overlap(&self, id: &str) -> Result> { + self._overlap(id) + } + + fn length(&self, id: &str) -> usize { + *self.reads2len.get(&id.to_string()).unwrap_or(&0) + } + + fn add_overlap(&mut self, id: String, ovl: (u32, u32)) -> Result<()> { + self.reads2ovl.entry(id).or_insert_with(Vec::new).push(ovl); + + self.number_of_value += 1; + + if self.number_of_value >= self.buffer_size { + self.clean_buffer()?; + } + + Ok(()) + } + + fn add_length(&mut self, id: String, length: usize) { + self.reads2len.entry(id).or_insert(length); + } + + fn add_overlap_and_length(&mut self, id: String, ovl: (u32, u32), length: usize) -> Result<()> { + self.add_length(id.clone(), length); + + self.add_overlap(id, ovl) + } + + fn get_reads(&self) -> rustc_hash::FxHashSet { + self.reads2len.keys().map(|x| x.to_string()).collect() + } + + fn read_buffer_size(&self) -> usize { + self.read_buffer_size + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* std use */ +use std::cmp::Reverse; + +/* crate use */ +use anyhow::{Context, Result}; +use rayon::prelude::*; + +/* local use */ +use crate::error; +use crate::reads2ovl; +use crate::util; + +pub trait BadPart { + fn compute_all_bad_part(&mut self); + + fn get_bad_part(&mut self, id: &str) -> Result<&(Vec<(u32, u32)>, usize)>; + + fn get_reads(&self) -> rustc_hash::FxHashSet; +} + +pub struct FromOverlap { + ovl: Box, + coverage: u64, + buffer: reads2ovl::MapReads2Ovl, + empty: (Vec<(u32, u32)>, usize), +} + +impl FromOverlap { + pub fn new(ovl: Box, coverage: u64) -> Self { + let empty = (Vec::new(), 0); + FromOverlap { + ovl, + coverage, + buffer: rustc_hash::FxHashMap::default(), + empty, + } + } + + fn compute_bad_part(mut ovls: Vec<(u32, u32)>, len: usize, coverage: usize) -> Vec<(u32, u32)> { + let mut gaps: Vec<(u32, u32)> = Vec::new(); + let mut stack: std::collections::BinaryHeap> = + std::collections::BinaryHeap::new(); + + ovls.sort_unstable(); + + let mut first_covered = 0; + let mut last_covered = 0; + + for interval in ovls { + while let Some(head) = stack.peek() { + if head.0 > interval.0 { + break; + } + + if stack.len() > coverage { + last_covered = head.0; + } + stack.pop(); + } + + if stack.len() <= coverage { + if last_covered != 0 { + gaps.push((last_covered, interval.0)); + } else { + first_covered = interval.0; + } + } + stack.push(Reverse(interval.1)); + } + + while stack.len() > coverage { + last_covered = stack + .peek() + .with_context(|| error::Error::NotReachableCode { + name: format!("{} {}", file!(), line!()), + }) + .unwrap() + .0; + if last_covered as usize >= len { + break; + } + stack.pop(); + } + + if first_covered != 0 { + gaps.insert(0, (0, first_covered)); + } + + if last_covered as usize != len { + gaps.push((last_covered, len as u32)); + } + + if gaps.is_empty() { + return gaps; + } + + /* clean overlapped bad region */ + let mut clean_gaps: Vec<(u32, u32)> = Vec::new(); + let mut begin = gaps[0].0; + let mut end = gaps[0].1; + for gaps in gaps.windows(2) { + let g1 = gaps[0]; + let g2 = gaps[1]; + + if g1.0 == g2.0 { + begin = g1.0; + end = g1.1.max(g2.1); + } else { + clean_gaps.push((begin, end)); + begin = g2.0; + end = g2.1; + } + } + clean_gaps.push((begin, end)); + + clean_gaps + } +} + +impl BadPart for FromOverlap { + fn compute_all_bad_part(&mut self) { + let mut new = rustc_hash::FxHashMap::default(); + + let coverage = self.coverage as usize; + + loop { + let finish = self.ovl.get_overlaps(&mut new); + + self.buffer.extend( + new.drain() + .par_bridge() + .map(|(k, v)| (k, (FromOverlap::compute_bad_part(v.0, v.1, coverage), v.1))) + .collect::(), + ); + + if finish { + break; + } + } + } + + fn get_bad_part(&mut self, id: &str) -> Result<&(Vec<(u32, u32)>, usize)> { + match self.buffer.get(id) { + Some(v) => Ok(v), + None => Ok(&self.empty), + } + } + + fn get_reads(&self) -> rustc_hash::FxHashSet { + self.buffer.keys().map(|x| x.to_string()).collect() + } +} + +pub struct FromReport { + buffer: reads2ovl::MapReads2Ovl, + empty: (Vec<(u32, u32)>, usize), +} + +impl FromReport { + pub fn new(input_path: &str) -> Result { + let input = + std::io::BufReader::new(std::fs::File::open(input_path).with_context(|| { + error::Error::CantReadFile { + filename: input_path.to_string(), + } + })?); + let mut reader = csv::ReaderBuilder::new() + .delimiter(b'\t') + .has_headers(false) + .from_reader(input); + + let mut buffer = rustc_hash::FxHashMap::default(); + for (line, record) in reader.records().enumerate() { + let result = record.with_context(|| error::Error::Reading { + filename: input_path.to_string(), + format: util::FileType::Fasta, + })?; + + let id = result[1].to_string(); + let len = util::str2usize(&result[2])?; + let bad_part = FromReport::parse_bad_string(&result[3]).with_context(|| { + error::Error::CorruptYacrdReport { + name: input_path.to_string(), + line, + } + })?; + + buffer.insert(id, (bad_part, len)); + } + + let empty = (Vec::new(), 0); + Ok(FromReport { buffer, empty }) + } + + fn parse_bad_string(bad_string: &str) -> Result> { + let mut ret = Vec::new(); + + if bad_string.is_empty() { + return Ok(ret); + } + + for sub in bad_string.split(';') { + let mut iter = sub.split(','); + iter.next(); + + ret.push(( + util::str2u32( + iter.next() + .with_context(|| error::Error::CorruptYacrdReportInPosition)?, + )?, + util::str2u32( + iter.next() + .with_context(|| error::Error::CorruptYacrdReportInPosition)?, + )?, + )); + } + + Ok(ret) + } +} + +impl BadPart for FromReport { + fn compute_all_bad_part(&mut self) {} + + fn get_bad_part(&mut self, id: &str) -> Result<&(Vec<(u32, u32)>, usize)> { + match self.buffer.get(id) { + Some(v) => Ok(v), + None => Ok(&self.empty), + } + } + + fn get_reads(&self) -> rustc_hash::FxHashSet { + self.buffer.keys().map(|x| x.to_string()).collect() + } +} + +#[cfg(test)] +mod tests { + use super::*; + + use std::io::Write; + + extern crate tempfile; + use self::tempfile::NamedTempFile; + + use reads2ovl::Reads2Ovl; + + #[test] + fn from_report() { + let mut report = NamedTempFile::new().expect("Can't create tmpfile"); + + writeln!( + report.as_file_mut(), + "NotBad SRR8494940.65223 2706 1131,0,1131;16,2690,2706 +NotCovered SRR8494940.141626 30116 326,0,326;27159,2957,30116 +Chimeric SRR8494940.91655 15691 151,0,151;4056,7213,11269;58,15633,15691" + ) + .expect("Error durring write of report in temp file"); + + let mut stack = FromReport::new(report.into_temp_path().to_str().unwrap()) + .expect("Error when create stack object"); + + assert_eq!( + [ + "SRR8494940.65223".to_string(), + "SRR8494940.141626".to_string(), + "SRR8494940.91655".to_string() + ] + .iter() + .cloned() + .collect::>(), + stack.get_reads() + ); + + assert_eq!( + &(vec![(0, 1131), (2690, 2706)], 2706), + stack.get_bad_part("SRR8494940.65223").unwrap() + ); + assert_eq!( + &(vec![(0, 326), (2957, 30116)], 30116), + stack.get_bad_part("SRR8494940.141626").unwrap() + ); + assert_eq!( + &(vec![(0, 151), (7213, 11269), (15633, 15691)], 15691), + stack.get_bad_part("SRR8494940.91655").unwrap() + ); + } + + #[test] + fn from_overlap() { + let mut ovl = reads2ovl::FullMemory::new(8192); + + ovl.add_overlap("A".to_string(), (10, 990)).unwrap(); + ovl.add_length("A".to_string(), 1000); + + ovl.add_overlap("B".to_string(), (10, 90)).unwrap(); + ovl.add_length("B".to_string(), 1000); + + ovl.add_overlap("C".to_string(), (10, 490)).unwrap(); + ovl.add_overlap("C".to_string(), (510, 990)).unwrap(); + ovl.add_length("C".to_string(), 1000); + + ovl.add_overlap("D".to_string(), (0, 990)).unwrap(); + ovl.add_length("D".to_string(), 1000); + + ovl.add_overlap("E".to_string(), (10, 1000)).unwrap(); + ovl.add_length("E".to_string(), 1000); + + ovl.add_overlap("F".to_string(), (0, 490)).unwrap(); + ovl.add_overlap("F".to_string(), (510, 1000)).unwrap(); + ovl.add_length("F".to_string(), 1000); + + let mut stack = FromOverlap::new(Box::new(ovl), 0); + + stack.compute_all_bad_part(); + + assert_eq!( + [ + "A".to_string(), + "B".to_string(), + "C".to_string(), + "D".to_string(), + "E".to_string(), + "F".to_string() + ] + .iter() + .cloned() + .collect::>(), + stack.get_reads() + ); + + assert_eq!( + &(vec![(0, 10), (990, 1000)], 1000), + stack.get_bad_part("A").unwrap() + ); + assert_eq!( + &(vec![(0, 10), (90, 1000)], 1000), + stack.get_bad_part("B").unwrap() + ); + assert_eq!( + &(vec![(0, 10), (490, 510), (990, 1000)], 1000), + stack.get_bad_part("C").unwrap() + ); + assert_eq!(&(vec![(990, 1000)], 1000), stack.get_bad_part("D").unwrap()); + assert_eq!(&(vec![(0, 10)], 1000), stack.get_bad_part("E").unwrap()); + assert_eq!(&(vec![(490, 510)], 1000), stack.get_bad_part("F").unwrap()); + } + + #[test] + fn coverage_upper_than_0() { + let mut ovl = reads2ovl::FullMemory::new(8192); + + ovl.add_length("A".to_string(), 1000); + + ovl.add_overlap("A".to_string(), (0, 425)).unwrap(); + ovl.add_overlap("A".to_string(), (0, 450)).unwrap(); + ovl.add_overlap("A".to_string(), (0, 475)).unwrap(); + + ovl.add_overlap("A".to_string(), (525, 1000)).unwrap(); + ovl.add_overlap("A".to_string(), (550, 1000)).unwrap(); + ovl.add_overlap("A".to_string(), (575, 1000)).unwrap(); + + let mut stack = FromOverlap::new(Box::new(ovl), 2); + + stack.compute_all_bad_part(); + + assert_eq!(&(vec![(425, 575)], 1000), stack.get_bad_part("A").unwrap()); + } + + #[test] + fn failled_correctly_on_corrupt_yacrd() { + let mut report = NamedTempFile::new().expect("Can't create tmpfile"); + + writeln!( + report.as_file_mut(), + "NotBad SRR8494940.65223 2706 1131,0,1131;16,2690,2706 +NotCovered SRR8494940.141626 30116 326,0,326;27159,2957,30116 +Chimeric SRR8494940.91655 15691 151,0,151;4056,7213,11269;58,156" + ) + .unwrap(); + + let stack = FromReport::new(report.into_temp_path().to_str().unwrap()); + + if !stack.is_err() { + assert!(false); + } + } + + #[test] + fn perfect_read_in_report() { + let mut report = NamedTempFile::new().expect("Can't create tmpfile"); + + writeln!(report.as_file_mut(), "NotBad perfect 2706 ") + .expect("Error durring write of report in temp file"); + + let mut stack = FromReport::new(report.into_temp_path().to_str().unwrap()) + .expect("Error when create stack object"); + + assert_eq!( + ["perfect".to_string()] + .iter() + .cloned() + .collect::>(), + stack.get_reads() + ); + + assert_eq!(&(vec![], 2706), stack.get_bad_part("perfect").unwrap()); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use thiserror::Error; + +/* local use */ +use crate::util; + +#[derive(Debug, Error)] +pub enum Error { + #[error( + "Reading of the file '{filename:}' impossible, does it exist and can be read by the user?" + )] + CantReadFile { filename: String }, + + #[error("Creation/opening of the file '{filename:}' impossible, directory in path exist? can be written by the user?")] + CantWriteFile { filename: String }, + + #[error("Format detection for '{filename:}' file not possible, filename need to contains .fasta, .fa, .fastq, fq, .paf, .m4, .mhap or .yacrd")] + UnableToDetectFileFormat { filename: String }, + + #[error( + "This operation {operation:} can't be run on this type ({filetype:?}) of file {filename:}" + )] + CantRunOperationOnFile { + operation: String, + filetype: util::FileType, + filename: String, + }, + + #[error("Error durring reading of file {filename:} in format {format:?}")] + Reading { + filename: String, + format: util::FileType, + }, + + #[error("Error during reading a file in format {format:?}")] + ReadingErrorNoFilename { format: util::FileType }, + + #[error("Error during writing of file in format {format:?}")] + WritingErrorNoFilename { format: util::FileType }, + + #[error("Error during yacrd overlap path creation {path:?}")] + PathCreation { path: std::path::PathBuf }, + + #[error("Error during yacrd overlap path destruction {path:?}")] + PathDestruction { path: std::path::PathBuf }, + + #[error("If you get this error please contact the author with this message and command line you use: {name:?}")] + NotReachableCode { name: String }, + + #[error("Yacrd postion seems corrupt")] + CorruptYacrdReportInPosition, + + #[error("Your yacrd file {name} seems corrupt at line {line} you probably need to relaunch analisys with overlapping file")] + CorruptYacrdReport { name: String, line: usize }, + + #[error("Error durring open database")] + OnDiskOpen, + + #[error("Error durring read database")] + OnDiskReadDatabase, + + #[error("Error durring on disk deserialize vector")] + OnDiskDeserializeVec, + + #[error("Error durring on disk serialize vector")] + OnDiskSerializeVec, + + #[error("Error durring on disk batch application")] + OnDiskBatchApplication, +} +/* +Copyright (c) 2018 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. +*/ + +#[derive(Debug, Clone, serde::Deserialize)] +pub struct PafRecord<'a> { + pub read_a: &'a str, + pub length_a: usize, + pub begin_a: u32, + pub end_a: u32, + pub _strand: char, + pub read_b: &'a str, + pub length_b: usize, + pub begin_b: u32, + pub end_b: u32, +} + +#[derive(Debug, Clone, serde::Deserialize)] +pub struct M4Record<'a> { + pub read_a: &'a str, + pub read_b: &'a str, + pub _error: f64, + pub _shared_min: u64, + pub _strand_a: char, + pub begin_a: u32, + pub end_a: u32, + pub length_a: usize, + pub _strand_b: char, + pub begin_b: u32, + pub end_b: u32, + pub length_b: usize, +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* std use */ +use std::io::BufRead; +use std::io::Read; +use std::process::{Command, Stdio}; + +#[cfg(test)] +mod tests { + + use super::*; + + fn diff_unorder(truth_path: &str, result_path: &str) { + let truth_file = std::io::BufReader::new( + std::fs::File::open(truth_path).expect(&format!("Impossible to open {}", truth_path)), + ); + + let mut truth: std::collections::HashSet = std::collections::HashSet::new(); + + for res in truth_file.lines() { + let line = res.unwrap(); + truth.insert(line); + } + + let result_file = std::io::BufReader::new( + std::fs::File::open(result_path).expect(&format!("Impossible to open {}", result_path)), + ); + + let mut result: std::collections::HashSet = std::collections::HashSet::new(); + + for res in result_file.lines() { + let line = res.unwrap(); + result.insert(line); + } + + if truth != result { + panic!( + "Truth {} and result {} are different", + truth_path, result_path + ); + } + } + + fn diff(truth_path: &str, result_path: &str) { + let truth_file = std::io::BufReader::new( + std::fs::File::open(truth_path).expect(&format!("Impossible to open {}", truth_path)), + ); + + let mut truth: Vec = Vec::new(); + + for res in truth_file.lines() { + let line = res.unwrap(); + truth.push(line); + } + + let result_file = std::io::BufReader::new( + std::fs::File::open(result_path).expect(&format!("Impossible to open {}", result_path)), + ); + + let mut result: Vec = Vec::new(); + + for res in result_file.lines() { + let line = res.unwrap(); + result.push(line); + } + + if truth != result { + panic!( + "Truth {} and result {} are different", + truth_path, result_path + ); + } + } + + #[test] + fn detection() { + let mut child = Command::new("./target/debug/yacrd") + .args(&["-i", "tests/reads.paf", "-o", "tests/result.yacrd"]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.yacrd"); + } + + #[test] + fn detection_ondisk() { + if cfg!(windows) { + () + } else { + if std::path::Path::new("tests/ondisk").exists() { + std::fs::remove_dir_all(std::path::Path::new("tests/ondisk")) + .expect("We can't delete temporary directory of ondisk test"); + } + + std::fs::create_dir(std::path::Path::new("tests/ondisk")) + .expect("We can't create temporary directory for ondisk test"); + + let mut child = Command::new("./target/debug/yacrd") + .args(&[ + "-i", + "tests/reads.paf", + "-o", + "tests/result.ondisk.yacrd", + "-d", + "tests/ondisk", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.ondisk.yacrd"); + } + } + + #[test] + fn filter() { + let mut child = Command::new("./target/debug/yacrd") + .args(&[ + "-i", + "tests/reads.paf", + "-o", + "tests/result.filter.yacrd", + "filter", + "-i", + "tests/reads.fastq", + "-o", + "tests/reads.filter.fastq", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.filter.yacrd"); + diff("tests/truth.filter.fastq", "tests/reads.filter.fastq") + } + + #[test] + fn extract() { + let mut child = Command::new("./target/debug/yacrd") + .args(&[ + "-i", + "tests/reads.paf", + "-o", + "tests/result.extract.yacrd", + "extract", + "-i", + "tests/reads.fastq", + "-o", + "tests/reads.extract.fastq", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.extract.yacrd"); + diff("tests/truth.extract.fastq", "tests/reads.extract.fastq") + } + + #[test] + fn split() { + let mut child = Command::new("./target/debug/yacrd") + .args(&[ + "-i", + "tests/reads.paf", + "-o", + "tests/result.split.yacrd", + "split", + "-i", + "tests/reads.fastq", + "-o", + "tests/reads.split.fastq", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.split.yacrd"); + diff("tests/truth.split.fastq", "tests/reads.split.fastq") + } + + #[test] + fn scrubb() { + let mut child = Command::new("./target/debug/yacrd") + .args(&[ + "-i", + "tests/reads.paf", + "-o", + "tests/result.scrubb.yacrd", + "scrubb", + "-i", + "tests/reads.fastq", + "-o", + "tests/reads.scrubb.fastq", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create yacrd subprocess"); + + if !child.wait().expect("Error durring yacrd run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + panic!(); + } + + diff_unorder("tests/truth.yacrd", "tests/result.scrubb.yacrd"); + diff("tests/truth.scrubb.fastq", "tests/reads.scrubb.fastq") + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use log::Level; + +pub fn i82level(level: i8) -> Option { + match level { + std::i8::MIN..=0 => None, + 1 => Some(log::Level::Error), + 2 => Some(log::Level::Warn), + 3 => Some(log::Level::Info), + 4 => Some(log::Level::Debug), + 5..=std::i8::MAX => Some(log::Level::Trace), + } +} + +#[cfg(test)] +mod tests { + use super::*; + + #[test] + fn loglevel() { + assert_eq!(i82level(i8::MIN), None); + assert_eq!(i82level(-3), None); + assert_eq!(i82level(1), Some(log::Level::Error)); + assert_eq!(i82level(2), Some(log::Level::Warn)); + assert_eq!(i82level(3), Some(log::Level::Info)); + assert_eq!(i82level(4), Some(log::Level::Debug)); + assert_eq!(i82level(5), Some(log::Level::Trace)); + assert_eq!(i82level(i8::MAX), Some(log::Level::Trace)); + } +} +/* +Copyright (c) 2021 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use clap::Parser; + +use br::error::IO::*; +use br::error::*; +use br::*; + +#[derive(clap::Parser, Debug)] +#[clap( + version = "0.1", + author = "Pierre Marijon ", + about = "A version of br where memory usage depend on number of kmer not kmer length" +)] +pub struct Command { + /// fasta file to be correct + #[clap(short = 'i', long = "inputs")] + pub inputs: Vec, + + /// path where corrected read was write + #[clap(short = 'o', long = "outputs")] + pub outputs: Vec, + + /// use kmer present in fasta file as solid kmer and store them in HashSet + #[clap(short = 'S', long = "kmer-solid")] + pub kmer_solid: Vec, + + /// kmer length lower or equal to 32 + #[clap(short = 'k', long = "kmer")] + pub kmer_size: Option, + + /// correction method used, methods are applied in the order you specify, default value is 'one' + #[clap( + short = 'm', + long = "method", + possible_values = &["one", "two", "graph", "greedy", "gap_size"], + )] + pub methods: Option>, + + /// number of kmer need to be solid after one, greedy correction to validate it, default value is '2' + #[clap(short = 'c', long = "confirm")] + pub confirm: Option, + + /// number of base we use to try correct error, default value is '7' + #[clap(short = 'M', long = "max-search")] + pub max_search: Option, + + /// if this flag is set br correct only in forward orientation + #[clap(short = 'n', long = "not-two-side")] + pub two_side: bool, + + /// Number of thread use by br, 0 use all avaible core, default value 0 + #[clap(short = 't', long = "threads")] + pub threads: Option, + + /// Number of sequence record load in buffer, default 8192 + #[clap(short = 'b', long = "record_buffer")] + pub record_buffer: Option, + + /// verbosity level also control by environment variable BR_LOG if flag is set BR_LOG value is ignored + #[clap(short = 'v', long = "verbosity", parse(from_occurrences))] + pub verbosity: i8, +} + +#[cfg(not(tarpaulin_include))] +fn main() -> Result<()> { + let params = Command::parse(); + + let mut files = Vec::new(); + + for path in params.kmer_solid { + files.push(std::io::BufReader::new( + std::fs::File::open(&path) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {:?}", path.clone()))?, + )); + } + + let solid: set::BoxKmerSet = Box::new(set::Hash::new( + files, + params.kmer_size.ok_or(Error::Cli(Cli::KmerSolidNeedK))?, + )); + + let confirm = params.confirm.unwrap_or(2); + let max_search = params.max_search.unwrap_or(7); + let record_buffer = params.record_buffer.unwrap_or(8192); + + let methods = br::build_methods(params.methods, &solid, confirm, max_search); + + br::run_correction( + ¶ms.inputs, + ¶ms.outputs, + methods, + params.two_side, + record_buffer, + )?; + + Ok(()) +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use clap::Parser; + +use br::error::Cli::*; +use br::error::*; +use br::*; + +#[derive(clap::Parser, Debug)] +#[clap( + version = "0.1", + author = "Pierre Marijon ", + about = "Br: Brutal rewrite a simple long read corrector based on kmer spectrum methode" +)] +pub struct Command { + /// solidity bitfield produce by pcon + #[clap(short = 's', long = "solidity")] + pub solidity: Option, + + /// kmer length if you didn't provide solidity path you must give a kmer length + #[clap(short = 'k', long = "kmer")] + pub kmer_size: Option, + + /// fasta file to be correct + #[clap(short = 'i', long = "inputs")] + pub inputs: Vec, + + /// path where corrected read was write + #[clap(short = 'o', long = "outputs")] + pub outputs: Vec, + + /// if you want choose the minimum abundance you can set this parameter + #[clap(short = 'a', long = "abundance")] + pub abundance: Option, + + /// Choose method to automaticly choose minimum abundance, format is {method}_{params}, method must be ['first-minimum', 'rarefaction', 'percent-most', 'percent-least'] params is a float between 0 to 1, default value is first-minimum_0.0, more information in pcon documentation + #[clap(short = 'A', long = "abundance-method")] + pub abundance_method: Option, + + /// correction method used, methods are applied in the order you specify, default value is 'one' + #[clap( + short = 'm', + long = "method", + possible_values = &["one", "two", "graph", "greedy", "gap_size"], + )] + pub methods: Option>, + + /// number of kmer need to be solid after one, greedy correction to validate it, default value is '2' + #[clap(short = 'c', long = "confirm")] + pub confirm: Option, + + /// number of base we use to try correct error, default value is '7' + #[clap(short = 'M', long = "max-search")] + pub max_search: Option, + + /// if this flag is set br correct only in forward orientation + #[clap(short = 'n', long = "not-two-side")] + pub two_side: bool, + + /// Number of thread use by br, 0 use all avaible core, default value 0 + #[clap(short = 't', long = "threads")] + pub threads: Option, + + /// Number of sequence record load in buffer, default 8192 + #[clap(short = 'b', long = "record_buffer")] + pub record_buffer: Option, + + /// verbosity level also control by environment variable BR_LOG if flag is set BR_LOG value is ignored + #[clap(short = 'v', long = "verbosity", parse(from_occurrences))] + pub verbosity: i8, +} + +#[cfg(not(tarpaulin_include))] +fn main() -> Result<()> { + let params = Command::parse(); + + if params.inputs.len() != params.outputs.len() { + return Err(anyhow!(Error::Cli(NotSameNumberOfInAndOut))); + } + + if let Some(level) = cli::i82level(params.verbosity) { + env_logger::builder() + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .filter_level(level.to_level_filter()) + .init(); + } else { + env_logger::Builder::from_env("BR_LOG") + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .init(); + } + + let confirm = params.confirm.unwrap_or(2); + let max_search = params.max_search.unwrap_or(7); + let record_buffer = params.record_buffer.unwrap_or(8192); + + if let Some(threads) = params.threads { + log::info!("Set number of threads to {}", threads); + + set_nb_threads(threads); + } + + let solid = if let Some(path) = params.solidity { + read_solidity(path)? + } else if let Some(kmer_size) = params.kmer_size { + let count = count_kmer(¶ms.inputs, kmer_size, record_buffer)?; + + let abundance_method = params.abundance_method.unwrap_or(AbundanceMethod { + method: pcon::spectrum::ThresholdMethod::FirstMinimum, + params: 0.0, + }); + + let threshold = params.abundance.unwrap_or(compute_abundance_threshold( + &count, + abundance_method, + std::io::stdout(), + )?); + + Box::new(set::Pcon::new(pcon::solid::Solid::from_counter( + &count, threshold, + ))) + } else { + anyhow::bail!(Error::Cli(NoSolidityNoKmer)); + }; + + let methods = br::build_methods(params.methods, &solid, confirm, max_search); + + br::run_correction( + ¶ms.inputs, + ¶ms.outputs, + methods, + params.two_side, + record_buffer, + )?; + + Ok(()) +} + +fn read_solidity<'a>(path: String) -> Result> { + let solidity_reader = std::io::BufReader::new( + std::fs::File::open(&path) + .with_context(|| Error::IO(IO::CantOpenFile)) + .with_context(|| anyhow!("File {:?}", path.clone()))?, + ); + + log::info!("Load solidity file"); + + Ok(Box::new(set::Pcon::new(pcon::solid::Solid::deserialize( + solidity_reader, + )?))) +} + +fn count_kmer( + inputs: &[String], + kmer_size: u8, + record_buffer_len: usize, +) -> Result { + let mut counter = pcon::counter::Counter::new(kmer_size); + + log::info!("Start count kmer from input"); + for input in inputs { + let fasta = std::io::BufReader::new( + std::fs::File::open(&input) + .with_context(|| Error::IO(IO::CantOpenFile)) + .with_context(|| anyhow!("File {:?}", input.clone()))?, + ); + + counter.count_fasta(fasta, record_buffer_len); + } + log::info!("End count kmer from input"); + + Ok(counter) +} + +fn compute_abundance_threshold( + count: &pcon::counter::Counter, + method: AbundanceMethod, + out: W, +) -> Result +where + W: std::io::Write, +{ + let spectrum = pcon::spectrum::Spectrum::from_counter(count); + + let abundance = spectrum + .get_threshold(method.method, method.params) + .ok_or(Error::CantComputeAbundance)?; + + spectrum + .write_histogram(out, Some(abundance)) + .with_context(|| anyhow!("Error durring write of kmer histograme"))?; + println!("If this curve seems bad or minimum abundance choose (marked by *) not apopriate set parameter -a"); + + Ok(abundance as u8) +} + +#[derive(Debug)] +pub struct AbundanceMethod { + pub method: pcon::spectrum::ThresholdMethod, + pub params: f64, +} + +impl std::str::FromStr for AbundanceMethod { + type Err = br::error::Cli; + + fn from_str(s: &str) -> Result { + let elements: Vec<&str> = s.split('_').collect(); + + if elements.len() > 2 { + Err(Cli::CantParseAbundanceMethod) + } else { + let method = match elements[0] { + "first-minimum" => pcon::spectrum::ThresholdMethod::FirstMinimum, + "rarefaction" => pcon::spectrum::ThresholdMethod::Rarefaction, + "percent-most" => pcon::spectrum::ThresholdMethod::PercentAtMost, + "percent-least" => pcon::spectrum::ThresholdMethod::PercentAtLeast, + _ => return Err(Cli::CantParseAbundanceMethod), + }; + + let params = if method == pcon::spectrum::ThresholdMethod::FirstMinimum { + 0.0 + } else if let Ok(p) = f64::from_str(elements[1]) { + if p > 0.0 && p < 1.0 { + p + } else { + return Err(Cli::CantParseAbundanceMethod); + } + } else { + return Err(Cli::CantParseAbundanceMethod); + }; + + Ok(AbundanceMethod { method, params }) + } + } +} + +#[cfg(test)] +mod tests { + use super::*; + + use std::str::FromStr; + + use std::io::Seek; + use std::io::Write; + + use rand::seq::SliceRandom; + use rand::{Rng, SeedableRng}; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + fn generate_seq_file() -> tempfile::NamedTempFile { + let mut rng = rand::rngs::SmallRng::seed_from_u64(42); + + let nucs = [b'A', b'C', b'T', b'G']; + + let mut sequence = (0..1000) + .map(|_| *nucs.choose(&mut rng).unwrap()) + .collect::>(); + + let mut tmpfile = tempfile::NamedTempFile::new().unwrap(); + + writeln!( + tmpfile.as_file_mut(), + ">42\n{}", + std::str::from_utf8(&sequence).unwrap() + ) + .unwrap(); + + for _ in 0..25 { + for nuc in sequence.iter_mut() { + if rng.gen_ratio(2, 100) { + *nuc = *nucs.choose(&mut rng).unwrap(); + } + } + + writeln!( + tmpfile.as_file_mut(), + ">42\n{}", + std::str::from_utf8(&sequence).unwrap() + ) + .unwrap(); + } + + tmpfile.seek(std::io::SeekFrom::Start(0)).unwrap(); + + tmpfile + } + + static COUNT: &[u8] = &[ + 5, 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 5, 192, 88, 111, 210, 96, 140, 18, 100, 144, 140, 66, + 57, 202, 213, 210, 227, 251, 122, 209, 155, 149, 210, 99, 20, 10, 45, 45, 163, 21, 156, + 107, 68, 221, 3, 137, 17, 141, 154, 232, 18, 227, 139, 15, 186, 159, 224, 15, 94, 78, 76, + 83, 27, 34, 168, 118, 148, 79, 51, 105, 75, 153, 164, 57, 61, 52, 44, 92, 198, 11, 32, 67, + 54, 96, 145, 102, 241, 117, 12, 49, 47, 27, 207, 213, 54, 64, 2, 180, 143, 57, 9, 161, 101, + 12, 185, 36, 251, 126, 44, 132, 165, 125, 114, 154, 23, 35, 121, 156, 139, 119, 204, 206, + 161, 217, 58, 42, 106, 113, 224, 81, 128, 27, 6, 198, 78, 233, 104, 93, 85, 187, 130, 198, + 101, 7, 83, 206, 191, 7, 130, 237, 249, 135, 248, 43, 106, 209, 84, 52, 178, 239, 37, 164, + 94, 133, 67, 14, 110, 244, 91, 215, 151, 194, 158, 142, 101, 31, 121, 205, 4, 177, 95, 123, + 38, 187, 235, 233, 213, 146, 41, 81, 119, 52, 93, 236, 202, 35, 95, 82, 192, 246, 115, 201, + 129, 108, 211, 34, 114, 5, 95, 4, 95, 8, 134, 104, 93, 255, 85, 10, 196, 46, 179, 204, 159, + 124, 218, 139, 46, 203, 167, 84, 177, 81, 184, 34, 82, 187, 133, 114, 250, 58, 215, 185, + 176, 225, 30, 132, 237, 74, 125, 61, 17, 106, 78, 94, 55, 230, 76, 210, 234, 244, 90, 239, + 101, 184, 226, 169, 202, 122, 207, 151, 47, 194, 28, 74, 181, 217, 219, 51, 84, 94, 148, + 71, 84, 51, 237, 138, 228, 66, 117, 143, 193, 12, 101, 195, 31, 27, 238, 67, 210, 150, 244, + 181, 84, 0, 145, 165, 0, 106, 248, 28, 151, 31, 67, 27, 161, 176, 229, 125, 247, 92, 5, 47, + 33, 10, 63, 221, 20, 4, 70, 129, 42, 24, 213, 67, 202, 104, 176, 130, 216, 110, 186, 192, + 36, 197, 71, 250, 155, 77, 31, 136, 65, 95, 216, 170, 184, 96, 137, 147, 30, 149, 64, 197, + 5, 209, 12, 5, 222, 120, 96, 48, 209, 196, 251, 142, 201, 176, 103, 139, 165, 7, 16, 236, + 73, 133, 23, 206, 189, 170, 180, 136, 56, 220, 159, 80, 139, 138, 136, 195, 81, 251, 159, + 136, 179, 197, 119, 181, 109, 243, 6, 13, 200, 56, 77, 228, 137, 240, 43, 57, 42, 164, 19, + 14, 5, 246, 149, 250, 230, 182, 242, 159, 43, 136, 23, 148, 125, 242, 178, 181, 96, 84, 56, + 35, 26, 253, 241, 219, 77, 19, 54, 216, 250, 74, 127, 8, 92, 90, 242, 49, 196, 222, 243, + 67, 159, 11, 162, 220, 157, 134, 53, 220, 65, 216, 198, 19, 175, 254, 202, 208, 0, 2, 0, 0, + ]; + + #[test] + fn _count_kmer() { + init(); + + let file = generate_seq_file(); + + let path = file.path().to_str().unwrap().to_string(); + + let count = count_kmer(&[path], 5, 26).unwrap(); + + let mut output = std::io::Cursor::new(Vec::new()); + count.serialize(&mut output).unwrap(); + + assert_eq!(COUNT, output.into_inner()); + } + + #[test] + fn _compute_abundance_threshold() { + init(); + + let output = vec![]; + let count = pcon::counter::Counter::deserialize(COUNT).unwrap(); + + let abu_method = AbundanceMethod { + method: pcon::spectrum::ThresholdMethod::FirstMinimum, + params: 0.0, + }; + + assert_eq!( + 2, + compute_abundance_threshold(&count, abu_method, output).unwrap() + ); + } + + static SOLID: &[u8] = &[ + 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 77, 136, 193, 9, 0, 64, 8, 195, 94, 183, 255, 136, 55, + 134, 15, 145, 216, 10, 130, 208, 180, 52, 15, 40, 113, 147, 62, 223, 181, 248, 140, 93, + 161, 13, 1, 52, 40, 137, 69, 44, 65, 0, 0, 0, + ]; + + #[test] + fn _read_solidity() { + init(); + + let count = pcon::counter::Counter::deserialize(COUNT).unwrap(); + let compute = pcon::solid::Solid::from_counter(&count, 2); + + let mut compute_out = vec![]; + compute.serialize(&mut compute_out).unwrap(); + + assert_eq!(SOLID, compute_out.as_slice()); + + let mut tmpfile = tempfile::NamedTempFile::new().unwrap(); + + tmpfile.write_all(SOLID).unwrap(); + + let path = tmpfile.path().to_str().unwrap().to_string(); + + let read = read_solidity(path).unwrap(); + for kmer in 0..cocktail::kmer::get_kmer_space_size(5) { + assert_eq!(compute.get(kmer), read.get(kmer)); + } + } + + #[test] + fn abundance_method_parsing() { + init(); + + let tmp = AbundanceMethod::from_str("first-minimum").unwrap(); + assert_eq!(tmp.method, pcon::spectrum::ThresholdMethod::FirstMinimum); + assert_eq!(tmp.params, 0.0); + + let tmp = AbundanceMethod::from_str("rarefaction_0.5").unwrap(); + assert_eq!(tmp.method, pcon::spectrum::ThresholdMethod::Rarefaction); + assert_eq!(tmp.params, 0.5); + + let tmp = AbundanceMethod::from_str("percent-most_0.1").unwrap(); + assert_eq!(tmp.method, pcon::spectrum::ThresholdMethod::PercentAtMost); + assert_eq!(tmp.params, 0.1); + + let tmp = AbundanceMethod::from_str("percent-least_0.8").unwrap(); + assert_eq!(tmp.method, pcon::spectrum::ThresholdMethod::PercentAtLeast); + assert_eq!(tmp.params, 0.8); + + // First minimum params is always 0.0 + let tmp = AbundanceMethod::from_str("first-minimum_0.8").unwrap(); + assert_eq!(tmp.method, pcon::spectrum::ThresholdMethod::FirstMinimum); + assert_eq!(tmp.params, 0.0); + + // name not match + assert!(AbundanceMethod::from_str("aesxàyxauie_0.8").is_err()); + + // to many field + assert!(AbundanceMethod::from_str("first-minimum_0.8_aiue_auie").is_err()); + + // params to large + assert!(AbundanceMethod::from_str("rarefaction_34.8").is_err()); + + // params don't care + assert!(AbundanceMethod::from_str("first-minimum_42.42").is_ok()); + assert!(AbundanceMethod::from_str("first-minimum_auie").is_ok()); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +pub mod hash; +pub mod pcon; + +pub use self::hash::Hash; +pub use self::pcon::Pcon; + +pub trait KmerSet: Sync { + fn get(&self, kmer: u64) -> bool; + + fn k(&self) -> u8; +} + +pub type BoxKmerSet<'a> = Box; +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local use */ +pub use crate::set::KmerSet; + +pub struct Hash { + set: rustc_hash::FxHashSet, + k: u8, +} + +impl Hash { + pub fn new(inputs: Vec, k: u8) -> Self + where + R: std::io::Read, + { + let mut set = rustc_hash::FxHashSet::default(); + + for input in inputs { + let mut records = bio::io::fasta::Reader::new(input).records(); + + while let Some(Ok(record)) = records.next() { + for cano in cocktail::tokenizer::Canonical::new(record.seq(), k) { + set.insert(cano); + } + } + } + + Self { set, k } + } +} + +impl KmerSet for Hash { + fn get(&self, kmer: u64) -> bool { + self.set.contains(&cocktail::kmer::canonical(kmer, self.k)) + } + + fn k(&self) -> u8 { + self.k + } +} + +#[cfg(test)] +mod tests { + use super::*; + + static FILE: &[u8] = b">1\nACGTGGGAATTGTGGCCACATCACGAGGTCCTGCGTATTGACGACTGTAAAGCGAGTGGCCGTGGAATTTCAAGCTCAATTAGCCGAACCAATCCGCCTA"; + + #[test] + fn canonical() { + let file = std::io::Cursor::new(FILE); + + let hash = Hash::new(vec![file], 11); + + let set: crate::set::BoxKmerSet = Box::new(hash); + + let mut records = bio::io::fasta::Reader::new(FILE).records(); + for cano in cocktail::tokenizer::Canonical::new(records.next().unwrap().unwrap().seq(), 11) + { + assert!(set.get(cano)) + } + } + + #[test] + fn forward() { + let file = std::io::Cursor::new(FILE); + + let hash = Hash::new(vec![file], 11); + + let set: crate::set::BoxKmerSet = Box::new(hash); + + let mut records = bio::io::fasta::Reader::new(FILE).records(); + for kmer in cocktail::tokenizer::Tokenizer::new(records.next().unwrap().unwrap().seq(), 11) + { + assert!(set.get(kmer)) + } + } + + #[test] + fn absence() { + let file = std::io::Cursor::new(FILE); + + let hash = Hash::new(vec![file], 11); + + let set: crate::set::BoxKmerSet = Box::new(hash); + + assert!(!set.get(0)); + } + + #[test] + fn k() { + let file = std::io::Cursor::new(FILE); + + let hash = Hash::new(vec![file], 11); + + let set: crate::set::BoxKmerSet = Box::new(hash); + + assert_eq!(set.k(), 11); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local use */ +use crate::set::KmerSet; + +pub struct Pcon { + set: pcon::solid::Solid, +} + +impl Pcon { + pub fn new(set: pcon::solid::Solid) -> Self { + Pcon { set } + } +} + +impl KmerSet for Pcon { + fn get(&self, kmer: u64) -> bool { + self.set.get(kmer) + } + + fn k(&self) -> u8 { + self.set.k + } +} + +#[cfg(test)] +mod tests { + use super::*; + + static SEQ: &[u8] = b"ACGTGGGAATTGTGGCCACATCACGAGGTCCTGCGTATTGACGACTGTAAAGCGAGTGGCCGTGGAATTTCAAGCTCAATTAGCCGAACCAATCCGCCTA"; + + #[test] + fn canonical() { + let mut solid = pcon::solid::Solid::new(11); + for cano in cocktail::tokenizer::Canonical::new(SEQ, 11) { + solid.set(cano, true); + } + + let set: crate::set::BoxKmerSet = Box::new(Pcon::new(solid)); + + for cano in cocktail::tokenizer::Canonical::new(SEQ, 11) { + assert!(set.get(cano)) + } + } + + #[test] + fn forward() { + let mut solid = pcon::solid::Solid::new(11); + for cano in cocktail::tokenizer::Canonical::new(SEQ, 11) { + solid.set(cano, true); + } + + let set: crate::set::BoxKmerSet = Box::new(Pcon::new(solid)); + + for kmer in cocktail::tokenizer::Tokenizer::new(SEQ, 11) { + assert!(set.get(kmer)) + } + } + + #[test] + fn absence() { + let mut solid = pcon::solid::Solid::new(11); + for cano in cocktail::tokenizer::Canonical::new(SEQ, 11) { + solid.set(cano, true); + } + + let set: crate::set::BoxKmerSet = Box::new(Pcon::new(solid)); + + assert!(!set.get(0)); + } + + #[test] + fn k() { + let mut solid = pcon::solid::Solid::new(11); + for cano in cocktail::tokenizer::Canonical::new(SEQ, 11) { + solid.set(cano, true); + } + + let set: crate::set::BoxKmerSet = Box::new(Pcon::new(solid)); + + assert_eq!(set.k(), 11); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use log::debug; + +/* local use */ +use crate::correct::*; + +pub struct GapSize<'a> { + valid_kmer: &'a set::BoxKmerSet<'a>, + graph: graph::Graph<'a>, + one: One<'a>, +} + +impl<'a> GapSize<'a> { + pub fn new(valid_kmer: &'a set::BoxKmerSet<'a>, c: u8) -> Self { + Self { + valid_kmer, + graph: graph::Graph::new(valid_kmer), + one: One::new(valid_kmer, c), + } + } + + pub fn ins_sub_correction(&self, kmer: u64, gap_size: usize) -> Option<(Vec, usize)> { + let mut alts = alt_nucs(self.valid_kmer, kmer); + + if alts.len() != 1 { + debug!("not one alts {:?}", alts); + return None; + } + + let mut corr = add_nuc_to_end(kmer >> 2, alts[0], self.k()); + let mut local_corr = vec![cocktail::kmer::bit2nuc(alts[0])]; + let mut viewed_kmer = rustc_hash::FxHashSet::default(); + viewed_kmer.insert(corr); + + for i in 0..gap_size { + alts = next_nucs(self.valid_kmer, corr); + + if alts.len() != 1 { + debug!( + "failled multiple successor {} {:?} i: {}", + cocktail::kmer::kmer2seq(corr, self.valid_kmer.k()), + alts, + i + ); + return None; + } + + corr = add_nuc_to_end(corr, alts[0], self.k()); + debug!( + "kmer {}", + cocktail::kmer::kmer2seq(corr, self.valid_kmer.k()) + ); + if viewed_kmer.contains(&corr) { + debug!( + "we view this kmer previously {}", + cocktail::kmer::kmer2seq(corr, self.k()) + ); + return None; + } + viewed_kmer.insert(corr); + + local_corr.push(cocktail::kmer::bit2nuc(alts[0])); + } + + let offset = local_corr.len(); + Some((local_corr, offset)) + } +} + +impl<'a> Corrector for GapSize<'a> { + fn valid_kmer(&self) -> &set::BoxKmerSet<'a> { + self.valid_kmer + } + + fn correct_error(&self, kmer: u64, seq: &[u8]) -> Option<(Vec, usize)> { + let (error_len, _first_correct_kmer) = error_len(seq, kmer, self.valid_kmer()); + + debug!("error_len {}", error_len); + match error_len.cmp(&(self.k() as usize)) { + std::cmp::Ordering::Less => self.graph.correct_error(kmer, seq), // we can avoid a second compute of error_len + std::cmp::Ordering::Equal => self.one.correct_error(kmer, seq), + std::cmp::Ordering::Greater => { + self.ins_sub_correction(kmer, error_len - self.k() as usize) + } + } + } +} + +#[cfg(test)] +mod tests { + + use super::*; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + #[test] + fn csc() { + init(); + + let refe = b"AGCGTATCTT"; + // ||||| ||||| + let read = b"AGCGTTTCTT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cssc() { + init(); + + let refe = b"TCTCTAATCTTC"; + // ||||| ||||| + let read = b"TCTCTGGTCTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn csssc() { + init(); + + let refe = b"TCTCTAAATCTTC"; + // ||||| ||||| + let read = b"TCTCTGGGTCTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrect + } + + #[test] + fn cscsc() { + init(); + + let refe = b"GTGTGACTTACACCTCGTTGAGCACCCGATGTTGGTATAGTCCGAACAAC"; + // ||||| | ||||| + let read = b"GTGTGACTTACACCTCGTTGAGTAGCCGATGTTGGTATAGTCCGAACAAC"; + + println!("{}", String::from_utf8(refe.to_vec()).unwrap()); + println!("{}", String::from_utf8(read.to_vec()).unwrap()); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(11); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 11) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cdc() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGAACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cddc() { + init(); + + let refe = b"CAAAGCATTTTT"; + // ||||| + let read = b"CAAAGTTTTT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cic() { + init(); + + let refe = b"GGATAACTCT"; + // ||||| + let read = b"GGATATACTCT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = GapSize::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use log::debug; + +/* local use */ +use crate::correct::*; + +struct Score; + +impl bio::alignment::pairwise::MatchFunc for Score { + fn score(&self, a: u8, b: u8) -> i32 { + if a == b { + 1 + } else { + -1 + } + } +} + +pub struct Greedy<'a> { + valid_kmer: &'a set::BoxKmerSet<'a>, + max_search: u8, + nb_validate: u8, +} + +impl<'a> Greedy<'a> { + pub fn new(valid_kmer: &'a set::BoxKmerSet, max_search: u8, nb_validate: u8) -> Self { + Self { + valid_kmer, + max_search, + nb_validate, + } + } + + fn match_alignement(&self, before_seq: Vec, read: &[u8], corr: &[u8]) -> Option { + let mut r = before_seq.clone(); + r.extend_from_slice(read); + + let mut c = before_seq.clone(); + c.extend_from_slice(corr); + + let mut aligner = + bio::alignment::pairwise::Aligner::with_capacity(10, 10, -1, -1, Score {}); + let alignment = aligner.global(r.as_slice(), c.as_slice()); + + let mut offset = 0; + for ops in alignment.operations[before_seq.len()..].windows(2) { + match ops[0] { + bio::alignment::AlignmentOperation::Del => offset -= 1, + bio::alignment::AlignmentOperation::Ins => offset += 1, + _ => (), + } + + if ops[0] == bio::alignment::AlignmentOperation::Match && ops[0] == ops[1] { + let mut offset_corr = 0; + for op in alignment.operations.iter().rev() { + match op { + bio::alignment::AlignmentOperation::Del => offset_corr -= 1, + bio::alignment::AlignmentOperation::Ins => offset_corr += 1, + _ => break, + } + } + return Some(offset - offset_corr); + } + } + + None + } + + fn follow_graph(&self, mut kmer: u64) -> Option<(u8, u64)> { + let alts = next_nucs(self.valid_kmer(), kmer); + + if alts.len() != 1 { + debug!("failled branching node {:?}", alts); + return None; + } + + kmer = add_nuc_to_end(kmer, alts[0], self.k()); + + Some((cocktail::kmer::bit2nuc(alts[0]), kmer)) + } + + fn check_next_kmers(&self, mut kmer: u64, seq: &[u8]) -> bool { + if seq.len() < self.nb_validate as usize { + return false; + } + + for nuc in &seq[..self.nb_validate as usize] { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(*nuc), self.k()); + if !self.valid_kmer.get(kmer) { + return false; + } + } + + true + } +} + +impl<'a> Corrector for Greedy<'a> { + fn k(&self) -> u8 { + self.valid_kmer.k() + } + + fn valid_kmer(&self) -> &set::BoxKmerSet { + self.valid_kmer + } + + fn correct_error(&self, mut kmer: u64, seq: &[u8]) -> Option<(Vec, usize)> { + let alts = alt_nucs(self.valid_kmer(), kmer); + if alts.len() != 1 { + debug!("failled multiple successor {:?}", alts); + return None; + } + + let mut viewed_kmer = rustc_hash::FxHashSet::default(); + + let mut local_corr = Vec::new(); + let before_seq = cocktail::kmer::kmer2seq(kmer >> 2, self.k() - 1) + .as_bytes() + .to_vec(); + + kmer = add_nuc_to_end(kmer >> 2, alts[0], self.k()); + + local_corr.push(cocktail::kmer::bit2nuc(alts[0])); + viewed_kmer.insert(kmer); + + for i in 0..(self.max_search as usize) { + if let Some((base, new_kmer)) = self.follow_graph(kmer) { + local_corr.push(base); + kmer = new_kmer; + } + + if viewed_kmer.contains(&kmer) { + debug!("we view this kmer previously"); + return None; + } + viewed_kmer.insert(kmer); + + if seq.len() < i as usize { + return None; + } + + if let Some(off) = self.match_alignement(before_seq.clone(), &seq[..i], &local_corr) { + if self.check_next_kmers(kmer, &seq[i..]) { + let offset: usize = (local_corr.len() as i64 + off) as usize; + return Some((local_corr, offset)); + } + } + } + + None + } +} + +#[cfg(test)] +mod tests { + + use super::*; + + static K: u8 = 11; + static REFE: &[u8] = b"TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG"; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + fn get_solid() -> pcon::solid::Solid { + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(K); + + for kmer in cocktail::tokenizer::Tokenizer::new(REFE, K) { + data.set(kmer, true); + } + + data + } + + #[test] + fn branching_path_csc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||||||| ||||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTCACTGCCCGATACGCAGATGAAAGAGG"; + + let mut data = get_solid(); + + data.set(cocktail::kmer::seq2bit(b"CACATTTCGCG"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn branching_path_cdc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||||////////////////////////// + let read = b"TAAGGCGCGTCCCGCACACATTTCCTGCCCGATACGCAGATGAAAGAGG"; + + let mut data = get_solid(); + + data.set(cocktail::kmer::seq2bit(b"CACATTTCGCG"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn branching_path_cic() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||||\\\\\\\\\\\\\\\\\\\\\\\\\\ + let read = b"TAAGGCGCGTCCCGCACACATTTCAGCTGCCCGATACGCAGATGAAAGAGG"; + + let mut data = get_solid(); + + data.set(cocktail::kmer::seq2bit(b"CACACATTTCT"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn csc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||||||| ||||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTCACTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn cssc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||| ||||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTGACTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn csssc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||| |||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTGATTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn cscsc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||| |||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTGATTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + #[ignore] + fn cdc() { + init(); + + // TTTCGCTGCCCG + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||||////////////////////////// + let read = b"TAAGGCGCGTCCCGCACACATTTCCTGCCCGATACGCAGATGAAAGAGG"; + // TTTCCTGCCCG + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + #[ignore] + fn cddc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATCGCTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + #[ignore] + fn cdddc() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACACGCTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn cic() { + init(); + + // TAAGGCGCGTCCCGCACACATTTCGCTGCCCGATACGCAGATGAAAGAGG + // ||||||||||||||||||||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\ + let read = b"TAAGGCGCGTCCCGCACACATTTCAGCTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn ciic() { + init(); + + // TAAGGCGCGTCCCGCACACATTTC--GCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||||||| |||||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTCAAGCTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } + + #[test] + fn ciiic() { + init(); + + // TAAGGCGCGTCCCGCACACATTTC---GCTGCCCGATACGCAGATGAAAGAGG + // |||||||||||||||||||||||| |||||||||||||||||||||||||| + let read = b"TAAGGCGCGTCCCGCACACATTTCAAAGCTGCCCGATACGCAGATGAAAGAGG"; + + let data = get_solid(); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Greedy::new(&set, 7, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(REFE, corrector.correct(REFE).as_slice()); // test not overcorrection + } +} +/* crate use */ +use log::debug; +use strum::IntoEnumIterator; + +/* crate use */ +use crate::correct::*; +use crate::set; + +/////////////////////////////////////////// +// Generic Trait for correction scenario // +/////////////////////////////////////////// +pub trait Scenario: std::fmt::Debug + Copy { + fn init(&self, c: usize, k: u8) -> Self; + + fn c(&self) -> usize; + + fn apply(&self, valid_kmer: &set::BoxKmerSet, kmer: u64, seq: &[u8]) -> Option<(u64, usize)>; + + fn correct(&self, valid_kmer: &set::BoxKmerSet, kmer: u64, _seq: &[u8]) -> (Vec, usize); + + fn get_score(&self, valid_kmer: &set::BoxKmerSet, ori: u64, seq: &[u8]) -> usize { + if let Some((mut kmer, offset)) = self.apply(valid_kmer, ori, seq) { + if !valid_kmer.get(kmer) { + return 0; + } + + if offset + self.c() > seq.len() { + return 0; + } + + let mut score = 0; + + for nuc in &seq[offset..offset + self.c()] { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(*nuc), valid_kmer.k()); + + if valid_kmer.get(kmer) { + score += 1 + } else { + break; + } + } + + score + } else { + 0 + } + } + + fn one_more(&self, valid_kmer: &set::BoxKmerSet, mut kmer: u64, seq: &[u8]) -> bool { + // Get correction + let (corr, offset) = self.correct(valid_kmer, kmer, seq); + + // Can we read one base more + if seq.len() > self.c() + offset + 1 { + kmer >>= 2; + // Apply correction on kmer + corr.iter().for_each(|nuc| { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(*nuc), valid_kmer.k()) + }); + + // Apply base previously check + seq[offset..(offset + self.c() + 1)].iter().for_each(|nuc| { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(*nuc), valid_kmer.k()) + }); + + valid_kmer.get(kmer) + } else { + false + } + } +} + +////////////////////////////////////////// +// Exsist use scenario to correct error // +////////////////////////////////////////// +pub struct Exist<'a, S> +where + S: Scenario + IntoEnumIterator, +{ + valid_kmer: &'a set::BoxKmerSet<'a>, + c: u8, + _phantom: std::marker::PhantomData<&'a S>, +} + +impl<'a, S> Exist<'a, S> +where + S: Scenario + IntoEnumIterator, +{ + pub fn new(valid_kmer: &'a set::BoxKmerSet, c: u8) -> Self { + Self { + valid_kmer, + c, + _phantom: std::marker::PhantomData, + } + } + + fn get_scenarii(&self, kmer: u64, seq: &[u8]) -> Vec { + let mut scenarii: Vec = Vec::new(); + + for mut scenario in S::iter() { + scenario = scenario.init(self.c as usize, self.valid_kmer.k()); + + if scenario.get_score(self.valid_kmer, kmer, seq) == self.c as usize { + scenarii.push(scenario) + } + } + + scenarii + } +} + +impl<'a, S> Corrector for Exist<'a, S> +where + S: Scenario + IntoEnumIterator, +{ + fn valid_kmer(&self) -> &set::BoxKmerSet { + self.valid_kmer + } + + fn correct_error(&self, kmer: u64, seq: &[u8]) -> Option<(Vec, usize)> { + let alts = alt_nucs(self.valid_kmer, kmer); + + if alts.len() != 1 { + debug!("not one alts {:?}", alts); + return None; + } + debug!("one alts {:?}", alts); + + let corr = add_nuc_to_end(kmer >> 2, alts[0], self.k()); + let mut scenarii = self.get_scenarii(corr, seq); + + if scenarii.is_empty() { + debug!("no scenario"); + None + } else if scenarii.len() == 1 { + debug!("one {:?}", scenarii); + Some(scenarii[0].correct(self.valid_kmer, corr, seq)) + } else { + debug!("multiple {:?}", scenarii); + scenarii.retain(|x| x.one_more(self.valid_kmer, corr, seq)); + debug!("multiple {:?}", scenarii); + + if scenarii.len() == 1 { + Some(scenarii[0].correct(self.valid_kmer, corr, seq)) + } else { + None + } + } + } +} + +pub mod one; +pub mod two; +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use strum_macros::EnumIter; + +/* crate use */ +use crate::correct::exist::{Exist, Scenario}; +use crate::correct::*; +use crate::set; + +//////////////////////////////////// +// Scenario for correct two error // +//////////////////////////////////// +#[derive(Debug, EnumIter, Clone, Copy)] +pub enum ScenarioTwo { + II(usize, u8), + IS(usize, u8), + SS(usize, u8), + SD(usize, u8), + DD(usize, u8), + + ICI(usize, u8), + ICS(usize, u8), + ICD(usize, u8), + SCI(usize, u8), + SCS(usize, u8), + SCD(usize, u8), + DCI(usize, u8), + DCD(usize, u8), +} + +impl Scenario for ScenarioTwo { + fn init(&self, c: usize, k: u8) -> Self { + match self { + ScenarioTwo::II(_, _) => ScenarioTwo::II(c, k), + ScenarioTwo::IS(_, _) => ScenarioTwo::IS(c, k), + ScenarioTwo::SS(_, _) => ScenarioTwo::SS(c, k), + ScenarioTwo::SD(_, _) => ScenarioTwo::SD(c, k), + ScenarioTwo::DD(_, _) => ScenarioTwo::DD(c, k), + ScenarioTwo::ICI(_, _) => ScenarioTwo::ICI(c, k), + ScenarioTwo::ICS(_, _) => ScenarioTwo::ICS(c, k), + ScenarioTwo::ICD(_, _) => ScenarioTwo::ICD(c, k), + ScenarioTwo::SCI(_, _) => ScenarioTwo::SCI(c, k), + ScenarioTwo::SCS(_, _) => ScenarioTwo::SCS(c, k), + ScenarioTwo::SCD(_, _) => ScenarioTwo::SCD(c, k), + ScenarioTwo::DCI(_, _) => ScenarioTwo::DCI(c, k), + ScenarioTwo::DCD(_, _) => ScenarioTwo::DCD(c, k), + } + } + + fn c(&self) -> usize { + match self { + ScenarioTwo::II(c, _) => *c, + ScenarioTwo::IS(c, _) => *c, + ScenarioTwo::SS(c, _) => *c, + ScenarioTwo::SD(c, _) => *c, + ScenarioTwo::DD(c, _) => *c, + ScenarioTwo::ICI(c, _) => *c, + ScenarioTwo::ICS(c, _) => *c, + ScenarioTwo::ICD(c, _) => *c, + ScenarioTwo::SCI(c, _) => *c, + ScenarioTwo::SCS(c, _) => *c, + ScenarioTwo::SCD(c, _) => *c, + ScenarioTwo::DCI(c, _) => *c, + ScenarioTwo::DCD(c, _) => *c, + } + } + + fn apply( + &self, + valid_kmer: &set::BoxKmerSet, + mut kmer: u64, + seq: &[u8], + ) -> Option<(u64, usize)> { + match self { + ScenarioTwo::II(_, _) => Some((kmer, 3)), // kmer not change check from base 3 + ScenarioTwo::IS(_, _) => Some((kmer, 2)), // kmer not change check from base 2 + ScenarioTwo::SS(_, k) => { + if seq.len() < 2 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + if valid_kmer.get(kmer) { + None + } else { + let alts = alt_nucs(valid_kmer, kmer); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer >> 2, alts[0], *k), 2)) + } + } + } + } + ScenarioTwo::SD(_, k) => { + if seq.is_empty() { + None + } else { + let alts = alt_nucs(valid_kmer, kmer << 2); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer, alts[0], *k), 1)) + } + } + } + ScenarioTwo::DD(_, k) => { + let alts = alt_nucs(valid_kmer, kmer << 2); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer, alts[0], *k), 0)) + } + } + ScenarioTwo::ICI(_, k) => { + // If seq is to short we can't apply + if seq.len() < 4 { + None + } else { + let corr = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[3]), *k); // If kmer with thrid base is valid is an ICI + + if valid_kmer.get(corr) { + Some((corr, 4)) + } else { + None + } + } + } + ScenarioTwo::ICS(_, k) => { + // If seq is to short we can't apply + if seq.len() < 4 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + if valid_kmer.get(kmer) { + None + } else { + let alts = alt_nucs(valid_kmer, kmer); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer >> 2, alts[0], *k), 3)) + } + } + } + } + ScenarioTwo::ICD(_, k) => { + // If seq is to short we can't apply + if seq.len() < 4 { + None + } else { + let second = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[2]), *k); + + let alts = alt_nucs(valid_kmer, second << 2); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(second, alts[0], *k), 3)) + } + } + } + ScenarioTwo::SCI(_, k) => { + if seq.len() < 4 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[3]), *k); + + Some((kmer, 4)) + } + } + ScenarioTwo::SCS(_, k) => { + if seq.len() < 3 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + if valid_kmer.get(kmer) { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[2]), *k); + + if !valid_kmer.get(kmer) { + let alts = alt_nucs(valid_kmer, kmer); + + if alts.len() == 1 { + Some((add_nuc_to_end(kmer >> 2, alts[0], *k), 3)) + } else { + None + } + } else { + None + } + } else { + None + } + } + } + ScenarioTwo::SCD(_, k) => { + if seq.len() < 2 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + + let alts = alt_nucs(valid_kmer, kmer << 2); + + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer, alts[0], *k), 2)) + } + } + } + ScenarioTwo::DCI(_, k) => { + if seq.len() < 4 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[1]), *k); + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[3]), *k); + + Some((kmer, 4)) + } + } + ScenarioTwo::DCD(_, k) => { + if seq.len() < 2 { + None + } else { + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(seq[0]), *k); + + let alts = alt_nucs(valid_kmer, kmer << 2); + if alts.len() != 1 { + None + } else { + Some((add_nuc_to_end(kmer, alts[0], *k), 1)) + } + } + } + } + } + + fn correct(&self, valid_kmer: &set::BoxKmerSet, kmer: u64, seq: &[u8]) -> (Vec, usize) { + match self { + ScenarioTwo::II(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 2), + ScenarioTwo::IS(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 2), + ScenarioTwo::SS(_, _) | ScenarioTwo::SD(_, _) | ScenarioTwo::DD(_, _) => { + let (corr, offset) = self + .apply(valid_kmer, kmer, seq) + .expect("we can't failled her"); + + ( + vec![ + cocktail::kmer::bit2nuc((corr & 0b1100) >> 2), + cocktail::kmer::bit2nuc(corr & 0b11), + ], + offset, + ) + } + ScenarioTwo::ICI(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 3), + ScenarioTwo::ICD(_, _) => { + let (corr, offset) = self + .apply(valid_kmer, kmer, seq) + .expect("we can't failled her"); + + ( + vec![ + cocktail::kmer::bit2nuc((corr & 0b1100) >> 2), + cocktail::kmer::bit2nuc(corr & 0b11), + ], + offset - 1, + ) + } + ScenarioTwo::ICS(_, _) => { + let (corr, offset) = self + .apply(valid_kmer, kmer, seq) + .expect("we can't failled her"); + + ( + vec![ + cocktail::kmer::bit2nuc((corr & 0b1100) >> 2), + cocktail::kmer::bit2nuc(corr & 0b11), + ], + offset + 1, + ) + } + ScenarioTwo::SCI(_, _) + | ScenarioTwo::SCS(_, _) + | ScenarioTwo::SCD(_, _) + | ScenarioTwo::DCD(_, _) => { + let (corr, offset) = self + .apply(valid_kmer, kmer, seq) + .expect("we can't failled her"); + + ( + vec![ + cocktail::kmer::bit2nuc((corr & 0b110000) >> 4), + cocktail::kmer::bit2nuc((corr & 0b1100) >> 2), + cocktail::kmer::bit2nuc(corr & 0b11), + ], + offset, + ) + } + /* ScenarioTwo::DCD => { + None + }, + */ + _ => (vec![], 1), + } + } +} + +pub type Two<'a> = Exist<'a, ScenarioTwo>; + +#[cfg(test)] +mod tests { + + use super::*; + + use crate::correct::Corrector; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + fn filter<'a>(ori: &[u8]) -> Vec { + ori.iter() + .cloned() + .filter(|x| *x != b'-') + .collect::>() + } + + #[test] + fn short() { + init(); + + let refe = filter(b"CTGGTGCACTACCGGATAGG"); + // |||||| | + let read = filter(b"-------ACTACCTG"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(read, corrector.correct(&read).as_slice()); // test correction work + } + + #[test] + fn ciic() { + init(); + + let refe = filter(b"GATACATGGA--CACTAGTATG"); + // |||||||||| |||||||||| + let read = filter(b"GATACATGGATTCACTAGTATG"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cisc() { + init(); + + let refe = filter(b"GATACATGGA-CACTAGTATG"); + // |||||||||| ||||||||| + let read = filter(b"GATACATGGATGACTAGTATG"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cssc() { + init(); + + let refe = b"TCGTTATTCGGTGGACTCCT"; + // |||||||||| |||||||| + let read = b"TCGTTATTCGAAGGACTCCT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn csdc() { + init(); + + let refe = b"AACAGCTGAATCTACCATTG"; + // |||||||||| ///////// + let read = b"AACAGCTGAAGTACCATTG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cddc() { + init(); + + let refe = b"TGCCGTAGGCCATTGCGGCT"; + // |||||||||| |||||||| + let read = b"TGCCGTAGGC--TTGCGGCT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(refe, corrector.correct(&filter(read)).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cicic() { + init(); + + let refe = filter(b"ATAGTAACGG-A-CACACTT"); + // |||||||||| | ||||||| + let read = filter(b"ATAGTAACGGAAGCACACTT"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 3); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cicsc() { + init(); + + let refe = filter(b"GAGCCCAGAG-CGATATTCT"); + // |||||||||| | ||||||| + let read = filter(b"GAGCCCAGAGACTATATTCT"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cicdc() { + init(); + + let refe = filter(b"TCGAAAGCAT-GGGTACGTT"); + // |||||||||| | ||||||| + let read = filter(b"TCGAAAGCATAG-GTACGTT"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cscic() { + init(); + + let refe = filter(b"AAGGATGCATCG-ACTCAAG"); + // |||||||||| | ||||||| + let read = filter(b"AAGGATGCATGGAACTCAAG"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cscsc() { + init(); + + let refe = filter(b"ACACGTGCGCTTGGAGGTAC"); + // |||||||||| | ||||||| + let read = filter(b"ACACGTGCGCATCGAGGTAC"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cscdc() { + init(); + + let refe = filter(b"TATGCTCTGCGTAATCATAG"); + // |||||||||| | ||||||| + let read = filter(b"TATGCTCTGCAT-ATCATAG"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cdcic() { + init(); + + let refe = filter(b"GCTTCGTGATAG-TACGCTT"); + // |||||||||| | ||||||| + let read = filter(b"GCTTCGTGAT-GATACGCTT"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cdcsc() { + init(); + + let refe = filter(b"GGACCTGATCACGTCAATTA"); + // |||||||||| | ||||||| + let read = filter(b"GGACCTGATC-CCTCAATTA"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } + + #[test] + fn cdcdc() { + init(); + + let refe = filter(b"GGAATACGTGCGTTGGGTAA"); + // |||||||||| | ||||||| + let read = filter(b"GGAATACGTG-G-TGGGTAA"); + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Two::new(&set, 2); + + assert_eq!(&refe, corrector.correct(&read).as_slice()); // test correction work + assert_eq!(&refe, corrector.correct(&refe).as_slice()); // test not overcorrection + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use strum_macros::EnumIter; + +/* crate use */ +use crate::correct::exist::{Exist, Scenario}; +use crate::set; + +//////////////////////////////////// +// Scenario for correct one error // +//////////////////////////////////// +#[derive(Debug, EnumIter, Clone, Copy)] +pub enum ScenarioOne { + I(usize, u8), + S(usize, u8), + D(usize, u8), +} + +impl Scenario for ScenarioOne { + fn init(&self, c: usize, k: u8) -> Self { + match self { + ScenarioOne::I(_, _) => ScenarioOne::I(c, k), + ScenarioOne::S(_, _) => ScenarioOne::S(c, k), + ScenarioOne::D(_, _) => ScenarioOne::D(c, k), + } + } + + fn c(&self) -> usize { + match self { + ScenarioOne::I(c, _) => *c, + ScenarioOne::S(c, _) => *c, + ScenarioOne::D(c, _) => *c, + } + } + + fn apply(&self, _valid_kmer: &set::BoxKmerSet, kmer: u64, _seq: &[u8]) -> Option<(u64, usize)> { + match self { + ScenarioOne::I(_, _) => Some((kmer, 2)), + ScenarioOne::S(_, _) => Some((kmer, 1)), + ScenarioOne::D(_, _) => Some((kmer, 0)), + } + } + + fn correct(&self, _valid_kmer: &set::BoxKmerSet, kmer: u64, _seq: &[u8]) -> (Vec, usize) { + match self { + ScenarioOne::I(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 2), + ScenarioOne::S(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 1), + ScenarioOne::D(_, _) => (vec![cocktail::kmer::bit2nuc(kmer & 0b11)], 0), + } + } +} + +pub type One<'a> = Exist<'a, ScenarioOne>; + +#[cfg(test)] +mod tests { + + use super::*; + use crate::correct::Corrector; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + fn filter<'a>(ori: &[u8]) -> Vec { + ori.iter() + .cloned() + .filter(|x| *x != b'-') + .collect::>() + } + + #[test] + fn csc() { + init(); + + let refe = b"ACTGACGAC"; + let read = b"ACTGATGAC"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn csc_relaxe() { + init(); + + let refe = b"ACTGACCACT"; + let read = b"ACTGATCACT"; + let conf = b"ACTGACAC"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + for kmer in cocktail::tokenizer::Tokenizer::new(conf, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cssc() { + init(); + + let refe = b"ACTGACGAG"; + let read = b"ACTGATAAG"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // don't correct + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cic() { + init(); + + let refe = filter(b"ACTGA-CGAC"); + let read = filter(b"ACTGATCGAC"); + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(&read).as_slice()); + assert_eq!(refe, corrector.correct(&refe).as_slice()); + } + + #[test] + fn cic_relaxe() { + init(); + + // GCGTAC-G + // AGCGTAC + // GTACTTG + let refe = filter(b"GAGCGTAC-GTTGGAT"); + let read = filter(b"GAGCGTACTGTTGGAT"); + let conf = b"GCGTACGTGA"; + + let mut data = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(&refe, 7) { + data.set(kmer, true); + } + + for kmer in cocktail::tokenizer::Tokenizer::new(conf, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(&read).as_slice()); + assert_eq!(refe, corrector.correct(&refe).as_slice()); + } + + #[test] + fn ciic() { + init(); + + let refe = b"ACTGACGA"; + let read = b"ACTGATTCGA"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // don't correct + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cdc() { + init(); + + let refe = b"ACTGACGACCC"; + let read = b"ACTGAGACCC"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cdc_relaxe() { + init(); + + let refe = b"GAGCGTACGTTGGAT"; + let read = b"GAGCGTAGTTGGAT"; + let conf = b"GCGTACTT"; + + let mut data = pcon::solid::Solid::new(7); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 7) { + data.set(kmer, true); + } + + for kmer in cocktail::tokenizer::Tokenizer::new(conf, 7) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cddc() { + init(); + + let refe = b"ACTGACGAG"; + let read = b"ACTGAAG"; + + let mut data = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = One::new(&set, 2); + + assert_eq!(read, corrector.correct(read).as_slice()); // don't correct + assert_eq!(refe, corrector.correct(refe).as_slice()); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local use */ +use crate::set; + +const MASK_LOOKUP: [u64; 32] = { + let mut lookup = [0; 32]; + + let mut k = 1; + while k < 32 { + lookup[k] = (1 << (2 * k)) - 1; + + k += 1; + } + + lookup +}; + +#[inline(always)] +pub(crate) fn mask(k: u8) -> u64 { + MASK_LOOKUP[k as usize] +} + +pub trait Corrector { + fn valid_kmer(&self) -> &set::BoxKmerSet; + + fn correct_error(&self, kmer: u64, seq: &[u8]) -> Option<(Vec, usize)>; + + fn k(&self) -> u8 { + self.valid_kmer().k() + } + + fn correct(&self, seq: &[u8]) -> Vec { + let mut correct: Vec = Vec::with_capacity(seq.len()); + + if seq.len() < self.k() as usize { + return seq.to_vec(); + } + + let mut i = self.k() as usize; + let mut kmer = cocktail::kmer::seq2bit(&seq[0..i]); + + for n in &seq[0..i] { + correct.push(*n); + } + + let mut previous = self.valid_kmer().get(kmer); + while i < seq.len() { + let nuc = seq[i]; + + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(nuc), self.k()); + + if !self.valid_kmer().get(kmer) && previous { + if let Some((local_correct, offset)) = self.correct_error(kmer, &seq[i..]) { + kmer >>= 2; + + for nuc in local_correct { + kmer = add_nuc_to_end( + kmer, + cocktail::kmer::nuc2bit(nuc), + self.valid_kmer().k(), + ); + correct.push(nuc); + } + + log::debug!("error at position {} cor", i); + + previous = true; + i += offset; + } else { + correct.push(nuc); + + log::debug!("error at position {} not", i); + + i += 1; + previous = false; + } + } else { + previous = self.valid_kmer().get(kmer); + correct.push(nuc); + + i += 1; + } + } + + correct + } +} + +pub(crate) fn add_nuc_to_end(kmer: u64, nuc: u64, k: u8) -> u64 { + ((kmer << 2) & mask(k)) ^ nuc +} + +pub(crate) fn alt_nucs(valid_kmer: &set::BoxKmerSet, ori: u64) -> Vec { + next_nucs(valid_kmer, ori >> 2) +} + +pub(crate) fn next_nucs(valid_kmer: &set::BoxKmerSet, kmer: u64) -> Vec { + let mut correct_nuc: Vec = Vec::with_capacity(4); + + for alt_nuc in 0..4 { + if valid_kmer.get(add_nuc_to_end(kmer, alt_nuc, valid_kmer.k())) { + correct_nuc.push(alt_nuc); + } + } + + correct_nuc +} + +pub(crate) fn error_len( + subseq: &[u8], + mut kmer: u64, + valid_kmer: &set::BoxKmerSet, +) -> (usize, u64) { + let mut j = 0; + + loop { + j += 1; + + if j >= subseq.len() { + break; + } + + kmer = add_nuc_to_end(kmer, cocktail::kmer::nuc2bit(subseq[j]), valid_kmer.k()); + + if valid_kmer.get(kmer) { + break; + } + } + + (j, kmer) +} + +pub mod exist; +pub mod gap_size; +pub mod graph; +pub mod greedy; + +pub use exist::one::One; +pub use exist::two::Two; +pub use gap_size::GapSize; +pub use graph::Graph; +pub use greedy::Greedy; + +#[cfg(test)] +mod tests { + + use super::*; + + #[test] + fn found_alt_kmer() { + let mut data = pcon::solid::Solid::new(5); + data.set(cocktail::kmer::seq2bit(b"ACTGA"), true); + data.set(cocktail::kmer::seq2bit(b"ACTGT"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let kmer = cocktail::kmer::seq2bit(b"ACTGC"); + + assert_eq!(alt_nucs(&set, kmer), vec![0, 2]); + } +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use log::debug; + +/* local use */ +use crate::correct::*; + +pub struct Graph<'a> { + valid_kmer: &'a set::BoxKmerSet<'a>, +} + +impl<'a> Graph<'a> { + pub fn new(valid_kmer: &'a set::BoxKmerSet<'a>) -> Self { + Self { valid_kmer } + } +} + +impl<'a> Corrector for Graph<'a> { + fn valid_kmer(&self) -> &set::BoxKmerSet { + self.valid_kmer + } + + fn correct_error(&self, mut kmer: u64, seq: &[u8]) -> Option<(Vec, usize)> { + let (error_len, first_correct_kmer) = error_len(seq, kmer, self.valid_kmer()); + + let mut viewed_kmer = rustc_hash::FxHashSet::default(); + + let mut local_corr = Vec::new(); + + let alts = alt_nucs(self.valid_kmer(), kmer); + if alts.len() != 1 { + debug!("failed multiple successor {:?}", alts); + return None; + } + + kmer = add_nuc_to_end(kmer >> 2, alts[0], self.k()); + local_corr.push(cocktail::kmer::bit2nuc(alts[0])); + viewed_kmer.insert(kmer); + + while self.valid_kmer().get(kmer) { + let alts = next_nucs(self.valid_kmer(), kmer); + + if alts.len() != 1 { + debug!("failed branching node {:?}", alts); + return None; + } + + kmer = add_nuc_to_end(kmer, alts[0], self.k()); + + if viewed_kmer.contains(&kmer) { + debug!("we view this kmer previously"); + return None; + } + viewed_kmer.insert(kmer); + + local_corr.push(cocktail::kmer::bit2nuc(alts[0])); + + if kmer == first_correct_kmer { + break; + } + } + + Some((local_corr, error_len + 1)) + } +} + +#[cfg(test)] +mod tests { + + use super::*; + + fn init() { + let _ = env_logger::builder() + .is_test(true) + .filter_level(log::LevelFilter::Trace) + .try_init(); + } + + #[test] + fn branching_path_csc() { + init(); + + let refe = b"TCTTTATTTTC"; + // ||||| ||||| + let read = b"TCTTTGTTTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + data.set(cocktail::kmer::seq2bit(b"TTTTT"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn branching_path_cdc() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGAACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + data.set(cocktail::kmer::seq2bit(b"GGACT"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(read, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn branching_path_cic() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGATCACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + data.set(cocktail::kmer::seq2bit(b"GGACT"), true); + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(read, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn csc() { + init(); + + let refe = b"TCTTTATTTTC"; + // ||||| ||||| + let read = b"TCTTTGTTTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cssc() { + init(); + + let refe = b"TCTCTAATCTTC"; + // ||||| ||||| + let read = b"TCTCTGGTCTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn csssc() { + init(); + + let refe = b"TCTCTAAATCTTC"; + // ||||| ||||| + let read = b"TCTCTGGGTCTTC"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrect + } + + #[test] + fn cscsc() { + init(); + + let refe = b"TCTTTACATTTTT"; + // ||||| | ||||| + let read = b"TCTTTGCGTTTTT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn cdc() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGAACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cddc() { + init(); + + let refe = b"CAAAGCATTTTT"; + // ||||| + let read = b"CAAAGTTTTT"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); + assert_eq!(refe, corrector.correct(refe).as_slice()); + } + + #[test] + fn cic() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGATCACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } + + #[test] + fn ciic() { + init(); + + let refe = b"GATACATGGACACTAGTATG"; + // |||||||||| + let read = b"GATACATGGATTCACTAGTATG"; + + let mut data: pcon::solid::Solid = pcon::solid::Solid::new(5); + + for kmer in cocktail::tokenizer::Tokenizer::new(refe, 5) { + data.set(kmer, true); + } + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(data)); + + let corrector = Graph::new(&set); + + assert_eq!(refe, corrector.correct(read).as_slice()); // test correction work + assert_eq!(refe, corrector.correct(refe).as_slice()); // test not overcorrection + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local mod */ +pub mod cli; +pub mod correct; +pub mod error; +pub mod set; + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use rayon::iter::ParallelBridge; +use rayon::prelude::*; + +/* local use */ +use error::IO::*; +use error::*; + +pub fn run_correction<'a>( + inputs: &[String], + outputs: &[String], + methods: Vec>, + two_side: bool, + record_buffer_len: usize, +) -> Result<()> { + for (input, output) in inputs.iter().zip(outputs) { + log::info!("Read file {} write in {}", input, output); + + let reader = bio::io::fasta::Reader::new(std::io::BufReader::new( + std::fs::File::open(input) + .with_context(|| error::Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", input.clone()))?, + )); + + let mut write = bio::io::fasta::Writer::new(std::io::BufWriter::new( + std::fs::File::create(&output) + .with_context(|| error::Error::IO(CantCreateFile)) + .with_context(|| anyhow!("File {}", output.clone()))?, + )); + + let mut iter = reader.records(); + let mut records = Vec::with_capacity(record_buffer_len); + let mut corrected: Vec; + + let mut end = false; + loop { + for _ in 0..record_buffer_len { + if let Some(Ok(record)) = iter.next() { + records.push(record); + } else { + end = true; + break; + } + } + + log::info!("Buffer len: {}", records.len()); + + corrected = records + .drain(..) + .par_bridge() + .map(|record| { + log::debug!("begin correct read {} {}", record.id(), record.seq().len()); + + let seq = record.seq(); + + let mut correct = seq.to_vec(); + methods + .iter() + .for_each(|x| correct = x.correct(correct.as_slice())); + + if !two_side { + correct.reverse(); + methods + .iter() + .for_each(|x| correct = x.correct(correct.as_slice())); + + correct.reverse(); + } + + log::debug!("end correct read {}", record.id()); + bio::io::fasta::Record::with_attrs(record.id(), record.desc(), &correct) + }) + .collect(); + + for corr in corrected { + write + .write_record(&corr) + .with_context(|| Error::IO(IO::ErrorDurringWrite)) + .with_context(|| anyhow!("File {}", output.clone()))? + } + + records.clear(); + + if end { + break; + } + } + } + + Ok(()) +} + +pub fn build_methods<'a>( + params: Option>, + solid: &'a set::BoxKmerSet, + confirm: u8, + max_search: u8, +) -> Vec> { + let mut methods: Vec> = Vec::new(); + + if let Some(ms) = params { + for method in ms { + match &method[..] { + "one" => methods.push(Box::new(correct::One::new(solid, confirm))), + "two" => methods.push(Box::new(correct::Two::new(solid, confirm))), + "graph" => methods.push(Box::new(correct::Graph::new(solid))), + "greedy" => { + methods.push(Box::new(correct::Greedy::new(solid, max_search, confirm))) + } + "gap_size" => methods.push(Box::new(correct::GapSize::new(solid, confirm))), + _ => unreachable!(), + } + } + } else { + methods.push(Box::new(correct::One::new(solid, confirm))); + } + + methods +} + +/// Set the number of threads use by count step +pub fn set_nb_threads(nb_threads: usize) { + rayon::ThreadPoolBuilder::new() + .num_threads(nb_threads) + .build_global() + .unwrap(); +} + +#[cfg(test)] +mod tests { + use super::*; + + #[test] + fn methods_list() { + // Not perfect test + + let set: set::BoxKmerSet = Box::new(set::Pcon::new(pcon::solid::Solid::new(5))); + let mut methods = build_methods(None, &set, 2, 5); + + assert_eq!(methods.len(), 1); + + methods = build_methods(Some(vec!["one".to_string(), "two".to_string()]), &set, 2, 5); + + assert_eq!(methods.len(), 2); + + methods = build_methods( + Some(vec![ + "one".to_string(), + "two".to_string(), + "graph".to_string(), + "greedy".to_string(), + "gap_size".to_string(), + "gap_size".to_string(), + ]), + &set, + 2, + 5, + ); + + assert_eq!(methods.len(), 6); + } + + #[test] + #[should_panic] + fn methods_unreachable() { + let set: set::BoxKmerSet = Box::new(set::Pcon::new(pcon::solid::Solid::new(5))); + let _ = build_methods(Some(vec!["oe".to_string(), "tw".to_string()]), &set, 2, 5); + } + + #[test] + fn change_number_of_thread() { + set_nb_threads(16); + assert_eq!(rayon::current_num_threads(), 16); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use thiserror::Error; + +/// All error produce by Pcon +#[derive(Debug, Error)] +pub enum Error { + /// See enum [Cli] + #[error(transparent)] + Cli(#[from] Cli), + + /// See enum [IO] + #[error(transparent)] + IO(#[from] IO), + + #[error("Can't compute minimal abundance")] + CantComputeAbundance, +} + +/// Error emmit durring Cli parsing +#[derive(Debug, Error)] +pub enum Cli { + /// Number of inputs and outputs must be the same + #[error("Kmer size must be odd")] + NotSameNumberOfInAndOut, + + #[error("You must provide a solidity path '-s', a kmer solid path '-S' or a kmer length '-k'")] + NoSolidityNoKmer, + + #[error("If you provide kmer solid path '-S' you must provide a kmer length '-k'")] + KmerSolidNeedK, + + #[error("Abundance method threshold can't be parse")] + CantParseAbundanceMethod, +} + +/// Error emmit when pcon try to work with file +#[repr(C)] +#[derive(Debug, Error)] +pub enum IO { + /// We can't create file. In C binding it's equal to 0 + #[error("We can't create file")] + CantCreateFile, + + /// We can't open file. In C binding it's equal to 1 + #[error("We can't open file")] + CantOpenFile, + + /// Error durring write in file. In C binding it's equal to 2 + #[error("Error durring write")] + ErrorDurringWrite, + + /// Error durring read file. In C binding it's equal to 3 + #[error("Error durring read")] + ErrorDurringRead, + + /// No error, this exist only for C binding it's the value of a new error pointer + #[error("Isn't error if you see this please contact the author with this message and a description of what you do with pcon")] + NoError, +} +#[cfg(test)] +mod tests { + use std::io::Read; + use std::process::{Command, Stdio}; + + fn run_finish(mut child: std::process::Child) -> bool { + if !child.wait().expect("Error durring br run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + + false + } else { + true + } + } + + #[test] + fn count() { + let child = Command::new("./target/debug/br") + .args(&[ + "-i", + "tests/data/raw.fasta", + "-o", + "tests/data/corr.fasta", + "-k", + "11", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create br subprocess"); + + assert!(run_finish(child)); + } + + #[test] + fn solid() { + let child = Command::new("./target/debug/br") + .args(&[ + "-i", + "tests/data/raw.fasta", + "-o", + "tests/data/corr.fasta", + "-s", + "tests/data/raw.k11.a2.solid", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create br subprocess"); + + assert!(run_finish(child)); + } + + #[test] + fn no_count_no_solid() { + let child = Command::new("./target/debug/br") + .args(&["-i", "tests/data/raw.fasta", "-o", "tests/data/corr.fasta"]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create br subprocess"); + + assert!(!run_finish(child)); + } +} +#[cfg(test)] +mod tests { + use std::io::Read; + use std::process::{Command, Stdio}; + + fn run_finish(mut child: std::process::Child) -> bool { + if !child.wait().expect("Error durring br run").success() { + let mut stdout = String::new(); + let mut stderr = String::new(); + + child.stdout.unwrap().read_to_string(&mut stdout).unwrap(); + child.stderr.unwrap().read_to_string(&mut stderr).unwrap(); + + println!("stdout: {}", stdout); + println!("stderr: {}", stderr); + + false + } else { + true + } + } + + #[test] + fn run() { + let child = Command::new("./target/debug/br_large") + .args(&[ + "-i", + "tests/data/raw.fasta", + "-o", + "tests/data/corr.fasta", + "-S", + "tests/data/raw.k31.fasta", + "-k", + "31", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create br subprocess"); + + assert!(run_finish(child)); + } + + #[test] + fn no_kmer_size() { + let child = Command::new("./target/debug/br_large") + .args(&[ + "-i", + "tests/data/raw.fasta", + "-o", + "tests/data/corr.fasta", + "-S", + "tests/data/raw.k31.fasta", + ]) + .stderr(Stdio::piped()) + .stdout(Stdio::piped()) + .spawn() + .expect("Couldn't create br subprocess"); + + assert!(!run_finish(child)); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; + +/* local use */ +use crate::error::IO::*; +use crate::error::*; +use crate::*; + +pub fn count(params: cli::SubCommandCount) -> Result<()> { + let params = cli::check_count_param(params)?; + + let record_buffer = if let Some(len) = params.record_buffer { + len + } else { + 8192 + }; + + log::info!("Start of count structure initialization"); + let mut counter = counter::Counter::new(params.kmer); + log::info!("End of count structure initialization"); + + for input in params.inputs.iter() { + log::info!("Start of kmer count of the file {}", input); + let reader = niffler::get_reader(Box::new( + std::fs::File::open(input) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", input.clone()))?, + )) + .with_context(|| anyhow!("File {}", input.clone()))? + .0; + + counter.count_fasta(reader, record_buffer); + + log::info!("End of kmer count of the file {}", &input); + } + + dump::dump_worker( + counter, + params.output, + params.csv, + params.solid, + params.spectrum, + params.abundance, + ); + + Ok(()) +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* project mod declaration */ +pub mod cli; +pub mod error; + +pub mod count; +pub mod counter; +pub mod dump; +pub mod solid; +pub mod spectrum; +pub mod static_counter; + +pub mod binding; + +/// Set the number of threads use by pcon +pub fn set_nb_threads(nb_threads: usize) { + rayon::ThreadPoolBuilder::new() + .num_threads(nb_threads) + .build_global() + .unwrap(); +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{Context, Result}; +use rayon::prelude::*; + +/* local use */ +use crate::error::IO::*; +use crate::error::*; +use crate::*; + +/// Based on Kmergenie we assume kmer spectrum is a mixture of Pareto law and some Gaussians law +/// Erroneous kmer follow Pareto law, Gaussians law represente true and repetitive kmer +/// We use this property to found the threshold to remove many Erroneous kmer and keep Many True kmer +#[derive(Debug, PartialEq)] +pub enum ThresholdMethod { + /// The first local minimum match with the intersection of Pareto and Gaussians + FirstMinimum, + + /// More we remove kmer less we remove Erroneous kmer when remove less than n percent view before + Rarefaction, + + /// Remove at most n percent of total kmer + PercentAtMost, + + /// Remove at least n percent of total kmer + PercentAtLeast, +} + +/// A struct to represent kmer spectrum and usefull corresponding function +pub struct Spectrum { + data: Box<[u64]>, +} + +impl Spectrum { + pub fn from_counter(counter: &counter::Counter) -> Self { + let counts = unsafe { + &(*(counter.get_raw_count() as *const [counter::AtoCount] as *const [counter::Count])) + }; + + let data = counts + .par_chunks(counts.len() / rayon::current_num_threads()) + .map(|chunk| { + let mut d: Box<[u64]> = vec![0u64; 256].into_boxed_slice(); + + for count in chunk.iter() { + d[*count as usize] = d[*count as usize].saturating_add(1); + } + + d + }) + .reduce( + || vec![0u64; 256].into_boxed_slice(), + |a, b| { + let mut d = Vec::with_capacity(256); + + for x in a.iter().zip(b.iter()) { + d.push(x.0.saturating_add(*x.1)); + } + + d.into_boxed_slice() + }, + ); + + Self { data } + } + + pub fn get_threshold(&self, method: ThresholdMethod, params: f64) -> Option { + match method { + ThresholdMethod::FirstMinimum => self.first_minimum(), + ThresholdMethod::Rarefaction => self.rarefaction(params), + ThresholdMethod::PercentAtMost => self.percent_at_most(params), + ThresholdMethod::PercentAtLeast => self.percent_at_least(params), + } + } + + fn first_minimum(&self) -> Option { + for (i, d) in self.data.windows(2).enumerate() { + if d[1] > d[0] { + return Some(i as u8); + } + } + + None + } + + fn rarefaction(&self, limit: f64) -> Option { + let mut cumulative_sum = 0; + + for (index, value) in self.data.iter().enumerate() { + cumulative_sum += index as u64 * value; + + if (*value as f64 / cumulative_sum as f64) < limit { + return Some(index as u8); + } + } + + None + } + + fn percent_at_most(&self, percent: f64) -> Option { + self.percent_at_least(percent).map(|x| x - 1) + } + + fn percent_at_least(&self, percent: f64) -> Option { + let total: u64 = self + .data + .iter() + .enumerate() + .map(|(index, value)| index as u64 * value) + .sum(); + + let mut cumulative_sum = 0; + for (index, value) in self.data.iter().enumerate() { + cumulative_sum += index as u64 * value; + + if (cumulative_sum as f64 / total as f64) > percent { + return Some(index as u8); + } + } + + None + } + + #[allow(dead_code)] + pub(crate) fn get_raw_histogram(&self) -> &[u64] { + &self.data + } + + pub fn write_csv(&self, mut writer: W) -> Result<()> + where + W: std::io::Write, + { + for (i, nb) in self.data.iter().enumerate() { + writeln!(writer, "{},{}", i, nb).with_context(|| Error::IO(ErrorDurringWrite))?; + } + + Ok(()) + } + + pub fn write_histogram(&self, mut out: W, point: Option) -> std::io::Result<()> + where + W: std::io::Write, + { + // Draw kmer spectrum in console + let shape = get_shape(); + + let factor = (*self.data.iter().max().unwrap() as f64).log(10.0) / shape.1 as f64; + + let normalized: Box<[f64]> = self + .data + .iter() + .map(|y| { + if *y == 0 { + 0.0 + } else { + (*y as f64).log(10.0) / factor + } + }) + .collect(); + + for h in (1..=shape.1).rev() { + for w in 0..shape.0 { + if normalized[w] >= h as f64 { + let delta = normalized[w] - h as f64; + if delta > 1.0 { + write!(out, "\u{258c}")?; + } else if delta > 0.5 { + write!(out, "\u{2596}")?; + } else { + write!(out, " ")?; + } + } else { + write!(out, " ")?; + } + } + + writeln!(out)?; + } + + let mut last_line = vec![b' '; shape.0]; + for x in (0..shape.0).step_by(5) { + last_line[x] = b'5' + } + last_line[0] = b'0'; + if let Some(pos) = point { + if (pos as usize) < last_line.len() { + last_line[pos as usize] = b'*'; + } + } + + writeln!(out, "{}", std::str::from_utf8(&last_line).unwrap())?; + + Ok(()) + } +} + +#[allow(dead_code)] +fn term_size() -> (usize, usize) { + match term_size::dimensions() { + Some((w, h)) => (w, h), + None => (80, 24), + } +} + +#[cfg(test)] +fn get_shape() -> (usize, usize) { + (256, 48) +} + +#[cfg(not(test))] +fn get_shape() -> (usize, usize) { + let term_size = term_size(); + + ( + core::cmp::min(256, term_size.0), + core::cmp::min(48, term_size.1), + ) +} + +#[cfg(test)] +mod tests { + + use super::*; + + lazy_static::lazy_static! { + static ref COUNTER: crate::counter::Counter = { + let mut counter = crate::counter::Counter::new(5); + + for i in 0..cocktail::kmer::get_kmer_space_size(5) { + counter.inc(i); + } + + counter.inc(0); + + counter + }; + } + + #[test] + fn from_counter() { + let spectrum = Spectrum::from_counter(&COUNTER); + + assert_eq!( + spectrum.get_raw_histogram(), + &[ + 0, 0, 511, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, + 0, 0, 0, 0, 0 + ] + ); + } + + static SPECTRUM: [u64; 256] = [ + 992273316, 64106898, 6792586, 1065818, 220444, 62400, 36748, 54062, 100806, 178868, 287058, + 424184, 568742, 705680, 805332, 871544, 874546, 827252, 744428, 636722, 523488, 418036, + 320506, 237956, 170642, 118046, 77290, 48320, 30500, 21096, 15632, 12758, 11838, 10888, + 10402, 9872, 9018, 7960, 7236, 6304, 5276, 4524, 3714, 3056, 2628, 2018, 1578, 1256, 1036, + 906, 708, 716, 592, 476, 540, 520, 446, 388, 316, 264, 258, 200, 230, 172, 164, 184, 154, + 162, 126, 124, 126, 156, 152, 98, 116, 108, 134, 116, 88, 124, 96, 94, 96, 72, 52, 56, 68, + 50, 54, 66, 54, 28, 44, 48, 30, 42, 48, 32, 38, 34, 44, 30, 32, 28, 18, 34, 20, 28, 26, 28, + 28, 32, 22, 16, 10, 26, 8, 26, 14, 14, 30, 6, 32, 38, 26, 26, 16, 30, 20, 38, 20, 22, 22, + 28, 14, 16, 20, 20, 20, 10, 12, 14, 12, 10, 18, 16, 16, 12, 18, 2, 14, 6, 12, 8, 0, 6, 2, + 4, 2, 0, 0, 2, 4, 2, 2, 6, 6, 0, 0, 2, 0, 2, 4, 0, 2, 2, 6, 2, 0, 0, 0, 2, 2, 2, 2, 2, 0, + 2, 2, 0, 2, 2, 0, 2, 2, 2, 0, 0, 2, 4, 2, 0, 2, 0, 2, 2, 2, 0, 2, 2, 2, 2, 2, 0, 0, 0, 2, + 0, 0, 2, 2, 2, 2, 4, 0, 2, 4, 4, 0, 2, 0, 0, 2, 2, 0, 0, 0, 0, 0, 4, 2, 0, 2, 0, 0, 0, 2, + 0, 4, 2, 0, 4, 2, 0, 0, 284, + ]; + + #[test] + fn first_local_min() { + let spectrum = Spectrum { + data: Box::new(SPECTRUM), + }; + + assert_eq!( + spectrum.get_threshold(ThresholdMethod::FirstMinimum, 0.1), + Some(6) + ); + } + + #[test] + fn failled_first_local_min() { + let tmp = (0..256).map(|_| 1).collect::>(); + + let spectrum = Spectrum { data: tmp }; + + assert_eq!( + spectrum.get_threshold(ThresholdMethod::FirstMinimum, 0.1), + None + ); + } + + #[test] + fn rarefaction() { + let spectrum = Spectrum { + data: Box::new(SPECTRUM), + }; + + assert_eq!( + spectrum.get_threshold(ThresholdMethod::Rarefaction, 0.1), + Some(2) + ); + } + + #[test] + fn failled_rarefaction() { + let tmp = (0..256).map(|_| 1).collect::>(); + + let spectrum = Spectrum { data: tmp }; + + assert_eq!( + spectrum.get_threshold(ThresholdMethod::FirstMinimum, 0.00001), + None + ); + } + + #[test] + fn test_draw_hist() { + let spectrum = Spectrum { + data: Box::new(SPECTRUM), + }; + + let mut output = vec![]; + spectrum.write_histogram(&mut output, Some(6)).unwrap(); + + let good_output = " +▖ +▌ +▌ +▌ +▌ +▌ +▌▖ +▌▌ +▌▌ +▌▌ +▌▌ +▌▌ +▌▌▌ +▌▌▌ +▌▌▌ +▌▌▌ +▌▌▌▌ ▖▖▖▖ +▌▌▌▌ ▖▌▌▌▌▌▌▖▖ +▌▌▌▌ ▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▖ ▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌ ▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌ ▖▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ +▌▌▌▌▌▖ ▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ +▌▌▌▌▌▌ ▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▖▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ ▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▖ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▖▌▖▖ ▖▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▌▖▌▌ ▌▖▖▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖ ▖ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ ▖▖ ▖▖ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▌▌▖▌▌▌▌▌▌▖▌▖ ▌ ▖▖▖▖▌ ▖ ▖ ▖ ▌▌▖▖ ▖ ▌ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▌▖▌▌▌▌▌▌ ▌ ▌ ▌ ▌▌▌▌ ▌▖▌▖▌▌▌ ▖▖▖ ▖ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ ▌ ▌▌▌▌ ▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ ▖▌▖ ▌▌▌▖▌ ▌ ▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▌▌▌▌ ▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ ▌ ▌▖ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌���▌▌▌▌▌ ▌▌▌▌ ▌ ▌▌ ▌ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌ ▌▌▌▌ ▌ ▌ ▌ ▌▌ ▌ ▌ ▌ ▌ ▌▌ ▌ ▌ ▌ ▌ +▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▌▖▌▌▌▌ ▌▖▌▖ ▖▌▖▖▌▌ ▖ ▖▌ ▖▖▌▖ ▖▖▖▖▖ ▖▖ ▖▖ ▖▖▖ ▖▌▖ ▖ ▖▖▖ ▖▖▖▖▖ ▖ ▖▖▖▖▌ ▖▌▌ ▖ ▖▖ ▌▖ ▖ ▖ ▌▖ ▌▖ ▌ +0 5* 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 +"; + + assert_eq!(good_output, std::str::from_utf8(&output).unwrap()); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use cocktail::*; + +/* local use */ +use crate::error::IO::*; +use crate::error::*; +use crate::*; + +pub fn dump(params: cli::SubCommandDump) -> Result<()> { + let params = cli::check_dump_param(params)?; + + log::info!("Start of read of count"); + let reader = std::fs::File::open(¶ms.input) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", params.input.clone()))?; + + let counter = counter::Counter::deserialize(reader) + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("File {}", params.input.clone()))?; + + log::info!("End of read of count"); + + dump_worker( + counter, + params.bin, + params.csv, + params.solid, + params.spectrum, + params.abundance, + ); + + Ok(()) +} + +pub(crate) fn dump_worker( + counter: counter::Counter, + bin_path: Option, + csv_path: Option, + solid_path: Option, + spectrum_path: Option, + abundance: counter::Count, +) { + rayon::scope(|s| { + s.spawn(|_| { + if let Some(output) = bin_path.clone() { + log::info!("Start of dump count data in binary"); + let writer = std::io::BufWriter::new( + std::fs::File::create(&output) + .with_context(|| Error::IO(CantCreateFile)) + .with_context(|| anyhow!("File {}", output.clone())) + .unwrap(), + ); + + counter + .serialize(writer) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("In file {}", output.clone())) + .unwrap(); + + log::info!("End of dump count data in binary"); + } + }); + + s.spawn(|_| { + if let Some(output) = csv_path.clone() { + log::info!("Start of dump count data in csv"); + + let writer = std::io::BufWriter::new( + std::fs::File::create(&output) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", output.clone())) + .unwrap(), + ); + + csv(writer, &counter, abundance) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("File {} in csv format", output)) + .unwrap(); + + log::info!("End of dump count data in csv"); + } + }); + + s.spawn(|_| { + if let Some(output) = solid_path.clone() { + log::info!("Start of dump count data in solid format"); + + let writer = std::io::BufWriter::new( + std::fs::File::create(&output) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", output.clone())) + .unwrap(), + ); + + solid(writer, &counter, abundance) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("File {} in solid format", output)) + .unwrap(); + + log::info!("End of dump count data in solid format"); + } + }); + + s.spawn(|_| { + if let Some(output) = spectrum_path.clone() { + log::info!("Start of dump count data in spectrum"); + + let writer = std::io::BufWriter::new( + std::fs::File::create(&output) + .with_context(|| Error::IO(CantOpenFile)) + .with_context(|| anyhow!("File {}", output.clone())) + .unwrap(), + ); + + spectrum(writer, &counter) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("File {} in spectrum format", output)) + .unwrap(); + + log::info!("End of dump count data in spectrum"); + } + }); + }); +} + +/// Write in the given instance of io::Write the count in `counter` in binary format. +pub fn binary(writer: W, counter: &counter::Counter) -> Result<()> +where + W: std::io::Write, +{ + counter + .serialize(writer) + .with_context(|| Error::IO(ErrorDurringWrite))?; + + Ok(()) +} + +/// Write in the given instance of io::Write the count in `counter` in csv format. +/// Only count upper than `abundance` is write. +pub fn csv(mut writer: W, counter: &counter::Counter, abundance: counter::Count) -> Result<()> +where + W: std::io::Write, +{ + let counts = unsafe { + &(*(counter.get_raw_count() as *const [counter::AtoCount] as *const [counter::Count])) + }; + + for (hash, value) in counts.iter().enumerate() { + let kmer = if cocktail::kmer::parity_even(hash as u64) { + kmer::kmer2seq((hash as u64) << 1, counter.k) + } else { + kmer::kmer2seq(((hash as u64) << 1) ^ 0b1, counter.k) + }; + + if value > &abundance { + writeln!(writer, "{},{}", kmer, value).with_context(|| Error::IO(ErrorDurringWrite))?; + } + } + + Ok(()) +} + +/// Serialize in the given instance of io::Write an instance of [solid::Solid] build from counts in `counter` upper than `abundance`. +pub fn solid(writer: W, counter: &counter::Counter, abundance: counter::Count) -> Result<()> +where + W: std::io::Write, +{ + let solid = solid::Solid::from_counter(counter, abundance); + + solid + .serialize(writer) + .with_context(|| Error::IO(ErrorDurringWrite))?; + + Ok(()) +} + +/// Write in the given instance of io::Write the kmer spectrum from counts in `counter` +pub fn spectrum(writer: W, counter: &counter::Counter) -> Result<()> +where + W: std::io::Write, +{ + let spectrum = spectrum::Spectrum::from_counter(counter); + + spectrum + .write_csv(writer) + .with_context(|| Error::IO(ErrorDurringWrite))?; + + Ok(()) +} + +#[cfg(test)] +mod tests { + lazy_static::lazy_static! { + static ref COUNTER: crate::counter::Counter = { + let mut counter = crate::counter::Counter::new(5); + + for i in 0..cocktail::kmer::get_kmer_space_size(5) { + counter.inc(i); + } + + counter.inc(0); + + counter + }; + } + + const CSV_ABUNDANCE_MIN_1: &[u8] = &[ + 65, 65, 65, 65, 65, 44, 51, 10, 65, 65, 65, 65, 71, 44, 50, 10, 65, 65, 65, 67, 67, 44, 50, + 10, 65, 65, 65, 67, 84, 44, 50, 10, 65, 65, 65, 84, 67, 44, 50, 10, 65, 65, 65, 84, 84, 44, + 50, 10, 65, 65, 65, 71, 65, 44, 50, 10, 65, 65, 65, 71, 71, 44, 50, 10, 65, 65, 67, 65, 67, + 44, 50, 10, 65, 65, 67, 65, 84, 44, 50, 10, 65, 65, 67, 67, 65, 44, 50, 10, 65, 65, 67, 67, + 71, 44, 50, 10, 65, 65, 67, 84, 65, 44, 50, 10, 65, 65, 67, 84, 71, 44, 50, 10, 65, 65, 67, + 71, 67, 44, 50, 10, 65, 65, 67, 71, 84, 44, 50, 10, 65, 65, 84, 65, 67, 44, 50, 10, 65, 65, + 84, 65, 84, 44, 50, 10, 65, 65, 84, 67, 65, 44, 50, 10, 65, 65, 84, 67, 71, 44, 50, 10, 65, + 65, 84, 84, 65, 44, 50, 10, 65, 65, 84, 84, 71, 44, 50, 10, 65, 65, 84, 71, 67, 44, 50, 10, + 65, 65, 84, 71, 84, 44, 50, 10, 65, 65, 71, 65, 65, 44, 50, 10, 65, 65, 71, 65, 71, 44, 50, + 10, 65, 65, 71, 67, 67, 44, 50, 10, 65, 65, 71, 67, 84, 44, 50, 10, 65, 65, 71, 84, 67, 44, + 50, 10, 65, 65, 71, 84, 84, 44, 50, 10, 65, 65, 71, 71, 65, 44, 50, 10, 65, 65, 71, 71, 71, + 44, 50, 10, 65, 67, 65, 65, 67, 44, 50, 10, 65, 67, 65, 65, 84, 44, 50, 10, 65, 67, 65, 67, + 65, 44, 50, 10, 65, 67, 65, 67, 71, 44, 50, 10, 65, 67, 65, 84, 65, 44, 50, 10, 65, 67, 65, + 84, 71, 44, 50, 10, 65, 67, 65, 71, 67, 44, 50, 10, 65, 67, 65, 71, 84, 44, 50, 10, 65, 67, + 67, 65, 65, 44, 50, 10, 65, 67, 67, 65, 71, 44, 50, 10, 65, 67, 67, 67, 67, 44, 50, 10, 65, + 67, 67, 67, 84, 44, 50, 10, 65, 67, 67, 84, 67, 44, 50, 10, 65, 67, 67, 84, 84, 44, 50, 10, + 65, 67, 67, 71, 65, 44, 50, 10, 65, 67, 67, 71, 71, 44, 50, 10, 65, 67, 84, 65, 65, 44, 50, + 10, 65, 67, 84, 65, 71, 44, 50, 10, 65, 67, 84, 67, 67, 44, 50, 10, 65, 67, 84, 67, 84, 44, + 50, 10, 65, 67, 84, 84, 67, 44, 50, 10, 65, 67, 84, 84, 84, 44, 50, 10, 65, 67, 84, 71, 65, + 44, 50, 10, 65, 67, 84, 71, 71, 44, 50, 10, 65, 67, 71, 65, 67, 44, 50, 10, 65, 67, 71, 65, + 84, 44, 50, 10, 65, 67, 71, 67, 65, 44, 50, 10, 65, 67, 71, 67, 71, 44, 50, 10, 65, 67, 71, + 84, 65, 44, 50, 10, 65, 67, 71, 84, 71, 44, 50, 10, 65, 67, 71, 71, 67, 44, 50, 10, 65, 67, + 71, 71, 84, 44, 50, 10, 65, 84, 65, 65, 67, 44, 50, 10, 65, 84, 65, 65, 84, 44, 50, 10, 65, + 84, 65, 67, 65, 44, 50, 10, 65, 84, 65, 67, 71, 44, 50, 10, 65, 84, 65, 84, 65, 44, 50, 10, + 65, 84, 65, 84, 71, 44, 50, 10, 65, 84, 65, 71, 67, 44, 50, 10, 65, 84, 65, 71, 84, 44, 50, + 10, 65, 84, 67, 65, 65, 44, 50, 10, 65, 84, 67, 65, 71, 44, 50, 10, 65, 84, 67, 67, 67, 44, + 50, 10, 65, 84, 67, 67, 84, 44, 50, 10, 65, 84, 67, 84, 67, 44, 50, 10, 65, 84, 67, 84, 84, + 44, 50, 10, 65, 84, 67, 71, 65, 44, 50, 10, 65, 84, 67, 71, 71, 44, 50, 10, 65, 84, 84, 65, + 65, 44, 50, 10, 65, 84, 84, 65, 71, 44, 50, 10, 65, 84, 84, 67, 67, 44, 50, 10, 65, 84, 84, + 67, 84, 44, 50, 10, 65, 84, 84, 84, 67, 44, 50, 10, 65, 84, 84, 84, 84, 44, 50, 10, 65, 84, + 84, 71, 65, 44, 50, 10, 65, 84, 84, 71, 71, 44, 50, 10, 65, 84, 71, 65, 67, 44, 50, 10, 65, + 84, 71, 65, 84, 44, 50, 10, 65, 84, 71, 67, 65, 44, 50, 10, 65, 84, 71, 67, 71, 44, 50, 10, + 65, 84, 71, 84, 65, 44, 50, 10, 65, 84, 71, 84, 71, 44, 50, 10, 65, 84, 71, 71, 67, 44, 50, + 10, 65, 84, 71, 71, 84, 44, 50, 10, 65, 71, 65, 65, 65, 44, 50, 10, 65, 71, 65, 65, 71, 44, + 50, 10, 65, 71, 65, 67, 67, 44, 50, 10, 65, 71, 65, 67, 84, 44, 50, 10, 65, 71, 65, 84, 67, + 44, 50, 10, 65, 71, 65, 84, 84, 44, 50, 10, 65, 71, 65, 71, 65, 44, 50, 10, 65, 71, 65, 71, + 71, 44, 50, 10, 65, 71, 67, 65, 67, 44, 50, 10, 65, 71, 67, 65, 84, 44, 50, 10, 65, 71, 67, + 67, 65, 44, 50, 10, 65, 71, 67, 67, 71, 44, 50, 10, 65, 71, 67, 84, 65, 44, 50, 10, 65, 71, + 67, 84, 71, 44, 50, 10, 65, 71, 67, 71, 67, 44, 50, 10, 65, 71, 67, 71, 84, 44, 50, 10, 65, + 71, 84, 65, 67, 44, 50, 10, 65, 71, 84, 65, 84, 44, 50, 10, 65, 71, 84, 67, 65, 44, 50, 10, + 65, 71, 84, 67, 71, 44, 50, 10, 65, 71, 84, 84, 65, 44, 50, 10, 65, 71, 84, 84, 71, 44, 50, + 10, 65, 71, 84, 71, 67, 44, 50, 10, 65, 71, 84, 71, 84, 44, 50, 10, 65, 71, 71, 65, 65, 44, + 50, 10, 65, 71, 71, 65, 71, 44, 50, 10, 65, 71, 71, 67, 67, 44, 50, 10, 65, 71, 71, 67, 84, + 44, 50, 10, 65, 71, 71, 84, 67, 44, 50, 10, 65, 71, 71, 84, 84, 44, 50, 10, 65, 71, 71, 71, + 65, 44, 50, 10, 65, 71, 71, 71, 71, 44, 50, 10, 67, 65, 65, 65, 67, 44, 50, 10, 67, 65, 65, + 65, 84, 44, 50, 10, 67, 65, 65, 67, 65, 44, 50, 10, 67, 65, 65, 67, 71, 44, 50, 10, 67, 65, + 65, 84, 65, 44, 50, 10, 67, 65, 65, 84, 71, 44, 50, 10, 67, 65, 65, 71, 67, 44, 50, 10, 67, + 65, 65, 71, 84, 44, 50, 10, 67, 65, 67, 65, 65, 44, 50, 10, 67, 65, 67, 65, 71, 44, 50, 10, + 67, 65, 67, 67, 67, 44, 50, 10, 67, 65, 67, 67, 84, 44, 50, 10, 67, 65, 67, 84, 67, 44, 50, + 10, 67, 65, 67, 84, 84, 44, 50, 10, 67, 65, 67, 71, 65, 44, 50, 10, 67, 65, 67, 71, 71, 44, + 50, 10, 67, 65, 84, 65, 65, 44, 50, 10, 67, 65, 84, 65, 71, 44, 50, 10, 67, 65, 84, 67, 67, + 44, 50, 10, 67, 65, 84, 67, 84, 44, 50, 10, 67, 65, 84, 84, 67, 44, 50, 10, 67, 65, 84, 84, + 84, 44, 50, 10, 67, 65, 84, 71, 65, 44, 50, 10, 67, 65, 84, 71, 71, 44, 50, 10, 67, 65, 71, + 65, 67, 44, 50, 10, 67, 65, 71, 65, 84, 44, 50, 10, 67, 65, 71, 67, 65, 44, 50, 10, 67, 65, + 71, 67, 71, 44, 50, 10, 67, 65, 71, 84, 65, 44, 50, 10, 67, 65, 71, 84, 71, 44, 50, 10, 67, + 65, 71, 71, 67, 44, 50, 10, 67, 65, 71, 71, 84, 44, 50, 10, 67, 67, 65, 65, 65, 44, 50, 10, + 67, 67, 65, 65, 71, 44, 50, 10, 67, 67, 65, 67, 67, 44, 50, 10, 67, 67, 65, 67, 84, 44, 50, + 10, 67, 67, 65, 84, 67, 44, 50, 10, 67, 67, 65, 84, 84, 44, 50, 10, 67, 67, 65, 71, 65, 44, + 50, 10, 67, 67, 65, 71, 71, 44, 50, 10, 67, 67, 67, 65, 67, 44, 50, 10, 67, 67, 67, 65, 84, + 44, 50, 10, 67, 67, 67, 67, 65, 44, 50, 10, 67, 67, 67, 67, 71, 44, 50, 10, 67, 67, 67, 84, + 65, 44, 50, 10, 67, 67, 67, 84, 71, 44, 50, 10, 67, 67, 67, 71, 67, 44, 50, 10, 67, 67, 67, + 71, 84, 44, 50, 10, 67, 67, 84, 65, 67, 44, 50, 10, 67, 67, 84, 65, 84, 44, 50, 10, 67, 67, + 84, 67, 65, 44, 50, 10, 67, 67, 84, 67, 71, 44, 50, 10, 67, 67, 84, 84, 65, 44, 50, 10, 67, + 67, 84, 84, 71, 44, 50, 10, 67, 67, 84, 71, 67, 44, 50, 10, 67, 67, 84, 71, 84, 44, 50, 10, + 67, 67, 71, 65, 65, 44, 50, 10, 67, 67, 71, 65, 71, 44, 50, 10, 67, 67, 71, 67, 67, 44, 50, + 10, 67, 67, 71, 67, 84, 44, 50, 10, 67, 67, 71, 84, 67, 44, 50, 10, 67, 67, 71, 84, 84, 44, + 50, 10, 67, 67, 71, 71, 65, 44, 50, 10, 67, 67, 71, 71, 71, 44, 50, 10, 67, 84, 65, 65, 65, + 44, 50, 10, 67, 84, 65, 65, 71, 44, 50, 10, 67, 84, 65, 67, 67, 44, 50, 10, 67, 84, 65, 67, + 84, 44, 50, 10, 67, 84, 65, 84, 67, 44, 50, 10, 67, 84, 65, 84, 84, 44, 50, 10, 67, 84, 65, + 71, 65, 44, 50, 10, 67, 84, 65, 71, 71, 44, 50, 10, 67, 84, 67, 65, 67, 44, 50, 10, 67, 84, + 67, 65, 84, 44, 50, 10, 67, 84, 67, 67, 65, 44, 50, 10, 67, 84, 67, 67, 71, 44, 50, 10, 67, + 84, 67, 84, 65, 44, 50, 10, 67, 84, 67, 84, 71, 44, 50, 10, 67, 84, 67, 71, 67, 44, 50, 10, + 67, 84, 67, 71, 84, 44, 50, 10, 67, 84, 84, 65, 67, 44, 50, 10, 67, 84, 84, 65, 84, 44, 50, + 10, 67, 84, 84, 67, 65, 44, 50, 10, 67, 84, 84, 67, 71, 44, 50, 10, 67, 84, 84, 84, 65, 44, + 50, 10, 67, 84, 84, 84, 71, 44, 50, 10, 67, 84, 84, 71, 67, 44, 50, 10, 67, 84, 84, 71, 84, + 44, 50, 10, 67, 84, 71, 65, 65, 44, 50, 10, 67, 84, 71, 65, 71, 44, 50, 10, 67, 84, 71, 67, + 67, 44, 50, 10, 67, 84, 71, 67, 84, 44, 50, 10, 67, 84, 71, 84, 67, 44, 50, 10, 67, 84, 71, + 84, 84, 44, 50, 10, 67, 84, 71, 71, 65, 44, 50, 10, 67, 84, 71, 71, 71, 44, 50, 10, 67, 71, + 65, 65, 67, 44, 50, 10, 67, 71, 65, 65, 84, 44, 50, 10, 67, 71, 65, 67, 65, 44, 50, 10, 67, + 71, 65, 67, 71, 44, 50, 10, 67, 71, 65, 84, 65, 44, 50, 10, 67, 71, 65, 84, 71, 44, 50, 10, + 67, 71, 65, 71, 67, 44, 50, 10, 67, 71, 65, 71, 84, 44, 50, 10, 67, 71, 67, 65, 65, 44, 50, + 10, 67, 71, 67, 65, 71, 44, 50, 10, 67, 71, 67, 67, 67, 44, 50, 10, 67, 71, 67, 67, 84, 44, + 50, 10, 67, 71, 67, 84, 67, 44, 50, 10, 67, 71, 67, 84, 84, 44, 50, 10, 67, 71, 67, 71, 65, + 44, 50, 10, 67, 71, 67, 71, 71, 44, 50, 10, 67, 71, 84, 65, 65, 44, 50, 10, 67, 71, 84, 65, + 71, 44, 50, 10, 67, 71, 84, 67, 67, 44, 50, 10, 67, 71, 84, 67, 84, 44, 50, 10, 67, 71, 84, + 84, 67, 44, 50, 10, 67, 71, 84, 84, 84, 44, 50, 10, 67, 71, 84, 71, 65, 44, 50, 10, 67, 71, + 84, 71, 71, 44, 50, 10, 67, 71, 71, 65, 67, 44, 50, 10, 67, 71, 71, 65, 84, 44, 50, 10, 67, + 71, 71, 67, 65, 44, 50, 10, 67, 71, 71, 67, 71, 44, 50, 10, 67, 71, 71, 84, 65, 44, 50, 10, + 67, 71, 71, 84, 71, 44, 50, 10, 67, 71, 71, 71, 67, 44, 50, 10, 67, 71, 71, 71, 84, 44, 50, + 10, 84, 65, 65, 65, 67, 44, 50, 10, 84, 65, 65, 65, 84, 44, 50, 10, 84, 65, 65, 67, 65, 44, + 50, 10, 84, 65, 65, 67, 71, 44, 50, 10, 84, 65, 65, 84, 65, 44, 50, 10, 84, 65, 65, 84, 71, + 44, 50, 10, 84, 65, 65, 71, 67, 44, 50, 10, 84, 65, 65, 71, 84, 44, 50, 10, 84, 65, 67, 65, + 65, 44, 50, 10, 84, 65, 67, 65, 71, 44, 50, 10, 84, 65, 67, 67, 67, 44, 50, 10, 84, 65, 67, + 67, 84, 44, 50, 10, 84, 65, 67, 84, 67, 44, 50, 10, 84, 65, 67, 84, 84, 44, 50, 10, 84, 65, + 67, 71, 65, 44, 50, 10, 84, 65, 67, 71, 71, 44, 50, 10, 84, 65, 84, 65, 65, 44, 50, 10, 84, + 65, 84, 65, 71, 44, 50, 10, 84, 65, 84, 67, 67, 44, 50, 10, 84, 65, 84, 67, 84, 44, 50, 10, + 84, 65, 84, 84, 67, 44, 50, 10, 84, 65, 84, 84, 84, 44, 50, 10, 84, 65, 84, 71, 65, 44, 50, + 10, 84, 65, 84, 71, 71, 44, 50, 10, 84, 65, 71, 65, 67, 44, 50, 10, 84, 65, 71, 65, 84, 44, + 50, 10, 84, 65, 71, 67, 65, 44, 50, 10, 84, 65, 71, 67, 71, 44, 50, 10, 84, 65, 71, 84, 65, + 44, 50, 10, 84, 65, 71, 84, 71, 44, 50, 10, 84, 65, 71, 71, 67, 44, 50, 10, 84, 65, 71, 71, + 84, 44, 50, 10, 84, 67, 65, 65, 65, 44, 50, 10, 84, 67, 65, 65, 71, 44, 50, 10, 84, 67, 65, + 67, 67, 44, 50, 10, 84, 67, 65, 67, 84, 44, 50, 10, 84, 67, 65, 84, 67, 44, 50, 10, 84, 67, + 65, 84, 84, 44, 50, 10, 84, 67, 65, 71, 65, 44, 50, 10, 84, 67, 65, 71, 71, 44, 50, 10, 84, + 67, 67, 65, 67, 44, 50, 10, 84, 67, 67, 65, 84, 44, 50, 10, 84, 67, 67, 67, 65, 44, 50, 10, + 84, 67, 67, 67, 71, 44, 50, 10, 84, 67, 67, 84, 65, 44, 50, 10, 84, 67, 67, 84, 71, 44, 50, + 10, 84, 67, 67, 71, 67, 44, 50, 10, 84, 67, 67, 71, 84, 44, 50, 10, 84, 67, 84, 65, 67, 44, + 50, 10, 84, 67, 84, 65, 84, 44, 50, 10, 84, 67, 84, 67, 65, 44, 50, 10, 84, 67, 84, 67, 71, + 44, 50, 10, 84, 67, 84, 84, 65, 44, 50, 10, 84, 67, 84, 84, 71, 44, 50, 10, 84, 67, 84, 71, + 67, 44, 50, 10, 84, 67, 84, 71, 84, 44, 50, 10, 84, 67, 71, 65, 65, 44, 50, 10, 84, 67, 71, + 65, 71, 44, 50, 10, 84, 67, 71, 67, 67, 44, 50, 10, 84, 67, 71, 67, 84, 44, 50, 10, 84, 67, + 71, 84, 67, 44, 50, 10, 84, 67, 71, 84, 84, 44, 50, 10, 84, 67, 71, 71, 65, 44, 50, 10, 84, + 67, 71, 71, 71, 44, 50, 10, 84, 84, 65, 65, 65, 44, 50, 10, 84, 84, 65, 65, 71, 44, 50, 10, + 84, 84, 65, 67, 67, 44, 50, 10, 84, 84, 65, 67, 84, 44, 50, 10, 84, 84, 65, 84, 67, 44, 50, + 10, 84, 84, 65, 84, 84, 44, 50, 10, 84, 84, 65, 71, 65, 44, 50, 10, 84, 84, 65, 71, 71, 44, + 50, 10, 84, 84, 67, 65, 67, 44, 50, 10, 84, 84, 67, 65, 84, 44, 50, 10, 84, 84, 67, 67, 65, + 44, 50, 10, 84, 84, 67, 67, 71, 44, 50, 10, 84, 84, 67, 84, 65, 44, 50, 10, 84, 84, 67, 84, + 71, 44, 50, 10, 84, 84, 67, 71, 67, 44, 50, 10, 84, 84, 67, 71, 84, 44, 50, 10, 84, 84, 84, + 65, 67, 44, 50, 10, 84, 84, 84, 65, 84, 44, 50, 10, 84, 84, 84, 67, 65, 44, 50, 10, 84, 84, + 84, 67, 71, 44, 50, 10, 84, 84, 84, 84, 65, 44, 50, 10, 84, 84, 84, 84, 71, 44, 50, 10, 84, + 84, 84, 71, 67, 44, 50, 10, 84, 84, 84, 71, 84, 44, 50, 10, 84, 84, 71, 65, 65, 44, 50, 10, + 84, 84, 71, 65, 71, 44, 50, 10, 84, 84, 71, 67, 67, 44, 50, 10, 84, 84, 71, 67, 84, 44, 50, + 10, 84, 84, 71, 84, 67, 44, 50, 10, 84, 84, 71, 84, 84, 44, 50, 10, 84, 84, 71, 71, 65, 44, + 50, 10, 84, 84, 71, 71, 71, 44, 50, 10, 84, 71, 65, 65, 67, 44, 50, 10, 84, 71, 65, 65, 84, + 44, 50, 10, 84, 71, 65, 67, 65, 44, 50, 10, 84, 71, 65, 67, 71, 44, 50, 10, 84, 71, 65, 84, + 65, 44, 50, 10, 84, 71, 65, 84, 71, 44, 50, 10, 84, 71, 65, 71, 67, 44, 50, 10, 84, 71, 65, + 71, 84, 44, 50, 10, 84, 71, 67, 65, 65, 44, 50, 10, 84, 71, 67, 65, 71, 44, 50, 10, 84, 71, + 67, 67, 67, 44, 50, 10, 84, 71, 67, 67, 84, 44, 50, 10, 84, 71, 67, 84, 67, 44, 50, 10, 84, + 71, 67, 84, 84, 44, 50, 10, 84, 71, 67, 71, 65, 44, 50, 10, 84, 71, 67, 71, 71, 44, 50, 10, + 84, 71, 84, 65, 65, 44, 50, 10, 84, 71, 84, 65, 71, 44, 50, 10, 84, 71, 84, 67, 67, 44, 50, + 10, 84, 71, 84, 67, 84, 44, 50, 10, 84, 71, 84, 84, 67, 44, 50, 10, 84, 71, 84, 84, 84, 44, + 50, 10, 84, 71, 84, 71, 65, 44, 50, 10, 84, 71, 84, 71, 71, 44, 50, 10, 84, 71, 71, 65, 67, + 44, 50, 10, 84, 71, 71, 65, 84, 44, 50, 10, 84, 71, 71, 67, 65, 44, 50, 10, 84, 71, 71, 67, + 71, 44, 50, 10, 84, 71, 71, 84, 65, 44, 50, 10, 84, 71, 71, 84, 71, 44, 50, 10, 84, 71, 71, + 71, 67, 44, 50, 10, 84, 71, 71, 71, 84, 44, 50, 10, 71, 65, 65, 65, 65, 44, 50, 10, 71, 65, + 65, 65, 71, 44, 50, 10, 71, 65, 65, 67, 67, 44, 50, 10, 71, 65, 65, 67, 84, 44, 50, 10, 71, + 65, 65, 84, 67, 44, 50, 10, 71, 65, 65, 84, 84, 44, 50, 10, 71, 65, 65, 71, 65, 44, 50, 10, + 71, 65, 65, 71, 71, 44, 50, 10, 71, 65, 67, 65, 67, 44, 50, 10, 71, 65, 67, 65, 84, 44, 50, + 10, 71, 65, 67, 67, 65, 44, 50, 10, 71, 65, 67, 67, 71, 44, 50, 10, 71, 65, 67, 84, 65, 44, + 50, 10, 71, 65, 67, 84, 71, 44, 50, 10, 71, 65, 67, 71, 67, 44, 50, 10, 71, 65, 67, 71, 84, + 44, 50, 10, 71, 65, 84, 65, 67, 44, 50, 10, 71, 65, 84, 65, 84, 44, 50, 10, 71, 65, 84, 67, + 65, 44, 50, 10, 71, 65, 84, 67, 71, 44, 50, 10, 71, 65, 84, 84, 65, 44, 50, 10, 71, 65, 84, + 84, 71, 44, 50, 10, 71, 65, 84, 71, 67, 44, 50, 10, 71, 65, 84, 71, 84, 44, 50, 10, 71, 65, + 71, 65, 65, 44, 50, 10, 71, 65, 71, 65, 71, 44, 50, 10, 71, 65, 71, 67, 67, 44, 50, 10, 71, + 65, 71, 67, 84, 44, 50, 10, 71, 65, 71, 84, 67, 44, 50, 10, 71, 65, 71, 84, 84, 44, 50, 10, + 71, 65, 71, 71, 65, 44, 50, 10, 71, 65, 71, 71, 71, 44, 50, 10, 71, 67, 65, 65, 67, 44, 50, + 10, 71, 67, 65, 65, 84, 44, 50, 10, 71, 67, 65, 67, 65, 44, 50, 10, 71, 67, 65, 67, 71, 44, + 50, 10, 71, 67, 65, 84, 65, 44, 50, 10, 71, 67, 65, 84, 71, 44, 50, 10, 71, 67, 65, 71, 67, + 44, 50, 10, 71, 67, 65, 71, 84, 44, 50, 10, 71, 67, 67, 65, 65, 44, 50, 10, 71, 67, 67, 65, + 71, 44, 50, 10, 71, 67, 67, 67, 67, 44, 50, 10, 71, 67, 67, 67, 84, 44, 50, 10, 71, 67, 67, + 84, 67, 44, 50, 10, 71, 67, 67, 84, 84, 44, 50, 10, 71, 67, 67, 71, 65, 44, 50, 10, 71, 67, + 67, 71, 71, 44, 50, 10, 71, 67, 84, 65, 65, 44, 50, 10, 71, 67, 84, 65, 71, 44, 50, 10, 71, + 67, 84, 67, 67, 44, 50, 10, 71, 67, 84, 67, 84, 44, 50, 10, 71, 67, 84, 84, 67, 44, 50, 10, + 71, 67, 84, 84, 84, 44, 50, 10, 71, 67, 84, 71, 65, 44, 50, 10, 71, 67, 84, 71, 71, 44, 50, + 10, 71, 67, 71, 65, 67, 44, 50, 10, 71, 67, 71, 65, 84, 44, 50, 10, 71, 67, 71, 67, 65, 44, + 50, 10, 71, 67, 71, 67, 71, 44, 50, 10, 71, 67, 71, 84, 65, 44, 50, 10, 71, 67, 71, 84, 71, + 44, 50, 10, 71, 67, 71, 71, 67, 44, 50, 10, 71, 67, 71, 71, 84, 44, 50, 10, 71, 84, 65, 65, + 67, 44, 50, 10, 71, 84, 65, 65, 84, 44, 50, 10, 71, 84, 65, 67, 65, 44, 50, 10, 71, 84, 65, + 67, 71, 44, 50, 10, 71, 84, 65, 84, 65, 44, 50, 10, 71, 84, 65, 84, 71, 44, 50, 10, 71, 84, + 65, 71, 67, 44, 50, 10, 71, 84, 65, 71, 84, 44, 50, 10, 71, 84, 67, 65, 65, 44, 50, 10, 71, + 84, 67, 65, 71, 44, 50, 10, 71, 84, 67, 67, 67, 44, 50, 10, 71, 84, 67, 67, 84, 44, 50, 10, + 71, 84, 67, 84, 67, 44, 50, 10, 71, 84, 67, 84, 84, 44, 50, 10, 71, 84, 67, 71, 65, 44, 50, + 10, 71, 84, 67, 71, 71, 44, 50, 10, 71, 84, 84, 65, 65, 44, 50, 10, 71, 84, 84, 65, 71, 44, + 50, 10, 71, 84, 84, 67, 67, 44, 50, 10, 71, 84, 84, 67, 84, 44, 50, 10, 71, 84, 84, 84, 67, + 44, 50, 10, 71, 84, 84, 84, 84, 44, 50, 10, 71, 84, 84, 71, 65, 44, 50, 10, 71, 84, 84, 71, + 71, 44, 50, 10, 71, 84, 71, 65, 67, 44, 50, 10, 71, 84, 71, 65, 84, 44, 50, 10, 71, 84, 71, + 67, 65, 44, 50, 10, 71, 84, 71, 67, 71, 44, 50, 10, 71, 84, 71, 84, 65, 44, 50, 10, 71, 84, + 71, 84, 71, 44, 50, 10, 71, 84, 71, 71, 67, 44, 50, 10, 71, 84, 71, 71, 84, 44, 50, 10, 71, + 71, 65, 65, 65, 44, 50, 10, 71, 71, 65, 65, 71, 44, 50, 10, 71, 71, 65, 67, 67, 44, 50, 10, + 71, 71, 65, 67, 84, 44, 50, 10, 71, 71, 65, 84, 67, 44, 50, 10, 71, 71, 65, 84, 84, 44, 50, + 10, 71, 71, 65, 71, 65, 44, 50, 10, 71, 71, 65, 71, 71, 44, 50, 10, 71, 71, 67, 65, 67, 44, + 50, 10, 71, 71, 67, 65, 84, 44, 50, 10, 71, 71, 67, 67, 65, 44, 50, 10, 71, 71, 67, 67, 71, + 44, 50, 10, 71, 71, 67, 84, 65, 44, 50, 10, 71, 71, 67, 84, 71, 44, 50, 10, 71, 71, 67, 71, + 67, 44, 50, 10, 71, 71, 67, 71, 84, 44, 50, 10, 71, 71, 84, 65, 67, 44, 50, 10, 71, 71, 84, + 65, 84, 44, 50, 10, 71, 71, 84, 67, 65, 44, 50, 10, 71, 71, 84, 67, 71, 44, 50, 10, 71, 71, + 84, 84, 65, 44, 50, 10, 71, 71, 84, 84, 71, 44, 50, 10, 71, 71, 84, 71, 67, 44, 50, 10, 71, + 71, 84, 71, 84, 44, 50, 10, 71, 71, 71, 65, 65, 44, 50, 10, 71, 71, 71, 65, 71, 44, 50, 10, + 71, 71, 71, 67, 67, 44, 50, 10, 71, 71, 71, 67, 84, 44, 50, 10, 71, 71, 71, 84, 67, 44, 50, + 10, 71, 71, 71, 84, 84, 44, 50, 10, 71, 71, 71, 71, 65, 44, 50, 10, 71, 71, 71, 71, 71, 44, + 50, 10, + ]; + + const CSV_ABUNDANCE_MIN_2: &[u8] = &[65, 65, 65, 65, 65, 44, 51, 10]; + + #[test] + fn csv() { + let mut outfile = Vec::new(); + let counter = &*COUNTER; + + crate::dump::csv(&mut outfile, counter, 1).unwrap(); + assert_eq!(&outfile[..], &CSV_ABUNDANCE_MIN_1[..]); + + outfile.clear(); + + crate::dump::csv(&mut outfile, counter, 2).unwrap(); + assert_eq!(&outfile[..], &CSV_ABUNDANCE_MIN_2[..]); + } + + const SOLID_ABUNDANCE_MIN_1: &[u8] = &[ + 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 165, 192, 49, 1, 0, 0, 0, 64, 176, 75, 255, 200, 132, + 48, 156, 2, 70, 0, 241, 137, 65, 0, 0, 0, + ]; + + const SOLID_ABUNDANCE_MIN_2: &[u8] = &[ + 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 165, 192, 49, 1, 0, 0, 0, 130, 48, 61, 232, 95, 153, 16, + 140, 175, 17, 95, 201, 40, 124, 65, 0, 0, 0, + ]; + + #[test] + fn solid() { + let mut outfile = Vec::new(); + let counter = &*COUNTER; + + crate::dump::solid(&mut outfile, counter, 1).unwrap(); + assert_eq!(&outfile[..], &SOLID_ABUNDANCE_MIN_1[..]); + + outfile.clear(); + + crate::dump::solid(&mut outfile, counter, 2).unwrap(); + assert_eq!(&outfile[..], &SOLID_ABUNDANCE_MIN_2[..]); + } + + const SPECTRUM_ABUNDANCE_MIN_1: &[u8] = &[ + 48, 44, 48, 10, 49, 44, 48, 10, 50, 44, 53, 49, 49, 10, 51, 44, 49, 10, 52, 44, 48, 10, 53, + 44, 48, 10, 54, 44, 48, 10, 55, 44, 48, 10, 56, 44, 48, 10, 57, 44, 48, 10, 49, 48, 44, 48, + 10, 49, 49, 44, 48, 10, 49, 50, 44, 48, 10, 49, 51, 44, 48, 10, 49, 52, 44, 48, 10, 49, 53, + 44, 48, 10, 49, 54, 44, 48, 10, 49, 55, 44, 48, 10, 49, 56, 44, 48, 10, 49, 57, 44, 48, 10, + 50, 48, 44, 48, 10, 50, 49, 44, 48, 10, 50, 50, 44, 48, 10, 50, 51, 44, 48, 10, 50, 52, 44, + 48, 10, 50, 53, 44, 48, 10, 50, 54, 44, 48, 10, 50, 55, 44, 48, 10, 50, 56, 44, 48, 10, 50, + 57, 44, 48, 10, 51, 48, 44, 48, 10, 51, 49, 44, 48, 10, 51, 50, 44, 48, 10, 51, 51, 44, 48, + 10, 51, 52, 44, 48, 10, 51, 53, 44, 48, 10, 51, 54, 44, 48, 10, 51, 55, 44, 48, 10, 51, 56, + 44, 48, 10, 51, 57, 44, 48, 10, 52, 48, 44, 48, 10, 52, 49, 44, 48, 10, 52, 50, 44, 48, 10, + 52, 51, 44, 48, 10, 52, 52, 44, 48, 10, 52, 53, 44, 48, 10, 52, 54, 44, 48, 10, 52, 55, 44, + 48, 10, 52, 56, 44, 48, 10, 52, 57, 44, 48, 10, 53, 48, 44, 48, 10, 53, 49, 44, 48, 10, 53, + 50, 44, 48, 10, 53, 51, 44, 48, 10, 53, 52, 44, 48, 10, 53, 53, 44, 48, 10, 53, 54, 44, 48, + 10, 53, 55, 44, 48, 10, 53, 56, 44, 48, 10, 53, 57, 44, 48, 10, 54, 48, 44, 48, 10, 54, 49, + 44, 48, 10, 54, 50, 44, 48, 10, 54, 51, 44, 48, 10, 54, 52, 44, 48, 10, 54, 53, 44, 48, 10, + 54, 54, 44, 48, 10, 54, 55, 44, 48, 10, 54, 56, 44, 48, 10, 54, 57, 44, 48, 10, 55, 48, 44, + 48, 10, 55, 49, 44, 48, 10, 55, 50, 44, 48, 10, 55, 51, 44, 48, 10, 55, 52, 44, 48, 10, 55, + 53, 44, 48, 10, 55, 54, 44, 48, 10, 55, 55, 44, 48, 10, 55, 56, 44, 48, 10, 55, 57, 44, 48, + 10, 56, 48, 44, 48, 10, 56, 49, 44, 48, 10, 56, 50, 44, 48, 10, 56, 51, 44, 48, 10, 56, 52, + 44, 48, 10, 56, 53, 44, 48, 10, 56, 54, 44, 48, 10, 56, 55, 44, 48, 10, 56, 56, 44, 48, 10, + 56, 57, 44, 48, 10, 57, 48, 44, 48, 10, 57, 49, 44, 48, 10, 57, 50, 44, 48, 10, 57, 51, 44, + 48, 10, 57, 52, 44, 48, 10, 57, 53, 44, 48, 10, 57, 54, 44, 48, 10, 57, 55, 44, 48, 10, 57, + 56, 44, 48, 10, 57, 57, 44, 48, 10, 49, 48, 48, 44, 48, 10, 49, 48, 49, 44, 48, 10, 49, 48, + 50, 44, 48, 10, 49, 48, 51, 44, 48, 10, 49, 48, 52, 44, 48, 10, 49, 48, 53, 44, 48, 10, 49, + 48, 54, 44, 48, 10, 49, 48, 55, 44, 48, 10, 49, 48, 56, 44, 48, 10, 49, 48, 57, 44, 48, 10, + 49, 49, 48, 44, 48, 10, 49, 49, 49, 44, 48, 10, 49, 49, 50, 44, 48, 10, 49, 49, 51, 44, 48, + 10, 49, 49, 52, 44, 48, 10, 49, 49, 53, 44, 48, 10, 49, 49, 54, 44, 48, 10, 49, 49, 55, 44, + 48, 10, 49, 49, 56, 44, 48, 10, 49, 49, 57, 44, 48, 10, 49, 50, 48, 44, 48, 10, 49, 50, 49, + 44, 48, 10, 49, 50, 50, 44, 48, 10, 49, 50, 51, 44, 48, 10, 49, 50, 52, 44, 48, 10, 49, 50, + 53, 44, 48, 10, 49, 50, 54, 44, 48, 10, 49, 50, 55, 44, 48, 10, 49, 50, 56, 44, 48, 10, 49, + 50, 57, 44, 48, 10, 49, 51, 48, 44, 48, 10, 49, 51, 49, 44, 48, 10, 49, 51, 50, 44, 48, 10, + 49, 51, 51, 44, 48, 10, 49, 51, 52, 44, 48, 10, 49, 51, 53, 44, 48, 10, 49, 51, 54, 44, 48, + 10, 49, 51, 55, 44, 48, 10, 49, 51, 56, 44, 48, 10, 49, 51, 57, 44, 48, 10, 49, 52, 48, 44, + 48, 10, 49, 52, 49, 44, 48, 10, 49, 52, 50, 44, 48, 10, 49, 52, 51, 44, 48, 10, 49, 52, 52, + 44, 48, 10, 49, 52, 53, 44, 48, 10, 49, 52, 54, 44, 48, 10, 49, 52, 55, 44, 48, 10, 49, 52, + 56, 44, 48, 10, 49, 52, 57, 44, 48, 10, 49, 53, 48, 44, 48, 10, 49, 53, 49, 44, 48, 10, 49, + 53, 50, 44, 48, 10, 49, 53, 51, 44, 48, 10, 49, 53, 52, 44, 48, 10, 49, 53, 53, 44, 48, 10, + 49, 53, 54, 44, 48, 10, 49, 53, 55, 44, 48, 10, 49, 53, 56, 44, 48, 10, 49, 53, 57, 44, 48, + 10, 49, 54, 48, 44, 48, 10, 49, 54, 49, 44, 48, 10, 49, 54, 50, 44, 48, 10, 49, 54, 51, 44, + 48, 10, 49, 54, 52, 44, 48, 10, 49, 54, 53, 44, 48, 10, 49, 54, 54, 44, 48, 10, 49, 54, 55, + 44, 48, 10, 49, 54, 56, 44, 48, 10, 49, 54, 57, 44, 48, 10, 49, 55, 48, 44, 48, 10, 49, 55, + 49, 44, 48, 10, 49, 55, 50, 44, 48, 10, 49, 55, 51, 44, 48, 10, 49, 55, 52, 44, 48, 10, 49, + 55, 53, 44, 48, 10, 49, 55, 54, 44, 48, 10, 49, 55, 55, 44, 48, 10, 49, 55, 56, 44, 48, 10, + 49, 55, 57, 44, 48, 10, 49, 56, 48, 44, 48, 10, 49, 56, 49, 44, 48, 10, 49, 56, 50, 44, 48, + 10, 49, 56, 51, 44, 48, 10, 49, 56, 52, 44, 48, 10, 49, 56, 53, 44, 48, 10, 49, 56, 54, 44, + 48, 10, 49, 56, 55, 44, 48, 10, 49, 56, 56, 44, 48, 10, 49, 56, 57, 44, 48, 10, 49, 57, 48, + 44, 48, 10, 49, 57, 49, 44, 48, 10, 49, 57, 50, 44, 48, 10, 49, 57, 51, 44, 48, 10, 49, 57, + 52, 44, 48, 10, 49, 57, 53, 44, 48, 10, 49, 57, 54, 44, 48, 10, 49, 57, 55, 44, 48, 10, 49, + 57, 56, 44, 48, 10, 49, 57, 57, 44, 48, 10, 50, 48, 48, 44, 48, 10, 50, 48, 49, 44, 48, 10, + 50, 48, 50, 44, 48, 10, 50, 48, 51, 44, 48, 10, 50, 48, 52, 44, 48, 10, 50, 48, 53, 44, 48, + 10, 50, 48, 54, 44, 48, 10, 50, 48, 55, 44, 48, 10, 50, 48, 56, 44, 48, 10, 50, 48, 57, 44, + 48, 10, 50, 49, 48, 44, 48, 10, 50, 49, 49, 44, 48, 10, 50, 49, 50, 44, 48, 10, 50, 49, 51, + 44, 48, 10, 50, 49, 52, 44, 48, 10, 50, 49, 53, 44, 48, 10, 50, 49, 54, 44, 48, 10, 50, 49, + 55, 44, 48, 10, 50, 49, 56, 44, 48, 10, 50, 49, 57, 44, 48, 10, 50, 50, 48, 44, 48, 10, 50, + 50, 49, 44, 48, 10, 50, 50, 50, 44, 48, 10, 50, 50, 51, 44, 48, 10, 50, 50, 52, 44, 48, 10, + 50, 50, 53, 44, 48, 10, 50, 50, 54, 44, 48, 10, 50, 50, 55, 44, 48, 10, 50, 50, 56, 44, 48, + 10, 50, 50, 57, 44, 48, 10, 50, 51, 48, 44, 48, 10, 50, 51, 49, 44, 48, 10, 50, 51, 50, 44, + 48, 10, 50, 51, 51, 44, 48, 10, 50, 51, 52, 44, 48, 10, 50, 51, 53, 44, 48, 10, 50, 51, 54, + 44, 48, 10, 50, 51, 55, 44, 48, 10, 50, 51, 56, 44, 48, 10, 50, 51, 57, 44, 48, 10, 50, 52, + 48, 44, 48, 10, 50, 52, 49, 44, 48, 10, 50, 52, 50, 44, 48, 10, 50, 52, 51, 44, 48, 10, 50, + 52, 52, 44, 48, 10, 50, 52, 53, 44, 48, 10, 50, 52, 54, 44, 48, 10, 50, 52, 55, 44, 48, 10, + 50, 52, 56, 44, 48, 10, 50, 52, 57, 44, 48, 10, 50, 53, 48, 44, 48, 10, 50, 53, 49, 44, 48, + 10, 50, 53, 50, 44, 48, 10, 50, 53, 51, 44, 48, 10, 50, 53, 52, 44, 48, 10, 50, 53, 53, 44, + 48, 10, + ]; + + #[test] + fn spectrum() { + let mut outfile = Vec::new(); + let counter = &*COUNTER; + + crate::dump::spectrum(&mut outfile, counter).unwrap(); + + assert_eq!(&outfile[..], &SPECTRUM_ABUNDANCE_MIN_1[..]); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use thiserror::Error; + +/// All error produce by Pcon +#[derive(Debug, Error)] +pub enum Error { + /// See enum [Cli] + #[error(transparent)] + Cli(#[from] Cli), + + /// See enum [IO] + #[error(transparent)] + IO(#[from] IO), +} + +/// Error emmit durring Cli parsing +#[derive(Debug, Error)] +pub enum Cli { + /// For efficient computation of canonical the kmer size must be odd + #[error("Kmer size must be odd")] + KMustBeOdd, + + /// Kmer is store 2bit form on 64bit we can't manage larger kmer + #[error("Kmer size must be lower than 32")] + KMustBeLower32, + + /// You must set at least one dump option csv, solid, spectrum + #[error("You must set at least one dump option csv, solid, spectrum")] + ADumpOptionMustBeSet, +} + +/// Error emmit when pcon try to work with file +#[repr(C)] +#[derive(Debug, Error)] +pub enum IO { + /// We can't create file. In C binding it's equal to 0 + #[error("We can't create file")] + CantCreateFile, + + /// We can't open file. In C binding it's equal to 1 + #[error("We can't open file")] + CantOpenFile, + + /// Error durring write in file. In C binding it's equal to 2 + #[error("Error durring write")] + ErrorDurringWrite, + + /// Error durring read file. In C binding it's equal to 3 + #[error("Error durring read")] + ErrorDurringRead, + + /// No error, this exist only for C binding it's the value of a new error pointer + #[error("Isn't error if you see this please contact the author with this message and a description of what you do with pcon")] + NoError, +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* std use */ +use std::io::Read; +use std::io::Write; +use std::sync::atomic; + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use byteorder::{ReadBytesExt, WriteBytesExt}; +use rayon::prelude::*; + +/* local use */ +use crate::error::IO::*; +use crate::error::*; + +pub type AtoCount = atomic::AtomicU8; +pub type Count = u8; + +/// A counter of kmer based on cocktail crate 2bit conversion, canonicalisation and hashing. +/// If kmer occure more than 256 other occurence are ignored +pub struct Counter { + pub k: u8, + count: Box<[AtoCount]>, +} + +impl Counter { + /// Create a new Counter for kmer size equal to k, record_buffer_len control the number of record read in same time + pub fn new(k: u8) -> Self { + let tmp = vec![0u8; cocktail::kmer::get_hash_space_size(k) as usize]; + + Self { + k, + count: unsafe { + std::mem::transmute::, Box<[AtoCount]>>(tmp.into_boxed_slice()) + }, + } + } + + /// Read the given an instance of io::Read as a fasta format and count kmer init + pub fn count_fasta(&mut self, fasta: R, record_buffer_len: usize) + where + R: std::io::Read, + { + let mut reader = noodles::fasta::Reader::new(std::io::BufReader::new(fasta)); + + let mut iter = reader.records(); + let mut records = Vec::with_capacity(record_buffer_len); + + let mut end = false; + while !end { + for i in 0..record_buffer_len { + if let Some(Ok(record)) = iter.next() { + records.push(record); + } else { + end = true; + records.truncate(i); + break; + } + } + + log::info!("Buffer len: {}", records.len()); + + records.par_iter().for_each(|record| { + if record.sequence().len() >= self.k as usize { + let tokenizer = + cocktail::tokenizer::Canonical::new(record.sequence().as_ref(), self.k); + + for canonical in tokenizer { + Counter::inc_canonic_ato(&self.count, canonical); + } + } + }); + + records.clear() + } + } + + /// Increase the counter of a kmer + pub fn inc(&mut self, kmer: u64) { + self.inc_canonic(cocktail::kmer::canonical(kmer, self.k)); + } + + /// Increase the counter of a canonical kmer + pub fn inc_canonic(&self, canonical: u64) { + Counter::inc_canonic_ato(&self.count, canonical); + } + + fn inc_canonic_ato(count: &[AtoCount], canonical: u64) { + let hash = (canonical >> 1) as usize; + + if count[hash].load(std::sync::atomic::Ordering::SeqCst) != std::u8::MAX { + count[hash].fetch_add(1, std::sync::atomic::Ordering::SeqCst); + } + } + + /// Get the counter of a kmer + pub fn get(&self, kmer: u64) -> Count { + self.get_canonic(cocktail::kmer::canonical(kmer, self.k)) + } + + /// Get the counter of a canonical kmer + pub fn get_canonic(&self, canonical: u64) -> Count { + let hash = (canonical >> 1) as usize; + + self.count[hash].load(atomic::Ordering::SeqCst) + } + + pub(crate) fn get_raw_count(&self) -> &[AtoCount] { + &self.count + } + + /// Serialize counter in given [std::io::Write] + pub fn serialize(&self, w: W) -> Result<()> + where + W: std::io::Write, + { + let mut writer = w; + let count = unsafe { &*(&self.count as *const Box<[AtoCount]> as *const Box<[Count]>) }; + + writer + .write_u8(self.k) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("Error durring serialize counter"))?; + + for b in count + .par_chunks(2usize.pow(25)) + .map(|in_buffer| { + let mut out_buffer = Vec::new(); + + { + let mut writer = + flate2::write::GzEncoder::new(&mut out_buffer, flate2::Compression::fast()); + + writer + .write_all(in_buffer) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("Error durring serialize counter"))?; + } + + Ok(out_buffer) + }) + .collect::>>>() + { + let buf = b?; + + writer + .write_all(&buf) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("Error durring serialize counter"))?; + } + + Ok(()) + } + + /// Deserialize counter for given [std::io::Read] + pub fn deserialize(r: R) -> Result + where + R: std::io::Read, + { + let mut reader = r; + + let k = reader + .read_u8() + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize counter"))?; + + let mut deflate = flate2::read::MultiGzDecoder::new(reader); + let mut tmp = vec![0u8; cocktail::kmer::get_hash_space_size(k) as usize].into_boxed_slice(); + + deflate + .read_exact(&mut tmp) + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize counter"))?; + + Ok(Self { + k, + count: unsafe { std::mem::transmute::, Box<[AtoCount]>>(tmp) }, + }) + } + + /// Convert a counter in a StaticCounter + pub fn into_static(self) -> crate::static_counter::StaticCounter { + crate::static_counter::StaticCounter { + k: self.k, + count: unsafe { std::mem::transmute::, Box<[Count]>>(self.count) }, + } + } +} + +#[cfg(test)] +mod tests { + use super::*; + + const FASTA_FILE: &[u8] = b">random_seq 0 +GTTCTGCAAATTAGAACAGACAATACACTGGCAGGCGTTGCGTTGGGGGAGATCTTCCGTAACGAGCCGGCATTTGTAAGAAAGAGATTTCGAGTAAATG +>random_seq 1 +AGGATAGAAGCTTAAGTACAAGATAATTCCCATAGAGGAAGGGTGGTATTACAGTGCCGCCTGTTGAAAGCCCCAATCCCGCTTCAATTGTTGAGCTCAG +"; + + const FASTA_COUNT: &[u8] = &[ + 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 2, 0, 2, 0, 0, 0, 2, 2, 1, 0, 1, 1, 1, 2, 0, 0, + 0, 1, 0, 2, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, + 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 2, 2, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, + 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 2, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 2, 2, 2, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 2, + 0, 0, 1, 0, 0, 0, 0, 2, 2, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 2, 0, 0, 0, 1, 0, 0, 0, 0, 0, + 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, + 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 2, 0, 1, 0, 0, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 2, 1, 0, 0, 1, 1, + 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, + 0, 0, 0, 1, 0, 2, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 2, 0, 1, 1, 0, 1, 0, 0, 0, + 0, 1, 2, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 2, 1, 0, 0, 1, 1, 0, 2, 0, 0, 0, 0, 0, 0, 2, 0, + 1, 1, 0, 0, 0, 0, 0, 0, 2, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 2, 0, 0, 0, 1, + 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 1, 0, 1, 0, 0, 0, + 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 2, 0, 0, 0, 0, 2, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 2, 1, 0, 0, 0, 0, 1, 0, 0, 1, + 0, 2, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, + 1, 1, + ]; + + #[test] + fn count_fasta() { + let mut counter = crate::counter::Counter::new(5); + + counter.count_fasta(FASTA_FILE, 1); + + unsafe { + assert_eq!( + std::mem::transmute::<&[AtoCount], &[Count]>(counter.get_raw_count()), + &FASTA_COUNT[..] + ); + } + } + + const FASTQ_FILE: &[u8] = b"@random_seq 0 +CCAGTAGCTTGGTGTACCGACGCTGTAGAGTTACAGTCTCGCGTGGATATAAGCTACTATCGACAGCAGGGTACGTTGTGAGTAATCTAACGTCATCTCT ++ +X-Ee--b`x6h6Yy,c7S`p_C*K~SAgs;LFManA`-oLL6!Pgi>`X'P~6np^M1jQ+xQc9.ZCTEn+Yy?5r+b|ta=EyHil%Z}>>(%y\\=IC +@random_seq 1 +TCAAATTGGCCGCCGCACAGTGAACCCGGAACTAAACAAGCACCGCACCGTTTGGTACACTTGAACACCGTATAAATTCATGGTGTTTATAAGCCAATGG ++ + + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +use crate::error; +use error::*; + +use crate::counter; +use crate::dump; +use crate::solid; + +/* Helper */ +fn cstr2string(c_path: *const std::os::raw::c_char) -> String { + unsafe { String::from_utf8_unchecked(std::ffi::CStr::from_ptr(c_path).to_bytes().to_owned()) } +} + +fn reader_from_c_path( + c_path: *const std::os::raw::c_char, +) -> Result>, error::IO> { + let path = cstr2string(c_path); + + let file = match std::fs::File::open(&path) { + Ok(f) => f, + Err(_) => return Err(IO::CantOpenFile), + }; + + let niffler = match niffler::get_reader(Box::new(file)) { + Ok(f) => f, + Err(_) => return Err(IO::ErrorDurringRead), + }; + + Ok(std::io::BufReader::new(niffler.0)) +} + +fn writer_from_c_path( + c_path: *const std::os::raw::c_char, +) -> Result>, error::IO> { + let path = cstr2string(c_path); + + let file = match std::fs::File::create(&path) { + Ok(f) => f, + Err(_) => return Err(IO::CantOpenFile), + }; + + Ok(std::io::BufWriter::new(Box::new(file))) +} + +/* Error section */ +/// Create a new pcon io error it's init to no error, see [error::IO]. In python corresponding string error is emit. +#[no_mangle] +pub extern "C" fn pcon_error_new() -> *mut error::IO { + Box::into_raw(Box::new(error::IO::NoError)) +} + +/// Free a pcon io error +/// +/// # Safety +/// It's safe +#[no_mangle] +pub unsafe extern "C" fn pcon_error_free(error: *mut error::IO) { + if error.is_null() { + return; + } + + let boxed = Box::from_raw(error); + + drop(boxed); +} + +/* Counter section */ +/// Create a new Counter. In python binding Counter is an object, new is the default constructor. +/// See [counter::Counter::new]. +#[no_mangle] +pub extern "C" fn pcon_counter_new(k: u8) -> *mut counter::Counter { + Box::into_raw(Box::new(counter::Counter::new(k))) +} + +/// Free a Counter. In Python use del on Counter object. +/// +/// # Safety +/// It's safe +#[no_mangle] +pub unsafe extern "C" fn pcon_counter_free(counter: *mut counter::Counter) { + if counter.is_null() { + return; + } + + let boxed = Box::from_raw(counter); + + drop(boxed); +} + +/// Perform count of kmer in fasta file in path, this file can be compress in gzip, bzip2, xz. +/// You must check value of `io_error` is equal to NoError before use `counter`. +/// +/// In Python it's count_fasta method of Counter object. +/// See [counter::Counter::count_fasta]. +#[no_mangle] +pub extern "C" fn pcon_counter_count_fasta( + counter: &mut counter::Counter, + c_path: *const std::os::raw::c_char, + read_buffer_len: usize, + io_error: &mut error::IO, +) { + let reader = reader_from_c_path(c_path); + + match reader { + Ok(r) => counter.count_fasta(r, read_buffer_len), + Err(e) => *io_error = e, + } +} + +/// Increase the count of `kmer` +/// +/// In Python it's inc method of Counter object. +/// See [counter::Counter::inc]. +#[no_mangle] +pub extern "C" fn pcon_counter_inc(counter: &mut counter::Counter, kmer: u64) { + counter.inc(kmer); +} + +/// Increase the count of a canonical `kmer` +/// +/// In Python it's inc_canonic method of Counter object. +/// See [counter::Counter::inc_canonic]. +#[no_mangle] +pub extern "C" fn pcon_counter_inc_canonic(counter: &mut counter::Counter, kmer: u64) { + counter.inc_canonic(kmer); +} + +/// Get the count of value `kmer` +/// +/// In Python it's get method of Counter object. +/// See [counter::Counter::get]. +#[no_mangle] +pub extern "C" fn pcon_counter_get(counter: &counter::Counter, kmer: u64) -> counter::Count { + counter.get(kmer) +} + +/// Get the count of value a canonical `kmer` +/// +/// In Python it's get_canonic method of Counter object. +/// See [counter::Counter::get_canonic]. +#[no_mangle] +pub extern "C" fn pcon_counter_get_canonic( + counter: &counter::Counter, + kmer: u64, +) -> counter::Count { + counter.get_canonic(kmer) +} + +/// Serialize Counter in path of file +/// You must check value of `io_error` is equal to NoError before use `counter` +/// +/// In Python it's serialize method of Counter object. +/// See [counter::Counter::serialize]. +#[no_mangle] +pub extern "C" fn pcon_serialize_counter( + counter: &counter::Counter, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let writer = writer_from_c_path(c_path); + + match writer { + Ok(w) => match counter.serialize(w) { + Ok(_) => (), + Err(_) => *io_error = IO::ErrorDurringWrite, + }, + Err(e) => *io_error = e, + } +} + +/// Deserialize Counter from `c_path` in `counter` +/// You must check value of `io_error` is equal to NoError before use `counter` +/// +/// In Python it's deserialize class method of Counter. +/// See [counter::Counter::deserialize]. +#[no_mangle] +pub extern "C" fn pcon_deserialize_counter( + counter: &mut counter::Counter, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let reader = reader_from_c_path(c_path); + + match reader { + Ok(r) => match counter::Counter::deserialize(r) { + Ok(c) => *counter = c, + Err(_) => *io_error = IO::ErrorDurringRead, + }, + Err(e) => *io_error = e, + } +} + +/* solid section */ +/// Create a new Solid. In python binding Solid is an object, new is the default constructor. +/// See [solid::Solid::new] +#[no_mangle] +pub extern "C" fn pcon_solid_new(k: u8) -> *mut solid::Solid { + Box::into_raw(Box::new(solid::Solid::new(k))) +} + +/// Create a new Solid from value in Counter +/// In python binding, this is a Solid class method from_counter. +/// See [solid::Solid::from_counter]. +#[no_mangle] +pub extern "C" fn pcon_solid_from_counter( + counter: &counter::Counter, + abundance: counter::Count, +) -> *mut solid::Solid { + Box::into_raw(Box::new(solid::Solid::from_counter(counter, abundance))) +} + +/// Free a Solid. In Python use del on Solid object. +/// +/// # Safety +/// It's safe +#[no_mangle] +pub unsafe extern "C" fn pcon_solid_free(solid: *mut solid::Solid) { + if solid.is_null() { + return; + } + + let boxed = Box::from_raw(solid); + + drop(boxed); +} + +/// Set the solidity status of `kmer` to `value` +/// +/// In Python it's set method of Solid object. +/// See [solid::Solid::set]. +#[no_mangle] +pub extern "C" fn pcon_solid_set(solid: &mut solid::Solid, kmer: u64, value: bool) { + solid.set(kmer, value); +} + +/// Set the solidity status of a canonical `kmer` to `value` +/// +/// In Python it's set_canonic method of Solid object. +/// See [solid::Solid::set_canonic]. +#[no_mangle] +pub extern "C" fn pcon_solid_set_canonic(solid: &mut solid::Solid, kmer: u64, value: bool) { + solid.set_canonic(kmer, value); +} + +/// Get the solidity status of `kmer` +/// +/// In Python it's get method of Solid object. +/// See [solid::Solid::get]. +#[no_mangle] +pub extern "C" fn pcon_solid_get(solid: &mut solid::Solid, kmer: u64) -> bool { + solid.get(kmer) +} + +/// Get the solidity status of a canonical `kmer` +/// +/// In Python it's get_canonic method of Solid object. +/// See [solid::Solid::get_canonic]. +#[no_mangle] +pub extern "C" fn pcon_solid_get_canonic(solid: &mut solid::Solid, kmer: u64) -> bool { + solid.get_canonic(kmer) +} + +/// Serialize Solid in path of file +/// You must check value of `io_error` is equal to NoError before use `solid` +/// +/// In Python it's serialize method of Solid object. +/// See [solid::Solid::serialize]. +#[no_mangle] +pub extern "C" fn pcon_serialize_solid( + solid: &solid::Solid, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let writer = writer_from_c_path(c_path); + + match writer { + Ok(w) => match solid.serialize(w) { + Ok(_) => (), + Err(_) => *io_error = IO::ErrorDurringWrite, + }, + Err(e) => *io_error = e, + } +} + +/// Deserialize Solid from `c_path` in `counter` +/// You must check value of `io_error` is equal to NoError before use `solid` +/// +/// In Python it's deserialize class method of solid. +/// See [solid::Solid::deserialize]. +#[no_mangle] +pub extern "C" fn pcon_deserialize_solid( + solid: &mut solid::Solid, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let reader = reader_from_c_path(c_path); + + match reader { + Ok(r) => match solid::Solid::deserialize(r) { + Ok(s) => *solid = s, + Err(_) => *io_error = IO::ErrorDurringRead, + }, + Err(e) => *io_error = e, + } +} + +/* Dump section */ +/// See [dump::csv]. +/// You must check value of `io_error` is equal to NoError to be sure no problem occure durring write +/// +/// In Python it's csv function of dump module. +#[no_mangle] +pub extern "C" fn pcon_dump_csv( + counter: &counter::Counter, + abundance: counter::Count, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let writer = writer_from_c_path(c_path); + + match writer { + Ok(w) => match dump::csv(w, counter, abundance) { + Ok(_) => (), + Err(_) => *io_error = IO::ErrorDurringWrite, + }, + Err(e) => *io_error = e, + } +} + +/// See [dump::solid()]. +/// You must check value of `io_error` is equal to NoError to be sure no problem occure durring write +/// +/// In Python it's solid function of dump module. +#[no_mangle] +pub extern "C" fn pcon_dump_solid( + counter: &counter::Counter, + abundance: counter::Count, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let writer = writer_from_c_path(c_path); + + match writer { + Ok(w) => match dump::solid(w, counter, abundance) { + Ok(_) => (), + Err(_) => *io_error = IO::ErrorDurringWrite, + }, + Err(e) => *io_error = e, + } +} + +/// See [dump::spectrum]. +/// You must check value of `io_error` is equal to NoError to be sure no problem occure durring write +/// +/// In Python it's spectrum function of dump module. +#[no_mangle] +pub extern "C" fn pcon_dump_spectrum( + counter: &counter::Counter, + c_path: *const std::os::raw::c_char, + io_error: &mut error::IO, +) { + let writer = writer_from_c_path(c_path); + + match writer { + Ok(w) => match dump::spectrum(w, counter) { + Ok(_) => (), + Err(_) => *io_error = IO::ErrorDurringWrite, + }, + Err(e) => *io_error = e, + } +} + +/// See [set_count_nb_threads] +#[no_mangle] +pub extern "C" fn pcon_set_nb_threads(nb_threads: usize) { + crate::set_nb_threads(nb_threads); +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::Result; +use clap::Parser; + +use pcon::*; + +fn main() -> Result<()> { + let params = cli::Command::parse(); + + if let Some(level) = cli::i82level(params.verbosity) { + env_logger::builder() + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .filter_level(level.to_level_filter()) + .init(); + } else { + env_logger::Builder::from_env("PCON_LOG") + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .init(); + } + + if let Some(threads) = params.threads { + log::info!("Set number of threads to {}", threads); + + set_nb_threads(threads); + } + + match params.subcmd { + cli::SubCommand::Count(params) => count::count(params), + cli::SubCommand::Dump(params) => dump::dump(params), + } +} +/* std use */ +use std::io::Read; + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use byteorder::ReadBytesExt; + +/* local use */ +use crate::counter; +use crate::error::IO::*; +use crate::error::*; + +/// A struct to get a fast access to count +pub struct StaticCounter { + pub k: u8, + pub(crate) count: Box<[u8]>, +} + +impl StaticCounter { + /// Deserialize counter for given [std::io::Read] + pub fn deserialize(r: R) -> Result + where + R: std::io::Read, + { + let mut reader = r; + + let k = reader + .read_u8() + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize counter"))?; + + let mut deflate = flate2::read::MultiGzDecoder::new(reader); + let mut tmp = vec![0u8; cocktail::kmer::get_hash_space_size(k) as usize].into_boxed_slice(); + + deflate + .read_exact(&mut tmp) + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize counter"))?; + + Ok(Self { k, count: tmp }) + } + + /// Get the counter of a kmer + pub fn get(&self, kmer: u64) -> counter::Count { + self.get_canonic(cocktail::kmer::canonical(kmer, self.k)) + } + + /// Get the counter of a canonical kmer + pub fn get_canonic(&self, canonical: u64) -> counter::Count { + let hash = (canonical >> 1) as usize; + + self.count[hash] + } + + pub(crate) fn get_raw_count(&self) -> &[counter::Count] { + &self.count + } +} + +#[cfg(test)] +mod tests { + const FASTA_FILE: &[u8] = b">random_seq 0 +GTTCTGCAAATTAGAACAGACAATACACTGGCAGGCGTTGCGTTGGGGGAGATCTTCCGTAACGAGCCGGCATTTGTAAGAAAGAGATTTCGAGTAAATG +>random_seq 1 +AGGATAGAAGCTTAAGTACAAGATAATTCCCATAGAGGAAGGGTGGTATTACAGTGCCGCCTGTTGAAAGCCCCAATCCCGCTTCAATTGTTGAGCTCAG +"; + + const FASTA_COUNT: &[u8] = &[ + 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 2, 0, 2, 0, 0, 0, 2, 2, 1, 0, 1, 1, 1, 2, 0, 0, + 0, 1, 0, 2, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, + 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 2, 2, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, + 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 2, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 2, 2, 2, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 2, + 0, 0, 1, 0, 0, 0, 0, 2, 2, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 2, 0, 0, 0, 1, 0, 0, 0, 0, 0, + 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, + 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 2, 0, 1, 0, 0, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 2, 1, 0, 0, 1, 1, + 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, + 0, 0, 0, 1, 0, 2, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 2, 0, 1, 1, 0, 1, 0, 0, 0, + 0, 1, 2, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 2, 1, 0, 0, 1, 1, 0, 2, 0, 0, 0, 0, 0, 0, 2, 0, + 1, 1, 0, 0, 0, 0, 0, 0, 2, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 2, 0, 0, 0, 1, + 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 1, 0, 1, 0, 0, 0, + 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 2, 0, 0, 0, 0, 2, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, + 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 2, 1, 0, 0, 0, 0, 1, 0, 0, 1, + 0, 2, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, + 1, 1, + ]; + + #[test] + fn count_fasta() { + let mut counter = crate::counter::Counter::new(5); + + counter.count_fasta(FASTA_FILE, 1); + let static_count = counter.into_static(); + + assert_eq!(static_count.get_raw_count(), &FASTA_COUNT[..]); + } + + lazy_static::lazy_static! { + static ref COUNTER: crate::static_counter::StaticCounter = { + let mut counter = crate::counter::Counter::new(5); + + for i in 0..cocktail::kmer::get_kmer_space_size(5) { + counter.inc(i); + } + + counter.into_static() + }; + } + + const ALLKMERSEEONE: &[u8] = &[ + 5, 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 237, 208, 1, 9, 0, 0, 0, 128, 32, 232, 255, 232, 134, + 148, 19, 100, 233, 1, 1, 118, 18, 53, 208, 0, 2, 0, 0, + ]; + + #[test] + fn deserialize() { + let counter = + crate::static_counter::StaticCounter::deserialize(&ALLKMERSEEONE[..]).unwrap(); + + assert_eq!(counter.k, COUNTER.k); + + for (a, b) in counter + .get_raw_count() + .iter() + .zip(COUNTER.get_raw_count().iter()) + { + assert_eq!(a, b); + } + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +#[derive(clap::Parser, Debug)] +#[clap(version = "0.1", author = "Pierre Marijon ")] +/// Prompt COuNter is short kmer counter +pub struct Command { + #[clap(subcommand)] + pub subcmd: SubCommand, + + #[clap(short = 't', long = "threads")] + /// Number of thread use by pcon to count, 0 use all avaible core, default value 0 + pub threads: Option, + + #[clap(short = 'v', long = "verbosity", parse(from_occurrences))] + /// verbosity level also control by environment variable PCON_LOG if flag is set PCON_LOG value is ignored + pub verbosity: i8, +} + +#[derive(clap::Parser, Debug)] +pub enum SubCommand { + Count(SubCommandCount), + Dump(SubCommandDump), +} + +#[derive(clap::Parser, Debug)] +/// Perform kmer count +pub struct SubCommandCount { + #[clap(short = 'k', long = "kmer-size")] + /// Size of kmer + pub kmer: u8, + + #[clap(short = 'i', long = "inputs")] + /// Path to inputs + pub inputs: Vec, + + #[clap(short = 'o', long = "output")] + /// "Path where count are store in binary format" + pub output: Option, + + #[clap(short = 'b', long = "record_buffer")] + /// Number of sequence record load in buffer, default 8192 + pub record_buffer: Option, + + #[clap(short = 'a', long = "abundance", default_value = "0")] + /// Minimal abundance + pub abundance: crate::counter::Count, + + #[clap(short = 'c', long = "csv")] + /// Path where count is write in csv + pub csv: Option, + + #[clap(short = 's', long = "solid")] + /// Path where count is write in solid format + pub solid: Option, + + #[clap(short = 'S', long = "spectrum")] + /// Path where kmer spectrum is write + pub spectrum: Option, +} + +#[derive(clap::Parser, Debug)] +/// Convert count in usable format +pub struct SubCommandDump { + #[clap(short = 'i', long = "input", help = "Path to count file")] + pub input: String, + + #[clap(short = 'a', long = "abundance", default_value = "0")] + /// Minimal abundance + pub abundance: crate::counter::Count, + + #[clap(short = 'c', long = "csv")] + /// Path where count is write in csv + pub csv: Option, + + #[clap(short = 's', long = "solid")] + /// Path where count is write in solid format + pub solid: Option, + + #[clap(short = 'S', long = "spectrum")] + /// Path where kmer spectrum is write + pub spectrum: Option, + + #[clap(short = 'b', long = "bin")] + /// Path where count is write in bin + pub bin: Option, +} + +use crate::error::{Cli, Error}; +use Cli::*; + +pub fn check_count_param(params: SubCommandCount) -> Result { + if (params.kmer & 1) == 0 { + return Err(Error::Cli(KMustBeOdd)); + } + + if params.kmer > 32 { + return Err(Error::Cli(KMustBeLower32)); + } + + Ok(params) +} + +pub fn check_dump_param(params: SubCommandDump) -> Result { + if ![¶ms.csv, ¶ms.solid, ¶ms.spectrum, ¶ms.bin] + .iter() + .any(|x| x.is_some()) + { + return Err(Error::Cli(ADumpOptionMustBeSet)); + } + + Ok(params) +} + +pub fn i82level(level: i8) -> Option { + match level { + std::i8::MIN..=0 => None, + 1 => Some(log::Level::Error), + 2 => Some(log::Level::Warn), + 3 => Some(log::Level::Info), + 4 => Some(log::Level::Debug), + 5..=std::i8::MAX => Some(log::Level::Trace), + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use bitvec::prelude::*; +use byteorder::{ReadBytesExt, WriteBytesExt}; + +/* local use */ +use crate::error::IO::*; +use crate::error::*; +use crate::*; + +/// A struct to store if a kmer is Solid or not. Only kmer with abundance upper than a threshold is solid +pub struct Solid { + pub k: u8, + solid: BitBox, +} + +impl Solid { + /// Create a new Solid for kmer size equal to `k` + pub fn new(k: u8) -> Self { + Self { + k, + solid: bitbox![u8, Lsb0; 0; cocktail::kmer::get_hash_space_size(k) as usize], + } + } + + /// Create a new Solid with count in `counter` only kmer upper than `abundance` are solid + pub fn from_counter(counter: &counter::Counter, abundance: counter::Count) -> Self { + let counts = unsafe { + &(*(counter.get_raw_count() as *const [counter::AtoCount] as *const [counter::Count])) + }; + + let mut solid = bitbox![u8, Lsb0; 0; counts.len()]; + + unsafe { + for (index, count) in (*(counter.get_raw_count() as *const [counter::AtoCount] + as *const [counter::Count])) + .iter() + .enumerate() + { + if *count > abundance { + solid.set(index, true); + } + } + } + + Self { + k: counter.k, + solid, + } + } + + /// Solidity status of `kmer` is set to `value` + pub fn set(&mut self, kmer: u64, value: bool) { + self.set_canonic(cocktail::kmer::canonical(kmer, self.k), value); + } + + /// Solidity status of a canonical`kmer` is set to `value` + pub fn set_canonic(&mut self, canonical: u64, value: bool) { + let hash = (canonical >> 1) as usize; + + if let Some(mut v) = self.solid.get_mut(hash) { + *v = value; + } + } + + /// Get the solidity status of `kmer` + pub fn get(&self, kmer: u64) -> bool { + self.get_canonic(cocktail::kmer::canonical(kmer, self.k)) + } + + /// Get the solidity status of a canonical `kmer` + pub fn get_canonic(&self, canonical: u64) -> bool { + let hash = (canonical >> 1) as usize; + + self.solid[hash] + } + + #[allow(dead_code)] + pub(crate) fn get_raw_solid(&self) -> &BitBox { + &self.solid + } + + /// Serialize counter in given [std::io::Write] + pub fn serialize(&self, w: W) -> Result<()> + where + W: std::io::Write, + { + let mut writer = niffler::get_writer( + Box::new(w), + niffler::compression::Format::Gzip, + niffler::compression::Level::One, + )?; + + writer + .write_u8(self.k) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("Error durring serialize solid"))?; + + writer + .write_all(self.solid.as_raw_slice()) + .with_context(|| Error::IO(ErrorDurringWrite)) + .with_context(|| anyhow!("Error durring serialize solid"))?; + + Ok(()) + } + + /// Deserialize counter for given [std::io::Read] + pub fn deserialize(r: R) -> Result + where + R: std::io::Read, + { + let mut reader = niffler::get_reader(Box::new(r))?.0; + + let k = reader + .read_u8() + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize solid"))?; + + // >> 3 <-> divide by 8 + let mut tmp = + vec![0u8; (cocktail::kmer::get_hash_space_size(k) >> 3) as usize].into_boxed_slice(); + + reader + .read_exact(&mut tmp) + .with_context(|| Error::IO(ErrorDurringRead)) + .with_context(|| anyhow!("Error durring deserialize solid"))?; + + Ok(Self { + k, + solid: BitBox::from_boxed_slice(tmp), + }) + } +} + +#[cfg(test)] +mod tests { + use super::*; + + const FASTA_FILE: &[u8] = b">random_seq 0 +GTTCTGCAAATTAGAACAGACAATACACTGGCAGGCGTTGCGTTGGGGGAGATCTTCCGTAACGAGCCGGCATTTGTAAGAAAGAGATTTCGAGTAAATG +>random_seq 1 +AGGATAGAAGCTTAAGTACAAGATAATTCCCATAGAGGAAGGGTGGTATTACAGTGCCGCCTGTTGAAAGCCCCAATCCCGCTTCAATTGTTGAGCTCAG +"; + + fn get_solid() -> solid::Solid { + let mut counter = crate::counter::Counter::new(5); + + counter.count_fasta(FASTA_FILE, 1); + + solid::Solid::from_counter(&counter, 0) + } + + const SOLID: &[u8] = &[ + 112, 64, 113, 143, 130, 8, 128, 4, 6, 60, 214, 0, 243, 8, 193, 1, 30, 4, 34, 97, 4, 70, + 192, 12, 16, 144, 133, 38, 192, 41, 1, 4, 218, 179, 140, 0, 0, 140, 242, 35, 90, 56, 205, + 179, 64, 3, 25, 20, 226, 0, 32, 76, 1, 134, 48, 64, 7, 0, 200, 144, 98, 131, 2, 203, + ]; + + #[test] + fn presence() { + let solid = get_solid(); + + assert_eq!(solid.get_raw_solid().as_raw_slice(), SOLID); + } + + const SOLID_SET: &[u8] = &[ + 112, 64, 113, 143, 130, 8, 128, 4, 6, 52, 214, 0, 243, 8, 193, 1, 30, 4, 2, 97, 4, 70, 192, + 12, 16, 144, 133, 36, 192, 41, 1, 4, 218, 179, 140, 0, 0, 140, 242, 35, 90, 56, 205, 179, + 64, 3, 25, 20, 226, 0, 32, 76, 1, 134, 48, 64, 7, 0, 192, 144, 98, 131, 2, 203, + ]; + + #[test] + fn set_value() { + let mut solid = get_solid(); + + solid.set(cocktail::kmer::seq2bit(b"GTTCT"), false); + solid.set(cocktail::kmer::seq2bit(b"AAATG"), false); + solid.set(cocktail::kmer::seq2bit(b"AGGAT"), false); + solid.set(cocktail::kmer::seq2bit(b"CTCAG"), false); + + assert_eq!(solid.get_raw_solid().as_raw_slice(), SOLID_SET); + } + + const FASTA_SOLID: &[u8] = &[ + 31, 139, 8, 0, 0, 0, 0, 0, 4, 255, 1, 65, 0, 190, 255, 5, 112, 64, 113, 143, 130, 8, 128, + 4, 6, 60, 214, 0, 243, 8, 193, 1, 30, 4, 34, 97, 4, 70, 192, 12, 16, 144, 133, 38, 192, 41, + 1, 4, 218, 179, 140, 0, 0, 140, 242, 35, 90, 56, 205, 179, 64, 3, 25, 20, 226, 0, 32, 76, + 1, 134, 48, 64, 7, 0, 200, 144, 98, 131, 2, 203, 186, 210, 139, 120, 65, 0, 0, 0, + ]; + + #[test] + fn serialize() { + let mut outfile = Vec::new(); + + let solid = get_solid(); + solid.serialize(&mut outfile).unwrap(); + + assert_eq!(&outfile[..], &FASTA_SOLID[..]); + } + + #[test] + fn deserialize() { + let solid = crate::solid::Solid::deserialize(&FASTA_SOLID[..]).unwrap(); + + assert_eq!(solid.k, 5); + assert_eq!(solid.get_raw_solid().as_raw_slice(), SOLID); + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::{anyhow, Context, Result}; +use log::Level; + +/* local use */ +use crate::error::*; + +#[derive(clap::Parser, Debug)] +#[clap( + version = "0.1", + author = "Pierre Marijon ", + about = "KMRF: Kmer based Read Filter" +)] +pub struct Command { + /// solidity bitfield produce by pcon + #[clap(short = 's', long = "solidity")] + pub solidity: Option, + + /// fasta file to be correct + #[clap(short = 'i', long = "inputs")] + pub inputs: Vec, + + /// path where corrected read was write + #[clap(short = 'o', long = "outputs")] + pub outputs: Vec, + + /// if you want choose the minimum abundance you can set this parameter + #[clap(short = 'a', long = "abundance")] + pub abundance: Option, + + /// if a ratio of correct kmer on all kmer is lower than this threshold read is filter out, default 0.8 + #[clap(short = 'r', long = "ratio")] + pub ratio: Option, + + /// if a read have length lower than this threshold read is filter out, default 1000 + #[clap(short = 'l', long = "min-length")] + pub length: Option, + + /// kmer length if you didn't provide solidity path you must give a kmer length + #[clap(short = 'k', long = "kmer")] + pub kmer: Option, + + /// Number of thread use by br, 0 use all avaible core, default value 0 + #[clap(short = 't', long = "threads")] + pub threads: Option, + + /// Number of sequence record load in buffer, default 8192 + #[clap(short = 'b', long = "record_buffer")] + pub record_buffer: Option, + + /// verbosity level also control by environment variable BR_LOG if flag is set BR_LOG value is ignored + #[clap(short = 'v', long = "verbosity", parse(from_occurrences))] + pub verbosity: i8, +} + +pub fn i82level(level: i8) -> Option { + match level { + std::i8::MIN..=0 => None, + 1 => Some(log::Level::Error), + 2 => Some(log::Level::Warn), + 3 => Some(log::Level::Info), + 4 => Some(log::Level::Debug), + 5..=std::i8::MAX => Some(log::Level::Trace), + } +} + +pub fn read_or_compute_solidity( + solidity_path: Option, + kmer: Option, + inputs: &[String], + record_buffer_len: usize, + abundance: Option, +) -> Result { + if let Some(solidity_path) = solidity_path { + let solidity_reader = std::io::BufReader::new( + std::fs::File::open(&solidity_path) + .with_context(|| Error::CantOpenFile) + .with_context(|| anyhow!("File {:?}", solidity_path.clone()))?, + ); + + log::info!("Load solidity file"); + Ok(pcon::solid::Solid::deserialize(solidity_reader)?) + } else if let Some(kmer) = kmer { + let mut counter = pcon::counter::Counter::new(kmer); + + log::info!("Start count kmer from input"); + for input in inputs { + let fasta = std::io::BufReader::new( + std::fs::File::open(&input) + .with_context(|| Error::CantOpenFile) + .with_context(|| anyhow!("File {:?}", input.clone()))?, + ); + + counter.count_fasta(fasta, record_buffer_len); + } + log::info!("End count kmer from input"); + + log::info!("Start build spectrum from count"); + let spectrum = pcon::spectrum::Spectrum::from_counter(&counter); + log::info!("End build spectrum from count"); + + let abun = if let Some(a) = abundance { + a + } else { + log::info!("Start search threshold"); + let abundance = spectrum + .get_threshold(pcon::spectrum::ThresholdMethod::FirstMinimum, 0.0) + .ok_or(Error::CantComputeAbundance)?; + + spectrum + .write_histogram(std::io::stdout(), Some(abundance)) + .with_context(|| anyhow!("Error durring write of kmer histograme"))?; + println!("If this curve seems bad or minimum abundance choose (marked by *) not apopriate set parameter -a"); + log::info!("End search threshold"); + abundance as u8 + }; + + Ok(pcon::solid::Solid::from_counter(&counter, abun)) + } else { + Err(anyhow!(Error::NoSolidityNoKmer)) + } +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use thiserror::Error; + +/// All error produce by Pcon +#[derive(Debug, Error)] +pub enum Error { + /// We can't create file. In C binding it's equal to 0 + #[error("We can't create file")] + CantCreateFile, + + /// We can't open file. In C binding it's equal to 1 + #[error("We can't open file")] + CantOpenFile, + + /// Error durring write in file. In C binding it's equal to 2 + #[error("Error durring write")] + ErrorDurringWrite, + + /// Error durring read file. In C binding it's equal to 3 + #[error("Error durring read")] + ErrorDurringRead, + + #[error("You must provide a solidity path '-s' or a kmer length '-k'")] + NoSolidityNoKmer, + + #[error("Can't compute minimal abundance")] + CantComputeAbundance, + + /// No error, this exist only for C binding it's the value of a new error pointer + #[error("Isn't error if you see this please contact the author with this message and a description of what you do with pcon")] + NoError, +} +/* +Copyright (c) 2019 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* crate use */ +use anyhow::Result; +use clap::Parser; + +use kmrf::*; + +fn main() -> Result<()> { + let params = cli::Command::parse(); + + if let Some(level) = cli::i82level(params.verbosity) { + env_logger::builder() + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .filter_level(level.to_level_filter()) + .init(); + } else { + env_logger::Builder::from_env("KMRF_LOG") + .format_timestamp(Some(env_logger::fmt::TimestampPrecision::Millis)) + .init(); + } + + let ratio = if let Some(val) = params.ratio { + val + } else { + 0.9 + }; + + let length = if let Some(val) = params.length { + val + } else { + 1000 + }; + + if let Some(threads) = params.threads { + log::info!("Set number of threads to {}", threads); + + set_nb_threads(threads); + } + + let record_buffer = if let Some(len) = params.record_buffer { + len + } else { + 8192 + }; + + let solid = cli::read_or_compute_solidity( + params.solidity, + params.kmer, + ¶ms.inputs, + record_buffer, + params.abundance, + )?; + + kmrf::run_filter( + params.inputs, + params.outputs, + solid, + ratio, + length, + record_buffer, + )?; + + Ok(()) +} +/* +Copyright (c) 2020 Pierre Marijon + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. + */ + +/* local mod */ +pub mod cli; +pub mod error; + +/* crates use */ +use anyhow::{anyhow, Context, Result}; +use rayon::iter::ParallelBridge; +use rayon::prelude::*; + +/* local use */ +use error::*; + +pub fn run_filter( + inputs: Vec, + outputs: Vec, + solid: pcon::solid::Solid, + ratio: f64, + length: usize, + record_buffer_len: usize, +) -> Result<()> { + for (input, output) in inputs.iter().zip(outputs) { + log::info!("Start filter {} write in {}", input, output); + + let mut reader = std::fs::File::open(input) + .with_context(|| Error::CantOpenFile) + .with_context(|| anyhow!("File {}", input.clone())) + .map(std::io::BufReader::new) + .map(noodles::fasta::Reader::new)?; + + let mut writer = std::fs::File::create(&output) + .with_context(|| Error::CantCreateFile) + .with_context(|| anyhow!("File {}", output.clone())) + .map(std::io::BufWriter::new) + .map(noodles::fasta::Writer::new)?; + + let mut iter = reader.records(); + let mut records = Vec::with_capacity(record_buffer_len); + + let mut end = false; + loop { + for _ in 0..record_buffer_len { + if let Some(Ok(record)) = iter.next() { + records.push(record); + } else { + end = true; + break; + } + } + + log::info!("Buffer len: {}", records.len()); + + let keeped: Vec<_> = records + .drain(..) + .par_bridge() + .filter_map(|record| { + let l = record.sequence().len(); + if l < length || l < solid.k as usize { + return None; + } + + let mut nb_kmer = 0; + let mut nb_valid = 0; + + for cano in + cocktail::tokenizer::Canonical::new(record.sequence().as_ref(), solid.k) + { + nb_kmer += 1; + + if solid.get_canonic(cano) { + nb_valid += 1; + } + } + + let r = (nb_valid as f64) / (nb_kmer as f64); + + if r >= ratio { + Some(record) + } else { + None + } + }) + .collect(); + + for record in keeped { + writer + .write_record(&record) + .with_context(|| Error::ErrorDurringWrite) + .with_context(|| anyhow!("File {}", output.clone()))? + } + + records.clear(); + + if end { + break; + } + } + log::info!("End filter file {} write in {}", input, output); + } + + Ok(()) +} + +/// Set the number of threads use by count step +pub fn set_nb_threads(nb_threads: usize) { + rayon::ThreadPoolBuilder::new() + .num_threads(nb_threads) + .build_global() + .unwrap(); +}