document_id
int32
185
2.68k
question
stringlengths
11
194
id
int32
225
5.32k
answers
listlengths
1
1
chunks
listlengths
5
52
correct_chunks
listlengths
0
1
num_words
int64
404
5.47k
num_tokens
int64
652
7.87k
630
What is the main cause of HIV-1 infection in children?
262
[ "Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide." ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 1 ]
4,636
7,055
630
What plays the crucial role in the Mother to Child Transmission of HIV-1 and what increases the risk
276
[ "DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission." ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 2 ]
4,636
7,055
630
How many children were infected by HIV-1 in 2008-2009, worldwide?
278
[ "more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa." ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 3 ]
4,636
7,055
630
What is the role of C-C Motif Chemokine Ligand 3 Like 1 (CCL3L1) in mother to child transmission of HIV-1?
316
[ "High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 38 ]
4,636
7,055
630
What is DC-GENR and where is it expressed?
305
[ "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 5 ]
4,636
7,055
630
How does the presence of DC-SIGNR affect the MTCT of HIV-1?
306
[ "the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation." ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 40 ]
4,636
7,055
630
Why do low levels of DC-SIGNR enhance Mother to Child Transmission of HIV-1?
307
[ "in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 40 ]
4,636
7,055
630
What is the percentage of Mother to Child Transmission of HIV-1, when there is no intervention?
277
[ "Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45%" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 3 ]
4,636
7,055
630
Does C-C chemokine receptor type 5 (CCR5) affect the transmission of HIV-1?
312
[ "Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 38 ]
4,636
7,055
630
How does Mannanose Binding Lectin (MBL) affect elimination of HIV-1 pathogen?
318
[ "Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis," ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 38 ]
4,636
7,055
630
How can CCR5's effect in HIV-1 transmission be reduced?
321
[ "The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1" ]
[ "Functional Genetic Variants in DC-SIGNR Are Associated with Mother-to-Child Transmission of HIV-1\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC2752805/\n\nBoily-Larouche, Geneviève; Iscache, Anne-Laure; Zijenah, Lynn S.; Humphrey, Jean H.; Mouland, Andrew J.; Ward, Brian J.; Roger, Michel\n2009-10-07\nDOI:10.1371/journal.pone.0007211\nLicense:cc-by", "Abstract: BACKGROUND: Mother-to-child transmission (MTCT) is the main cause of HIV-1 infection in children worldwide. Given that the C-type lectin receptor, dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node–specific ICAM-grabbing non-integrin (L-SIGN)), can interact with pathogens including HIV-1 and is expressed at the maternal-fetal interface, we hypothesized that it could influence MTCT of HIV-1. METHODS AND FINDINGS: To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of 197 HIV-infected mothers and their infants recruited in Harare, Zimbabwe. Infants harbouring two copies of DC-SIGNR H1 and/or H3 haplotypes (H1-H1, H1-H3, H3-H3) had a 3.6-fold increased risk of in utero (IU) (P = 0.013) HIV-1 infection and a 5.7-fold increased risk of intrapartum (IP) (P = 0.025) HIV-1 infection after adjusting for a number of maternal", "factors. The implicated H1 and H3 haplotypes share two single nucleotide polymorphisms (SNPs) in promoter region (p-198A) and intron 2 (int2-180A) that were associated with increased risk of both IU (P = 0.045 and P = 0.003, respectively) and IP (P = 0.025, for int2-180A) HIV-1 infection. The promoter variant reduced transcriptional activity in vitro. In homozygous H1 infants bearing both the p-198A and int2-180A mutations, we observed a 4-fold decrease in the level of placental DC-SIGNR transcripts, disproportionately affecting the expression of membrane-bound isoforms compared to infant noncarriers (P = 0.011). CONCLUSION: These results suggest that DC-SIGNR plays a crucial role in MTCT of HIV-1 and that impaired placental DC-SIGNR expression increases risk of transmission.", "Text: Without specific interventions, the rate of HIV-1 mother-tochild transmission (MTCT) is approximately 15-45% [1] . UNAIDS estimates that last year alone, more than 400,000 children were infected worldwide, mostly through MTCT and 90% of them lived in sub-Saharan Africa. In the most heavilyaffected countries, such as Zimbabwe, HIV-1 is responsible for one third of all deaths among children under the age of five. MTCT of HIV-1 can occur during pregnancy (in utero, IU), delivery (intrapartum, IP) or breastfeeding (postpartum, PP). High maternal viral load, low CD4 cells count, vaginal delivery, low gestational age have all been identified as independent factors associated with MTCT of HIV-1 [1] . Although antiretrovirals can reduce MTCT to 2%, limited access to timely diagnostics and drugs in many developing world countries limits the potential impact of this strategy. A better understanding of the mechanisms acting at the maternal-fetal interface is crucial for the design of", "alternative interventions to antiretroviral therapy for transmission prevention.", "Dendritic cell-specific ICAM-grabbing non-integrin-related (DC-SIGNR, also known as CD209L or liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN)) can interact with a plethora of pathogens including HIV-1 and is expressed in placental capillary endothelial cells [2] . DC-SIGNR is organized in three distinct domains, an N-terminal cytoplasmic tail, a repeat region containing seven repeat of 23 amino acids and a C-terminal domain implicated in pathogen binding. Alternative splicing of DC-SIGNR gene leads to the production of a highly diversify isoforms repertoire which includes membrane-bound and soluble isoforms [3] . It has been proposed that interaction between DC-SIGNR and HIV-1 might enhance viral transfer to other susceptible cell types [2] but DC-SIGNR can also internalize and mediate proteasome-dependant degradation of viruses [4] that may differently affect the outcome of infection.", "Given the presence of DC-SIGNR at the maternal-fetal interface and its interaction with HIV-1, we hypothesized that it could influence MTCT of HIV-1. To investigate the potential role of DC-SIGNR in MTCT of HIV-1, we carried out a genetic association study of DC-SIGNR in a well-characterized cohort of HIV-infected mothers and their infants recruited in Zimbabwe, and identified specific DC-SIGNR variants associated with increased risks of HIV transmission. We further characterized the functional impact of these genetic variants on DC-SIGNR expression and show that they affect both the level and type of DC-SIGNR transcripts produced in the placenta.", "Samples consisted of stored DNA extracts obtained from 197 mother-child pairs co-enrolled immediately postpartum in the ZVITAMBO Vitamin A supplementation trial (Harare, Zimbabwe) and followed at 6 weeks, and 3-monthly intervals up to 24 months. The ZVITAMBO project was a randomized placebocontrolled clinical trial that enrolled 14,110 mother-child pairs, between November 1997 and January 2000, with the main objective of investigating the impact of immediate postpartum vitamin A supplementation on MTCT of HIV-1. The samples used in the present study were from mother-child pairs randomly assigned to the placebo group of the ZVITAMBO project. Antiretroviral prophylaxis for HIV-1-positive antenatal women was not available in the Harare public-sector during ZVITAMBO patient recruitment. The samples were consecutively drawn from two groups: 97 HIV-1-positive mother/HIV-1-positive child pairs and 100 HIV-1-positive mother/HIV-negative child pairs. Mother's serological status was determined", "by ELISA and confirmed by Western Blot. Infants were considered to be infected if they were HIV-1 seropositive at 18 months or older and had two or more positive HIV-1-DNA polymerase chain reaction (PCR) results at earlier ages. 100 infants were considered to be uninfected as they were ELISA negative at 18 months or older and had two DNA PCR negative results from samples collected at a younger age. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP as determined by PCR analyses of blood samples collected at birth, 6 weeks, 3 and 6 months of age and according to the following definitions adapted from Bryson and colleagues [5] . Briefly, infants who were DNA PCR positive at birth were infected IU. Infants with negative PCR results from sample obtained at birth but who become positive by 6 weeks of age were infected IP. Infants with negative PCR results at birth and 6 weeks of age but who subsequently became DNA PCR positive were", "considered to be infected during the PP period. In the analysis comparing the 3 different modes of MTCT, 12 HIV-1-infected infants were excluded because the PCR results were not available at 6 weeks of age. Full methods for recruitment, baseline characteristics collection, laboratory procedures have been described elsewhere [6] .", "The nucleotide sequence variation of the entire promoter, coding and part of 39-UTR regions of DC-SIGNR gene in the study population was determined previously [7] . Haplotype reconstruction was performed using Bayesian statistical method implemented in PHASE [8] , version 2.1.1, using single nucleotide polymorphism (SNP) with a minimum allele frequency (MAF) of 2%. We applied the algorithm five times, using different randomly generated seeds, and consistent results were obtained across runs ( Figure 1 ). Fifteen haplotype-tagged SNPs (htSNPs) were identified by the HaploBlockFinder software [9] with a MAF $5%. These htSNPs were genotyped in the 197 infants by direct PCR sequencing analysis as we have described previously [7] . The DC-SIGNR exon 4 repeat region genotype was determined by PCR amplification followed by migration in 1.5% agarose gels [10] . DNA sequences in the promoter region were analysed with the TESS interface (http//:www.cbil.upenn.edu/tess) for putative", "transcription factors binding sites using the TRANSFAC database.", "Luciferase reporter assays using pGL2-Basic vector were performed in order to investigate the functional effect of mutations on DC-SIGNR promoter activity. Genomic DNA from subjects homozygous for the promoter variants and WT was amplified from nucleotide position 2715 to 21 and cloned between the BglII and HindIII multiple cloning sites in the pGL2-Basic vector which harbours a reporter firefly luciferase gene downstream (Invitrogen Canada inc, Burlington, Canada). All recombinants clones were verified by DNA sequencing. The firefly luciferase test reporter vector was co-transfected at a ratio of 10:1 with the constitutive expressor of Renilla luciferase, phRL-CMV (Promega, Madison, WI, USA). We cultured HeLa cells in 6 wells plates (2610 5 cells) and transfected them the following day using lipofectamine (Invitrogen) according to the manufacturer. Cells were lysed and luciferase assays were performed using 20 mg of protein extract according to the manufacturer (Promega) at 44 h", "post-transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments. We carried out lucierase assays in triplicate in three independent experiments. Results are expressed as mean6 standard error of the mean (S.E.M).", "First-term placental tissues were obtained from abortions following voluntary interruption of pregnancy at CHUM Hôpital Saint-Luc (Montreal, Canada). Tissues from 3 H1 (associated with MTCT of HIV-1) and 3 H15 (wild-type) homozygous haplotypes were used to analyse possible differences in isoform expression. Total placental RNAs were extracted by MasterPure DNA and RNA Extraction Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer. Fragments corresponding to the DC-SIGNR coding region were reversed transcribed (RT) and then amplified by nested PCR with the following primers; RT primers RR, first PCR RF and RR and second PCR RcF and RcR according to Liu and colleagues [11] . 1 mg of total RNA was reverse transcribed with Expand RT (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer and were PCR-amplified with DNA Platinum Taq Polymerase (Invitrogen). Major PCR products from the second PCR reaction were gel extracted with the Qiagen", "Gel Extraction Kit (Qiagen Canada inc, Mississauga, ON, Canada) and cloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). For each placenta, 15 different clones were randomly selected and amplified with M13 primers and sequenced with ABI PRISM 3100 capillary automated sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed and aligned with GeneBank reference sequence NM_014257 using Lasergene software (DNA Stars, Madison, WI, USA).", "Quantitative expression of DC-SIGNR isoforms 1,5 mg of placental RNA was reverse transcribed using 2.5 mM of Oligo dT 20 and Expand RT in 20 ml volume according to the manufacturer (Roche Applied Science). 15 ng of total cDNA in a final volume of 20 ml was used to perform quantitative real-time PCR using Universal Express SYBR GreenER qPCR Supermix (Invitrogen) on a Rotor Gene Realtime Rotary Analyser (Corbett Life Science, Sydney, Australia). Samples from 2 subjects in each group were used because RNA quality of others was not suitable for a qRT-PCR analysis. Amplification of all DC-SIGNR isoforms was performed using an exon 5 specific primer pair (Table S1 ). Membrane-bound isoforms were amplified using primers specific for exon 3, corresponding to the common trans-membrane domain of DC-SIGNR. Primers were targeted to the exon-exon junction and RNA extracts were treated with DNase (Fermantas International inc, Burlington, ON, Canada) to avoid amplification of contaminant DNA.", "Standard curves (50-500 000 copies per reaction) were generated using serial dilution of a full-length DC-SIGNR or commercial GAPDH (Invitrogen) plasmid DNA. All qPCR reactions had efficiencies ranging from 99% to 100%, even in the presence of 20 ng of non-specific nucleic acids, and therefore could be compared. The copy number of unknown samples was estimated by placing the measured PCR cycle number (crossing threshold) on the standard curve. To correct for differences in both RNA quality and quantity between samples, the expression levels of transcripts were normalised to the reference GAPDH gene transcripts. GAPDH primer sequences were kindly provided by A. Mes-Masson at the CHUM. The results are presented as target gene copy number per 10 5 copies of GAPDH. The ratio of membrane-bound isoforms was calculated as E3/E5. Soluble isoforms were calculated by subtracting membrane-bound from total isoforms. We carried out qPCR assays in triplicate in three independent experiments.", "Results are expressed as mean6S.E.M.", "Statistical analysis was performed using the GraphPad PRISM 5.0 for Windows (GraphPad Software inc, San Diego, CA, USA). Differences in baseline characteristics and genotypic frequencies of haplotypes or htSNPs were compared between groups using the x 2 analysis or Fisher's exact test. Logistic regression analysis was used to estimate odds ratios (OR) for each genotype and baseline risk factors. Multiple logistic regression was used to define independent predictors identified as significant in the crude analysis. ORs and 95% confidence interval were calculated with the exact method. Comparisons of continuous variables between groups were assessed with the unpaired two-tailed Student's t test when variables were normally distributed and with the Mann-Whitney U test when otherwise. Differences were considered significant at P,0.05.", "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The", "We carried out an association study of DC-SIGNR polymorphism in 197 infants born to untreated HIV-1-infected mothers recruited in Harare, Zimbabwe. Among them, 97 infants were HIV-1-infected and 100 infants remained uninfected. Of the 97 HIV-1-infected infants, 57 were infected IU, 11 were infected IP, and 17 were infected PP. Timing of infection was not determined for 12 HIV-1-infected infants. Baseline characteristics of mothers and infants are presented in Table 1 . Maternal age and CD4 cell count, child sex, mode of delivery, duration of membrane rupture and gestational age were similar among all groups. However, maternal viral load .29 000 copies/ml was associated with increased risk in both IU and PP with odds ratios (OR) of 3.64 (95% CI = 1.82-7.31, P = 0.0002) and 4.45 (95% CI = 1.50-13.2, P = 0.0045) for HIV-1 transmission, respectively.", "Fifteen haplotype-tagged SNPs (htSNPs) corresponding to the 15 major DC-SIGNR haplotypes ( Figure 1 ) described among Zimbabweans [7] were genotyped in our study samples (Tables S2 and S3 ). H1 (31%) and H3 (11%) were the most frequent haplotypes observed (Figure 1 ). Being homozygous for the H1 haplotype was associated with increased risk of both IU (OR: 4.42, P = 0.022) and PP (OR: 7.31, P = 0.016) HIV-1 transmission ( Table 2) . Infants harbouring two copy combinations of H1 and/ or H3 haplotypes (H1-H1, H1-H3 or H3-H3) had increased risk of IU (OR: 3.42, P = 0.007) and IP (OR: 5.71, P = 0.025) but not PP (P = 0.098) HIV-1 infection compared to infant noncarriers ( Table 2 ). The latter associations remained significant after adjustment was made for the maternal viral load for both IU (OR: 3.57, 95% CI = 1.30-9.82, P = 0.013) and IP (OR: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. The H1 and H3 haplotypes share a cluster of mutations (p-198A, int2-391C, int2-180A,", "ex4RPT, int5+7C) ( Figure 1 ). Of these, the p-198A and int2-180A variants were significantly associated with MTCT of HIV-1 (Table S2 ). In the unadjusted regression analysis, homozygous infants for the p-198A and int2-180A variants had increased risk of IU (OR: 2.07 P = 0.045, OR: 3.78, P = 0.003, respectively) and IP (OR: 2.47, P = 0.17, O.R: 5.71, P = 0.025, respectively) HIV-1 infection compared to heterozygote infants or noncarriers (Table 3) . When adjustment was made for maternal factors, only the association with the int2-180A variant remained significant for IU (OR: 3.83, 95% CI = 1.42-10.4, P = 0.008) and IP (O.R: 5.71, 95% CI = 1.40-23.3, P = 0.025) HIV-1 transmission. Thus, infants homozygous for DC-SIGNR variant int2-180A contained in H1 and H3 haplotypes were 4-fold to 6-fold more likely to be infected by HIV-1 during pregnancy or at delivery, respectively.", "Alternative splicing of the DC-SIGNR gene in the placenta produces both membrane-bound and soluble isoform repertoires [3] . The relative proportion of membrane bound and soluble DC-SIGNR could plausibly influence the susceptibility to HIV-1 infection [11] . We therefore hypothesized that the DC-SIGNR mutations associated with MTCT of HIV-1 would have an impact on both the level of DC-SIGNR expression and in the isoform repertoire produced. We investigated DC-SIGNR transcript expression in first-term placentas obtained after elective abortion.", "We cloned DC-SIGNR from placental tissues by RT-PCR from 3 homozygous H1 samples containing both the DC-SIGNR p-198AA and int2-180AA variants associated with HIV-1 transmission and 3 homozygous wild-type (WT) (p-198CC, int2-180GG) samples. Fifteen clones per sample were randomly selected for sequencing. As expected, we found an extensive repertoire of DC-SIGNR transcripts in all samples with 9 to 16 different isoforms per individual. A total of 65 distinct transcripts were identified ( Figure S1 ), of which 3 were full-length transcripts. 64 of the sequenced clones contained a total of 69 amino acid substitutions with 3 new C termini and 2 premature stop codons. However, the diversity was mostly attributable to the entire deletion of exon 2 or exon 3 or to variations in the length of the neck region (exon 4) of DC-SIGNR. The deletion of exon 3 eliminates the trans-membrane domain of the protein and leads to the expression of soluble DC-SIGNR isoforms [3] . Interestingly, the abundance", "of membrane-bound isoforms in placental tissues of the H1 homozygotes appears to be lower than that observed in samples from WT individuals ( Figure S1 ). The deletion of exon 3 was confirmed by sequencing and we hypothesize that the skipping of exon 3, could be due to the presence of the int2-180A mutation observed in infants with the H1 haplotype. In fact, this intron mutation is located 180 bp downstream from exon 3 and potentially modifies splicing events (Figure 2A ). We confirmed that the variation in transcript proportions seen between the two groups was also reflected at the level of mRNA expression in the placenta. To quantify membrane-bound vs soluble isoforms in placental samples from homozygous H1 and WT infants, we amplified the exon 5 (E5) sequence present in all DC-SIGNR isoforms (total transcripts). We then amplified exon 3 (E3) which is deleted in the soluble forms and then calculated the E3:E5 ratio. We found that placental tissues from homozygous H1 infants express", "a significantly lower proportion of membrane-bound DC-SIGNR (18%) compared to that in WT individuals (36%) (P = 0.004) ( Figure 2B ) suggesting that exon 3 skipping happens more frequently in presence of the DC-SIGNR int2-180A variant associated with MTCT of HIV-1.", "The DC-SIGNR int2-180A variant is always transmitted with the promoter mutation p-198A (Figure 1 ). In the unadjusted regression analysis, the p-198A variant was significantly associated with IU but not with IP and PP HIV-1 transmission (Table 3) . Computational transcription factor binding site analysis predicts Table 1 . Baseline characteristics of mother and infants risk factors for intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission. Figure 3A ). The luciferase activity of the p-198A variant construct was significantly lower than that of the WT p-198C promoter construct (p-198C/A ratio = 2, P = 0.006) ( Figure 3B ) suggesting that DC-SIGNR p-198A affects promoter activity. The other promoter mutants (p-577C and p-323A) observed in the Zimbabwean population did not affect DC-SIGNR transcription in this assay ( Figure S2 ). To determine the net impact of the DC-SIGNR p-198A mutation on DC-SIGNR expression in the placenta, we quantitated the", "absolute number of total and membrane-bound DC-SIGNR transcripts in the H1 homozygote and wild-type placental samples as described earlier. The total number of DC-SIGNR transcripts was determined to be 6856213 (DC-SIGNR copies6S.E.M per 10 5 GAPDH copies) in the placental samples from homozygous H1 infants and was 4-fold lower compared to that found in placentas from WT individuals (27816638, P = 0.011) ( Figure 3C ). As suggested earlier, the int2-180A mutation might induce exon 3 skipping leading to a lower production of membrane-bound DC-SIGNR. Although, the decrease in the total number of DC-SIGNR transcripts in H1 homozygous placental samples containing both the p-198AA and int2-180AA variants affected the proportion of membrane-bound and soluble isoforms, the effect of these mutations was more pronounced on the membrane-bound isoforms with an 8-fold decrease (H1 = 117636.2 vs WT = 9906220.6, P = 0.003) compared to a 3-fold decrease in total soluble isoforms (H1 = 5686181.9 vs WT", "= 19256495.3, P = 0.03) ( Figure 3C ). Therefore, DC-SIGNR p-198A and int2-180A mutations associated with MTCT of HIV-1 significantly decreased the level of total placental DC-SIGNR transcripts, disproportionately affecting the membrane-bound isoform production. Table 3 . Associations between infant DC-SIGNR promoter p-198 and intron 2 (int2)-180 variants and intrauterine (IU), intrapartum (IP) and postpartum (PP) mother-to-child HIV-1 transmission.", "Our genetic results, supported by expression assay in placenta, suggest the involvement of DC-SIGNR in MTCT of HIV-1. Homozygosity for the haplotype H1 was associated with IU transmission in the unadjusted regression analysis. However, the association disappeared after adjustment was made for the maternal factors presumably because of the small number of H1 homozygote infants analysed in each groups. H1 and H3 were the most frequent haplotypes observed in the study population and they share a cluster of mutations (Figure 1 ). Grouping haplotypes H1 and H3 increased the power of the study and permitted the identification of specific DC-SIGNR mutations associated with MTCT of HIV-1. Indeed, two mutations shared by haplotypes H1 and H3 were associated with vertical transmission of HIV-1. The int2-180A was associated with a 4-fold increased risk of IU and 6fold increased risk of IP after adjustment for the maternal factors. Although the p-198A variant was associated with IU transmission,", "the association disappeared after adjustment was made for the maternal viral load. Nevertheless, we showed that this mutation reduces DC-SIGNR transcriptional activity in vitro and produces lower level of DC-SIGNR transcripts in placental tissues in combination with the int2-180A variant. Since int2-180A is always transmitted with p-198A on the MTCT associated combined haplotypes H1/H3, whereas p-198A is carried on other nonassociated haplotypes (Figure 1) , we can speculate that the p-198A mutation alone may have a minor effect in vivo whereas in combination with the int2-180A variant, they both act to reduce the level of placental DC-SIGNR expression resulting in an increased risk of MTCT of HIV-1.", "The majority of IU transmission occurs during the last trimester of pregnancy (reviewed in [12] ). Full-term placenta samples were not available for the current study and the expression assays were performed on first-term placental tissues. A previous study looking at DC-SIGNR placental isoforms repertoire in full-term placenta samples demonstrated similar diversity of DC-SIGNR transcripts as in the first-term placental tissues studied herein [3] . However, since levels of DC-SIGNR expression have never been compared between the different terms of pregnancy, it is not known whether DC-SIGNR expression varies during the course of pregnancy. Nevertheless, it is reasonable to assume that the inter-individual differences in both DC-SIGNR isoform repertoire and transcript levels observed between the H1 and WT homozygous infants would be reflected throughout the pregnancy. To date, most studies have focused on the potential role of DC-SIGNR in trans infection of HIV-1 in vitro [2, 10] .", "However, the multiple mechanisms involved in trans infection and redundancy among C-type lectin functions make it difficult to determine the actual participation of DC-SIGNR in this mode of infection in vivo [13, 14] . The strong correlation we observed between MTCT of HIV-1 and DC-SIGNR genetic variants producing low levels of DC-SIGNR in the placenta suggested that mechanisms other than DC-SIGNR-mediated trans infection might operate during vertical transmission of HIV-1. For example, DC-SIGNR has also been shown to function as a HIV-1 antigen-capturing receptor [15] . Chan and colleagues recently demonstrated that DC-SIGNR transfected CHO cells diminish SARS-CoV titers by enhanced capture and degradation of the virus in a proteasome-dependent manner [4] . Since endothelial cells express MHC-I and II, degraded viral antigens could then be presented to immune cells to elicit an adaptive immune response [16, 17] . The HIV-1 coreceptor CCR5, but not CD4, is co-expressed with DC-SIGNR", "on placental and blood-brain barrier (BBB) endothelial cells [18, 19] . HIV-1 gp120 binding to CCR5 receptor on endothelial cells compromises BBB integrity and enhances monocytes adhesion and transmigration across the BBB [20, 21] . It is thus possible that reduced expression of DC-SIGNR, particularly the membranebound isoforms, on placental capillary endothelial cells might favour HIV-1 binding to CCR5 receptor, instead of DC-SIGNR receptor, facilitating the migration of maternal HIV-1-infected cells across the placental barrier resulting in IU transmission of HIV-1.", "The int2-180A variant contained in the H1 and H3 haplotypes was associated with IP transmission suggesting that DC-SIGNR also affect transmission of HIV-1 during delivery. Little is known about the mechanisms underlying transmission of HIV-1 during delivery. Passage through the birth canal could potentially expose infants through a mucosal portal entry (presumably ophthalmic, skin, or gastrointestinal), whereas placental insult during delivery (physical or inflammatory) may enhance transplacental passage of maternal HIV-1-infected cells into foetal circulation [22, 23] . Such process called microtransfusion has been proposed in regards to the results obtain in a Malawian cohort. Kweik and colleagues found a significant association between levels of maternal DNA in umbilical cord blood and IP transmission of HIV-1 suggesting that passage of maternal infected cells through the placenta is likely to occur during delivery [22] . Thus, in a similar fashion as suggested earlier for IU", "transmission, the relatively lower level of DC-SIGNR in the placenta of homozygous infants harbouring the int2-180A variant could promote HIV-1 binding to CCR5 receptor on endothelial cells affecting the placental barrier integrity and facilitating the passage of maternal infected cells in foetal circulation during delivery.", "Beside DC-SIGNR, other HIV-1 receptors are known to influence MTCT of HIV-1 (reviewed in [24] ). Genetic variants in CCR5 have been shown to influence vertical transmission of HIV-1. CCR5 promoter variants resulting in higher expression of the receptor were associated with increased risk of MTCT of HIV-1 among sub-Saharan Africans [25, 26] . The 32-pb deletion polymorphism in CCR5 has be shown to protect from vertical transmission of HIV-1 [27] , but this variant is virtually absent among African populations [28] . High copy numbers of CCL3L1, a potent HIV-1 suppressive ligand for CCR5, are associated with higher chemokine production and lower risk of MTCT of HIV-1 among South African infants [29, 30] . Mannose-binding lectin (MBL) is an innate immune receptor synthesised in the liver and secreted in the bloodstream in response to inflammation signal. MBL promotes pathogen elimination by opsonization and phagocytosis, and reduced expression of MBL resulting from polymorphism in coding", "and non-coding regions has been associated with an increased risk of MTCT of HIV-1 [31, 32] .", "In this study, we demonstrate for the first time, the potential functional impact of DC-SIGNR mutations on its expression in the placenta and in vertical transmission of HIV-1. We believe that the presence of DC-SIGNR at the placental endothelial cell surface may protect infants from HIV-1 infection by capturing virus and promoting its degradation/presentation. However, in placenta containing low levels of DC-SIGNR, HIV-1 would preferentially binds CCR5 on endothelial cells resulting in a loss of placental barrier integrity and enhanced passage of maternal HIV-1-infected cells in foetal circulation leading to MTCT of HIV-1. This mechanism may also apply to other vertically-transmitted pathogens known to interact with DC-SIGNR such as HIV-2, hepatitis C and dengue viruses and warrant further investigation.", "Associations between child DC-SIGNR exon 4 repeated region genotypes and mother-to-child HIV-1 transmission.CI, Confidence interval; N, number; NA; not applicable; OR, odds ratio a P-value as determined by the Chi-square test. b Comparison between genotype and all others. Found at: doi:10.1371/journal.pone.0007211.s003 (0.05 MB DOC) Figure S1 DC-SIGNR transcripts repertoire in placenta. Major RT-PCR products from RNA extract from 3 homozygous H1 and 3 homozygous WT placenta samples were purified, cloned and sequenced. Sequenced were analysed according to NCBI reference sequence NM_014257. CT; cytoplasmic tail, TM; trans-membrane domain; WT; wild-type Found at: doi:10.1371/journal.pone.0007211.s004 (0.11 MB DOC) Figure S2 Effect of DC-SIGNR promoter variant on transcriptional activity in luciferase reporter assay in vitro in transfected HeLa cells. Relative luciferase expression from pGL2-Basic, parental vector without promoter. Expression DC-SIGNR promoter constructs, spanning p-577C", "variant or p-323A variant were calculated relatively to this value. Data are presented in mean values6S.E.M of three independent experiments performed in triplicate. One-way ANOVA test followed by the Dunnett test for multiple comparison was used to compare the relative luciferase expression of the p-557C and p-323A variant reporters against the wild-type (WT) construct (not significant). 0 mg, 0,5 mg or 1 mg CMV-Tat vector was transfected with LTR-Luc as a positive control in these experiments." ]
[ 38 ]
4,636
7,055
1,546
What is the size of bovine coronavirus?
917
[ "31 kb" ]
[ "First Complete Genome Sequence of a French Bovine coronavirus Strain\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5477389/\n\nSHA: eef0ecf5b8e7b179dadaef967e65f2ab68f021e1\n\nAuthors: Kin, Nathalie; Guerard, Pauline; Diancourt, Laure; Caro, Valérie; Vabret, Astrid; Ar Gouilh, Meriadeg\nDate: 2017-05-25\nDOI: 10.1128/genomea.00319-17\nLicense: cc-by\n\nAbstract: We sequenced the first Bovine coronavirus (BCoV) complete genome sequence from France. This BCoV was directly sequenced from a fecal sample collected from a calf in Normandy in 2014.", "Text: B ovine coronavirus (BCoV) belongs to the Nidovirales order, the Coronaviridae family, the Coronavirinae subfamily, and the Betacoronavirus (https://talk.ictvonline.org/ ICTV/proposals/2008.085-122V.v4.Coronaviridae.pdf). Its genome is a single-stranded, linear, and nonsegmented RNA of around 31 kb. BCoV is responsible for respiratory and enteric diseases in cattle, particularly during winter (1, 2) . To date, the 19 complete BCoV genome sequences available in GenBank databases (consulted on 17 January 2017) originated from the United States or Asia. Here, we report the first complete genome sequence of a BCoV detected in France.", "The BCoV/FRA-EPI/CAEN/2014/13 strain was obtained from a fecal sample collected from a 1-week-old calf in Normandy in 2014. The presence of BCoV in the fecal sample was assessed using an in-house reverse transcription-PCR (RT-PCR) targeting the M gene (3). A cDNA library was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) and hexamers. The complete genome sequencing of overlapping PCR products was carried out in both directions, using original primers and Sanger's dideoxy sequencing. Sequencing reactions were performed as previously described (3). Sequences were assembled and annotated using the Geneious software (version 5.1.6). We obtained a sequence counting 30,847 nucleotides. The orf1ab, HE, S, ns5, E, M, and N genes of the obtained BCoV were submitted to a Blastn analysis. According to these analyses, the orf1ab (20kb nucleotides, located at the 5= side of the genome) gene is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F strain from", "the United Arab Emirates (accession no. KF906251), with a nucleotide identity of 99.19%. Conversely, the NS2, HE, S, ns5, and M genes are closely related to the BCoV Bubalus/Italy/179/07-11 strain (accession no. EU019216), with nucleotide identities of 99.88%, 99.45%, 99.02%, 98.79%, and 99.28%, respectively. The E gene is closely related to the Chinese Bovine coronavirus strain BCV-AKS-01 (accession no. KU886219), with a nucleotide identity of 100%. Finally, the highest Blastn score for the N gene was found with the American enteric BCoV-ENT (accession no. AF391541), associated with a nucleotide identity of 100%.", "Multiple-sequence alignment, including 20 BCoVs and 10 clade A betacoronaviruses closely related to BCoV from North America, two DcCoVs from the United Arab Emirates, and two Human coronavirus OC43 (HCoV-OC43) strains from France, was performed using the Muscle algorithm implemented in MEGA7 (4, 5) . The phylogenetic analysis on the orf1ab confirms that BCoV/FRA-EPI/CAEN/2014/13 is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F. The orf1ab gene of these two viruses together clustered separately from that of BCoV and BCoV-like viruses from North America and Asia. This finding also confirms the results from our previous analysis on partial genomes in which nsp12, S, and N genes of American and Asian BCoVs group together in a cluster tentatively named C 1 . The nsp12 and N coding regions of BCoVs from France and DcCoVs from the United Arab Emirates clustered together in C 2 . The DcCoV S gene individualized from both HCoV-OC43 and BCoV S genes. Potential", "recombination events could be at the origin of DcCoV.", "Accession number(s). The complete genome sequence sequence of the BCoV/FRA-EPI/CAEN/2014/13 isolate has been deposited in GenBank under the accession number KX982264." ]
[ 1 ]
568
1,094
1,546
What is the molecular structure of bovine coronavirus?
918
[ "single-stranded, linear, and nonsegmented RNA" ]
[ "First Complete Genome Sequence of a French Bovine coronavirus Strain\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5477389/\n\nSHA: eef0ecf5b8e7b179dadaef967e65f2ab68f021e1\n\nAuthors: Kin, Nathalie; Guerard, Pauline; Diancourt, Laure; Caro, Valérie; Vabret, Astrid; Ar Gouilh, Meriadeg\nDate: 2017-05-25\nDOI: 10.1128/genomea.00319-17\nLicense: cc-by\n\nAbstract: We sequenced the first Bovine coronavirus (BCoV) complete genome sequence from France. This BCoV was directly sequenced from a fecal sample collected from a calf in Normandy in 2014.", "Text: B ovine coronavirus (BCoV) belongs to the Nidovirales order, the Coronaviridae family, the Coronavirinae subfamily, and the Betacoronavirus (https://talk.ictvonline.org/ ICTV/proposals/2008.085-122V.v4.Coronaviridae.pdf). Its genome is a single-stranded, linear, and nonsegmented RNA of around 31 kb. BCoV is responsible for respiratory and enteric diseases in cattle, particularly during winter (1, 2) . To date, the 19 complete BCoV genome sequences available in GenBank databases (consulted on 17 January 2017) originated from the United States or Asia. Here, we report the first complete genome sequence of a BCoV detected in France.", "The BCoV/FRA-EPI/CAEN/2014/13 strain was obtained from a fecal sample collected from a 1-week-old calf in Normandy in 2014. The presence of BCoV in the fecal sample was assessed using an in-house reverse transcription-PCR (RT-PCR) targeting the M gene (3). A cDNA library was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) and hexamers. The complete genome sequencing of overlapping PCR products was carried out in both directions, using original primers and Sanger's dideoxy sequencing. Sequencing reactions were performed as previously described (3). Sequences were assembled and annotated using the Geneious software (version 5.1.6). We obtained a sequence counting 30,847 nucleotides. The orf1ab, HE, S, ns5, E, M, and N genes of the obtained BCoV were submitted to a Blastn analysis. According to these analyses, the orf1ab (20kb nucleotides, located at the 5= side of the genome) gene is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F strain from", "the United Arab Emirates (accession no. KF906251), with a nucleotide identity of 99.19%. Conversely, the NS2, HE, S, ns5, and M genes are closely related to the BCoV Bubalus/Italy/179/07-11 strain (accession no. EU019216), with nucleotide identities of 99.88%, 99.45%, 99.02%, 98.79%, and 99.28%, respectively. The E gene is closely related to the Chinese Bovine coronavirus strain BCV-AKS-01 (accession no. KU886219), with a nucleotide identity of 100%. Finally, the highest Blastn score for the N gene was found with the American enteric BCoV-ENT (accession no. AF391541), associated with a nucleotide identity of 100%.", "Multiple-sequence alignment, including 20 BCoVs and 10 clade A betacoronaviruses closely related to BCoV from North America, two DcCoVs from the United Arab Emirates, and two Human coronavirus OC43 (HCoV-OC43) strains from France, was performed using the Muscle algorithm implemented in MEGA7 (4, 5) . The phylogenetic analysis on the orf1ab confirms that BCoV/FRA-EPI/CAEN/2014/13 is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F. The orf1ab gene of these two viruses together clustered separately from that of BCoV and BCoV-like viruses from North America and Asia. This finding also confirms the results from our previous analysis on partial genomes in which nsp12, S, and N genes of American and Asian BCoVs group together in a cluster tentatively named C 1 . The nsp12 and N coding regions of BCoVs from France and DcCoVs from the United Arab Emirates clustered together in C 2 . The DcCoV S gene individualized from both HCoV-OC43 and BCoV S genes. Potential", "recombination events could be at the origin of DcCoV.", "Accession number(s). The complete genome sequence sequence of the BCoV/FRA-EPI/CAEN/2014/13 isolate has been deposited in GenBank under the accession number KX982264." ]
[ 1 ]
568
1,094
1,546
How many nucleotides does bovine coronavirus contain?
919
[ "30,847 nucleotides" ]
[ "First Complete Genome Sequence of a French Bovine coronavirus Strain\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5477389/\n\nSHA: eef0ecf5b8e7b179dadaef967e65f2ab68f021e1\n\nAuthors: Kin, Nathalie; Guerard, Pauline; Diancourt, Laure; Caro, Valérie; Vabret, Astrid; Ar Gouilh, Meriadeg\nDate: 2017-05-25\nDOI: 10.1128/genomea.00319-17\nLicense: cc-by\n\nAbstract: We sequenced the first Bovine coronavirus (BCoV) complete genome sequence from France. This BCoV was directly sequenced from a fecal sample collected from a calf in Normandy in 2014.", "Text: B ovine coronavirus (BCoV) belongs to the Nidovirales order, the Coronaviridae family, the Coronavirinae subfamily, and the Betacoronavirus (https://talk.ictvonline.org/ ICTV/proposals/2008.085-122V.v4.Coronaviridae.pdf). Its genome is a single-stranded, linear, and nonsegmented RNA of around 31 kb. BCoV is responsible for respiratory and enteric diseases in cattle, particularly during winter (1, 2) . To date, the 19 complete BCoV genome sequences available in GenBank databases (consulted on 17 January 2017) originated from the United States or Asia. Here, we report the first complete genome sequence of a BCoV detected in France.", "The BCoV/FRA-EPI/CAEN/2014/13 strain was obtained from a fecal sample collected from a 1-week-old calf in Normandy in 2014. The presence of BCoV in the fecal sample was assessed using an in-house reverse transcription-PCR (RT-PCR) targeting the M gene (3). A cDNA library was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) and hexamers. The complete genome sequencing of overlapping PCR products was carried out in both directions, using original primers and Sanger's dideoxy sequencing. Sequencing reactions were performed as previously described (3). Sequences were assembled and annotated using the Geneious software (version 5.1.6). We obtained a sequence counting 30,847 nucleotides. The orf1ab, HE, S, ns5, E, M, and N genes of the obtained BCoV were submitted to a Blastn analysis. According to these analyses, the orf1ab (20kb nucleotides, located at the 5= side of the genome) gene is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F strain from", "the United Arab Emirates (accession no. KF906251), with a nucleotide identity of 99.19%. Conversely, the NS2, HE, S, ns5, and M genes are closely related to the BCoV Bubalus/Italy/179/07-11 strain (accession no. EU019216), with nucleotide identities of 99.88%, 99.45%, 99.02%, 98.79%, and 99.28%, respectively. The E gene is closely related to the Chinese Bovine coronavirus strain BCV-AKS-01 (accession no. KU886219), with a nucleotide identity of 100%. Finally, the highest Blastn score for the N gene was found with the American enteric BCoV-ENT (accession no. AF391541), associated with a nucleotide identity of 100%.", "Multiple-sequence alignment, including 20 BCoVs and 10 clade A betacoronaviruses closely related to BCoV from North America, two DcCoVs from the United Arab Emirates, and two Human coronavirus OC43 (HCoV-OC43) strains from France, was performed using the Muscle algorithm implemented in MEGA7 (4, 5) . The phylogenetic analysis on the orf1ab confirms that BCoV/FRA-EPI/CAEN/2014/13 is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F. The orf1ab gene of these two viruses together clustered separately from that of BCoV and BCoV-like viruses from North America and Asia. This finding also confirms the results from our previous analysis on partial genomes in which nsp12, S, and N genes of American and Asian BCoVs group together in a cluster tentatively named C 1 . The nsp12 and N coding regions of BCoVs from France and DcCoVs from the United Arab Emirates clustered together in C 2 . The DcCoV S gene individualized from both HCoV-OC43 and BCoV S genes. Potential", "recombination events could be at the origin of DcCoV.", "Accession number(s). The complete genome sequence sequence of the BCoV/FRA-EPI/CAEN/2014/13 isolate has been deposited in GenBank under the accession number KX982264." ]
[ 2 ]
568
1,094
1,546
What is the size of the orf1ab gene in bovine coronavirus?
920
[ "20kb" ]
[ "First Complete Genome Sequence of a French Bovine coronavirus Strain\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5477389/\n\nSHA: eef0ecf5b8e7b179dadaef967e65f2ab68f021e1\n\nAuthors: Kin, Nathalie; Guerard, Pauline; Diancourt, Laure; Caro, Valérie; Vabret, Astrid; Ar Gouilh, Meriadeg\nDate: 2017-05-25\nDOI: 10.1128/genomea.00319-17\nLicense: cc-by\n\nAbstract: We sequenced the first Bovine coronavirus (BCoV) complete genome sequence from France. This BCoV was directly sequenced from a fecal sample collected from a calf in Normandy in 2014.", "Text: B ovine coronavirus (BCoV) belongs to the Nidovirales order, the Coronaviridae family, the Coronavirinae subfamily, and the Betacoronavirus (https://talk.ictvonline.org/ ICTV/proposals/2008.085-122V.v4.Coronaviridae.pdf). Its genome is a single-stranded, linear, and nonsegmented RNA of around 31 kb. BCoV is responsible for respiratory and enteric diseases in cattle, particularly during winter (1, 2) . To date, the 19 complete BCoV genome sequences available in GenBank databases (consulted on 17 January 2017) originated from the United States or Asia. Here, we report the first complete genome sequence of a BCoV detected in France.", "The BCoV/FRA-EPI/CAEN/2014/13 strain was obtained from a fecal sample collected from a 1-week-old calf in Normandy in 2014. The presence of BCoV in the fecal sample was assessed using an in-house reverse transcription-PCR (RT-PCR) targeting the M gene (3). A cDNA library was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) and hexamers. The complete genome sequencing of overlapping PCR products was carried out in both directions, using original primers and Sanger's dideoxy sequencing. Sequencing reactions were performed as previously described (3). Sequences were assembled and annotated using the Geneious software (version 5.1.6). We obtained a sequence counting 30,847 nucleotides. The orf1ab, HE, S, ns5, E, M, and N genes of the obtained BCoV were submitted to a Blastn analysis. According to these analyses, the orf1ab (20kb nucleotides, located at the 5= side of the genome) gene is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F strain from", "the United Arab Emirates (accession no. KF906251), with a nucleotide identity of 99.19%. Conversely, the NS2, HE, S, ns5, and M genes are closely related to the BCoV Bubalus/Italy/179/07-11 strain (accession no. EU019216), with nucleotide identities of 99.88%, 99.45%, 99.02%, 98.79%, and 99.28%, respectively. The E gene is closely related to the Chinese Bovine coronavirus strain BCV-AKS-01 (accession no. KU886219), with a nucleotide identity of 100%. Finally, the highest Blastn score for the N gene was found with the American enteric BCoV-ENT (accession no. AF391541), associated with a nucleotide identity of 100%.", "Multiple-sequence alignment, including 20 BCoVs and 10 clade A betacoronaviruses closely related to BCoV from North America, two DcCoVs from the United Arab Emirates, and two Human coronavirus OC43 (HCoV-OC43) strains from France, was performed using the Muscle algorithm implemented in MEGA7 (4, 5) . The phylogenetic analysis on the orf1ab confirms that BCoV/FRA-EPI/CAEN/2014/13 is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F. The orf1ab gene of these two viruses together clustered separately from that of BCoV and BCoV-like viruses from North America and Asia. This finding also confirms the results from our previous analysis on partial genomes in which nsp12, S, and N genes of American and Asian BCoVs group together in a cluster tentatively named C 1 . The nsp12 and N coding regions of BCoVs from France and DcCoVs from the United Arab Emirates clustered together in C 2 . The DcCoV S gene individualized from both HCoV-OC43 and BCoV S genes. Potential", "recombination events could be at the origin of DcCoV.", "Accession number(s). The complete genome sequence sequence of the BCoV/FRA-EPI/CAEN/2014/13 isolate has been deposited in GenBank under the accession number KX982264." ]
[ 2 ]
568
1,094
1,546
Is the orf1ab gene at the 3' or 5' end of the bovine coronavirus genome?
921
[ "5= side" ]
[ "First Complete Genome Sequence of a French Bovine coronavirus Strain\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5477389/\n\nSHA: eef0ecf5b8e7b179dadaef967e65f2ab68f021e1\n\nAuthors: Kin, Nathalie; Guerard, Pauline; Diancourt, Laure; Caro, Valérie; Vabret, Astrid; Ar Gouilh, Meriadeg\nDate: 2017-05-25\nDOI: 10.1128/genomea.00319-17\nLicense: cc-by\n\nAbstract: We sequenced the first Bovine coronavirus (BCoV) complete genome sequence from France. This BCoV was directly sequenced from a fecal sample collected from a calf in Normandy in 2014.", "Text: B ovine coronavirus (BCoV) belongs to the Nidovirales order, the Coronaviridae family, the Coronavirinae subfamily, and the Betacoronavirus (https://talk.ictvonline.org/ ICTV/proposals/2008.085-122V.v4.Coronaviridae.pdf). Its genome is a single-stranded, linear, and nonsegmented RNA of around 31 kb. BCoV is responsible for respiratory and enteric diseases in cattle, particularly during winter (1, 2) . To date, the 19 complete BCoV genome sequences available in GenBank databases (consulted on 17 January 2017) originated from the United States or Asia. Here, we report the first complete genome sequence of a BCoV detected in France.", "The BCoV/FRA-EPI/CAEN/2014/13 strain was obtained from a fecal sample collected from a 1-week-old calf in Normandy in 2014. The presence of BCoV in the fecal sample was assessed using an in-house reverse transcription-PCR (RT-PCR) targeting the M gene (3). A cDNA library was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) and hexamers. The complete genome sequencing of overlapping PCR products was carried out in both directions, using original primers and Sanger's dideoxy sequencing. Sequencing reactions were performed as previously described (3). Sequences were assembled and annotated using the Geneious software (version 5.1.6). We obtained a sequence counting 30,847 nucleotides. The orf1ab, HE, S, ns5, E, M, and N genes of the obtained BCoV were submitted to a Blastn analysis. According to these analyses, the orf1ab (20kb nucleotides, located at the 5= side of the genome) gene is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F strain from", "the United Arab Emirates (accession no. KF906251), with a nucleotide identity of 99.19%. Conversely, the NS2, HE, S, ns5, and M genes are closely related to the BCoV Bubalus/Italy/179/07-11 strain (accession no. EU019216), with nucleotide identities of 99.88%, 99.45%, 99.02%, 98.79%, and 99.28%, respectively. The E gene is closely related to the Chinese Bovine coronavirus strain BCV-AKS-01 (accession no. KU886219), with a nucleotide identity of 100%. Finally, the highest Blastn score for the N gene was found with the American enteric BCoV-ENT (accession no. AF391541), associated with a nucleotide identity of 100%.", "Multiple-sequence alignment, including 20 BCoVs and 10 clade A betacoronaviruses closely related to BCoV from North America, two DcCoVs from the United Arab Emirates, and two Human coronavirus OC43 (HCoV-OC43) strains from France, was performed using the Muscle algorithm implemented in MEGA7 (4, 5) . The phylogenetic analysis on the orf1ab confirms that BCoV/FRA-EPI/CAEN/2014/13 is closely related to the Dromedary camel coronavirus (DcCoV) HKU23-23-362F. The orf1ab gene of these two viruses together clustered separately from that of BCoV and BCoV-like viruses from North America and Asia. This finding also confirms the results from our previous analysis on partial genomes in which nsp12, S, and N genes of American and Asian BCoVs group together in a cluster tentatively named C 1 . The nsp12 and N coding regions of BCoVs from France and DcCoVs from the United Arab Emirates clustered together in C 2 . The DcCoV S gene individualized from both HCoV-OC43 and BCoV S genes. Potential", "recombination events could be at the origin of DcCoV.", "Accession number(s). The complete genome sequence sequence of the BCoV/FRA-EPI/CAEN/2014/13 isolate has been deposited in GenBank under the accession number KX982264." ]
[ 2 ]
568
1,094
1,545
What is a significant cause of Influenze like illness among healthy adolescents and adults presenting for medical evaluation?
1,658
[ "HCoV" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 1 ]
767
1,233
1,545
What is the most common species of Human Coronavirus among adults?
1,659
[ "HCoV-OC43" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 2 ]
767
1,233
1,545
Which Human Coronavirus showed species specific clinical characteristics of its infection?
1,660
[ "HCoV‐HKU1" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 1 ]
767
1,233
1,545
What causes the outbreak of SARS and MERS.
1,717
[ "Highly virulent species of HCoV" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 2 ]
767
1,233
1,545
What is the case fatality rate of SARS and MERS?
1,718
[ "ranged from 14% to 45%" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 2 ]
767
1,233
1,545
What were the common HCOV strains in the 5 year USA study?
1,719
[ "HCoV-OC43 and HCoV-229E" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 5 ]
767
1,233
1,545
Which species are more prevalent but less severe?
1,720
[ "HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E" ]
[ "Species‐specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5820427/\n\nSHA: edfe02a438fa9b667313da8f03614303fc2a4a14\n\nAuthors: Bouvier, Monique; Chen, Wei‐Ju; Arnold, John C.; Fairchok, Mary P.; Danaher, Patrick J.; Lalani, Tahaniyat; Malone, Leslie; Mor, Deepika; Ridoré, Michelande; Burgess, Timothy H.; Millar, Eugene V.\nDate: 2018-02-02\nDOI: 10.1111/irv.12538\nLicense: cc-by", "Abstract: Human coronavirus (HCoV) is a known cause of influenza‐like illness (ILI). In a multisite, observational, longitudinal study of ILI among otherwise healthy adolescents and adults, 12% of subjects were PCR‐positive for HCoV. The distribution of species was as follows: HCoV‐OC43 (34%), HCoV‐229E (28%), HCoV‐NL63 (22%), and HCoV‐HKU1 (16%). We did not observe species‐specific differences in the clinical characteristics of HCoV infection, with the exception of HCoV‐HKU1, for which the severity of gastrointestinal symptoms trended higher on the fourth day of illness.\n\nText: Clinical manifestations of human coronavirus (HCoV) infection range from a mild, self-limiting illness of the upper respiratory tract to an acute respiratory distress syndrome with a high mortality rate.", "Highly virulent species of HCoV were responsible for outbreaks of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS); case-fatality rates ranged from 14% to 45%. [1] [2] [3] By contrast, other HCoV species (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) are much more prevalent, much less severe, and common causes of influenza-like illness (ILI). [4] [5] [6] [7] [8] [9] [10] [11] Five previous studies have described the species-specific clinical characteristics of HCoV infection among adults. 6, 7, [10] [11] [12] In two of these studies, a significant proportion of the study population had underlying medical conditions. 6, 7 Herein, we describe, among a cohort of otherwise healthy adolescents and adults with influenza-like illness (ILI), the species-specific prevalence and severity of symptoms associated with HCoV infection. 13 Patients 0-65 years of age and presenting for care <72 hours after onset of ILI symptoms were recruited for study", "participation. ILI was defined as a temperature ≥100.4°F and sore throat or one of the following respiratory symptoms: cough, sputum production, shortness of breath, or chest pain. Both inpatient and outpatient subjects were eligible to participate. Patients with underlying medical conditions (eg, diabetes, chronic obstructive pulmonary disease, severe asthma), women with a high-risk or complicated pregnancy, and patients with a poorly controlled psychiatric disorder were excluded. Information on patient demographics and presence/severity of symptoms at the time of enrollment was collected by in-person interview. Participants were then instructed on the use of a daily diary to record the presence/severity of symptoms for 7 days following initial symptom onset. Symptom severity was rated on an ordinal scale from 0 (none) to 3 (severe). Symptom severity scores were quantified using the following five measures: (i) individual symptom score for 20 symptoms, (ii) the upper respiratory", "symptom score, calculated as the sum of severity scores for earache, runny nose, sore throat, and sneezing, (iii) the lower respiratory symptom score, calculated as the sum of severity scores for cough, difficulty breathing, hoarseness, and chest discomfort, (iv) the gastrointestinal symptom score, calculated as the sum of severity scores for diarrhea, vomiting, anorexia, nausea, and (Table 1) .", "There was season-to-season variability in the leading causes of \n\nThe findings of our study, conducted over a 5-year period at five geographically dispersed sites in the USA, demonstrate that human coronavirus (HCoV) is an important cause of influenza-like illness (ILI) ranged from 4% to 22%. [8] [9] [10] [11] 14 Additionally, we found HCoV-OC43\n\nto be the most common species among adults, as has been reported elsewhere. 8, 9, 11, 12, 14 HCoV-OC43 and HCoV-229E were the most common strains in alternate seasons, reflecting a season-to-season variability of HCoV strain circulation that has been reported in other multiyear studies. 4 8 The mechanisms by which this particular species elicits these symptoms are not known.", "The strengths of this study of HCoV in otherwise healthy adolescents and adults include its multisite and multiyear design, the use of a multiplex diagnostic panel, the prospective collection of symptom data, and the use of a symptom severity scale similar to what has been employed previously. 15 One important limitation of this study was our selective recruitment of individuals who had presented to a healthcare facility for care of an ILI. Therefore, our cases are not representative of HCoV infection in the community, where individuals with mild, self-limiting illness due to HCoV opt not to seek medical care for the management of their ILI.\n\nIn summary, we have shown that HCoV is a significant cause of ILI among otherwise healthy adolescents and adults presenting for medical evaluation. Although there were differences in species distribution by age group, we did not detect any differences between species with respect to the clinical spectrum of disease." ]
[ 2 ]
767
1,233
1,552
What is required for a Hepatitis B infection in cells?
2,996
[ "both intracellular and cell-surface factors" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 1 ]
955
1,335
1,552
What regulates the broad, but less specific, virus-cell interaction in a hepatitis B infection?
2,997
[ "heparan sulfates in the membrane proteins" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 2 ]
955
1,335
1,552
Which protein domain of the Hepatitis B envelope is necessary for infection?
2,998
[ "Nterminus of HBV preS1 (amino acids 1-47)" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 3 ]
955
1,335
1,552
Where is NTCP located in the body?
2,999
[ "lateral surface (canalicular) of hepatocytes" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 6 ]
955
1,335
1,552
What does the NTCP protein mediate?
3,000
[ "bile acid transport" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 6 ]
955
1,335
1,552
Is NTCP sufficient to allow HBV infection?
3,001
[ "not sufficient" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 7 ]
955
1,335
1,552
Why is NTCP thought to not be sufficient for HBV infection?
3,002
[ "the majority of HepaRG cells were found to express NPCT but not to be infected" ]
[ "One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3562259/\n\nSHA: f4f36a8e9fee64d59ccf22b724c7dab345102658\n\nAuthors: Chen, Pei-Jer; Wu, T-C\nDate: 2013-01-11\nDOI: 10.1186/2045-3701-3-2\nLicense: cc-by\n\nAbstract: Following the successful cloning of receptor for SARS coronavirus a few years ago, Dr. Wenhui Li and colleagues raised attention again by publishing a possible receptor for hepatitis B virus in eLife. We will briefly review the significance of this finding and the future prospects of hepatitis B research.", "Text: Among the five hepatotropic hepatitis viruses, only hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV) still wait for the development of an in vitro infection system in cell culture. One hepatocellular carcinoma (HCC) cell line, HepaRG, can be infected at a modest efficiency after weeks of culture and induced differentiation [1] . Even primary human hepatocytes rapidly lose the capacity for HBV infection after brief cell culture. The HBV infection demands both intracellular and cell-surface factors. The intracellular requirements appear less stringent, as after transfection of HBV DNA into many HCC cell lines or mouse liver, which cannot be infected naturally, the viral genome is expressed and replicates actively. Thus, the failure of HBV infection is considered largely to be due to strict restriction on the interaction between HBV virions and the cell membrane.", "The molecules on the cell membrane needed for HBV infection can be divided into two classes: low affinity and high affinity molecules. Among others, the heparan sulfates in the membrane proteins mediate the broad, but less specific, virus-cell interaction. However, the high affinity membrane partners for HBV remain elusive (the carboxypeptidase D found for duck hepatitis B virus may be the only serious contender [2] ).", "HBV envelope protein, namely the surface antigens, plays an essential role in the infection process. Both genetic and functional examination identified one domain in the Nterminus of HBV preS1 (amino acids 1-47) necessary for infection. This domain has been shown to function as a direct mediator for HBV by binding presumably cellular corresponding receptor(s) [3] . More importantly, the myristoylated peptide is shown to effectively block HBV infection in primary human hepatocytes and in the human hepatocytechimera mouse at a nanomolar concentration [4] . In fact, a clinical trial testing the efficacy of this peptide in preventing HBV infection has been ongoing [5] . Clearly, this preS1 peptide can be a useful probe to pull out the interacting cellular factors, including specific viral receptors.", "Yan et al. have taken a reasonable approach to fish out possible HBV receptor(s) [6] . They engineered the first 2-47 amino acid peptide from PreS1 to increase its capacity to be cross-linked with proteins interacting with the cell membrane, without affecting its binding specificity. In order to obtain sufficient materials after cross-linking, they adopted the Tupaia hepatocytes, instead of human hepatocytes, for the experiments. The strategies actually brought down many membrane proteins, but in comparison with the negative control (homologous peptide without specific binding), they identified one cellular protein, NTCP (sodium taurocholate cotransporting peptide) by LC/MS/MS. The same protein was pulled down from human hepatocytes as well. The authors further produced HCC cell lines stably expressing NTCP and subsequently infected them with HBV or HDV.", "Immunofluorescence staining clearly demonstrated the expression of HBV and HDV proteins in these cell lines, suggestive of a successful viral infection. In addition, they documented a 2-4-fold increase of viral RNA and DNA after infection in the cell line by real-time PCR. They also showed a Southern blot supporting the presence of HBV covalently closed circular DNA in the infected cell, a well-recognized marker for productive HBV infection. Finally, they identified a stretch of 10 amino acids in the NTCP transmembrane domain, as the motif directly interacting with the PreS1 peptide.", "NTCP is a transmembrane protein, usually located in the lateral surface (canalicular) of hepatocytes, which mediates bile acid transport [7] . Geographically, it is a good candidate for an HBV receptor. Moreover, the authors could convert the cell lines previously non-permissible to HBV infection to permissible by over-expression of NTCP, again supporting its possible role in the HBV infection process. This can be a critical and long-awaited discovery toward understanding HBV receptors and establishing an experimental HBV infection system.", "Looking forward, we need to understand how NTCP interacts with both HBV envelope proteins and with other cellular proteins, especially through the motif embedded in the cell membrane. NTCP itself is not sufficient to allow HBV infection, as the majority of HepaRG cells were found to express NPCT but not to be infected [8] . NTCP might initiate or mediate molecular interactions that can overcome the cell-surface restrictions for viral entry. Such cooperative cellular or viral factors have to be discovered and demonstrated to enhance the efficiency of viral infection, at a level comparable to a natural one (hundreds or thousands fold viral amplification). For example, the authors can use the NTCP-expressing cell lines as the starting materials to systemically identify other factors (maybe carboxypeptidase D) and make these cell lines more productive and permissive to HBV infection. In the near future, standard virological assays for HBV infections, including Northern or Western blots,", "are expected to demonstrate the successful HBV infections in vitro.", "The HBV research community has searched for HBV receptors for decades. Many candidates have been discovered and then discarded. The current study, however, took advantage of a well-documented viral peptide required for HBV entry in combination with a state-of-the-art proteomics platform. As a Chinese proverb says \"a thousand-mile journey starts from one incremental step\". As such, the identification of NTCP as a potential viral receptor for HBV may serve as an important initial step for this journey, leading to the development of an HBV infection system to facilitate the HBV research and hepatitis B treatment." ]
[ 7 ]
955
1,335
1,553
What kinds of viruses are Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV)?
3,003
[ "arboviruses" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 3 ]
2,448
3,672
1,553
What are the current clinically-available methods to detect encephalitis viral antigens?
3,004
[ "ELISA and IFA" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 3 ]
2,448
3,672
1,553
What methods exist for detecting multiple antigens simultaneously in a one-sample, laboratory test?
3,005
[ "two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 3 ]
2,448
3,672
1,553
How many antigens could be detected by Liew's multiplex ELISA test?
3,006
[ "9" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 0 ]
2,448
3,672
1,553
What kind of antibodies were used in the ELISA-array assay?
3,007
[ "monoclonal" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 1 ]
2,448
3,672
1,553
How was the ELISA assay validated?
3,008
[ "using cultured viruses and inoculated chicken eggs with patient sera" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 5 ]
2,448
3,672
1,553
What capture antibodies were used in the study?
3,009
[ "4D5, 2B5, 1F1, 2B8, 4F9, and 4E11" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 6 ]
2,448
3,672
1,553
What was the spotting concentration range for the capture antibodies?
3,010
[ "from 0.2 to 0.0125 mg/ml" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 12 ]
2,448
3,672
1,553
How was the proper spotting concentration determined?
3,011
[ "combination of minimized cross reaction and higher signal intensity" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 12 ]
2,448
3,672
1,553
How was cross reaction detection determined?
3,012
[ "by applying JEV, YF, and DV cultures" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 12 ]
2,448
3,672
1,553
How was the ELISA-array assay validated?
3,013
[ "using cultured viruses and inoculated chicken eggs with patient sera" ]
[ "Development of an ELISA-array for simultaneous detection of five encephalitis viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3305475/\n\nSHA: ef2b8f83d5a3ab8ae35e4b51fea6d3ed9eb49122\n\nAuthors: Kang, Xiaoping; Li, Yuchang; Fan, Li; Lin, Fang; Wei, Jingjing; Zhu, Xiaolei; Hu, Yi; Li, Jing; Chang, Guohui; Zhu, Qingyu; Liu, Hong; Yang, Yinhui\nDate: 2012-02-27\nDOI: 10.1186/1743-422x-9-56\nLicense: cc-by", "Abstract: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), and eastern equine encephalitis virus (EEEV) can cause symptoms of encephalitis. Establishment of accurate and easy methods by which to detect these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, there are still no multiple antigen detection methods available clinically. An ELISA-array, which detects multiple antigens, is easy to handle, and inexpensive, has enormous potential in pathogen detection. An ELISA-array method for the simultaneous detection of five encephalitis viruses was developed in this study. Seven monoclonal antibodies against five encephalitis-associated viruses were prepared and used for development of the ELISA-array. The ELISA-array assay is based on a \"sandwich\" ELISA format and consists of viral antibodies printed directly on 96-well microtiter plates, allowing for direct detection of 5 viruses. The developed ELISA-array proved to", "have similar specificity and higher sensitivity compared with the conventional ELISAs. This method was validated by different viral cultures and three chicken eggs inoculated with infected patient serum. The results demonstrated that the developed ELISA-array is sensitive and easy to use, which would have potential for clinical use.", "Text: Japanese encephalitis virus(JEV), tick-borne encephalitis virus(TBEV), eastern equine encephalitis virus (EEEV), sindbis virus(SV), and dengue virus(DV) are arboviruses and cause symptoms of encephalitis, with a wide range of severity and fatality rates [1] . Establishment of an accurate and easy method for detection of these viruses is essential for the prevention and treatment of associated infectious diseases. Currently, ELISA and IFA are the methods which are clinically-available for the detection of encephalitis viral antigens, but they could only detect one pathogen in one assay [2, 3] .\n\nThere are a variety of different methods available for identifying multiple antigens in one sample simultaneously, such as two-dimensional gel electrophoresis , protein chip, mass spectrometry, and suspension array technology [4] [5] [6] . However, the application of these techniques on pathogen detection is still in an early phase, perhaps due to the complicated use and high cost.", "Antibody arrays for simultaneous multiple antigen quantification are considered the most accurate methods [7] [8] [9] [10] . Liew [11] validated one multiplex ELISA for the detection of 9 antigens; Anderson [12] used microarray ELISA for multiplex detection of antibodies to tumor antigens in breast cancer, and demonstrated that ELISA-based array assays had the broadest dynamic range and lowest sample volume requirements compared with the other assays.", "However, the application of ELISA-based arrays is currently limited to detection of cancer markers or interleukins; no detection of pathogens has been reported. In this study, we developed an ELISA-based array for the simultaneous detection of five encephalitis viruses. Seven specific monoclonal antibodies were prepared against five encephalitis viruses and used to establish an ELISA-array assay. The assay was validated using cultured viruses and inoculated chicken eggs with patient sera. The results demonstrated that this method combined the advantage of ELISA and protein array (multiplex and ease of use) and has potential for the identification of clinical encephalitis virus.", "Monoclonal antibodies were prepared from hybridoma cell lines constructed by Prof. Zhu et al. Purification was conducted by immunoaffinity chromatography on protein G affinity sepharose [13] . Specific monoclonal antibodies (4D5 against JEV, 2B5 against TBEV, 1F1 against SV, 2B8 against serotype 2 DV, 4F9 against serotype 4 DV, 4E11 against EEEV, and 2A10 against Flavivirus) were selected for this study. All of the antibodies were raised according to standard procedures.\n\nUsing 4D5, 2B5, 1F1, 2B8, 4F9, and 4E11 as capture antibodies, detection antibodies (2A10, 1 F1, and 4E11) were coupled to biotin-NHS ester(Pierce, Germany) at 4°C for 3 h according to the manufacturer's instructions. Unincorporated biotin was removed by Desalt spin column (Pierce). Immunologic reactions were reported by Streptavidin-HRP (CWBIO, Beijing, China) and Super Signal ELISA Femto Maximum sensitive substrate. Purified goat-anti mouse antibody was used as a positive control.", "JEV and DV were cultured in C6/36 cells; SV, TBEV, and EEEV were cultured in BHK-21 cells. The culture of TBEV and EEEV was conducted in biosafety level 3 facility, however, JEV, DV and SV were conducted in biosafety level 2 facility. Viral titers were determined by the 50% tissue culture infectious dose (TCID 50 ) method. All the cultures were inactivated by 0.025% β-propionolactone at 4°C overnight, then 37°C for 1 h to decompose β-propionolactone.\n\nAntibodies were spotted using a BIODOT machine (BD6000;California, USA) on ELISA plates (30 nl/dot). The plates were blocked with 3% BSA-PBS in 37°C for 1 h, followed by washing 3 times with PBS containing 0.1% Tween-20 for 2 min each. Then, the plates were dried, sealed, and stored at 4°C before use [11] .", "When spotting, different spotting buffers and concentrations of capture monoclonal antibodies were evaluated to optimize the ELISA-array assay. The optimization was evaluated by dot morphology and signal intensity. The tested spotting buffers included 1 × phosphate buffer saline (PBS), PBS +20% glycerol, and 1 × PBS + 20% glycerol+0.004% Triton-X100. A range of monoclonal antibody concentrations (0.0125, 0.025, 0.05, 0.1, and 0.2 mg/ml) were compared.\n\nFollowing a double antibody sandwich format, printed plates were incubated sequentially with inactivated viral cultures, biotin-labeled detecting antibody, HPR-labeled avidin, and substrate, followed by signal evaluation.", "Antigen binding was performed in PBS(containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h, followed by washing 3 times(1 × PBS containing 0.1% Tween-20). Incubation of ELISA plates with biotinylated detecting antibody cocktails was performed in PBS (containing 0.1% Tween-20 and 5% FCS) at 37°C for 2 h. After washing, specific binding of the detecting antibodies was reported by streptavidin-HRP and stained with Super Signal ELISA Femto Maximum sensitive substrate (Thermo scientific, Rockford, USA) [11, 14, 15] . Visualization of the plate was performed in AE 1000 cool CCD image analyzer(Beijing BGI GBI Biotech Company., LTD, China). The signal intensity and background of each spot was read out and recorded with \"Monster\"software. The positive signals were defined as a signal value > 400 and a signal value (sample)/signal value (negative) > 2.", "The identical antibodies used in the ELISA-array format were also tested in a conventional ELISA format to determine the difference in sensitivity and specificity of the two methods. The conventional ELISAs were performed at the same time as the ELISA-array assays to ensure similar reaction conditions. The conventional ELISAs were performed in an identical maner to the ELISA-array, except that antibodies were coated at a concentration of 2 μg/mL in PBS (pH 7.4), and substrate TMB was used instead of Super Signal ELISA Femto Maximum sensitive substrate [16, 17] .\n\nThree serum samples were collected from patients with nervous system symptoms and histories of tick bites. The serum samples were treated with penicillin and streptomycin, then inoculated into the allantoic cavities of chicken eggs. 3 days later, the liquid was collected and divided into two portions (one for inactivation and one for RNA extraction). The RNA and inactivated samples were stored at -70°C before use.", "RNA was extracted from the inoculated chicken eggs using a RNeasy mini kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. All RNA extraction procedures were conducted at BSL-3 facilities. The primers and probes were used as previously described [18] . The real-time RT-PCR was conducted with a Quti-teck q-RT-PCR Kit (Qiagen Inc,). The reaction consisted of 10 μL of 2 × reaction buffer (0.2 μL reverse transcription enzyme, and 250 nmol/l primers and probes). RNA and deionized water were added to a final volume of 20 μl. PCR was performed with a LightCycler 2.0 (Roche, Switzerland) [19] .\n\nOptimization of the ELISA-array assay\n\nThe spotted array layout is depicted in Figure 1 and the efficacy of three different spotting buffers on the quality of the printed ELISA-arrays were investigated by spot morphology observation and signal intensity comparison.", "The spotting concentration of the capture antibodies varied from 0.2 to 0.0125 mg/ml (each was serially diluted 2-fold). The efficacy of the spotting concentration of the capture antibodies was evaluated by virus culture detection, the proper spotting concentration was determined by a combination of minimized cross reaction and higher signal intensity. Figure 1 illustrates the array layout and Figure 2 demonstrates the result of the three spotting buffers and spot concentration of antibody 2B5 by TBE virus culture detection. Cross reaction detection was also conducted by applying JEV, YF, and DV cultures.", "Spot morphology observation (Figures 2a, b , and 2c) demonstrated that spotting buffer containing PBS with 20% glycerol produced tailed spot morphology; buffers containing PBS alone and PBS with 20% glycerol +0.004% Triton-X100 gave good spot morphology (round and full). Buffers containing PBS with 20% glycerol and PBS with 20% glycerol+0.004% Triton-X100 produced higher signal intensities than PBS alone. Thus, PBS with 20% glycerol+0.004% Triton-X100 was adopted as the optimized spotting buffer for subsequent experiments. Simultaneously, the spot concentration evaluation suggested that 0.05 mg/ml was optimal. At this concentration, the signal intensity was higher and the cross-reaction did not appear (Figure 2d ). Consequently, spotting concentration optimization of other capture antibodies (4D5, 1F1, 4E11, and 2B8) demonstrated that 0.05 mg/ml was also suitable(data not shown).", "The optimized ELISA array layout is shown in Figure 3 , which was applied in the following experiments. \n\nSuccessful detection of viral pathogens requires a test with high sensitivity and specificity. To evaluate the performance of the designed antibody arrays, the specificity and sensitivity of the individual analytes were examined. By testing serially-diluted viral cultures, including DV-2, DV-4, JEV, TBE, SV, and EEEV, the sensitivity of ELISAarray and the identical conventional ELISA were compared ( Table 1 ). The detection limit of the two methods was compared and demonstrated. The cross-reactivity test was conducted using BHK-21 and vero cell lysate, Yellow fever virus (YFV) cultures (5 × 10 5 TCID 50 /ml, West Nile virus(WNV) cultures(2 × 10 6 TCID 50 /ml), and Western equine encephalitis virus(1 × 10 7 TCID 50 /ml). The results demonstrated that neither the ELISA-array nor traditional ELISA displayed cross-reactivity.", "Equal volumes of cultured TBEV, JEV, DV-2, DV-4, SV, and EEEV were prepared for single sample detection; two or three of the cultures were mixed for multiplex detection. A cocktail of biotin conjugated antibody (2A10, 4E11, and 1F1) was used in all tests. The results demonstrated that for all virus combinations, each virus was detected specifically, with no false-positive or-negative results (Figures 4 and 5) .\n\nChicken eggs inoculated with infected human serum were used for validation of the ELISA-array assay. All samples showed high reaction signals with capture antibody 2B5, which was specific for TBEV ( Figure 6b ). The ELISA-array assay suggested that the three patients were all infected with TBEV.\n\nTo verify the results tested by ELISA-array, RNA extracted from chicken eggs was applied to a real time-RT-PCR assay using primers and probes targeting TBEV. The results were also positive (Figure 6a) . The consensus detection results confirmed that the ELISAarray assay was reliable.", "To be widely used in the clinical setting, the detection system should be easy to use and can be performed by untrained staff with little laboratory and experimental experience. Moreover, when the volume of the clinical samples is limited and an increasing number of pathogens per sample needs to be tested, the detecting system should be high-throughput to allow detection of multiple pathogens simultaneously [6, 20, 21] . Multiple detection, easy to use, and affordability are requirements for detection methods in the clinical setting. Thus, an ELISA-array, which combines the advantages of ELISA and protein array, meets the above requirements.", "It has been reported that an ELISA-array has been used in the diagnosis of cancer and auto-allergic disease [7, 12] ; however, No study has reported the detection of viral pathogens. In this study, we developed a multiplex ELISA-based method in a double-antibody sandwich format for the simultaneous detection of five encephalitis-associated viral pathogens.", "The production of a reliable antibody chip for identification of microorganisms requires careful screening of capture of antibodies [14] . Cross-reactivity must be minimized and the affinity of the antibody is as important as the specificity. First, we prepared and screened 23 monoclonal antibodies against eight viruses and verified the specificity and affinity to the target viruses by an immunofluorescence assay. Then, the antibodies were screened by an ELISA-array with a double-antibody sandwich ELISA format. The antibodies which produced cross-reactivity and low-positive signals were excluded. Finally, six antibodies were selected as capture antibodies. Another monoclonal antibody, 2A10, which could specifically react with all viruses in the genus Flavivirus was used for detecting antibody against DV, JEV, and TBEV. For the detection of EEEV and SV, although the detecting and trapping antibodies were the same (1F1 and 4E11, respectively), the antibodies produced excellent positive", "signals. The epitope was not defined; however, we suspect that the antibodies both target the surface of the virions. As one virion exits as, many with the same epitope appear, thus no interference occurred using the same antibody in the double-antibody sandwich format assay.", "Currently, the availability of antibodies suitable for an array format diagnostic assay is a major problem. In the ELISA-array assay, this problem exists as well. Because of the limitation of available antibodies, this assay could only detect 5 pathogens. In the future, with increasing numbers of suitable antibodies, especially specific antibodies against Flavivirus, this ELISAarray might be able to test more pathogens and be of greater potential use. To make the assay more amenable to multiple virus detection, the assay protocol was optimized. In addition to the dotting buffer, the capture antibody concentration and the different virus inactivation methods (heating and β-propiolactone) were also compared and evaluated. Heat inactivation was performed by heating the viral cultures at 56°C for 1 h, and β-propiolactone inactivation was performed by adding β-propiolactone into the retains better antigenicity than the heat-inactivation method. Thus, β-propiolactone treatment was chosen as", "the virus-inactivation method. A conventional ELISA is a standard method in many diagnostic laboratories. We compared the ELISA-array with a conventional ELISA and confirmed that the advantage of the ELISA-array was evident with comparable specificity and higher sensitivity than ELISA. The time required for the ELISA-array is significantly less than for conventional ELISA (4 h vs. a minimum of 6 h, respectively). Furthermore, less IgG is required for printing than for coating ELISA plates. Coating of a single well in microtiter plate requires 100 μl of a 1 μg/ml antibody solution, which is equivalent to 100 ng of IgG. For the ELISA-array, only 30 nl of a 50 μg/ml antibody solution is required for each spot, which is equivalent to 1.5 ng of IgG. With the characteristics of ease of use, sensitivity, specificity, and accuracy, the ELISA-array assay would be widely accepted for clinical use." ]
[ 5 ]
2,448
3,672
1,557
In 2010, how many cases of tuberculosis were estimated in China?
3,014
[ "108 per 100,000" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 3 ]
3,331
4,450
1,557
What is the population of Shandong province?
3,015
[ "94 million" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 1 ]
3,331
4,450
1,557
What was the purpose of this study?
3,016
[ "estimate the TB prevalence in Shandong" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 4 ]
3,331
4,450
1,557
What was the age range for the people surveyed?
3,017
[ "15 years old or above" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 4 ]
3,331
4,450
1,557
How was the survey designed?
3,018
[ "in accordance with WHO recommendations" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 5 ]
3,331
4,450
1,557
Was was the sample size?
3,019
[ "52500" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 5 ]
3,331
4,450
1,557
How were the clusters selected?
3,020
[ "A stratified multi stage random sampling" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 6 ]
3,331
4,450
1,557
How many people were in a community cluster?
3,021
[ "1250 to 1750" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 6 ]
3,331
4,450
1,557
Who was excluded from the study?
3,022
[ "Military barracks and prisons" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 6 ]
3,331
4,450
1,557
When was the study conducted?
3,023
[ "March to June 2010" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 7 ]
3,331
4,450
1,557
Who conducted the study?
3,024
[ "clinicians, public health doctors, radiologists, laboratory technicians and nurses" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 7 ]
3,331
4,450
1,557
What medium was used to collect the sputum samples?
3,025
[ "Löwenstein-Jensen medium" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 9 ]
3,331
4,450
1,557
What was the response rate for the study?
3,026
[ "95% to 97%" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 13 ]
3,331
4,450
1,557
What was the average age of a study participant?
3,027
[ "46 years" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 13 ]
3,331
4,450
1,557
What was the prevalence rate in Shandong in 2010 for sputum positive cases of tuberculosis?
3,028
[ "22.1" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 18 ]
3,331
4,450
1,557
What was the most striking finding of the study regarding tuberculosis patients?
3,029
[ "a large proportion of TB patients did not present consistent cough" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 20 ]
3,331
4,450
1,557
How many cases of sputum positive tuberculosis patients had no persistent cough?
3,030
[ "45%" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 20 ]
3,331
4,450
1,557
How many tuberculosis patients in Shandong were over 65 years old?
3,031
[ "over half" ]
[ "Changes in pulmonary tuberculosis prevalence: evidence from the 2010 population survey in a populous province of China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3890533/\n\nSHA: eef61bdfa49b8652fd660b5b8b7e74cf51922505\n\nAuthors: Wei, Xiaolin; Zhang, Xiulei; Yin, Jia; Walley, John; Beanland, Rachel; Zou, Guanyang; Zhang, Hongmei; Li, Fang; Liu, Zhimin; Zee, Benny CY; Griffiths, Sian M\nDate: 2014-01-11\nDOI: 10.1186/1471-2334-14-21\nLicense: cc-by", "Abstract: BACKGROUND: This paper reports findings from the prevalence survey conducted in Shandong China in 2010, a province with a population of 94 million. This study aimed to estimate TB prevalence of the province in 2010 in comparison with the 2000 survey; and to compare yields of TB cases from different case finding approaches. METHODS: A population based, cross-sectional survey was conducted using multi-stage random cluster sampling. 54,279 adults participated in the survey with a response rate of 96%. Doctors interviewed and classified participants as suspected TB cases if they presented with persistent cough, abnormal chest X-ray (CXRAY), or both. Three sputum specimens of all suspected cases were collected and sent for smear microscopy and culture. RESULTS: Adjusted prevalence rate of bacteriologically confirmed cases was 34 per 100,000 for adults in Shandong in 2010. Compared to the 2000 survey, TB prevalence has declined by 80%. 53% of bacteriologically confirmed cases did", "not present persistent cough. The yield of bacteriologically confirmed cases was 47% by symptom screening and 95% by CXRAY. Over 50% of TB cases were among over 65’s. CONCLUSIONS: The prevalence rate of bacteriologically confirmed cases was significantly reduced compared with 2000. The survey raised challenges to identify TB cases without clear symptoms.", "Text: China, with an estimated prevalence of all TB cases of 108 per 100,000 in 2010, has the second highest TB burden in the world, accounting for 13% of all cases worldwide [1] . The World Health organization (WHO) estimated that China had reached the targets of 85% treatment success by 1993 and 70% case detection rate by 2005 [2] . National TB prevalence surveys were conducted in China in 1979 China in , 1990 China in , 2000 , and 2010 [4] . Survey results provide more accurate estimates for TB prevalence rates than the WHO estimates and can be used to assess the likelihood of China achieving global targets for TB prevalence.", "Shandong province has a population of 94 million. It is a relatively developed province with a per capita GDP 1.6 times of the national average in 2010 [5] . The prevalence rate of TB in Shandong was lower compared with the average rate of China in 2000 [3] . Population representative samples were drawn in Shandong in the surveys of 2000 and 2010 using similar methods. The study aimed to estimate the TB prevalence in Shandong based on the 2010 survey, and compare results of the two cross sectional surveys.\n\nThe target population of the TB prevalence survey was residents of 15 years old or above who had lived in the selected clusters for more than 6 months. A population based, cross-sectional survey was conducted using multistage random cluster sampling method.", "The survey employed the same sampling methods as the China national survey in 2010, which was similar to the sampling methods used in 2000 [6] . The design of the surveys was in accordance with WHO recommendations [7] . The design effect factor due to cluster sampling was estimated at 1.28 [8] . A sample size of 52500 adults (≧15 years old), in 35 clusters, was calculated based on detecting a change of 20% in prevalence rate of TB smear positive cases compared with the rate of the 2000 survey (95 per 100,000), with a probability greater than 95% and 95% power, accounting for 90% response rate of participants [9] .", "A stratified multi stage random sampling was used to select the 35 clusters within 17 prefectures in Shandong province. The number of clusters was randomly allocated in proportion to the provincial population at the prefectural, county/district and township levels. A cluster was defined as a community (a village in the rural area or a resident community in an urban area) with a population of 1250 to 1750 adults (i.e., those of 15 years or older). If the community contained less than 1250 adult residents, the neighboring community to the north was annexed. If the community or combined communities containing more than 1750 adults, we randomly selected households and then included all adults in the household for the survey until the total number of selected adults reached 1750. Military barracks and prisons located in the cluster were excluded [7] .", "The survey was conducted from March to June 2010 by survey teams consisting of clinicians, public health doctors, radiologists, laboratory technicians and nurses. Local media was used to promote awareness of the survey. Community workers conducted a house-to-house census to update the database of residents, inform survey participants and obtain informed consent. The study did not involve children under 15 years old. Written informed consent was obtained from all participants of 16 years old or above. While from those of 15 years old, written informed consents were obtained from their parents or guardians. All documents were properly stored in the Shandong Chest Hospital. Ethical approvals for the study and consent procedures were obtained from the Institutional Review Board (IRB) of Shandong Chest Hospital (NIH register numberIRB00006010).", "Those who agreed to participate in the survey were invited to the county TB dispensary, where they completed a consultation with a trained clinical TB doctor regarding any symptoms suggestive of TB, such as persistent cough (lasting two weeks or longer), haemoptysis, weight loss and fever. All participants had a chest X-ray (CXRAY) taken that then were reviewed by a panel of radiologists. Those with symptoms or CXRAY films suggestive of TB were classified as suspected TB cases. All suspected cases were asked to produce three sputum samples, one at the time of consultation, another at night and the third in the early morning of the following day. Identified suspects completed an additional questionnaire regarding their social-economic situation, smoking status, and the presence of TB related symptoms in the preceding six months (cough, fever, weight loss, chest pain and haemoptysis).", "Sputum smears were conducted in local TB dispensaries. All sputum samples were cultured using the Löwenstein-Jensen medium in the provincial laboratory within 24 hours using cold chain transportation. Samples were excluded from TB when non-tuberculosis bacilli were identified from the culture. All sputum smear and culture were conducted strictly according the national TB laboratory external quality control measure, which is in consistent with the WHO TB prevalence survey guideline [7] . TB classification was made according to the China national TB guideline [10] . A positive smear had at least one acid fast bacillus identified during examination of at least 100 fields. Participants with positive sputum smear specimens were classified as sputum positive cases. Those with positive smear or culture sputum specimens were classified as sputum bacteriologically confirmed cases. Those being culture negative with abnormal CXRAY suggestive of TB and having been ruled out from other diseases by", "clinicians and radiologists were classified as CXRAY suggestive bacteriologically negative cases. Due to resource limitations the recommendation of broad-spectrum antimicrobial agents to confirm the diagnosis of negative TB cases was not applied in this survey [11] . Newly diagnosed cases were distinguished from previously diagnosed cases through checks during the interviews and against the TB registration system. Initial diagnosis was made by a group of local clinicians and radiologists. Subsequently, samples and CXRAY films of all suspected and confirmed cases were re-assessed by a group of senior clinicians and radiologists at provincial and national levels. CXRAY films of 100% of those scored as abnormal and 10% random sampling of those scored as normal were transferred for independent reading. The provincial laboratory team randomly examined one slide from the three samples of sputum positive cases, all three samples of CXRAY suggestive TB cases, and randomly selected 10% of the", "non-TB cases.", "Prevalence estimates of sputum positive, bacteriologically confirmed and all TB cases were calculated. In all analyses, population weightings were employed to adjust for the stratified multi-stage sampling design effect [8] . The survey results in 2010 and 2000 were standardized against the age structures of China's census population in 2010. The 2000 TB prevalence survey included all age groups [12] . The WHO recommended method was used to enable comparison between the two surveys that prevalence rates of child TB were assumed to reduce to the same extent as adult TB from 2000 to 2010 [13] . Subgroup analysis in gender, age groups and urban/rural residence were conducted. Case identification rate was calculated as the number of cases identified by a screening method over all suspected cases found by the method. Yields of the symptom consultation and CXRAY were calculated as a proportion of the total number of bacteriologically confirmed cases.", "The survey selected 17 urban clusters and 18 rural clusters. It covered a total population of 89,093, of which 56,671 were eligible for the survey (Figure 1 ). The response rate ranged from 95% to 97% in different clusters. 54,279 participants attended clinical consultation and were examined by CXRAY. Among them, 47% were males. The average age was 46 years with 14% of 65 years and older. A total of 572 suspected TB cases were found. Of these, 264 (46%) were identified based on CXRAY abnormalities, 228 (40%) were based on persistent cough, 80 (14%) were based on both. The survey diagnosed 172 new cases, including 19 new bacteriologically confirmed cases (including 11 sputum and culture positive cases, and 8 sputum negative but culture positive cases) and 153 CXRAY suggestive bacteriologically negative cases. The survey also identified 11 existing cases registered on the national TB program. In addition, the survey found four cases with culture positive non-tuberculosis bacilli, and", "excluded them from TB patients.", "All participants of the survey were first screened by symptoms and CXRAY. Those who had symptoms of consistent cough or haemoptysis, or CXRAY abnormalities were then screened by smear and culture. Case identification rates of new bacteriologically confirmed cases from the suspected cases were significantly higher with CXRAY as a primary tool (Figure 1 , 3.8%, P = 0.012) and further increased by both symptom screen of persistent cough and CXRAY (10%, P < 0.001) compared with symptom screen alone (0.4%). The same pattern of case identification rate was observed in the sputum positive cases (7.5%, 1.9% and 0% respectively). The proportion reporting persistent cough was not significantly higher among bacteriologically confirmed cases compared with other suspects (P = 0.565). The symptom consultation alone identified 308 suspects, including 6 (1.9%) sputum smear positive TB and 9 (2.9%) bacteriologically confirmed TB. Among the 344 suspects with CXRAY abnormalities, 11 (3.2%) had sputum", "positive TB and 18 (5.2%) had bacteriologically confirmed TB. The yield of bacteriologically confirmed cases was 47.4% by screening consultation and 94.7% by CXRAY. In the population of over 65 years old, symptom consultation and the CXRAY identified 174 and 182 suspected cases respectively, yielding5 (2.9%) and 9 (4.9%) of bacteriologically confirmed cases. Yields of bacteriologically confirmed cases were 55.6% by symptom consultation and 100% by CXRAY among over 65's.", "Of the 512 suspected cases that completed the additional questionnaire, 42% were farmers and 31% were current smokers (Table 1) . Per capita household income of bacteriologically confirmed cases was less than 50% of that of the non-TB cases (P < 0.05). Though smoking rate was higher among TB cases compared with non-TB cases, no significant differences were found (P > 0.05). Of the ten bacteriologically confirmed cases not presenting with persistent cough at the prevalence survey, one coughed for two days, one had chest pain, and the other eight had no symptoms of TB in the last six months.", "The crude prevalence rate in Shandong in 2010 of sputum positive cases was 22.1 (95% CI: 9.6-34.6), bacteriologically confirmed cases was 36.8 (95% CI: 17.8-55.8), and all cases were 337.1 (95% CI: 254.1-420.0) per 100,000 in adult population ( Table 2 ). The adjusted prevalence rates of the whole population in Shandong were17.8 (95% CI: 8.3-17.5), 27.8 (95% CI: 14.8-28.0) and 239.4 (95% CI: 179.9-298.9) per 100,000 in 2010. A remarkable decline of 82.0%, 80.2% and 31.4% was observed in TB prevalence rates of sputum positive, bacteriologically confirmed, and all cases, respectively, compared to the adjusted rates in 2000 [12] . Large declines were observed in males between 40 and 65 years old, and in females over 60 years old ( Figure 2) .", "The adjusted prevalence rates in the adult population were 21.4 (95% CI: 10.0-32.8), 33.5 (95% CI: 17.8-49.2) and 285.8 (95% CI: 254.2-356.4) for sputum positive cases, bacteriologically confirmed cases and all cases, respectively. Significant differences regarding adjusted TB prevalence rates were observed between males and females, over 65's and 15 to 64 years old, in rural and urban areas ( Table 2 , P < 0.001). The male to female ratios were 5.5 in sputum positive cases and 2.8 in bacteriologically confirmed cases, while the ratios climbed to 6.0 and 4.1, respectively, among those over 65 years. The majority of TB patients, 54.5% of sputum positive cases and 47.3% of bacteriologically confirmed cases, were from people 65 years or older. The ratio between over 65's and 15 to 64 years old was 8.4 in sputum positive cases and 5.9 in bacteriologically confirmed cases. The ratio between rural and urban areas was 2.7 in sputum positive cases and 4.8 in bacteriologically confirmed cases.", "The most striking finding was that a large proportion of TB patients did not present consistent cough. Passive case finding is the routine practice in developing countries where sputum microscopy is performed to identify TB cases among people with persistent cough. A large proportion of TB cases may be missed using this method as 53% of bacteriologically confirmed cases and 45% sputum positive cases in this study had no persistent cough but were identified through abnormal CXRAY. Nearly half of bacteriologically confirmed cases reported no symptoms in the last six months. This finding, although initially surprising, is consistent with reports from Vietnam (47% of bacteriologically confirmed cases not presenting persistent cough) [14] , Myanmar (38%) and Ethiopia (48%) [13] . CXRAY was sensitive in detecting TB cases, as yields of bacteriologically confirmed cases were much higher by CXRAY compared with by symptom screening, as reported in Vietnam [15] and some high HIV prevalence", "settings [16, 17] . CXRAY, though expensive at the initial installment, may improve TB case finding due to its short turnover time and high throughput [18] . Our findings suggest that the strategy of case finding using CXRAY followed by sputum or culture as the primary and secondary screening tests could be more effective, especially among the population of over 65 year olds, as the yields were higher in over 65's compared with the general Table 2 Prevalence rates of sputum positive TB cases, bacteriologically confirmed TB cases and all cases in Shandong, China, 2010 No population. Although using CXRAY to examine everyone is not feasible, it can be used in routine elder physical examinations. The China public health package now covers free CXRAY for elders, as well annual employee body examinations provided free CXRAY.", "In this survey, only one sputum positive patient had been detected and treated by the national program, though specific clinical consultation was conducted to identify any patients who have been diagnosed and treated for TB before. This may reflect the difference between the active case finding approach in the survey and the passive casing finding approach in practice. Nevertheless, it indicated that a large proportion of bacteriologically confirmed TB cases are missed by the national TB program.\n\nAnother notable change is the sharp decline of the proportion of sputum positive cases, which accounted for 30.5% of all cases in the 2000 survey but was reduced to 6.6% in the 2010 survey. The proportion of notified sputum cases out of all TB cases in Shandong also declined from 80.9% in 2005 to 64.6% in 2010 [19] .", "The prevalence rate of bacteriologically confirmed cases has reduced by 80% in the last decade in Shandong, compared with a national decline of 45% (from 216/ 100,000 in 2000 to 119/ 100,000 in 2010) [4] . The rapid decline of TB prevalence rate of bacteriologically confirmed cases in the recent decade may be attributed to China's strengthened public health system following the outbreak of severe acute respiratory syndrome in 2003 [2] . Another reason may be due to improved reporting of TB cases in the online communicable disease reporting system, and the improved collaboration between public hospitals and TB dispensaries [20] . Other factors such as social economic development may also have played an important role in the reduction of TB prevalence, as found in a study of TB notification rates trends in 134 countries [21] .", "The adjusted prevalence rate of bacteriologically confirmed cases in Shandong was lower than the WHO estimates for China in 2010 [1] . But the national prevalence rates of bacteriologically confirmed cases, 119/100,000 in 2010 [4] , was higher than the WHO estimate, 108/ 100,000, even the survey did not collect negative and extra-pulmonary TB cases. Vietnam reported similar findings in its 2006 survey [14] . One reason is that prevalence surveys results are based on active case finding while WHO estimates are based on notification rates from passive case finding. A re-evaluation of the reported TB prevalence in China is needed based on the recent survey.\n\nCXRAY suggestive bacteriologically negative cases may be smear or culture negative TB cases if they had any TB symptoms, while some may be caused by suboptimal smear or culture. As reported in China's previous surveys [3, 22] , including these cases as TB cases may result in an over-estimate of all pulmonary cases [23] .", "The survey revealed that over half of the TB patients were 65 years and older in Shandong, while the over 65's were more likely to present with abnormal CXRAY and persistent cough. Similar trends have been documented in other developed cities such as Hong Kong and Singapore [24] . These high rates may reflect the higher TB rates in the past and decline in immunity in the over 65's. How to treat elders with TB and other complications such as diabetes remains an ongoing challenge in China and similar settings.", "The survey results can be generalized to the Shandong population of 94 million or similar international settings with middle income and middle TB prevalence levels. The patterns of the TB epidemic found in Shandong, i.e., the proportion of patients with symptoms, ratios between urban and rural areas, men and women, were similar to those found in the national survey [4] . However, the prevalence rates cannot be extrapolated to western provinces in China with a higher TB prevalence. For logistical reasons, the eligible population did not include adults staying in the sampled clusters less than 6 months, which was the same practice in the 2000 survey. However, shortterm migrants may have a potentially higher prevalence of TB than the general population [25] . This may result in a lower estimate of the true prevalence rate. The survey did not collect social-economic indicators, smoking status and HIV status of all participants, so comparisons between TB cases and all non-TB patients are", "not available. However, the HIV prevalence in Shandong China is below 0.01%, and would not significantly alter the TB prevalence rate. In addition, the survey did not evaluate child TB and extra pulmonary TB. Discussions of using CXRAY as a screening tool was on the technical aspect, but not on costing side as we did not conduct any cost effectiveness analysis or the social willingness to pay for such a strategy in similar settings.", "This study has shown that the prevalence of bacteriologically confirmed TB in Shandong has reduced substantially over the last decade. Importantly, the majority of these cases did not present with persistent cough and the proportion of sputum positive cases has declined sharply. Further studies are recommended to assess the feasibility of adopting CXRAY in the existing health care services to detect TB cases and the cost effectiveness of such intervention. \n\nThe authors declare that they have no competing interests." ]
[ 25 ]
3,331
4,450
1,565
What enzymes have been reported to be linked with severity of infection and various pathological conditions caused by microorganisms?
3,041
[ "cysteine proteases" ]
[ "Design, Synthesis, Evaluation and Thermodynamics of 1-Substituted Pyridylimidazo[1,5-a]Pyridine Derivatives as Cysteine Protease Inhibitors\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3734177/\n\nSHA: ee8483f8f2cc5fe38be4e565eae3af9d0bb8220b\n\nAuthors: Khan, Mohd Sajid; Baig, Mohd Hassan; Ahmad, Saheem; Siddiqui, Shapi Ahmad; Srivastava, Ashwini Kumar; Srinivasan, Kumar Venkatraman; Ansari, Irfan A.\nDate: 2013-08-05\nDOI: 10.1371/journal.pone.0069982\nLicense: cc-by", "Abstract: Targeting papain family cysteine proteases is one of the novel strategies in the development of chemotherapy for a number of diseases. Novel cysteine protease inhibitors derived from 1-pyridylimidazo[1,5-a]pyridine representing pharmacologically important class of compounds are being reported here for the first time. The derivatives were initially designed and screened in silico by molecular docking studies against papain to explore the possible mode of action. The molecular interaction between the compounds and cysteine protease (papain) was found to be very similar to the interactions observed with the respective epoxide inhibitor (E-64c) of papain. Subsequently, compounds were synthesized to validate their efficacy in wet lab experiments. When characterized kinetically, these compounds show their K(i) and IC(50) values in the range of 13.75 to 99.30 µM and 13.40 to 96.50 µM, respectively. The thermodynamics studies suggest their binding with papain hydrophobically and", "entropically driven. These inhibitors also inhibit the growth of clinically important different types of Gram positive and Gram negative bacteria having MIC(50) values in the range of 0.6–1.4 µg/ml. Based on Lipinski’s rule of Five, we also propose these compounds as potent antibacterial prodrugs. The most active antibacterial compound was found to be 1-(2-pyridyl)-3-(2-hydroxyphenyl)imidazo[1,5-a]pyridine (3a).", "Text: Cysteine-protease inhibitors (CPI) have gained considerable attention over the last couple of decades and many classes of compounds are currently in human clinical trials for a number of diseases. Interest in papain family cysteine proteases as chemotherapeutic targets is derived from the recognition that they are critical to the life cycle or pathogenicity of many microorganisms. The cysteine proteases from Streptococcus sp. (streptopain) [1] , Staphylococcus sp. (staphopain) [2] , Plasmodium falciparum (falcipain-1, -2, and -3) and Trypanosoma cruzi (cruzipain) [3] are some of the most widely studied members of papain family which have been reported to be linked with severity of infection and various pathological conditions caused by these microorganisms.", "The activation of the kallikrein-kinin pathway, which could be activated by more than sixteen bacterial proteases, is a mechanism that some pathogens exploit to ensure that there is a supply of nutrients to the site of infection by increasing vascular permeability. This has been shown to occur in infections with several microbial species, including Pseudomonas, Serratia, Clostridium, Candida, Bacteroides, Porphyromonas and Staphylococcus sp. [4] . Many bacteria secrete several nonspecific proteases e.g. Pseudomonas, Serratia, Streptococcus, Staphylococcus and Bacteroides sp. have potent metallo-, cysteine and serine proteases with broad ranges of activities [5] . The critical role of bacterial proteases in virulence was successfully demonstrated by eliminating the proteaseencoding gene in P. gingivalis [6] .", "Recently described cystatin superfamily of proteins comprises both eukaryotic and prokaryotic cysteine protease inhibitors [7] . Human cystatins C, D and S, rat cystatins A and S, chicken cystatin and oryza cystatin have been reported to inhibit the replication of certain viruses and bacteria [8] although it has not yet been directly demonstrated that these effects are due to the protease inhibitory capacity of the cystatins [9] . The key role of cysteine proteases in microbial infections, coupled with the relative lack of redundancy compared to mammalian systems has made microbial proteases attractive targets for the development of novel chemotherapeutic approaches [10, 11] .", "Imidazopyridine ring systems represent an important class of compounds not only for their theoretical interest but also from a pharmacological point of view. They have been shown to possess a broad range of useful pharmacological activities [12] including antigastric, antisecretory, local anesthetic, antiviral, antianxiety, antibacterial, antifungal, antihelminthic, antiprotozoal, anticonvulsant, gastrointestinal, antiulcer (Zolmidine), anxiolytic (Alpidem), hypnotic (Zolpidem) and immunomodulatory [13] . The nature and the position of the substituents on the pyridinic moiety influence these pharmacological activities. These imidazopyridine heterocyclic structures form part of the skeleton of natural alkaloids, neuromuscular blocking agents [14] , reversible inhibitors of the H + , K + -ATPase enzymes with a potent antisecretory activity, and are known to be sedative hypnotics of the nervous system [15] . In this study, we have proposed kinetically and thermodynamically characterized", "1-substituted pyridylimidazo[1,5-a]pyridine derivatives as a potent and novel cysteine protease inhibitors which also acts as antibacterial agents.", "The crystal structure of papain was extracted from Protein Data Bank (PDB code: 1PE6) [16] . All the water molecules and heteroatoms were removed and hydrogen atoms were added to the protein. CharMm forcefield [17] was applied and the structure was subjected to energy minimization for 1000 steps using steepest descent method. The chemical structures of all the synthesized compounds were generated using chemdraw and were subsequently converted into 3D format using CORINA. A series of docking experiments were carried out with all the designed 1substituted pyridylimidazo[1,5-a]pyridine derivatives against papain using AutoDock Tools 4.0 [18] for possible cysteine-protease inhibitory activities. The compounds were selected on the basis of their binding energies and those reflecting good binding affinity were further analyzed on in silico platform. As a parameter for the molecular docking, the Lamarckian genetic algorithm, a combination between the genetic algorithm and the local search", "Pseudo-Solis and Wets algorithm, was employed. A grid box of 60660660 Å was generated around active site of papain making sure those inhibitors can freely rotate inside the grid. The number of docking runs was set to 10. Each docking was repeated five times, having in the end a total of 50 docking runs, to check the precision of results. The finally obtained docked complexes were subsequently visualized using PyMol [19] . The work was further authenticated in the wet lab after its detailed analysis on in silico platform.", "The designed derivatives were filtered by Lipinski's ''Rule of five'' that sets the criteria for drug-like properties. Drug likeness is a property that is most often used to characterize novel lead compounds [20] . According to this rule, poor absorption is expected if MW .500, log P.5, hydrogen bond donors .5, and hydrogen bond acceptors .10 [21] . In silico absorption, distribution, metabolism and excretion (ADME) properties of these derivatives were also predicted using following online bioinformatics tools.\n\nN http://www.organic-chemistry.org. N http://mobyle.rpbs.univ-paris-diderot.fr/cgi-bin/portal. py? Form = admetox N https://secure.chemsilico.com/pages/submit.php\n\nThe above study gave us an idea about the existence of possible mutagenic and tumorigenic properties in synthesized compounds. The result obtained helped us to screen out the synthesized compounds for their further usage as potent leads.", "Based on the results of docking studies, ten derivatives of 1pyridylimidazo[1,5-a]pyridine were synthesized according to Siddiqui et al., 2006 [22] which are named as follows: 1-", "The capacity of the 1-pyridylimidazo[1,5-a]pyridine derivatives to inhibit cysteine proteases was tested using papain as the model enzyme. The proteolytic activity of the reaction mixtures was determined using Bz-DL-Arg-pNA as the chromogenic substrate [23] . To solutions of active papain (final concentration: 0.05 mM) were added concentrated solutions of the different derivatives to final concentrations of 0.2 mM. After incubation for 30 min at 37uC, the substrate solution was added and after a further incubation for 20 min the reaction was stopped by the addition of 5% trichloric acid (TCA) acidified with 2.25% HCl and the absorbance of the reaction mixture was determined at a wavelength of 410 nm by Microplate Manager 4.0 (Bio-Rad laboratories). The same procedure was used at 32uC and 42uC for thermodynamics studies. The kinetic parameters for the substrate hydrolysis were determined by measuring the initial rate of enzymatic activity. The inhibition constant K i was determined by", "Dixon method [24] and also by the Lineweaver-Burk equation. The K m value was calculated from the double-reciprocal equation by fitting the data into the computer software Origin 6.1. The Lineweaver-Burk plot was used to determine the types of inhibition. For the kinetic analysis and rate constant determinations, the assays were carried out in triplicate, and the average value was considered throughout this work. Temperature dependence of the inhibition constants was used to determine the thermodynamic parameters. Changes in enthalpy (DH) were determined from the Van't Hoff plots by using the equation,", "Where DH is enthalpy change, R is gas constant, DS is entropy change and T is the absolute temperature. The entropy change was obtained from the equation,\n\nThe assay was done at different temperatures (32uC, 37uC, 42uC) calculating various K i of 1-pyridylimidazo[1,5-a]pyridine derivatives with papain as model enzyme.", "The disk diffusion method [25] was used for the preliminary antibacterial evaluation of 1-pyridylimidazo[1,5-a]pyridine derivatives. The MIC 50 of these derivatives, showing inhibition in the preliminary tests, were further determined by the microtitre plate technique using micro dilution method [26] . In brief, the bacterial strains (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii)) were grown and diluted to 2610 5 colony-forming units (CFU)/ml in sodium phosphate buffer (SPB) containing 0.03% Luria-Bertani (LB) broth. The synthesized derivatives were dissolved in DMSO and their serial dilution was performed in 50 mL of LB medium in 96-well microtitre plate to achieve the required concentrations (0.1-10 mg/ml) with bacterial inoculums (5610 4 CFU per well). DMSO was taken as negative control and Ceftriaxone and clotrimazole were taken as positive control. After incubation at 37uC overnight, the MICs were taken as the lowest inhibitor", "concentration at which the bacterial growth was inhibited. The average of three values was calculated and that was the MIC for the test material and bacterial strain.", "For the agar plate count method [27] , 25 mL aliquots of bacteria at 1610 5 CFU/ml in SPB containing 0.03% LB broth were incubated with 25 mL of diluted compounds for 2 h at 37uC. The mixtures of bacteria and compounds were serially diluted 10-fold with SPB and plated on LB plates that were incubated at 37uC overnight. Bacterial colonies were enumerated the following day.", "After having determined the MICs, bacterial strains from the wells of the microtitre plate with no visible bacterial growth were removed for serial sub cultivation of 2 ml into another new microtitre plate containing 100 ml of broth per well and further incubated for 24 h. The lowest concentration with no visible growth was defined as MBC [28], indicating 99.5% killing of the original inoculum. The absorbance of each well was measured at a wavelength of 620 nm by Microplate Manager 4.0 (Bio-Rad laboratories) and compared with a blank. Solvent (DMSO) was used as a negative control. Three replicates were done for each compound and experiment was repeated two times.", "Bacteria use their cysteine proteases for pathogenecity as could be depicted from the structure of Cif homolog in Burkholderia pseudomallei (CHBP) which reveals a papain-like fold and a conserved Cys-His-Gln catalytic triad [29] . It has been proven that bacterial pathogens have a unique papain-like hydrolytic activity to block the normal host cell cycle progression as the core of an avirulence (Avr) protein (AvrPphB) from the plant pathogen Pseudomonas syringae, resembles the papain-like cysteine proteases. The similarity of this AvrPphB protein with papain includes the catalytic triad of Cys-98, His-212, and Asp-227 in the AvrPphB active site [30] .", "Turk et al. have proposed, on the basis of kinetic and structural studies, that papain has seven subsites at the active site but only five subsites are important which can bind to an amino acid residue of the substrate [31] . A variety of intermediates are generated when papain reacts with substrate or an inhibitor [2] . Like serine proteases, cysteine proteases tend to have relatively shallow, solvent-exposed active sites that can accommodate short substrate/inhibitor segments of protein loops (e.g. from endogenous inhibitors such as cystatins) or strands. The inhibitor Table 3 . Name, Structure, IC50 & K i of 1-substituted pyridylimidazo[1,5-a]pyridine derivatives against cysteine protease papain.\n\nType of inhibition Ki (mM) IC 50 (mM)", "Non-Competitive 13.7 13.4 compound bound to protease with a combination of hydrogen bonds and hydrophobic interactions. As a part of our investigation in developing novel and efficient cysteine protease inhibitors, ten 1-substituted pyridylimidazo [1,5a] pyridine derivatives (3a-j) were primarily designed and screened on the basis of their docking energies against papain to elucidate their possible mode of action. It was found that these compounds were specific inhibitors of cysteine protease, papain and didn't show inhibition against other types of proteases like serine, aspartic or metalloproteases. They are specific for CA clan of cysteine protease and didn't show any significant inhibition against other clans of cysteine proteases.", "These new compounds were devised based on the knowledge of ability of a protein to alter its conformation to accommodate a binding ligand and enabled us to directly compare the relative positions of the residue in the binding pocket. Molecular docking study provided the structural insight into the binding of these compounds (3a-j) (Figure 1 ) within the active site of papain which mainly consist of a catalytic triad of Cys 25, His 159 and Asp 175 [32] . Moreover, role of other residues present in the active site of papain, playing important role in the accommodation of compounds have also been revealed. Initially, docking was performed with all the designed compounds (3a-j) against papain, a known cysteine protease enzyme and in this context, we observed very interesting results where our proposed inhibitors (3a-j) take advantage of aromatic and hydrophilic residues by making a variety of interactions with target enzyme. Although, compounds 3e-j gave significant results when docked", "with papain but during evaluation of antibacterial properties in wet lab experiments, they gave insignificant results (data not shown). Therefore, only four compounds were considered for discussion and further experiments like kinetic and thermodynamic studies to characterize these compounds as potent pro-inhibitors, were performed (3a-d).", "The findings of the above study have shown that the molecular interactions between the compounds 3a-d and papain were very similar to the interactions observed for E-64c, a derivative of naturally occurring epoxide inhibitor (E-64c) (Figure 1 ) of cysteine proteases [31, 32] , with papain; especially with regard to the hydrogen bonding and hydrophobic interactions of the ligands with conserved residues in the catalytic binding site (Figure 2 A-D). Several papain residues participated in hydrophobic interactions with compounds 3a-d, including Gln19, Cys25, Gly66 and Asp158. The pyridine moieties of compounds 3a-d interact with S2 site of papain which includes (Tyr61, Asn64, Gly65 & Tyr67) amino acids (Figure 2 A-D) . The active site residues that were found to be key player in the interaction of compounds within the active site (mostly through hydrophobic interactions) were Cys25, Tyr61, His159 and Trp177, while Trp177, Gln19 were found to me making hydrogen bonds only with compound", "3a. Besides this many other residues were also found to be actively involved ( Table 1) . Furthermore, the binding energies for the compound 3a, 3b, 3c and 3d with papain were found to be 26.12, 25.76, 26.84 and 25.62 Kcal/mol respectively, which were in great agreement with our wet lab experiments; shall be discussed later ( Table 1) . This confirmed the accuracy of our docking protocol. Since, the binding energy is a direct measure of strength of interaction and our compounds 3a-d showed stronger binding within the active site of papain in comparison to the inhibitor E-64c (DG: 24.04 Kcal/mol), therefore, the results suggest that these 1-substituted pyridylimidazo[1,5-a]pyridine derivatives (3ad) could be potent inhibitors of papain like cysteine proteases.", "The in silico interaction of compounds 3a-d with papain, which were observed as discussed above, was validated with wet lab Table 5 . Prediction of antibacterial compounds as drugs (http://www.organic-chemistry.org). Table 2) . Interestingly, the observed in silico binding energies for the compounds 3a-d against papain were found to be in great agreement (standard error 62 Kcal/mol) with the value of free energy of binding (DG) observed during thermodynamics studies ( Table 1 and 2) . Similarly, enthalpy change (DH) of the binding was negative whereas entropy (DS) change of the binding was positive which indicated the exothermic and entropically driven nature of binding. This pattern of temperature dependence is characteristic of hydrophobic interaction [33] . As discussed earlier that all the compounds (3a-d) were found to interact with the active site residues of papain through hydrophobic interactions at most instances during in silico studies, the same was observed by the analysis", "of Van't Hoff plots for all the proposed inhibitors at three different temperatures (32uC, 37uC and 42uC) in wet lab experiments ( Figure 3) . This proves the importance of these types of interactions in the positioning of compounds within the active site. Hence, thermodynamics as well as in silico study reveals that hydrophobic interactions favor binding of these proposed inhibitors with papain like cysteine proteases. Further wet lab results proposed the non competitive interaction of compounds (3a, 3c & 3d) with papain except for compound 3b which showed competitive interaction. In sum up, the above results of molecular docking studies and thermodynamic analysis of compounds 3a-d with papain showed that these compounds have the potential to be novel and unique cysteine protease inhibitors.", "In the current study, the cysteine protease inhibitory activity of synthesized derivatives of 1-substituted pyridylimidazo[1,5-a] pyridine (3a-d)) was also performed against papain and the inhibition constants (K i ) for the above said enzyme were observed to be 13.70, 23.20, 90.00 and 99.30 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Furthermore, the calculated IC 50 values were also found to be 13.40, 21.17, 94.50 and 96.50 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Except compound 3b, rest of the compounds showed non competitive, reversible inhibitions but all the compounds irrespective of types of binding, showed hydrophobic and entropically driven interaction. These derivatives (3a-j) were eventually evaluated for their antibacterial activities against seven clinically important microbes (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii). Here, we are showing the data of only four compounds", "(3a-d) because of their significant results ( Table 4 ). All the compounds strictly followed the pattern of antiprotease activity towards bacterial growth except P. vulgaris and E. coli at one instance each (Table 4) . Since compound 3c & 3d do not have much difference in their IC50 values (3c-94.5 mM and 3d-96.5 mM) against cysteine protease, papain and hence in antibacterial activity in all instances except one. It might be random due to so close in IC50 values. Compounds 3c & 3d are having much difference in their IC50 values (3b-21.17 mM and 3c-94.5 mM) and they showed exact pattern for their antibacterial activity for all microbes except for E. coli at one instance. Although, E. coli does contain six major cysteine proteases but none belong to the CA clan of papain. It is argued that these compounds also inhibited the cysteine proteases of other clan than papain but with low efficacy.", "Since, pyridylimidazo[1,5-a]pyridine derivatives is absolutely new scaffold towards antibacterial agents and hence, not any standard compound(s) of same scaffold is available for reference. So, Clotrimazole (1-[(2-chlorophenyl)(diphenyl)methyl]-1H-imidazole), an imidazole derivatives and Ceftriaxone (third-generation cephalosporin antibiotic with broad spectrum activity against Gram-positive and Gram-negative bacteria) have been used as positive control whereas DMSO has been used as negative control. All the above mentioned bacterial species have been shown to secrete certain cysteine proteases which play very important role in the pathogenecity of different diseases caused by these microorganisms. The minimum inhibitory concentration (MICs) of compounds (3a-d) ( Table 4 ) against all tested bacteria except E. coli and P. vulgaris, were observed to be in great agreement with their respective inhibition constant (K i )/IC 50 values against papain (Table 3 ) which clearly indicates that", "these compounds have the potential to inhibit the papain like cysteine proteases of these pathogens. The partition coefficient (logP) is a well-established measure of the compound's lipophilicity. The distribution of calculated logP (cLogP) values of a majority of drugs in the market is in the range of zero to five. All the compounds studied except 3d, showed good agreement with the criteria laid down for the prediction of a compound to be a potential drug ( Table 5 ). All the compounds do not show any threat against toxicity risk assessment except compound 3d which showed threat as tumorogenic effect due to the presence of isobutyl group. Among all the tested compounds, compound 3a was the most potent whose MIC was the lowest among all the tested compounds and showed maximum drug score and positive values for drug likeness.", "In summary, the results of the present study have established that 1-substituted pyridylimidazo[1,5-a]pyridine derivatives could be candidate for novel and potent inhibitors of papain like cysteine proteases, which play deleterious role in the progression of different diseases caused by diverse microorganisms. Therefore, this group of compounds could be the subject of future research to confront the challenges with resistant microorganisms that is a major threat globally.\n\nFile S1 Types of inhibitions with Ki (Compounds 3a-3d).\n\n(DOC)" ]
[ 1 ]
3,444
5,218
1,565
At what temperatures was the assay completed?
3,042
[ "32uC, 37uC, 42uC" ]
[ "Design, Synthesis, Evaluation and Thermodynamics of 1-Substituted Pyridylimidazo[1,5-a]Pyridine Derivatives as Cysteine Protease Inhibitors\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3734177/\n\nSHA: ee8483f8f2cc5fe38be4e565eae3af9d0bb8220b\n\nAuthors: Khan, Mohd Sajid; Baig, Mohd Hassan; Ahmad, Saheem; Siddiqui, Shapi Ahmad; Srivastava, Ashwini Kumar; Srinivasan, Kumar Venkatraman; Ansari, Irfan A.\nDate: 2013-08-05\nDOI: 10.1371/journal.pone.0069982\nLicense: cc-by", "Abstract: Targeting papain family cysteine proteases is one of the novel strategies in the development of chemotherapy for a number of diseases. Novel cysteine protease inhibitors derived from 1-pyridylimidazo[1,5-a]pyridine representing pharmacologically important class of compounds are being reported here for the first time. The derivatives were initially designed and screened in silico by molecular docking studies against papain to explore the possible mode of action. The molecular interaction between the compounds and cysteine protease (papain) was found to be very similar to the interactions observed with the respective epoxide inhibitor (E-64c) of papain. Subsequently, compounds were synthesized to validate their efficacy in wet lab experiments. When characterized kinetically, these compounds show their K(i) and IC(50) values in the range of 13.75 to 99.30 µM and 13.40 to 96.50 µM, respectively. The thermodynamics studies suggest their binding with papain hydrophobically and", "entropically driven. These inhibitors also inhibit the growth of clinically important different types of Gram positive and Gram negative bacteria having MIC(50) values in the range of 0.6–1.4 µg/ml. Based on Lipinski’s rule of Five, we also propose these compounds as potent antibacterial prodrugs. The most active antibacterial compound was found to be 1-(2-pyridyl)-3-(2-hydroxyphenyl)imidazo[1,5-a]pyridine (3a).", "Text: Cysteine-protease inhibitors (CPI) have gained considerable attention over the last couple of decades and many classes of compounds are currently in human clinical trials for a number of diseases. Interest in papain family cysteine proteases as chemotherapeutic targets is derived from the recognition that they are critical to the life cycle or pathogenicity of many microorganisms. The cysteine proteases from Streptococcus sp. (streptopain) [1] , Staphylococcus sp. (staphopain) [2] , Plasmodium falciparum (falcipain-1, -2, and -3) and Trypanosoma cruzi (cruzipain) [3] are some of the most widely studied members of papain family which have been reported to be linked with severity of infection and various pathological conditions caused by these microorganisms.", "The activation of the kallikrein-kinin pathway, which could be activated by more than sixteen bacterial proteases, is a mechanism that some pathogens exploit to ensure that there is a supply of nutrients to the site of infection by increasing vascular permeability. This has been shown to occur in infections with several microbial species, including Pseudomonas, Serratia, Clostridium, Candida, Bacteroides, Porphyromonas and Staphylococcus sp. [4] . Many bacteria secrete several nonspecific proteases e.g. Pseudomonas, Serratia, Streptococcus, Staphylococcus and Bacteroides sp. have potent metallo-, cysteine and serine proteases with broad ranges of activities [5] . The critical role of bacterial proteases in virulence was successfully demonstrated by eliminating the proteaseencoding gene in P. gingivalis [6] .", "Recently described cystatin superfamily of proteins comprises both eukaryotic and prokaryotic cysteine protease inhibitors [7] . Human cystatins C, D and S, rat cystatins A and S, chicken cystatin and oryza cystatin have been reported to inhibit the replication of certain viruses and bacteria [8] although it has not yet been directly demonstrated that these effects are due to the protease inhibitory capacity of the cystatins [9] . The key role of cysteine proteases in microbial infections, coupled with the relative lack of redundancy compared to mammalian systems has made microbial proteases attractive targets for the development of novel chemotherapeutic approaches [10, 11] .", "Imidazopyridine ring systems represent an important class of compounds not only for their theoretical interest but also from a pharmacological point of view. They have been shown to possess a broad range of useful pharmacological activities [12] including antigastric, antisecretory, local anesthetic, antiviral, antianxiety, antibacterial, antifungal, antihelminthic, antiprotozoal, anticonvulsant, gastrointestinal, antiulcer (Zolmidine), anxiolytic (Alpidem), hypnotic (Zolpidem) and immunomodulatory [13] . The nature and the position of the substituents on the pyridinic moiety influence these pharmacological activities. These imidazopyridine heterocyclic structures form part of the skeleton of natural alkaloids, neuromuscular blocking agents [14] , reversible inhibitors of the H + , K + -ATPase enzymes with a potent antisecretory activity, and are known to be sedative hypnotics of the nervous system [15] . In this study, we have proposed kinetically and thermodynamically characterized", "1-substituted pyridylimidazo[1,5-a]pyridine derivatives as a potent and novel cysteine protease inhibitors which also acts as antibacterial agents.", "The crystal structure of papain was extracted from Protein Data Bank (PDB code: 1PE6) [16] . All the water molecules and heteroatoms were removed and hydrogen atoms were added to the protein. CharMm forcefield [17] was applied and the structure was subjected to energy minimization for 1000 steps using steepest descent method. The chemical structures of all the synthesized compounds were generated using chemdraw and were subsequently converted into 3D format using CORINA. A series of docking experiments were carried out with all the designed 1substituted pyridylimidazo[1,5-a]pyridine derivatives against papain using AutoDock Tools 4.0 [18] for possible cysteine-protease inhibitory activities. The compounds were selected on the basis of their binding energies and those reflecting good binding affinity were further analyzed on in silico platform. As a parameter for the molecular docking, the Lamarckian genetic algorithm, a combination between the genetic algorithm and the local search", "Pseudo-Solis and Wets algorithm, was employed. A grid box of 60660660 Å was generated around active site of papain making sure those inhibitors can freely rotate inside the grid. The number of docking runs was set to 10. Each docking was repeated five times, having in the end a total of 50 docking runs, to check the precision of results. The finally obtained docked complexes were subsequently visualized using PyMol [19] . The work was further authenticated in the wet lab after its detailed analysis on in silico platform.", "The designed derivatives were filtered by Lipinski's ''Rule of five'' that sets the criteria for drug-like properties. Drug likeness is a property that is most often used to characterize novel lead compounds [20] . According to this rule, poor absorption is expected if MW .500, log P.5, hydrogen bond donors .5, and hydrogen bond acceptors .10 [21] . In silico absorption, distribution, metabolism and excretion (ADME) properties of these derivatives were also predicted using following online bioinformatics tools.\n\nN http://www.organic-chemistry.org. N http://mobyle.rpbs.univ-paris-diderot.fr/cgi-bin/portal. py? Form = admetox N https://secure.chemsilico.com/pages/submit.php\n\nThe above study gave us an idea about the existence of possible mutagenic and tumorigenic properties in synthesized compounds. The result obtained helped us to screen out the synthesized compounds for their further usage as potent leads.", "Based on the results of docking studies, ten derivatives of 1pyridylimidazo[1,5-a]pyridine were synthesized according to Siddiqui et al., 2006 [22] which are named as follows: 1-", "The capacity of the 1-pyridylimidazo[1,5-a]pyridine derivatives to inhibit cysteine proteases was tested using papain as the model enzyme. The proteolytic activity of the reaction mixtures was determined using Bz-DL-Arg-pNA as the chromogenic substrate [23] . To solutions of active papain (final concentration: 0.05 mM) were added concentrated solutions of the different derivatives to final concentrations of 0.2 mM. After incubation for 30 min at 37uC, the substrate solution was added and after a further incubation for 20 min the reaction was stopped by the addition of 5% trichloric acid (TCA) acidified with 2.25% HCl and the absorbance of the reaction mixture was determined at a wavelength of 410 nm by Microplate Manager 4.0 (Bio-Rad laboratories). The same procedure was used at 32uC and 42uC for thermodynamics studies. The kinetic parameters for the substrate hydrolysis were determined by measuring the initial rate of enzymatic activity. The inhibition constant K i was determined by", "Dixon method [24] and also by the Lineweaver-Burk equation. The K m value was calculated from the double-reciprocal equation by fitting the data into the computer software Origin 6.1. The Lineweaver-Burk plot was used to determine the types of inhibition. For the kinetic analysis and rate constant determinations, the assays were carried out in triplicate, and the average value was considered throughout this work. Temperature dependence of the inhibition constants was used to determine the thermodynamic parameters. Changes in enthalpy (DH) were determined from the Van't Hoff plots by using the equation,", "Where DH is enthalpy change, R is gas constant, DS is entropy change and T is the absolute temperature. The entropy change was obtained from the equation,\n\nThe assay was done at different temperatures (32uC, 37uC, 42uC) calculating various K i of 1-pyridylimidazo[1,5-a]pyridine derivatives with papain as model enzyme.", "The disk diffusion method [25] was used for the preliminary antibacterial evaluation of 1-pyridylimidazo[1,5-a]pyridine derivatives. The MIC 50 of these derivatives, showing inhibition in the preliminary tests, were further determined by the microtitre plate technique using micro dilution method [26] . In brief, the bacterial strains (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii)) were grown and diluted to 2610 5 colony-forming units (CFU)/ml in sodium phosphate buffer (SPB) containing 0.03% Luria-Bertani (LB) broth. The synthesized derivatives were dissolved in DMSO and their serial dilution was performed in 50 mL of LB medium in 96-well microtitre plate to achieve the required concentrations (0.1-10 mg/ml) with bacterial inoculums (5610 4 CFU per well). DMSO was taken as negative control and Ceftriaxone and clotrimazole were taken as positive control. After incubation at 37uC overnight, the MICs were taken as the lowest inhibitor", "concentration at which the bacterial growth was inhibited. The average of three values was calculated and that was the MIC for the test material and bacterial strain.", "For the agar plate count method [27] , 25 mL aliquots of bacteria at 1610 5 CFU/ml in SPB containing 0.03% LB broth were incubated with 25 mL of diluted compounds for 2 h at 37uC. The mixtures of bacteria and compounds were serially diluted 10-fold with SPB and plated on LB plates that were incubated at 37uC overnight. Bacterial colonies were enumerated the following day.", "After having determined the MICs, bacterial strains from the wells of the microtitre plate with no visible bacterial growth were removed for serial sub cultivation of 2 ml into another new microtitre plate containing 100 ml of broth per well and further incubated for 24 h. The lowest concentration with no visible growth was defined as MBC [28], indicating 99.5% killing of the original inoculum. The absorbance of each well was measured at a wavelength of 620 nm by Microplate Manager 4.0 (Bio-Rad laboratories) and compared with a blank. Solvent (DMSO) was used as a negative control. Three replicates were done for each compound and experiment was repeated two times.", "Bacteria use their cysteine proteases for pathogenecity as could be depicted from the structure of Cif homolog in Burkholderia pseudomallei (CHBP) which reveals a papain-like fold and a conserved Cys-His-Gln catalytic triad [29] . It has been proven that bacterial pathogens have a unique papain-like hydrolytic activity to block the normal host cell cycle progression as the core of an avirulence (Avr) protein (AvrPphB) from the plant pathogen Pseudomonas syringae, resembles the papain-like cysteine proteases. The similarity of this AvrPphB protein with papain includes the catalytic triad of Cys-98, His-212, and Asp-227 in the AvrPphB active site [30] .", "Turk et al. have proposed, on the basis of kinetic and structural studies, that papain has seven subsites at the active site but only five subsites are important which can bind to an amino acid residue of the substrate [31] . A variety of intermediates are generated when papain reacts with substrate or an inhibitor [2] . Like serine proteases, cysteine proteases tend to have relatively shallow, solvent-exposed active sites that can accommodate short substrate/inhibitor segments of protein loops (e.g. from endogenous inhibitors such as cystatins) or strands. The inhibitor Table 3 . Name, Structure, IC50 & K i of 1-substituted pyridylimidazo[1,5-a]pyridine derivatives against cysteine protease papain.\n\nType of inhibition Ki (mM) IC 50 (mM)", "Non-Competitive 13.7 13.4 compound bound to protease with a combination of hydrogen bonds and hydrophobic interactions. As a part of our investigation in developing novel and efficient cysteine protease inhibitors, ten 1-substituted pyridylimidazo [1,5a] pyridine derivatives (3a-j) were primarily designed and screened on the basis of their docking energies against papain to elucidate their possible mode of action. It was found that these compounds were specific inhibitors of cysteine protease, papain and didn't show inhibition against other types of proteases like serine, aspartic or metalloproteases. They are specific for CA clan of cysteine protease and didn't show any significant inhibition against other clans of cysteine proteases.", "These new compounds were devised based on the knowledge of ability of a protein to alter its conformation to accommodate a binding ligand and enabled us to directly compare the relative positions of the residue in the binding pocket. Molecular docking study provided the structural insight into the binding of these compounds (3a-j) (Figure 1 ) within the active site of papain which mainly consist of a catalytic triad of Cys 25, His 159 and Asp 175 [32] . Moreover, role of other residues present in the active site of papain, playing important role in the accommodation of compounds have also been revealed. Initially, docking was performed with all the designed compounds (3a-j) against papain, a known cysteine protease enzyme and in this context, we observed very interesting results where our proposed inhibitors (3a-j) take advantage of aromatic and hydrophilic residues by making a variety of interactions with target enzyme. Although, compounds 3e-j gave significant results when docked", "with papain but during evaluation of antibacterial properties in wet lab experiments, they gave insignificant results (data not shown). Therefore, only four compounds were considered for discussion and further experiments like kinetic and thermodynamic studies to characterize these compounds as potent pro-inhibitors, were performed (3a-d).", "The findings of the above study have shown that the molecular interactions between the compounds 3a-d and papain were very similar to the interactions observed for E-64c, a derivative of naturally occurring epoxide inhibitor (E-64c) (Figure 1 ) of cysteine proteases [31, 32] , with papain; especially with regard to the hydrogen bonding and hydrophobic interactions of the ligands with conserved residues in the catalytic binding site (Figure 2 A-D). Several papain residues participated in hydrophobic interactions with compounds 3a-d, including Gln19, Cys25, Gly66 and Asp158. The pyridine moieties of compounds 3a-d interact with S2 site of papain which includes (Tyr61, Asn64, Gly65 & Tyr67) amino acids (Figure 2 A-D) . The active site residues that were found to be key player in the interaction of compounds within the active site (mostly through hydrophobic interactions) were Cys25, Tyr61, His159 and Trp177, while Trp177, Gln19 were found to me making hydrogen bonds only with compound", "3a. Besides this many other residues were also found to be actively involved ( Table 1) . Furthermore, the binding energies for the compound 3a, 3b, 3c and 3d with papain were found to be 26.12, 25.76, 26.84 and 25.62 Kcal/mol respectively, which were in great agreement with our wet lab experiments; shall be discussed later ( Table 1) . This confirmed the accuracy of our docking protocol. Since, the binding energy is a direct measure of strength of interaction and our compounds 3a-d showed stronger binding within the active site of papain in comparison to the inhibitor E-64c (DG: 24.04 Kcal/mol), therefore, the results suggest that these 1-substituted pyridylimidazo[1,5-a]pyridine derivatives (3ad) could be potent inhibitors of papain like cysteine proteases.", "The in silico interaction of compounds 3a-d with papain, which were observed as discussed above, was validated with wet lab Table 5 . Prediction of antibacterial compounds as drugs (http://www.organic-chemistry.org). Table 2) . Interestingly, the observed in silico binding energies for the compounds 3a-d against papain were found to be in great agreement (standard error 62 Kcal/mol) with the value of free energy of binding (DG) observed during thermodynamics studies ( Table 1 and 2) . Similarly, enthalpy change (DH) of the binding was negative whereas entropy (DS) change of the binding was positive which indicated the exothermic and entropically driven nature of binding. This pattern of temperature dependence is characteristic of hydrophobic interaction [33] . As discussed earlier that all the compounds (3a-d) were found to interact with the active site residues of papain through hydrophobic interactions at most instances during in silico studies, the same was observed by the analysis", "of Van't Hoff plots for all the proposed inhibitors at three different temperatures (32uC, 37uC and 42uC) in wet lab experiments ( Figure 3) . This proves the importance of these types of interactions in the positioning of compounds within the active site. Hence, thermodynamics as well as in silico study reveals that hydrophobic interactions favor binding of these proposed inhibitors with papain like cysteine proteases. Further wet lab results proposed the non competitive interaction of compounds (3a, 3c & 3d) with papain except for compound 3b which showed competitive interaction. In sum up, the above results of molecular docking studies and thermodynamic analysis of compounds 3a-d with papain showed that these compounds have the potential to be novel and unique cysteine protease inhibitors.", "In the current study, the cysteine protease inhibitory activity of synthesized derivatives of 1-substituted pyridylimidazo[1,5-a] pyridine (3a-d)) was also performed against papain and the inhibition constants (K i ) for the above said enzyme were observed to be 13.70, 23.20, 90.00 and 99.30 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Furthermore, the calculated IC 50 values were also found to be 13.40, 21.17, 94.50 and 96.50 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Except compound 3b, rest of the compounds showed non competitive, reversible inhibitions but all the compounds irrespective of types of binding, showed hydrophobic and entropically driven interaction. These derivatives (3a-j) were eventually evaluated for their antibacterial activities against seven clinically important microbes (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii). Here, we are showing the data of only four compounds", "(3a-d) because of their significant results ( Table 4 ). All the compounds strictly followed the pattern of antiprotease activity towards bacterial growth except P. vulgaris and E. coli at one instance each (Table 4) . Since compound 3c & 3d do not have much difference in their IC50 values (3c-94.5 mM and 3d-96.5 mM) against cysteine protease, papain and hence in antibacterial activity in all instances except one. It might be random due to so close in IC50 values. Compounds 3c & 3d are having much difference in their IC50 values (3b-21.17 mM and 3c-94.5 mM) and they showed exact pattern for their antibacterial activity for all microbes except for E. coli at one instance. Although, E. coli does contain six major cysteine proteases but none belong to the CA clan of papain. It is argued that these compounds also inhibited the cysteine proteases of other clan than papain but with low efficacy.", "Since, pyridylimidazo[1,5-a]pyridine derivatives is absolutely new scaffold towards antibacterial agents and hence, not any standard compound(s) of same scaffold is available for reference. So, Clotrimazole (1-[(2-chlorophenyl)(diphenyl)methyl]-1H-imidazole), an imidazole derivatives and Ceftriaxone (third-generation cephalosporin antibiotic with broad spectrum activity against Gram-positive and Gram-negative bacteria) have been used as positive control whereas DMSO has been used as negative control. All the above mentioned bacterial species have been shown to secrete certain cysteine proteases which play very important role in the pathogenecity of different diseases caused by these microorganisms. The minimum inhibitory concentration (MICs) of compounds (3a-d) ( Table 4 ) against all tested bacteria except E. coli and P. vulgaris, were observed to be in great agreement with their respective inhibition constant (K i )/IC 50 values against papain (Table 3 ) which clearly indicates that", "these compounds have the potential to inhibit the papain like cysteine proteases of these pathogens. The partition coefficient (logP) is a well-established measure of the compound's lipophilicity. The distribution of calculated logP (cLogP) values of a majority of drugs in the market is in the range of zero to five. All the compounds studied except 3d, showed good agreement with the criteria laid down for the prediction of a compound to be a potential drug ( Table 5 ). All the compounds do not show any threat against toxicity risk assessment except compound 3d which showed threat as tumorogenic effect due to the presence of isobutyl group. Among all the tested compounds, compound 3a was the most potent whose MIC was the lowest among all the tested compounds and showed maximum drug score and positive values for drug likeness.", "In summary, the results of the present study have established that 1-substituted pyridylimidazo[1,5-a]pyridine derivatives could be candidate for novel and potent inhibitors of papain like cysteine proteases, which play deleterious role in the progression of different diseases caused by diverse microorganisms. Therefore, this group of compounds could be the subject of future research to confront the challenges with resistant microorganisms that is a major threat globally.\n\nFile S1 Types of inhibitions with Ki (Compounds 3a-3d).\n\n(DOC)" ]
[ 14 ]
3,444
5,218
1,565
What criteria sets the guideline for drug-like properties?
3,043
[ "Lipinski's ''Rule of five''" ]
[ "Design, Synthesis, Evaluation and Thermodynamics of 1-Substituted Pyridylimidazo[1,5-a]Pyridine Derivatives as Cysteine Protease Inhibitors\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3734177/\n\nSHA: ee8483f8f2cc5fe38be4e565eae3af9d0bb8220b\n\nAuthors: Khan, Mohd Sajid; Baig, Mohd Hassan; Ahmad, Saheem; Siddiqui, Shapi Ahmad; Srivastava, Ashwini Kumar; Srinivasan, Kumar Venkatraman; Ansari, Irfan A.\nDate: 2013-08-05\nDOI: 10.1371/journal.pone.0069982\nLicense: cc-by", "Abstract: Targeting papain family cysteine proteases is one of the novel strategies in the development of chemotherapy for a number of diseases. Novel cysteine protease inhibitors derived from 1-pyridylimidazo[1,5-a]pyridine representing pharmacologically important class of compounds are being reported here for the first time. The derivatives were initially designed and screened in silico by molecular docking studies against papain to explore the possible mode of action. The molecular interaction between the compounds and cysteine protease (papain) was found to be very similar to the interactions observed with the respective epoxide inhibitor (E-64c) of papain. Subsequently, compounds were synthesized to validate their efficacy in wet lab experiments. When characterized kinetically, these compounds show their K(i) and IC(50) values in the range of 13.75 to 99.30 µM and 13.40 to 96.50 µM, respectively. The thermodynamics studies suggest their binding with papain hydrophobically and", "entropically driven. These inhibitors also inhibit the growth of clinically important different types of Gram positive and Gram negative bacteria having MIC(50) values in the range of 0.6–1.4 µg/ml. Based on Lipinski’s rule of Five, we also propose these compounds as potent antibacterial prodrugs. The most active antibacterial compound was found to be 1-(2-pyridyl)-3-(2-hydroxyphenyl)imidazo[1,5-a]pyridine (3a).", "Text: Cysteine-protease inhibitors (CPI) have gained considerable attention over the last couple of decades and many classes of compounds are currently in human clinical trials for a number of diseases. Interest in papain family cysteine proteases as chemotherapeutic targets is derived from the recognition that they are critical to the life cycle or pathogenicity of many microorganisms. The cysteine proteases from Streptococcus sp. (streptopain) [1] , Staphylococcus sp. (staphopain) [2] , Plasmodium falciparum (falcipain-1, -2, and -3) and Trypanosoma cruzi (cruzipain) [3] are some of the most widely studied members of papain family which have been reported to be linked with severity of infection and various pathological conditions caused by these microorganisms.", "The activation of the kallikrein-kinin pathway, which could be activated by more than sixteen bacterial proteases, is a mechanism that some pathogens exploit to ensure that there is a supply of nutrients to the site of infection by increasing vascular permeability. This has been shown to occur in infections with several microbial species, including Pseudomonas, Serratia, Clostridium, Candida, Bacteroides, Porphyromonas and Staphylococcus sp. [4] . Many bacteria secrete several nonspecific proteases e.g. Pseudomonas, Serratia, Streptococcus, Staphylococcus and Bacteroides sp. have potent metallo-, cysteine and serine proteases with broad ranges of activities [5] . The critical role of bacterial proteases in virulence was successfully demonstrated by eliminating the proteaseencoding gene in P. gingivalis [6] .", "Recently described cystatin superfamily of proteins comprises both eukaryotic and prokaryotic cysteine protease inhibitors [7] . Human cystatins C, D and S, rat cystatins A and S, chicken cystatin and oryza cystatin have been reported to inhibit the replication of certain viruses and bacteria [8] although it has not yet been directly demonstrated that these effects are due to the protease inhibitory capacity of the cystatins [9] . The key role of cysteine proteases in microbial infections, coupled with the relative lack of redundancy compared to mammalian systems has made microbial proteases attractive targets for the development of novel chemotherapeutic approaches [10, 11] .", "Imidazopyridine ring systems represent an important class of compounds not only for their theoretical interest but also from a pharmacological point of view. They have been shown to possess a broad range of useful pharmacological activities [12] including antigastric, antisecretory, local anesthetic, antiviral, antianxiety, antibacterial, antifungal, antihelminthic, antiprotozoal, anticonvulsant, gastrointestinal, antiulcer (Zolmidine), anxiolytic (Alpidem), hypnotic (Zolpidem) and immunomodulatory [13] . The nature and the position of the substituents on the pyridinic moiety influence these pharmacological activities. These imidazopyridine heterocyclic structures form part of the skeleton of natural alkaloids, neuromuscular blocking agents [14] , reversible inhibitors of the H + , K + -ATPase enzymes with a potent antisecretory activity, and are known to be sedative hypnotics of the nervous system [15] . In this study, we have proposed kinetically and thermodynamically characterized", "1-substituted pyridylimidazo[1,5-a]pyridine derivatives as a potent and novel cysteine protease inhibitors which also acts as antibacterial agents.", "The crystal structure of papain was extracted from Protein Data Bank (PDB code: 1PE6) [16] . All the water molecules and heteroatoms were removed and hydrogen atoms were added to the protein. CharMm forcefield [17] was applied and the structure was subjected to energy minimization for 1000 steps using steepest descent method. The chemical structures of all the synthesized compounds were generated using chemdraw and were subsequently converted into 3D format using CORINA. A series of docking experiments were carried out with all the designed 1substituted pyridylimidazo[1,5-a]pyridine derivatives against papain using AutoDock Tools 4.0 [18] for possible cysteine-protease inhibitory activities. The compounds were selected on the basis of their binding energies and those reflecting good binding affinity were further analyzed on in silico platform. As a parameter for the molecular docking, the Lamarckian genetic algorithm, a combination between the genetic algorithm and the local search", "Pseudo-Solis and Wets algorithm, was employed. A grid box of 60660660 Å was generated around active site of papain making sure those inhibitors can freely rotate inside the grid. The number of docking runs was set to 10. Each docking was repeated five times, having in the end a total of 50 docking runs, to check the precision of results. The finally obtained docked complexes were subsequently visualized using PyMol [19] . The work was further authenticated in the wet lab after its detailed analysis on in silico platform.", "The designed derivatives were filtered by Lipinski's ''Rule of five'' that sets the criteria for drug-like properties. Drug likeness is a property that is most often used to characterize novel lead compounds [20] . According to this rule, poor absorption is expected if MW .500, log P.5, hydrogen bond donors .5, and hydrogen bond acceptors .10 [21] . In silico absorption, distribution, metabolism and excretion (ADME) properties of these derivatives were also predicted using following online bioinformatics tools.\n\nN http://www.organic-chemistry.org. N http://mobyle.rpbs.univ-paris-diderot.fr/cgi-bin/portal. py? Form = admetox N https://secure.chemsilico.com/pages/submit.php\n\nThe above study gave us an idea about the existence of possible mutagenic and tumorigenic properties in synthesized compounds. The result obtained helped us to screen out the synthesized compounds for their further usage as potent leads.", "Based on the results of docking studies, ten derivatives of 1pyridylimidazo[1,5-a]pyridine were synthesized according to Siddiqui et al., 2006 [22] which are named as follows: 1-", "The capacity of the 1-pyridylimidazo[1,5-a]pyridine derivatives to inhibit cysteine proteases was tested using papain as the model enzyme. The proteolytic activity of the reaction mixtures was determined using Bz-DL-Arg-pNA as the chromogenic substrate [23] . To solutions of active papain (final concentration: 0.05 mM) were added concentrated solutions of the different derivatives to final concentrations of 0.2 mM. After incubation for 30 min at 37uC, the substrate solution was added and after a further incubation for 20 min the reaction was stopped by the addition of 5% trichloric acid (TCA) acidified with 2.25% HCl and the absorbance of the reaction mixture was determined at a wavelength of 410 nm by Microplate Manager 4.0 (Bio-Rad laboratories). The same procedure was used at 32uC and 42uC for thermodynamics studies. The kinetic parameters for the substrate hydrolysis were determined by measuring the initial rate of enzymatic activity. The inhibition constant K i was determined by", "Dixon method [24] and also by the Lineweaver-Burk equation. The K m value was calculated from the double-reciprocal equation by fitting the data into the computer software Origin 6.1. The Lineweaver-Burk plot was used to determine the types of inhibition. For the kinetic analysis and rate constant determinations, the assays were carried out in triplicate, and the average value was considered throughout this work. Temperature dependence of the inhibition constants was used to determine the thermodynamic parameters. Changes in enthalpy (DH) were determined from the Van't Hoff plots by using the equation,", "Where DH is enthalpy change, R is gas constant, DS is entropy change and T is the absolute temperature. The entropy change was obtained from the equation,\n\nThe assay was done at different temperatures (32uC, 37uC, 42uC) calculating various K i of 1-pyridylimidazo[1,5-a]pyridine derivatives with papain as model enzyme.", "The disk diffusion method [25] was used for the preliminary antibacterial evaluation of 1-pyridylimidazo[1,5-a]pyridine derivatives. The MIC 50 of these derivatives, showing inhibition in the preliminary tests, were further determined by the microtitre plate technique using micro dilution method [26] . In brief, the bacterial strains (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii)) were grown and diluted to 2610 5 colony-forming units (CFU)/ml in sodium phosphate buffer (SPB) containing 0.03% Luria-Bertani (LB) broth. The synthesized derivatives were dissolved in DMSO and their serial dilution was performed in 50 mL of LB medium in 96-well microtitre plate to achieve the required concentrations (0.1-10 mg/ml) with bacterial inoculums (5610 4 CFU per well). DMSO was taken as negative control and Ceftriaxone and clotrimazole were taken as positive control. After incubation at 37uC overnight, the MICs were taken as the lowest inhibitor", "concentration at which the bacterial growth was inhibited. The average of three values was calculated and that was the MIC for the test material and bacterial strain.", "For the agar plate count method [27] , 25 mL aliquots of bacteria at 1610 5 CFU/ml in SPB containing 0.03% LB broth were incubated with 25 mL of diluted compounds for 2 h at 37uC. The mixtures of bacteria and compounds were serially diluted 10-fold with SPB and plated on LB plates that were incubated at 37uC overnight. Bacterial colonies were enumerated the following day.", "After having determined the MICs, bacterial strains from the wells of the microtitre plate with no visible bacterial growth were removed for serial sub cultivation of 2 ml into another new microtitre plate containing 100 ml of broth per well and further incubated for 24 h. The lowest concentration with no visible growth was defined as MBC [28], indicating 99.5% killing of the original inoculum. The absorbance of each well was measured at a wavelength of 620 nm by Microplate Manager 4.0 (Bio-Rad laboratories) and compared with a blank. Solvent (DMSO) was used as a negative control. Three replicates were done for each compound and experiment was repeated two times.", "Bacteria use their cysteine proteases for pathogenecity as could be depicted from the structure of Cif homolog in Burkholderia pseudomallei (CHBP) which reveals a papain-like fold and a conserved Cys-His-Gln catalytic triad [29] . It has been proven that bacterial pathogens have a unique papain-like hydrolytic activity to block the normal host cell cycle progression as the core of an avirulence (Avr) protein (AvrPphB) from the plant pathogen Pseudomonas syringae, resembles the papain-like cysteine proteases. The similarity of this AvrPphB protein with papain includes the catalytic triad of Cys-98, His-212, and Asp-227 in the AvrPphB active site [30] .", "Turk et al. have proposed, on the basis of kinetic and structural studies, that papain has seven subsites at the active site but only five subsites are important which can bind to an amino acid residue of the substrate [31] . A variety of intermediates are generated when papain reacts with substrate or an inhibitor [2] . Like serine proteases, cysteine proteases tend to have relatively shallow, solvent-exposed active sites that can accommodate short substrate/inhibitor segments of protein loops (e.g. from endogenous inhibitors such as cystatins) or strands. The inhibitor Table 3 . Name, Structure, IC50 & K i of 1-substituted pyridylimidazo[1,5-a]pyridine derivatives against cysteine protease papain.\n\nType of inhibition Ki (mM) IC 50 (mM)", "Non-Competitive 13.7 13.4 compound bound to protease with a combination of hydrogen bonds and hydrophobic interactions. As a part of our investigation in developing novel and efficient cysteine protease inhibitors, ten 1-substituted pyridylimidazo [1,5a] pyridine derivatives (3a-j) were primarily designed and screened on the basis of their docking energies against papain to elucidate their possible mode of action. It was found that these compounds were specific inhibitors of cysteine protease, papain and didn't show inhibition against other types of proteases like serine, aspartic or metalloproteases. They are specific for CA clan of cysteine protease and didn't show any significant inhibition against other clans of cysteine proteases.", "These new compounds were devised based on the knowledge of ability of a protein to alter its conformation to accommodate a binding ligand and enabled us to directly compare the relative positions of the residue in the binding pocket. Molecular docking study provided the structural insight into the binding of these compounds (3a-j) (Figure 1 ) within the active site of papain which mainly consist of a catalytic triad of Cys 25, His 159 and Asp 175 [32] . Moreover, role of other residues present in the active site of papain, playing important role in the accommodation of compounds have also been revealed. Initially, docking was performed with all the designed compounds (3a-j) against papain, a known cysteine protease enzyme and in this context, we observed very interesting results where our proposed inhibitors (3a-j) take advantage of aromatic and hydrophilic residues by making a variety of interactions with target enzyme. Although, compounds 3e-j gave significant results when docked", "with papain but during evaluation of antibacterial properties in wet lab experiments, they gave insignificant results (data not shown). Therefore, only four compounds were considered for discussion and further experiments like kinetic and thermodynamic studies to characterize these compounds as potent pro-inhibitors, were performed (3a-d).", "The findings of the above study have shown that the molecular interactions between the compounds 3a-d and papain were very similar to the interactions observed for E-64c, a derivative of naturally occurring epoxide inhibitor (E-64c) (Figure 1 ) of cysteine proteases [31, 32] , with papain; especially with regard to the hydrogen bonding and hydrophobic interactions of the ligands with conserved residues in the catalytic binding site (Figure 2 A-D). Several papain residues participated in hydrophobic interactions with compounds 3a-d, including Gln19, Cys25, Gly66 and Asp158. The pyridine moieties of compounds 3a-d interact with S2 site of papain which includes (Tyr61, Asn64, Gly65 & Tyr67) amino acids (Figure 2 A-D) . The active site residues that were found to be key player in the interaction of compounds within the active site (mostly through hydrophobic interactions) were Cys25, Tyr61, His159 and Trp177, while Trp177, Gln19 were found to me making hydrogen bonds only with compound", "3a. Besides this many other residues were also found to be actively involved ( Table 1) . Furthermore, the binding energies for the compound 3a, 3b, 3c and 3d with papain were found to be 26.12, 25.76, 26.84 and 25.62 Kcal/mol respectively, which were in great agreement with our wet lab experiments; shall be discussed later ( Table 1) . This confirmed the accuracy of our docking protocol. Since, the binding energy is a direct measure of strength of interaction and our compounds 3a-d showed stronger binding within the active site of papain in comparison to the inhibitor E-64c (DG: 24.04 Kcal/mol), therefore, the results suggest that these 1-substituted pyridylimidazo[1,5-a]pyridine derivatives (3ad) could be potent inhibitors of papain like cysteine proteases.", "The in silico interaction of compounds 3a-d with papain, which were observed as discussed above, was validated with wet lab Table 5 . Prediction of antibacterial compounds as drugs (http://www.organic-chemistry.org). Table 2) . Interestingly, the observed in silico binding energies for the compounds 3a-d against papain were found to be in great agreement (standard error 62 Kcal/mol) with the value of free energy of binding (DG) observed during thermodynamics studies ( Table 1 and 2) . Similarly, enthalpy change (DH) of the binding was negative whereas entropy (DS) change of the binding was positive which indicated the exothermic and entropically driven nature of binding. This pattern of temperature dependence is characteristic of hydrophobic interaction [33] . As discussed earlier that all the compounds (3a-d) were found to interact with the active site residues of papain through hydrophobic interactions at most instances during in silico studies, the same was observed by the analysis", "of Van't Hoff plots for all the proposed inhibitors at three different temperatures (32uC, 37uC and 42uC) in wet lab experiments ( Figure 3) . This proves the importance of these types of interactions in the positioning of compounds within the active site. Hence, thermodynamics as well as in silico study reveals that hydrophobic interactions favor binding of these proposed inhibitors with papain like cysteine proteases. Further wet lab results proposed the non competitive interaction of compounds (3a, 3c & 3d) with papain except for compound 3b which showed competitive interaction. In sum up, the above results of molecular docking studies and thermodynamic analysis of compounds 3a-d with papain showed that these compounds have the potential to be novel and unique cysteine protease inhibitors.", "In the current study, the cysteine protease inhibitory activity of synthesized derivatives of 1-substituted pyridylimidazo[1,5-a] pyridine (3a-d)) was also performed against papain and the inhibition constants (K i ) for the above said enzyme were observed to be 13.70, 23.20, 90.00 and 99.30 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Furthermore, the calculated IC 50 values were also found to be 13.40, 21.17, 94.50 and 96.50 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Except compound 3b, rest of the compounds showed non competitive, reversible inhibitions but all the compounds irrespective of types of binding, showed hydrophobic and entropically driven interaction. These derivatives (3a-j) were eventually evaluated for their antibacterial activities against seven clinically important microbes (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii). Here, we are showing the data of only four compounds", "(3a-d) because of their significant results ( Table 4 ). All the compounds strictly followed the pattern of antiprotease activity towards bacterial growth except P. vulgaris and E. coli at one instance each (Table 4) . Since compound 3c & 3d do not have much difference in their IC50 values (3c-94.5 mM and 3d-96.5 mM) against cysteine protease, papain and hence in antibacterial activity in all instances except one. It might be random due to so close in IC50 values. Compounds 3c & 3d are having much difference in their IC50 values (3b-21.17 mM and 3c-94.5 mM) and they showed exact pattern for their antibacterial activity for all microbes except for E. coli at one instance. Although, E. coli does contain six major cysteine proteases but none belong to the CA clan of papain. It is argued that these compounds also inhibited the cysteine proteases of other clan than papain but with low efficacy.", "Since, pyridylimidazo[1,5-a]pyridine derivatives is absolutely new scaffold towards antibacterial agents and hence, not any standard compound(s) of same scaffold is available for reference. So, Clotrimazole (1-[(2-chlorophenyl)(diphenyl)methyl]-1H-imidazole), an imidazole derivatives and Ceftriaxone (third-generation cephalosporin antibiotic with broad spectrum activity against Gram-positive and Gram-negative bacteria) have been used as positive control whereas DMSO has been used as negative control. All the above mentioned bacterial species have been shown to secrete certain cysteine proteases which play very important role in the pathogenecity of different diseases caused by these microorganisms. The minimum inhibitory concentration (MICs) of compounds (3a-d) ( Table 4 ) against all tested bacteria except E. coli and P. vulgaris, were observed to be in great agreement with their respective inhibition constant (K i )/IC 50 values against papain (Table 3 ) which clearly indicates that", "these compounds have the potential to inhibit the papain like cysteine proteases of these pathogens. The partition coefficient (logP) is a well-established measure of the compound's lipophilicity. The distribution of calculated logP (cLogP) values of a majority of drugs in the market is in the range of zero to five. All the compounds studied except 3d, showed good agreement with the criteria laid down for the prediction of a compound to be a potential drug ( Table 5 ). All the compounds do not show any threat against toxicity risk assessment except compound 3d which showed threat as tumorogenic effect due to the presence of isobutyl group. Among all the tested compounds, compound 3a was the most potent whose MIC was the lowest among all the tested compounds and showed maximum drug score and positive values for drug likeness.", "In summary, the results of the present study have established that 1-substituted pyridylimidazo[1,5-a]pyridine derivatives could be candidate for novel and potent inhibitors of papain like cysteine proteases, which play deleterious role in the progression of different diseases caused by diverse microorganisms. Therefore, this group of compounds could be the subject of future research to confront the challenges with resistant microorganisms that is a major threat globally.\n\nFile S1 Types of inhibitions with Ki (Compounds 3a-3d).\n\n(DOC)" ]
[ 10 ]
3,444
5,218
1,565
What could be novel candidates as potent inhibitors of papain like cysteine proteases in resistant microorganisms?
3,044
[ "1-substituted pyridylimidazo[1,5-a]pyridine derivatives" ]
[ "Design, Synthesis, Evaluation and Thermodynamics of 1-Substituted Pyridylimidazo[1,5-a]Pyridine Derivatives as Cysteine Protease Inhibitors\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3734177/\n\nSHA: ee8483f8f2cc5fe38be4e565eae3af9d0bb8220b\n\nAuthors: Khan, Mohd Sajid; Baig, Mohd Hassan; Ahmad, Saheem; Siddiqui, Shapi Ahmad; Srivastava, Ashwini Kumar; Srinivasan, Kumar Venkatraman; Ansari, Irfan A.\nDate: 2013-08-05\nDOI: 10.1371/journal.pone.0069982\nLicense: cc-by", "Abstract: Targeting papain family cysteine proteases is one of the novel strategies in the development of chemotherapy for a number of diseases. Novel cysteine protease inhibitors derived from 1-pyridylimidazo[1,5-a]pyridine representing pharmacologically important class of compounds are being reported here for the first time. The derivatives were initially designed and screened in silico by molecular docking studies against papain to explore the possible mode of action. The molecular interaction between the compounds and cysteine protease (papain) was found to be very similar to the interactions observed with the respective epoxide inhibitor (E-64c) of papain. Subsequently, compounds were synthesized to validate their efficacy in wet lab experiments. When characterized kinetically, these compounds show their K(i) and IC(50) values in the range of 13.75 to 99.30 µM and 13.40 to 96.50 µM, respectively. The thermodynamics studies suggest their binding with papain hydrophobically and", "entropically driven. These inhibitors also inhibit the growth of clinically important different types of Gram positive and Gram negative bacteria having MIC(50) values in the range of 0.6–1.4 µg/ml. Based on Lipinski’s rule of Five, we also propose these compounds as potent antibacterial prodrugs. The most active antibacterial compound was found to be 1-(2-pyridyl)-3-(2-hydroxyphenyl)imidazo[1,5-a]pyridine (3a).", "Text: Cysteine-protease inhibitors (CPI) have gained considerable attention over the last couple of decades and many classes of compounds are currently in human clinical trials for a number of diseases. Interest in papain family cysteine proteases as chemotherapeutic targets is derived from the recognition that they are critical to the life cycle or pathogenicity of many microorganisms. The cysteine proteases from Streptococcus sp. (streptopain) [1] , Staphylococcus sp. (staphopain) [2] , Plasmodium falciparum (falcipain-1, -2, and -3) and Trypanosoma cruzi (cruzipain) [3] are some of the most widely studied members of papain family which have been reported to be linked with severity of infection and various pathological conditions caused by these microorganisms.", "The activation of the kallikrein-kinin pathway, which could be activated by more than sixteen bacterial proteases, is a mechanism that some pathogens exploit to ensure that there is a supply of nutrients to the site of infection by increasing vascular permeability. This has been shown to occur in infections with several microbial species, including Pseudomonas, Serratia, Clostridium, Candida, Bacteroides, Porphyromonas and Staphylococcus sp. [4] . Many bacteria secrete several nonspecific proteases e.g. Pseudomonas, Serratia, Streptococcus, Staphylococcus and Bacteroides sp. have potent metallo-, cysteine and serine proteases with broad ranges of activities [5] . The critical role of bacterial proteases in virulence was successfully demonstrated by eliminating the proteaseencoding gene in P. gingivalis [6] .", "Recently described cystatin superfamily of proteins comprises both eukaryotic and prokaryotic cysteine protease inhibitors [7] . Human cystatins C, D and S, rat cystatins A and S, chicken cystatin and oryza cystatin have been reported to inhibit the replication of certain viruses and bacteria [8] although it has not yet been directly demonstrated that these effects are due to the protease inhibitory capacity of the cystatins [9] . The key role of cysteine proteases in microbial infections, coupled with the relative lack of redundancy compared to mammalian systems has made microbial proteases attractive targets for the development of novel chemotherapeutic approaches [10, 11] .", "Imidazopyridine ring systems represent an important class of compounds not only for their theoretical interest but also from a pharmacological point of view. They have been shown to possess a broad range of useful pharmacological activities [12] including antigastric, antisecretory, local anesthetic, antiviral, antianxiety, antibacterial, antifungal, antihelminthic, antiprotozoal, anticonvulsant, gastrointestinal, antiulcer (Zolmidine), anxiolytic (Alpidem), hypnotic (Zolpidem) and immunomodulatory [13] . The nature and the position of the substituents on the pyridinic moiety influence these pharmacological activities. These imidazopyridine heterocyclic structures form part of the skeleton of natural alkaloids, neuromuscular blocking agents [14] , reversible inhibitors of the H + , K + -ATPase enzymes with a potent antisecretory activity, and are known to be sedative hypnotics of the nervous system [15] . In this study, we have proposed kinetically and thermodynamically characterized", "1-substituted pyridylimidazo[1,5-a]pyridine derivatives as a potent and novel cysteine protease inhibitors which also acts as antibacterial agents.", "The crystal structure of papain was extracted from Protein Data Bank (PDB code: 1PE6) [16] . All the water molecules and heteroatoms were removed and hydrogen atoms were added to the protein. CharMm forcefield [17] was applied and the structure was subjected to energy minimization for 1000 steps using steepest descent method. The chemical structures of all the synthesized compounds were generated using chemdraw and were subsequently converted into 3D format using CORINA. A series of docking experiments were carried out with all the designed 1substituted pyridylimidazo[1,5-a]pyridine derivatives against papain using AutoDock Tools 4.0 [18] for possible cysteine-protease inhibitory activities. The compounds were selected on the basis of their binding energies and those reflecting good binding affinity were further analyzed on in silico platform. As a parameter for the molecular docking, the Lamarckian genetic algorithm, a combination between the genetic algorithm and the local search", "Pseudo-Solis and Wets algorithm, was employed. A grid box of 60660660 Å was generated around active site of papain making sure those inhibitors can freely rotate inside the grid. The number of docking runs was set to 10. Each docking was repeated five times, having in the end a total of 50 docking runs, to check the precision of results. The finally obtained docked complexes were subsequently visualized using PyMol [19] . The work was further authenticated in the wet lab after its detailed analysis on in silico platform.", "The designed derivatives were filtered by Lipinski's ''Rule of five'' that sets the criteria for drug-like properties. Drug likeness is a property that is most often used to characterize novel lead compounds [20] . According to this rule, poor absorption is expected if MW .500, log P.5, hydrogen bond donors .5, and hydrogen bond acceptors .10 [21] . In silico absorption, distribution, metabolism and excretion (ADME) properties of these derivatives were also predicted using following online bioinformatics tools.\n\nN http://www.organic-chemistry.org. N http://mobyle.rpbs.univ-paris-diderot.fr/cgi-bin/portal. py? Form = admetox N https://secure.chemsilico.com/pages/submit.php\n\nThe above study gave us an idea about the existence of possible mutagenic and tumorigenic properties in synthesized compounds. The result obtained helped us to screen out the synthesized compounds for their further usage as potent leads.", "Based on the results of docking studies, ten derivatives of 1pyridylimidazo[1,5-a]pyridine were synthesized according to Siddiqui et al., 2006 [22] which are named as follows: 1-", "The capacity of the 1-pyridylimidazo[1,5-a]pyridine derivatives to inhibit cysteine proteases was tested using papain as the model enzyme. The proteolytic activity of the reaction mixtures was determined using Bz-DL-Arg-pNA as the chromogenic substrate [23] . To solutions of active papain (final concentration: 0.05 mM) were added concentrated solutions of the different derivatives to final concentrations of 0.2 mM. After incubation for 30 min at 37uC, the substrate solution was added and after a further incubation for 20 min the reaction was stopped by the addition of 5% trichloric acid (TCA) acidified with 2.25% HCl and the absorbance of the reaction mixture was determined at a wavelength of 410 nm by Microplate Manager 4.0 (Bio-Rad laboratories). The same procedure was used at 32uC and 42uC for thermodynamics studies. The kinetic parameters for the substrate hydrolysis were determined by measuring the initial rate of enzymatic activity. The inhibition constant K i was determined by", "Dixon method [24] and also by the Lineweaver-Burk equation. The K m value was calculated from the double-reciprocal equation by fitting the data into the computer software Origin 6.1. The Lineweaver-Burk plot was used to determine the types of inhibition. For the kinetic analysis and rate constant determinations, the assays were carried out in triplicate, and the average value was considered throughout this work. Temperature dependence of the inhibition constants was used to determine the thermodynamic parameters. Changes in enthalpy (DH) were determined from the Van't Hoff plots by using the equation,", "Where DH is enthalpy change, R is gas constant, DS is entropy change and T is the absolute temperature. The entropy change was obtained from the equation,\n\nThe assay was done at different temperatures (32uC, 37uC, 42uC) calculating various K i of 1-pyridylimidazo[1,5-a]pyridine derivatives with papain as model enzyme.", "The disk diffusion method [25] was used for the preliminary antibacterial evaluation of 1-pyridylimidazo[1,5-a]pyridine derivatives. The MIC 50 of these derivatives, showing inhibition in the preliminary tests, were further determined by the microtitre plate technique using micro dilution method [26] . In brief, the bacterial strains (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii)) were grown and diluted to 2610 5 colony-forming units (CFU)/ml in sodium phosphate buffer (SPB) containing 0.03% Luria-Bertani (LB) broth. The synthesized derivatives were dissolved in DMSO and their serial dilution was performed in 50 mL of LB medium in 96-well microtitre plate to achieve the required concentrations (0.1-10 mg/ml) with bacterial inoculums (5610 4 CFU per well). DMSO was taken as negative control and Ceftriaxone and clotrimazole were taken as positive control. After incubation at 37uC overnight, the MICs were taken as the lowest inhibitor", "concentration at which the bacterial growth was inhibited. The average of three values was calculated and that was the MIC for the test material and bacterial strain.", "For the agar plate count method [27] , 25 mL aliquots of bacteria at 1610 5 CFU/ml in SPB containing 0.03% LB broth were incubated with 25 mL of diluted compounds for 2 h at 37uC. The mixtures of bacteria and compounds were serially diluted 10-fold with SPB and plated on LB plates that were incubated at 37uC overnight. Bacterial colonies were enumerated the following day.", "After having determined the MICs, bacterial strains from the wells of the microtitre plate with no visible bacterial growth were removed for serial sub cultivation of 2 ml into another new microtitre plate containing 100 ml of broth per well and further incubated for 24 h. The lowest concentration with no visible growth was defined as MBC [28], indicating 99.5% killing of the original inoculum. The absorbance of each well was measured at a wavelength of 620 nm by Microplate Manager 4.0 (Bio-Rad laboratories) and compared with a blank. Solvent (DMSO) was used as a negative control. Three replicates were done for each compound and experiment was repeated two times.", "Bacteria use their cysteine proteases for pathogenecity as could be depicted from the structure of Cif homolog in Burkholderia pseudomallei (CHBP) which reveals a papain-like fold and a conserved Cys-His-Gln catalytic triad [29] . It has been proven that bacterial pathogens have a unique papain-like hydrolytic activity to block the normal host cell cycle progression as the core of an avirulence (Avr) protein (AvrPphB) from the plant pathogen Pseudomonas syringae, resembles the papain-like cysteine proteases. The similarity of this AvrPphB protein with papain includes the catalytic triad of Cys-98, His-212, and Asp-227 in the AvrPphB active site [30] .", "Turk et al. have proposed, on the basis of kinetic and structural studies, that papain has seven subsites at the active site but only five subsites are important which can bind to an amino acid residue of the substrate [31] . A variety of intermediates are generated when papain reacts with substrate or an inhibitor [2] . Like serine proteases, cysteine proteases tend to have relatively shallow, solvent-exposed active sites that can accommodate short substrate/inhibitor segments of protein loops (e.g. from endogenous inhibitors such as cystatins) or strands. The inhibitor Table 3 . Name, Structure, IC50 & K i of 1-substituted pyridylimidazo[1,5-a]pyridine derivatives against cysteine protease papain.\n\nType of inhibition Ki (mM) IC 50 (mM)", "Non-Competitive 13.7 13.4 compound bound to protease with a combination of hydrogen bonds and hydrophobic interactions. As a part of our investigation in developing novel and efficient cysteine protease inhibitors, ten 1-substituted pyridylimidazo [1,5a] pyridine derivatives (3a-j) were primarily designed and screened on the basis of their docking energies against papain to elucidate their possible mode of action. It was found that these compounds were specific inhibitors of cysteine protease, papain and didn't show inhibition against other types of proteases like serine, aspartic or metalloproteases. They are specific for CA clan of cysteine protease and didn't show any significant inhibition against other clans of cysteine proteases.", "These new compounds were devised based on the knowledge of ability of a protein to alter its conformation to accommodate a binding ligand and enabled us to directly compare the relative positions of the residue in the binding pocket. Molecular docking study provided the structural insight into the binding of these compounds (3a-j) (Figure 1 ) within the active site of papain which mainly consist of a catalytic triad of Cys 25, His 159 and Asp 175 [32] . Moreover, role of other residues present in the active site of papain, playing important role in the accommodation of compounds have also been revealed. Initially, docking was performed with all the designed compounds (3a-j) against papain, a known cysteine protease enzyme and in this context, we observed very interesting results where our proposed inhibitors (3a-j) take advantage of aromatic and hydrophilic residues by making a variety of interactions with target enzyme. Although, compounds 3e-j gave significant results when docked", "with papain but during evaluation of antibacterial properties in wet lab experiments, they gave insignificant results (data not shown). Therefore, only four compounds were considered for discussion and further experiments like kinetic and thermodynamic studies to characterize these compounds as potent pro-inhibitors, were performed (3a-d).", "The findings of the above study have shown that the molecular interactions between the compounds 3a-d and papain were very similar to the interactions observed for E-64c, a derivative of naturally occurring epoxide inhibitor (E-64c) (Figure 1 ) of cysteine proteases [31, 32] , with papain; especially with regard to the hydrogen bonding and hydrophobic interactions of the ligands with conserved residues in the catalytic binding site (Figure 2 A-D). Several papain residues participated in hydrophobic interactions with compounds 3a-d, including Gln19, Cys25, Gly66 and Asp158. The pyridine moieties of compounds 3a-d interact with S2 site of papain which includes (Tyr61, Asn64, Gly65 & Tyr67) amino acids (Figure 2 A-D) . The active site residues that were found to be key player in the interaction of compounds within the active site (mostly through hydrophobic interactions) were Cys25, Tyr61, His159 and Trp177, while Trp177, Gln19 were found to me making hydrogen bonds only with compound", "3a. Besides this many other residues were also found to be actively involved ( Table 1) . Furthermore, the binding energies for the compound 3a, 3b, 3c and 3d with papain were found to be 26.12, 25.76, 26.84 and 25.62 Kcal/mol respectively, which were in great agreement with our wet lab experiments; shall be discussed later ( Table 1) . This confirmed the accuracy of our docking protocol. Since, the binding energy is a direct measure of strength of interaction and our compounds 3a-d showed stronger binding within the active site of papain in comparison to the inhibitor E-64c (DG: 24.04 Kcal/mol), therefore, the results suggest that these 1-substituted pyridylimidazo[1,5-a]pyridine derivatives (3ad) could be potent inhibitors of papain like cysteine proteases.", "The in silico interaction of compounds 3a-d with papain, which were observed as discussed above, was validated with wet lab Table 5 . Prediction of antibacterial compounds as drugs (http://www.organic-chemistry.org). Table 2) . Interestingly, the observed in silico binding energies for the compounds 3a-d against papain were found to be in great agreement (standard error 62 Kcal/mol) with the value of free energy of binding (DG) observed during thermodynamics studies ( Table 1 and 2) . Similarly, enthalpy change (DH) of the binding was negative whereas entropy (DS) change of the binding was positive which indicated the exothermic and entropically driven nature of binding. This pattern of temperature dependence is characteristic of hydrophobic interaction [33] . As discussed earlier that all the compounds (3a-d) were found to interact with the active site residues of papain through hydrophobic interactions at most instances during in silico studies, the same was observed by the analysis", "of Van't Hoff plots for all the proposed inhibitors at three different temperatures (32uC, 37uC and 42uC) in wet lab experiments ( Figure 3) . This proves the importance of these types of interactions in the positioning of compounds within the active site. Hence, thermodynamics as well as in silico study reveals that hydrophobic interactions favor binding of these proposed inhibitors with papain like cysteine proteases. Further wet lab results proposed the non competitive interaction of compounds (3a, 3c & 3d) with papain except for compound 3b which showed competitive interaction. In sum up, the above results of molecular docking studies and thermodynamic analysis of compounds 3a-d with papain showed that these compounds have the potential to be novel and unique cysteine protease inhibitors.", "In the current study, the cysteine protease inhibitory activity of synthesized derivatives of 1-substituted pyridylimidazo[1,5-a] pyridine (3a-d)) was also performed against papain and the inhibition constants (K i ) for the above said enzyme were observed to be 13.70, 23.20, 90.00 and 99.30 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Furthermore, the calculated IC 50 values were also found to be 13.40, 21.17, 94.50 and 96.50 mM for compounds 3a, 3b, 3c and 3d respectively ( Table 3) . Except compound 3b, rest of the compounds showed non competitive, reversible inhibitions but all the compounds irrespective of types of binding, showed hydrophobic and entropically driven interaction. These derivatives (3a-j) were eventually evaluated for their antibacterial activities against seven clinically important microbes (S. aureus, P. vulgaris, Group D Streptococci, Bacillus sp., E. coli, P. aeruginosa and S. morganii). Here, we are showing the data of only four compounds", "(3a-d) because of their significant results ( Table 4 ). All the compounds strictly followed the pattern of antiprotease activity towards bacterial growth except P. vulgaris and E. coli at one instance each (Table 4) . Since compound 3c & 3d do not have much difference in their IC50 values (3c-94.5 mM and 3d-96.5 mM) against cysteine protease, papain and hence in antibacterial activity in all instances except one. It might be random due to so close in IC50 values. Compounds 3c & 3d are having much difference in their IC50 values (3b-21.17 mM and 3c-94.5 mM) and they showed exact pattern for their antibacterial activity for all microbes except for E. coli at one instance. Although, E. coli does contain six major cysteine proteases but none belong to the CA clan of papain. It is argued that these compounds also inhibited the cysteine proteases of other clan than papain but with low efficacy.", "Since, pyridylimidazo[1,5-a]pyridine derivatives is absolutely new scaffold towards antibacterial agents and hence, not any standard compound(s) of same scaffold is available for reference. So, Clotrimazole (1-[(2-chlorophenyl)(diphenyl)methyl]-1H-imidazole), an imidazole derivatives and Ceftriaxone (third-generation cephalosporin antibiotic with broad spectrum activity against Gram-positive and Gram-negative bacteria) have been used as positive control whereas DMSO has been used as negative control. All the above mentioned bacterial species have been shown to secrete certain cysteine proteases which play very important role in the pathogenecity of different diseases caused by these microorganisms. The minimum inhibitory concentration (MICs) of compounds (3a-d) ( Table 4 ) against all tested bacteria except E. coli and P. vulgaris, were observed to be in great agreement with their respective inhibition constant (K i )/IC 50 values against papain (Table 3 ) which clearly indicates that", "these compounds have the potential to inhibit the papain like cysteine proteases of these pathogens. The partition coefficient (logP) is a well-established measure of the compound's lipophilicity. The distribution of calculated logP (cLogP) values of a majority of drugs in the market is in the range of zero to five. All the compounds studied except 3d, showed good agreement with the criteria laid down for the prediction of a compound to be a potential drug ( Table 5 ). All the compounds do not show any threat against toxicity risk assessment except compound 3d which showed threat as tumorogenic effect due to the presence of isobutyl group. Among all the tested compounds, compound 3a was the most potent whose MIC was the lowest among all the tested compounds and showed maximum drug score and positive values for drug likeness.", "In summary, the results of the present study have established that 1-substituted pyridylimidazo[1,5-a]pyridine derivatives could be candidate for novel and potent inhibitors of papain like cysteine proteases, which play deleterious role in the progression of different diseases caused by diverse microorganisms. Therefore, this group of compounds could be the subject of future research to confront the challenges with resistant microorganisms that is a major threat globally.\n\nFile S1 Types of inhibitions with Ki (Compounds 3a-3d).\n\n(DOC)" ]
[ 7 ]
3,444
5,218
1,547
How long is the SAIBK gene?
1,622
[ "27,534 nucleotides" ]
[ "Complete Genome Sequence of a Nephropathogenic Infectious Bronchitis Virus Strain Isolated in China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3795213/\n\nSHA: f2df4fc3c60338755fd23da3d7e01c0455e20745\n\nAuthors: Yang, Jing-tian; Ma, Bing-cun\nDate: 2013-10-10\nDOI: 10.1128/genomea.00815-13\nLicense: cc-by\n\nAbstract: Infectious bronchitis virus (IBV) causes tremendous economic losses to the poultry industry. Here, we report the complete genome analysis results for a new natural recombination nephropathogenic IBV strain named SAIBK, which was isolated in the Sichuan province of China in 2005.", "Text: tagious and acute disease in domestic chickens, belongs to group III of the genus Coronavirus in the family Coronaviridae (1) . It is an enveloped, unsegmented, positive-sense, single-stranded RNA (ssRNA) virus and has a genome of approximately 27.6 kb (2) . Recently, many epidemiological analysis reports have suggested that nephropathogenic IBVs have become increasingly prevalent (3) (4) (5) (6) in China. In this work, the complete genome sequence of an isolate named SAIBK was analyzed and recombination was detected between SAIBK and some previously reported IBVs.", "A rapid amplification of cDNA ends (RACE) kit (TaKaRa, Japan) was used to obtain the 5= and 3= ends of the genome. Other parts were amplified by 19 primers with overlap between each fragment and were cloned into the pMD19-T vector (TaKaRa, Japan). All fragments were sequenced three times by Sangon Biotech (Shanghai, China). The sequenced fragments were assembled using the SeqMan software program (DNAStar, Inc.). Sequence alignment was conducted and a phylogenetic tree was constructed using the software program MEGA5 (7). Recombination analysis was performed using the RDP 4.14 (8) and SimPlot 3.5.1 (9) software programs.\n\nThe complete genome of the SAIBK strain is 27,534 nucleotides (nt) in length, including the poly(A) tail. It has a classical IBV genome organization with 10 open reading frames (ORFs):", "The genome sequence of SAIBK shows the highest identity (94.3%) to the Chinese IBV strain SC021202 (GenBank accession no. EU714029) and the lowest identity (85.8%) to two Chinese IBV strains, BJ (GenBank accession no. AY319651) and DY07 (GenBank accession no. HM245923). It has lower nucleotide identities of 88.1%, 87.9%, and 87.7% to the most popularly used IBV vaccine strains, H120, H52, and M41, respectively.\n\nPhylogenetic analysis of the complete genome results indicated that the SAIBK strain clusters into the same branch as the IBV YN strain (GenBank accession no. JF893452) and the SC021202 strain (GenBank accession no. EU714029). The S1 subunit of the IBV genome is the major determinant of serotype (10) (11) (12) (13) , and S1 analysis indicated that the SAIBK strain has a 4/91-like serotype.", "The employed recombination detection methods revealed that SAIBK is a chimera virus, with recombination by the SC021202 strain as a major parent and the H120 vaccine strain as a minor parent. The first and second recombination regions were located at positions 7231 to 9126 and 13437 to 14473 in genes 1a and 1b, respectively. There were two other recombination regions detected at positions 951 to 1067 and 5393 to 5605 of SAIBK, which were recombined with the SC021202 strain as a major parent and the H52 vaccine strain as a minor parent. The recombination detection results suggested that SAIBK is possibly a chimera virus derived from the popularly used vaccine strains H120 and H52 and the field strain SC021202, and the SC021202 strain was isolated from chickens vaccinated with H120 in the Sichuan province of China in 2003 (14) . This result revealed that the field IBVs in Sichuan Province have undergone genetic recombination and are possibly emerging as new mutant strains, such as", "SAIBK.", "Nucleotide sequence accession number. The complete genome sequence of the SAIBK isolate was submitted to GenBank and assigned the accession no. DQ288927." ]
[ 2 ]
584
1,015
1,547
How many open reading frames are in the SAIBK gene?
1,623
[ "10" ]
[ "Complete Genome Sequence of a Nephropathogenic Infectious Bronchitis Virus Strain Isolated in China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3795213/\n\nSHA: f2df4fc3c60338755fd23da3d7e01c0455e20745\n\nAuthors: Yang, Jing-tian; Ma, Bing-cun\nDate: 2013-10-10\nDOI: 10.1128/genomea.00815-13\nLicense: cc-by\n\nAbstract: Infectious bronchitis virus (IBV) causes tremendous economic losses to the poultry industry. Here, we report the complete genome analysis results for a new natural recombination nephropathogenic IBV strain named SAIBK, which was isolated in the Sichuan province of China in 2005.", "Text: tagious and acute disease in domestic chickens, belongs to group III of the genus Coronavirus in the family Coronaviridae (1) . It is an enveloped, unsegmented, positive-sense, single-stranded RNA (ssRNA) virus and has a genome of approximately 27.6 kb (2) . Recently, many epidemiological analysis reports have suggested that nephropathogenic IBVs have become increasingly prevalent (3) (4) (5) (6) in China. In this work, the complete genome sequence of an isolate named SAIBK was analyzed and recombination was detected between SAIBK and some previously reported IBVs.", "A rapid amplification of cDNA ends (RACE) kit (TaKaRa, Japan) was used to obtain the 5= and 3= ends of the genome. Other parts were amplified by 19 primers with overlap between each fragment and were cloned into the pMD19-T vector (TaKaRa, Japan). All fragments were sequenced three times by Sangon Biotech (Shanghai, China). The sequenced fragments were assembled using the SeqMan software program (DNAStar, Inc.). Sequence alignment was conducted and a phylogenetic tree was constructed using the software program MEGA5 (7). Recombination analysis was performed using the RDP 4.14 (8) and SimPlot 3.5.1 (9) software programs.\n\nThe complete genome of the SAIBK strain is 27,534 nucleotides (nt) in length, including the poly(A) tail. It has a classical IBV genome organization with 10 open reading frames (ORFs):", "The genome sequence of SAIBK shows the highest identity (94.3%) to the Chinese IBV strain SC021202 (GenBank accession no. EU714029) and the lowest identity (85.8%) to two Chinese IBV strains, BJ (GenBank accession no. AY319651) and DY07 (GenBank accession no. HM245923). It has lower nucleotide identities of 88.1%, 87.9%, and 87.7% to the most popularly used IBV vaccine strains, H120, H52, and M41, respectively.\n\nPhylogenetic analysis of the complete genome results indicated that the SAIBK strain clusters into the same branch as the IBV YN strain (GenBank accession no. JF893452) and the SC021202 strain (GenBank accession no. EU714029). The S1 subunit of the IBV genome is the major determinant of serotype (10) (11) (12) (13) , and S1 analysis indicated that the SAIBK strain has a 4/91-like serotype.", "The employed recombination detection methods revealed that SAIBK is a chimera virus, with recombination by the SC021202 strain as a major parent and the H120 vaccine strain as a minor parent. The first and second recombination regions were located at positions 7231 to 9126 and 13437 to 14473 in genes 1a and 1b, respectively. There were two other recombination regions detected at positions 951 to 1067 and 5393 to 5605 of SAIBK, which were recombined with the SC021202 strain as a major parent and the H52 vaccine strain as a minor parent. The recombination detection results suggested that SAIBK is possibly a chimera virus derived from the popularly used vaccine strains H120 and H52 and the field strain SC021202, and the SC021202 strain was isolated from chickens vaccinated with H120 in the Sichuan province of China in 2003 (14) . This result revealed that the field IBVs in Sichuan Province have undergone genetic recombination and are possibly emerging as new mutant strains, such as", "SAIBK.", "Nucleotide sequence accession number. The complete genome sequence of the SAIBK isolate was submitted to GenBank and assigned the accession no. DQ288927." ]
[ 0 ]
584
1,015
1,547
What virus has the closest genetic identity with the SAIBK gene?
1,624
[ "Chinese IBV strain SC021202" ]
[ "Complete Genome Sequence of a Nephropathogenic Infectious Bronchitis Virus Strain Isolated in China\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3795213/\n\nSHA: f2df4fc3c60338755fd23da3d7e01c0455e20745\n\nAuthors: Yang, Jing-tian; Ma, Bing-cun\nDate: 2013-10-10\nDOI: 10.1128/genomea.00815-13\nLicense: cc-by\n\nAbstract: Infectious bronchitis virus (IBV) causes tremendous economic losses to the poultry industry. Here, we report the complete genome analysis results for a new natural recombination nephropathogenic IBV strain named SAIBK, which was isolated in the Sichuan province of China in 2005.", "Text: tagious and acute disease in domestic chickens, belongs to group III of the genus Coronavirus in the family Coronaviridae (1) . It is an enveloped, unsegmented, positive-sense, single-stranded RNA (ssRNA) virus and has a genome of approximately 27.6 kb (2) . Recently, many epidemiological analysis reports have suggested that nephropathogenic IBVs have become increasingly prevalent (3) (4) (5) (6) in China. In this work, the complete genome sequence of an isolate named SAIBK was analyzed and recombination was detected between SAIBK and some previously reported IBVs.", "A rapid amplification of cDNA ends (RACE) kit (TaKaRa, Japan) was used to obtain the 5= and 3= ends of the genome. Other parts were amplified by 19 primers with overlap between each fragment and were cloned into the pMD19-T vector (TaKaRa, Japan). All fragments were sequenced three times by Sangon Biotech (Shanghai, China). The sequenced fragments were assembled using the SeqMan software program (DNAStar, Inc.). Sequence alignment was conducted and a phylogenetic tree was constructed using the software program MEGA5 (7). Recombination analysis was performed using the RDP 4.14 (8) and SimPlot 3.5.1 (9) software programs.\n\nThe complete genome of the SAIBK strain is 27,534 nucleotides (nt) in length, including the poly(A) tail. It has a classical IBV genome organization with 10 open reading frames (ORFs):", "The genome sequence of SAIBK shows the highest identity (94.3%) to the Chinese IBV strain SC021202 (GenBank accession no. EU714029) and the lowest identity (85.8%) to two Chinese IBV strains, BJ (GenBank accession no. AY319651) and DY07 (GenBank accession no. HM245923). It has lower nucleotide identities of 88.1%, 87.9%, and 87.7% to the most popularly used IBV vaccine strains, H120, H52, and M41, respectively.\n\nPhylogenetic analysis of the complete genome results indicated that the SAIBK strain clusters into the same branch as the IBV YN strain (GenBank accession no. JF893452) and the SC021202 strain (GenBank accession no. EU714029). The S1 subunit of the IBV genome is the major determinant of serotype (10) (11) (12) (13) , and S1 analysis indicated that the SAIBK strain has a 4/91-like serotype.", "The employed recombination detection methods revealed that SAIBK is a chimera virus, with recombination by the SC021202 strain as a major parent and the H120 vaccine strain as a minor parent. The first and second recombination regions were located at positions 7231 to 9126 and 13437 to 14473 in genes 1a and 1b, respectively. There were two other recombination regions detected at positions 951 to 1067 and 5393 to 5605 of SAIBK, which were recombined with the SC021202 strain as a major parent and the H52 vaccine strain as a minor parent. The recombination detection results suggested that SAIBK is possibly a chimera virus derived from the popularly used vaccine strains H120 and H52 and the field strain SC021202, and the SC021202 strain was isolated from chickens vaccinated with H120 in the Sichuan province of China in 2003 (14) . This result revealed that the field IBVs in Sichuan Province have undergone genetic recombination and are possibly emerging as new mutant strains, such as", "SAIBK.", "Nucleotide sequence accession number. The complete genome sequence of the SAIBK isolate was submitted to GenBank and assigned the accession no. DQ288927." ]
[ 3 ]
584
1,015
187
How many surgical masks or respirators have past studies projected will be required for a pandemic in the United States?
257
[ "an estimated 7.3 billion" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
187
What is the acronym MERS-CoV?
248
[ "Middle East respiratory syndrome coronavirus" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 1 ]
2,853
4,807
187
What are the critical factors that determine the effect of an epidemic?
249
[ "Transmissibility and severity" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 1 ]
2,853
4,807
187
When did the World Health Organization (WHO) officially declare the 2019-nCoV epidemic as a Public Health Emergency of International Concern?
250
[ "January 30, 2020" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 11 ]
2,853
4,807
187
What influenza virus was identified in China in 2013?
251
[ "H7N9" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
187
What past research has been done on severe, single-wave pandemics?
252
[ "After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States." ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
187
What is a clinical attack rate?
253
[ "the proportion of individuals who become ill with or die from a disease in a population initially uninfected" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
187
What was the clinical attack rate in the 2009 H1N1 pandemic?
254
[ "20%" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
187
What is the estimated R0 of COVID-19?
255
[ "2.2" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 10 ]
2,853
4,807
187
How many ventilators have past studies projected will be required for a pandemic in the United States?
1,657
[ "35 000 to 60 000" ]
[ "Preparation for Possible Sustained Transmission of 2019 Novel Coronavirus\nLessons From Previous Epidemics\nhttps://jamanetwork.com/journals/jama/fullarticle/2761285\nFebruary 11, 2020\nDavid L. Swerdlow, MD1; Lyn Finelli, DrPH, MS2\nAuthor Affiliations Article Information\nJAMA. 2020;323(12):1129-1130. doi:10.1001/jama.2020.1960\nCOVID-19 Resource Center\nrelated articles icon Related\nArticles\nauthor interview icon Interviews\nAudio Interview (25:53)\nCOVID-19 Update From China", "Transmissibility and severity are the 2 most critical factors that determine the effect of an epidemic. Neither the 2009 pandemic influenza A(H1N1) virus ([H1N1]pdm09) pandemic or the severe acute respiratory syndrome coronavirus (SARS-CoV) or the Middle East respiratory syndrome coronavirus (MERS-CoV) epidemics had the combination of both high transmissibility and severity. Control strategies are driven by this combination. R0, the basic reproduction number, is a commonly used measure of transmissibility and is defined as the number of additional persons one case infects over the course of their illness. An R0 of less than 1 indicates the infection will die out “eventually.” An R0 of greater than 1 indicates the infection has the potential for sustained transmission.", "For example, influenza A(H1N1)pdm09, first identified in southern California on April 15, 2009, was highly transmissible. By May 5, 2009, influenza A(H1N1)pdm09 had spread to 41 US states and 21 countries.1 While influenza A(H1N1)pdm09 was highly transmissible, it was not severe. Initial estimates of the R0 of influenza A(H1N1)pdm09 were 1.7.2 Although an estimated 201 200 respiratory deaths due to influenza A(H1N1)pdm09 occurred during the first year of the pandemic, the number of deaths per population was 30 times lower than that seen during the 1968 influenza pandemic, 1000 times less than the 1918 pandemic, and even less than typical seasonal influenza epidemics (estimated by the World Health Organization [WHO] to be 250 000 to 500 000 per year, although estimation methods differ).3 Influenza A(H1N1)pdm09 was highly transmissible but not severe.", "SARS-CoV (2003) and MERS-CoV (2012-current) cause severe disease, but despite the initial R0 estimations of greater than 2.0 for SARS-CoV (indicating sustained and even worldwide transmission could occur), and some large outbreaks, neither were as transmissible as initial concerns suggested. SARS-CoV caused 8098 reported cases and 774 deaths (case-fatality rate, 9.6%) in 37 countries before the epidemic was controlled. Control was thought to have been possible because a high proportion of cases were severe, making it easier to rapidly identify and isolate infected individuals. In addition, the virus was present at lower levels in upper airway secretions. There was no secondary transmission in the United States from the 8 imported cases, although in Toronto, Canada, a single importation is thought to have led to about 400 cases and 44 deaths. Later estimates of R0 were less than 1, indicating that SARS-CoV may not have been capable of sustained transmission, especially in the setting", "of control measures.4", "Similarly, MERS-CoV appears to have high severity and low transmissibility. Since 2012, MERS-CoV has caused 2494 reported cases and 858 deaths (case-fatality rate, 34%) in 27 countries. MERS-CoV has also caused some rapid outbreaks, mainly in hospitals in Saudi Arabia, Jordan, and South Korea, but estimates of MERS-CoV R0 are less than 1, and thus far it has been contained.5\n\nCan a respiratory virus that is both transmissible and severe be contained? In preparation for an influenza pandemic, the US Department of Health and Human Services’ Pandemic Influenza Plan included a combination of nonpharmaceutical (border and school closing, infection control measures) and pharmaceutical (antiviral prophylaxis, vaccines) interventions meant to be used in combination to interrupt or slow influenza transmission. Despite implementation of some of these interventions, influenza A(H1N1)pdm09 spread to 120 countries in 3 months.", "With the emergence of MERS-CoV in the Middle East, a preparedness plan was developed that included a surveillance plan, laboratory testing, and contact tracing guidance. Infection control guidance was developed for use in health care settings and traveler guidance was developed for the public.6 The US Centers for Disease Control and Prevention (CDC) distributed MERS-CoV polymerase chain reaction test kits to state health departments. Two cases were imported into the United States. Contacts were traced, including household, hospital, and airline contacts. No secondary cases were identified in the United States. MERS-CoV was thought to be severe and control measures relied on recognition of suspect cases. However, during a hospital outbreak in Jeddah, Saudi Arabia, among hospitalized patients only 5 of 53 (9%) health care–associated cases had documented presence in the same room as a patient with MERS.5 Despite the high case-fatality rate (an important measure of severity), MERS cases", "can be asymptomatic and mild (25% in one outbreak). Although it is not known how often asymptomatic or mildly symptomatic patients transmit MERS, initiating comprehensive measures such as isolating patients suspected of having or having been exposed to the virus and using personal protective equipment when caring for them may be extremely difficult because so many patients have mild and nonspecific symptoms.", "Is the world ready for a respiratory virus with high transmissibility and severity? After a new influenza virus (H7N9) was identified in China in 2013, a series of modeling articles described the effect of, and level of preparedness for, a severe, single-wave pandemic in the United States.7 In scenarios that used clinical attack rates (the proportion of individuals who become ill with or die from a disease in a population initially uninfected) of 20% to 30% (for comparison the clinical attack rate was 20% in the first year of the 2009 H1N1 pandemic), depending on severity there would be an estimated 669 000 to 4.3 million hospitalizations and an estimated 54 000 to 538 000 deaths without any interventions in the United States. The models suggested that without a vaccine, school closures would be unlikely to affect the pandemic, an estimated 35 000 to 60 000 ventilators would be needed, up to an estimated 7.3 billion surgical masks or respirators would be required, and perhaps most", "important, if vaccine development did not start before the virus was introduced, it was unlikely that a significant number of hospitalizations and deaths could be averted due to the time it takes to develop, test, manufacture, and distribute a vaccine.", "It is impossible to know what will happen so early in this novel 2019 coronavirus (2019-nCoV) epidemic. The scope, morbidity, and mortality will depend on the combination of severity and transmissibility. Numerous experts have “nowcasted” how many cases have occurred and forecasted how many cases will likely occur. A recent study suggests rapid person to person transmission can occur.8 Disease modelers have estimated R0 to be 2.2.9 The University of Hong Kong estimates the outbreak could infect more than 150 000 persons per day in China at its peak.", "Is 2019-nCoV infection severe? To date approximately 14% of cases of 2019-nCoV have been described as severe by WHO, with a case-fatality rate of 2.1%.10 Estimates of severity are usually higher in the beginning of an epidemic due to the identification of the most severely affected cases and decline as the epidemic progresses. However, because many infected persons have not yet recovered and may still die, the case-fatality rate and severity could be underestimated. On January 30, 2020, WHO officially declared the 2019-nCoV epidemic as a Public Health Emergency of International Concern, indicating its concern that countries aside from China could be affected by 2019-nCoV.", "In preparing for possible sustained transmission of 2019-nCoV beyond China, applicable lessons from previous experiences with epidemics/pandemics of respiratory viruses should be carefully considered to better control and mitigate potential consequences. Influenza preparedness plans have been developed that aim to stop, slow, or limit the spread of an influenza pandemic to the United States. These plans address limiting domestic spread and mitigating disease but also sustaining infrastructure and reducing the adverse effects of the pandemic on the economy and society. These plans would be useful to enact during the 2019-nCoV epidemic should the United States experience sustained transmission. Countries have been successful in the past and there is nothing yet to predict that this time it is likely to be worse. Effective prevention and control will not be easy if there is sustained transmission and will require the full attention of public health, federal and local governments, the", "private sector, and every citizen.", "Back to topArticle Information\nCorresponding Author: David L. Swerdlow, MD, Clinical Epidemiology Lead, Medical Development and Scientific/Clinical Affairs, Pfizer Vaccines, 500 Arcola Rd, Collegeville, PA 19426 (david.swerdlow@pfizer.com).\n\nPublished Online: February 11, 2020. doi:10.1001/jama.2020.1960\n\nConflict of Interest Disclosures: Dr Swerdlow reports owning stock and stock options in Pfizer Inc. Dr Swerdlow also reports providing a one-time consultation consisting of an overview of SARS and MERS epidemiology to GLG Consulting and receiving an honorarium. Dr Finelli reports owning stock in Merck and Co.\n\nFunding/Support: Pfizer Inc provided salary support for Dr Swerdlow.\n\nRole of the Funder/Sponsor: Pfizer Inc reviewed the manuscript and approved the decision to submit the manuscript for publication.", "References\n1.\nSwerdlow DL, Finelli L, Bridges CB. 2009 H1N1 influenza pandemic: field and epidemiologic investigations in the United States at the start of the first pandemic of the 21st century. Clin Infect Dis. 2011;52(suppl 1):S1-S3. doi:10.1093/cid/ciq005PubMedGoogle ScholarCrossref\n2.\nBalcan D, Hu H, Goncalves B, et al. Seasonal transmission potential and activity peaks of the new influenza A(H1N1): a Monte Carlo likelihood analysis based on human mobility. BMC Medicine. 2009;7(45). doi:10.1186/1741-7015-7-45\n3.\nDawood FS, Iuliano AD, Reed C, et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling study. Lancet Infect Dis. 2012;12(9):687-695. doi:10.1016/S1473-3099(12)70121-4PubMedGoogle ScholarCrossref\n4.", "Chowell G, Castillo-Chavez C, Fenimore PW, Kribs-Zaleta CM, Arriola L, Hyman JM. Model parameters and outbreak control for SARS. Emerg Infect Dis. 2004;10(7):1258-1263. doi:10.3201/eid1007.030647PubMedGoogle ScholarCrossref\n5.\nKillerby ME, Biggs HM, Midgley CM, Gerber SI, Watson JT. Middle East respiratory syndrome coronavirus transmission. Emerg Infect Dis. 2020;26(2):191-198. doi:10.3201/eid2602.190697PubMedGoogle ScholarCrossref\n6.\nRasmussen SA, Watson AK, Swerdlow DL. Middle East respiratory syndrome (MERS). Microbiol Spectr. 2016;4(3). doi:10.1128/microbiolspec.EI10-0020-2016PubMedGoogle Scholar\n7.\nSwerdlow DL, Pillai SK, Meltzer MI, eds. CDC modeling efforts in response to a potential public health emergency: influenza A(H7N9) as an example. Clin Infect Dis. 2015;60(suppl):S1-S63. https://academic.oup.com/cid/issue/60/suppl_1.Google Scholar\n8.", "Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585\nArticlePubMedGoogle Scholar\n9.\nLi Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus–infected pneumonia. N Engl J Med. Published online January 29, 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar\n10.\nWorld Health Organization. Novel coronavirus (2019-nCoV) situation reports. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/. Accessed February 4, 2020.\nComment\n2 Comments for this articleEXPAND ALL\nFebruary 12, 2020\nUnderstanding R and Disease Control\nOz Mansoor | Public Health Physician, Wellington", "The message, that we need to prepare for a pandemic is vital. But the article misreports some key ideas. Firstly, SARS was not controlled \"because a high proportion of cases were severe.\" While that helped , it was because cases were not infectious before some days after symptom onset (usually in the second week of illness). This gave more time for case identification and isolation. And most cases did not pass on infection to anybody, but a few spread to many. When all such individuals were identified and isolated, spread stopped.", "Unfortunately, the new virusappears to be spreading from people much earlier in the course of illness, and even with mild symptoms - which was never documented for SARS. However, it is not clear that it is any different or better at spread between people, and perhaps with the same pattern of most cases not causing further spread.\n\nSecondly, the R0, the basic reproduction number, is correctly described as the average number of infections each case causes. But it lacks two key ideas: 1) the 0 after the R implies the native state, which is a fully susceptible population and without any control measures. R is the effectiive number and can include the impact of control measures.\n\nTo claim that it was the lack of transmissibility, rather than the control measures that ended SARS, is not based on any evidence. And it ignores the heroic efforts of affected countries.", "Elimination of SARS demonstrated the potential of globally coordinated collective action, as well as the damage caused by ignorance and prejudice. Most seem to have already forgotten the lessons of SARS.CONFLICT OF INTEREST: Worked for WHO/WPRO in SARS responseREAD MORE\nFebruary 24, 2020\nCOVID 19: a global presence and not only a new pathogen?\nGiuliano Ramadori, Professor of Medicine | University Clinic, Göttingen, Germany", "In the winter season there comes the time of upper and lower respiratory tract infections characterised by cough, dyspnea and eventually fever (influenza-like illness).Some of the patients, especially older people living alone affected by the disease ,may need hospitalization and eventually intensive care. In many of the cases who are hospitalized nasal and/or tracheal fluid are examined for viral or bacterial agents. Only in less than 50% of the cases influenza viruses are considered to be the cause of the disease.In the rest of the cases diagnostic procedure for human coronaviruses is not performed routinely. One of the fourdifferent Human Coronaviruses (HuCoV: 229E,NL 63,0C43 and HKU1) can however be found in up to 30% ofpatients negative for influenza viruses (1). Chinese scientists in Wuhan, who had to deal with an increasing number of acute respiratory tract diseases resembling viral pneumonia, performed deep sequencing analysis from samples taken from the lower respiratory", "tract and found a \"novel\" coronavirus. The sequence of the complete genome was made public. At the same time, however, the notice from Wuhan brought to mind the SARS- and MERS-epidemics. The measures taken by the Chinese- and WHO-authorities are now well known.", "Recently about 150 new cases have been identified in northern Italy and health authorities are still looking for case 0 (the source). Is it possible that COVID-19 was already existent in Italy -- and not only in Italy but possibly everywhere in the world -- and that newly available nucleotide sequence allows now to find the cause of previously undefined influenza-like illness?\n\nREFERENCE\n\n1. Benezit F et al.:Non-influenza respiratory viruses in adult patients admitted with influenza-like illness:a 3- year prospective multicenter study.Infection, 13 february 2020, https://doi.org/10.1007/s15010-019-01388-1).CONFLICT OF INTEREST: None ReportedREAD MORE\nSee More About\nGlobal Health Public Health Pulmonary Medicine Infectious Diseases Influenza\nDownload PDF\nCite This\nPermissionsComment\nCME & MOC\n Coronavirus Resource Center", "Trending\nOpinion is learning has multimedia\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nMarch 24, 2020\nOpinion is learning has multimedia\n2019 Novel Coronavirus—Important Information for Clinicians\nMarch 17, 2020\nResearch is learning has multimedia\nClinical Characteristics of Patients With Novel Coronavirus (2019-nCoV) Infection Hospitalized in Beijing, China\nMarch 17, 2020\nSelect Your Interests\nJOB LISTINGS ON JAMA CAREER CENTER®\nACADEMIC CARDIOLOGIST: HEART FAILURE SPECIALIST\nPhoenix, Arizona\nNONINVASIVE CARDIOLOGIST\nWest Grove, Pennsylvania\nCARDIOLOGIST\nPhoenixville, Pennsylvania\nCARDIAC INTENSIVIST FACULTY\nWest Reading, Pennsylvania\nCLINICAL FACULTY: CARDIOLOGY / ELECTROPHYSIOLOGIST\nPhoenix, Arizona\nSee more at JAMA Career Center\nOthers Also Liked\nCoronavirus Dx Emergency Use Authorizations Progressing Rapidly Despite Criticism\nMadeleine Johnson, 360Dx, 2020", "Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods\nCanrong Wu, Acta Pharmaceutica Sinica B, 2020\nCommercial Labs Step up Coronavirus Test Efforts After FDA Guidance\n360Dx, 2020\nPowered by\nTrending\nUS Emergency Legal Responses to Novel Coronavirus—Balancing Public Health and Civil Liberties\nJAMA Opinion March 24, 2020\nPractical Aspects of Otolaryngologic Clinical Services During the COVID-19 Epidemic\nJAMA Otolaryngology–Head & Neck Surgery Opinion March 20, 2020\n2019 Novel Coronavirus—Important Information for Clinicians\nJAMA Opinion March 17, 2020\nJAMA\nCONTENT\nHome New Online Current Issue\nJOURNAL INFORMATION\nFor Authors Editors & Publishers RSS Contact Us\nJN Learning / CME Store Apps Jobs Institutions Reprints & Permissions\nJournal Cover\nSubscribe\nGo\nJAMA Network\nPUBLICATIONS", "JAMA JAMA Network Open JAMA Cardiology JAMA Dermatology JAMA Facial Plastic Surgery JAMA Health Forum JAMA Internal Medicine JAMA Neurology JAMA Oncology JAMA Ophthalmology JAMA Otolaryngology–Head & Neck Surgery JAMA Pediatrics JAMA Psychiatry JAMA Surgery Archives of Neurology & Psychiatry (1919-1959)\nSITES\nAMA Manual of Style Art and Images in Psychiatry Breast Cancer Screening Guidelines Colorectal Screening Guidelines Declaration of Helsinki Depression Screening Guidelines Evidence-Based Medicine: An Oral History Fishbein Fellowship Genomics and Precision Health Health Disparities Hypertension Guidelines JAMA Network Audio JAMA Network Conferences Machine Learning Med Men Medical Education Opioid Management Guidelines Peer Review Congress Research Ethics Sepsis and Septic Shock Statins and Dyslipidemia Topics and Collections\nFEATURED ARTICLES", "ACS Breast Cancer Screening Guideline CDC Guideline for Prescribing Opioids CDC Guideline for Prevention of Surgical Site Infections Consensus Definitions for Sepsis and Septic Shock Global Burden of Cancer, 1990-2016 Global Burden of Disease in Children, 1990-2013 Global Burden of Hypertension, 1990-2015 Global Firearm Mortality, 1990-2016 Health Care Spending in the US and Other High-Income Countries Income and Life Expectancy in the US JNC 8 Guideline for Management of High Blood Pressure President Obama on US Health Care Reform Screening for Colorectal Cancer Screening for Depression in Adults Screening for Prostate Cancer Statins for Primary Prevention of Cardiovascular Disease The State of US Health, 1990-2016 US Burden of Cardiovascular Disease, 1990-2016 WMA Declaration of Helsinki, 7th Revision\nBLOGS\nJAMA Health Forum AMA Style Insider\nINFORMATION FOR\nAuthors Institutions & Librarians Advertisers Subscription Agents Employers & Job Seekers Media\nJAMA NETWORK PRODUCTS", "AMA Manual of Style JAMAevidence JN Listen Peer Review Congress\nJN LEARNING\nHome CME Quizzes State CME Audio / Podcast Courses Clinical Challenge CME Atrial Fibrillation Course Marijuana Course Penicillin Allergy Course Cervical Cancer Screening Course CME / MOC Reporting Preferences About CME & MOC\nHelp\nSubscriptions & Renewals Email Subscriptions Update Your Address Contact Us Frequently Asked Questions\nJAMA CAREER CENTER\nPhysician Job Listings", "Get the latest from JAMA\nEmail address\nSign Up\nPrivacy Policy | Terms of Use\nJama Network Logo\n© 2020 American Medical Association. All Rights Reserved.\nTerms of Use| Privacy Policy| Accessibility Statement\n\nSilverchair Logo" ]
[ 8 ]
2,853
4,807
1,582
How is exhaled breath condensate used in viral research?
5,193
[ "the isolation of respiratory viruses" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 1 ]
3,427
4,677
1,582
How many patients were i this study?
5,194
[ "102" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 1 ]
3,427
4,677
1,582
What was the conclusion of this study?
5,195
[ "EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 2 ]
3,427
4,677
1,582
How long did the patient breath into the RTube?
5,196
[ "10 minutes" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 5 ]
3,427
4,677
1,582
What followed the reverse transcription step in the analysis?
5,197
[ "denaturation step" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 10 ]
3,427
4,677
1,582
What was the last step in the analysis?
5,198
[ "amplification step" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 13 ]
3,427
4,677
1,582
What percentage of the patients were between 20 and 30 years old in this study?
5,199
[ "52%" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 14 ]
3,427
4,677
1,582
Why is EBC an attractive method for screening?
5,200
[ "easy to perform and can be conducted in a home environment" ]
[ "Exhaled breath condensate sampling is not a new method for detection of respiratory viruses\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059288/\n\nSHA: f3b46e7e8f58799207cc44515f859c1daf5e4dfc\n\nAuthors: Houspie, Lieselot; De Coster, Sarah; Keyaerts, Els; Narongsack, Phouthalack; De Roy, Rikka; Talboom, Ive; Sisk, Maura; Maes, Piet; Verbeeck, Jannick; Van Ranst, Marc\nDate: 2011-03-04\nDOI: 10.1186/1743-422x-8-98\nLicense: cc-by", "Abstract: BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. METHODS: In our study, 102 volunteers experiencing upper airway infection were recruited over the winter and early spring of 2008/2009 and the first half of the winter of 2009/2010. Ninety-nine EBCs were successfully obtained and screened for 14 commonly circulating respiratory viruses. To investigate the efficiency of virus isolation from EBC, a nasal swab was taken in parallel from a subset of volunteers. The combined use of the ECoVent device with the RTube™ allowed the registration of the exhaled volume and breathing frequency during collection. In this way, the number of exhaled viral particles per liter air or per minute can theoretically be estimated. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza", "B. Rhinovirus was detected in 6 EBCs and 1 EBC was Influenza B positive. We report a viral detection rate of 7% for the EBCs, which is much lower than the detection rate of 46.8% observed using nasal swabs. CONCLUSION: Although very promising, EBC collection using the RTube™ is not reliable for diagnosis of respiratory infections.", "Text: Human respiratory tract infections represent the most commonly encountered infections worldwide. In the majority of cases, the etiology of these infections remains undetermined due to rapid convalescence after infection. Respiratory tract infections in healthy adults can be caused by a variety of pathogens and the detection of these agents is currently based on their isolation from nasal swabs (NS), bronchoalveolar lavages (BAL), nasopharyngeal aspirates and sputum samples. The acquisition of these specimens by semi-invasive and invasive techniques is often unpleasant for the patient. Therefore, exhaled breath condensate (EBC) analysis has recently been explored as a new and non-invasive method to monitor lung inflammation and pulmonary disease such as chronic obstructive pulmonary disease (COPD), asthma, cystic fibrosis, lung cancer etc. EBCs mainly consist of water vapour but a small fraction contains respiratory droplets derived from the airway lining fluid [1, 2] . This", "observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. At first, investigators suspected that turbulence of the inhaled air was responsible for the aerosolisation of the respiratory fluid. However, the effect of the turbulent airflow is limited to the upper airways since the turbulent airflow becomes laminar as it reaches the smaller bronchial airways and alveoli. Recently, the bronchiole fluid film burst model has been described [3] . This model suggests that aerosols are produced during inhalation by the bursting of fluid bubbles present in the bronchioles.", "The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. Therefore we screened the EBC samples with virus specific PCR assays targeting 14 \n\nIn this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). The patient was instructed to breath orally at tidal volumes into a mouthpiece attached to a condenser for 10 minutes. No nose clips were used during collection and saliva contamination was avoided by the presence of a one-way valve and the T-shaped section of the mouthpiece.", "In a first part of the study that started during the winter and spring of 2008/2009, 70 EBC samples were collected from patients who voluntary presented themselves to our laboratory. The majority of these volunteers were students that responded to the information leaflet, distributed in the university buildings of the Catholic University of Leuven. The samples were collected with the aluminium cooler sleeve chilled at -80°C.", "In the fall and first half of the winter of 2009/2010, 32 condensates were collected from patients who presented themselves to their general practitioner. Due to practical circumstances, the condensates were collected with the cooler chilled at -20°C. For 13 out of 32 collections, the RTube™ was connected by a custom made connectingpiece to the ECoVent (Jaeger, Germany). This device registers ventilatory parameters such as the exhaled volume, breathing frequency and tidal volume. Additionally, a NS was obtained in parallel with the condensate collection from each patient.", "All EBCs were immediately stored at -20°C. Nasal swabs (NS) were refrigerated. After viral DNA and RNA extraction, EBC samples and nasal swabs were stored at -80°C. Three specimens were excluded from the study due to incorrect condensate collection. A short questionnaire was used to document the date of birth, the severity of respiratory complaints and to record the days of symptomatic illness from all volunteers. This study was approved by the Medical Ethics Committee of the University Hospital of Leuven and informed consents were received from all participants.\n\nViral DNA and RNA were isolated with the QIAamp MinElute Virus kit (Qiagen, Westburg, The Netherlands) according to the instruction manual. EBC extracts were eluted in 60 μl elution buffer and NS extracts in 110 μl elution buffer.", "The breath condensates were screened for 11 respiratory RNA viruses (CoV NL63, E229 and OC43, RV, HMPV, InfA&B and PIV1-4) [4] [5] [6] [7] using a OneStep RT-PCR Kit (Qiagen, Westburg, The Netherlands) in a 50 μl reaction containing 10 μl of the extracted RNA, 0.6 μM of forward and reverse primers (Table 2), 1.5 μl One Step Enzyme Mix, 10 μl 5 × One Step RT-PCR Buffer and 400 μM of each dNTP. For adenovirus screening, a DNA PCR was carried out for which the amplification reaction mix contained 0.5 μM forward primer (AdFW) and reverse primer (AdRV), 0.4 mM dNTPs, 10 μl Buffer C and 1 U Taq polymerase in a final volume of 50 μl. The PCR primers used were located in conserved regions of the genomes of the respiratory pathogens ( Table 2 ). The reactions were carried out in a T3000 Thermocycler 48 (Westburg, Leusden, The Netherlands) with an initial reverse transcription step for RNA viruses at 50°C for 30 min, followed by PCR activation at 95°C for 30 s, 45 cycles of amplification", "followed by a final extension step for 10 min at 72°C. The DNA amplification program was initiated with a denaturation step at 94°C for 3 min, followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and a final extension step at 72°C for 1 min. The amplicons were subjected to a 6% polyacrylamide gel and visualised under UV light by staining with ethidium bromide. PCR products were purified using the Invitek MSB Spin PCRapace Kit and cycle sequenced in forward and reverse direction using the ABI PRISM Big-Dye Termination Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed with the ABI3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). Consensus sequences were obtained using the SeqMan II software (DNASTAR, Madison, Wis.). For samples from HRSV was detected using a RT-PCR assay as previously described [8, 9] . In brief, a multiplex mix was prepared in a final volume of 25 μl using 5 μl extracted RNA, 12.5 μl of", "Eurogentec One-Step Reverse Transcriptase qPCR Master Mix containing ROX as a passive reference, 0.125 μl Euroscript + RT & RNase inhibitor (Eurogentec, Seraing, Belgium) 200 nM of HRSV-A and -B specific forward and reverse primers and 100 nM of HRSV-A and -B MGB probes. cRNA standards were constructed using the MEGAshortscript T7 kit (Ambion, Austin, TX, USA) and spectrophotometrically quantified.", "The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset", "HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was", "completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) .", "In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the", "EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection.", "For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample.", "Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing.", "Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially", "presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a", "positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced", "shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported.", "Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all", "larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials.", "The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] .", "Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC.", "For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined.", "Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV.", "In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in", "condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] ." ]
[ 18 ]
3,427
4,677
1,571
What is the leading cause of death among children after the age of 1 month?
502
[ "Pneumonia remains the leading cause of death in children outside the neonatal period," ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 1 ]
3,587
4,920
1,571
How has the number of childhood pneumonia been reduced?
504
[ "New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 1 ]
3,587
4,920
1,571
What percentage of childhood deaths are due to pneumonia?
507
[ "approximately 900,000 of the estimated 6.3 million child deaths in 2013" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 2 ]
3,587
4,920
1,571
How has the childhood population grown in the last two decades?
510
[ "global childhood population from 605 million in 2000 to 664 million in 2015" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 4 ]
3,587
4,920
1,571
What is the reduction in the number of childhood pneumonia cases?
511
[ "Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 4 ]
3,587
4,920
1,571
How much is the reduction in the childhood pneumonia deaths?
512
[ "Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 4 ]
3,587
4,920
1,571
Childhood pneumonia rate for high income countries vs low and middle income countries.
513
[ "The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries." ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 5 ]
3,587
4,920
1,571
What percentage of childhood pneumonia deaths occur outside hospital in low and middle income countries?
514
[ "up to 81% of severe pneumonia deaths occur outside a hospital" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 5 ]
3,587
4,920
1,571
Case Fatality Rates for Childhood Pneumonia in high income vs low and middle income countries.
515
[ "the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 5 ]
3,587
4,920
1,571
How can childhood pneumonia affect the subsequent health of a person?
516
[ "Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 6 ]
3,587
4,920
1,571
What is the increase in the risk of respiratory disease after having childhood pneumonia.
517
[ "The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia." ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 6 ]
3,587
4,920
1,571
Which is the best method to identify pneumonia in a person?
518
[ "Chest radiologic changes have been considered the gold standard for defining a pneumonia event" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 8 ]
3,587
4,920
1,571
What is responsible for the reduction of radiologic pneumonia?
520
[ "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia." ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 10 ]
3,587
4,920
1,571
What is the percentage reduction in pneumonia cases due to vaccination?
521
[ "Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 10 ]
3,587
4,920
1,571
What is the revised WHO definition of Bacterial Pneumonia?
522
[ "A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[]
3,587
4,920
1,571
What is the reduction in bacterial pneumonia under the revised WHO definition of bacterial pneumonia?
524
[ "Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21]" ]
[ "Community-acquired pneumonia in children — a changing spectrum of disease\n\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/\n\nSHA: eecb946b106a94f26a79a964f0160e8e16f79f42\n\nAuthors: le Roux, David M.; Zar, Heather J.\nDate: 2017-09-21\nDOI: 10.1007/s00247-017-3827-8\nLicense: cc-by", "Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.", "Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and", "outcome in children.", "The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] .", "Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] .", "Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity", "across the life course.", "Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term \"end-point consolidation\" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. \"Other infiltrate\" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. \"Primary end-point pneumonia\" included either end-point consolidation or a pleural effusion associated with a", "pulmonary parenchymal infiltrate (including \"other\" infiltrate).", "Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] .", "The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of \"presumed bacterial pneumonia\" has been introduced, and this definition includes pneumonia cases with", "WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no", "evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia.", "Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in", "children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] .", "Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] .", "In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] .", "A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] .", "More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good", "evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] .", "Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However", "recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] .", "Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas.", "Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age", "(4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] .", "The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] .", "The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political", "will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] .", "Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] .", "Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] .", "Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] .", "Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of", "failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization", "pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] .", "Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] .", "Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia." ]
[ 12 ]
3,587
4,920