hexsha
stringlengths
40
40
size
int64
1
1.03M
ext
stringclasses
10 values
lang
stringclasses
1 value
max_stars_repo_path
stringlengths
3
239
max_stars_repo_name
stringlengths
5
130
max_stars_repo_head_hexsha
stringlengths
40
78
max_stars_repo_licenses
listlengths
1
10
max_stars_count
int64
1
191k
max_stars_repo_stars_event_min_datetime
stringlengths
24
24
max_stars_repo_stars_event_max_datetime
stringlengths
24
24
max_issues_repo_path
stringlengths
3
239
max_issues_repo_name
stringlengths
5
130
max_issues_repo_head_hexsha
stringlengths
40
78
max_issues_repo_licenses
listlengths
1
10
max_issues_count
int64
1
67k
max_issues_repo_issues_event_min_datetime
stringlengths
24
24
max_issues_repo_issues_event_max_datetime
stringlengths
24
24
max_forks_repo_path
stringlengths
3
239
max_forks_repo_name
stringlengths
5
130
max_forks_repo_head_hexsha
stringlengths
40
78
max_forks_repo_licenses
listlengths
1
10
max_forks_count
int64
1
105k
max_forks_repo_forks_event_min_datetime
stringlengths
24
24
max_forks_repo_forks_event_max_datetime
stringlengths
24
24
content
stringlengths
1
1.03M
avg_line_length
float64
1
958k
max_line_length
int64
1
1.03M
alphanum_fraction
float64
0
1
7949b46abf93a8c89542a41e9995cdcc77854a17
2,053
py
Python
binding-python/runtime/src/main/python/etch/binding/support/Validator_long.py
apache/etch
5a875755019a7f342a07c8c368a50e3efb6ae68c
[ "ECL-2.0", "Apache-2.0" ]
9
2015-02-14T15:09:54.000Z
2021-11-10T15:09:45.000Z
binding-python/runtime/src/main/python/etch/binding/support/Validator_long.py
apache/etch
5a875755019a7f342a07c8c368a50e3efb6ae68c
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
binding-python/runtime/src/main/python/etch/binding/support/Validator_long.py
apache/etch
5a875755019a7f342a07c8c368a50e3efb6ae68c
[ "ECL-2.0", "Apache-2.0" ]
14
2015-04-20T10:35:00.000Z
2021-11-10T15:09:35.000Z
""" # Licensed to the Apache Software Foundation (ASF) under one * # or more contributor license agreements. See the NOTICE file * # distributed with this work for additional information * # regarding copyright ownership. The ASF licenses this file * # to you under the Apache License, Version 2.0 (the * # "License"); you may not use this file except in compliance * # with the License. You may obtain a copy of the License at * # * # http://www.apache.org/licenses/LICENSE-2.0 * # * # Unless required by applicable law or agreed to in writing, * # software distributed under the License is distributed on an * # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * # KIND, either express or implied. See the License for the * # specific language governing permissions and limitations * # under the License. """ from __future__ import absolute_import import types from ...python.Exceptions import * from ...python.Types import * from .TypeValidator import * from ..transport.fmt.TypeCode import * class Validator_long(NumberTypeValidator): """ Validator for long """ def __init__(self, nDims): """ Construct the validator. @param nDims the number of dimensions. 0 or scalar. """ typs = [Long] super(Validator_long,self).__init__(typs, None, nDims, "long[%d]" % nDims, Long, [TypeCode.LONGS, TypeCode.LONG]) def checkValue(self, value): tc = super(Validator_long,self).checkValue(value) if tc == TypeCode.LONG: if value >= Byte.MIN_VALUE and value <= Byte.MAX_VALUE: return TypeCode.BYTE if value >= Short.MIN_VALUE and value <= Short.MAX_VALUE: return TypeCode.SHORT if value >= Integer.MIN_VALUE and value <= Integer.MAX_VALUE: return TypeCode.INT return tc
39.480769
121
0.608865
7949b651a739be2fbff05378bef3ae2f5f118b99
613
py
Python
scaffold/wsgi.py
wooojtek/una
d06a15f763aebe25a1111ff69ffcd2a84b707df4
[ "Apache-2.0" ]
null
null
null
scaffold/wsgi.py
wooojtek/una
d06a15f763aebe25a1111ff69ffcd2a84b707df4
[ "Apache-2.0" ]
null
null
null
scaffold/wsgi.py
wooojtek/una
d06a15f763aebe25a1111ff69ffcd2a84b707df4
[ "Apache-2.0" ]
null
null
null
""" WSGI config for scaffold project. It exposes the WSGI callable as a module-level variable named ``application``. For more information on this file, see https://docs.djangoproject.com/en/1.6/howto/deployment/wsgi/ """ from scaffold.boot import fix_path fix_path() import os from django.core.wsgi import get_wsgi_application from djangae.wsgi import DjangaeApplication from djangae.utils import on_production settings = "scaffold.settings_live" if on_production() else "scaffold.settings" os.environ.setdefault("DJANGO_SETTINGS_MODULE", settings) application = DjangaeApplication(get_wsgi_application())
26.652174
79
0.807504
7949b6d520b99186591675ae19340aa7c18660d6
3,609
py
Python
pid_control/src/pid_control/PID.py
andrewtron3000/hacdc-ros-pkg
f3178ebc5a71889066db102e3b57beb0dcc1a204
[ "BSD-2-Clause-FreeBSD" ]
null
null
null
pid_control/src/pid_control/PID.py
andrewtron3000/hacdc-ros-pkg
f3178ebc5a71889066db102e3b57beb0dcc1a204
[ "BSD-2-Clause-FreeBSD" ]
null
null
null
pid_control/src/pid_control/PID.py
andrewtron3000/hacdc-ros-pkg
f3178ebc5a71889066db102e3b57beb0dcc1a204
[ "BSD-2-Clause-FreeBSD" ]
null
null
null
#!/usr/bin/env python #********************************************************************* # Software License Agreement (BSD License) # # Copyright (c) 2011 andrewtron3000 # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions # are met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials provided # with the distribution. # * Neither the name of the Willow Garage nor the names of its # contributors may be used to endorse or promote products derived # from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS # FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE # COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, # BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN # ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. #********************************************************************/ # # PID controller adapted from "PID without a PhD" written by # Tim Wescott # import roslib; roslib.load_manifest('pid_control') import rospy from pid_control.msg import PIDDiagnostics class PIDController: def __init__(self, namespace, commandMin, commandMax, iMin, iMax): self._namespace = namespace self._commandMin= commandMin self._commandMax= commandMax self._iMin = iMin self._iMax= iMax self._iState = 0.0 self._dState = None self._Publisher = rospy.Publisher(self._namespace + '/diagnostics', PIDDiagnostics) def update(self, error, position): # get the gains from the parameter server try: gains = rospy.get_param(self._namespace) p, i, d = gains['p'], gains['i'], gains['d'] # proportional term pTerm = p * error # integral term self._iState += error if self._iState > self._iMax: self._iState = self._iMax elif self._iState < self._iMin: self._iState = self._iMin iTerm = i * self._iState # derivitive term if self._dState == None: self._dState = position dTerm = d * (self._dState - position) self._dState = position # compute command command = pTerm + iTerm + dTerm if command > self._commandMax: command = self._commandMax elif command < self._commandMin: command = self._commandMin # publish diagnostics self._Publisher.publish(PIDDiagnostics(error = error, command = command)) except: rospy.logwarn('PID gains not set') command = 0.0 return command
39.659341
91
0.636741
7949b6f36f9d405d6bf081ad66bdf7a1db847cc3
1,410
py
Python
core/arxiv/submission/domain/event/versioning/version_0_0_0_example.py
woutersj/arxiv-submission-core
6077ce4e0685d67ce7010800083a898857158112
[ "MIT" ]
14
2019-05-26T22:52:17.000Z
2021-11-05T12:26:46.000Z
core/arxiv/submission/domain/event/versioning/version_0_0_0_example.py
woutersj/arxiv-submission-core
6077ce4e0685d67ce7010800083a898857158112
[ "MIT" ]
30
2018-01-31T19:16:08.000Z
2018-12-08T08:41:04.000Z
core/arxiv/submission/domain/event/versioning/version_0_0_0_example.py
cul-it/arxiv-submission-core
6077ce4e0685d67ce7010800083a898857158112
[ "MIT" ]
8
2019-01-10T22:01:39.000Z
2021-11-20T21:44:51.000Z
""" An example version mapping module. This module gathers together all event mappings for version 0.0.0. The mappings in this module will never be used, since there are no data prior to version 0.0.0. """ from typing import Tuple from ._base import BaseVersionMapping, EventData VERSION = '0.0.0' class SetTitleExample(BaseVersionMapping): """Perform no changes whatsoever to the `title` field.""" class Meta: """Metadata about this mapping.""" event_version = VERSION """All of the mappings in this module are for the same version.""" event_type = 'SetTitle' """This mapping applies to :class:`.domain.event.SetTitle`.""" tests = [ ({'event_version': '0.0.0', 'title': 'The title'}, {'event_version': '0.0.0', 'title': 'The best title!!'}) ] """Expected changes to the ``title`` field.""" def transform_title(self, orig: EventData, key: str, val: str) \ -> Tuple[str, str]: """Make the title the best.""" parts = val.split() return key, " ".join([parts[0], "best"] + parts[1:]) def transform(self, orig: EventData, xf: EventData) -> EventData: """Add some emphasis.""" ed = EventData() for k, v in xf.items(): if isinstance(v, str): v = f"{v}!!" ed[k] = v # type: ignore return ed
30
74
0.580142
7949b72832334e04c07b9843f516d96b6d8a57f1
2,837
py
Python
code/sa_experiment1b.py
mliang1987/Traveling-Salesman-Project
ed3789e37aafb5d254ce7fdbc512711db3d8351c
[ "MIT" ]
1
2020-01-12T02:05:31.000Z
2020-01-12T02:05:31.000Z
code/sa_experiment1b.py
mliang1987/Traveling-Salesman-Project
ed3789e37aafb5d254ce7fdbc512711db3d8351c
[ "MIT" ]
null
null
null
code/sa_experiment1b.py
mliang1987/Traveling-Salesman-Project
ed3789e37aafb5d254ce7fdbc512711db3d8351c
[ "MIT" ]
null
null
null
#################################################################################################### # CSE 6140 - Fall 2019 # Rodrigo Alves Lima # Shichao Liang # Jeevanjot Singh # Kevin Tynes #################################################################################################### """ This file contains the SQD experiment for Simulated Annealing. For a set of fixed times, the algorithm iterates through specified qualities for 50 iterations, calculating the probability of a solution of at least the specified quality being found. Then, plots the result. """ import simulated_annealing as sa import random import time import math import pandas as pd import numpy as np import matplotlib.pyplot as plt from scipy.interpolate import make_interp_spline, BSpline from scipy.ndimage.filters import gaussian_filter1d def run_sqd_experiment(city, optimal): ''' Plots the SQD for a given city instance and the optimal path for that city. ''' file_path = "Data/{}.tsp".format(city) times = [1, 5, 10, 20] qualities = [0, 0.05, 0.1, 0.2, 0.3] df2 = pd.DataFrame(index = qualities, columns = times) for max_time in times: print("Running time",max_time) p_values = [] for quality in qualities: print("\tRunning quality",quality) test_quality = math.floor((quality+1)*optimal) experiment = [] for i in range(10): sol, _, _ = sa.simulated_annealing_single(file_path, random.randint(1,100), time.time(), max_time, test_quality = test_quality) experiment.append(sol<=test_quality) t_count = experiment.count(True) p = t_count / len(experiment) p_values.append(p) df2[max_time] = p_values print("Smoothing out splines...") for t in times: df2[t] = gaussian_filter1d(df2[t].values.tolist(), sigma = 1) print("Plotting...") plt.figure() plt.gcf().subplots_adjust(bottom=0.2) plt.axis([min(qualities),max(qualities),-0.1,1.1]) plt.plot(df2[1], color = 'b', linewidth = 1.0) plt.plot(df2[5], color = 'g', linewidth = 1.0) plt.plot(df2[10], color = 'r', linewidth = 1.0) plt.plot(df2[20], color = 'b', linewidth = 1.0, linestyle = "--") #plt.plot(df2[1], color = 'g', linewidth = 1.0, linestyle = "--") #plt.plot(df2[5], color = 'r', linewidth = 1.0, linestyle = "--") plt.legend(["{}s".format(item) for item in times]) plt.title("Solution Quality Distributions for {}".format(city), fontsize = 10) plt.ylabel("Probability(Solve)", fontsize = 8) plt.xlabel("Relative Solution Quality [ratio]", fontsize = 8) plt.savefig("sqd_ls1_{}.png".format(city)) if __name__ == "__main__": run_sqd_experiment("Champaign", 52643) #run_sqd_experiment("Atlanta", 2003763)
37.328947
143
0.602749
7949b73271ed69e12688ec79bc36cf4e7bfc27d7
5,038
py
Python
pyflux/gas/tests/gas_llt_tests_skewt.py
ThomasHoppe/pyflux
297f2afc2095acd97c12e827dd500e8ea5da0c0f
[ "BSD-3-Clause" ]
2,091
2016-04-01T02:52:10.000Z
2022-03-29T11:38:15.000Z
pyflux/gas/tests/gas_llt_tests_skewt.py
EricSchles/pyflux
297f2afc2095acd97c12e827dd500e8ea5da0c0f
[ "BSD-3-Clause" ]
160
2016-04-26T14:52:18.000Z
2022-03-15T02:09:07.000Z
pyflux/gas/tests/gas_llt_tests_skewt.py
EricSchles/pyflux
297f2afc2095acd97c12e827dd500e8ea5da0c0f
[ "BSD-3-Clause" ]
264
2016-05-02T14:03:31.000Z
2022-03-29T07:48:20.000Z
import numpy as np import pyflux as pf noise = np.random.normal(0,1,200) data = np.zeros(200) for i in range(1,len(data)): data[i] = 1.0*data[i-1] + noise[i] countdata = np.random.poisson(3,200) def test_skewt_couple_terms(): """ Tests latent variable list length is correct, and that the estimated latent variables are not nan """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit() assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) def test_skewt_couple_terms_integ(): """ Tests latent variable list length is correct, and that the estimated latent variables are not nan """ model = pf.GASLLT(data=data, integ=1, family=pf.Skewt()) x = model.fit() assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) def test_skewt_bbvi(): """ Tests an GAS model estimated with BBVI and that the length of the latent variable list is correct, and that the estimated latent variables are not nan """ """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('BBVI',iterations=100) assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) """ def test_skewt_bbvi_mini_batch(): """ Tests an ARIMA model estimated with BBVI and that the length of the latent variable list is correct, and that the estimated latent variables are not nan """ """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('BBVI',iterations=100, mini_batch=32) assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) """ def test_skewt_bbvi_elbo(): """ Tests that the ELBO increases """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('BBVI',iterations=100, record_elbo=True) assert(x.elbo_records[-1]>x.elbo_records[0]) def test_skewt_bbvi_mini_batch_elbo(): """ Tests that the ELBO increases """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('BBVI',iterations=100, mini_batch=32, record_elbo=True) assert(x.elbo_records[-1]>x.elbo_records[0]) def test_skewt_mh(): """ Tests an GAS model estimated with Metropolis-Hastings and that the length of the latent variable list is correct, and that the estimated latent variables are not nan """ """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('M-H',nsims=300) assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) """ """ Uncomment in future if Skewt becomes more robust def test_skewt_laplace(): Tests an GAS model estimated with Laplace approximation and that the length of the latent variable list is correct, and that the estimated latent variables are not nan model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('Laplace') assert(len(model.latent_variables.z_list) == 4) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) """ def test_skewt_pml(): """ Tests a PML model estimated with Laplace approximation and that the length of the latent variable list is correct, and that the estimated latent variables are not nan """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit('PML') assert(len(model.latent_variables.z_list) == 5) lvs = np.array([i.value for i in model.latent_variables.z_list]) assert(len(lvs[np.isnan(lvs)]) == 0) def test_skewt_predict_length(): """ Tests that the prediction dataframe length is equal to the number of steps h """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit() x.summary() assert(model.predict(h=5).shape[0] == 5) def test_skewt_predict_is_length(): """ Tests that the prediction IS dataframe length is equal to the number of steps h """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit() assert(model.predict_is(h=5).shape[0] == 5) def test_skewt_predict_nans(): """ Tests that the predictions are not nans model = pf.GASLLT(data=data, family=pf.Skewt()) """ """ model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit() x.summary() assert(len(model.predict(h=5).values[np.isnan(model.predict(h=5).values)]) == 0) """ """ def test_skewt_predict_is_nans(): Tests that the in-sample predictions are not nans model = pf.GASLLT(data=data, family=pf.Skewt()) x = model.fit() x.summary() assert(len(model.predict_is(h=5).values[np.isnan(model.predict_is(h=5).values)]) == 0) """
33.364238
90
0.665939
7949b8a55d67807673992517aa6c7d22f6466fba
4,293
py
Python
torch_glow/tests/nodes/quantized_linear_test.py
YonginKwon/glow
7d316d028e1792534416755bf80af422adccdaa9
[ "Apache-2.0" ]
2
2020-03-23T21:04:00.000Z
2020-04-02T22:49:49.000Z
torch_glow/tests/nodes/quantized_linear_test.py
YonginKwon/glow
7d316d028e1792534416755bf80af422adccdaa9
[ "Apache-2.0" ]
null
null
null
torch_glow/tests/nodes/quantized_linear_test.py
YonginKwon/glow
7d316d028e1792534416755bf80af422adccdaa9
[ "Apache-2.0" ]
null
null
null
from __future__ import absolute_import, division, print_function, unicode_literals import torch from tests.utils import jitVsGlow import unittest class TestQuantizedLinear(unittest.TestCase): def test_quantized_linear_packed(self): """Basic test of the PyTorch quantized::linear Node on Glow.""" q = torch.nn.quantized.Quantize( scale=1 / 25, zero_point=17, dtype=torch.quint8) dq = torch.nn.quantized.DeQuantize() linear = torch.nn.Linear(5, 5) linear.weight.data.fill_(1.2) linear.bias.data.fill_(3.0) model = torch.nn.Sequential(q, linear, dq) model.qconfig = torch.quantization.get_default_qconfig("fbgemm") torch.quantization.prepare(model, inplace=True) torch.quantization.convert(model, inplace=True) x = torch.tensor(range(5), dtype=torch.float) x = torch.cat((x, x, x, x, x)) x = torch.reshape(x, [5, 5]) jitVsGlow( model, x, expected_fused_ops={ "aten::quantize_per_tensor", "quantized::linear", "aten::dequantize", }, ) def test_quantized_linear_packed_dq_cut(self): """Basic test of the PyTorch quantized::linear Node on Glow, with dequantize excluded. """ q = torch.nn.quantized.Quantize( scale=1 / 25, zero_point=17, dtype=torch.quint8) dq = torch.nn.quantized.DeQuantize() linear = torch.nn.Linear(5, 5) linear.weight.data.fill_(1.2) linear.bias.data.fill_(3.0) model = torch.nn.Sequential(q, linear, dq) model.qconfig = torch.quantization.get_default_qconfig("fbgemm") torch.quantization.prepare(model, inplace=True) torch.quantization.convert(model, inplace=True) x = torch.tensor(range(5), dtype=torch.float) x = torch.cat((x, x, x, x, x)) x = torch.reshape(x, [5, 5]) jitVsGlow( model, x, expected_fused_ops={ "aten::quantize_per_tensor", "quantized::linear", }, black_list=[ "aten::dequantize", ] ) @unittest.skip(reason="random input could cause flaky") def test_quantized_linear_random_input(self): """Basic test of the PyTorch quantized::linear Node on Glow.""" def test_f(inputs, weights, bias=None): q_int = torch.nn.quantized.Quantize( scale=1 / 13, zero_point=0, dtype=torch.qint8 ) q_uint = torch.nn.quantized.Quantize( scale=1 / 13, zero_point=10, dtype=torch.quint8 ) dq = torch.nn.quantized.DeQuantize() q_inputs = q_uint(inputs) q_weights = q_int(weights) return dq(torch.nn.quantized.functional.linear(q_inputs, q_weights, bias)) for _ in range(100): inputs = torch.randn(7, 7) weights = torch.randn(7, 7) bias = torch.tensor([1, 1, 1, 1, 1, 1, 1], dtype=torch.float) * 0.1 jitVsGlow( test_f, inputs, weights, bias, expected_fused_ops={ "glow::unpacked_quantized_linear", "aten::quantize_per_tensor", "aten::dequantize", }, ) def test_quantized_linear_packed_rowwise(self): """Basic test of the PyTorch quantized::linear Node with rowwise quantized packed weights on Glow.""" linear = torch.nn.Linear(6, 5) linear.weight.data.random_(0, 100) linear.bias.data.random_(0, 10) x = torch.tensor(range(30), dtype=torch.float) x = torch.reshape(x, [5, 6]) model = torch.quantization.QuantWrapper(linear) model.qconfig = torch.quantization.get_default_qconfig('fbgemm') torch.quantization.prepare(model, inplace=True) torch.quantization.convert(model, inplace=True) jitVsGlow(model, x, expected_fused_ops={"aten::quantize_per_tensor", "quantized::linear", "aten::dequantize"})
33.023077
98
0.566271
7949bb2e19e10dd58a78aecae386dd1caffc6181
768
py
Python
tests/demo/demoproject/urls.py
GigiusB/djaxei
2fd181acd8c10c259d4ffdfbcef03ea959222d6f
[ "MIT" ]
null
null
null
tests/demo/demoproject/urls.py
GigiusB/djaxei
2fd181acd8c10c259d4ffdfbcef03ea959222d6f
[ "MIT" ]
null
null
null
tests/demo/demoproject/urls.py
GigiusB/djaxei
2fd181acd8c10c259d4ffdfbcef03ea959222d6f
[ "MIT" ]
null
null
null
"""demoproject URL Configuration The `urlpatterns` list routes URLs to views. For more information please see: https://docs.djangoproject.com/en/1.11/topics/http/urls/ Examples: Function views 1. Add an import: from my_app import views 2. Add a URL to urlpatterns: url(r'^$', views.home, name='home') Class-based views 1. Add an import: from other_app.views import Home 2. Add a URL to urlpatterns: url(r'^$', Home.as_view(), name='home') Including another URLconf 1. Import the include() function: from django.conf.urls import url, include 2. Add a URL to urlpatterns: url(r'^blog/', include('blog.urls')) """ from django.conf.urls import url from django.contrib import admin urlpatterns = [ url(r'^admin/', admin.site.urls), ]
34.909091
79
0.705729
7949bb95a685cce66419d9bac0f8a6396dd72ecb
1,071
py
Python
ait/dsn/sle/__init__.py
kmarwah/AIT-DSN
338614dfef6713431f79d6daaffc0e4303be0ced
[ "MIT" ]
12
2019-01-30T17:43:51.000Z
2022-02-23T03:36:57.000Z
ait/dsn/sle/__init__.py
kmarwah/AIT-DSN
338614dfef6713431f79d6daaffc0e4303be0ced
[ "MIT" ]
117
2018-04-16T16:11:48.000Z
2022-03-31T18:21:24.000Z
ait/dsn/sle/__init__.py
kmarwah/AIT-DSN
338614dfef6713431f79d6daaffc0e4303be0ced
[ "MIT" ]
12
2018-08-30T15:52:56.000Z
2022-01-12T19:52:04.000Z
# Advanced Multi-Mission Operations System (AMMOS) Instrument Toolkit (AIT) # Bespoke Link to Instruments and Small Satellites (BLISS) # # Copyright 2017, by the California Institute of Technology. ALL RIGHTS # RESERVED. United States Government Sponsorship acknowledged. Any # commercial use must be negotiated with the Office of Technology Transfer # at the California Institute of Technology. # # This software may be subject to U.S. export control laws. By accepting # this software, the user agrees to comply with all applicable U.S. export # laws and regulations. User has the responsibility to obtain export licenses, # or other export authority as may be required before exporting such # information to foreign countries or providing access to foreign persons. import sys from .raf import RAF from .rcf import RCF from .cltu import CLTU # Default port to which Frames will be emitted by SLE RAF/RCF ('FRAM') sys.modules['ait'].DEFAULT_FRAME_PORT = 3726 # Default frame type for incoming frame bytearrays sys.modules['ait'].DEFAULT_FRAME_TYPE = 'TMTransFrame'
41.192308
78
0.79085
7949bbec5becbee936601c098d76b594bc90d038
453
py
Python
conanfile.py
rossb34/wildcat-ws
f1636982fcbac21ce6231858555f4544641c88b8
[ "MIT" ]
null
null
null
conanfile.py
rossb34/wildcat-ws
f1636982fcbac21ce6231858555f4544641c88b8
[ "MIT" ]
null
null
null
conanfile.py
rossb34/wildcat-ws
f1636982fcbac21ce6231858555f4544641c88b8
[ "MIT" ]
null
null
null
from conans import ConanFile, CMake, tools class NetConan(ConanFile): name = "wildcat-ws" version = "0.2.2" license = "MIT" author = "<Ross Bennett> <rossbennett34@gmail.com>" url = "https://github.com/rossb34/wildcat-ws" description = "Web socket library" exports_sources = "include/*" no_copy_source = True def package(self): self.copy("*.hpp") def package_id(self): self.info.header_only()
23.842105
55
0.637969
7949bbfd4758f87e5c6fed7fe3d7bd5c2b97c2e2
778
py
Python
anstoss3k/engine/definitions.py
ericziethen/anstoss3k-poc
e28424556258b24ad4e513011b7597f150ad9719
[ "MIT" ]
null
null
null
anstoss3k/engine/definitions.py
ericziethen/anstoss3k-poc
e28424556258b24ad4e513011b7597f150ad9719
[ "MIT" ]
36
2020-02-13T09:23:36.000Z
2022-03-12T00:16:20.000Z
anstoss3k/engine/definitions.py
ericziethen/anstoss3k-poc
e28424556258b24ad4e513011b7597f150ad9719
[ "MIT" ]
null
null
null
import enum @enum.unique class GameAction(enum.Enum): # pylint: disable=invalid-name FINISH_MOVE = 'Finish Move' @enum.unique class GameState(enum.Enum): # pylint: disable=invalid-name UNKNOWN = 'Unknown State' TEAM_SELECTION = 'Team Selection' PROGRESS_WEEK = 'Week Progress' MATCH_DAY_PREVIEW = 'Match Day Preview' MATCH_DAY_RESULTS = 'Match Day Results' MATCH_DAY_TABLES = 'Tables' SEASON_END = 'Season End' class State(): def __init__(self, data): self.data = data def handle_input(self, action): '''Process the input and update the current state.''' raise NotImplementedError def next_state(self, action): '''Decide which state to go next to.''' raise NotImplementedError
22.882353
61
0.670951
7949bc1912f9eb09f3739364371cf20d489c2051
6,502
py
Python
pyEX/client.py
jay-johnson/pyEX
b326cfeffa06c3699bc15168b539323f4fd9dec8
[ "Apache-2.0" ]
null
null
null
pyEX/client.py
jay-johnson/pyEX
b326cfeffa06c3699bc15168b539323f4fd9dec8
[ "Apache-2.0" ]
null
null
null
pyEX/client.py
jay-johnson/pyEX
b326cfeffa06c3699bc15168b539323f4fd9dec8
[ "Apache-2.0" ]
null
null
null
import os from functools import partial from .common import PyEXception, _getJson, _USAGE_TYPES from .refdata import symbols, iexSymbols, symbolsDF, iexSymbolsDF, \ symbolsList, iexSymbolsList, corporateActions, corporateActionsDF, dividends as refDividends, dividendsDF as refDividendsDF, nextDayExtDate, nextDayExtDateDF, directory, directoryDF from .markets import markets, marketsDF from .stats import stats, statsDF, recent, recentDF, records, recordsDF, summary, summaryDF, daily, dailyDF from .stocks import balanceSheet, balanceSheetDF, batch, batchDF, bulkBatch, bulkBatchDF, book, bookDF, cashFlow, cashFlowDF, chart, chartDF, \ bulkMinuteBars, bulkMinuteBarsDF, company, companyDF, collections, collectionsDF, crypto, cryptoDF, delayedQuote, delayedQuoteDF, dividends, dividendsDF, \ earnings, earningsDF, earningsToday, earningsTodayDF, estimates, estimatesDF, spread, spreadDF, financials, financialsDF, incomeStatement, incomeStatementDF, ipoToday, ipoTodayDF, \ ipoUpcoming, ipoUpcomingDF, threshold, thresholdDF, shortInterest, shortInterestDF, marketShortInterest, marketShortInterestDF, keyStats, keyStatsDF, \ largestTrades, largestTradesDF, list, listDF, logo, logoPNG, logoNotebook, news, newsDF, marketNews, marketNewsDF, ohlc, ohlcDF, marketOhlc, marketOhlcDF, \ peers, peersDF, yesterday, yesterdayDF, marketYesterday, marketYesterdayDF, price, priceDF, quote, quoteDF, relevant, relevantDF, sectorPerformance, \ sectorPerformanceDF, splits, splitsDF, volumeByVenue, volumeByVenueDF from .marketdata.sse import topsSSE, lastSSE, deepSSE, tradesSSE _INCLUDE_FUNCTIONS = [ # Refdata ('symbols', symbols), ('iexSymbols', iexSymbols), ('symbolsDF', symbolsDF), ('iexSymbolsDF', iexSymbolsDF), ('symbolsList', symbolsList), ('iexSymbolsList', iexSymbolsList), ('corporateActions', corporateActions), ('corporateActionsDF', corporateActionsDF), ('refDividends', refDividends), ('refDividendsDF', refDividendsDF), ('nextDayExtDate', nextDayExtDate), ('nextDayExtDateDF', nextDayExtDateDF), ('directory', directory), ('directoryDF', directoryDF), # Markets ('markets', markets), ('marketsDF', marketsDF), # Stats ('stats', stats), ('statsDF', statsDF), ('recent', recent), ('recentDF', recentDF), ('records', records), ('recordsDF', recordsDF), ('summary', summary), ('summaryDF', summaryDF), ('daily', daily), ('dailyDF', dailyDF), # Stocks ('balanceSheet', balanceSheet), ('balanceSheetDF', balanceSheetDF), ('batch', batch), ('batchDF', batchDF), ('bulkBatch', bulkBatch), ('bulkBatchDF', bulkBatchDF), ('book', book), ('bookDF', bookDF), ('cashFlow', cashFlow), ('cashFlowDF', cashFlowDF), ('chart', chart), ('chartDF', chartDF), ('bulkMinuteBars', bulkMinuteBars), ('bulkMinuteBarsDF', bulkMinuteBarsDF), ('company', company), ('companyDF', companyDF), ('collections', collections), ('collectionsDF', collectionsDF), ('crypto', crypto), ('cryptoDF', cryptoDF), ('delayedQuote', delayedQuote), ('delayedQuoteDF', delayedQuoteDF), ('dividends', dividends), ('dividendsDF', dividendsDF), ('earnings', earnings), ('earningsDF', earningsDF), ('earningsToday', earningsToday), ('earningsTodayDF', earningsTodayDF), ('spread', spread), ('spreadDF', spreadDF), ('financials', financials), ('financialsDF', financialsDF), ('incomeStatement', incomeStatement), ('incomeStatementDF', incomeStatementDF), ('ipoToday', ipoToday), ('ipoTodayDF', ipoTodayDF), ('ipoUpcoming', ipoUpcoming), ('ipoUpcomingDF', ipoUpcomingDF), ('threshold', threshold), ('thresholdDF', thresholdDF), ('shortInterest', shortInterest), ('shortInterestDF', shortInterestDF), ('marketShortInterest', marketShortInterest), ('marketShortInterestDF', marketShortInterestDF), ('estimates', estimates), ('estimatesDF', estimatesDF), ('keyStats', keyStats), ('keyStatsDF', keyStatsDF), ('largestTrades', largestTrades), ('largestTradesDF', largestTradesDF), ('list', list), ('listDF', listDF), ('logo', logo), ('logoPNG', logoPNG), ('logoNotebook', logoNotebook), ('news', news), ('newsDF', newsDF), ('marketNews', marketNews), ('marketNewsDF', marketNewsDF), ('ohlc', ohlc), ('ohlcDF', ohlcDF), ('marketOhlc', marketOhlc), ('marketOhlcDF', marketOhlcDF), ('peers', peers), ('peersDF', peersDF), ('yesterday', yesterday), ('yesterdayDF', yesterdayDF), ('marketYesterday', marketYesterday), ('marketYesterdayDF', marketYesterdayDF), ('price', price), ('priceDF', priceDF), ('quote', quote), ('quoteDF', quoteDF), ('relevant', relevant), ('relevantDF', relevantDF), ('sectorPerformance', sectorPerformance), ('sectorPerformanceDF', sectorPerformanceDF), ('splits', splits), ('splitsDF', splitsDF), ('volumeByVenue', volumeByVenue), ('volumeByVenueDF', volumeByVenueDF), # SSE Streaming ('topsSSE', topsSSE), ('lastSSE', lastSSE), ('deepSSE', deepSSE), ('tradesSSE', tradesSSE), ] class Client(object): '''IEX Cloud Client Client has access to all methods provided as standalone, but in an authenticated way Args: api_token (string): api token (can pickup from IEX_TOKEN environment variable) verson (string): api version to use (defaults to beta) ''' def __init__(self, api_token=None, version='beta'): self._token = api_token or os.environ.get('IEX_TOKEN', '') if not self._token: raise PyEXception('API Token missing or not in environment (IEX_TOKEN)') self._version = version for name, method in _INCLUDE_FUNCTIONS: setattr(self, name, partial(self.bind, meth=method)) def bind(self, *args, meth=None, **kwargs): return meth(token=self._token, version=self._version, *args, **kwargs) def account(self): return _getJson('account/metadata', self._token, self._version) def usage(self, type=None): if type: if type not in _USAGE_TYPES: raise PyEXception('type not recognized: {}'.format(type)) return _getJson('account/usage/{type}'.format(type=type), self._token, self._version) return _getJson('account/usage/messages', self._token, self._version)
38.702381
185
0.675177
7949bc23e335994e38769e22908011bccccd621f
27,183
py
Python
conga/tcrdist/make_10x_clones_file.py
scfurl/conga
eaf7b0a583180a72f7c81f981b29b53781507a12
[ "MIT" ]
null
null
null
conga/tcrdist/make_10x_clones_file.py
scfurl/conga
eaf7b0a583180a72f7c81f981b29b53781507a12
[ "MIT" ]
null
null
null
conga/tcrdist/make_10x_clones_file.py
scfurl/conga
eaf7b0a583180a72f7c81f981b29b53781507a12
[ "MIT" ]
null
null
null
from .basic import * from .all_genes import all_genes #import parse_tsv from collections import Counter from itertools import chain import sys import pandas as pd from ..util import organism2vdj_type, IG_VDJ_TYPE MIN_CDR3_LEN = 6 # otherwise tcrdist barfs; actually we could also set this to 5 and be OK def show(tcr): "For debugging" if type( tcr[0] ) is str: return ' '.join(tcr[:3]) else: return ' '.join( show(x) for x in tcr ) def fixup_gene_name( gene, gene_suffix, expected_gene_names ): if gene in expected_gene_names: return gene # ALL DONE if '*' not in gene: gene += gene_suffix if gene in expected_gene_names: return gene # ALL DONE vj = gene[3] assert vj in 'VJ' if vj=='V' and 'DV' in gene: # sometimes they just delete the '/' # sometimes they convert it into a '-' new_gene = gene[:gene.index('DV')]+'/'+gene[gene.index('DV'):] if new_gene in expected_gene_names: gene = new_gene else: new_gene = gene[:gene.index('DV')-1]+'/'+gene[gene.index('DV'):] if new_gene in expected_gene_names: gene = new_gene else: print('trouble parsing V gene with DV in it:', gene) return gene # may still not be in expected_gene_names, will check for that later def get_ab_from_10x_chain(chain, organism): ''' Returns None if the chain is not valid for this 'organism' ''' if organism in ['human', 'mouse']: if chain in ['TRA','TRB']: return chain[2] else: return None elif organism in ['human_gd','mouse_gd']: if chain in ['TRA','TRG','TRD']: return 'A' if chain=='TRG' else 'B' else: return None elif organism in ['human_ig','mouse_ig']: if chain in ['IGH', 'IGK', 'IGL']: return 'B' if chain=='IGH' else 'A' else: return None else: print('unrecognized organism in get_ab_from_10x_chain:', organism) sys.exit() def read_tcr_data( organism, contig_annotations_csvfile, consensus_annotations_csvfile, allow_unknown_genes = False, verbose = False, prefix_clone_ids_with_tcr_type = False, ): """ Parse tcr data, only taking 'productive' tcrs Returns: clonotype2tcrs, clonotype2barcodes """ expected_gene_names = set(all_genes[organism].keys()) #from cdr3s_human import all_align_fasta gene_suffix = '*01' # may not be used if prefix_clone_ids_with_tcr_type: if organism2vdj_type[organism] == IG_VDJ_TYPE: clone_id_prefix = 'bcr_' else: clone_id_prefix = 'tcr_' else: clone_id_prefix = '' # read the contig annotations-- map from clonotypes to barcodes # barcode,is_cell,contig_id,high_confidence,length,chain,v_gene,d_gene,j_gene,c_gene,full_length,productive,cdr3,cdr3_nt,reads,umis,raw_clonotype_id,raw_consensus_id # AAAGATGGTCTTCTCG-1,True,AAAGATGGTCTTCTCG-1_contig_1,True,695,TRB,TRBV5-1*01,TRBD2*02,TRBJ2-3*01,TRBC2*01,True,True,CASSPLAGYAADTQYF,TGCGCCAGCAGCCCCCTAGCGGGATACGCAGCAGATACGCAGTATTTT,9427,9,clonotype14,clonotype14_consensus_1 assert exists( contig_annotations_csvfile ) #_, lines = parse_csv_file(contig_annotations_csvfile) df = pd.read_csv(contig_annotations_csvfile) df['productive'] = df['productive'].astype(str) #sometimes it already is if there are 'Nones' in there... clonotype2barcodes = {} clonotype2tcrs_backup = {} ## in case we dont have a consensus_annotations_csvfile for l in df.itertuples(): bc = l.barcode clonotype = clone_id_prefix + l.raw_clonotype_id # annoying: pandas sometimes converts to True/False booleans and sometimes not. assert l.productive in [ 'None', 'False', 'True'] if clonotype =='None': continue if clonotype not in clonotype2barcodes: clonotype2barcodes[clonotype] = [] if bc in clonotype2barcodes[clonotype]: pass #print 'repeat barcode' else: clonotype2barcodes[clonotype].append( bc ) ## experimenting here ########################################3 if l.productive != 'True': continue if l.cdr3.lower() == 'none' or l.cdr3_nt.lower() == 'none': continue chain = l.chain ab = get_ab_from_10x_chain(chain, organism) if ab is None: continue if clonotype not in clonotype2tcrs_backup: clonotype2tcrs_backup[ clonotype ] = {'A':Counter(), 'B':Counter() } # stolen from below vg = fixup_gene_name(l.v_gene, gene_suffix, expected_gene_names) jg = fixup_gene_name(l.j_gene, gene_suffix, expected_gene_names) if vg not in expected_gene_names: print('unrecognized V gene:', organism, vg) if not allow_unknown_genes: continue if jg not in expected_gene_names: print('unrecognized J gene:', organism, jg) if not allow_unknown_genes: continue #assert vg in all_align_fasta[organism] #assert jg in all_align_fasta[organism] tcr_chain = ( vg, jg, l.cdr3, l.cdr3_nt.lower() ) clonotype2tcrs_backup[clonotype][ab][tcr_chain] += int(l.umis) for id in clonotype2tcrs_backup: for ab in 'AB': for t1,count1 in clonotype2tcrs_backup[id][ab].items(): for t2, count2 in clonotype2tcrs_backup[id][ab].items(): if t2<=t1:continue if t1[3] == t2[3]: print('repeat??', count1, count2, t1, t2) if consensus_annotations_csvfile is None: clonotype2tcrs = clonotype2tcrs_backup else: ## now read details on the individual chains for each clonotype # ==> tcr/human/JCC176_TX2_TCR_consensus_annotations.csv <== # clonotype_id,consensus_id,length,chain,v_gene,d_gene,j_gene,c_gene,full_length,productive,cdr3,cdr3_nt,reads,umis # clonotype100,clonotype100_consensus_1,550,TRB,TRBV24-1*01,TRBD1*01,TRBJ2-7*01,TRBC2*01,True,True,CATSDPGQGGYEQYF,TGTGCCACCAGTGACCCCGGACAGGGAGGATACGAGCAGTACTTC,8957,9 assert exists(consensus_annotations_csvfile) df = pd.read_csv( consensus_annotations_csvfile ) df['productive'] = df['productive'].astype(str) #sometimes it already is if there are 'Nones' in there... ## first get clonotypes with one alpha and one beta clonotype2tcrs = {} for l in df.itertuples(): assert l.productive in [ 'None', 'False', 'True'] if l.productive == 'True': id = l.clonotype_id if id not in clonotype2tcrs: # dictionaries mapping from tcr to umi-count clonotype2tcrs[id] = { 'A':Counter(), 'B':Counter() } #, 'G':[], 'D': [] } assert id in clonotype2barcodes ch = l.chain ab = get_ab_from_10x_chain(ch, organism) if ab is None: print('skipline:', consensus_annotations_csvfile, ch, l.v_gene, l.j_gene) continue vg = fixup_gene_name(l.v_gene, gene_suffix, expected_gene_names) jg = fixup_gene_name(l.j_gene, gene_suffix, expected_gene_names) if vg not in expected_gene_names: print('unrecognized V gene:', organism, vg) if not allow_unknown_genes: continue if jg not in expected_gene_names: print('unrecognized J gene:', organism, jg) if not allow_unknown_genes: continue #assert vg in all_align_fasta[organism] #assert jg in all_align_fasta[organism] tcr_chain = ( vg, jg, l.cdr3, l.cdr3_nt.lower() ) if tcr_chain not in clonotype2tcrs[id][ab]: umis = int( l.umis ) clonotype2tcrs[id][ab][ tcr_chain ] = umis old_umis = clonotype2tcrs_backup[id][ab][tcr_chain] if umis != old_umis: print('diff_umis:',umis, old_umis, id,ab,tcr_chain) else: print('repeat?',id,ab,tcr_chain) # else: # if l.productive not in [ 'None','False' ]: # print('unproductive?',l.productive) if verbose: idl1 = sorted( clonotype2tcrs_backup.keys()) idl2 = sorted( clonotype2tcrs.keys()) print('same ids:', len(idl1), len(idl2), idl1==idl2) for id in clonotype2tcrs_backup: if id in clonotype2tcrs: for ab in 'AB': tl1 = sorted(clonotype2tcrs_backup[id][ab].keys()) tl2 = sorted(clonotype2tcrs[id][ab].keys()) if tl1 != tl2: print('diffids:',id,ab,tl1,tl2) return clonotype2tcrs, clonotype2barcodes def read_tcr_data_batch( organism, metadata_file, allow_unknown_genes = False, verbose = False, prefix_clone_ids_with_tcr_type = False, ): """ Parse tcr data, only taking 'productive' tcrs Returns: clonotype2tcrs, clonotype2barcodes """ assert exists( metadata_file ) md = pd.read_csv(metadata_file, dtype=str)#"string") if prefix_clone_ids_with_tcr_type: if organism2vdj_type[organism] == IG_VDJ_TYPE: clone_id_prefix = 'bcr_' else: clone_id_prefix = 'tcr_' else: clone_id_prefix = '' # read in contig files and update suffix to match GEX matrix contig_list = [] for x in range(len(md['file'])): dfx = pd.read_csv( md.loc[ x , 'file'] ) #read contig_df suffix = md.loc[ x , 'suffix'] # new suffix barcodes = dfx['barcode'].str.split('-').str.get(0) #hacky dfx['barcode'] = barcodes + '-' + suffix dfx['contig_id'] = barcodes + '-' + suffix + '_' + \ dfx['contig_id'].str.split('_').str.get(1) + \ '_' + dfx['contig_id'].str.split('_').str.get(2) # currently unused, but can't hurt # giving each library a tag here really boosted the number of clones I got back dfx['raw_clonotype_id'] = clone_id_prefix + dfx['raw_clonotype_id'] + '_' + suffix dfx['raw_consensus_id'] = clone_id_prefix + dfx['raw_consensus_id'] + '_' + suffix # currently unused, can't hurt contig_list.append(dfx) df = pd.concat(contig_list) expected_gene_names = set(all_genes[organism].keys()) #from cdr3s_human import all_align_fasta gene_suffix = '*01' # may not be used # read the contig annotations-- map from clonotypes to barcodes # barcode,is_cell,contig_id,high_confidence,length,chain,v_gene,d_gene,j_gene,c_gene,full_length,productive,cdr3,cdr3_nt,reads,umis,raw_clonotype_id,raw_consensus_id # AAAGATGGTCTTCTCG-1,True,AAAGATGGTCTTCTCG-1_contig_1,True,695,TRB,TRBV5-1*01,TRBD2*02,TRBJ2-3*01,TRBC2*01,True,True,CASSPLAGYAADTQYF,TGCGCCAGCAGCCCCCTAGCGGGATACGCAGCAGATACGCAGTATTTT,9427,9,clonotype14,clonotype14_consensus_1 #_, lines = parse_csv_file(contig_annotations_csvfile) #df = pd.read_csv(contig_annotations_csvfile) df['productive'] = df['productive'].astype(str) #sometimes it already is if there are 'Nones' in there... clonotype2tcrs = {} clonotype2barcodes = {} for l in df.itertuples(): # the fields we use: barcode raw_clonotype_id productive cdr3 cdr3_nt chain v_gene j_gene umis bc = l.barcode clonotype = l.raw_clonotype_id # annoying: pandas sometimes converts to True/False booleans and sometimes not. assert l.productive in [ 'None', 'False', 'True'] if clonotype =='None': continue if clonotype not in clonotype2barcodes: clonotype2barcodes[clonotype] = [] if bc in clonotype2barcodes[clonotype]: pass #print 'repeat barcode' else: clonotype2barcodes[clonotype].append( bc ) ## experimenting here ########################################3 if l.productive != 'True': continue if l.cdr3.lower() == 'none' or l.cdr3_nt.lower() == 'none': continue chain = l.chain ab = get_ab_from_10x_chain(chain, organism) if ab is None: continue if clonotype not in clonotype2tcrs: clonotype2tcrs[ clonotype ] = {'A':Counter(), 'B':Counter() } # stolen from below vg = fixup_gene_name(l.v_gene, gene_suffix, expected_gene_names) jg = fixup_gene_name(l.j_gene, gene_suffix, expected_gene_names) if vg not in expected_gene_names: print('unrecognized V gene:', organism, vg) if not allow_unknown_genes: continue if jg not in expected_gene_names: print('unrecognized J gene:', organism, jg) if not allow_unknown_genes: continue #assert vg in all_align_fasta[organism] #assert jg in all_align_fasta[organism] tcr_chain = ( vg, jg, l.cdr3, l.cdr3_nt.lower() ) clonotype2tcrs[clonotype][ab][tcr_chain] += int(l.umis) for id in clonotype2tcrs: for ab in 'AB': for t1,count1 in clonotype2tcrs[id][ab].items(): for t2, count2 in clonotype2tcrs[id][ab].items(): if t2<=t1:continue if t1[3] == t2[3]: print('repeat??', count1, count2, t1, t2) return clonotype2tcrs, clonotype2barcodes def _make_clones_file( organism, outfile, clonotype2tcrs, clonotype2barcodes, verbose=False ): ''' Make a clones file with information parsed from the 10X csv files organism is one of ['mouse','human'] outfile is the name of the clones file to be created ''' #tmpfile = outfile+'.tmp' # a temporary intermediate file bc_mapfile = outfile+'.barcode_mapping.tsv' outmap = open(bc_mapfile,'w') outmap.write('clone_id\tbarcodes\n') outfields = 'clone_id subject clone_size va_gene ja_gene va2_gene ja2_gene vb_gene jb_gene cdr3a cdr3a_nucseq cdr3a2 cdr3a2_nucseq cdr3b cdr3b_nucseq'\ .split() extra_fields = 'alpha_umi alpha2_umi beta_umi num_alphas num_betas'.split() outfields += extra_fields # we used to make a temporary file and then run tcr-dist/file_converter.py on it # for this slim version, just take the temporary file #out = open(tmpfile,'w') out = open(outfile,'w') out.write('\t'.join( outfields )+'\n' ) for clonotype in sorted(clonotype2tcrs.keys()): tcrs = clonotype2tcrs[clonotype] if len(tcrs['A']) >= 1 and len(tcrs['B']) >= 1: atcrs = tcrs['A'].most_common() btcrs = tcrs['B'].most_common() if len(atcrs)>1: if verbose: print('multiple alphas, picking top umi:',' '.join( str(x) for _,x in atcrs )) atcr2, atcr2_umi = atcrs[1] else: atcr2, atcr2_umi = ('', '', '', ''), 0 if len(btcrs)>1 and verbose: print('multiple betas, picking top umi:',' '.join( str(x) for _,x in btcrs )) atcr, atcr_umi = atcrs[0] btcr, btcr_umi = btcrs[0] outl = {} outl['clone_id'] = clonotype outl['subject'] = 'UNK_S' outl['clone_size'] = len(clonotype2barcodes[clonotype]) outl['va_gene'] = atcr[0] outl['ja_gene'] = atcr[1] outl['cdr3a'] = atcr[2] outl['cdr3a_nucseq'] = atcr[3] outl['alpha_umi'] = str(atcr_umi) outl['va2_gene'] = atcr2[0] outl['ja2_gene'] = atcr2[1] outl['cdr3a2'] = atcr2[2] outl['cdr3a2_nucseq'] = atcr2[3] outl['alpha2_umi'] = str(atcr2_umi) outl['num_alphas'] = str(len(atcrs)) outl['vb_gene'] = btcr[0] outl['jb_gene'] = btcr[1] outl['cdr3b'] = btcr[2] outl['cdr3b_nucseq'] = btcr[3] outl['beta_umi'] = str(btcr_umi) outl['num_betas'] = str(len(btcrs)) if len(outl['cdr3a']) < MIN_CDR3_LEN or len(outl['cdr3b']) < MIN_CDR3_LEN: if verbose: print('Warning: skipping clonotype with short cdr3s: {} {} {}'\ .format(clonotype, outl['cdr3a'], outl['cdr3b'] )) continue out.write( '\t'.join(str(outl[x]) for x in outfields)+'\n') outmap.write('{}\t{}\n'.format(clonotype,','.join(clonotype2barcodes[clonotype]))) out.close() outmap.close() # for the time being, go with the clones file we just made even though it doesn't have all the usual stupid info def setup_filtered_clonotype_dicts( clonotype2tcrs, clonotype2barcodes, min_repeat_count_fraction = 0.33, verbose = False ): ''' returns new_clonotype2tcrs, new_clonotype2barcodes ''' # get count of how many cells support each pairing # pairing_counts, pairing_counts_by_umi = Counter(), Counter() for cid, tcrs in clonotype2tcrs.items(): size = len(clonotype2barcodes[cid]) for t1, umi1 in tcrs['A'].items(): for t2, umi2 in tcrs['B'].items(): pairing_counts[ (t1,t2) ] += size pairing_counts_by_umi[ (t1,t2) ] += min(umi1, umi2) # this is no longer going to be a bijection! chain_partner = {} valid_ab_pairings = set() for ( (t1,t2), count ) in list(pairing_counts.most_common()): # make a copy for sanity if t1 in chain_partner or t2 in chain_partner: t1_p2 = chain_partner.get(t1,None) t2_p2 = chain_partner.get(t2,None) oldcount1 = pairing_counts[ (t1,t1_p2) ] oldcount2 = pairing_counts[ (t2_p2,t2) ] if count >= min_repeat_count_fraction * max(oldcount1,oldcount2): # take it anyway -- second alpha or genuinely shared alpha? if verbose: print('take_rep_partners:', count, oldcount1, oldcount2, t1, t2, t1_p2, t2_p2) # dont overwrite the old pairing... might not do either of these! if t1 not in chain_partner: chain_partner[t1] = t2 if t2 not in chain_partner: chain_partner[t2] = t1 valid_ab_pairings.add( (t1, t2 ) ) else: if verbose: print('skip_rep_partners:', count, oldcount1, oldcount2, t1, t2, t1_p2, t2_p2) else: # neither chain already in chain_partner # # NOTE: removed the code checking for TIES!!!!!!!!!!! if verbose: print('norep_partners:', count, t1, t2) chain_partner[t1] = t2 chain_partner[t2] = t1 valid_ab_pairings.add( ( t1, t2 ) ) # now let's revisit the clonotypes pairs_tuple2clonotypes = {} ab_counts = Counter() # for diagnostics for (clone_size, cid) in reversed( sorted( (len(y), x) for x,y in clonotype2barcodes.items() ) ): if cid not in clonotype2tcrs: #print('WHOAH missing tcrs for clonotype', clone_size, cid, clonotype2barcodes[cid]) continue tcrs = clonotype2tcrs[cid] was_good_clone = len(tcrs['A']) >= 1 and len(tcrs['B']) >= 1 pairs = [] for atcr in tcrs['A']: for btcr in tcrs['B']: if ( atcr,btcr ) in valid_ab_pairings: pairs.append( (atcr,btcr) ) if pairs: pairs_tuple = None if len(pairs)>1: alphas = set( x[0] for x in pairs ) betas = set( x[1] for x in pairs ) ab_counts[ (len(alphas),len(betas) ) ] += clone_size if len(alphas) == 2 and len(betas) == 1: ## only allow double-alphas assert len(pairs) == 2 pairs_tuple = tuple(x[1] for x in reversed(sorted( [ (pairing_counts[x],x) for x in pairs ] ))) assert len( pairs_tuple)==2 # confirm ordered by counts assert pairing_counts[pairs_tuple[0]] >= pairing_counts[pairs_tuple[1]] else: ab_counts[ (1,1) ] += clone_size pairs_tuple = tuple(pairs) assert len(pairs_tuple) == 1 if pairs_tuple: pairs_tuple2clonotypes.setdefault( pairs_tuple, [] ).append( cid ) else: if verbose: print('SKIPCLONE:', was_good_clone, cid, clone_size, pairs, 'bad_pairs') else: if verbose: print('SKIPCLONE:', was_good_clone, cid, clone_size, 'no_valid_pairs') ## reorder pairs_tuples in the case of ties, using umis reorder = [] for pt, clonotypes in pairs_tuple2clonotypes.items(): assert len(pt) in [1,2] if len(pt) == 2: assert pt[0][1] == pt[1][1] # same beta chain at1, bt = pt[0] at2, _ = pt[1] count1, count2 = pairing_counts[(at1,bt)], pairing_counts[(at2,bt)] assert count1 >= count2 if count1 == count2: # no way to figure out which is the primary alpha! # look at umis? c1 = sum( clonotype2tcrs[x]['A'][at1] for x in clonotypes ) c2 = sum( clonotype2tcrs[x]['A'][at2] for x in clonotypes ) if verbose: print('alphatie:', count1, count2, c1, c2, show(at1), show(at2), show(bt)) if c2 > c1: reorder.append( pt ) for pt in reorder: #print('reorder:', show(pt)) assert len(pt) == 2 rpt = (pt[1], pt[0]) assert pt in pairs_tuple2clonotypes and rpt not in pairs_tuple2clonotypes pairs_tuple2clonotypes[rpt] = pairs_tuple2clonotypes[pt][:] del pairs_tuple2clonotypes[pt] ## look for len1 pairs_tuples that overlap with two different len2 pairs_tuples merge_into_pairs = [] for pt1 in pairs_tuple2clonotypes: if len(pt1) == 1: overlaps = [] for pt2 in pairs_tuple2clonotypes: if len(pt2) == 2 and pt2[0] == pt1[0]: overlaps.append( pt2 ) elif len(pt2) == 2 and pt2[1] == pt1[0]: # this 'elif' was added 2020-12-12; before that we were missing some # overlaps... # print('MISSED OVERLAP:', pairing_counts[pt2[0]], pairing_counts[pt2[1]], # pairing_counts_by_umi[pt2[0]], pairing_counts_by_umi[pt2[1]], # show(pt1), show(pt2)) overlaps.append( pt2 ) if len(overlaps)>1: if verbose: print('badoverlaps:', len(overlaps), show(pt1), show(overlaps)) elif len(overlaps)==1: pt2 = overlaps[0] merge_into_pairs.append( (pt1,pt2) ) for pt1, pt2 in merge_into_pairs: assert len(pt1) == 1 and len(pt2) == 2 #print('mergeinto:', show(pt1), show(pt2)) pairs_tuple2clonotypes[pt2].extend( pairs_tuple2clonotypes[pt1] ) del pairs_tuple2clonotypes[pt1] ## look for pairs_tuples that will give the same clones file line if verbose: for pt1, clonotypes in pairs_tuple2clonotypes.items(): for pt2 in pairs_tuple2clonotypes: if pt1 < pt2 and pt1[0] == pt2[0]: print('overlap:', len(pt1), len(pt2), pt1, pt2) ## now setup new clonotype2tcrs, clonotype2barcodes mappings new_clonotype2tcrs = {} new_clonotype2barcodes = {} for pairs_tuple, clonotypes in pairs_tuple2clonotypes.items(): c0 = clonotypes[0] if len(clonotypes)>1: if verbose: print('merging:', ' '.join(clonotypes)) tcrs = {'A':Counter(), 'B':Counter()} for (atcr,btcr) in pairs_tuple: tcrs['A'][atcr] += pairing_counts[(atcr, btcr)] tcrs['B'][btcr] += pairing_counts[(atcr, btcr)] if len(pairs_tuple)==2: a1, a2 = pairs_tuple[0][0], pairs_tuple[1][0] if tcrs['A'][a1] == tcrs['A'][a2]: tcrs['A'][a1] += 1 # ensure the desired order else: assert tcrs['A'][a1] > tcrs['A'][a2] assert len(tcrs['A']) in [1,2] assert len(tcrs['B']) == 1 assert c0 not in new_clonotype2tcrs new_clonotype2tcrs[c0] = tcrs new_clonotype2barcodes[c0] = list(chain( *(clonotype2barcodes[x] for x in clonotypes))) # print 'new:', new_clonotype2barcodes[c0] # for c in clonotypes: # print 'old:', clonotype2barcodes[c] # print len(new_clonotype2barcodes[c0]), sum( len(clonotype2barcodes[x]) for x in clonotypes) assert len(new_clonotype2barcodes[c0]) == sum( len(clonotype2barcodes[x]) for x in clonotypes) print('ab_counts:', ab_counts.most_common()) old_good_clonotypes = [ x for x,y in clonotype2tcrs.items() if len(y['A']) >= 1 and len(y['B']) >= 1 ] old_num_barcodes = sum( len(clonotype2barcodes[x]) for x in old_good_clonotypes ) new_num_barcodes = sum( len(x) for x in list(new_clonotype2barcodes.values()) ) print('old_num_barcodes:', old_num_barcodes, 'new_num_barcodes:', new_num_barcodes) return new_clonotype2tcrs, new_clonotype2barcodes def make_10x_clones_file( filtered_contig_annotations_csvfile, organism, clones_file, # the OUTPUT file, the one we're making stringent = True, # dont believe the 10x clonotypes; reduce 'duplicated' and 'fake' clones consensus_annotations_csvfile = None, ): clonotype2tcrs, clonotype2barcodes = read_tcr_data( organism, filtered_contig_annotations_csvfile, consensus_annotations_csvfile ) if stringent: clonotype2tcrs, clonotype2barcodes = setup_filtered_clonotype_dicts( clonotype2tcrs, clonotype2barcodes ) _make_clones_file( organism, clones_file, clonotype2tcrs, clonotype2barcodes ) def make_10x_clones_file_batch( metadata_file, organism, clones_file, # the OUTPUT file, the one we're making stringent = True, # dont believe the 10x clonotypes; reduce 'duplicated' and 'fake' clones ): clonotype2tcrs, clonotype2barcodes = read_tcr_data_batch( organism, metadata_file ) if stringent: clonotype2tcrs, clonotype2barcodes = setup_filtered_clonotype_dicts( clonotype2tcrs, clonotype2barcodes ) _make_clones_file( organism, clones_file, clonotype2tcrs, clonotype2barcodes )
40.211538
229
0.588125
7949bc75d3c7d1b8a78edddba0cc11fba159845c
1,214
py
Python
ginger/app/api/v1/token.py
MiracleWong/flask-api
a3e14c666284a39b3a9992558c494b869f9d864f
[ "MIT" ]
null
null
null
ginger/app/api/v1/token.py
MiracleWong/flask-api
a3e14c666284a39b3a9992558c494b869f9d864f
[ "MIT" ]
null
null
null
ginger/app/api/v1/token.py
MiracleWong/flask-api
a3e14c666284a39b3a9992558c494b869f9d864f
[ "MIT" ]
null
null
null
# -*- coding:utf-8 -*- ''' created by MiracleWong on 2019/2/8 ''' from flask import current_app, jsonify from app.libs.enums import ClientTypeEnum from app.libs.redprint import Redprint from app.modules.user import User from app.validators.forms import ClientForm from itsdangerous import TimedJSONWebSignatureSerializer as Serializer __author__ = 'MiracleWong' api = Redprint('token') @api.route('', methods=['POST']) def get_token(): form = ClientForm().validate_for_api() promise = { ClientTypeEnum.USER_MAIL: User.verify, } identity = promise[ClientTypeEnum(form.type.data)]( form.account.data, form.secret.data ) expiration = current_app.config['TOKEN_EXPIRATION'] token = generate_auth_token(identity['uid'], form.type.data, identity['scope'], expiration) t = { 'token': token.decode("ascii") } return jsonify(t), 201 def generate_auth_token(uid, ac_type, scope=None, expiration=7200): """生成令牌""" s = Serializer(current_app.config['SECRET_KEY'], expires_in=expiration) return s.dumps({ 'uid': uid, 'type': ac_type.value, 'scope': scope })
26.977778
70
0.652389
7949bd1d0f14c8e86af0468e100e1aa311170d9d
10,084
py
Python
firexapp/submit/arguments.py
FireXStuff/firexapp
04be9f087ca405582be6107b2b345923e25e6f5f
[ "BSD-3-Clause" ]
7
2019-02-15T22:00:10.000Z
2022-02-02T02:12:35.000Z
firexapp/submit/arguments.py
FireXStuff/firexapp
04be9f087ca405582be6107b2b345923e25e6f5f
[ "BSD-3-Clause" ]
13
2019-03-11T20:28:08.000Z
2021-02-22T16:12:59.000Z
firexapp/submit/arguments.py
FireXStuff/firexapp
04be9f087ca405582be6107b2b345923e25e6f5f
[ "BSD-3-Clause" ]
null
null
null
import os import sys import re from firexkit.argument_conversion import ConverterRegister from typing import Union from firexapp.submit.console import setup_console_logging logger = setup_console_logging(__name__) def get_chain_args(other_args: []): """This function converts a flat list of --key value pairs into a dictionary""" chain_arguments = {} # Create arguments list for the chain it = iter(other_args) no_value_exception = None for x in it: if not x.startswith('-'): if no_value_exception: # the error was earlier raise no_value_exception raise ChainArgException('Error: Argument should start with a proper dash (- or --)\n%s' % x) try: value = next(it) if str(value).startswith("-"): # there might be an error. we'll find out later no_value_exception = ChainArgException( 'Error: Arguments must have an accompanying value\n%s' % x) except StopIteration: raise ChainArgException('Error: Arguments must have an accompanying value\n%s' % x) key = x.lstrip('-') if not re.match('^[A-Za-z].*', key): raise ChainArgException('Error: Argument should start with a letter\n%s' % key) chain_arguments[key] = value return chain_arguments class ChainArgException(Exception): pass class InputConverter: """ This class uses a singleton object design to store converters which parse the cli arguments. Converter functions are stored into the singleton InputConverter object by adding the @register decorator to the top of each desired function. """ _global_instance = None pre_load_was_run = False @classmethod def instance(cls) -> ConverterRegister: # usd by tests only """Used for unit testing only""" if cls._global_instance is None: cls._global_instance = ConverterRegister() return cls._global_instance @classmethod def register(cls, *args): """ Registers a callable object to be run during conversion. The callable should take in kwargs, and return a dict with any changes to the input arguments, or None if no changes are necessary. :Example single argument converter: @InputConverter.register @SingleArgDecorator('something') def convert_something(arg_value): arg_value = arg_value.upper() return arg_value :Optionally, dependencies can defined at registration: @InputConverter.register('other_converter', 'and_another_converter') @SingleArgDecorator('something') def convert_something(arg_value): arg_value = arg_value.upper() return arg_value Conversion occurs on two occasions, before microservices are loaded, or after. You can explicitly mark a converter to run pre-loading or post-loading of the ALL microservices by passing True (pre) or False (post) during registration. This design is used in the spirit of failing fast, providing early failure of runs before the bulk of microservices are imported. If bool is not provided, it will register to run pre unless loading has already occurred. @InputConverter.register('other_converter', False) @SingleArgDecorator('something') def convert_something(arg_value): ... return arg_value When a conversion fails the given function can simply call raise to instruct the user how to correct their inputs. """ for arg in args: if not isinstance(arg, bool): continue if arg and cls.pre_load_was_run: raise Exception("Pre-microservice load conversion has already been run. " "You can only register post load") preload = arg break else: preload = not cls.pre_load_was_run args = args + (preload,) if preload: for arg in args: if not callable(arg): continue converter = arg # special handling of single argument decorator single_arg_decorator = getattr(converter, "single_arg_decorator", None) if not single_arg_decorator: continue # need to override the append method of the single argument converters old_append = converter.append def new_append(*more_ags): # special handling of first post load call if cls.pre_load_was_run: # re-register this converter, but in post single_arg_decorator.args.clear() InputConverter.register(converter) # restore original behaviour converter.append = old_append old_append(*more_ags) converter.append = new_append return cls.instance().register(*args) @classmethod def convert(cls, pre_load=None, **kwargs) -> dict: """ Activates conversion. kwargs provided are passed to any registered converter. This function should be called twice, and only twice. Once with initially loaded converters, and then with the secondary ones. :param pre_load: Used for testing. preload is defaulted to None and will auto populate """ # Auto set whether this is preload, unless explicitly specified pre_load = not cls.pre_load_was_run if pre_load is None else pre_load if pre_load and cls.pre_load_was_run: raise Exception("Pre-microservice conversion was already run") cls.pre_load_was_run = True return cls.instance().convert(pre_task=pre_load, **kwargs) @InputConverter.register def convert_booleans(kwargs): """Converts standard true/false/none values to bools and None""" for key, value in kwargs.items(): if not isinstance(value, str): continue if value.upper() == 'TRUE': value = True elif value.upper() == 'FALSE': value = False elif value.upper() == 'NONE': value = None kwargs[key] = value return kwargs @InputConverter.register def auto_load_pydev_debugging_plugin(kwargs): if not sys.gettrace() or sys.gettrace().__class__.__module__ == "coverage": return logger.debug("Debug detected") plugins = kwargs.get("plugins", "") if "pydev_debug_plugin.py" in plugins: logger.debug("Debug plugin already included") return # local and include the pydev debugging plugin logger.debug("Auto-including debug plugin") import firexapp.testing debugging_plugin = os.path.join(os.path.dirname(firexapp.testing.__file__), "pydev_debug_plugin.py") if plugins: debugging_plugin = "," + debugging_plugin return {"plugins": plugins + debugging_plugin} _global_argument_whitelist = set() def whitelist_arguments(argument_list: Union[str, list]): """ Function for adding argument keys to the global argument whitelist. Used during validation of input arguments :param argument_list:List of argument keys to whitelist. :type argument_list: list """ if type(argument_list) == str: argument_list = [argument_list] global _global_argument_whitelist _global_argument_whitelist |= set(argument_list) def find_unused_arguments(chain_args: {}, ignore_list: [], all_tasks: []): """ Function to detect any arguments that are not explicitly consumed by any microservice. :note: This should be run AFTER all microservices have been loaded. :param chain_args: The dictionary of chain args to check :type chain_args: dict :param ignore_list: A list of exception arguments that are acceptable. This usually includes application args. :type ignore_list: list :param all_tasks: A list of all microservices. Usually app.tasks :return: A dictionary of un-applicable arguments """ import Levenshtein as Lev if len(chain_args) == 0: return {}, {} ignore_list += _global_argument_whitelist # remove any whitelisted unused_chain_args = chain_args.copy() for std_arg in ignore_list: if std_arg in unused_chain_args: unused_chain_args.pop(std_arg) # build up used chain arg list used_chain_args = [] for _, task in all_tasks.items(): used_chain_args.extend(getattr(task, "required_args", [])) used_chain_args.extend(getattr(task, "optional_args", [])) # Loop through used args and remove any found in unused list for used_arg in used_chain_args: if used_arg in unused_chain_args: unused_chain_args.pop(used_arg) # Loop through remaining unused chain args and build near-match dict close_matches = {} for unused_arg in unused_chain_args: close_match = {} for used_arg in used_chain_args: # for unused args less than 10 chars long, use distance method, otherwise use ratio method. if len(unused_arg) < 10: distance = Lev.distance(used_arg, unused_arg) if distance < 3: if not close_match or close_match['distance'] > distance: close_match['arg'] = used_arg close_match['distance'] = distance else: match_ratio = Lev.ratio(used_arg, unused_arg) if match_ratio > 0.9: if not close_match or close_match['ratio'] < match_ratio: close_match['arg'] = used_arg close_match['ratio'] = match_ratio # Store the closest match in the returned dict if close_match: close_matches[unused_arg] = close_match['arg'] return unused_chain_args, close_matches
37.76779
119
0.640916
7949bd7c87d9717796d5d7dc76f3dac2d087527d
9,263
py
Python
test/tasks_classification_task_test.py
jlin27/ClassyVision-1
113ddb0b66471eb84add9af53751d9067786a7f0
[ "MIT" ]
null
null
null
test/tasks_classification_task_test.py
jlin27/ClassyVision-1
113ddb0b66471eb84add9af53751d9067786a7f0
[ "MIT" ]
null
null
null
test/tasks_classification_task_test.py
jlin27/ClassyVision-1
113ddb0b66471eb84add9af53751d9067786a7f0
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 # Copyright (c) Facebook, Inc. and its affiliates. # # This source code is licensed under the MIT license found in the # LICENSE file in the root directory of this source tree. import copy import shutil import tempfile import unittest from test.generic.config_utils import get_fast_test_task_config, get_test_task_config from test.generic.utils import compare_model_state, compare_samples, compare_states import torch from classy_vision.dataset import build_dataset from classy_vision.generic.util import get_checkpoint_dict from classy_vision.hooks import CheckpointHook, LossLrMeterLoggingHook from classy_vision.losses import build_loss from classy_vision.models import build_model from classy_vision.optim import build_optimizer from classy_vision.tasks import ClassificationTask, build_task from classy_vision.trainer import LocalTrainer class TestClassificationTask(unittest.TestCase): def _compare_model_state(self, model_state_1, model_state_2, check_heads=True): compare_model_state(self, model_state_1, model_state_2, check_heads) def _compare_samples(self, sample_1, sample_2): compare_samples(self, sample_1, sample_2) def _compare_states(self, state_1, state_2, check_heads=True): compare_states(self, state_1, state_2) def setUp(self): # create a base directory to write checkpoints to self.base_dir = tempfile.mkdtemp() def tearDown(self): # delete all the temporary data created shutil.rmtree(self.base_dir) def test_build_task(self): config = get_test_task_config() task = build_task(config) self.assertTrue(isinstance(task, ClassificationTask)) def test_hooks_config_builds_correctly(self): config = get_test_task_config() config["hooks"] = [{"name": "loss_lr_meter_logging"}] task = build_task(config) self.assertTrue(len(task.hooks) == 1) self.assertTrue(isinstance(task.hooks[0], LossLrMeterLoggingHook)) def test_get_state(self): config = get_test_task_config() loss = build_loss(config["loss"]) task = ( ClassificationTask() .set_num_epochs(1) .set_loss(loss) .set_model(build_model(config["model"])) .set_optimizer(build_optimizer(config["optimizer"])) ) for phase_type in ["train", "test"]: dataset = build_dataset(config["dataset"][phase_type]) task.set_dataset(dataset, phase_type) task.prepare() task = build_task(config) task.prepare() def test_synchronize_losses_non_distributed(self): """ Tests that synchronize losses has no side effects in a non-distributed setting. """ test_config = get_fast_test_task_config() task = build_task(test_config) task.prepare() old_losses = copy.deepcopy(task.losses) task.synchronize_losses() self.assertEqual(old_losses, task.losses) def test_synchronize_losses_when_losses_empty(self): config = get_fast_test_task_config() task = build_task(config) task.prepare() task.set_use_gpu(torch.cuda.is_available()) # Losses should be empty when creating task self.assertEqual(len(task.losses), 0) task.synchronize_losses() def test_checkpointing(self): """ Tests checkpointing by running train_steps to make sure the train_steps run the same way after loading from a checkpoint. """ config = get_fast_test_task_config() task = build_task(config).set_hooks([LossLrMeterLoggingHook()]) task_2 = build_task(config).set_hooks([LossLrMeterLoggingHook()]) task.set_use_gpu(torch.cuda.is_available()) # prepare the tasks for the right device task.prepare() # test in both train and test mode for _ in range(2): task.advance_phase() # set task's state as task_2's checkpoint task_2._set_checkpoint_dict(get_checkpoint_dict(task, {}, deep_copy=True)) task_2.prepare() # task 2 should have the same state self._compare_states(task.get_classy_state(), task_2.get_classy_state()) # this tests that both states' iterators return the same samples sample = next(task.get_data_iterator()) sample_2 = next(task_2.get_data_iterator()) self._compare_samples(sample, sample_2) # test that the train step runs the same way on both states # and the loss remains the same task.train_step() task_2.train_step() self._compare_states(task.get_classy_state(), task_2.get_classy_state()) def test_final_train_checkpoint(self): """Test that a train phase checkpoint with a where of 1.0 can be loaded""" config = get_fast_test_task_config() task = build_task(config).set_hooks( [CheckpointHook(self.base_dir, {}, phase_types=["train"])] ) task_2 = build_task(config) task.set_use_gpu(torch.cuda.is_available()) trainer = LocalTrainer() trainer.train(task) # make sure fetching the where raises an exception, which means that # where is >= 1.0 with self.assertRaises(Exception): task.where # set task_2's state as task's final train checkpoint task_2.set_checkpoint(self.base_dir) task_2.prepare() # we should be able to train the task trainer.train(task_2) def test_test_only_checkpointing(self): """ Tests checkpointing by running train_steps to make sure the train_steps run the same way after loading from a training task checkpoint on a test_only task. """ train_config = get_fast_test_task_config() train_config["num_epochs"] = 10 test_config = get_fast_test_task_config() test_config["test_only"] = True train_task = build_task(train_config).set_hooks([LossLrMeterLoggingHook()]) test_only_task = build_task(test_config).set_hooks([LossLrMeterLoggingHook()]) # prepare the tasks for the right device train_task.prepare() # test in both train and test mode trainer = LocalTrainer() trainer.train(train_task) # set task's state as task_2's checkpoint test_only_task._set_checkpoint_dict( get_checkpoint_dict(train_task, {}, deep_copy=True) ) test_only_task.prepare() test_state = test_only_task.get_classy_state() # We expect the phase idx to be different for a test only task self.assertEqual(test_state["phase_idx"], -1) # We expect that test only state is test, no matter what train state is self.assertFalse(test_state["train"]) # Num updates should be 0 self.assertEqual(test_state["num_updates"], 0) # train_phase_idx should -1 self.assertEqual(test_state["train_phase_idx"], -1) # Verify task will run trainer = LocalTrainer() trainer.train(test_only_task) def test_test_only_task(self): """ Tests the task in test mode by running train_steps to make sure the train_steps run as expected on a test_only task """ test_config = get_fast_test_task_config() test_config["test_only"] = True # delete train dataset del test_config["dataset"]["train"] test_only_task = build_task(test_config).set_hooks([LossLrMeterLoggingHook()]) test_only_task.prepare() test_state = test_only_task.get_classy_state() # We expect that test only state is test, no matter what train state is self.assertFalse(test_state["train"]) # Num updates should be 0 self.assertEqual(test_state["num_updates"], 0) # Verify task will run trainer = LocalTrainer() trainer.train(test_only_task) def test_train_only_task(self): """ Tests that the task runs when only a train dataset is specified. """ test_config = get_fast_test_task_config() # delete the test dataset from the config del test_config["dataset"]["test"] task = build_task(test_config).set_hooks([LossLrMeterLoggingHook()]) task.prepare() # verify the the task can still be trained trainer = LocalTrainer() trainer.train(task) @unittest.skipUnless(torch.cuda.is_available(), "This test needs a gpu to run") def test_checkpointing_different_device(self): config = get_fast_test_task_config() task = build_task(config) task_2 = build_task(config) for use_gpu in [True, False]: task.set_use_gpu(use_gpu) task.prepare() # set task's state as task_2's checkpoint task_2._set_checkpoint_dict(get_checkpoint_dict(task, {}, deep_copy=True)) # we should be able to run the trainer using state from a different device trainer = LocalTrainer() task_2.set_use_gpu(not use_gpu) trainer.train(task_2)
35.220532
87
0.665227
7949bda533828f1e8fdf163b488d976fb9c63c61
23,268
py
Python
pyxdsm/XDSM.py
eirikurj/pyXDSM
6c631150f6b78e367127c0b7f4e273c3bb37f6ce
[ "Apache-2.0" ]
30
2018-09-30T11:47:05.000Z
2021-11-11T18:04:32.000Z
pyxdsm/XDSM.py
eirikurj/pyXDSM
6c631150f6b78e367127c0b7f4e273c3bb37f6ce
[ "Apache-2.0" ]
20
2018-06-08T15:44:36.000Z
2022-01-05T19:43:50.000Z
pyxdsm/XDSM.py
eirikurj/pyXDSM
6c631150f6b78e367127c0b7f4e273c3bb37f6ce
[ "Apache-2.0" ]
32
2017-11-29T09:55:35.000Z
2022-03-06T12:15:41.000Z
from __future__ import print_function import os import numpy as np import json import subprocess from collections import namedtuple from pyxdsm import __version__ as pyxdsm_version OPT = "Optimization" SUBOPT = "SubOptimization" SOLVER = "MDA" DOE = "DOE" IFUNC = "ImplicitFunction" FUNC = "Function" GROUP = "Group" IGROUP = "ImplicitGroup" METAMODEL = "Metamodel" tikzpicture_template = r""" %%% Preamble Requirements %%% % \usepackage{{geometry}} % \usepackage{{amsfonts}} % \usepackage{{amsmath}} % \usepackage{{amssymb}} % \usepackage{{tikz}} % Optional packages such as sfmath set through python interface % \usepackage{{{optional_packages}}} % \usetikzlibrary{{arrows,chains,positioning,scopes,shapes.geometric,shapes.misc,shadows}} %%% End Preamble Requirements %%% \input{{"{diagram_styles_path}"}} \begin{{tikzpicture}} \matrix[MatrixSetup]{{ {nodes}}}; % XDSM process chains {process} \begin{{pgfonlayer}}{{data}} \path {edges} \end{{pgfonlayer}} \end{{tikzpicture}} """ tex_template = r""" % XDSM diagram created with pyXDSM {version}. \documentclass{{article}} \usepackage{{geometry}} \usepackage{{amsfonts}} \usepackage{{amsmath}} \usepackage{{amssymb}} \usepackage{{tikz}} % Optional packages such as sfmath set through python interface \usepackage{{{optional_packages}}} % Define the set of TikZ packages to be included in the architecture diagram document \usetikzlibrary{{arrows,chains,positioning,scopes,shapes.geometric,shapes.misc,shadows}} % Set the border around all of the architecture diagrams to be tight to the diagrams themselves % (i.e. no longer need to tinker with page size parameters) \usepackage[active,tightpage]{{preview}} \PreviewEnvironment{{tikzpicture}} \setlength{{\PreviewBorder}}{{5pt}} \begin{{document}} \input{{"{tikzpicture_path}"}} \end{{document}} """ def chunk_label(label, n_chunks): # looping till length l for i in range(0, len(label), n_chunks): yield label[i : i + n_chunks] def _parse_label(label, label_width=None): if isinstance(label, (tuple, list)): if label_width is None: return r"$\begin{array}{c}" + r" \\ ".join(label) + r"\end{array}$" else: labels = [] for chunk in chunk_label(label, label_width): labels.append(", ".join(chunk)) return r"$\begin{array}{c}" + r" \\ ".join(labels) + r"\end{array}$" else: return r"${}$".format(label) def _label_to_spec(label, spec): if isinstance(label, str): label = [ label, ] for var in label: if var: spec.add(var) System = namedtuple("System", "node_name style label stack faded label_width spec_name") Input = namedtuple("Input", "node_name label label_width style stack") Output = namedtuple("Output", "node_name label label_width style stack side") Connection = namedtuple("Connection", "src target label label_width style stack faded") class XDSM(object): def __init__(self, use_sfmath=True): self.systems = [] self.connections = [] self.left_outs = {} self.right_outs = {} self.ins = {} self.processes = [] self.process_arrows = [] self.use_sfmath = use_sfmath def add_system(self, node_name, style, label, stack=False, faded=False, label_width=None, spec_name=None): """ Add a "system" block, which will be placed on the diagonal of the XDSM diagram. Parameters ---------- node_name : str The unique name given to this component style : str The type of the component label : str or list/tuple of strings The label to appear on the diagram. There are two options for this: - a single string - a list or tuple of strings, which is used for line breaking In either case, they should probably be enclosed in \text{} declarations to make sure the font is upright. stack : bool If true, the system will be displayed as several stacked rectangles, indicating the component is executed in parallel. faded : bool If true, the component will be faded, in order to highlight some other system. label_width : int or None If not None, AND if ``label`` is given as either a tuple or list, then this parameter controls how many items in the tuple/list will be displayed per line. If None, the label will be printed one item per line if given as a tuple or list, otherwise the string will be printed on a single line. spec_name : str The spec name used for the spec file. """ if spec_name is None: spec_name = node_name sys = System(node_name, style, label, stack, faded, label_width, spec_name) self.systems.append(sys) def add_input(self, name, label, label_width=None, style="DataIO", stack=False): """ Add an input, which will appear in the top row of the diagram. Parameters ---------- name : str The unique name given to this component label : str or list/tuple of strings The label to appear on the diagram. There are two options for this: - a single string - a list or tuple of strings, which is used for line breaking In either case, they should probably be enclosed in \text{} declarations to make sure the font is upright. label_width : int or None If not None, AND if ``label`` is given as either a tuple or list, then this parameter controls how many items in the tuple/list will be displayed per line. If None, the label will be printed one item per line if given as a tuple or list, otherwise the string will be printed on a single line. style : str The style given to this component. Can be one of ['DataInter', 'DataIO'] stack : bool If true, the system will be displayed as several stacked rectangles, indicating the component is executed in parallel. """ self.ins[name] = Input("output_" + name, label, label_width, style, stack) def add_output(self, name, label, label_width=None, style="DataIO", stack=False, side="left"): """ Add an output, which will appear in the left or right-most column of the diagram. Parameters ---------- name : str The unique name given to this component label : str or list/tuple of strings The label to appear on the diagram. There are two options for this: - a single string - a list or tuple of strings, which is used for line breaking In either case, they should probably be enclosed in \text{} declarations to make sure the font is upright. label_width : int or None If not None, AND if ``label`` is given as either a tuple or list, then this parameter controls how many items in the tuple/list will be displayed per line. If None, the label will be printed one item per line if given as a tuple or list, otherwise the string will be printed on a single line. style : str The style given to this component. Can be one of ``['DataInter', 'DataIO']`` stack : bool If true, the system will be displayed as several stacked rectangles, indicating the component is executed in parallel. side : str Must be one of ``['left', 'right']``. This parameter controls whether the output is placed on the left-most column or the right-most column of the diagram. """ if side == "left": self.left_outs[name] = Output("left_output_" + name, label, label_width, style, stack, side) elif side == "right": self.right_outs[name] = Output("right_output_" + name, label, label_width, style, stack, side) else: raise ValueError("The option 'side' must be given as either 'left' or 'right!'") def connect(self, src, target, label, label_width=None, style="DataInter", stack=False, faded=False): """ Connects two components with a data line, and adds a label to indicate the data being transferred. Parameters ---------- src : str The name of the source component. target : str The name of the target component. label : str or list/tuple of strings The label to appear on the diagram. There are two options for this: - a single string - a list or tuple of strings, which is used for line breaking In either case, they should probably be enclosed in \text{} declarations to make sure the font is upright. label_width : int or None If not None, AND if ``label`` is given as either a tuple or list, then this parameter controls how many items in the tuple/list will be displayed per line. If None, the label will be printed one item per line if given as a tuple or list, otherwise the string will be printed on a single line. style : str The style given to this component. Can be one of ``['DataInter', 'DataIO']`` stack : bool If true, the system will be displayed as several stacked rectangles, indicating the component is executed in parallel. faded : bool If true, the component will be faded, in order to highlight some other system. """ if src == target: raise ValueError("Can not connect component to itself") if (not isinstance(label_width, int)) and (label_width is not None): raise ValueError("label_width argument must be an integer") self.connections.append(Connection(src, target, label, label_width, style, stack, faded)) def add_process(self, systems, arrow=True): """ Add a process line between a list of systems, to indicate process flow. Parameters ---------- systems : list The names of the components, in the order in which they should be connected. For a complete cycle, repeat the first component as the last component. arrow : bool If true, arrows will be added to the process lines to indicate the direction of the process flow. """ self.processes.append(systems) self.process_arrows.append(arrow) def _build_node_grid(self): size = len(self.systems) comps_rows = np.arange(size) comps_cols = np.arange(size) if self.ins: size += 1 # move all comps down one row comps_rows += 1 if self.left_outs: size += 1 # shift all comps to the right by one, to make room for inputs comps_cols += 1 if self.right_outs: size += 1 # don't need to shift anything in this case # build a map between comp node_names and row idx for ordering calculations row_idx_map = {} col_idx_map = {} node_str = r"\node [{style}] ({node_name}) {{{node_label}}};" grid = np.empty((size, size), dtype=object) grid[:] = "" # add all the components on the diagonal for i_row, j_col, comp in zip(comps_rows, comps_cols, self.systems): style = comp.style if comp.stack is True: # stacking style += ",stack" if comp.faded is True: # fading style += ",faded" label = _parse_label(comp.label, comp.label_width) node = node_str.format(style=style, node_name=comp.node_name, node_label=label) grid[i_row, j_col] = node row_idx_map[comp.node_name] = i_row col_idx_map[comp.node_name] = j_col # add all the off diagonal nodes from components for conn in self.connections: # src, target, style, label, stack, faded, label_width src_row = row_idx_map[conn.src] target_col = col_idx_map[conn.target] loc = (src_row, target_col) style = conn.style if conn.stack is True: # stacking style += ",stack" if conn.faded is True: # fading style += ",faded" label = _parse_label(conn.label, conn.label_width) node_name = "{}-{}".format(conn.src, conn.target) node = node_str.format(style=style, node_name=node_name, node_label=label) grid[loc] = node # add the nodes for left outputs for comp_name, out in self.left_outs.items(): style = out.style if out.stack: style += ",stack" i_row = row_idx_map[comp_name] loc = (i_row, 0) label = _parse_label(out.label, out.label_width) node = node_str.format(style=style, node_name=out.node_name, node_label=label) grid[loc] = node # add the nodes for right outputs for comp_name, out in self.right_outs.items(): style = out.style if out.stack: style += ",stack" i_row = row_idx_map[comp_name] loc = (i_row, -1) label = _parse_label(out.label, out.label_width) node = node_str.format(style=style, node_name=out.node_name, node_label=label) grid[loc] = node # add the inputs to the top of the grid for comp_name, inp in self.ins.items(): # node_name, style, label, stack = in_data style = inp.style if inp.stack: style += ",stack" j_col = col_idx_map[comp_name] loc = (0, j_col) label = _parse_label(inp.label, label_width=inp.label_width) node = node_str.format(style=style, node_name=inp.node_name, node_label=label) grid[loc] = node # mash the grid data into a string rows_str = "" for i, row in enumerate(grid): rows_str += "%Row {}\n".format(i) + "&\n".join(row) + r"\\" + "\n" return rows_str def _build_edges(self): h_edges = [] v_edges = [] edge_string = "({start}) edge [DataLine] ({end})" for conn in self.connections: od_node_name = "{}-{}".format(conn.src, conn.target) h_edges.append(edge_string.format(start=conn.src, end=od_node_name)) v_edges.append(edge_string.format(start=od_node_name, end=conn.target)) for comp_name, out in self.left_outs.items(): node_name = out.node_name h_edges.append(edge_string.format(start=comp_name, end=node_name)) for comp_name, out in self.right_outs.items(): node_name = out.node_name h_edges.append(edge_string.format(start=comp_name, end=node_name)) for comp_name, inp in self.ins.items(): node_name = inp.node_name v_edges.append(edge_string.format(start=comp_name, end=node_name)) paths_str = "% Horizontal edges\n" + "\n".join(h_edges) + "\n" paths_str += "% Vertical edges\n" + "\n".join(v_edges) + ";" return paths_str def _build_process_chain(self): sys_names = [s.node_name for s in self.systems] output_names = ( [data[0] for _, data in self.ins.items()] + [data[0] for _, data in self.left_outs.items()] + [data[0] for _, data in self.right_outs.items()] ) # comp_name, in_data in self.ins.items(): # node_name, style, label, stack = in_data chain_str = "" for proc, arrow in zip(self.processes, self.process_arrows): chain_str += "{ [start chain=process]\n \\begin{pgfonlayer}{process} \n" start_tip = False for i, sys in enumerate(proc): if sys not in sys_names and sys not in output_names: raise ValueError( 'process includes a system named "{}" but no system with that name exists.'.format(sys) ) if sys in output_names and i == 0: start_tip = True if i == 0: chain_str += "\\chainin ({});\n".format(sys) else: if sys in output_names or (i == 1 and start_tip): if arrow: chain_str += "\\chainin ({}) [join=by ProcessTipA];\n".format(sys) else: chain_str += "\\chainin ({}) [join=by ProcessTip];\n".format(sys) else: if arrow: chain_str += "\\chainin ({}) [join=by ProcessHVA];\n".format(sys) else: chain_str += "\\chainin ({}) [join=by ProcessHV];\n".format(sys) chain_str += "\\end{pgfonlayer}\n}" return chain_str def _compose_optional_package_list(self): # Check for optional LaTeX packages optional_packages_list = [] if self.use_sfmath: optional_packages_list.append("sfmath") # Join all packages into one string separated by comma optional_packages_str = ",".join(optional_packages_list) return optional_packages_str def write(self, file_name, build=True, cleanup=True, quiet=False, outdir="."): """ Write output files for the XDSM diagram. This produces the following: - {file_name}.tikz A file containing the TikZ definition of the XDSM diagram. - {file_name}.tex A standalone document wrapped around an include of the TikZ file which can be compiled to a pdf. - {file_name}.pdf An optional compiled version of the standalone tex file. Parameters ---------- file_name : str The prefix to be used for the output files build : bool Flag that determines whether the standalone PDF of the XDSM will be compiled. Default is True. cleanup : bool Flag that determines if pdflatex build files will be deleted after build is complete quiet : bool Set to True to suppress output from pdflatex. outdir : str Path to an existing directory in which to place output files. If a relative path is given, it is interpreted relative to the current working directory. """ nodes = self._build_node_grid() edges = self._build_edges() process = self._build_process_chain() module_path = os.path.dirname(__file__) diagram_styles_path = os.path.join(module_path, "diagram_styles") # Hack for Windows. MiKTeX needs Linux style paths. diagram_styles_path = diagram_styles_path.replace("\\", "/") optional_packages_str = self._compose_optional_package_list() tikzpicture_str = tikzpicture_template.format( nodes=nodes, edges=edges, process=process, diagram_styles_path=diagram_styles_path, optional_packages=optional_packages_str, ) base_output_fp = os.path.join(outdir, file_name) with open(base_output_fp + ".tikz", "w") as f: f.write(tikzpicture_str) tex_str = tex_template.format( nodes=nodes, edges=edges, tikzpicture_path=file_name + ".tikz", diagram_styles_path=diagram_styles_path, optional_packages=optional_packages_str, version=pyxdsm_version, ) with open(base_output_fp + ".tex", "w") as f: f.write(tex_str) if build: command = [ "pdflatex", "-halt-on-error", "-interaction=nonstopmode", "-output-directory={}".format(outdir), ] if quiet: command += ["-interaction=batchmode", "-halt-on-error"] command += [f"{file_name}.tex"] subprocess.run(command, check=True) if cleanup: for ext in ["aux", "fdb_latexmk", "fls", "log"]: f_name = "{}.{}".format(base_output_fp, ext) if os.path.exists(f_name): os.remove(f_name) def write_sys_specs(self, folder_name): """ Write I/O spec json files for systems to specified folder An I/O spec of a system is the collection of all variables going into and out of it. That includes any variables being passed between systems, as well as all inputs and outputs. This information is useful for comparing implementations (such as components and groups in OpenMDAO) to the XDSM diagrams. The json spec files can be used to write testing utilities that compare the inputs/outputs of an implementation to the XDSM, and thus allow you to verify that your codes match the XDSM diagram precisely. This technique is especially useful when large engineering teams are collaborating on model development. It allows them to use the XDSM as a shared contract between team members so everyone can be sure that their codes will sync up. Parameters ---------- folder_name: str name of the folder, which will be created if it doesn't exist, to put spec files into """ # find un-connected to each system by looking at Inputs specs = {} for sys in self.systems: specs[sys.node_name] = {"inputs": set(), "outputs": set()} for sys_name, inp in self.ins.items(): _label_to_spec(inp.label, specs[sys_name]["inputs"]) # find connected inputs/outputs to each system by looking at Connections for conn in self.connections: _label_to_spec(conn.label, specs[conn.target]["inputs"]) _label_to_spec(conn.label, specs[conn.src]["outputs"]) # find unconnected outputs to each system by looking at Outputs for sys_name, out in self.left_outs.items(): _label_to_spec(out.label, specs[sys_name]["outputs"]) for sys_name, out in self.right_outs.items(): _label_to_spec(out.label, specs[sys_name]["outputs"]) if not os.path.isdir(folder_name): os.mkdir(folder_name) for sys in self.systems: if sys.spec_name is not False: path = os.path.join(folder_name, sys.spec_name + ".json") with open(path, "w") as f: spec = specs[sys.node_name] spec["inputs"] = list(spec["inputs"]) spec["outputs"] = list(spec["outputs"]) json_str = json.dumps(spec, indent=2) f.write(json_str)
37.169329
119
0.598204
7949be3a9ff9c4ac43a60bb4593001ffd25163e4
16,208
py
Python
venv/Lib/site-packages/twilio/rest/supersim/v1/network_access_profile/network_access_profile_network.py
syt1209/PythonProjects
0409dbd3c0b0ddf00debc38875059c828eb31dec
[ "MIT" ]
1
2021-02-16T00:59:29.000Z
2021-02-16T00:59:29.000Z
venv/Lib/site-packages/twilio/rest/supersim/v1/network_access_profile/network_access_profile_network.py
syt1209/PythonProjects
0409dbd3c0b0ddf00debc38875059c828eb31dec
[ "MIT" ]
null
null
null
venv/Lib/site-packages/twilio/rest/supersim/v1/network_access_profile/network_access_profile_network.py
syt1209/PythonProjects
0409dbd3c0b0ddf00debc38875059c828eb31dec
[ "MIT" ]
null
null
null
# coding=utf-8 r""" This code was generated by \ / _ _ _| _ _ | (_)\/(_)(_|\/| |(/_ v1.0.0 / / """ from twilio.base import values from twilio.base.instance_context import InstanceContext from twilio.base.instance_resource import InstanceResource from twilio.base.list_resource import ListResource from twilio.base.page import Page class NetworkAccessProfileNetworkList(ListResource): """ PLEASE NOTE that this class contains preview products that are subject to change. Use them with caution. If you currently do not have developer preview access, please contact help@twilio.com. """ def __init__(self, version, network_access_profile_sid): """ Initialize the NetworkAccessProfileNetworkList :param Version version: Version that contains the resource :param network_access_profile_sid: The unique string that identifies the Network Access Profile resource :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkList :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkList """ super(NetworkAccessProfileNetworkList, self).__init__(version) # Path Solution self._solution = {'network_access_profile_sid': network_access_profile_sid, } self._uri = '/NetworkAccessProfiles/{network_access_profile_sid}/Networks'.format(**self._solution) def stream(self, limit=None, page_size=None): """ Streams NetworkAccessProfileNetworkInstance records from the API as a generator stream. This operation lazily loads records as efficiently as possible until the limit is reached. The results are returned as a generator, so this operation is memory efficient. :param int limit: Upper limit for the number of records to return. stream() guarantees to never return more than limit. Default is no limit :param int page_size: Number of records to fetch per request, when not set will use the default value of 50 records. If no page_size is defined but a limit is defined, stream() will attempt to read the limit with the most efficient page size, i.e. min(limit, 1000) :returns: Generator that will yield up to limit results :rtype: list[twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance] """ limits = self._version.read_limits(limit, page_size) page = self.page(page_size=limits['page_size'], ) return self._version.stream(page, limits['limit']) def list(self, limit=None, page_size=None): """ Lists NetworkAccessProfileNetworkInstance records from the API as a list. Unlike stream(), this operation is eager and will load `limit` records into memory before returning. :param int limit: Upper limit for the number of records to return. list() guarantees never to return more than limit. Default is no limit :param int page_size: Number of records to fetch per request, when not set will use the default value of 50 records. If no page_size is defined but a limit is defined, list() will attempt to read the limit with the most efficient page size, i.e. min(limit, 1000) :returns: Generator that will yield up to limit results :rtype: list[twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance] """ return list(self.stream(limit=limit, page_size=page_size, )) def page(self, page_token=values.unset, page_number=values.unset, page_size=values.unset): """ Retrieve a single page of NetworkAccessProfileNetworkInstance records from the API. Request is executed immediately :param str page_token: PageToken provided by the API :param int page_number: Page Number, this value is simply for client state :param int page_size: Number of records to return, defaults to 50 :returns: Page of NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkPage """ data = values.of({'PageToken': page_token, 'Page': page_number, 'PageSize': page_size, }) response = self._version.page(method='GET', uri=self._uri, params=data, ) return NetworkAccessProfileNetworkPage(self._version, response, self._solution) def get_page(self, target_url): """ Retrieve a specific page of NetworkAccessProfileNetworkInstance records from the API. Request is executed immediately :param str target_url: API-generated URL for the requested results page :returns: Page of NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkPage """ response = self._version.domain.twilio.request( 'GET', target_url, ) return NetworkAccessProfileNetworkPage(self._version, response, self._solution) def create(self, network): """ Create the NetworkAccessProfileNetworkInstance :param unicode network: The SID that identifies the Network resource :returns: The created NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance """ data = values.of({'Network': network, }) payload = self._version.create(method='POST', uri=self._uri, data=data, ) return NetworkAccessProfileNetworkInstance( self._version, payload, network_access_profile_sid=self._solution['network_access_profile_sid'], ) def get(self, sid): """ Constructs a NetworkAccessProfileNetworkContext :param sid: The SID of the resource to fetch :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext """ return NetworkAccessProfileNetworkContext( self._version, network_access_profile_sid=self._solution['network_access_profile_sid'], sid=sid, ) def __call__(self, sid): """ Constructs a NetworkAccessProfileNetworkContext :param sid: The SID of the resource to fetch :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext """ return NetworkAccessProfileNetworkContext( self._version, network_access_profile_sid=self._solution['network_access_profile_sid'], sid=sid, ) def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ return '<Twilio.Supersim.V1.NetworkAccessProfileNetworkList>' class NetworkAccessProfileNetworkPage(Page): """ PLEASE NOTE that this class contains preview products that are subject to change. Use them with caution. If you currently do not have developer preview access, please contact help@twilio.com. """ def __init__(self, version, response, solution): """ Initialize the NetworkAccessProfileNetworkPage :param Version version: Version that contains the resource :param Response response: Response from the API :param network_access_profile_sid: The unique string that identifies the Network Access Profile resource :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkPage :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkPage """ super(NetworkAccessProfileNetworkPage, self).__init__(version, response) # Path Solution self._solution = solution def get_instance(self, payload): """ Build an instance of NetworkAccessProfileNetworkInstance :param dict payload: Payload response from the API :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance """ return NetworkAccessProfileNetworkInstance( self._version, payload, network_access_profile_sid=self._solution['network_access_profile_sid'], ) def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ return '<Twilio.Supersim.V1.NetworkAccessProfileNetworkPage>' class NetworkAccessProfileNetworkContext(InstanceContext): """ PLEASE NOTE that this class contains preview products that are subject to change. Use them with caution. If you currently do not have developer preview access, please contact help@twilio.com. """ def __init__(self, version, network_access_profile_sid, sid): """ Initialize the NetworkAccessProfileNetworkContext :param Version version: Version that contains the resource :param network_access_profile_sid: The unique string that identifies the Network Access Profile resource :param sid: The SID of the resource to fetch :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext """ super(NetworkAccessProfileNetworkContext, self).__init__(version) # Path Solution self._solution = {'network_access_profile_sid': network_access_profile_sid, 'sid': sid, } self._uri = '/NetworkAccessProfiles/{network_access_profile_sid}/Networks/{sid}'.format(**self._solution) def delete(self): """ Deletes the NetworkAccessProfileNetworkInstance :returns: True if delete succeeds, False otherwise :rtype: bool """ return self._version.delete(method='DELETE', uri=self._uri, ) def fetch(self): """ Fetch the NetworkAccessProfileNetworkInstance :returns: The fetched NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance """ payload = self._version.fetch(method='GET', uri=self._uri, ) return NetworkAccessProfileNetworkInstance( self._version, payload, network_access_profile_sid=self._solution['network_access_profile_sid'], sid=self._solution['sid'], ) def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ context = ' '.join('{}={}'.format(k, v) for k, v in self._solution.items()) return '<Twilio.Supersim.V1.NetworkAccessProfileNetworkContext {}>'.format(context) class NetworkAccessProfileNetworkInstance(InstanceResource): """ PLEASE NOTE that this class contains preview products that are subject to change. Use them with caution. If you currently do not have developer preview access, please contact help@twilio.com. """ def __init__(self, version, payload, network_access_profile_sid, sid=None): """ Initialize the NetworkAccessProfileNetworkInstance :returns: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance """ super(NetworkAccessProfileNetworkInstance, self).__init__(version) # Marshaled Properties self._properties = { 'sid': payload.get('sid'), 'network_access_profile_sid': payload.get('network_access_profile_sid'), 'friendly_name': payload.get('friendly_name'), 'iso_country': payload.get('iso_country'), 'identifiers': payload.get('identifiers'), 'url': payload.get('url'), } # Context self._context = None self._solution = { 'network_access_profile_sid': network_access_profile_sid, 'sid': sid or self._properties['sid'], } @property def _proxy(self): """ Generate an instance context for the instance, the context is capable of performing various actions. All instance actions are proxied to the context :returns: NetworkAccessProfileNetworkContext for this NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkContext """ if self._context is None: self._context = NetworkAccessProfileNetworkContext( self._version, network_access_profile_sid=self._solution['network_access_profile_sid'], sid=self._solution['sid'], ) return self._context @property def sid(self): """ :returns: The unique string that identifies the resource :rtype: unicode """ return self._properties['sid'] @property def network_access_profile_sid(self): """ :returns: The unique string that identifies the Network Access Profile resource :rtype: unicode """ return self._properties['network_access_profile_sid'] @property def friendly_name(self): """ :returns: A human readable identifier of this resource :rtype: unicode """ return self._properties['friendly_name'] @property def iso_country(self): """ :returns: The ISO country code of the Network resource :rtype: unicode """ return self._properties['iso_country'] @property def identifiers(self): """ :returns: The MCC/MNCs included in the resource :rtype: list[dict] """ return self._properties['identifiers'] @property def url(self): """ :returns: The absolute URL of the resource :rtype: unicode """ return self._properties['url'] def delete(self): """ Deletes the NetworkAccessProfileNetworkInstance :returns: True if delete succeeds, False otherwise :rtype: bool """ return self._proxy.delete() def fetch(self): """ Fetch the NetworkAccessProfileNetworkInstance :returns: The fetched NetworkAccessProfileNetworkInstance :rtype: twilio.rest.supersim.v1.network_access_profile.network_access_profile_network.NetworkAccessProfileNetworkInstance """ return self._proxy.fetch() def __repr__(self): """ Provide a friendly representation :returns: Machine friendly representation :rtype: str """ context = ' '.join('{}={}'.format(k, v) for k, v in self._solution.items()) return '<Twilio.Supersim.V1.NetworkAccessProfileNetworkInstance {}>'.format(context)
40.52
135
0.687068
7949be69c09b29524e5240125420a9df8f942647
607
py
Python
python/anyascii/_data/_245.py
casept/anyascii
d4f426b91751254b68eaa84c6cd23099edd668e6
[ "ISC" ]
null
null
null
python/anyascii/_data/_245.py
casept/anyascii
d4f426b91751254b68eaa84c6cd23099edd668e6
[ "ISC" ]
null
null
null
python/anyascii/_data/_245.py
casept/anyascii
d4f426b91751254b68eaa84c6cd23099edd668e6
[ "ISC" ]
null
null
null
b='Na Dit Pao Ju Luo Shua Shang Su Luo Fen Wai Bao Li Xiong Vuot Dang Danh Mong Mong Mong Cheng Zhang Sou Shen Ge Cha Yu Hui Che Jiao Zhu Shu Xiao Ning Pan Jiang Jiang Diao Zong Qiang Qiu Feng Zhan Ke Die Ze Guang Se Fen Jiang Yan Zhi Riu Li Ling Yi Qu Pan Gou Jia He Peng Ju Banh Che Chua Lop Lie Shi Po Xiang Pi Luo Cu Yu Mui Kong Xie Wan Yan Pei Cheng Manh Ti Che Bi Lian Jia Ting Ti Cong Die Shu Li Lu Xia Cui Tam Bo Tui Pu Lin Fen Phuon Bo Chan Dang Tai'
607
607
0.574959
7949bfdb05efe16fbab5fc34fb448a282c8c1e7c
1,211
py
Python
cvxpy/reductions/dcp2cone/atom_canonicalizers/mul_canon.py
mostafaelaraby/cvxpy
078e025be8b8315b5f579bd0209e8e3a1e2a2a19
[ "ECL-2.0", "Apache-2.0" ]
1
2020-10-21T22:15:55.000Z
2020-10-21T22:15:55.000Z
cvxpy/reductions/dcp2cone/atom_canonicalizers/mul_canon.py
mostafaelaraby/cvxpy
078e025be8b8315b5f579bd0209e8e3a1e2a2a19
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
cvxpy/reductions/dcp2cone/atom_canonicalizers/mul_canon.py
mostafaelaraby/cvxpy
078e025be8b8315b5f579bd0209e8e3a1e2a2a19
[ "ECL-2.0", "Apache-2.0" ]
1
2020-11-16T08:43:33.000Z
2020-11-16T08:43:33.000Z
from cvxpy.expressions.variable import Variable from cvxpy.utilities import scopes # TODO(akshayka): expose as a reduction for user's convenience def mul_canon(expr, args): # Only allow param * var (not var * param). Associate right to left. # TODO: Only descend if both sides have parameters lhs = args[0] rhs = args[1] if not (lhs.parameters() and rhs.parameters()): return expr.copy(args), [] op_type = type(expr) if lhs.variables(): with scopes.dpp_scope(): assert rhs.is_affine() t = Variable(lhs.shape) return op_type(t, rhs), [t == lhs] elif rhs.variables(): with scopes.dpp_scope(): assert lhs.is_affine() t = Variable(rhs.shape) return op_type(lhs, t), [t == rhs] # Neither side has variables. One side must be affine in parameters. lhs_affine = False rhs_affine = False with scopes.dpp_scope(): lhs_affine = lhs.is_affine() rhs_affine = rhs.is_affine() assert lhs_affine or rhs_affine if lhs_affine: t = Variable(rhs.shape) return lhs * t, [t == rhs] else: t = Variable(lhs.shape) return t * rhs, [t == lhs]
30.275
72
0.615194
7949c04b52334035e4a93de37c2afd940e8d7ba3
5,272
py
Python
dataent/commands/scheduler.py
dataent/dataent
c41bd5942ffe5513f4d921c4c0595c84bbc422b4
[ "MIT" ]
null
null
null
dataent/commands/scheduler.py
dataent/dataent
c41bd5942ffe5513f4d921c4c0595c84bbc422b4
[ "MIT" ]
6
2020-03-24T17:15:56.000Z
2022-02-10T18:41:31.000Z
dataent/commands/scheduler.py
dataent/dataent
c41bd5942ffe5513f4d921c4c0595c84bbc422b4
[ "MIT" ]
null
null
null
from __future__ import unicode_literals, absolute_import, print_function import click import sys import dataent from dataent.utils import cint from dataent.commands import pass_context, get_site def _is_scheduler_enabled(): enable_scheduler = False try: dataent.connect() enable_scheduler = cint(dataent.db.get_single_value("System Settings", "enable_scheduler")) and True or False except: pass finally: dataent.db.close() return enable_scheduler @click.command('trigger-scheduler-event') @click.argument('event') @pass_context def trigger_scheduler_event(context, event): "Trigger a scheduler event" import dataent.utils.scheduler for site in context.sites: try: dataent.init(site=site) dataent.connect() dataent.utils.scheduler.trigger(site, event, now=True) finally: dataent.destroy() @click.command('enable-scheduler') @pass_context def enable_scheduler(context): "Enable scheduler" import dataent.utils.scheduler for site in context.sites: try: dataent.init(site=site) dataent.connect() dataent.utils.scheduler.enable_scheduler() dataent.db.commit() print("Enabled for", site) finally: dataent.destroy() @click.command('disable-scheduler') @pass_context def disable_scheduler(context): "Disable scheduler" import dataent.utils.scheduler for site in context.sites: try: dataent.init(site=site) dataent.connect() dataent.utils.scheduler.disable_scheduler() dataent.db.commit() print("Disabled for", site) finally: dataent.destroy() @click.command('scheduler') @click.option('--site', help='site name') @click.argument('state', type=click.Choice(['pause', 'resume', 'disable', 'enable'])) @pass_context def scheduler(context, state, site=None): from dataent.installer import update_site_config import dataent.utils.scheduler if not site: site = get_site(context) try: dataent.init(site=site) if state == 'pause': update_site_config('pause_scheduler', 1) elif state == 'resume': update_site_config('pause_scheduler', 0) elif state == 'disable': dataent.connect() dataent.utils.scheduler.disable_scheduler() dataent.db.commit() elif state == 'enable': dataent.connect() dataent.utils.scheduler.enable_scheduler() dataent.db.commit() print('Scheduler {0}d for site {1}'.format(state, site)) finally: dataent.destroy() @click.command('set-maintenance-mode') @click.option('--site', help='site name') @click.argument('state', type=click.Choice(['on', 'off'])) @pass_context def set_maintenance_mode(context, state, site=None): from dataent.installer import update_site_config if not site: site = get_site(context) try: dataent.init(site=site) update_site_config('maintenance_mode', 1 if (state == 'on') else 0) finally: dataent.destroy() @click.command('doctor') #Passing context always gets a site and if there is no use site it breaks @click.option('--site', help='site name') def doctor(site=None): "Get diagnostic info about background workers" from dataent.utils.doctor import doctor as _doctor return _doctor(site=site) @click.command('show-pending-jobs') @click.option('--site', help='site name') @pass_context def show_pending_jobs(context, site=None): "Get diagnostic info about background jobs" from dataent.utils.doctor import pending_jobs as _pending_jobs if not site: site = get_site(context) with dataent.init_site(site): pending_jobs = _pending_jobs(site=site) return pending_jobs @click.command('purge-jobs') @click.option('--site', help='site name') @click.option('--queue', default=None, help='one of "low", "default", "high') @click.option('--event', default=None, help='one of "all", "weekly", "monthly", "hourly", "daily", "weekly_long", "daily_long"') def purge_jobs(site=None, queue=None, event=None): "Purge any pending periodic tasks, if event option is not given, it will purge everything for the site" from dataent.utils.doctor import purge_pending_jobs dataent.init(site or '') count = purge_pending_jobs(event=event, site=site, queue=queue) print("Purged {} jobs".format(count)) @click.command('schedule') def start_scheduler(): from dataent.utils.scheduler import start_scheduler start_scheduler() @click.command('worker') @click.option('--queue', type=str) @click.option('--quiet', is_flag = True, default = False, help = 'Hide Log Outputs') def start_worker(queue, quiet = False): from dataent.utils.background_jobs import start_worker start_worker(queue, quiet = quiet) @click.command('ready-for-migration') @click.option('--site', help='site name') @pass_context def ready_for_migration(context, site=None): from dataent.utils.doctor import get_pending_jobs if not site: site = get_site(context) try: dataent.init(site=site) pending_jobs = get_pending_jobs(site=site) if pending_jobs: print('NOT READY for migration: site {0} has pending background jobs'.format(site)) sys.exit(1) else: print('READY for migration: site {0} does not have any background jobs'.format(site)) return 0 finally: dataent.destroy() commands = [ disable_scheduler, doctor, enable_scheduler, purge_jobs, ready_for_migration, scheduler, set_maintenance_mode, show_pending_jobs, start_scheduler, start_worker, trigger_scheduler_event, ]
26.761421
128
0.743361
7949c0897a2ff802477791b7589b0eb77d8a7ca1
62,075
py
Python
untitled.py
Steve-YJ/sagemaker-studio-end-to-end
2227bd22d531b2b41e3abcc4778a3e4d2b7aada8
[ "MIT" ]
1
2021-04-15T00:47:16.000Z
2021-04-15T00:47:16.000Z
untitled.py
Steve-YJ/sagemaker-studio-end-to-end
2227bd22d531b2b41e3abcc4778a3e4d2b7aada8
[ "MIT" ]
null
null
null
untitled.py
Steve-YJ/sagemaker-studio-end-to-end
2227bd22d531b2b41e3abcc4778a3e4d2b7aada8
[ "MIT" ]
null
null
null
from pyspark.sql.session import SparkSession from pyspark.sql.dataframe import DataFrame # You may want to configure the Spark Context with the right credentials provider. spark = SparkSession.builder.master('local').getOrCreate() mode = None def capture_stdout(func, *args, **kwargs): """Capture standard output to a string buffer""" from contextlib import redirect_stdout import io stdout_string = io.StringIO() with redirect_stdout(stdout_string): func(*args, **kwargs) return stdout_string.getvalue() def convert_or_coerce(pandas_df, spark): """Convert pandas df to pyspark df and coerces the mixed cols to string""" import re try: return spark.createDataFrame(pandas_df) except TypeError as e: match = re.search(r".*field (\w+).*Can not merge type.*", str(e)) if match is None: raise e mixed_col_name = match.group(1) # Coercing the col to string pandas_df[mixed_col_name] = pandas_df[mixed_col_name].astype("str") return pandas_df def default_spark(value): return {"default": value} def default_spark_with_stdout(df, stdout): return { "default": df, "stdout": stdout, } def default_spark_with_trained_parameters(value, trained_parameters): return {"default": value, "trained_parameters": trained_parameters} def default_spark_with_trained_parameters_and_state(df, trained_parameters, state): return {"default": df, "trained_parameters": trained_parameters, "state": state} def dispatch(key_name, args, kwargs, funcs): """ Dispatches to another operator based on a key in the passed parameters. This also slices out any parameters using the parameter_name passed in, and will reassemble the trained_parameters correctly after invocation. Args: key_name: name of the key in kwargs used to identify the function to use. args: dataframe that will be passed as the first set of parameters to the function. kwargs: keyword arguments that key_name will be found in; also where args will be passed to parameters. These are also expected to include trained_parameters if there are any. funcs: dictionary mapping from value of key_name to (function, parameter_name) """ if key_name not in kwargs: raise OperatorCustomerError(f"Missing required parameter {key_name}") operator = kwargs[key_name] if operator not in funcs: raise OperatorCustomerError(f"Invalid choice selected for {key_name}. {operator} is not supported.") func, parameter_name = funcs[operator] # Extract out the parameters that should be available. func_params = kwargs.get(parameter_name, {}) if func_params is None: func_params = {} # Extract out any trained parameters. specific_trained_parameters = None if "trained_parameters" in kwargs: trained_parameters = kwargs["trained_parameters"] if trained_parameters is not None and parameter_name in trained_parameters: specific_trained_parameters = trained_parameters[parameter_name] func_params["trained_parameters"] = specific_trained_parameters # Execute the function (should return a dict). result = func(*args, **func_params) # Check if the result contains any trained parameters and remap them to the proper structure. if result is not None and "trained_parameters" in result: existing_trained_parameters = kwargs.get("trained_parameters") updated_trained_parameters = result["trained_parameters"] if existing_trained_parameters is not None or updated_trained_parameters is not None: existing_trained_parameters = existing_trained_parameters if existing_trained_parameters is not None else {} existing_trained_parameters[parameter_name] = result["trained_parameters"] # Update the result trained_parameters so they are part of the original structure. result["trained_parameters"] = existing_trained_parameters else: # If the given trained parameters were None and the returned trained parameters were None, don't return anything. del result["trained_parameters"] return result def get_dataframe_with_sequence_ids(df: DataFrame): df_cols = df.columns rdd_with_seq = df.rdd.zipWithIndex() df_with_seq = rdd_with_seq.toDF() df_with_seq = df_with_seq.withColumnRenamed("_2", "_seq_id_") for col_name in df_cols: df_with_seq = df_with_seq.withColumn(col_name, df_with_seq["_1"].getItem(col_name)) df_with_seq = df_with_seq.drop("_1") return df_with_seq def get_execution_state(status: str, message=None): return {"status": status, "message": message} class OperatorCustomerError(Exception): """Error type for Customer Errors in Spark Operators""" def encode_categorical_ordinal_encode( df, input_column=None, output_column=None, invalid_handling_strategy=None, trained_parameters=None ): INVALID_HANDLING_STRATEGY_SKIP = "Skip" INVALID_HANDLING_STRATEGY_ERROR = "Error" INVALID_HANDLING_STRATEGY_KEEP = "Keep" INVALID_HANDLING_STRATEGY_REPLACE_WITH_NAN = "Replace with NaN" from pyspark.ml.feature import StringIndexer, StringIndexerModel from pyspark.sql.functions import when expects_column(df, input_column, "Input column") invalid_handling_map = { INVALID_HANDLING_STRATEGY_SKIP: "skip", INVALID_HANDLING_STRATEGY_ERROR: "error", INVALID_HANDLING_STRATEGY_KEEP: "keep", INVALID_HANDLING_STRATEGY_REPLACE_WITH_NAN: "keep", } output_column, output_is_temp = get_temp_col_if_not_set(df, output_column) # process inputs handle_invalid = ( invalid_handling_strategy if invalid_handling_strategy in invalid_handling_map else INVALID_HANDLING_STRATEGY_ERROR ) trained_parameters = load_trained_parameters( trained_parameters, {"invalid_handling_strategy": invalid_handling_strategy} ) input_handle_invalid = invalid_handling_map.get(handle_invalid) index_model, index_model_loaded = load_pyspark_model_from_trained_parameters( trained_parameters, StringIndexerModel, "string_indexer_model" ) if index_model is None: indexer = StringIndexer(inputCol=input_column, outputCol=output_column, handleInvalid=input_handle_invalid) # fit the model and transform try: index_model = fit_and_save_model(trained_parameters, "string_indexer_model", indexer, df) except Exception as e: if input_handle_invalid == "error": raise OperatorSparkOperatorCustomerError( f"Encountered error calculating string indexes. Halting because error handling is set to 'Error'. Please check your data and try again: {e}" ) else: raise e output_df = transform_using_trained_model(index_model, df, index_model_loaded) # finally, if missing should be nan, convert them if handle_invalid == INVALID_HANDLING_STRATEGY_REPLACE_WITH_NAN: new_val = float("nan") # convert all numLabels indices to new_val num_labels = len(index_model.labels) output_df = output_df.withColumn( output_column, when(output_df[output_column] == num_labels, new_val).otherwise(output_df[output_column]) ) # finally handle the output column name appropriately. output_df = replace_input_if_output_is_temp(output_df, input_column, output_column, output_is_temp) return default_spark_with_trained_parameters(output_df, trained_parameters) def encode_categorical_one_hot_encode( df, input_column=None, input_already_ordinal_encoded=None, invalid_handling_strategy=None, drop_last=None, output_style=None, output_column=None, trained_parameters=None, ): INVALID_HANDLING_STRATEGY_SKIP = "Skip" INVALID_HANDLING_STRATEGY_ERROR = "Error" INVALID_HANDLING_STRATEGY_KEEP = "Keep" OUTPUT_STYLE_VECTOR = "Vector" OUTPUT_STYLE_COLUMNS = "Columns" invalid_handling_map = { INVALID_HANDLING_STRATEGY_SKIP: "skip", INVALID_HANDLING_STRATEGY_ERROR: "error", INVALID_HANDLING_STRATEGY_KEEP: "keep", } handle_invalid = invalid_handling_map.get(invalid_handling_strategy, "error") expects_column(df, input_column, "Input column") output_format = output_style if output_style in [OUTPUT_STYLE_VECTOR, OUTPUT_STYLE_COLUMNS] else OUTPUT_STYLE_VECTOR drop_last = parse_parameter(bool, drop_last, "Drop Last", True) input_ordinal_encoded = parse_parameter(bool, input_already_ordinal_encoded, "Input already ordinal encoded", False) output_column = output_column if output_column else input_column trained_parameters = load_trained_parameters( trained_parameters, {"invalid_handling_strategy": invalid_handling_strategy, "drop_last": drop_last} ) from pyspark.ml.feature import ( StringIndexer, StringIndexerModel, OneHotEncoder, OneHotEncoderModel, ) from pyspark.ml.functions import vector_to_array import pyspark.sql.functions as sf from pyspark.sql.types import DoubleType # first step, ordinal encoding. Not required if input_ordinal_encoded==True # get temp name for ordinal encoding ordinal_name = temp_col_name(df, output_column) if input_ordinal_encoded: df_ordinal = df.withColumn(ordinal_name, df[input_column].cast("int")) labels = None else: index_model, index_model_loaded = load_pyspark_model_from_trained_parameters( trained_parameters, StringIndexerModel, "string_indexer_model" ) if index_model is None: # apply ordinal encoding indexer = StringIndexer(inputCol=input_column, outputCol=ordinal_name, handleInvalid=handle_invalid) try: index_model = fit_and_save_model(trained_parameters, "string_indexer_model", indexer, df) except Exception as e: if handle_invalid == "error": raise OperatorSparkOperatorCustomerError( f"Encountered error calculating string indexes. Halting because error handling is set to 'Error'. Please check your data and try again: {e}" ) else: raise e try: df_ordinal = transform_using_trained_model(index_model, df, index_model_loaded) except Exception as e: if handle_invalid == "error": raise OperatorSparkOperatorCustomerError( f"Encountered error transforming string indexes. Halting because error handling is set to 'Error'. Please check your data and try again: {e}" ) else: raise e labels = index_model.labels # drop the input column if required from the ordinal encoded dataset if output_column == input_column: df_ordinal = df_ordinal.drop(input_column) temp_output_col = temp_col_name(df_ordinal, output_column) # apply onehot encoding on the ordinal cur_handle_invalid = handle_invalid if input_ordinal_encoded else "error" cur_handle_invalid = "keep" if cur_handle_invalid == "skip" else cur_handle_invalid ohe_model, ohe_model_loaded = load_pyspark_model_from_trained_parameters( trained_parameters, OneHotEncoderModel, "one_hot_encoder_model" ) if ohe_model is None: ohe = OneHotEncoder( dropLast=drop_last, handleInvalid=cur_handle_invalid, inputCol=ordinal_name, outputCol=temp_output_col ) try: ohe_model = fit_and_save_model(trained_parameters, "one_hot_encoder_model", ohe, df_ordinal) except Exception as e: if handle_invalid == "error": raise OperatorSparkOperatorCustomerError( f"Encountered error calculating encoding categories. Halting because error handling is set to 'Error'. Please check your data and try again: {e}" ) else: raise e output_df = transform_using_trained_model(ohe_model, df_ordinal, ohe_model_loaded) if output_format == OUTPUT_STYLE_COLUMNS: if labels is None: labels = list(range(ohe_model.categorySizes[0])) current_output_cols = set(list(output_df.columns)) old_cols = [sf.col(name) for name in df.columns if name in current_output_cols] arr_col = vector_to_array(output_df[temp_output_col]) new_cols = [(arr_col[i]).alias(f"{output_column}_{name}") for i, name in enumerate(labels)] output_df = output_df.select(*(old_cols + new_cols)) else: # remove the temporary ordinal encoding output_df = output_df.drop(ordinal_name) output_df = output_df.withColumn(output_column, sf.col(temp_output_col)) output_df = output_df.drop(temp_output_col) final_ordering = [col for col in df.columns] if output_column not in final_ordering: final_ordering.append(output_column) output_df = output_df.select(final_ordering) return default_spark_with_trained_parameters(output_df, trained_parameters) import re from pyspark.sql import functions as sf, types def format_string_lower_case(df, input_column=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.lower(df[input_column].cast(types.StringType())) ) ) def format_string_upper_case(df, input_column=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.upper(df[input_column].cast(types.StringType())) ) ) def format_string_title_case(df, input_column=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.title(), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_capitalize(df, input_column=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.capitalize(), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_swap_case(df, input_column=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.swapcase(), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_left_pad( df, input_column=None, width=None, fill_character=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") width = parse_parameter(int, width, "Width") fill_character = parse_parameter(str, fill_character, "Fill character", " ") MAX_WIDTH = 1000 if width > MAX_WIDTH: raise OperatorSparkOperatorCustomerError(f"Width must be less than {MAX_WIDTH}. Received: {width}") if len(fill_character) > 1: raise OperatorSparkOperatorCustomerError(f"Fill character can only be a single character. Received: {fill_character}") return default_spark( df.withColumn( output_column if output_column else input_column, sf.lpad(df[input_column].cast(types.StringType()), len=width, pad=fill_character), ) ) def format_string_right_pad( df, input_column=None, width=None, fill_character=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") width = parse_parameter(int, width, "Width") fill_character = parse_parameter(str, fill_character, "Fill character", " ") MAX_WIDTH = 1000 if width > MAX_WIDTH: raise OperatorSparkOperatorCustomerError(f"Width must be less than {MAX_WIDTH}. Received: {width}") if len(fill_character) > 1: raise OperatorSparkOperatorCustomerError(f"Fill character can only be a single character. Received: {fill_character}") return default_spark( df.withColumn( output_column if output_column else input_column, sf.rpad(df[input_column].cast(types.StringType()), len=width, pad=fill_character), ) ) def format_string_center_pad_on_either_side( df, input_column=None, width=None, fill_character=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") width = parse_parameter(int, width, "Width") fill_character = parse_parameter(str, fill_character, "Fill character", " ") MAX_WIDTH = 1000 if width > MAX_WIDTH: raise OperatorSparkOperatorCustomerError(f"Width must be less than {MAX_WIDTH}. Received: {width}") if len(fill_character) > 1: raise OperatorSparkOperatorCustomerError(f"Fill character can only be a single character. Received: {fill_character}") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.center(width=width, fillchar=fill_character), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_strip_characters_from_left( df, input_column=None, characters_to_remove=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.lstrip(to_strip=characters_to_remove), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_strip_characters_from_right( df, input_column=None, characters_to_remove=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.rstrip(to_strip=characters_to_remove), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_strip_left_and_right( df, input_column=None, characters_to_remove=None, output_column=None, trained_parameters=None ): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.pandas_udf(lambda s: s.str.strip(to_strip=characters_to_remove), returnType=types.StringType())( df[input_column].cast(types.StringType()) ), ) ) def format_string_prepend_zeros(df, input_column=None, width=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") width = parse_parameter(int, width, "Width") MAX_WIDTH = 1000 if width > MAX_WIDTH: raise OperatorSparkOperatorCustomerError(f"Width must be less than {MAX_WIDTH}. Received: {width}") return default_spark( df.withColumn( output_column if output_column else input_column, sf.lpad(df[input_column].cast(types.StringType()), len=width, pad="0"), ) ) def format_string_add_prefix(df, input_column=None, prefix=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.concat(sf.lit(prefix), df[input_column].cast(types.StringType())), ) ) def format_string_add_suffix(df, input_column=None, suffix=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") return default_spark( df.withColumn( output_column if output_column else input_column, sf.concat(df[input_column].cast(types.StringType()), sf.lit(suffix)), ) ) def format_string_remove_symbols(df, input_column=None, symbols=None, output_column=None, trained_parameters=None): expects_column(df, input_column, "Input column") symbols = "!@#$%^&*()_+=-/\\`~{}|<>?" if not symbols else symbols regex = "|".join([re.escape(symbol) for symbol in symbols]) return default_spark( df.withColumn( output_column if output_column else input_column, sf.regexp_replace(df[input_column].cast(types.StringType()), f"({regex})", ""), ) ) from enum import Enum from pyspark.sql.types import BooleanType, DateType, DoubleType, LongType, StringType from pyspark.sql import functions as f class NonCastableDataHandlingMethod(Enum): REPLACE_WITH_NULL = "replace_null" REPLACE_WITH_NULL_AND_PUT_NON_CASTABLE_DATA_IN_NEW_COLUMN = "replace_null_with_new_col" REPLACE_WITH_FIXED_VALUE = "replace_value" REPLACE_WITH_FIXED_VALUE_AND_PUT_NON_CASTABLE_DATA_IN_NEW_COLUMN = "replace_value_with_new_col" DROP_NON_CASTABLE_ROW = "drop" @staticmethod def get_names(): return [item.name for item in NonCastableDataHandlingMethod] @staticmethod def get_values(): return [item.value for item in NonCastableDataHandlingMethod] class MohaveDataType(Enum): BOOL = "bool" DATE = "date" FLOAT = "float" LONG = "long" STRING = "string" OBJECT = "object" @staticmethod def get_names(): return [item.name for item in MohaveDataType] @staticmethod def get_values(): return [item.value for item in MohaveDataType] PYTHON_TYPE_MAPPING = { MohaveDataType.BOOL: bool, MohaveDataType.DATE: str, MohaveDataType.FLOAT: float, MohaveDataType.LONG: int, MohaveDataType.STRING: str, } MOHAVE_TO_SPARK_TYPE_MAPPING = { MohaveDataType.BOOL: BooleanType, MohaveDataType.DATE: DateType, MohaveDataType.FLOAT: DoubleType, MohaveDataType.LONG: LongType, MohaveDataType.STRING: StringType, } SPARK_TYPE_MAPPING_TO_SQL_TYPE = { BooleanType: "BOOLEAN", LongType: "BIGINT", DoubleType: "DOUBLE", StringType: "STRING", DateType: "DATE", } SPARK_TO_MOHAVE_TYPE_MAPPING = {value: key for (key, value) in MOHAVE_TO_SPARK_TYPE_MAPPING.items()} def cast_single_column_type_helper(df, column_name_to_cast, column_name_to_add, mohave_data_type, date_formatting): if mohave_data_type == MohaveDataType.DATE: df = df.withColumn(column_name_to_add, f.to_date(df[column_name_to_cast], date_formatting)) else: df = df.withColumn( column_name_to_add, df[column_name_to_cast].cast(MOHAVE_TO_SPARK_TYPE_MAPPING[mohave_data_type]()) ) return df def cast_single_column_type( df, column, mohave_data_type, invalid_data_handling_method, replace_value=None, date_formatting="dd-MM-yyyy" ): """Cast single column to a new type Args: df (DataFrame): spark dataframe column (Column): target column for type casting mohave_data_type (Enum): Enum MohaveDataType invalid_data_handling_method (Enum): Enum NonCastableDataHandlingMethod replace_value (str): value to replace for invalid data when "replace_value" is specified date_formatting (str): format for date. Default format is "dd-MM-yyyy" Returns: df (DataFrame): casted spark dataframe """ cast_to_date = f.to_date(df[column], date_formatting) cast_to_non_date = df[column].cast(MOHAVE_TO_SPARK_TYPE_MAPPING[mohave_data_type]()) non_castable_column = f"{column}_typecast_error" temp_column = "temp_column" if invalid_data_handling_method == NonCastableDataHandlingMethod.REPLACE_WITH_NULL: # Replace non-castable data to None in the same column. pyspark's default behaviour # Original dataframe # +---+------+ # | id | txt | # +---+---+--+ # | 1 | foo | # | 2 | bar | # | 3 | 1 | # +---+------+ # cast txt column to long # +---+------+ # | id | txt | # +---+------+ # | 1 | None | # | 2 | None | # | 3 | 1 | # +---+------+ return df.withColumn(column, cast_to_date if (mohave_data_type == MohaveDataType.DATE) else cast_to_non_date) if invalid_data_handling_method == NonCastableDataHandlingMethod.DROP_NON_CASTABLE_ROW: # Drop non-castable row # Original dataframe # +---+------+ # | id | txt | # +---+---+--+ # | 1 | foo | # | 2 | bar | # | 3 | 1 | # +---+------+ # cast txt column to long, _ non-castable row # +---+----+ # | id|txt | # +---+----+ # | 3| 1 | # +---+----+ df = df.withColumn(column, cast_to_date if (mohave_data_type == MohaveDataType.DATE) else cast_to_non_date) return df.where(df[column].isNotNull()) if ( invalid_data_handling_method == NonCastableDataHandlingMethod.REPLACE_WITH_NULL_AND_PUT_NON_CASTABLE_DATA_IN_NEW_COLUMN ): # Replace non-castable data to None in the same column and put non-castable data to a new column # Original dataframe # +---+------+ # | id | txt | # +---+------+ # | 1 | foo | # | 2 | bar | # | 3 | 1 | # +---+------+ # cast txt column to long # +---+----+------------------+ # | id|txt |txt_typecast_error| # +---+----+------------------+ # | 1|None| foo | # | 2|None| bar | # | 3| 1 | | # +---+----+------------------+ df = df.withColumn(temp_column, cast_to_date if (mohave_data_type == MohaveDataType.DATE) else cast_to_non_date) df = df.withColumn(non_castable_column, f.when(df[temp_column].isNotNull(), "").otherwise(df[column]),) elif invalid_data_handling_method == NonCastableDataHandlingMethod.REPLACE_WITH_FIXED_VALUE: # Replace non-castable data to a value in the same column # Original dataframe # +---+------+ # | id | txt | # +---+------+ # | 1 | foo | # | 2 | bar | # | 3 | 1 | # +---+------+ # cast txt column to long, replace non-castable value to 0 # +---+-----+ # | id| txt | # +---+-----+ # | 1| 0 | # | 2| 0 | # | 3| 1 | # +---+----+ value = _validate_and_cast_value(value=replace_value, mohave_data_type=mohave_data_type) df = df.withColumn(temp_column, cast_to_date if (mohave_data_type == MohaveDataType.DATE) else cast_to_non_date) replace_date_value = f.when(df[temp_column].isNotNull(), df[temp_column]).otherwise( f.to_date(f.lit(value), date_formatting) ) replace_non_date_value = f.when(df[temp_column].isNotNull(), df[temp_column]).otherwise(value) df = df.withColumn( temp_column, replace_date_value if (mohave_data_type == MohaveDataType.DATE) else replace_non_date_value ) elif ( invalid_data_handling_method == NonCastableDataHandlingMethod.REPLACE_WITH_FIXED_VALUE_AND_PUT_NON_CASTABLE_DATA_IN_NEW_COLUMN ): # Replace non-castable data to a value in the same column and put non-castable data to a new column # Original dataframe # +---+------+ # | id | txt | # +---+---+--+ # | 1 | foo | # | 2 | bar | # | 3 | 1 | # +---+------+ # cast txt column to long, replace non-castable value to 0 # +---+----+------------------+ # | id|txt |txt_typecast_error| # +---+----+------------------+ # | 1| 0 | foo | # | 2| 0 | bar | # | 3| 1 | | # +---+----+------------------+ value = _validate_and_cast_value(value=replace_value, mohave_data_type=mohave_data_type) df = df.withColumn(temp_column, cast_to_date if (mohave_data_type == MohaveDataType.DATE) else cast_to_non_date) df = df.withColumn(non_castable_column, f.when(df[temp_column].isNotNull(), "").otherwise(df[column]),) replace_date_value = f.when(df[temp_column].isNotNull(), df[temp_column]).otherwise( f.to_date(f.lit(value), date_formatting) ) replace_non_date_value = f.when(df[temp_column].isNotNull(), df[temp_column]).otherwise(value) df = df.withColumn( temp_column, replace_date_value if (mohave_data_type == MohaveDataType.DATE) else replace_non_date_value ) # drop temporary column df = df.withColumn(column, df[temp_column]).drop(temp_column) df_cols = df.columns if non_castable_column in df_cols: # Arrange columns so that non_castable_column col is next to casted column df_cols.remove(non_castable_column) column_index = df_cols.index(column) arranged_cols = df_cols[: column_index + 1] + [non_castable_column] + df_cols[column_index + 1 :] df = df.select(*arranged_cols) return df def _validate_and_cast_value(value, mohave_data_type): if value is None: return value try: return PYTHON_TYPE_MAPPING[mohave_data_type](value) except ValueError as e: raise ValueError( f"Invalid value to replace non-castable data. " f"{mohave_data_type} is not in mohave supported date type: {MohaveDataType.get_values()}. " f"Please use a supported type", e, ) import os import collections import tempfile import zipfile import base64 import logging from io import BytesIO import numpy as np class OperatorSparkOperatorCustomerError(Exception): """Error type for Customer Errors in Spark Operators""" def temp_col_name(df, *illegal_names): """Generates a temporary column name that is unused. """ name = "temp_col" idx = 0 name_set = set(list(df.columns) + list(illegal_names)) while name in name_set: name = f"_temp_col_{idx}" idx += 1 return name def get_temp_col_if_not_set(df, col_name): """Extracts the column name from the parameters if it exists, otherwise generates a temporary column name. """ if col_name: return col_name, False else: return temp_col_name(df), True def replace_input_if_output_is_temp(df, input_column, output_column, output_is_temp): """Replaces the input column in the dataframe if the output was not set This is used with get_temp_col_if_not_set to enable the behavior where a transformer will replace its input column if an output is not specified. """ if output_is_temp: df = df.withColumn(input_column, df[output_column]) df = df.drop(output_column) return df else: return df def parse_parameter(typ, value, key, default=None, nullable=False): if value is None: if default is not None or nullable: return default else: raise OperatorSparkOperatorCustomerError(f"Missing required input: '{key}'") else: try: value = typ(value) if isinstance(value, (int, float, complex)) and not isinstance(value, bool): if np.isnan(value) or np.isinf(value): raise OperatorSparkOperatorCustomerError( f"Invalid value provided for '{key}'. Expected {typ.__name__} but received: {value}" ) else: return value else: return value except (ValueError, TypeError): raise OperatorSparkOperatorCustomerError( f"Invalid value provided for '{key}'. Expected {typ.__name__} but received: {value}" ) except OverflowError: raise OperatorSparkOperatorCustomerError( f"Overflow Error: Invalid value provided for '{key}'. Given value '{value}' exceeds the range of type " f"'{typ.__name__}' for this input. Insert a valid value for type '{typ.__name__}' and try your request " f"again." ) def expects_valid_column_name(value, key, nullable=False): if nullable and value is None: return if value is None or len(str(value).strip()) == 0: raise OperatorSparkOperatorCustomerError(f"Column name cannot be null, empty, or whitespace for parameter '{key}': {value}") def expects_parameter(value, key, condition=None): if value is None: raise OperatorSparkOperatorCustomerError(f"Missing required input: '{key}'") elif condition is not None and not condition: raise OperatorSparkOperatorCustomerError(f"Invalid value provided for '{key}': {value}") def expects_column(df, value, key): if not value or value not in df.columns: raise OperatorSparkOperatorCustomerError(f"Expected column in dataframe for '{key}' however received '{value}'") def expects_parameter_value_in_list(key, value, items): if value not in items: raise OperatorSparkOperatorCustomerError(f"Illegal parameter value. {key} expected to be in {items}, but given {value}") def encode_pyspark_model(model): with tempfile.TemporaryDirectory() as dirpath: dirpath = os.path.join(dirpath, "model") # Save the model model.save(dirpath) # Create the temporary zip-file. mem_zip = BytesIO() with zipfile.ZipFile(mem_zip, "w", zipfile.ZIP_DEFLATED, compresslevel=9) as zf: # Zip the directory. for root, dirs, files in os.walk(dirpath): for file in files: rel_dir = os.path.relpath(root, dirpath) zf.write(os.path.join(root, file), os.path.join(rel_dir, file)) zipped = mem_zip.getvalue() encoded = base64.b85encode(zipped) return str(encoded, "utf-8") def decode_pyspark_model(model_factory, encoded): with tempfile.TemporaryDirectory() as dirpath: zip_bytes = base64.b85decode(encoded) mem_zip = BytesIO(zip_bytes) mem_zip.seek(0) with zipfile.ZipFile(mem_zip, "r") as zf: zf.extractall(dirpath) model = model_factory.load(dirpath) return model def hash_parameters(value): # pylint: disable=W0702 try: if isinstance(value, collections.Hashable): return hash(value) if isinstance(value, dict): return hash(frozenset([hash((hash_parameters(k), hash_parameters(v))) for k, v in value.items()])) if isinstance(value, list): return hash(frozenset([hash_parameters(v) for v in value])) raise RuntimeError("Object not supported for serialization") except: # noqa: E722 raise RuntimeError("Object not supported for serialization") def load_trained_parameters(trained_parameters, operator_parameters): trained_parameters = trained_parameters if trained_parameters else {} parameters_hash = hash_parameters(operator_parameters) stored_hash = trained_parameters.get("_hash") if stored_hash != parameters_hash: trained_parameters = {"_hash": parameters_hash} return trained_parameters def load_pyspark_model_from_trained_parameters(trained_parameters, model_factory, name): if trained_parameters is None or name not in trained_parameters: return None, False try: model = decode_pyspark_model(model_factory, trained_parameters[name]) return model, True except Exception as e: logging.error(f"Could not decode PySpark model {name} from trained_parameters: {e}") del trained_parameters[name] return None, False def fit_and_save_model(trained_parameters, name, algorithm, df): model = algorithm.fit(df) trained_parameters[name] = encode_pyspark_model(model) return model def transform_using_trained_model(model, df, loaded): try: return model.transform(df) except Exception as e: if loaded: raise OperatorSparkOperatorCustomerError( f"Encountered error while using stored model. Please delete the operator and try again. {e}" ) else: raise e import re from datetime import date import numpy as np import pandas as pd from pyspark.sql.types import ( BooleanType, IntegralType, FractionalType, StringType, ) def type_inference(df): # noqa: C901 # pylint: disable=R0912 """Core type inference logic Args: df: spark dataframe Returns: dict a schema that maps from column name to mohave datatype """ columns_to_infer = [col for (col, col_type) in df.dtypes if col_type == "string"] pandas_df = df.toPandas() report = {} for (columnName, _) in pandas_df.iteritems(): if columnName in columns_to_infer: column = pandas_df[columnName].values report[columnName] = { "sum_string": len(column), "sum_numeric": sum_is_numeric(column), "sum_integer": sum_is_integer(column), "sum_boolean": sum_is_boolean(column), "sum_date": sum_is_date(column), "sum_null_like": sum_is_null_like(column), "sum_null": sum_is_null(column), } # Analyze numeric_threshold = 0.8 integer_threshold = 0.8 date_threshold = 0.8 bool_threshold = 0.8 column_types = {} for col, insights in report.items(): # Convert all columns to floats to make thresholds easy to calculate. proposed = MohaveDataType.STRING.value if (insights["sum_numeric"] / insights["sum_string"]) > numeric_threshold: proposed = MohaveDataType.FLOAT.value if (insights["sum_integer"] / insights["sum_numeric"]) > integer_threshold: proposed = MohaveDataType.LONG.value elif (insights["sum_boolean"] / insights["sum_string"]) > bool_threshold: proposed = MohaveDataType.BOOL.value elif (insights["sum_date"] / insights["sum_string"]) > date_threshold: proposed = MohaveDataType.DATE.value column_types[col] = proposed for f in df.schema.fields: if f.name not in columns_to_infer: if isinstance(f.dataType, IntegralType): column_types[f.name] = MohaveDataType.LONG.value elif isinstance(f.dataType, FractionalType): column_types[f.name] = MohaveDataType.FLOAT.value elif isinstance(f.dataType, StringType): column_types[f.name] = MohaveDataType.STRING.value elif isinstance(f.dataType, BooleanType): column_types[f.name] = MohaveDataType.BOOL.value else: # unsupported types in mohave column_types[f.name] = MohaveDataType.OBJECT.value return column_types def _is_numeric_single(x): try: x_float = float(x) return np.isfinite(x_float) except ValueError: return False except TypeError: # if x = None return False def sum_is_numeric(x): """count number of numeric element Args: x: numpy array Returns: int """ castables = np.vectorize(_is_numeric_single)(x) return np.count_nonzero(castables) def _is_integer_single(x): try: if not _is_numeric_single(x): return False return float(x) == int(x) except ValueError: return False except TypeError: # if x = None return False def sum_is_integer(x): castables = np.vectorize(_is_integer_single)(x) return np.count_nonzero(castables) def _is_boolean_single(x): boolean_list = ["true", "false"] try: is_boolean = x.lower() in boolean_list return is_boolean except ValueError: return False except TypeError: # if x = None return False except AttributeError: return False def sum_is_boolean(x): castables = np.vectorize(_is_boolean_single)(x) return np.count_nonzero(castables) def sum_is_null_like(x): # noqa: C901 def _is_empty_single(x): try: return bool(len(x) == 0) except TypeError: return False def _is_null_like_single(x): try: return bool(null_like_regex.match(x)) except TypeError: return False def _is_whitespace_like_single(x): try: return bool(whitespace_regex.match(x)) except TypeError: return False null_like_regex = re.compile(r"(?i)(null|none|nil|na|nan)") # (?i) = case insensitive whitespace_regex = re.compile(r"^\s+$") # only whitespace empty_checker = np.vectorize(_is_empty_single)(x) num_is_null_like = np.count_nonzero(empty_checker) null_like_checker = np.vectorize(_is_null_like_single)(x) num_is_null_like += np.count_nonzero(null_like_checker) whitespace_checker = np.vectorize(_is_whitespace_like_single)(x) num_is_null_like += np.count_nonzero(whitespace_checker) return num_is_null_like def sum_is_null(x): return np.count_nonzero(pd.isnull(x)) def _is_date_single(x): try: return bool(date.fromisoformat(x)) # YYYY-MM-DD except ValueError: return False except TypeError: return False def sum_is_date(x): return np.count_nonzero(np.vectorize(_is_date_single)(x)) def cast_df(df, schema): """Cast datafram from given schema Args: df: spark dataframe schema: schema to cast to. It map from df's col_name to mohave datatype Returns: casted dataframe """ # col name to spark data type mapping col_to_spark_data_type_map = {} # get spark dataframe's actual datatype fields = df.schema.fields for f in fields: col_to_spark_data_type_map[f.name] = f.dataType cast_expr = [] # iterate given schema and cast spark dataframe datatype for col_name in schema: mohave_data_type_from_schema = MohaveDataType(schema.get(col_name, MohaveDataType.OBJECT.value)) if mohave_data_type_from_schema != MohaveDataType.OBJECT: spark_data_type_from_schema = MOHAVE_TO_SPARK_TYPE_MAPPING[mohave_data_type_from_schema] # Only cast column when the data type in schema doesn't match the actual data type if not isinstance(col_to_spark_data_type_map[col_name], spark_data_type_from_schema): # use spark-sql expression instead of spark.withColumn to improve performance expr = f"CAST (`{col_name}` as {SPARK_TYPE_MAPPING_TO_SQL_TYPE[spark_data_type_from_schema]})" else: # include column that has same dataType as it is expr = f"`{col_name}`" else: # include column that has same mohave object dataType as it is expr = f"`{col_name}`" cast_expr.append(expr) if len(cast_expr) != 0: df = df.selectExpr(*cast_expr) return df, schema def validate_schema(df, schema): """Validate if every column is covered in the schema Args: schema (): """ columns_in_df = df.columns columns_in_schema = schema.keys() if len(columns_in_df) != len(columns_in_schema): raise ValueError( f"Invalid schema column size. " f"Number of columns in schema should be equal as number of columns in dataframe. " f"schema columns size: {len(columns_in_schema)}, dataframe column size: {len(columns_in_df)}" ) for col in columns_in_schema: if col not in columns_in_df: raise ValueError( f"Invalid column name in schema. " f"Column in schema does not exist in dataframe. " f"Non-existed columns: {col}" ) def s3_source(spark, mode, dataset_definition): """Represents a source that handles sampling, etc.""" content_type = dataset_definition["s3ExecutionContext"]["s3ContentType"].upper() has_header = dataset_definition["s3ExecutionContext"]["s3HasHeader"] path = dataset_definition["s3ExecutionContext"]["s3Uri"].replace("s3://", "s3a://") try: if content_type == "CSV": df = spark.read.csv(path=path, header=has_header, escape='"', quote='"') elif content_type == "PARQUET": df = spark.read.parquet(path) return default_spark(df) except Exception as e: raise RuntimeError("An error occurred while reading files from S3") from e def infer_and_cast_type(df, spark, inference_data_sample_size=1000, trained_parameters=None): """Infer column types for spark dataframe and cast to inferred data type. Args: df: spark dataframe spark: spark session inference_data_sample_size: number of row data used for type inference trained_parameters: trained_parameters to determine if we need infer data types Returns: a dict of pyspark df with column data type casted and trained parameters """ from pyspark.sql.utils import AnalysisException # if trained_parameters is none or doesn't contain schema key, then type inference is needed if trained_parameters is None or not trained_parameters.get("schema", None): # limit first 1000 rows to do type inference limit_df = df.limit(inference_data_sample_size) schema = type_inference(limit_df) else: schema = trained_parameters["schema"] try: validate_schema(df, schema) except ValueError as e: raise OperatorCustomerError(e) try: df, schema = cast_df(df, schema) except (AnalysisException, ValueError) as e: raise OperatorCustomerError(e) trained_parameters = {"schema": schema} return default_spark_with_trained_parameters(df, trained_parameters) def custom_pandas(df, spark, code): """ Apply custom pandas code written by the user on the input dataframe. Right now only pyspark dataframe is supported as input, so the pyspark df is converted to pandas df before the custom pandas code is being executed. The output df is converted back to pyspark df before getting returned. Example: The custom code expects the user to provide an output df. code = \""" import pandas as pd df = pd.get_dummies(df['country'], prefix='country') \""" Notes: This operation expects the user code to store the output in df variable. Args: spark: Spark Session params (dict): dictionary that has various params. Required param for this operation is "code" df: pyspark dataframe Returns: df: pyspark dataframe with the custom pandas code executed on the input df. """ import ast exec_block = ast.parse(code, mode="exec") if len(exec_block.body) == 0: return default_spark(df) pandas_df = df.toPandas() _globals, _locals = {}, {"df": pandas_df} stdout = capture_stdout(exec, compile(exec_block, "<string>", mode="exec"), _locals) # pylint: disable=W0122 pandas_df = eval("df", _globals, _locals) # pylint: disable=W0123 # find list of columns with all None values and fill with empty str. null_columns = pandas_df.columns[pandas_df.isnull().all()].tolist() pandas_df[null_columns] = pandas_df[null_columns].fillna("") # convert the mixed cols to str, since pyspark df does not support mixed col. df = convert_or_coerce(pandas_df, spark) # while statement is to recurse over all fields that have mixed type and cannot be converted while not isinstance(df, DataFrame): df = convert_or_coerce(df, spark) return default_spark_with_stdout(df, stdout) def format_string(df, spark, **kwargs): return dispatch( "operator", [df], kwargs, { "Lower case": (format_string_lower_case, "lower_case_parameters"), "Upper case": (format_string_upper_case, "upper_case_parameters"), "Title case": (format_string_title_case, "title_case_parameters"), "Capitalize": (format_string_capitalize, "capitalize_parameters"), "Swap case": (format_string_swap_case, "swap_case_parameters"), "Left pad": (format_string_left_pad, "left_pad_parameters"), "Right pad": (format_string_right_pad, "right_pad_parameters"), "Center (pad on either side)": ( format_string_center_pad_on_either_side, "center_pad_on_either_side_parameters", ), "Strip characters from left": ( format_string_strip_characters_from_left, "strip_characters_from_left_parameters", ), "Strip characters from right": ( format_string_strip_characters_from_right, "strip_characters_from_right_parameters", ), "Strip left and right": (format_string_strip_left_and_right, "strip_left_and_right_parameters"), "Prepend zeros": (format_string_prepend_zeros, "prepend_zeros_parameters"), "Add prefix": (format_string_add_prefix, "add_prefix_parameters"), "Add suffix": (format_string_add_suffix, "add_suffix_parameters"), "Remove symbols": (format_string_remove_symbols, "remove_symbols_parameters"), }, ) def encode_categorical(df, spark, **kwargs): return dispatch( "operator", [df], kwargs, { "Ordinal encode": (encode_categorical_ordinal_encode, "ordinal_encode_parameters"), "One-hot encode": (encode_categorical_one_hot_encode, "one_hot_encode_parameters"), }, ) def cast_single_data_type( # noqa: C901 df, spark, column, data_type, non_castable_data_handling_method="replace_null", replace_value=None, date_formatting="dd-MM-yyyy", ): """Cast pyspark dataframe column type Args: column: column name e.g.: "col_1" data_type: data type to cast to non_castable_data_handling_method: supported method: ("replace_null","replace_null_with_new_col", "replace_value","replace_value_with_new_col","drop") If not specified, it will use the default method replace_null. see casting.NonCastableDataHandlingMethod replace_value: value to replace non-castable data date_formatting: date format to cast to Returns: df: pyspark df with column data type casted """ from pyspark.sql.utils import AnalysisException supported_type = MohaveDataType.get_values() df_cols = df.columns # Validate input params if column not in df_cols: raise OperatorCustomerError( f"Invalid column name. {column} is not in current columns {df_cols}. Please use a valid column name." ) if data_type not in supported_type: raise OperatorCustomerError( f"Invalid data_type. {data_type} is not in {supported_type}. Please use a supported data type." ) support_invalid_data_handling_method = NonCastableDataHandlingMethod.get_values() if non_castable_data_handling_method not in support_invalid_data_handling_method: raise OperatorCustomerError( f"Invalid data handling method. " f"{non_castable_data_handling_method} is not in {support_invalid_data_handling_method}. " f"Please use a supported method." ) mohave_data_type = MohaveDataType(data_type) spark_data_type = [f.dataType for f in df.schema.fields if f.name == column] if isinstance(spark_data_type[0], MOHAVE_TO_SPARK_TYPE_MAPPING[mohave_data_type]): return default_spark(df) try: df = cast_single_column_type( df, column=column, mohave_data_type=MohaveDataType(data_type), invalid_data_handling_method=NonCastableDataHandlingMethod(non_castable_data_handling_method), replace_value=replace_value, date_formatting=date_formatting, ) except (AnalysisException, ValueError) as e: raise OperatorCustomerError(e) return default_spark(df) op_1_output = s3_source(spark=spark, mode=mode, **{'dataset_definition': {'__typename': 'S3CreateDatasetDefinitionOutput', 'datasetSourceType': 'S3', 'name': 'claims.csv', 'description': None, 's3ExecutionContext': {'__typename': 'S3ExecutionContext', 's3Uri': 's3://sagemaker-us-east-1-870180618679/fraud-detect-demo/data/raw/claims.csv', 's3ContentType': 'csv', 's3HasHeader': True}}}) op_2_output = infer_and_cast_type(op_1_output['default'], spark=spark, **{}) op_3_output = custom_pandas(op_2_output['default'], spark=spark, **{'code': '# Table is available as variable `df`\ncat_cols = df.dtypes[df.dtypes == object].index\ndf[cat_cols] = df[cat_cols].apply(lambda x: x.str.lower())\n'}) op_4_output = format_string(op_3_output['default'], spark=spark, **{'operator': 'Remove symbols', 'remove_symbols_parameters': {'symbols': '!@#$%^&*()_+=-/\\`~{}|<>?', 'input_column': 'driver_relationship'}, 'lower_case_parameters': {}}) op_5_output = format_string(op_4_output['default'], spark=spark, **{'operator': 'Remove symbols', 'remove_symbols_parameters': {'symbols': '!@#$%^&*()_+=-/\\`~{}|<>?', 'input_column': 'collision_type'}, 'lower_case_parameters': {}}) op_6_output = format_string(op_5_output['default'], spark=spark, **{'operator': 'Remove symbols', 'remove_symbols_parameters': {'symbols': '!@#$%^&*()_+=-/\\`~{}|<>?', 'input_column': 'incident_type'}, 'lower_case_parameters': {}}) op_7_output = encode_categorical(op_6_output['default'], spark=spark, **{'operator': 'One-hot encode', 'one_hot_encode_parameters': {'invalid_handling_strategy': 'Keep', 'drop_last': False, 'output_style': 'Columns', 'input_column': 'driver_relationship'}, 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN'}}) op_8_output = encode_categorical(op_7_output['default'], spark=spark, **{'operator': 'One-hot encode', 'one_hot_encode_parameters': {'invalid_handling_strategy': 'Keep', 'drop_last': False, 'output_style': 'Columns', 'input_column': 'incident_type'}, 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN'}}) op_9_output = encode_categorical(op_8_output['default'], spark=spark, **{'operator': 'One-hot encode', 'one_hot_encode_parameters': {'invalid_handling_strategy': 'Keep', 'drop_last': False, 'output_style': 'Columns', 'input_column': 'collision_type'}, 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN'}}) op_10_output = encode_categorical(op_9_output['default'], spark=spark, **{'operator': 'One-hot encode', 'one_hot_encode_parameters': {'invalid_handling_strategy': 'Keep', 'drop_last': False, 'output_style': 'Columns', 'input_column': 'authorities_contacted'}, 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN'}}) op_11_output = encode_categorical(op_10_output['default'], spark=spark, **{'operator': 'Ordinal encode', 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN', 'input_column': 'incident_severity'}}) op_12_output = encode_categorical(op_11_output['default'], spark=spark, **{'operator': 'Ordinal encode', 'ordinal_encode_parameters': {'invalid_handling_strategy': 'Replace with NaN', 'input_column': 'police_report_available'}}) op_13_output = custom_pandas(op_12_output['default'], spark=spark, **{'code': "# Table is available as variable `df`\nimport pandas as pd\ndf['event_time'] = pd.to_datetime('now').timestamp()"}) op_14_output = cast_single_data_type(op_13_output['default'], spark=spark, **{'column': 'police_report_available', 'original_data_type': 'Float', 'data_type': 'long'}) op_15_output = cast_single_data_type(op_14_output['default'], spark=spark, **{'column': 'authorities_contacted_fire', 'original_data_type': 'Float', 'data_type': 'long'}) op_16_output = cast_single_data_type(op_15_output['default'], spark=spark, **{'column': 'authorities_contacted_ambulance', 'original_data_type': 'Float', 'data_type': 'long'}) op_17_output = cast_single_data_type(op_16_output['default'], spark=spark, **{'column': 'authorities_contacted_none', 'original_data_type': 'Float', 'data_type': 'long'}) op_18_output = cast_single_data_type(op_17_output['default'], spark=spark, **{'column': 'authorities_contacted_police', 'original_data_type': 'Float', 'data_type': 'long'}) op_19_output = cast_single_data_type(op_18_output['default'], spark=spark, **{'column': 'collision_type_na', 'original_data_type': 'Float', 'data_type': 'long'}) op_20_output = cast_single_data_type(op_19_output['default'], spark=spark, **{'column': 'collision_type_side', 'original_data_type': 'Float', 'data_type': 'long'}) op_21_output = cast_single_data_type(op_20_output['default'], spark=spark, **{'column': 'incident_type_theft', 'original_data_type': 'Float', 'data_type': 'long'}) op_22_output = cast_single_data_type(op_21_output['default'], spark=spark, **{'column': 'incident_type_breakin', 'original_data_type': 'Float', 'data_type': 'long'}) op_23_output = cast_single_data_type(op_22_output['default'], spark=spark, **{'column': 'incident_type_collision', 'original_data_type': 'Float', 'data_type': 'long'}) op_24_output = cast_single_data_type(op_23_output['default'], spark=spark, **{'column': 'driver_relationship_other', 'original_data_type': 'Float', 'data_type': 'long'}) op_25_output = cast_single_data_type(op_24_output['default'], spark=spark, **{'column': 'driver_relationship_child', 'original_data_type': 'Float', 'data_type': 'long'}) op_26_output = cast_single_data_type(op_25_output['default'], spark=spark, **{'column': 'driver_relationship_spouse', 'original_data_type': 'Float', 'data_type': 'long'}) op_27_output = cast_single_data_type(op_26_output['default'], spark=spark, **{'column': 'driver_relationship_na', 'original_data_type': 'Float', 'data_type': 'long'}) op_28_output = cast_single_data_type(op_27_output['default'], spark=spark, **{'column': 'driver_relationship_self', 'original_data_type': 'Float', 'data_type': 'long'}) op_29_output = cast_single_data_type(op_28_output['default'], spark=spark, **{'column': 'total_claim_amount', 'original_data_type': 'Long', 'data_type': 'float'}) op_30_output = cast_single_data_type(op_29_output['default'], spark=spark, **{'column': 'vehicle_claim', 'original_data_type': 'Long', 'data_type': 'float'}) op_31_output = cast_single_data_type(op_30_output['default'], spark=spark, **{'column': 'injury_claim', 'original_data_type': 'Long', 'data_type': 'float'}) op_32_output = cast_single_data_type(op_31_output['default'], spark=spark, **{'column': 'incident_severity', 'original_data_type': 'Float', 'data_type': 'long'}) op_33_output = cast_single_data_type(op_32_output['default'], spark=spark, **{'column': 'collision_type_rear', 'original_data_type': 'Float', 'data_type': 'long'}) op_34_output = cast_single_data_type(op_33_output['default'], spark=spark, **{'column': 'collision_type_front', 'original_data_type': 'Float', 'data_type': 'long'}) # Glossary: variable name to node_id # # op_1_output: e5d60d4f-6284-4a68-a788-39787909ebc9 # op_2_output: 1626aef2-cad0-4922-a496-34586d3def90 # op_3_output: 921ad4e5-3812-4651-b3cd-fecc38e0bba6 # op_4_output: e90bfd12-d702-4c79-8e11-5e4011600fda # op_5_output: 10ca6bec-5d89-43bd-ba3e-7b5e839e9d23 # op_6_output: 09a3e1c7-29c5-46e8-8690-4cdaf905628a # op_7_output: a5333162-b98e-41f4-8b18-5bb68b98a615 # op_8_output: de96bceb-ac8c-40d4-a9e8-5a777b44437c # op_9_output: 2e5cb36f-b0a5-4763-9740-2ef60f3c6376 # op_10_output: e20b22bc-12aa-469e-9d6c-c4083ddedf08 # op_11_output: cd48da2b-c648-41e2-b828-38b518fc795d # op_12_output: 9ff4c2a4-e1fe-4a66-819f-f7d8df7a5fed # op_13_output: 67fdfb06-278a-4360-8454-3ec1abf1ddd3 # op_14_output: f324323b-8d6e-4e6f-a362-eb9405c2aabf # op_15_output: c3e12fe4-0792-4627-a728-43bb51312196 # op_16_output: 0e239308-1ad0-421b-9e8f-36011d83a6b6 # op_17_output: 93d33455-1cf2-485d-aaf7-5ae5c7d5197e # op_18_output: 0eff4390-66cb-423a-bad4-40fc368aa6d4 # op_19_output: 488aa71e-881e-451e-be8b-5d960530715c # op_20_output: 38ede4e0-ac3c-4e73-9b5e-ad5216997520 # op_21_output: dc6b5e18-0423-4940-afbe-57e24560400e # op_22_output: acb3f245-c50b-4174-8295-5b933500568b # op_23_output: 9dfb1906-6d9a-45d3-ac92-d5f3f535ff8a # op_24_output: a65a0721-7696-4e64-9e65-2423dc65163e # op_25_output: 9b23353f-c840-4bed-9368-636a249038b7 # op_26_output: 1c9c8473-9ccb-4ce4-a2a0-db15c648565e # op_27_output: a00c44fb-3704-4e1c-bda7-887f0feae6a6 # op_28_output: 7bd2e323-2ef9-4329-844a-0f2406ff980c # op_29_output: 7132ae96-da8f-4a02-8708-0bc233a5ecd2 # op_30_output: 10a9d871-4660-44fb-aa9f-14f14a4f5a44 # op_31_output: 01b14795-ad16-4e33-af09-5cedf7a3b806 # op_32_output: 8328f4cc-9adf-47e7-9752-9ab1cf83e7b9 # op_33_output: 6d59ff64-c095-4f20-a7ba-c4a49e842c7c # op_34_output: 62d710d9-a288-4004-b960-6cf452c0380c
40.545395
387
0.679613
7949c22e3d0f8a9f1429ac74fb8b1711cc87c423
5,906
py
Python
assignment5/linkshort/linkshort_test.py
rahulraj/web_projects
4d16cb7d7a9c0e408d5f44165dbdc050bbaceddd
[ "MIT" ]
1
2017-04-25T07:06:22.000Z
2017-04-25T07:06:22.000Z
assignment5/linkshort/linkshort_test.py
rahulraj/web_projects
4d16cb7d7a9c0e408d5f44165dbdc050bbaceddd
[ "MIT" ]
null
null
null
assignment5/linkshort/linkshort_test.py
rahulraj/web_projects
4d16cb7d7a9c0e408d5f44165dbdc050bbaceddd
[ "MIT" ]
null
null
null
import unittest import tempfile import os import simplejson as json from functools import partial import __init__ as linkshort class LinkShortTest(unittest.TestCase): def setUp(self): self.database_handle, linkshort.app.database = tempfile.mkstemp() self.app = linkshort.app.test_client() linkshort.initialize_database() def test_get_index(self): """ Send a get request to /, it should return a template. The test won't inspect the template too closely, because the goal is to test the controller, not the presentation logic. i.e. if the GUI is redesigned, these tests should not break. """ output = self.app.get('/') self.assertTrue('Link Shortener' in output.data) def register(self, username, password, confirmation): return self.app.post('/register', data=dict( username=username, password=password, confirmPassword=confirmation ), follow_redirects=True) def register_test_user(self): return self.register('test_user', 'test_password', 'test_password') def login(self, username, password): return self.app.post('/login', data=dict( username=username, password=password ), follow_redirects=True) def login_test_user(self): return self.login('test_user', 'test_password') def logout(self): return self.app.get('/logout', follow_redirects=True) def dict_from_request(self, request_function): """ Executes request_function, and then converts the JSON response into a dict. Returns the dict. """ result = request_function() return json.loads(result.data) def test_simple_registration(self): result = self.dict_from_request(self.register_test_user) self.assertTrue(result['success']) def test_invalid_confirmation_in_registration(self): invalid_register = partial(self.register, 'another_user', 'paswod', 'password') result = self.dict_from_request(invalid_register) self.assertFalse(result['success']) def test_duplicate_username_fails_registration(self): self.register_test_user() result = self.dict_from_request(self.register_test_user) self.assertFalse(result['success']) def test_blank_password_fails_registration(self): invalid_register = partial(self.register, 'user', '', '') result = self.dict_from_request(invalid_register) self.assertFalse(result['success']) def test_spaces_password_fails_registration(self): invalid_register = partial(self.register, 'user', ' ', ' ') result = self.dict_from_request(invalid_register) self.assertFalse(result['success']) def test_spaces_in_password_fails_registration(self): invalid_register = partial(self.register, 'user', 'hi there', 'hi there') result = self.dict_from_request(invalid_register) self.assertFalse(result['success']) def test_login_fails_with_new_user(self): invalid_login = partial(self.login, 'user', 'password') result = self.dict_from_request(invalid_login) self.assertFalse(result['success']) def test_login_succeeds_after_registration(self): self.register_test_user() result = self.dict_from_request(self.login_test_user) self.assertTrue(result['success']) def add_page(self, original_url, shortened_url): return self.app.post('/pages', data=dict( originalUrl=original_url, outputUrl=shortened_url ), follow_redirects=True) def get_pages(self): return self.app.get('/pages', follow_redirects=True) def test_no_pages_initially(self): self.register_test_user() pages = self.dict_from_request(self.get_pages) self.assertEquals(0, len(pages['pages'])) def test_shorten_page_fails_for_blank_page(self): self.register_test_user() invalid_add_page = partial(self.add_page, '', '') result = self.dict_from_request(invalid_add_page) self.assertFalse(result['success']) def test_get_pages_fails_when_no_user(self): result = self.get_pages() self.assertEquals(401, result.status_code) def test_shorten_pages_fails_when_no_user(self): result = self.add_page('www.google.com', '') self.assertEquals(401, result.status_code) def test_simple_shorten_page(self): self.register_test_user() add_page = partial(self.add_page, 'www.google.com', '') result = self.dict_from_request(add_page) self.assertTrue(result['success']) def test_shorten_page_provided_value(self): self.register_test_user() add_page = partial(self.add_page, 'www.google.com', 'search') result = self.dict_from_request(add_page) self.assertTrue(result['success']) self.assertEquals('search', result['shortenedUrl']) def test_shortened_urls_must_be_unique(self): self.test_shorten_page_provided_value() add_page = partial(self.add_page, 'www.duckduckgo.com', 'search') result = self.dict_from_request(add_page) self.assertFalse(result['success']) def test_shortened_urls_cant_have_forward_slashes(self): self.register_test_user() add_page = partial(self.add_page, 'www.google.com', 'a/search/engine') result = self.dict_from_request(add_page) self.assertFalse(result['success']) def test_shortened_pages_are_added_to_users_pages(self): self.test_simple_shorten_page() result = self.dict_from_request(self.get_pages) self.assertEquals(1, len(result['pages'])) def test_no_page_visits_initially(self): self.test_simple_shorten_page() result = self.dict_from_request(self.get_pages) self.assertEquals(0, len(result['pages'][0]['visits'])) def test_page_visits_are_logged(self): self.test_shorten_page_provided_value() self.app.get('/search') result = self.dict_from_request(self.get_pages) self.assertEquals(1, len(result['pages'][0]['visits'])) def tearDown(self): os.close(self.database_handle) os.unlink(linkshort.app.database) if __name__ == '__main__': unittest.main()
35.154762
83
0.734677
7949c24318db3531fe578c4e1d6e70e7aa965cb8
1,133
py
Python
IntroToCS_ex4/check_update_word_pattern.py
nadavWeisler/IntroToCS
725fc8822eeb34f6917692846689dee29b24af55
[ "MIT" ]
null
null
null
IntroToCS_ex4/check_update_word_pattern.py
nadavWeisler/IntroToCS
725fc8822eeb34f6917692846689dee29b24af55
[ "MIT" ]
null
null
null
IntroToCS_ex4/check_update_word_pattern.py
nadavWeisler/IntroToCS
725fc8822eeb34f6917692846689dee29b24af55
[ "MIT" ]
null
null
null
############################################################# # FILE : check_update_word_pattern.py # WRITER : Nadav Weisler , weisler , 316493758 # EXERCISE : intro2cs ex4 2019 - Hangman # DESCRIPTION: test several inputs for the # function "update_word_pattern from hangman.py ############################################################# from hangman import update_word_pattern def test_update_word_pattern(): """Function that test several inputs for the function "update_word_pattern from hangman.py""" words = [ 'hello', 'hello', 'hello', 'hello' ] patterns = [ '_____', 'hell_', 'hell_', 'h____' ] letters = [ 'h', 'h', 'o', 'd' ] results = [ "h____", "hell_", "hello", "h____" ] for i in range(len(words)): if update_word_pattern(words[i], patterns[i], letters[i]) != results[i]: print("Test failed") return False print("Test done!") return True if __name__ == '__main__': test_update_word_pattern()
22.66
80
0.494263
7949c3ba293422c43e32702126015f51b411990d
7,664
py
Python
pet_ct/data/labeler.py
seyuboglu/weakly-supervised-petct
182821ae6b6abe1bc3623692aeba85da8083b27b
[ "Apache-2.0" ]
9
2020-08-09T23:25:41.000Z
2022-03-09T20:24:02.000Z
pet_ct/data/labeler.py
seyuboglu/weakly-supervised-petct
182821ae6b6abe1bc3623692aeba85da8083b27b
[ "Apache-2.0" ]
4
2020-09-17T10:47:09.000Z
2022-03-12T00:20:26.000Z
pet_ct/data/labeler.py
geoffreyangus/pet-ct
fa96a07734afade475f6a1e1587ec14965fe2de3
[ "Apache-2.0" ]
1
2021-04-12T17:42:02.000Z
2021-04-12T17:42:02.000Z
""" noisy labeling functions to be used for weak supervision tasks. """ import re import pet_ct.data.term_graphs as term_graphs import pet_ct.data.match_fns as match_fns class Labeler(object): """ Labeler must always return a tuple of `labels` and a list of `edges`, denoting each label by its index in `labels` list. """ def __init__(self, term_graph_class="", term_graph_args={}): """ """ self.term_graph = getattr(term_graphs, term_graph_class)(**term_graph_args) def _contains_term(self, c, name="", neg_regexes=[], hit_code=2, miss_code=1, is_root=True): """returns hit_code if name is in s, else miss_code Uses the term regexes specified in term_graph to find positions. If term is the parent of another term, it will continue down the term graph until it finds a term or reaches a leaf. If there is a hit, the all node and all of its ancestors return hit_code, while the rest of the graph returns abstentions. If there is no hit, the entire tree returns the miss_code. We use strings in order to allow for the use of more elaborate phrasal regular expressions. Uses BFS when iterating through children. Args: s (string) lowercase string containing all tokens of interest name (string) name of term of interest in term_graph. Returns: an integer reflecting metal's paradigm, where 0 is abstain, 1 is a negative classification, and 2 is a positive classification. """ assert name in self.term_graph.name_to_term.keys(), ( f"term graph does not contain {name}" ) term = self.term_graph.name_to_term[name] labels = [] names = [] children = term.get("children", []) for i, child in enumerate(children): child_labels, child_names = self._contains_term(c, name=child, neg_regexes=neg_regexes, miss_code=miss_code, hit_code=hit_code, is_root=False) labels += child_labels names += child_names search_results = Labeler.search(c, regexes=term.get('match_res', []), neg_regexes=neg_regexes, hit_code=hit_code, miss_code=miss_code) for match_fn_dict in term.get("match_fns", []): fn = match_fn_dict['fn'] fn_args = match_fn_dict['args'] match = getattr(match_fns, fn)(c, **fn_args) if match: negated = False pos = match['start'] start = max(c[:pos].rfind('.'), 0) end = pos + c[pos:].find('.') # returns -1 if not found for neg in neg_regexes: pattern = re.compile(r"\b" + neg + r"\b") # search for negations within the same sentence if re.search(pattern, c[start:pos]) or re.search(pattern, c[pos:end]): negated = True break if not negated: search_results.append(hit_code) else: search_results.append(miss_code) else: search_results.append(miss_code) if len(search_results) > 0: labels += [max(search_results)] names.append(name) # no regexes matched in any of the nodes, set the whole tree to negative if is_root: names = {n:i for i, n in enumerate(names)} if hit_code not in labels: labels = [miss_code for label in labels] return labels, names def contains_term(self, c, names=[], neg_regexes=["no", "not", "without"], hit_code=2, miss_code=1, aggregate=False): """ """ if type(names) != list: names = [names] res = [] for name in names: labels, _ = self._contains_term(c, name=name, neg_regexes=neg_regexes, hit_code=hit_code, miss_code=miss_code, is_root=True) res += labels if aggregate: if res: res = [max(res)] else: res = [miss_code] # TODO: incorporate edges of G_{source} return res, [] @staticmethod def contains_evidence(c, neg_regexes=["no", "not", "without"], hit_code=2, miss_code=1, aggregate=False): """ """ regexes = [ "evidence of metabolically active disease", "evidence of metabolically active", "evidence.*?malignancy", "evidence.*?disease", "significant evidence", "significant.*?activity", "significant.*?uptake", "significant", "definite evidence", "definite scintigraphic evidence" "scintigraphic evidence", "sign.*?malignancy", "abnormal.*?uptake", "hypermetabolic activity", "evidence", "disease", "activity", "uptake", "malignancy", ] labels = Labeler.search(c, regexes, neg_regexes=neg_regexes, hit_code=hit_code, miss_code=miss_code) if aggregate: labels = [Labeler.aggregate_labels(labels, agg_type='max')] return labels, [] # always independent @staticmethod def search(c, regexes, neg_regexes=[], hit_code=2, miss_code=1): """ """ labels = [] for regex in regexes: pattern = re.compile(r"\b" + regex + r"\b") res = re.search(pattern, c) if res: pos = res.start() start = max(c[:pos].rfind('.'), 0) end = pos + c[pos:].find('.') # returns -1 if not found negated = False for neg in neg_regexes: pattern = re.compile(r"\b" + neg + r"\b") # search for negations within the same sentence if re.search(pattern, c[start:pos]) or re.search(pattern, c[pos:end]): negated = True labels.append(miss_code) break if not negated: labels.append(hit_code) else: labels.append(0) return labels @staticmethod def extract_from_sources_df(series, cols=[], agg_type=None): """ Extracts labels directly from a dataframe series (row). """ labels = [] for col in cols: labels.append(series[col]) if agg_type: labels = [Labeler.aggregate_labels(labels, agg_type=agg_type)] return labels, [] @staticmethod def aggregate_labels(labels, agg_type='max'): """ Returns a single (representative) value for a set of labels. Args: labels (list) list of prospective labels for given sources agg_type (string) """ if agg_type == 'max': return max(labels) elif agg_type == 'majority': value, count = Counter(labels).most_common() return value else: raise ValueError(f"agg_type {agg_type} not recognized.")
35.813084
99
0.522573
7949c607dd0195abd13aec31c53174d3358c5e0e
3,062
py
Python
src/rock_rhino_image_processor/rock_rhino_image_processor/robot_enable.py
househear/_ws_moveit2
ea5c43ddd412ade6b4bebbdb929b6e08b7a5e888
[ "Apache-2.0" ]
null
null
null
src/rock_rhino_image_processor/rock_rhino_image_processor/robot_enable.py
househear/_ws_moveit2
ea5c43ddd412ade6b4bebbdb929b6e08b7a5e888
[ "Apache-2.0" ]
null
null
null
src/rock_rhino_image_processor/rock_rhino_image_processor/robot_enable.py
househear/_ws_moveit2
ea5c43ddd412ade6b4bebbdb929b6e08b7a5e888
[ "Apache-2.0" ]
null
null
null
# Copyright 1996-2020 Soft_illusion. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # This file is used to enable all the sensors and making robot move import rclpy from webots_ros2_core.webots_node import WebotsNode from geometry_msgs.msg import Twist DEVICE_CONFIG = { 'camera_mid': {'topic_name': 'camera', 'timestep': 16} } class RobotEnable(WebotsNode): def __init__(self, args): super().__init__('robot_enable', args) # self.start_device_manager() # Front wheels self.left_motor_front = self.robot.getMotor('left_front_wheel') self.left_motor_front.setPosition(float('inf')) self.left_motor_front.setVelocity(0) self.right_motor_front = self.robot.getMotor('right_front_wheel') self.right_motor_front.setPosition(float('inf')) self.right_motor_front.setVelocity(0) # Rear wheels self.left_motor_rear = self.robot.getMotor('left_rear_wheel') self.left_motor_rear.setPosition(float('inf')) self.left_motor_rear.setVelocity(0) self.right_motor_rear = self.robot.getMotor('right_rear_wheel') self.right_motor_rear.setPosition(float('inf')) self.right_motor_rear.setVelocity(0) self.motor_max_speed = self.left_motor_rear.getMaxVelocity() # Create Subscriber self.cmd_vel_subscriber = self.create_subscription( Twist, 'cmd_vel', self.cmd_velocity_callback, 1) self.start_device_manager(DEVICE_CONFIG) self.get_logger().info('Sensor enabled') def cmd_velocity_callback(self, msg): wheel_gap = 0.1 # in meter wheel_radius = 0.04 # in meter left_speed = ((2.0 * msg.linear.x - msg.angular.z * wheel_gap) / (2.0 * wheel_radius)) right_speed = ((2.0 * msg.linear.x + msg.angular.z * wheel_gap) / (2.0 * wheel_radius)) left_speed = min(self.motor_max_speed, max(-self.motor_max_speed, left_speed)) right_speed = min(self.motor_max_speed, max(-self.motor_max_speed, right_speed)) self.left_motor_front.setVelocity(left_speed) self.right_motor_front.setVelocity(right_speed) self.left_motor_rear.setVelocity(left_speed) self.right_motor_rear.setVelocity(right_speed) def main(args=None): rclpy.init(args=args) robot_object = RobotEnable(args=args) rclpy.spin(robot_object) robot_object.destroy_node() rclpy.shutdown() if __name__ == '__main__': main()
35.195402
74
0.683867
7949c67473b9681ec59a45d555e98a842a31b776
4,419
py
Python
data/stuff.py
loganstone/rogue
ffcdd6073178e4fe5ae4774ef9d98b185cf1cc9e
[ "MIT" ]
null
null
null
data/stuff.py
loganstone/rogue
ffcdd6073178e4fe5ae4774ef9d98b185cf1cc9e
[ "MIT" ]
null
null
null
data/stuff.py
loganstone/rogue
ffcdd6073178e4fe5ae4774ef9d98b185cf1cc9e
[ "MIT" ]
null
null
null
import tcod from random import randint from components.equipment import EquipmentSlots from components.equippable import Equippable from components.item import Item from entity import Entity from render_functions import RenderOrder from game_messages import Message from item_functions import (cast_confuse, cast_fireball, cast_lightning, heal) class ItemBase: chances = 0 is_consumable = False is_equippable = False def __init__(self, name, character, color): self.name = name self.character = character self.color = color def get_entity(self, x, y): raise NotImplementedError class Consumable(ItemBase): is_consumable = True def __init__(self, name, character, color, item_component): ItemBase.__init__(self, name, character, color) self.item_component = item_component def get_entity(self, x, y): return Entity(x, y, self.character, self.color, self.name, render_order=RenderOrder.ITEM, item=self.item_component) class Scroll(Consumable): def __init__(self, name, color, item_component): Consumable.__init__(self, name, '#', color, item_component) class Potion(Consumable): def __init__(self, name, color, item_component): Consumable.__init__(self, name, '!', color, item_component) class Equipment(ItemBase): is_equippable = True def __init__(self, name, character, color, equippable_component): ItemBase.__init__(self, name, character, color) self.equippable_component = equippable_component def get_entity(self, x, y): return Entity(x, y, self.character, self.color, self.name, equippable=self.equippable_component) class HealingPotion(Potion): chances = 35 def __init__(self): amount = randint(30, 40) Potion.__init__( self, 'Healing Potion', tcod.violet, Item(use_function=heal, amount=amount)) class LightningBoltScroll(Scroll): chances = [[25, 4]] def __init__(self): damage = randint(10, 50) Scroll.__init__( self, 'Lightning Bolt Scroll', tcod.yellow, Item(use_function=cast_lightning, damage=damage, maximum_range=5)) class FireballScroll(Scroll): chances = [[25, 6]] def __init__(self): text = ('Left-click a target tile for the fireball,' ' or right-click to cancel.') damage = randint(20, 25) Scroll.__init__( self, 'Fireball Scroll', tcod.red, Item(use_function=cast_fireball, targeting=True, targeting_message=Message(text, tcod.light_cyan), damage=damage, radius=3)) class ConfusionScroll(Scroll): chances = [[10, 2]] def __init__(self): text = ('Left-click an enemy to confuse it,' ' or right-click to cancel.') Scroll.__init__( self, 'Confusion Scroll', tcod.light_pink, Item(use_function=cast_confuse, targeting=True, targeting_message=Message(text, tcod.light_cyan), number_of_turns=10)) class Dagger(Equipment): def __init__(self): Equipment.__init__( self, 'Dagger', '_', tcod.sky, Equippable(EquipmentSlots.MAIN_HAND, power_bonus=2)) class Sword(Equipment): chances = [[5, 4]] def __init__(self): Equipment.__init__( self, 'Sword', '/', tcod.sky, Equippable(EquipmentSlots.MAIN_HAND, power_bonus=4)) class Shield(Equipment): chances = [[15, 8]] def __init__(self): Equipment.__init__( self, 'Shield', '[', tcod.darker_orange, Equippable(EquipmentSlots.OFF_HAND, defense_bonus=1)) ITEMS = [ # Potions HealingPotion, # Scrolls LightningBoltScroll, FireballScroll, ConfusionScroll, # Equipment Sword, Shield ]
24.016304
69
0.572301
7949c82dd193e835afd703e167c31176ce1d93c9
3,938
py
Python
tests/unit/states/grafana_datasource_test.py
preoctopus/salt
aceaaa0e2f2f2ff29a694393bd82bba0d88fa44d
[ "Apache-2.0" ]
2
2015-09-21T14:13:30.000Z
2016-02-12T11:33:46.000Z
tests/unit/states/grafana_datasource_test.py
preoctopus/salt
aceaaa0e2f2f2ff29a694393bd82bba0d88fa44d
[ "Apache-2.0" ]
1
2019-09-06T13:57:28.000Z
2019-09-06T13:57:28.000Z
tests/unit/states/grafana_datasource_test.py
preoctopus/salt
aceaaa0e2f2f2ff29a694393bd82bba0d88fa44d
[ "Apache-2.0" ]
2
2017-01-05T16:14:59.000Z
2019-01-31T23:15:25.000Z
# -*- coding: utf-8 -*- # Import Python libs from __future__ import absolute_import # Import Salt Testing Libs from salttesting import skipIf, TestCase from salttesting.mock import ( NO_MOCK, NO_MOCK_REASON, Mock, MagicMock, patch ) from salttesting.helpers import ensure_in_syspath ensure_in_syspath('../../') # Import Salt Libs from salt.states import grafana_datasource grafana_datasource.__opts__ = {} grafana_datasource.__salt__ = {} profile = { 'grafana_url': 'http://grafana', 'grafana_token': 'token', } def mock_json_response(data): response = MagicMock() response.json = MagicMock(return_value=data) return Mock(return_value=response) @skipIf(NO_MOCK, NO_MOCK_REASON) class GrafanaDatasourceTestCase(TestCase): def test_present(self): with patch('requests.get', mock_json_response([])): with patch('requests.post') as rpost: ret = grafana_datasource.present('test', 'type', 'url', profile=profile) rpost.assert_called_once_with( 'http://grafana/api/datasources', grafana_datasource._get_json_data('test', 'type', 'url'), headers={'Authorization': 'Bearer token', 'Accept': 'application/json'}, timeout=3 ) self.assertTrue(ret['result']) self.assertEqual(ret['comment'], 'New data source test added') data = grafana_datasource._get_json_data('test', 'type', 'url') data.update({'id': 1, 'orgId': 1}) with patch('requests.get', mock_json_response([data])): with patch('requests.put') as rput: ret = grafana_datasource.present('test', 'type', 'url', profile=profile) rput.assert_called_once_with( 'http://grafana/api/datasources/1', grafana_datasource._get_json_data('test', 'type', 'url'), headers={'Authorization': 'Bearer token', 'Accept': 'application/json'}, timeout=3 ) self.assertTrue(ret['result']) self.assertEqual(ret['comment'], 'Data source test already up-to-date') self.assertEqual(ret['changes'], None) with patch('requests.put') as rput: ret = grafana_datasource.present('test', 'type', 'newurl', profile=profile) rput.assert_called_once_with( 'http://grafana/api/datasources/1', grafana_datasource._get_json_data('test', 'type', 'newurl'), headers={'Authorization': 'Bearer token', 'Accept': 'application/json'}, timeout=3 ) self.assertTrue(ret['result']) self.assertEqual(ret['comment'], 'Data source test updated') self.assertEqual(ret['changes'], {'old': {'url': 'url'}, 'new': {'url': 'newurl'}}) def test_absent(self): with patch('requests.get', mock_json_response([])): with patch('requests.delete') as rdelete: ret = grafana_datasource.absent('test', profile=profile) rdelete.assert_not_called() self.assertTrue(ret['result']) self.assertEqual(ret['comment'], 'Data source test already absent') with patch('requests.get', mock_json_response([{'name': 'test', 'id': 1}])): with patch('requests.delete') as rdelete: ret = grafana_datasource.absent('test', profile=profile) rdelete.assert_called_once_with( 'http://grafana/api/datasources/1', headers={'Authorization': 'Bearer token', 'Accept': 'application/json'}, timeout=3 ) self.assertTrue(ret['result']) self.assertEqual(ret['comment'], 'Data source test was deleted')
40.597938
99
0.579736
7949c87e8954ad60872aa0ad909597e63eadba92
2,425
py
Python
multi-scale-economic-dynamics/control.py
sitar777/math-modeling-2022
cea86c26eac5002f31a69414059e593143598f77
[ "Apache-2.0" ]
null
null
null
multi-scale-economic-dynamics/control.py
sitar777/math-modeling-2022
cea86c26eac5002f31a69414059e593143598f77
[ "Apache-2.0" ]
null
null
null
multi-scale-economic-dynamics/control.py
sitar777/math-modeling-2022
cea86c26eac5002f31a69414059e593143598f77
[ "Apache-2.0" ]
null
null
null
from scipy.integrate import RK45 import matplotlib.pyplot as plt COEFFS_FRANCE = [ .0221, .4608, -.0077, .5585, -2.0733, .1453, .0067, 1.1813, -0.51, ] def ode_system(t, v): coeffs = COEFFS_FRANCE control = [ [-0.016, 0], [-15, 0.1], [0, 0], ] x, y, z = v dinputdt = [ coeffs[0] * x * (1 - x) + coeffs[1] * x * z / (1 + z) + coeffs[2] * x * y + control[0][0] * x + control[0][1], coeffs[3] * y * (1 - y) + coeffs[4] * y * z / (1 + z) + coeffs[5] * x * y + control[1][0] * y + control[1][1], (coeffs[6] * z * (1 - z) + coeffs[7] * z * x / (1 + x) + coeffs[8] * z * y / (1 + y) + control[2][0] * z + control[2][1]), ] return dinputdt if __name__ == '__main__': fig, axs = plt.subplots(2, 2) axs[0, 0].remove() axs[0, 0] = fig.add_subplot(2, 2, 1, projection='3d') x_range = list(range(0, 80, 20)) y_range = list(range(0, 80, 20)) z_range = list(range(70, 150, 20)) v0 = (20.72, 2.71, 113.58) solution = RK45(ode_system, 0, v0, 1000, 1) t_values = [] y_values = [] while True: # get solution step state t_values.append(solution.t) y_values.append(solution.y.tolist()) # break loop after modeling is finished if solution.status == 'finished': break if solution.status == 'failed': break solution.step() x, y, z = zip(*y_values) axs[0, 0].plot(x, y, z, color='r') axs[0, 0].plot(v0[0], v0[1], v0[2], marker='o', color='g') axs[0, 0].plot(x[-1], y[-1], z[-1], marker='o', color='b') print(x[-1], y[-1], z[-1]) axs[0, 1].plot(x, y, color='r') axs[0, 1].plot(v0[0], v0[1], marker='o', color='g') axs[0, 1].plot(x[-1], y[-1], marker='o', color='b') axs[1, 0].plot(y, z, color='r') axs[1, 0].plot(v0[1], v0[2], marker='o', color='g') axs[1, 0].plot(y[-1], z[-1], marker='o', color='b') axs[1, 1].plot(x, z, color='r') axs[1, 1].plot(v0[0], v0[2], marker='o', color='g') axs[1, 1].plot(x[-1], z[-1], marker='o', color='b') axs[0, 1].set_xlabel('x') axs[0, 1].set_ylabel('y') axs[1, 0].set_xlabel('y') axs[1, 0].set_ylabel('z') axs[1, 1].set_xlabel('x') axs[1, 1].set_ylabel('z') axs[0, 0].set_xlabel('x') axs[0, 0].set_ylabel('y') axs[0, 0].set_zlabel('z') plt.show()
24.744898
118
0.489072
7949c8853532a536be5126e01c4f6b29fb279038
14,319
py
Python
StichensisTest/TreeCalcs.py
northcoastmountainrat/Sitchensis
8e292dd91dd915495a04ab0abd9a606db7fd9ab4
[ "MIT" ]
null
null
null
StichensisTest/TreeCalcs.py
northcoastmountainrat/Sitchensis
8e292dd91dd915495a04ab0abd9a606db7fd9ab4
[ "MIT" ]
12
2018-04-04T20:27:52.000Z
2018-05-02T17:42:59.000Z
StichensisTest/TreeCalcs.py
northcoastmountainrat/Sitchensis
8e292dd91dd915495a04ab0abd9a606db7fd9ab4
[ "MIT" ]
null
null
null
# -*- coding: utf-8 -*- """ Created on Fri Jan 13 12:46:48 2017 @author: rdk10 """ import numpy as np import pandas as pd #For storing data as a data.frame #import os, sys ##import numpy as np #os.chdir('C:/Users/rdk10/Desktop/ComputerProgramming/Python/TreeCalcs') #use this to nav to where files are stored #This adds the directory of the CrownMapFunctions module to the search path #sys.path.append('C:/Users/rdk10/Desktop/ComputerProgramming/Python/TreeCalcs') #sys.path.append('C:/Users/rdk10/Desktop/ComputerProgramming/Python/TreeViz') import Functions as f #This accesses the file with function definitions import Routines as rt #import numbers as n import pdb #import temp as tmp #import numbers def calculateTree(treeData, custRefs, mapType, treeName, outDir, intermediateFiles = False): ##This is a giant function that brings in a dictionary of tree data and does all the calculations on it, # #Inputs: dictionary of Trunk, segment, and trunk data, a dictionary with any custom references, a treeName and a logFileName #Outputs a dictionary with calculated Trunks, Segments, Branches, a logFile written to the current directory #The calculated dictioary can be directly input to the Plot tree routine. treePathAndName = outDir + '/' + treeName logFileName = '{0}_ProcessLog.txt'.format(treePathAndName) treeName = logFileName.split('_')[0] lf = open(logFileName,'w') #open a file for writing ('w') to, lf for log file lf.write('\n#####################################################\n') lf.write('############## Main Trunk Calculations ##############\n') lf.write('#####################################################\n') lf.close() """Section for calculating things on the main trunk, this includes arranging the trunk into a segment-like form, it also calculates reference x,y locations, other locations on the trunk with the @ symbol, and x,y of each section location""" #Calculates trunk values, resorts columns, not sure if I need to correct this as program looks for col names anyway. #Row sorted by names then by height #pdb.set_trace() trunkDat = treeData['trunk'] trunkDat = rt.trunkRoutine(trunkDat, custRefs, logFileName) #####For testing ########################################### #trunkDat.loc[:,['name','height','ref','ref type','ref x','ref y','x','y']] ################################################################ #Rearranges the trunk data into segment form mainTrunks = rt.arrangeTrunkData(trunkDat, logFileName) trunks = pd.concat(list(mainTrunks.values()),ignore_index = True) if intermediateFiles: trunks.to_csv('{0}_trunks.csv'.format(treeName), date_format = False, index = False) """#################################################################################################""" """This section will do all the calculations on segments, starting with determining reference x,y locations on references main trunks and other trunk segments. """ """#################################################################################################""" ###This is the log file I'll use to help error check. lf = open(logFileName,'a') #'a' stands for append lf.write('\n##################################################\n') lf.write('############## Segment calculations ##############\n') lf.write('##################################################\n') lf.close() if mapType == 'trunk map' or mapType == 'trunk and branch map': f.print2Log(logFileName,'There are no segments in this tree') if mapType == 'segment map' or mapType == 'full map': segs = treeData['segments'] branches = treeData['branches'] ####################################################################### ######## Segments to Custom References ############################## ####################################################################### if len(custRefs)>0 and (any(segs['base ref'].isin(custRefs['name'])) or any(segs['top ref'].isin(custRefs['name']))): segs = rt.segs2custRefs(segs, custRefs, logFileName) ####################################################################### ###### References to Main Trunks ################################### ####################################################################### f.print2Log(logFileName,'\n############# Segments referenced to main trunks ############\n') ####This code calcualates the x,y values for segment bases and tops referenced to the main trunk. segs = rt.segs2trunks(segs, mainTrunks, custRefs, logFileName) if intermediateFiles: segs.to_csv('{0}_segs2trunks.csv'.format(treeName), date_format = False, index = False) #f.print2Log(logFileName, '\n\n############## Segments referenced to nodes #################\n') """The while loop bleow cycles through all the segments until either all the rows are calculated or until it has cycled though a number of times equal to the numer of uncalculated rows + 1""" #Count the number of missing values emptyRows = int(np.isnan(segs.loc[:,['base x', 'base y','top x','top y']]).sum().sum()/2) #origNumRows = emptyRows counter = 0 #loop until there are no more values to calculate or until a number of iterations = to rows needing calculating + 1 # This loop is needed because we there are refs to segments that aren't calculated on the first pass. while emptyRows > 0 and counter < 10: counter = counter + 1 previousEmptyRows = emptyRows #This is for the break statement at the end of the loop ####################################################################### ###### References to Nodes ################################### ####################################################################### f.print2Log(logFileName, "\n############ Segments referenced to nodes round {0} #############\n".format(counter)) segs = rt.segs2nodes(segs, logFileName) if intermediateFiles: segs.to_csv('{0}_segs2nodes{1}.csv'.format(treeName,counter), date_format = False, index = False) ####################################################################### ###### References to Tunk segments ################################# ####################################################################### f.print2Log(logFileName, "\n############ Segments referenced to trunk segments round {0} #############\n".format(counter)) segs = rt.segs2reits(segs, logFileName) if intermediateFiles: segs.to_csv('{0}_segs2reits{1}.csv'.format(treeName,counter), date_format = False, index = False) ####################################################################### ############ Mid Segment Calcs ###################################### ####################################################################### f.print2Log(logFileName, "\n############ Segments referenced to mid-segments round {0} #############\n".format(counter)) segs = rt.segs2midsegs(segs, logFileName) if intermediateFiles: segs.to_csv('{0}_segs2midSegs{1}.csv'.format(treeName,counter), date_format = False, index = False) emptyRows = int(np.isnan(segs.loc[:,['base x', 'base y','top x','top y']]).sum().sum()/2) f.print2Log(logFileName,'\nAfter pass {0} there are {1} uncalculated segment base or top locations'.format(counter, emptyRows)) if emptyRows == previousEmptyRows: f.print2Log(logFileName,'\nThere are the same number of empty rows after the last pass, \ncheck to make sure these rows have enough information to calculate them'.format(counter, emptyRows)) #locate where basex and basey are missing t1 = segs['base x'].isnull() t2 = segs['base y'].isnull() test1 = f.vectorBool(t1,t2,'or') #locate where topy and topx are missing t1 = segs['top x'].isnull() t2 = segs['top y'].isnull() test2 = f.vectorBool(t1,t2,'or') #create a combination "or" vector test3 = f.vectorBool(test1,test2,'or') #subset segnames using above vector emptySegs = segs.loc[test3,'name'].tolist() f.print2Log(logFileName,'\nThe offending segment(s) are {0}, check that the heights are between origin segment heights'.format(emptySegs)) break lf = open(logFileName,'a') #'a' stands for append lf.write('\n\n####################################################\n') lf.write('############## Branch calculations ##############\n') lf.write('####################################################\n') lf.write('\n############# Branches bases referenced to main trunks ############\n') lf.close() if mapType == 'trunk and branch map' or mapType == 'full map': branches = treeData['branches'] branches = rt.brBase2Trunks(branches, mainTrunks, logFileName) if intermediateFiles: branches.to_csv('{0}_brFromTrnk.csv'.format(treeName), date_format = False, index = False) f.print2Log(logFileName, '\n############## Branch bases referenced to segments #################\n') f.print2Log(logFileName, '####################################################################\n') if mapType == 'full map' : f.print2Log(logFileName, '\n############## Branch bases referenced to nodes #################\n') branches = rt.brBase2nodes(branches, segs, logFileName) if intermediateFiles: branches.to_csv('{0}_brFromNodes.csv'.format(treeName), date_format = False, index = False) f.print2Log(logFileName, "\n############ Branch bases referenced to trunk segments #############\n") branches = rt.brBase2reits(branches, segs, logFileName) if intermediateFiles: branches.to_csv('{0}_brFromReits.csv'.format(treeName), date_format = False, index = False) f.print2Log(logFileName, "\n############ Branch bases referenced to mid-segments #############\n") branches = rt.brBase2midsegs(branches, segs, logFileName) if intermediateFiles: branches.to_csv('{0}_brFromMidSegs.csv'.format(treeName), date_format = False, index = False) else: f.print2Log(logFileName, "There are no segments on this tree to map to") f.print2Log(logFileName, "\n############ All branch tops #############\n") branches = rt.brTops(branches, logFileName) if intermediateFiles: branches.to_csv('{0}_brFinal.csv'.format(treeName), date_format = False, index = False) else: f.print2Log(logFileName,'\nThere are no mapped branches for this tree') lf = open(logFileName,'a') #'a' stands for append lf.write('\n\n##################################################################\n') lf.write('############## Final clean and output up etc.... ##############\n') lf.write('##################################################################\n') lf.close() date = pd.Timestamp("today").strftime("%d%b%Y").lstrip('0') finalFileName = '{0}_{1}.xlsx'.format(treeName, date) f.print2Log(logFileName,"Calculated and cleaned tree file output to: '{0}'".format(finalFileName)) ## Rearrange column headers to make pretty trunkPrintCols = ['name','base radius','base x','base y','base z','top radius','top x','top y','top z', '% dead','s_fuzz','l_fuzz','notes'] segPrintCols =['position','name','o/e','type','base radius','base x','base y','base z','top radius','top x','top y','top z', '% dead','s_fuzz','l_fuzz','notes'] branchPrintCols = ['name','origin','o/e','l/d','base radius','base x','base y','base z','top radius','top x','top y','top z','slope','hd', '% dead','notes'] ##Move non-main segemnts to segments dataframe and only include relevant columns sparseTrunks = trunks.loc[:,trunkPrintCols] if mapType == 'segment map' or mapType == 'full map': sparseSegments = segs.loc[:,segPrintCols] if mapType == 'trunk and branch map' or mapType == 'full map': sparseBranches = branches.loc[:,branchPrintCols] segAppendRows = sparseTrunks['name'] != 'M' if any(segAppendRows)==True: if mapType == 'trunk map' or mapType == 'trunk and branch map': sparseSegments = sparseTrunks.loc[segAppendRows] else: sparseSegments = sparseSegments.append(sparseTrunks.loc[segAppendRows]) sparseTrunks = sparseTrunks.loc[segAppendRows == False] if mapType == 'trunk map': treeData = {'trunk': sparseTrunks} elif mapType == 'segment map': treeData = {'trunk': sparseTrunks, 'segments':sparseSegments} elif mapType == 'trunk and branch map': treeData = {'trunk': sparseTrunks, 'branches': sparseBranches} elif mapType == 'full map': treeData = {'trunk': sparseTrunks, 'segments':sparseSegments, 'branches': sparseBranches} return(treeData)
55.933594
226
0.507019
7949c8f0c73e255221fba021043f4afdc24dd1c0
338
py
Python
tests/test_data_extractor.py
DavidRobertQuinn/IV
eaa22b0ee98cb7186f461f0ca464299c96f0f189
[ "Apache-2.0" ]
null
null
null
tests/test_data_extractor.py
DavidRobertQuinn/IV
eaa22b0ee98cb7186f461f0ca464299c96f0f189
[ "Apache-2.0" ]
null
null
null
tests/test_data_extractor.py
DavidRobertQuinn/IV
eaa22b0ee98cb7186f461f0ca464299c96f0f189
[ "Apache-2.0" ]
1
2019-07-12T16:14:01.000Z
2019-07-12T16:14:01.000Z
from IV.data_extractor import create_PV_dataframe import pandas as pd import os HERE = os.path.dirname(__file__) test_data_loc = os.path.join(HERE, "test_data") def test_create_PV_dataframe(): df = create_PV_dataframe( "test", "test", test_data_loc, light=True, force_analysis=True) assert isinstance(df, pd.DataFrame)
26
71
0.754438
7949c96c2527ef50872a663a1bb8d924022350ce
8,544
py
Python
sdk/network/azure-mgmt-network/azure/mgmt/network/v2018_10_01/operations/_express_route_links_operations.py
LianwMS/azure-sdk-for-python
612d7bca9de86ee1bd1fa59291d7bf897ba9213f
[ "MIT" ]
2
2019-05-17T21:24:53.000Z
2020-02-12T11:13:42.000Z
sdk/network/azure-mgmt-network/azure/mgmt/network/v2018_10_01/operations/_express_route_links_operations.py
LianwMS/azure-sdk-for-python
612d7bca9de86ee1bd1fa59291d7bf897ba9213f
[ "MIT" ]
15
2019-07-12T18:18:04.000Z
2019-07-25T20:55:51.000Z
sdk/network/azure-mgmt-network/azure/mgmt/network/v2018_10_01/operations/_express_route_links_operations.py
LianwMS/azure-sdk-for-python
612d7bca9de86ee1bd1fa59291d7bf897ba9213f
[ "MIT" ]
2
2020-05-21T22:51:22.000Z
2020-05-26T20:53:01.000Z
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- from typing import TYPE_CHECKING import warnings from azure.core.exceptions import HttpResponseError, ResourceExistsError, ResourceNotFoundError, map_error from azure.core.paging import ItemPaged from azure.core.pipeline import PipelineResponse from azure.core.pipeline.transport import HttpRequest, HttpResponse from azure.mgmt.core.exceptions import ARMErrorFormat from .. import models if TYPE_CHECKING: # pylint: disable=unused-import,ungrouped-imports from typing import Any, Callable, Dict, Generic, Iterable, Optional, TypeVar T = TypeVar('T') ClsType = Optional[Callable[[PipelineResponse[HttpRequest, HttpResponse], T, Dict[str, Any]], Any]] class ExpressRouteLinksOperations(object): """ExpressRouteLinksOperations operations. You should not instantiate this class directly. Instead, you should create a Client instance that instantiates it for you and attaches it as an attribute. :ivar models: Alias to model classes used in this operation group. :type models: ~azure.mgmt.network.v2018_10_01.models :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An object model deserializer. """ models = models def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self._config = config def get( self, resource_group_name, # type: str express_route_port_name, # type: str link_name, # type: str **kwargs # type: Any ): # type: (...) -> "models.ExpressRouteLink" """Retrieves the specified ExpressRouteLink resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param express_route_port_name: The name of the ExpressRoutePort resource. :type express_route_port_name: str :param link_name: The name of the ExpressRouteLink resource. :type link_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: ExpressRouteLink, or the result of cls(response) :rtype: ~azure.mgmt.network.v2018_10_01.models.ExpressRouteLink :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["models.ExpressRouteLink"] error_map = {404: ResourceNotFoundError, 409: ResourceExistsError} error_map.update(kwargs.pop('error_map', {})) api_version = "2018-10-01" # Construct URL url = self.get.metadata['url'] # type: ignore path_format_arguments = { 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'expressRoutePortName': self._serialize.url("express_route_port_name", express_route_port_name, 'str'), 'linkName': self._serialize.url("link_name", link_name, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = 'application/json' # Construct and send request request = self._client.get(url, query_parameters, header_parameters) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) deserialized = self._deserialize('ExpressRouteLink', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized get.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/ExpressRoutePorts/{expressRoutePortName}/links/{linkName}'} # type: ignore def list( self, resource_group_name, # type: str express_route_port_name, # type: str **kwargs # type: Any ): # type: (...) -> Iterable["models.ExpressRouteLinkListResult"] """Retrieve the ExpressRouteLink sub-resources of the specified ExpressRoutePort resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param express_route_port_name: The name of the ExpressRoutePort resource. :type express_route_port_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either ExpressRouteLinkListResult or the result of cls(response) :rtype: ~azure.core.paging.ItemPaged[~azure.mgmt.network.v2018_10_01.models.ExpressRouteLinkListResult] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["models.ExpressRouteLinkListResult"] error_map = {404: ResourceNotFoundError, 409: ResourceExistsError} error_map.update(kwargs.pop('error_map', {})) api_version = "2018-10-01" def prepare_request(next_link=None): if not next_link: # Construct URL url = self.list.metadata['url'] # type: ignore path_format_arguments = { 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'expressRoutePortName': self._serialize.url("express_route_port_name", express_route_port_name, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') else: url = next_link query_parameters = {} # type: Dict[str, Any] # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = 'application/json' # Construct and send request request = self._client.get(url, query_parameters, header_parameters) return request def extract_data(pipeline_response): deserialized = self._deserialize('ExpressRouteLinkListResult', pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, iter(list_of_elem) def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) return pipeline_response return ItemPaged( get_next, extract_data ) list.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/ExpressRoutePorts/{expressRoutePortName}/links'} # type: ignore
47.466667
198
0.668656
7949c9870f617671d4eb3fb0eb74359d2a70f649
770
py
Python
sample_app/_verify_user.py
encyphered/accelbyte-python-sdk
09c1e989d7251de308150fdcd3119d662ca2d205
[ "MIT" ]
null
null
null
sample_app/_verify_user.py
encyphered/accelbyte-python-sdk
09c1e989d7251de308150fdcd3119d662ca2d205
[ "MIT" ]
null
null
null
sample_app/_verify_user.py
encyphered/accelbyte-python-sdk
09c1e989d7251de308150fdcd3119d662ca2d205
[ "MIT" ]
null
null
null
import click from accelbyte_py_sdk.api.iam import admin_verify_user_without_verification_code_v3 from ._utils import login_as as login_as_internal @click.command() @click.argument("user_id") @click.option("--namespace") @click.option("--doc", type=bool) @click.option("--login_as", type=click.Choice(["client", "user"], case_sensitive=False)) def verify_user( user_id, namespace, doc, login_as, ): login_as_internal(login_as) if doc: click.echo(admin_verify_user_without_verification_code_v3.__doc__) result, error = admin_verify_user_without_verification_code_v3( user_id=user_id, namespace=namespace, ) if error: raise Exception(str(error)) click.echo("Verify user success.")
26.551724
88
0.709091
7949ca2865027ea0e1f90df1d73a9c9921501aac
11,477
py
Python
lib/python3.8/site-packages/ansible_collections/cisco/nxos/plugins/modules/nxos_aaa_server_host.py
cjsteel/python3-venv-ansible-2.10.5
c95395c4cae844dc66fddde9b4343966f4b2ecd5
[ "Apache-1.1" ]
null
null
null
lib/python3.8/site-packages/ansible_collections/cisco/nxos/plugins/modules/nxos_aaa_server_host.py
cjsteel/python3-venv-ansible-2.10.5
c95395c4cae844dc66fddde9b4343966f4b2ecd5
[ "Apache-1.1" ]
null
null
null
lib/python3.8/site-packages/ansible_collections/cisco/nxos/plugins/modules/nxos_aaa_server_host.py
cjsteel/python3-venv-ansible-2.10.5
c95395c4cae844dc66fddde9b4343966f4b2ecd5
[ "Apache-1.1" ]
null
null
null
#!/usr/bin/python # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # from __future__ import absolute_import, division, print_function __metaclass__ = type DOCUMENTATION = """ module: nxos_aaa_server_host extends_documentation_fragment: - cisco.nxos.nxos short_description: Manages AAA server host-specific configuration. description: - Manages AAA server host-specific configuration. version_added: 1.0.0 author: Jason Edelman (@jedelman8) notes: - Tested against NXOSv 7.3.(0)D1(1) on VIRL - Changes to the host key (shared secret) are not idempotent for type 0. - If C(state=absent) removes the whole host configuration. options: server_type: description: - The server type is either radius or tacacs. required: true choices: - radius - tacacs type: str address: description: - Address or name of the radius or tacacs host. required: true type: str key: description: - Shared secret for the specified host or keyword 'default'. type: str encrypt_type: description: - The state of encryption applied to the entered key. O for clear text, 7 for encrypted. Type-6 encryption is not supported. choices: - '0' - '7' type: str host_timeout: description: - Timeout period for specified host, in seconds or keyword 'default. Range is 1-60. type: str auth_port: description: - Alternate UDP port for RADIUS authentication or keyword 'default'. type: str acct_port: description: - Alternate UDP port for RADIUS accounting or keyword 'default'. type: str tacacs_port: description: - Alternate TCP port TACACS Server or keyword 'default'. type: str state: description: - Manage the state of the resource. default: present choices: - present - absent type: str """ EXAMPLES = """ # Radius Server Host Basic settings - name: Radius Server Host Basic settings cisco.nxos.nxos_aaa_server_host: state: present server_type: radius address: 1.2.3.4 acct_port: 2084 host_timeout: 10 # Radius Server Host Key Configuration - name: Radius Server Host Key Configuration cisco.nxos.nxos_aaa_server_host: state: present server_type: radius address: 1.2.3.4 key: hello encrypt_type: 7 # TACACS Server Host Configuration - name: Tacacs Server Host Configuration cisco.nxos.nxos_aaa_server_host: state: present server_type: tacacs tacacs_port: 89 host_timeout: 10 address: 5.6.7.8 """ RETURN = """ proposed: description: k/v pairs of parameters passed into module returned: always type: dict sample: {"address": "1.2.3.4", "auth_port": "2084", "host_timeout": "10", "server_type": "radius"} existing: description: - k/v pairs of existing configuration returned: always type: dict sample: {} end_state: description: k/v pairs of configuration after module execution returned: always type: dict sample: {"address": "1.2.3.4", "auth_port": "2084", "host_timeout": "10", "server_type": "radius"} updates: description: command sent to the device returned: always type: list sample: ["radius-server host 1.2.3.4 auth-port 2084 timeout 10"] changed: description: check to see if a change was made on the device returned: always type: bool sample: true """ import re from ansible_collections.cisco.nxos.plugins.module_utils.network.nxos.nxos import ( load_config, run_commands, ) from ansible_collections.cisco.nxos.plugins.module_utils.network.nxos.nxos import ( get_capabilities, nxos_argument_spec, ) from ansible.module_utils.basic import AnsibleModule def execute_show_command(command, module): device_info = get_capabilities(module) network_api = device_info.get("network_api", "nxapi") if network_api == "cliconf": cmds = [command] body = run_commands(module, cmds) elif network_api == "nxapi": cmds = {"command": command, "output": "text"} body = run_commands(module, cmds) return body def flatten_list(command_lists): flat_command_list = [] for command in command_lists: if isinstance(command, list): flat_command_list.extend(command) else: flat_command_list.append(command) return flat_command_list def get_aaa_host_info(module, server_type, address): aaa_host_info = {} command = "show run | inc {0}-server.host.{1}".format(server_type, address) body = execute_show_command(command, module)[0] if body: try: if "radius" in body: pattern = ( r"\S+ host \S+(?:\s+key 7\s+(\S+))?(?:\s+auth-port (\d+))?" r"(?:\s+acct-port (\d+))?(?:\s+authentication)?" r"(?:\s+accounting)?(?:\s+timeout (\d+))?" ) match = re.search(pattern, body) aaa_host_info["key"] = match.group(1) if aaa_host_info["key"]: aaa_host_info["key"] = aaa_host_info["key"].replace( '"', "" ) aaa_host_info["encrypt_type"] = "7" aaa_host_info["auth_port"] = match.group(2) aaa_host_info["acct_port"] = match.group(3) aaa_host_info["host_timeout"] = match.group(4) elif "tacacs" in body: pattern = ( r"\S+ host \S+(?:\s+key 7\s+(\S+))?(?:\s+port (\d+))?" r"(?:\s+timeout (\d+))?" ) match = re.search(pattern, body) aaa_host_info["key"] = match.group(1) if aaa_host_info["key"]: aaa_host_info["key"] = aaa_host_info["key"].replace( '"', "" ) aaa_host_info["encrypt_type"] = "7" aaa_host_info["tacacs_port"] = match.group(2) aaa_host_info["host_timeout"] = match.group(3) aaa_host_info["server_type"] = server_type aaa_host_info["address"] = address except TypeError: return {} else: return {} return aaa_host_info def config_aaa_host(server_type, address, params, existing): cmds = [] cmd_str = "{0}-server host {1}".format(server_type, address) cmd_no_str = "no " + cmd_str key = params.get("key") enc_type = params.get("encrypt_type", "") defval = False nondef = False if key: if key != "default": cmds.append(cmd_str + " key {0} {1}".format(enc_type, key)) else: cmds.append(cmd_no_str + " key 7 {0}".format(existing.get("key"))) locdict = { "auth_port": "auth-port", "acct_port": "acct-port", "tacacs_port": "port", "host_timeout": "timeout", } # platform CLI needs the keywords in the following order for key in ["auth_port", "acct_port", "tacacs_port", "host_timeout"]: item = params.get(key) if item: if item != "default": cmd_str += " {0} {1}".format(locdict.get(key), item) nondef = True else: cmd_no_str += " {0} 1".format(locdict.get(key)) defval = True if defval: cmds.append(cmd_no_str) if nondef or not existing: cmds.append(cmd_str) return cmds def main(): argument_spec = dict( server_type=dict(choices=["radius", "tacacs"], required=True), address=dict(type="str", required=True), key=dict(type="str"), encrypt_type=dict(type="str", choices=["0", "7"]), host_timeout=dict(type="str"), auth_port=dict(type="str"), acct_port=dict(type="str"), tacacs_port=dict(type="str"), state=dict(choices=["absent", "present"], default="present"), ) argument_spec.update(nxos_argument_spec) module = AnsibleModule( argument_spec=argument_spec, supports_check_mode=True ) warnings = list() server_type = module.params["server_type"] address = module.params["address"] key = module.params["key"] encrypt_type = module.params["encrypt_type"] host_timeout = module.params["host_timeout"] auth_port = module.params["auth_port"] acct_port = module.params["acct_port"] tacacs_port = module.params["tacacs_port"] state = module.params["state"] args = dict( server_type=server_type, address=address, key=key, encrypt_type=encrypt_type, host_timeout=host_timeout, auth_port=auth_port, acct_port=acct_port, tacacs_port=tacacs_port, ) proposed = dict((k, v) for k, v in args.items() if v is not None) changed = False if encrypt_type and not key: module.fail_json(msg="encrypt_type must be used with key") if tacacs_port and server_type != "tacacs": module.fail_json( msg="tacacs_port can only be used with server_type=tacacs" ) if (auth_port or acct_port) and server_type != "radius": module.fail_json( msg="auth_port and acct_port can only be used" "when server_type=radius" ) existing = get_aaa_host_info(module, server_type, address) end_state = existing commands = [] delta = {} if state == "present": if not existing: delta = proposed else: for key, value in proposed.items(): if key == "encrypt_type": delta[key] = value if value != existing.get(key): if value != "default" or existing.get(key): delta[key] = value command = config_aaa_host(server_type, address, delta, existing) if command: commands.append(command) elif state == "absent": intersect = dict(set(proposed.items()).intersection(existing.items())) if intersect.get("address") and intersect.get("server_type"): command = "no {0}-server host {1}".format( intersect.get("server_type"), intersect.get("address") ) commands.append(command) cmds = flatten_list(commands) if cmds: if module.check_mode: module.exit_json(changed=True, commands=cmds) else: changed = True load_config(module, cmds) end_state = get_aaa_host_info(module, server_type, address) results = {} results["proposed"] = proposed results["existing"] = existing results["updates"] = cmds results["changed"] = changed results["warnings"] = warnings results["end_state"] = end_state module.exit_json(**results) if __name__ == "__main__": main()
29.888021
83
0.611658
7949ca9863e34ed9d0c57c8edc8383e5102957d6
541
py
Python
mail_alias_manager/util/debug_routes/__init__.py
stuvusIT/mail_alias_manager
260b6d1da4db03079afee159c23c3f83f4e75937
[ "MIT" ]
3
2020-11-21T13:10:13.000Z
2021-06-04T12:58:21.000Z
mail_alias_manager/util/debug_routes/__init__.py
stuvusIT/mail_alias_manager
260b6d1da4db03079afee159c23c3f83f4e75937
[ "MIT" ]
1
2021-11-14T18:55:44.000Z
2021-11-14T18:55:44.000Z
mail_alias_manager/util/debug_routes/__init__.py
stuvusIT/mail_alias_manager
260b6d1da4db03079afee159c23c3f83f4e75937
[ "MIT" ]
2
2020-11-21T13:20:10.000Z
2021-06-04T13:03:27.000Z
""" Module containing Debug Methods and sites. This Module should only be loaded in debug Mode. """ from flask.app import Flask from . import root # noqa from . import routes # noqa def register_debug_routes(app: Flask): """Register the debug routes blueprint with the flask app.""" if not app.config["DEBUG"]: app.logger.warning("This Module should only be loaded if DEBUG mode is active!") raise Warning("This Module should only be loaded if DEBUG mode is active!") app.register_blueprint(root.DEBUG_BLP)
30.055556
88
0.719039
7949caa0b3baa8d2fe9618104a4c52a16005a9c8
5,079
py
Python
script/runTazer.py
jstrube/tazer
18a6d66ad2c20376609f1af7940e43b2031e4fd0
[ "BSD-3-Clause" ]
null
null
null
script/runTazer.py
jstrube/tazer
18a6d66ad2c20376609f1af7940e43b2031e4fd0
[ "BSD-3-Clause" ]
null
null
null
script/runTazer.py
jstrube/tazer
18a6d66ad2c20376609f1af7940e43b2031e4fd0
[ "BSD-3-Clause" ]
null
null
null
#!/usr/bin/python import sys import argparse import tazerUtil as tu # Check python version def checkPython(): if sys.version_info.major < 3: print("This script was tested with python version 3.7. Thus it requires python 3") ver = "python " + str(sys.version_info.major) + "." + str(sys.version_info.minor) + "." + str(sys.version_info.micro) print(ver) exit(1) # Handles if a client command is passed on command line using quotation marks (i.e. "ls -alh") def parseClientCommand(comList): res = [] for one in comList: if ' ' in one: one.split() res + one else: res.append(one) return res def parseArgs(): parser = argparse.ArgumentParser() parser.add_argument('pathToBuild', action='store', type=str, help='path to the build directory of Tazer') parser.add_argument('-c', '--client', action='append', nargs='+', type=str, help='command for the client to run') parser.add_argument('-s', "--server", action='store', type=str, default=None, help='server IP address') parser.add_argument('-p', "--port", action='store', type=str, default=None, help='server port') parser.add_argument('--clientOnly', action='store_true', default=False, help='only runs the client') parser.add_argument('--serverOnly', action='store_true', default=False, help='only runs the sever') parser.add_argument('--closeServer', action='store_true', default=False, help='closes the server') parser.add_argument('--serverLog', action='store', type=str, default=None, help='outfile for server log') parser.add_argument('--clientLog', action='store', type=str, default=None, help='outfile for client log') parser.add_argument('--printEnv', action='store_true', default=False, help='prints Tazer environment variables') tazerEnvVars = tu.TazerEnv().getEnvVars() for envVar in tazerEnvVars: envVarArg = "--" + envVar parser.add_argument(envVarArg, action='store', default=None, help='Tazer environment variable') args = parser.parse_args() if sum([args.serverOnly, args.closeServer, args.clientOnly]) > 1: parser.error("Cannot set clientOnly serverOnly closeServer at the same time") if args.clientOnly and args.client == None: parser.error('Must set a client command to run') if args.clientOnly == False and args.serverOnly == False and args.closeServer == False and args.client == None: parser.error('Must set a client command to run') return args # This takes the arguments from the command line and sets the Tazer environment variables def getEnvFromArgs(args): tazerEnv = tu.TazerEnv() tazerEnv.setVar(args) tazerEnv.setEnv() if args.printEnv: tazerEnv.printEnv() # This runs both the server and client def runLocalCommand(path, server, port, comList, serverLog=None, clientLog=None): print("--Run Server and Client--") tazerServer = tu.TazerServer(path, serverIpAddr=server, port=port, outputFileName=serverLog) tazerServer.run() if tazerServer.poll(): tazerServer.ping(serverIpAddr=server, port=port) tazerServer.pid() try: tazerClient = tu.TazerClient(path, outputFileName=clientLog) tazerClient.run(parseClientCommand(comList)) except: print("Failed running client") finally: tazerServer.close(serverIpAddr=server, port=port) tazerServer.kill() else: print("Could not launch server. Check to see if server:port is avaialble") # Only runs the server. This leaves the server running. def runServerCommand(path, server, port, serverLog=None): print("--Server Only--") tazerServer = tu.TazerServer(path, serverIpAddr=server, port=port, outputFileName=serverLog) tazerServer.run() if tazerServer.poll(): tazerServer.ping(serverIpAddr=server, port=port) tazerServer.pid() else: print("Could not launch server. Check to see if server:port is avaialble") # Send a close command to a server def closeServerCommand(path, server, port, serverLog=None): print("--Close server--") tu.TazerServer(path, outputFileName=serverLog).close(serverIpAddr=server, port=port) # Runs a client command def runClientCommand(path, comList, clientLog=None): print("--Client Only--") newComList = parseClientCommand(comList) tu.TazerClient(path, outputFileName=clientLog).run(newComList) def main(): checkPython() args = parseArgs() getEnvFromArgs(args) if args.closeServer: closeServerCommand(args.pathToBuild, args.server, args.port, serverLog=args.serverLog) elif args.serverOnly: runServerCommand(args.pathToBuild, args.server, args.port, serverLog=args.serverLog) elif args.clientOnly: runClientCommand(args.pathToBuild, *args.client, clientLog=args.clientLog) else: runLocalCommand(args.pathToBuild, args.server, args.port, *args.client, serverLog=args.serverLog, clientLog=args.clientLog) if __name__ == "__main__": main()
44.165217
131
0.692065
7949cae2cafb04608c997156a078a9263c806b47
146
py
Python
app/backend/emailtemplates/admin.py
NicholasCF/meridien
dd00caf341d4c9979b89dc8441224ff2b97eac7f
[ "MIT" ]
null
null
null
app/backend/emailtemplates/admin.py
NicholasCF/meridien
dd00caf341d4c9979b89dc8441224ff2b97eac7f
[ "MIT" ]
41
2020-05-24T06:47:53.000Z
2022-02-27T11:10:41.000Z
app/backend/emailtemplates/admin.py
NicholasCF/meridien
dd00caf341d4c9979b89dc8441224ff2b97eac7f
[ "MIT" ]
2
2020-11-26T12:19:30.000Z
2020-12-19T01:14:02.000Z
from django.contrib import admin from emailtemplates.models import EmailTemplate # Register your models here. admin.site.register(EmailTemplate)
24.333333
47
0.842466
7949cb841e60289f7b5204ce7764e11ba9ab5b77
71,250
py
Python
QMTest/TestCommonTests.py
moroten/scons
20927b42ed4f0cb87f51287fa3b4b6cf915afcf8
[ "MIT" ]
1
2017-01-28T15:39:07.000Z
2017-01-28T15:39:07.000Z
QMTest/TestCommonTests.py
moroten/scons
20927b42ed4f0cb87f51287fa3b4b6cf915afcf8
[ "MIT" ]
1
2020-05-19T02:59:19.000Z
2020-05-21T09:05:19.000Z
QMTest/TestCommonTests.py
moroten/scons
20927b42ed4f0cb87f51287fa3b4b6cf915afcf8
[ "MIT" ]
2
2018-01-16T11:29:16.000Z
2020-05-13T16:48:26.000Z
#!/usr/bin/env python """ TestCommonTests.py: Unit tests for the TestCommon.py module. Copyright 2000-2010 Steven Knight This module is free software, and you may redistribute it and/or modify it under the same terms as Python itself, so long as this copyright message and disclaimer are retained in their original form. IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT, INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OF THIS CODE, EVEN IF THE AUTHOR HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE CODE PROVIDED HEREUNDER IS ON AN "AS IS" BASIS, AND THERE IS NO OBLIGATION WHATSOEVER TO PROVIDE MAINTENANCE, SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS. """ __author__ = "Steven Knight <knight at baldmt dot com>" __revision__ = "TestCommonTests.py 1.3.D001 2010/06/03 12:58:27 knight" import difflib import os import re import signal import stat import sys import unittest # Strip the current directory so we get the right TestCommon.py module. sys.path = sys.path[1:] import TestCmd import TestCommon def lstrip(s): lines = [ _.expandtabs() for _ in s.split('\n') ] if lines[0] == '': lines = lines[1:] spaces = len(re.match('^( *).*', lines[0]).group(1)) if spaces: lines = [ l[spaces:] for l in lines ] return '\n'.join(lines) if sys.version[:3] == '1.5': expected_newline = '\\012' else: expected_newline = '\\n' def assert_display(expect, result, error=None): try: expect = expect.pattern except AttributeError: pass result = [ '\n', ('*'*80) + '\n', expect, ('*'*80) + '\n', result, ('*'*80) + '\n', ] if error: result.append(error) return ''.join(result) class TestCommonTestCase(unittest.TestCase): """Base class for TestCommon test cases, fixture and utility methods.""" create_run_env = True def setUp(self): self.orig_cwd = os.getcwd() if self.create_run_env: self.run_env = TestCmd.TestCmd(workdir = '') def tearDown(self): os.chdir(self.orig_cwd) def set_up_execution_scripts(self): run_env = self.run_env run_env.subdir('sub dir') self.python = sys.executable self.pass_script = run_env.workpath('sub dir', 'pass') self.fail_script = run_env.workpath('sub dir', 'fail') self.stdout_script = run_env.workpath('sub dir', 'stdout') self.stderr_script = run_env.workpath('sub dir', 'stderr') self.signal_script = run_env.workpath('sub dir', 'signal') self.stdin_script = run_env.workpath('sub dir', 'stdin') preamble = "import sys" stdout = "; sys.stdout.write(r'%s: STDOUT: ' + repr(sys.argv[1:]) + '\\n')" stderr = "; sys.stderr.write(r'%s: STDERR: ' + repr(sys.argv[1:]) + '\\n')" exit0 = "; sys.exit(0)" exit1 = "; sys.exit(1)" if sys.platform == 'win32': wrapper = '@python -c "%s" %%1 %%2 %%3 %%4 %%5 %%6 %%7 %%8 %%9\n' else: wrapper = '#! /usr/bin/env python\n%s\n' wrapper = '#! /usr/bin/env python\n%s\n' pass_body = preamble + stdout % self.pass_script + exit0 fail_body = preamble + stdout % self.fail_script + exit1 stderr_body = preamble + stderr % self.stderr_script + exit0 run_env.write(self.pass_script, wrapper % pass_body) run_env.write(self.fail_script, wrapper % fail_body) run_env.write(self.stderr_script, wrapper % stderr_body) signal_body = lstrip("""\ import os import signal os.kill(os.getpid(), signal.SIGTERM) """) run_env.write(self.signal_script, wrapper % signal_body) stdin_body = lstrip("""\ import sys input = sys.stdin.read()[:-1] sys.stdout.write(r'%s: STDOUT: ' + repr(input) + '\\n') sys.stderr.write(r'%s: STDERR: ' + repr(input) + '\\n') """ % (self.stdin_script, self.stdin_script)) run_env.write(self.stdin_script, wrapper % stdin_body) def run_execution_test(self, script, expect_stdout, expect_stderr): self.set_up_execution_scripts() run_env = self.run_env os.chdir(run_env.workpath('sub dir')) # Everything before this prepared our "source directory." # Now do the real test. script = script % self.__dict__ run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() expect_stdout = expect_stdout % self.__dict__ assert stdout == expect_stdout, assert_display(expect_stdout, stdout, stderr) try: match = expect_stderr.match except AttributeError: expect_stderr = expect_stderr % self.__dict__ assert stderr == expect_stderr, assert_display(expect_stderr, stderr) else: assert expect_stderr.match(stderr), assert_display(expect_stderr, stderr) class __init__TestCase(TestCommonTestCase): def test___init__(self): """Test initialization""" run_env = self.run_env os.chdir(run_env.workdir) script = lstrip("""\ from __future__ import print_function from TestCommon import TestCommon tc = TestCommon(workdir='') import os print(os.getcwd()) """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout()[:-1] assert stdout != run_env.workdir, stdout stderr = run_env.stderr() assert stderr == "", stderr class banner_TestCase(TestCommonTestCase): create_run_env = False def test_banner(self): """Test banner()""" tc = TestCommon.TestCommon(workdir='') b = tc.banner('xyzzy ') assert b == "xyzzy ==========================================================================", b tc.banner_width = 10 b = tc.banner('xyzzy ') assert b == "xyzzy ====", b b = tc.banner('xyzzy ', 20) assert b == "xyzzy ==============", b tc.banner_char = '-' b = tc.banner('xyzzy ') assert b == "xyzzy ----", b class must_be_writable_TestCase(TestCommonTestCase): def test_file_does_not_exists(self): """Test must_be_writable(): file does not exist""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Missing files: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_writable_file_exists(self): """Test must_be_writable(): writable file exists""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") f1 = tc.workpath('file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode | stat.S_IWUSR) tc.must_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_non_writable_file_exists(self): """Test must_be_writable(): non-writable file exists""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") f1 = tc.workpath('file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode & ~stat.S_IWUSR) tc.must_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Unwritable files: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_file_specified_as_list(self): """Test must_be_writable(): file specified as list""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") f1 = tc.workpath('sub', 'file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode | stat.S_IWUSR) tc.must_be_writable(['sub', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_contain_TestCase(TestCommonTestCase): def test_success(self): """Test must_contain(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 contents\\n") tc.must_contain('file1', "1 c") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_missing(self): """Test must_contain(): file missing""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_contain('file1', "1 c\\n") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr.find("No such file or directory:") != -1, stderr def test_failure(self): """Test must_contain(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 does not match\\n") tc.must_contain('file1', "1 c") tc.run() """) expect = lstrip("""\ File `file1' does not contain required string. Required string ================================================================ 1 c file1 contents ================================================================= file1 does not match """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == expect, repr(stdout) stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_mode(self): """Test must_contain(): mode""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 contents\\n", mode='w') tc.must_contain('file1', "1 c", mode='r') tc.write('file2', "file2 contents\\n", mode='wb') tc.must_contain('file2', "2 c", mode='rb') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_contain_all_lines_TestCase(TestCommonTestCase): def test_success(self): """Test must_contain_all_lines(): success""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_contain_all_lines(output, lines) test.must_contain_all_lines(output, ['www\\n']) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_contain_all_lines(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_all_lines(output, lines) test.pass_test() """) expect = lstrip("""\ Missing expected lines from output: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' output ========================================================================= www zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr def test_find(self): """Test must_contain_all_lines(): find""" run_env = self.run_env script = lstrip(""" import re import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'x.*', '.*y', ] output = '''\\ www xxx yyy zzz ''' def re_search(output, line): return re.compile(line, re.S).search(output) test.must_contain_all_lines(output, lines, find=re_search) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_title(self): """Test must_contain_all_lines(): title""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_all_lines(output, lines, title='STDERR') test.pass_test() """) expect = lstrip("""\ Missing expected lines from STDERR: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' STDERR ========================================================================= www zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr class must_contain_any_line_TestCase(TestCommonTestCase): def test_success(self): """Test must_contain_any_line(): success""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'aaa\\n', 'yyy\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_contain_any_line(output, lines) test.must_contain_any_line(output, ['www\\n']) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_contain_any_line(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_any_line(output, lines) test.pass_test() """) expect = lstrip("""\ Missing any expected line from output: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' output ========================================================================= www zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr def test_find(self): """Test must_contain_any_line(): find""" run_env = self.run_env script = lstrip(""" import re import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'aaa', '.*y', ] output = '''\\ www xxx yyy zzz ''' def re_search(output, line): return re.compile(line, re.S).search(output) test.must_contain_any_line(output, lines, find=re_search) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_title(self): """Test must_contain_any_line(): title""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_any_line(output, lines, title='STDOUT') test.pass_test() """) expect = lstrip("""\ Missing any expected line from STDOUT: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' STDOUT ========================================================================= www zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr class must_contain_exactly_lines_TestCase(TestCommonTestCase): def test_success_list(self): """Test must_contain_exactly_lines(): success (input list)""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'yyy\\n', 'xxx\\n', 'zzz', 'www\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_contain_exactly_lines(output, lines) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_success_string(self): """Test must_contain_exactly_lines(): success (input string)""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = '''\\ yyy xxx zzz www ''' output = '''\\ www xxx yyy zzz ''' test.must_contain_exactly_lines(output, lines) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_contain_exactly_lines(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_exactly_lines(output, lines) test.pass_test() """) expect = lstrip("""\ Missing expected lines from output: 'xxx' 'yyy' Missing output ================================================================= Extra unexpected lines from output: 'www' 'zzz' Extra output =================================================================== """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr def test_find(self): """Test must_contain_exactly_lines(): find""" run_env = self.run_env script = lstrip(""" import re import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'zzz', '.*y', 'xxx', 'www', ] output = '''\\\ www xxx yyy zzz ''' def re_search(output, line): pattern = re.compile(line, re.S) index = 0 for o in output: if pattern.search(o): return index index +=1 return None test.must_contain_exactly_lines(output, lines, find=re_search) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_title(self): """Test must_contain_exactly_lines(): title""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_exactly_lines(output, lines, title='STDOUT') test.pass_test() """) expect = lstrip("""\ Missing expected lines from STDOUT: 'xxx' 'yyy' Missing STDOUT ================================================================= Extra unexpected lines from STDOUT: 'www' 'zzz' Extra STDOUT =================================================================== """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr class must_contain_lines_TestCase(TestCommonTestCase): def test_success(self): """Test must_contain_lines(): success""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_contain_lines(lines, output) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_contain_lines(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www zzz ''' test.must_contain_lines(lines, output) test.pass_test() """) expect = lstrip("""\ Missing expected lines from output: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' output ========================================================================= www zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr class must_exist_TestCase(TestCommonTestCase): def test_success(self): """Test must_exist(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_exist('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_exist(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_exist('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Missing files: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_file_specified_as_list(self): """Test must_exist(): file specified as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") tc.must_exist(['sub', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_broken_link(self) : """Test must_exist(): exists but it is a broken link""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.symlink('badtarget', "brokenlink") tc.must_exist('brokenlink') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_exist_one_of_TestCase(TestCommonTestCase): def test_success(self): """Test must_exist_one_of(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_exist_one_of(['file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_exist_one_of(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_exist_one_of(['file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Missing one of: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_files_specified_as_list(self): """Test must_exist_one_of(): files specified as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_exist_one_of(['file2', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_files_specified_with_wildcards(self): """Test must_exist_one_of(): files specified with wildcards""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file7', "file7\\n") tc.must_exist_one_of(['file?']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_given_as_list(self): """Test must_exist_one_of(): file given as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") tc.must_exist_one_of(['file2', ['sub', 'file1']]) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_given_as_sequence(self): """Test must_exist_one_of(): file given as sequence""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") tc.must_exist_one_of(['file2', ('sub', 'file1')]) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_match_TestCase(TestCommonTestCase): def test_success(self): """Test must_match(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_match('file1', "file1\\n") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_does_not_exists(self): """Test must_match(): file does not exist""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_match('file1', "file1\\n") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr.find("No such file or directory:") != -1, stderr def test_failure(self): """Test must_match(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 does not match\\n") tc.must_match('file1', "file1\\n") tc.run() """) expect = lstrip("""\ Unexpected contents of `file1' contents ======================================================================= 1c1 < file1 --- > file1 does not match """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == expect, stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_mode(self): """Test must_match(): mode""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n", mode='w') tc.must_match('file1', "file1\\n", mode='r') tc.write('file2', "file2\\n", mode='wb') tc.must_match('file2', "file2\\n", mode='rb') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_not_be_writable_TestCase(TestCommonTestCase): def test_file_does_not_exists(self): """Test must_not_be_writable(): file does not exist""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_not_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Missing files: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_writable_file_exists(self): """Test must_not_be_writable(): writable file exists""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") f1 = tc.workpath('file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode | stat.S_IWUSR) tc.must_not_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Writable files: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_non_writable_file_exists(self): """Test must_not_be_writable(): non-writable file exists""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") f1 = tc.workpath('file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode & ~stat.S_IWUSR) tc.must_not_be_writable('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_specified_as_list(self): """Test must_not_be_writable(): file specified as list""" run_env = self.run_env script = lstrip("""\ import os import stat from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") f1 = tc.workpath('sub', 'file1') mode = os.stat(f1)[stat.ST_MODE] os.chmod(f1, mode & ~stat.S_IWUSR) tc.must_not_be_writable(['sub', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_not_contain_TestCase(TestCommonTestCase): def test_success(self): """Test must_not_contain(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 contents\\n") tc.must_not_contain('file1', "1 does not contain c") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_does_not_exist(self): """Test must_not_contain(): file does not exist""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_not_contain('file1', "1 c\\n") tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr.find("No such file or directory:") != -1, stderr def test_failure(self): """Test must_not_contain(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 does contain contents\\n") tc.must_not_contain('file1', "1 does contain c") tc.run() """) expect = lstrip("""\ File `file1' contains banned string. Banned string ================================================================== 1 does contain c file1 contents ================================================================= file1 does contain contents """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == expect, repr(stdout) stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_mode(self): """Test must_not_contain(): mode""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1 contents\\n", mode='w') tc.must_not_contain('file1', "1 does not contain c", mode='r') tc.write('file2', "file2 contents\\n", mode='wb') tc.must_not_contain('file2', "2 does not contain c", mode='rb') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_not_contain_any_line_TestCase(TestCommonTestCase): def test_failure(self): """Test must_not_contain_any_line(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', 'www\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_not_contain_any_line(output, lines) test.pass_test() """) expect = lstrip("""\ Unexpected lines in output: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' 'www%(expected_newline)s' output ========================================================================= www xxx yyy zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr def test_find(self): """Test must_not_contain_any_line(): find""" run_env = self.run_env script = lstrip(""" import re import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'x.*' '.*y' ] output = '''\\ www zzz ''' def re_search(output, line): return re.compile(line, re.S).search(output) test.must_not_contain_any_line(output, lines, find=re_search) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_success(self): """Test must_not_contain_any_line(): success""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n' 'yyy\\n' ] output = '''\\ www zzz ''' test.must_not_contain_any_line(output, lines) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_title(self): """Test must_not_contain_any_line(): title""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_not_contain_any_line(output, lines, title='XYZZY') test.pass_test() """) expect = lstrip("""\ Unexpected lines in XYZZY: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' XYZZY ========================================================================== www xxx yyy zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr class must_not_contain_lines_TestCase(TestCommonTestCase): def test_failure(self): """Test must_not_contain_lines(): failure""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n', 'yyy\\n', ] output = '''\\ www xxx yyy zzz ''' test.must_not_contain_lines(lines, output) test.pass_test() """) expect = lstrip("""\ Unexpected lines in output: 'xxx%(expected_newline)s' 'yyy%(expected_newline)s' output ========================================================================= www xxx yyy zzz """ % globals()) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() stderr = run_env.stderr() assert stdout == expect, assert_display(expect, stdout, stderr) assert stderr.find("FAILED") != -1, stderr def test_success(self): """Test must_not_contain_lines(): success""" run_env = self.run_env script = lstrip(""" import TestCommon test = TestCommon.TestCommon(workdir='') lines = [ 'xxx\\n' 'yyy\\n' ] output = '''\\ www zzz ''' test.must_not_contain_lines(lines, output) test.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class must_not_exist_TestCase(TestCommonTestCase): def test_failure(self): """Test must_not_exist(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_not_exist('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Unexpected files exist: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_success(self): """Test must_not_exist(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_not_exist('file1') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_specified_as_list(self): """Test must_not_exist(): file specified as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.must_not_exist(['sub', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_existing_broken_link(self): """Test must_not_exist(): exists but it is a broken link""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.symlink('badtarget', 'brokenlink') tc.must_not_exist('brokenlink') tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Unexpected files exist: `brokenlink'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr class must_not_exist_any_of_TestCase(TestCommonTestCase): def test_success(self): """Test must_not_exist_any_of(): success""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_not_exist_any_of(['file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_failure(self): """Test must_not_exist_any_of(): failure""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file1', "file1\\n") tc.must_not_exist_any_of(['file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Unexpected files exist: `file1'\n", stdout stderr = run_env.stderr() assert stderr.find("FAILED") != -1, stderr def test_files_specified_as_list(self): """Test must_not_exist_any_of(): files specified as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.must_not_exist_any_of(['file2', 'file1']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_files_specified_with_wildcards(self): """Test must_not_exist_any_of(): files specified with wildcards""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.write('file7', "file7\\n") tc.must_not_exist_any_of(['files?']) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_given_as_list(self): """Test must_not_exist_any_of(): file given as list""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") tc.must_not_exist_any_of(['file2', ['sub', 'files*']]) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr def test_file_given_as_sequence(self): """Test must_not_exist_any_of(): file given as sequence""" run_env = self.run_env script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(workdir='') tc.subdir('sub') tc.write(['sub', 'file1'], "sub/file1\\n") tc.must_not_exist_any_of(['file2', ('sub', 'files?')]) tc.pass_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr class run_TestCase(TestCommonTestCase): def test_argument_handling(self): """Test run(): argument handling""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) tc.run(arguments = "arg1 arg2 arg3", stdout = r"%(pass_script)s: STDOUT: ['arg1', 'arg2', 'arg3']" + "\\n") """) self.run_execution_test(script, "", "") def test_default_pass(self): """Test run(): default arguments, script passes""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(pass_script)s', interpreter=r'%(python)s', workdir='') tc.run() """) self.run_execution_test(script, "", "") def test_default_fail(self): """Test run(): default arguments, script fails""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(fail_script)s', interpreter='%(python)s', workdir='') tc.run() """) expect_stdout = lstrip("""\ %(fail_script)s returned 1 STDOUT ========================================================================= %(fail_script)s: STDOUT: [] STDERR ========================================================================= """) expect_stderr = lstrip("""\ FAILED test of .*fail \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin>( \(<module>\))? """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_default_stderr(self): """Test run(): default arguments, error output""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(stderr_script)s', interpreter='%(python)s', workdir='') tc.run() """) expect_stdout = lstrip("""\ STDOUT ========================================================================= STDERR ========================================================================= 0a1 > %(stderr_script)s: STDERR: [] """) expect_stderr = lstrip("""\ FAILED test of .*stderr \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin> """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_exception_handling(self): """Test run(): exception handling""" script = lstrip("""\ import TestCmd from TestCommon import TestCommon def raise_exception(*args, **kw): raise TypeError("forced TypeError") TestCmd.TestCmd.start = raise_exception tc = TestCommon(program='%(pass_script)s', interpreter='%(python)s', workdir='') tc.run() """) expect_stdout = lstrip("""\ STDOUT ========================================================================= STDERR ========================================================================= """) expect_stderr = lstrip("""\ Exception trying to execute: \\[%s, '[^']*pass'\\] Traceback \\((innermost|most recent call) last\\): File "<stdin>", line \\d+, in (\\?|<module>) File "[^"]+TestCommon.py", line \\d+, in run TestCmd.run\\(self, \\*\\*kw\\) File "[^"]+TestCmd.py", line \\d+, in run .* File "[^"]+TestCommon.py", line \\d+, in start raise e TypeError: forced TypeError """ % re.escape(repr(sys.executable))) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_ignore_stderr(self): """Test run(): ignore stderr""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(stderr_script)s', interpreter='%(python)s', workdir='') tc.run(stderr = None) """) self.run_execution_test(script, "", "") def test_match_function_stdout(self): """Test run(): explicit match function, stdout""" script = lstrip("""\ def my_match_exact(actual, expect): return actual == expect from TestCommon import TestCommon, match_re_dotall tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_re_dotall) tc.run(arguments = "arg1 arg2 arg3", stdout = r"%(pass_script)s: STDOUT: ['arg1', 'arg2', 'arg3']" + "\\n", match = my_match_exact) """) self.run_execution_test(script, "", "") def test_match_function_stderr(self): """Test run(): explicit match function, stderr""" script = lstrip("""\ def my_match_exact(actual, expect): return actual == expect from TestCommon import TestCommon, match_re_dotall tc = TestCommon(program=r'%(stderr_script)s', interpreter='%(python)s', workdir="", match=match_re_dotall) tc.run(arguments = "arg1 arg2 arg3", stderr = r"%(stderr_script)s: STDERR: ['arg1', 'arg2', 'arg3']" + "\\n", match = my_match_exact) """) self.run_execution_test(script, "", "") def test_matched_status_fails(self): """Test run(): matched status, script fails""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(fail_script)s', interpreter='%(python)s', workdir='') tc.run(status = 1) """) self.run_execution_test(script, "", "") def test_matched_stdout(self): """Test run(): matched stdout""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) tc.run(stdout = r"%(pass_script)s: STDOUT: []" + "\\n") """) self.run_execution_test(script, "", "") def test_matched_stderr(self): """Test run(): matched stderr""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(stderr_script)s', interpreter='%(python)s', workdir="", match=match_exact) tc.run(stderr = r"%(stderr_script)s: STDERR: []" + "\\n") """) self.run_execution_test(script, "", "") def test_mismatched_status_pass(self): """Test run(): mismatched status, script passes""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir='') tc.run(status = 1) """) expect_stdout = lstrip("""\ %(pass_script)s returned 0 (expected 1) STDOUT ========================================================================= %(pass_script)s: STDOUT: [] STDERR ========================================================================= """) expect_stderr = lstrip("""\ FAILED test of .*pass \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin>( \(<module>\))? """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_mismatched_status_fail(self): """Test run(): mismatched status, script fails""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(fail_script)s', interpreter='%(python)s', workdir='') tc.run(status = 2) """) expect_stdout = lstrip("""\ %(fail_script)s returned 1 (expected 2) STDOUT ========================================================================= %(fail_script)s: STDOUT: [] STDERR ========================================================================= """) expect_stderr = lstrip("""\ FAILED test of .*fail \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin>( \(<module>\))? """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_mismatched_stdout(self): """Test run(): mismatched stdout""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir='') tc.run(stdout = "Not found\\n") """) expect_stdout = lstrip("""\ STDOUT ========================================================================= 1c1 < Not found --- > %(pass_script)s: STDOUT: [] """) expect_stderr = lstrip("""\ FAILED test of .*pass \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin>( \(<module>\))? """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_mismatched_stderr(self): """Test run(): mismatched stderr""" script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(stderr_script)s', interpreter='%(python)s', workdir='') tc.run(stderr = "Not found\\n") """) expect_stdout = lstrip("""\ STDOUT ========================================================================= STDERR ========================================================================= 1c1 < Not found --- > %(stderr_script)s: STDERR: [] """) expect_stderr = lstrip("""\ FAILED test of .*stderr \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin>( \(<module>\))? """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_option_handling(self): """Test run(): option handling""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) tc.run(options = "opt1 opt2 opt3", stdout = r"%(pass_script)s: STDOUT: ['opt1', 'opt2', 'opt3']" + "\\n") """) self.run_execution_test(script, "", "") def test_options_plus_arguments(self): """Test run(): option handling with arguments""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) tc.run(options = "opt1 opt2 opt3", arguments = "arg1 arg2 arg3", stdout = r"%(pass_script)s: STDOUT: ['opt1', 'opt2', 'opt3', 'arg1', 'arg2', 'arg3']" + "\\n") """) self.run_execution_test(script, "", "") def test_signal_handling(self): """Test run(): signal handling""" try: os.kill except AttributeError: sys.stderr.write('can not test, no os.kill ... ') return script = lstrip("""\ from TestCommon import TestCommon tc = TestCommon(program=r'%(signal_script)s', interpreter='%(python)s', workdir='') tc.run() """) self.SIGTERM = signal.SIGTERM # Script returns the signal value as a negative number. expect_stdout = lstrip("""\ %(signal_script)s returned -%(SIGTERM)s STDOUT ========================================================================= STDERR ========================================================================= """) expect_stderr = lstrip("""\ FAILED test of .*signal \\tat line \\d+ of .*TestCommon\\.py \\(_complete\\) \\tfrom line \\d+ of .*TestCommon\\.py \\(run\\) \\tfrom line \\d+ of <stdin> """) expect_stderr = re.compile(expect_stderr, re.M) self.run_execution_test(script, expect_stdout, expect_stderr) def test_stdin(self): """Test run(): stdin handling""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(stdin_script)s', interpreter='%(python)s', workdir='', match=match_exact) expect_stdout = r"%(stdin_script)s: STDOUT: 'input'" + "\\n" expect_stderr = r"%(stdin_script)s: STDERR: 'input'" + "\\n" tc.run(stdin="input\\n", stdout = expect_stdout, stderr = expect_stderr) """) expect_stdout = lstrip("""\ %(pass_script)s returned 0 (expected 1) STDOUT ========================================================================= %(pass_script)s: STDOUT: [] STDERR ========================================================================= """) self.run_execution_test(script, "", "") class start_TestCase(TestCommonTestCase): def test_option_handling(self): """Test start(): option handling""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) p = tc.start(options = "opt1 opt2 opt3") expect = r"%(pass_script)s: STDOUT: ['opt1', 'opt2', 'opt3']" + "\\n" tc.finish(p, stdout = expect) """) self.run_execution_test(script, "", "") def test_options_plus_arguments(self): """Test start(): option handling with arguments""" script = lstrip("""\ from TestCommon import TestCommon, match_exact tc = TestCommon(program=r'%(pass_script)s', interpreter='%(python)s', workdir="", match=match_exact) p = tc.start(options = "opt1 opt2 opt3", arguments = "arg1 arg2 arg3") expect = r"%(pass_script)s: STDOUT: ['opt1', 'opt2', 'opt3', 'arg1', 'arg2', 'arg3']" + "\\n" tc.finish(p, stdout = expect) """) self.run_execution_test(script, "", "") class skip_test_TestCase(TestCommonTestCase): def test_skip_test(self): """Test skip_test()""" run_env = self.run_env script = lstrip("""\ import TestCommon test = TestCommon.TestCommon(workdir='') test.skip_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Skipping test.\n", stdout stderr = run_env.stderr() expect = [ "NO RESULT for test at line 3 of <stdin>\n", "NO RESULT for test at line 3 of <stdin> (<module>)\n", ] assert stderr in expect, repr(stderr) script = lstrip("""\ import TestCommon test = TestCommon.TestCommon(workdir='') test.skip_test("skipping test because I said so\\n") """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "skipping test because I said so\n", stdout stderr = run_env.stderr() expect = [ "NO RESULT for test at line 3 of <stdin>\n", "NO RESULT for test at line 3 of <stdin> (<module>)\n", ] assert stderr in expect, repr(stderr) import os os.environ['TESTCOMMON_PASS_SKIPS'] = '1' try: script = lstrip("""\ import TestCommon test = TestCommon.TestCommon(workdir='') test.skip_test() """) run_env.run(program=sys.executable, stdin=script) stdout = run_env.stdout() assert stdout == "Skipping test.\n", stdout stderr = run_env.stderr() assert stderr == "PASSED\n", stderr finally: del os.environ['TESTCOMMON_PASS_SKIPS'] class variables_TestCase(TestCommonTestCase): def test_variables(self): """Test global variables""" run_env = self.run_env variables = [ 'fail_test', 'no_result', 'pass_test', 'match_exact', 'match_re', 'match_re_dotall', 'python', '_python_', 'TestCmd', 'TestCommon', 'exe_suffix', 'obj_suffix', 'shobj_prefix', 'shobj_suffix', 'lib_prefix', 'lib_suffix', 'dll_prefix', 'dll_suffix', ] script = "from __future__ import print_function" + \ "import TestCommon\n" + \ '\n'.join([ "print(TestCommon.%s)\n" % v for v in variables ]) run_env.run(program=sys.executable, stdin=script) stderr = run_env.stderr() assert stderr == "", stderr script = "from __future__ import print_function" + \ "from TestCommon import *\n" + \ '\n'.join([ "print(%s)" % v for v in variables ]) run_env.run(program=sys.executable, stdin=script) stderr = run_env.stderr() assert stderr == "", stderr if __name__ == "__main__": tclasses = [ __init__TestCase, banner_TestCase, must_be_writable_TestCase, must_contain_TestCase, must_contain_all_lines_TestCase, must_contain_any_line_TestCase, must_contain_exactly_lines_TestCase, must_contain_lines_TestCase, must_exist_TestCase, must_exist_one_of_TestCase, must_match_TestCase, must_not_be_writable_TestCase, must_not_contain_TestCase, must_not_contain_any_line_TestCase, must_not_contain_lines_TestCase, must_not_exist_TestCase, must_not_exist_any_of_TestCase, run_TestCase, start_TestCase, skip_test_TestCase, variables_TestCase, ] suite = unittest.TestSuite() for tclass in tclasses: names = unittest.getTestCaseNames(tclass, 'test_') suite.addTests([ tclass(n) for n in names ]) if not unittest.TextTestRunner().run(suite).wasSuccessful(): sys.exit(1) # Local Variables: # tab-width:4 # indent-tabs-mode:nil # End: # vim: set expandtab tabstop=4 shiftwidth=4:
30.435711
111
0.525235
7949cc2babbaaaffa5e411764d29ed573a0c7c69
8,092
py
Python
test/test_database.py
darcyabjones/acc-to-tax
608651a4f055c75839eef26a9b4a0582f5840ed2
[ "MIT" ]
null
null
null
test/test_database.py
darcyabjones/acc-to-tax
608651a4f055c75839eef26a9b4a0582f5840ed2
[ "MIT" ]
null
null
null
test/test_database.py
darcyabjones/acc-to-tax
608651a4f055c75839eef26a9b4a0582f5840ed2
[ "MIT" ]
null
null
null
""" """ import os import re from unittest.mock import MagicMock import pytest from acc2tax.database import int2bool from acc2tax.database import bool2int from acc2tax.database import Base from acc2tax.database import BaseTable from acc2tax.database import Acc2Tax from acc2tax.database import Nodes from acc2tax.database import Names from acc2tax.database import Division from acc2tax.database import GenCode # Define fixtures @pytest.fixture() def session(): """ Sets up an in-memory sqlite database for testing. """ from sqlalchemy import create_engine from sqlalchemy.orm import sessionmaker # Setup engine = create_engine("sqlite:///:memory:", echo=False) Session = sessionmaker(bind=engine) session = Session() Base.metadata.create_all(engine) yield session # Teardown session.close() @pytest.fixture() def nodes_table(session): Nodes.from_file("test/data/sample_nodes.dmp", session) return Nodes @pytest.mark.parametrize("expected,i", [ (True, '1'), (False, '0'), ]) def test_int2bool(i, expected): assert int2bool(i) == expected return @pytest.mark.parametrize("i,expected", [ (True, '1'), (False, '0'), ]) def test_bool2int(i, expected): assert bool2int(i) == expected return class TestBaseTable(object): parser_test_lines = [ { "line": "one\t2\t0\n", "sep": "\t", "end": "\n", "columns": [("a", str, str), ("b", int, str), ("c", int2bool, bool2int)], "expected": {"a": "one", "b": 2, "c": False}, }, { "line": "1234\t|\t567\t|\teight\t|\n", "sep": "\t|\t", "end": "\t|\n", "columns": [("a", int, str), ("b", str, str), ("c", str, str)], "expected": {"a": 1234, "b": "567", "c": "eight"} }, { "line": "1234\t|\t567\t|\t\t|\n", "sep": "\t|\t", "end": "\t|\n", "columns": [("a", int, str), ("b", str, str), ("c", str, str)], "expected": {"a": 1234, "b": "567", "c": ""} }, ] parser_test_files = [ { "path": "test/data/sample_nodes.dmp", "sep": Nodes.sep, "end": Nodes.end, "columns": Nodes.columns, "header": Nodes.header, }, { "path": "test/data/sample_names.dmp", "sep": Names.sep, "end": Names.end, "columns": Names.columns, "header": Names.header, }, { "path": "test/data/sample_division.dmp", "sep": Division.sep, "end": Division.end, "columns": Division.columns, "header": Division.header, }, ] writer_test_records = [ { "records": [ MagicMock( taxid=2, parent_taxid=1, rank="species", embl_code='', division_id=0, inherited_div_flag=False, genetic_code_id='TEST', inherited_genetic_code_flag=True, mitochonchondrial_genetic_code_id="TEST", inherited_mitochonchondrial_genetic_code_flag=True, genbank_hidden_flag=False, hidden_subtree_root_flag=False, comments='' ), MagicMock( taxid=3, parent_taxid=1, rank="species", embl_code='', division_id=0, inherited_div_flag=False, genetic_code_id='TEST', inherited_genetic_code_flag=True, mitochonchondrial_genetic_code_id="TEST", inherited_mitochonchondrial_genetic_code_flag=True, genbank_hidden_flag=True, hidden_subtree_root_flag=False, comments='' ), ], "sep": Nodes.sep, "end": Nodes.end, "columns": Nodes.columns, "header": Nodes.header, "expected": [ [["2", "1", "species", "", "0", "0", "TEST", "1", "TEST","1", "0", "0", ""], ["3", "1", "species", "", "0", "0", "TEST", "1", "TEST","1", "1", "0", ""],] ], }, { "records": [ MagicMock( taxid=2, name_="species1", unique_name="", name_class="Scientific name", ), MagicMock( taxid=3, name_="species2", unique_name="species2_1", name_class="Common name", ), ], "sep": Names.sep, "end": Names.end, "columns": Names.columns, "header": Names.header, "expected": [ "\t|\t".join(x) + "\t|\n" for x in [["2", "species1", "", "Scientific name"], ["3", "species2", "species2_1", "Common name"],] ], }, ] @pytest.mark.parametrize("line,sep,end,columns,expected", [ (l["line"], l["sep"], l["end"], l["columns"], l["expected"]) for l in parser_test_lines ] ) def test_line_trans(self, line, sep, end, columns, expected): result = BaseTable.line_trans(line, sep, end, columns) print("result:", result) for k_exp, v_exp in expected.items(): assert v_exp == result[k_exp] return @pytest.mark.parametrize("line,sep,end,columns,expected", [ (l["line"], l["sep"], l["end"], l["columns"], l["expected"]) for l in parser_test_lines ] ) def test_string_fmt(self, line, sep, end, columns, expected): obj = MagicMock(**expected) result = BaseTable.string_fmt(obj, sep, end, columns) print("result:", result) assert result == line return @pytest.mark.parametrize("path,sep,end,columns,header", [ (l["path"], l["sep"], l["end"], l["columns"], l["header"]) for l in parser_test_files ] ) def test_from_file(self, path, sep, end, columns, header): session = MagicMock() session.commit = MagicMock(return_value=None) session.bulk_insert_mappings = MagicMock(return_value=None) BaseTable.from_file( filepath=path, session=session, sep=sep, columns=columns, header=header, ) session.bulk_insert_mappings.assert_called() session.commit.assert_called_once() return @pytest.mark.parametrize("records,sep,end,columns,header,expected", [ (l["records"], l["sep"], l["end"], l["columns"], l["header"], l["expected"]) for l in writer_test_records ] ) def test_to_table(self, records, sep, end, columns, header, expected): # Since name is a special attribute for mock we need to assign it # After creation time. for record in records: record.name = record.name_ results = BaseTable.to_table(records, sep, end, columns, header) for result, exp in zip(results, expected): assert result == exp return class TestNodes(object): def test_from_file(self, session): Nodes.from_file("test/data/sample_nodes.dmp", session) record = session.query(Nodes).filter(Nodes.taxid == 1224).one() assert record.parent_taxid == 2 assert record.rank == "phylum" return def test_get_parents(self, session, nodes_table): # Nodes table is already populated with fixture Nodes.get_parents() return
30.421053
96
0.498023
7949cd037e31307fbc988a596decd4ecf4e0dfad
6,702
py
Python
lib/surface/compute/url_maps/remove_host_rule.py
bshaffer/google-cloud-sdk
f587382fd112f238c0d6d5ca3dab8f52d2b5c5f9
[ "Apache-2.0" ]
null
null
null
lib/surface/compute/url_maps/remove_host_rule.py
bshaffer/google-cloud-sdk
f587382fd112f238c0d6d5ca3dab8f52d2b5c5f9
[ "Apache-2.0" ]
null
null
null
lib/surface/compute/url_maps/remove_host_rule.py
bshaffer/google-cloud-sdk
f587382fd112f238c0d6d5ca3dab8f52d2b5c5f9
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- # # Copyright 2014 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Command for removing a host rule from a URL map.""" from __future__ import absolute_import from __future__ import division from __future__ import unicode_literals from apitools.base.py import encoding from googlecloudsdk.api_lib.compute import base_classes from googlecloudsdk.calliope import base from googlecloudsdk.calliope import exceptions from googlecloudsdk.command_lib.compute.url_maps import flags from googlecloudsdk.command_lib.compute.url_maps import url_maps_utils @base.ReleaseTracks(base.ReleaseTrack.GA, base.ReleaseTrack.BETA) class RemoveHostRule(base.UpdateCommand): """Remove a host rule from a URL map. *{command}* is used to remove a host rule from a URL map. When a host rule is removed, its path matcher is only removed if it is not referenced by any other host rules and `--delete-orphaned-path-matcher` is provided. ## EXAMPLES To remove a host rule that contains the host `example.com` from the URL map named `MY-URL-MAP`, you can use this command: $ {command} MY-URL-MAP --host example.com """ URL_MAP_ARG = None @classmethod def Args(cls, parser): cls.URL_MAP_ARG = flags.UrlMapArgument() cls.URL_MAP_ARG.AddArgument(parser) parser.add_argument( '--host', required=True, help='One of the hosts in the host rule to remove.') parser.add_argument( '--delete-orphaned-path-matcher', action='store_true', default=False, help=('If provided and a path matcher is orphaned as a result of this ' 'command, the command removes the orphaned path matcher instead ' 'of failing.')) def _GetGetRequest(self, client, url_map_ref): """Returns the request for the existing URL map resource.""" if url_maps_utils.IsGlobalUrlMapRef(url_map_ref): return (client.apitools_client.urlMaps, 'Get', client.messages.ComputeUrlMapsGetRequest( urlMap=url_map_ref.Name(), project=url_map_ref.project)) else: return (client.apitools_client.regionUrlMaps, 'Get', client.messages.ComputeRegionUrlMapsGetRequest( urlMap=url_map_ref.Name(), project=url_map_ref.project, region=url_map_ref.region)) def _GetSetRequest(self, client, url_map_ref, replacement): if url_maps_utils.IsGlobalUrlMapRef(url_map_ref): return (client.apitools_client.urlMaps, 'Update', client.messages.ComputeUrlMapsUpdateRequest( urlMap=url_map_ref.Name(), urlMapResource=replacement, project=url_map_ref.project)) else: return (client.apitools_client.regionUrlMaps, 'Update', client.messages.ComputeRegionUrlMapsUpdateRequest( urlMap=url_map_ref.Name(), urlMapResource=replacement, project=url_map_ref.project, region=url_map_ref.region)) def _Modify(self, args, existing): """Returns a modified URL map message.""" replacement = encoding.CopyProtoMessage(existing) path_matcher_to_remove = None new_host_rules = [] for host_rule in existing.hostRules: if args.host in host_rule.hosts: path_matcher_to_remove = host_rule.pathMatcher else: new_host_rules.append(host_rule) if not path_matcher_to_remove: raise exceptions.ToolException( 'No host rule contains the host [{0}].'.format(args.host)) replacement.hostRules = new_host_rules path_matcher_is_used_by_other_rules = False for host_rule in replacement.hostRules: if host_rule.pathMatcher == path_matcher_to_remove: path_matcher_is_used_by_other_rules = True break if not path_matcher_is_used_by_other_rules: if args.delete_orphaned_path_matcher: replacement.pathMatchers = [ path_matcher for path_matcher in existing.pathMatchers if path_matcher.name != path_matcher_to_remove] else: raise exceptions.ToolException( 'This operation will orphan the path matcher [{0}]. To ' 'delete the orphan path matcher, rerun this command with ' '[--delete-orphaned-path-matcher] or use [gcloud compute ' 'url-maps edit] to modify the URL map by hand.'.format( host_rule.pathMatcher)) return replacement def Run(self, args): """Issues requests necessary to remove host rule on URL maps.""" holder = base_classes.ComputeApiHolder(self.ReleaseTrack()) client = holder.client url_map_ref = self.URL_MAP_ARG.ResolveAsResource(args, holder.resources) get_request = self._GetGetRequest(client, url_map_ref) objects = client.MakeRequests([get_request]) new_object = self._Modify(args, objects[0]) return client.MakeRequests( [self._GetSetRequest(client, url_map_ref, new_object)]) @base.ReleaseTracks(base.ReleaseTrack.ALPHA) class RemoveHostRuleAlpha(RemoveHostRule): """Remove a host rule from a URL map. *{command}* is used to remove a host rule from a URL map. When a host rule is removed, its path matcher is only removed if it is not referenced by any other host rules and `--delete-orphaned-path-matcher` is provided. ## EXAMPLES To remove a host rule that contains the host `example.com` from the URL map named `MY-URL-MAP`, you can use this command: $ {command} MY-URL-MAP --host example.com --global """ URL_MAP_ARG = None @classmethod def Args(cls, parser): cls.URL_MAP_ARG = flags.UrlMapArgument(include_alpha=True) cls.URL_MAP_ARG.AddArgument(parser) parser.add_argument( '--host', required=True, help='One of the hosts in the host rule to remove.') parser.add_argument( '--delete-orphaned-path-matcher', action='store_true', default=False, help=('If provided and a path matcher is orphaned as a result of this ' 'command, the command removes the orphaned path matcher instead ' 'of failing.'))
35.839572
79
0.693524
7949ce4693772bd404fef33280f01f30cf041320
3,135
py
Python
pt_bt/pso.py
LukeKort/Opp_lite
e47b0a1e38dc1e675663c83dc2d75f4506a859e5
[ "MIT" ]
null
null
null
pt_bt/pso.py
LukeKort/Opp_lite
e47b0a1e38dc1e675663c83dc2d75f4506a859e5
[ "MIT" ]
null
null
null
pt_bt/pso.py
LukeKort/Opp_lite
e47b0a1e38dc1e675663c83dc2d75f4506a859e5
[ "MIT" ]
null
null
null
# Particle Swarm (Aug. 04, 2021) import time import numpy as np import random as rand from importlib import reload #to reload a previuly loaded file def pso(n_particles,n_variables,n_iterations,tolerance,a,b,pso_only_w,pso_only_c1,pso_only_c2): from random_matrix import radom_generator #random generator. takes x and y vector dimentions between the limits a and b import functions reload(functions) #uptade the changes made in the function file from functions import objective #objetive function(s) from functions import constraints #constraint function(s) best_result_acum = np.empty((n_iterations)) #preallocation v = radom_generator(n_variables,n_particles,a,b) #velocity matrix x_aux = radom_generator(n_variables,n_particles,a,b) x = radom_generator(n_variables,n_particles,a,b) x_best = np.zeros((n_variables)) cc = 1 #controler counter t_0 = time.time() #start time for i in range(n_iterations): x_0=x.copy() #stores the last x before uptade for j in range(n_particles): v[:,j]= pso_only_w*v[:,j] + rand.random()*pso_only_c1*(x_aux[:,j]-x[:,j]) + rand.random()*pso_only_c2*(x_best - x[:,j]) #new velocity matrix x[:,j]=x_0[:,j]+v[:,j] #new position matrix for k in range(n_variables): #test with the limits (a,b) if x[k,j]<a[k]: x[k,j]=a[k]+(b[k]-a[k])*rand.random() if x[k,j]>b[k]: x[k,j]=a[k]+(b[k]-a[k])*rand.random() if (constraints(x[:,j])) is True: #teste the new x within the constraints functions if (objective(x[:,j])) < objective(x_aux[:,j]): #teste the new x within the objetive function x_aux[:,j] = x[:,j].copy() #setting new best particle position if cc == 1: results = np.full(n_particles,objective(x_aux[:,j])) #the 1st best value will fill the results vector best_result_acum = np.full(n_iterations,objective(x_aux[:,j])) cc += 1 else: results[j] = objective(x_aux[:,j]) #save result per particle best_result = min(results).copy() #find best result of all particles best_result_acum[i] = best_result.copy() idx = results.tolist().index(best_result) #find the best result's index inside the results vector x_best = x_aux[:,idx] #find the best result's position if tolerance >= np.amax(abs(x-x_0)): #break for setting tolerance break t_end = time.time() #finish time t_total = t_end - t_0 #total processing time if cc == 1: best_result = x_best = 'Not found!' #if the problem can't be solved, rise the messange print('#Particle Swarm\nMelhor resultado:',best_result,'\nPosição:',x_best,'\nTempo de execução:',(t_total),'s\n') return({'best_result':best_result,'acumulate_result':best_result_acum,'x_best':x_best,'t_total':t_total,'max_n_iteration':i})
49.761905
152
0.610845
7949ced8450baf9835425acb6c6215ccc23e19c3
7,723
py
Python
cvlib/object_detection.py
wajahatali93/cvlib
2722470f22b44141b989c31acbaa1ec08d694050
[ "MIT" ]
null
null
null
cvlib/object_detection.py
wajahatali93/cvlib
2722470f22b44141b989c31acbaa1ec08d694050
[ "MIT" ]
null
null
null
cvlib/object_detection.py
wajahatali93/cvlib
2722470f22b44141b989c31acbaa1ec08d694050
[ "MIT" ]
null
null
null
import cv2 import os import numpy as np from .utils import download_file initialize = True net = None dest_dir = os.path.expanduser('~') + os.path.sep + '.cvlib' + os.path.sep + 'object_detection' + os.path.sep + 'yolo' + os.path.sep + 'yolov3' classes = None COLORS = np.random.uniform(0, 255, size=(80, 3)) def populate_class_labels(): class_file_name = 'yolov3_classes.txt' class_file_abs_path = dest_dir + os.path.sep + class_file_name url = 'https://github.com/arunponnusamy/object-detection-opencv/raw/master/yolov3.txt' if not os.path.exists(class_file_abs_path): download_file(url=url, file_name=class_file_name, dest_dir=dest_dir) f = open(class_file_abs_path, 'r') classes = [line.strip() for line in f.readlines()] return classes def get_output_layers(net): layer_names = net.getLayerNames() output_layers = [layer_names[i[0] - 1] for i in net.getUnconnectedOutLayers()] return output_layers def draw_bbox(img, bbox, labels, confidence, colors=None, write_conf=False): global COLORS global classes if classes is None: classes = populate_class_labels() for i, label in enumerate(labels): if colors is None: color = COLORS[classes.index(label)] else: color = colors[classes.index(label)] if write_conf: label += ' ' + str(format(confidence[i] * 100, '.2f')) + '%' cv2.rectangle(img, (bbox[i][0],bbox[i][1]), (bbox[i][2],bbox[i][3]), color, 2) cv2.putText(img, label, (bbox[i][0],bbox[i][1]-10), cv2.FONT_HERSHEY_SIMPLEX, 0.5, color, 2) return img def detect_common_objects(image, confidence=0.5, nms_thresh=0.3, model='yolov3', enable_gpu=False): Height, Width = image.shape[:2] scale = 0.00392 global classes global dest_dir config_file_abs_path = '' weights_file_abs_path = '' if model == 'yolov3-tiny': config_file_name = 'yolov3-tiny.cfg' cfg_url = "https://github.com/pjreddie/darknet/raw/master/cfg/yolov3-tiny.cfg" weights_file_name = 'yolov3-tiny.weights' weights_url = 'https://pjreddie.com/media/files/yolov3-tiny.weights' blob = cv2.dnn.blobFromImage(image, scale, (416,416), (0,0,0), True, crop=False) config_file_abs_path = dest_dir + os.path.sep + config_file_name weights_file_abs_path = dest_dir + os.path.sep + weights_file_name else: config_file_name = 'yolov3.cfg' cfg_url = 'https://github.com/arunponnusamy/object-detection-opencv/raw/master/yolov3.cfg' weights_file_name = 'yolov3.weights' blob = cv2.dnn.blobFromImage(image, scale, (416,416), (0,0,0), True, crop=False) config_file_abs_path = dest_dir + os.path.sep + config_file_name weights_file_abs_path = '/cvlib-od/model_data/yolo3.weights' if not os.path.exists(config_file_abs_path): download_file(url=cfg_url, file_name=config_file_name, dest_dir=dest_dir) if not os.path.exists(weights_file_abs_path): download_file(url=weights_url, file_name=weights_file_name, dest_dir=dest_dir) global initialize global net if initialize: classes = populate_class_labels() net = cv2.dnn.readNet(weights_file_abs_path, config_file_abs_path) initialize = False # enables opencv dnn module to use CUDA on Nvidia card instead of cpu if enable_gpu: net.setPreferableBackend(cv2.dnn.DNN_BACKEND_CUDA) net.setPreferableTarget(cv2.dnn.DNN_TARGET_CUDA) net.setInput(blob) outs = net.forward(get_output_layers(net)) class_ids = [] confidences = [] boxes = [] for out in outs: for detection in out: scores = detection[5:] class_id = np.argmax(scores) max_conf = scores[class_id] if max_conf > confidence: center_x = int(detection[0] * Width) center_y = int(detection[1] * Height) w = int(detection[2] * Width) h = int(detection[3] * Height) x = center_x - (w / 2) y = center_y - (h / 2) class_ids.append(class_id) confidences.append(float(max_conf)) boxes.append([x, y, w, h]) indices = cv2.dnn.NMSBoxes(boxes, confidences, confidence, nms_thresh) bbox = [] label = [] conf = [] for i in indices: i = i[0] box = boxes[i] x = box[0] y = box[1] w = box[2] h = box[3] bbox.append([int(x), int(y), int(x+w), int(y+h)]) label.append(str(classes[class_ids[i]])) conf.append(confidences[i]) return bbox, label, conf class YOLO: def __init__(self, weights, config, labels, version='yolov3'): print('[INFO] Initializing YOLO ..') self.config = config self.weights = weights self.version = version with open(labels, 'r') as f: self.labels = [line.strip() for line in f.readlines()] self.colors = np.random.uniform(0, 255, size=(len(self.labels), 3)) self.net = cv2.dnn.readNet(self.weights, self.config) layer_names = self.net.getLayerNames() self.output_layers = [layer_names[i[0] - 1] for i in self.net.getUnconnectedOutLayers()] def detect_objects(self, image, confidence=0.5, nms_thresh=0.3, enable_gpu=False): if enable_gpu: net.setPreferableBackend(cv2.dnn.DNN_BACKEND_CUDA) net.setPreferableTarget(cv2.dnn.DNN_TARGET_CUDA) Height, Width = image.shape[:2] scale = 0.00392 blob = cv2.dnn.blobFromImage(image, scale, (416,416), (0,0,0), True, crop=False) self.net.setInput(blob) outs = self.net.forward(self.output_layers) class_ids = [] confidences = [] boxes = [] for out in outs: for detection in out: scores = detection[5:] class_id = np.argmax(scores) max_conf = scores[class_id] if max_conf > confidence: center_x = int(detection[0] * Width) center_y = int(detection[1] * Height) w = int(detection[2] * Width) h = int(detection[3] * Height) x = center_x - (w / 2) y = center_y - (h / 2) class_ids.append(class_id) confidences.append(float(max_conf)) boxes.append([x, y, w, h]) indices = cv2.dnn.NMSBoxes(boxes, confidences, confidence, nms_thresh) bbox = [] label = [] conf = [] for i in indices: i = i[0] box = boxes[i] x = box[0] y = box[1] w = box[2] h = box[3] bbox.append([int(x), int(y), int(x+w), int(y+h)]) label.append(str(self.labels[class_ids[i]])) conf.append(confidences[i]) return bbox, label, conf def draw_bbox(self, img, bbox, labels, confidence, colors=None, write_conf=False): if colors is None: colors = self.colors for i, label in enumerate(labels): color = colors[self.labels.index(label)] if write_conf: label += ' ' + str(format(confidence[i] * 100, '.2f')) + '%' cv2.rectangle(img, (bbox[i][0],bbox[i][1]), (bbox[i][2],bbox[i][3]), color, 2) cv2.putText(img, label, (bbox[i][0],bbox[i][1]-10), cv2.FONT_HERSHEY_SIMPLEX, 0.5, color, 2)
31.522449
142
0.582546
7949cef9db58642cf4708cbd41d38ef4a91abb86
252
py
Python
falmer/matte/utils.py
sussexstudent/services-api
ae735bd9d6177002c3d986e5c19a78102233308f
[ "MIT" ]
2
2017-04-27T19:35:59.000Z
2017-06-13T16:19:33.000Z
falmer/matte/utils.py
sussexstudent/falmer
ae735bd9d6177002c3d986e5c19a78102233308f
[ "MIT" ]
975
2017-04-13T11:31:07.000Z
2022-02-10T07:46:18.000Z
falmer/matte/utils.py
sussexstudent/services-api
ae735bd9d6177002c3d986e5c19a78102233308f
[ "MIT" ]
3
2018-05-09T06:42:25.000Z
2020-12-10T18:29:30.000Z
def create_image_from_bytes(file, file_name, internal_source): from .models import MatteImage image = MatteImage() image.file = file image.title = file_name image.internal_source = internal_source image.save() return image
25.2
62
0.722222
7949cf3833d15ea38a31bff5eebb536f90a0a27f
16,396
py
Python
scripts/initial.py
thunlp/HNRE
ab34ed9849f761d7e69d3dc42e3095d0e567b63c
[ "MIT" ]
96
2018-08-29T08:57:25.000Z
2021-12-26T08:19:48.000Z
scripts/initial.py
thunlp/HNRE
ab34ed9849f761d7e69d3dc42e3095d0e567b63c
[ "MIT" ]
14
2018-10-19T10:33:40.000Z
2022-01-08T23:37:26.000Z
scripts/initial.py
thunlp/HNRE
ab34ed9849f761d7e69d3dc42e3095d0e567b63c
[ "MIT" ]
25
2018-10-18T09:46:24.000Z
2021-12-01T09:10:48.000Z
import numpy as np import os import sys import json def makedirs(path): if not os.path.exists(path): os.makedirs(path) makedirs('data/pn/') makedirs('outputs/summary/') makedirs('outputs/ckpt/') makedirs('outputs/logits/') # folder of training datasets if len(sys.argv) > 1: data_path = sys.argv[1] else: data_path = "./raw_data/" # files to export data if len(sys.argv) > 2: export_path = sys.argv[2] else: export_path = "./data/" #length of sentence fixlen = 120 #max length of position embedding is 100 (-100~+100) maxlen = 100 word2id = {} relation2id = {} word_size = 0 word_vec = None def pos_embed(x): return max(0, min(x + maxlen, maxlen + maxlen + 1)) def find_index(x,y): for index, item in enumerate(y): if x == item: return index return -1 def assert_equal(x, y): assert x==y, 'ERROR: {} != {}'.format(x, y) def init_word(): # reading word embedding data... global word2id, word_size print('reading word embedding data...') f = open(data_path + 'vec.txt', "r") total, size = f.readline().strip().split()[:2] total = (int)(total) word_size = (int)(size) vec = np.ones((total, word_size), dtype = np.float32) for i in range(total): content = f.readline().strip().split() word2id[content[0]] = len(word2id) for j in range(word_size): vec[i][j] = (float)(content[j+1]) f.close() word2id['UNK'] = len(word2id) word2id['BLANK'] = len(word2id) global word_vec word_vec = vec def init_relation(): # reading relation ids... global relation2id print('reading relation ids...') f = open(data_path + "relation2id.txt","r") total = (int)(f.readline().strip()) for i in range(total): content = f.readline().strip().split() relation2id[content[0]] = int(content[1]) f.close() def sort_files(name): hash = {} f = open(data_path + name + '.txt','r') s = 0 while True: content = f.readline() if content == '': break s = s + 1 origin_data = content content = content.strip().split() en1_id = content[0] en2_id = content[1] rel_name = content[4] if rel_name in relation2id: relation = relation2id[rel_name] else: relation = relation2id['NA'] id = str(en1_id)+"#"+str(en2_id)+"#"+str(relation) if not id in hash: hash[id] = [] hash[id].append(origin_data) f.close() f = open(data_path + name + "_sort.txt", "w") f.write("%d\n"%(s)) for i in hash: for j in hash[i]: f.write(j) f.close() def sort_test_files(name): hash = {} f = open(data_path + name + '.txt','r') s = 0 while True: content = f.readline() if content == '': break s = s + 1 origin_data = content content = content.strip().split() en1_id = content[0] en2_id = content[1] rel_name = content[4] if rel_name in relation2id: relation = relation2id[rel_name] else: relation = relation2id['NA'] id = str(en1_id)+"#"+str(en2_id) if not id in hash: hash[id] = [] hash[id].append(origin_data) f.close() f = open(data_path + name + "_sort.txt", "w") f.write("%d\n"%(s)) for i in hash: for j in hash[i]: f.write(j) f.close() def init_train_files(name): print('reading ' + name +' data...') f = open(data_path + name + '.txt','r') total = (int)(f.readline().strip()) sen_word = np.zeros((total, fixlen), dtype = np.int32) sen_pos1 = np.zeros((total, fixlen), dtype = np.int32) sen_pos2 = np.zeros((total, fixlen), dtype = np.int32) sen_mask = np.zeros((total, fixlen), dtype = np.int32) sen_len = np.zeros((total), dtype = np.int32) sen_label = np.zeros((total), dtype = np.int32) instance_scope = [] instance_triple = [] for s in range(total): content = f.readline().strip().split() sentence = content[5:-1] en1_id = content[0] en2_id = content[1] en1_name = content[2] en2_name = content[3] rel_name = content[4] if rel_name in relation2id: relation = relation2id[rel_name] else: relation = relation2id['NA'] for i in range(len(sentence)): if sentence[i] == en1_name: en1pos = i if sentence[i] == en2_name: en2pos = i en_first = min(en1pos,en2pos) en_second = en1pos + en2pos - en_first for i in range(fixlen): sen_word[s][i] = word2id['BLANK'] sen_pos1[s][i] = pos_embed(i - en1pos) sen_pos2[s][i] = pos_embed(i - en2pos) if i >= len(sentence): sen_mask[s][i] = 0 elif i - en_first<=0: sen_mask[s][i] = 1 elif i - en_second<=0: sen_mask[s][i] = 2 else: sen_mask[s][i] = 3 for i, word in enumerate(sentence): if i >= fixlen: break elif not word in word2id: sen_word[s][i] = word2id['UNK'] else: sen_word[s][i] = word2id[word] sen_len[s] = min(fixlen, len(sentence)) sen_label[s] = relation tup = (en1_id,en2_id,relation) if instance_triple == [] or instance_triple[len(instance_triple) - 1] != tup: instance_triple.append(tup) instance_scope.append([s,s]) instance_scope[len(instance_triple) - 1][1] = s if (s+1) % 100 == 0: sys.stdout.write(str(s)+'\r') sys.stdout.flush() return np.array(instance_triple), np.array(instance_scope), sen_len, sen_label, sen_word, sen_pos1, sen_pos2, sen_mask def init_test_files(name): print('reading ' + name +' data...') f = open(data_path + name + '.txt','r') total = (int)(f.readline().strip()) sen_word = np.zeros((total, fixlen), dtype = np.int32) sen_pos1 = np.zeros((total, fixlen), dtype = np.int32) sen_pos2 = np.zeros((total, fixlen), dtype = np.int32) sen_mask = np.zeros((total, fixlen), dtype = np.int32) sen_len = np.zeros((total), dtype = np.int32) sen_label = np.zeros((total), dtype = np.int32) entity_pair = [] entity_scope = [] for s in range(total): content = f.readline().strip().split() sentence = content[5:-1] en1_id = content[0] en2_id = content[1] en1_name = content[2] en2_name = content[3] rel_name = content[4] if rel_name in relation2id: relation = relation2id[rel_name] else: relation = relation2id['NA'] for i in range(len(sentence)): if sentence[i] == en1_name: en1pos = i if sentence[i] == en2_name: en2pos = i en_first = min(en1pos,en2pos) en_second = en1pos + en2pos - en_first for i in range(fixlen): sen_word[s][i] = word2id['BLANK'] sen_pos1[s][i] = pos_embed(i - en1pos) sen_pos2[s][i] = pos_embed(i - en2pos) if i >= len(sentence): sen_mask[s][i] = 0 elif i - en_first<=0: sen_mask[s][i] = 1 elif i - en_second<=0: sen_mask[s][i] = 2 else: sen_mask[s][i] = 3 for i, word in enumerate(sentence): if i >= fixlen: break elif not word in word2id: sen_word[s][i] = word2id['UNK'] else: sen_word[s][i] = word2id[word] sen_len[s] = min(fixlen, len(sentence)) sen_label[s] = relation pair = (en1_id,en2_id) if entity_pair == [] or entity_pair[-1] != pair: entity_pair.append(pair) entity_scope.append([s,s]) entity_scope[-1][1] = s if (s+1) % 100 == 0: sys.stdout.write(str(s)+'\r') sys.stdout.flush() return np.array(entity_pair), np.array(entity_scope), sen_len, sen_label, sen_word, sen_pos1, sen_pos2, sen_mask def init_test_files_pn(name): print('reading ' + name +' data...') f = open(data_path + name + '.txt','r') total = (int)(f.readline().strip()) print(total) sen_word = np.zeros((total, fixlen), dtype = np.int32) sen_pos1 = np.zeros((total, fixlen), dtype = np.int32) sen_pos2 = np.zeros((total, fixlen), dtype = np.int32) sen_mask = np.zeros((total, fixlen), dtype = np.int32) sen_len = np.zeros((total), dtype = np.int32) sen_label = np.zeros((total), dtype = np.int32) entity_pair = [] entity_pair_pall = [] entity_pair_palli = [] entity_scope = [] entity_scope_pall = [] sall = 0 for s in range(total): content = f.readline().strip().split() sentence = content[5:-1] en1_id = content[0] en2_id = content[1] en1_name = content[2] en2_name = content[3] rel_name = content[4] if rel_name in relation2id: relation = relation2id[rel_name] else: relation = relation2id['NA'] for i in range(len(sentence)): if sentence[i] == en1_name: en1pos = i if sentence[i] == en2_name: en2pos = i en_first = min(en1pos,en2pos) en_second = en1pos + en2pos - en_first for i in range(fixlen): sen_word[s][i] = word2id['BLANK'] sen_pos1[s][i] = pos_embed(i - en1pos) sen_pos2[s][i] = pos_embed(i - en2pos) if i >= len(sentence): sen_mask[s][i] = 0 elif i - en_first<=0: sen_mask[s][i] = 1 elif i - en_second<=0: sen_mask[s][i] = 2 else: sen_mask[s][i] = 3 for i, word in enumerate(sentence): if i >= fixlen: break elif not word in word2id: sen_word[s][i] = word2id['UNK'] else: sen_word[s][i] = word2id[word] sen_len[s] = min(fixlen, len(sentence)) sen_label[s] = relation pair = (en1_id,en2_id) if entity_pair == [] or entity_pair[-1] != pair: if len(entity_pair) > 0: first_t = entity_scope[-1][0] last_t = entity_scope[-1][1] if last_t - first_t >= 0: entity_pair_pall.append(entity_pair[-1]) entity_pair_palli.append(len(entity_pair) - 1) entity_scope_pall.append([sall, sall + last_t - first_t]) sall = sall + 1 + last_t - first_t entity_pair.append(pair) entity_scope.append([s,s]) entity_scope[-1][1] = s if (s+1) % 100 == 0: sys.stdout.write(str(s)+'\r') sys.stdout.flush() f.close() first_t = entity_scope[-1][0] last_t = entity_scope[-1][1] if last_t - first_t >= 0: entity_pair_pall.append(entity_pair[-1]) entity_pair_palli.append(len(entity_pair) - 1) entity_scope_pall.append([sall, sall + last_t - first_t]) sall = sall + 1 + last_t - first_t index_pall = np.hstack([np.arange(entity_scope[x][0], entity_scope[x][1] + 1) for x in entity_pair_palli]) index_pone = np.hstack([np.random.randint(entity_scope[x][0], entity_scope[x][1] + 1) for x in entity_pair_palli]) index_ptwo = [] for x in entity_pair_palli: if entity_scope[x][0] == entity_scope[x][1]: index_ptwo.append(np.array([entity_scope[x][0],entity_scope[x][0]])) else: index_ptwo.append(np.random.choice(np.arange(entity_scope[x][0], entity_scope[x][1] + 1), 2, replace=False)) index_ptwo = np.hstack(index_ptwo) arrays = {} arrays['entity_pair'] = np.array(entity_pair) arrays['word'] = sen_word arrays['label'] = sen_label arrays['len'] = sen_len arrays['mask'] = sen_mask arrays['pos1'] = sen_pos1 arrays['pos2'] = sen_pos2 arrays['entity_scope'] = np.array(entity_scope) arrays['entity_pair_pn'] = np.array(entity_pair_pall) arrays['word_pall'] = sen_word[index_pall] arrays['label_pall'] = sen_label[index_pall] arrays['len_pall'] = sen_len[index_pall] arrays['mask_pall'] = sen_mask[index_pall] arrays['pos1_pall'] = sen_pos1[index_pall] arrays['pos2_pall'] = sen_pos2[index_pall] arrays['entity_scope_pall'] = np.array(entity_scope_pall) arrays['word_pone'] = sen_word[index_pone] arrays['label_pone'] = sen_label[index_pone] arrays['len_pone'] = sen_len[index_pone] arrays['mask_pone'] = sen_mask[index_pone] arrays['pos1_pone'] = sen_pos1[index_pone] arrays['pos2_pone'] = sen_pos2[index_pone] arrays['entity_scope_pone'] = np.tile(np.arange(arrays['word_pone'].shape[0]).reshape((-1, 1)), 2) arrays['word_ptwo'] = sen_word[index_ptwo] arrays['label_ptwo'] = sen_label[index_ptwo] arrays['len_ptwo'] = sen_len[index_ptwo] arrays['mask_ptwo'] = sen_mask[index_ptwo] arrays['pos1_ptwo'] = sen_pos1[index_ptwo] arrays['pos2_ptwo'] = sen_pos2[index_ptwo] arrays['entity_scope_ptwo'] = np.tile(2 * np.arange(arrays['word_pone'].shape[0]).reshape((-1, 1)), 2) arrays['entity_scope_ptwo'][:, 1] = arrays['entity_scope_ptwo'][:, 1] + 1 fin = open(data_path + name + '.txt', 'r').readlines()[1:] fout = open(data_path + name + '_pall.txt', 'w') fout.write('{}\n'.format(sall)) _ = [fout.write(fin[x]) for x in index_pall] assert_equal(len(_), sall) fout.close() fout = open(data_path + name + '_pone.txt', 'w') fout.write('{}\n'.format(arrays['word_pone'].shape[0])) _ = [fout.write(fin[x]) for x in index_pone] fout.close() fout = open(data_path + name + '_ptwo.txt', 'w') fout.write('{}\n'.format(arrays['word_ptwo'].shape[0])) _ = [fout.write(fin[x]) for x in index_pall] fout.close() return arrays init_word() init_relation() np.save(export_path+'vec', word_vec) json.dump({ "word2id":word2id, "relation2id":relation2id, "word_size":word_size, "fixlen":fixlen, "maxlen":maxlen }, open(export_path+'config', "wt")) sort_files("train") instance_triple, instance_scope, train_len, train_label, train_word, train_pos1, train_pos2, train_mask = init_train_files("train_sort") np.save(export_path+'train_instance_triple', instance_triple) np.save(export_path+'train_instance_scope', instance_scope) np.save(export_path+'train_len', train_len) np.save(export_path+'train_label', train_label) np.save(export_path+'train_word', train_word) np.save(export_path+'train_pos1', train_pos1) np.save(export_path+'train_pos2', train_pos2) np.save(export_path+'train_mask', train_mask) sort_test_files("test") instance_triple, instance_scope, test_len, test_label, test_word, test_pos1, test_pos2, test_mask = init_test_files("test_sort") np.save(export_path+'test_entity_pair', instance_triple) np.save(export_path+'test_entity_scope', instance_scope) np.save(export_path+'test_len', test_len) np.save(export_path+'test_label', test_label) np.save(export_path+'test_word', test_word) np.save(export_path+'test_pos1', test_pos1) np.save(export_path+'test_pos2', test_pos2) np.save(export_path+'test_mask', test_mask) for name, data in init_test_files_pn("test_sort").items(): np.save(export_path + 'pn/test_' + name + '.npy', data) # initialize bag label for test label = np.load('./data/test_label.npy') scope = np.load('./data/test_entity_scope.npy') all_true_label = np.zeros((scope.shape[0], 53)) for pid in range(scope.shape[0]): all_true_label[pid][label[scope[pid][0]:scope[pid][1]+1]] = 1 all_true_label = np.reshape(all_true_label[:, 1:], -1) np.save('./data/all_true_label.npy', all_true_label) label = np.load('./data/pn/test_label_pone.npy') scope = np.load('./data/pn/test_entity_scope_pone.npy') all_true_label = np.zeros((scope.shape[0], 53)) for pid in range(scope.shape[0]): all_true_label[pid][label[scope[pid][0]:scope[pid][1]+1]] = 1 all_true_label = np.reshape(all_true_label[:, 1:], -1) np.save('./data/pn/true_label.npy', all_true_label)
34.517895
136
0.582886
7949cf3e53dc7fa3d65da4affdc230ffc54a5f82
1,302
py
Python
test.py
samadams13/Linux-Email-Automation
202fcac287f3c4cb71892d85b47a7c8a6dd6dc42
[ "MIT" ]
null
null
null
test.py
samadams13/Linux-Email-Automation
202fcac287f3c4cb71892d85b47a7c8a6dd6dc42
[ "MIT" ]
null
null
null
test.py
samadams13/Linux-Email-Automation
202fcac287f3c4cb71892d85b47a7c8a6dd6dc42
[ "MIT" ]
null
null
null
import smtplib, ssl, time, os from email.mime.text import MIMEText from email.mime.image import MIMEImage from email.mime.multipart import MIMEMultipart ''' This file takes the SMTP Sender Email address, Receiver Email address as inputs and sends a mail with a specific message using GMail as the SMTP server. This file is useful to send mails from the commandline or programmatically without opening a browser ''' port = 465 # For SSL smtp_server = "smtp.gmail.com" sender_email = "" # Enter sender's email receiver_email = "" # Enter receiver address password = "" #Enter sender's pass date = time.ctime() message = MIMEMultipart() text = MIMEText("""\ Subject: [Web Development Course Reminder] This message is sent because you have took oath that you will study daily web development. So, start now. Current Time/Date: {date} --Abhishek Raj --Naam to suna hi hoga.""") message.attach(text) #attaches text to the email img_data = open('', 'rb').read() #Enter image filename image = MIMEImage(img_data, name=os.path.basename()) #Enter image filename message.attach(image) #attaches image to the email context = ssl.create_default_context() with smtplib.SMTP_SSL(smtp_server, port) as server: server.login(sender_email, password) server.sendmail(sender_email, receiver_email, message)
36.166667
105
0.764209
7949cf46c6daf77a9c65c056672897139376c8b0
4,127
py
Python
mypy/erasetype.py
crusaderky/mypy
b29a4330d2d7d1032c30a1990e7f1c477db070fd
[ "PSF-2.0" ]
null
null
null
mypy/erasetype.py
crusaderky/mypy
b29a4330d2d7d1032c30a1990e7f1c477db070fd
[ "PSF-2.0" ]
null
null
null
mypy/erasetype.py
crusaderky/mypy
b29a4330d2d7d1032c30a1990e7f1c477db070fd
[ "PSF-2.0" ]
null
null
null
from typing import Optional, Container, Callable from mypy.types import ( Type, TypeVisitor, UnboundType, AnyType, NoneType, TypeVarId, Instance, TypeVarType, CallableType, TupleType, TypedDictType, UnionType, Overloaded, ErasedType, PartialType, DeletedType, TypeTranslator, UninhabitedType, TypeType, TypeOfAny, LiteralType, ) from mypy.nodes import ARG_STAR, ARG_STAR2 def erase_type(typ: Type) -> Type: """Erase any type variables from a type. Also replace tuple types with the corresponding concrete types. Examples: A -> A B[X] -> B[Any] Tuple[A, B] -> tuple Callable[[A1, A2, ...], R] -> Callable[..., Any] Type[X] -> Type[Any] """ return typ.accept(EraseTypeVisitor()) class EraseTypeVisitor(TypeVisitor[Type]): def visit_unbound_type(self, t: UnboundType) -> Type: # TODO: replace with an assert after UnboundType can't leak from semantic analysis. return AnyType(TypeOfAny.from_error) def visit_any(self, t: AnyType) -> Type: return t def visit_none_type(self, t: NoneType) -> Type: return t def visit_uninhabited_type(self, t: UninhabitedType) -> Type: return t def visit_erased_type(self, t: ErasedType) -> Type: # Should not get here. raise RuntimeError() def visit_partial_type(self, t: PartialType) -> Type: # Should not get here. raise RuntimeError() def visit_deleted_type(self, t: DeletedType) -> Type: return t def visit_instance(self, t: Instance) -> Type: return Instance(t.type, [AnyType(TypeOfAny.special_form)] * len(t.args), t.line) def visit_type_var(self, t: TypeVarType) -> Type: return AnyType(TypeOfAny.special_form) def visit_callable_type(self, t: CallableType) -> Type: # We must preserve the fallback type for overload resolution to work. any_type = AnyType(TypeOfAny.special_form) return CallableType( arg_types=[any_type, any_type], arg_kinds=[ARG_STAR, ARG_STAR2], arg_names=[None, None], ret_type=any_type, fallback=t.fallback, is_ellipsis_args=True, implicit=True, ) def visit_overloaded(self, t: Overloaded) -> Type: return t.fallback.accept(self) def visit_tuple_type(self, t: TupleType) -> Type: return t.partial_fallback.accept(self) def visit_typeddict_type(self, t: TypedDictType) -> Type: return t.fallback.accept(self) def visit_literal_type(self, t: LiteralType) -> Type: # The fallback for literal types should always be either # something like int or str, or an enum class -- types that # don't contain any TypeVars. So there's no need to visit it. return t def visit_union_type(self, t: UnionType) -> Type: erased_items = [erase_type(item) for item in t.items] return UnionType.make_simplified_union(erased_items) def visit_type_type(self, t: TypeType) -> Type: return TypeType.make_normalized(t.item.accept(self), line=t.line) def erase_typevars(t: Type, ids_to_erase: Optional[Container[TypeVarId]] = None) -> Type: """Replace all type variables in a type with any, or just the ones in the provided collection. """ def erase_id(id: TypeVarId) -> bool: if ids_to_erase is None: return True return id in ids_to_erase return t.accept(TypeVarEraser(erase_id, AnyType(TypeOfAny.special_form))) def replace_meta_vars(t: Type, target_type: Type) -> Type: """Replace unification variables in a type with the target type.""" return t.accept(TypeVarEraser(lambda id: id.is_meta_var(), target_type)) class TypeVarEraser(TypeTranslator): """Implementation of type erasure""" def __init__(self, erase_id: Callable[[TypeVarId], bool], replacement: Type) -> None: self.erase_id = erase_id self.replacement = replacement def visit_type_var(self, t: TypeVarType) -> Type: if self.erase_id(t.id): return self.replacement return t
33.827869
91
0.665617
7949d04136353b10331d93a21f465e4406fa8185
1,573
py
Python
setup.py
tspp520/PaddleX
5f3974c7ba7b378cc2969b8609a7ee682e59a5c1
[ "Apache-2.0" ]
1
2020-05-06T13:07:18.000Z
2020-05-06T13:07:18.000Z
setup.py
chunfeng0301/PaddleX
5f3974c7ba7b378cc2969b8609a7ee682e59a5c1
[ "Apache-2.0" ]
null
null
null
setup.py
chunfeng0301/PaddleX
5f3974c7ba7b378cc2969b8609a7ee682e59a5c1
[ "Apache-2.0" ]
null
null
null
# copyright (c) 2020 PaddlePaddle Authors. All Rights Reserve. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import setuptools import sys long_description = "PaddleX. A end-to-end deeplearning model development toolkit base on PaddlePaddle\n\n" setuptools.setup( name="paddlex", version='0.1.5', author="paddlex", author_email="paddlex@baidu.com", description=long_description, long_description=long_description, long_description_content_type="text/plain", url="https://github.com/PaddlePaddle/PaddleX", packages=setuptools.find_packages(), setup_requires=['cython', 'numpy', 'sklearn'], install_requires=[ 'pycocotools', 'pyyaml', 'colorama', 'tqdm', 'visualdl==1.3.0', 'paddleslim==1.0.1', 'paddlehub>=1.6.2' ], classifiers=[ "Programming Language :: Python :: 3", "License :: OSI Approved :: Apache Software License", "Operating System :: OS Independent", ], license='Apache 2.0', entry_points={'console_scripts': [ 'paddlex=paddlex.command:main', ]})
35.75
106
0.699936
7949d06455dc32bde6b56923227a5e16ecd95225
577
py
Python
Python/venv/lib/python3.6/site-packages/png/__init__.py
Nyahmi/ET-WorldGenerator
7506102ca1116536ebcdcdb352cf96b93cd53120
[ "MIT" ]
null
null
null
Python/venv/lib/python3.6/site-packages/png/__init__.py
Nyahmi/ET-WorldGenerator
7506102ca1116536ebcdcdb352cf96b93cd53120
[ "MIT" ]
null
null
null
Python/venv/lib/python3.6/site-packages/png/__init__.py
Nyahmi/ET-WorldGenerator
7506102ca1116536ebcdcdb352cf96b93cd53120
[ "MIT" ]
null
null
null
try: exec("from .png import *", globals(), locals()) # Following methods are not parts of API and imports only for unittest exec("from .png import _main", globals(), locals()) exec("from .png import strtobytes", globals(), locals()) exec("from .png import array", globals(), locals()) except SyntaxError: # On Python < 2.5 relative import cause syntax error from png import * # Following methods are not parts of API and imports only for unittest from png import _main from png import strtobytes from png import array
41.214286
76
0.668977
7949d0c48c5314b5696589328376a79ccc061186
5,131
py
Python
colossus/apps/campaigns/api.py
hrithik098/colossus
9544838dfc2ab75895d8605d1480fd019b107828
[ "MIT" ]
6
2021-02-08T02:46:48.000Z
2021-03-29T10:26:58.000Z
colossus/apps/campaigns/api.py
qube-ai/colossus
9544838dfc2ab75895d8605d1480fd019b107828
[ "MIT" ]
null
null
null
colossus/apps/campaigns/api.py
qube-ai/colossus
9544838dfc2ab75895d8605d1480fd019b107828
[ "MIT" ]
null
null
null
import logging import re from smtplib import SMTPException import html2text from django.contrib.sites.shortcuts import get_current_site from django.core.mail import EmailMultiAlternatives from django.utils import timezone from django.utils.translation import gettext as _ from colossus.apps.campaigns.constants import CampaignStatus from colossus.apps.subscribers.constants import ActivityTypes from colossus.utils import get_absolute_url, get_campaign_connection logger = logging.getLogger(__name__) def get_test_email_context(**kwargs): if 'sub' not in kwargs: kwargs['sub'] = '#' if 'unsub' not in kwargs: kwargs['unsub'] = '#' if 'name' not in kwargs: kwargs['name'] = '<< Test Name >>' if 'uuid' not in kwargs: kwargs['uuid'] = '[SUBSCRIBER_UUID]' return kwargs def send_campaign_email(email, context, to, connection=None, is_test=False): if isinstance(to, str): to = [to, ] subject = email.subject if is_test: subject = '[%s] %s' % (_('Test'), subject) rich_text_message = email.render(context) plain_text_message = html2text.html2text(rich_text_message, bodywidth=2000) # Remove track open from plain text version plain_text_message = re.sub(r'(!\[\]\(https?://.*/track/open/.*/\)\n\n)', '', plain_text_message, 1) headers = dict() if not is_test: headers['List-ID'] = '%s <%s.list-id.%s>' % ( email.campaign.mailing_list.name, email.campaign.mailing_list.uuid, context['domain'] ), headers['List-Post'] = 'NO', headers['List-Unsubscribe-Post'] = 'List-Unsubscribe=One-Click' list_subscribe_header = ['<%s>' % context['sub']] list_unsubscribe_header = ['<%s>' % context['unsub']] if email.campaign.mailing_list.list_manager: list_subscribe_header.append('<mailto:%s?subject=subscribe>' % email.campaign.mailing_list.list_manager) list_unsubscribe_header.append( '<mailto:%s?subject=unsubscribe>' % email.campaign.mailing_list.list_manager ) headers['List-Subscribe'] = ', '.join(list_subscribe_header) headers['List-Unsubscribe'] = ', '.join(list_unsubscribe_header) message = EmailMultiAlternatives( subject=subject, body=plain_text_message, from_email=email.get_from(), to=to, connection=connection, headers=headers ) message.attach_alternative(rich_text_message, 'text/html') try: message.send(fail_silently=False) return True except SMTPException: logger.exception('Could not send email "%s" due to SMTP error.' % email.uuid) return False def send_campaign_email_subscriber(email, subscriber, site, connection=None): unsubscribe_absolute_url = get_absolute_url('subscribers:unsubscribe', kwargs={ 'mailing_list_uuid': email.campaign.mailing_list.uuid, 'subscriber_uuid': subscriber.uuid, 'campaign_uuid': email.campaign.uuid }) subscribe_absolute_url = get_absolute_url('subscribers:subscribe', kwargs={ 'mailing_list_uuid': email.campaign.mailing_list.uuid }) context = { 'domain': site.domain, 'uuid': subscriber.uuid, 'name': subscriber.name, 'sub': subscribe_absolute_url, 'unsub': unsubscribe_absolute_url } return send_campaign_email(email, context, subscriber.get_email(), connection) def send_campaign_email_test(email, recipient_list, connection=None): if email.campaign.mailing_list is not None: unsubscribe_absolute_url = get_absolute_url('subscribers:unsubscribe_manual', kwargs={ 'mailing_list_uuid': email.campaign.mailing_list.uuid }) else: unsubscribe_absolute_url = '#' context = get_test_email_context(unsub=unsubscribe_absolute_url) return send_campaign_email(email, context, recipient_list, is_test=True, connection=connection) def send_campaign(campaign): connection = get_campaign_connection(campaign=campaign) campaign.status = CampaignStatus.DELIVERING campaign.save(update_fields=['status']) site = get_current_site(request=None) # get site based on SITE_ID if campaign.track_clicks: campaign.email.enable_click_tracking() if campaign.track_opens: campaign.email.enable_open_tracking() with connection: for subscriber in campaign.get_recipients(): if not subscriber.activities.filter(activity_type=ActivityTypes.SENT, email=campaign.email).exists(): sent = send_campaign_email_subscriber(campaign.email, subscriber, site, connection) if sent: subscriber.create_activity(ActivityTypes.SENT, email=campaign.email) subscriber.update_open_and_click_rate() subscriber.last_sent = timezone.now() subscriber.save(update_fields=['last_sent']) campaign.mailing_list.update_open_and_click_rate() campaign.status = CampaignStatus.SENT campaign.save(update_fields=['status'])
36.913669
116
0.682908
7949d0da585f467394c19cbf96fb5353ce29be6d
1,076
py
Python
src/games/domino/module/players/strategies/alphazero.py
2kodevs/cooperAItive
910c4c1cb356e3c404ce4b9a64c812cab3333742
[ "MIT" ]
1
2021-09-16T12:58:24.000Z
2021-09-16T12:58:24.000Z
src/games/domino/module/players/strategies/alphazero.py
2kodevs/cooperAItive
910c4c1cb356e3c404ce4b9a64c812cab3333742
[ "MIT" ]
3
2021-09-08T23:20:20.000Z
2022-01-30T22:45:44.000Z
src/games/domino/module/players/strategies/alphazero.py
2kodevs/cooperAItive
910c4c1cb356e3c404ce4b9a64c812cab3333742
[ "MIT" ]
null
null
null
from ..player import BasePlayer from .utils.alphazero import encoder_generator, rollout_maker, selector_maker from .utils.mc import monte_carlo from .models import AlphaZeroNet from .utils import parse_bool class AlphaZero(BasePlayer): def __init__(self, name, handouts, rollouts, NN, tag='', load_model=True): super().__init__(f'AlphaZero::{name}') if isinstance(NN, str): _, self.NN = AlphaZeroNet().load(NN, tag, load_model=parse_bool(load_model)) else: self.NN = NN self.handouts = int(handouts) self.rollouts = int(rollouts) def filter(self, valids): data = {} selector = selector_maker(data, self.valid_moves(), self.pieces_per_player - len(self.pieces), False, 6) encoder = encoder_generator(self.max_number) rollout = rollout_maker(data, self.NN) _, action, *_ = monte_carlo( self, encoder, rollout, selector, self.handouts, self.rollouts, ) return [action]
30.742857
112
0.618959
7949d1c2f88e8fdb6e561cdfd1e2e96f9ed13e1f
779
py
Python
qmpy/analysis/thermodynamics/tests.py
tachyontraveler/qmpy
f024de3aa85d4367cd31775bd53eede30c74c083
[ "MIT" ]
103
2015-02-13T16:51:59.000Z
2022-03-24T22:08:54.000Z
qmpy/analysis/thermodynamics/tests.py
tachyontraveler/qmpy
f024de3aa85d4367cd31775bd53eede30c74c083
[ "MIT" ]
59
2015-12-02T22:43:21.000Z
2022-03-28T03:54:44.000Z
qmpy/analysis/thermodynamics/tests.py
tachyontraveler/qmpy
f024de3aa85d4367cd31775bd53eede30c74c083
[ "MIT" ]
62
2015-02-24T21:58:59.000Z
2022-03-21T16:49:09.000Z
from django.test import TestCase from qmpy.analysis.thermodynamics import * class PhaseTestCase(TestCase): def test_create(self): test = Phase(composition={"Li": 2, "Fe": 4, "O": 6}, energy=-1.2345) self.assertEqual(test.name, "LiFe2O3") self.assertEqual(test.space, set(["Fe", "Li", "O"])) self.assertEqual( test.unit_comp, {"Fe": 0.33333333333333331, "O": 0.5, "Li": 0.16666666666666666}, ) self.assertEqual(test.nom_comp, {"Fe": 2, "O": 3, "Li": 1}) self.assertEqual(test.comp, {"Fe": 4, "O": 6, "Li": 2}) self.assertEqual(test.latex, "Li$_{}$Fe$_{2}$O$_{3}$") class PhaseSpaceTestCase(TestCase): def test_create(self): test = PhaseSpace("Li-Fe-O", load="legacy.dat")
35.409091
77
0.591784
7949d1ccac73ed84545ab848531e848ec4474175
3,421
py
Python
pympler/mprofile.py
mrJean1/pympler
a24dd8f22c427e9acd7ebfd8525b3db2f4b9abfe
[ "Apache-2.0" ]
null
null
null
pympler/mprofile.py
mrJean1/pympler
a24dd8f22c427e9acd7ebfd8525b3db2f4b9abfe
[ "Apache-2.0" ]
null
null
null
pympler/mprofile.py
mrJean1/pympler
a24dd8f22c427e9acd7ebfd8525b3db2f4b9abfe
[ "Apache-2.0" ]
2
2018-04-04T17:13:01.000Z
2018-04-17T21:15:25.000Z
""" Memory usage profiler for Python. """ import inspect import sys from pympler import muppy class MProfiler(object): """A memory usage profiler class. Memory data for each function is stored as a 3-element list in the dictionary self.memories. The index is always a codepoint (see below). The following are the definitions of the members: [0] = The number of times this function was called [1] = Minimum memory consumption when this function was measured. [2] = Maximum memory consumption when this function was measured. A codepoint is a list of 3-tuple of the type (filename, functionname, linenumber). You can omit either element, which will cause the profiling to be triggered if any of the other criteria match. E.g. - (None, foo, None), will profile any foo function, - (bar, foo, None) will profile only the foo function from the bar file, - (bar, foo, 17) will profile only line 17 of the foo function defined in the file bar. Additionally, you can define on what events you want the profiling be triggered. Possible events are defined in http://docs.python.org/lib/debugger-hooks.html. If you do not define either codepoints or events, the profiler will record the memory usage in at every codepoint and event. """ def __init__(self, codepoints=None, events=None): """ keyword arguments: codepoints -- a list of points in code to monitor (defaults to all codepoints) events -- a list of events to monitor (defaults to all events) """ self.memories = {} self.codepoints = codepoints self.events = events def codepoint_included(self, codepoint): """Check if codepoint matches any of the defined codepoints.""" if self.codepoints is None: return True for cp in self.codepoints: mismatch = False for i in range(len(cp)): if (cp[i] is not None) and (cp[i] != codepoint[i]): mismatch = True break if not mismatch: return True return False def profile(self, frame, event, arg): # arg req to match signature """Profiling method used to profile matching codepoints and events.""" if (self.events is None) or (event in self.events): frame_info = inspect.getframeinfo(frame) cp = (frame_info[0], frame_info[2], frame_info[1]) if self.codepoint_included(cp): objects = muppy.get_objects() size = muppy.get_size(objects) if cp not in self.memories: self.memories[cp] = [0, 0, 0, 0] self.memories[cp][0] = 1 self.memories[cp][1] = size self.memories[cp][2] = size else: self.memories[cp][0] += 1 if self.memories[cp][1] > size: self.memories[cp][1] = size if self.memories[cp][2] < size: self.memories[cp][2] = size def run(self, cmd): sys.setprofile(self.profile) try: exec(cmd) finally: sys.setprofile(None) return self if __name__ == "__main__": p = MProfiler() p.run("print 'hello'") print(p.memories)
35.268041
78
0.590763
7949d218e56a09f778ca6ed4aeefa53bf31bdd01
5,147
py
Python
pl_bolts/datamodules/ssl_imagenet_datamodule.py
btwardow/pytorch-lightning-bolts
4a7b6ffe0fcbeee37f8bac6af1e926469b2052bf
[ "Apache-2.0" ]
1
2021-06-28T03:24:11.000Z
2021-06-28T03:24:11.000Z
pl_bolts/datamodules/ssl_imagenet_datamodule.py
btwardow/pytorch-lightning-bolts
4a7b6ffe0fcbeee37f8bac6af1e926469b2052bf
[ "Apache-2.0" ]
null
null
null
pl_bolts/datamodules/ssl_imagenet_datamodule.py
btwardow/pytorch-lightning-bolts
4a7b6ffe0fcbeee37f8bac6af1e926469b2052bf
[ "Apache-2.0" ]
null
null
null
import os from pytorch_lightning import LightningDataModule from torch.utils.data import DataLoader from pl_bolts.datasets.imagenet_dataset import UnlabeledImagenet from pl_bolts.transforms.dataset_normalizations import imagenet_normalization from pl_bolts.utils import _TORCHVISION_AVAILABLE from pl_bolts.utils.warnings import warn_missing_pkg if _TORCHVISION_AVAILABLE: from torchvision import transforms as transform_lib else: warn_missing_pkg('torchvision') # pragma: no-cover class SSLImagenetDataModule(LightningDataModule): # pragma: no cover name = 'imagenet' def __init__( self, data_dir, meta_dir=None, num_workers=16, batch_size: int = 32, shuffle: bool = False, pin_memory: bool = False, drop_last: bool = False, *args, **kwargs, ): super().__init__(*args, **kwargs) if not _TORCHVISION_AVAILABLE: raise ModuleNotFoundError( # pragma: no-cover 'You want to use ImageNet dataset loaded from `torchvision` which is not installed yet.' ) self.data_dir = data_dir self.num_workers = num_workers self.meta_dir = meta_dir self.batch_size = batch_size self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last @property def num_classes(self): return 1000 def _verify_splits(self, data_dir, split): dirs = os.listdir(data_dir) if split not in dirs: raise FileNotFoundError( f'a {split} Imagenet split was not found in {data_dir}, make sure the' f' folder contains a subfolder named {split}' ) def prepare_data(self): # imagenet cannot be downloaded... must provide path to folder with the train/val splits self._verify_splits(self.data_dir, 'train') self._verify_splits(self.data_dir, 'val') for split in ['train', 'val']: files = os.listdir(os.path.join(self.data_dir, split)) if 'meta.bin' not in files: raise FileNotFoundError( """ no meta.bin present. Imagenet is no longer automatically downloaded by PyTorch. To get imagenet: 1. download yourself from http://www.image-net.org/challenges/LSVRC/2012/downloads 2. download the devkit (ILSVRC2012_devkit_t12.tar.gz) 3. generate the meta.bin file using the devkit 4. copy the meta.bin file into both train and val split folders To generate the meta.bin do the following: from pl_bolts.datamodules.imagenet_dataset import UnlabeledImagenet path = '/path/to/folder/with/ILSVRC2012_devkit_t12.tar.gz/' UnlabeledImagenet.generate_meta_bins(path) """ ) def train_dataloader(self, num_images_per_class=-1, add_normalize=False): transforms = self._default_transforms() if self.train_transforms is None else self.train_transforms dataset = UnlabeledImagenet( self.data_dir, num_imgs_per_class=num_images_per_class, meta_dir=self.meta_dir, split='train', transform=transforms ) loader = DataLoader( dataset, batch_size=self.batch_size, shuffle=self.shuffle, num_workers=self.num_workers, drop_last=self.drop_last, pin_memory=self.pin_memory ) return loader def val_dataloader(self, num_images_per_class=50, add_normalize=False): transforms = self._default_transforms() if self.val_transforms is None else self.val_transforms dataset = UnlabeledImagenet( self.data_dir, num_imgs_per_class_val_split=num_images_per_class, meta_dir=self.meta_dir, split='val', transform=transforms ) loader = DataLoader( dataset, batch_size=self.batch_size, shuffle=False, num_workers=self.num_workers, drop_last=self.drop_last, pin_memory=self.pin_memory ) return loader def test_dataloader(self, num_images_per_class, add_normalize=False): transforms = self._default_transforms() if self.test_transforms is None else self.test_transforms dataset = UnlabeledImagenet( self.data_dir, num_imgs_per_class=num_images_per_class, meta_dir=self.meta_dir, split='test', transform=transforms ) loader = DataLoader( dataset, batch_size=self.batch_size, shuffle=False, num_workers=self.num_workers, drop_last=self.drop_last, pin_memory=self.pin_memory ) return loader def _default_transforms(self): mnist_transforms = transform_lib.Compose([transform_lib.ToTensor(), imagenet_normalization()]) return mnist_transforms
34.543624
107
0.628133
7949d26e5a187b3306ad26f86ec2b4816ea9b988
25,225
py
Python
Integrations/python/test/testTableTools.py
AlSpinks/deephaven-core
19686fb518229fd7e331071205cc56fca42ad943
[ "MIT" ]
null
null
null
Integrations/python/test/testTableTools.py
AlSpinks/deephaven-core
19686fb518229fd7e331071205cc56fca42ad943
[ "MIT" ]
1
2022-03-03T21:24:40.000Z
2022-03-03T21:24:54.000Z
Integrations/python/test/testTableTools.py
AlSpinks/deephaven-core
19686fb518229fd7e331071205cc56fca42ad943
[ "MIT" ]
null
null
null
# # Copyright (c) 2016-2021 Deephaven Data Labs and Patent Pending # ############################################################################## # NOTE: the jvm should have been initialized, or this test will certainly fail ############################################################################## import sys import jpy import numpy from datetime import datetime, date from deephaven import TableTools if sys.version_info[0] < 3: import unittest2 as unittest # not part of the standard library, installed via pip (or the like) # it provides backward compatibility with python3 style subTest context manager (handy for complex tests) else: import unittest class TestTableTools(unittest.TestCase): """ Test cases for the deephaven.TableTools module (performed locally) - """ @classmethod def setUpClass(self): self.nByteArray = numpy.array([1, 2, 3], dtype=numpy.int8) self.nShortArray = numpy.array([1, 2, 3], dtype=numpy.int16) self.nIntArray = numpy.array([1, 2, 3], dtype=numpy.int32) self.nLongArray = numpy.array([1, 2, 3], dtype=numpy.int64) self.nFloatArray = numpy.array([1, 2, 3], dtype=numpy.float32) self.nDoubleArray = numpy.array([1, 2, 3], dtype=numpy.float64) self.nCharArray = numpy.array(['A', 'B', 'C']) self.nStringArray = numpy.array([u'one', u'two', u'three']) self.nBooleanArray = numpy.array([True, False, True], dtype=numpy.bool) self.nTimeArray = numpy.array([1, 2, 3], dtype='datetime64[s]') self.intList = [1, 2, None] self.floatList = [1., 2., None] self.charList = ['A', 'B', None] self.stringList = [u'one', u'two', None] self.booleanList = [True, False, None] self.timeList = [datetime.utcnow(), datetime.utcnow(), datetime.utcnow()] def testTableBasics(self): """ Test cases for table creation, and a few other basic table methods: diff(), html(), show(), showCommaDelimited(), showWithIndex(), string(), roundDecimalColumns(), roundDecimalColumnsExcept(), merge(), mergeSorted() """ tab, tab2, tab3, tab4, tab5, tab6 = None, None, None, None, None, None with self.subTest(msg="emptyTable(long)"): tab = TableTools.emptyTable(3) # set some cols which aren't dumb tab = tab.update("intCol=(int)i", "fltCol=(float)i*0.5", "dblCol=(double)i*0.3") with self.subTest(msg="newTable(TableDefinition)"): # assuming the first test passed... tab3 = TableTools.newTable(tab.getDefinition()) # Essentially table to string methods with self.subTest(msg="html test"): print("html rendering = \n{}".format(TableTools.html(tab))) with self.subTest(msg="show(Table, *cols)"): print("show =") TableTools.show(tab, "intCol", "dblCol") with self.subTest(msg="show(Table, 2, *cols)"): print("show & row limit =") TableTools.show(tab, 2, "intCol", "dblCol") with self.subTest(msg="showCommaDelimited(Table, *cols)"): print("showCommaDelimited =") TableTools.showCommaDelimited(tab, "intCol", "dblCol") with self.subTest(msg="showCommaDelimited(Table, 2, *cols)"): print("showCommaDelimited & row limit =") TableTools.showCommaDelimited(tab, 2, "intCol", "dblCol") with self.subTest(msg="showWithIndex(Table, *cols)"): print("showWithIndex =") TableTools.showWithIndex(tab, "intCol", "dblCol") with self.subTest(msg="showWithIndex(Table, 2, *cols)"): print("showWithIndex & row limit =") TableTools.showWithIndex(tab, 2, "intCol", "dblCol") with self.subTest(msg="string(Table, *cols)"): print("string =\n {}".format(TableTools.string(tab, "intCol", "dblCol"))) with self.subTest(msg="string(Table, 2, *cols)"): print("string & row limit =\n {}".format(TableTools.string(tab, 2, "intCol", "dblCol"))) with self.subTest(msg="roundDecimalColumns"): tab4 = TableTools.roundDecimalColumns(tab) with self.subTest(msg="roundDecimalColumns(*cols)"): tab5 = TableTools.roundDecimalColumns(tab, "fltCol", "dblCol") with self.subTest(msg="roundDecimalColumnsExcept(*cols)"): tab6 = TableTools.roundDecimalColumns(tab, "fltCol") with self.subTest(msg="diff test of a table with itself"): print("diff output of table with itself = \n{}".format(TableTools.diff(tab, tab, 3))) with self.subTest(msg="diff test of a table with rounded version of itself"): print("diff output of table with rounded version of itself = \n{}".format(TableTools.diff(tab, tab4, 3))) with self.subTest(msg="merge(*tables)"): tab4 = TableTools.merge(tab, tab) with self.subTest(msg="merge([tables])"): tab4 = TableTools.merge([tab, tab]) with self.subTest(msg="mergeSorted(col, [tables])"): tab4 = TableTools.mergeSorted("intCol", [tab, tab]) with self.subTest(msg="merge(col, *tables)"): tab4 = TableTools.mergeSorted("intCol", tab, tab) del tab, tab2, tab3, tab4, tab5, tab6 def testColumnHolder(self): """ Test cases for <primitive>Col() methods & associated newTable() method """ holders = [] junk, tab = None, None with self.subTest(msg="byteCol"): holders.append(TableTools.byteCol("byteCol", self.nByteArray)) with self.subTest(msg="shortCol"): holders.append(TableTools.shortCol("shortCol", self.nShortArray)) with self.subTest(msg="intCol"): holders.append(TableTools.intCol("intCol", self.nIntArray)) with self.subTest(msg="longCol"): holders.append(TableTools.longCol("longCol", self.nLongArray)) with self.subTest(msg="floatCol"): holders.append(TableTools.floatCol("floatCol", self.floatList)) with self.subTest(msg="doubleCol"): holders.append(TableTools.doubleCol("doubleCol", self.nDoubleArray)) with self.subTest(msg="charCol"): holders.append(TableTools.charCol("charCol", self.nCharArray)) with self.subTest(msg="newTable with column holders"): self.assertGreater(len(holders), 0) # make sure that we even do something useful tab = TableTools.newTable(*holders) print("tab =\n{}".format(TableTools.html(tab))) del holders, tab holders = [] with self.subTest(msg="byteCol with list"): holders.append(TableTools.byteCol("byteList", self.intList)) with self.subTest(msg="shortCol with list"): holders.append(TableTools.shortCol("shortList", self.intList)) with self.subTest(msg="intCol with list"): holders.append(TableTools.intCol("intList", self.intList)) with self.subTest(msg="longCol with list"): holders.append(TableTools.longCol("longList", self.intList)) with self.subTest(msg="floatCol with list"): holders.append(TableTools.doubleCol("floatList", self.floatList)) with self.subTest(msg="doubleCol with list"): holders.append(TableTools.doubleCol("doubleList", self.floatList)) with self.subTest(msg="charCol with list"): holders.append(TableTools.charCol("charList", self.charList)) print('prim col from list = \n{}'.format(TableTools.html(TableTools.newTable(*holders)))) del holders holders = [] with self.subTest(msg="col with string array"): holders.append(TableTools.col("stringCol", self.nStringArray)) with self.subTest(msg="col with boolean array"): holders.append(TableTools.col("booleanCol", self.nBooleanArray)) with self.subTest(msg="col with time array"): holders.append(TableTools.col("timeCol", self.nTimeArray)) print('obj col = \n{}'.format(TableTools.html(TableTools.newTable(*holders)))) del holders holders = [] with self.subTest(msg="col with int list"): holders.append(TableTools.col("intList2", self.intList)) with self.subTest(msg="col with double list"): holders.append(TableTools.col("doubleList2", self.floatList)) with self.subTest(msg="col with char list"): holders.append(TableTools.col("stringList", self.stringList)) with self.subTest(msg="col with char list"): holders.append(TableTools.col("charList2", self.charList)) with self.subTest(msg="col with boolean list"): holders.append(TableTools.col("booleanList", self.booleanList)) with self.subTest(msg="col with time list"): holders.append(TableTools.col("timeList", self.timeList)) print('col from list = \n{}'.format(TableTools.html(TableTools.newTable(*holders)))) del holders holders = [] with self.subTest(msg="col with byte"): holders.append(TableTools.col("byteCol", self.nByteArray)) with self.subTest(msg="col with short"): holders.append(TableTools.col("shortCol", self.nShortArray)) with self.subTest(msg="col with int"): holders.append(TableTools.col("intCol", self.nIntArray)) with self.subTest(msg="col with long"): holders.append(TableTools.col("longCol", self.nLongArray)) with self.subTest(msg="col with float"): holders.append(TableTools.col("floatCol", self.nFloatArray)) with self.subTest(msg="col with double"): holders.append(TableTools.col("doubleCol", self.nDoubleArray)) with self.subTest(msg="col with char"): holders.append(TableTools.col("charCol", self.nCharArray)) print("primitive from col =\n{}".format(TableTools.html(TableTools.newTable(*holders)))) del holders def testColumnSource(self): """ Test cases for colSource(), objColSource() methods & associated newTable() method """ # type inference does not work for list and dicts (i.e. not converted to java collections & maps) colSources = [] names = [] mapSources = {} with self.subTest(msg="colSource with byte"): key, val = "byte", TableTools.colSource(self.nByteArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with short"): key, val = "short", TableTools.colSource(self.nShortArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with int"): key, val = "int", TableTools.colSource(self.nIntArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with long"): key, val = "long", TableTools.colSource(self.nLongArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with float"): key, val = "float", TableTools.colSource(self.nFloatArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with double"): key, val = "double", TableTools.colSource(self.nDoubleArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with char"): key, val = "char", TableTools.colSource(self.nCharArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with string"): key, val = "string", TableTools.colSource(self.nStringArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with boolean"): key, val = "boolean", TableTools.colSource(self.nBooleanArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="colSource with time"): key, val = "time", TableTools.colSource(self.nTimeArray) names.append(key) colSources.append(val) mapSources[key] = val with self.subTest(msg="newTable with name and column source list"): self.assertGreater(len(colSources), 0) # make sure that we even do something useful print("table from [names], [sources] = \n{}".format(TableTools.html(TableTools.newTable(3, names, colSources)))) with self.subTest(msg="newTable with {name: column source} map"): self.assertGreater(len(mapSources), 0) # make sure that we even do something useful print("table from [names : sources] = \n{}".format(TableTools.html(TableTools.newTable(3, mapSources)))) del names, colSources, mapSources names, colSources = [], [] with self.subTest(msg="colSource with int list"): key, val = "intList", TableTools.colSource(self.intList) names.append(key) colSources.append(val) with self.subTest(msg="colSource with float list"): key, val = "floatList", TableTools.colSource(self.floatList) names.append(key) colSources.append(val) with self.subTest(msg="colSource with string list"): key, val = "strList", TableTools.colSource(self.stringList) names.append(key) colSources.append(val) with self.subTest(msg="colSource with char list"): key, val = "charList", TableTools.colSource(self.charList) names.append(key) colSources.append(val) with self.subTest(msg="colSource with boolean list"): key, val = "boolList", TableTools.colSource(self.booleanList) names.append(key) colSources.append(val) with self.subTest(msg="colSource with time list"): key, val = "time", TableTools.colSource(self.timeList) names.append(key) colSources.append(val) print("table from colSource with lists = \n{}".format(TableTools.html(TableTools.newTable(3, names, colSources)))) del names, colSources names, colSources = [], [] with self.subTest(msg="objColSource with string"): key, val = "string", TableTools.objColSource(self.nStringArray) names.append(key) colSources.append(val) with self.subTest(msg="objColSource with boolean"): key, val = "boolean", TableTools.objColSource(self.nBooleanArray) names.append(key) colSources.append(val) with self.subTest(msg="objColSource with time"): key, val = "time", TableTools.objColSource(self.nTimeArray) names.append(key) colSources.append(val) # NOTE: this one is kinda dumb...probably not what anyone wants with self.subTest(msg="objColSource with double primitive"): key, val = "double", TableTools.objColSource(self.nDoubleArray) names.append(key) colSources.append(val) print("table from objColSource = \n{}".format(TableTools.html(TableTools.newTable(3, names, colSources)))) del names, colSources names, colSources = [], [] with self.subTest(msg="objColSource with string list"): key, val = "string", TableTools.objColSource(self.stringList) names.append(key) colSources.append(val) with self.subTest(msg="objColSource with boolean list"): key, val = "boolean", TableTools.objColSource(self.booleanList) names.append(key) colSources.append(val) with self.subTest(msg="objColSource with time list"): key, val = "time", TableTools.objColSource(self.timeList) names.append(key) colSources.append(val) # NOTE: this one is kinda dumb...probably not what anyone wants with self.subTest(msg="objColSource with float list"): key, val = "double", TableTools.objColSource(self.floatList) names.append(key) colSources.append(val) print("table from objColSource with lists = \n{}".format(TableTools.html(TableTools.newTable(3, names, colSources)))) del names, colSources @unittest.skip("what to do?") def testGetKey(self): """ Test for getKey() & getPrevKey() methods? """ # TODO: getKey(), getPrevKey() pass @unittest.skip("what to do?") def testReadFiles(self): """ Test for file reading capability? """ # TODO: readBin(), readCsv(), readHeaderlessCsv(), writeCsv() # need data files for these tests pass def testPrimitiveColCases(self): """ Testing column construction from primitive cases """ with self.subTest(msg="col with bool"): col1 = TableTools.col('bool1', numpy.array([True], dtype=numpy.bool)) self.assertEqual(col1.dataType.toString(), 'class java.lang.Boolean') # print("table from bool = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('bool2', True, False, None) self.assertEqual(col2.dataType.toString(), 'class java.lang.Boolean') # print("table from bool varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with int"): col1 = TableTools.col('int1', 1) self.assertEqual(col1.dataType.toString(), 'long') # print("table from int = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('int2', 1, 2, None) self.assertEqual(col2.dataType.toString(), 'long') # print("table from int varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with float"): col1 = TableTools.col('float1', 1.0) self.assertEqual(col1.dataType.toString(), 'double') # print("table from float = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('float2', 1.0, 2.0, None) self.assertEqual(col2.dataType.toString(), 'double') # print("table from float varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with string"): col1 = TableTools.col('string1', 'one') self.assertEqual(col1.dataType.toString(), 'class java.lang.String') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('string2', 'one', 'two', None) self.assertEqual(col2.dataType.toString(), 'class java.lang.String') # print("table from string varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with datetime"): col1 = TableTools.col('datetime1', datetime.utcnow()) self.assertEqual(col1.dataType.toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('datetime2', datetime.utcnow(), datetime.utcnow(), None) self.assertEqual(col2.dataType.toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from datetime varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with date"): col1 = TableTools.col('date1', date.today()) self.assertEqual(col1.dataType.toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(col1)))) col2 = TableTools.col('date2', date.today(), date.today(), None) self.assertEqual(col2.dataType.toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from date varargs = \n{}".format(TableTools.html(TableTools.newTable(col2)))) with self.subTest(msg="col with no argument"): col1 = TableTools.col('empty', []) self.assertEqual(col1.dataType.toString(), 'class java.lang.Object') # print("table from empty = \n{}".format(TableTools.html(TableTools.newTable(col1)))) def testPrimitiveColSourceCases(self): """ Testing column source construction from primitive cases """ with self.subTest(msg="colSource with bool"): col1 = TableTools.colSource(True) self.assertEqual(col1.getType().toString(), 'class java.lang.Boolean') # print("table from bool = \n{}".format(TableTools.html(TableTools.newTable(1, {'bool1': col1})))) col2 = TableTools.colSource(True, False, None) self.assertEqual(col2.getType().toString(), 'class java.lang.Boolean') # print("table from bool varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'bool2': col2})))) with self.subTest(msg="colSource with int"): col1 = TableTools.colSource(1) self.assertEqual(col1.getType().toString(), 'long') # print("table from int = \n{}".format(TableTools.html(TableTools.newTable(1, {'int1': col1})))) col2 = TableTools.colSource(1, 2, None) self.assertEqual(col2.getType().toString(), 'long') # print("table from int varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'int2': col2})))) with self.subTest(msg="colSource with float"): col1 = TableTools.colSource(1.0) self.assertEqual(col1.getType().toString(), 'double') # print("table from float = \n{}".format(TableTools.html(TableTools.newTable(1, {'float1': col1})))) col2 = TableTools.colSource(1.0, 2.0, None) self.assertEqual(col2.getType().toString(), 'double') # print("table from float varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'float2': col2})))) with self.subTest(msg="colSource with string"): col1 = TableTools.colSource('one') self.assertEqual(col1.getType().toString(), 'class java.lang.String') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(1, {'string1': col1})))) col2 = TableTools.colSource('one', 'two', None) self.assertEqual(col2.getType().toString(), 'class java.lang.String') # print("table from string varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'string2': col2})))) with self.subTest(msg="colSource with datetime"): col1 = TableTools.colSource(datetime.utcnow()) self.assertEqual(col1.getType().toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(1, {'datetime1': col1})))) col2 = TableTools.colSource(datetime.utcnow(), datetime.utcnow(), None) self.assertEqual(col2.getType().toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from datetime varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'datetime2': col2})))) with self.subTest(msg="colSource with date"): col1 = TableTools.colSource(date.today()) self.assertEqual(col1.getType().toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from string = \n{}".format(TableTools.html(TableTools.newTable(1, {'date1': col1})))) col2 = TableTools.colSource(date.today(), date.today(), None) self.assertEqual(col2.getType().toString(), 'class io.deephaven.db.tables.utils.DBDateTime') # print("table from date varargs = \n{}".format(TableTools.html(TableTools.newTable(3, {'date2': col2})))) def testBreakingCases(self): """ Testing some cases observed to fail previously """ tab1, tab2, tab3 = None, None, None with self.subTest(msg="charCol with list"): tab1 = TableTools.newTable(TableTools.charCol('tab1', ['A', 'B', 'C', 'D'])) print("tab1 = \n{}".format(TableTools.html(tab1))) with self.subTest(msg="charCol with string"): tab2 = TableTools.newTable(TableTools.charCol('tab2', 'EFGH')) print("tab2 = \n{}".format(TableTools.html(tab2))) with self.subTest(msg="col with single string"): tab3 = TableTools.newTable(TableTools.col('tab3', 'EFGH')) print("tab3 = \n{}".format(TableTools.html(tab3))) del tab1, tab2, tab3
49.075875
126
0.614073
7949d279bf67566ef448917878b1798a9c6560fc
221
py
Python
contrib/wallettools/walletchangepass.py
thachpv91/bapcoin85
3f889681d8487846f98f1b077ff03928b15038d8
[ "MIT" ]
null
null
null
contrib/wallettools/walletchangepass.py
thachpv91/bapcoin85
3f889681d8487846f98f1b077ff03928b15038d8
[ "MIT" ]
null
null
null
contrib/wallettools/walletchangepass.py
thachpv91/bapcoin85
3f889681d8487846f98f1b077ff03928b15038d8
[ "MIT" ]
null
null
null
from jsonrpc import ServiceProxy access = ServiceProxy("http://127.0.0.1:45882") pwd = raw_input("Enter old wallet passphrase: ") pwd2 = raw_input("Enter new wallet passphrase: ") access.walletpassphrasechange(pwd, pwd2)
36.833333
49
0.769231
7949d37ea786d83a734f17e4bc7fcfa9ab835b97
1,292
bzl
Python
dotnet/private/deps/nunit.bzl
lb5tr/rules_dotnet
43479c10ef07156a29a4265caa72db33279219db
[ "Apache-2.0" ]
null
null
null
dotnet/private/deps/nunit.bzl
lb5tr/rules_dotnet
43479c10ef07156a29a4265caa72db33279219db
[ "Apache-2.0" ]
null
null
null
dotnet/private/deps/nunit.bzl
lb5tr/rules_dotnet
43479c10ef07156a29a4265caa72db33279219db
[ "Apache-2.0" ]
null
null
null
load("@bazel_tools//tools/build_defs/repo:http.bzl", "http_archive", "http_file") def dotnet_repositories_nunit(): http_file( name = "nuget", urls = ["https://dist.nuget.org/win-x86-commandline/v4.6.2/nuget.exe"], sha256 = "2c562c1a18d720d4885546083ec8eaad6773a6b80befb02564088cc1e55b304e", ) http_archive( name = "nunit2", url = "https://github.com/nunit/nunitv2/archive/2.6.4.zip", sha256 = "2db7b4356e7cd9ac022c3f211853e39ae7b3587915124b555c7c39f712902c28", strip_prefix = "nunitv2-2.6.4", build_file = "@io_bazel_rules_dotnet//dotnet/externals:BUILD.nunit2", ) http_archive( name = "nunit3", url = "https://www.nuget.org/api/v2/package/NUnit/3.10.1", sha256 = "3529193f6028d7f7ccc65c6cb83d62d1b1c39a7d7ba5f74036cd6b69f55b10b6", build_file = "@io_bazel_rules_dotnet//dotnet/externals:BUILD.nunit3", type = "zip", ) http_archive( name = "nunit3_consolerunner", url = "https://www.nuget.org/api/v2/package/NUnit.ConsoleRunner/3.8.0", sha256 = "785d80095c50f142727e741578297b2ef5e1a0e537e2511697ac25e8bd9fa2ae", build_file = "@io_bazel_rules_dotnet//dotnet/externals:BUILD.nunit3-consolerunner", type = "zip", )
39.151515
91
0.674923
7949d43fef3b196646bb8660a2bf6d9f524e0e1f
17,283
py
Python
omnibot/processor.py
lyft/omnibot
8e9000e872595010e4c3e294e2df39a33f05d491
[ "Apache-2.0" ]
72
2019-11-21T00:02:18.000Z
2022-01-20T02:23:09.000Z
omnibot/processor.py
lyft/omnibot
8e9000e872595010e4c3e294e2df39a33f05d491
[ "Apache-2.0" ]
30
2019-11-22T04:24:57.000Z
2021-09-24T22:50:12.000Z
omnibot/processor.py
lyft/omnibot
8e9000e872595010e4c3e294e2df39a33f05d491
[ "Apache-2.0" ]
6
2019-12-26T00:37:41.000Z
2021-04-09T04:21:17.000Z
""" Core processing logic. """ import re import json import importlib import requests from omnibot import logging from omnibot import settings from omnibot.services import slack from omnibot.services.slack.message import Message, MessageUnsupportedError from omnibot.services.slack.slash_command import SlashCommand from omnibot.services.slack.interactive_component import InteractiveComponent from omnibot.services import stats from omnibot.services.slack import parser from omnibot.services.slack.team import Team from omnibot.services.slack.bot import Bot from omnibot.utils import get_callback_id, merge_logging_context logger = logging.getLogger(__name__) def process_event(event): """ Dispatcher for slack api events. """ statsd = stats.get_statsd_client() team = Team.get_team_by_id(event['team_id']) bot = Bot.get_bot_by_bot_id(team, event['api_app_id']) event_info = event['event'] event_type = event_info['type'] event_trace = merge_logging_context( { 'event_ts': event_info['event_ts'], 'event_type': event_type, }, bot.logging_context, ) statsd.incr('event.process.attempt.{}'.format(event_type)) if event_type == 'message' or event_type == 'app_mention': try: with statsd.timer('process_event'): logger.debug( 'Processing message: {}'.format( json.dumps(event, indent=2) ), extra=event_trace ) try: message = Message(bot, event_info, event_trace) _process_message_handlers(message) except MessageUnsupportedError: pass except Exception: statsd.incr('event.process.failed.{}'.format(event_type)) logger.exception( 'Could not process message.', exc_info=True, extra=event_trace ) else: logger.debug( 'Event is not a message type.', extra=event_trace ) logger.debug(event) def _process_message_handlers(message): bot = message.bot statsd = stats.get_statsd_client() command_matched = False handler_called = False for handler in bot.message_handlers: # We only match commands against directed messages if handler['match_type'] == 'command': if not _should_handle_command(handler, message): continue # We only match against a single command if command_matched: continue if message.command_text.startswith(handler['match']): command_matched = True message.set_match('command', handler['match']) for callback in handler['callbacks']: _handle_message_callback(message, callback) handler_called = True if handler['match_type'] == 'regex': match = bool(re.search(handler['match'], message.parsed_text)) regex_should_not_match = handler.get('regex_type') == 'absence' # A matched regex should callback only if the regex is supposed to # match. An unmatched regex should callback only if the regex is # not supposed to match. if match != regex_should_not_match: message.set_match('regex', handler['match']) for callback in handler['callbacks']: _handle_message_callback(message, callback) handler_called = True if handler_called: statsd.incr('event.handled') elif not handler_called: _handle_help(message) def process_slash_command(command): """ Dispatcher for slack slash commands. """ statsd = stats.get_statsd_client() team = Team.get_team_by_id(command['team_id']) bot = Bot.get_bot_by_bot_id(team, command['omnibot_bot_id']) if command['command'].startswith('/'): command_name = command['command'][1:] else: command_name = command['command'] event_trace = merge_logging_context( { 'trigger_id': command['trigger_id'], 'command': command_name, }, bot.logging_context, ) statsd.incr('slash_command.process.attempt.{}'.format(command_name)) try: with statsd.timer('process_slash_command'): logger.debug( 'Processing slash_command: {}'.format( json.dumps(command, indent=2) ), extra=event_trace ) slash_command = SlashCommand(bot, command, event_trace) _process_slash_command_handlers(slash_command) except Exception: statsd.incr('slash_command.process.failed.{}'.format(command_name)) logger.exception( 'Could not process slash command.', exc_info=True, extra=event_trace ) def process_interactive_component(component): """ Dispatcher for slack interactive components """ statsd = stats.get_statsd_client() team = Team.get_team_by_id(component['team']['id']) bot = Bot.get_bot_by_bot_id(team, component['omnibot_bot_id']) event_trace = merge_logging_context( { 'callback_id': get_callback_id(component), 'component_type': component['type'], }, bot.logging_context, ) statsd.incr( 'interactive_component.process.attempt.{}'.format( get_callback_id(component) ) ) try: with statsd.timer('process_interactive_component'): logger.debug( 'Processing interactive component: {}'.format( json.dumps(component, indent=2) ), extra=event_trace ) interactive_component = InteractiveComponent( bot, component, event_trace ) _process_interactive_component(interactive_component) except Exception: statsd.incr( 'interactive_component.process.failed.{}'.format( get_callback_id(component) ) ) logger.exception( 'Could not process interactive component.', exc_info=True, extra=event_trace ) def _process_slash_command_handlers(command): handler_called = False for handler in command.bot.slash_command_handlers: if command.command != handler.get('command'): continue for callback in handler['callbacks']: _handle_slash_command_callback( command, callback, handler.get('response_type', 'ephemeral') ) handler_called = True if not handler_called: # TODO: send back a default help message here. pass def _process_interactive_component(component): handler_called = False for handler in component.bot.interactive_component_handlers: if component.callback_id != handler.get('callback_id'): continue for callback in handler.get('callbacks', []): _handle_interactive_component_callback( component, callback, handler.get('response_type', 'ephemeral') ) handler_called = True if not handler_called: # TODO: send back a default help message here. pass def _handle_help(message): statsd = stats.get_statsd_client() if message.directed: statsd.incr('event.defaulted') if settings.HELP_CALLBACK: _handle_message_callback( message, settings.HELP_CALLBACK['callback'] ) elif settings.DEFAULT_TO_HELP: _handle_message_callback( message, { 'module': 'omnibot.callbacks.message_callbacks:help_callback' } ) else: # TODO: respond with error message here pass else: statsd.incr('event.ignored') def _should_handle_command(handler, message): handle_mention = ( handler.get('match_mention', False) and message.mentioned ) if message.directed or handle_mention: return True else: return False def parse_kwargs(kwargs, bot, event_trace=None): if event_trace is None: event_trace = {} statsd = stats.get_statsd_client() omnibot_parse = kwargs.pop('omnibot_parse', {}) for attr, to_parse in omnibot_parse.items(): if attr not in kwargs: logger.warning( '{} not found in kwargs when parsing post response.'.format(attr), extra=event_trace ) with statsd.timer('unexpand_metadata'): if 'specials' in to_parse: kwargs[attr] = parser.unextract_specials(kwargs[attr]) if 'channels' in to_parse: kwargs[attr] = parser.unextract_channels( kwargs[attr], bot ) if 'users' in to_parse: kwargs[attr] = parser.unextract_users( kwargs[attr], bot ) def _handle_post_message(message, kwargs): try: channel = kwargs.pop('channel') except KeyError: channel = message.channel_id try: thread_ts = kwargs.pop('thread_ts') except KeyError: if message.channel.get('is_im'): thread_ts = None else: thread_ts = message.ts if thread_ts: kwargs['thread_ts'] = thread_ts parse_kwargs(kwargs, message.bot, message.event_trace) try: ret = slack.client( message.bot, ).api_call( 'chat.postMessage', channel=channel, **kwargs ) except json.decoder.JSONDecodeError: logger.exception( 'JSON decode failure when parsing {}'.format(kwargs), extra=message.event_trace, ) return logger.debug(ret, extra=message.event_trace) if not ret['ok']: logger.error(ret, extra=message.event_trace) def _handle_action(action, container, kwargs): parse_kwargs(kwargs, container.bot, container.event_trace) ret = slack.client( container.bot, ).api_call( action, **kwargs ) logger.debug( 'return from action {}: {}'.format(action, ret), extra=container.event_trace, ) if not ret['ok']: if ret.get('error') == 'missing_scope': logger.warning( 'action {} failed, attempting as user.'.format(action), extra=container.event_trace ) try: ret = slack.client( container.bot, client_type='user' ).api_call( action, **kwargs ) except json.decoder.JSONDecodeError: logger.exception( 'JSON decode failure when parsing {}'.format(kwargs), extra=container.event_trace, ) return logger.debug( 'return from action {}: {}'.format(action, ret), extra=container.event_trace, ) if not ret['ok']: logger.debug( 'return from failed action {}: {}'.format(action, ret), extra=container.event_trace, ) else: if not ret['ok']: logger.debug( 'return from failed action {}: {}'.format(action, ret), extra=container.event_trace, ) def _handle_message_callback(message, callback): logger.info( 'Handling callback for message: match_type="{}" match="{}"'.format( message.match_type, message.match ), extra={ **message.event_trace, 'module': callback['module'], 'request_kwargs': callback.get('kwargs', {}).get('request_kwargs', {}), 'client_kwargs': {'service': callback.get('kwargs', {}).get('client_kwargs', {}).get('service', "")}, }, ) response = _handle_callback(message, callback) for action in response.get('actions', []): if not isinstance(action, dict): logger.error( 'Action in response is not a dict.', extra=message.event_trace ) continue logger.debug( 'action for callback: {}'.format(action), extra=message.event_trace, ) if action['action'] == 'chat.postMessage': _handle_post_message(message, action['kwargs']) else: _handle_action(action['action'], message, action['kwargs']) def _handle_slash_command_callback(command, callback, response_type): logger.info( 'Handling callback for slash_command: command="{}"'.format( command.command ), extra={**command.event_trace, 'callback': callback}, ) response = _handle_callback(command, callback) for command_response in response.get('responses', []): logger.debug( 'Handling response for callback (pre-parse): {}'.format( json.dumps(command_response) ), extra=command.event_trace, ) if 'response_type' not in command_response: command_response['response_type'] = response_type parse_kwargs(command_response, command.bot, command.event_trace) logger.debug( 'Handling response for callback (post-parse): {}'.format( json.dumps(command_response) ), extra=command.event_trace, ) r = requests.post( command.response_url, json=command_response ) if r.status_code != requests.codes.ok: msg = 'Got status code {0} for {1}, with response: {2}' logger.error( msg.format( r.status_code, command.response_url, r.text ), extra=command.event_trace ) for action in response.get('actions', []): if not isinstance(action, dict): logger.error( 'Action in response is not a dict.', extra=command.event_trace ) continue logger.debug( 'Action in response: {}'.format(action), extra=command.event_trace, ) _handle_action(action['action'], command, action['kwargs']) def _handle_interactive_component_callback(component, callback, response_type): logger.info( 'Handling callback for interactive component', extra={**component.event_trace, 'callback': callback}, ) response = _handle_callback(component, callback) for component_response in response.get('responses', []): logger.debug( 'Handling response for callback (pre-parse): {}'.format( json.dumps(component_response) ), extra=component.event_trace, ) if 'response_type' not in component_response: component_response['response_type'] = response_type parse_kwargs(component_response, component.bot, component.event_trace) logger.debug( 'Handling response for callback (post-parse): {}'.format( json.dumps(component_response) ), extra=component.event_trace, ) r = requests.post( component.response_url, json=component_response ) if r.status_code != requests.codes.ok: msg = 'Got status code {0} for {1}, with response: {2}' logger.error( msg.format( r.status_code, component.response_url, r.text ), extra=component.event_trace ) for action in response.get('actions', []): if not isinstance(action, dict): logger.error( 'Action in response is not a dict.', extra=component.event_trace ) continue logger.debug( 'Action in response: {}'.format(action), extra=component.event_trace, ) if action['action'] == 'chat.postMessage': _handle_post_message(component, action['kwargs']) else: _handle_action(action['action'], component, action['kwargs']) def _handle_callback(container, callback): module_name, function_name = callback['module'].split(':') module = importlib.import_module(module_name) function = getattr(module, function_name) kwargs = callback.get('kwargs', {}) response = function( container=container, **kwargs ) return response
33.690058
113
0.567494
7949d51ef0576402bbde4f048ab92655db724063
7,646
py
Python
tests/extras/test_postgres.py
bharel/Yellowbox
d397d878ccd074af21f552cb1375714ba97e9e22
[ "MIT" ]
1
2020-08-07T20:02:12.000Z
2020-08-07T20:02:12.000Z
tests/extras/test_postgres.py
bharel/yellowbox
d397d878ccd074af21f552cb1375714ba97e9e22
[ "MIT" ]
null
null
null
tests/extras/test_postgres.py
bharel/yellowbox
d397d878ccd074af21f552cb1375714ba97e9e22
[ "MIT" ]
null
null
null
from pytest import fixture, mark from sqlalchemy import Column, Integer, MetaData, String, Table, create_engine, select from tests.util import unique_name_generator from yellowbox import connect, temp_network from yellowbox.containers import upload_file from yellowbox.extras.postgresql import POSTGRES_INTERNAL_PORT, PostgreSQLService from yellowbox.utils import docker_host_name @mark.parametrize('spinner', [True, False]) def test_make_pg(docker_client, spinner): with PostgreSQLService.run(docker_client, spinner=spinner): pass @mark.asyncio async def test_local_connection_async(docker_client): service: PostgreSQLService async with PostgreSQLService.arun(docker_client) as service: with service.connection() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) connection.execute(""" DELETE FROM foo WHERE x = 10; """) with service.connection() as connection: results = connection.execute(""" SELECT x, y FROM foo WHERE y like 't%%' """) vals = [row['x'] for row in results] assert vals == [2, 3] @fixture(scope='module') def service(docker_client): with PostgreSQLService.run(docker_client, spinner=False) as service: yield service db_name = fixture(unique_name_generator()) @fixture def db(service, db_name): with service.database(db_name) as db: yield db @fixture def engine(db): engine = create_engine(db.local_connection_string()) yield engine engine.dispose() def test_local_connection(engine): with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) connection.execute(""" DELETE FROM foo WHERE x = 10; """) with engine.connect() as connection: results = connection.execute(""" SELECT x, y FROM foo WHERE y like 't%%' """) vals = [row['x'] for row in results] assert vals == [2, 3] def test_sibling(docker_client, create_and_pull, engine, service, db_name): with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) container = create_and_pull( docker_client, "postgres:latest", f'psql -h {docker_host_name} -p {service.external_port()} -U {service.user} -d {db_name}' " -c 'DELETE FROM foo WHERE x < 3'", environment={'PGPASSWORD': service.password}, detach=True, ) container.start() return_status = container.wait() assert return_status["StatusCode"] == 0 with engine.connect() as connection: results = connection.execute("""SELECT y from foo""") vals = [row['y'] for row in results] assert vals == ['three', 'ten'] def test_sibling_network(docker_client, create_and_pull, engine, service, db_name): with temp_network(docker_client) as network, \ connect(network, service) as service_alias: with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) container = create_and_pull( docker_client, "postgres:latest", f'psql -h {service_alias[0]} -p {POSTGRES_INTERNAL_PORT} -U {service.user} -d {db_name}' " -c 'DELETE FROM foo WHERE x < 3'", environment={'PGPASSWORD': service.password}, detach=True, ) with connect(network, container): container.start() return_status = container.wait() assert return_status["StatusCode"] == 0 with engine.connect() as connection: results = connection.execute("SELECT y from foo") vals = [row['y'] for row in results] assert vals == ['three', 'ten'] def test_alchemy_usage(docker_client, engine): table = Table('foo', MetaData(), Column('x', Integer), Column('y', String)) with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) results = connection.execute(select([table.c.x]).where(table.c.y.like('t%'))) vals = [row['x'] for row in results] assert vals == [2, 3, 10] def test_remote_connection_string(docker_client, create_and_pull, service, engine, db): with temp_network(docker_client) as network, \ connect(network, service) as service_alias: with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) conn_string = db.container_connection_string(service_alias[0]) container = create_and_pull( docker_client, "python:latest", 'sh -c "pip install sqlalchemy psycopg2 && python ./main.py"', detach=True, ) upload_file( container, './main.py', bytes( "import sqlalchemy as sa;" f"e = sa.create_engine('{conn_string}');" "e.execute('DELETE FROM foo WHERE x < 3');", 'ascii') ) with connect(network, container): container.start() return_status = container.wait() assert return_status["StatusCode"] == 0 with engine.connect() as connection: results = connection.execute("SELECT y from foo") vals = [row['y'] for row in results] assert vals == ['three', 'ten'] def test_remote_connection_string_host(docker_client, create_and_pull, service, engine, db): with engine.connect() as connection: connection.execute(""" CREATE TABLE foo (x INTEGER, y TEXT); INSERT INTO foo VALUES (1,'one'), (2, 'two'), (3, 'three'), (10, 'ten'); """) conn_string = db.host_connection_string() container = create_and_pull( docker_client, "python:latest", 'sh -c "pip install sqlalchemy psycopg2 && python ./main.py"', detach=True, ) upload_file( container, './main.py', bytes( "import sqlalchemy as sa;" f"e = sa.create_engine('{conn_string}');" "e.execute('DELETE FROM foo WHERE x < 3');", 'ascii') ) container.start() return_status = container.wait() assert return_status["StatusCode"] == 0 with engine.connect() as connection: results = connection.execute("SELECT y from foo") vals = [row['y'] for row in results] assert vals == ['three', 'ten'] def test_mk_db(docker_client): with PostgreSQLService.run(docker_client, default_db='foo') as service: assert service.database_exists('foo') assert not service.database_exists('bar') with service.database('bar'): assert service.database_exists('foo') assert service.database_exists('bar') assert service.database_exists('foo') assert not service.database_exists('bar')
34.754545
100
0.59639
7949d6aa835152feeeb100320ea47f2697bff0aa
744
py
Python
language/Basics/dictionaries3.py
Binary-bug/Python
233425ded6abc26c889599a82a181487789e3bab
[ "MIT" ]
null
null
null
language/Basics/dictionaries3.py
Binary-bug/Python
233425ded6abc26c889599a82a181487789e3bab
[ "MIT" ]
null
null
null
language/Basics/dictionaries3.py
Binary-bug/Python
233425ded6abc26c889599a82a181487789e3bab
[ "MIT" ]
null
null
null
fruit = {"orange":"a sweet, orange, citrus fruit", "apple": " good for making cider", "lemon":"a sour, yellow citrus fruit", "grape":"a small, sweet fruit growing in bunches", "lime": "a sour, green citrus fruit", "lime":"its yellow"} print(fruit) # .items will produce a dynamic view object that looks like tuples print(fruit.items()) f_tuple = tuple(fruit.items()) print(f_tuple) for snack in f_tuple: item, description = snack print(item + "-" + description) print("-"*80) #Python allows to construct dict out of tuples print(dict(f_tuple)) # strings are actually immutable objects and concatenating two strings in a for loop # might not be efficient
25.655172
85
0.642473
7949d6d5a03d611505284f723cda9b7838fa3f81
578
py
Python
oscar/lib/python2.7/site-packages/phonenumbers/shortdata/region_AX.py
AMuratTuran/mkn
557086426773ced10d82c969304bd349414a601e
[ "BSD-3-Clause" ]
4
2018-10-19T04:36:20.000Z
2020-02-13T16:14:09.000Z
oscar/lib/python2.7/site-packages/phonenumbers/shortdata/region_AX.py
AMuratTuran/mkn
557086426773ced10d82c969304bd349414a601e
[ "BSD-3-Clause" ]
5
2020-03-24T16:37:25.000Z
2021-06-10T21:24:54.000Z
upibo-venv/Lib/site-packages/phonenumbers/shortdata/region_AX.py
smbpgroup/upibo
625dcda9f9692c62aeb9fe8f7123a5d407c610ae
[ "BSD-3-Clause" ]
null
null
null
"""Auto-generated file, do not edit by hand. AX metadata""" from ..phonemetadata import NumberFormat, PhoneNumberDesc, PhoneMetadata PHONE_METADATA_AX = PhoneMetadata(id='AX', country_code=None, international_prefix=None, general_desc=PhoneNumberDesc(national_number_pattern='1\\d{2}|75[12]\\d{2}', possible_length=(3, 5)), emergency=PhoneNumberDesc(national_number_pattern='112', example_number='112', possible_length=(3,)), short_code=PhoneNumberDesc(national_number_pattern='112|75[12]\\d{2}', example_number='112', possible_length=(3, 5)), short_data=True)
64.222222
121
0.766436
7949d6d8c6e513d0c3d178447a46b48751790cd4
10,688
py
Python
fanficfare/writers/base_writer.py
C133742/FanFicFare
66b7de966825ddf1b44f53ea72f8ebcdeeeab73b
[ "Apache-2.0" ]
1
2020-08-27T03:49:02.000Z
2020-08-27T03:49:02.000Z
fanficfare/writers/base_writer.py
C133742/FanFicFare
66b7de966825ddf1b44f53ea72f8ebcdeeeab73b
[ "Apache-2.0" ]
null
null
null
fanficfare/writers/base_writer.py
C133742/FanFicFare
66b7de966825ddf1b44f53ea72f8ebcdeeeab73b
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- # Copyright 2011 Fanficdownloader team, 2018 FanFicFare team # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from __future__ import absolute_import import re import os.path import datetime import string import zipfile from zipfile import ZipFile, ZIP_DEFLATED import logging # py2 vs py3 transition from .. import six from ..six import text_type as unicode from ..six import ensure_text from ..six import ensure_binary from ..six import BytesIO # StringIO under py2 from ..configurable import Configurable from ..htmlcleanup import removeEntities, removeAllEntities, stripHTML logger = logging.getLogger(__name__) class BaseStoryWriter(Configurable): @staticmethod def getFormatName(): return 'base' @staticmethod def getFormatExt(): return '.bse' def __init__(self, configuration, adapter): Configurable.__init__(self, configuration) self.adapter = adapter self.story = adapter.getStoryMetadataOnly() # only cache the metadata initially. self.story.setMetadata('formatname',self.getFormatName()) self.story.setMetadata('formatext',self.getFormatExt()) def getMetadata(self,key, removeallentities=False): return stripHTML(self.story.getMetadata(key, removeallentities)) def getOutputFileName(self): if self.getConfig('zip_output'): return self.getZipFileName() else: return self.getBaseFileName() def getBaseFileName(self): return self.story.formatFileName(self.getConfig('output_filename'),self.getConfig('allow_unsafe_filename')) def getZipFileName(self): return self.story.formatFileName(self.getConfig('zip_filename'),self.getConfig('allow_unsafe_filename')) def _write(self, out, text): out.write(ensure_binary(text)) def writeTitlePage(self, out, START, ENTRY, END, WIDE_ENTRY=None, NO_TITLE_ENTRY=None): """ Write the title page, but only include entries that there's metadata for. START, ENTRY and END are expected to already by string.Template(). START and END are expected to use the same names as Story.metadata, but ENTRY should use label and value. """ if self.getConfig("include_titlepage"): if self.hasConfig("titlepage_start"): START = string.Template(self.getConfig("titlepage_start")) if self.hasConfig("titlepage_entry"): ENTRY = string.Template(self.getConfig("titlepage_entry")) if self.hasConfig("titlepage_end"): END = string.Template(self.getConfig("titlepage_end")) if self.hasConfig("titlepage_wide_entry"): WIDE_ENTRY = string.Template(self.getConfig("titlepage_wide_entry")) if self.hasConfig("titlepage_no_title_entry"): NO_TITLE_ENTRY = string.Template(self.getConfig("titlepage_no_title_entry")) self._write(out,START.substitute(self.story.getAllMetadata())) if WIDE_ENTRY==None: WIDE_ENTRY=ENTRY titleEntriesList = self.getConfigList("titlepage_entries") + self.getConfigList("extra_titlepage_entries") wideTitleEntriesList = self.getConfigList("wide_titlepage_entries") for entry in titleEntriesList: if self.isValidMetaEntry(entry): if self.story.getMetadata(entry): if entry in wideTitleEntriesList: TEMPLATE=WIDE_ENTRY else: TEMPLATE=ENTRY label=self.get_label(entry) # if self.hasConfig(entry+"_label"): # label=self.getConfig(entry+"_label") # elif entry in self.titleLabels: # logger.debug("Using fallback label for %s_label"%entry) # label=self.titleLabels[entry] # else: # label="%s"%entry.title() # logger.debug("No known label for %s, fallback to '%s'"%(entry,label)) # If the label for the title entry is empty, use the # 'no title' option if there is one. if label == "" and NO_TITLE_ENTRY: TEMPLATE= NO_TITLE_ENTRY self._write(out,TEMPLATE.substitute({'label':label, 'id':entry, 'value':self.story.getMetadata(entry)})) else: self._write(out, entry) self._write(out,END.substitute(self.story.getAllMetadata())) def writeTOCPage(self, out, START, ENTRY, END): """ Write the Table of Contents page. START, ENTRY and END are expected to already by string.Template(). START and END are expected to use the same names as Story.metadata, but ENTRY should use index and chapter. """ # Only do TOC if there's more than one chapter and it's configured. if self.story.getChapterCount() > 1 and self.getConfig("include_tocpage") and not self.metaonly : if self.hasConfig("tocpage_start"): START = string.Template(self.getConfig("tocpage_start")) if self.hasConfig("tocpage_entry"): ENTRY = string.Template(self.getConfig("tocpage_entry")) if self.hasConfig("tocpage_end"): END = string.Template(self.getConfig("tocpage_end")) self._write(out,START.substitute(self.story.getAllMetadata())) for index, chap in enumerate(self.story.getChapters(fortoc=True)): if chap['html']: self._write(out,ENTRY.substitute(chap)) self._write(out,END.substitute(self.story.getAllMetadata())) # if no outstream is given, write to file. def writeStory(self,outstream=None, metaonly=False, outfilename=None, forceOverwrite=False): self.metaonly = metaonly if outfilename == None: outfilename=self.getOutputFileName() self.outfilename = outfilename # minor cheat, tucking css into metadata. if self.getConfig("output_css"): self.story.setMetadata("output_css", self.getConfig("output_css"), condremoveentities=False) else: self.story.setMetadata("output_css",'') if not outstream: close=True logger.info("Save directly to file: %s" % outfilename) if self.getConfig('make_directories'): path="" outputdirs = os.path.dirname(ensure_text(outfilename)).split('/') for dir in outputdirs: path+=dir+"/" if not os.path.exists(path): os.mkdir(path) ## os.makedirs() doesn't work in 2.5.2? ## Check for output file date vs updated date here if not (self.getConfig('always_overwrite') or forceOverwrite): if os.path.exists(outfilename): ## date() truncs off time, which files have, but sites don't report. lastupdated=self.story.getMetadataRaw('dateUpdated').date() fileupdated=datetime.datetime.fromtimestamp(os.stat(outfilename)[8]).date() if fileupdated > lastupdated: logger.warn("File(%s) Updated(%s) more recently than Story(%s) - Skipping" % (outfilename,fileupdated,lastupdated)) return if not metaonly: self.story = self.adapter.getStory() # get full story # now, just # before writing. # Fetch before # opening file. outstream = open(outfilename,"wb") else: close=False logger.debug("Save to stream") if not metaonly: self.story = self.adapter.getStory() # get full story now, # just before # writing. Okay if # double called with # above, it will only # fetch once. if self.getConfig('zip_output'): out = BytesIO() self.zipout = ZipFile(outstream, 'w', compression=ZIP_DEFLATED) self.writeStoryImpl(out) self.zipout.writestr(self.getBaseFileName(),out.getvalue()) # declares all the files created by Windows. otherwise, when # it runs in appengine, windows unzips the files as 000 perms. for zf in self.zipout.filelist: zf.create_system = 0 self.zipout.close() out.close() else: self.writeStoryImpl(outstream) if close: outstream.close() def writeFile(self, filename, data): logger.debug("writeFile:%s"%filename) if self.getConfig('zip_output'): outputdirs = os.path.dirname(self.getBaseFileName()) if outputdirs: filename=outputdirs+'/'+filename self.zipout.writestr(filename,data) else: outputdirs = os.path.dirname(self.outfilename) if outputdirs: filename=outputdirs+'/'+filename dir = os.path.dirname(filename) if not os.path.exists(dir): os.mkdir(dir) ## os.makedirs() doesn't work in 2.5.2? outstream = open(filename,"wb") outstream.write(data) outstream.close() def writeStoryImpl(self, out): "Must be overriden by sub classes." pass
40.950192
139
0.573915
7949d73dc8abd8b23ca090be1eca08da0142d808
972
py
Python
mmseg/datasets/pipelines/__init__.py
Togal-ai-Team/mmsegmentation
55f50ec84865270024d847b6e2a787693b90835d
[ "Apache-2.0" ]
null
null
null
mmseg/datasets/pipelines/__init__.py
Togal-ai-Team/mmsegmentation
55f50ec84865270024d847b6e2a787693b90835d
[ "Apache-2.0" ]
null
null
null
mmseg/datasets/pipelines/__init__.py
Togal-ai-Team/mmsegmentation
55f50ec84865270024d847b6e2a787693b90835d
[ "Apache-2.0" ]
1
2022-01-04T01:16:12.000Z
2022-01-04T01:16:12.000Z
# Copyright (c) OpenMMLab. All rights reserved. from .compose import Compose from .formatting import (Collect, ImageToTensor, ToDataContainer, ToTensor, Transpose, to_tensor) from .loading import LoadAnnotations, LoadImageFromFile from .test_time_aug import MultiScaleFlipAug from .transforms import (CLAHE, AdjustGamma, Normalize, Pad, PhotoMetricDistortion, RandomCrop, RandomCutOut, RandomFlip, RandomMosaic, RandomRotate, Rerange, Resize, RGB2Gray, SegRescale, Corrupt) __all__ = [ 'Compose', 'to_tensor', 'ToTensor', 'ImageToTensor', 'ToDataContainer', 'Transpose', 'Collect', 'LoadAnnotations', 'LoadImageFromFile', 'MultiScaleFlipAug', 'Resize', 'RandomFlip', 'Pad', 'RandomCrop', 'Normalize', 'SegRescale', 'PhotoMetricDistortion', 'RandomRotate', 'AdjustGamma', 'CLAHE', 'Rerange', 'RGB2Gray', 'RandomCutOut', 'RandomMosaic', 'Corrupt' ]
48.6
75
0.679012
7949d7bd3525ca9e3e3fbff3c6337b5c402d6886
41,857
py
Python
cup/util/conf.py
0xflotus/CUP
5e4330cb2e4ccdc67ad94f0084e745eed6f96d6b
[ "Apache-2.0" ]
null
null
null
cup/util/conf.py
0xflotus/CUP
5e4330cb2e4ccdc67ad94f0084e745eed6f96d6b
[ "Apache-2.0" ]
null
null
null
cup/util/conf.py
0xflotus/CUP
5e4330cb2e4ccdc67ad94f0084e745eed6f96d6b
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env python # -*- coding: utf-8 -* # Copyright: [CUP] - See LICENSE for details. # Authors: Liu.Jia@baidu, Guannan Ma (@mythmgn), """ :description: Complex and constructive conf support """ import os import time import copy import shutil from xml.dom import minidom # import subprocess import json import cup # G_TOOL_PATH = None __all__ = [ 'Configure2Dict', 'Dict2Configure', 'HdfsXmlConf' ] class CConf(object): """ Depreciated class. Please do not use it. Use python configparser instead. """ def __init__(self, path, name, revert_version=''): self.name = name self.path = path self.file_abspath = self.path + '/' + self.name self.exclude = ['# ', '['] self.sep = ':' self.bakfile = self.path + '/' + self.name + '.bak.' + revert_version def __del__(self): if os.path.exists(self.bakfile): os.unlink(self.bakfile) def _backup(self, new_bakfile): shutil.copyfile(self.file_abspath, new_bakfile) def __getitem__(self, key): with open(self.file_abspath) as src: value = '' for line in src.readlines(): if len(line) > 0 and line[0] not in self.exclude: spstrs = line.split(':') k = spstrs[0].strip() if k == key: value = spstrs[1].strip() return value def __len__(self): """ This function should not be used """ return 0 def update(self, kvs): """ update conf with a dict. dict = {'key' : 'value', 'key1': 'value'} """ self._backup(self.bakfile) with open(self.bakfile) as src: with open(self.file_abspath, 'w') as trg: for line in src.readlines(): if len(line) > 0 and line[0] not in self.exclude: splist = line.splistlit(':') k = splist[0].strip() if k in kvs.keys(): line = k + ' : ' + kvs[k] + '\n' trg.write(line) def revert(self): """ revert the conf """ os.rename(self.bakfile, self.file_abspath) def write_kv_into_conf(self, kvkvs): """ 将key-value写进conf """ with open(self.file_abspath, 'w+') as fhandle: for i in kvkvs.keys: fhandle.write('%s:%s\n' % (i, kvkvs[i])) class CConfModer(object): """ deprecated. Recommand using Configure2Dict / Dict2Configure """ def __init__(self, toolpath): if not os.path.exists(toolpath): raise IOError( 'File not found - The cfmod tool cannot be found: %s' % toolpath ) self._modtool = toolpath def updatekv(self, confpath, key, val): """ update key with value """ cmd = "%s -c %s -u %s:%s " % (self._modtool, confpath, key, val) try_times = 0 while True: ret = cup.shell.ShellExec().run(cmd, 120) if( ret['returncode'] == 0 or not ret['returncode'] or try_times > 1 ): ret['stdout'] = ret['stdout'].decode('gbk') ret['stdout'] = ret['stdout'].encode('utf-8') # print ret['stdout'] break else: try_times += 1 print 'err:updatekv' time.sleep(1) def updatekvlist(self, confpath, kvlist): """ update a list of key/value """ strcmd = '' for key_value in kvlist: strcmd += ' -u %s:%s ' % (key_value['key'], key_value['value']) cmd = "%s -c %s %s" % (self._modtool, confpath, strcmd) try_times = 0 while True: ret = cup.shell.ShellExec().run(cmd, 120) if( ret['returncode'] == 0 or not ret['returncode'] or try_times > 1 ): ret['stdout'] = ret['stdout'].decode('gbk') ret['stdout'] = ret['stdout'].encode('utf-8') print ret['stdout'] break else: try_times += 1 print 'err:updatekvlist' time.sleep(1) def addkv(self, confpath, key, val): """ add key value into a conf """ cmd = "%s -c %s -i %s:%s &>/dev/null" % ( self._modtool, confpath, key, val ) try_times = 0 while True: ret = cup.shell.ShellExec().run(cmd, 120) if( ret['returncode'] == 0 or not ret['returncode'] or try_times > 1 ): ret['stdout'] = ret['stdout'].decode('gbk') ret['stdout'] = ret['stdout'].encode('utf-8') print ret['stdout'] break else: try_times += 1 print 'err:addkv' time.sleep(1) if(ret == 0 or try_times > 1): print cmd break else: time.sleep(1) try_times += 1 def delkv(self, confpath, key): """ del a key from a conf file """ cmd = "%s -c %s -d %s " % (self._modtool, confpath, key) try_times = 0 while True: ret = cup.shell.ShellExec().run(cmd, 120) if( ret['returncode'] == 0 or not ret['returncode'] or try_times > 1 ): ret['stdout'] = ret['stdout'].decode('gbk') ret['stdout'] = ret['stdout'].encode('utf-8') print ret['stdout'] break else: try_times += 1 print 'err:delkv' time.sleep(1) if(ret == 0 or try_times > 1): print cmd break else: time.sleep(1) try_times += 1 class ArrayFormatError(cup.err.BaseCupException): """ array format error for Configure2Dict """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class LineFormatError(cup.err.BaseCupException): """ Line error class """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class KeyFormatError(cup.err.BaseCupException): """ Key error class """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class ValueFormatError(cup.err.BaseCupException): """ value error class """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class UnknowConfError(cup.err.BaseCupException): """ unkown error class """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class ConfDictSetItemError(cup.err.BaseCupException): """ ConfDict Error """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class ConfListSetItemError(cup.err.BaseCupException): """ ConfList Error """ def __init__(self, errmsg): super(self.__class__, self).__init__(errmsg) class ConfList(list): """ Conf list attributes. e.g. @disk: /home/disk1 @disk: /home/disk2 """ def __init__(self): super(self.__class__, self).__init__() self._ind = 0 self._comments = [] def append_ex(self, item, comments): """ append a item with conf comments """ assert type(comments) == list, 'comments should be a list' super(self.__class__, self).append(item) self._ind += 1 self._comments.append(comments) def get_ex(self, ind): """ get conf list item with its comments """ try: return (self.__getitem__(ind), self._comments[ind]) except IndexError: return (self.__getitem__(ind), []) def __delitem__(self, index): list.__delitem__(index) del self._comments[index] def append(self, item): """append item""" self.append_ex(item, []) def insert(self, ind, item): """plz do not use this function""" raise ConfDictSetItemError( 'Do not support "insert". Use "append" instead' ) def extend(self, seqs): """plz do not use extend""" raise ConfDictSetItemError( 'Do not support "extend". Use "append" instead' ) class ConfDict(dict): """ ConfDict that Configure2Dict and Dict2Configure can use. """ def __init__(self, *args, **kwargs): self.update(*args, **kwargs) self._index = 0 self._extra_dict = {} self._tail = None self._reverse_ind = -99999999 def __delitem__(self, key): dict.__delitem__(key) del self._extra_dict[key] def set_ex(self, key, value, comments): """ In addtion to dict['key'] = value, set_ex also set comments along with the key. """ super(self.__class__, self).__setitem__(key, value) if key not in self._extra_dict: if isinstance(value, list) or isinstance(value, dict): self._extra_dict[key] = (self._index, comments) self._index += 1 else: self._extra_dict[key] = (self._reverse_ind, comments) self._reverse_ind += 1 def get_ex(self, key): """ get (value, comments) with key, comments is a list """ value = self.get(key) comments = self._extra_dict.get(key) if comments is None: comments = [] return (value, comments) def __setitem__(self, key, value): super(self.__class__, self).__setitem__(key, value) if key not in self._extra_dict: if isinstance(value, list) or isinstance(value, dict): self._extra_dict[key] = (self._index, []) self._index += 1 else: self._extra_dict[key] = (self._reverse_ind, []) self._reverse_ind += 1 def _compare_keys(self, keyx, keyy): if self._extra_dict[keyx][0] == self._extra_dict[keyy][0]: return 0 elif self._extra_dict[keyx][0] < self._extra_dict[keyy][0]: return -1 else: return 1 def get_ordered_keys(self): """ get keys in order """ keys = sorted(self.keys(), self._compare_keys) return keys # @brief translate configure(public/configure) conf to dict class Configure2Dict(object): # pylint: disable=R0903 """ Configure2Dict support conf features below: 1. comments As we support access/modify comments in a conf file, you should obey rules below: Comment closely above the object you want to comment. Do NOT comment after the line. Otherwise, you might get/set a wrong comment above the object. 2. sections 2.1 global section - if key:value is not under any [section], it is under the global layer by default - global section is the 0th layer section e.g. test.conf: # test.conf global-key: value global-key1: value1 2.2 child section - [section1] means a child section under Global. And it's the 1st layer section - [.section2] means a child section under the nearest section above. It's the 2nd layer section. - [..section3] means a child section under the nearest section above. And the prefix .. means it is the 3rd layer section e.g.: test.conf: :: global-key: value [section] host: abc.com port: 8080 [.section_child] child_key: child_value [..section_child_child] control: ssh [...section_child_child_child] wow_key: wow_value 2.3 section access method get_dict method will convert conf into a ConfDict which is derived from python dict. - Access the section with confdict['section']['section-child']. - Access the section with confdict.get_ex('section') with (value, comments) 3. key:value and key:value array 3.1 key:value key:value can be set under Global section which is closely after the 1st line with no [section] above. key:value can also be set under sections. :: # test.conf key1: value1 [section] key_section: value_in_section [.seciton] key_section_child: value_section_child 3.2 key:value arrays key:value arrays can be access with confdict['section']['disk']. You will get a ConfList derived from python list. :: # test.conf # Global layer, key:value host: abc.com port: 12345 # 1st layer [monitor] @disk: /home/data0 @disk: /home/data1 [section] @disk: /home/disk/disk1 @disk: /home/disk/disk2 4. Example :: # test.conf # Global layer, key:value host: abc.com port: 12345 # 1st layer [monitor] @disk: /home/data0 @disk: /home/data1 [section] @disk: /home/disk/disk1 @disk: /home/disk/disk2 [monitor] timeout: 100 regex: sshd # 2nd layer that belongs to [monitor] [.timeout] # key:value in timeout max: 100 # 3rd layer that belongs to [monitor] [timeout] [..handler] default: exit """ def __init__(self, configure_file, remove_comments=True, separator=':'): """ @param configure_file: configure file path @param remove_comments: if you comment after key:value # comment, whether we should remove it when you access the key @raise: IOError configure_file not found cup.util.conf.KeyFormatError Key format error cup.util.conf.ValueFormatError value value cup.util.conf.LineFormatError line format error cup.util.conf.ArrayFormatError @array format error cup.util.conf.UnknowConfError unknown error """ self._file = configure_file if not os.path.exists(configure_file): raise IOError('%s does not exists' % configure_file) if not os.path.isfile(configure_file): raise IOError('%s is not a file' % configure_file) self._lines = [] self._dict = ConfDict() self._remove_comments = remove_comments self._blank_and_comments = {} self._separator = separator def _strip_value(self, value): if self._remove_comments: rev = value.split('#')[0].strip() else: rev = value return rev def _handle_key_value_tuple(self, linenum, conf_dict_now, comments): num = linenum line = self._lines[num] key, value = line rev_comments = comments if not key.startswith('@'): conf_dict_now.set_ex(key, value, rev_comments) rev_comments = [] else: # @key: value # it's a conf array. # e.g. # @disk : /home/disk1 # @disk : /home/disk2 # conf_dict_now[key[1:]] = [value] if not key[1:] in conf_dict_now: conf_array = ConfList() conf_dict_now.set_ex(key[1:], conf_array, rev_comments) else: conf_array = conf_dict_now[key[1:]] conf_array.append_ex(value, []) rev_comments = [] num += 1 while num < len(self._lines): # get all items if self._handle_comments(rev_comments, self._lines[num]): num += 1 continue if not type(self._lines[num]) == tuple or \ self._lines[num][0] != key: num -= 1 break conf_dict_now[key[1:]].append_ex( self._lines[num][1], rev_comments ) rev_comments = [] num += 1 return (num, rev_comments) @classmethod def _handle_comments(cls, comments, line): if line[0] == '__comments__': comments.append(line[1]) return True return False @classmethod def _handle_group_keys( cls, key, conf_dict_now, conf_layer_stack, comments ): for groupkey in key.split('.'): conf_dict_now = conf_layer_stack[-1] while isinstance(conf_dict_now, list): conf_dict_now = conf_dict_now[-1] if groupkey in conf_dict_now: conf_dict_now = conf_dict_now[groupkey] # push this layer into the stack conf_layer_stack.append(conf_dict_now) else: if groupkey[0] == '@': groupkey = groupkey[1:] if groupkey in conf_dict_now: conf_dict_now[groupkey].append_ex( {}, comments ) comments = [] else: conflist = ConfList() conf_dict_now.set_ex( groupkey, conflist, comments ) comments = [] conflist.append(ConfDict()) else: conf_dict_now.set_ex( groupkey, ConfDict(), comments ) comments = [] conf_layer_stack.append(conf_dict_now[groupkey]) return comments # GLOBAL level 1 # [groupA] level 2 # [.@groupB] level 3 # [..@groupC] level 4 # pylint: disable=R0912, R0915 def get_dict(self, ignore_error=False): """ get conf_dict which you can use to access conf info. :param ignore_error: True, CUP will parse the conf file without catching exceptions """ comments = [] self._get_input_lines(ignore_error) conf_layer_stack = [self._dict] num = 0 length = len(self._lines) last_list_key = None while num < length: line = self._lines[num] if self._handle_comments(comments, line): num += 1 continue conf_dict_now = conf_layer_stack[-1] # conf_dict_now is current while isinstance(conf_dict_now, list): # [], find the working dict conf_dict_now = conf_dict_now[-1] if isinstance(line, tuple): # key value num, comments = self._handle_key_value_tuple( num, conf_dict_now, comments ) else: key = line.lstrip('.') level = len(line) - len(key) + 2 # determine the level if key == 'GLOBAL': # GLOBAL is the 1st level level = 1 conf_layer_stack = [self._dict] # [Group1.SubGroup1] sub-key: Value # if sth below level cannot be computed as len(line) - len(key) elif '.' in key: # conf_layer_stack back to [self._dict] conf_layer_stack = [self._dict] comments = self._handle_group_keys( key, conf_dict_now, conf_layer_stack, comments ) elif level > len(conf_layer_stack) + 1: raise ArrayFormatError(line) elif level == len(conf_layer_stack) + 1: # new grou for if key[0] == '@': key = key[1:] conflist = ConfList() conflist.append(ConfDict()) conf_dict_now.set_ex(key, conflist, []) else: conf_dict_now.set_ex(key, ConfDict(), comments) comments = [] conf_layer_stack.append(conf_dict_now[key]) elif level == len(conf_layer_stack): # -1 means the last item. -2 means the second from the end conf_dict_now = conf_layer_stack[-2] # back one while isinstance(conf_dict_now, list): conf_dict_now = conf_dict_now[-1] if key[0] == '@': tmpkey = key[1:] if tmpkey in conf_dict_now: # the same group # pylint: disable=E1101 # conf_dict_now[tmpkey] = ConfDict() if tmpkey != last_list_key: conf_layer_stack[-1] = conf_dict_now[tmpkey] conf_layer_stack[-1].append_ex( ConfDict(), comments ) comments = [] else: # different group conflist = ConfList() conflist.append(ConfDict()) conf_dict_now.set_ex(tmpkey, conflist, comments) # conf_dict_now.set_ex(tmpkey, conflist, []) comments = [] conf_layer_stack[-1] = conf_dict_now[tmpkey] last_list_key = tmpkey else: conf_dict_now.set_ex(key, ConfDict(), comments) comments = [] conf_layer_stack[-1] = conf_dict_now[key] elif level < len(conf_layer_stack): conf_dict_now = conf_layer_stack[level - 2] # get back while isinstance(conf_dict_now, list): conf_dict_now = conf_dict_now[-1] if key[0] == '@': tmpkey = key[1:] if tmpkey in conf_dict_now: # the same group tmpdict = ConfDict() conf_layer_stack[level - 1].append(tmpdict) else: # different group conflist = ConfList() conflist.append(ConfDict()) conf_dict_now.set_ex(tmpkey, conflist, []) conf_layer_stack[level - 1] = conf_dict_now[tmpkey] else: conf_dict_now.set_ex(key, ConfDict(), comments) comments = [] conf_layer_stack[level - 1] = conf_dict_now[key] conf_layer_stack = conf_layer_stack[:level] else: raise UnknowConfError('exception occured') num += 1 return self._dict # Check the key id format def _check_key_valid(self, key): # pylint: disable=R0201 if key == '' or key == '@': raise KeyFormatError(key) if key[0] == '@': key = key[1:] for char in key: if not char.isalnum() and char != '_' \ and char != '-' and char != '.' and char != '$': raise KeyFormatError(key) # Check the [GROUP] key format def _check_groupkey_valid(self, key): for groupkey in key.split('.'): self._check_key_valid(groupkey) def _handle_include_syntx(self, line, ignore_error): """handle $include file.conf """ if ignore_error: try: include_file = line.split()[-1].strip('"') include_dict = Configure2Dict(include_file).get_dict( ignore_error ) if '$include' not in self._dict: newdict = ConfDict() self._dict.set_ex('$include', newdict, '') newdict.set_ex( include_file, include_dict, '' ) # pylint: disable=W0703 # Does not know exact exception type except Exception: cup.log.warn( 'failed to handle include file, line:{0}'.format( line) ) else: include_file = line.split()[-1].strip('"') include_dict = Configure2Dict(include_file).get_dict( ignore_error ) if '$include' not in self._dict: newdict = ConfDict() self._dict.set_ex('$include', newdict, '') newdict.set_ex( include_file, include_dict, '' ) # Read in the file content, with format check def _get_input_lines(self, ignore_error): # pylint: disable=R0912,R0915 """ read conf lines """ try: fhanle = open(self._file, 'r') except IOError as error: cup.log.error('open file failed:%s, err:%s' % (self._file, error)) raise IOError(str(error)) for line in fhanle.readlines(): line = line.strip() # if it's a blank line or a line with comments only if line == '': line = '__comments__%s%s' % (self._separator, '\n') if line.startswith('#'): line = '__comments__%s%s\n' % (self._separator, line) continue if line.startswith('$include'): self._handle_include_syntx(line, ignore_error) continue # if it's a section if line.startswith('['): if line.find('#') > 0: line = line[:line.find('#')].strip() if not line.endswith(']'): raise LineFormatError('Parse line error, line:\n' + line) line = line[1:-1] key = line.lstrip('.') self._check_groupkey_valid(key) # check if key is valid self._lines.append(line) continue # key, value = line.split(':', 1) key, value = line.split(self._separator, 1) key = key.strip() value = value.strip(' \t') # if remove_comments is True, delete comments in value. self._check_key_valid(key) if value.startswith('"'): # if the value is a string if not value.endswith('"'): raise ValueFormatError(line) else: if key != '__comments__': value = self._strip_value(value) if value.startswith('"'): tmp_value = '' # reserve escape in the value string escape = False for single in value: if escape: if single == '0': tmp_value += '\0' elif single == 'n': tmp_value += '\n' elif single == 'r': tmp_value += '\r' elif single == 't': tmp_value += '\t' elif single == 'v': tmp_value += '\v' elif single == 'a': tmp_value += '\a' elif single == 'b': tmp_value += '\b' elif single == 'd': tmp_value += r'\d' elif single == 'f': tmp_value += '\f' elif single == "'": tmp_value += "'" elif single == '"': tmp_value += '"' elif single == '\\': tmp_value += '\\' else: # raise ValueFormatError(line) pass escape = False elif single == '\\': escape = True else: tmp_value += single if escape: raise ValueFormatError(line) value = tmp_value self._lines.append((key, value)) fhanle.close() class Dict2Configure(object): """ Convert Dict into Configure. You can convert a ConfDict or python dict into a conf file. """ ## # @param dict the conf dict, make sure the type format is right # def __init__(self, conf_dict, separator=':'): self._dict = None self.set_dict(conf_dict) self._level = 0 self._str = '' self._separator = separator def _get_field_value_sep(self): return self._separator # The separator between each line @classmethod def _get_linesep(cls): return '\n' # The flag of an array @classmethod def _get_arrayflag(cls): return '@' def _get_levelsep(self): return '.' * self._level def _get_arraylevel_sep(self): return '.' * self._level + self._get_arrayflag() def _get_indents(self): return ' ' * self._level * 4 def _get_write_string(self): self._str = '' self._level = 0 self._get_confstring(self._dict) return self._str def write_conf(self, conf_file): """ write the conf into of the dict into a conf_file """ with open(conf_file, 'w') as fhandle: fhandle.write(self._get_write_string()) # pylint: disable=R0911 @classmethod def _comp_write_keys(cls, valuex, valuey): _py_type = [bool, int, float, str, unicode] if type(valuex) == type(valuey): return 0 for py_type in _py_type: if isinstance(valuex, py_type): return -1 for py_type in _py_type: if isinstance(valuey, py_type): return 1 if isinstance(valuex, list) and isinstance(valuey, list): try: if isinstance(valuex[0], dict) or isinstance(valuex[0], list): return 1 else: return -1 # pylint: disable=W0703 except Exception: return -1 else: return -1 # if isinstance(valuex, list) and isinstance(valuey, str): # return 1 if isinstance(valuex, dict): return 1 if isinstance(valuey, dict): return -1 return 1 # pylint: disable=R0912 def _get_confstring(self, _dict): # for item in sorted( # _dict.items(), lambda x, y: self._comp_type(x[1], y[1]) # ): try: order_keys = _dict.get_ordered_keys() except AttributeError: order_keys = sorted( _dict.keys(), lambda x, y: self._comp_write_keys( _dict[x], _dict[y] ) ) if '$include' in order_keys: for filepath in _dict['$include']: self._str += '$include "{0}"{1}'.format( filepath, self._get_linesep() ) order_keys.remove('$include') for key in order_keys: if key == '$include': cup.log.warn('cup.conf does not support $include writeback yet') continue try: item = _dict.get_ex(key) value = item[0] comments = item[1][1] except AttributeError: value = _dict.get(key) comments = [] for comment in comments: self._str += self._get_indents() + comment if isinstance(value, tuple) or isinstance(value, list): if isinstance(value, tuple): print 'its a tuple, key:%s, value:%s' % (key, value) if len(value) > 0 and isinstance(value[0], dict): # items are all arrays # [..@section] # abc: # [..@section] # abc: for ind in xrange(0, len(value)): try: item = value.get_ex(ind) except AttributeError: item = (value[ind], []) for comment in item[1]: self._str += self._get_indents() + comment self._add_arraylevel(key) self._get_confstring(item[0]) self._minus_level() else: # a array list and array list has no sub-dict # @item # @item for ind in xrange(0, len(value)): try: item = value.get_ex(ind) except AttributeError: item = (value[ind], []) for comment in item[1]: self._str += self._get_indents() + comment self._appendline( self._get_arrayflag() + str(key), item[0] ) elif isinstance(value, dict): self._addlevel(key) self._get_confstring(value) self._minus_level() else: # type(value) == type(""): self._appendline(key, value) def _get_confstring_ex(self, _dict): pass def _appendline(self, key, value): self._str += ( self._get_indents() + str(key) + self._get_field_value_sep()+str(value)+self._get_linesep() ) def _addlevel(self, key): self._str += ( self._get_indents() + '[' + self._get_levelsep() + str(key) + ']' + self._get_linesep() ) self._level += 1 def _add_arraylevel(self, key): self._str += ( self._get_indents() + '[' + self._get_arraylevel_sep() + str(key) + ']' + self._get_linesep() ) self._level += 1 def _minus_level(self): self._level -= 1 # Set the conf dict def set_dict(self, conf_dict): """ set a new conf_dict """ if not isinstance(conf_dict, dict): raise TypeError('conf_dict is not a type of dict') self._dict = conf_dict # itemlist=sorted(dict.items(), lambda x,y: _comp_type(x[1],y[1])) # sort the dict, make type{dict} last @classmethod def _comp_type(cls, item_a, item_b): if type(item_a) in (tuple, list): if len(item_a) > 0: item_a = item_a[0] if type(item_b) in (tuple, list): if len(item_b) > 0: item_b = item_b[0] if type(item_a) == type(item_b): return 0 elif type(item_b) == dict: return -1 elif type(item_a) == dict: return 1 # if type(item_a)!=type({}) or type(item_b)==type({}): # return -1 return 1 class HdfsXmlConf(object): """ hdfs xmlconf modifier. Example: :: # modify and write new conf into hadoop-site.xmlconf xmlobj = xmlconf.HdfsXmlConf(xmlfile) # get hdfs conf items into a python dict key_values = xmlobj.get_items() # modify hdfs conf items for name in self._confdict['journalnode']['hadoop_site']: if name in key_values: key_values[name]['value'] = \ self._confdict['journalnode']['hadoop_site'][name] else: key_values[name] = { 'value': self._confdict['journalnode']['hadoop_site'][name], 'description': ' ' } hosts = ','.join(self._confdict['journalnode']['host']) key_values['dfs.journalnode.hosts'] = { 'value': hosts, 'description':' journalnode hosts' } # write back conf items with new values xmlobj.write_conf(key_values) """ def __init__(self, filepath): if not os.path.exists(filepath): raise IOError('file not found:{0}'.format(filepath)) if not os.path.isfile(filepath): raise IOError('{0} not a file'.format(filepath)) self._xmlpath = filepath self._confdict = None def _load_items(self): self._confdict = {} dom = minidom.parse(self._xmlpath) properties = dom.getElementsByTagName('property') for pro in properties: tmpdict = {} try: tmpdict['value'] = pro.getElementsByTagName( 'value' )[0].childNodes[0].nodeValue except IndexError: tmpdict['value'] = None try: tmpdict['description'] = pro.getElementsByTagName( 'description' )[0].childNodes[0].nodeValue except IndexError: tmpdict['description'] = None self._confdict[ pro.getElementsByTagName('name')[0].childNodes[0].nodeValue ] = tmpdict return self._confdict def get_items(self): """ return hadoop config items as a dict. :: { 'dfs.datanode.max.xcievers': { 'value': 'true', 'description': 'xxxxxxxxxx' }, ...... } """ return self._load_items() def _write_to_conf(self, new_confdict): dom = minidom.parse(self._xmlpath) properties = dom.getElementsByTagName('property') tmpdict = copy.deepcopy(new_confdict) # modify if name exists for pro in properties: name = pro.getElementsByTagName('name')[0].childNodes[0].nodeValue valuenode = pro.getElementsByTagName('value')[0] if name in tmpdict: need_modify = False if valuenode.firstChild is None: if tmpdict[name]['value'] is not None: valuenode.appendChild(dom.createTextNode('')) need_modify = True else: need_modify = True if need_modify: valuenode.firstChild.replaceWholeText( tmpdict[name]['value'] ) del tmpdict[name] else: parent = pro.parentNode parent.insertBefore(dom.createComment(pro.toxml()), pro) parent.removeChild(pro) configuration_node = dom.getElementsByTagName('configuration')[0] for name in tmpdict: new_pro = dom.createElement('property') new_name = dom.createElement('name') new_name.appendChild(dom.createTextNode(name)) new_pro.appendChild(new_name) # value in the new property new_value = dom.createElement('value') if new_value is not None: new_value.appendChild( dom.createTextNode(tmpdict[name]['value']) ) new_pro.appendChild(new_value) # description new_desc = dom.createElement('description') new_desc.appendChild( dom.createTextNode(tmpdict[name]['description']) ) new_pro.appendChild(new_desc) configuration_node.appendChild(new_pro) return dom.toprettyxml(newl='\n') def write_conf(self, kvs): """ update config items with a dict kvs. Refer to the example above. :: { key : { 'value': value, 'description': 'description'}, ...... } """ self._load_items() str_xml = self._write_to_conf(kvs) with open(self._xmlpath, 'w') as fhandle: fhandle.write(str_xml) self._confdict = kvs def _main_hanle(): dict4afs = Configure2Dict('/tmp/metaserver.conf') dictafs = dict4afs.get_dict() print json.dumps(dictafs, sort_keys=True, indent=4) if __name__ == "__main__": pass # conf = CConf(g_prodUnitRuntime + 'Unitserver0/conf/','UnitServer.conf') # conf.update({'MasterPort':'1234','ProxyPortDelta':'0'}) # conf.addAfterKeywordIfNoexist( # 'SnapshotPatchLimit', ('DelServerPerHourLimit', '99') # ) # vi:set tw=0 ts=4 sw=4 nowrap fdm=indent
33.62008
83
0.488855
7949d814ca2438d5469a43697e6e0f18d9762aca
3,353
py
Python
Lab2/Lab.py
GnomGad/PythonLabs
e04e03aee2e3f1c6960e7af707f1c56887c45d32
[ "MIT" ]
null
null
null
Lab2/Lab.py
GnomGad/PythonLabs
e04e03aee2e3f1c6960e7af707f1c56887c45d32
[ "MIT" ]
null
null
null
Lab2/Lab.py
GnomGad/PythonLabs
e04e03aee2e3f1c6960e7af707f1c56887c45d32
[ "MIT" ]
null
null
null
import os import hashlib import random import re import subprocess def Ex1(): rus = "йцукенгшщзхъфывапролджэячсмитьбюё" eng = "qwertyuiopasdfghjklzxcvbnm" Ex1_Result(rus,"Ex1Text.txt") def Ex1_Result(lang,path): with open(path, "r") as file: text = file.read().lower() dtext = {i:text.count(i) for i in lang} [print(i[0],"-",round(i[1]/len(dtext),2),"%") for i in sorted(dtext.items(),key = lambda i: i[1],reverse=True)] def Ex2(): path = os.getcwd() hashes = {} for filename in os.listdir(path): if os.path.isfile(filename): with open(filename, "rb") as file: hashes.setdefault(hashlib.md5(file.read()).digest(),[]).append(filename) for filenames in hashes: if len(hashes[filenames]) > 1: print("---Файлы Копии---\n", ", ".join(hashes[filenames]), sep="") def Ex3(): path = os.getcwd()+"\\Music" getMusic = "E:\\VKMusic 4\\Music" if not os.path.exists(path): os.mkdir(path) Ex3_CreateMusics(os.getcwd()) Ex3_CreateDurations(os.getcwd()) Ex3_CreateList(os.getcwd()) Ex3_Rename(path) def Ex3_Rename(path): for filename in os.listdir(path): if filename[-4:] ==".mp3": for i in Ex3_GetList(path+"\\Musics.txt"): if (filename[:-4]) in i and os.path.exists(path+"\\"+filename): os.replace(path+"\\"+filename,path+"\\"+i[:-1]) break def Ex3_CreateMusics(path): for i in Ex3_GetList(path+"\\MusicNames.txt"): with open(path+"\\Music\\"+i[:-1], "w+",encoding="UTF-8") as file: pass def Ex3_CreateDurations(path): with open(path+"\\MusicDurations.txt", "w+",encoding="UTF-8") as file: for i in Ex3_GetList(path+"\\MusicNames.txt"): file.write("[{0}.{1}]\n".format(random.randint(0,9),random.randint(10,60))) def Ex3_CreateList(path): with open(path+"\\Music\\Musics.txt", "w+",encoding="UTF-8") as file: mus =Ex3_GetList(path+"\\MusicNames.txt") dur =Ex3_GetList(path+"\\MusicDurations.txt") for i in range(len(mus)): file.write(str(i+1)+". "+mus[i][:-5]+" "+dur[i][:-1]+".mp3\n") def Ex3_GetList(path): with open(path, "r",encoding="UTF-8") as file: return file.readlines() def Ex4(): lst = [] reg = "(:(-)?[\)]+)|\){3,}" while True: t = input() if t == "": break else: lst.append(t) [print("Строка,",i,"позиция",j,": найдено",res) for i, j, res in TestReg(lst,reg)] def TestReg(lst,reg): for i in range(len(lst)): parser = re.search(reg,lst[i]) count =0 while parser!=None: yield i+1,parser.regs[0][0]+count+1,parser.group() count+=parser.regs[0][1] lst[i] = lst[i][parser.regs[0][1]:] parser = re.search(reg,lst[i]) def Ex5(): reg = "[A-ZА-ЯЁ][A-ZА-ЯЁa-zа-яё]+([0-9]{4}$|[0-9]{2}$)" [print(res) for i, j, res in TestReg(input().split(),reg)] def Ex6(): subprocess.call("reorganize.py --source \"D:\\TestDir\" --days 2 --size 4096",shell=True) def Ex7(): subprocess.call("trackmix.py -s \"D:\\Application\\Git\\PythonLabs\\Lab2\\TestM\" -d \"kek.mp3\" -f 15 -l --extended",shell=True) Ex4()
28.415254
133
0.555025
7949d8337ed3b54a85fec27c1c99e5e140f0754c
2,345
py
Python
tests/test_env_spec.py
bobh66/hera-workflows
7dc94de3725b13fcba7ff54cd96cb90119ae2591
[ "MIT" ]
null
null
null
tests/test_env_spec.py
bobh66/hera-workflows
7dc94de3725b13fcba7ff54cd96cb90119ae2591
[ "MIT" ]
null
null
null
tests/test_env_spec.py
bobh66/hera-workflows
7dc94de3725b13fcba7ff54cd96cb90119ae2591
[ "MIT" ]
null
null
null
import json from argo_workflows.models import ConfigMapKeySelector, EnvVarSource, SecretKeySelector from pydantic import BaseModel from hera.env import ConfigMapEnvSpec, EnvSpec, SecretEnvSpec class MockModel(BaseModel): field1: int = 1 field2: int = 2 def test_env_spec_sets_base_model(mock_model): m = mock_model() env = EnvSpec(name="model_string", value=m) argo_spec = env.argo_spec assert argo_spec.value == '{"field1": 1, "field2": 2}' model_dict = json.loads(argo_spec.value) test_model = MockModel(**model_dict) assert test_model.field1 == m.field1 assert test_model.field2 == m.field2 def test_env_spec_sets_primitive_types_as_expected(): int_val = 1 int_env = EnvSpec(name="int", value=int_val) int_spec = int_env.argo_spec assert int_spec.value == '1' assert json.loads(int_spec.value) == int_val # values are stringified to env variable values, but strings are already stringified # so the test here ensures that strings are passed as strings, by comparison to # other primitive types str_val = 'str' str_env = EnvSpec(name="str", value=str_val) str_spec = str_env.argo_spec assert str_spec.value == 'str' dict_val = {'a': 42} dict_env = EnvSpec(name="dict", value=dict_val) dict_spec = dict_env.argo_spec assert dict_spec.value == '{"a": 42}' assert json.loads(dict_spec.value) == dict_val def test_secret_env_spec_contains_expected_fields(): env = SecretEnvSpec(name='s', secret_name='a', secret_key='b') spec = env.argo_spec assert not hasattr(spec, 'value') assert spec.name == 's' assert isinstance(spec.value_from, EnvVarSource) assert isinstance(spec.value_from.secret_key_ref, SecretKeySelector) assert spec.value_from.secret_key_ref.name == 'a' assert spec.value_from.secret_key_ref.key == 'b' def test_config_map_env_spec_contains_expected_fields(): env = ConfigMapEnvSpec(name='s', config_map_name='a', config_map_key='b') spec = env.argo_spec assert not hasattr(spec, 'value') assert spec.name == 's' assert isinstance(spec.value_from, EnvVarSource) assert isinstance(spec.value_from.config_map_key_ref, ConfigMapKeySelector) assert spec.value_from.config_map_key_ref.name == 'a' assert spec.value_from.config_map_key_ref.key == 'b'
33.985507
88
0.725373
7949d83a10c2a20ae19d5a513ffe3561de54084b
6,356
py
Python
sygnal/helper/context_factory.py
kibablu/sygnal
4f4d7ce014d680a9336bc0723014c40f87393b91
[ "Apache-2.0" ]
98
2015-02-04T21:30:52.000Z
2022-02-27T18:44:40.000Z
sygnal/helper/context_factory.py
kibablu/sygnal
4f4d7ce014d680a9336bc0723014c40f87393b91
[ "Apache-2.0" ]
224
2015-02-21T12:54:29.000Z
2022-03-28T18:52:47.000Z
sygnal/helper/context_factory.py
kibablu/sygnal
4f4d7ce014d680a9336bc0723014c40f87393b91
[ "Apache-2.0" ]
94
2015-02-21T12:49:04.000Z
2022-02-17T12:11:46.000Z
# Copyright 2014-2016 OpenMarket Ltd # Copyright 2019 New Vector Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Adapted from Synapse: # https://github.com/matrix-org/synapse/blob/1016f303e58b1305ed5b3572fde002e1273e0fc0/synapse/crypto/context_factory.py#L77 import logging import idna from OpenSSL import SSL from service_identity import VerificationError from service_identity.pyopenssl import verify_hostname, verify_ip_address from twisted.internet.abstract import isIPAddress, isIPv6Address from twisted.internet.interfaces import IOpenSSLClientConnectionCreator from twisted.internet.ssl import CertificateOptions, TLSVersion, platformTrust from twisted.python.failure import Failure from twisted.web.iweb import IPolicyForHTTPS from zope.interface import implementer logger = logging.getLogger(__name__) @implementer(IPolicyForHTTPS) class ClientTLSOptionsFactory(object): """Factory for Twisted SSLClientConnectionCreators that are used to make connections to remote servers for federation. Uses one of two OpenSSL context objects for all connections, depending on whether we should do SSL certificate verification. get_options decides whether we should do SSL certificate verification and constructs an SSLClientConnectionCreator factory accordingly. """ def __init__(self): # Use CA root certs provided by OpenSSL trust_root = platformTrust() # "insecurelyLowerMinimumTo" is the argument that will go lower than # Twisted's default, which is why it is marked as "insecure" (since # Twisted's defaults are reasonably secure). But, since Twisted is # moving to TLS 1.2 by default, we want to respect the config option if # it is set to 1.0 (which the alternate option, raiseMinimumTo, will not # let us do). minTLS = TLSVersion.TLSv1_2 self._verify_ssl = CertificateOptions( trustRoot=trust_root, insecurelyLowerMinimumTo=minTLS ) self._verify_ssl_context = self._verify_ssl.getContext() self._verify_ssl_context.set_info_callback(self._context_info_cb) def get_options(self, host): ssl_context = self._verify_ssl_context return SSLClientConnectionCreator(host, ssl_context) @staticmethod def _context_info_cb(ssl_connection, where, ret): """The 'information callback' for our openssl context object.""" # we assume that the app_data on the connection object has been set to # a TLSMemoryBIOProtocol object. (This is done by SSLClientConnectionCreator) tls_protocol = ssl_connection.get_app_data() try: # ... we further assume that SSLClientConnectionCreator has set the # '_synapse_tls_verifier' attribute to a ConnectionVerifier object. tls_protocol._synapse_tls_verifier.verify_context_info_cb( ssl_connection, where ) except: # noqa: E722, taken from the twisted implementation logger.exception("Error during info_callback") f = Failure() tls_protocol.failVerification(f) def creatorForNetloc(self, hostname, port): """Implements the IPolicyForHTTPS interace so that this can be passed directly to agents. """ return self.get_options(hostname) @implementer(IOpenSSLClientConnectionCreator) class SSLClientConnectionCreator(object): """Creates openssl connection objects for client connections. Replaces twisted.internet.ssl.ClientTLSOptions """ def __init__(self, hostname, ctx): self._ctx = ctx self._verifier = ConnectionVerifier(hostname) def clientConnectionForTLS(self, tls_protocol): context = self._ctx connection = SSL.Connection(context, None) # as per twisted.internet.ssl.ClientTLSOptions, we set the application # data to our TLSMemoryBIOProtocol... connection.set_app_data(tls_protocol) # ... and we also gut-wrench a '_synapse_tls_verifier' attribute into the # tls_protocol so that the SSL context's info callback has something to # call to do the cert verification. setattr(tls_protocol, "_synapse_tls_verifier", self._verifier) return connection class ConnectionVerifier(object): """Set the SNI, and do cert verification This is a thing which is attached to the TLSMemoryBIOProtocol, and is called by the ssl context's info callback. """ # This code is based on twisted.internet.ssl.ClientTLSOptions. def __init__(self, hostname): if isIPAddress(hostname) or isIPv6Address(hostname): self._hostnameBytes = hostname.encode("ascii") self._is_ip_address = True else: # twisted's ClientTLSOptions falls back to the stdlib impl here if # idna is not installed, but points out that lacks support for # IDNA2008 (http://bugs.python.org/issue17305). # # We can rely on having idna. self._hostnameBytes = idna.encode(hostname) self._is_ip_address = False self._hostnameASCII = self._hostnameBytes.decode("ascii") def verify_context_info_cb(self, ssl_connection, where): if where & SSL.SSL_CB_HANDSHAKE_START and not self._is_ip_address: ssl_connection.set_tlsext_host_name(self._hostnameBytes) if where & SSL.SSL_CB_HANDSHAKE_DONE: try: if self._is_ip_address: verify_ip_address(ssl_connection, self._hostnameASCII) else: verify_hostname(ssl_connection, self._hostnameASCII) except VerificationError: f = Failure() tls_protocol = ssl_connection.get_app_data() tls_protocol.failVerification(f)
40.484076
124
0.708779
7949d889d1b95927344aaf68774b0c6e011afe1b
87
py
Python
spektral/__init__.py
sjiang87/spektral
cef8575f9aa5a724fb125fc5596f52f71580793d
[ "MIT" ]
1
2020-06-25T02:08:40.000Z
2020-06-25T02:08:40.000Z
spektral/__init__.py
sjiang87/spektral
cef8575f9aa5a724fb125fc5596f52f71580793d
[ "MIT" ]
null
null
null
spektral/__init__.py
sjiang87/spektral
cef8575f9aa5a724fb125fc5596f52f71580793d
[ "MIT" ]
null
null
null
from . import datasets from . import layers from . import utils __version__ = '0.5.1'
14.5
22
0.724138
7949d8f0c43df42defb1c222051cdc77687524a5
3,145
py
Python
mistral/db/sqlalchemy/types.py
soda-research/mistral
550a3de9c2defc7ce26336cb705d9c8d87bbaddd
[ "Apache-2.0" ]
3
2015-08-28T04:57:56.000Z
2017-03-27T10:59:56.000Z
mistral/db/sqlalchemy/types.py
soda-research/mistral
550a3de9c2defc7ce26336cb705d9c8d87bbaddd
[ "Apache-2.0" ]
21
2015-04-14T22:41:53.000Z
2019-02-20T09:30:10.000Z
mistral/db/sqlalchemy/types.py
soda-research/mistral
550a3de9c2defc7ce26336cb705d9c8d87bbaddd
[ "Apache-2.0" ]
12
2015-08-14T02:27:37.000Z
2020-12-31T10:09:21.000Z
# Copyright 2013 - Mirantis, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # This module implements SQLAlchemy-based types for dict and list # expressed by json-strings # from oslo_serialization import jsonutils import sqlalchemy as sa from sqlalchemy.dialects import mysql from sqlalchemy.ext import mutable class JsonEncoded(sa.TypeDecorator): """Represents an immutable structure as a json-encoded string.""" impl = sa.Text def process_bind_param(self, value, dialect): if value is not None: value = jsonutils.dumps(value) return value def process_result_value(self, value, dialect): if value is not None: value = jsonutils.loads(value) return value class MutableList(mutable.Mutable, list): @classmethod def coerce(cls, key, value): """Convert plain lists to MutableList.""" if not isinstance(value, MutableList): if isinstance(value, list): return MutableList(value) # this call will raise ValueError return mutable.Mutable.coerce(key, value) return value def __add__(self, value): """Detect list add events and emit change events.""" list.__add__(self, value) self.changed() def append(self, value): """Detect list add events and emit change events.""" list.append(self, value) self.changed() def __setitem__(self, key, value): """Detect list set events and emit change events.""" list.__setitem__(self, key, value) self.changed() def __delitem__(self, i): """Detect list del events and emit change events.""" list.__delitem__(self, i) self.changed() def JsonDictType(): """Returns an SQLAlchemy Column Type suitable to store a Json dict.""" return mutable.MutableDict.as_mutable(JsonEncoded) def JsonListType(): """Returns an SQLAlchemy Column Type suitable to store a Json array.""" return MutableList.as_mutable(JsonEncoded) def MediumText(): # TODO(rakhmerov): Need to do for postgres. return sa.Text().with_variant(mysql.MEDIUMTEXT(), 'mysql') class JsonEncodedMediumText(JsonEncoded): impl = MediumText() def JsonMediumDictType(): return mutable.MutableDict.as_mutable(JsonEncodedMediumText) def LongText(): # TODO(rakhmerov): Need to do for postgres. return sa.Text().with_variant(mysql.LONGTEXT(), 'mysql') class JsonEncodedLongText(JsonEncoded): impl = LongText() def JsonLongDictType(): return mutable.MutableDict.as_mutable(JsonEncodedLongText)
29.12037
77
0.683625
7949d981499b6ba8071165c493de24027ed6ba54
1,025
py
Python
test/test_v1_access_credential_secret_source.py
gabriel-samfira/client-python
c2e184c3cad6797af35b0160a36ffcbba77284a7
[ "Apache-2.0" ]
21
2018-02-21T23:59:28.000Z
2021-12-08T05:47:37.000Z
test/test_v1_access_credential_secret_source.py
gabriel-samfira/client-python
c2e184c3cad6797af35b0160a36ffcbba77284a7
[ "Apache-2.0" ]
47
2018-02-01T15:35:01.000Z
2022-02-11T07:45:54.000Z
test/test_v1_access_credential_secret_source.py
gabriel-samfira/client-python
c2e184c3cad6797af35b0160a36ffcbba77284a7
[ "Apache-2.0" ]
19
2018-04-03T09:20:52.000Z
2021-06-01T06:07:28.000Z
# coding: utf-8 """ KubeVirt API This is KubeVirt API an add-on for Kubernetes. OpenAPI spec version: 1.0.0 Contact: kubevirt-dev@googlegroups.com Generated by: https://github.com/swagger-api/swagger-codegen.git """ from __future__ import absolute_import import os import sys import unittest import kubevirt from kubevirt.rest import ApiException from kubevirt.models.v1_access_credential_secret_source import V1AccessCredentialSecretSource class TestV1AccessCredentialSecretSource(unittest.TestCase): """ V1AccessCredentialSecretSource unit test stubs """ def setUp(self): pass def tearDown(self): pass def testV1AccessCredentialSecretSource(self): """ Test V1AccessCredentialSecretSource """ # FIXME: construct object with mandatory attributes with example values #model = kubevirt.models.v1_access_credential_secret_source.V1AccessCredentialSecretSource() pass if __name__ == '__main__': unittest.main()
22.777778
100
0.732683
7949da0a237a80e832d317063c1bc70ac02b8909
8,260
py
Python
cairis/test/test_DependencyAPI.py
RachelLar/Cairis
93498fb5334ef1f88f16554823a3b9121c3675b8
[ "Apache-2.0" ]
null
null
null
cairis/test/test_DependencyAPI.py
RachelLar/Cairis
93498fb5334ef1f88f16554823a3b9121c3675b8
[ "Apache-2.0" ]
null
null
null
cairis/test/test_DependencyAPI.py
RachelLar/Cairis
93498fb5334ef1f88f16554823a3b9121c3675b8
[ "Apache-2.0" ]
null
null
null
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import logging import jsonpickle from cairis.core.Dependency import Dependency from cairis.test.CairisDaemonTestCase import CairisDaemonTestCase from cairis.tools.ModelDefinitions import DependencyModel import os from cairis.mio.ModelImport import importModelFile __author__ = 'Robin Quetin, Shamal Faily' class DependencyAPITests(CairisDaemonTestCase): def setUp(self): self.logger = logging.getLogger(__name__) importModelFile(os.environ['CAIRIS_SRC'] + '/../examples/exemplars/NeuroGrid/NeuroGrid.xml',1,'test') self.working_name_1 = ('Stroke', 'all', 'all', 'all') self.working_name_2 = ('Stroke', 'Data%20Consumer', 'Certificate%20Authority', 'Personal%20certificate') self.existing_environment_1 = 'Stroke' self.existing_environment_2 = 'Psychosis' self.existing_role_1 = 'Data Consumer' self.existing_role_2 = 'Certificate Authority' self.existing_type = 'goal' self.existing_dependency = 'Upload authorisation' def test_all_get(self): method = 'test_all_get' url = '/api/dependencies?session_id=test' rv = self.app.get(url) self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, dict, 'The response is not a valid JSON dictionary') self.assertGreater(len(json_dict), 0, 'No dependencies found') assert isinstance(json_dict, dict) item = json_dict.items()[0] self.logger.info('[%s] First dependency: %s [%d]\n', method, item[0], item[1]['theId']) def test_dependencies_name_get(self): method = 'test_dependencies_name_get' url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % self.working_name_1 rv = self.app.get(url) self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, list, 'The response is not a valid JSON dictionary') self.assertGreater(len(json_dict), 0, 'No dependencies found') assert isinstance(json_dict, list) ids = [] for dep in json_dict: ids.append(str(dep['theId'])) self.logger.info('[%s] Dependency IDs: %s\n', method, ', '.join(ids)) def test_dependency_name_get(self): method = 'test_dependency_name_get' url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % self.working_name_2 rv = self.app.get(url) self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, list, 'The response is not a valid JSON dictionary') self.assertEqual(len(json_dict), 1, 'Result is not unique') assert isinstance(json_dict, list) item = json_dict[0] has_keys = all (k in item for k in DependencyModel.required) self.assertTrue(has_keys, 'Result is not a dependency') dep_name = '/'.join([item['theEnvironmentName'], item['theDepender'], item['theDependee'], item['theDependency']]) self.logger.info('[%s] Dependency: %s [%d]\n', method, dep_name, item['theId']) def test_dependency_post(self): method = 'test_dependency_post' url = '/api/dependencies' new_dep = self.prepare_new_dependency() json_dict = { 'session_id': 'test', 'object': new_dep } json_body = jsonpickle.encode(json_dict) new_name = (new_dep.theEnvironmentName, new_dep.theDepender, new_dep.theDependee, new_dep.theDependency) delete_url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % new_name self.app.delete(delete_url) rv = self.app.post(url, data=json_body, content_type='application/json') self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, dict, 'Response is not a valid JSON dictionary') message = json_dict.get('message', None) self.assertIsNotNone(message, 'No message in response') self.assertNotIsInstance(message, dict, 'Message is an object') self.logger.info('[%s] Message: %s', method, message) dep_id = json_dict.get('dependency_id', None) self.assertIsNotNone(dep_id, 'No dependency ID returned') self.logger.info('[%s] New dependency ID: %d\n', method, dep_id) new_name = (new_dep.theEnvironmentName, new_dep.theDepender, new_dep.theDependee, new_dep.theDependency) delete_url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % new_name self.app.delete(delete_url) def test_dependency_name_delete(self): method = 'test_dependency_name_delete' url = '/api/dependencies' new_dep = self.prepare_new_dependency() json_dict = { 'session_id': 'test', 'object': new_dep } json_body = jsonpickle.encode(json_dict) self.app.post(url, data=json_body, content_type='application/json') new_name = (new_dep.theEnvironmentName, new_dep.theDepender, new_dep.theDependee, new_dep.theDependency) delete_url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % new_name rv = self.app.delete(delete_url) self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, dict, 'Response is not a valid JSON dictionary') message = json_dict.get('message', None) self.assertIsNotNone(message, 'No message in response') self.assertNotIsInstance(message, dict, 'Message is an object') self.logger.info('[%s] Message: %s\n', method, message) def test_dependency_name_put(self): method = 'test_dependency_name_put' url = '/api/dependencies' new_dep = self.prepare_new_dependency() json_dict = { 'session_id': 'test', 'object': new_dep } json_body = jsonpickle.encode(json_dict) self.app.post(url, data=json_body, content_type='application/json') new_name = (new_dep.theEnvironmentName, new_dep.theDepender, new_dep.theDependee, new_dep.theDependency) upd_dep = new_dep upd_dep.theEnvironmentName = self.existing_environment_2 json_dict = { 'session_id': 'test', 'object': upd_dep } json_body = jsonpickle.encode(json_dict) upd_url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % new_name rv = self.app.put(upd_url, data=json_body, content_type='application/json') self.assertIsNotNone(rv.data, 'No response') json_dict = jsonpickle.decode(rv.data) self.assertIsInstance(json_dict, dict, 'Response is not a valid JSON dictionary') message = json_dict.get('message', None) self.assertIsNotNone(message, 'No message in response') self.assertNotIsInstance(message, dict, 'Message is an object') self.logger.info('[%s] Message: %s\n', method, message) delete_name = (upd_dep.theEnvironmentName, upd_dep.theDepender, upd_dep.theDependee, upd_dep.theDependency) del_get_url = '/api/dependencies/environment/%s/depender/%s/dependee/%s/dependency/%s?session_id=test' % delete_name rv = self.app.get(del_get_url) self.logger.debug('[%s] Updated dependency:\n%s\n', method, rv.data) self.app.delete(del_get_url) def prepare_new_dependency(self): d = Dependency( -1, self.existing_environment_1, self.existing_role_1, self.existing_role_2, self.existing_type, self.existing_dependency, 'This is a test dependency' ) return d
44.648649
120
0.719492
7949dab1f6e0425bb2f4eb025f7238d57b02b5b3
19,705
py
Python
multiagent/environment.py
RavenPillmann/multiagent-particle-envs
466cc6953dfc57a0bfba5c37609db3ee7e2508a8
[ "MIT" ]
null
null
null
multiagent/environment.py
RavenPillmann/multiagent-particle-envs
466cc6953dfc57a0bfba5c37609db3ee7e2508a8
[ "MIT" ]
null
null
null
multiagent/environment.py
RavenPillmann/multiagent-particle-envs
466cc6953dfc57a0bfba5c37609db3ee7e2508a8
[ "MIT" ]
null
null
null
import gym from gym import spaces from gym.envs.registration import EnvSpec import numpy as np from multiagent.multi_discrete import MultiDiscrete from multiagent.scenarios.constants import D_LINE, O_LINE, Q_BACK NOT_DONE = 0 Q_BACK_FIRST_DOWN_LINE = 1 AGENT_OUT_OF_BOUNDS = 2 D_LINE_REACHED_Q_BACK = 3 Q_BACK_NOT_IN_BOUNDS = 4 Q_BACK_THREW_BALL = 5 # environment for all agents in the multiagent world # currently code assumes that no agents will be created/destroyed at runtime! class MultiAgentEnv(gym.Env): metadata = { 'render.modes' : ['human', 'rgb_array'] } def __init__(self, world, reset_callback=None, reward_callback=None, observation_callback=None, info_callback=None, done_callback=None, shared_viewer=True): self.world = world self.agents = self.world.policy_agents # set required vectorized gym env property self.n = len(world.policy_agents) # scenario callbacks self.reset_callback = reset_callback self.reward_callback = reward_callback self.observation_callback = observation_callback self.info_callback = info_callback # self.done_callback = _done_callback # environment parameters self.discrete_action_space = True # if true, action is a number 0...N, otherwise action is a one-hot N-dimensional vector self.discrete_action_input = False # if true, even the action is continuous, action will be performed discretely self.force_discrete_action = world.discrete_action if hasattr(world, 'discrete_action') else False # if true, every agent has the same reward self.shared_reward = world.collaborative if hasattr(world, 'collaborative') else False self.time = 0 # configure spaces self.action_space = [] self.observation_space = [] for agent in self.get_agents(): total_action_space = [] # physical action space if self.discrete_action_space: u_action_space = spaces.Discrete(world.dim_p * 2 + 1) else: u_action_space = spaces.Box(low=-agent.u_range, high=+agent.u_range, shape=(world.dim_p,), dtype=np.float32) if agent.movable: total_action_space.append(u_action_space) # communication action space if self.discrete_action_space: c_action_space = spaces.Discrete(world.dim_c) else: c_action_space = spaces.Box(low=0.0, high=1.0, shape=(world.dim_c,), dtype=np.float32) if not agent.silent: total_action_space.append(c_action_space) # total action space if len(total_action_space) > 1: # all action spaces are discrete, so simplify to MultiDiscrete action space if all([isinstance(act_space, spaces.Discrete) for act_space in total_action_space]): act_space = MultiDiscrete([[0, act_space.n - 1] for act_space in total_action_space]) else: act_space = spaces.Tuple(total_action_space) self.action_space.append(act_space) else: self.action_space.append(total_action_space[0]) # observation space obs_dim = len(observation_callback(agent, self.world)) self.observation_space.append(spaces.Box(low=-np.inf, high=+np.inf, shape=(obs_dim,), dtype=np.float32)) agent.action.c = np.zeros(self.world.dim_c) # rendering self.shared_viewer = shared_viewer if self.shared_viewer: self.viewer = None else: self.viewers = [None] * self.n self._reset_render() def get_agents(self): return [agent if not agent.is_done else None for agent in self.agents] def step(self, action_n): obs_n = [] reward_n = [] done_n = [] info_n = {'n': []} self.agents = self.world.policy_agents # print(self.agents) # set action for each agent for i, agent in enumerate(self.agents): self._set_action(action_n[i], agent, self.action_space[i]) # advance world state self.world.step() # record observation for each agent # print("New step") chance_of_completion = np.random.uniform(0.0, 1.0) made_throw = chance_of_completion < list(filter(lambda player: player.position == 'q_back', self.world.agents))[0].completion_percentage for agent in self.agents: obs_n.append(self._get_obs(agent)) reward = self._get_reward(agent) is_done = self.done_callback(agent, self.world) done_n.append(is_done) # TODO: # If done, I need to somehow indicate that so that no more actions are taken... # if (agent.position == 'q_back'): # print(agent.state.p_pos, self.world.line_of_scrimmage, agent.state.p_pos[1], self.world.line_of_scrimmage - agent.state.p_pos[1]) if is_done != NOT_DONE: agent.is_done = True # print("agent position", agent.position) # print(agent.state.p_pos) additional_reward = self.get_final_reward(is_done, agent, made_throw) # print("additional_reward", additional_reward) reward = reward + additional_reward reward_n.append(reward) info_n['n'].append(self._get_info(agent)) # all agents get total reward in cooperative case reward = np.sum(reward_n) if self.shared_reward: reward_n = [reward] * self.n return obs_n, reward_n, done_n, info_n def get_final_reward(self, is_done, agent, made_throw): # print(is_done, Q_BACK_NOT_IN_BOUNDS) if (is_done == Q_BACK_FIRST_DOWN_LINE): if (agent.position == O_LINE) or (agent.position == Q_BACK): return 120 else: return -120 elif (is_done == AGENT_OUT_OF_BOUNDS): return -80 elif (is_done == D_LINE_REACHED_Q_BACK): if (agent.position == O_LINE) or (agent.position == Q_BACK): return -120 # TODO else: return 120 elif is_done == Q_BACK_NOT_IN_BOUNDS: if (agent.position == O_LINE) or (agent.position == Q_BACK): return -80 else: return 80 elif is_done == Q_BACK_THREW_BALL: if (agent.position == O_LINE) or (agent.position == Q_BACK): return 80 if made_throw else -80 else: return -80 if made_throw else 80 def reset(self): # reset world self.reset_callback(self.world) # reset renderer self._reset_render() # record observations for each agent obs_n = [] self.agents = self.world.policy_agents for agent in self.get_agents(): obs = None if agent: obs = self._get_obs(agent) obs_n.append(obs) return obs_n # get info used for benchmarking def _get_info(self, agent): if self.info_callback is None: return {} return self.info_callback(agent, self.world) # get observation for a particular agent def _get_obs(self, agent): if self.observation_callback is None: return np.zeros(0) return self.observation_callback(agent, self.world) # get dones for a particular agent # unused right now -- agents are allowed to go beyond the viewing screen # def _get_done(self, agent): # if self.done_callback is None: # return False # return self.done_callback(agent, self.world) def done_callback(self, agent, world): # Use world.timeout, and see what's wrong if world.time > world.timeout: return Q_BACK_THREW_BALL # Agent is done if it is out of bounds if (not agent.in_bounds): return AGENT_OUT_OF_BOUNDS q_back = list(filter(lambda player: player.position == 'q_back', world.agents))[0] d_line = list(filter(lambda player: player.position == 'd_line', world.agents)) line_of_scrimmage = world.line_of_scrimmage q_pos = q_back.state.p_pos # Quarterback is past line of scrimmage if (q_pos[1] > (line_of_scrimmage + world.first_down_line)): return Q_BACK_FIRST_DOWN_LINE if (not q_back.in_bounds): return Q_BACK_NOT_IN_BOUNDS for d_player in d_line: # Check if d_player is close to q_back (ie touching, look into how to find that out) # If so return True d_pos = d_player.state.p_pos dist_min = q_back.size + d_player.size # If the quarterback and defensive player are touching, set agents to done if (((d_pos[0] - q_pos[0])**2 + (d_pos[1] - q_pos[1])**2)**0.5 < dist_min): return D_LINE_REACHED_Q_BACK return NOT_DONE # get reward for a particular agent def _get_reward(self, agent): if self.reward_callback is None: return 0.0 return self.reward_callback(agent, self.world) # set env action for a particular agent def _set_action(self, action, agent, action_space, time=None): agent.action.u = np.zeros(self.world.dim_p) agent.action.c = np.zeros(self.world.dim_c) # process action if isinstance(action_space, MultiDiscrete): act = [] size = action_space.high - action_space.low + 1 index = 0 for s in size: act.append(action[index:(index+s)]) index += s action = act else: action = [action] if agent.movable: # physical action if self.discrete_action_input: agent.action.u = np.zeros(self.world.dim_p) # process discrete action if action[0] == 1: agent.action.u[0] = -1.0 if action[0] == 2: agent.action.u[0] = +1.0 if action[0] == 3: agent.action.u[1] = -1.0 if action[0] == 4: agent.action.u[1] = +1.0 else: if self.force_discrete_action: d = np.argmax(action[0]) action[0][:] = 0.0 action[0][d] = 1.0 if self.discrete_action_space: agent.action.u[0] += action[0][1] - action[0][2] agent.action.u[1] += action[0][3] - action[0][4] else: agent.action.u = action[0] sensitivity = 5.0 if agent.accel is not None: sensitivity = agent.accel agent.action.u *= sensitivity action = action[1:] if not agent.silent: # communication action if self.discrete_action_input: agent.action.c = np.zeros(self.world.dim_c) agent.action.c[action[0]] = 1.0 else: agent.action.c = action[0] action = action[1:] # make sure we used all elements of action assert len(action) == 0 # reset rendering assets def _reset_render(self): self.render_geoms = None self.render_geoms_xform = None # render environment def render_whole_field(self, mode='human'): if mode == 'human': alphabet = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' message = '' for agent in self.world.agents: comm = [] for other in self.world.agents: if other is agent: continue if np.all(other.state.c == 0): word = '_' else: word = alphabet[np.argmax(other.state.c)] message += (other.name + ' to ' + agent.name + ': ' + word + ' ') # for i in range(len(self.viewers)): # # create viewers (if necessary) # if self.viewers[i] is None: # # import rendering only if we need it (and don't import for headless machines) # #from gym.envs.classic_control import rendering # from multiagent import rendering # self.viewers[i] = rendering.Viewer(700,700) if self.viewer is None: from multiagent import rendering self.viewer = rendering.Viewer(53*7, 120*7) # create rendering geometry if self.render_geoms is None: # import rendering only if we need it (and don't import for headless machines) #from gym.envs.classic_control import rendering from multiagent import rendering self.render_geoms = [] self.render_geoms_xform = [] for entity in self.world.entities: size = 2*entity.size # if entity.position == 'q_back': # size = 2*size geom = rendering.make_circle(size) xform = rendering.Transform() if 'q_back' == entity.position: geom.set_color(0, 1, 0, alpha=0.5) else: geom.set_color(*entity.color) geom.add_attr(xform) self.render_geoms.append(geom) self.render_geoms_xform.append(xform) self.viewer.geoms = [] for geom in self.render_geoms: self.viewer.add_geom(geom) line_of_scrimmage = self.world.line_of_scrimmage first_down_line = line_of_scrimmage + self.world.first_down_line self.viewer.draw_line((0, line_of_scrimmage), (53, line_of_scrimmage)) self.viewer.draw_line((0, first_down_line), (53, first_down_line)) results = [] from multiagent import rendering # update bounds to center around agent cam_range = 1 if self.shared_viewer: pos = np.zeros(self.world.dim_p) else: pos = self.agents[i].state.p_pos self.viewer.set_bounds(0, 53, 0, 120) # update geometry positions for e, entity in enumerate(self.world.entities): self.render_geoms_xform[e].set_translation(*entity.state.p_pos) # render to display or array results.append(self.viewer.render(return_rgb_array = mode=='rgb_array')) return results # render environment def render(self, mode='human'): if mode == 'human': alphabet = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' message = '' for agent in self.world.agents: comm = [] for other in self.world.agents: if other is agent: continue if np.all(other.state.c == 0): word = '_' else: word = alphabet[np.argmax(other.state.c)] message += (other.name + ' to ' + agent.name + ': ' + word + ' ') for i in range(len(self.viewers)): # create viewers (if necessary) if self.viewers[i] is None: # import rendering only if we need it (and don't import for headless machines) #from gym.envs.classic_control import rendering from multiagent import rendering self.viewers[i] = rendering.Viewer(700,700) # create rendering geometry if self.render_geoms is None: # import rendering only if we need it (and don't import for headless machines) #from gym.envs.classic_control import rendering from multiagent import rendering self.render_geoms = [] self.render_geoms_xform = [] for entity in self.world.entities: geom = rendering.make_circle(entity.size) xform = rendering.Transform() if 'q_back' == entity.position: geom.set_color(0, 1, 0, alpha=0.5) else: geom.set_color(*entity.color) geom.add_attr(xform) self.render_geoms.append(geom) self.render_geoms_xform.append(xform) # add geoms to viewer for viewer in self.viewers: viewer.geoms = [] for geom in self.render_geoms: viewer.add_geom(geom) results = [] for i in range(len(self.viewers)): from multiagent import rendering # update bounds to center around agent cam_range = 1 if self.shared_viewer: pos = np.zeros(self.world.dim_p) else: pos = self.agents[i].state.p_pos self.viewers[i].set_bounds(pos[0]-cam_range,pos[0]+cam_range,pos[1]-cam_range,pos[1]+cam_range) # update geometry positions for e, entity in enumerate(self.world.entities): self.render_geoms_xform[e].set_translation(*entity.state.p_pos) # render to display or array results.append(self.viewers[i].render(return_rgb_array = mode=='rgb_array')) return results # create receptor field locations in local coordinate frame def _make_receptor_locations(self, agent): receptor_type = 'polar' range_min = 0.05 * 2.0 range_max = 1.00 dx = [] # circular receptive field if receptor_type == 'polar': for angle in np.linspace(-np.pi, +np.pi, 8, endpoint=False): for distance in np.linspace(range_min, range_max, 3): dx.append(distance * np.array([np.cos(angle), np.sin(angle)])) # add origin dx.append(np.array([0.0, 0.0])) # grid receptive field if receptor_type == 'grid': for x in np.linspace(-range_max, +range_max, 5): for y in np.linspace(-range_max, +range_max, 5): dx.append(np.array([x,y])) return dx # vectorized wrapper for a batch of multi-agent environments # assumes all environments have the same observation and action space class BatchMultiAgentEnv(gym.Env): metadata = { 'runtime.vectorized': True, 'render.modes' : ['human', 'rgb_array'] } def __init__(self, env_batch): self.env_batch = env_batch @property def n(self): return np.sum([env.n for env in self.env_batch]) @property def action_space(self): return self.env_batch[0].action_space @property def observation_space(self): return self.env_batch[0].observation_space def step(self, action_n, time): obs_n = [] reward_n = [] done_n = [] info_n = {'n': []} i = 0 for env in self.env_batch: obs, reward, done, _ = env.step(action_n[i:(i+env.n)], time) i += env.n obs_n += obs # reward = [r / len(self.env_batch) for r in reward] reward_n += reward done_n += done return obs_n, reward_n, done_n, info_n def reset(self): obs_n = [] for env in self.env_batch: obs_n += env.reset() return obs_n # render environment def render(self, mode='human', close=True): results_n = [] for env in self.env_batch: results_n += env.render(mode, close) return results_n
38.713163
147
0.574372
7949db00de54c07f91399857d4370b1f9dde9ead
8,430
py
Python
tfx/orchestration/experimental/interactive/interactive_context_test.py
rtg0795/tfx
63c31b719896eef645df3850d0e6b946e44cd059
[ "Apache-2.0" ]
null
null
null
tfx/orchestration/experimental/interactive/interactive_context_test.py
rtg0795/tfx
63c31b719896eef645df3850d0e6b946e44cd059
[ "Apache-2.0" ]
null
null
null
tfx/orchestration/experimental/interactive/interactive_context_test.py
rtg0795/tfx
63c31b719896eef645df3850d0e6b946e44cd059
[ "Apache-2.0" ]
null
null
null
# Copyright 2019 Google LLC. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for tfx.orchestration.experimental.interactive.interactive_context.""" import builtins import os import shutil import tempfile import textwrap from typing import Any, Dict, List from unittest import mock import jinja2 import nbformat import tensorflow as tf from tfx import types from tfx.dsl.components.base import base_component from tfx.dsl.components.base import base_executor from tfx.dsl.components.base import executor_spec from tfx.orchestration.experimental.interactive import interactive_context from tfx.orchestration.experimental.interactive import standard_visualizations from tfx.orchestration.launcher.in_process_component_launcher import InProcessComponentLauncher from tfx.types import component_spec from tfx.types import standard_artifacts from tfx.utils import telemetry_utils class InteractiveContextTest(tf.test.TestCase): def setUp(self): super().setUp() builtins.__dict__['__IPYTHON__'] = True self._tmpdir = None def tearDown(self): if self._tmpdir: shutil.rmtree(self._tmpdir, ignore_errors=True) super().tearDown() def _setupTestNotebook(self, notebook_name='test_notebook.ipynb'): notebook = nbformat.v4.new_notebook( cells=[ nbformat.v4.new_markdown_cell(source='A markdown cell.'), nbformat.v4.new_code_cell(source='foo = 1'), nbformat.v4.new_markdown_cell(source='Another markdown cell.'), nbformat.v4.new_code_cell(source=textwrap.dedent('''\ %%skip_for_export !pip install something !ls x = 1 y = 2 print('this cell should not be exported')''')), nbformat.v4.new_code_cell(source=textwrap.dedent('''\ def bar(): %some_line_magic print('this line should not be exported') a = "hello" b = "world" return a + b''')), nbformat.v4.new_code_cell(source=textwrap.dedent('''\ def baz(): c = "nyan" d = "cat" return c + d''')), ] ) self._tmpdir = tempfile.mkdtemp() self._exportdir = tempfile.mkdtemp() self._notebook_fp = os.path.join(self._tmpdir, notebook_name) nbformat.write(notebook, self._notebook_fp) def testBasicRun(self): class _FakeComponentSpec(types.ComponentSpec): PARAMETERS = {} INPUTS = {} OUTPUTS = {} class _FakeExecutor(base_executor.BaseExecutor): CALLED = False def Do(self, input_dict: Dict[str, List[types.Artifact]], output_dict: Dict[str, List[types.Artifact]], exec_properties: Dict[str, Any]) -> None: _FakeExecutor.CALLED = True class _FakeComponent(base_component.BaseComponent): SPEC_CLASS = _FakeComponentSpec EXECUTOR_SPEC = executor_spec.ExecutorClassSpec(_FakeExecutor) def __init__(self, spec: types.ComponentSpec): super().__init__(spec=spec) c = interactive_context.InteractiveContext() component = _FakeComponent(_FakeComponentSpec()) c.run(component) self.assertTrue(_FakeExecutor.CALLED) def testRunMethodRequiresIPython(self): del builtins.__dict__['__IPYTHON__'] c = interactive_context.InteractiveContext() self.assertIsNone(c.run(None)) def testUnresolvedChannel(self): class _FakeComponentSpec(types.ComponentSpec): PARAMETERS = {} INPUTS = { 'input': component_spec.ChannelParameter(type=standard_artifacts.Examples) } OUTPUTS = {} class _FakeExecutor(base_executor.BaseExecutor): CALLED = False def Do(self, input_dict: Dict[str, List[types.Artifact]], output_dict: Dict[str, List[types.Artifact]], exec_properties: Dict[str, Any]) -> None: _FakeExecutor.CALLED = True class _FakeComponent(base_component.BaseComponent): SPEC_CLASS = _FakeComponentSpec EXECUTOR_SPEC = executor_spec.ExecutorClassSpec(_FakeExecutor) def __init__(self, spec: types.ComponentSpec): super().__init__(spec=spec) c = interactive_context.InteractiveContext() foo = types.Channel(type=standard_artifacts.Examples).set_artifacts( [standard_artifacts.Examples()]) component = _FakeComponent(_FakeComponentSpec(input=foo)) with self.assertRaisesRegex(ValueError, 'Unresolved input channel'): c.run(component) @mock.patch.object(jinja2.Environment, 'get_template', return_value=jinja2.Template('{{ notebook_content }}')) def testExportToPipeline(self, mock_get_template): self._setupTestNotebook() c = interactive_context.InteractiveContext() export_filepath = os.path.join(self._exportdir, 'exported_pipeline.py') c.export_to_pipeline(notebook_filepath=self._notebook_fp, export_filepath=export_filepath, runner_type='beam') with open(export_filepath, 'r') as exported_pipeline: code = exported_pipeline.read() self.assertEqual(code, textwrap.dedent('''\ foo = 1 def bar(): a = "hello" b = "world" return a + b def baz(): c = "nyan" d = "cat" return c + d''')) def testExportToPipelineRaisesErrorInvalidRunnerType(self): self._setupTestNotebook() c = interactive_context.InteractiveContext() export_filepath = os.path.join(self._exportdir, 'exported_pipeline.py') with self.assertRaisesRegex(ValueError, 'runner_type'): c.export_to_pipeline(notebook_filepath=self._notebook_fp, export_filepath=export_filepath, runner_type='foobar') @mock.patch('tfx.orchestration.experimental.interactive.' 'standard_visualizations.ExampleAnomaliesVisualization.display') def testShow(self, *unused_mocks): context = interactive_context.InteractiveContext() mock_object = mock.MagicMock() standard_visualizations.ExampleAnomaliesVisualization.display = mock_object mock_object.assert_not_called() artifact = standard_artifacts.ExampleAnomalies() context.show( types.Channel(type=standard_artifacts.ExampleAnomalies).set_artifacts( [artifact])) mock_object.assert_called_with(artifact) @mock.patch('tfx.orchestration.launcher.in_process_component_launcher.' 'InProcessComponentLauncher.create') def testTelemetry(self, mock_launcher_create): class _FakeLauncher: def __init__(self): self.recorded_labels = [] def launch(self): self.recorded_labels = telemetry_utils.make_beam_labels_args() return mock.MagicMock() class _FakeComponentSpec(types.ComponentSpec): PARAMETERS = {} INPUTS = {} OUTPUTS = {} class _FakeExecutor(base_executor.BaseExecutor): def Do(self, input_dict: Dict[str, List[types.Artifact]], output_dict: Dict[str, List[types.Artifact]], exec_properties: Dict[str, Any]) -> None: pass class _FakeComponent(base_component.BaseComponent): SPEC_CLASS = _FakeComponentSpec EXECUTOR_SPEC = executor_spec.ExecutorClassSpec(_FakeExecutor) def __init__(self): super().__init__(spec=_FakeComponentSpec()) # Set up fake on launcher. fake_launcher = _FakeLauncher() mock_launcher_create.side_effect = [fake_launcher] InProcessComponentLauncher.create = mock_launcher_create context = interactive_context.InteractiveContext() context.run(_FakeComponent()) self.assertIn('--labels tfx_runner=interactivecontext', ' '.join(fake_launcher.recorded_labels)) if __name__ == '__main__': tf.test.main()
34.834711
95
0.681851
7949dcc654078584a7db402a3f685b97bc1a40e0
7,150
py
Python
experiments/murtaza/off_policy_ssl/gym/sac.py
Asap7772/rail-rl-franka-eval
4bf99072376828193d05b53cf83c7e8f4efbd3ba
[ "MIT" ]
null
null
null
experiments/murtaza/off_policy_ssl/gym/sac.py
Asap7772/rail-rl-franka-eval
4bf99072376828193d05b53cf83c7e8f4efbd3ba
[ "MIT" ]
null
null
null
experiments/murtaza/off_policy_ssl/gym/sac.py
Asap7772/rail-rl-franka-eval
4bf99072376828193d05b53cf83c7e8f4efbd3ba
[ "MIT" ]
null
null
null
""" Test twin sac against various environments. """ import gym from railrl.data_management.env_replay_buffer import EnvReplayBuffer from railrl.launchers.launcher_util import run_experiment import railrl.torch.pytorch_util as ptu from railrl.samplers.data_collector import MdpPathCollector from railrl.samplers.data_collector.step_collector import MdpStepCollector from railrl.torch.networks import FlattenMlp from railrl.torch.sac.policies import TanhGaussianPolicy, MakeDeterministic from railrl.torch.sac.sac import SACTrainer import railrl.misc.hyperparameter as hyp from railrl.torch.torch_rl_algorithm import ( TorchBatchRLAlgorithm, TorchOnlineRLAlgorithm, ) ENV_PARAMS = { 'half-cheetah': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 10000, 'env_id':'HalfCheetah-v2' }, 'hopper': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 10000, 'env_id':'Hopper-v2' }, 'humanoid': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 10000, 'env_id':'Humanoid-v2' }, 'inv-double-pendulum': { # 2 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 100, 'env_id':'InvertedDoublePendulum-v2' }, 'pendulum': { # 2 DoF 'num_expl_steps_per_train_loop': 200, 'max_path_length': 200, 'num_epochs': 200, 'min_num_steps_before_training': 2000, 'target_update_period': 200, 'env_id':'InvertedPendulum-v2' }, 'ant': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 10000, 'env_id':'Ant-v2' }, 'walker': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 10000, 'env_id':'Walker2d-v2' }, 'swimmer': { # 6 DoF 'num_expl_steps_per_train_loop': 1000, 'max_path_length': 1000, 'num_epochs': 2000, 'env_id':'Swimmer-v2' }, } def experiment(variant): env_params = ENV_PARAMS[variant['env']] variant.update(env_params) if 'env_id' in env_params: expl_env = gym.make(env_params['env_id']) eval_env = gym.make(env_params['env_id']) obs_dim = expl_env.observation_space.low.size action_dim = eval_env.action_space.low.size M = variant['layer_size'] qf1 = FlattenMlp( input_size=obs_dim + action_dim, output_size=1, hidden_sizes=[M, M], ) qf2 = FlattenMlp( input_size=obs_dim + action_dim, output_size=1, hidden_sizes=[M, M], ) target_qf1 = FlattenMlp( input_size=obs_dim + action_dim, output_size=1, hidden_sizes=[M, M], ) target_qf2 = FlattenMlp( input_size=obs_dim + action_dim, output_size=1, hidden_sizes=[M, M], ) policy = TanhGaussianPolicy( obs_dim=obs_dim, action_dim=action_dim, hidden_sizes=[M, M], ) eval_policy = MakeDeterministic(policy) eval_path_collector = MdpPathCollector( eval_env, eval_policy, ) replay_buffer = EnvReplayBuffer( variant['replay_buffer_size'], expl_env, ) trainer = SACTrainer( env=eval_env, policy=policy, qf1=qf1, qf2=qf2, target_qf1=target_qf1, target_qf2=target_qf2, **variant['trainer_kwargs'] ) if variant['collection_mode'] == 'online': expl_path_collector = MdpStepCollector( expl_env, policy, ) algorithm = TorchOnlineRLAlgorithm( trainer=trainer, exploration_env=expl_env, evaluation_env=eval_env, exploration_data_collector=expl_path_collector, evaluation_data_collector=eval_path_collector, replay_buffer=replay_buffer, max_path_length=variant['max_path_length'], batch_size=variant['batch_size'], num_epochs=variant['num_epochs'], num_eval_steps_per_epoch=variant['num_eval_steps_per_epoch'], num_expl_steps_per_train_loop=variant['num_expl_steps_per_train_loop'], num_trains_per_train_loop=variant['num_trains_per_train_loop'], min_num_steps_before_training=variant['min_num_steps_before_training'], ) else: expl_path_collector = MdpPathCollector( expl_env, policy, ) algorithm = TorchBatchRLAlgorithm( trainer=trainer, exploration_env=expl_env, evaluation_env=eval_env, exploration_data_collector=expl_path_collector, evaluation_data_collector=eval_path_collector, replay_buffer=replay_buffer, max_path_length=variant['max_path_length'], batch_size=variant['batch_size'], num_epochs=variant['num_epochs'], num_eval_steps_per_epoch=variant['num_eval_steps_per_epoch'], num_expl_steps_per_train_loop=variant['num_expl_steps_per_train_loop'], num_trains_per_train_loop=variant['num_trains_per_train_loop'], min_num_steps_before_training=variant['min_num_steps_before_training'], ) algorithm.to(ptu.device) algorithm.train() if __name__ == "__main__": variant = dict( num_epochs=3000, num_eval_steps_per_epoch=5000, num_trains_per_train_loop=1000, num_expl_steps_per_train_loop=1000, min_num_steps_before_training=1000, max_path_length=1000, batch_size=256, replay_buffer_size=int(1E6), layer_size=256, algorithm="SAC", version="normal", collection_mode='batch', trainer_kwargs=dict( discount=0.99, soft_target_tau=5e-3, target_update_period=1, policy_lr=3E-4, qf_lr=3E-4, reward_scale=1, use_automatic_entropy_tuning=True, ), ) # n_seeds = 1 # mode = 'local' # exp_prefix = 'dev' n_seeds = 2 mode = 'ec2' exp_prefix = 'sac_mujoco_envs_unnormalized_run_longer' search_space = { 'env': [ # 'half-cheetah', # 'inv-double-pendulum', # 'pendulum', # 'ant', 'walker', # 'hopper', # 'humanoid', # 'swimmer', ], } sweeper = hyp.DeterministicHyperparameterSweeper( search_space, default_parameters=variant, ) for exp_id, variant in enumerate(sweeper.iterate_hyperparameters()): for _ in range(n_seeds): run_experiment( experiment, num_exps_per_instance=3, exp_prefix=exp_prefix, mode=mode, variant=variant, exp_id=exp_id, time_in_mins=int(2.8 * 24 * 60), # if you use mode=sss )
30.952381
83
0.614965
7949dceb549381f448a11eab464a933b8176a3b0
987
py
Python
src/dashboards/context_processors.py
PhaseDMS/phase
4f776d0b1b5e7916a3e26aee890b3c2b9454ef0e
[ "MIT" ]
2
2021-09-10T19:40:30.000Z
2022-01-31T07:15:51.000Z
src/dashboards/context_processors.py
PhaseDMS/phase
4f776d0b1b5e7916a3e26aee890b3c2b9454ef0e
[ "MIT" ]
null
null
null
src/dashboards/context_processors.py
PhaseDMS/phase
4f776d0b1b5e7916a3e26aee890b3c2b9454ef0e
[ "MIT" ]
1
2021-09-10T19:40:42.000Z
2021-09-10T19:40:42.000Z
from django.contrib.auth.models import AnonymousUser from django.core.cache import cache from dashboards.models import Dashboard def dashboards(request): """Fetch and cache data required to render the dashboards menu.""" user = getattr(request, "user") context = {} if not isinstance(user, AnonymousUser): context.update({"user_dashboards": get_user_dashboards(user)}) return context def get_user_dashboards(user): cache_key = "user_{}_dashboards".format(user.id) dashboards = cache.get(cache_key) if dashboards is None: qs = Dashboard.objects.filter(authorized_users=user).select_related( "category__organisation" ) dashboards = [ ( dashboard.category.organisation.name, dashboard.title, dashboard.get_absolute_url(), ) for dashboard in qs ] cache.set(cache_key, dashboards, 500) return dashboards
27.416667
76
0.646403
7949dd0d3e2864e058e3c1c9efd9731adcf25e32
326
py
Python
setup.py
Nimphal/world-news
a424603c55245e0922d1b887f4cd7dd0711e6305
[ "MIT" ]
null
null
null
setup.py
Nimphal/world-news
a424603c55245e0922d1b887f4cd7dd0711e6305
[ "MIT" ]
null
null
null
setup.py
Nimphal/world-news
a424603c55245e0922d1b887f4cd7dd0711e6305
[ "MIT" ]
null
null
null
from setuptools import setup, find_packages setup( name = 'world-news', version = '1.0.0', packages = find_packages(), install_requires = [ "Flask" ], author = 'Nevelina Aleksandrova', author_email = 'nevelina.aleksandrova@gmail.com', description = 'Map-based world news aggregator' )
23.285714
53
0.650307
7949dd2e40fb0cd1649823ac0e3c4c83fbeb354c
2,554
py
Python
test_toolbox.py
atravitz/toolbox
3c98d1a107110655529caa40f1c768466ce52421
[ "MIT" ]
null
null
null
test_toolbox.py
atravitz/toolbox
3c98d1a107110655529caa40f1c768466ce52421
[ "MIT" ]
null
null
null
test_toolbox.py
atravitz/toolbox
3c98d1a107110655529caa40f1c768466ce52421
[ "MIT" ]
null
null
null
"""tests for toolbox.py module.""" import numpy as np from toolbox import * import unittest import numpy.testing as nptest import os import matplotlib.pyplot as plt class PotentialTests(unittest.TestCase): def setUp(self): self.epsilon = 1.0 self.sigma = 1.0 self.R = 0 self.r_values = np.linspace(1+self.R, 3.5*self.sigma+self.R, 100) self.V_true, self.F_true = lj(r=self.r_values, epsilon=self.epsilon, sigma=self.sigma, R=self.R) def test_lj(self): pass def test_force_to_potential(self): """Uses a lj potential to test force_to_potential().""" # TODO: Come up with reasonable and universal criteria print(self.F_true[-1]) V_test = force_to_potential(self.r_values, self.F_true) plt.figure(dpi=120) plt.plot(self.r_values, self.F_true, 'k--', label='F_true') plt.plot(self.r_values, self.V_true, '.', label='V_true') plt.plot(self.r_values[1:], V_test,'.', label='V_test') plt.ylim(-10,10) plt.legend() plt.savefig('test_f2p.png') percent_error = np.abs((V_test-self.V_true[1:])) self.assertLess(np.max(percent_error), 2) def test_potential_to_force(self): """Uses a lj potential to test force_to_potential().""" # TODO: Come up with reasonable and universal criteria F_test = potential_to_force(self.r_values, self.V_true) plt.figure(dpi=120) plt.plot(self.r_values, self.V_true, 'k--', label='V_true') plt.plot(self.r_values, self.F_true, '.', label='F_true') plt.plot(self.r_values, F_test,'.', label='F_test') plt.savefig('test_p2f.png') percent_error = np.abs((F_test-self.F_true))/np.abs(self.F_true) self.assertLess(np.max(percent_error), 1) class CorrTests(unittest.TestCase): def test_scalar_sin(self): """test autocorr with a sin function """ x_range = np.linspace(0,3,100) sin_x = np.sin(x_range*2*np.pi) autocorr(sin_x) def test_scalar_random(self): random = np.random.standard_normal(size=50) ac = autocorr(random) self.assertEqual(ac[0], 1.0) def test_vec_unit(self): unit_vecs = np.array([[0,0,1], [0,0,1]]) def test_vec_random(self): random = np.random.standard_normal(size=(50,3)) ac = vector_autocorr(random) self.assertEqual(ac[0], 1.0) if __name__ == '__main__': unittest.main()
34.053333
73
0.612373
7949ddd4fff0edadc9cca18b4de1cea87ad8f725
1,436
py
Python
example/test.py
movingpictures83/OTUSummary
2cc84a2beca4b3ed217a6b6d3d0498fa1c8f24e4
[ "MIT" ]
null
null
null
example/test.py
movingpictures83/OTUSummary
2cc84a2beca4b3ed217a6b6d3d0498fa1c8f24e4
[ "MIT" ]
null
null
null
example/test.py
movingpictures83/OTUSummary
2cc84a2beca4b3ed217a6b6d3d0498fa1c8f24e4
[ "MIT" ]
null
null
null
def isnumber(mystring): digitcount = 0 for i in range(0, len(mystring)): c = mystring[i] if ((not c.isdigit()) and (c != '.') and (not (i == 0 and c == '-'))): return False elif (c.isdigit()): digitcount += 1 if (digitcount != 0): return True def test(file1, file2): firstfile = open(file1, 'r') secondfile = open(file2, 'r') lines1 = [] lines2 = [] for line in firstfile: lines1.append(line.strip()) for line in secondfile: lines2.append(line.strip()) if (len(lines1) != len(lines2)): return False for i in range(0, len(lines1)): contents1 = lines1[i].split('\t') contents2 = lines2[i].split('\t') for j in range(0, len(contents1)): if (isnumber(contents1[j]) and not isnumber(contents2[j])): return False elif (not isnumber(contents1[j]) and isnumber(contents2[j])): return False elif (isnumber(contents1[j])): f1 = float(contents1[j]) f2 = float(contents2[j]) if (f1 == 0): if (f2 != 0): return False elif ((f2-f1)/f1 > 0.01): return False else: if (contents1[j] != contents2[j]): print(contents1[j]) print(contents2[j]) return False return True
30.553191
78
0.491643
7949dfc2b5c18d7de0268d2f3a2ed448d884b61c
78
py
Python
Python/01.py
Jose0Cicero1Ribeiro0Junior/Python_Praticas
ad7ae517735e51f25c40d9c38d3efc214d749dfb
[ "MIT" ]
null
null
null
Python/01.py
Jose0Cicero1Ribeiro0Junior/Python_Praticas
ad7ae517735e51f25c40d9c38d3efc214d749dfb
[ "MIT" ]
null
null
null
Python/01.py
Jose0Cicero1Ribeiro0Junior/Python_Praticas
ad7ae517735e51f25c40d9c38d3efc214d749dfb
[ "MIT" ]
null
null
null
# Faça um programa que leia um número inteiro e o imprima n = int(6) print(n)
19.5
57
0.717949
7949dfdfd88eb377da76287b249cdae853691acb
2,127
py
Python
integrationtest/vm/virtualrouter/volume/test_crt_data_volume_tmpt_from_d.py
sherry546/zstack-woodpecker
54a37459f2d72ce6820974feaa6eb55772c3d2ce
[ "Apache-2.0" ]
2
2016-03-23T08:45:44.000Z
2017-06-26T02:40:46.000Z
integrationtest/vm/virtualrouter/volume/test_crt_data_volume_tmpt_from_d.py
KevinDavidMitnick/zstack-woodpecker
96257faaf3c362168d008bdb47002025ad669b24
[ "Apache-2.0" ]
null
null
null
integrationtest/vm/virtualrouter/volume/test_crt_data_volume_tmpt_from_d.py
KevinDavidMitnick/zstack-woodpecker
96257faaf3c362168d008bdb47002025ad669b24
[ "Apache-2.0" ]
2
2020-03-12T03:11:28.000Z
2021-07-26T01:57:58.000Z
''' Create Volume Template from Data Volume @author: Youyk ''' import zstackwoodpecker.test_util as test_util import zstackwoodpecker.test_lib as test_lib import zstackwoodpecker.test_state as test_state import os test_stub = test_lib.lib_get_test_stub() test_obj_dict = test_state.TestStateDict() def test(): test_util.test_dsc('Create test vm and check') vm = test_stub.create_vlan_vm() test_obj_dict.add_vm(vm) test_util.test_dsc('Create volume and check') disk_offering = test_lib.lib_get_disk_offering_by_name(os.environ.get('smallDiskOfferingName')) volume_creation_option = test_util.VolumeOption() volume_creation_option.set_disk_offering_uuid(disk_offering.uuid) volume = test_stub.create_volume(volume_creation_option) test_obj_dict.add_volume(volume) test_util.test_dsc('Attach volume and check') #vm.check() volume.attach(vm) test_util.test_dsc('Detach volume and check') volume.detach() test_util.test_dsc('Create volume template and check') bs_list = test_lib.lib_get_backup_storage_list_by_vm(vm.get_vm()) bs_uuid_list = [] for bs in bs_list: bs_uuid_list.append(bs.uuid) vol_tmpt = volume.create_template(bs_uuid_list, 'new_data_template') test_obj_dict.add_image(vol_tmpt) vol_tmpt.check() volume.check() volume.delete() test_obj_dict.rm_volume(volume) test_util.test_dsc('Create volume from template and check') ps_uuid = vm.get_vm().allVolumes[0].primaryStorageUuid volume2 = vol_tmpt.create_data_volume(ps_uuid, 'new_volume_from_template') test_obj_dict.add_volume(volume2) vol_tmpt.delete() test_obj_dict.rm_image(vol_tmpt) volume2.check() volume2.attach(vm) vm.check() volume2.check() volume2.detach() volume2.delete() test_obj_dict.rm_volume(volume2) vm.destroy() test_util.test_pass('Create Data Volume Template from Data Volume Success') #Will be called only if exception happens in test(). def error_cleanup(): test_lib.lib_error_cleanup(test_obj_dict)
31.279412
100
0.728256
7949e01866ac1973fb577ee31a5d5f5847d8ca52
1,117
py
Python
steamapi/getleaguelisting.py
NNTin/Dota-2-Meta-Analyzer
ce19ab414cbe0a8ff720539fd766db69604e3488
[ "MIT" ]
22
2016-03-27T21:28:18.000Z
2021-09-13T14:48:43.000Z
steamapi/getleaguelisting.py
NNTin/Dota-2-Meta-Analyzer
ce19ab414cbe0a8ff720539fd766db69604e3488
[ "MIT" ]
24
2016-03-28T09:39:41.000Z
2018-11-06T20:42:30.000Z
steamapi/getleaguelisting.py
NNTin/Reply-Dota-2-Reddit
e47d20f3d5bfacc9f39625324e57781e8d3f029a
[ "MIT" ]
null
null
null
import requests import time from steamapi.steamapikey import SteamAPIKey #message = True leagueListingDictionary = {} def requestGetLeagueListing(): keyValues = ['name', 'description', 'tournament_url', 'itemdef'] response = {} attempt = 0 while response == {}: URL = "https://api.steampowered.com/IDOTA2Match_570/GetLeagueListing/v1?key=" + SteamAPIKey response = requests.get(URL) response.connection.close() response = response.json() if response == {}: attempt += 1 if (attempt == 5): print('Tried %s times, cancelling API request. (Skipped counter increases)') break print('Failed API request, retrying in %s seconds' %(attempt * 2)) time.sleep(attempt * 2) continue else: break global leagueListingDictionary for league in response['result']['leagues']: leagueListingDictionary[league['leagueid']] = {} for key in keyValues: leagueListingDictionary[league['leagueid']][key] = league.get(key, 0)
26.595238
99
0.606088
7949e0ae3310068542e313570a433cc3f6fee63e
5,339
py
Python
kubernetes/client/models/v1beta1_network_policy_egress_rule.py
Prahladk09/python-1
2dfb3035535e4be52ba549f1ff47acbe573b73f6
[ "Apache-2.0" ]
11
2020-10-13T05:27:59.000Z
2021-09-23T02:56:32.000Z
kubernetes/client/models/v1beta1_network_policy_egress_rule.py
Prahladk09/python-1
2dfb3035535e4be52ba549f1ff47acbe573b73f6
[ "Apache-2.0" ]
48
2020-10-15T09:53:36.000Z
2021-07-05T15:33:24.000Z
kubernetes/client/models/v1beta1_network_policy_egress_rule.py
Prahladk09/python-1
2dfb3035535e4be52ba549f1ff47acbe573b73f6
[ "Apache-2.0" ]
4
2020-12-04T08:51:35.000Z
2022-03-27T09:42:20.000Z
# coding: utf-8 """ Kubernetes No description provided (generated by Swagger Codegen https://github.com/swagger-api/swagger-codegen) OpenAPI spec version: v1.14.4 Generated by: https://github.com/swagger-api/swagger-codegen.git """ from pprint import pformat from six import iteritems import re class V1beta1NetworkPolicyEgressRule(object): """ NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ """ Attributes: swagger_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ swagger_types = { 'ports': 'list[V1beta1NetworkPolicyPort]', 'to': 'list[V1beta1NetworkPolicyPeer]' } attribute_map = { 'ports': 'ports', 'to': 'to' } def __init__(self, ports=None, to=None): """ V1beta1NetworkPolicyEgressRule - a model defined in Swagger """ self._ports = None self._to = None self.discriminator = None if ports is not None: self.ports = ports if to is not None: self.to = to @property def ports(self): """ Gets the ports of this V1beta1NetworkPolicyEgressRule. List of destination ports for outgoing traffic. Each item in this list is combined using a logical OR. If this field is empty or missing, this rule matches all ports (traffic not restricted by port). If this field is present and contains at least one item, then this rule allows traffic only if the traffic matches at least one port in the list. :return: The ports of this V1beta1NetworkPolicyEgressRule. :rtype: list[V1beta1NetworkPolicyPort] """ return self._ports @ports.setter def ports(self, ports): """ Sets the ports of this V1beta1NetworkPolicyEgressRule. List of destination ports for outgoing traffic. Each item in this list is combined using a logical OR. If this field is empty or missing, this rule matches all ports (traffic not restricted by port). If this field is present and contains at least one item, then this rule allows traffic only if the traffic matches at least one port in the list. :param ports: The ports of this V1beta1NetworkPolicyEgressRule. :type: list[V1beta1NetworkPolicyPort] """ self._ports = ports @property def to(self): """ Gets the to of this V1beta1NetworkPolicyEgressRule. List of destinations for outgoing traffic of pods selected for this rule. Items in this list are combined using a logical OR operation. If this field is empty or missing, this rule matches all destinations (traffic not restricted by destination). If this field is present and contains at least one item, this rule allows traffic only if the traffic matches at least one item in the to list. :return: The to of this V1beta1NetworkPolicyEgressRule. :rtype: list[V1beta1NetworkPolicyPeer] """ return self._to @to.setter def to(self, to): """ Sets the to of this V1beta1NetworkPolicyEgressRule. List of destinations for outgoing traffic of pods selected for this rule. Items in this list are combined using a logical OR operation. If this field is empty or missing, this rule matches all destinations (traffic not restricted by destination). If this field is present and contains at least one item, this rule allows traffic only if the traffic matches at least one item in the to list. :param to: The to of this V1beta1NetworkPolicyEgressRule. :type: list[V1beta1NetworkPolicyPeer] """ self._to = to def to_dict(self): """ Returns the model properties as a dict """ result = {} for attr, _ in iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value return result def to_str(self): """ Returns the string representation of the model """ return pformat(self.to_dict()) def __repr__(self): """ For `print` and `pprint` """ return self.to_str() def __eq__(self, other): """ Returns true if both objects are equal """ if not isinstance(other, V1beta1NetworkPolicyEgressRule): return False return self.__dict__ == other.__dict__ def __ne__(self, other): """ Returns true if both objects are not equal """ return not self == other
34.445161
398
0.622588
7949e0e3ffeae813308c77f2755779fdaf13cf1c
355
py
Python
src/anyconfig/api/datatypes.py
Terrance-forks/python-anyconfig
21d7c0e30287569b394972557b5a54fab03bcd5c
[ "MIT" ]
213
2015-01-14T22:09:20.000Z
2022-02-02T17:23:41.000Z
src/anyconfig/api/datatypes.py
Terrance-forks/python-anyconfig
21d7c0e30287569b394972557b5a54fab03bcd5c
[ "MIT" ]
120
2015-03-13T15:47:43.000Z
2022-03-31T01:55:34.000Z
src/anyconfig/api/datatypes.py
Terrance-forks/python-anyconfig
21d7c0e30287569b394972557b5a54fab03bcd5c
[ "MIT" ]
34
2015-01-12T05:03:30.000Z
2021-09-09T14:40:56.000Z
# # Copyright (C) 2012 Satoru SATOH <satoru.satoh@gmail.com> # SPDX-License-Identifier: MIT # # pylint: disable=unused-import,import-error,invalid-name r"""Public APIs to dump configurations data. """ import typing from ..backend import base from ..common import InDataT MaybeDataT = typing.Optional[InDataT] ParserT = base.Parser # vim:sw=4:ts=4:et:
19.722222
58
0.746479
7949e11430f9258dd2a181a66625fa88cfe610ac
1,892
py
Python
url_tldr.py
AmanKishore/GPT3-Experiments
ea661b66d6cab843e406c65f7a1db1de41c62a57
[ "MIT" ]
null
null
null
url_tldr.py
AmanKishore/GPT3-Experiments
ea661b66d6cab843e406c65f7a1db1de41c62a57
[ "MIT" ]
null
null
null
url_tldr.py
AmanKishore/GPT3-Experiments
ea661b66d6cab843e406c65f7a1db1de41c62a57
[ "MIT" ]
null
null
null
import os import openai import re from collections import OrderedDict import requests, PyPDF2 from io import BytesIO from WebScraper import scraper openai.api_key = os.environ["OPENAI_API_KEY"] def getTLDRfromURL(): # creating a pdf file object url = input("Enter the pdf url: ") response = requests.get(url) my_raw_data = response.content final_text = "" with BytesIO(my_raw_data) as data: try: read_pdf = PyPDF2.PdfFileReader(data) # Iterate through pages (max of 1 to save money) for page in range(min(read_pdf.getNumPages(), 1)): ai_text = read_pdf.getPage(page).extractText() response = openai.Completion.create( engine="davinci", prompt=ai_text + "\n\ntl;dr:", temperature=0.3, max_tokens=60, top_p=1.0, frequency_penalty=0.0, presence_penalty=0.0 ) final_text += response["choices"][0]["text"] except: data = scraper(url) response = openai.Completion.create( engine="davinci", prompt=data[500:] + "\n\ntl;dr:", temperature=0.3, max_tokens=60, top_p=1.0, frequency_penalty=0.0, presence_penalty=0.0 ) final_text = response["choices"][0]["text"] "\n".join(list(OrderedDict.fromkeys(final_text.split("\n")))) final_text = final_text.replace('Click to expand... ', '') final_text = final_text.replace('\n\n', '\n') final_text = re.sub(r'^\\s+|[\\s&&[^\\r\\n]](?=\\s|$)|\\s+\\z', '', final_text) return final_text if __name__ == "__main__": response = getTLDRfromURL() print(response)
30.031746
83
0.534355
7949e19e91d9d1b850a38856ca4f3f5948f99af4
1,624
py
Python
main_api/migrations/0004_auto_20180917_1332.py
connorrunyan1/ragnarok
4c8e7754a6b3c316da982d142f461775cc25d644
[ "MIT" ]
6
2018-08-11T14:52:40.000Z
2021-01-06T01:39:15.000Z
main_api/migrations/0004_auto_20180917_1332.py
connorrunyan1/ragnarok
4c8e7754a6b3c316da982d142f461775cc25d644
[ "MIT" ]
10
2018-10-25T18:31:36.000Z
2022-02-10T07:28:39.000Z
main_api/migrations/0004_auto_20180917_1332.py
connorrunyan1/ragnarok
4c8e7754a6b3c316da982d142f461775cc25d644
[ "MIT" ]
5
2018-10-25T19:41:07.000Z
2020-07-11T09:26:50.000Z
# Generated by Django 2.1 on 2018-09-17 10:32 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('main_api', '0003_auto_20180809_1001'), ] operations = [ migrations.CreateModel( name='UserProfile', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('balance', models.IntegerField(default=0, verbose_name='Account balance')), ('user', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='profile', to=settings.AUTH_USER_MODEL, verbose_name='Master account')), ], options={ 'db_table': 'cp_user_profile', }, ), migrations.AlterModelOptions( name='userverification', options={'verbose_name': 'E-Mail Verification', 'verbose_name_plural': 'E-Mail Verifications'}, ), migrations.AlterField( model_name='userverification', name='is_available', field=models.BooleanField(default=True, verbose_name='Is token available?'), ), migrations.AlterField( model_name='userverification', name='user', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='verification', to=settings.AUTH_USER_MODEL, verbose_name='Master account'), ), ]
38.666667
173
0.632389
7949e1a5a81f7da54eb5a73694f6d6c8335363b3
544
py
Python
administrator/logger.py
flifloo/BotBDE
9c508b81b0f5cbde80f29a8d1972d6c901478e41
[ "MIT" ]
null
null
null
administrator/logger.py
flifloo/BotBDE
9c508b81b0f5cbde80f29a8d1972d6c901478e41
[ "MIT" ]
2
2020-04-10T16:43:50.000Z
2020-05-28T15:49:46.000Z
administrator/logger.py
flifloo/BotBDE
9c508b81b0f5cbde80f29a8d1972d6c901478e41
[ "MIT" ]
null
null
null
import logging from logging import handlers from os import mkdir from os.path import isdir if not isdir("../logs"): mkdir("../logs") log_format = "{%(levelname)s}[%(asctime)s]: %(name)s | %(message)s" logging.basicConfig( format=log_format, level=logging.INFO ) logger = logging.getLogger("Administrator") handler = handlers.TimedRotatingFileHandler("../logs/current.log", when="d", interval=1) handler.suffix = "%Y-%m-%d" handler.style = log_format handler.setFormatter(logging.Formatter(log_format)) logger.addHandler(handler)
25.904762
88
0.731618
7949e226b7a80d0d404a2d9be9a4bb57c091f6f4
304
py
Python
main.py
jaideng1/self-deletion
74b7ac42757e3c8313843bbe3629c852eedb74b8
[ "MIT" ]
null
null
null
main.py
jaideng1/self-deletion
74b7ac42757e3c8313843bbe3629c852eedb74b8
[ "MIT" ]
null
null
null
main.py
jaideng1/self-deletion
74b7ac42757e3c8313843bbe3629c852eedb74b8
[ "MIT" ]
null
null
null
import os inp = str(raw_input("Do you want to delete this program? ")) if inp.lower() == "yes" or inp.lower() == "y": if os.path.exists("main.py"): print("cya <o/") os.remove("main.py") else: print("doesn't exist.") else: print("oh. ok. guess i live another day.")
21.714286
60
0.5625
7949e249e2d536248b4cd881d61f4c4f6ef7b04d
40,811
py
Python
05-data_acquisition/telegram_bot/echo_bot/myvenv/lib/python3.8/site-packages/telegram/user.py
sachinpr0001/data_science
d028233ff7bbcbbb6b26f01806d1c5ccf788df9a
[ "MIT" ]
null
null
null
05-data_acquisition/telegram_bot/echo_bot/myvenv/lib/python3.8/site-packages/telegram/user.py
sachinpr0001/data_science
d028233ff7bbcbbb6b26f01806d1c5ccf788df9a
[ "MIT" ]
null
null
null
05-data_acquisition/telegram_bot/echo_bot/myvenv/lib/python3.8/site-packages/telegram/user.py
sachinpr0001/data_science
d028233ff7bbcbbb6b26f01806d1c5ccf788df9a
[ "MIT" ]
null
null
null
#!/usr/bin/env python # pylint: disable=W0622 # # A library that provides a Python interface to the Telegram Bot API # Copyright (C) 2015-2021 # Leandro Toledo de Souza <devs@python-telegram-bot.org> # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser Public License for more details. # # You should have received a copy of the GNU Lesser Public License # along with this program. If not, see [http://www.gnu.org/licenses/]. """This module contains an object that represents a Telegram User.""" from datetime import datetime from typing import TYPE_CHECKING, Any, List, Optional, Union, Tuple from telegram import TelegramObject, constants from telegram.utils.helpers import ( mention_html as util_mention_html, DEFAULT_NONE, DEFAULT_20, ) from telegram.utils.helpers import mention_markdown as util_mention_markdown from telegram.utils.types import JSONDict, FileInput, ODVInput, DVInput if TYPE_CHECKING: from telegram import ( Bot, Message, UserProfilePhotos, MessageId, InputMediaAudio, InputMediaDocument, InputMediaPhoto, InputMediaVideo, MessageEntity, ReplyMarkup, PhotoSize, Audio, Contact, Document, InlineKeyboardMarkup, LabeledPrice, Location, Animation, Sticker, Video, Venue, VideoNote, Voice, ) class User(TelegramObject): """This object represents a Telegram user or bot. Objects of this class are comparable in terms of equality. Two objects of this class are considered equal, if their :attr:`id` is equal. Args: id (:obj:`int`): Unique identifier for this user or bot. is_bot (:obj:`bool`): :obj:`True`, if this user is a bot. first_name (:obj:`str`): User's or bots first name. last_name (:obj:`str`, optional): User's or bots last name. username (:obj:`str`, optional): User's or bots username. language_code (:obj:`str`, optional): IETF language tag of the user's language. can_join_groups (:obj:`str`, optional): :obj:`True`, if the bot can be invited to groups. Returned only in :attr:`telegram.Bot.get_me` requests. can_read_all_group_messages (:obj:`str`, optional): :obj:`True`, if privacy mode is disabled for the bot. Returned only in :attr:`telegram.Bot.get_me` requests. supports_inline_queries (:obj:`str`, optional): :obj:`True`, if the bot supports inline queries. Returned only in :attr:`telegram.Bot.get_me` requests. bot (:class:`telegram.Bot`, optional): The Bot to use for instance methods. Attributes: id (:obj:`int`): Unique identifier for this user or bot. is_bot (:obj:`bool`): :obj:`True`, if this user is a bot. first_name (:obj:`str`): User's or bot's first name. last_name (:obj:`str`): Optional. User's or bot's last name. username (:obj:`str`): Optional. User's or bot's username. language_code (:obj:`str`): Optional. IETF language tag of the user's language. can_join_groups (:obj:`str`): Optional. :obj:`True`, if the bot can be invited to groups. Returned only in :attr:`telegram.Bot.get_me` requests. can_read_all_group_messages (:obj:`str`): Optional. :obj:`True`, if privacy mode is disabled for the bot. Returned only in :attr:`telegram.Bot.get_me` requests. supports_inline_queries (:obj:`str`): Optional. :obj:`True`, if the bot supports inline queries. Returned only in :attr:`telegram.Bot.get_me` requests. bot (:class:`telegram.Bot`): Optional. The Bot to use for instance methods. """ __slots__ = ( 'is_bot', 'can_read_all_group_messages', 'username', 'first_name', 'last_name', 'can_join_groups', 'supports_inline_queries', 'id', 'bot', 'language_code', '_id_attrs', ) def __init__( self, id: int, first_name: str, is_bot: bool, last_name: str = None, username: str = None, language_code: str = None, can_join_groups: bool = None, can_read_all_group_messages: bool = None, supports_inline_queries: bool = None, bot: 'Bot' = None, **_kwargs: Any, ): # Required self.id = int(id) # pylint: disable=C0103 self.first_name = first_name self.is_bot = is_bot # Optionals self.last_name = last_name self.username = username self.language_code = language_code self.can_join_groups = can_join_groups self.can_read_all_group_messages = can_read_all_group_messages self.supports_inline_queries = supports_inline_queries self.bot = bot self._id_attrs = (self.id,) @property def name(self) -> str: """:obj:`str`: Convenience property. If available, returns the user's :attr:`username` prefixed with "@". If :attr:`username` is not available, returns :attr:`full_name`. """ if self.username: return f'@{self.username}' return self.full_name @property def full_name(self) -> str: """:obj:`str`: Convenience property. The user's :attr:`first_name`, followed by (if available) :attr:`last_name`. """ if self.last_name: return f'{self.first_name} {self.last_name}' return self.first_name @property def link(self) -> Optional[str]: """:obj:`str`: Convenience property. If :attr:`username` is available, returns a t.me link of the user. """ if self.username: return f"https://t.me/{self.username}" return None def get_profile_photos( self, offset: int = None, limit: int = 100, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> Optional['UserProfilePhotos']: """ Shortcut for:: bot.get_user_profile_photos(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.get_user_profile_photos`. """ return self.bot.get_user_profile_photos( user_id=self.id, offset=offset, limit=limit, timeout=timeout, api_kwargs=api_kwargs, ) def mention_markdown(self, name: str = None) -> str: """ Note: :attr:`telegram.ParseMode.MARKDOWN` is a legacy mode, retained by Telegram for backward compatibility. You should use :meth:`mention_markdown_v2` instead. Args: name (:obj:`str`): The name used as a link for the user. Defaults to :attr:`full_name`. Returns: :obj:`str`: The inline mention for the user as markdown (version 1). """ if name: return util_mention_markdown(self.id, name) return util_mention_markdown(self.id, self.full_name) def mention_markdown_v2(self, name: str = None) -> str: """ Args: name (:obj:`str`): The name used as a link for the user. Defaults to :attr:`full_name`. Returns: :obj:`str`: The inline mention for the user as markdown (version 2). """ if name: return util_mention_markdown(self.id, name, version=2) return util_mention_markdown(self.id, self.full_name, version=2) def mention_html(self, name: str = None) -> str: """ Args: name (:obj:`str`): The name used as a link for the user. Defaults to :attr:`full_name`. Returns: :obj:`str`: The inline mention for the user as HTML. """ if name: return util_mention_html(self.id, name) return util_mention_html(self.id, self.full_name) def pin_message( self, message_id: int, disable_notification: ODVInput[bool] = DEFAULT_NONE, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> bool: """Shortcut for:: bot.pin_chat_message(chat_id=update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.pin_chat_message`. Returns: :obj:`bool`: On success, :obj:`True` is returned. """ return self.bot.pin_chat_message( chat_id=self.id, message_id=message_id, disable_notification=disable_notification, timeout=timeout, api_kwargs=api_kwargs, ) def unpin_message( self, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, message_id: int = None, ) -> bool: """Shortcut for:: bot.unpin_chat_message(chat_id=update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.unpin_chat_message`. Returns: :obj:`bool`: On success, :obj:`True` is returned. """ return self.bot.unpin_chat_message( chat_id=self.id, timeout=timeout, api_kwargs=api_kwargs, message_id=message_id, ) def unpin_all_messages( self, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> bool: """Shortcut for:: bot.unpin_all_chat_messages(chat_id=update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.unpin_all_chat_messages`. Returns: :obj:`bool`: On success, :obj:`True` is returned. """ return self.bot.unpin_all_chat_messages( chat_id=self.id, timeout=timeout, api_kwargs=api_kwargs, ) def send_message( self, text: str, parse_mode: ODVInput[str] = DEFAULT_NONE, disable_web_page_preview: ODVInput[bool] = DEFAULT_NONE, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, ) -> 'Message': """Shortcut for:: bot.send_message(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_message`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_message( chat_id=self.id, text=text, parse_mode=parse_mode, disable_web_page_preview=disable_web_page_preview, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, entities=entities, ) def send_photo( self, photo: Union[FileInput, 'PhotoSize'], caption: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, parse_mode: ODVInput[str] = DEFAULT_NONE, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_photo(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_photo`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_photo( chat_id=self.id, photo=photo, caption=caption, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, parse_mode=parse_mode, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, filename=filename, ) def send_media_group( self, media: List[ Union['InputMediaAudio', 'InputMediaDocument', 'InputMediaPhoto', 'InputMediaVideo'] ], disable_notification: ODVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, timeout: DVInput[float] = DEFAULT_20, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> List['Message']: """Shortcut for:: bot.send_media_group(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_media_group`. Returns: List[:class:`telegram.Message`:] On success, instance representing the message posted. """ return self.bot.send_media_group( chat_id=self.id, media=media, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, ) def send_audio( self, audio: Union[FileInput, 'Audio'], duration: int = None, performer: str = None, title: str = None, caption: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, parse_mode: ODVInput[str] = DEFAULT_NONE, thumb: FileInput = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_audio(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_audio`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_audio( chat_id=self.id, audio=audio, duration=duration, performer=performer, title=title, caption=caption, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, parse_mode=parse_mode, thumb=thumb, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, filename=filename, ) def send_chat_action( self, action: str, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> bool: """Shortcut for:: bot.send_chat_action(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_chat_action`. Returns: :obj:`True`: On success. """ return self.bot.send_chat_action( chat_id=self.id, action=action, timeout=timeout, api_kwargs=api_kwargs, ) send_action = send_chat_action """Alias for :attr:`send_chat_action`""" def send_contact( self, phone_number: str = None, first_name: str = None, last_name: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, contact: 'Contact' = None, vcard: str = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_contact(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_contact`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_contact( chat_id=self.id, phone_number=phone_number, first_name=first_name, last_name=last_name, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, contact=contact, vcard=vcard, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, ) def send_dice( self, disable_notification: ODVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, emoji: str = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_dice(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_dice`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_dice( chat_id=self.id, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, emoji=emoji, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, ) def send_document( self, document: Union[FileInput, 'Document'], filename: str = None, caption: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, parse_mode: ODVInput[str] = DEFAULT_NONE, thumb: FileInput = None, api_kwargs: JSONDict = None, disable_content_type_detection: bool = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, ) -> 'Message': """Shortcut for:: bot.send_document(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_document`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_document( chat_id=self.id, document=document, filename=filename, caption=caption, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, parse_mode=parse_mode, thumb=thumb, api_kwargs=api_kwargs, disable_content_type_detection=disable_content_type_detection, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, ) def send_game( self, game_short_name: str, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'InlineKeyboardMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_game(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_game`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_game( chat_id=self.id, game_short_name=game_short_name, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, ) def send_invoice( self, title: str, description: str, payload: str, provider_token: str, currency: str, prices: List['LabeledPrice'], start_parameter: str = None, photo_url: str = None, photo_size: int = None, photo_width: int = None, photo_height: int = None, need_name: bool = None, need_phone_number: bool = None, need_email: bool = None, need_shipping_address: bool = None, is_flexible: bool = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'InlineKeyboardMarkup' = None, provider_data: Union[str, object] = None, send_phone_number_to_provider: bool = None, send_email_to_provider: bool = None, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, max_tip_amount: int = None, suggested_tip_amounts: List[int] = None, ) -> 'Message': """Shortcut for:: bot.send_invoice(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_invoice`. Warning: As of API 5.2 :attr:`start_parameter` is an optional argument and therefore the order of the arguments had to be changed. Use keyword arguments to make sure that the arguments are passed correctly. .. versionchanged:: 13.5 As of Bot API 5.2, the parameter :attr:`start_parameter` is optional. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_invoice( chat_id=self.id, title=title, description=description, payload=payload, provider_token=provider_token, currency=currency, prices=prices, start_parameter=start_parameter, photo_url=photo_url, photo_size=photo_size, photo_width=photo_width, photo_height=photo_height, need_name=need_name, need_phone_number=need_phone_number, need_email=need_email, need_shipping_address=need_shipping_address, is_flexible=is_flexible, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, provider_data=provider_data, send_phone_number_to_provider=send_phone_number_to_provider, send_email_to_provider=send_email_to_provider, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, max_tip_amount=max_tip_amount, suggested_tip_amounts=suggested_tip_amounts, ) def send_location( self, latitude: float = None, longitude: float = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, location: 'Location' = None, live_period: int = None, api_kwargs: JSONDict = None, horizontal_accuracy: float = None, heading: int = None, proximity_alert_radius: int = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_location(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_location`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_location( chat_id=self.id, latitude=latitude, longitude=longitude, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, location=location, live_period=live_period, api_kwargs=api_kwargs, horizontal_accuracy=horizontal_accuracy, heading=heading, proximity_alert_radius=proximity_alert_radius, allow_sending_without_reply=allow_sending_without_reply, ) def send_animation( self, animation: Union[FileInput, 'Animation'], duration: int = None, width: int = None, height: int = None, thumb: FileInput = None, caption: str = None, parse_mode: ODVInput[str] = DEFAULT_NONE, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_animation(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_animation`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_animation( chat_id=self.id, animation=animation, duration=duration, width=width, height=height, thumb=thumb, caption=caption, parse_mode=parse_mode, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, filename=filename, ) def send_sticker( self, sticker: Union[FileInput, 'Sticker'], disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_sticker(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_sticker`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_sticker( chat_id=self.id, sticker=sticker, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, ) def send_video( self, video: Union[FileInput, 'Video'], duration: int = None, caption: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, width: int = None, height: int = None, parse_mode: ODVInput[str] = DEFAULT_NONE, supports_streaming: bool = None, thumb: FileInput = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_video(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_video`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_video( chat_id=self.id, video=video, duration=duration, caption=caption, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, width=width, height=height, parse_mode=parse_mode, supports_streaming=supports_streaming, thumb=thumb, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, filename=filename, ) def send_venue( self, latitude: float = None, longitude: float = None, title: str = None, address: str = None, foursquare_id: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, venue: 'Venue' = None, foursquare_type: str = None, api_kwargs: JSONDict = None, google_place_id: str = None, google_place_type: str = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, ) -> 'Message': """Shortcut for:: bot.send_venue(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_venue`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_venue( chat_id=self.id, latitude=latitude, longitude=longitude, title=title, address=address, foursquare_id=foursquare_id, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, venue=venue, foursquare_type=foursquare_type, api_kwargs=api_kwargs, google_place_id=google_place_id, google_place_type=google_place_type, allow_sending_without_reply=allow_sending_without_reply, ) def send_video_note( self, video_note: Union[FileInput, 'VideoNote'], duration: int = None, length: int = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, thumb: FileInput = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_video_note(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_video_note`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_video_note( chat_id=self.id, video_note=video_note, duration=duration, length=length, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, thumb=thumb, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, filename=filename, ) def send_voice( self, voice: Union[FileInput, 'Voice'], duration: int = None, caption: str = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: DVInput[float] = DEFAULT_20, parse_mode: ODVInput[str] = DEFAULT_NONE, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, caption_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, filename: str = None, ) -> 'Message': """Shortcut for:: bot.send_voice(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_voice`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_voice( chat_id=self.id, voice=voice, duration=duration, caption=caption, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, parse_mode=parse_mode, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, caption_entities=caption_entities, filename=filename, ) def send_poll( self, question: str, options: List[str], is_anonymous: bool = True, # We use constant.POLL_REGULAR instead of Poll.REGULAR here to avoid circular imports type: str = constants.POLL_REGULAR, # pylint: disable=W0622 allows_multiple_answers: bool = False, correct_option_id: int = None, is_closed: bool = None, disable_notification: ODVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, explanation: str = None, explanation_parse_mode: ODVInput[str] = DEFAULT_NONE, open_period: int = None, close_date: Union[int, datetime] = None, api_kwargs: JSONDict = None, allow_sending_without_reply: ODVInput[bool] = DEFAULT_NONE, explanation_entities: Union[List['MessageEntity'], Tuple['MessageEntity', ...]] = None, ) -> 'Message': """Shortcut for:: bot.send_poll(update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.send_poll`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.send_poll( chat_id=self.id, question=question, options=options, is_anonymous=is_anonymous, type=type, # pylint=pylint, allows_multiple_answers=allows_multiple_answers, correct_option_id=correct_option_id, is_closed=is_closed, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, reply_markup=reply_markup, timeout=timeout, explanation=explanation, explanation_parse_mode=explanation_parse_mode, open_period=open_period, close_date=close_date, api_kwargs=api_kwargs, allow_sending_without_reply=allow_sending_without_reply, explanation_entities=explanation_entities, ) def send_copy( self, from_chat_id: Union[str, int], message_id: int, caption: str = None, parse_mode: ODVInput[str] = DEFAULT_NONE, caption_entities: Union[Tuple['MessageEntity', ...], List['MessageEntity']] = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, allow_sending_without_reply: DVInput[bool] = DEFAULT_NONE, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> 'MessageId': """Shortcut for:: bot.copy_message(chat_id=update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.copy_message`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.copy_message( chat_id=self.id, from_chat_id=from_chat_id, message_id=message_id, caption=caption, parse_mode=parse_mode, caption_entities=caption_entities, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, allow_sending_without_reply=allow_sending_without_reply, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, ) def copy_message( self, chat_id: Union[int, str], message_id: int, caption: str = None, parse_mode: ODVInput[str] = DEFAULT_NONE, caption_entities: Union[Tuple['MessageEntity', ...], List['MessageEntity']] = None, disable_notification: DVInput[bool] = DEFAULT_NONE, reply_to_message_id: int = None, allow_sending_without_reply: DVInput[bool] = DEFAULT_NONE, reply_markup: 'ReplyMarkup' = None, timeout: ODVInput[float] = DEFAULT_NONE, api_kwargs: JSONDict = None, ) -> 'MessageId': """Shortcut for:: bot.copy_message(from_chat_id=update.effective_user.id, *args, **kwargs) For the documentation of the arguments, please see :meth:`telegram.Bot.copy_message`. Returns: :class:`telegram.Message`: On success, instance representing the message posted. """ return self.bot.copy_message( from_chat_id=self.id, chat_id=chat_id, message_id=message_id, caption=caption, parse_mode=parse_mode, caption_entities=caption_entities, disable_notification=disable_notification, reply_to_message_id=reply_to_message_id, allow_sending_without_reply=allow_sending_without_reply, reply_markup=reply_markup, timeout=timeout, api_kwargs=api_kwargs, )
35.705162
99
0.613879
7949e33b8ccab2e1d3483759e84c0ea1967b2a51
972
py
Python
kubernetes/test/test_v1_stateful_set_list.py
anemerovsky-essextec/python
6e40b9169b27c3f1f9422c0f6dd1cd9caef8d57c
[ "Apache-2.0" ]
null
null
null
kubernetes/test/test_v1_stateful_set_list.py
anemerovsky-essextec/python
6e40b9169b27c3f1f9422c0f6dd1cd9caef8d57c
[ "Apache-2.0" ]
null
null
null
kubernetes/test/test_v1_stateful_set_list.py
anemerovsky-essextec/python
6e40b9169b27c3f1f9422c0f6dd1cd9caef8d57c
[ "Apache-2.0" ]
null
null
null
# coding: utf-8 """ Kubernetes No description provided (generated by Swagger Codegen https://github.com/swagger-api/swagger-codegen) OpenAPI spec version: v1.12.1 Generated by: https://github.com/swagger-api/swagger-codegen.git """ from __future__ import absolute_import import os import sys import unittest import kubernetes.client from kubernetes.client.rest import ApiException from kubernetes.client.models.v1_stateful_set_list import V1StatefulSetList class TestV1StatefulSetList(unittest.TestCase): """ V1StatefulSetList unit test stubs """ def setUp(self): pass def tearDown(self): pass def testV1StatefulSetList(self): """ Test V1StatefulSetList """ # FIXME: construct object with mandatory attributes with example values #model = kubernetes.client.models.v1_stateful_set_list.V1StatefulSetList() pass if __name__ == '__main__': unittest.main()
21.6
105
0.711934
7949e46e353f23ae7af80c14510eff90961e1175
737
py
Python
setup.py
znstrider/speedo
238d591bbf374596b22fb44abba5ba849b4ed32b
[ "MIT" ]
4
2021-02-08T11:52:59.000Z
2021-03-15T13:01:13.000Z
setup.py
znstrider/speedo
238d591bbf374596b22fb44abba5ba849b4ed32b
[ "MIT" ]
null
null
null
setup.py
znstrider/speedo
238d591bbf374596b22fb44abba5ba849b4ed32b
[ "MIT" ]
null
null
null
import setuptools with open("README.md", "r") as fh: long_description = fh.read() setuptools.setup( name="speedo", version="0.0.1", author="znstrider", author_email="mindfulstrider@gmail.com", description="Class to make speedometer plots", long_description=long_description, long_description_content_type="text/markdown", url="https://github.com/znstrider/speedo", packages=setuptools.find_packages(), classifiers=[ "Programming Language :: Python :: 3", "License :: OSI Approved :: MIT License", "Operating System :: OS Independent", "Framework :: Matplotlib", "Topic :: Scientific/Engineering :: Visualization" ], python_requires='>=3.6', )
29.48
58
0.658073
7949e4aefdb1df4f55956456aa8c9de081acfe30
752
py
Python
spinup/user_config.py
liushunyu/stable-spinningup
7ece777a564b05334c78005eda094ed729d31304
[ "MIT" ]
null
null
null
spinup/user_config.py
liushunyu/stable-spinningup
7ece777a564b05334c78005eda094ed729d31304
[ "MIT" ]
null
null
null
spinup/user_config.py
liushunyu/stable-spinningup
7ece777a564b05334c78005eda094ed729d31304
[ "MIT" ]
null
null
null
import os import os.path as osp # Default neural network backend for each algo # (Must be either 'tf1' or 'pytorch') DEFAULT_BACKEND = { 'vpg': 'pytorch', 'trpo': 'tf1', 'ppo': 'pytorch', 'ddpg': 'pytorch', 'td3': 'pytorch', 'sac': 'pytorch', 'dqn': 'pytorch' } # Where experiment outputs are saved by default: DEFAULT_DATA_DIR = osp.join(osp.abspath(osp.dirname(osp.dirname(__file__))),'data') # Whether to automatically insert a date and time stamp into the names of # save directories: FORCE_DATESTAMP = True # Whether GridSearch provides automatically-generated default shorthands: DEFAULT_SHORTHAND = True # Tells the GridSearch how many seconds to pause for before launching # experiments. WAIT_BEFORE_LAUNCH = 5
26.857143
83
0.716755
7949e6a877eca0756074bee0ab2b3ea9c3bdd100
13,062
py
Python
tests/linear/goland_wing/test_goland_flutter.py
jomorlier/sharpy-1
9800df617efd046d4c4af048bbab17f88a91e6a8
[ "BSD-3-Clause" ]
null
null
null
tests/linear/goland_wing/test_goland_flutter.py
jomorlier/sharpy-1
9800df617efd046d4c4af048bbab17f88a91e6a8
[ "BSD-3-Clause" ]
null
null
null
tests/linear/goland_wing/test_goland_flutter.py
jomorlier/sharpy-1
9800df617efd046d4c4af048bbab17f88a91e6a8
[ "BSD-3-Clause" ]
1
2020-05-25T17:11:09.000Z
2020-05-25T17:11:09.000Z
import numpy as np import os import unittest import cases.templates.flying_wings as wings import sharpy.sharpy_main import sharpy.utils.sharpydir as sharpydir class TestGolandFlutter(unittest.TestCase): def setup(self): # Problem Set up u_inf = 1. alpha_deg = 0. rho = 1.02 num_modes = 4 # Lattice Discretisation M = 16 N = 32 M_star_fact = 10 # Linear UVLM settings integration_order = 2 remove_predictor = False use_sparse = True # ROM Properties rom_settings = dict() rom_settings['algorithm'] = 'mimo_rational_arnoldi' rom_settings['r'] = 6 frequency_continuous_k = np.array([0.]) # Case Admin - Create results folders case_name = 'goland_cs' case_nlin_info = 'M%dN%dMs%d_nmodes%d' % (M, N, M_star_fact, num_modes) case_rom_info = 'rom_MIMORA_r%d_sig%04d_%04dj' % (rom_settings['r'], frequency_continuous_k[-1].real * 100, frequency_continuous_k[-1].imag * 100) case_name += case_nlin_info + case_rom_info self.route_test_dir = os.path.abspath(os.path.dirname(os.path.realpath(__file__))) fig_folder = self.route_test_dir + '/figures/' os.makedirs(fig_folder, exist_ok=True) # SHARPy nonlinear reference solution ws = wings.GolandControlSurface(M=M, N=N, Mstar_fact=M_star_fact, u_inf=u_inf, alpha=alpha_deg, cs_deflection=[0, 0], rho=rho, sweep=0, physical_time=2, n_surfaces=2, route=self.route_test_dir + '/cases', case_name=case_name) ws.gust_intensity = 0.01 ws.sigma = 1 ws.clean_test_files() ws.update_derived_params() ws.set_default_config_dict() ws.generate_aero_file() ws.generate_fem_file() frequency_continuous_w = 2 * u_inf * frequency_continuous_k / ws.c_ref rom_settings['frequency'] = frequency_continuous_w rom_settings['tangent_input_file'] = ws.route + '/' + ws.case_name + '.rom.h5' ws.config['SHARPy'] = { 'flow': ['BeamLoader', 'AerogridLoader', 'StaticCoupled', 'AerogridPlot', 'BeamPlot', 'Modal', 'LinearAssembler', 'FrequencyResponse', 'AsymptoticStability', ], 'case': ws.case_name, 'route': ws.route, 'write_screen': 'off', 'write_log': 'on', 'log_folder': self.route_test_dir + '/output/' + ws.case_name + '/', 'log_file': ws.case_name + '.log'} ws.config['BeamLoader'] = { 'unsteady': 'off', 'orientation': ws.quat} ws.config['AerogridLoader'] = { 'unsteady': 'off', 'aligned_grid': 'on', 'mstar': ws.Mstar_fact * ws.M, 'freestream_dir': ws.u_inf_direction } ws.config['StaticUvlm'] = { 'rho': ws.rho, 'velocity_field_generator': 'SteadyVelocityField', 'velocity_field_input': { 'u_inf': ws.u_inf, 'u_inf_direction': ws.u_inf_direction}, 'rollup_dt': ws.dt, 'print_info': 'on', 'horseshoe': 'off', 'num_cores': 4, 'n_rollup': 0, 'rollup_aic_refresh': 0, 'rollup_tolerance': 1e-4} ws.config['StaticCoupled'] = { 'print_info': 'on', 'max_iter': 200, 'n_load_steps': 1, 'tolerance': 1e-10, 'relaxation_factor': 0., 'aero_solver': 'StaticUvlm', 'aero_solver_settings': { 'rho': ws.rho, 'print_info': 'off', 'horseshoe': 'off', 'num_cores': 4, 'n_rollup': 0, 'rollup_dt': ws.dt, 'rollup_aic_refresh': 1, 'rollup_tolerance': 1e-4, 'velocity_field_generator': 'SteadyVelocityField', 'velocity_field_input': { 'u_inf': ws.u_inf, 'u_inf_direction': ws.u_inf_direction}}, 'structural_solver': 'NonLinearStatic', 'structural_solver_settings': {'print_info': 'off', 'max_iterations': 150, 'num_load_steps': 4, 'delta_curved': 1e-1, 'min_delta': 1e-10, 'gravity_on': 'on', 'gravity': 9.754}} ws.config['AerogridPlot'] = {'folder': self.route_test_dir + '/output/', 'include_rbm': 'off', 'include_applied_forces': 'on', 'minus_m_star': 0} ws.config['AeroForcesCalculator'] = {'folder': self.route_test_dir + '/output/forces', 'write_text_file': 'on', 'text_file_name': ws.case_name + '_aeroforces.csv', 'screen_output': 'on', 'unsteady': 'off'} ws.config['BeamPlot'] = {'folder': self.route_test_dir + '/output/', 'include_rbm': 'off', 'include_applied_forces': 'on'} ws.config['BeamCsvOutput'] = {'folder': self.route_test_dir + '/output/', 'output_pos': 'on', 'output_psi': 'on', 'screen_output': 'on'} ws.config['Modal'] = {'folder': self.route_test_dir + '/output/', 'NumLambda': 20, 'rigid_body_modes': 'off', 'print_matrices': 'on', 'keep_linear_matrices': 'on', 'write_dat': 'off', 'rigid_modes_cg': 'off', 'continuous_eigenvalues': 'off', 'dt': 0, 'plot_eigenvalues': False, 'max_rotation_deg': 15., 'max_displacement': 0.15, 'write_modes_vtk': True, 'use_undamped_modes': True} ws.config['LinearAssembler'] = {'linear_system': 'LinearAeroelastic', 'linear_system_settings': { 'beam_settings': {'modal_projection': 'on', 'inout_coords': 'modes', 'discrete_time': 'on', 'newmark_damp': 0.5e-4, 'discr_method': 'newmark', 'dt': ws.dt, 'proj_modes': 'undamped', 'use_euler': 'off', 'num_modes': num_modes, 'print_info': 'on', 'gravity': 'on', 'remove_sym_modes': 'on', 'remove_dofs': []}, 'aero_settings': {'dt': ws.dt, 'ScalingDict': {'length': 0.5 * ws.c_ref, 'speed': u_inf, 'density': rho}, 'integr_order': integration_order, 'density': ws.rho, 'remove_predictor': remove_predictor, 'use_sparse': use_sparse, 'rigid_body_motion': 'off', 'use_euler': 'off', 'remove_inputs': ['u_gust'], 'rom_method': ['Krylov'], 'rom_method_settings': {'Krylov': rom_settings}}, 'rigid_body_motion': False}} ws.config['AsymptoticStability'] = {'print_info': True, 'folder': self.route_test_dir + '/output/', 'velocity_analysis': [160, 180, 20]} ws.config['LinDynamicSim'] = {'dt': ws.dt, 'n_tsteps': ws.n_tstep, 'sys_id': 'LinearAeroelastic', 'postprocessors': ['BeamPlot', 'AerogridPlot'], 'postprocessors_settings': {'AerogridPlot': { 'u_inf': ws.u_inf, 'folder': self.route_test_dir + '/output/', 'include_rbm': 'on', 'include_applied_forces': 'on', 'minus_m_star': 0}, 'BeamPlot': {'folder': ws.route + '/output/', 'include_rbm': 'on', 'include_applied_forces': 'on'}}} ws.config['FrequencyResponse'] = {'compute_fom': 'on', 'quick_plot': 'off', 'folder': self.route_test_dir + '/output/', 'frequency_unit': 'k', 'frequency_bounds': [0.0001, 1.0], } ws.config.write() self.data = sharpy.sharpy_main.main(['', ws.route + ws.case_name + '.sharpy']) def run_rom_stable(self): ssrom = self.data.linear.linear_system.uvlm.rom['Krylov'].ssrom eigs_rom = np.linalg.eigvals(ssrom.A) assert all(np.abs(eigs_rom) <= 1.), 'UVLM Krylov ROM is unstable - flutter speed may not be correct. Change' \ 'ROM settings to achieve stability' print('ROM is stable') def run_flutter(self): flutter_ref_speed = 166 # at current discretisation u_inf = self.data.linear.stability['velocity_results']['u_inf'] eval_real = self.data.linear.stability['velocity_results']['evals_real'] eval_imag = self.data.linear.stability['velocity_results']['evals_imag'] # Flutter onset ind_zero_real = np.where(eval_real >= 0)[0][0] assert ind_zero_real > 0, 'Flutter speed not below 165.00 m/s' flutter_speed = 0.5 * (u_inf[ind_zero_real] + u_inf[ind_zero_real - 1]) flutter_frequency = np.sqrt(eval_real[ind_zero_real] ** 2 + eval_imag[ind_zero_real] ** 2) print('Flutter speed = %.1f m/s' % flutter_speed) print('Flutter frequency = %.2f rad/s' % flutter_frequency) assert np.abs( flutter_speed - flutter_ref_speed) / flutter_ref_speed < 1e-2, ' Flutter speed error greater than ' \ '1 percent' print('Test Complete') def test_flutter(self): self.setup() self.run_rom_stable() self.run_flutter() def tearDown(self): import shutil folders = ['cases', 'figures', 'output'] for folder in folders: shutil.rmtree(self.route_test_dir + '/' + folder) if __name__ == '__main__': unittest.main()
46.65
118
0.406752
7949e6c6d66e40b8dbb8c03e6b01e4be940f4e2a
19,120
py
Python
qface/idl/domain.py
Gagi2k/qface
5069fdc5f406495590a83a799ecbe30009436f1d
[ "MIT" ]
38
2016-11-30T10:36:56.000Z
2022-02-19T14:58:00.000Z
qface/idl/domain.py
Gagi2k/qface
5069fdc5f406495590a83a799ecbe30009436f1d
[ "MIT" ]
70
2016-11-30T09:12:58.000Z
2022-01-27T12:52:41.000Z
qface/idl/domain.py
Gagi2k/qface
5069fdc5f406495590a83a799ecbe30009436f1d
[ "MIT" ]
23
2016-12-07T15:23:15.000Z
2021-06-07T08:32:40.000Z
# Copyright (c) Pelagicore AB 2016 '''The domian module contains an object hierachy which resembles the QFace grammar as a domain model. It is created from the QFace and the main input for the code generation templates. .. note:: Changes on this API will result into broken templates .. code-block:: text System +- Module +- Import +- Interface +- Property +- Operation +- Event +- Struct (has attributes) +- Enum (has values) .. note:: When the API talks about an order list, the order is by appearance in the QFace file. ''' from collections import OrderedDict, ChainMap import click import logging log = logging.getLogger(__name__) class System(object): """The root entity which consist of modules""" def __init__(self): log.debug('System()') self._moduleMap = OrderedDict() # type: dict[str, Module] def __unicode__(self): return 'system' def __repr__(self): return '<System>' @property def modules(self): '''returns ordered list of module symbols''' return self._moduleMap.values() def lookup(self, name: str): '''lookup a symbol by fully qualified name.''' # <module> if name in self._moduleMap: return self._moduleMap[name] # <module>.<Symbol> (module_name, type_name, fragment_name) = self.split_typename(name) if not module_name and type_name: click.secho('not able to lookup symbol: {0}'.format(name), fg='red') return None module = self._moduleMap[module_name] return module.lookup(type_name, fragment_name) @staticmethod def split_typename(name): parts = name.rsplit('#', 1) fragment_name = None module_name = None type_name = None if len(parts) == 2: fragment_name = parts[1] name = parts[0] parts = name.rsplit('.', 1) if len(parts) == 1: type_name = parts[0] elif len(parts) == 2: module_name = parts[0] type_name = parts[1] return (module_name, type_name, fragment_name) def toJson(self): o = OrderedDict() o['modules'] = [o.toJson() for o in self.modules] return o class NamedElement(object): def __init__(self, name, module: 'Module'): self.name = name """symbol name""" self.module = module """module the symbol belongs to""" def __unicode__(self): return self.name def __str__(self): return self.name def __repr__(self): return '<{0} name={1}>'.format(type(self), self.name) @property def qualified_name(self): '''return the fully qualified name (`<module>.<name>`)''' if self.module == self: return self.module.name else: if "." not in self.name: return '{0}.{1}'.format(self.module.name, self.name) else: # We have a fully qualified reference, just return it return self.name def toJson(self): o = OrderedDict() if self.name: o['name'] = self.name return o class Symbol(NamedElement): """A symbol represents a base class for names elements""" def __init__(self, name: str, module: 'Module'): super().__init__(name, module) self.comment = '' """comment which appeared in QFace right before symbol""" self._tags = dict() """a value attached to the symbol""" self.value = None self._contentMap = ChainMap() self._dependencies = set() self.type = TypeSymbol('', self) self.kind = self.__class__.__name__.lower() """ the associated type information """ @property def system(self): '''returns reference to system''' return self.module._system @property def tags(self): return self._tags def add_tag(self, tag): """ add a tag to the tag list """ if tag not in self._tags: self._tags[tag] = dict() def add_attribute(self, tag, name, value): """ add an attribute (nam, value pair) to the named tag """ self.add_tag(tag) d = self._tags[tag] d[name] = value def tag(self, name): """ return tag by name """ return self._tags[name] def attribute(self, tag, name): """ return attribute by tag and attribute name """ if tag in self._tags and name in self._tags[tag]: return self._tags[tag][name] @property def contents(self): """ return general list of symbol contents """ return self._contentMap.values() @property def dependencies(self): if not self._dependencies: self._dependencies = [x.type for x in self.contents] return self._dependencies def toJson(self): o = super().toJson() if self.type.is_valid: o['type'] = self.type.toJson() return o class TypeSymbol(NamedElement): """Defines a type in the system""" def __init__(self, name: str, parent: NamedElement): super().__init__(name, parent.module) log.debug('TypeSymbol()') self.parent = parent """ the parent symbol of this type """ self.is_void = False # type:bool """ if type represents the void type """ self.is_primitive = False # type:bool """ if type represents a primitive type """ self.is_complex = False # type:bool """ if type represents a complex type """ self.is_list = False # type:bool """ if type represents a list of nested types """ self.is_map = False # type:bool """ if type represents a map of nested types. A key type is not defined """ self.is_model = False # type:bool """ if type represents a model of nested types """ self.nested = None """nested type if symbol is list or model""" self.__reference = None self.__is_resolved = False @property def is_valid(self): '''checks if type is a valid type''' return (self.is_primitive and self.name) \ or (self.is_complex and self.name) \ or (self.is_list and self.nested) \ or (self.is_map and self.nested) \ or (self.is_model and self.nested) @property def is_bool(self): '''checks if type is primitive and bool''' return self.is_primitive and self.name == 'bool' @property def is_int(self): '''checks if type is primitive and int''' return self.is_primitive and self.name == 'int' @property def is_real(self): '''checks if type is primitive and real''' return self.is_primitive and self.name == 'real' @property def is_string(self): '''checks if type is primitive and string''' return self.is_primitive and self.name == 'string' @property def is_var(self): '''checks if type is primitive and var''' return self.is_primitive and self.name == 'var' @property def is_enumeration(self): '''checks if type is complex and instance of type Enum''' return self.is_complex and isinstance(self.reference, Enum) @property def is_enum(self): '''checks if type is an enumeration and reference is enum''' return self.is_enumeration and self.reference.is_enum @property def is_flag(self): '''checks if type is an enumeration and reference is flag ''' return self.is_enumeration and self.reference.is_flag @property def is_struct(self): '''checks if type is complex and struct''' return self.is_complex and isinstance(self.reference, Struct) @property def is_interface(self): '''checks if type is interface''' return self.is_complex and isinstance(self.reference, Interface) @property def reference(self): """returns the symbol reference of the type name""" if not self.__is_resolved: self._resolve() return self.__reference def _resolve(self): """resolve the type symbol from name by doing a lookup""" self.__is_resolved = True if self.is_complex: type = self.nested if self.nested else self type.__reference = self.module.lookup(type.name) @property def type(self): """ return the type information. In this case: self """ return self def toJson(self): o = super().toJson() if self.is_void: o['void'] = self.is_void if self.is_primitive: o['primitive'] = self.is_primitive if self.is_complex: o['complex'] = self.is_complex if self.is_list: o['list'] = self.is_list if self.is_map: o['map'] = self.is_map if self.is_model: o['model'] = self.is_model if self.nested: o['nested'] = self.nested.toJson() return o class Module(Symbol): """Module is a namespace for types, e.g. interfaces, enums, structs""" def __init__(self, name: str, system: System): """init""" super().__init__(name, self) log.debug('Module()') self.version = '1.0' self._system = system self._system._moduleMap[name] = self self._interfaceMap = OrderedDict() # type: dict[str, Interface] self._structMap = OrderedDict() # type: dict[str, Struct] self._enumMap = OrderedDict() # type: dict[str, Enum] self._contentMap = ChainMap(self._interfaceMap, self._structMap, self._enumMap) self._importMap = OrderedDict() # type: dict[str, Module] @property def interfaces(self): '''returns ordered list of interface symbols''' return self._interfaceMap.values() @property def structs(self): '''returns ordered list of struct symbols''' return self._structMap.values() @property def enums(self): '''returns ordered list of enum symbols''' return self._enumMap.values() @property def imports(self): '''returns ordered list of import symbols''' return self._importMap.values() def checkType(self, type: str): if type.is_primitive: return True (module_name, type_name, fragment_name) = System.split_typename(type.name) if module_name and module_name not in self._importMap: return False return True @property def name_parts(self): '''return module name splitted by '.' in parts''' return self.name.split('.') @property def majorVersion(self): """ returns the major version number of the version information """ return self.version.split('.')[0] @property def minorVersion(self): """ returns the minor version number of the version information """ return self.version.split('.')[1] @property def module_name(self): """ returns the last part of the module uri """ return self.name.split('.')[-1] def lookup(self, name: str, fragment: str = None): '''lookup a symbol by name. If symbol is not local it will be looked up system wide''' if name in self._contentMap: symbol = self._contentMap[name] if fragment: return symbol._contentMap[fragment] return symbol return self.system.lookup(name) def toJson(self): o = super().toJson() o['version'] = self.version o['interfaces'] = [s.toJson() for s in self.interfaces] o['structs'] = [s.toJson() for s in self.structs] o['enums'] = [s.toJson() for s in self.enums] return o class Interface(Symbol): """A interface is an object with operations, properties and signals""" def __init__(self, name: str, module: Module): super().__init__(name, module) log.debug('Interface()') self.module._interfaceMap[name] = self self._propertyMap = OrderedDict() # type: dict[str, Property] self._operationMap = OrderedDict() # type: dict[str, Operation] self._signalMap = OrderedDict() # type: dict[str, Signal] self._contentMap = ChainMap(self._propertyMap, self._operationMap, self._signalMap) self._extends = None @property def properties(self): '''returns ordered list of properties''' return self._propertyMap.values() @property def operations(self): '''returns ordered list of operations''' return self._operationMap.values() @property def signals(self): '''returns ordered list of signals''' return self._signalMap.values() @property def extends(self): ''' returns the symbol defined by the extends interface attribute ''' return self.module.lookup(self._extends) def toJson(self): o = super().toJson() o['properties'] = [s.toJson() for s in self.properties] o['operations'] = [s.toJson() for s in self.operations] o['signals'] = [s.toJson() for s in self.signals] return o class Operation(Symbol): """An operation inside a interface""" def __init__(self, name: str, interface: Interface): super().__init__(name, interface.module) log.debug('Operation()') self.interface = interface """ the interface the operation is part of """ self.interface._operationMap[name] = self self._parameterMap = self._contentMap = OrderedDict() # type: dict[Parameter] self.is_const = False # type: bool """reflects is the operation was declared as const operation""" @property def qualified_name(self): '''return the fully qualified name (`<module>.<interface>#<operation>`)''' return '{0}.{1}#{2}'.format(self.module.name, self.interface.name, self.name) @property def parameters(self): '''returns ordered list of parameters''' return self._parameterMap.values() def toJson(self): o = super().toJson() o['parameters'] = [s.toJson() for s in self.parameters] o['type'] = self.type.toJson() return o class Signal(Symbol): """A signal inside an interface""" def __init__(self, name: str, interface: Interface): super().__init__(name, interface.module) log.debug('Signal()') self.interface = interface self.interface._signalMap[name] = self self._parameterMap = self._contentMap = OrderedDict() # type: dict[Parameter] @property def qualified_name(self): '''return the fully qualified name (`module + "." + name`)''' return '{0}.{1}#{2}'.format(self.module.name, self.interface.name, self.name) @property def parameters(self): '''returns ordered list of parameters''' return self._parameterMap.values() def toJson(self): o = super().toJson() o['parameters'] = [s.toJson() for s in self.parameters] return o class Parameter(Symbol): """An operation parameter""" def __init__(self, name: str, operation: Operation): super().__init__(name, operation.module) log.debug('Parameter()') self.operation = operation self.operation._parameterMap[name] = self class Property(Symbol): """A typed property inside a interface""" def __init__(self, name: str, interface: Interface): super().__init__(name, interface.module) log.debug('Property()') self.interface = interface self.interface._propertyMap[name] = self self.readonly = False self.const = False @property def is_model(self): ''' true if type is a model ''' return self.type.is_model @property def is_primitive_model(self): ''' true if type is a model of nested primitive types ''' return self.type.is_model and self.type.nested.is_primitive @property def is_complex_model(self): ''' true if type is a model of nested complex types ''' return self.type.is_model and self.type.nested.is_complex @property def qualified_name(self): '''return the fully qualified name (`<module>.<interface>#<property>`)''' return '{0}.{1}#{2}'.format(self.module.name, self.interface.name, self.name) @property def writeable(self): return not self.readonly and not self.const def toJson(self): o = super().toJson() if self.readonly: o['readonly'] = True if self.const: o['const'] = True return o class Struct(Symbol): """Represents a data container""" def __init__(self, name: str, module: Module): super().__init__(name, module) log.debug('Struct()') self.module._structMap[name] = self self._fieldMap = self._contentMap = OrderedDict() @property def fields(self): '''returns ordered list of members''' return self._fieldMap.values() def toJson(self): o = super().toJson() o['fields'] = [s.toJson() for s in self.fields] return o class Field(Symbol): """A member in a struct""" def __init__(self, name: str, struct: Struct): super().__init__(name, struct.module) log.debug('Field()') self.struct = struct # type:Struct self.struct._fieldMap[name] = self @property def qualified_name(self): '''return the fully qualified name (`<module>.<struct>#<field>`)''' return '{0}.{1}#{2}'.format(self.module.name, self.struct.name, self.name) class Enum(Symbol): """An enum (flag) inside a module""" def __init__(self, name: str, module: Module): super().__init__(name, module) log.debug('Enum()') self.is_enum = True self.is_flag = False self.module._enumMap[name] = self self._memberMap = self._contentMap = OrderedDict() # type: dict[EnumMember] @property def members(self): '''returns ordered list of members''' return self._memberMap.values() def toJson(self): o = super().toJson() if self.is_enum: o['enum'] = self.is_enum if self.is_flag: o['flag'] = self.is_flag o['members'] = [s.toJson() for s in self.members] return o class EnumMember(Symbol): """A enum value""" def __init__(self, name: str, enum: Enum): super().__init__(name, enum.module) log.debug('EnumMember()') self.enum = enum self.enum._memberMap[name] = self self.value = 0 def qualified_name(self): '''return the fully qualified name (`<module>.<enum>#<member>`)''' return '{0}.{1}#{2}'.format(self.module.name, self.enum.name, self.name) def toJson(self): o = super().toJson() o['value'] = self.value return o
31.344262
91
0.59864
7949e7b97b49f6f33ffd53efa087359927e2e82f
2,139
py
Python
2020/11/2/solution.py
twsh/Advent-of-Code
69f394f6740a32825bc847ca18d91f53fbcccb10
[ "MIT" ]
null
null
null
2020/11/2/solution.py
twsh/Advent-of-Code
69f394f6740a32825bc847ca18d91f53fbcccb10
[ "MIT" ]
null
null
null
2020/11/2/solution.py
twsh/Advent-of-Code
69f394f6740a32825bc847ca18d91f53fbcccb10
[ "MIT" ]
null
null
null
def parse_map(in_file): with open(in_file) as f: lines = f.read().splitlines() width = len(lines[0]) height = len(lines) points = {} for x in range(width): for y in range(height): points[(x, y)] = lines[y][x] return points def look(seat, grid, direction): (x, y) = seat if direction == "right": w = x + 1 z = y elif direction == "left": w = x - 1 z = y elif direction == "down": w = x z = y + 1 elif direction == "up": w = x z = y - 1 elif direction == "upright": w = x + 1 z = y - 1 elif direction == "upleft": w = x - 1 z = y - 1 elif direction == "downright": w = x + 1 z = y + 1 elif direction == "downleft": w = x - 1 z = y + 1 try: if grid[(w, z)] in ("#", "L"): return grid[(w, z)] else: return look((w, z), grid, direction) except KeyError: return None def check_seat(seat, grid): visible = 0 directions = [ "up", "down", "left", "right", "upleft", "downleft", "upright", "downright", ] for direction in directions: seen = look(seat, grid, direction) if seen == "#": visible += 1 return visible def count_occupied(grid): total = 0 for seat in grid: if grid[seat] == "#": total += 1 return total def solve(in_file): grid = parse_map(in_file) unstable = True updates = {} while unstable: for seat in grid: if grid[seat] == "L" and check_seat(seat, grid) == 0: updates[seat] = "#" elif grid[seat] == "#" and check_seat(seat, grid) >= 5: updates[seat] = "L" if updates: for update in updates: grid[update] = updates[update] updates = {} else: unstable = False return count_occupied(grid) # print(solve("sample.txt")) # 26 print(solve("input.txt")) # 2045
22.28125
67
0.462366
7949e7ea48d128d1f4f5d097e15dbcc77c909a21
42,413
py
Python
tests/test_exh.py
pmacosta/putil
416cea52df8221981727e25d133e9b4e3f464798
[ "MIT" ]
6
2015-12-15T04:09:08.000Z
2020-02-21T01:40:57.000Z
tests/test_exh.py
pmacosta/putil
416cea52df8221981727e25d133e9b4e3f464798
[ "MIT" ]
null
null
null
tests/test_exh.py
pmacosta/putil
416cea52df8221981727e25d133e9b4e3f464798
[ "MIT" ]
2
2016-01-21T23:29:17.000Z
2020-02-21T01:41:05.000Z
# test_exh.py # Copyright (c) 2013-2016 Pablo Acosta-Serafini # See LICENSE for details # pylint: disable=C0103,C0111,C0302,C0413,E0611,F0401,R0201,R0204,R0903,R0912 # pylint: disable=R0914,R0915,W0108,W0122,W0123,W0212,W0612,W0631,W0640 # Standard library imports from __future__ import print_function import collections import copy import os import re import sys from itertools import product if sys.hexversion >= 0x03000000: import unittest.mock as mock # PyPI imports import pytest if sys.hexversion < 0x03000000: import mock # Putil imports import putil.eng import putil.exh import putil.misc import putil.pcontracts from putil.test import AE, AI, AROPROP, CLDICTS, GET_EXMSG TEST_DIR = os.path.realpath(os.path.dirname(__file__)) SUPPORT_DIR = os.path.join(TEST_DIR, 'support') sys.path.append(SUPPORT_DIR) import exh_support_module_1 import exh_support_module_2 if sys.hexversion > 0x03000000: def exec_function(source, filename, global_map): """ A wrapper around exec() """ exec(compile(source, filename, 'exec'), global_map) else: # From https://stackoverflow.com/questions/12809234/ # is-it-possible-to-call-exec-so-that-its-compatible-with- # both-python-3-and-pytho # "OK, this is pretty gross. In Py2, exec was a statement, but that will # be a syntax error if we try to put it in a Py3 file, even if it isn't # executed. So hide it inside an evaluated string literal instead." eval(compile("""\ def exec_function(source, filename, global_map): exec compile(source, filename, "exec") in global_map """, '<exec_function>', 'exec' )) ### # Global variables ### CTNAME = 'tests.test_exh.TestExHandle' PENG_FNAME = sys.modules['putil.eng'].__file__ ### # Helper functions ### sarg = lambda msg: 'Argument `{0}` is not valid'.format(msg) ### # Test functions ### def test_add(): """ Test add function behavior """ obj = putil.exh.addex # Exceptions AI(obj, 'extype', 5, 'Message') AI(obj, 'exmsg', RuntimeError, 2.0) AI(obj, 'condition', RuntimeError, 'Message', 1) AI(obj, 'edata', RuntimeError, 'Message', False, 5) inst1 = obj(IOError, 'First exception') inst2 = obj(TypeError, 'My exception') inst3 = obj(RuntimeError, 'Third exception') inst2(False) AE(inst2, TypeError, 'My exception', True) inst4 = obj(IOError, 'Invalid *[name]*') inst4(False) AE(inst4, IOError, 'Invalid arg', True, [{'field':'name', 'value':'arg'}]) obj(TypeError, 'My exception', False) with pytest.raises(TypeError) as excinfo: obj(TypeError, 'My exception', True) assert GET_EXMSG(excinfo) == 'My exception' edata = [{'field':'name', 'value':'arg'}] obj(IOError, 'Invalid *[name]*', False, edata) with pytest.raises(IOError) as excinfo: obj(IOError, 'Invalid *[name]*', True, edata) assert GET_EXMSG(excinfo) == 'Invalid arg' def test_add_ai(): """ Test add_ai function behavior """ obj = putil.exh.addai # Exceptions AI(obj, 'argname', 5) AI(obj, 'condition', 'name', 1) inst1 = obj('value') inst2 = obj('fname') inst3 = obj('kwarg') inst2(False) AE(inst2, RuntimeError, 'Argument `fname` is not valid', True) obj('arg', False) with pytest.raises(RuntimeError) as excinfo: obj('arg', True) assert GET_EXMSG(excinfo) == 'Argument `arg` is not valid' def test_star_exh_obj(): """ Test [get|set|del]_exh_obj() function behavior """ AI(putil.exh.set_exh_obj, 'obj', obj=5) # set_exh_obj function exobj = putil.exh.ExHandle() putil.exh.set_exh_obj(exobj) assert id(putil.exh.get_exh_obj()) == id(exobj) # del_exh_obj function putil.exh.del_exh_obj() assert putil.exh.get_exh_obj() is None # Test that nothing happens if del_exh_obj is called when there # is no global object handler set putil.exh.del_exh_obj() new_exh_obj = putil.exh.get_or_create_exh_obj() assert id(new_exh_obj) != id(exobj) assert not new_exh_obj._full_cname # If there is a global exception handler the arguments passed # should not have any effect assert id(putil.exh.get_or_create_exh_obj(True)) == id(new_exh_obj) assert not new_exh_obj._full_cname # Test passed arguments are correctly assigned putil.exh.del_exh_obj() new_exh_obj = putil.exh.get_or_create_exh_obj(True) assert new_exh_obj._full_cname putil.exh.del_exh_obj() # get_or_create_exh_obj function obj = putil.exh.get_or_create_exh_obj AI(obj, 'full_cname', full_cname=5) AI(obj, 'exclude', exclude=5) AI(obj, 'callables_fname', callables_fname=True) args = {'callables_fname':'_not_a_file_'} msg = 'File _not_a_file_ could not be found' AE(obj, OSError, msg, **args) # exclude parameter pobj = putil.pinspect.Callables([PENG_FNAME]) new_exh_obj = putil.exh.get_or_create_exh_obj(exclude=['putil.eng']) new_exh_obj._exclude = ['putil.eng'] putil.exh.del_exh_obj() # callables_fname parameter with putil.misc.TmpFile() as fname: pobj.save(fname) new_exh_obj = putil.exh.get_or_create_exh_obj(callables_fname=fname) assert pobj == new_exh_obj._callables_obj putil.exh.del_exh_obj() @pytest.mark.parametrize( 'arg, ref', [ (RuntimeError, 'RuntimeError'), (OSError, 'OSError') ] ) def test_ex_type_str(arg, ref): """ test _ex_type_str() function behavior """ assert putil.exh._ex_type_str(arg) == ref class TestExHandle(object): """ Tests for ExHandle class """ def test_init(self): """ Test constructor behavior """ # Exceptions obj = putil.exh.ExHandle AI(obj, 'full_cname', full_cname=5) AI(obj, 'exclude', exclude=5) AI(obj, 'exclude', exclude=['p', 'a', 5, 'c']) AI(obj, 'callables_fname', callables_fname=True) arg = {'exclude':['sys', '_not_a_module_']} msg = 'Source for module _not_a_module_ could not be found' AE(obj, ValueError, msg, **arg) arg = {'callables_fname':'_not_an_existing_file_'} msg = 'File _not_an_existing_file_ could not be found' # Functionality exobj = putil.exh.ExHandle() assert not exobj._full_cname assert exobj._exclude is None assert exobj._exclude_list == [] exobj = putil.exh.ExHandle(False, []) assert not exobj._full_cname assert exobj._exclude == [] assert exobj._exclude_list == [] exobj = putil.exh.ExHandle(True, None) assert exobj._full_cname assert exobj._exclude is None assert exobj._exclude_list == [] exobj = putil.exh.ExHandle(exclude=['putil.exh']) assert exobj._exclude == ['putil.exh'] assert exobj._exclude_list == [ sys.modules['putil.exh'].__file__.replace('.pyc', '.py') ] pobj = putil.pinspect.Callables([PENG_FNAME]) with putil.misc.TmpFile() as fname: pobj.save(fname) exobj = putil.exh.ExHandle(callables_fname=fname) assert pobj == exobj._callables_obj @pytest.mark.parametrize( 'args, extype, exname', [ ((5, RuntimeError, 'Message'), RuntimeError, sarg('exname')), (('34', RuntimeError, 'Message'), RuntimeError, sarg('exname')), (('exception', 5, 'Message'), RuntimeError, sarg('extype')), (('exception', RuntimeError, True), RuntimeError, sarg('exmsg')) ] ) @pytest.mark.parametrize('full_cname', [True, False]) def test_add_exception_exceptions(self, full_cname, args, extype, exname): """ Test add_exception() method exceptions """ obj = putil.exh.ExHandle(full_cname).add_exception AE(obj, extype, exname, *args) # These should not raise an exception obj = putil.exh.ExHandle(full_cname) obj.add_exception(exname='name1', extype=RuntimeError, exmsg='desc1') obj.add_exception(exname='name2', extype=TypeError, exmsg='desc2') def test_add_exception(self): """ Test add_exception() function behavior """ # pylint: disable=E0602,W0613 # Functions that are going to be traced def func1(): aobj('first_exception', TypeError, dmsg('first')) print("Hello") def prop_decorator(func): return func @putil.pcontracts.contract(text=str) @prop_decorator def func2(text): aobj('second_exception', ValueError, dmsg('second')) aobj('third_exception', OSError, dmsg('third')) print(text) class Class1(object): def __init__(self, exobj): self._value = None self._aobj = exobj.add_exception @property def value3(self): self._aobj('getter_exception', TypeError, pmsg('Get')) return self._value @value3.setter @putil.pcontracts.contract(value=int) def value3(self, value): self._aobj('setter_exception', TypeError, pmsg('Set')) self._value = value @value3.deleter def value3(self): self._aobj('deleter_exception', TypeError, pmsg('Delete')) print('Cannot delete attribute') def _get_value4_int(self): self._aobj('dummy_exception', OSError, 'Bypass exception') return self._value def _get_value4(self): return self._get_value4_int() value4 = property(_get_value4) def func7(): aobj(emsg(7), TypeError, mmsg(7)) def func8(): aobj(emsg(8), TypeError, mmsg(8)) def func9(): aobj(emsg(9), TypeError, mmsg(9)) def func10(): aobj(emsg(10), TypeError, mmsg(10)) def func11(): aobj(emsg(11), TypeError, mmsg(11)) def func12(): aobj(emsg(12), TypeError, mmsg(12)) def func13(): aobj(emsg(13), TypeError, mmsg(13)) def func14(): aobj(emsg(14), TypeError, mmsg(14)) # Add a function via exec iftxt = ( "def func15(exobj):" " aobj(emsg(15), TypeError, mmsg(15))" ) gmap = locals() exec_function(iftxt, '<exec_function>', gmap) func15 = gmap['func15'] # Helper functions dmsg = lambda msg: 'This is the {0} exception'.format(msg) emsg = lambda num: 'total_exception_{0}'.format(num) mmsg = lambda num: 'Total exception #{0}'.format(num) pmsg = lambda msg: '{0} function exception'.format(msg) root = CTNAME+'.test_add_exception' # Assertions exobj = putil.exh.ExHandle( full_cname=True, exclude=['_pytest', 'tests.test_exh'] ) assert exobj.exceptions_db == [] # Generate all possible combinations of full_cname and exclude options # full_cname exclude combinations = product([True, False], [None, ['_pytest', 'execnet']]) for full_cname, exclude in combinations: exobj = putil.exh.ExHandle(full_cname=full_cname, exclude=exclude) aobj = exobj.add_exception # Trace functions dobj = Class1(exobj) dobj.value3 = 5 print(dobj.value3) del dobj.value3 cdb = exobj._ex_dict func1() func2("world") func7() func8() func9() func10() func11() func12() func13() func14() func15(exobj) exh_support_module_1.func16(exobj) # Define references cpath = lambda msg: 'Class1.value3({0})'.format(msg) fkeys = [ 'first_exception', 'second_exception', 'third_exception', 'setter_exception', 'getter_exception', 'deleter_exception', emsg(7), emsg(8), emsg(9), emsg(10), emsg(11), emsg(12), emsg(13), emsg(14), emsg(15), emsg(16), 'dummy_exception' ] fnames = [ 'func1', 'func2', 'func2', cpath('setter'), cpath('getter'), cpath('deleter'), 'func7', 'func8', 'func9', 'func10', 'func11', 'func12', 'func13', 'func14', '', '/exh_support_module_1.func16', 'Class1.value4(getter)', ] if full_cname and exclude: template = root+'/'+CTNAME+'.' func_name = 'test_add_exception.' fnames = ( [template+func_name+item for item in fnames[0:14]]+ [root, root+'/exh_support_module_1.func16']+ [template+func_name+item for item in fnames[-1]] ) fexh = [TypeError, ValueError, OSError]+13*[TypeError]+[OSError] fdesc = [ dmsg('first'), dmsg('second'), dmsg('third'), pmsg('Set'), pmsg('Get'), pmsg('Delete'), mmsg(7), mmsg(8), mmsg(9), mmsg(10), mmsg(11), mmsg(12), mmsg(13), mmsg(14), mmsg(15), mmsg(16), 'Bypass exception' ] # Test that exceptions have been added correctly to handler assert cdb cdb = exobj._flatten_ex_dict() for exname in cdb: erec = cdb[exname] iobj = zip(fnames, fexh, fdesc) match_dict = dict( [(key, value) for key, value in zip(fkeys, iobj)] ) for key, ttuple in match_dict.items(): if re.compile(r'\d+/'+key).match(exname): break else: raise RuntimeError('Callable not found') if full_cname and exclude: assert erec['function'][0] == exobj.encode_call(ttuple[0]) else: if not full_cname: assert erec['function'][0] is None else: assert re.compile(('.+/{0}'+ttuple[0]).format(root)) assert erec['type'] == ttuple[1] assert erec['msg'] == ttuple[2] # Test that function IDs are unique mdict = collections.defaultdict(lambda: []) for exname in cdb: func_id = exname.split('/')[0] mdict[exname] = mdict[exname].append(func_id) exlist = [] for exname, value in mdict.items(): if value and match(exname) and (len(set(value)) != len(value)): raise RuntimeError('Functions do not have unique IDs') exlist = exlist+value if value else exlist assert len(set(exlist)) == len(exlist) # Test that exec code gets correctly flagged frobj = sys._getframe(0) gcf = exobj._get_callable_full_name for item in [func15, None]: assert gcf(frobj, '<module>', item) == 'dynamic' # Test what happens when top of stack is reached exobj = putil.exh.ExHandle(full_cname=True, exclude=['_pytest']) obj = exobj.add_exception def func_f(): obj(emsg('F'), TypeError, mmsg('F')) def mock_get_frame(num): if num < 4: return frobj raise ValueError('Top of the stack') frobj = sys._getframe(0) cname = 'putil.exh.sys._getframe' with mock.patch(cname, side_effect=mock_get_frame): func_f() ecb = exobj._flatten_ex_dict() exname = list(ecb.keys())[0] erec = ecb[exname] ref = sorted( { 'function': [root+'/'+root+'/'+root+'/'+root], 'type':TypeError, 'msg':mmsg('F'), 'raised': [False] }.items() ) assert re.compile(r'\d+/'+emsg('F')).match(exname) erec['function'] = [ exobj.decode_call(call) for call in erec['function'] ] assert sorted(erec.items()) == ref ### # Test property search ### exobj = putil.exh.ExHandle( full_cname=True, exclude=['_pytest', 'tests.test_exh'] ) cobj = exh_support_module_2.MyClass(exobj) cobj.value = 5 cdb = cobj._exhobj._flatten_ex_dict() assert len(list(cdb.keys())) == 1 key = list(cdb.keys())[0] item = cdb[key] assert cobj._exhobj.decode_call(item['function'][0]).endswith( 'exh_support_module_2.MyClass.value(setter)' ) assert item['msg'] == 'Illegal value' ### # Test exclude: test without exclusion and with exclusion, # the function name should be 'None' ### # Test with function that has a contract decorator putil.exh.set_exh_obj( putil.exh.ExHandle(full_cname=True, exclude=['_pytest']) ) _ = putil.eng.peng(15, 3, False) cdb = putil.exh.get_exh_obj()._flatten_ex_dict() for item in cdb.values(): assert item['function'][0] putil.exh.set_exh_obj( putil.exh.ExHandle( full_cname=True, exclude=['_pytest', 'putil.eng'] ) ) _ = putil.eng.peng(15, 3, False) cdb = putil.exh.get_exh_obj()._flatten_ex_dict() for item in cdb.values(): assert not item['function'][0] # Test with function that has an exception in body import tests.support.exh_support_module_1 putil.exh.set_exh_obj( putil.exh.ExHandle(full_cname=True, exclude=['_pytest']) ) tests.support.exh_support_module_1.simple_exception() cdb = putil.exh.get_exh_obj()._flatten_ex_dict() for item in cdb.values(): assert item['function'][0] putil.exh.set_exh_obj( putil.exh.ExHandle( full_cname=True, exclude=['_pytest', 'tests.support.exh_support_module_1'] ) ) tests.support.exh_support_module_1.simple_exception() cdb = putil.exh.get_exh_obj()._flatten_ex_dict() for item in cdb.values(): assert not item['function'][0] def test_raise_exception_if_exceptions(self): """ Test raise_exception_if method exceptions """ # pylint: disable=W0702 # Helper functions def check_rec(mname, extype, exmsg): assert erec['function'].endswith('{0}'.format(mname)) assert erec['type'] == extype assert erec['msg'] == exmsg assert erec['raised'] def check_str(exobj, slist, llist): root = CTNAME+'.test_raise_exception_if_exceptions' ref = [ '{0}/{0}.func_top/{0}.func_mid/{0}.func_base'.format(root), '{0}/{0}.func_base'.format(root), '{0}/{0}.func_mid/{0}.func_base'.format(root) ] pb = lambda x, nflip: x if nflip else (not x) alist = ['*' if item else '' for item in llist] cdb_int = exobj._flatten_ex_dict() entry = cdb_int[list(cdb_int.keys())[0]] entry = cdb_int[list(cdb_int.keys())[0]] assert ( [exobj.decode_call(item) for item in entry['function']] == ref ) assert entry['raised'] == llist stxt = str(exobj).split('\n')[3:] plist = [item.endswith(' [raised]') for item in stxt] assert all([pb(item, sitem) for item, sitem in zip(plist, slist)]) db = exobj.exceptions_db exmsg = 'RuntimeError (Invalid condition)' for num in range(0, 3): assert db[num]['data'] == exmsg+alist[num] for num, fname in zip(range(0, 3), ref): assert db[num]['name'] == fname # Tests obj = putil.exh.ExHandle() def func3(cond1=False, cond2=False, cond3=False, cond4=False): exobj = putil.exh.ExHandle() items = ( (RuntimeError, 'This is an exception'), (OSError, 'This is an exception with a *[fname]* field') ) for num, (extype, exmsg) in enumerate(items): exobj.add_exception('my_exception'+str(num+1), extype, exmsg) exobj.raise_exception_if('my_exception1', cond1, edata=None) edata = {'field':'fname', 'value':'my_file.txt'} exobj.raise_exception_if('my_exception2', cond2, edata=edata) if cond3: exobj.raise_exception_if('my_exception3', False) edata = {'field':'not_a_field', 'value':'my_file.txt'} exobj.raise_exception_if('my_exception2', cond4, edata=edata) return exobj robj = obj.raise_exception_if AI(robj, 'exname', exname=5, condition=False) AI(robj, 'condition', exname='my_exception', condition=5) items = [ 354, {'field':'my_field'}, {'field':3, 'value':5}, {'value':5}, [{'field':'my_field1', 'value':5}, {'field':'my_field'}], [{'field':'my_field1', 'value':5}, {'field':3, 'value':5}], [{'field':'my_field1', 'value':5}, {'value':5}] ] for item in items: AI(robj, 'edata', 'my_exception', False, item) AE(func3, RuntimeError, 'This is an exception', True, False) exmsg = 'This is an exception with a my_file.txt field' AE(func3, OSError, exmsg, cond2=True) exmsg = 'Exception name my_exception3 not found' AE(func3, ValueError, exmsg, cond3=True) exmsg = 'Field not_a_field not in exception message' AE(func3, RuntimeError, exmsg, cond4=True) # Test that edata=None works exobj = func3() cdb = exobj._flatten_ex_dict() if not cdb: pytest.fail('_ex_dict empty') for exname, erec in cdb.items(): mname = 'test_exh.test_raise_exception.func3' if exname.endswith('/{0}.my_exception1'.format(mname)): check_rec(mname, RuntimeError, 'This is an exception') if exname.endswith('/{0}.my_exception2'.format(mname)): msg = 'This is an exception with a *[fname]* field' check_rec(mname, OSError, msg) exobj = putil.exh.ExHandle(full_cname=True) def func_base(exobj, cond): """ Test raised field """ exobj.add_exception( 'multi_path_exception', RuntimeError, 'Invalid condition' ) exobj.raise_exception_if( exname='multi_path_exception', condition=cond ) def func_mid(exobj, cond): """ Add multi-path to exception object """ func_base(exobj, cond) def func_top(exobj, cond): """ Add another multi-path to exception object """ func_mid(exobj, cond) # Mangle "natural" order to test __str__, which # sorts the function names func_top(exobj, False) func_base(exobj, False) func_mid(exobj, False) fpointers = [func_mid, func_top, func_base] slist = [[False, True, False], [False, True, True], [True, True, True]] llist = [[False, False, True], [True, False, True], [True, True, True]] for fpointer, sitem, litem in zip(fpointers, slist, llist): try: fpointer(exobj, True) except: pass check_str(exobj, sitem, litem) def test_exceptions_db(self): """ Test _exceptions_db property behavior """ for full_cname in [True, False]: # Functions definitions def func4(exobj): exobj.add_exception( 'my_exception1', RuntimeError, 'This is exception #1' ) def func5(exobj): exobj.add_exception( 'my_exception2', ValueError, 'This is exception #2, *[result]*' ) exobj.add_exception( 'my_exception3', TypeError, 'This is exception #3' ) exobj = putil.exh.ExHandle(full_cname) func4(exobj) func5(exobj) # Actual tests # Test that property cannot be deleted AROPROP(exobj, 'exceptions_db') # Test contents tdata_in = exobj.exceptions_db if (not tdata_in) or (len(tdata_in) != 3): pytest.fail('Erroneous exceptions database') tdata_out = list() regtext1 = r'[\w|\W]+/'+CTNAME+'.test_exceptions_db.func4' regtext2 = r'[\w|\W]+/'+CTNAME+'.test_exceptions_db.func5' regtext3 = r'\d+/my_exception[2-3]' cname = CTNAME+'.test_exceptions_db' for erec in tdata_in: name = None if full_cname: if re.compile(regtext1).match(erec['name']): name = '{0}.func4'.format(cname) elif re.compile(regtext2).match(erec['name']): name = '{0}.func5'.format(cname) else: if re.compile(r'\d+/my_exception1').match(erec['name']): name = '{0}.func4'.format(cname) elif re.compile(regtext3).match(erec['name']): name = '{0}.func5'.format(cname) if not name: pytest.fail('Exception not found') tdata_out.append({'name':name, 'data':erec['data']}) ref = [ { 'name':'{0}.func4'.format(cname), 'data':'RuntimeError (This is exception #1)' }, { 'name':'{0}.func5'.format(cname), 'data':'ValueError (This is exception #2, *[result]*)' }, { 'name':'{0}.func5'.format(cname), 'data':'TypeError (This is exception #3)' } ] assert CLDICTS(tdata_out, ref) def test_save_callables(self): """ Test save_callables method behavior """ obj1 = putil.pinspect.Callables([PENG_FNAME]) with putil.misc.TmpFile() as fname1: with putil.misc.TmpFile() as fname2: callables_fname1 = fname1 callables_fname2 = fname2 obj1.save(callables_fname1) obj2 = putil.exh.ExHandle(callables_fname=callables_fname1) obj2.save_callables(callables_fname2) obj3 = putil.pinspect.Callables() obj3.load(callables_fname2) assert obj1 == obj3 def test_save_callables_exceptions(self): """ Test save_callables method exceptions """ obj = putil.exh.ExHandle() AI(obj.save_callables, 'callables_fname', True) def test_callables_db(self): """ Test callables_db property behavior """ # Function definitions def func6(exobj): exobj.add_exception( 'my_exception', RuntimeError, 'This is an exception' ) return exobj # Actual tests exobj = func6(putil.exh.ExHandle()) # Actual contents of what is returned should be checked # in pinspect module assert exobj.callables_db is not None # Test that property cannot be deleted AROPROP(exobj, 'callables_db') def test_callables_separator(self): """ Test callables_separator property behavior """ exobj = putil.exh.ExHandle() # Actual contents of what is returned should be checked in # pinspect module assert exobj.callables_separator == '/' # Test that property cannot be deleted AROPROP(exobj, 'callables_separator') def test_str(self): """ Test __str__ method behavior """ for full_cname in [True, False]: # Functions definition def func7(exobj): exobj.add_exception( 'my_exception7', RuntimeError, 'This is exception #7' ) exobj.raise_exception_if('my_exception7', False) def func8(exobj): exobj.add_exception( 'my_exception8', ValueError, 'This is exception #8, *[fname]*' ) exobj.add_exception( 'my_exception9', TypeError, 'This is exception #9' ) exobj = putil.exh.ExHandle(full_cname) func7(exobj) func8(exobj) # Actual tests str_in = str(exobj).split('\n\n') str_out = list() cname = 'test_exh.TestExHandle.test_str' for str_element in str_in: str_list = str_element.split('\n') if str_list[0].endswith('/my_exception7'): str_list[0] = ( 'Name : {0}.func7/my_exception7'.format(cname) ) elif str_list[0].endswith('/my_exception8'): str_list[0] = ( 'Name : {0}.func8/my_exception8'.format(cname) ) elif str_list[0].endswith('/my_exception9'): str_list[0] = ( 'Name : {0}.func8/my_exception9'.format(cname) ) if str_list[3].endswith('{0}.func7'.format(cname)): str_list[3] = 'Function: {0}'.format( '{0}.func7'.format(cname) if full_cname else 'None' ) elif str_list[3].endswith('{0}.func8'.format(cname)): str_list[3] = 'Function: {0}'.format( '{0}.func8'.format(cname) if full_cname else 'None' ) str_out.append('\n'.join(str_list)) # str_check = list() str_check.append( 'Name : '+cname+'.func7/my_exception7\n' 'Type : RuntimeError\n' 'Message : This is exception #7\n' 'Function: {name}'.format( name='{0}.func7'.format(cname) if full_cname else 'None' ) ) str_check.append( 'Name : '+cname+'.func8/my_exception8\n' 'Type : ValueError\n' 'Message : This is exception #8, *[fname]*\n' 'Function: {name}'.format( name='{0}.func8'.format(cname) if full_cname else 'None' ) ) str_check.append( 'Name : '+cname+'.func8/my_exception9\n' 'Type : TypeError\n' 'Message : This is exception #9\n' 'Function: {name}'.format( name='{0}.func8'.format(cname) if full_cname else 'None' ) ) if sorted(str_out) != sorted(str_check): print('\n\nActual output:\n{text}'.format( text='\n'.join(sorted(str_out)) ) ) print('\n\nReference output\n{text}'.format( text='\n'.join(sorted(str_check)) ) ) assert sorted(str_out) == sorted(str_check) def test_copy(self): """ Test __copy__ method behavior """ # Functions definition def funca(exobj): exobj.add_exception( 'my_exceptionA', RuntimeError, 'This is exception #A' ) def funcb(exobj): exobj.add_exception( 'my_exceptionB', ValueError, 'This is exception #B' ) exobj.add_exception( 'my_exceptionC', TypeError, 'This is exception #C' ) class Clsc(object): def __init__(self, exobj): self._exobj = exobj self._value = None def _set_value(self, value): self._exobj.add_exception( 'my_exceptionD', OSError, 'This is exception #D' ) self._value = value value = property(None, _set_value, None, doc='Value property') source_obj = putil.exh.ExHandle(full_cname=True) funca(source_obj) funcb(source_obj) obj = Clsc(source_obj) obj.value = 5 # Actual tests dest_obj = copy.copy(source_obj) assert source_obj._ex_dict == dest_obj._ex_dict assert id(source_obj._ex_dict) != id(dest_obj._ex_dict) assert source_obj._callables_obj == dest_obj._callables_obj assert id(source_obj._callables_obj) != id(dest_obj._callables_obj) assert source_obj._clut == dest_obj._clut assert id(source_obj._clut) != id(dest_obj._clut) assert source_obj._full_cname == dest_obj._full_cname assert CLDICTS(source_obj.exceptions_db, dest_obj.exceptions_db) def test_multiple_paths_to_same_exception(self): """ Test that different paths to a single exception definition do not overwrite each other """ def exdef(obj): obj.add_exception( 'my_exception', RuntimeError, 'This is the exception' ) def funca(obj): exdef(obj) def funcb(obj): exdef(obj) exobj = putil.exh.ExHandle(full_cname=True) funca(exobj) funcb(exobj) exdb = sorted(exobj.exceptions_db, key=lambda item: item['name']) assert len(exdb) == 2 assert exdb[0]['data'] == 'RuntimeError (This is the exception)' assert exdb[1]['data'] == 'RuntimeError (This is the exception)' cname = CTNAME+'.test_multiple_paths_to_same_exception' assert exdb[0]['name'].endswith( '{0}/{0}.funca/{0}.exdef'.format(cname) ) assert exdb[1]['name'].endswith( '{0}/{0}.funcb/{0}.exdef'.format(cname) ) str_in = putil.misc.flatten_list( [item.split('\n') for item in str(exobj).split('\n\n')] ) fstring = cname+'/'+cname+'.func{0}/'+cname+'.exdef' assert str_in[0].endswith('/my_exception') assert str_in[1] == 'Type : RuntimeError' assert str_in[2] == 'Message : This is the exception' assert str_in[3].startswith('Function: ') assert ( str_in[3].endswith(fstring.format('a')) or str_in[3].endswith(fstring.format('b')) ) assert str_in[4].startswith(' '*10) assert str_in[4].endswith( fstring.format( 'a' if str_in[3].endswith(fstring.format('b')) else 'b' ) ) def test_add(self): """ Test __add__ method behavior """ scomp = lambda a, b: bool(sorted(a) == sorted(b)) def check_add(sobj): ex_dict_ref = { 'call1':{'a':5, 'b':6}, 'call2':{'a':7, 'b':8}, 'call3':{'a':10, 'b':100}, 'call4':{'a':200, 'b':300} } c_ref = {'id1':5, 'ssid1':10, 'id2':3, 'ssid2':1} rcdb_ref = {'rc1':5, 'rc2':7, 'rc3':0, 'rc4':-1} mod_ref = { 'key1':'alpha', 'key2':'beta', 'key3':'pi', 'key4':'gamma' } fnames_ref = {'hello':0, 'world':1} mlist_ref = ['this', 'is', 'a', 'test'] cls_ref = ['once', 'upon', 'a', 'time'] assert scomp(sobj._ex_dict, c_ref) cobj = sobj._callables_obj assert scomp(cobj._callables_db, ex_dict_ref) assert scomp(cobj._reverse_callables_db, rcdb_ref) assert scomp(cobj._modules_dict, mod_ref) assert scomp(cobj._fnames, fnames_ref) assert scomp(cobj._module_names, mlist_ref) assert scomp(cobj._class_names, cls_ref) def comp_objs(obj): ref = { CTNAME+'.test_add': '0', CTNAME+'.test_add.func1': '1', CTNAME+'.test_add.func2': '3', CTNAME+'.test_add.func3': '2' } assert obj._clut == ref nref = [ 'copy_exception_1', 'copy_exception_2', 'copy_exception_3', 'contract:putil.eng.peng.frac_length_0', 'contract:putil.eng.peng.number_0', 'contract:putil.eng.peng.rjust_0', ] alist = [ item.split(obj._callables_separator)[1] for item in obj._flatten_ex_dict() ] assert sorted(alist) == sorted(nref) for key, value in obj._flatten_ex_dict().items(): name = key.split(obj._callables_separator)[1] if name == 'copy_exception_1': assert value['function'] == ['0/1'] elif name == 'copy_exception_2': assert value['function'] == ['0/3'] elif name == 'copy_exception_3': assert value['function'] == ['0/2'] else: assert value['function'] == [None] # pylint: disable=W0104 obj1 = putil.exh.ExHandle(_copy=True) obj1._ex_dict = {'id1':5, 'ssid1':10} obj1._callables_obj = putil.pinspect.Callables() obj1._callables_obj._callables_db = { 'call1':{'a':5, 'b':6}, 'call2':{'a':7, 'b':8} } obj1._callables_obj._reverse_callables_db = {'rc1':5, 'rc2':7} obj1._callables_obj._modules_dict = {'key1':'alpha', 'key2':'beta'} obj1._callables_obj._fnames = {'hello':0} obj1._callables_obj._module_names = ['this', 'is'] obj1._callables_obj._class_names = ['once', 'upon'] # obj2 = putil.exh.ExHandle(_copy=True) obj2._ex_dict = {'id2':3, 'ssid2':1} obj2._callables_obj = putil.pinspect.Callables() obj2._callables_obj._callables_db = { 'call3':{'a':10, 'b':100}, 'call4':{'a':200, 'b':300} } obj2._callables_obj._reverse_callables_db = {'rc3':0, 'rc4':-1} obj2._callables_obj._modules_dict = {'key3':'pi', 'key4':'gamma'} obj2._callables_obj._fnames = {'world':0} obj2._callables_obj._module_names = ['a', 'test'] obj2._callables_obj._class_names = ['a', 'time'] # check_add(obj1+obj2) obj1 += obj2 check_add(obj1) # Incompatible types with pytest.raises(TypeError) as excinfo: obj1+5 msg = 'Unsupported operand type(s) for +: putil.exh.ExHandle and int' assert GET_EXMSG(excinfo) == msg # Incompatible types with pytest.raises(TypeError) as excinfo: obj1 += 5 assert GET_EXMSG(excinfo) == msg # obj2._full_cname = True with pytest.raises(RuntimeError) as excinfo: obj1+obj2 msg = 'Incompatible exception handlers' assert GET_EXMSG(excinfo) == msg with pytest.raises(RuntimeError) as excinfo: obj1 += obj2 assert GET_EXMSG(excinfo) == msg obj2._full_cname = False obj2._exclude = ['_pytest'] with pytest.raises(RuntimeError) as excinfo: obj1+obj2 assert GET_EXMSG(excinfo) == msg with pytest.raises(RuntimeError) as excinfo: obj1 += obj2 assert GET_EXMSG(excinfo) == msg obj2._exclude = None # Test re-mapping of callables look-up table obj1 = putil.exh.ExHandle(full_cname=True, exclude=['putil.eng']) obj2 = putil.exh.ExHandle(full_cname=True, exclude=['putil.eng']) def func1(exhobj): exhobj.add_exception( 'copy_exception_1', TypeError, 'Copy exception #1' ) def func2(exhobj): exhobj.add_exception( 'copy_exception_2', RuntimeError, 'Copy exception #2' ) def func3(exhobj): exhobj.add_exception( 'copy_exception_3', ValueError, 'Copy exception #3' ) putil.exh.del_exh_obj() putil.exh.get_or_create_exh_obj( full_cname=True, exclude=['putil.eng'] ) putil.eng.peng(1, 3, False) exhobj += putil.exh.get_exh_obj() putil.exh.del_exh_obj() # Test __add__ func1(obj1) func3(obj1) func1(obj2) func2(obj2) func3(obj2) obj1_ref = copy.copy(obj1) obj2_ref = copy.copy(obj2) assert obj1_ref == obj1 assert obj2_ref == obj2 obj3 = obj1+obj2 assert obj1_ref == obj1 assert obj2_ref == obj2 comp_objs(obj3) # Test __iadd__ obj1 = putil.exh.ExHandle(full_cname=True, exclude=['putil.eng']) obj2 = putil.exh.ExHandle(full_cname=True, exclude=['putil.eng']) func1(obj1) func3(obj1) func1(obj2) func2(obj2) func3(obj2) obj2_ref = copy.copy(obj2) assert obj2_ref == obj2 obj1 += obj2 assert obj2_ref == obj2 comp_objs(obj1) def test_eq(self): """ Test __eq__ method behavior """ putil.exh.get_or_create_exh_obj() # Trace some exceptions putil.eng.peng(100, 3, True) obj1 = putil.exh.get_exh_obj() obj2 = copy.copy(obj1) assert obj1 == obj2 assert obj1 != 5 def test_nonzero(self): """ Test __nonzero__ method behavior """ exhobj = putil.exh.ExHandle() assert not exhobj def my_func(exhobj): exhobj.add_exception('test', RuntimeError, 'Message') my_func(exhobj) assert exhobj
40.3549
79
0.544833
7949e826c413c242d31fecc441782f399f92ab57
63,706
bzl
Python
tools/build_variables.bzl
Zhaopudark/pytorch
8559d39cf032a9118c470ebe3a5047f89d94fe5c
[ "Intel" ]
1
2022-02-05T18:15:29.000Z
2022-02-05T18:15:29.000Z
tools/build_variables.bzl
Zhaopudark/pytorch
8559d39cf032a9118c470ebe3a5047f89d94fe5c
[ "Intel" ]
null
null
null
tools/build_variables.bzl
Zhaopudark/pytorch
8559d39cf032a9118c470ebe3a5047f89d94fe5c
[ "Intel" ]
null
null
null
# In both open-source and fbcode builds, these are generated into # torch/csrc/{autgrad,jit}/generated.i GENERATED_CPP = [ "autograd/generated/Functions.cpp", "autograd/generated/VariableType_0.cpp", "autograd/generated/VariableType_1.cpp", "autograd/generated/VariableType_2.cpp", "autograd/generated/VariableType_3.cpp", "autograd/generated/VariableType_4.cpp", "autograd/generated/TraceType_0.cpp", "autograd/generated/TraceType_1.cpp", "autograd/generated/TraceType_2.cpp", "autograd/generated/TraceType_3.cpp", "autograd/generated/TraceType_4.cpp", "autograd/generated/ADInplaceOrViewType_0.cpp", "autograd/generated/ADInplaceOrViewType_1.cpp", "autograd/generated/python_functions_0.cpp", "autograd/generated/python_functions_1.cpp", "autograd/generated/python_functions_2.cpp", "autograd/generated/python_functions_3.cpp", "autograd/generated/python_functions_4.cpp", "autograd/generated/python_nn_functions.cpp", "autograd/generated/python_fft_functions.cpp", "autograd/generated/python_linalg_functions.cpp", "autograd/generated/python_return_types.cpp", "autograd/generated/python_sparse_functions.cpp", "autograd/generated/python_special_functions.cpp", "autograd/generated/python_torch_functions_0.cpp", "autograd/generated/python_torch_functions_1.cpp", "autograd/generated/python_torch_functions_2.cpp", "autograd/generated/python_variable_methods.cpp", ] # NVFuser runtime library libtorch_nvfuser_runtime_sources = [ "torch/csrc/jit/codegen/cuda/runtime/bf16_support.cu", "torch/csrc/jit/codegen/cuda/runtime/block_reduction.cu", "torch/csrc/jit/codegen/cuda/runtime/block_sync_atomic.cu", "torch/csrc/jit/codegen/cuda/runtime/block_sync_default.cu", "torch/csrc/jit/codegen/cuda/runtime/broadcast.cu", "torch/csrc/jit/codegen/cuda/runtime/fp16_support.cu", "torch/csrc/jit/codegen/cuda/runtime/grid_broadcast.cu", "torch/csrc/jit/codegen/cuda/runtime/grid_reduction.cu", "torch/csrc/jit/codegen/cuda/runtime/grid_sync.cu", "torch/csrc/jit/codegen/cuda/runtime/helpers.cu", "torch/csrc/jit/codegen/cuda/runtime/index_utils.cu", "torch/csrc/jit/codegen/cuda/runtime/random_numbers.cu", "torch/csrc/jit/codegen/cuda/runtime/tensor.cu", "torch/csrc/jit/codegen/cuda/runtime/welford.cu", "torch/csrc/jit/codegen/cuda/runtime/warp.cu", "aten/src/ATen/cuda/detail/PhiloxCudaStateRaw.cuh", "aten/src/ATen/cuda/detail/UnpackRaw.cuh", ] libtorch_nvfuser_generated_headers = ["{}.h".format(name.split("/")[-1].split(".")[0]) for name in libtorch_nvfuser_runtime_sources] def libtorch_generated_sources(gencode_pattern): return [gencode_pattern.format(name) for name in [ "autograd/generated/Functions.cpp", "autograd/generated/VariableType_0.cpp", "autograd/generated/VariableType_1.cpp", "autograd/generated/VariableType_2.cpp", "autograd/generated/VariableType_3.cpp", "autograd/generated/VariableType_4.cpp", "autograd/generated/TraceType_0.cpp", "autograd/generated/TraceType_1.cpp", "autograd/generated/TraceType_2.cpp", "autograd/generated/TraceType_3.cpp", "autograd/generated/TraceType_4.cpp", "autograd/generated/ADInplaceOrViewType_0.cpp", "autograd/generated/ADInplaceOrViewType_1.cpp", ]] # copied from https://github.com/pytorch/pytorch/blob/f99a693cd9ff7a9b5fdc71357dac66b8192786d3/aten/src/ATen/core/CMakeLists.txt jit_core_headers = [ "torch/csrc/utils/memory.h", "torch/csrc/Export.h", "torch/csrc/jit/frontend/source_range.h", "torch/csrc/jit/serialization/callstack_debug_info_serialization.h", "torch/csrc/jit/serialization/source_range_serialization.h", "torch/csrc/jit/frontend/lexer.h", "torch/csrc/jit/frontend/strtod.h", "torch/csrc/jit/frontend/parser_constants.h", "torch/csrc/jit/frontend/function_schema_parser.h", "torch/csrc/jit/frontend/parse_string_literal.h", "torch/csrc/jit/frontend/schema_type_parser.h", "torch/csrc/jit/frontend/error_report.h", "torch/csrc/jit/frontend/tree.h", "torch/custom_class.h", "torch/custom_class_detail.h", "torch/library.h", ] jit_core_sources = [ "torch/csrc/jit/frontend/error_report.cpp", "torch/csrc/jit/frontend/function_schema_parser.cpp", "torch/csrc/jit/frontend/lexer.cpp", "torch/csrc/jit/frontend/schema_type_parser.cpp", "torch/csrc/jit/frontend/strtod.cpp", "torch/csrc/jit/frontend/source_range.cpp", ] # copied from https://github.com/pytorch/pytorch/blob/0bde610c14b92d351b968a0228df29e92442b1cc/torch/CMakeLists.txt # There are some common files used in both internal lite-interpreter and full-jit. Making a separate # list for the shared files. core_sources_common = [ "torch/csrc/autograd/autograd_meta.cpp", "torch/csrc/autograd/forward_grad.cpp", "torch/csrc/jit/frontend/edit_distance.cpp", "torch/csrc/jit/mobile/compatibility/runtime_compatibility.cpp", "torch/csrc/jit/mobile/type_parser.cpp", "torch/csrc/jit/operator_upgraders/upgraders_guard.cpp", "torch/csrc/jit/operator_upgraders/version_map.cpp", "torch/csrc/jit/runtime/instruction.cpp", "torch/csrc/jit/runtime/jit_exception.cpp", "torch/csrc/jit/runtime/operator.cpp", "torch/csrc/jit/mobile/register_ops_common_utils.cpp", "torch/csrc/jit/runtime/print_handler.cpp", "torch/csrc/jit/runtime/slice_indices_adjust.cpp", "torch/csrc/jit/runtime/register_ops_utils.cpp", "torch/csrc/jit/runtime/vararg_functions.cpp", "torch/csrc/jit/mobile/promoted_prim_ops.cpp", "torch/csrc/jit/mobile/prim_ops_registery.cpp", "torch/csrc/profiler/util.cpp", ] torch_unpickler_common = [ "torch/csrc/jit/serialization/import_read.cpp", "torch/csrc/jit/serialization/unpickler.cpp", ] libtorch_sources_common = sorted(core_sources_common + torch_unpickler_common) # The profilers are not needed in the lite interpreter build. libtorch_profiler_sources = [ "torch/csrc/autograd/profiler_legacy.cpp", "torch/csrc/autograd/profiler_kineto.cpp", "torch/csrc/profiler/api.cpp", "torch/csrc/profiler/kineto_shim.cpp", "torch/csrc/profiler/nvtx_observer.cpp", "torch/csrc/monitor/counters.cpp", "torch/csrc/monitor/events.cpp", ] libtorch_edge_profiler_sources = libtorch_profiler_sources + [ "torch/csrc/jit/mobile/profiler_edge.cpp", ] core_trainer_sources = [ "torch/csrc/autograd/anomaly_mode.cpp", "torch/csrc/autograd/autograd.cpp", "torch/csrc/autograd/autograd_not_implemented_fallback.cpp", "torch/csrc/autograd/cpp_hook.cpp", "torch/csrc/autograd/custom_function.cpp", "torch/csrc/autograd/engine.cpp", "torch/csrc/autograd/function.cpp", "torch/csrc/autograd/function_hook.cpp", "torch/csrc/autograd/functions/accumulate_grad.cpp", "torch/csrc/autograd/functions/basic_ops.cpp", "torch/csrc/autograd/functions/tensor.cpp", "torch/csrc/autograd/functions/utils.cpp", "torch/csrc/autograd/input_buffer.cpp", "torch/csrc/autograd/record_function_ops.cpp", "torch/csrc/autograd/saved_variable.cpp", "torch/csrc/autograd/variable.cpp", "torch/csrc/autograd/utils/warnings.cpp", "torch/csrc/jit/frontend/name_mangler.cpp", "torch/csrc/jit/ir/type_hashing.cpp", "torch/csrc/jit/serialization/pickler.cpp", "torch/csrc/jit/serialization/type_name_uniquer.cpp", ] core_sources_full_mobile_no_backend_interface = [ "torch/csrc/jit/api/function_impl.cpp", "torch/csrc/jit/api/module.cpp", "torch/csrc/jit/api/object.cpp", "torch/csrc/jit/backends/backend_debug_handler.cpp", "torch/csrc/jit/backends/backend_detail.cpp", "torch/csrc/jit/backends/backend_resolver.cpp", "torch/csrc/jit/codegen/fuser/codegen.cpp", "torch/csrc/jit/codegen/fuser/compiler.cpp", "torch/csrc/jit/codegen/fuser/executor.cpp", "torch/csrc/jit/codegen/fuser/fallback.cpp", "torch/csrc/jit/codegen/fuser/interface.cpp", "torch/csrc/jit/codegen/fuser/kernel_cache.cpp", "torch/csrc/jit/frontend/builtin_functions.cpp", "torch/csrc/jit/frontend/versioned_symbols.cpp", "torch/csrc/jit/frontend/canonicalize_modified_loop.cpp", "torch/csrc/jit/frontend/convert_to_ssa.cpp", "torch/csrc/jit/frontend/exit_transforms.cpp", "torch/csrc/jit/frontend/inline_loop_condition.cpp", "torch/csrc/jit/frontend/ir_emitter.cpp", "torch/csrc/jit/frontend/parser.cpp", "torch/csrc/jit/frontend/schema_matching.cpp", "torch/csrc/jit/frontend/script_type_parser.cpp", "torch/csrc/jit/frontend/sugared_value.cpp", "torch/csrc/jit/frontend/tracer.cpp", "torch/csrc/jit/ir/alias_analysis.cpp", "torch/csrc/jit/ir/attributes.cpp", "torch/csrc/jit/ir/constants.cpp", "torch/csrc/jit/ir/ir.cpp", "torch/csrc/jit/ir/irparser.cpp", "torch/csrc/jit/ir/node_hashing.cpp", "torch/csrc/jit/ir/scope.cpp", "torch/csrc/jit/ir/subgraph_matcher.cpp", "torch/csrc/jit/jit_log.cpp", "torch/csrc/jit/jit_opt_limit.cpp", "torch/csrc/jit/mobile/nnc/aot_compiler.cpp", "torch/csrc/jit/mobile/nnc/backend.cpp", "torch/csrc/jit/mobile/nnc/context.cpp", "torch/csrc/jit/mobile/nnc/registry.cpp", "torch/csrc/jit/operator_upgraders/utils.cpp", "torch/csrc/jit/operator_upgraders/upgraders.cpp", "torch/csrc/jit/operator_upgraders/upgraders_entry.cpp", "torch/csrc/jit/passes/annotate_warns.cpp", "torch/csrc/jit/passes/bailout_graph.cpp", "torch/csrc/jit/passes/batch_mm.cpp", "torch/csrc/jit/passes/canonicalize.cpp", "torch/csrc/jit/passes/canonicalize_graph_fuser_ops.cpp", "torch/csrc/jit/passes/clear_profiling.cpp", "torch/csrc/jit/passes/clear_undefinedness.cpp", "torch/csrc/jit/passes/common_subexpression_elimination.cpp", "torch/csrc/jit/passes/common_expression_hoisting.cpp", "torch/csrc/jit/passes/concat_opt.cpp", "torch/csrc/jit/passes/constant_pooling.cpp", "torch/csrc/jit/passes/constant_propagation.cpp", "torch/csrc/jit/passes/restore_mutation.cpp", "torch/csrc/jit/passes/create_autodiff_subgraphs.cpp", "torch/csrc/jit/passes/dead_code_elimination.cpp", "torch/csrc/jit/passes/eliminate_no_ops.cpp", "torch/csrc/jit/passes/remove_redundant_profiles.cpp", "torch/csrc/jit/passes/remove_exceptions.cpp", "torch/csrc/jit/passes/decompose_ops.cpp", "torch/csrc/jit/passes/dtype_analysis.cpp", "torch/csrc/jit/passes/device_type_analysis.cpp", "torch/csrc/jit/passes/erase_number_types.cpp", "torch/csrc/jit/passes/fixup_trace_scope_blocks.cpp", "torch/csrc/jit/passes/freeze_module.cpp", "torch/csrc/jit/passes/fuse_linear.cpp", "torch/csrc/jit/passes/fuse_relu.cpp", "torch/csrc/jit/passes/graph_fuser.cpp", "torch/csrc/jit/passes/graph_rewrite_helper.cpp", "torch/csrc/jit/passes/guard_elimination.cpp", "torch/csrc/jit/passes/hoist_conv_packed_params.cpp", "torch/csrc/jit/passes/inline_autodiff_subgraphs.cpp", "torch/csrc/jit/passes/inline_forked_closures.cpp", "torch/csrc/jit/passes/inline_fork_wait.cpp", "torch/csrc/jit/passes/inliner.cpp", "torch/csrc/jit/passes/inplace_check.cpp", "torch/csrc/jit/passes/insert_guards.cpp", "torch/csrc/jit/passes/lift_closures.cpp", "torch/csrc/jit/passes/liveness.cpp", "torch/csrc/jit/passes/loop_unrolling.cpp", "torch/csrc/jit/passes/lower_grad_of.cpp", "torch/csrc/jit/passes/lower_tuples.cpp", "torch/csrc/jit/passes/normalize_ops.cpp", "torch/csrc/jit/passes/peephole_dict_idioms.cpp", "torch/csrc/jit/passes/peephole_list_idioms.cpp", "torch/csrc/jit/passes/value_refinement_utils.cpp", "torch/csrc/jit/passes/peephole_alias_sensitive.cpp", "torch/csrc/jit/passes/pass_manager.cpp", "torch/csrc/jit/passes/peephole.cpp", "torch/csrc/jit/passes/peephole_non_tensor.cpp", "torch/csrc/jit/passes/create_functional_graphs.cpp", "torch/csrc/jit/passes/remove_mutation.cpp", "torch/csrc/jit/passes/prepack_folding.cpp", "torch/csrc/jit/passes/fold_conv_bn.cpp", "torch/csrc/jit/passes/frozen_concat_linear.cpp", "torch/csrc/jit/passes/frozen_conv_add_relu_fusion.cpp", "torch/csrc/jit/passes/frozen_conv_folding.cpp", "torch/csrc/jit/passes/frozen_linear_transpose.cpp", "torch/csrc/jit/passes/frozen_ops_to_mkldnn.cpp", "torch/csrc/jit/passes/frozen_graph_optimizations.cpp", "torch/csrc/jit/passes/remove_expands.cpp", "torch/csrc/jit/passes/remove_dropout.cpp", "torch/csrc/jit/passes/requires_grad_analysis.cpp", "torch/csrc/jit/passes/shape_analysis.cpp", "torch/csrc/jit/passes/integer_value_refinement.cpp", "torch/csrc/jit/passes/replacement_of_old_operators.cpp", "torch/csrc/jit/passes/symbolic_shape_analysis.cpp", "torch/csrc/jit/passes/symbolic_shape_runtime_fusion.cpp", "torch/csrc/jit/passes/specialize_autogradzero.cpp", "torch/csrc/jit/passes/update_differentiable_graph_requires_grad.cpp", "torch/csrc/jit/passes/variadic_ops.cpp", "torch/csrc/jit/passes/subgraph_rewrite.cpp", "torch/csrc/jit/passes/tensorexpr_fuser.cpp", "torch/csrc/jit/passes/utils/memory_dag.cpp", "torch/csrc/jit/passes/utils/subgraph_utils.cpp", "torch/csrc/jit/passes/utils/optimization_utils.cpp", "torch/csrc/jit/passes/utils/op_registry.cpp", "torch/csrc/jit/passes/xnnpack_rewrite.cpp", "torch/csrc/jit/passes/vulkan_rewrite.cpp", "torch/csrc/jit/passes/metal_rewrite.cpp", "torch/csrc/jit/passes/quantization/helper.cpp", "torch/csrc/jit/passes/quantization/quantization_type.cpp", "torch/csrc/jit/passes/quantization/insert_observers.cpp", "torch/csrc/jit/passes/quantization/insert_quant_dequant.cpp", "torch/csrc/jit/passes/quantization/dedup_module_uses.cpp", "torch/csrc/jit/passes/quantization/finalize.cpp", "torch/csrc/jit/passes/quantization/fusion_passes.cpp", "torch/csrc/jit/python/update_graph_executor_opt.cpp", "torch/csrc/jit/runtime/argument_spec.cpp", "torch/csrc/jit/runtime/autodiff.cpp", "torch/csrc/jit/runtime/graph_executor.cpp", "torch/csrc/jit/runtime/interpreter/frame.cpp", "torch/csrc/jit/runtime/interpreter/preprocess_graph.cpp", "torch/csrc/jit/runtime/interpreter.cpp", "torch/csrc/jit/runtime/logging.cpp", "torch/csrc/jit/runtime/profiling_graph_executor_impl.cpp", "torch/csrc/jit/runtime/profiling_record.cpp", "torch/csrc/jit/runtime/script_profile.cpp", "torch/csrc/jit/runtime/symbolic_script.cpp", "torch/csrc/jit/runtime/symbolic_shape_registry.cpp", "torch/csrc/jit/runtime/symbolic_shape_registry_util.cpp", "torch/csrc/jit/runtime/jit_trace.cpp", "torch/csrc/jit/serialization/callstack_debug_info_serialization.cpp", "torch/csrc/jit/serialization/import.cpp", "torch/csrc/jit/serialization/import_export_helpers.cpp", "torch/csrc/jit/serialization/import_source.cpp", "torch/csrc/jit/serialization/pickle.cpp", "torch/csrc/jit/serialization/python_print.cpp", "torch/csrc/jit/serialization/source_range_serialization.cpp", "torch/csrc/jit/tensorexpr/block_codegen.cpp", "torch/csrc/jit/tensorexpr/bounds_inference.cpp", "torch/csrc/jit/tensorexpr/bounds_overlap.cpp", "torch/csrc/jit/tensorexpr/codegen.cpp", "torch/csrc/jit/tensorexpr/cpp_codegen.cpp", "torch/csrc/jit/tensorexpr/eval.cpp", "torch/csrc/jit/tensorexpr/expr.cpp", "torch/csrc/jit/tensorexpr/external_functions_registry.cpp", "torch/csrc/jit/tensorexpr/graph_opt.cpp", "torch/csrc/jit/tensorexpr/hash_provider.cpp", "torch/csrc/jit/tensorexpr/intrinsic_symbols.cpp", "torch/csrc/jit/tensorexpr/ir.cpp", "torch/csrc/jit/tensorexpr/ir_cloner.cpp", "torch/csrc/jit/tensorexpr/ir_mutator.cpp", "torch/csrc/jit/tensorexpr/ir_printer.cpp", "torch/csrc/jit/tensorexpr/ir_simplifier.cpp", "torch/csrc/jit/tensorexpr/ir_verifier.cpp", "torch/csrc/jit/tensorexpr/ir_visitor.cpp", "torch/csrc/jit/tensorexpr/kernel.cpp", "torch/csrc/jit/tensorexpr/llvm_codegen.cpp", "torch/csrc/jit/tensorexpr/llvm_jit.cpp", "torch/csrc/jit/tensorexpr/loopnest.cpp", "torch/csrc/jit/tensorexpr/loopnest_randomization.cpp", "torch/csrc/jit/tensorexpr/lowerings.cpp", "torch/csrc/jit/tensorexpr/mem_dependency_checker.cpp", "torch/csrc/jit/tensorexpr/operators/conv2d.cpp", "torch/csrc/jit/tensorexpr/operators/matmul.cpp", "torch/csrc/jit/tensorexpr/operators/misc.cpp", "torch/csrc/jit/tensorexpr/operators/norm.cpp", "torch/csrc/jit/tensorexpr/operators/pointwise.cpp", "torch/csrc/jit/tensorexpr/operators/quantization.cpp", "torch/csrc/jit/tensorexpr/operators/reduction.cpp", "torch/csrc/jit/tensorexpr/operators/softmax.cpp", "torch/csrc/jit/tensorexpr/reduction.cpp", "torch/csrc/jit/tensorexpr/registerizer.cpp", "torch/csrc/jit/tensorexpr/tensor.cpp", "torch/csrc/jit/tensorexpr/types.cpp", "torch/csrc/jit/tensorexpr/unique_name_manager.cpp", "torch/csrc/jit/testing/file_check.cpp", "torch/csrc/jit/testing/hooks_for_testing.cpp", "torch/csrc/utils/tensor_flatten.cpp", "torch/csrc/utils/variadic.cpp", ] core_sources_full_mobile = core_sources_full_mobile_no_backend_interface + [ "torch/csrc/jit/backends/backend_debug_info.cpp", "torch/csrc/jit/backends/backend_interface.cpp", ] core_sources_full = core_sources_full_mobile + [ "torch/csrc/jit/runtime/static/fusion.cpp", "torch/csrc/jit/runtime/static/impl.cpp", "torch/csrc/jit/runtime/static/memory_planner.cpp", "torch/csrc/jit/runtime/static/native_ops.cpp", "torch/csrc/jit/runtime/static/ops.cpp", "torch/csrc/jit/runtime/static/passes.cpp", "torch/csrc/jit/runtime/static/te_wrapper.cpp", "torch/csrc/jit/tensorexpr/external_functions.cpp", "torch/csrc/jit/tensorexpr/external_functions_codegen.cpp", ] lazy_tensor_core_sources = [ "torch/csrc/lazy/backend/backend_device.cpp", "torch/csrc/lazy/backend/backend_interface.cpp", "torch/csrc/lazy/backend/lowering_context.cpp", "torch/csrc/lazy/core/config.cpp", "torch/csrc/lazy/core/hash.cpp", "torch/csrc/lazy/core/helpers.cpp", "torch/csrc/lazy/core/ir.cpp", "torch/csrc/lazy/core/ir_dump_util.cpp", "torch/csrc/lazy/core/ir_metadata.cpp", "torch/csrc/lazy/core/ir_util.cpp", "torch/csrc/lazy/core/lazy_graph_executor.cpp", "torch/csrc/lazy/core/lazy_view.cpp", "torch/csrc/lazy/core/metrics.cpp", "torch/csrc/lazy/core/multi_wait.cpp", "torch/csrc/lazy/core/permutation_util.cpp", "torch/csrc/lazy/core/shape.cpp", "torch/csrc/lazy/core/tensor.cpp", "torch/csrc/lazy/core/tensor_impl.cpp", "torch/csrc/lazy/core/tensor_util.cpp", "torch/csrc/lazy/core/thread_pool.cpp", "torch/csrc/lazy/core/view_ops/as_strided.cpp", "torch/csrc/lazy/core/view_ops/as_strided_view_update.cpp", "torch/csrc/lazy/core/view_ops/diagonal.cpp", "torch/csrc/lazy/core/view_ops/diagonal_view_update.cpp", "torch/csrc/lazy/core/view_ops/narrow.cpp", "torch/csrc/lazy/core/view_ops/narrow_view_update.cpp", "torch/csrc/lazy/core/view_ops/permute.cpp", "torch/csrc/lazy/core/view_ops/resize.cpp", "torch/csrc/lazy/core/view_ops/select.cpp", "torch/csrc/lazy/core/view_ops/squeeze.cpp", "torch/csrc/lazy/core/view_ops/unsqueeze.cpp", "torch/csrc/lazy/core/view_ops/select_view_update.cpp", "torch/csrc/lazy/core/view_ops/view.cpp", "torch/csrc/lazy/ts_backend/config.cpp", "torch/csrc/lazy/ts_backend/ops/arithmetic_ir_ops.cpp", "torch/csrc/lazy/ts_backend/ops/cast.cpp", "torch/csrc/lazy/ts_backend/ops/device_data.cpp", "torch/csrc/lazy/ts_backend/ops/expand.cpp", "torch/csrc/lazy/ts_backend/ops/generic.cpp", "torch/csrc/lazy/ts_backend/ops/scalar.cpp", "torch/csrc/lazy/ts_backend/ts_node.cpp", ] libtorch_core_sources = sorted( core_sources_common + torch_unpickler_common + core_sources_full + core_trainer_sources + libtorch_profiler_sources + lazy_tensor_core_sources, ) # These files are the only ones that are supported on Windows. libtorch_distributed_base_sources = [ "torch/csrc/distributed/c10d/FileStore.cpp", "torch/csrc/distributed/c10d/GlooDeviceFactory.cpp", "torch/csrc/distributed/c10d/ParamCommsUtils.cpp", "torch/csrc/distributed/c10d/PrefixStore.cpp", "torch/csrc/distributed/c10d/ProcessGroup.cpp", "torch/csrc/distributed/c10d/ProcessGroupGloo.cpp", "torch/csrc/distributed/c10d/ProcessGroupMPI.cpp", "torch/csrc/distributed/c10d/ProcessGroupWrapper.cpp", "torch/csrc/distributed/c10d/Store.cpp", "torch/csrc/distributed/c10d/TCPStore.cpp", "torch/csrc/distributed/c10d/Utils.cpp", "torch/csrc/distributed/c10d/comm.cpp", "torch/csrc/distributed/c10d/default_comm_hooks.cpp", "torch/csrc/distributed/c10d/exception.cpp", "torch/csrc/distributed/c10d/logger.cpp", "torch/csrc/distributed/c10d/reducer.cpp", "torch/csrc/distributed/c10d/sequence_num.cpp", "torch/csrc/distributed/c10d/socket.cpp", ] # These files are only supported on Linux (and others) but not on Windows. libtorch_distributed_extra_sources = [ "torch/csrc/distributed/autograd/autograd.cpp", "torch/csrc/distributed/autograd/utils.cpp", "torch/csrc/distributed/autograd/context/container.cpp", "torch/csrc/distributed/autograd/context/context.cpp", "torch/csrc/distributed/autograd/engine/dist_engine.cpp", "torch/csrc/distributed/autograd/functions/recvrpc_backward.cpp", "torch/csrc/distributed/autograd/functions/sendrpc_backward.cpp", "torch/csrc/distributed/autograd/rpc_messages/autograd_metadata.cpp", "torch/csrc/distributed/autograd/rpc_messages/propagate_gradients_req.cpp", "torch/csrc/distributed/autograd/rpc_messages/propagate_gradients_resp.cpp", "torch/csrc/distributed/autograd/rpc_messages/cleanup_autograd_context_req.cpp", "torch/csrc/distributed/autograd/rpc_messages/cleanup_autograd_context_resp.cpp", "torch/csrc/distributed/autograd/rpc_messages/rpc_with_autograd.cpp", "torch/csrc/distributed/autograd/rpc_messages/rpc_with_profiling_req.cpp", "torch/csrc/distributed/autograd/rpc_messages/rpc_with_profiling_resp.cpp", "torch/csrc/distributed/autograd/rpc_messages/rref_backward_req.cpp", "torch/csrc/distributed/autograd/rpc_messages/rref_backward_resp.cpp", "torch/csrc/distributed/c10d/HashStore.cpp", "torch/csrc/distributed/c10d/ProcessGroupRoundRobin.cpp", "torch/csrc/distributed/rpc/agent_utils.cpp", "torch/csrc/distributed/rpc/message.cpp", "torch/csrc/distributed/rpc/profiler/remote_profiler_manager.cpp", "torch/csrc/distributed/rpc/profiler/server_process_global_profiler.cpp", "torch/csrc/distributed/rpc/python_call.cpp", "torch/csrc/distributed/rpc/python_remote_call.cpp", "torch/csrc/distributed/rpc/python_resp.cpp", "torch/csrc/distributed/rpc/request_callback.cpp", "torch/csrc/distributed/rpc/request_callback_no_python.cpp", "torch/csrc/distributed/rpc/rpc_agent.cpp", "torch/csrc/distributed/rpc/rref_context.cpp", "torch/csrc/distributed/rpc/rref_impl.cpp", "torch/csrc/distributed/rpc/rref_proto.cpp", "torch/csrc/distributed/rpc/script_call.cpp", "torch/csrc/distributed/rpc/script_remote_call.cpp", "torch/csrc/distributed/rpc/script_resp.cpp", "torch/csrc/distributed/rpc/tensorpipe_agent.cpp", "torch/csrc/distributed/rpc/tensorpipe_utils.cpp", "torch/csrc/distributed/rpc/testing/faulty_tensorpipe_agent.cpp", "torch/csrc/distributed/rpc/torchscript_functions.cpp", "torch/csrc/distributed/rpc/types.cpp", "torch/csrc/distributed/rpc/utils.cpp", ] libtorch_distributed_sources = libtorch_distributed_base_sources + libtorch_distributed_extra_sources jit_sources_full = [ "torch/csrc/jit/codegen/cuda/interface.cpp", "torch/csrc/jit/passes/lower_graph.cpp", "torch/csrc/jit/runtime/register_c10_ops.cpp", "torch/csrc/jit/runtime/register_prim_ops.cpp", "torch/csrc/jit/runtime/register_prim_ops_fulljit.cpp", "torch/csrc/jit/runtime/register_special_ops.cpp", "torch/csrc/jit/passes/remove_inplace_ops.cpp", "torch/csrc/jit/passes/utils/check_alias_annotation.cpp", "torch/csrc/jit/passes/autocast.cpp", ] libtorch_core_jit_sources = sorted(jit_sources_full) torch_mobile_tracer_sources = [ "torch/csrc/jit/mobile/model_tracer/tracer.cpp", "torch/csrc/jit/mobile/model_tracer/TensorUtils.cpp", "torch/csrc/jit/mobile/model_tracer/TracerRunner.cpp", "torch/csrc/jit/mobile/model_tracer/MobileModelRunner.cpp", "torch/csrc/jit/mobile/model_tracer/OperatorCallTracer.cpp", "torch/csrc/jit/mobile/model_tracer/KernelDTypeTracer.cpp", ] torch_mobile_core = [ # backend_debug_info.cpp provides # __torch__.torch.classes.backend.BackendDebugInfo class # This should not be needed eventually. # TODO: Remove this dependency "torch/csrc/jit/backends/backend_debug_info.cpp", "torch/csrc/jit/mobile/compatibility/model_compatibility.cpp", "torch/csrc/jit/mobile/function.cpp", "torch/csrc/jit/mobile/import.cpp", "torch/csrc/jit/mobile/interpreter.cpp", "torch/csrc/jit/mobile/module.cpp", "torch/csrc/jit/mobile/observer.cpp", "torch/csrc/jit/mobile/parse_bytecode.cpp", "torch/csrc/jit/mobile/parse_operators.cpp", "torch/csrc/jit/mobile/upgrader_mobile.cpp", "torch/csrc/jit/runtime/register_prim_ops.cpp", "torch/csrc/jit/runtime/register_special_ops.cpp", ] libtorch_lite_eager_symbolication = [ "torch/csrc/jit/frontend/source_range.cpp", "torch/csrc/jit/ir/scope.cpp", "torch/csrc/jit/mobile/debug_info.cpp", "torch/csrc/jit/serialization/callstack_debug_info_serialization.cpp", "torch/csrc/jit/serialization/source_range_serialization.cpp", # Later we can split serialization and deserialization logic # to have better separation within build and only build relevant parts. "torch/csrc/jit/serialization/pickle.cpp", "torch/csrc/jit/serialization/pickler.cpp", "torch/csrc/jit/serialization/unpickler.cpp", ] # TODO: core_trainer_sources is not necessary for libtorch lite libtorch_lite_cmake_sources = sorted( core_trainer_sources + core_sources_common + torch_unpickler_common + torch_mobile_core, ) libtorch_cmake_sources = libtorch_core_sources + libtorch_core_jit_sources libtorch_extra_sources = libtorch_core_jit_sources + [ "torch/csrc/autograd/TraceTypeManual.cpp", "torch/csrc/autograd/VariableTypeManual.cpp", "torch/csrc/autograd/FunctionsManual.cpp", "torch/csrc/jit/api/module_save.cpp", "torch/csrc/jit/codegen/fuser/cpu/fused_kernel.cpp", "torch/csrc/jit/mobile/compatibility/backport.cpp", "torch/csrc/jit/mobile/compatibility/backport_manager.cpp", "torch/csrc/jit/mobile/compatibility/model_compatibility.cpp", # To be included for eager symbolication in lite interpreter # when it is built in libtorch "torch/csrc/jit/mobile/debug_info.cpp", "torch/csrc/jit/mobile/function.cpp", "torch/csrc/jit/mobile/import.cpp", "torch/csrc/jit/mobile/import_data.cpp", "torch/csrc/jit/mobile/interpreter.cpp", "torch/csrc/jit/mobile/module.cpp", "torch/csrc/jit/mobile/observer.cpp", "torch/csrc/jit/mobile/parse_bytecode.cpp", "torch/csrc/jit/mobile/parse_operators.cpp", "torch/csrc/jit/mobile/train/export_data.cpp", "torch/csrc/jit/mobile/train/optim/sgd.cpp", "torch/csrc/jit/mobile/train/random.cpp", "torch/csrc/jit/mobile/train/sequential.cpp", "torch/csrc/jit/mobile/upgrader_mobile.cpp", "torch/csrc/jit/serialization/onnx.cpp", "torch/csrc/jit/serialization/export.cpp", "torch/csrc/jit/serialization/export_bytecode.cpp", "torch/csrc/jit/serialization/export_module.cpp", "torch/csrc/jit/serialization/import_legacy.cpp", "torch/csrc/utils/byte_order.cpp", "torch/csrc/utils/out_types.cpp", ] def libtorch_sources(gencode_pattern = ":generate-code[{}]"): return libtorch_generated_sources(gencode_pattern) + libtorch_core_sources + libtorch_distributed_sources + libtorch_extra_sources libtorch_cuda_core_sources = [ "torch/csrc/CudaIPCTypes.cpp", "torch/csrc/cuda/comm.cpp", "torch/csrc/jit/codegen/fuser/cuda/fused_kernel.cpp", "torch/csrc/profiler/cuda.cpp", "torch/csrc/autograd/functions/comm.cpp", "torch/csrc/jit/codegen/cuda/arith.cpp", "torch/csrc/jit/codegen/cuda/compute_at.cpp", "torch/csrc/jit/codegen/cuda/compute_at_map.cpp", "torch/csrc/jit/codegen/cuda/codegen.cpp", "torch/csrc/jit/codegen/cuda/dispatch.cpp", "torch/csrc/jit/codegen/cuda/expr_evaluator.cpp", "torch/csrc/jit/codegen/cuda/executor.cpp", "torch/csrc/jit/codegen/cuda/executor_kernel_arg.cpp", "torch/csrc/jit/codegen/cuda/executor_launch_params.cpp", "torch/csrc/jit/codegen/cuda/evaluator_common.cpp", "torch/csrc/jit/codegen/cuda/executor_utils.cpp", "torch/csrc/jit/codegen/cuda/fusion.cpp", "torch/csrc/jit/codegen/cuda/graph_fuser.cpp", "torch/csrc/jit/codegen/cuda/index_compute.cpp", "torch/csrc/jit/codegen/cuda/index_reference_replay.cpp", "torch/csrc/jit/codegen/cuda/instrumentation.cpp", "torch/csrc/jit/codegen/cuda/ir_base_nodes.cpp", "torch/csrc/jit/codegen/cuda/ir_cloner.cpp", "torch/csrc/jit/codegen/cuda/ir_graphviz.cpp", "torch/csrc/jit/codegen/cuda/ir_nodes.cpp", "torch/csrc/jit/codegen/cuda/ir_iostream.cpp", "torch/csrc/jit/codegen/cuda/ir_utils.cpp", "torch/csrc/jit/codegen/cuda/iter_visitor.cpp", "torch/csrc/jit/codegen/cuda/kernel.cpp", "torch/csrc/jit/codegen/cuda/kernel_cache.cpp", "torch/csrc/jit/codegen/cuda/kernel_expr_evaluator.cpp", "torch/csrc/jit/codegen/cuda/kernel_ir.cpp", "torch/csrc/jit/codegen/cuda/kernel_ir_builder.cpp", "torch/csrc/jit/codegen/cuda/kernel_ir_printer.cpp", "torch/csrc/jit/codegen/cuda/lower_alias_memory.cpp", "torch/csrc/jit/codegen/cuda/lower_warp_reduce.cpp", "torch/csrc/jit/codegen/cuda/lower_allocation.cpp", "torch/csrc/jit/codegen/cuda/lower_expr_sort.cpp", "torch/csrc/jit/codegen/cuda/lower_index.cpp", "torch/csrc/jit/codegen/cuda/lower_insert_syncs.cpp", "torch/csrc/jit/codegen/cuda/lower_loops.cpp", "torch/csrc/jit/codegen/cuda/lower_magic_zero.cpp", "torch/csrc/jit/codegen/cuda/lower_misaligned_vectorization.cpp", "torch/csrc/jit/codegen/cuda/lower_predicate.cpp", "torch/csrc/jit/codegen/cuda/lower_shift.cpp", "torch/csrc/jit/codegen/cuda/lower_thread_predicate.cpp", "torch/csrc/jit/codegen/cuda/lower_trivial_reductions.cpp", "torch/csrc/jit/codegen/cuda/lower_unroll.cpp", "torch/csrc/jit/codegen/cuda/lower_utils.cpp", "torch/csrc/jit/codegen/cuda/lower_validation.cpp", "torch/csrc/jit/codegen/cuda/lower2device.cpp", "torch/csrc/jit/codegen/cuda/manager.cpp", "torch/csrc/jit/codegen/cuda/mutator.cpp", "torch/csrc/jit/codegen/cuda/non_divisible_split.cpp", "torch/csrc/jit/codegen/cuda/ops/composite.cpp", "torch/csrc/jit/codegen/cuda/ops/normalization.cpp", "torch/csrc/jit/codegen/cuda/parallel_dimension_map.cpp", "torch/csrc/jit/codegen/cuda/parallel_type_bitmap.cpp", "torch/csrc/jit/codegen/cuda/parser.cpp", "torch/csrc/jit/codegen/cuda/partial_split_map.cpp", "torch/csrc/jit/codegen/cuda/partition.cpp", "torch/csrc/jit/codegen/cuda/predicate_compute.cpp", "torch/csrc/jit/codegen/cuda/register_interface.cpp", "torch/csrc/jit/codegen/cuda/root_domain_map.cpp", "torch/csrc/jit/codegen/cuda/scheduler/pointwise.cpp", "torch/csrc/jit/codegen/cuda/scheduler/normalization.cpp", "torch/csrc/jit/codegen/cuda/scheduler/reduction.cpp", "torch/csrc/jit/codegen/cuda/scheduler/reduction_utils.cpp", "torch/csrc/jit/codegen/cuda/scheduler/registry.cpp", "torch/csrc/jit/codegen/cuda/scheduler/utils.cpp", "torch/csrc/jit/codegen/cuda/type_inference.cpp", "torch/csrc/jit/codegen/cuda/type_promotion.cpp", "torch/csrc/jit/codegen/cuda/fusion_segmenter.cpp", "torch/csrc/jit/codegen/cuda/tensor_view.cpp", "torch/csrc/jit/codegen/cuda/transform_iter.cpp", "torch/csrc/jit/codegen/cuda/transform_replay.cpp", "torch/csrc/jit/codegen/cuda/transform_rfactor.cpp", "torch/csrc/jit/codegen/cuda/transform_view.cpp", "torch/csrc/jit/codegen/cuda/type.cpp", "torch/csrc/jit/codegen/cuda/utils.cpp", "torch/csrc/jit/passes/frozen_conv_add_relu_fusion_cuda.cpp", "torch/csrc/jit/tensorexpr/cuda_codegen.cpp", "torch/csrc/jit/runtime/register_cuda_ops.cpp", ] # These files are the only ones that are supported on Windows. libtorch_cuda_distributed_base_sources = [ "torch/csrc/distributed/c10d/reducer_cuda.cpp", ] # These files are only supported on Linux (and others) but not on Windows. libtorch_cuda_distributed_extra_sources = [ "torch/csrc/distributed/c10d/NCCLUtils.cpp", "torch/csrc/distributed/c10d/ProcessGroupNCCL.cpp", "torch/csrc/distributed/rpc/tensorpipe_cuda.cpp", "torch/csrc/distributed/c10d/quantization/quantization_gpu.cu", ] libtorch_cuda_distributed_sources = libtorch_cuda_distributed_base_sources + libtorch_cuda_distributed_extra_sources libtorch_cuda_sources = libtorch_cuda_core_sources + libtorch_cuda_distributed_sources + [ "torch/csrc/cuda/nccl.cpp", ] torch_cpp_srcs = [ "torch/csrc/api/src/cuda.cpp", # this just forwards stuff, no real CUDA "torch/csrc/api/src/data/datasets/mnist.cpp", "torch/csrc/api/src/data/samplers/distributed.cpp", "torch/csrc/api/src/data/samplers/random.cpp", "torch/csrc/api/src/data/samplers/sequential.cpp", "torch/csrc/api/src/data/samplers/stream.cpp", "torch/csrc/api/src/enum.cpp", "torch/csrc/api/src/imethod.cpp", "torch/csrc/api/src/jit.cpp", "torch/csrc/api/src/serialize.cpp", "torch/csrc/api/src/nn/init.cpp", "torch/csrc/api/src/nn/module.cpp", "torch/csrc/api/src/nn/modules/_functions.cpp", "torch/csrc/api/src/nn/modules/activation.cpp", "torch/csrc/api/src/nn/modules/adaptive.cpp", "torch/csrc/api/src/nn/modules/batchnorm.cpp", "torch/csrc/api/src/nn/modules/normalization.cpp", "torch/csrc/api/src/nn/modules/instancenorm.cpp", "torch/csrc/api/src/nn/modules/conv.cpp", "torch/csrc/api/src/nn/modules/dropout.cpp", "torch/csrc/api/src/nn/modules/distance.cpp", "torch/csrc/api/src/nn/modules/embedding.cpp", "torch/csrc/api/src/nn/modules/fold.cpp", "torch/csrc/api/src/nn/modules/linear.cpp", "torch/csrc/api/src/nn/modules/loss.cpp", "torch/csrc/api/src/nn/modules/padding.cpp", "torch/csrc/api/src/nn/modules/pixelshuffle.cpp", "torch/csrc/api/src/nn/modules/pooling.cpp", "torch/csrc/api/src/nn/modules/rnn.cpp", "torch/csrc/api/src/nn/modules/upsampling.cpp", "torch/csrc/api/src/nn/modules/transformer.cpp", "torch/csrc/api/src/nn/modules/container/functional.cpp", "torch/csrc/api/src/nn/options/activation.cpp", "torch/csrc/api/src/nn/options/adaptive.cpp", "torch/csrc/api/src/nn/options/batchnorm.cpp", "torch/csrc/api/src/nn/options/conv.cpp", "torch/csrc/api/src/nn/options/dropout.cpp", "torch/csrc/api/src/nn/options/instancenorm.cpp", "torch/csrc/api/src/nn/options/linear.cpp", "torch/csrc/api/src/nn/options/normalization.cpp", "torch/csrc/api/src/nn/options/embedding.cpp", "torch/csrc/api/src/nn/options/padding.cpp", "torch/csrc/api/src/nn/options/pooling.cpp", "torch/csrc/api/src/nn/options/rnn.cpp", "torch/csrc/api/src/nn/options/vision.cpp", "torch/csrc/api/src/nn/options/transformer.cpp", "torch/csrc/api/src/optim/adagrad.cpp", "torch/csrc/api/src/optim/adam.cpp", "torch/csrc/api/src/optim/adamw.cpp", "torch/csrc/api/src/optim/lbfgs.cpp", "torch/csrc/api/src/optim/optimizer.cpp", "torch/csrc/api/src/optim/rmsprop.cpp", "torch/csrc/api/src/optim/serialize.cpp", "torch/csrc/api/src/optim/sgd.cpp", "torch/csrc/api/src/optim/schedulers/lr_scheduler.cpp", "torch/csrc/api/src/optim/schedulers/step_lr.cpp", "torch/csrc/api/src/serialize/input-archive.cpp", "torch/csrc/api/src/serialize/output-archive.cpp", "torch/csrc/utils/crash_handler.cpp", ] libtorch_python_cuda_core_sources = [ "torch/csrc/cuda/Event.cpp", "torch/csrc/cuda/Module.cpp", "torch/csrc/cuda/python_comm.cpp", "torch/csrc/cuda/Storage.cpp", "torch/csrc/cuda/Stream.cpp", "torch/csrc/cuda/Graph.cpp", "torch/csrc/cuda/serialization.cpp", "torch/csrc/cuda/shared/cudart.cpp", "torch/csrc/cuda/shared/nvtx.cpp", "torch/csrc/cuda/utils.cpp", ] libtorch_python_cuda_sources = libtorch_python_cuda_core_sources + [ "torch/csrc/cuda/python_nccl.cpp", "torch/csrc/cuda/shared/cudnn.cpp", "torch/csrc/cuda/Tensor.cpp", ] libtorch_python_core_sources = [ "torch/csrc/DataLoader.cpp", "torch/csrc/Device.cpp", "torch/csrc/Dtype.cpp", "torch/csrc/DynamicTypes.cpp", "torch/csrc/Exceptions.cpp", "torch/csrc/Generator.cpp", "torch/csrc/Layout.cpp", "torch/csrc/MemoryFormat.cpp", "torch/csrc/QScheme.cpp", "torch/csrc/Module.cpp", "torch/csrc/python_dimname.cpp", "torch/csrc/Size.cpp", "torch/csrc/Storage.cpp", "torch/csrc/Stream.cpp", "torch/csrc/TypeInfo.cpp", "torch/csrc/api/src/python/init.cpp", "torch/csrc/autograd/functions/init.cpp", "torch/csrc/autograd/init.cpp", "torch/csrc/autograd/profiler_python.cpp", "torch/csrc/autograd/python_anomaly_mode.cpp", "torch/csrc/autograd/python_saved_variable_hooks.cpp", "torch/csrc/autograd/python_mode.cpp", "torch/csrc/autograd/python_cpp_function.cpp", "torch/csrc/autograd/python_engine.cpp", "torch/csrc/autograd/python_function.cpp", "torch/csrc/autograd/python_hook.cpp", "torch/csrc/autograd/python_legacy_variable.cpp", "torch/csrc/autograd/python_torch_functions_manual.cpp", "torch/csrc/autograd/python_variable.cpp", "torch/csrc/autograd/python_variable_indexing.cpp", "torch/csrc/jit/backends/backend_init.cpp", "torch/csrc/jit/python/init.cpp", "torch/csrc/jit/passes/onnx.cpp", "torch/csrc/jit/passes/onnx/cast_all_constant_to_floating.cpp", "torch/csrc/jit/passes/onnx/eval_peephole.cpp", "torch/csrc/jit/passes/onnx/constant_fold.cpp", "torch/csrc/jit/passes/onnx/constant_map.cpp", "torch/csrc/jit/passes/onnx/eliminate_unused_items.cpp", "torch/csrc/jit/passes/onnx/fixup_onnx_controlflow.cpp", "torch/csrc/jit/passes/onnx/list_model_parameters.cpp", "torch/csrc/jit/passes/onnx/function_substitution.cpp", "torch/csrc/jit/passes/onnx/helper.cpp", "torch/csrc/jit/passes/onnx/peephole.cpp", "torch/csrc/jit/passes/onnx/preprocess_for_onnx.cpp", "torch/csrc/jit/passes/onnx/prepare_division_for_onnx.cpp", "torch/csrc/jit/passes/onnx/scalar_type_analysis.cpp", "torch/csrc/jit/passes/onnx/unpack_quantized_weights.cpp", "torch/csrc/jit/passes/onnx/remove_inplace_ops_for_onnx.cpp", "torch/csrc/jit/passes/onnx/shape_type_inference.cpp", "torch/csrc/jit/passes/onnx/function_extraction.cpp", "torch/csrc/jit/python/pybind_utils.cpp", "torch/csrc/jit/passes/onnx/pattern_conversion/common.cpp", "torch/csrc/jit/passes/onnx/pattern_conversion/pattern_encapsulation.cpp", "torch/csrc/jit/passes/onnx/pattern_conversion/pattern_conversion.cpp", "torch/csrc/jit/python/python_arg_flatten.cpp", "torch/csrc/jit/python/python_custom_class.cpp", "torch/csrc/jit/python/python_dict.cpp", "torch/csrc/jit/python/python_interpreter.cpp", "torch/csrc/jit/python/python_ir.cpp", "torch/csrc/jit/python/python_list.cpp", "torch/csrc/jit/python/python_tracer.cpp", "torch/csrc/jit/python/script_init.cpp", "torch/csrc/jit/frontend/concrete_module_type.cpp", "torch/csrc/jit/frontend/tree_views.cpp", "torch/csrc/jit/python/python_sugared_value.cpp", "torch/csrc/jit/python/python_tree_views.cpp", "torch/csrc/jit/runtime/static/init.cpp", "torch/csrc/jit/tensorexpr/tensorexpr_init.cpp", "torch/csrc/monitor/python_init.cpp", "torch/csrc/multiprocessing/init.cpp", "torch/csrc/onnx/init.cpp", "torch/csrc/serialization.cpp", "torch/csrc/tensor/python_tensor.cpp", "torch/csrc/utils/init.cpp", "torch/csrc/utils/throughput_benchmark.cpp", "torch/csrc/utils.cpp", "torch/csrc/utils/cuda_lazy_init.cpp", "torch/csrc/utils/invalid_arguments.cpp", "torch/csrc/utils/object_ptr.cpp", "torch/csrc/utils/python_arg_parser.cpp", "torch/csrc/utils/python_dispatch.cpp", "torch/csrc/utils/structseq.cpp", "torch/csrc/utils/tensor_apply.cpp", "torch/csrc/utils/tensor_dtypes.cpp", "torch/csrc/utils/tensor_layouts.cpp", "torch/csrc/utils/tensor_memoryformats.cpp", "torch/csrc/utils/tensor_qschemes.cpp", "torch/csrc/utils/tensor_list.cpp", "torch/csrc/utils/tensor_new.cpp", "torch/csrc/utils/tensor_numpy.cpp", "torch/csrc/utils/tensor_types.cpp", "torch/csrc/utils/disable_torch_function.cpp", ] libtorch_python_distributed_core_sources = [ "torch/csrc/distributed/c10d/init.cpp", "torch/csrc/distributed/c10d/python_comm_hook.cpp", "torch/csrc/distributed/c10d/quantization/quantization.cpp", ] libtorch_python_distributed_sources = libtorch_python_distributed_core_sources + [ "torch/csrc/distributed/autograd/init.cpp", "torch/csrc/distributed/rpc/init.cpp", "torch/csrc/distributed/rpc/py_rref.cpp", "torch/csrc/distributed/rpc/python_functions.cpp", "torch/csrc/distributed/rpc/python_rpc_handler.cpp", "torch/csrc/distributed/rpc/request_callback_impl.cpp", "torch/csrc/distributed/rpc/testing/init.cpp", "torch/csrc/distributed/rpc/unpickled_python_call.cpp", "torch/csrc/distributed/rpc/unpickled_python_remote_call.cpp", "torch/csrc/jit/runtime/register_distributed_ops.cpp", ] def glob_libtorch_python_sources(gencode_pattern = ":generate-code[{}]"): _libtorch_python_sources = [gencode_pattern.format(name) for name in [ "autograd/generated/python_functions_0.cpp", "autograd/generated/python_functions_1.cpp", "autograd/generated/python_functions_2.cpp", "autograd/generated/python_functions_3.cpp", "autograd/generated/python_functions_4.cpp", "autograd/generated/python_nn_functions.cpp", "autograd/generated/python_fft_functions.cpp", "autograd/generated/python_linalg_functions.cpp", "autograd/generated/python_return_types.cpp", "autograd/generated/python_sparse_functions.cpp", "autograd/generated/python_special_functions.cpp", "autograd/generated/python_torch_functions_0.cpp", "autograd/generated/python_torch_functions_1.cpp", "autograd/generated/python_torch_functions_2.cpp", "autograd/generated/python_variable_methods.cpp", ]] _libtorch_python_sources.extend(libtorch_python_core_sources) _libtorch_python_sources.extend(libtorch_python_distributed_sources) return _libtorch_python_sources aten_cpu_source_non_codegen_list = [ "aten/src/ATen/AccumulateType.cpp", "aten/src/ATen/BatchedTensorImpl.cpp", "aten/src/ATen/CPUGeneratorImpl.cpp", "aten/src/ATen/Context.cpp", "aten/src/ATen/DLConvertor.cpp", "aten/src/ATen/EmptyTensor.cpp", "aten/src/ATen/ExpandUtils.cpp", "aten/src/ATen/FunctionalInverses.cpp", "aten/src/ATen/FunctionalStorageImpl.cpp", "aten/src/ATen/FunctionalTensorWrapper.cpp", "aten/src/ATen/FunctionalizeFallbackKernel.cpp", "aten/src/ATen/MemoryOverlap.cpp", "aten/src/ATen/MapAllocator.cpp", "aten/src/ATen/NamedTensorUtils.cpp", "aten/src/ATen/ParallelCommon.cpp", "aten/src/ATen/ParallelNative.cpp", "aten/src/ATen/ParallelNativeTBB.cpp", "aten/src/ATen/ParallelOpenMP.cpp", "aten/src/ATen/ParallelThreadPoolNative.cpp", "aten/src/ATen/ScalarOps.cpp", "aten/src/ATen/SequenceNumber.cpp", "aten/src/ATen/SparseTensorImpl.cpp", "aten/src/ATen/SparseCsrTensorImpl.cpp", "aten/src/ATen/SparseTensorUtils.cpp", "aten/src/ATen/TensorGeometry.cpp", "aten/src/ATen/TensorIndexing.cpp", "aten/src/ATen/TensorMeta.cpp", "aten/src/ATen/TensorNames.cpp", "aten/src/ATen/TensorUtils.cpp", "aten/src/ATen/ThreadLocalState.cpp", "aten/src/ATen/FuncTorchTLS.cpp", "aten/src/ATen/Utils.cpp", "aten/src/ATen/Version.cpp", "aten/src/ATen/VmapMode.cpp", "aten/src/ATen/VmapTransforms.cpp", "aten/src/ATen/core/BackendSelectFallbackKernel.cpp", "aten/src/ATen/core/DeprecatedTypeProperties.cpp", "aten/src/ATen/core/DeprecatedTypePropertiesRegistry.cpp", "aten/src/ATen/core/Dict.cpp", "aten/src/ATen/core/Dimname.cpp", "aten/src/ATen/core/Formatting.cpp", "aten/src/ATen/core/Generator.cpp", "aten/src/ATen/core/List.cpp", "aten/src/ATen/core/NamedTensor.cpp", "aten/src/ATen/core/Tensor.cpp", "aten/src/ATen/core/VariableFallbackKernel.cpp", "aten/src/ATen/core/VariableHooksInterface.cpp", "aten/src/ATen/core/Vitals.cpp", "aten/src/ATen/core/boxing/KernelFunction.cpp", "aten/src/ATen/core/custom_class.cpp", "aten/src/ATen/core/dispatch/DispatchKeyExtractor.cpp", "aten/src/ATen/core/dispatch/Dispatcher.cpp", "aten/src/ATen/core/dispatch/ObservedOperators.cpp", "aten/src/ATen/core/dispatch/OperatorEntry.cpp", "aten/src/ATen/core/interned_strings.cpp", "aten/src/ATen/core/ivalue.cpp", "aten/src/ATen/core/library.cpp", "aten/src/ATen/core/op_registration/infer_schema.cpp", "aten/src/ATen/core/op_registration/op_registration.cpp", "aten/src/ATen/core/operator_name.cpp", "aten/src/ATen/core/PythonModeTLS.cpp", "aten/src/ATen/core/register_symbols.cpp", "aten/src/ATen/core/class_type.cpp", "aten/src/ATen/core/type.cpp", "aten/src/ATen/core/type_factory.cpp", "aten/src/ATen/core/dynamic_type.cpp", "aten/src/ATen/core/tensor_type.cpp", "aten/src/ATen/core/union_type.cpp", "aten/src/ATen/cpu/FlushDenormal.cpp", "aten/src/ATen/detail/CPUGuardImpl.cpp", "aten/src/ATen/detail/CUDAHooksInterface.cpp", "aten/src/ATen/detail/HIPHooksInterface.cpp", "aten/src/ATen/detail/ORTHooksInterface.cpp", "aten/src/ATen/metal/Context.cpp", "aten/src/ATen/native/AutogradComposite.cpp", "aten/src/ATen/native/BatchLinearAlgebraKernel.cpp", "aten/src/ATen/native/DispatchStub.cpp", "aten/src/ATen/native/UpSample.cpp", "aten/src/ATen/native/mkl/LinearAlgebra.cpp", "aten/src/ATen/native/mkl/SparseBlasImpl.cpp", "aten/src/ATen/native/mkl/SparseCsrLinearAlgebra.cpp", "aten/src/ATen/native/mkl/SpectralOps.cpp", "aten/src/ATen/native/mkldnn/BinaryOps.cpp", "aten/src/ATen/native/mkldnn/Conv.cpp", "aten/src/ATen/native/mkldnn/Copy.cpp", "aten/src/ATen/native/mkldnn/Gelu.cpp", "aten/src/ATen/native/mkldnn/IDeepRegistration.cpp", "aten/src/ATen/native/mkldnn/Linear.cpp", "aten/src/ATen/native/mkldnn/MKLDNNCommon.cpp", "aten/src/ATen/native/mkldnn/MKLDNNConversions.cpp", "aten/src/ATen/native/mkldnn/MkldnnTensorMath.cpp", "aten/src/ATen/native/mkldnn/Normalization.cpp", "aten/src/ATen/native/mkldnn/Pooling.cpp", "aten/src/ATen/native/mkldnn/Relu.cpp", "aten/src/ATen/native/mkldnn/SoftMax.cpp", "aten/src/ATen/native/mkldnn/TensorFactories.cpp", "aten/src/ATen/native/mkldnn/TensorShape.cpp", "aten/src/ATen/native/mkldnn/UnaryOps.cpp", "aten/src/ATen/native/mkldnn/Utils.cpp", "aten/src/ATen/native/mkldnn/Matmul.cpp", "aten/src/ATen/native/quantized/cpu/init_qnnpack.cpp", "aten/src/ATen/record_function.cpp", "aten/src/ATen/Dispatch.cpp", "aten/src/ATen/SavedTensorHooks.cpp", "aten/src/ATen/vulkan/Context.cpp", "aten/src/ATen/nnapi/nnapi_bind.cpp", "aten/src/ATen/nnapi/nnapi_wrapper.cpp", "aten/src/ATen/nnapi/nnapi_model_loader.cpp", "aten/src/ATen/native/prim_native_functions.cpp", ] aten_cpu_source_codegen_list = [ "aten/src/ATen/native/cpu/AdaptiveAvgPoolKernel.cpp", "aten/src/ATen/native/cpu/AdaptiveMaxPoolKernel.cpp", ] # When building lite interpreter in OSS, "aten/src/ATen/native/cpu/AdaptiveAvgPoolKernel.cpp" will go through # codegen process. The codegen version of this file, like Activation.cpp.DEFAULT.cpp, will be included # in ${cpu_kernel_cpp} in aten/src/ATen/CMakeLists.txt. As a result, in aten/src/ATen/CMakeLists.txt, # only aten_cpu_source_non_codegen_list need to be added to ${all_cpu_cpp}. aten_cpu_source_list = sorted(aten_cpu_source_non_codegen_list + aten_cpu_source_codegen_list) # Same as ${aten_cpu_source_codegen_list}, this list will go through aten codegen, and be included in # ${cpu_kernel_cpp} in aten/src/ATen/CMakeLists.txt. aten_native_source_codegen_list = [ "aten/src/ATen/native/cpu/Activation.cpp", "aten/src/ATen/native/cpu/AvgPoolKernel.cpp", "aten/src/ATen/native/cpu/BinaryOpsKernel.cpp", "aten/src/ATen/native/cpu/BlasKernel.cpp", "aten/src/ATen/native/cpu/CatKernel.cpp", "aten/src/ATen/native/cpu/ChannelShuffleKernel.cpp", "aten/src/ATen/native/cpu/ComplexKernel.cpp", "aten/src/ATen/native/cpu/CopyKernel.cpp", "aten/src/ATen/native/cpu/CrossKernel.cpp", "aten/src/ATen/native/cpu/DepthwiseConvKernel.cpp", "aten/src/ATen/native/cpu/DistanceOpsKernel.cpp", "aten/src/ATen/native/cpu/DistributionKernels.cpp", "aten/src/ATen/native/cpu/FillKernel.cpp", "aten/src/ATen/native/cpu/FunctionOfAMatrixUtilsKernel.cpp", "aten/src/ATen/native/cpu/GridSamplerKernel.cpp", "aten/src/ATen/native/cpu/HistogramKernel.cpp", "aten/src/ATen/native/cpu/IndexKernel.cpp", "aten/src/ATen/native/cpu/LerpKernel.cpp", "aten/src/ATen/native/cpu/LinearAlgebraKernel.cpp", "aten/src/ATen/native/cpu/MaxPooling.cpp", "aten/src/ATen/native/cpu/MaxPoolKernel.cpp", "aten/src/ATen/native/cpu/MaxUnpoolKernel.cpp", "aten/src/ATen/native/cpu/MultinomialKernel.cpp", "aten/src/ATen/native/cpu/PointwiseOpsKernel.cpp", "aten/src/ATen/native/cpu/PowKernel.cpp", "aten/src/ATen/native/cpu/RangeFactoriesKernel.cpp", "aten/src/ATen/native/cpu/ReduceAllOpsKernel.cpp", "aten/src/ATen/native/cpu/ReduceOpsKernel.cpp", "aten/src/ATen/native/cpu/RenormKernel.cpp", "aten/src/ATen/native/cpu/ScatterGatherKernel.cpp", "aten/src/ATen/native/cpu/SoftMaxKernel.cpp", "aten/src/ATen/native/cpu/SortingKernel.cpp", "aten/src/ATen/native/cpu/StackKernel.cpp", "aten/src/ATen/native/cpu/SumKernel.cpp", "aten/src/ATen/native/cpu/TensorCompareKernel.cpp", "aten/src/ATen/native/cpu/UnaryOpsKernel.cpp", "aten/src/ATen/native/cpu/Unfold2d.cpp", "aten/src/ATen/native/cpu/UnfoldBackwardKernel.cpp", "aten/src/ATen/native/cpu/UpSampleKernel.cpp", "aten/src/ATen/native/cpu/UpSampleMoreKernel.cpp", "aten/src/ATen/native/cpu/batch_norm_kernel.cpp", "aten/src/ATen/native/cpu/group_norm_kernel.cpp", "aten/src/ATen/native/cpu/layer_norm_kernel.cpp", "aten/src/ATen/native/quantized/cpu/kernels/QuantizedOpKernels.cpp", ] # This aten native source file list will not go through aten codegen process aten_native_source_non_codegen_list = [ "aten/src/ATen/native/ao_sparse/library.cpp", "aten/src/ATen/native/ao_sparse/quantized/cpu/fbgemm_utils.cpp", "aten/src/ATen/native/ao_sparse/quantized/cpu/qlinear.cpp", "aten/src/ATen/native/ao_sparse/quantized/cpu/qlinear_dynamic.cpp", "aten/src/ATen/native/ao_sparse/quantized/cpu/qlinear_prepack.cpp", "aten/src/ATen/native/ao_sparse/quantized/cpu/qlinear_unpack.cpp", "aten/src/ATen/native/quantized/cpu/fbgemm_utils.cpp", "aten/src/ATen/native/quantized/cpu/fused_obs_fake_quant.cpp", "aten/src/ATen/native/quantized/cpu/int_repr_quant.cpp", "aten/src/ATen/native/quantized/cpu/make_per_tensor_quantized_tensor.cpp", "aten/src/ATen/native/quantized/cpu/q_adaavgpool.cpp", "aten/src/ATen/native/quantized/cpu/q_avgpool.cpp", "aten/src/ATen/native/quantized/cpu/q_avgpool3d.cpp", "aten/src/ATen/native/quantized/cpu/qadd.cpp", "aten/src/ATen/native/quantized/cpu/qbatch_norm.cpp", "aten/src/ATen/native/quantized/cpu/qchannel_shuffle.cpp", "aten/src/ATen/native/quantized/cpu/qclamp.cpp", "aten/src/ATen/native/quantized/cpu/qconcat.cpp", "aten/src/ATen/native/quantized/cpu/qconv.cpp", "aten/src/ATen/native/quantized/cpu/qconv_prepack.cpp", "aten/src/ATen/native/quantized/cpu/qconv_unpack.cpp", "aten/src/ATen/native/quantized/cpu/qelu.cpp", "aten/src/ATen/native/quantized/cpu/qembeddingbag.cpp", "aten/src/ATen/native/quantized/cpu/qembeddingbag_prepack.cpp", "aten/src/ATen/native/quantized/cpu/qembeddingbag_unpack.cpp", "aten/src/ATen/native/quantized/cpu/qgelu.cpp", "aten/src/ATen/native/quantized/cpu/qhardsigmoid.cpp", "aten/src/ATen/native/quantized/cpu/qhardswish.cpp", "aten/src/ATen/native/quantized/cpu/qlinear.cpp", "aten/src/ATen/native/quantized/cpu/qlinear_dynamic.cpp", "aten/src/ATen/native/quantized/cpu/qconv_dynamic.cpp", "aten/src/ATen/native/quantized/cpu/qlinear_prepack.cpp", "aten/src/ATen/native/quantized/cpu/qlinear_unpack.cpp", "aten/src/ATen/native/quantized/cpu/qmatmul.cpp", "aten/src/ATen/native/quantized/cpu/qmul.cpp", "aten/src/ATen/native/quantized/cpu/qnormalization.cpp", "aten/src/ATen/native/quantized/cpu/qpool.cpp", "aten/src/ATen/native/quantized/cpu/qreduction.cpp", "aten/src/ATen/native/quantized/cpu/qrelu.cpp", "aten/src/ATen/native/quantized/cpu/qsigmoid.cpp", "aten/src/ATen/native/quantized/cpu/qsort.cpp", "aten/src/ATen/native/quantized/cpu/qtanh.cpp", "aten/src/ATen/native/quantized/cpu/qthreshold.cpp", "aten/src/ATen/native/quantized/cpu/qupsample_bilinear2d.cpp", "aten/src/ATen/native/quantized/cpu/qupsample_nearest2d.cpp", "aten/src/ATen/native/quantized/cpu/qupsample_nearest3d.cpp", "aten/src/ATen/native/quantized/cpu/tensor_operators.cpp", "aten/src/ATen/native/quantized/Copy.cpp", "aten/src/ATen/native/quantized/QTensor.cpp", "aten/src/ATen/native/quantized/TensorCompare.cpp", "aten/src/ATen/native/quantized/TensorFactories.cpp", "aten/src/ATen/native/quantized/affine_quantizer.cpp", "aten/src/ATen/native/quantized/affine_quantizer_base.cpp", "aten/src/ATen/native/quantized/fake_quant_per_channel_affine.cpp", "aten/src/ATen/native/quantized/fake_quant_per_tensor_affine.cpp", "aten/src/ATen/native/quantized/library.cpp", "aten/src/ATen/quantized/QTensorImpl.cpp", "aten/src/ATen/quantized/Quantizer.cpp", "aten/src/ATen/native/attention.cpp", "aten/src/ATen/native/Activation.cpp", "aten/src/ATen/native/AdaptiveAveragePooling.cpp", "aten/src/ATen/native/AdaptiveAveragePooling3d.cpp", "aten/src/ATen/native/AdaptiveMaxPooling2d.cpp", "aten/src/ATen/native/AdaptiveMaxPooling3d.cpp", "aten/src/ATen/native/AffineGridGenerator.cpp", "aten/src/ATen/native/AveragePool2d.cpp", "aten/src/ATen/native/AveragePool3d.cpp", "aten/src/ATen/native/BatchLinearAlgebra.cpp", "aten/src/ATen/native/Batching.cpp", "aten/src/ATen/native/BinaryOps.cpp", "aten/src/ATen/native/Blas.cpp", "aten/src/ATen/native/BlasKernel.cpp", "aten/src/ATen/native/Bucketization.cpp", "aten/src/ATen/native/CPUBlas.cpp", "aten/src/ATen/native/ChanelShuffle.cpp", "aten/src/ATen/native/Col2Im.cpp", "aten/src/ATen/native/ConstantPadNd.cpp", "aten/src/ATen/native/Convolution.cpp", "aten/src/ATen/native/ConvolutionMM2d.cpp", "aten/src/ATen/native/ConvolutionMM3d.cpp", "aten/src/ATen/native/ConvolutionTBC.cpp", "aten/src/ATen/native/Copy.cpp", "aten/src/ATen/native/Correlation.cpp", "aten/src/ATen/native/CPUFallback.cpp", "aten/src/ATen/native/Cross.cpp", "aten/src/ATen/native/DilatedMaxPool2d.cpp", "aten/src/ATen/native/DilatedMaxPool3d.cpp", # Referenced by both native and ATen/Version.cpp. Does not reference to other native symbols # "aten/src/ATen/native/DispatchStub.cpp", # "aten/src/ATen/native/quantized/cpu/init_qnnpack.cpp", "aten/src/ATen/native/Distance.cpp", "aten/src/ATen/native/Distributions.cpp", "aten/src/ATen/native/Dropout.cpp", "aten/src/ATen/native/Embedding.cpp", "aten/src/ATen/native/EmbeddingBag.cpp", "aten/src/ATen/native/Fill.cpp", "aten/src/ATen/native/ForeachOpsKernels.cpp", "aten/src/ATen/native/FractionalMaxPool2d.cpp", "aten/src/ATen/native/FractionalMaxPool3d.cpp", "aten/src/ATen/native/FunctionOfAMatrixUtils.cpp", "aten/src/ATen/native/GatedLinearUnit.cpp", "aten/src/ATen/native/GridSampler.cpp", "aten/src/ATen/native/Histogram.cpp", "aten/src/ATen/native/Im2Col.cpp", "aten/src/ATen/native/IndexingUtils.cpp", "aten/src/ATen/native/Integration.cpp", "aten/src/ATen/native/Itertools.cpp", "aten/src/ATen/native/LegacyBridge.cpp", "aten/src/ATen/native/Lerp.cpp", "aten/src/ATen/native/Linear.cpp", "aten/src/ATen/native/LinearAlgebra.cpp", "aten/src/ATen/native/Loss.cpp", "aten/src/ATen/native/LossCTC.cpp", "aten/src/ATen/native/LossMultiLabelMargin.cpp", "aten/src/ATen/native/LossMultiMargin.cpp", "aten/src/ATen/native/LossNLL.cpp", "aten/src/ATen/native/LossNLL2d.cpp", "aten/src/ATen/native/MaxPooling.cpp", "aten/src/ATen/native/MaxUnpooling.cpp", "aten/src/ATen/native/Memory.cpp", "aten/src/ATen/native/MetaTensor.cpp", "aten/src/ATen/native/NNPACK.cpp", "aten/src/ATen/native/NaiveConvolutionTranspose2d.cpp", "aten/src/ATen/native/NaiveConvolutionTranspose3d.cpp", "aten/src/ATen/native/NaiveDilatedConvolution.cpp", "aten/src/ATen/native/NamedTensor.cpp", "aten/src/ATen/native/Normalization.cpp", "aten/src/ATen/native/Onehot.cpp", "aten/src/ATen/native/PackedSequence.cpp", "aten/src/ATen/native/PixelShuffle.cpp", "aten/src/ATen/native/PointwiseOps.cpp", "aten/src/ATen/native/Pooling.cpp", "aten/src/ATen/native/Pow.cpp", "aten/src/ATen/native/QuantizedLinear.cpp", "aten/src/ATen/native/RNN.cpp", "aten/src/ATen/native/RangeFactories.cpp", "aten/src/ATen/native/ReduceAllOps.cpp", "aten/src/ATen/native/ReduceOps.cpp", "aten/src/ATen/native/ReflectionPad.cpp", "aten/src/ATen/native/Repeat.cpp", "aten/src/ATen/native/ReplicationPadding.cpp", "aten/src/ATen/native/Resize.cpp", "aten/src/ATen/native/RowwisePrune.cpp", "aten/src/ATen/native/SegmentReduce.cpp", "aten/src/ATen/native/Scalar.cpp", "aten/src/ATen/native/SobolEngineOps.cpp", "aten/src/ATen/native/SobolEngineOpsUtils.cpp", "aten/src/ATen/native/SoftMax.cpp", "aten/src/ATen/native/Sorting.cpp", "aten/src/ATen/native/SpectralOps.cpp", "aten/src/ATen/native/SummaryOps.cpp", "aten/src/ATen/native/TensorAdvancedIndexing.cpp", "aten/src/ATen/native/TensorCompare.cpp", "aten/src/ATen/native/TensorConversions.cpp", "aten/src/ATen/native/TensorFactories.cpp", "aten/src/ATen/native/TensorIteratorReduce.cpp", "aten/src/ATen/native/TensorProperties.cpp", "aten/src/ATen/native/TensorShape.cpp", "aten/src/ATen/native/TensorTransformations.cpp", "aten/src/ATen/native/TestOps.cpp", "aten/src/ATen/native/TriangularOps.cpp", "aten/src/ATen/native/TypeProperties.cpp", "aten/src/ATen/native/UnaryOps.cpp", "aten/src/ATen/native/Unfold2d.cpp", "aten/src/ATen/native/Unfold3d.cpp", "aten/src/ATen/native/UnfoldBackward.cpp", "aten/src/ATen/native/Unique.cpp", # Low-level functions that can be directly referenced # "aten/src/ATen/native/UpSample.cpp", "aten/src/ATen/native/UpSampleBicubic2d.cpp", "aten/src/ATen/native/UpSampleBilinear2d.cpp", "aten/src/ATen/native/UpSampleLinear1d.cpp", "aten/src/ATen/native/UpSampleNearest1d.cpp", "aten/src/ATen/native/UpSampleNearest2d.cpp", "aten/src/ATen/native/UpSampleNearest3d.cpp", "aten/src/ATen/native/UpSampleTrilinear3d.cpp", "aten/src/ATen/native/VariableMethodStubs.cpp", "aten/src/ATen/native/WeightNorm.cpp", "aten/src/ATen/native/group_norm.cpp", "aten/src/ATen/native/layer_norm.cpp", "aten/src/ATen/native/sparse/ParamUtils.cpp", "aten/src/ATen/native/sparse/SoftMax.cpp", "aten/src/ATen/native/sparse/SparseBlas.cpp", "aten/src/ATen/native/sparse/SparseBlasImpl.cpp", "aten/src/ATen/native/sparse/SparseMatMul.cpp", "aten/src/ATen/native/sparse/SparseTensor.cpp", "aten/src/ATen/native/sparse/SparseCsrTensor.cpp", "aten/src/ATen/native/sparse/SparseTensorMath.cpp", "aten/src/ATen/native/sparse/SparseUnaryOps.cpp", "aten/src/ATen/native/sparse/SparseCsrTensorMath.cpp", "aten/src/ATen/native/utils/Factory.cpp", "aten/src/ATen/native/xnnpack/Activation.cpp", "aten/src/ATen/native/xnnpack/ChannelShuffle.cpp", "aten/src/ATen/native/xnnpack/Convolution.cpp", "aten/src/ATen/native/xnnpack/AveragePooling.cpp", "aten/src/ATen/native/xnnpack/Init.cpp", "aten/src/ATen/native/xnnpack/Linear.cpp", "aten/src/ATen/native/xnnpack/MaxPooling.cpp", "aten/src/ATen/native/xnnpack/OpContext.cpp", "aten/src/ATen/native/xnnpack/RegisterOpContextClass.cpp", "aten/src/ATen/native/xnnpack/Shim.cpp", # Files not in native, but depends on native symbols # "aten/src/ATen/TensorIndexing.cpp", "aten/src/ATen/TensorIterator.cpp", "aten/src/ATen/nnapi/nnapi_register.cpp", ] # 1. Files in ATen/native with a few exceptions # TODO: move the exceptions to proper locations # 2. The whole aten native source list includes the list with and without aten codegen process. aten_native_source_list = sorted(aten_native_source_non_codegen_list + aten_native_source_codegen_list) # These are cpp files which need to go in the torch_cuda_cu library # .cu files can be found via glob aten_cuda_cu_source_list = [ "aten/src/ATen/cuda/CUDABlas.cpp", "aten/src/ATen/cuda/CUDASolver.cpp", "aten/src/ATen/cuda/CUDASparseBlas.cpp", "aten/src/ATen/cuda/CublasHandlePool.cpp", "aten/src/ATen/cuda/CusolverDnHandlePool.cpp", "aten/src/ATen/native/cuda/Activation.cpp", "aten/src/ATen/native/cuda/BatchLinearAlgebra.cpp", "aten/src/ATen/native/cuda/BatchLinearAlgebraLib.cpp", "aten/src/ATen/native/cuda/Blas.cpp", "aten/src/ATen/native/cuda/Equal.cpp", "aten/src/ATen/native/cuda/IndexKernel.cpp", "aten/src/ATen/native/cuda/ReduceOps.cpp", "aten/src/ATen/native/cuda/ScanKernels.cpp", "aten/src/ATen/native/cuda/Sort.cpp", "aten/src/ATen/native/cuda/Sorting.cpp", "aten/src/ATen/native/cuda/TensorModeKernel.cpp", "aten/src/ATen/native/cuda/TensorShapeCUDA.cpp", "aten/src/ATen/native/cuda/TensorTopK.cpp", "aten/src/ATen/native/cuda/jit_utils.cpp", "aten/src/ATen/native/sparse/cuda/SparseBlas.cpp", "aten/src/ATen/native/sparse/cuda/SparseBlasImpl.cpp", "aten/src/ATen/native/sparse/cuda/SparseBlasLegacy.cpp", "aten/src/ATen/native/sparse/cuda/SparseCUDABlas.cpp", ] # Files using thrust::sort_by_key need to be linked last aten_cuda_with_sort_by_key_source_list = [ # empty_cuda is needed by torch_cuda_cpp "aten/src/ATen/native/cuda/TensorFactories.cu", ] aten_cuda_cu_with_sort_by_key_source_list = [ "aten/src/ATen/native/cuda/Unique.cu", ]
46.980826
134
0.738518
7949e9e4d35f72be7d201ee700812b575f35f904
143,340
py
Python
virtual/lib/python3.8/site-packages/sqlalchemy/orm/relationships.py
Lenus254/personal_blog
aac38e4b5372c86efa8e24db2e051fef8e5feef8
[ "Unlicense" ]
4
2022-02-06T00:54:58.000Z
2022-02-25T12:44:43.000Z
virtual/lib/python3.8/site-packages/sqlalchemy/orm/relationships.py
Lenus254/personal_blog
aac38e4b5372c86efa8e24db2e051fef8e5feef8
[ "Unlicense" ]
1
2022-03-12T06:00:21.000Z
2022-03-12T07:07:55.000Z
virtual/lib/python3.8/site-packages/sqlalchemy/orm/relationships.py
Lenus254/personal_blog
aac38e4b5372c86efa8e24db2e051fef8e5feef8
[ "Unlicense" ]
1
2022-02-08T13:43:20.000Z
2022-02-08T13:43:20.000Z
# orm/relationships.py # Copyright (C) 2005-2022 the SQLAlchemy authors and contributors # <see AUTHORS file> # # This module is part of SQLAlchemy and is released under # the MIT License: https://www.opensource.org/licenses/mit-license.php """Heuristics related to join conditions as used in :func:`_orm.relationship`. Provides the :class:`.JoinCondition` object, which encapsulates SQL annotation and aliasing behavior focused on the `primaryjoin` and `secondaryjoin` aspects of :func:`_orm.relationship`. """ from __future__ import absolute_import import collections import re import weakref from . import attributes from .base import _is_mapped_class from .base import state_str from .interfaces import MANYTOMANY from .interfaces import MANYTOONE from .interfaces import ONETOMANY from .interfaces import PropComparator from .interfaces import StrategizedProperty from .util import _orm_annotate from .util import _orm_deannotate from .util import CascadeOptions from .. import exc as sa_exc from .. import log from .. import schema from .. import sql from .. import util from ..inspection import inspect from ..sql import coercions from ..sql import expression from ..sql import operators from ..sql import roles from ..sql import visitors from ..sql.util import _deep_deannotate from ..sql.util import _shallow_annotate from ..sql.util import adapt_criterion_to_null from ..sql.util import ClauseAdapter from ..sql.util import join_condition from ..sql.util import selectables_overlap from ..sql.util import visit_binary_product def remote(expr): """Annotate a portion of a primaryjoin expression with a 'remote' annotation. See the section :ref:`relationship_custom_foreign` for a description of use. .. seealso:: :ref:`relationship_custom_foreign` :func:`.foreign` """ return _annotate_columns( coercions.expect(roles.ColumnArgumentRole, expr), {"remote": True} ) def foreign(expr): """Annotate a portion of a primaryjoin expression with a 'foreign' annotation. See the section :ref:`relationship_custom_foreign` for a description of use. .. seealso:: :ref:`relationship_custom_foreign` :func:`.remote` """ return _annotate_columns( coercions.expect(roles.ColumnArgumentRole, expr), {"foreign": True} ) @log.class_logger class RelationshipProperty(StrategizedProperty): """Describes an object property that holds a single item or list of items that correspond to a related database table. Public constructor is the :func:`_orm.relationship` function. .. seealso:: :ref:`relationship_config_toplevel` """ strategy_wildcard_key = "relationship" inherit_cache = True _links_to_entity = True _persistence_only = dict( passive_deletes=False, passive_updates=True, enable_typechecks=True, active_history=False, cascade_backrefs=True, ) _dependency_processor = None def __init__( self, argument, secondary=None, primaryjoin=None, secondaryjoin=None, foreign_keys=None, uselist=None, order_by=False, backref=None, back_populates=None, overlaps=None, post_update=False, cascade=False, viewonly=False, lazy="select", collection_class=None, passive_deletes=_persistence_only["passive_deletes"], passive_updates=_persistence_only["passive_updates"], remote_side=None, enable_typechecks=_persistence_only["enable_typechecks"], join_depth=None, comparator_factory=None, single_parent=False, innerjoin=False, distinct_target_key=None, doc=None, active_history=_persistence_only["active_history"], cascade_backrefs=_persistence_only["cascade_backrefs"], load_on_pending=False, bake_queries=True, _local_remote_pairs=None, query_class=None, info=None, omit_join=None, sync_backref=None, _legacy_inactive_history_style=False, ): """Provide a relationship between two mapped classes. This corresponds to a parent-child or associative table relationship. The constructed class is an instance of :class:`.RelationshipProperty`. A typical :func:`_orm.relationship`, used in a classical mapping:: mapper(Parent, properties={ 'children': relationship(Child) }) Some arguments accepted by :func:`_orm.relationship` optionally accept a callable function, which when called produces the desired value. The callable is invoked by the parent :class:`_orm.Mapper` at "mapper initialization" time, which happens only when mappers are first used, and is assumed to be after all mappings have been constructed. This can be used to resolve order-of-declaration and other dependency issues, such as if ``Child`` is declared below ``Parent`` in the same file:: mapper(Parent, properties={ "children":relationship(lambda: Child, order_by=lambda: Child.id) }) When using the :ref:`declarative_toplevel` extension, the Declarative initializer allows string arguments to be passed to :func:`_orm.relationship`. These string arguments are converted into callables that evaluate the string as Python code, using the Declarative class-registry as a namespace. This allows the lookup of related classes to be automatic via their string name, and removes the need for related classes to be imported into the local module space before the dependent classes have been declared. It is still required that the modules in which these related classes appear are imported anywhere in the application at some point before the related mappings are actually used, else a lookup error will be raised when the :func:`_orm.relationship` attempts to resolve the string reference to the related class. An example of a string- resolved class is as follows:: from sqlalchemy.ext.declarative import declarative_base Base = declarative_base() class Parent(Base): __tablename__ = 'parent' id = Column(Integer, primary_key=True) children = relationship("Child", order_by="Child.id") .. seealso:: :ref:`relationship_config_toplevel` - Full introductory and reference documentation for :func:`_orm.relationship`. :ref:`orm_tutorial_relationship` - ORM tutorial introduction. :param argument: A mapped class, or actual :class:`_orm.Mapper` instance, representing the target of the relationship. :paramref:`_orm.relationship.argument` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a string name when using Declarative. .. warning:: Prior to SQLAlchemy 1.3.16, this value is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. .. versionchanged 1.3.16:: The string evaluation of the main "argument" no longer accepts an open ended Python expression, instead only accepting a string class name or dotted package-qualified name. .. seealso:: :ref:`declarative_configuring_relationships` - further detail on relationship configuration when using Declarative. :param secondary: For a many-to-many relationship, specifies the intermediary table, and is typically an instance of :class:`_schema.Table`. In less common circumstances, the argument may also be specified as an :class:`_expression.Alias` construct, or even a :class:`_expression.Join` construct. :paramref:`_orm.relationship.secondary` may also be passed as a callable function which is evaluated at mapper initialization time. When using Declarative, it may also be a string argument noting the name of a :class:`_schema.Table` that is present in the :class:`_schema.MetaData` collection associated with the parent-mapped :class:`_schema.Table`. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. The :paramref:`_orm.relationship.secondary` keyword argument is typically applied in the case where the intermediary :class:`_schema.Table` is not otherwise expressed in any direct class mapping. If the "secondary" table is also explicitly mapped elsewhere (e.g. as in :ref:`association_pattern`), one should consider applying the :paramref:`_orm.relationship.viewonly` flag so that this :func:`_orm.relationship` is not used for persistence operations which may conflict with those of the association object pattern. .. seealso:: :ref:`relationships_many_to_many` - Reference example of "many to many". :ref:`orm_tutorial_many_to_many` - ORM tutorial introduction to many-to-many relationships. :ref:`self_referential_many_to_many` - Specifics on using many-to-many in a self-referential case. :ref:`declarative_many_to_many` - Additional options when using Declarative. :ref:`association_pattern` - an alternative to :paramref:`_orm.relationship.secondary` when composing association table relationships, allowing additional attributes to be specified on the association table. :ref:`composite_secondary_join` - a lesser-used pattern which in some cases can enable complex :func:`_orm.relationship` SQL conditions to be used. .. versionadded:: 0.9.2 :paramref:`_orm.relationship.secondary` works more effectively when referring to a :class:`_expression.Join` instance. :param active_history=False: When ``True``, indicates that the "previous" value for a many-to-one reference should be loaded when replaced, if not already loaded. Normally, history tracking logic for simple many-to-ones only needs to be aware of the "new" value in order to perform a flush. This flag is available for applications that make use of :func:`.attributes.get_history` which also need to know the "previous" value of the attribute. :param backref: Indicates the string name of a property to be placed on the related mapper's class that will handle this relationship in the other direction. The other property will be created automatically when the mappers are configured. Can also be passed as a :func:`.backref` object to control the configuration of the new relationship. .. seealso:: :ref:`relationships_backref` - Introductory documentation and examples. :paramref:`_orm.relationship.back_populates` - alternative form of backref specification. :func:`.backref` - allows control over :func:`_orm.relationship` configuration when using :paramref:`_orm.relationship.backref`. :param back_populates: Takes a string name and has the same meaning as :paramref:`_orm.relationship.backref`, except the complementing property is **not** created automatically, and instead must be configured explicitly on the other mapper. The complementing property should also indicate :paramref:`_orm.relationship.back_populates` to this relationship to ensure proper functioning. .. seealso:: :ref:`relationships_backref` - Introductory documentation and examples. :paramref:`_orm.relationship.backref` - alternative form of backref specification. :param overlaps: A string name or comma-delimited set of names of other relationships on either this mapper, a descendant mapper, or a target mapper with which this relationship may write to the same foreign keys upon persistence. The only effect this has is to eliminate the warning that this relationship will conflict with another upon persistence. This is used for such relationships that are truly capable of conflicting with each other on write, but the application will ensure that no such conflicts occur. .. versionadded:: 1.4 .. seealso:: :ref:`error_qzyx` - usage example :param bake_queries=True: Enable :ref:`lambda caching <engine_lambda_caching>` for loader strategies, if applicable, which adds a performance gain to the construction of SQL constructs used by loader strategies, in addition to the usual SQL statement caching used throughout SQLAlchemy. This parameter currently applies only to the "lazy" and "selectin" loader strategies. There is generally no reason to set this parameter to False. .. versionchanged:: 1.4 Relationship loaders no longer use the previous "baked query" system of query caching. The "lazy" and "selectin" loaders make use of the "lambda cache" system for the construction of SQL constructs, as well as the usual SQL caching system that is throughout SQLAlchemy as of the 1.4 series. :param cascade: A comma-separated list of cascade rules which determines how Session operations should be "cascaded" from parent to child. This defaults to ``False``, which means the default cascade should be used - this default cascade is ``"save-update, merge"``. The available cascades are ``save-update``, ``merge``, ``expunge``, ``delete``, ``delete-orphan``, and ``refresh-expire``. An additional option, ``all`` indicates shorthand for ``"save-update, merge, refresh-expire, expunge, delete"``, and is often used as in ``"all, delete-orphan"`` to indicate that related objects should follow along with the parent object in all cases, and be deleted when de-associated. .. seealso:: :ref:`unitofwork_cascades` - Full detail on each of the available cascade options. :ref:`tutorial_delete_cascade` - Tutorial example describing a delete cascade. :param cascade_backrefs=True: A boolean value indicating if the ``save-update`` cascade should operate along an assignment event intercepted by a backref. When set to ``False``, the attribute managed by this relationship will not cascade an incoming transient object into the session of a persistent parent, if the event is received via backref. .. deprecated:: 1.4 The :paramref:`_orm.relationship.cascade_backrefs` flag will default to False in all cases in SQLAlchemy 2.0. .. seealso:: :ref:`backref_cascade` - Full discussion and examples on how the :paramref:`_orm.relationship.cascade_backrefs` option is used. :param collection_class: A class or callable that returns a new list-holding object. will be used in place of a plain list for storing elements. .. seealso:: :ref:`custom_collections` - Introductory documentation and examples. :param comparator_factory: A class which extends :class:`.RelationshipProperty.Comparator` which provides custom SQL clause generation for comparison operations. .. seealso:: :class:`.PropComparator` - some detail on redefining comparators at this level. :ref:`custom_comparators` - Brief intro to this feature. :param distinct_target_key=None: Indicate if a "subquery" eager load should apply the DISTINCT keyword to the innermost SELECT statement. When left as ``None``, the DISTINCT keyword will be applied in those cases when the target columns do not comprise the full primary key of the target table. When set to ``True``, the DISTINCT keyword is applied to the innermost SELECT unconditionally. It may be desirable to set this flag to False when the DISTINCT is reducing performance of the innermost subquery beyond that of what duplicate innermost rows may be causing. .. versionchanged:: 0.9.0 - :paramref:`_orm.relationship.distinct_target_key` now defaults to ``None``, so that the feature enables itself automatically for those cases where the innermost query targets a non-unique key. .. seealso:: :ref:`loading_toplevel` - includes an introduction to subquery eager loading. :param doc: Docstring which will be applied to the resulting descriptor. :param foreign_keys: A list of columns which are to be used as "foreign key" columns, or columns which refer to the value in a remote column, within the context of this :func:`_orm.relationship` object's :paramref:`_orm.relationship.primaryjoin` condition. That is, if the :paramref:`_orm.relationship.primaryjoin` condition of this :func:`_orm.relationship` is ``a.id == b.a_id``, and the values in ``b.a_id`` are required to be present in ``a.id``, then the "foreign key" column of this :func:`_orm.relationship` is ``b.a_id``. In normal cases, the :paramref:`_orm.relationship.foreign_keys` parameter is **not required.** :func:`_orm.relationship` will automatically determine which columns in the :paramref:`_orm.relationship.primaryjoin` condition are to be considered "foreign key" columns based on those :class:`_schema.Column` objects that specify :class:`_schema.ForeignKey`, or are otherwise listed as referencing columns in a :class:`_schema.ForeignKeyConstraint` construct. :paramref:`_orm.relationship.foreign_keys` is only needed when: 1. There is more than one way to construct a join from the local table to the remote table, as there are multiple foreign key references present. Setting ``foreign_keys`` will limit the :func:`_orm.relationship` to consider just those columns specified here as "foreign". 2. The :class:`_schema.Table` being mapped does not actually have :class:`_schema.ForeignKey` or :class:`_schema.ForeignKeyConstraint` constructs present, often because the table was reflected from a database that does not support foreign key reflection (MySQL MyISAM). 3. The :paramref:`_orm.relationship.primaryjoin` argument is used to construct a non-standard join condition, which makes use of columns or expressions that do not normally refer to their "parent" column, such as a join condition expressed by a complex comparison using a SQL function. The :func:`_orm.relationship` construct will raise informative error messages that suggest the use of the :paramref:`_orm.relationship.foreign_keys` parameter when presented with an ambiguous condition. In typical cases, if :func:`_orm.relationship` doesn't raise any exceptions, the :paramref:`_orm.relationship.foreign_keys` parameter is usually not needed. :paramref:`_orm.relationship.foreign_keys` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a Python-evaluable string when using Declarative. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. .. seealso:: :ref:`relationship_foreign_keys` :ref:`relationship_custom_foreign` :func:`.foreign` - allows direct annotation of the "foreign" columns within a :paramref:`_orm.relationship.primaryjoin` condition. :param info: Optional data dictionary which will be populated into the :attr:`.MapperProperty.info` attribute of this object. :param innerjoin=False: When ``True``, joined eager loads will use an inner join to join against related tables instead of an outer join. The purpose of this option is generally one of performance, as inner joins generally perform better than outer joins. This flag can be set to ``True`` when the relationship references an object via many-to-one using local foreign keys that are not nullable, or when the reference is one-to-one or a collection that is guaranteed to have one or at least one entry. The option supports the same "nested" and "unnested" options as that of :paramref:`_orm.joinedload.innerjoin`. See that flag for details on nested / unnested behaviors. .. seealso:: :paramref:`_orm.joinedload.innerjoin` - the option as specified by loader option, including detail on nesting behavior. :ref:`what_kind_of_loading` - Discussion of some details of various loader options. :param join_depth: When non-``None``, an integer value indicating how many levels deep "eager" loaders should join on a self-referring or cyclical relationship. The number counts how many times the same Mapper shall be present in the loading condition along a particular join branch. When left at its default of ``None``, eager loaders will stop chaining when they encounter a the same target mapper which is already higher up in the chain. This option applies both to joined- and subquery- eager loaders. .. seealso:: :ref:`self_referential_eager_loading` - Introductory documentation and examples. :param lazy='select': specifies How the related items should be loaded. Default value is ``select``. Values include: * ``select`` - items should be loaded lazily when the property is first accessed, using a separate SELECT statement, or identity map fetch for simple many-to-one references. * ``immediate`` - items should be loaded as the parents are loaded, using a separate SELECT statement, or identity map fetch for simple many-to-one references. * ``joined`` - items should be loaded "eagerly" in the same query as that of the parent, using a JOIN or LEFT OUTER JOIN. Whether the join is "outer" or not is determined by the :paramref:`_orm.relationship.innerjoin` parameter. * ``subquery`` - items should be loaded "eagerly" as the parents are loaded, using one additional SQL statement, which issues a JOIN to a subquery of the original statement, for each collection requested. * ``selectin`` - items should be loaded "eagerly" as the parents are loaded, using one or more additional SQL statements, which issues a JOIN to the immediate parent object, specifying primary key identifiers using an IN clause. .. versionadded:: 1.2 * ``noload`` - no loading should occur at any time. This is to support "write-only" attributes, or attributes which are populated in some manner specific to the application. * ``raise`` - lazy loading is disallowed; accessing the attribute, if its value were not already loaded via eager loading, will raise an :exc:`~sqlalchemy.exc.InvalidRequestError`. This strategy can be used when objects are to be detached from their attached :class:`.Session` after they are loaded. .. versionadded:: 1.1 * ``raise_on_sql`` - lazy loading that emits SQL is disallowed; accessing the attribute, if its value were not already loaded via eager loading, will raise an :exc:`~sqlalchemy.exc.InvalidRequestError`, **if the lazy load needs to emit SQL**. If the lazy load can pull the related value from the identity map or determine that it should be None, the value is loaded. This strategy can be used when objects will remain associated with the attached :class:`.Session`, however additional SELECT statements should be blocked. .. versionadded:: 1.1 * ``dynamic`` - the attribute will return a pre-configured :class:`_query.Query` object for all read operations, onto which further filtering operations can be applied before iterating the results. See the section :ref:`dynamic_relationship` for more details. * True - a synonym for 'select' * False - a synonym for 'joined' * None - a synonym for 'noload' .. seealso:: :doc:`/orm/loading_relationships` - Full documentation on relationship loader configuration. :ref:`dynamic_relationship` - detail on the ``dynamic`` option. :ref:`collections_noload_raiseload` - notes on "noload" and "raise" :param load_on_pending=False: Indicates loading behavior for transient or pending parent objects. When set to ``True``, causes the lazy-loader to issue a query for a parent object that is not persistent, meaning it has never been flushed. This may take effect for a pending object when autoflush is disabled, or for a transient object that has been "attached" to a :class:`.Session` but is not part of its pending collection. The :paramref:`_orm.relationship.load_on_pending` flag does not improve behavior when the ORM is used normally - object references should be constructed at the object level, not at the foreign key level, so that they are present in an ordinary way before a flush proceeds. This flag is not not intended for general use. .. seealso:: :meth:`.Session.enable_relationship_loading` - this method establishes "load on pending" behavior for the whole object, and also allows loading on objects that remain transient or detached. :param order_by: Indicates the ordering that should be applied when loading these items. :paramref:`_orm.relationship.order_by` is expected to refer to one of the :class:`_schema.Column` objects to which the target class is mapped, or the attribute itself bound to the target class which refers to the column. :paramref:`_orm.relationship.order_by` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a Python-evaluable string when using Declarative. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. :param passive_deletes=False: Indicates loading behavior during delete operations. A value of True indicates that unloaded child items should not be loaded during a delete operation on the parent. Normally, when a parent item is deleted, all child items are loaded so that they can either be marked as deleted, or have their foreign key to the parent set to NULL. Marking this flag as True usually implies an ON DELETE <CASCADE|SET NULL> rule is in place which will handle updating/deleting child rows on the database side. Additionally, setting the flag to the string value 'all' will disable the "nulling out" of the child foreign keys, when the parent object is deleted and there is no delete or delete-orphan cascade enabled. This is typically used when a triggering or error raise scenario is in place on the database side. Note that the foreign key attributes on in-session child objects will not be changed after a flush occurs so this is a very special use-case setting. Additionally, the "nulling out" will still occur if the child object is de-associated with the parent. .. seealso:: :ref:`passive_deletes` - Introductory documentation and examples. :param passive_updates=True: Indicates the persistence behavior to take when a referenced primary key value changes in place, indicating that the referencing foreign key columns will also need their value changed. When True, it is assumed that ``ON UPDATE CASCADE`` is configured on the foreign key in the database, and that the database will handle propagation of an UPDATE from a source column to dependent rows. When False, the SQLAlchemy :func:`_orm.relationship` construct will attempt to emit its own UPDATE statements to modify related targets. However note that SQLAlchemy **cannot** emit an UPDATE for more than one level of cascade. Also, setting this flag to False is not compatible in the case where the database is in fact enforcing referential integrity, unless those constraints are explicitly "deferred", if the target backend supports it. It is highly advised that an application which is employing mutable primary keys keeps ``passive_updates`` set to True, and instead uses the referential integrity features of the database itself in order to handle the change efficiently and fully. .. seealso:: :ref:`passive_updates` - Introductory documentation and examples. :paramref:`.mapper.passive_updates` - a similar flag which takes effect for joined-table inheritance mappings. :param post_update: This indicates that the relationship should be handled by a second UPDATE statement after an INSERT or before a DELETE. Currently, it also will issue an UPDATE after the instance was UPDATEd as well, although this technically should be improved. This flag is used to handle saving bi-directional dependencies between two individual rows (i.e. each row references the other), where it would otherwise be impossible to INSERT or DELETE both rows fully since one row exists before the other. Use this flag when a particular mapping arrangement will incur two rows that are dependent on each other, such as a table that has a one-to-many relationship to a set of child rows, and also has a column that references a single child row within that list (i.e. both tables contain a foreign key to each other). If a flush operation returns an error that a "cyclical dependency" was detected, this is a cue that you might want to use :paramref:`_orm.relationship.post_update` to "break" the cycle. .. seealso:: :ref:`post_update` - Introductory documentation and examples. :param primaryjoin: A SQL expression that will be used as the primary join of the child object against the parent object, or in a many-to-many relationship the join of the parent object to the association table. By default, this value is computed based on the foreign key relationships of the parent and child tables (or association table). :paramref:`_orm.relationship.primaryjoin` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a Python-evaluable string when using Declarative. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. .. seealso:: :ref:`relationship_primaryjoin` :param remote_side: Used for self-referential relationships, indicates the column or list of columns that form the "remote side" of the relationship. :paramref:`_orm.relationship.remote_side` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a Python-evaluable string when using Declarative. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. .. seealso:: :ref:`self_referential` - in-depth explanation of how :paramref:`_orm.relationship.remote_side` is used to configure self-referential relationships. :func:`.remote` - an annotation function that accomplishes the same purpose as :paramref:`_orm.relationship.remote_side`, typically when a custom :paramref:`_orm.relationship.primaryjoin` condition is used. :param query_class: A :class:`_query.Query` subclass that will be used internally by the ``AppenderQuery`` returned by a "dynamic" relationship, that is, a relationship that specifies ``lazy="dynamic"`` or was otherwise constructed using the :func:`_orm.dynamic_loader` function. .. seealso:: :ref:`dynamic_relationship` - Introduction to "dynamic" relationship loaders. :param secondaryjoin: A SQL expression that will be used as the join of an association table to the child object. By default, this value is computed based on the foreign key relationships of the association and child tables. :paramref:`_orm.relationship.secondaryjoin` may also be passed as a callable function which is evaluated at mapper initialization time, and may be passed as a Python-evaluable string when using Declarative. .. warning:: When passed as a Python-evaluable string, the argument is interpreted using Python's ``eval()`` function. **DO NOT PASS UNTRUSTED INPUT TO THIS STRING**. See :ref:`declarative_relationship_eval` for details on declarative evaluation of :func:`_orm.relationship` arguments. .. seealso:: :ref:`relationship_primaryjoin` :param single_parent: When True, installs a validator which will prevent objects from being associated with more than one parent at a time. This is used for many-to-one or many-to-many relationships that should be treated either as one-to-one or one-to-many. Its usage is optional, except for :func:`_orm.relationship` constructs which are many-to-one or many-to-many and also specify the ``delete-orphan`` cascade option. The :func:`_orm.relationship` construct itself will raise an error instructing when this option is required. .. seealso:: :ref:`unitofwork_cascades` - includes detail on when the :paramref:`_orm.relationship.single_parent` flag may be appropriate. :param uselist: A boolean that indicates if this property should be loaded as a list or a scalar. In most cases, this value is determined automatically by :func:`_orm.relationship` at mapper configuration time, based on the type and direction of the relationship - one to many forms a list, many to one forms a scalar, many to many is a list. If a scalar is desired where normally a list would be present, such as a bi-directional one-to-one relationship, set :paramref:`_orm.relationship.uselist` to False. The :paramref:`_orm.relationship.uselist` flag is also available on an existing :func:`_orm.relationship` construct as a read-only attribute, which can be used to determine if this :func:`_orm.relationship` deals with collections or scalar attributes:: >>> User.addresses.property.uselist True .. seealso:: :ref:`relationships_one_to_one` - Introduction to the "one to one" relationship pattern, which is typically when the :paramref:`_orm.relationship.uselist` flag is needed. :param viewonly=False: When set to ``True``, the relationship is used only for loading objects, and not for any persistence operation. A :func:`_orm.relationship` which specifies :paramref:`_orm.relationship.viewonly` can work with a wider range of SQL operations within the :paramref:`_orm.relationship.primaryjoin` condition, including operations that feature the use of a variety of comparison operators as well as SQL functions such as :func:`_expression.cast`. The :paramref:`_orm.relationship.viewonly` flag is also of general use when defining any kind of :func:`_orm.relationship` that doesn't represent the full set of related objects, to prevent modifications of the collection from resulting in persistence operations. When using the :paramref:`_orm.relationship.viewonly` flag in conjunction with backrefs, the originating relationship for a particular state change will not produce state changes within the viewonly relationship. This is the behavior implied by :paramref:`_orm.relationship.sync_backref` being set to False. .. versionchanged:: 1.3.17 - the :paramref:`_orm.relationship.sync_backref` flag is set to False when using viewonly in conjunction with backrefs. .. seealso:: :paramref:`_orm.relationship.sync_backref` :param sync_backref: A boolean that enables the events used to synchronize the in-Python attributes when this relationship is target of either :paramref:`_orm.relationship.backref` or :paramref:`_orm.relationship.back_populates`. Defaults to ``None``, which indicates that an automatic value should be selected based on the value of the :paramref:`_orm.relationship.viewonly` flag. When left at its default, changes in state will be back-populated only if neither sides of a relationship is viewonly. .. versionadded:: 1.3.17 .. versionchanged:: 1.4 - A relationship that specifies :paramref:`_orm.relationship.viewonly` automatically implies that :paramref:`_orm.relationship.sync_backref` is ``False``. .. seealso:: :paramref:`_orm.relationship.viewonly` :param omit_join: Allows manual control over the "selectin" automatic join optimization. Set to ``False`` to disable the "omit join" feature added in SQLAlchemy 1.3; or leave as ``None`` to leave automatic optimization in place. .. note:: This flag may only be set to ``False``. It is not necessary to set it to ``True`` as the "omit_join" optimization is automatically detected; if it is not detected, then the optimization is not supported. .. versionchanged:: 1.3.11 setting ``omit_join`` to True will now emit a warning as this was not the intended use of this flag. .. versionadded:: 1.3 """ super(RelationshipProperty, self).__init__() self.uselist = uselist self.argument = argument self.secondary = secondary self.primaryjoin = primaryjoin self.secondaryjoin = secondaryjoin self.post_update = post_update self.direction = None self.viewonly = viewonly if viewonly: self._warn_for_persistence_only_flags( passive_deletes=passive_deletes, passive_updates=passive_updates, enable_typechecks=enable_typechecks, active_history=active_history, cascade_backrefs=cascade_backrefs, ) if viewonly and sync_backref: raise sa_exc.ArgumentError( "sync_backref and viewonly cannot both be True" ) self.sync_backref = sync_backref self.lazy = lazy self.single_parent = single_parent self._user_defined_foreign_keys = foreign_keys self.collection_class = collection_class self.passive_deletes = passive_deletes self.cascade_backrefs = cascade_backrefs self.passive_updates = passive_updates self.remote_side = remote_side self.enable_typechecks = enable_typechecks self.query_class = query_class self.innerjoin = innerjoin self.distinct_target_key = distinct_target_key self.doc = doc self.active_history = active_history self._legacy_inactive_history_style = _legacy_inactive_history_style self.join_depth = join_depth if omit_join: util.warn( "setting omit_join to True is not supported; selectin " "loading of this relationship may not work correctly if this " "flag is set explicitly. omit_join optimization is " "automatically detected for conditions under which it is " "supported." ) self.omit_join = omit_join self.local_remote_pairs = _local_remote_pairs self.bake_queries = bake_queries self.load_on_pending = load_on_pending self.comparator_factory = ( comparator_factory or RelationshipProperty.Comparator ) self.comparator = self.comparator_factory(self, None) util.set_creation_order(self) if info is not None: self.info = info self.strategy_key = (("lazy", self.lazy),) self._reverse_property = set() if overlaps: self._overlaps = set(re.split(r"\s*,\s*", overlaps)) else: self._overlaps = () if cascade is not False: self.cascade = cascade elif self.viewonly: self.cascade = "none" else: self.cascade = "save-update, merge" self.order_by = order_by self.back_populates = back_populates if self.back_populates: if backref: raise sa_exc.ArgumentError( "backref and back_populates keyword arguments " "are mutually exclusive" ) self.backref = None else: self.backref = backref def _warn_for_persistence_only_flags(self, **kw): for k, v in kw.items(): if v != self._persistence_only[k]: # we are warning here rather than warn deprecated as this is a # configuration mistake, and Python shows regular warnings more # aggressively than deprecation warnings by default. Unlike the # case of setting viewonly with cascade, the settings being # warned about here are not actively doing the wrong thing # against viewonly=True, so it is not as urgent to have these # raise an error. util.warn( "Setting %s on relationship() while also " "setting viewonly=True does not make sense, as a " "viewonly=True relationship does not perform persistence " "operations. This configuration may raise an error " "in a future release." % (k,) ) def instrument_class(self, mapper): attributes.register_descriptor( mapper.class_, self.key, comparator=self.comparator_factory(self, mapper), parententity=mapper, doc=self.doc, ) class Comparator(PropComparator): """Produce boolean, comparison, and other operators for :class:`.RelationshipProperty` attributes. See the documentation for :class:`.PropComparator` for a brief overview of ORM level operator definition. .. seealso:: :class:`.PropComparator` :class:`.ColumnProperty.Comparator` :class:`.ColumnOperators` :ref:`types_operators` :attr:`.TypeEngine.comparator_factory` """ _of_type = None _extra_criteria = () def __init__( self, prop, parentmapper, adapt_to_entity=None, of_type=None, extra_criteria=(), ): """Construction of :class:`.RelationshipProperty.Comparator` is internal to the ORM's attribute mechanics. """ self.prop = prop self._parententity = parentmapper self._adapt_to_entity = adapt_to_entity if of_type: self._of_type = of_type self._extra_criteria = extra_criteria def adapt_to_entity(self, adapt_to_entity): return self.__class__( self.property, self._parententity, adapt_to_entity=adapt_to_entity, of_type=self._of_type, ) @util.memoized_property def entity(self): """The target entity referred to by this :class:`.RelationshipProperty.Comparator`. This is either a :class:`_orm.Mapper` or :class:`.AliasedInsp` object. This is the "target" or "remote" side of the :func:`_orm.relationship`. """ # this is a relatively recent change made for # 1.4.27 as part of #7244. # TODO: shouldn't _of_type be inspected up front when received? if self._of_type is not None: return inspect(self._of_type) else: return self.property.entity @util.memoized_property def mapper(self): """The target :class:`_orm.Mapper` referred to by this :class:`.RelationshipProperty.Comparator`. This is the "target" or "remote" side of the :func:`_orm.relationship`. """ return self.property.mapper @util.memoized_property def _parententity(self): return self.property.parent def _source_selectable(self): if self._adapt_to_entity: return self._adapt_to_entity.selectable else: return self.property.parent._with_polymorphic_selectable def __clause_element__(self): adapt_from = self._source_selectable() if self._of_type: of_type_entity = inspect(self._of_type) else: of_type_entity = None ( pj, sj, source, dest, secondary, target_adapter, ) = self.property._create_joins( source_selectable=adapt_from, source_polymorphic=True, of_type_entity=of_type_entity, alias_secondary=True, extra_criteria=self._extra_criteria, ) if sj is not None: return pj & sj else: return pj def of_type(self, cls): r"""Redefine this object in terms of a polymorphic subclass. See :meth:`.PropComparator.of_type` for an example. """ return RelationshipProperty.Comparator( self.property, self._parententity, adapt_to_entity=self._adapt_to_entity, of_type=cls, extra_criteria=self._extra_criteria, ) def and_(self, *other): """Add AND criteria. See :meth:`.PropComparator.and_` for an example. .. versionadded:: 1.4 """ return RelationshipProperty.Comparator( self.property, self._parententity, adapt_to_entity=self._adapt_to_entity, of_type=self._of_type, extra_criteria=self._extra_criteria + other, ) def in_(self, other): """Produce an IN clause - this is not implemented for :func:`_orm.relationship`-based attributes at this time. """ raise NotImplementedError( "in_() not yet supported for " "relationships. For a simple " "many-to-one, use in_() against " "the set of foreign key values." ) __hash__ = None def __eq__(self, other): """Implement the ``==`` operator. In a many-to-one context, such as:: MyClass.some_prop == <some object> this will typically produce a clause such as:: mytable.related_id == <some id> Where ``<some id>`` is the primary key of the given object. The ``==`` operator provides partial functionality for non- many-to-one comparisons: * Comparisons against collections are not supported. Use :meth:`~.RelationshipProperty.Comparator.contains`. * Compared to a scalar one-to-many, will produce a clause that compares the target columns in the parent to the given target. * Compared to a scalar many-to-many, an alias of the association table will be rendered as well, forming a natural join that is part of the main body of the query. This will not work for queries that go beyond simple AND conjunctions of comparisons, such as those which use OR. Use explicit joins, outerjoins, or :meth:`~.RelationshipProperty.Comparator.has` for more comprehensive non-many-to-one scalar membership tests. * Comparisons against ``None`` given in a one-to-many or many-to-many context produce a NOT EXISTS clause. """ if isinstance(other, (util.NoneType, expression.Null)): if self.property.direction in [ONETOMANY, MANYTOMANY]: return ~self._criterion_exists() else: return _orm_annotate( self.property._optimized_compare( None, adapt_source=self.adapter ) ) elif self.property.uselist: raise sa_exc.InvalidRequestError( "Can't compare a collection to an object or collection; " "use contains() to test for membership." ) else: return _orm_annotate( self.property._optimized_compare( other, adapt_source=self.adapter ) ) def _criterion_exists(self, criterion=None, **kwargs): if getattr(self, "_of_type", None): info = inspect(self._of_type) target_mapper, to_selectable, is_aliased_class = ( info.mapper, info.selectable, info.is_aliased_class, ) if self.property._is_self_referential and not is_aliased_class: to_selectable = to_selectable._anonymous_fromclause() single_crit = target_mapper._single_table_criterion if single_crit is not None: if criterion is not None: criterion = single_crit & criterion else: criterion = single_crit else: is_aliased_class = False to_selectable = None if self.adapter: source_selectable = self._source_selectable() else: source_selectable = None ( pj, sj, source, dest, secondary, target_adapter, ) = self.property._create_joins( dest_selectable=to_selectable, source_selectable=source_selectable, ) for k in kwargs: crit = getattr(self.property.mapper.class_, k) == kwargs[k] if criterion is None: criterion = crit else: criterion = criterion & crit # annotate the *local* side of the join condition, in the case # of pj + sj this is the full primaryjoin, in the case of just # pj its the local side of the primaryjoin. if sj is not None: j = _orm_annotate(pj) & sj else: j = _orm_annotate(pj, exclude=self.property.remote_side) if ( criterion is not None and target_adapter and not is_aliased_class ): # limit this adapter to annotated only? criterion = target_adapter.traverse(criterion) # only have the "joined left side" of what we # return be subject to Query adaption. The right # side of it is used for an exists() subquery and # should not correlate or otherwise reach out # to anything in the enclosing query. if criterion is not None: criterion = criterion._annotate( {"no_replacement_traverse": True} ) crit = j & sql.True_._ifnone(criterion) if secondary is not None: ex = ( sql.exists(1) .where(crit) .select_from(dest, secondary) .correlate_except(dest, secondary) ) else: ex = ( sql.exists(1) .where(crit) .select_from(dest) .correlate_except(dest) ) return ex def any(self, criterion=None, **kwargs): """Produce an expression that tests a collection against particular criterion, using EXISTS. An expression like:: session.query(MyClass).filter( MyClass.somereference.any(SomeRelated.x==2) ) Will produce a query like:: SELECT * FROM my_table WHERE EXISTS (SELECT 1 FROM related WHERE related.my_id=my_table.id AND related.x=2) Because :meth:`~.RelationshipProperty.Comparator.any` uses a correlated subquery, its performance is not nearly as good when compared against large target tables as that of using a join. :meth:`~.RelationshipProperty.Comparator.any` is particularly useful for testing for empty collections:: session.query(MyClass).filter( ~MyClass.somereference.any() ) will produce:: SELECT * FROM my_table WHERE NOT (EXISTS (SELECT 1 FROM related WHERE related.my_id=my_table.id)) :meth:`~.RelationshipProperty.Comparator.any` is only valid for collections, i.e. a :func:`_orm.relationship` that has ``uselist=True``. For scalar references, use :meth:`~.RelationshipProperty.Comparator.has`. """ if not self.property.uselist: raise sa_exc.InvalidRequestError( "'any()' not implemented for scalar " "attributes. Use has()." ) return self._criterion_exists(criterion, **kwargs) def has(self, criterion=None, **kwargs): """Produce an expression that tests a scalar reference against particular criterion, using EXISTS. An expression like:: session.query(MyClass).filter( MyClass.somereference.has(SomeRelated.x==2) ) Will produce a query like:: SELECT * FROM my_table WHERE EXISTS (SELECT 1 FROM related WHERE related.id==my_table.related_id AND related.x=2) Because :meth:`~.RelationshipProperty.Comparator.has` uses a correlated subquery, its performance is not nearly as good when compared against large target tables as that of using a join. :meth:`~.RelationshipProperty.Comparator.has` is only valid for scalar references, i.e. a :func:`_orm.relationship` that has ``uselist=False``. For collection references, use :meth:`~.RelationshipProperty.Comparator.any`. """ if self.property.uselist: raise sa_exc.InvalidRequestError( "'has()' not implemented for collections. " "Use any()." ) return self._criterion_exists(criterion, **kwargs) def contains(self, other, **kwargs): """Return a simple expression that tests a collection for containment of a particular item. :meth:`~.RelationshipProperty.Comparator.contains` is only valid for a collection, i.e. a :func:`_orm.relationship` that implements one-to-many or many-to-many with ``uselist=True``. When used in a simple one-to-many context, an expression like:: MyClass.contains(other) Produces a clause like:: mytable.id == <some id> Where ``<some id>`` is the value of the foreign key attribute on ``other`` which refers to the primary key of its parent object. From this it follows that :meth:`~.RelationshipProperty.Comparator.contains` is very useful when used with simple one-to-many operations. For many-to-many operations, the behavior of :meth:`~.RelationshipProperty.Comparator.contains` has more caveats. The association table will be rendered in the statement, producing an "implicit" join, that is, includes multiple tables in the FROM clause which are equated in the WHERE clause:: query(MyClass).filter(MyClass.contains(other)) Produces a query like:: SELECT * FROM my_table, my_association_table AS my_association_table_1 WHERE my_table.id = my_association_table_1.parent_id AND my_association_table_1.child_id = <some id> Where ``<some id>`` would be the primary key of ``other``. From the above, it is clear that :meth:`~.RelationshipProperty.Comparator.contains` will **not** work with many-to-many collections when used in queries that move beyond simple AND conjunctions, such as multiple :meth:`~.RelationshipProperty.Comparator.contains` expressions joined by OR. In such cases subqueries or explicit "outer joins" will need to be used instead. See :meth:`~.RelationshipProperty.Comparator.any` for a less-performant alternative using EXISTS, or refer to :meth:`_query.Query.outerjoin` as well as :ref:`ormtutorial_joins` for more details on constructing outer joins. kwargs may be ignored by this operator but are required for API conformance. """ if not self.property.uselist: raise sa_exc.InvalidRequestError( "'contains' not implemented for scalar " "attributes. Use ==" ) clause = self.property._optimized_compare( other, adapt_source=self.adapter ) if self.property.secondaryjoin is not None: clause.negation_clause = self.__negated_contains_or_equals( other ) return clause def __negated_contains_or_equals(self, other): if self.property.direction == MANYTOONE: state = attributes.instance_state(other) def state_bindparam(local_col, state, remote_col): dict_ = state.dict return sql.bindparam( local_col.key, type_=local_col.type, unique=True, callable_=self.property._get_attr_w_warn_on_none( self.property.mapper, state, dict_, remote_col ), ) def adapt(col): if self.adapter: return self.adapter(col) else: return col if self.property._use_get: return sql.and_( *[ sql.or_( adapt(x) != state_bindparam(adapt(x), state, y), adapt(x) == None, ) for (x, y) in self.property.local_remote_pairs ] ) criterion = sql.and_( *[ x == y for (x, y) in zip( self.property.mapper.primary_key, self.property.mapper.primary_key_from_instance(other), ) ] ) return ~self._criterion_exists(criterion) def __ne__(self, other): """Implement the ``!=`` operator. In a many-to-one context, such as:: MyClass.some_prop != <some object> This will typically produce a clause such as:: mytable.related_id != <some id> Where ``<some id>`` is the primary key of the given object. The ``!=`` operator provides partial functionality for non- many-to-one comparisons: * Comparisons against collections are not supported. Use :meth:`~.RelationshipProperty.Comparator.contains` in conjunction with :func:`_expression.not_`. * Compared to a scalar one-to-many, will produce a clause that compares the target columns in the parent to the given target. * Compared to a scalar many-to-many, an alias of the association table will be rendered as well, forming a natural join that is part of the main body of the query. This will not work for queries that go beyond simple AND conjunctions of comparisons, such as those which use OR. Use explicit joins, outerjoins, or :meth:`~.RelationshipProperty.Comparator.has` in conjunction with :func:`_expression.not_` for more comprehensive non-many-to-one scalar membership tests. * Comparisons against ``None`` given in a one-to-many or many-to-many context produce an EXISTS clause. """ if isinstance(other, (util.NoneType, expression.Null)): if self.property.direction == MANYTOONE: return _orm_annotate( ~self.property._optimized_compare( None, adapt_source=self.adapter ) ) else: return self._criterion_exists() elif self.property.uselist: raise sa_exc.InvalidRequestError( "Can't compare a collection" " to an object or collection; use " "contains() to test for membership." ) else: return _orm_annotate(self.__negated_contains_or_equals(other)) @util.memoized_property def property(self): self.prop.parent._check_configure() return self.prop def _with_parent(self, instance, alias_secondary=True, from_entity=None): assert instance is not None adapt_source = None if from_entity is not None: insp = inspect(from_entity) if insp.is_aliased_class: adapt_source = insp._adapter.adapt_clause return self._optimized_compare( instance, value_is_parent=True, adapt_source=adapt_source, alias_secondary=alias_secondary, ) def _optimized_compare( self, state, value_is_parent=False, adapt_source=None, alias_secondary=True, ): if state is not None: try: state = inspect(state) except sa_exc.NoInspectionAvailable: state = None if state is None or not getattr(state, "is_instance", False): raise sa_exc.ArgumentError( "Mapped instance expected for relationship " "comparison to object. Classes, queries and other " "SQL elements are not accepted in this context; for " "comparison with a subquery, " "use %s.has(**criteria)." % self ) reverse_direction = not value_is_parent if state is None: return self._lazy_none_clause( reverse_direction, adapt_source=adapt_source ) if not reverse_direction: criterion, bind_to_col = ( self._lazy_strategy._lazywhere, self._lazy_strategy._bind_to_col, ) else: criterion, bind_to_col = ( self._lazy_strategy._rev_lazywhere, self._lazy_strategy._rev_bind_to_col, ) if reverse_direction: mapper = self.mapper else: mapper = self.parent dict_ = attributes.instance_dict(state.obj()) def visit_bindparam(bindparam): if bindparam._identifying_key in bind_to_col: bindparam.callable = self._get_attr_w_warn_on_none( mapper, state, dict_, bind_to_col[bindparam._identifying_key], ) if self.secondary is not None and alias_secondary: criterion = ClauseAdapter( self.secondary._anonymous_fromclause() ).traverse(criterion) criterion = visitors.cloned_traverse( criterion, {}, {"bindparam": visit_bindparam} ) if adapt_source: criterion = adapt_source(criterion) return criterion def _get_attr_w_warn_on_none(self, mapper, state, dict_, column): """Create the callable that is used in a many-to-one expression. E.g.:: u1 = s.query(User).get(5) expr = Address.user == u1 Above, the SQL should be "address.user_id = 5". The callable returned by this method produces the value "5" based on the identity of ``u1``. """ # in this callable, we're trying to thread the needle through # a wide variety of scenarios, including: # # * the object hasn't been flushed yet and there's no value for # the attribute as of yet # # * the object hasn't been flushed yet but it has a user-defined # value # # * the object has a value but it's expired and not locally present # # * the object has a value but it's expired and not locally present, # and the object is also detached # # * The object hadn't been flushed yet, there was no value, but # later, the object has been expired and detached, and *now* # they're trying to evaluate it # # * the object had a value, but it was changed to a new value, and # then expired # # * the object had a value, but it was changed to a new value, and # then expired, then the object was detached # # * the object has a user-set value, but it's None and we don't do # the comparison correctly for that so warn # prop = mapper.get_property_by_column(column) # by invoking this method, InstanceState will track the last known # value for this key each time the attribute is to be expired. # this feature was added explicitly for use in this method. state._track_last_known_value(prop.key) def _go(): last_known = to_return = state._last_known_values[prop.key] existing_is_available = last_known is not attributes.NO_VALUE # we support that the value may have changed. so here we # try to get the most recent value including re-fetching. # only if we can't get a value now due to detachment do we return # the last known value current_value = mapper._get_state_attr_by_column( state, dict_, column, passive=attributes.PASSIVE_OFF if state.persistent else attributes.PASSIVE_NO_FETCH ^ attributes.INIT_OK, ) if current_value is attributes.NEVER_SET: if not existing_is_available: raise sa_exc.InvalidRequestError( "Can't resolve value for column %s on object " "%s; no value has been set for this column" % (column, state_str(state)) ) elif current_value is attributes.PASSIVE_NO_RESULT: if not existing_is_available: raise sa_exc.InvalidRequestError( "Can't resolve value for column %s on object " "%s; the object is detached and the value was " "expired" % (column, state_str(state)) ) else: to_return = current_value if to_return is None: util.warn( "Got None for value of column %s; this is unsupported " "for a relationship comparison and will not " "currently produce an IS comparison " "(but may in a future release)" % column ) return to_return return _go def _lazy_none_clause(self, reverse_direction=False, adapt_source=None): if not reverse_direction: criterion, bind_to_col = ( self._lazy_strategy._lazywhere, self._lazy_strategy._bind_to_col, ) else: criterion, bind_to_col = ( self._lazy_strategy._rev_lazywhere, self._lazy_strategy._rev_bind_to_col, ) criterion = adapt_criterion_to_null(criterion, bind_to_col) if adapt_source: criterion = adapt_source(criterion) return criterion def __str__(self): return str(self.parent.class_.__name__) + "." + self.key def merge( self, session, source_state, source_dict, dest_state, dest_dict, load, _recursive, _resolve_conflict_map, ): if load: for r in self._reverse_property: if (source_state, r) in _recursive: return if "merge" not in self._cascade: return if self.key not in source_dict: return if self.uselist: impl = source_state.get_impl(self.key) instances_iterable = impl.get_collection(source_state, source_dict) # if this is a CollectionAttributeImpl, then empty should # be False, otherwise "self.key in source_dict" should not be # True assert not instances_iterable.empty if impl.collection else True if load: # for a full merge, pre-load the destination collection, # so that individual _merge of each item pulls from identity # map for those already present. # also assumes CollectionAttributeImpl behavior of loading # "old" list in any case dest_state.get_impl(self.key).get(dest_state, dest_dict) dest_list = [] for current in instances_iterable: current_state = attributes.instance_state(current) current_dict = attributes.instance_dict(current) _recursive[(current_state, self)] = True obj = session._merge( current_state, current_dict, load=load, _recursive=_recursive, _resolve_conflict_map=_resolve_conflict_map, ) if obj is not None: dest_list.append(obj) if not load: coll = attributes.init_state_collection( dest_state, dest_dict, self.key ) for c in dest_list: coll.append_without_event(c) else: dest_state.get_impl(self.key).set( dest_state, dest_dict, dest_list, _adapt=False ) else: current = source_dict[self.key] if current is not None: current_state = attributes.instance_state(current) current_dict = attributes.instance_dict(current) _recursive[(current_state, self)] = True obj = session._merge( current_state, current_dict, load=load, _recursive=_recursive, _resolve_conflict_map=_resolve_conflict_map, ) else: obj = None if not load: dest_dict[self.key] = obj else: dest_state.get_impl(self.key).set( dest_state, dest_dict, obj, None ) def _value_as_iterable( self, state, dict_, key, passive=attributes.PASSIVE_OFF ): """Return a list of tuples (state, obj) for the given key. returns an empty list if the value is None/empty/PASSIVE_NO_RESULT """ impl = state.manager[key].impl x = impl.get(state, dict_, passive=passive) if x is attributes.PASSIVE_NO_RESULT or x is None: return [] elif hasattr(impl, "get_collection"): return [ (attributes.instance_state(o), o) for o in impl.get_collection(state, dict_, x, passive=passive) ] else: return [(attributes.instance_state(x), x)] def cascade_iterator( self, type_, state, dict_, visited_states, halt_on=None ): # assert type_ in self._cascade # only actively lazy load on the 'delete' cascade if type_ != "delete" or self.passive_deletes: passive = attributes.PASSIVE_NO_INITIALIZE else: passive = attributes.PASSIVE_OFF if type_ == "save-update": tuples = state.manager[self.key].impl.get_all_pending(state, dict_) else: tuples = self._value_as_iterable( state, dict_, self.key, passive=passive ) skip_pending = ( type_ == "refresh-expire" and "delete-orphan" not in self._cascade ) for instance_state, c in tuples: if instance_state in visited_states: continue if c is None: # would like to emit a warning here, but # would not be consistent with collection.append(None) # current behavior of silently skipping. # see [ticket:2229] continue instance_dict = attributes.instance_dict(c) if halt_on and halt_on(instance_state): continue if skip_pending and not instance_state.key: continue instance_mapper = instance_state.manager.mapper if not instance_mapper.isa(self.mapper.class_manager.mapper): raise AssertionError( "Attribute '%s' on class '%s' " "doesn't handle objects " "of type '%s'" % (self.key, self.parent.class_, c.__class__) ) visited_states.add(instance_state) yield c, instance_mapper, instance_state, instance_dict @property def _effective_sync_backref(self): if self.viewonly: return False else: return self.sync_backref is not False @staticmethod def _check_sync_backref(rel_a, rel_b): if rel_a.viewonly and rel_b.sync_backref: raise sa_exc.InvalidRequestError( "Relationship %s cannot specify sync_backref=True since %s " "includes viewonly=True." % (rel_b, rel_a) ) if ( rel_a.viewonly and not rel_b.viewonly and rel_b.sync_backref is not False ): rel_b.sync_backref = False def _add_reverse_property(self, key): other = self.mapper.get_property(key, _configure_mappers=False) if not isinstance(other, RelationshipProperty): raise sa_exc.InvalidRequestError( "back_populates on relationship '%s' refers to attribute '%s' " "that is not a relationship. The back_populates parameter " "should refer to the name of a relationship on the target " "class." % (self, other) ) # viewonly and sync_backref cases # 1. self.viewonly==True and other.sync_backref==True -> error # 2. self.viewonly==True and other.viewonly==False and # other.sync_backref==None -> warn sync_backref=False, set to False self._check_sync_backref(self, other) # 3. other.viewonly==True and self.sync_backref==True -> error # 4. other.viewonly==True and self.viewonly==False and # self.sync_backref==None -> warn sync_backref=False, set to False self._check_sync_backref(other, self) self._reverse_property.add(other) other._reverse_property.add(self) if not other.mapper.common_parent(self.parent): raise sa_exc.ArgumentError( "reverse_property %r on " "relationship %s references relationship %s, which " "does not reference mapper %s" % (key, self, other, self.parent) ) if ( self.direction in (ONETOMANY, MANYTOONE) and self.direction == other.direction ): raise sa_exc.ArgumentError( "%s and back-reference %s are " "both of the same direction %r. Did you mean to " "set remote_side on the many-to-one side ?" % (other, self, self.direction) ) @util.memoized_property @util.preload_module("sqlalchemy.orm.mapper") def entity(self): """Return the target mapped entity, which is an inspect() of the class or aliased class that is referred towards. """ mapperlib = util.preloaded.orm_mapper if isinstance(self.argument, util.string_types): argument = self._clsregistry_resolve_name(self.argument)() elif callable(self.argument) and not isinstance( self.argument, (type, mapperlib.Mapper) ): argument = self.argument() else: argument = self.argument if isinstance(argument, type): return mapperlib.class_mapper(argument, configure=False) try: entity = inspect(argument) except sa_exc.NoInspectionAvailable: pass else: if hasattr(entity, "mapper"): return entity raise sa_exc.ArgumentError( "relationship '%s' expects " "a class or a mapper argument (received: %s)" % (self.key, type(argument)) ) @util.memoized_property def mapper(self): """Return the targeted :class:`_orm.Mapper` for this :class:`.RelationshipProperty`. This is a lazy-initializing static attribute. """ return self.entity.mapper def do_init(self): self._check_conflicts() self._process_dependent_arguments() self._setup_registry_dependencies() self._setup_join_conditions() self._check_cascade_settings(self._cascade) self._post_init() self._generate_backref() self._join_condition._warn_for_conflicting_sync_targets() super(RelationshipProperty, self).do_init() self._lazy_strategy = self._get_strategy((("lazy", "select"),)) def _setup_registry_dependencies(self): self.parent.mapper.registry._set_depends_on( self.entity.mapper.registry ) def _process_dependent_arguments(self): """Convert incoming configuration arguments to their proper form. Callables are resolved, ORM annotations removed. """ # accept callables for other attributes which may require # deferred initialization. This technique is used # by declarative "string configs" and some recipes. for attr in ( "order_by", "primaryjoin", "secondaryjoin", "secondary", "_user_defined_foreign_keys", "remote_side", ): attr_value = getattr(self, attr) if isinstance(attr_value, util.string_types): setattr( self, attr, self._clsregistry_resolve_arg( attr_value, favor_tables=attr == "secondary" )(), ) elif callable(attr_value) and not _is_mapped_class(attr_value): setattr(self, attr, attr_value()) # remove "annotations" which are present if mapped class # descriptors are used to create the join expression. for attr in "primaryjoin", "secondaryjoin": val = getattr(self, attr) if val is not None: setattr( self, attr, _orm_deannotate( coercions.expect( roles.ColumnArgumentRole, val, argname=attr ) ), ) if self.secondary is not None and _is_mapped_class(self.secondary): raise sa_exc.ArgumentError( "secondary argument %s passed to to relationship() %s must " "be a Table object or other FROM clause; can't send a mapped " "class directly as rows in 'secondary' are persisted " "independently of a class that is mapped " "to that same table." % (self.secondary, self) ) # ensure expressions in self.order_by, foreign_keys, # remote_side are all columns, not strings. if self.order_by is not False and self.order_by is not None: self.order_by = tuple( coercions.expect( roles.ColumnArgumentRole, x, argname="order_by" ) for x in util.to_list(self.order_by) ) self._user_defined_foreign_keys = util.column_set( coercions.expect( roles.ColumnArgumentRole, x, argname="foreign_keys" ) for x in util.to_column_set(self._user_defined_foreign_keys) ) self.remote_side = util.column_set( coercions.expect( roles.ColumnArgumentRole, x, argname="remote_side" ) for x in util.to_column_set(self.remote_side) ) self.target = self.entity.persist_selectable def _setup_join_conditions(self): self._join_condition = jc = JoinCondition( parent_persist_selectable=self.parent.persist_selectable, child_persist_selectable=self.entity.persist_selectable, parent_local_selectable=self.parent.local_table, child_local_selectable=self.entity.local_table, primaryjoin=self.primaryjoin, secondary=self.secondary, secondaryjoin=self.secondaryjoin, parent_equivalents=self.parent._equivalent_columns, child_equivalents=self.mapper._equivalent_columns, consider_as_foreign_keys=self._user_defined_foreign_keys, local_remote_pairs=self.local_remote_pairs, remote_side=self.remote_side, self_referential=self._is_self_referential, prop=self, support_sync=not self.viewonly, can_be_synced_fn=self._columns_are_mapped, ) self.primaryjoin = jc.primaryjoin self.secondaryjoin = jc.secondaryjoin self.direction = jc.direction self.local_remote_pairs = jc.local_remote_pairs self.remote_side = jc.remote_columns self.local_columns = jc.local_columns self.synchronize_pairs = jc.synchronize_pairs self._calculated_foreign_keys = jc.foreign_key_columns self.secondary_synchronize_pairs = jc.secondary_synchronize_pairs @property def _clsregistry_resolve_arg(self): return self._clsregistry_resolvers[1] @property def _clsregistry_resolve_name(self): return self._clsregistry_resolvers[0] @util.memoized_property @util.preload_module("sqlalchemy.orm.clsregistry") def _clsregistry_resolvers(self): _resolver = util.preloaded.orm_clsregistry._resolver return _resolver(self.parent.class_, self) @util.preload_module("sqlalchemy.orm.mapper") def _check_conflicts(self): """Test that this relationship is legal, warn about inheritance conflicts.""" mapperlib = util.preloaded.orm_mapper if self.parent.non_primary and not mapperlib.class_mapper( self.parent.class_, configure=False ).has_property(self.key): raise sa_exc.ArgumentError( "Attempting to assign a new " "relationship '%s' to a non-primary mapper on " "class '%s'. New relationships can only be added " "to the primary mapper, i.e. the very first mapper " "created for class '%s' " % ( self.key, self.parent.class_.__name__, self.parent.class_.__name__, ) ) @property def cascade(self): """Return the current cascade setting for this :class:`.RelationshipProperty`. """ return self._cascade @cascade.setter def cascade(self, cascade): self._set_cascade(cascade) def _set_cascade(self, cascade): cascade = CascadeOptions(cascade) if self.viewonly: non_viewonly = set(cascade).difference( CascadeOptions._viewonly_cascades ) if non_viewonly: raise sa_exc.ArgumentError( 'Cascade settings "%s" apply to persistence operations ' "and should not be combined with a viewonly=True " "relationship." % (", ".join(sorted(non_viewonly))) ) if "mapper" in self.__dict__: self._check_cascade_settings(cascade) self._cascade = cascade if self._dependency_processor: self._dependency_processor.cascade = cascade def _check_cascade_settings(self, cascade): if ( cascade.delete_orphan and not self.single_parent and (self.direction is MANYTOMANY or self.direction is MANYTOONE) ): raise sa_exc.ArgumentError( "For %(direction)s relationship %(rel)s, delete-orphan " "cascade is normally " 'configured only on the "one" side of a one-to-many ' "relationship, " 'and not on the "many" side of a many-to-one or many-to-many ' "relationship. " "To force this relationship to allow a particular " '"%(relatedcls)s" object to be referred towards by only ' 'a single "%(clsname)s" object at a time via the ' "%(rel)s relationship, which " "would allow " "delete-orphan cascade to take place in this direction, set " "the single_parent=True flag." % { "rel": self, "direction": "many-to-one" if self.direction is MANYTOONE else "many-to-many", "clsname": self.parent.class_.__name__, "relatedcls": self.mapper.class_.__name__, }, code="bbf0", ) if self.passive_deletes == "all" and ( "delete" in cascade or "delete-orphan" in cascade ): raise sa_exc.ArgumentError( "On %s, can't set passive_deletes='all' in conjunction " "with 'delete' or 'delete-orphan' cascade" % self ) if cascade.delete_orphan: self.mapper.primary_mapper()._delete_orphans.append( (self.key, self.parent.class_) ) def _persists_for(self, mapper): """Return True if this property will persist values on behalf of the given mapper. """ return ( self.key in mapper.relationships and mapper.relationships[self.key] is self ) def _columns_are_mapped(self, *cols): """Return True if all columns in the given collection are mapped by the tables referenced by this :class:`.Relationship`. """ for c in cols: if ( self.secondary is not None and self.secondary.c.contains_column(c) ): continue if not self.parent.persist_selectable.c.contains_column( c ) and not self.target.c.contains_column(c): return False return True def _generate_backref(self): """Interpret the 'backref' instruction to create a :func:`_orm.relationship` complementary to this one.""" if self.parent.non_primary: return if self.backref is not None and not self.back_populates: if isinstance(self.backref, util.string_types): backref_key, kwargs = self.backref, {} else: backref_key, kwargs = self.backref mapper = self.mapper.primary_mapper() if not mapper.concrete: check = set(mapper.iterate_to_root()).union( mapper.self_and_descendants ) for m in check: if m.has_property(backref_key) and not m.concrete: raise sa_exc.ArgumentError( "Error creating backref " "'%s' on relationship '%s': property of that " "name exists on mapper '%s'" % (backref_key, self, m) ) # determine primaryjoin/secondaryjoin for the # backref. Use the one we had, so that # a custom join doesn't have to be specified in # both directions. if self.secondary is not None: # for many to many, just switch primaryjoin/ # secondaryjoin. use the annotated # pj/sj on the _join_condition. pj = kwargs.pop( "primaryjoin", self._join_condition.secondaryjoin_minus_local, ) sj = kwargs.pop( "secondaryjoin", self._join_condition.primaryjoin_minus_local, ) else: pj = kwargs.pop( "primaryjoin", self._join_condition.primaryjoin_reverse_remote, ) sj = kwargs.pop("secondaryjoin", None) if sj: raise sa_exc.InvalidRequestError( "Can't assign 'secondaryjoin' on a backref " "against a non-secondary relationship." ) foreign_keys = kwargs.pop( "foreign_keys", self._user_defined_foreign_keys ) parent = self.parent.primary_mapper() kwargs.setdefault("viewonly", self.viewonly) kwargs.setdefault("post_update", self.post_update) kwargs.setdefault("passive_updates", self.passive_updates) kwargs.setdefault("sync_backref", self.sync_backref) self.back_populates = backref_key relationship = RelationshipProperty( parent, self.secondary, pj, sj, foreign_keys=foreign_keys, back_populates=self.key, **kwargs ) mapper._configure_property(backref_key, relationship) if self.back_populates: self._add_reverse_property(self.back_populates) @util.preload_module("sqlalchemy.orm.dependency") def _post_init(self): dependency = util.preloaded.orm_dependency if self.uselist is None: self.uselist = self.direction is not MANYTOONE if not self.viewonly: self._dependency_processor = ( dependency.DependencyProcessor.from_relationship )(self) @util.memoized_property def _use_get(self): """memoize the 'use_get' attribute of this RelationshipLoader's lazyloader.""" strategy = self._lazy_strategy return strategy.use_get @util.memoized_property def _is_self_referential(self): return self.mapper.common_parent(self.parent) def _create_joins( self, source_polymorphic=False, source_selectable=None, dest_selectable=None, of_type_entity=None, alias_secondary=False, extra_criteria=(), ): aliased = False if alias_secondary and self.secondary is not None: aliased = True if source_selectable is None: if source_polymorphic and self.parent.with_polymorphic: source_selectable = self.parent._with_polymorphic_selectable if of_type_entity: dest_mapper = of_type_entity.mapper if dest_selectable is None: dest_selectable = of_type_entity.selectable aliased = True else: dest_mapper = self.mapper if dest_selectable is None: dest_selectable = self.entity.selectable if self.mapper.with_polymorphic: aliased = True if self._is_self_referential and source_selectable is None: dest_selectable = dest_selectable._anonymous_fromclause() aliased = True elif ( dest_selectable is not self.mapper._with_polymorphic_selectable or self.mapper.with_polymorphic ): aliased = True single_crit = dest_mapper._single_table_criterion aliased = aliased or ( source_selectable is not None and ( source_selectable is not self.parent._with_polymorphic_selectable or source_selectable._is_subquery ) ) ( primaryjoin, secondaryjoin, secondary, target_adapter, dest_selectable, ) = self._join_condition.join_targets( source_selectable, dest_selectable, aliased, single_crit, extra_criteria, ) if source_selectable is None: source_selectable = self.parent.local_table if dest_selectable is None: dest_selectable = self.entity.local_table return ( primaryjoin, secondaryjoin, source_selectable, dest_selectable, secondary, target_adapter, ) def _annotate_columns(element, annotations): def clone(elem): if isinstance(elem, expression.ColumnClause): elem = elem._annotate(annotations.copy()) elem._copy_internals(clone=clone) return elem if element is not None: element = clone(element) clone = None # remove gc cycles return element class JoinCondition(object): def __init__( self, parent_persist_selectable, child_persist_selectable, parent_local_selectable, child_local_selectable, primaryjoin=None, secondary=None, secondaryjoin=None, parent_equivalents=None, child_equivalents=None, consider_as_foreign_keys=None, local_remote_pairs=None, remote_side=None, self_referential=False, prop=None, support_sync=True, can_be_synced_fn=lambda *c: True, ): self.parent_persist_selectable = parent_persist_selectable self.parent_local_selectable = parent_local_selectable self.child_persist_selectable = child_persist_selectable self.child_local_selectable = child_local_selectable self.parent_equivalents = parent_equivalents self.child_equivalents = child_equivalents self.primaryjoin = primaryjoin self.secondaryjoin = secondaryjoin self.secondary = secondary self.consider_as_foreign_keys = consider_as_foreign_keys self._local_remote_pairs = local_remote_pairs self._remote_side = remote_side self.prop = prop self.self_referential = self_referential self.support_sync = support_sync self.can_be_synced_fn = can_be_synced_fn self._determine_joins() self._sanitize_joins() self._annotate_fks() self._annotate_remote() self._annotate_local() self._annotate_parentmapper() self._setup_pairs() self._check_foreign_cols(self.primaryjoin, True) if self.secondaryjoin is not None: self._check_foreign_cols(self.secondaryjoin, False) self._determine_direction() self._check_remote_side() self._log_joins() def _log_joins(self): if self.prop is None: return log = self.prop.logger log.info("%s setup primary join %s", self.prop, self.primaryjoin) log.info("%s setup secondary join %s", self.prop, self.secondaryjoin) log.info( "%s synchronize pairs [%s]", self.prop, ",".join( "(%s => %s)" % (l, r) for (l, r) in self.synchronize_pairs ), ) log.info( "%s secondary synchronize pairs [%s]", self.prop, ",".join( "(%s => %s)" % (l, r) for (l, r) in self.secondary_synchronize_pairs or [] ), ) log.info( "%s local/remote pairs [%s]", self.prop, ",".join( "(%s / %s)" % (l, r) for (l, r) in self.local_remote_pairs ), ) log.info( "%s remote columns [%s]", self.prop, ",".join("%s" % col for col in self.remote_columns), ) log.info( "%s local columns [%s]", self.prop, ",".join("%s" % col for col in self.local_columns), ) log.info("%s relationship direction %s", self.prop, self.direction) def _sanitize_joins(self): """remove the parententity annotation from our join conditions which can leak in here based on some declarative patterns and maybe others. We'd want to remove "parentmapper" also, but apparently there's an exotic use case in _join_fixture_inh_selfref_w_entity that relies upon it being present, see :ticket:`3364`. """ self.primaryjoin = _deep_deannotate( self.primaryjoin, values=("parententity", "proxy_key") ) if self.secondaryjoin is not None: self.secondaryjoin = _deep_deannotate( self.secondaryjoin, values=("parententity", "proxy_key") ) def _determine_joins(self): """Determine the 'primaryjoin' and 'secondaryjoin' attributes, if not passed to the constructor already. This is based on analysis of the foreign key relationships between the parent and target mapped selectables. """ if self.secondaryjoin is not None and self.secondary is None: raise sa_exc.ArgumentError( "Property %s specified with secondary " "join condition but " "no secondary argument" % self.prop ) # find a join between the given mapper's mapped table and # the given table. will try the mapper's local table first # for more specificity, then if not found will try the more # general mapped table, which in the case of inheritance is # a join. try: consider_as_foreign_keys = self.consider_as_foreign_keys or None if self.secondary is not None: if self.secondaryjoin is None: self.secondaryjoin = join_condition( self.child_persist_selectable, self.secondary, a_subset=self.child_local_selectable, consider_as_foreign_keys=consider_as_foreign_keys, ) if self.primaryjoin is None: self.primaryjoin = join_condition( self.parent_persist_selectable, self.secondary, a_subset=self.parent_local_selectable, consider_as_foreign_keys=consider_as_foreign_keys, ) else: if self.primaryjoin is None: self.primaryjoin = join_condition( self.parent_persist_selectable, self.child_persist_selectable, a_subset=self.parent_local_selectable, consider_as_foreign_keys=consider_as_foreign_keys, ) except sa_exc.NoForeignKeysError as nfe: if self.secondary is not None: util.raise_( sa_exc.NoForeignKeysError( "Could not determine join " "condition between parent/child tables on " "relationship %s - there are no foreign keys " "linking these tables via secondary table '%s'. " "Ensure that referencing columns are associated " "with a ForeignKey or ForeignKeyConstraint, or " "specify 'primaryjoin' and 'secondaryjoin' " "expressions." % (self.prop, self.secondary) ), from_=nfe, ) else: util.raise_( sa_exc.NoForeignKeysError( "Could not determine join " "condition between parent/child tables on " "relationship %s - there are no foreign keys " "linking these tables. " "Ensure that referencing columns are associated " "with a ForeignKey or ForeignKeyConstraint, or " "specify a 'primaryjoin' expression." % self.prop ), from_=nfe, ) except sa_exc.AmbiguousForeignKeysError as afe: if self.secondary is not None: util.raise_( sa_exc.AmbiguousForeignKeysError( "Could not determine join " "condition between parent/child tables on " "relationship %s - there are multiple foreign key " "paths linking the tables via secondary table '%s'. " "Specify the 'foreign_keys' " "argument, providing a list of those columns which " "should be counted as containing a foreign key " "reference from the secondary table to each of the " "parent and child tables." % (self.prop, self.secondary) ), from_=afe, ) else: util.raise_( sa_exc.AmbiguousForeignKeysError( "Could not determine join " "condition between parent/child tables on " "relationship %s - there are multiple foreign key " "paths linking the tables. Specify the " "'foreign_keys' argument, providing a list of those " "columns which should be counted as containing a " "foreign key reference to the parent table." % self.prop ), from_=afe, ) @property def primaryjoin_minus_local(self): return _deep_deannotate(self.primaryjoin, values=("local", "remote")) @property def secondaryjoin_minus_local(self): return _deep_deannotate(self.secondaryjoin, values=("local", "remote")) @util.memoized_property def primaryjoin_reverse_remote(self): """Return the primaryjoin condition suitable for the "reverse" direction. If the primaryjoin was delivered here with pre-existing "remote" annotations, the local/remote annotations are reversed. Otherwise, the local/remote annotations are removed. """ if self._has_remote_annotations: def replace(element): if "remote" in element._annotations: v = dict(element._annotations) del v["remote"] v["local"] = True return element._with_annotations(v) elif "local" in element._annotations: v = dict(element._annotations) del v["local"] v["remote"] = True return element._with_annotations(v) return visitors.replacement_traverse(self.primaryjoin, {}, replace) else: if self._has_foreign_annotations: # TODO: coverage return _deep_deannotate( self.primaryjoin, values=("local", "remote") ) else: return _deep_deannotate(self.primaryjoin) def _has_annotation(self, clause, annotation): for col in visitors.iterate(clause, {}): if annotation in col._annotations: return True else: return False @util.memoized_property def _has_foreign_annotations(self): return self._has_annotation(self.primaryjoin, "foreign") @util.memoized_property def _has_remote_annotations(self): return self._has_annotation(self.primaryjoin, "remote") def _annotate_fks(self): """Annotate the primaryjoin and secondaryjoin structures with 'foreign' annotations marking columns considered as foreign. """ if self._has_foreign_annotations: return if self.consider_as_foreign_keys: self._annotate_from_fk_list() else: self._annotate_present_fks() def _annotate_from_fk_list(self): def check_fk(col): if col in self.consider_as_foreign_keys: return col._annotate({"foreign": True}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, check_fk ) if self.secondaryjoin is not None: self.secondaryjoin = visitors.replacement_traverse( self.secondaryjoin, {}, check_fk ) def _annotate_present_fks(self): if self.secondary is not None: secondarycols = util.column_set(self.secondary.c) else: secondarycols = set() def is_foreign(a, b): if isinstance(a, schema.Column) and isinstance(b, schema.Column): if a.references(b): return a elif b.references(a): return b if secondarycols: if a in secondarycols and b not in secondarycols: return a elif b in secondarycols and a not in secondarycols: return b def visit_binary(binary): if not isinstance( binary.left, sql.ColumnElement ) or not isinstance(binary.right, sql.ColumnElement): return if ( "foreign" not in binary.left._annotations and "foreign" not in binary.right._annotations ): col = is_foreign(binary.left, binary.right) if col is not None: if col.compare(binary.left): binary.left = binary.left._annotate({"foreign": True}) elif col.compare(binary.right): binary.right = binary.right._annotate( {"foreign": True} ) self.primaryjoin = visitors.cloned_traverse( self.primaryjoin, {}, {"binary": visit_binary} ) if self.secondaryjoin is not None: self.secondaryjoin = visitors.cloned_traverse( self.secondaryjoin, {}, {"binary": visit_binary} ) def _refers_to_parent_table(self): """Return True if the join condition contains column comparisons where both columns are in both tables. """ pt = self.parent_persist_selectable mt = self.child_persist_selectable result = [False] def visit_binary(binary): c, f = binary.left, binary.right if ( isinstance(c, expression.ColumnClause) and isinstance(f, expression.ColumnClause) and pt.is_derived_from(c.table) and pt.is_derived_from(f.table) and mt.is_derived_from(c.table) and mt.is_derived_from(f.table) ): result[0] = True visitors.traverse(self.primaryjoin, {}, {"binary": visit_binary}) return result[0] def _tables_overlap(self): """Return True if parent/child tables have some overlap.""" return selectables_overlap( self.parent_persist_selectable, self.child_persist_selectable ) def _annotate_remote(self): """Annotate the primaryjoin and secondaryjoin structures with 'remote' annotations marking columns considered as part of the 'remote' side. """ if self._has_remote_annotations: return if self.secondary is not None: self._annotate_remote_secondary() elif self._local_remote_pairs or self._remote_side: self._annotate_remote_from_args() elif self._refers_to_parent_table(): self._annotate_selfref( lambda col: "foreign" in col._annotations, False ) elif self._tables_overlap(): self._annotate_remote_with_overlap() else: self._annotate_remote_distinct_selectables() def _annotate_remote_secondary(self): """annotate 'remote' in primaryjoin, secondaryjoin when 'secondary' is present. """ def repl(element): if self.secondary.c.contains_column(element): return element._annotate({"remote": True}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, repl ) self.secondaryjoin = visitors.replacement_traverse( self.secondaryjoin, {}, repl ) def _annotate_selfref(self, fn, remote_side_given): """annotate 'remote' in primaryjoin, secondaryjoin when the relationship is detected as self-referential. """ def visit_binary(binary): equated = binary.left.compare(binary.right) if isinstance(binary.left, expression.ColumnClause) and isinstance( binary.right, expression.ColumnClause ): # assume one to many - FKs are "remote" if fn(binary.left): binary.left = binary.left._annotate({"remote": True}) if fn(binary.right) and not equated: binary.right = binary.right._annotate({"remote": True}) elif not remote_side_given: self._warn_non_column_elements() self.primaryjoin = visitors.cloned_traverse( self.primaryjoin, {}, {"binary": visit_binary} ) def _annotate_remote_from_args(self): """annotate 'remote' in primaryjoin, secondaryjoin when the 'remote_side' or '_local_remote_pairs' arguments are used. """ if self._local_remote_pairs: if self._remote_side: raise sa_exc.ArgumentError( "remote_side argument is redundant " "against more detailed _local_remote_side " "argument." ) remote_side = [r for (l, r) in self._local_remote_pairs] else: remote_side = self._remote_side if self._refers_to_parent_table(): self._annotate_selfref(lambda col: col in remote_side, True) else: def repl(element): # use set() to avoid generating ``__eq__()`` expressions # against each element if element in set(remote_side): return element._annotate({"remote": True}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, repl ) def _annotate_remote_with_overlap(self): """annotate 'remote' in primaryjoin, secondaryjoin when the parent/child tables have some set of tables in common, though is not a fully self-referential relationship. """ def visit_binary(binary): binary.left, binary.right = proc_left_right( binary.left, binary.right ) binary.right, binary.left = proc_left_right( binary.right, binary.left ) check_entities = ( self.prop is not None and self.prop.mapper is not self.prop.parent ) def proc_left_right(left, right): if isinstance(left, expression.ColumnClause) and isinstance( right, expression.ColumnClause ): if self.child_persist_selectable.c.contains_column( right ) and self.parent_persist_selectable.c.contains_column(left): right = right._annotate({"remote": True}) elif ( check_entities and right._annotations.get("parentmapper") is self.prop.mapper ): right = right._annotate({"remote": True}) elif ( check_entities and left._annotations.get("parentmapper") is self.prop.mapper ): left = left._annotate({"remote": True}) else: self._warn_non_column_elements() return left, right self.primaryjoin = visitors.cloned_traverse( self.primaryjoin, {}, {"binary": visit_binary} ) def _annotate_remote_distinct_selectables(self): """annotate 'remote' in primaryjoin, secondaryjoin when the parent/child tables are entirely separate. """ def repl(element): if self.child_persist_selectable.c.contains_column(element) and ( not self.parent_local_selectable.c.contains_column(element) or self.child_local_selectable.c.contains_column(element) ): return element._annotate({"remote": True}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, repl ) def _warn_non_column_elements(self): util.warn( "Non-simple column elements in primary " "join condition for property %s - consider using " "remote() annotations to mark the remote side." % self.prop ) def _annotate_local(self): """Annotate the primaryjoin and secondaryjoin structures with 'local' annotations. This annotates all column elements found simultaneously in the parent table and the join condition that don't have a 'remote' annotation set up from _annotate_remote() or user-defined. """ if self._has_annotation(self.primaryjoin, "local"): return if self._local_remote_pairs: local_side = util.column_set( [l for (l, r) in self._local_remote_pairs] ) else: local_side = util.column_set(self.parent_persist_selectable.c) def locals_(elem): if "remote" not in elem._annotations and elem in local_side: return elem._annotate({"local": True}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, locals_ ) def _annotate_parentmapper(self): if self.prop is None: return def parentmappers_(elem): if "remote" in elem._annotations: return elem._annotate({"parentmapper": self.prop.mapper}) elif "local" in elem._annotations: return elem._annotate({"parentmapper": self.prop.parent}) self.primaryjoin = visitors.replacement_traverse( self.primaryjoin, {}, parentmappers_ ) def _check_remote_side(self): if not self.local_remote_pairs: raise sa_exc.ArgumentError( "Relationship %s could " "not determine any unambiguous local/remote column " "pairs based on join condition and remote_side " "arguments. " "Consider using the remote() annotation to " "accurately mark those elements of the join " "condition that are on the remote side of " "the relationship." % (self.prop,) ) def _check_foreign_cols(self, join_condition, primary): """Check the foreign key columns collected and emit error messages.""" can_sync = False foreign_cols = self._gather_columns_with_annotation( join_condition, "foreign" ) has_foreign = bool(foreign_cols) if primary: can_sync = bool(self.synchronize_pairs) else: can_sync = bool(self.secondary_synchronize_pairs) if ( self.support_sync and can_sync or (not self.support_sync and has_foreign) ): return # from here below is just determining the best error message # to report. Check for a join condition using any operator # (not just ==), perhaps they need to turn on "viewonly=True". if self.support_sync and has_foreign and not can_sync: err = ( "Could not locate any simple equality expressions " "involving locally mapped foreign key columns for " "%s join condition " "'%s' on relationship %s." % ( primary and "primary" or "secondary", join_condition, self.prop, ) ) err += ( " Ensure that referencing columns are associated " "with a ForeignKey or ForeignKeyConstraint, or are " "annotated in the join condition with the foreign() " "annotation. To allow comparison operators other than " "'==', the relationship can be marked as viewonly=True." ) raise sa_exc.ArgumentError(err) else: err = ( "Could not locate any relevant foreign key columns " "for %s join condition '%s' on relationship %s." % ( primary and "primary" or "secondary", join_condition, self.prop, ) ) err += ( " Ensure that referencing columns are associated " "with a ForeignKey or ForeignKeyConstraint, or are " "annotated in the join condition with the foreign() " "annotation." ) raise sa_exc.ArgumentError(err) def _determine_direction(self): """Determine if this relationship is one to many, many to one, many to many. """ if self.secondaryjoin is not None: self.direction = MANYTOMANY else: parentcols = util.column_set(self.parent_persist_selectable.c) targetcols = util.column_set(self.child_persist_selectable.c) # fk collection which suggests ONETOMANY. onetomany_fk = targetcols.intersection(self.foreign_key_columns) # fk collection which suggests MANYTOONE. manytoone_fk = parentcols.intersection(self.foreign_key_columns) if onetomany_fk and manytoone_fk: # fks on both sides. test for overlap of local/remote # with foreign key. # we will gather columns directly from their annotations # without deannotating, so that we can distinguish on a column # that refers to itself. # 1. columns that are both remote and FK suggest # onetomany. onetomany_local = self._gather_columns_with_annotation( self.primaryjoin, "remote", "foreign" ) # 2. columns that are FK but are not remote (e.g. local) # suggest manytoone. manytoone_local = set( [ c for c in self._gather_columns_with_annotation( self.primaryjoin, "foreign" ) if "remote" not in c._annotations ] ) # 3. if both collections are present, remove columns that # refer to themselves. This is for the case of # and_(Me.id == Me.remote_id, Me.version == Me.version) if onetomany_local and manytoone_local: self_equated = self.remote_columns.intersection( self.local_columns ) onetomany_local = onetomany_local.difference(self_equated) manytoone_local = manytoone_local.difference(self_equated) # at this point, if only one or the other collection is # present, we know the direction, otherwise it's still # ambiguous. if onetomany_local and not manytoone_local: self.direction = ONETOMANY elif manytoone_local and not onetomany_local: self.direction = MANYTOONE else: raise sa_exc.ArgumentError( "Can't determine relationship" " direction for relationship '%s' - foreign " "key columns within the join condition are present " "in both the parent and the child's mapped tables. " "Ensure that only those columns referring " "to a parent column are marked as foreign, " "either via the foreign() annotation or " "via the foreign_keys argument." % self.prop ) elif onetomany_fk: self.direction = ONETOMANY elif manytoone_fk: self.direction = MANYTOONE else: raise sa_exc.ArgumentError( "Can't determine relationship " "direction for relationship '%s' - foreign " "key columns are present in neither the parent " "nor the child's mapped tables" % self.prop ) def _deannotate_pairs(self, collection): """provide deannotation for the various lists of pairs, so that using them in hashes doesn't incur high-overhead __eq__() comparisons against original columns mapped. """ return [(x._deannotate(), y._deannotate()) for x, y in collection] def _setup_pairs(self): sync_pairs = [] lrp = util.OrderedSet([]) secondary_sync_pairs = [] def go(joincond, collection): def visit_binary(binary, left, right): if ( "remote" in right._annotations and "remote" not in left._annotations and self.can_be_synced_fn(left) ): lrp.add((left, right)) elif ( "remote" in left._annotations and "remote" not in right._annotations and self.can_be_synced_fn(right) ): lrp.add((right, left)) if binary.operator is operators.eq and self.can_be_synced_fn( left, right ): if "foreign" in right._annotations: collection.append((left, right)) elif "foreign" in left._annotations: collection.append((right, left)) visit_binary_product(visit_binary, joincond) for joincond, collection in [ (self.primaryjoin, sync_pairs), (self.secondaryjoin, secondary_sync_pairs), ]: if joincond is None: continue go(joincond, collection) self.local_remote_pairs = self._deannotate_pairs(lrp) self.synchronize_pairs = self._deannotate_pairs(sync_pairs) self.secondary_synchronize_pairs = self._deannotate_pairs( secondary_sync_pairs ) _track_overlapping_sync_targets = weakref.WeakKeyDictionary() def _warn_for_conflicting_sync_targets(self): if not self.support_sync: return # we would like to detect if we are synchronizing any column # pairs in conflict with another relationship that wishes to sync # an entirely different column to the same target. This is a # very rare edge case so we will try to minimize the memory/overhead # impact of this check for from_, to_ in [ (from_, to_) for (from_, to_) in self.synchronize_pairs ] + [ (from_, to_) for (from_, to_) in self.secondary_synchronize_pairs ]: # save ourselves a ton of memory and overhead by only # considering columns that are subject to a overlapping # FK constraints at the core level. This condition can arise # if multiple relationships overlap foreign() directly, but # we're going to assume it's typically a ForeignKeyConstraint- # level configuration that benefits from this warning. if to_ not in self._track_overlapping_sync_targets: self._track_overlapping_sync_targets[ to_ ] = weakref.WeakKeyDictionary({self.prop: from_}) else: other_props = [] prop_to_from = self._track_overlapping_sync_targets[to_] for pr, fr_ in prop_to_from.items(): if ( not pr.mapper._dispose_called and pr not in self.prop._reverse_property and pr.key not in self.prop._overlaps and self.prop.key not in pr._overlaps # note: the "__*" symbol is used internally by # SQLAlchemy as a general means of suppressing the # overlaps warning for some extension cases, however # this is not currently # a publicly supported symbol and may change at # any time. and "__*" not in self.prop._overlaps and "__*" not in pr._overlaps and not self.prop.parent.is_sibling(pr.parent) and not self.prop.mapper.is_sibling(pr.mapper) and not self.prop.parent.is_sibling(pr.mapper) and not self.prop.mapper.is_sibling(pr.parent) and ( self.prop.key != pr.key or not self.prop.parent.common_parent(pr.parent) ) ): other_props.append((pr, fr_)) if other_props: util.warn( "relationship '%s' will copy column %s to column %s, " "which conflicts with relationship(s): %s. " "If this is not the intention, consider if these " "relationships should be linked with " "back_populates, or if viewonly=True should be " "applied to one or more if they are read-only. " "For the less common case that foreign key " "constraints are partially overlapping, the " "orm.foreign() " "annotation can be used to isolate the columns that " "should be written towards. To silence this " "warning, add the parameter 'overlaps=\"%s\"' to the " "'%s' relationship." % ( self.prop, from_, to_, ", ".join( sorted( "'%s' (copies %s to %s)" % (pr, fr_, to_) for (pr, fr_) in other_props ) ), ",".join(sorted(pr.key for pr, fr in other_props)), self.prop, ), code="qzyx", ) self._track_overlapping_sync_targets[to_][self.prop] = from_ @util.memoized_property def remote_columns(self): return self._gather_join_annotations("remote") @util.memoized_property def local_columns(self): return self._gather_join_annotations("local") @util.memoized_property def foreign_key_columns(self): return self._gather_join_annotations("foreign") def _gather_join_annotations(self, annotation): s = set( self._gather_columns_with_annotation(self.primaryjoin, annotation) ) if self.secondaryjoin is not None: s.update( self._gather_columns_with_annotation( self.secondaryjoin, annotation ) ) return {x._deannotate() for x in s} def _gather_columns_with_annotation(self, clause, *annotation): annotation = set(annotation) return set( [ col for col in visitors.iterate(clause, {}) if annotation.issubset(col._annotations) ] ) def join_targets( self, source_selectable, dest_selectable, aliased, single_crit=None, extra_criteria=(), ): """Given a source and destination selectable, create a join between them. This takes into account aliasing the join clause to reference the appropriate corresponding columns in the target objects, as well as the extra child criterion, equivalent column sets, etc. """ # place a barrier on the destination such that # replacement traversals won't ever dig into it. # its internal structure remains fixed # regardless of context. dest_selectable = _shallow_annotate( dest_selectable, {"no_replacement_traverse": True} ) primaryjoin, secondaryjoin, secondary = ( self.primaryjoin, self.secondaryjoin, self.secondary, ) # adjust the join condition for single table inheritance, # in the case that the join is to a subclass # this is analogous to the # "_adjust_for_single_table_inheritance()" method in Query. if single_crit is not None: if secondaryjoin is not None: secondaryjoin = secondaryjoin & single_crit else: primaryjoin = primaryjoin & single_crit if extra_criteria: if secondaryjoin is not None: secondaryjoin = secondaryjoin & sql.and_(*extra_criteria) else: primaryjoin = primaryjoin & sql.and_(*extra_criteria) if aliased: if secondary is not None: secondary = secondary._anonymous_fromclause(flat=True) primary_aliasizer = ClauseAdapter( secondary, exclude_fn=_ColInAnnotations("local") ) secondary_aliasizer = ClauseAdapter( dest_selectable, equivalents=self.child_equivalents ).chain(primary_aliasizer) if source_selectable is not None: primary_aliasizer = ClauseAdapter( secondary, exclude_fn=_ColInAnnotations("local") ).chain( ClauseAdapter( source_selectable, equivalents=self.parent_equivalents, ) ) secondaryjoin = secondary_aliasizer.traverse(secondaryjoin) else: primary_aliasizer = ClauseAdapter( dest_selectable, exclude_fn=_ColInAnnotations("local"), equivalents=self.child_equivalents, ) if source_selectable is not None: primary_aliasizer.chain( ClauseAdapter( source_selectable, exclude_fn=_ColInAnnotations("remote"), equivalents=self.parent_equivalents, ) ) secondary_aliasizer = None primaryjoin = primary_aliasizer.traverse(primaryjoin) target_adapter = secondary_aliasizer or primary_aliasizer target_adapter.exclude_fn = None else: target_adapter = None return ( primaryjoin, secondaryjoin, secondary, target_adapter, dest_selectable, ) def create_lazy_clause(self, reverse_direction=False): binds = util.column_dict() equated_columns = util.column_dict() has_secondary = self.secondaryjoin is not None if has_secondary: lookup = collections.defaultdict(list) for l, r in self.local_remote_pairs: lookup[l].append((l, r)) equated_columns[r] = l elif not reverse_direction: for l, r in self.local_remote_pairs: equated_columns[r] = l else: for l, r in self.local_remote_pairs: equated_columns[l] = r def col_to_bind(col): if ( (not reverse_direction and "local" in col._annotations) or reverse_direction and ( (has_secondary and col in lookup) or (not has_secondary and "remote" in col._annotations) ) ): if col not in binds: binds[col] = sql.bindparam( None, None, type_=col.type, unique=True ) return binds[col] return None lazywhere = self.primaryjoin if self.secondaryjoin is None or not reverse_direction: lazywhere = visitors.replacement_traverse( lazywhere, {}, col_to_bind ) if self.secondaryjoin is not None: secondaryjoin = self.secondaryjoin if reverse_direction: secondaryjoin = visitors.replacement_traverse( secondaryjoin, {}, col_to_bind ) lazywhere = sql.and_(lazywhere, secondaryjoin) bind_to_col = {binds[col].key: col for col in binds} return lazywhere, bind_to_col, equated_columns class _ColInAnnotations(object): """Serializable object that tests for a name in c._annotations.""" __slots__ = ("name",) def __init__(self, name): self.name = name def __call__(self, c): return self.name in c._annotations
38.845528
79
0.579413
7949e9fa4b0fdd2d2c6caf9583dd4670734d5fa9
3,024
py
Python
compare_gan/src/gans/ops.py
hwalsuklee/compare_gan
d6c5976ba2b9d19dbff42f439c20b48565d10235
[ "Apache-2.0" ]
2
2018-10-03T09:52:44.000Z
2022-03-03T03:00:23.000Z
compare_gan/src/gans/ops.py
hwalsuklee/compare_gan
d6c5976ba2b9d19dbff42f439c20b48565d10235
[ "Apache-2.0" ]
null
null
null
compare_gan/src/gans/ops.py
hwalsuklee/compare_gan
d6c5976ba2b9d19dbff42f439c20b48565d10235
[ "Apache-2.0" ]
null
null
null
# coding=utf-8 # Copyright 2018 Google LLC & Hwalsuk Lee. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import division import numpy as np import scipy.misc import tensorflow as tf def check_folder(log_dir): if not tf.gfile.IsDirectory(log_dir): tf.gfile.MakeDirs(log_dir) return log_dir def save_images(images, image_path): with tf.gfile.Open(image_path, "wb") as f: scipy.misc.imsave(f, images * 255.0) def gaussian(batch_size, n_dim, mean=0., var=1.): return np.random.normal(mean, var, (batch_size, n_dim)).astype(np.float32) def lrelu(input_, leak=0.2, name="lrelu"): return tf.maximum(input_, leak * input_, name=name) def linear(input_, output_size, scope=None, stddev=0.02, bias_start=0.0): shape = input_.get_shape().as_list() with tf.variable_scope(scope or "Linear"): matrix = tf.get_variable( "Matrix", [shape[1], output_size], tf.float32, tf.random_normal_initializer(stddev=stddev)) bias = tf.get_variable( "bias", [output_size], initializer=tf.constant_initializer(bias_start)) return tf.matmul(input_, matrix) + bias def batch_norm(input_, is_training, scope): return tf.contrib.layers.batch_norm( input_, decay=0.999, epsilon=0.001, updates_collections=None, scale=True, fused=False, is_training=is_training, scope=scope) def conv2d(input_, output_dim, k_h, k_w, d_h, d_w, stddev=0.02, name="conv2d"): with tf.variable_scope(name): w = tf.get_variable( "w", [k_h, k_w, input_.get_shape()[-1], output_dim], initializer=tf.truncated_normal_initializer(stddev=stddev)) conv = tf.nn.conv2d(input_, w, strides=[1, d_h, d_w, 1], padding="SAME") biases = tf.get_variable( "biases", [output_dim], initializer=tf.constant_initializer(0.0)) return tf.reshape(tf.nn.bias_add(conv, biases), conv.get_shape()) def deconv2d( input_, output_shape, k_h, k_w, d_h, d_w, stddev=0.02, name="deconv2d"): with tf.variable_scope(name): w = tf.get_variable( "w", [k_h, k_w, output_shape[-1], input_.get_shape()[-1]], initializer=tf.random_normal_initializer(stddev=stddev)) deconv = tf.nn.conv2d_transpose( input_, w, output_shape=output_shape, strides=[1, d_h, d_w, 1]) biases = tf.get_variable( "biases", [output_shape[-1]], initializer=tf.constant_initializer(0.0)) return tf.reshape(tf.nn.bias_add(deconv, biases), deconv.get_shape())
32.516129
79
0.689153
7949eb93941a7a360b1a0c0636271378a03b6570
435
py
Python
src/Backend/query_DT_candidates.py
uhh-lt/cam-hci
dd402322bb37470963c5cc46765592f952e2c3f0
[ "MIT" ]
null
null
null
src/Backend/query_DT_candidates.py
uhh-lt/cam-hci
dd402322bb37470963c5cc46765592f952e2c3f0
[ "MIT" ]
42
2018-02-23T14:54:35.000Z
2018-03-09T10:50:56.000Z
src/Backend/query_DT_candidates.py
uhh-lt/cam-hci
dd402322bb37470963c5cc46765592f952e2c3f0
[ "MIT" ]
null
null
null
from elasticsearch import Elasticsearch ES_HOST = {"host": "localhost", "port": 9200} INDEX_NAME = 'dt-index' es = Elasticsearch(hosts=[ES_HOST], timeout=300) def get_all_similarities(comparison_object): # print(comparison_object) res = es.search(index=INDEX_NAME, size=10000, body={"query": {"match": {"first": comparison_object}}}) return list(set([hit['_source']['second'].lower() for hit in res['hits']['hits']]))
31.071429
106
0.698851
7949ed6258a82d36cfa6f81a12d715f3313d6b56
6,074
py
Python
popbl_servicesapp/flask_app/delivery/application/routes.py
xetxezarreta/master-popbl1
253880b9ba358f63f666893cdbbffe7391fcd096
[ "MIT" ]
null
null
null
popbl_servicesapp/flask_app/delivery/application/routes.py
xetxezarreta/master-popbl1
253880b9ba358f63f666893cdbbffe7391fcd096
[ "MIT" ]
1
2021-06-02T00:57:11.000Z
2021-06-02T00:57:11.000Z
popbl_servicesapp/flask_app/delivery/application/routes.py
xetxezarreta/master-popbl1
253880b9ba358f63f666893cdbbffe7391fcd096
[ "MIT" ]
null
null
null
from flask import request, jsonify, abort from flask import current_app as app from .models import Delivery from werkzeug.exceptions import NotFound, InternalServerError, BadRequest, UnsupportedMediaType import traceback from . import Session from .BLConsul import BLConsul from .config import Config import requests from .delivery_logic import DeliveryLogic bl_consul = BLConsul.get_instance() logic = DeliveryLogic() # Get Service from consul by name and return ########################################################################## @app.route('/{}/<string:external_service_name>'.format(Config.SERVICE_NAME)) def external_service_response(external_service_name): service = bl_consul.get_service(external_service_name) service['Name'] = external_service_name print(""*50) print(external_service_name) if service is None: ret_message = "The service does not exist or there is no healthy replica" status_code = 404 else: ret_message, status_code = call_external_service(service) return ret_message, status_code @app.route('/{}/kv'.format(Config.SERVICE_NAME)) def key_values(): kv = bl_consul.get_key_value_items() return jsonify(kv), 200 @app.route('/{}/catalog'.format(Config.SERVICE_NAME)) def get_catalog(): catalog = bl_consul.get_service_catalog() return jsonify(catalog), 200 @app.route('/{}/replicas'.format(Config.SERVICE_NAME)) def get_replicas(): replicas = bl_consul.get_service_replicas() return jsonify(replicas), 200 def call_external_service(service): url = "http://{host}:{port}/{path}".format( host=service['Address'], port=service['Port'], path=service['Name'] ) response = requests.get(url) if response: ret_message = jsonify({ "caller": Config.SERVICE_NAME, "callerURL": "{}:{}".format(Config.IP, Config.PORT), "answerer": service['Name'], "answererURL": "{}:{}".format(service['Address'], service['Port']), "response": response.text, "status_code": response.status_code }) status_code = response.status_code else: ret_message = "Could not get message" status_code = 500 return ret_message, status_code @app.route('/delivery/health', methods=['HEAD', 'GET']) def health_check(): # print("Health check on delivery") return "OK", 200 # Crea un objeto delivery que contiene la referencia que lo une a un pedido, asi como su estado y su descripcion # El estado sera en un principio "en proceso" # La descripcion estara en blanco @app.route('/delivery/create_delivery', methods=['POST']) def create_delivery(): session = Session() status = False if request.headers['Content-Type'] != 'application/json': abort(UnsupportedMediaType.code) content = request.json print("Contenido del request:\n") print(content) try: temdel = Delivery( ref=content['orderId'], status=content['status'], description=content['description'] ) session.add(temdel) session.commit() except KeyError: session.rollback() session.close() abort(BadRequest.code) status = False response = jsonify(status) session.close() print(response) if not response: # if response == False return {"success": False} else: return {"success": True} # Se modifica el valor del estado de una delivery mediente la referencia @app.route('/delivery/update_delivery', methods=['POST']) def update_delivery(): session = Session() status = False if request.headers['Content-Type'] != 'application/json': abort(UnsupportedMediaType.code) content = request.json print("Contenido del request:\n") print(content) deli = session.query(Delivery).filter_by(ref=content['orderId']).first() print("Contenido de la query") print(deli) if deli: # Updatear deli.status = content['status'] session.add(deli) session.commit() status = True else: status = False response = jsonify(status) session.close() print(response) if not response: # if response == False return {"success": False} else: return {"success": True} # El usuario añade a uno de los pedidos referenciados la descripcion necesaria para que seudiese realizar la entrega # El pedido debe existir en la base de datos y tener su status como finalizado o ready @app.route('/delivery/info_delivery', methods=['POST']) def info_delivery(): session = Session() status = False if request.headers['Content-Type'] != 'application/json': abort(UnsupportedMediaType.code) content = request.json print("Contenido del request:\n") print(content) deli = session.query(Delivery).filter_by(ref=content['orderId']).first() print("Contenido de la query") print(deli) if deli: # Updatear deli.description = content['description'] session.add(deli) session.commit() status = True else: status = False response = jsonify(status) session.close() print(response) if not response: # if response == False return {"success": False} else: return {"success": True} # Error Handling ####################################################################################################### @app.errorhandler(UnsupportedMediaType) def unsupported_media_type_handler(e): return get_jsonified_error(e) @app.errorhandler(BadRequest) def bad_request_handler(e): return get_jsonified_error(e) @app.errorhandler(NotFound) def resource_not_found_handler(e): return get_jsonified_error(e) @app.errorhandler(InternalServerError) def server_error_handler(e): return get_jsonified_error(e) def get_jsonified_error(e): traceback.print_tb(e.__traceback__) return jsonify({"error_code": e.code, "error_message": e.description}), e.code
27.73516
120
0.651465
7949ee2058ba85e5da1d839fef8119f0f84ff0b0
1,172
py
Python
quiz_master/quiz_app/tests/models/test_QuizModel.py
DiyanKalaydzhiev23/quiz_master
d8624a59d5bfc52c13ede72b024d1178c17c1780
[ "MIT" ]
null
null
null
quiz_master/quiz_app/tests/models/test_QuizModel.py
DiyanKalaydzhiev23/quiz_master
d8624a59d5bfc52c13ede72b024d1178c17c1780
[ "MIT" ]
null
null
null
quiz_master/quiz_app/tests/models/test_QuizModel.py
DiyanKalaydzhiev23/quiz_master
d8624a59d5bfc52c13ede72b024d1178c17c1780
[ "MIT" ]
null
null
null
from django.contrib.auth import get_user_model from django.core.exceptions import ValidationError from django.test import TestCase from quiz_master.quiz_app.models import Quiz UserModel = get_user_model() class QuizModelTests(TestCase): def setUp(self): self.user = UserModel( username='Meto', password="metilab", email='di@metilab.com', ) self.user.full_clean() self.user.save() def test_quiz_model_create__with_valid_data__expect_success(self): quiz_instance = Quiz( category="biology", name="phagocytes", author=self.user, ) quiz_instance.full_clean() quiz_instance.save() self.assertIsNotNone(quiz_instance.pk) def test_quiz_model__with_invalid_name__expect_fail(self): name = 'n' * 151 quiz_instance = Quiz( category="biology", name=name, author=self.user, ) with self.assertRaises(ValidationError) as context: quiz_instance.full_clean() quiz_instance.save() self.assertIsNotNone(context.exception)
24.93617
70
0.62884