text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_flags_from_vec_29() { let (flags, subcommand, argv) = flags_from_vec(svec![ "deno", "--seed", "250", "--v8-flags=--expose-gc", "run", "script.ts" ]); assert_eq!( flags, DenoFlags { seed: Some(250 as u64), v8_flags: Some(svec!["deno", "--expose-gc", "--random-seed=250"]), ..DenoFlags::default() } ); assert_eq!(subcommand, DenoSubcommand::Run); assert_eq!(argv, svec!["deno", "script.ts"]); }
rust_cleaned_test_functions.jsonl/112858
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 278 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14130, 5673, 13251, 62, 17, 24, 368, 341, 262, 1077, 320, 11161, 11, 1186, 5631, 11, 10213, 8, 284, 8042, 5673, 13251, 1141, 4083, 90515, 414, 330, 5183, 78, 756, 414, 14482, 22602, 756, 414, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_permissions_request_read() { let guard = PERMISSION_PROMPT_GUARD.lock().unwrap(); let whitelist = vec![PathBuf::from("/foo/bar")]; let mut perms0 = DenoPermissions::from_flags(&Flags { read_whitelist: whitelist.clone(), ..Default::default() }); set_prompt_result(false); // regardless of prompt result assert_eq!( perms0.request_read(&Some(Path::new("/foo/bar"))), PermissionState::Allow ); let mut perms1 = DenoPermissions::from_flags(&Flags { read_whitelist: whitelist.clone(), ..Default::default() }); set_prompt_result(true); assert_eq!( perms1.request_read(&Some(Path::new("/foo/baz"))), PermissionState::Allow ); let mut perms2 = DenoPermissions::from_flags(&Flags { read_whitelist: whitelist, ..Default::default() }); set_prompt_result(false); assert_eq!( perms2.request_read(&Some(Path::new("/foo/baz"))), PermissionState::Deny ); drop(guard); }
rust_cleaned_test_functions.jsonl/78059
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 448 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44767, 7893, 6443, 368, 341, 262, 1077, 7616, 284, 96540, 71346, 2828, 84513, 7376, 21003, 1005, 15454, 543, 262, 1077, 67727, 284, 7486, 20703, 1820, 15064, 486, 1499, 4283, 7975, 49513, 899, 935, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_list_index_trait_range_panic_wrong_order() { Python::with_gil(|py| { let list = PyList::new(py, &[2, 3, 5]); #[allow(clippy::reversed_empty_ranges)] list[2..1].extract::<Vec<i32>>().unwrap(); }) }
rust_cleaned_test_functions.jsonl/108643
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 3560, 78491, 9698, 620, 31270, 75198, 7869, 368, 341, 286, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 310, 1077, 1140, 284, 5355, 852, 486, 931, 46827, 11, 44590, 17, 11, 220, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_wait_for_max_stake() { solana_logger::setup(); let mut validator_config = ValidatorConfig::default(); validator_config.rpc_config.enable_validator_exit = true; let config = ClusterConfig { cluster_lamports: 10_000, node_stakes: vec![100; 4], validator_configs: vec![validator_config; 4], ..ClusterConfig::default() }; let cluster = LocalCluster::new(&config); let client = RpcClient::new_socket(cluster.entry_point_info.rpc); assert!(client .wait_for_max_stake(CommitmentConfig::default(), 33.0f32) .is_ok()); assert!(client.get_slot().unwrap() > 10); }
rust_cleaned_test_functions.jsonl/36004
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 281 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18760, 5478, 6345, 1261, 726, 368, 341, 262, 2048, 3362, 27413, 486, 15188, 543, 262, 1077, 5206, 22935, 5332, 284, 32566, 2648, 486, 2258, 543, 262, 22935, 5332, 55177, 5332, 28697, 64959, 16880, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_close_wait_ack() { let mut s = socket_close_wait(); s.send_slice(b"abcdef").unwrap(); recv!(s, [TcpRepr { seq_number: LOCAL_SEQ + 1, ack_number: Some(REMOTE_SEQ + 1 + 1), payload: &b"abcdef"[..], ..RECV_TEMPL }]); send!(s, TcpRepr { seq_number: REMOTE_SEQ + 1 + 1, ack_number: Some(LOCAL_SEQ + 1 + 6), ..SEND_TEMPL }); }
rust_cleaned_test_functions.jsonl/1748
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 291 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12704, 18760, 48447, 368, 341, 286, 1077, 5206, 274, 284, 7575, 12704, 18760, 543, 286, 274, 5219, 26488, 1883, 1, 41202, 1827, 15454, 543, 286, 27006, 10297, 82, 11, 508, 77536, 693, 649, 341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_message_unique_program_ids_order_preserved() { let program_id0 = Pubkey::new_unique(); let program_id1 = Pubkey::default(); // Key less than program_id0 let program_ids = get_program_ids(&[ Instruction::new_with_bincode(program_id0, &0, vec![]), Instruction::new_with_bincode(program_id1, &0, vec![]), Instruction::new_with_bincode(program_id0, &0, vec![]), ]); assert_eq!(program_ids, vec![program_id0, program_id1]); }
rust_cleaned_test_functions.jsonl/55516
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6462, 21218, 25096, 8077, 7869, 32116, 2771, 368, 341, 286, 1077, 2025, 842, 15, 284, 22611, 792, 486, 931, 21218, 543, 286, 1077, 2025, 842, 16, 284, 22611, 792, 486, 2258, 2129, 442, 5309, 268...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add() { let vals = vec![ ("12.34", "1.234", "13.574"), ("12.34", "-1.234", "11.106"), ("1234e6", "1234e-6", "1234000000.001234"), ("1234e-6", "1234e6", "1234000000.001234"), ("18446744073709551616.0", "1", "18446744073709551617"), ("184467440737e3380", "0", "184467440737e3380"), ]; for &(x, y, z) in vals.iter() { let mut a = BigDecimal::from_str(x).unwrap(); let b = BigDecimal::from_str(y).unwrap(); let c = BigDecimal::from_str(z).unwrap(); let s = a.clone() + b.clone(); assert_eq!(s, c); a += b; assert_eq!(a, c); } }
rust_cleaned_test_functions.jsonl/75811
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 444 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 368, 341, 286, 1077, 28356, 284, 7486, 90515, 310, 3489, 16, 17, 13, 18, 19, 497, 330, 16, 13, 17, 18, 19, 497, 330, 16, 18, 13, 20, 22, 19, 4461, 310, 3489, 16, 17, 13, 18, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_playback_status_to_fidl() { let status = PlaybackStatus::Playing; let status: fidl::PlaybackStatus = status.into(); let expected = fidl::PlaybackStatus::Playing; assert_eq!(expected, status); }
rust_cleaned_test_functions.jsonl/15962
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22144, 1419, 4773, 2346, 761, 55464, 368, 341, 286, 1077, 2639, 284, 95301, 2522, 486, 27471, 280, 286, 1077, 2639, 25, 32104, 75, 486, 87125, 2522, 284, 2639, 39860, 543, 286, 1077, 3601, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_file_type() { assert_eq!("block special file", pretty_filetype(S_IFBLK, 0)); assert_eq!("character special file", pretty_filetype(S_IFCHR, 0)); assert_eq!("regular file", pretty_filetype(S_IFREG, 1)); assert_eq!("regular empty file", pretty_filetype(S_IFREG, 0)); assert_eq!("weird file", pretty_filetype(0, 0)); }
rust_cleaned_test_functions.jsonl/36729
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 166 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2458, 1819, 368, 341, 286, 2060, 10714, 17223, 4574, 3281, 1034, 497, 5020, 2458, 1313, 3759, 19035, 9389, 42, 11, 220, 15, 1106, 286, 2060, 10714, 17223, 19190, 3281, 1034, 497, 5020, 2458, 1313,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_f64() { let cases = vec![ ("12345", 12345f64), ("123.45", 123.45), ("-123.45", -123.45), ("0.00012345000098765", 0.00012345000098765), ("1234500009876.5", 1234500009876.5), ("3.141592653589793", 3.141592653589793), ("3", 3f64), ("1234567890123456", 1234567890123456f64), ("1234567890123456000", 1234567890123456000f64), ("1234.567890123456", 1234.567890123456), ("0.1234567890123456", 0.1234567890123456), ("0", 0f64), ("0.111111111111111", 0.1111111111111110), ("0.1111111111111111", 0.1111111111111111), ("0.1111111111111119", 0.1111111111111119), ("0.000000000000000001", 0.000000000000000001), ("0.000000000000000002", 0.000000000000000002), ("0.000000000000000003", 0.000000000000000003), ("0.000000000000000005", 0.000000000000000005), ("0.000000000000000008", 0.000000000000000008), ("0.1000000000000001", 0.1000000000000001), ("0.1000000000000002", 0.1000000000000002), ("0.1000000000000003", 0.1000000000000003), ("0.1000000000000005", 0.1000000000000005), ("0.1000000000000008", 0.1000000000000008), ]; let mut ctx = EvalContext::default(); for (dec_str, exp) in cases { let dec = dec_str.parse::<Decimal>().unwrap(); let res = format!("{}", dec); assert_eq!(res, dec_str); let f: f64 = dec.convert(&mut ctx).unwrap(); assert!((exp - f).abs() < EPSILON, "expect: {}, got: {}", exp, f); } }
rust_cleaned_test_functions.jsonl/40306
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 911 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 761, 21, 19, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 3489, 16, 17, 18, 19, 20, 497, 220, 16, 17, 18, 19, 20, 69, 21, 19, 1326, 310, 3489, 16, 17, 18, 13, 19, 20, 497, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_timer() { let mut timer = Timer::new(10); timer.add_task(Duration::from_millis(20), Task::A); timer.add_task(Duration::from_millis(150), Task::C); timer.add_task(Duration::from_millis(100), Task::B); assert_eq!(timer.pending.len(), 3); let tick_time = timer.next_timeout().unwrap(); assert_eq!(timer.pop_task_before(tick_time).unwrap(), Task::A); assert_eq!(timer.pop_task_before(tick_time), None); let tick_time = timer.next_timeout().unwrap(); assert_eq!(timer.pop_task_before(tick_time).unwrap(), Task::B); assert_eq!(timer.pop_task_before(tick_time), None); let tick_time = timer.next_timeout().unwrap(); assert_eq!(timer.pop_task_before(tick_time).unwrap(), Task::C); assert_eq!(timer.pop_task_before(tick_time), None); }
rust_cleaned_test_functions.jsonl/1908
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 387 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16255, 368, 341, 286, 1077, 5206, 9021, 284, 17759, 486, 931, 7, 16, 15, 317, 286, 9021, 1364, 12184, 64114, 486, 1499, 717, 56212, 7, 17, 15, 701, 5430, 486, 32, 317, 286, 9021, 1364, 12184, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_valid_s3_list_multipart_uploads() { let mock_response = MockResponseReader::read_response( "test_resources/generated/valid", "s3-list-multipart-uploads.xml", ); let mock = MockRequestDispatcher::with_status(200).with_body(&mock_response); let client = S3Client::new_with(mock, MockCredentialsProvider, rusoto_region::UsEast1); let request = ListMultipartUploadsRequest::default(); let result = client.list_multipart_uploads(request).sync(); assert!(result.is_ok(), "parse error: {:?}", result); }
rust_cleaned_test_functions.jsonl/29201
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 255 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 8337, 643, 18, 2019, 717, 18204, 62, 19374, 368, 341, 286, 1077, 7860, 9655, 284, 14563, 2582, 5062, 486, 878, 9655, 1006, 310, 330, 1944, 35569, 79372, 14, 1891, 756, 310, 330, 82, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty_array() { let mut builder = PrimitiveArrayBuilder::<i64>::with_capacity(16); let data_array: DFInt64Array = builder.finish(); // verify empty data array and data type assert!(data_array.is_empty()); assert_eq!(&DataType::Int64, data_array.data_type()); }
rust_cleaned_test_functions.jsonl/102160
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 3858, 368, 341, 262, 1077, 5206, 7363, 284, 51460, 1857, 3297, 27638, 72, 21, 19, 6831, 4197, 35603, 7, 16, 21, 317, 262, 1077, 821, 3858, 25, 43376, 1072, 21, 19, 1857, 284, 7363, 4008...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_flatten_grammar_with_final_precedence() { let result = flatten_variable(Variable { name: "test".to_string(), kind: VariableType::Named, rule: Rule::prec_left( Precedence::Integer(101), Rule::seq(vec![Rule::non_terminal(1), Rule::non_terminal(2)]), ), }) .unwrap(); assert_eq!( result.productions, vec![Production { dynamic_precedence: 0, steps: vec![ ProductionStep::new(Symbol::non_terminal(1)) .with_prec(Precedence::Integer(101), Some(Associativity::Left)), ProductionStep::new(Symbol::non_terminal(2)) .with_prec(Precedence::Integer(101), Some(Associativity::Left)), ] }] ); let result = flatten_variable(Variable { name: "test".to_string(), kind: VariableType::Named, rule: Rule::prec_left( Precedence::Integer(101), Rule::seq(vec![Rule::non_terminal(1)]), ), }) .unwrap(); assert_eq!( result.productions, vec![Production { dynamic_precedence: 0, steps: vec![ProductionStep::new(Symbol::non_terminal(1)) .with_prec(Precedence::Integer(101), Some(Associativity::Left)),] }] ); }
rust_cleaned_test_functions.jsonl/122535
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 852 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5081, 14456, 62, 41094, 6615, 20676, 10442, 1998, 763, 368, 341, 286, 1077, 1102, 284, 45343, 14635, 7, 7827, 341, 310, 829, 25, 330, 1944, 3263, 983, 3904, 3148, 310, 3093, 25, 12407, 929, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_delta() { let mut rng = rand::thread_rng(); let y = Scalar::random(&mut rng); let z = Scalar::random(&mut rng); // Choose n = 256 to ensure we overflow the group order during let n = 256; // code copied from previous implementation let z2 = z * z; let z3 = z2 * z; let mut power_g = Scalar::zero(); let mut exp_y = Scalar::one(); // start at y^0 = 1 let mut exp_2 = Scalar::one(); // start at 2^0 = 1 for _ in 0..n { power_g += (z - z2) * exp_y - z3 * exp_2; exp_y = exp_y * y; exp_2 = exp_2 + exp_2; } assert_eq!(power_g, delta(n, 1, &y, &z),); }
rust_cleaned_test_functions.jsonl/17372
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 382 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26710, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 286, 1077, 379, 284, 35176, 486, 11463, 2099, 6984, 28422, 317, 286, 1077, 1147, 284, 35176, 486, 11463, 2099, 6984, 284...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_resolve_module_5() { let (_temp_dir, deno_dir) = test_setup(); let module_specifier = "http://localhost:4545/tests/subdir/mod2.ts"; let containing_file = add_root!("/deno/tests/006_url_imports.ts"); let expected_module_name = "http://localhost:4545/tests/subdir/mod2.ts"; let expected_filename = deno_fs::normalize_path( deno_dir .deps .join("localhost_PORT4545/tests/subdir/mod2.ts") .as_ref(), ); let (module_name, filename) = deno_dir .resolve_module(module_specifier, containing_file) .unwrap(); assert_eq!(module_name, expected_module_name); assert_eq!(filename, expected_filename); }
rust_cleaned_test_functions.jsonl/42048
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 267 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 77291, 10750, 62, 20, 368, 341, 220, 1077, 5453, 3888, 4334, 11, 3371, 78, 4334, 8, 284, 1273, 21363, 1428, 220, 1077, 4688, 13594, 3049, 284, 330, 1254, 1110, 8301, 25, 19, 20, 19, 20, 62468,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_human_formatted() { assert_eq!(dur(10, 4), parse_dur("10m 4s").unwrap()); assert_eq!(dur(19, 3), parse_dur("19m3s").unwrap()); assert_eq!(dur(0, 10), parse_dur(" 10 ").unwrap()); assert_eq!(dur(0, 9), parse_dur("6s 3s").unwrap()); // Units are added assert!(parse_dur("s").is_err()); assert!(parse_dur("10s m").is_err()); assert!(parse_dur("10sm").is_err()); }
rust_cleaned_test_functions.jsonl/51536
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 229 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 86247, 86610, 368, 341, 286, 2060, 10714, 10297, 70692, 7, 16, 15, 11, 220, 19, 701, 4715, 82289, 445, 16, 15, 76, 220, 19, 82, 1827, 15454, 1423, 286, 2060, 10714, 10297, 70692, 7, 16, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_basic_timeout() { let (mut pm, mut timeout_rx) = make_pacemaker(); // jump start the pacemaker pm.process_certificates(Some(0), None, None); for _ in 0..2 { let round = block_on(timeout_rx.next()).unwrap(); // round for timeout is not changed as no timeout certificate was gathered at this point assert_eq!(1, round); pm.process_local_timeout(round); } }
rust_cleaned_test_functions.jsonl/9072
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34729, 20537, 368, 341, 262, 1077, 320, 6984, 8836, 11, 5206, 9632, 24330, 8, 284, 1281, 620, 580, 58675, 1428, 262, 442, 7784, 1191, 279, 22894, 58675, 198, 262, 8836, 16988, 37097, 24405, 65405,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_process_unknown_command() { let mut rng = ThreadRng256 {}; let user_immediately_present = |_| Ok(()); let mut ctap_state = CtapState::new(&mut rng, user_immediately_present); // This command does not exist. let reset_reponse = ctap_state.process_command(&[0xDF], DUMMY_CHANNEL_ID); let expected_response = vec![Ctap2StatusCode::CTAP1_ERR_INVALID_COMMAND as u8]; assert_eq!(reset_reponse, expected_response); }
rust_cleaned_test_functions.jsonl/35319
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 57507, 10811, 368, 341, 286, 1077, 5206, 28422, 284, 8752, 49, 968, 17, 20, 21, 9321, 286, 1077, 1196, 17895, 43187, 36976, 284, 66091, 7622, 7, 1423, 286, 1077, 5206, 20251, 391, 4387, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_invalid_framing() { let input = "--BEGIN data----- -----END data-----"; assert_eq!(parse(&input), Err(PemError::MalformedFraming)); }
rust_cleaned_test_functions.jsonl/61389
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 86 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 31433, 761, 2396, 287, 368, 341, 286, 1077, 1946, 284, 14482, 37588, 821, 34764, 286, 34703, 4689, 821, 15081, 876, 286, 2060, 10714, 10297, 6400, 2099, 1355, 701, 15495, 5304, 336, 1454, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_trim_end_matches() { let tests: Vec<(_, _, _)> = vec![ ("/a/b/cde/", "/", "/a/b/cde"), ("\nhello\nworld\n", "\n", "\nhello\nworld"), (", hello, world, ", ", ", ", hello, world"), ]; for (input, pat, expected) in tests { let mut args = HashMap::new(); args.insert("pat".to_string(), to_value(pat).unwrap()); let result = trim_end_matches(&to_value(input).unwrap(), &args); assert!(result.is_ok()); assert_eq!(result.unwrap(), to_value(expected).unwrap()); } }
rust_cleaned_test_functions.jsonl/119640
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 317 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70025, 6213, 38344, 368, 341, 286, 1077, 7032, 25, 11312, 27, 41117, 8358, 716, 16018, 284, 7486, 90515, 310, 88889, 64, 3470, 2899, 450, 28105, 64657, 3521, 64, 3470, 2899, 450, 4461, 310, 51658,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_fq_repr_is_zero() { assert!(BigInteger256::from(0).is_zero()); assert!(!BigInteger256::from(1).is_zero()); assert!(!BigInteger256([0, 0, 1, 0]).is_zero()); }
rust_cleaned_test_functions.jsonl/3540
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 68535, 6892, 19359, 368, 341, 262, 2060, 10297, 53219, 17, 20, 21, 486, 1499, 7, 15, 568, 285, 19359, 1423, 262, 2060, 0, 3471, 53219, 17, 20, 21, 486, 1499, 7, 16, 568, 285, 19359,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encoder_send() { fn check_send<S: Send>(_: &S) {} let enc = EncoderBuilder::new().build(Vec::new()); check_send(&enc); }
rust_cleaned_test_functions.jsonl/118878
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 86 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39068, 13565, 368, 341, 286, 5168, 1779, 13565, 18858, 25, 11000, 2235, 23211, 609, 50, 8, 5613, 286, 1077, 3209, 284, 55115, 3297, 486, 931, 1005, 5834, 49923, 486, 931, 1423, 286, 1779, 13565, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_simpleslicedeserializer_impl() { let data: [u8; 4] = [0; 4]; let mut v = SimpleSliceDeserializer::new(&data); for i in 0..4 { v.offset = i; assert_eq!(v.offset(), i); assert_eq!(v.avaliable(), 4 - i); for r in 0..v.avaliable() { v.can_read(r).unwrap(); } assert!(matches!( v.can_read(v.avaliable() + 1), Err(ErrorKind::UnableToRead) )); } }
rust_cleaned_test_functions.jsonl/90004
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 258 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 6664, 642, 415, 58526, 41939, 21007, 368, 341, 262, 1077, 821, 25, 508, 84, 23, 26, 220, 19, 60, 284, 508, 15, 26, 220, 19, 935, 262, 1077, 5206, 348, 284, 8993, 33236, 80097, 486, 931,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parse_int() { assert_eq!(parse_int::<u16>(b"0"), Some(0)); assert_eq!(parse_int::<u8>(b"12"), Some(12)); assert_eq!(parse_int::<u16>(b"2018"), Some(2018)); assert_eq!(parse_int::<u32>(b"2018"), Some(2018)); assert_eq!(parse_int::<u32>(b"01d8"), None); assert_eq!(parse_int::<u32>(b"-018"), None); assert_eq!(parse_int::<i16>(b"0"), Some(0)); assert_eq!(parse_int::<i16>(b"-12"), Some(-12)); assert_eq!(parse_int::<i16>(b"2018"), Some(2018)); assert_eq!(parse_int::<i32>(b"-018"), Some(-18)); assert_eq!(parse_int::<i32>(b"-0d18"), None); }
rust_cleaned_test_functions.jsonl/100
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 341 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4042, 368, 341, 286, 2060, 10714, 10297, 6400, 4042, 27638, 84, 16, 21, 2235, 65, 1, 15, 3975, 4329, 7, 15, 1106, 286, 2060, 10714, 10297, 6400, 4042, 27638, 84, 23, 2235, 65, 1, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_guide_library_rejects_mixed_length() { let g1 = Guide::new(0, "foo-1", "ACGTCAGCATGCATGACGTT", "FOO", GuideType::Other); let g2 = Guide::new(1, "foo-2", "GCTAGACTGGACTCTAATGCC", "FOO", GuideType::Other); let result = GuideLibrary::new(vec![g1, g2]); assert!(result.err().unwrap().to_string().contains("More than one guide length found")); }
rust_cleaned_test_functions.jsonl/48768
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 182 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80407, 39461, 1288, 583, 82, 717, 3286, 5118, 368, 341, 286, 1077, 342, 16, 284, 12712, 486, 931, 7, 15, 11, 330, 7975, 12, 16, 497, 330, 1706, 38, 7749, 1890, 28196, 22863, 828, 38, 1706, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitive_array_gt_eq_scalar() { cmp_i64_scalar!( gt_eq_scalar, vec![6, 7, 8, 9, 10, 6, 7, 8, 9, 10], 8, vec![false, false, true, true, true, false, false, true, true, true] ); }
rust_cleaned_test_functions.jsonl/36031
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 166 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84087, 3858, 37479, 10714, 41652, 368, 341, 286, 26089, 5318, 21, 19, 41652, 33673, 310, 25161, 10714, 41652, 345, 310, 7486, 20703, 21, 11, 220, 22, 11, 220, 23, 11, 220, 24, 11, 220, 16, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_record_schema_with_currently_parsing_schema() { let schema = Schema::parse_str( r#" { "type": "record", "name": "test", "fields": [{ "name": "recordField", "type": { "type": "record", "name": "Node", "fields": [ {"name": "label", "type": "string"}, {"name": "children", "type": {"type": "array", "items": "Node"}} ] } }] } "#, ) .unwrap(); let mut lookup = HashMap::new(); lookup.insert("recordField".to_owned(), 0); let mut node_lookup = HashMap::new(); node_lookup.insert("children".to_owned(), 1); node_lookup.insert("label".to_owned(), 0); let expected = Schema::Record { name: Name::new("test"), doc: None, fields: vec![RecordField { name: "recordField".to_string(), doc: None, default: None, schema: Schema::Record { name: Name::new("Node"), doc: None, fields: vec![ RecordField { name: "label".to_string(), doc: None, default: None, schema: Schema::String, order: RecordFieldOrder::Ascending, position: 0, }, RecordField { name: "children".to_string(), doc: None, default: None, schema: Schema::Array(Box::new(Schema::Ref { name: Name::new("Node"), })), order: RecordFieldOrder::Ascending, position: 1, }, ], lookup: node_lookup, }, order: RecordFieldOrder::Ascending, position: 0, }], lookup, }; assert_eq!(schema, expected); let canonical_form = &schema.canonical_form(); let expected = r#"{"name":"test","type":"record","fields":[{"name":"recordField","type":{"name":"Node","type":"record","fields":[{"name":"label","type":"string"},{"name":"children","type":{"type":"array","items":"Node"}}]}}]}"#; assert_eq!(canonical_form, &expected); }
rust_cleaned_test_functions.jsonl/108436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1701 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14192, 25371, 6615, 11080, 398, 620, 28598, 25371, 368, 341, 286, 1077, 10802, 284, 12539, 486, 6400, 2895, 1006, 310, 435, 2, 698, 310, 341, 394, 330, 1313, 788, 330, 8548, 756, 394, 330, 606, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_move_iter() { let v = SmallVector::zero(); let v: Vec<int> = v.move_iter().collect(); assert_eq!(Vec::new(), v); let v = SmallVector::one(1); assert_eq!(vec!(1), v.move_iter().collect()); let v = SmallVector::many(vec!(1, 2, 3)); assert_eq!(vec!(1, 2, 3), v.move_iter().collect()); }
rust_cleaned_test_functions.jsonl/86520
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 183 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17134, 11723, 368, 341, 286, 1077, 348, 284, 14994, 3781, 486, 14154, 543, 286, 1077, 348, 25, 11312, 4159, 29, 284, 348, 13635, 11723, 1005, 17384, 543, 286, 2060, 10714, 10297, 10050, 486, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_physical_memory_map_from_u32_gets_valid_segment() { let address: u32 = 0x1000_0000; let expected_map: PhysicalMap = PhysicalMap::CartridgeDomain1_2; let result_map: PhysicalMap = PhysicalMap::from_u32(address); assert_eq!(expected_map, result_map); }
rust_cleaned_test_functions.jsonl/77138
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84980, 19195, 5376, 5673, 7300, 18, 17, 3062, 82, 8337, 28061, 368, 341, 220, 1077, 2621, 25, 575, 18, 17, 284, 220, 15, 87, 16, 15, 15, 15, 62, 15, 15, 15, 15, 280, 220, 1077, 3601, 5376,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hash_as_u64() { let arr: Vec<u8> = (0..HASH_BYTES).map(|i| i as u8 + 1).collect(); let hash = Hash::new(&arr); assert_eq!(CrdsFilter::hash_as_u64(&hash), 0x807060504030201); }
rust_cleaned_test_functions.jsonl/82264
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8950, 11898, 7300, 21, 19, 368, 341, 286, 1077, 2890, 25, 11312, 34837, 23, 29, 284, 320, 15, 496, 70707, 40705, 568, 2186, 22428, 72, 91, 600, 438, 575, 23, 488, 220, 16, 568, 17384, 543, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_export_to_json() { let descriptor = "wpkh(xprv9s21ZrQH143K4CTb63EaMxja1YiTnSEWKMbn23uoEnAzxjdUJRQkazCAtzxGm4LSoTSVTptoV9RbchnKPW9HxKtZumdyxyikZFDLhogJ5Uj/44'/0'/0'/0/*)"; let change_descriptor = "wpkh(xprv9s21ZrQH143K4CTb63EaMxja1YiTnSEWKMbn23uoEnAzxjdUJRQkazCAtzxGm4LSoTSVTptoV9RbchnKPW9HxKtZumdyxyikZFDLhogJ5Uj/44'/0'/0'/1/*)"; let wallet = Wallet::new_offline( descriptor, Some(change_descriptor), Network::Bitcoin, get_test_db(), ) .unwrap(); let export = WalletExport::export_wallet(&wallet, "Test Label", true).unwrap(); assert_eq!(export.to_string(), "{\"descriptor\":\"wpkh(xprv9s21ZrQH143K4CTb63EaMxja1YiTnSEWKMbn23uoEnAzxjdUJRQkazCAtzxGm4LSoTSVTptoV9RbchnKPW9HxKtZumdyxyikZFDLhogJ5Uj/44\'/0\'/0\'/0/*)\",\"blockheight\":5000,\"label\":\"Test Label\"}"); }
rust_cleaned_test_functions.jsonl/21477
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 519 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27114, 2346, 9455, 368, 341, 286, 1077, 16414, 284, 330, 8421, 30664, 2075, 649, 85, 24, 82, 17, 16, 57, 81, 48, 39, 16, 19, 18, 42, 19, 1162, 65, 21, 18, 36, 64, 44, 87, 5580, 16, 56, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_persist_app() { block_on(async { let config = config_generator(); let storage = Rc::new(Mutex::new(MemStorage::new())); let app_set = make_test_app_set(); StateMachineBuilder::new( StubPolicyEngine, StubHttpRequest, StubInstaller::default(), StubTimer, StubMetricsReporter, Rc::clone(&storage), config, app_set.clone(), ) .oneshot_check(CheckOptions::default()) .await .map(|_| ()) .collect::<()>() .await; let storage = storage.lock().await; let apps = app_set.to_vec().await; storage.get_string(&apps[0].id).await.unwrap(); assert!(storage.committed()); }); }
rust_cleaned_test_functions.jsonl/126411
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 512 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 4975, 8191, 368, 341, 286, 2504, 4470, 18285, 341, 310, 1077, 2193, 284, 2193, 25813, 543, 310, 1077, 5819, 284, 81463, 486, 931, 3189, 9371, 486, 931, 3189, 336, 5793, 486, 931, 7392, 310,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_tokens() -> Result<(), io::Error> { // Given let mut vocab_file = tempfile::NamedTempFile::new()?; write!(vocab_file, "{{\"hello\": 1,\n \"world\": 0,\n \"<unk>\": 2,\n \"!\": 3\n}}")?; let path = vocab_file.into_temp_path(); let openai_gpt_vocab = OpenAiGptVocab::from_file(path.to_path_buf().to_str().unwrap()); assert_eq!(openai_gpt_vocab.id_to_token(&(1 as i64)), "hello"); assert_eq!(openai_gpt_vocab.id_to_token(&(0 as i64)), "world"); assert_eq!(openai_gpt_vocab.id_to_token(&(3 as i64)), "!"); assert_eq!(openai_gpt_vocab.id_to_token(&(2 as i64)), "<unk>"); drop(path); Ok(()) }
rust_cleaned_test_functions.jsonl/25062
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 364 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 28838, 368, 1464, 5714, 68843, 6399, 486, 1454, 29, 341, 322, 286, 16246, 198, 286, 1077, 5206, 23820, 2458, 284, 54819, 486, 15810, 12151, 1703, 486, 931, 94136, 286, 3270, 10297, 86847, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parallel_vs_sequential() { let prod_ctor = || (0u32..100); let xform_ctor = || do_some_work; let result_xform = |acc: u32, x| acc.wrapping_add(x); let prod = prod_ctor(); let par_r = ParallelIterator::new(prod_ctor, xform_ctor).fold(0, &result_xform); let seq_r = prod.map(do_some_work).fold(0, &result_xform); assert_eq!(par_r, seq_r); }
rust_cleaned_test_functions.jsonl/57636
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 220 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60625, 42434, 3453, 15838, 368, 341, 286, 1077, 14475, 54185, 284, 1369, 320, 15, 84, 18, 17, 496, 16, 15, 15, 317, 286, 1077, 856, 627, 54185, 284, 1369, 653, 61855, 11498, 280, 286, 1077, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_no_maturity_increase_if_no_proposal() { // Single neuron assert_eq!(compute_maturities(vec![1], Vec::<&str>::new()), vec![0]); // Two neurons assert_eq!( compute_maturities(vec![1, 5], Vec::<&str>::new()), vec![0, 0] ); }
rust_cleaned_test_functions.jsonl/1132
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 717, 37854, 73807, 11119, 6536, 21663, 32556, 368, 341, 262, 442, 11327, 48284, 198, 262, 2060, 10714, 10297, 27706, 717, 2628, 1361, 25592, 20703, 16, 1125, 11312, 27638, 5, 495, 6831, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_neuron_action_is_not_authorized() { local_test_on_sns_subnet(|runtime| async move { let neuron_owner = Sender::from_keypair(&TEST_USER1_KEYPAIR); let unauthorized_caller = Sender::from_keypair(&TEST_USER2_KEYPAIR); let neuron_owner_account_identifier = AccountIdentifier::from(neuron_owner.get_principal_id()); let alloc = Tokens::from_tokens(1000).unwrap(); let system_params = NervousSystemParameters { neuron_claimer_permissions: Some(NeuronPermissionList { permissions: NeuronPermissionType::all(), }), ..NervousSystemParameters::with_default_values() }; let sns_init_payload = SnsInitPayloadsBuilder::new() .with_ledger_account(neuron_owner_account_identifier, alloc) .with_nervous_system_parameters(system_params) .build(); let sns_canisters = SnsCanisters::set_up(&runtime, sns_init_payload).await; // Stake and claim a neuron capable of making a proposal let neuron_owner_nid = sns_canisters .stake_and_claim_neuron(&neuron_owner, Some(ONE_YEAR_SECONDS as u32)) .await; // Get that neuron's subaccount let neuron_owner_subaccount = neuron_owner_nid .subaccount() .expect("Error creating the subaccount"); let proposal_payload = Proposal { title: "Motion to delete this SNS".into(), action: Some(Action::Motion(Motion { motion_text: "I'm a bad actor and this should not be tolerated".into(), })), ..Default::default() }; let manage_neuron_response: ManageNeuronResponse = sns_canisters .governance .update_from_sender( "manage_neuron", candid_one, ManageNeuron { subaccount: neuron_owner_subaccount.to_vec(), command: Some(Command::MakeProposal(proposal_payload)), }, &unauthorized_caller, ) .await .expect("Error calling manage_neuron"); match manage_neuron_response.command.unwrap() { CommandResponse::Error(e) => assert_eq!(e.error_type, ErrorType::NotAuthorized as i32), response => panic!("Unexpected response, {:?}", response), } Ok(()) }); }
rust_cleaned_test_functions.jsonl/107250
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13925, 36090, 7931, 6892, 7913, 62, 19084, 368, 341, 262, 2205, 4452, 4470, 643, 4412, 95681, 22428, 22255, 91, 3312, 3271, 341, 286, 1077, 48284, 29027, 284, 54610, 486, 1499, 3097, 12670, 2099, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_message_unique_program_ids() { let program_id0 = Pubkey::default(); let program_ids = get_program_ids(&[ Instruction::new_with_bincode(program_id0, &0, vec![]), Instruction::new_with_bincode(program_id0, &0, vec![]), ]); assert_eq!(program_ids, vec![program_id0]); }
rust_cleaned_test_functions.jsonl/55512
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6462, 21218, 25096, 8077, 368, 341, 286, 1077, 2025, 842, 15, 284, 22611, 792, 486, 2258, 543, 286, 1077, 2025, 8077, 284, 633, 25096, 8077, 2099, 9640, 310, 29051, 486, 931, 6615, 21816, 1851, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lograte_env() { assert_ne!(DEFAULT_LOG_RATE, 0); let _writelock = get_env_lock().write(); static mut COUNTER: Counter = create_counter!("test_lograte_env", 0, 1); env::set_var("SOLANA_DEFAULT_LOG_RATE", "50"); inc_counter!(COUNTER, Level::Error, 2); unsafe { assert_eq!(COUNTER.lograte.load(Ordering::Relaxed), 50); } static mut COUNTER2: Counter = create_counter!("test_lograte_env", 0, 1); env::set_var("SOLANA_DEFAULT_LOG_RATE", "0"); inc_counter!(COUNTER2, Level::Error, 2); unsafe { assert_eq!(COUNTER2.lograte.load(Ordering::Relaxed), DEFAULT_LOG_RATE); } }
rust_cleaned_test_functions.jsonl/92061
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 353 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5224, 7698, 15879, 368, 341, 286, 2060, 13925, 10297, 17285, 8419, 29108, 11, 220, 15, 317, 286, 1077, 716, 86, 58962, 1176, 284, 633, 15879, 9818, 1005, 4934, 543, 286, 1099, 5206, 356, 35019, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_containing() { let mut map = HashMap::new(); map.insert("hey", 1); let tests = vec![ (to_value("hello world").unwrap(), to_value("hel").unwrap(), true), (to_value("hello world").unwrap(), to_value("hol").unwrap(), false), (to_value(vec![1, 2, 3]).unwrap(), to_value(3).unwrap(), true), (to_value(vec![1, 2, 3]).unwrap(), to_value(4).unwrap(), false), (to_value(map.clone()).unwrap(), to_value("hey").unwrap(), true), (to_value(map.clone()).unwrap(), to_value("ho").unwrap(), false), ]; for (container, needle, expected) in tests { assert_eq!(containing(Some(&container), &[needle]).unwrap(), expected); } }
rust_cleaned_test_functions.jsonl/125455
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 359 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10260, 2056, 368, 341, 286, 1077, 5206, 2415, 284, 10528, 486, 931, 543, 286, 2415, 7030, 445, 35561, 497, 220, 16, 626, 286, 1077, 7032, 284, 7486, 90515, 310, 320, 983, 3142, 445, 14990, 1879,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_slice_serialize_deserialize() { let config = ReadConfig { error_on_trailing_bytes: true, }; let test = Test { slice: b"Hello there", }; let mut slice = [0u8; 1024]; let length = binver::write_to_slice(&mut slice, &test).unwrap(); assert_eq!(slice[6..10], (test.slice.len() as u32).to_be_bytes()); assert_eq!(&slice[..length][10..], test.slice); let result: Test = binver::deserialize_slice_with_config(&slice[..length], config).unwrap(); assert_eq!(result.slice, b"Hello there"); }
rust_cleaned_test_functions.jsonl/103509
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26488, 88686, 15768, 9050, 368, 341, 262, 1077, 2193, 284, 4457, 2648, 341, 286, 1465, 4470, 3547, 14277, 12524, 25, 830, 345, 262, 3634, 262, 1077, 1273, 284, 3393, 341, 286, 15983, 25, 293, 1,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_algo_with_prefix_to_url() { let mock_client = mock_client(); let algorithm = mock_client.algo("algo://anowell/Pinky/0.1"); assert_eq!( algorithm.to_url().unwrap().path(), "/v1/algo/anowell/Pinky/0.1" ); }
rust_cleaned_test_functions.jsonl/692
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 153 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 76993, 6615, 13974, 2346, 2903, 368, 341, 286, 1077, 7860, 8179, 284, 7860, 8179, 543, 286, 1077, 12111, 284, 7860, 8179, 12168, 3346, 445, 72464, 1110, 276, 79499, 16341, 38034, 14, 15, 13, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_dependencies() { fn do_check(toml: &str, expected: Vec<Dependency>) { let cargo_toml = CargoToml::new(toml).unwrap(); assert_eq!(cargo_toml.dependencies(), expected); } do_check(r#" [dependencies] foo = "1.0" bar = { git = "https://example.com" } [dependencies.baz] version = "2.0" git = "https://example.com" branch = "dev" "#, vec![ Dependency { name: "bar".to_string(), optional: false, source: DependencySource::Git { url: "https://example.com".to_string(), version: None, branch: None, }, }, Dependency { name: "baz".to_string(), optional: false, source: DependencySource::Git { url: "https://example.com".to_string(), version: Some("2.0".to_string()), branch: Some("dev".to_string()), }, }, Dependency { name: "foo".to_string(), optional: false, source: DependencySource::Version("1.0".to_string()), }, ]); do_check(r#" dependencies = { foo = "1.0", bar = { git = "https://example.com" } } "#, vec![ Dependency { name: "bar".to_string(), optional: false, source: DependencySource::Git { url: "https://example.com".to_string(), version: None, branch: None, }, }, Dependency { name: "foo".to_string(), optional: false, source: DependencySource::Version("1.0".to_string()), }, ]); do_check(r#" dependencies.foo = "1.0" dependencies.bar.git = "https://example.com" dependencies.bar.version = "2.0" dependencies.baz = { version = "9.2" } "#, vec![ Dependency { name: "bar".to_string(), optional: false, source: DependencySource::Git { url: "https://example.com".to_string(), version: Some("2.0".to_string()), branch: None, }, }, Dependency { name: "baz".to_string(), optional: false, source: DependencySource::Version("9.2".to_string()), }, Dependency { name: "foo".to_string(), optional: false, source: DependencySource::Version("1.0".to_string()), }, ]); do_check(r#" [dependencies] bar.git = "https://example.com" bar.version = "2.0" "#, vec![Dependency { name: "bar".to_string(), optional: false, source: DependencySource::Git { url: "https://example.com".to_string(), version: Some("2.0".to_string()), branch: None, }, }]); }
rust_cleaned_test_functions.jsonl/99638
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1502 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 71841, 368, 341, 262, 5168, 653, 7200, 1155, 316, 75, 25, 609, 495, 11, 3601, 25, 11312, 27, 36387, 9231, 341, 286, 1077, 25652, 528, 316, 75, 284, 61288, 24732, 75, 486, 931, 1155, 316,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_main_thread_task() { let myself = Process::myself().unwrap(); let task = myself.task_main_thread().unwrap(); check_unwrap(&myself, task.stat()); }
rust_cleaned_test_functions.jsonl/17534
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 72 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11027, 10814, 12184, 368, 341, 262, 1077, 7037, 284, 8603, 486, 2408, 721, 1005, 15454, 543, 262, 1077, 3383, 284, 7037, 15034, 11027, 10814, 1005, 15454, 543, 262, 1779, 4907, 10097, 2099, 2408, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_json_block() { let n = Block { base: BaseNode::default(), body: vec![Statement::Expr(ExprStmt { base: BaseNode::default(), expression: Expression::StringLit(StringLit { base: Default::default(), value: "hello".to_string(), }), })], }; let serialized = serde_json::to_string(&n).unwrap(); assert_eq!( serialized, r#"{"type":"Block","body":[{"type":"ExpressionStatement","expression":{"type":"StringLiteral","value":"hello"}}]}"# ); let deserialized: Block = serde_json::from_str(serialized.as_str()).unwrap(); assert_eq!(deserialized, n) }
rust_cleaned_test_functions.jsonl/40417
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 321 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 7113, 368, 341, 262, 1077, 308, 284, 8362, 341, 286, 2331, 25, 5351, 1955, 486, 2258, 3148, 286, 2487, 25, 7486, 20703, 8636, 486, 16041, 7, 16041, 31063, 341, 310, 2331, 25, 5351, 1955, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_auto_import_split_common_target_longer() { check_assist( add_import, " use std::fmt::Debug; impl std::fmt::nested::Display<|> for Foo { } ", " use std::fmt::{ nested::Display, Debug}; impl Display<|> for Foo { } ", ); }
rust_cleaned_test_functions.jsonl/39957
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 156 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27740, 18434, 17052, 21107, 11123, 17799, 261, 368, 341, 286, 1779, 12083, 380, 1006, 310, 912, 18434, 345, 310, 6228, 810, 1460, 486, 12501, 486, 7939, 401, 6383, 1460, 486, 12501, 486, 59271, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_disk_backing_file_helper() { let num_sectors = 2; let f = TempFile::new().unwrap(); let size = SECTOR_SIZE * num_sectors; f.as_file().set_len(size).unwrap(); let disk_properties = DiskProperties::new(String::from(f.as_path().to_str().unwrap()), true).unwrap(); assert_eq!(size, SECTOR_SIZE * num_sectors); assert_eq!(disk_properties.nsectors, num_sectors); let cfg = disk_properties.virtio_block_config_space(); assert_eq!(cfg.len(), CONFIG_SPACE_SIZE); for (i, byte) in cfg.iter().enumerate() { assert_eq!(*byte, (num_sectors >> (8 * i)) as u8); } assert!(DiskProperties::new("invalid-disk-path".to_string(), true).is_err()); }
rust_cleaned_test_functions.jsonl/73913
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 385 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41687, 3895, 287, 2458, 10418, 368, 341, 286, 1077, 1629, 3453, 12532, 284, 220, 17, 280, 286, 1077, 282, 284, 19944, 1703, 486, 931, 1005, 15454, 543, 286, 1077, 1379, 284, 5052, 26275, 4098, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_vcx_schema_get_attrs_with_pool() { let _setup = SetupLibraryWalletPoolZeroFees::init(); let (schema_id, _) = libindy::utils::anoncreds::tests::create_and_write_test_schema(utils::constants::DEFAULT_SCHEMA_ATTRS); let cb = return_types_u32::Return_U32_U32_STR::new().unwrap(); assert_eq!(vcx_schema_get_attributes(cb.command_handle, CString::new("Test Source ID").unwrap().into_raw(), CString::new(schema_id).unwrap().into_raw(), Some(cb.get_callback())), error::SUCCESS.code_num); let (_err, attrs) = cb.receive(TimeoutUtils::some_short()).unwrap(); let mut result_vec = vec!(attrs.clone().unwrap()); let mut expected_vec = vec!(DEFAULT_SCHEMA_ATTRS); assert_eq!(result_vec.sort(), expected_vec.sort()); }
rust_cleaned_test_functions.jsonl/118201
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 478 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 25844, 25371, 3062, 39578, 6615, 15709, 368, 341, 286, 1077, 716, 15188, 284, 18626, 16915, 38259, 10551, 17999, 37, 5516, 486, 2327, 1428, 286, 1077, 320, 17349, 842, 11, 27439, 284, 3051, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_maximum_too_low() { let array = [0u8; 2048]; FastCDC::new(&array, 64, 256, 1023); }
rust_cleaned_test_functions.jsonl/32055
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 66 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 93581, 2346, 78, 23767, 368, 341, 286, 1077, 1334, 284, 508, 15, 84, 23, 26, 220, 17, 15, 19, 23, 935, 286, 17288, 73458, 486, 931, 2099, 1653, 11, 220, 21, 19, 11, 220, 17, 20, 21, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_verify_root_mismatch() { let (root, proof, _) = test_generate_proof::<NoExtensionLayout>( test_entries(), vec![b"bravo"], ); let items = vec![ (b"bravo", Some("incorrect")), ]; match verify_proof::<NoExtensionLayout, _, _, _>(&root, &proof, items.iter()) { Err(VerifyError::RootMismatch(_)) => {} result => panic!("expected VerifyError::RootMismatch, got {:?}", result), } }
rust_cleaned_test_functions.jsonl/56662
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35638, 12993, 717, 24976, 368, 341, 10217, 320, 2888, 11, 11064, 11, 27439, 284, 1273, 48851, 86757, 27638, 2753, 12049, 2175, 17055, 197, 18185, 26092, 3148, 197, 40213, 20703, 65, 1, 1323, 27217, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_less_than() { assert_expression!( "A < B", Expression::BinaryExpression( Operator::Less, Box::new("A".as_var_expr(1, 7)), Box::new("B".as_var_expr(1, 11)), ExpressionType::Unresolved ) ); }
rust_cleaned_test_functions.jsonl/102631
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 201 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50747, 51613, 368, 341, 286, 2060, 28068, 33673, 310, 330, 32, 366, 425, 756, 310, 16378, 486, 21338, 9595, 1006, 394, 28498, 486, 27451, 345, 394, 8261, 486, 931, 445, 32, 3263, 300, 4612, 2191...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encode_bytes_compare() { let pairs: Vec<(&[u8], &[u8], _)> = vec![ (b"", b"\x00", Ordering::Less), (b"\x00", b"\x00", Ordering::Equal), (b"\xFF", b"\x00", Ordering::Greater), (b"\xFF", b"\xFF\x00", Ordering::Less), (b"a", b"b", Ordering::Less), (b"a", b"\x00", Ordering::Greater), (b"\x00", b"\x01", Ordering::Less), (b"\x00\x01", b"\x00\x00", Ordering::Greater), (b"\x00\x00\x00", b"\x00\x00", Ordering::Greater), (b"\x00\x00\x00", b"\x00\x00", Ordering::Greater), ( b"\x00\x00\x00\x00\x00\x00\x00\x00", b"\x00\x00\x00\x00\x00\x00\x00\x00\x00", Ordering::Less, ), (b"\x01\x02\x03\x00", b"\x01\x02\x03", Ordering::Greater), (b"\x01\x03\x03\x04", b"\x01\x03\x03\x05", Ordering::Less), ( b"\x01\x02\x03\x04\x05\x06\x07", b"\x01\x02\x03\x04\x05\x06\x07\x08", Ordering::Less, ), ( b"\x01\x02\x03\x04\x05\x06\x07\x08\x09", b"\x01\x02\x03\x04\x05\x06\x07\x08", Ordering::Greater, ), ( b"\x01\x02\x03\x04\x05\x06\x07\x08\x00", b"\x01\x02\x03\x04\x05\x06\x07\x08", Ordering::Greater, ), ]; for (x, y, ord) in pairs { assert_eq!(encode_bytes(x).cmp(&encode_bytes(y)), ord); assert_eq!( encode_bytes_desc(x).cmp(&encode_bytes_desc(y)), ord.reverse() ); } }
rust_cleaned_test_functions.jsonl/55211
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1173 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 12524, 32235, 368, 341, 286, 1077, 13530, 25, 11312, 27, 2099, 58, 84, 23, 1125, 44590, 84, 23, 1125, 716, 16018, 284, 7486, 90515, 310, 320, 65, 56323, 293, 11934, 87, 15, 15, 497, 686...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_config_defaults_with_serialization() { let _ = env_logger::builder().is_test(true).try_init(); if serde_json::from_str::<ConfigurationSpec>(r#"{}"#).is_ok() { panic!("discovery handler is required"); } serde_json::from_str::<ConfigurationSpec>( r#"{"discoveryHandler":{"name":"random", "discoveryDetails":"serialized details"}}"#, ) .unwrap(); if serde_json::from_str::<ConfigurationSpec>(r#"{"discoveryHandler":{"name":"random"}}"#) .is_err() { panic!("discovery details are not required"); } if serde_json::from_str::<ConfigurationSpec>(r#"{"discoveryHandler":{}}"#).is_ok() { panic!("discovery handler name is required"); } let json = r#"{"discoveryHandler":{"name":"onvif", "discoveryDetails":"{\"onvif\":{}}"}}"#; let deserialized: ConfigurationSpec = serde_json::from_str(json).unwrap(); assert_eq!(default_capacity(), deserialized.capacity); assert_eq!(None, deserialized.broker_pod_spec); assert_eq!(None, deserialized.instance_service_spec); assert_eq!(None, deserialized.configuration_service_spec); assert_eq!(0, deserialized.broker_properties.len()); }
rust_cleaned_test_functions.jsonl/34768
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 566 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5332, 42290, 6615, 25602, 2022, 368, 341, 286, 1077, 716, 284, 6105, 27413, 486, 17850, 1005, 285, 4452, 3715, 568, 1539, 6137, 1428, 286, 421, 61570, 9455, 486, 1499, 2895, 27638, 7688, 8327, 223...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_update_epoch_slots_new_root() { let mut current_root = 0; let mut completed_slots = BTreeSet::new(); let node_info = Node::new_localhost_with_address(&BvmAddr::default()); let node_group_info = RwLock::new(NodeGroupInfo::new_with_invalid_keypair( node_info.info.clone(), )); let my_address = BvmAddr::new_rand(); let (completed_slots_sender, completed_slots_receiver) = channel(); // Send a new slot before the root is updated let newly_completed_slot = 63; completed_slots_sender .send(vec![newly_completed_slot]) .unwrap(); FixService::update_epoch_slots( my_address.clone(), current_root, &mut current_root.clone(), &mut completed_slots, &node_group_info, &completed_slots_receiver, ); // We should see epoch state update let (my_epoch_slots_in_gossip, updated_ts) = { let r_node_group_info = node_group_info.read().unwrap(); let (my_epoch_slots_in_gossip, updated_ts) = r_node_group_info .get_epoch_state_for_node(&my_address, None) .clone() .unwrap(); (my_epoch_slots_in_gossip.clone(), updated_ts) }; assert_eq!(my_epoch_slots_in_gossip.root, 0); assert_eq!(current_root, 0); assert_eq!(my_epoch_slots_in_gossip.slots.len(), 1); assert!(my_epoch_slots_in_gossip .slots .contains(&newly_completed_slot)); // Calling update again with no updates to either the roots or set of completed slots // should not update gossip FixService::update_epoch_slots( my_address.clone(), current_root, &mut current_root, &mut completed_slots, &node_group_info, &completed_slots_receiver, ); assert!(node_group_info .read() .unwrap() .get_epoch_state_for_node(&my_address, Some(updated_ts)) .is_none()); sleep(Duration::from_millis(10)); // Updating just the root again should update gossip (simulates replay phase updating root // after a slot has been signaled as completed) FixService::update_epoch_slots( my_address.clone(), current_root + 1, &mut current_root, &mut completed_slots, &node_group_info, &completed_slots_receiver, ); let r_node_group_info = node_group_info.read().unwrap(); let (my_epoch_slots_in_gossip, _) = r_node_group_info .get_epoch_state_for_node(&my_address, Some(updated_ts)) .clone() .unwrap(); // Check the root was updated correctly assert_eq!(my_epoch_slots_in_gossip.root, 1); assert_eq!(current_root, 1); assert_eq!(my_epoch_slots_in_gossip.slots.len(), 1); assert!(my_epoch_slots_in_gossip .slots .contains(&newly_completed_slot)); }
rust_cleaned_test_functions.jsonl/20953
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1586 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 20682, 54161, 5921, 12993, 368, 341, 286, 1077, 5206, 1482, 12993, 284, 220, 15, 401, 286, 1077, 5206, 8145, 54161, 284, 425, 6533, 1649, 486, 931, 543, 286, 1077, 2436, 3109, 284, 6018, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_list_in_out() { #[api_v2_schema] #[derive(Serialize, Deserialize)] enum Sort { Asc, Desc, } #[api_v2_schema] #[derive(Serialize, Deserialize)] struct Params { sort: Option<Sort>, limit: Option<u16>, } #[api_v2_operation] fn get_pets(_q: web::Query<Params>) -> web::Json<Vec<Pet>> { unimplemented!(); } run_and_check_app( || { App::new() .wrap_api() .with_json_spec_at("/api/spec") .service(web::resource("/pets").route(web::get().to(get_pets))) .build() }, |addr| { let mut resp = CLIENT .get(&format!("http://{}/api/spec", addr)) .send() .expect("request failed?"); check_json( &mut resp, json!({ "definitions": { "Pet": { "properties": { "class": { "enum": ["Dog", "Cat", "EverythingElse"], "type": "string" }, "id": { "format": "int64", "type": "integer" }, "name": { "type": "string" }, "updated": { "format": "date-time", "type": "string" }, "uid": { "format": "uuid", "type": "string" } }, "required":["class", "name", "updated"] } }, "paths": { "/pets": { "get": { "responses": { "200": { "schema": { "type": "array", "items": { "$ref": "#/definitions/Pet" } } } } }, "parameters": [{ "format": "int32", "in": "query", "name": "limit", "type": "integer" }, { "enum": ["Asc", "Desc"], "in": "query", "name": "sort", "type": "string" }], } }, "swagger": "2.0" }), ); }, ); }
rust_cleaned_test_functions.jsonl/95584
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2115 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 1243, 6068, 368, 341, 262, 11506, 2068, 2273, 17, 25371, 921, 262, 11506, 27098, 3759, 9050, 11, 48440, 5563, 262, 7618, 15967, 341, 286, 39560, 345, 286, 31185, 345, 262, 555, 262, 11506, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_internal_fn_big() -> Result<(), Box<EvalAltResult>> { let engine = Engine::new(); assert_eq!( engine.eval::<INT>( " fn math_me(a, b, c, d, e, f) { a - b * c + d * e - f } math_me(100, 5, 2, 9, 6, 32) ", )?, 112 ); Ok(()) }
rust_cleaned_test_functions.jsonl/131007
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 240 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23472, 15246, 36386, 368, 1464, 5714, 68843, 8261, 23835, 831, 26017, 2077, 2452, 341, 262, 1077, 4712, 284, 8200, 486, 931, 1428, 262, 2060, 10714, 33673, 286, 4712, 31710, 27638, 3221, 17055, 310,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_send_generic_message_fails_with_invalid_connection() { init!("true"); let handle = ::connection::tests::build_test_connection(); match send_generic_message(handle, "this is the message", "type", "title") { Ok(x) => panic!("test shoudl fail: {}", x), Err(x) => assert_eq!(x, error::NOT_READY.code_num), }; }
rust_cleaned_test_functions.jsonl/75280
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13565, 41232, 6462, 761, 6209, 6615, 31433, 15866, 368, 341, 286, 2930, 17223, 1866, 797, 286, 1077, 3705, 284, 3504, 7742, 486, 23841, 486, 5834, 4452, 15866, 1428, 286, 2432, 3624, 41232, 6462, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_or_as_filename() { new_ucmd!() .args(&["x", "-a", "-z", "-o"]) .run() .status_code(1); }
rust_cleaned_test_functions.jsonl/11035
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 83 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8734, 11898, 13323, 368, 341, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183, 87, 497, 6523, 64, 497, 6523, 89, 497, 6523, 78, 14108, 286, 659, 6108, 741, 286, 659, 2829, 4136, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_direct_read_write() { let path = tempdir_with_prefix("_rust_rocksdb_direct_read_write"); let mut opts = DBOptions::new(); opts.create_if_missing(true); opts.set_use_direct_reads(true); opts.set_use_direct_io_for_flush_and_compaction(true); DB::open(opts, path.path().to_str().unwrap()).unwrap(); }
rust_cleaned_test_functions.jsonl/34112
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32871, 6443, 9165, 368, 341, 262, 1077, 1815, 284, 2730, 3741, 6615, 13974, 16975, 35788, 26608, 14553, 1999, 32871, 6443, 9165, 797, 262, 1077, 5206, 12185, 284, 5952, 3798, 486, 931, 543, 262, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_angle_x() { let angle: Radians<f64> = Radians::full_turn_div_4(); let unit_y = Vector3::unit_y(); let unit_z = Vector3::unit_z(); let matrix = Matrix4x4::from_affine_angle_x(angle); let expected = unit_z.extend(0.0); let result = matrix * unit_y.extend(0.0); assert!(relative_eq!(result, expected, epsilon = 1e-8)); }
rust_cleaned_test_functions.jsonl/129124
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 21727, 3212, 368, 341, 286, 1077, 9210, 25, 431, 20736, 63895, 21, 19, 29, 284, 431, 20736, 486, 8878, 37274, 16237, 62, 19, 543, 286, 1077, 4982, 4178, 284, 4196, 18, 486, 3843, 4178, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_drop_panic() { let (array, receiver) = default_drop(); assert_eq!(receiver.try_recv().ok(), None); let result = thread::spawn(move || { array.set(DroppableElement::new(1, None)); }) .join(); assert!(result.is_err()); let indices = receiver.iter().collect::<Vec<_>>(); assert_eq!(indices.len(), 1); assert_eq!(indices[0], 0); }
rust_cleaned_test_functions.jsonl/13511
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 215 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29584, 620, 31270, 368, 341, 286, 1077, 320, 1653, 11, 13964, 8, 284, 1638, 29584, 1428, 286, 2060, 10714, 10297, 37553, 48779, 36118, 1005, 562, 1507, 2240, 626, 286, 1077, 1102, 284, 4516, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_is_valid_password() { assert_eq!(is_valid_password(112233), true); assert_eq!(is_valid_password(123444), false); assert_eq!(is_valid_password(111122), true); }
rust_cleaned_test_functions.jsonl/82656
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 78 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 8337, 10122, 368, 341, 6948, 10714, 10297, 285, 8337, 10122, 7, 16, 16, 17, 17, 18, 18, 701, 830, 317, 6948, 10714, 10297, 285, 8337, 10122, 7, 16, 17, 18, 19, 19, 19, 701, 895, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_call_hierarchy_on_def() { check_hierarchy( r#" //- /lib.rs fn call$0ee() {} fn caller() { callee(); } "#, expect![["callee Function FileId(0) 0..14 3..9"]], expect![["caller Function FileId(0) 15..44 18..24 : [33..39]"]], expect![[]], ); }
rust_cleaned_test_functions.jsonl/38285
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13429, 95043, 4470, 7844, 368, 341, 286, 1779, 95043, 1006, 310, 435, 2, 698, 61463, 608, 2740, 25638, 198, 8822, 1618, 3, 15, 2127, 368, 5613, 8822, 19865, 368, 341, 262, 94800, 543, 532, 57676...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_special_tokens() { let trainer = UnigramTrainerBuilder::default() .show_progress(false) .special_tokens(vec![ AddedToken::from("[SEP]", true), AddedToken::from("[CLS]", true), ]) .build() .unwrap(); let (unigram, _) = trainer .train(HashMap::from_iter(vec![ ("The".into(), 12), ("are".into(), 11), ])) .unwrap(); let mut pieces = unigram.iter(); assert_eq!(pieces.next(), Some(&("[SEP]".into(), 0.0))); assert_eq!(pieces.next(), Some(&("[CLS]".into(), 0.0))); }
rust_cleaned_test_functions.jsonl/18988
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 388 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41629, 28838, 368, 341, 286, 1077, 28894, 284, 1230, 49127, 1282, 1743, 3297, 486, 2258, 741, 310, 659, 3445, 27200, 3576, 340, 310, 659, 15144, 28838, 25592, 90515, 394, 17684, 3323, 486, 1499, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_arginfo_cmp() { let info = flag!("-foo", FooFlag); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Less); assert_eq!(info.cmp("-foo="), Ordering::Less); assert_eq!(info.cmp("-foo=bar"), Ordering::Less); let info = take_arg!("-foo", OsString, Separated, Foo); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Less); assert_eq!(info.cmp("-foo="), Ordering::Less); assert_eq!(info.cmp("-foo=bar"), Ordering::Less); let info = take_arg!("-foo", OsString, Concatenated, Foo); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Equal); assert_eq!(info.cmp("-foo="), Ordering::Equal); assert_eq!(info.cmp("-foo=bar"), Ordering::Equal); let info = take_arg!("-foo", OsString, Concatenated('='), Foo); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Greater); assert_eq!(info.cmp("-foo="), Ordering::Equal); assert_eq!(info.cmp("-foo=bar"), Ordering::Equal); let info = take_arg!("-foo", OsString, CanBeSeparated, Foo); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Equal); assert_eq!(info.cmp("-foo="), Ordering::Equal); assert_eq!(info.cmp("-foo=bar"), Ordering::Equal); let info = take_arg!("-foo", OsString, CanBeSeparated('='), Foo); assert_eq!(info.cmp("-foo"), Ordering::Equal); assert_eq!(info.cmp("bar"), Ordering::Less); assert_eq!(info.cmp("-bar"), Ordering::Greater); assert_eq!(info.cmp("-qux"), Ordering::Less); assert_eq!(info.cmp("-foobar"), Ordering::Greater); assert_eq!(info.cmp("-foo="), Ordering::Equal); assert_eq!(info.cmp("-foo=bar"), Ordering::Equal); }
rust_cleaned_test_functions.jsonl/16227
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1293 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6057, 2733, 35193, 368, 341, 286, 1077, 3546, 284, 5181, 0, 13645, 7975, 497, 33428, 12135, 317, 286, 2060, 10714, 10297, 2733, 520, 1307, 13645, 7975, 3975, 68621, 486, 2993, 317, 286, 2060, 1071...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_call_superclass() { let hdr = indoc! {" #include <memory> class A { public: virtual void foo() const {}; virtual ~A() {} }; class B : public A { public: void bar() const {} }; inline std::unique_ptr<B> get_b() { return std::make_unique<B>(); } "}; let rs = quote! { let b = ffi::get_b(); b.as_ref().unwrap().as_ref().foo(); }; run_test("", hdr, rs, &["A", "B", "get_b"], &[]); }
rust_cleaned_test_functions.jsonl/9975
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13429, 38886, 1040, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 262, 671, 997, 366, 17269, 397, 262, 536, 362, 341, 262, 584, 510, 286, 4108, 737, 15229, 368, 733, 9321, 286, 4108...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pacemaker_time_interval() { let interval = ExponentialTimeInterval::new(Duration::from_millis(3000), 1.5, 2); assert_eq!(3000, interval.get_round_duration(0).as_millis()); assert_eq!(4500, interval.get_round_duration(1).as_millis()); assert_eq!( 6750, interval.get_round_duration(2).as_millis() ); // Test that there is no integer overflow assert_eq!(6750, interval.get_round_duration(1000).as_millis()); }
rust_cleaned_test_functions.jsonl/9071
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 580, 58675, 3009, 20541, 368, 341, 262, 1077, 9873, 284, 1374, 59825, 68041, 486, 931, 64114, 486, 1499, 717, 56212, 7, 18, 15, 15, 15, 701, 220, 16, 13, 20, 11, 220, 17, 317, 262, 2060...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_subsequences() { assert_eq!( Solution::find_subsequences(vec![4, 6, 7, 7]), vec![ vec![4, 6], vec![4, 6, 7], vec![4, 6, 7, 7], vec![4, 7], vec![4, 7, 7], vec![6, 7], vec![6, 7, 7], vec![7, 7] ] ); assert_eq!( Solution::find_subsequences(vec![4, 4, 3, 2, 1]), vec![vec![4, 4]] ); }
rust_cleaned_test_functions.jsonl/60427
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 378 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 5228, 61708, 368, 341, 286, 2060, 10714, 33673, 310, 12478, 486, 3903, 5228, 61708, 25592, 20703, 19, 11, 220, 21, 11, 220, 22, 11, 220, 22, 17036, 310, 7486, 90515, 394, 7486, 20703, 19,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_swab_256_test() { new_ucmd!() .args(&["conv=swab"]) .pipe_in_fixture("seq-byte-values.test") .succeeds() .stdout_is_fixture_bytes("seq-byte-values-swapped.test"); }
rust_cleaned_test_functions.jsonl/99856
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 120 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32581, 370, 62, 17, 20, 21, 4452, 368, 341, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183, 12027, 28, 2280, 370, 14108, 286, 659, 13768, 1243, 74409, 445, 13262, 53952, 69050, 5958, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bloom_indexer_single_column_prune() -> Result<()> { struct Test { name: &'static str, expr: Expression, expected_eval_result: BloomFilterExprEvalResult, } let tests: Vec<Test> = vec![ Test { name: "ColumnUInt8 = 34", expr: col("ColumnUInt8").eq(lit(34u8)), expected_eval_result: BloomFilterExprEvalResult::False, }, Test { name: "ColumnUInt16 = 30", expr: col("ColumnUInt16").eq(lit(30u16)), expected_eval_result: BloomFilterExprEvalResult::False, }, Test { name: "ColumnUInt32 = 12134", expr: col("ColumnUInt32").eq(lit(12134u32)), expected_eval_result: BloomFilterExprEvalResult::False, }, Test { name: "ColumnUInt64 = 21323722", expr: col("ColumnUInt64").eq(lit(21323722_u64)), expected_eval_result: BloomFilterExprEvalResult::False, }, Test { name: "ColumnString = 'batman'", expr: col("ColumnString").eq(lit("batman".as_bytes())), expected_eval_result: BloomFilterExprEvalResult::False, }, ]; let data_blocks = create_blocks(); let indexer = BloomFilterIndexer::from_data_and_seeds(data_blocks.as_ref(), create_seeds())?; for test in tests { let res = indexer.eval(&test.expr)?; assert_eq!(res, test.expected_eval_result, "{}", test.name); } Ok(()) }
rust_cleaned_test_functions.jsonl/101376
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 738 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 18474, 3560, 261, 19487, 8744, 5294, 2886, 368, 1464, 5714, 71698, 341, 262, 2036, 3393, 341, 286, 829, 25, 30136, 1978, 607, 345, 286, 15169, 25, 16378, 345, 286, 3601, 21296, 5287, 25, 24...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bounding_box() { let layout = Layout::new(Vector::new(13, 2), Vertex::new(2, 0), 10, 10); let s = Tile::new(3, 4); assert_eq!(layout.bounding_box_of(s), (23, 42, 10, 10)); }
rust_cleaned_test_functions.jsonl/95168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 113 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 13586, 10194, 368, 341, 286, 1077, 6789, 284, 13821, 486, 931, 20258, 486, 931, 7, 16, 18, 11, 220, 17, 701, 23225, 486, 931, 7, 17, 11, 220, 15, 701, 220, 16, 15, 11, 220, 16, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_spj_0_with_re() { let task = generate_judge_task(SOURCE_RE, PROBLEM); let judge = Judge::new(); for report in judge.judge(task) { match report { Report::RuntimeError => {} res => panic!("Wrong judge result: {}", res), } } }
rust_cleaned_test_functions.jsonl/52122
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10123, 73, 62, 15, 6615, 1288, 368, 341, 262, 1077, 3383, 284, 6923, 5374, 19561, 12184, 3759, 13077, 2192, 11, 5308, 69292, 317, 262, 1077, 11651, 284, 20207, 486, 931, 543, 262, 369, 1895, 304...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_intersection_size_hint() { let x = BTreeSet::from([3, 4]); let y = BTreeSet::from([1, 2, 3]); let mut iter = x.intersection(&y); assert_eq!(iter.size_hint(), (1, Some(1))); assert_eq!(iter.next(), Some(&3)); assert_eq!(iter.size_hint(), (0, Some(0))); assert_eq!(iter.next(), None); iter = y.intersection(&y); assert_eq!(iter.size_hint(), (0, Some(3))); assert_eq!(iter.next(), Some(&1)); assert_eq!(iter.size_hint(), (0, Some(2))); }
rust_cleaned_test_functions.jsonl/13736
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 234 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 82558, 2368, 45825, 368, 341, 262, 1077, 856, 284, 425, 6533, 1649, 486, 1499, 2561, 18, 11, 220, 19, 2558, 262, 1077, 379, 284, 425, 6533, 1649, 486, 1499, 2561, 16, 11, 220, 17, 11, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mut_rev_iterator() { let mut xs = [1, 2, 3, 4, 5]; for (i, x) in xs.iter_mut().rev().enumerate() { *x += i; } assert!(xs == [5, 5, 5, 5, 5]) }
rust_cleaned_test_functions.jsonl/12891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 106 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 38082, 13491, 368, 341, 262, 1077, 5206, 11943, 284, 508, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 935, 262, 369, 320, 72, 11, 856, 8, 304, 11943, 19471, 29523, 1005, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_encode_many() { let pems = parse_many(SAMPLE_CRLF); let encoded = encode_many(&pems); assert_eq!(SAMPLE_CRLF, encoded); }
rust_cleaned_test_functions.jsonl/61397
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 88 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 22101, 368, 341, 286, 1077, 281, 11852, 284, 4715, 22101, 3759, 18918, 920, 80658, 317, 286, 1077, 20498, 284, 16164, 22101, 2099, 79, 11852, 626, 286, 2060, 10714, 10297, 82725, 920, 80658, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_serde_stakes_enum_compat() { #[derive(Debug, PartialEq, Deserialize, Serialize)] struct Dummy { head: String, #[serde(with = "serde_stakes_enum_compat")] stakes: Arc<StakesEnum>, tail: String, } let mut rng = rand::thread_rng(); let stakes_cache = StakesCache::new(Stakes { unused: rng.gen(), epoch: rng.gen(), ..Stakes::default() }); for _ in 0..rng.gen_range(5usize, 10) { let vote_pubkey = solana_sdk::pubkey::new_rand(); let vote_account = vote_state::create_account( &vote_pubkey, &solana_sdk::pubkey::new_rand(), // node_pubkey rng.gen_range(0, 101), // commission rng.gen_range(0, 1_000_000), // lamports ); stakes_cache.check_and_store(&vote_pubkey, &vote_account); for _ in 0..rng.gen_range(10usize, 20) { let stake_pubkey = solana_sdk::pubkey::new_rand(); let rent = Rent::with_slots_per_epoch(rng.gen()); let stake_account = stake_state::create_account( &stake_pubkey, // authorized &vote_pubkey, &vote_account, &rent, rng.gen_range(0, 1_000_000), // lamports ); stakes_cache.check_and_store(&stake_pubkey, &stake_account); } } let stakes: Stakes<StakeAccount> = stakes_cache.stakes().clone(); assert!(stakes.vote_accounts.as_ref().len() >= 5); assert!(stakes.stake_delegations.len() >= 50); let dummy = Dummy { head: String::from("dummy-head"), stakes: Arc::new(StakesEnum::from(stakes.clone())), tail: String::from("dummy-tail"), }; assert!(dummy.stakes.vote_accounts().as_ref().len() >= 5); let data = bincode::serialize(&dummy).unwrap(); let other: Dummy = bincode::deserialize(&data).unwrap(); assert_eq!(other, dummy); let stakes = Stakes::<Delegation>::from(stakes); assert!(stakes.vote_accounts.as_ref().len() >= 5); assert!(stakes.stake_delegations.len() >= 50); let other = match &*other.stakes { StakesEnum::Accounts(_) => panic!("wrong type!"), StakesEnum::Delegations(delegations) => delegations, }; assert_eq!(other, &stakes) }
rust_cleaned_test_functions.jsonl/22044
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1334 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 1261, 2050, 31054, 89602, 368, 341, 286, 11506, 27098, 42618, 11, 55039, 11, 48440, 11, 39900, 5563, 286, 2036, 50567, 341, 310, 1968, 25, 923, 345, 310, 11506, 47024, 16980, 284, 330,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_example_1_1() { assert_eq!( solve_1(&parse("80871224585914546619083218645595")), String::from("24176176") ); }
rust_cleaned_test_functions.jsonl/103743
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 103 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39304, 62, 16, 62, 16, 368, 341, 286, 2060, 10714, 33673, 310, 11625, 62, 16, 2099, 6400, 445, 23, 15, 23, 22, 16, 17, 17, 19, 20, 23, 20, 24, 16, 19, 20, 19, 21, 21, 16, 24, 15, 23, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mut_chunks_rev() { let mut v = [0u8, 1, 2, 3, 4, 5, 6]; for (i, chunk) in v.chunks_mut(3).rev().enumerate() { for x in chunk.iter_mut() { *x = i as u8; } } let result = [2u8, 2, 2, 1, 1, 1, 0]; assert!(v == result); }
rust_cleaned_test_functions.jsonl/31859
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 65470, 38082, 368, 341, 286, 1077, 5206, 348, 284, 508, 15, 84, 23, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 935, 286, 369, 320, 72, 11, 11879...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_expand_template() { let rv = expand_template("{{ {foo} {bar} }}", |var| var.key.to_uppercase()); assert_eq!(&rv, "{ FOO BAR }"); }
rust_cleaned_test_functions.jsonl/76136
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 74 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 67875, 8693, 368, 341, 262, 1077, 17570, 284, 9225, 8693, 445, 2979, 314, 7975, 92, 314, 2257, 92, 3869, 497, 760, 947, 91, 762, 4735, 2389, 34445, 5638, 1423, 262, 2060, 10714, 0, 2099, 10553, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_tiledinputpart_level_height_failure_invalid_level() { let input = MultiPartInputFile::new(&*SRC_IMAGE_PATH, 0, true).unwrap(); let tiled_input_part = super::TiledInputPart::new(&input, 0); tiled_input_part.level_height(i32::MIN).unwrap(); }
rust_cleaned_test_functions.jsonl/59304
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 2181, 1355, 4480, 8274, 9561, 43618, 31433, 8274, 368, 341, 286, 1077, 1946, 284, 17439, 5800, 2505, 1703, 486, 931, 2099, 9, 56017, 19121, 7944, 11, 220, 15, 11, 830, 568, 15454, 543, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_capture_quantifiers() { struct Row { description: &'static str, language: Language, pattern: &'static str, capture_quantifiers: &'static [(usize, &'static str, CaptureQuantifier)], } let rows = &[ // Simple quantifiers Row { description: "Top level capture", language: get_language("python"), pattern: r#" (module) @mod "#, capture_quantifiers: &[(0, "mod", CaptureQuantifier::One)], }, Row { description: "Nested list capture capture", language: get_language("javascript"), pattern: r#" (array (_)* @elems) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "elems", CaptureQuantifier::ZeroOrMore), ], }, Row { description: "Nested non-empty list capture capture", language: get_language("javascript"), pattern: r#" (array (_)+ @elems) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "elems", CaptureQuantifier::OneOrMore), ], }, // Nested quantifiers Row { description: "capture nested in optional pattern", language: get_language("javascript"), pattern: r#" (array (call_expression (arguments (_) @arg))? @call) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "call", CaptureQuantifier::ZeroOrOne), (0, "arg", CaptureQuantifier::ZeroOrOne), ], }, Row { description: "optional capture nested in non-empty list pattern", language: get_language("javascript"), pattern: r#" (array (call_expression (arguments (_)? @arg))+ @call) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "call", CaptureQuantifier::OneOrMore), (0, "arg", CaptureQuantifier::ZeroOrMore), ], }, Row { description: "non-empty list capture nested in optional pattern", language: get_language("javascript"), pattern: r#" (array (call_expression (arguments (_)+ @args))? @call) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "call", CaptureQuantifier::ZeroOrOne), (0, "args", CaptureQuantifier::ZeroOrMore), ], }, // Quantifiers in alternations Row { description: "capture is the same in all alternatives", language: get_language("javascript"), pattern: r#"[ (function_declaration name:(identifier) @name) (call_expression function:(identifier) @name) ]"#, capture_quantifiers: &[(0, "name", CaptureQuantifier::One)], }, Row { description: "capture appears in some alternatives", language: get_language("javascript"), pattern: r#"[ (function_declaration name:(identifier) @name) (function) ] @fun"#, capture_quantifiers: &[ (0, "fun", CaptureQuantifier::One), (0, "name", CaptureQuantifier::ZeroOrOne), ], }, Row { description: "capture has different quantifiers in alternatives", language: get_language("javascript"), pattern: r#"[ (call_expression arguments:(arguments (_)+ @args)) (new_expression arguments:(arguments (_)? @args)) ] @call"#, capture_quantifiers: &[ (0, "call", CaptureQuantifier::One), (0, "args", CaptureQuantifier::ZeroOrMore), ], }, // Quantifiers in siblings Row { description: "siblings have different captures with different quantifiers", language: get_language("javascript"), pattern: r#" (call_expression (arguments (identifier)? @self (_)* @args)) @call "#, capture_quantifiers: &[ (0, "call", CaptureQuantifier::One), (0, "self", CaptureQuantifier::ZeroOrOne), (0, "args", CaptureQuantifier::ZeroOrMore), ], }, Row { description: "siblings have same capture with different quantifiers", language: get_language("javascript"), pattern: r#" (call_expression (arguments (identifier) @args (_)* @args)) @call "#, capture_quantifiers: &[ (0, "call", CaptureQuantifier::One), (0, "args", CaptureQuantifier::OneOrMore), ], }, // Combined scenarios Row { description: "combined nesting, alternatives, and siblings", language: get_language("javascript"), pattern: r#" (array (call_expression (arguments [ (identifier) @self (_)+ @args ]) )+ @call ) @array "#, capture_quantifiers: &[ (0, "array", CaptureQuantifier::One), (0, "call", CaptureQuantifier::OneOrMore), (0, "self", CaptureQuantifier::ZeroOrMore), (0, "args", CaptureQuantifier::ZeroOrMore), ], }, // Multiple patterns Row { description: "multiple patterns", language: get_language("javascript"), pattern: r#" (function_declaration name: (identifier) @x) (statement_identifier) @y (property_identifier)+ @z (array (identifier)* @x) "#, capture_quantifiers: &[ // x (0, "x", CaptureQuantifier::One), (1, "x", CaptureQuantifier::Zero), (2, "x", CaptureQuantifier::Zero), (3, "x", CaptureQuantifier::ZeroOrMore), // y (0, "y", CaptureQuantifier::Zero), (1, "y", CaptureQuantifier::One), (2, "y", CaptureQuantifier::Zero), (3, "y", CaptureQuantifier::Zero), // z (0, "z", CaptureQuantifier::Zero), (1, "z", CaptureQuantifier::Zero), (2, "z", CaptureQuantifier::OneOrMore), (3, "z", CaptureQuantifier::Zero), ], }, Row { description: "multiple alternatives", language: get_language("javascript"), pattern: r#" [ (array (identifier) @x) (function_declaration name: (identifier)+ @x) ] [ (array (identifier) @x) (function_declaration name: (identifier)+ @x) ] "#, capture_quantifiers: &[ (0, "x", CaptureQuantifier::OneOrMore), (1, "x", CaptureQuantifier::OneOrMore), ], }, ]; allocations::record(|| { eprintln!(""); for row in rows.iter() { if let Some(filter) = EXAMPLE_FILTER.as_ref() { if !row.description.contains(filter.as_str()) { continue; } } eprintln!(" query example: {:?}", row.description); let query = Query::new(row.language, row.pattern).unwrap(); for (pattern, capture, expected_quantifier) in row.capture_quantifiers { let index = query.capture_index_for_name(capture).unwrap(); let actual_quantifier = query.capture_quantifiers(*pattern)[index as usize]; assert_eq!( actual_quantifier, *expected_quantifier, "Description: {}, Pattern: {:?}, expected quantifier of @{} to be {:?} instead of {:?}", row.description, row.pattern .split_ascii_whitespace() .collect::<Vec<_>>() .join(" "), capture, *expected_quantifier, actual_quantifier, ) } } }); }
rust_cleaned_test_functions.jsonl/77482
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 4750 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55148, 53346, 11836, 368, 341, 262, 2036, 10801, 341, 286, 4008, 25, 30136, 1978, 607, 345, 286, 4128, 25, 11434, 345, 286, 5383, 25, 30136, 1978, 607, 345, 286, 12322, 53346, 11836, 25, 30136, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_read_str() { assert_eq!(from_str("\""), Err(SyntaxError(EOFWhileParsingString, 1, 2))); assert_eq!(from_str("\"lol"), Err(SyntaxError(EOFWhileParsingString, 1, 5))); assert_eq!(from_str("\"\""), Ok(String("".to_string()))); assert_eq!(from_str("\"foo\""), Ok(String("foo".to_string()))); assert_eq!(from_str("\"\\\"\""), Ok(String("\"".to_string()))); assert_eq!(from_str("\"\\b\""), Ok(String("\x08".to_string()))); assert_eq!(from_str("\"\\n\""), Ok(String("\n".to_string()))); assert_eq!(from_str("\"\\r\""), Ok(String("\r".to_string()))); assert_eq!(from_str("\"\\t\""), Ok(String("\t".to_string()))); assert_eq!(from_str(" \"foo\" "), Ok(String("foo".to_string()))); assert_eq!(from_str("\"\\u12ab\""), Ok(String("\u{12ab}".to_string()))); assert_eq!(from_str("\"\\uAB12\""), Ok(String("\u{AB12}".to_string()))); }
rust_cleaned_test_functions.jsonl/41698
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 459 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 2895, 368, 341, 286, 2060, 10714, 10297, 1499, 2895, 38915, 3975, 262, 15495, 93549, 1454, 7, 23483, 7983, 68839, 703, 11, 220, 16, 11, 220, 17, 4945, 286, 2060, 10714, 10297, 1499, 2895, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_kubeconfig_path() { let expect_str = "/fake/.kube/config"; env::set_var(KUBECONFIG, expect_str); assert_eq!(PathBuf::from(expect_str), kubeconfig_path().unwrap()); }
rust_cleaned_test_functions.jsonl/94957
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4698, 3760, 1676, 2638, 368, 341, 286, 1077, 1720, 2895, 284, 3521, 30570, 11930, 97717, 14730, 876, 286, 6105, 486, 746, 4612, 16738, 42389, 24652, 11, 1720, 2895, 317, 286, 2060, 10714, 10297, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_make_mac() { let key = key(); let mac = Mac::new( MacType::Header, &key, sys_time(1000, 100), "nonny", "POST", "mysite.com", 443, "/v1/api", None, None, ) .unwrap(); println!("got {:?}", mac); assert!( mac.0 == vec![ 192, 227, 235, 121, 157, 185, 197, 79, 189, 214, 235, 139, 9, 232, 99, 55, 67, 30, 68, 0, 150, 187, 192, 238, 21, 200, 209, 107, 245, 159, 243, 178 ] ); }
rust_cleaned_test_functions.jsonl/52131
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 427 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28230, 22802, 368, 341, 286, 1077, 1376, 284, 1376, 543, 286, 1077, 8978, 284, 7401, 486, 931, 1006, 310, 7401, 929, 486, 4047, 345, 310, 609, 792, 345, 310, 5708, 3009, 7, 16, 15, 15, 15, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map_no_available_assoc_id() { let mut aid_map: Map = Default::default(); for i in 0..31 { aid_map.aids[i] = u64::max_value(); } // Set the remaining 24 aids in the last array positions for i in 0..24 { aid_map.aids[31] += 1 << i; } let result = aid_map.assign_aid(); assert!(result.is_err()); assert_eq!(format!("{}", result.unwrap_err()), "no available association ID"); }
rust_cleaned_test_functions.jsonl/42226
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 252 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 6536, 26962, 18891, 842, 368, 341, 286, 1077, 5206, 12296, 5376, 25, 5027, 284, 7899, 486, 2258, 543, 1789, 286, 369, 600, 304, 220, 15, 496, 18, 16, 341, 310, 12296, 5376, 5849, 3365, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_iter() { let mut iter = ArrayVec::from([1, 2, 3]).into_iter(); assert_eq!(iter.size_hint(), (3, Some(3))); assert_eq!(iter.next_back(), Some(3)); assert_eq!(iter.next(), Some(1)); assert_eq!(iter.next_back(), Some(2)); assert_eq!(iter.size_hint(), (0, Some(0))); assert_eq!(iter.next_back(), None); }
rust_cleaned_test_functions.jsonl/36763
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 163 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 368, 341, 262, 1077, 5206, 5367, 284, 2910, 10050, 486, 1499, 2561, 16, 11, 220, 17, 11, 220, 18, 10697, 18122, 11723, 543, 262, 2060, 10714, 10297, 2015, 2486, 45825, 1507, 320, 18, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_class_declaration() { expect_printed("class A {}", "class A {}"); expect_printed("class A extends B {}", "class A extends B {}"); expect_printed("class A { b() {} }", "class A { b() {} }"); expect_printed("class A { null() {} }", "class A { null() {} }"); expect_printed("class A { undefined() {} }", "class A { undefined() {} }"); expect_printed("class A { 123() {} }", "class A { 123() {} }"); expect_printed("class A { \"abc\"() {} }", "class A { \"abc\"() {} }"); expect_printed("class A { [b]() {} }", "class A { [b]() {} }"); expect_printed( "class A { constructor(a) {}\nb() {} }", "class A { constructor(a) {}\nb() {} }", ); expect_printed("class A { get b() {} }", "class A { get b() {} }"); expect_printed("class A { get [b]() {} }", "class A { get [b]() {} }"); expect_printed("class A { set [b]() {} }", "class A { set [b]() {} }"); expect_printed("class A { b() {}; c() {}; }", "class A { b() {}\nc() {} }"); expect_printed("class A {;}", "class A {}"); }
rust_cleaned_test_functions.jsonl/93451
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 418 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4790, 77926, 368, 341, 262, 1720, 10064, 291, 445, 1040, 362, 24689, 330, 1040, 362, 4687, 797, 262, 1720, 10064, 291, 445, 1040, 362, 2239, 425, 24689, 330, 1040, 362, 2239, 425, 4687, 797, 262...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_eval() { let result = Packet::parse("C200B40A82\n").unwrap().eval(); assert_eq!(result, 3); let result = Packet::parse("04005AC33890").unwrap().eval(); assert_eq!(result, 54); let result = Packet::parse("880086C3E88112").unwrap().eval(); assert_eq!(result, 7); let result = Packet::parse("CE00C43D881120").unwrap().eval(); assert_eq!(result, 9); let result = Packet::parse("D8005AC2A8F0").unwrap().eval(); assert_eq!(result, 1); let result = Packet::parse("F600BC2D8F").unwrap().eval(); assert_eq!(result, 0); let result = Packet::parse("9C005AC2F8F0").unwrap().eval(); assert_eq!(result, 0); let result = Packet::parse("9C0141080250320F1802104A08").unwrap().eval(); assert_eq!(result, 1); }
rust_cleaned_test_functions.jsonl/129858
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 400 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21296, 368, 341, 286, 1077, 1102, 284, 28889, 486, 6400, 445, 34, 17, 15, 15, 33, 19, 15, 32, 23, 17, 1699, 1827, 15454, 1005, 14170, 543, 286, 2060, 10714, 10297, 1382, 11, 220, 18, 317, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_list_primitive_accessors() { // primitives let list = make_list(vec![Field::Bool(false)]); assert_eq!(false, list.get_bool(0).unwrap()); let list = make_list(vec![Field::Byte(3), Field::Byte(4)]); assert_eq!(4, list.get_byte(1).unwrap()); let list = make_list(vec![Field::Short(4), Field::Short(5), Field::Short(6)]); assert_eq!(6, list.get_short(2).unwrap()); let list = make_list(vec![Field::Int(5)]); assert_eq!(5, list.get_int(0).unwrap()); let list = make_list(vec![Field::Long(6), Field::Long(7)]); assert_eq!(7, list.get_long(1).unwrap()); let list = make_list(vec![Field::UByte(3), Field::UByte(4)]); assert_eq!(4, list.get_ubyte(1).unwrap()); let list = make_list(vec![Field::UShort(4), Field::UShort(5), Field::UShort(6)]); assert_eq!(6, list.get_ushort(2).unwrap()); let list = make_list(vec![Field::UInt(5)]); assert_eq!(5, list.get_uint(0).unwrap()); let list = make_list(vec![Field::ULong(6), Field::ULong(7)]); assert_eq!(7, list.get_ulong(1).unwrap()); let list = make_list(vec![ Field::Float(8.1), Field::Float(9.2), Field::Float(10.3), ]); assert_eq!(10.3, list.get_float(2).unwrap()); let list = make_list(vec![Field::Double(3.1415)]); assert_eq!(3.1415, list.get_double(0).unwrap()); let list = make_list(vec![Field::Str("abc".to_string())]); assert_eq!(&"abc".to_string(), list.get_string(0).unwrap()); let list = make_list(vec![Field::Bytes(ByteArray::from(vec![1, 2, 3, 4, 5]))]); assert_eq!(&[1, 2, 3, 4, 5], list.get_bytes(0).unwrap().data()); let list = make_list(vec![Field::Decimal(Decimal::from_i32(4, 5, 2))]); assert_eq!(&[0, 0, 0, 4], list.get_decimal(0).unwrap().data()); }
rust_cleaned_test_functions.jsonl/43813
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 806 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 84087, 12759, 1087, 368, 341, 262, 442, 71194, 198, 262, 1077, 1140, 284, 1281, 2019, 25592, 20703, 1877, 486, 11233, 3576, 41958, 262, 2060, 10714, 10297, 3849, 11, 1140, 670, 22159, 7, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_invalid_request() { let mut block = default_block(); let mem = default_mem(); let vq = VirtQueue::new(GuestAddress(0), &mem, 16); block.set_queue(0, vq.create_queue()); block.activate(mem.clone()).unwrap(); initialize_virtqueue(&vq); let request_type_addr = GuestAddress(vq.dtable[0].addr.get()); // Request is invalid because the first descriptor is write-only. vq.dtable[0] .flags .set(VIRTQ_DESC_F_NEXT | VIRTQ_DESC_F_WRITE); mem.write_obj::<u32>(VIRTIO_BLK_T_IN, request_type_addr) .unwrap(); invoke_handler_for_queue_event(&mut block); assert_eq!(vq.used.idx.get(), 1); assert_eq!(vq.used.ring[0].get().id, 0); assert_eq!(vq.used.ring[0].get().len, 0); }
rust_cleaned_test_functions.jsonl/73917
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 415 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 7893, 368, 341, 286, 1077, 5206, 2504, 284, 1638, 7113, 543, 286, 1077, 1833, 284, 1638, 12976, 543, 286, 1077, 348, 80, 284, 47775, 7554, 486, 931, 6699, 3045, 4286, 7, 15, 701, 609, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find() { ::init().unwrap(); // Our find let vec = vec![1i32, 2, 3]; let val = Iterator::from_vec(vec).find(|val| val == 2); assert_eq!(val.unwrap(), 2); }
rust_cleaned_test_functions.jsonl/50295
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 118 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 368, 341, 286, 3504, 2327, 1005, 15454, 1428, 286, 442, 5633, 1477, 198, 286, 1077, 7486, 284, 7486, 20703, 16, 72, 18, 17, 11, 220, 17, 11, 220, 18, 935, 286, 1077, 1044, 284, 23023, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bank_squash() { solana_logger::setup(); let (genesis_block, mint_keypair) = GenesisBlock::new(2); let key1 = Keypair::new(); let key2 = Keypair::new(); let parent = Arc::new(Bank::new(&genesis_block)); let tx_transfer_mint_to_1 = system_transaction::transfer(&mint_keypair, &key1.pubkey(), 1, genesis_block.hash(), 0); trace!("parent process tx "); assert_eq!(parent.process_transaction(&tx_transfer_mint_to_1), Ok(())); trace!("done parent process tx "); assert_eq!(parent.transaction_count(), 1); assert_eq!( parent.get_signature_status(&tx_transfer_mint_to_1.signatures[0]), Some(Ok(())) ); trace!("new form parent"); let bank = new_from_parent(&parent); trace!("done new form parent"); assert_eq!( bank.get_signature_status(&tx_transfer_mint_to_1.signatures[0]), Some(Ok(())) ); assert_eq!(bank.transaction_count(), parent.transaction_count()); let tx_transfer_1_to_2 = system_transaction::transfer(&key1, &key2.pubkey(), 1, genesis_block.hash(), 0); assert_eq!(bank.process_transaction(&tx_transfer_1_to_2), Ok(())); assert_eq!(bank.transaction_count(), 2); assert_eq!(parent.transaction_count(), 1); assert_eq!( parent.get_signature_status(&tx_transfer_1_to_2.signatures[0]), None ); for _ in 0..3 { assert_eq!(bank.get_balance(&key1.pubkey()), 0); assert_eq!(bank.get_account(&key1.pubkey()), None); assert_eq!(bank.get_balance(&key2.pubkey()), 1); trace!("start"); assert_eq!( bank.get_signature_status(&tx_transfer_mint_to_1.signatures[0]), Some(Ok(())) ); assert_eq!( bank.get_signature_status(&tx_transfer_1_to_2.signatures[0]), Some(Ok(())) ); trace!("SQUASH"); bank.squash(); assert_eq!(parent.transaction_count(), 1); assert_eq!(bank.transaction_count(), 2); } }
rust_cleaned_test_functions.jsonl/41903
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1147 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35733, 643, 446, 988, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 320, 77894, 7113, 11, 28337, 3097, 12670, 8, 284, 40788, 4713, 486, 931, 7, 17, 317, 286, 1077, 1376, 16, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_is_string_at_position_g() { let example: Vec<char> = "abaa".to_string().chars().collect(); assert!(!is_string_at_position(&example, 1, "a")); }
rust_cleaned_test_functions.jsonl/126891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 87 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 3904, 3752, 9661, 1889, 368, 341, 286, 1077, 3110, 25, 11312, 21919, 29, 284, 330, 370, 5305, 3263, 983, 3904, 1005, 19255, 1005, 17384, 543, 286, 2060, 0, 3471, 285, 3904, 3752, 9661, 209...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parse_lines() { let arena = Arena::new(); assert_syntaxes( &parse(&arena, "foo\nbar"), &[ Syntax::new_comment( &arena, vec![SingleLineSpan { line: 0.into(), start_col: 0, end_col: 3, }], "foo", ), Syntax::new_comment( &arena, vec![SingleLineSpan { line: 1.into(), start_col: 0, end_col: 3, }], "bar", ), ], ); }
rust_cleaned_test_functions.jsonl/16027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 567 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 18323, 368, 341, 286, 1077, 24902, 284, 27047, 486, 931, 1428, 286, 2060, 78894, 288, 1006, 310, 609, 6400, 2099, 30527, 11, 330, 7975, 1699, 2257, 4461, 310, 609, 9640, 394, 32117, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_close_range_native() -> Result<()> { let fd = fcntl::open("/dev/null", fcntl::OFlag::O_RDWR, sys::stat::Mode::empty())?; let syscall = LinuxSyscall {}; syscall .close_range(0) .context("failed to clean up the fds")?; let fd_flag = fcntl::fcntl(fd, fcntl::F_GETFD)?; if (fd_flag & fcntl::FdFlag::FD_CLOEXEC.bits()) == 0 { bail!("CLOEXEC flag is not set correctly"); } unistd::close(fd)?; Ok(()) }
rust_cleaned_test_functions.jsonl/84397
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 284 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12704, 9698, 44494, 368, 1464, 5714, 71698, 341, 286, 1077, 12414, 284, 282, 75017, 486, 2508, 4283, 3583, 19293, 497, 282, 75017, 486, 46, 12135, 486, 46, 66266, 11, 5708, 486, 9878, 486, 3636, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_panic_hook_single_method() { local_test_e(|runtime| async move { let canister = Project::new(std::env::var("CARGO_MANIFEST_DIR").unwrap()) .cargo_bin("panics", &[]) .install_(&runtime, Vec::new()) .await .unwrap(); let res: Result<Vec<u8>, String> = canister.update_("test_panic_hook", bytes, Vec::new()).await; assert_matches!(res, Err(msg) if msg.contains("This message should be passed as trap message thanks to the hook")); Ok(()) }) }
rust_cleaned_test_functions.jsonl/126879
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 264 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 31270, 32005, 19487, 9032, 368, 341, 262, 2205, 4452, 2204, 22428, 22255, 91, 3312, 3271, 341, 286, 1077, 646, 1571, 284, 5787, 486, 931, 5194, 486, 3160, 486, 947, 445, 34, 7581, 46, 25143...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_rng_32_true_values() { let seed: &[_] = &[1, 23, 456, 7890, 12345]; let mut ra: IsaacRng = SeedableRng::from_seed(seed); // Regression test that isaac is actually using the above vector let v = (0..10).map(|_| ra.next_u32()).collect::<Vec<_>>(); assert_eq!(v, vec!(2558573138, 873787463, 263499565, 2103644246, 3595684709, 4203127393, 264982119, 2765226902, 2737944514, 3900253796)); let seed: &[_] = &[12345, 67890, 54321, 9876]; let mut rb: IsaacRng = SeedableRng::from_seed(seed); // skip forward to the 10000th number for _ in 0..10000 { rb.next_u32(); } let v = (0..10).map(|_| rb.next_u32()).collect::<Vec<_>>(); assert_eq!(v, vec!(3676831399, 3183332890, 2834741178, 3854698763, 2717568474, 1576568959, 3507990155, 179069555, 141456972, 2478885421)); }
rust_cleaned_test_functions.jsonl/42033
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 531 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66849, 62, 18, 17, 16082, 9146, 368, 341, 286, 1077, 10320, 25, 609, 13496, 60, 284, 44590, 16, 11, 220, 17, 18, 11, 220, 19, 20, 21, 11, 220, 22, 23, 24, 15, 11, 220, 16, 17, 18, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_next() { let mut kc = KeltnerChannel::new(3, 2.0_f64).unwrap(); let a = kc.next(2.0); let b = kc.next(5.0); let c = kc.next(1.0); let d = kc.next(6.25); assert_eq!(round(a.average), 2.0); assert_eq!(round(b.average), 3.5); assert_eq!(round(c.average), 2.25); assert_eq!(round(d.average), 4.25); assert_eq!(round(a.upper), 2.0); assert_eq!(round(b.upper), 6.5); assert_eq!(round(c.upper), 7.75); assert_eq!(round(d.upper), 12.25); assert_eq!(round(a.lower), 2.0); assert_eq!(round(b.lower), 0.5); assert_eq!(round(c.lower), -3.25); assert_eq!(round(d.lower), -3.75); }
rust_cleaned_test_functions.jsonl/130306
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 412 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11257, 368, 341, 286, 1077, 5206, 87518, 284, 730, 3818, 1194, 9629, 486, 931, 7, 18, 11, 220, 17, 13, 15, 761, 21, 19, 568, 15454, 1428, 286, 1077, 264, 284, 87518, 4529, 7, 17, 13, 15, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sparse_index() -> Result<()> { let schema = DataSchemaRefExt::create(vec![ DataField::new("name", DataType::Utf8, true), DataField::new("age", DataType::Int32, false), ]); let block1 = DataBlock::create_by_array(schema.clone(), vec![ Series::new(vec!["jack", "ace", "bohu"]), Series::new(vec![11, 6, 24]), ]); let block2 = DataBlock::create_by_array(schema.clone(), vec![ Series::new(vec!["xjack", "xace", "xbohu"]), Series::new(vec![11, 6, 24]), ]); let idx_slice = vec![ SparseIndex { col: "name".to_string(), values: vec![ SparseIndexValue { min: DataValue::Utf8(Some("jack".to_string())), max: DataValue::Utf8(Some("bohu".to_string())), page_no: 0, }, SparseIndexValue { min: DataValue::Utf8(Some("xjack".to_string())), max: DataValue::Utf8(Some("xbohu".to_string())), page_no: 1, }, ], version: IndexSchemaVersion::V1, }, SparseIndex { col: "age".to_string(), values: vec![ SparseIndexValue { min: DataValue::Int32(Some(11)), max: DataValue::Int32(Some(24)), page_no: 0, }, SparseIndexValue { min: DataValue::Int32(Some(11)), max: DataValue::Int32(Some(24)), page_no: 1, }, ], version: IndexSchemaVersion::V1, }, ]; // Create index. { let actual = SparseIndex::create_index(&["name".to_string(), "age".to_string()], &[block1, block2])?; let expected = idx_slice.clone(); assert_eq!(actual, expected); } // Apply index. { let mut idx_map = HashMap::new(); idx_map.insert("name".to_string(), idx_slice[0].clone()); idx_map.insert("age".to_string(), idx_slice[1].clone()); let expr = col("name").eq(lit(24)); let (actual, _) = SparseIndex::apply_index(idx_map, &expr)?; let expected = true; assert_eq!(actual, expected); } Ok(()) }
rust_cleaned_test_functions.jsonl/34177
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1300 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 71123, 3560, 368, 1464, 5714, 71698, 341, 262, 1077, 10802, 284, 2885, 8632, 3945, 6756, 486, 3182, 25592, 90515, 286, 2885, 1877, 486, 931, 445, 606, 497, 33172, 486, 38980, 23, 11, 830, 1326, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_file_style_underline() { _do_test_file_style_underline(&[ "--file-style", "magenta", "--file-decoration-style", "magenta underline", ]); }
rust_cleaned_test_functions.jsonl/70078
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2458, 15117, 58228, 1056, 368, 341, 286, 716, 2982, 4452, 2458, 15117, 58228, 1056, 2099, 9640, 310, 14482, 1192, 11297, 756, 310, 330, 76, 47062, 756, 310, 14482, 1192, 30266, 11297, 756, 310, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1