diff --git a/032dad3d59669c324774b0aa1256f76c8f34876110dc4463b65122b1b415c729/peer_review/images_list.json b/032dad3d59669c324774b0aa1256f76c8f34876110dc4463b65122b1b415c729/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/032dad3d59669c324774b0aa1256f76c8f34876110dc4463b65122b1b415c729/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/036e7e997067448ba1f8ac4a284e1bf78eded349d2ce629edb771331d60d1ade/peer_review/images_list.json b/036e7e997067448ba1f8ac4a284e1bf78eded349d2ce629edb771331d60d1ade/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/036e7e997067448ba1f8ac4a284e1bf78eded349d2ce629edb771331d60d1ade/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/03958f873bda5dcf088e0d766c000075ed7adb61f8e7f76a9a5c0ea0d50554df/peer_review/images_list.json b/03958f873bda5dcf088e0d766c000075ed7adb61f8e7f76a9a5c0ea0d50554df/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..66534b429ad2f4cd494d504b4983f8b7f2facc99
--- /dev/null
+++ b/03958f873bda5dcf088e0d766c000075ed7adb61f8e7f76a9a5c0ea0d50554df/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Integrated scRNA-Seq data showing consistency of clustering between individual and integrated data types.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Integrated scATAC-Seq data showing consistency of clustering between individual and integrated data types.",
+    "bbox": [
+      [
+        200,
+        602,
+        771,
+        818
+      ]
+    ],
+    "page_idx": 12
+  }
+]
\ No newline at end of file
diff --git a/03a74308dd22e6d95943be0ac25db777eeea49e185e458d3fb917f6f378c9923/peer_review/images_list.json b/03a74308dd22e6d95943be0ac25db777eeea49e185e458d3fb917f6f378c9923/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..fa78bf6c462368bb322a27c59aa662d30768c7fd
--- /dev/null
+++ b/03a74308dd22e6d95943be0ac25db777eeea49e185e458d3fb917f6f378c9923/peer_review/images_list.json
@@ -0,0 +1,261 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5. Optical and mechanical properties of microstructures. (c) Top view of SEM image of UPstextured silicon wafer obtained by etching in (B). (d) Schematic diagram of sunlight reflection on UPstextured silicon wafer. (e) Reflectance spectrum of standard silicon wafer, and UPs-textured silicon wafer without and with trapping effects of microstructures responding to sunlight. The experimental parameters are \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        145,
+        284,
+        854,
+        393
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3. Fabrication of multi-height gradients microstructure. (a) Response time and OM images between on and off state at \\(z = 150 \\mu \\mathrm{m}\\) . Diffraction patterns of (b) simulation at \\(z = 1060 \\mu \\mathrm{m}\\) and (c) experiment at \\(z = 1078 \\mu \\mathrm{m}\\) , and the corresponding (d) 2D profile image and (e) 3D surface topography of the fabricated height gradient microstructures through one-step lithograph. The scale bar denotes 10 \\(\\mu \\mathrm{m}\\) . (f) Normalized intensity along the representative dashed line in (c) and (e). The experimental parameters are given as follows: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        202,
+        437,
+        787,
+        688
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5. Optical and mechanical properties of microstructures. (a) Experimentally observed OM image of diffraction pattern, corresponding (b) 3D surface topography of microstructures obtained via the lithography: (top) the 3D data model from 3D surface topography and (bottom) the simulated mechanical response of the microstructure at different angles at a specific distance ( \\(z = 3400 \\mu \\mathrm{m}\\) ). (c) Top view of SEM image of UPs-textured silicon wafer obtained by etching in (B). (d) Schematic diagram of sunlight reflection on UPs-textured silicon wafer. (e) Reflectance spectrum of standard silicon wafer, and UPs-textured silicon wafer without and with trapping effects of microstructure responding to sunlight. The experimental parameters are \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Schematic diagram of light propagation.",
+    "bbox": [
+      [
+        303,
+        650,
+        680,
+        805
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. The resultant SEM image of electrode.",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R1. Schematic diagram of light propagation.",
+    "bbox": [
+      [
+        313,
+        467,
+        668,
+        611
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1. Design concept and principle. (b) Calculated NLC molecular distributions along the \\(z\\) -axis driven by an electric field (1 kHz, 400 Vpp), and NLC molecular orientation of \\(x - z\\) plane aligning to the electric field lines (E).",
+    "bbox": [
+      [
+        352,
+        92,
+        640,
+        406
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3. Optical characterization of experimentally fabricated multi-height gradients microstructure. (a) Response time and OM images between on and off state at \\(z = 150 \\mu \\mathrm{m}\\) . The experimental parameters are given as follows: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        377,
+        528,
+        612,
+        641
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R1. (a) Schematic diagram of NLC device. (b) The schematic diagram of the initial orientation of NLC molecules based on the Hyflon coated electrode surface (top), and corresponding the image of polarized optical microscope of the NLC device (bottom). (c) The schematic diagram of NLC molecular orientation driven by an electric field.",
+    "bbox": [
+      [
+        213,
+        525,
+        797,
+        747
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R1 Simulated OM images of diffraction patterns obtained (a) without and (b) with a linear polarizer before the charge coupled device (CCD) when different voltages were applied ( \\(U = 0\\) , 20, 40, 60, 80, 100, 200, 300, 400 Vpp). The parameters of the sample in the experiment are given as follows: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R3 (a) Simulated and (b) experimental OM images of diffraction patterns obtained a1, b1 with and a2, b2 without a linear polarizer before the camera. The experimental parameters are given as: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.39.77 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(\\lambda = 405 \\mathrm{nm}\\) , and \\(U = 400 \\mathrm{Vpp}\\) .",
+    "bbox": [],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Fig. 6 a Experimentally observed OM images at \\(R = 0.289\\) , and b corresponding calculated NLC molecular orientations of \\(x\\) -z plane, aligning with the electric field (E) when \\(D = 29.87 \\mu \\mathrm{m}\\) , \\(L = 10.13 \\mu \\mathrm{m}\\) ; and \\(D = 35.05 \\mu \\mathrm{m}\\) , \\(L = 5.95 \\mu \\mathrm{m}\\) , respectively. Experimental parameters are: \\(H = 50 \\mu \\mathrm{m}\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Design concept and principle. a Experimental setup and achieved diffraction patterns of the proposed dynamic photomask when the laser beam passes it. b Top: spatial distribution of calculated NLC molecular directors along the \\(z\\) -axis driven by an electric field (1 kHz, 400 Vpp); bottom: distribution map of NLC director's tilt angle \\((\\theta)\\) of \\(x\\) - \\(z\\) plane aligning to the electric field (E). The inset highlighted with green rectangle depicts the enlarged part of \\(x\\) from 5 to \\(20\\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(9\\mu \\mathrm{m}\\) ; the inset highlighted with pink rectangle detail shows the director of each LC molecule \\(x\\) from 8 to \\(12\\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(2\\mu \\mathrm{m}\\) ; the inset highlighted with black circle defines the tilt angle \\(\\theta\\) . c Experimentally observed OM image of diffraction pattern, d corresponding 3D surface topography of the microstructure obtained via one-step lithography, and e transferred microstructure on silicon wafer at \\(z = 2530\\mu \\mathrm{m}\\) . Note: LP-linear polarizer, and QWP-quarter waveplate. The sample parameters are given as: \\(D = 20.11\\mu \\mathrm{m}\\) , \\(L = 19.89\\mu \\mathrm{m}\\) , \\(H = 50\\mu \\mathrm{m}\\) , \\(U = 400\\mathrm{Vpp}\\) , and \\(\\lambda = 405\\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        101,
+        241,
+        900,
+        567
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Design concept and principle. b bottom: distribution map of NLC director's tilt angle \\((\\theta)\\) of \\(x\\) - \\(z\\) plane aligning to the electric field (E). The inset highlighted with green rectangle depicts the enlarged part of \\(x\\) from 5 to \\(20 \\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(9 \\mu \\mathrm{m}\\) ; the inset highlighted with pink rectangle detail shows the director of each LC molecule \\(x\\) from 8 to \\(12 \\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(2 \\mu \\mathrm{m}\\) ; the inset highlighted with black circle defines the tilt angle \\(\\theta\\) .",
+    "bbox": [],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6a.jpg",
+    "caption": "Fig. 2 Spatial evolution of the diffraction patterns. b Normalized intensity along the selected yellow dashed line in the OM images of experimental diffraction patterns in Supplementary Fig. 6a with \\(D = 29.87 \\mu \\mathrm{m}\\) , \\(L = 10.13 \\mu \\mathrm{m}\\) and \\(D = 35.05 \\mu \\mathrm{m}\\) , \\(L = 5.95 \\mu \\mathrm{m}\\) , when \\(R = 0.289\\) , \\(H = 50 \\mu \\mathrm{m}\\) and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure R1. Simulated diffraction patterns at specific distances ( \\(z = 0\\) , 10, 40, 80, 100, 150, 200, 500, 1000, 1500, 2000, 2500, 3000, 3500 \\(\\mu \\mathrm{m}\\) ), when \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) . The scale bar denotes \\(10 \\mu \\mathrm{m}\\) .",
+    "bbox": [],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 Spatial evolution of the diffraction patterns. c Normalized intensity at a representative dashed line in the simulated diffraction pattern with different LC layer thickness ( \\(H = 1\\) , 5, 9, 30, \\(50 \\mu \\mathrm{m}\\) ) when \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(\\lambda = 405 \\mathrm{nm}\\) and \\(R = 0.560\\) .",
+    "bbox": [
+      [
+        363,
+        459,
+        636,
+        604
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Supplementary Fig. 7 a Simulated diffraction patterns with \\(H = 1\\) , 5, 9, 30, and \\(50 \\mu \\mathrm{m}\\) . b Experimentally observed OM images and c corresponding \\(Z_{\\mathrm{T}}\\) values when \\(H = 30\\) , 50, 80, and \\(100 \\mu \\mathrm{m}\\) . The experimental parameters are: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(R = 0.56\\) , \\(U = 400 \\mathrm{Vpp}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        222,
+        90,
+        770,
+        351
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Design concept and principle. b Top: spatial distribution of calculated NLC molecular directors along the \\(z\\) -axis driven by an electric field (1 kHz, 400 Vpp); bottom: distribution map of NLC director's tilt angle \\((\\theta)\\) of \\(x - z\\) plane aligning to the electric field (E). The inset highlighted with green rectangle depicts the enlarged part of \\(x\\) from 5 to \\(20\\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(9\\mu \\mathrm{m}\\) ; the inset highlighted with pink rectangle details shows the director of each LC molecule \\(x\\) from 8 to \\(12\\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(2\\mu \\mathrm{m}\\) ; the inset highlighted with black circle defines the tilt angle \\(\\theta\\) .",
+    "bbox": [
+      [
+        352,
+        88,
+        639,
+        409
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Design concept and principle. b bottom: distribution map of NLC director's tilt angle \\((\\theta)\\) of \\(x\\) -plane aligning to the electric field (E). The inset highlighted with green rectangle depicts the enlarged",
+    "bbox": [
+      [
+        358,
+        703,
+        637,
+        855
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary Fig. 3 b Simulated and c experimental OM images of diffraction patterns. In the OFF state (0 Vpp), the NLC molecules exhibited a homeotropic arrangement, resulting in no diffraction pattern. As the electric field was applied, diffraction patterns began to emerge. After 60 Vpp, the director of LC molecules remained almost unchanged. However, the diffraction pattern became visible at 40 Vpp. When the voltage exceeded 60 Vpp, only tiny differences in the diffraction pattern can be observed, which can be ascribed to minute molecule orientation disparity. The parameters of the experiment are given as follows: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 50 \\mu \\mathrm{m}\\) , \\(\\lambda = 405 \\mathrm{nm}\\) , and \\(z = 300 \\mu \\mathrm{m}\\) .",
+    "bbox": [],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure R2. Experimentally observed OM images of diffraction patterns respond to voltage ( \\(U = 0\\) , 20, 40, 60, 80, 100, 200, 300, 400 Vpp) with \\(D = 40.23\\) , \\(L = 39.77 \\mu \\mathrm{m}\\) when \\(H = 50 \\mu \\mathrm{m}\\) , \\(\\lambda = 405 \\mathrm{nm}\\) , and \\(z = 300 \\mu \\mathrm{m}\\) . Scale bar denotes \\(20 \\mu \\mathrm{m}\\) .",
+    "bbox": [
+      [
+        360,
+        597,
+        634,
+        802
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure R3. (a) Distribution map of negative LC director's tilt angle \\((\\theta)\\) of \\(x - z\\) plane aligning to the electric field (E). The inset with green rectangle depicts the enlarged part of \\(x\\) from 28 to \\(32 \\mu \\mathrm{m}\\) and \\(z\\) from 0 to \\(2 \\mu \\mathrm{m}\\) . (b) Spatial distribution of calculated NLC molecule directors along the \\(z\\) -axis when \\(z = 0.4\\) , 10, \\(19.6 \\mu \\mathrm{m}\\) . The parameters of the experiment are given as follows: \\(D = 20.11 \\mu \\mathrm{m}\\) , \\(L = 19.89 \\mu \\mathrm{m}\\) , \\(H = 20 \\mu \\mathrm{m}\\) , and \\(\\lambda = 405 \\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        291,
+        90,
+        707,
+        319
+      ]
+    ],
+    "page_idx": 35
+  }
+]
\ No newline at end of file
diff --git a/03c32499e771b72a768116d2d769268099064b26a9d65fb9077ed09a0227a18f/peer_review/images_list.json b/03c32499e771b72a768116d2d769268099064b26a9d65fb9077ed09a0227a18f/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..4638ab4dde803706fa9a77875c46dc5006891ef8
--- /dev/null
+++ b/03c32499e771b72a768116d2d769268099064b26a9d65fb9077ed09a0227a18f/peer_review/images_list.json
@@ -0,0 +1,93 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 ID continuum modelling results of the BPMEA. (a) Modelled and experimental Faradaic efficiencies of CO for catalyst layer (CL) incorporated with Sustainion (Sus-CL) or Nafion (Naf-CL) as a function of current densities. Comparison of (b) pH, (c) (bi)carbonate concentrations, and (d) CO2 local concentration across CLs at 100 mA cm-2. Profiles of (e) pH, (f) (bi)carbonate ions, and (g) CO2 local concentration across CEL and Sus-CL as a function of proton transference numbers. The bipolar junction is located at \\(x = 0 \\mu \\mathrm{m}\\) , and the CEL/CL is located at \\(x = 75 \\mu \\mathrm{m}\\) . The concentration profiles of the CEL for (c) and (d) are presented in Fig. S2, and not shown here for clarity.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S1 Model predicted (a) \\(CO_2\\) fluxes and (b) local partial current density of CO evolution within Sus- and Naf-CL.",
+    "bbox": [
+      [
+        205,
+        81,
+        773,
+        283
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S2 Comparison of (a) the ohmic resistances and (b) cell voltages (solid line) and ohmic losses (dashed lines) of the BPMEA as a function of current densities for CLs based with NiNC-IMI 15 wt% Sus, NiNC-IMI 15 wt% Naf, NiNC-IMI 15 wt% Sus using 1M KOH, and NiNC-IMI 15 wt% Sus with spacer at CEL|cathode interface. The rest of the samples used 0.1 M KOH as the analyte.",
+    "bbox": [
+      [
+        175,
+        225,
+        816,
+        492
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. S3 Comparison of the (a)averaged Nernstian shift and (b) pH values caused by ionomers in the catalyst layers at different current densities estimated from models. Note: the more positive values of the Nernstian shift lead to reduced cell voltages.",
+    "bbox": [
+      [
+        118,
+        159,
+        870,
+        422
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. S4 Comparison of (a) FEs for CO₂ reduction reaction (CO₂RR) gaseous products, (b) FEs for H₂, (c) partial current density of CO₂RR gaseous product, and (d) cell voltages of BPMEA with NiNC-IMI 15% Sus CL as cathode with recently reported literature data by Yang et al.¹³, Siritanaratkul et al.¹⁴,¹⁵, Yue et al.¹⁶, Xie et al.¹⁷, Li et al.¹⁸, and Eagle et al.¹⁹.",
+    "bbox": [
+      [
+        125,
+        170,
+        868,
+        651
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. S5 (a) NMR spectra of the anolyte after the test. X-ray photoelectron spectroscopy (b) survey and (c) high-resolution spectra of C1s, N1s, and Ni2p3/2 of NiNC-IMI catalyst survey, accompanied by a schematic illustration highlighting distinct functionalities. The Ni-Nx motifs, identified as the Ni states between binding energy between 856 and 854 eV, is proposed as the active site for electrochemical CO₂ reduction. (d) The pore size distribution of the catalyst was evaluated using N₂ physisorption and BET analysis. (e) Transmission electron microscopy image showcasing the as-prepared catalysts. (f) Cross-sectional image illustrating the catalyst layer after spray coating on the electrode. Related data and images for (b)-(f) have been presented in our previous publication by Brückner et al.⁹.",
+    "bbox": [
+      [
+        290,
+        87,
+        697,
+        359
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. S6 Comparison of the (a) averaged Nernstian shift and (b) pH values caused by ionomers in the catalyst layers at different current densities estimated from models. Note: the more positive values of the Nernstian shift lead to reduced cell voltages.",
+    "bbox": [
+      [
+        222,
+        165,
+        767,
+        356
+      ]
+    ],
+    "page_idx": 19
+  }
+]
\ No newline at end of file
diff --git a/03e2bbf832d9683ec5ce0abc6b992fd7d8bbafa9f7e03faa1162f30a7e8ab680/peer_review/images_list.json b/03e2bbf832d9683ec5ce0abc6b992fd7d8bbafa9f7e03faa1162f30a7e8ab680/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..6d136d038275fcf0f5149d0b107b800e13309920
--- /dev/null
+++ b/03e2bbf832d9683ec5ce0abc6b992fd7d8bbafa9f7e03faa1162f30a7e8ab680/peer_review/images_list.json
@@ -0,0 +1,16 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "The thickness of Derma-tac (alpha-step)",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "The thickness of Derma-tac (Alpha-Step)",
+    "bbox": [],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/0482b75cf7b12fd6582e971757fa6f6aa15f97e0af9f6b97b5e19506a8254319/peer_review/images_list.json b/0482b75cf7b12fd6582e971757fa6f6aa15f97e0af9f6b97b5e19506a8254319/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0482b75cf7b12fd6582e971757fa6f6aa15f97e0af9f6b97b5e19506a8254319/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0493af0c4dc35637a0544ed0beefa4a9392ed0b64e563f90a349e89c7c643265/peer_review/images_list.json b/0493af0c4dc35637a0544ed0beefa4a9392ed0b64e563f90a349e89c7c643265/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0493af0c4dc35637a0544ed0beefa4a9392ed0b64e563f90a349e89c7c643265/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/049ba6717e1f2a560710ed28b75af60b4bc15de029b1a17460609a752f5c7fd5/peer_review/images_list.json b/049ba6717e1f2a560710ed28b75af60b4bc15de029b1a17460609a752f5c7fd5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/049ba6717e1f2a560710ed28b75af60b4bc15de029b1a17460609a752f5c7fd5/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/04b1bf17357e5efc04fce9a32543f4a1ceaee9c8e79093d5b7d8586aee20beb5/peer_review/images_list.json b/04b1bf17357e5efc04fce9a32543f4a1ceaee9c8e79093d5b7d8586aee20beb5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..01b5fdc1f5a1264995dae5d7a51f3449c34863c3
--- /dev/null
+++ b/04b1bf17357e5efc04fce9a32543f4a1ceaee9c8e79093d5b7d8586aee20beb5/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Scatterplots for correlations between Post-Pre differences in FA, MD, and FC with individual performance gain (LU and N-back change). Increased FA change was associated with more pronounced gain in N-back task. Increased FC change was associated with more pronounced gain in LU task. Decreased MD changes were associated with FC increases. FA, fractional anisotropy. MD, mean diffusivity. FC, functional connectivity. LU, letter updating. Blue bars/points/0: sham group. Orange bars/points/1: anodal tDCS group. \\(p < 0.10 * p < 0.05 ** p < 0.01\\)",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. Electric field distribution of the applied stimulation protocol on an MNI brain using SimNibs \\(^{74}\\) anode centered over the left dorsolateral prefrontal cortex (F3, 5-cm diameter, 1 mA) and return (cathode) centered over the contralateral supraorbital region (Fp2, 5-cm diameter, 1 mA). Field magnitude below the anodal electrode: \\(\\sim 0.15 \\mathrm{~V} / \\mathrm{m}\\). LH, left hemisphere.",
+    "bbox": [
+      [
+        230,
+        288,
+        763,
+        389
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R4. Overlay of the canonical tract derived from the probabilistic tractography (yellow) and the JHU WM atlas labels (multicolored). SLF, superior longitudinal fasciculus. CC, corpus callosum. LH, left hemisphere.",
+    "bbox": [],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R5. White matter pathways' microstructure (fractional anisotropy, FA) in two specific fiber tracts of interest (Corpus callosum, CC, and left superior longitudinal fasciculus, SLF) reconstructed using FreeSurfer's TRACULA (v7). The display shows the respective tract in a sample subject (overlaid on the individual FA image). FA along the CC was increased after the intervention in anodal compared to sham group for those individuals with initially higher FA in the tract. FA along the SLF did not change through the intervention.",
+    "bbox": [
+      [
+        134,
+        205,
+        860,
+        432
+      ]
+    ],
+    "page_idx": 21
+  }
+]
\ No newline at end of file
diff --git a/04d3558bc25d9db827f2354105dafd0c48aaa7a3d6a779cac218c84fc60a09bd/peer_review/images_list.json b/04d3558bc25d9db827f2354105dafd0c48aaa7a3d6a779cac218c84fc60a09bd/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..e3e361358a79b51f6b090d252cd9157aa27d8c26
--- /dev/null
+++ b/04d3558bc25d9db827f2354105dafd0c48aaa7a3d6a779cac218c84fc60a09bd/peer_review/images_list.json
@@ -0,0 +1,310 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Table 1. Photocatalyst screening for C-C cross-coupling reactions<sup>a</sup>",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Table 2. Substrate scope \\(^{a,b}\\)",
+    "bbox": [
+      [
+        115,
+        100,
+        880,
+        400
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1. Photoredexcatolytic C(Ar)-C(Ar) cross-coupling reactions. a,b, Previous (a) and our (b) methods for photocatalytic C(Ar)-C(Ar) cross-coupling reactions. c, Comparisons of excited-state lifetime and excited-state oxidation potentials of representative photocatalysts and Au(BZI)(TMCz). Shown at the bottom are chemical reducing agents. Refer to Supplementary Tables 1 and 2 for the values. d, UV-Vis absorption spectrum of \\(10\\mu \\mathrm{M}\\) Au(BZI)(TMCz) recorded in toluene at 298 K. Inset figures denote the hole and electron distributions calculated for the singlet transition of the triplet geometry of Au(BZI)(TMCz) with exclusive ligand-to-ligand charge transfer (LLCT) transition character.",
+    "bbox": [
+      [
+        115,
+        90,
+        884,
+        580
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. Photoluminescence decay traces. Photoluminescence decay traces of five independently prepared solutions of \\(\\mathrm{Au(BZI)(TMCz)}\\) ( \\(50 \\mu \\mathrm{M}\\) in de-aerated toluene) recorded after \\(377 \\mathrm{nm}\\) pulsed laser excitation (time duration \\(= 0.8 \\mathrm{ns}\\) ).",
+    "bbox": [
+      [
+        283,
+        234,
+        690,
+        505
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. Excited-state oxidation potentials and lifetimes of reported two-coordinate metal complexes.",
+    "bbox": [
+      [
+        328,
+        87,
+        672,
+        504
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1. Photoredexcatolytic C(Ar)-C(Ar) cross-coupling reactions. a,b, Previous (a) and our (b) methods for photocatalytic C(Ar)-C(Ar) cross-coupling reactions. c, Comparisons of excited-state lifetime and excited-state oxidation potentials of representative photocatalysts and Au(BZI)(TMCz). Shown at the bottom are chemical reducing agents. Refer to Supplementary Tables 1 and 2 for the values. d, UV-Vis absorption spectrum of 10 \\(\\mu \\mathrm{M}\\) Au(BZI)(TMCz) recorded in toluene at 298 K. Inset figures denote the hole and electron distributions calculated for the singlet transition of the triplet geometry of Au(BZI)(TMCz) with exclusive ligand-to-ligand charge transfer (LLCT) transition character.",
+    "bbox": [
+      [
+        115,
+        90,
+        883,
+        580
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2. Oxidative quenching. a, Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}\\) Au(BZI)(TMCz), recorded with increasing concentration of 1a (0–100 mM). The peak marked with an asterisk (\\*) is the Raman signal of the solvent. b, Photoluminescence decay traces of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}\\) Au(BZI)(TMCz), recorded with increasing concentration of 1a (0–100 mM) at a wavelength of \\(540 \\mathrm{nm}\\) after picosecond pulsed laser photoexcitation at \\(377 \\mathrm{nm}\\) (pulse duration \\(= 25 \\mathrm{ps}\\) ). c, Corresponding pseudo-first-order kinetics analysis of the quenching rate as a function of added 1a. The quenching rate was calculated according to the relationship rate \\(= 1 / \\tau_{\\mathrm{obs}}(\\mathrm{1a}) - 1 / \\tau_{\\mathrm{obs}}(0)\\) , where \\(\\tau_{\\mathrm{obs}}(\\mathrm{1a})\\) and \\(\\tau_{\\mathrm{obs}}(0)\\) are the observed photoluminescence lifetime of \\(50 \\mu \\mathrm{M}\\) Au(BZI)(TMCz) in the presence and absence, respectively, of 1a. d, Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}\\) Au(BZI)(TMCz) recorded with increasing concentration of DIPEA (0–500 mM).",
+    "bbox": [
+      [
+        288,
+        188,
+        708,
+        510
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1. Photoredoxcatalytic C(Ar)–C(Ar) cross-coupling reactions. a,b, Previous (a) and our (b) methods for photocatalytic C(Ar)–C(Ar) cross-coupling reactions. c, Comparisons of excited-state lifetime and excited-state oxidation potentials of representative photocatalysts and Au(BZI)(TMCz). Shown at the bottom are chemical reducing agents. Refer to Supplementary Tables 1 and 2 for the values. d, UV–Vis absorption spectrum of \\(10~\\mu \\mathrm{M}\\) Au(BZI)(TMCz) recorded in toluene at 298 K. Inset figures denote the hole and electron distributions calculated for the singlet transition of the triplet geometry of Au(BZI)(TMCz) with exclusive ligand-to-ligand charge transfer (LLCT) transition character.",
+    "bbox": [],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Table 1. Photocatalyst screening for C-C cross-coupling reactions",
+    "bbox": [
+      [
+        115,
+        520,
+        802,
+        875
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_10.jpg",
+    "caption": "Supplementary Fig. 10 Reaction set-up. a, Emission spectrum of blue LEDs. b, Schematic representation of the photoreactor. c,d, Photos showing the photoreactor.",
+    "bbox": [],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Reaction scale: 1 (0.5 mmol) and 2 (5.0 mmol). \\(^{b}\\) Isolated yields, except \\(^{1}\\mathrm{H}\\) NMR yields for 3da and 3ea due to purification challenges from the protodebrominated products.",
+    "bbox": [],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M} \\mathrm{fac} - \\mathrm{Ir}(\\mathrm{ppy})_3\\) recorded with increased concentrations of DIPEA (0–1000 mM).",
+    "bbox": [],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. Reductive quenching. Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M} f a c - \\mathrm{Ir}(\\mathrm{ppy})_{3}\\) recorded with increased concentrations of DIPEA (0–1000 mM).",
+    "bbox": [
+      [
+        308,
+        110,
+        692,
+        330
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "Supplementary Fig. 1 UV–Vis absorption spectra. UV–Vis absorption spectra (toluene) of \\(10 \\mu \\mathrm{M} \\mathrm{Au}(\\mathrm{I})\\) complexes tested in this study and the LEDs (405 nm) emission spectrum (black). The dotted line is a 10-times amplified absorption spectrum of \\(\\mathrm{Au}(\\mathrm{IPr})(\\mathrm{Cz})\\) .",
+    "bbox": [
+      [
+        308,
+        453,
+        692,
+        671
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary Fig. 3 Electrochemical potentials. a–c, Cyclic (CV, blue solid curves) and differential pulse voltammograms (DPV, blue dashed lines) of Ar-saturated DMSO containing \\(0.10\\mathrm{M}\\) \\(\\mathrm{Bu_4NFP_6}\\) and \\(2.0\\mathrm{mM}\\) sample: a, \\(\\mathrm{Au(BZI)(TMCz)}\\) ; b, 1a; c, DIPEA. Grey lines are signals recorded for an Ar-saturated DMSO containing \\(0.10\\mathrm{M}\\) \\(\\mathrm{Bu_4NFP_6}\\) blank. Conditions: a glassy carbon disc and a Pt wire as the working and counter electrodes, respectively. An \\(\\mathrm{Ag / AgNO_3}\\) pseudo reference electrode. Scan rate \\(= 0.10\\mathrm{V}\\mathrm{s}^{-1}\\) for CV and \\(4\\mathrm{mV}\\mathrm{s}^{-1}\\) for DPV. The electrochemical potentials were corrected using a \\(\\mathrm{Fc^{+} / Fc}\\) redox couple as an external standard.",
+    "bbox": [
+      [
+        115,
+        90,
+        876,
+        293
+      ]
+    ],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Reaction scale: 1 (0.5 mmol) and 2 (5.0 mmol). \\(^b\\) Isolated yields, except \\(^1\\mathrm{H}\\) NMR yields for 3da and 3ea due to purification challenges from the protodebrominated products.",
+    "bbox": [
+      [
+        115,
+        140,
+        870,
+        430
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1. Photoredoxcatalytic C(Ar)-C(Ar) cross-coupling reactions. a,b, Previous (a) and our (b) methods for photocatalytic C(Ar)-C(Ar) cross-coupling reactions. c, Comparisons of excited-state lifetime and excited-state oxidation potentials of representative photocatalysts and Au(BZI)(TMCz). Shown at the bottom are chemical reducing agents. Refer to Supplementary Tables 1 and 2 for the values. d, UV–Vis absorption spectrum of Au(BZI)(TMCz) recorded in toluene at 298 K. Inset figures denote the hole and electron distributions calculated for the singlet transition of the triplet geometry of Au(BZI)(TMCz) with exclusive ligand-to-ligand charge transfer (LLCT) transition character.",
+    "bbox": [],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Scheme 1. Catalysis cycle. Plausible mechanism of the photoredox catalytic C–C cross-coupling reaction.",
+    "bbox": [
+      [
+        120,
+        88,
+        880,
+        425
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "aReaction scale : 1a (0.05 mmol) and 2a (0.5 mmol). bYields were determined by \\(^1\\mathrm {H}\\) NMR spectroscopy using bromoform as the internal standard. \\(^{c}24\\) h reaction time",
+    "bbox": [
+      [
+        175,
+        88,
+        816,
+        640
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "10. Figure 1, caption: it indicates the concentration of Au(BZI)(TMCz) used for the UV-Vis spectrum. Unless these complexes aggregate at higher concentrations, there's no need to include the concentration of the sample here, since the y-axis reports molar absorptivity.",
+    "bbox": [
+      [
+        163,
+        664,
+        833,
+        797
+      ]
+    ],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Figure 3. Electron transfer. a,b, Heat maps showing nanosecond photoinduced transient Vis–NIR absorption difference signals of Ar-saturated DMSO containing \\(100 \\mu \\mathrm{M} \\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})\\) recorded in the absence (a) and presence (b) of \\(200 \\mathrm{mM} 1 \\mathrm{a}\\) , recorded after \\(355 \\mathrm{nm}\\) pulsed laser photoexcitation. c, Topmost panel, selected photoinduced transient Vis–NIR absorption difference spectra of Ar-saturated DMSO containing \\(100 \\mu \\mathrm{M} \\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})\\) ; second panel, selected photoinduced transient Vis–NIR absorption difference spectra of Ar-saturated DMSO containing \\(100 \\mu \\mathrm{M} \\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})\\) recorded in the presence of \\(200 \\mathrm{mM} 1 \\mathrm{a}\\) ; third panel, Vis–NIR absorption difference spectra of \\(2.0 \\mathrm{mM} \\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})\\) recorded under an anodic potential of \\(0.45 \\mathrm{V} \\mathrm{vs} \\mathrm{Ag}^{+ / 0}\\) (conditions: Pt mesh working electrode, Pt coil counter electrode, \\(\\mathrm{Ag / AgNO_3}\\) pseudo-reference electrode, and Ar-saturated DMSO containing \\(0.10 \\mathrm{M} \\mathrm{Bu}_4 \\mathrm{NPF}_6\\) and the \\(\\mathrm{Au(I)}\\) complex); fourth panel, the absorption spectrum simulated for \\(\\mathrm{[Au(BZI)(TMCz)]^{+}}\\) (CAM-B3LYP and LANL2DZ basis sets for Au and \\(6 - 311 + \\mathrm{g}(\\mathrm{d},\\mathrm{p})\\) basis set for the other atoms), where the vertical bars indicate oscillator strengths; bottom-most panel, photoluminescence spectrum of Ar-saturated DMSO containing \\(10 \\mu \\mathrm{M} \\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})\\) . d, Temporal changes of the \\(870 \\mathrm{nm} \\mathrm{[Au(BZI)(TMCz)]^{+}}\\) traces. e, Second-order kinetics analysis for charge recombination between \\(\\mathrm{[Au(BZI)(TMCz)]^{+}}\\) and \\(1 \\mathrm{a}^+\\) . See Supplementary Fig. 7 for the results for the other substrates. f, Decay traces recorded at \\(870 \\mathrm{nm}\\) in the presence of \\(50 \\mathrm{mM} 1 \\mathrm{a}\\) and increased concentrations of \\(2 \\mathrm{a}\\) (0–300 mM). g, Pseudo-first-order kinetics analysis for the catalyst recovery through electron transfer to \\(\\mathrm{[Au(BZI)(TMCz)]^{+}}\\) . See Supplementary Fig. 9 for the results for the other substrates.",
+    "bbox": [
+      [
+        118,
+        234,
+        875,
+        515
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_5.jpg",
+    "caption": "Supplementary Fig. 5 Stern-Volmer Analysis. Plot of \\(I_0 / I\\) as a function of molar concentration of 1a.",
+    "bbox": [
+      [
+        348,
+        113,
+        620,
+        330
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Supplementary Fig. 7 Charge recombination. a–d, Second-order kinetics analysis for charge recombination between [Au(BZI)(TMCz)]\\*\\* and the substrate radical anion: a, 4-trifluoromethylphenyl bromide; b, 4-trifluoromethylphenyl iodide; c, 2-chlorquinoline; d, 3-bromoquinoline. The 870 nm photoinduced absorption kinetic traces were recorded for 100 μM Au(BZI)(TMCz) and 50 mM substrate, recorded after 355 nm pulsed laser photoexcitation (Ar-saturated DMSO).",
+    "bbox": [
+      [
+        160,
+        95,
+        835,
+        640
+      ]
+    ],
+    "page_idx": 34
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_9.jpg",
+    "caption": "Supplementary Fig. 9 Catalyst recovery. a–d, Pseudo-first-order kinetics analysis for the recovery of Au(BZI)(TMCz) through electron transfer from the radical adduct of 2a and the aryl halide to [Au(BZI)(TMCz)]<sup>++</sup>: a, 50 mM trifluoromethylphenyl bromide and 0–300 mM 2a; b, 50 mM trifluoromethylphenyl iodide and 0–300 mM 2a; c, 50 mM 2-chloroquinoline and 0–250 mM 2a; d, 50 mM 3-boromoquinoline and 0–300 mM 2a.",
+    "bbox": [
+      [
+        160,
+        95,
+        833,
+        579
+      ]
+    ],
+    "page_idx": 36
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2. Oxidative quenching. a, Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}[\\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})]\\) recorded with increased concentration of 1a (0–100 mM). The peak marked with an asterisk (\\*) is the Raman signal of the solvent. b, Photoluminescence decay traces of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}[\\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})]\\) recorded with increased concentration of 1a (0–40 mM) at a wavelength of \\(540 \\mathrm{nm}\\) after picosecond pulsed laser photoexcitation of \\(377 \\mathrm{nm}\\) (pulse duration = 0.2 ns). c, Corresponding pseudo first-order kinetics analysis of the quenching rate as a function of added 1a. The quenching rate is calculated with the relationship rate = \\(1 / \\tau - 1 / \\tau_0\\) , where \\(\\tau\\) and \\(\\tau_0\\) are the observed photoluminescence lifetime of \\(50 \\mu \\mathrm{M}[\\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})]\\) in the presence and absence, respectively, of 1a. d, Photoluminescence ( \\(\\lambda_{\\mathrm{ex}} = 380 \\mathrm{nm}\\) ) spectra of Ar-saturated DMSO containing \\(50 \\mu \\mathrm{M}[\\mathrm{Au}(\\mathrm{BZI})(\\mathrm{TMCz})]\\) recorded with increased concentration of DIPEA (0–500 mM).",
+    "bbox": [
+      [
+        213,
+        88,
+        784,
+        525
+      ]
+    ],
+    "page_idx": 36
+  }
+]
\ No newline at end of file
diff --git a/04d582b40fff4ca72ea92fb6489e1caf504d7821023ce030e4a5dc7af0ffe859/peer_review/images_list.json b/04d582b40fff4ca72ea92fb6489e1caf504d7821023ce030e4a5dc7af0ffe859/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..617aef3bc489ac2693d38a06e1939c48eaf5dc58
--- /dev/null
+++ b/04d582b40fff4ca72ea92fb6489e1caf504d7821023ce030e4a5dc7af0ffe859/peer_review/images_list.json
@@ -0,0 +1,184 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure S1",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Figure 5 DPYD andTYMP are required for GSCs proliferation and self-renewal",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure S7. The IDH Status of Glioma could influence Immune and Metabolic Proteome",
+    "bbox": [
+      [
+        163,
+        120,
+        810,
+        833
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure 3 Proteomic Metabolism and Immune Subtypes of Glioma Could Predict Clinical Outcomes",
+    "bbox": [
+      [
+        172,
+        110,
+        850,
+        670
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure S7. The IDH Status of Glioma could influence Immune and Metabolic Proteome",
+    "bbox": [
+      [
+        165,
+        123,
+        808,
+        831
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Figure 5 DPYD andTYMP are required for GSCs proliferation and self-renewal",
+    "bbox": [
+      [
+        150,
+        120,
+        850,
+        844
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure S7. The IDH Status of Glioma could influence Immune and Metabolic Proteome",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure 3 Proteomic Metabolism and Immune Subtypes of Glioma Could Predict Clinical Outcomes",
+    "bbox": [
+      [
+        170,
+        168,
+        848,
+        722
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure S7",
+    "bbox": [
+      [
+        165,
+        125,
+        805,
+        830
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2 Proteomic Features Vary among Glioma Clinical Classifications",
+    "bbox": [],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure S7",
+    "bbox": [],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5B.jpg",
+    "caption": "Figure 5B. DPYD mRNA levels and protein levels in T4121 and Mes28 cells after knocking-down shows the efficiency higher than \\(50\\%\\) (Student's-t test, \\(\\mathrm{p}< 0.0001\\) ).",
+    "bbox": [
+      [
+        160,
+        191,
+        816,
+        494
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5F.jpg",
+    "caption": "Legend: Figure 5F. The phospho- H2A positive cell percentage is calculated, indicating increased DNA damage after DYPD knockdown (Student's-t test).",
+    "bbox": [
+      [
+        150,
+        90,
+        846,
+        355
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure S7",
+    "bbox": [
+      [
+        163,
+        125,
+        803,
+        832
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5K.jpg",
+    "caption": "Figure 5K",
+    "bbox": [
+      [
+        147,
+        316,
+        750,
+        838
+      ]
+    ],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4A.jpg",
+    "caption": "Figure 4A",
+    "bbox": [],
+    "page_idx": 35
+  }
+]
\ No newline at end of file
diff --git a/04e54a8171b4bd17627f1b2f4f9f0027e3a20ca26ff9e5bfcbb8c21daeee608b/peer_review/images_list.json b/04e54a8171b4bd17627f1b2f4f9f0027e3a20ca26ff9e5bfcbb8c21daeee608b/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0bcac340fc8ce9adee34473b001503f95dd88e99
--- /dev/null
+++ b/04e54a8171b4bd17627f1b2f4f9f0027e3a20ca26ff9e5bfcbb8c21daeee608b/peer_review/images_list.json
@@ -0,0 +1,205 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 c XRD patterns of NGA-COF synthesized and simulated.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1d.jpg",
+    "caption": "Fig. 1d Nitrogen adsorption-desorption isotherms of NGA-COF with corresponding pore size distribution inset.",
+    "bbox": [
+      [
+        147,
+        88,
+        528,
+        315
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Fig. 2. Simulated pore size of NGA-COF.",
+    "bbox": [
+      [
+        148,
+        406,
+        629,
+        628
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3c.jpg",
+    "caption": "Fig. 3c \\(k^2\\) -weighted FT-EXAFS spectra of Pt-foil, NGA-COF@Pt and PtO2.",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3e.jpg",
+    "caption": "Fig. 3e Corresponding EXAFS R space fitting curve of NGA-COF@Pt (Inset: Simulations models of NGA-COF@Pt).",
+    "bbox": [
+      [
+        150,
+        504,
+        525,
+        723
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4e.jpg",
+    "caption": "Fig. 4e High-resolution XPS spectra of \\(N\\) 1s of different samples.",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6d.jpg",
+    "caption": "Fig. 6d Zeta potential of NGA-COF and NGA-COF@Pt at different pH values.",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7b.jpg",
+    "caption": "Fig. 7b (old version) Schematic illustration of H intermediates adsorbed on the Pt site of NGA-COF@Pt-2H, which is easy to desorb. DEMS measurements of \\(H_{2}\\) , DH and \\(D_{2}\\) signals from the reaction products for D-labeled.",
+    "bbox": [],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Fig. 7 Schematic illustration and corresponding free energy diagram of HER over Pt site of a Pt (111) and b NGA-COF@Pt before and after optimizing by H\\* intermediates.",
+    "bbox": [
+      [
+        148,
+        208,
+        840,
+        445
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_16.jpg",
+    "caption": "Supplementary Fig. 16. a-d SEM images and e-f TEM images at different magnifications of NGA-COF@Pt after chronopotentiometric test in 0.5 M \\(H_{2}SO_{4}\\) .",
+    "bbox": [],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5e.jpg",
+    "caption": "Fig. 5e In-situ Raman spectra of NGA-COF@Pt at various potentials. Electrolyte: 0.5 \\(M H_{2}SO_{4}\\) .",
+    "bbox": [],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Fig. 6. a Magnified atomic-resolution HAADF-STEM image of NGA-COF@Pt. b Enlarged atomic-resolution HAADF-STEM image of NGA-COF@Pt and c corresponding distance between two bright spots (Pt atoms) in the red box. d Simulated distance between two adjacent Pt atoms in NGA-COF@Pt.",
+    "bbox": [],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Additional aberration-corrected HAADF-STEM images of NGA-COF@Pt.",
+    "bbox": [
+      [
+        147,
+        92,
+        722,
+        630
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary Fig. 3. a-c SEM images of \\(\\mathrm{TiO2NTs}\\) .",
+    "bbox": [
+      [
+        153,
+        758,
+        848,
+        873
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1a.jpg",
+    "caption": "Fig. 1a Schematic illustration of the synthesis of NGA-COF.",
+    "bbox": [
+      [
+        148,
+        199,
+        850,
+        350
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2d.jpg",
+    "caption": "Fig. 2d EDS mappings of NGA-COF@Pt and commercial 20 wt.% PtC for Pt elements. The alignment issue in Fig. 2d has been fixed according to the suggestion.",
+    "bbox": [
+      [
+        149,
+        202,
+        722,
+        483
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1d.jpg",
+    "caption": "Fig. 1d. Nitrogen adsorption–desorption isotherms of NGA-COF with corresponding pore size distribution inset.",
+    "bbox": [],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_37.jpg",
+    "caption": "Supplementary Fig. 37. Calculated TDOS of NGA-COF and NGA-COF@Pt.",
+    "bbox": [
+      [
+        171,
+        280,
+        525,
+        499
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5d.jpg",
+    "caption": "Fig. 5d EIS of different samples. Electrolyte: \\(0.5 \\text{M} \\text{H}_2\\text{SO}_4\\)",
+    "bbox": [
+      [
+        150,
+        545,
+        525,
+        772
+      ]
+    ],
+    "page_idx": 21
+  }
+]
\ No newline at end of file
diff --git a/050529daf1daf78ef8cedaf4674a0be73a105c7021e9dcbcfb5618448dc10399/peer_review/images_list.json b/050529daf1daf78ef8cedaf4674a0be73a105c7021e9dcbcfb5618448dc10399/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..697741742475d510e1745ffb4ff64554df51487d
--- /dev/null
+++ b/050529daf1daf78ef8cedaf4674a0be73a105c7021e9dcbcfb5618448dc10399/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure S1. (a) The four 3-fold axes of the cubic symmetry. (b) Orientations of the FA molecule such that its molecular dipole satisfies the 3-fold symmetry within the PbI \\(_6\\) cage. I, Pb, C, N, and H are shown in violet, white octahedra, brown, light blue, and pink, respectively.",
+    "bbox": [
+      [
+        130,
+        98,
+        872,
+        355
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure S3. Zoom on the final FAPbI3 structures starting from all-aligned (a) and pseudo-random (b) FA configurations after vc-relax. The Pb-I distances for two adjacent octahedra are highlighted. The typical \\(- \\theta /\\theta\\) tilting pattern of the octahedra can be seen in the pseudo-random case, while the all-aligned case shows a non-physical collective I-shift resulting in a tilting angle of \\(\\theta\\) for all octahedra. The reference system for the tilt angle and the tilting angles are shown in red. The color code is the same as in Fig.1.",
+    "bbox": [
+      [
+        130,
+        81,
+        865,
+        327
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure S4. Comparison of the total energy per unit cell between the all-aligned and pseudo-randomly oriented FA configurations for different supercells. On the x-axis, the number of atoms in the supercell and the k-point grid (e.g., \\(\\mathrm{k1 = 1 \\times 1 \\times 1}\\) k-point grid) are given. The all-aligned FA configurations (gray) are always higher in energy (less stable) and are set to \\(0 \\mathrm{eV}\\) for each supercell. The energies of the pseudo-randomly oriented FA configurations (blue) are given with respect to the corresponding value of the all-aligned ones.",
+    "bbox": [
+      [
+        267,
+        323,
+        725,
+        590
+      ]
+    ],
+    "page_idx": 17
+  }
+]
\ No newline at end of file
diff --git a/05076b04f05611927d832f0da3d4ffa4dcfd58c6fd3c8e741c288ede24fc3e8e/peer_review/images_list.json b/05076b04f05611927d832f0da3d4ffa4dcfd58c6fd3c8e741c288ede24fc3e8e/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..44314466e7174e4d64fe0e1c35be0cb78dd81938
--- /dev/null
+++ b/05076b04f05611927d832f0da3d4ffa4dcfd58c6fd3c8e741c288ede24fc3e8e/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1 Long-term stability of the CEP-SERS patch in \\(50\\mathrm{mM}\\) NaCl solution measured by SERS intensity of \\(1\\mu \\mathrm{M}\\) R6G.",
+    "bbox": [],
+    "page_idx": 2
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2 (a) Measured SERS Spectra of pH 4 buffer solution (blue), 1 μM R6G in the buffer solution (magenta), and 1 μM R6G after 1 hour immersion in the buffer solution (red). (b) pH stability of CEP-SERS patch under varying pH environment and (c) under varying immersion duration in pH 4 buffer solution evaluated by 1 μM R6G SERS intensity measurement at 1365 cm-1.",
+    "bbox": [
+      [
+        186,
+        466,
+        814,
+        628
+      ]
+    ],
+    "page_idx": 3
+  }
+]
\ No newline at end of file
diff --git a/051d508d2527ceb90efdf6ed26b621b83537910322d956a72866bd26be024ca3/peer_review/images_list.json b/051d508d2527ceb90efdf6ed26b621b83537910322d956a72866bd26be024ca3/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/051d508d2527ceb90efdf6ed26b621b83537910322d956a72866bd26be024ca3/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/05225d17b4449ec0559648b67741e3748a3e400b9813ff34e06b11744539c34d/peer_review/images_list.json b/05225d17b4449ec0559648b67741e3748a3e400b9813ff34e06b11744539c34d/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..be2ea03468d76e00d6d2210c5edb60c7ec578bc6
--- /dev/null
+++ b/05225d17b4449ec0559648b67741e3748a3e400b9813ff34e06b11744539c34d/peer_review/images_list.json
@@ -0,0 +1,72 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. R1. Comparing geographical patterns of SST over the two warming phases. Panels A, B, D and E use the same colour scale, highlighting how cooler habitats disappeared from the region over time. Panels C and F use the same colour scale, highlighting how mean warming may have been greatest in northern regions (note that panel C does not capture rapid warming over the stage boundary at this temporal resolution). These (sub)zones cover the range of temperature values of the main \\(\\mathrm{CO_2}\\) scenario, from Spinatum at 400 ppm to Exaratum at 1000 ppm (see Table 2 and global maps, Fig. S8, for additional scenarios). For comparison with Fig. 1, these show the Toarcian paleogeography (i.e. maximum sea-level coastlines for the study interval). The coverage of occurrences per (sub)zone is shown (A, B, D, E only) using the same colouration as Fig. 1.",
+    "bbox": [
+      [
+        115,
+        90,
+        925,
+        644
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. R2. Boxplots of modelled seawater temperatures (SST) at regional sampled occurrences, rather than over the entire coverage of the region. This highlights how sampling can exacerbate or compensate for modelled changes in regional temperature, resulting in observed changes slightly different to the original modelled changes (via CLIMBER-X). Panels are the region names plotted approximately according to paleocoordinates, with N, E and W being abbreviations of north, east and west. X-axis labels are abbreviations of the ammonite (sub)zones, through Margaritatus, Spinatum, Tenuicostatum, Exaratum, Falciferum, and Bifrons.",
+    "bbox": [
+      [
+        115,
+        92,
+        840,
+        610
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. R3. Boxplots of regional sampled occurrences paleolatitudes (plat) in the Toarcian (Toa). Assuming higher latitudes are cooler and lower latitudes are warmer, this highlights how sampling can exacerbate or compensate for modelled changes in regional temperature. Some of the observed temperature changes in Fig. R2 are likely because of changes in sampling paleolatitude, rather than changes in modelled regional temperature. See Fig. R2 for further details.",
+    "bbox": [
+      [
+        120,
+        99,
+        830,
+        545
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R4. Sea surface temperature estimates (in \\(^\\circ \\mathrm{C}\\) , scale bar on right) of the 400 ppm \\(\\mathrm{CO_2}\\) scenario with the Toarcian paleogeography (180 Ma), showing the original CLIMBER-X output (top panel), the data downscaled by nearest neighbour values (middle), and the data downscaled by bilinear interpolation (lower). Downscaling is to the same resolution as the HadCM3 model, which is quantitatively demonstrated to produce similar temperature features as the CLIMBER-X model.",
+    "bbox": [
+      [
+        123,
+        92,
+        820,
+        555
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R5. Sea surface temperature estimates (in \\(^\\circ \\mathrm{C}\\) , scale bar on right) of the 1000ppm \\(\\mathrm{CO_2}\\) scenario with the Toarcian paleogeography (180 Ma). Further details as in Fig. R4.",
+    "bbox": [
+      [
+        125,
+        92,
+        822,
+        558
+      ]
+    ],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/055c635ef5ff7a481cce5739a3e68be679d4efd18c3744431eaf8e18a25f3f77/peer_review/images_list.json b/055c635ef5ff7a481cce5739a3e68be679d4efd18c3744431eaf8e18a25f3f77/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ace98b679cef2d0c0dcd37ca011928a7c4eb51d2
--- /dev/null
+++ b/055c635ef5ff7a481cce5739a3e68be679d4efd18c3744431eaf8e18a25f3f77/peer_review/images_list.json
@@ -0,0 +1,16 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig 1. Containers used for Oxitec V 2.0 fsRIDL egg releases in Florida (2021). Eggs are hatched in water and males fly out of the holes. A similar container can be used for pgSIT - requiring the males to FLY out - preventing any surviving flightless females (most die on the surface of the water due to lack of flight) from even entering the environment.",
+    "bbox": [
+      [
+        115,
+        144,
+        880,
+        540
+      ]
+    ],
+    "page_idx": 15
+  }
+]
\ No newline at end of file
diff --git a/057e2e27efee7373cf5b78cfff39555b737e598a4088a3ff490826cd25e121be/peer_review/images_list.json b/057e2e27efee7373cf5b78cfff39555b737e598a4088a3ff490826cd25e121be/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/057e2e27efee7373cf5b78cfff39555b737e598a4088a3ff490826cd25e121be/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/059a54d253ab5af79d48ff1a3f02886f0511ffb2444cb09d7b8ed598ea46c8cb/peer_review/images_list.json b/059a54d253ab5af79d48ff1a3f02886f0511ffb2444cb09d7b8ed598ea46c8cb/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..7aaf2da2a282cdfa072d5942d93e8641841b0e0a
--- /dev/null
+++ b/059a54d253ab5af79d48ff1a3f02886f0511ffb2444cb09d7b8ed598ea46c8cb/peer_review/images_list.json
@@ -0,0 +1,37 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "I appreciate the careful analysis and testing of both N and C tagging, but I would simplify figure 3 and make it smaller. I have three suggestions:",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5a.jpg",
+    "caption": "In Figure 5a, I have problems seeing the path for the DNA. The figure might suffer from the PDF conversion, but also, the electrostatic surface potential makes it challenging to see.",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig 1. While I have no concerns with the conclusions presented by the authors, the layout of the cropped gels in Fig 1 are somewhat disorienting – specifically when the width of the gels differs in a single panel (e.g. panel b). Additionally, the cropping of the final two gels in panel e appears to be a bit aggressive. The full gels included as source data provide essential and reassuring context. I don’t have specific suggestions for how to improve the figure, but I encourage the authors to consider adjustments to improve readability.",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_4.jpg",
+    "caption": "New Supplementary Figure 4:",
+    "bbox": [
+      [
+        113,
+        78,
+        875,
+        853
+      ]
+    ],
+    "page_idx": 10
+  }
+]
\ No newline at end of file
diff --git a/05bf643a9d532f9bf0fa15baf0d9ab972ffa3fc6f3d979b4a60cf0f537b0972d/peer_review/images_list.json b/05bf643a9d532f9bf0fa15baf0d9ab972ffa3fc6f3d979b4a60cf0f537b0972d/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/05bf643a9d532f9bf0fa15baf0d9ab972ffa3fc6f3d979b4a60cf0f537b0972d/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/05cdd05c8033f50c5d58d58f81996f649b1fce4c208692e95be55fcdb4c8a5aa/peer_review/images_list.json b/05cdd05c8033f50c5d58d58f81996f649b1fce4c208692e95be55fcdb4c8a5aa/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..a37e3df2bce5db89fef6e040c58f53882809ea12
--- /dev/null
+++ b/05cdd05c8033f50c5d58d58f81996f649b1fce4c208692e95be55fcdb4c8a5aa/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2. The developmental changes of cortical MI and HFO at given lobes. a \\(\\mathrm{MI}^{80\\mathrm{Hz}}\\) & 0.5-1 Hz denotes the strength of coupling between the amplitude of \\(\\mathrm{HFO}^{80\\mathrm{Hz}}\\) and the phase of slow-wave0.5-1 Hz, as rated by modulation index. b Occurrence rate (/min) of \\(\\mathrm{HFO}_{\\mathrm{HIL}}^{80\\mathrm{Hz}}\\) as defined by the Hilbert method. In each violin plot, a regression line is provided based on a model incorporating the square root of age ( \\(\\sqrt{\\mathrm{age}}\\) ) as an independent variable. The white circle within each violin plot represents the median.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2. The developmental changes of cortical MI and HFO at given lobes. a \\(\\mathrm{MI}_{\\geq 80\\mathrm{Hz}}\\) & 0.5-1 \\(\\mathrm{Hz}\\) denotes the strength of coupling between the amplitude of \\(\\mathrm{HFO}_{\\geq 80\\mathrm{Hz}}\\) and the phase of slow-wave0.5-1 \\(\\mathrm{Hz}\\) , as rated by modulation index. b Occurrence rate (/min) of \\(\\mathrm{HFO}_{\\mathrm{HIL}_{\\geq 80\\mathrm{Hz}}}\\) as defined by the Hilbert method. In each violin plot, a regression line is provided based on a model incorporating the square root of age ( \\(\\sqrt{\\mathrm{age}}\\) ) as an independent variable. The white circle within each violin plot represents the median.",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Figure 5. Dynamic tractography. The video snapshots present the varying intensity of a co-growth of \\(\\mathrm{MI} \\geq 80 \\mathrm{~Hz}\\) & \\(0.5 - 1 \\mathrm{~Hz}\\) and \\(\\mathbf{b}\\) co-diminution of HFOHIL \\(\\geq 80 \\mathrm{~Hz}\\) at ages 1, 5, 10, and 20 years, as estimated by univariate regression analysis incorporating 'lage as an independent variable. Supplementary Movies 4-5 show the data across generations from 1 to 21 years. The brain images in this figure were created using FreeSurfer (https://surfer.nmr.mgh.harvard.edu/fswiki/CorticalParcellation).",
+    "bbox": [],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/05d4b9f2850394e9266c31450e9dda48f8747cd9d03b3709c218ddce72f9a01d/peer_review/images_list.json b/05d4b9f2850394e9266c31450e9dda48f8747cd9d03b3709c218ddce72f9a01d/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..319a0986f18d6c219604b70f5f26272428f85c8c
--- /dev/null
+++ b/05d4b9f2850394e9266c31450e9dda48f8747cd9d03b3709c218ddce72f9a01d/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Dash lines represent intramolecular H-bonding",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/064d527fad7716c8fc035b281d94ad0c0f3efc69fc8d0100b12f56fb6a277f4e/peer_review/images_list.json b/064d527fad7716c8fc035b281d94ad0c0f3efc69fc8d0100b12f56fb6a277f4e/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..1c848d0f6d62d5c4b5e0ade3b861a0dedc0637ab
--- /dev/null
+++ b/064d527fad7716c8fc035b281d94ad0c0f3efc69fc8d0100b12f56fb6a277f4e/peer_review/images_list.json
@@ -0,0 +1,86 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Rebuttal Figure 1. Volcano plots summarising results of RNAseq performed on whole skin from ears and tails of affected Ikkb<sup>mut/mut</sup> and Ikkb<sup>WT</sup> mice. Genes implicated in psoriasis (S100a8, S100a9, Defb4, Tnf, Il36a, Il36g, Nos2, Ccl20, Ccl2, Il1B, Cxcl9, Il23a) are labelled. Th2-related genes that have been noted in AD are also shown as they are either downregulated (Il34) or not significantly different (Ccl24, Ccr4, Ccl17).",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Rebuttal Figure 2. Analysis of \\(\\mathrm{CD4 + }\\) T cells recovered from ears, tail and back skin.",
+    "bbox": [
+      [
+        123,
+        98,
+        868,
+        227
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Rebuttal Figure 3. Sorted naive T cells (CD4+ CD4+ CD62L+ GFP-cells) from \\(Ikkb^{WT}x\\) \\(Foxp3^{\\mathrm{GFP}}\\) (top panel) or \\(Ikkb^{mut / mut}x\\) \\(Foxp3^{\\mathrm{GFP}}\\) mice (lower panel) were injected intravenously into \\(Rag1^{- / - }\\) recipient mice (n=3 per genotype). At 8 weeks post-transfer, blood was collected from each mouse and analysed by flow cytometry. Donor CD4+ T cells are shown in Q1 and those that have upregulated Foxp3 (GFP) are shown in Q2.",
+    "bbox": [
+      [
+        137,
+        93,
+        753,
+        263
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Rebuttal Figure 4. Tregs (GFP+) and conventional T cells (GFP-) were isolated from \\(Ikkb^{mut / mut}x\\) \\(Foxp3^{\\mathrm{GFP}}\\) mice, stimulated in vitro with anti-CD3+antiCD28, then harvested and analysed on day 3 for GFP expression.",
+    "bbox": [
+      [
+        123,
+        479,
+        707,
+        737
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Rebuttal Figure 6. Appearance of back skin from mice of indicated genotypes.",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Rebuttal Figure 7. Quantification of Foxp3+ cells from lesional skin",
+    "bbox": [
+      [
+        120,
+        533,
+        870,
+        690
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Rebuttal Figure 8. Analysis of cell-intrinsic action of IKK2 by construction of mixed bone marrow chimeras. Irradiated \\(Rag1^{-/ - }\\) mice were reconstituted with 50:50 mixtures of CD45-allotype marked donor bone marrow from \\(Ikbk^{WT}\\) , \\(Ikbk^{b/mut}\\) or \\(Ikbk^{b/mut/mut}\\) mice. Foxp3+ Tregs were analysed 8 weeks after reconstitution according to allotype of donor origin. Results are pooled from two identical experiments.",
+    "bbox": [
+      [
+        128,
+        90,
+        699,
+        280
+      ]
+    ],
+    "page_idx": 10
+  }
+]
\ No newline at end of file
diff --git a/067df0eb8137db0da746a790e0e613cd07272687c57489dcca1d3a758dbb2277/peer_review/images_list.json b/067df0eb8137db0da746a790e0e613cd07272687c57489dcca1d3a758dbb2277/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..26a15dd3ef8ca84c28f3d51a3b307aa65bf95be7
--- /dev/null
+++ b/067df0eb8137db0da746a790e0e613cd07272687c57489dcca1d3a758dbb2277/peer_review/images_list.json
@@ -0,0 +1,51 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Bone mineral density",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Hip fracture",
+    "bbox": [
+      [
+        504,
+        113,
+        803,
+        430
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Coronary artery disease",
+    "bbox": [
+      [
+        123,
+        544,
+        426,
+        868
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Type 2 diabetes",
+    "bbox": [
+      [
+        504,
+        544,
+        803,
+        868
+      ]
+    ],
+    "page_idx": 19
+  }
+]
\ No newline at end of file
diff --git a/06b1630909e8e227d7da602a7a917bcb78d8a8e2df2080ead1f389e367c0558e/peer_review/images_list.json b/06b1630909e8e227d7da602a7a917bcb78d8a8e2df2080ead1f389e367c0558e/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..a60205f3b6453e8948aaeb419bebbe33d7bd028d
--- /dev/null
+++ b/06b1630909e8e227d7da602a7a917bcb78d8a8e2df2080ead1f389e367c0558e/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Comparison of colonines from stlP-overexpressed and complemented strains. (A) Colonies of the wild-type strain (M145), M145 overexpressing StlP (M145+pXZ15), and the complemented stlP mutants created by transposon mutagenesis (ΔstlP+pXZ15) or gene replacement (ΔstlPFL+pXZ15). All strains contain plasmid pXZ15, which expresses stlP from constitutive gapAp promoter. For each strain, approximately 100 spores were plated on LPMA plate and incubated 5 days at 30 °C before imaging. (B) Quantitative assessment of colony diameters. The average diameters are: 3.8±0.6 mm (M145), 2.5±0.5 mm (ΔstlP+pXZ15), 2.5±0.2 mm (ΔstlPFL+pXZ15), and 3.35±0.38 mm (M145+pXZ15). Please note that the colony size of wild-type strain is significantly reduced by overexpression of StlP. Error bars represent the standard error of the mean (*, 0.01<P<0.05).",
+    "bbox": [],
+    "page_idx": 7
+  }
+]
\ No newline at end of file
diff --git a/06bffe0e66fe9b7bc88c34f124ac1a5025fa53d58d4be56435974a852e35e681/peer_review/images_list.json b/06bffe0e66fe9b7bc88c34f124ac1a5025fa53d58d4be56435974a852e35e681/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/06bffe0e66fe9b7bc88c34f124ac1a5025fa53d58d4be56435974a852e35e681/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0881102f92b71ddf7f1d973c580e2e057a1c1d457488b491ccfa9270b62ba04a/peer_review/images_list.json b/0881102f92b71ddf7f1d973c580e2e057a1c1d457488b491ccfa9270b62ba04a/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0881102f92b71ddf7f1d973c580e2e057a1c1d457488b491ccfa9270b62ba04a/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0888d3fec0a1094130c8c2a1244d52b0adc8f316523c3adf225186b1448e15f5/peer_review/images_list.json b/0888d3fec0a1094130c8c2a1244d52b0adc8f316523c3adf225186b1448e15f5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..30d3330fcaadf5e897c5565b8814b93041747d34
--- /dev/null
+++ b/0888d3fec0a1094130c8c2a1244d52b0adc8f316523c3adf225186b1448e15f5/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1: Possible mechanisms of cancer development in psoriasis patients",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/08aebf361b3e6167428945ee0469ab84c7465d77a1439e9b4f1c63b73651dcd4/peer_review/images_list.json b/08aebf361b3e6167428945ee0469ab84c7465d77a1439e9b4f1c63b73651dcd4/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..762ad9fa7666f531dd648ccb39019282200998dc
--- /dev/null
+++ b/08aebf361b3e6167428945ee0469ab84c7465d77a1439e9b4f1c63b73651dcd4/peer_review/images_list.json
@@ -0,0 +1,72 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Collective movement of UrNMs in \\(200~\\mathrm{mM}\\) urea that is dispersed in acetate buffer. (a) A time-lapse sequence of images that show the collective movement of UrNMs in \\(200~\\mathrm{mM}\\) urea in acetate buffer. (b) Velocity analysis of UrNMs particulate in PBS buffer and in acetate buffer. The significant difference is analyzed by student's t-test: \\(^{**}\\mathrm{P}< 0.01\\) . \\(\\mathrm{N} = 5\\) .",
+    "bbox": [
+      [
+        316,
+        201,
+        675,
+        460
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2b. Trajectory tracking of the UrNMs in collective movement. (b) and (f) depict one-second-long trajectories during a spreading stage. (c) and (g) show one-second-long trajectories during a sinking stage. (d) and (e) display four-second-long trajectories during a swirling stage in urea. The blue and green color-coded trajectories indicate counterclockwise and clockwise directions of UrNMs on the left and right sides of the chamber, respectively. \\(N = 15\\) .",
+    "bbox": [
+      [
+        118,
+        376,
+        884,
+        551
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R4. Enzymatic activity of UrNMs after treatment in simulated urine or urine from mice for 30 min. (a) The real-time UV-vis light absorbance of phenol red solutions containing 200 mM urea and treated UrNMs. In the control group, the UrNMs were mixed with PBS solution. (b) The specific enzymatic activity of UrNMs after treatment. Significant difference is analyzed by students' t-test: \\(\\star \\star \\star = \\mathsf{P} < 0.001\\) ; ns = not significant \\((P > 0.05)\\) . \\(\\mathsf{N} = 3\\)",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R6. Convective dynamics of CatNMs. A time-lapse sequence of images that show the directional and collective movement of CatNMs in \\(100mM\\mathsf{H}_2\\mathsf{O}_2\\) . Scale bar: \\(4mm\\) .",
+    "bbox": [],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. R1 Collective motion of UrNMs/MSNPs indicated by colour change. A time-lapse sequence of images shows the directional and collective movement of (a) UrNMs in urea with phenol red and (b) MSNPs in urea with phenol red. Scale bar: 4 mm.",
+    "bbox": [
+      [
+        118,
+        583,
+        877,
+        677
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. R2 Motion analysis of UrNMs in urea with varying NaCl concentrations. (a) Mean square displacement (MSD) of UrNMs in \\(50~\\mathrm{mM}\\) urea solutions with different NaCl concentrations (0.05, 0.5, 5, 25 and \\(50~\\mathrm{mM}\\) ), analyzed by tracking 20 particles. (b) The diffusion coefficient of the nanomotors at each condition was determined. Ionic self-diffusiophoresis is a plausible explanation, as the ionic species have different diffusivities. These differences between the cations and anions lead to the generation of local electric fields and double-layer polarization around the particle, initiating its motion. Consequently, increasing the ionic strength in the medium inhibits the formation of a concentration gradient, thereby reducing the self-propulsion of the nanomotors.",
+    "bbox": [
+      [
+        142,
+        145,
+        857,
+        360
+      ]
+    ],
+    "page_idx": 26
+  }
+]
\ No newline at end of file
diff --git a/08c99ee7ca75d50af4d6934f96f90513a2dc9b59d917f22d4ce6f57eb222af23/peer_review/images_list.json b/08c99ee7ca75d50af4d6934f96f90513a2dc9b59d917f22d4ce6f57eb222af23/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/08c99ee7ca75d50af4d6934f96f90513a2dc9b59d917f22d4ce6f57eb222af23/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0944c67707575528e5b0b90844d0835daa9bc0e7b8dcb4d47e6dd8c6cdb05e16/peer_review/images_list.json b/0944c67707575528e5b0b90844d0835daa9bc0e7b8dcb4d47e6dd8c6cdb05e16/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..2ca266a214abe3b2e0a09372c07cc30295a447ab
--- /dev/null
+++ b/0944c67707575528e5b0b90844d0835daa9bc0e7b8dcb4d47e6dd8c6cdb05e16/peer_review/images_list.json
@@ -0,0 +1,275 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. R1. The schematic drawing of enhanced repulsive force between \\*OOH and \\(\\mathrm{N_4}\\) .",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. R2. ORR polarization curves in 0.1 M KOH before and after the addition of 1 mM SCN⁻.",
+    "bbox": [
+      [
+        277,
+        92,
+        695,
+        330
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. R3. (a) Fourier transformation of EXAFS spectra of CoPc, Co foil, CoPc-O-COF, and CoPc-S-COF. (b) The EXAFS fitting results of CoPc-O-COF, CoPc-S-COF and CoPc.",
+    "bbox": [
+      [
+        168,
+        149,
+        831,
+        355
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. R4. Co K-edge XANES spectra of CoPc, CoPc-O-COF, CoPc-S-COF, and Co foil.",
+    "bbox": [
+      [
+        303,
+        496,
+        684,
+        727
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. R5. (a) The visualized scheme of the uniform conjugated system of CoPc-S-COF (top) and CoPc-O-COF (bottom). The schematic diagram of the uniform conjugated system in top/side/bottom view for (b) CoPc-S-COF and (c) CoPc-O-COF.",
+    "bbox": [
+      [
+        147,
+        112,
+        850,
+        330
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. R6 Pore volume and pore size distribution of (a) CoPc-O-COF and (b) CoPc-S-COF.",
+    "bbox": [
+      [
+        150,
+        555,
+        848,
+        740
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. R7 Tafel plots of CoPc-O-COF, CoPc-S-COF, and CoPcF16.",
+    "bbox": [
+      [
+        315,
+        355,
+        675,
+        560
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. R8 Mass activity of CoPc-O-COF and CoPc-S-COF.",
+    "bbox": [
+      [
+        308,
+        105,
+        668,
+        312
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Fig. R9 ORR polarization curves in \\(0.1\\mathrm{M}\\) KOH before and after the addition of 1 and \\(25\\mathrm{mM}\\) SCN-",
+    "bbox": [
+      [
+        304,
+        225,
+        663,
+        422
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Fig. R10 PXRD patterns of (a) CoPc-S-COF and (b) CoPc-O-COF after immersion in different solutions.",
+    "bbox": [
+      [
+        152,
+        248,
+        827,
+        456
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Fig. R1. (a) LSVs of CoPc-S-COF at 1600 rpm in \\(\\mathrm{O}_2\\) -saturated 0.1 M KOH with or without salt bridge. (b) \\(\\mathrm{H}_2\\mathrm{O}_2\\) selectivity and electron transfer number \\(n\\) of CoPc-S-COF with or without salt bridge.",
+    "bbox": [
+      [
+        130,
+        477,
+        866,
+        690
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Fig. R2. (a) Fourier transform of EXAFS spectra of CoPc, Co foil, CoPc-O-COF, and CoPc-S-COF. (b) The EXAFS fitting results of CoPc-O-COF, CoPc-S-COF and CoPc.",
+    "bbox": [
+      [
+        178,
+        344,
+        825,
+        548
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "Fig. R3. The Co \\(k^{3}\\) -weighted \\(K\\) -space spectra of CoPc-O-COF, CoPc-S-COF, and CoPc.",
+    "bbox": [
+      [
+        300,
+        627,
+        690,
+        870
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Fig. R4. The Co K-edge XANES spectra of (a) CoPc-O-COF and (d) CoPc-S-COF before and after stability tests. The EXAFS fitting results of (b) CoPc-O-COF and (e) CoPc-S-COF before and after stability tests. The Co \\(k^3\\) -weighted \\(K\\) -space spectra of (c) CoPc-O-COF and (f) CoPc-S-COF before and after stability tests.",
+    "bbox": [
+      [
+        130,
+        120,
+        875,
+        409
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Fig. R5. TEM and HR-TEM images of (a, b, e, f) CoPc-O-COF and (c, d, g, h) CoPc-S-COF before and after soaking into \\(3\\% \\mathrm{H}_2\\mathrm{O}_2\\) solution for three days.",
+    "bbox": [
+      [
+        123,
+        316,
+        870,
+        583
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Fig. R6. FT-IR spectra of (a) CoPc-O-COF and (b) CoPc-S-COF before and after soaking into \\(3\\% \\mathrm{H}_2\\mathrm{O}_2\\) solution for three days.",
+    "bbox": [
+      [
+        133,
+        640,
+        833,
+        857
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Fig. R7. (a) ORR polarization curves of CoPc-S-COF and CoPc-O-COF in 0.1 M KOH before and after the addition of 1, 5, and 25 mM SCN. (b) ORR polarization curves of the metal free H2PcF16 electrode as well as CoPc-S-COF and CoPc-O-COF in 0.1 M KOH.",
+    "bbox": [
+      [
+        122,
+        512,
+        864,
+        731
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_17.jpg",
+    "caption": "Fig. R8. \\(\\mathrm{H}_2\\mathrm{O}_2\\) electroproduction in flow cell with \\(1\\mathrm{M}\\mathrm{Na}_2\\mathrm{SO}_4\\) electrolyte. (a) LSV of CoPc-S-COF in flow cell. (b) The chronoamperometry measurements at varied applied voltages of CoPc-S-COF. (c) \\(\\mathrm{FE}_{\\mathrm{H}_2\\mathrm{O}_2}\\) of CoPc-S-COF at varied applied voltages. (e) \\(\\mathrm{H}_2\\mathrm{O}_2\\) yields of CoPc-S-COF under a current density of \\(100\\mathrm{mA}\\mathrm{cm}^{-2}\\) . (d) Chronopotentiometry curve at a current density of \\(100\\mathrm{mA}\\mathrm{cm}^{-2}\\) and the corresponding \\(\\mathrm{FE}_{\\mathrm{H}_2\\mathrm{O}_2}\\) in the flow cell for CoPc-S-COF.",
+    "bbox": [
+      [
+        130,
+        321,
+        858,
+        597
+      ]
+    ],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_18.jpg",
+    "caption": "Fig. R9. (a, d) Schematic synthesis of the model molecules. (b, e) Molecular and (c, f) packing structure of the model molecules in their single crystals. C, H, and S are displayed in grey, white, and yellow, respectively.",
+    "bbox": [
+      [
+        223,
+        163,
+        780,
+        528
+      ]
+    ],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_19.jpg",
+    "caption": "Fig. R10. Co L₂, 3-edge XANES spectra of CoPc-O-COF and CoPc-S-COF.",
+    "bbox": [
+      [
+        312,
+        283,
+        678,
+        488
+      ]
+    ],
+    "page_idx": 29
+  }
+]
\ No newline at end of file
diff --git a/095469cfb060397b6035b406f7d7d0172ce5667468268642908fd0837d74b800/peer_review/images_list.json b/095469cfb060397b6035b406f7d7d0172ce5667468268642908fd0837d74b800/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..cfaa8d300fe76d2b5f288d7baf88807220bdc388
--- /dev/null
+++ b/095469cfb060397b6035b406f7d7d0172ce5667468268642908fd0837d74b800/peer_review/images_list.json
@@ -0,0 +1,16 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Old Figure 2",
+    "bbox": [
+      [
+        115,
+        88,
+        725,
+        386
+      ]
+    ],
+    "page_idx": 12
+  }
+]
\ No newline at end of file
diff --git a/096f68b6c3d806b969c69bed1e41f06bd80db5156ede8c7cd6984ab2b966a978/peer_review/images_list.json b/096f68b6c3d806b969c69bed1e41f06bd80db5156ede8c7cd6984ab2b966a978/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/096f68b6c3d806b969c69bed1e41f06bd80db5156ede8c7cd6984ab2b966a978/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/09e2f6d8368f45f241148534f7e3b1c2e7e38ac3b1a679c3a67f2969c7c46037/peer_review/images_list.json b/09e2f6d8368f45f241148534f7e3b1c2e7e38ac3b1a679c3a67f2969c7c46037/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..58fdba3c54b6965af91798079062288ec6044b24
--- /dev/null
+++ b/09e2f6d8368f45f241148534f7e3b1c2e7e38ac3b1a679c3a67f2969c7c46037/peer_review/images_list.json
@@ -0,0 +1,184 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1 Illustration of the preparation of the HS/DAC complex and HS/DAC coating.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2 (a) Zeta Potentials of free HS, DAC and HS/DAC complex. (b) Surface potentials of TPU films with and without coatings. (c) Molecular structures and in vitro antimicrobial properties of DA/QAC model complex with neutralizing charge.",
+    "bbox": [
+      [
+        191,
+        92,
+        821,
+        469
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R3 The water contact angles (a), ATR-FTIR spectra (b) and XPS (c) of bare films and HS/DAC coated films before and after treated with saline solution \\((n = 6)\\) . (d) Salt-triggered adaptive dissociation and its antibacterial and antithrombotic mechanism of HS/DAC coating. \\(\\mathrm{***}p< 0.001\\) .",
+    "bbox": [
+      [
+        186,
+        90,
+        795,
+        710
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R4 Agar plate colony counting assay of the blood pretreated bare films and the blood pretreated coated films, \\(\\mathrm{n} = 4\\) . \\(***p< 0.001\\) .",
+    "bbox": [
+      [
+        312,
+        133,
+        686,
+        350
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R5 (a) Photographs of the thrombi on the surface of samples and cross-sectional observation of the samples. (b) Quantitative analysis of samples before and after circulation \\((n = 4)\\) . \\(***p< 0.001\\) , \\(**p< 0.01\\) .",
+    "bbox": [
+      [
+        186,
+        308,
+        821,
+        595
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R6 Evaluation of the anti-thrombotic ability of the HS/DAC coating in vitro and in vivo. (a) Anti-FXa and (b) anti-FIIa assays of the bioactivity of heparin on the HS/DAC-coated TPU (n = 3). (c) Amounts of BSA absorbed on bare and HS/DAC-coated TPU, as determined by a BCA protein assay kit (n = 9). (d) CLSM images of Fg adhesion, activation and leukocyte adhesion on the surface of bare catheters and HS/DAC-coated catheters. (e) Schematics of the antithrombotic mechanism of HS/DAC-coated catheters. (f) Digital and SEM images of the thrombus on the bare and HS/DAC-coated CVC catheters in the acute canine model in vivo. (g) Process by which the electrostatic interaction of the HS/DAC coating dissociates and",
+    "bbox": [
+      [
+        185,
+        87,
+        790,
+        691
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure R7 a Colony count of the HS/DAC coatings to S. aureus and E. coli. b Antibacterial activity of the HS/DAC coatings against S. aureus and E. coli. c Zone of inhibition tests of bare and HS/DAC coated TPU films \\((n = 4)\\) . \\(***p< 0.001\\) .",
+    "bbox": [
+      [
+        202,
+        144,
+        808,
+        327
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure R8 Antibiofilm activity of the coating. (a)Agar plate colony counting assay and (b) SEM images of the bare TPU and (HS/DAC)-TPU incubated with bacteria for 48 h \\(\\mathrm{(n = 3)}\\) . (c) Images of catheters and live bacteria adhering to the inner surfaces of the catheters and PVC tubes in flow conditions at different times. \\(***p< 0.001\\)",
+    "bbox": [
+      [
+        218,
+        160,
+        780,
+        597
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure R9 Molecular structures and in vitro antimicrobial properties of DA/QAC model complex with neutralizing charge.",
+    "bbox": [
+      [
+        191,
+        84,
+        810,
+        267
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Figure R10 a The multi-channel circulation model of long-term stability underflow. b. Thrombosis on the surface of the coating after flowing at \\(0 \\mathrm{s}^{-1}\\) , \\(30 \\mathrm{s}^{-1}\\) and \\(300 \\mathrm{s}^{-1}\\) for 30 days. c The corresponding thrombus mass changes. d The colony count of HS/DAC coating after flowing at \\(0 \\mathrm{s}^{-1}\\) , \\(30 \\mathrm{s}^{-1}\\) and \\(300 \\mathrm{s}^{-1}\\) for 30 days. e The corresponding antibacterial rate. f The staining and SEM images of the HS/DAC coating with high speed water impact. g The corresponding thrombus mass changes. h The corresponding antibacterial rate.",
+    "bbox": [
+      [
+        243,
+        215,
+        763,
+        593
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_19.jpg",
+    "caption": "Supplementary Fig. 19 (a) Cell viability of bare, HS/QAC and HS/DAC-coated TPU via extraction mode \\((n = 8)\\) and contact mode \\((n = 3 - 4)\\) .",
+    "bbox": [
+      [
+        180,
+        386,
+        777,
+        586
+      ]
+    ],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Figure R1 The content of S element in the extraction solution of the bare TPU and HS/DAC coated TPU \\((n = 3)\\) .",
+    "bbox": [
+      [
+        348,
+        85,
+        650,
+        265
+      ]
+    ],
+    "page_idx": 38
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3c.jpg",
+    "caption": "Fig. 3c Amounts of BSA absorbed on bare and HS/DAC-coated TPU. The sample was immersed in BSA solution and the adsorption of proteins was determined by a BCA protein assay kit \\(\\mathrm{(n = 9)}\\) .",
+    "bbox": [
+      [
+        305,
+        583,
+        660,
+        783
+      ]
+    ],
+    "page_idx": 40
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4i.jpg",
+    "caption": "Fig. 4i The long-term antibacterial stability of HS/DAC coating in artificial blood with shear rates of 0, 30, and \\(300 \\mathrm{~s}^{-1}\\) after 30 days of flow (n = 4).",
+    "bbox": [],
+    "page_idx": 52
+  }
+]
\ No newline at end of file
diff --git a/0a1b75e49f103cdf8d52a64e9c6d04b4fe6a41db65bf68a4ee14e89a66f058c4/peer_review/images_list.json b/0a1b75e49f103cdf8d52a64e9c6d04b4fe6a41db65bf68a4ee14e89a66f058c4/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0a1b75e49f103cdf8d52a64e9c6d04b4fe6a41db65bf68a4ee14e89a66f058c4/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0a341ed850ec9151cf2cfa046f9e77fd255dd63ae5c07e37348211f2cd01cb62/peer_review/images_list.json b/0a341ed850ec9151cf2cfa046f9e77fd255dd63ae5c07e37348211f2cd01cb62/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0a341ed850ec9151cf2cfa046f9e77fd255dd63ae5c07e37348211f2cd01cb62/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0a452ed82ebb3f09ae511e44394209155f62dae83c1c2f2edba89664bbf318cb/peer_review/images_list.json b/0a452ed82ebb3f09ae511e44394209155f62dae83c1c2f2edba89664bbf318cb/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0a452ed82ebb3f09ae511e44394209155f62dae83c1c2f2edba89664bbf318cb/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0a6b8025fe63ede42bbc75764a31f72c0e5e57a292ccb22e0161a2c8d90351c2/peer_review/images_list.json b/0a6b8025fe63ede42bbc75764a31f72c0e5e57a292ccb22e0161a2c8d90351c2/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0a6b8025fe63ede42bbc75764a31f72c0e5e57a292ccb22e0161a2c8d90351c2/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0a6c94dfbac671fb686117770b978806da70c70e41c33003bc81f83b0e028c73/peer_review/images_list.json b/0a6c94dfbac671fb686117770b978806da70c70e41c33003bc81f83b0e028c73/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..6ecceab63f84ade8f0f868d27c1120ee585bde81
--- /dev/null
+++ b/0a6c94dfbac671fb686117770b978806da70c70e41c33003bc81f83b0e028c73/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S1. Relationship between coupling strength and the minimum FSR in the region of gradually reduced FSR. a, Simulated minimum FSR when varying the coupling \\(\\mu\\) . The phenomenon of gradually reduced FSR happens when the coupling \\(\\mu\\) starts to become comparable with the FSR of the cavity 1. For example, when the coupling \\(\\mu\\) is small, it can only couple degenerate modes therefore provide a conventional two mode splitting with a splitting equal to \\(2\\mu\\) . When the coupling \\(\\mu\\) becomes stronger, such that \\(2\\mu\\) is larger than the FSR, dispersive coupling starts to contribute, and multi-hybrid modes are formed. We extract the coupling strength \\(\\mu\\) in",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/0a6e6a3a08da886347f9cea32930b301d9ee96c0ebea0c3acd080f10c7740148/peer_review/images_list.json b/0a6e6a3a08da886347f9cea32930b301d9ee96c0ebea0c3acd080f10c7740148/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0a6e6a3a08da886347f9cea32930b301d9ee96c0ebea0c3acd080f10c7740148/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0ab9485f323a84a87f5e9b35a5af0f9f487ed9784339ca91bceacdf95cc00a39/peer_review/images_list.json b/0ab9485f323a84a87f5e9b35a5af0f9f487ed9784339ca91bceacdf95cc00a39/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..c4e6df3a4db726d8a86626a35d9c97f350eabdf4
--- /dev/null
+++ b/0ab9485f323a84a87f5e9b35a5af0f9f487ed9784339ca91bceacdf95cc00a39/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "rFig. 1. Total distance travelled during the conditioning session in the blue laser-paired chamber and during post-conditioning session in the entire arena in CPP test. No significant difference was observed in both D3-Cre and D3-Cre/ChR2 mice. \\(n = 8\\) mice per group. Data are expressed as mean \\(\\pm\\) SEM.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "rFig. 2. Orofacial grooming induced by optogenetic activation of OT D3 neurons suppresses sucrose splash-triggered body licking. Blue light (activation of D3-Cre/ChR2 neurons; 10 ms pulses, 20 Hz for 10 s) or green light (same parameters as blue light as comparison) was delivered when sucrose splash-triggered body licking occurred (n = 5 mice). Left, percent of trials in which body licking terminated. Right, percent of trials in which body licking terminated and orofacial grooming initiated. Each mouse was tested for 20 trials. Data are expressed as mean ± SEM. Wilcoxon signed-rank test. p < 0.0001 for (D) and p = 0.0005 for (E). ***p<0.001, ****p<0.0001.",
+    "bbox": [
+      [
+        356,
+        285,
+        642,
+        455
+      ]
+    ],
+    "page_idx": 6
+  }
+]
\ No newline at end of file
diff --git a/0aba7a6c67bb32744ae9f23d32bc02ac36daf6e1b2cba411a28c3517122eae16/peer_review/images_list.json b/0aba7a6c67bb32744ae9f23d32bc02ac36daf6e1b2cba411a28c3517122eae16/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..5ffbc61b297dd2ea5cc7a79d2394a6c5be1ca2bd
--- /dev/null
+++ b/0aba7a6c67bb32744ae9f23d32bc02ac36daf6e1b2cba411a28c3517122eae16/peer_review/images_list.json
@@ -0,0 +1,51 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4. Photovoltaic performance of the PSCs based on PVSK, PVSK-HABr/CF, and PVSK-HABr/Cl₂-CF. (b) \\(J - V\\) curves measured in the reverse scan direction (1.2 to 0 V, 250 mV s⁻¹). (c) Statistical PCE. (d) Statistical \\(V_{\\text{OC}}\\).",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Entry for the Table of Contents",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_24.jpg",
+    "caption": "Supplementary Fig. 24 | Photovoltaic parameters of the PVSK, HACl/CF-treated, HACl/Cl₂-CF-treated, and HABr/Cl₂-CF-treated devices.",
+    "bbox": [
+      [
+        211,
+        567,
+        784,
+        855
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_25.jpg",
+    "caption": "Supplementary Fig. 25 | Photovoltaic parameters of the devices post-treated by HABr/CF containing different ratios of \\(\\mathrm{Br}_2\\) as additives. (a) \\(V_{\\mathrm{OC}}\\) , (b) \\(J_{\\mathrm{SC}}\\) , (c) fill factor and (d) efficiency.",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_12.jpg",
+    "caption": "Supplementary Fig. 12 | SEM images of perovskite films without and with HABr/Cl₂-CF treatment. The perovskite films were fabricated by the one-step spin-coating method and showed almost a PbI₂-free surface.",
+    "bbox": [
+      [
+        160,
+        92,
+        841,
+        269
+      ]
+    ],
+    "page_idx": 7
+  }
+]
\ No newline at end of file
diff --git a/0f15a7bd2d76f5d2bb944609afd0241a2619b021e00ef177a72e85197b771b85/peer_review/images_list.json b/0f15a7bd2d76f5d2bb944609afd0241a2619b021e00ef177a72e85197b771b85/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..d869a71c6ae730d14316fdca381db99da5e77128
--- /dev/null
+++ b/0f15a7bd2d76f5d2bb944609afd0241a2619b021e00ef177a72e85197b771b85/peer_review/images_list.json
@@ -0,0 +1,135 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Response Figure 2: DNMT1 knockout leads to higher abundance of cytoplasmic dsRNA in TC1 cell (A) and MCA205 (B).",
+    "bbox": [
+      [
+        212,
+        243,
+        784,
+        391
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Response Figure 3: Our analysis of the LUAD cohort in the TCGA database revealed that patients with high Myc expression are predominantly enriched in the cell cycle signaling pathway.",
+    "bbox": [
+      [
+        301,
+        136,
+        675,
+        358
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Response Figure 4: (A) Differential Gene Expression Profiles Following Myc Deletion. (B) Altered CDK Family Gene Expression in Response to Myc Deletion. (C) Shared Downregulated Genes Following Myc and NAT10 Deletion.",
+    "bbox": [
+      [
+        222,
+        88,
+        760,
+        228
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Response Figure 5: High-dose (200 mg/kg) remodelin significantly inhibited tumor growth compared to low-dose (100 mg/kg) and Normal saline in Nude/Nude mice.",
+    "bbox": [
+      [
+        262,
+        216,
+        736,
+        373
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_10.jpg",
+    "caption": "Response Figure 10: (C) Tumor growth curves and weight of WT or sgNAT10 TC1 cells inoculated into C57BL/6N mice (n=5) treated with neutralizing antibodies targeting IFNAR1 or PBS injected every 2–3 days.",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_12.jpg",
+    "caption": "Response Figure 12: DNMT1 knockout leads to higher abundance of cytoplasmic dsRNA in TC1 cell (A) and MCA205 (B).",
+    "bbox": [
+      [
+        210,
+        567,
+        785,
+        716
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_13.jpg",
+    "caption": "Response Figure 13: (H) Western blot analysis of NAT10, DNMT1, MYC and CDK2 in matched WT and siNAT10 A549 tumor cells. \\(\\beta\\) -actin was used as a loading control.",
+    "bbox": [
+      [
+        230,
+        87,
+        770,
+        283
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_14.jpg",
+    "caption": "Response Figure 14: The expression levels of CDK2 were assessed in relation to high and low NAT10 expression groups, using data from TCGA.",
+    "bbox": [
+      [
+        384,
+        95,
+        602,
+        250
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_16.jpg",
+    "caption": "Response Figure 16: The acRIP-seq data for WT and sgNAT10 cell lines were visualized using the IGV software.",
+    "bbox": [],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_17.jpg",
+    "caption": "Response Figure 17: (B) The peaks of myc in WT and sgNAT10 TC1 cells from Ribo-seq data were visualized using the IGV software.",
+    "bbox": [
+      [
+        325,
+        334,
+        671,
+        496
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "(B) For the multivariate COX analysis, we utilized \"TCGA-biolink\" package to obtain survival and status data for TCGA-LUAD cohort. Multivariate COX regression analysis was conducted using the \"survival\" package, with the confidence interval for the hazard ratio (HR) set at 95%.",
+    "bbox": [],
+    "page_idx": 24
+  }
+]
\ No newline at end of file
diff --git a/0f4310622954e59af1d0d5a58d6634e16d0142140cf087ccdb479322baa6805f/peer_review/images_list.json b/0f4310622954e59af1d0d5a58d6634e16d0142140cf087ccdb479322baa6805f/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..10660b4abe1ea0ada536b18f5a40756405540f0d
--- /dev/null
+++ b/0f4310622954e59af1d0d5a58d6634e16d0142140cf087ccdb479322baa6805f/peer_review/images_list.json
@@ -0,0 +1,296 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_4.jpg",
+    "caption": "<New Supplementary Figure 4>",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "<New Figure 4>",
+    "bbox": [
+      [
+        155,
+        123,
+        847,
+        393
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "<New Figure 5>",
+    "bbox": [
+      [
+        155,
+        450,
+        844,
+        736
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "<New Figure 6>",
+    "bbox": [
+      [
+        156,
+        123,
+        745,
+        409
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "<New Supplementary Figure 1>",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "<New Figure 4>",
+    "bbox": [
+      [
+        160,
+        225,
+        794,
+        773
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "<New Figure 5>",
+    "bbox": [
+      [
+        155,
+        125,
+        812,
+        677
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_10.jpg",
+    "caption": "<New Supplementary Figure 10>",
+    "bbox": [
+      [
+        202,
+        115,
+        586,
+        355
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "<New Figure 5>",
+    "bbox": [
+      [
+        150,
+        610,
+        612,
+        901
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "<New Figure 4>",
+    "bbox": [
+      [
+        150,
+        253,
+        510,
+        499
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "<New Figure 6>",
+    "bbox": [
+      [
+        156,
+        644,
+        700,
+        908
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_8.jpg",
+    "caption": "<New Supplementary Figure 8>",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_9.jpg",
+    "caption": "<New Supplementary Figure 9>",
+    "bbox": [
+      [
+        155,
+        327,
+        818,
+        647
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "<New Supplementary Figure 3>",
+    "bbox": [
+      [
+        155,
+        470,
+        755,
+        775
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "<Figure R3GA1>",
+    "bbox": [
+      [
+        150,
+        293,
+        730,
+        666
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "<New Figure 1>",
+    "bbox": [
+      [
+        152,
+        618,
+        650,
+        876
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "<New Supplementary Figure 1>",
+    "bbox": [
+      [
+        150,
+        120,
+        644,
+        614
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "< New Figure 3>",
+    "bbox": [
+      [
+        152,
+        130,
+        408,
+        348
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "< New Supplementary Figure 3>",
+    "bbox": [
+      [
+        150,
+        388,
+        842,
+        738
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Figure 5.",
+    "bbox": [],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure S10.",
+    "bbox": [
+      [
+        123,
+        314,
+        544,
+        560
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Figure 5.",
+    "bbox": [
+      [
+        120,
+        135,
+        737,
+        400
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Figure 6.",
+    "bbox": [
+      [
+        120,
+        450,
+        476,
+        577
+      ]
+    ],
+    "page_idx": 23
+  }
+]
\ No newline at end of file
diff --git a/0f4d1e9b0c508ff4216b04d82c08117885c301b0ac50f7ffce3add99051c992a/peer_review/images_list.json b/0f4d1e9b0c508ff4216b04d82c08117885c301b0ac50f7ffce3add99051c992a/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..cf26fc55cf25c4ef97a3e507d1a9b597c58d0b8e
--- /dev/null
+++ b/0f4d1e9b0c508ff4216b04d82c08117885c301b0ac50f7ffce3add99051c992a/peer_review/images_list.json
@@ -0,0 +1,79 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Long-term stability of NW networks. a. Transresistance pattern of an Ag NW network after deposition and b. evolution over time of transresistance values of all the 208 configurations, monitored by placing the ERT setup in a hermetically closed box to limit the interaction with the environment. After initial stabilization, transresistance values of the multiterminal NW network tend to stabilize to near constant values and no network failures were observed after 20 days.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. Repeatability and consistency of the network output under the same input pattern. a. Input pattern and corresponding stimulating input voltage pattern in the spatio-temporal domain. b. experimental configuration for NW network stimulation. c. Time traces of output voltages for 30 stimulations with the pattern reported in panel a. d. Detail of time traces reported in panel a with a focus on the output response waveform of the output when the corresponding input is directly stimulated. e. Detail of time traces reported in panel a with a focus on the output response waveform of the input when the corresponding input is not directly stimulated. Adapted from ref. [6].",
+    "bbox": [
+      [
+        156,
+        88,
+        822,
+        720
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R3. Repeatability of NW network dynamics in samples with nominally identical characteristics. Response of a. NW network 1 and b. NW network 2 of an arbitrary stimulation voltage waveform. Stimulation voltage waveforms, composed of two spaced voltage pulses with amplitude of 0.8 V and 3 V, respectively, and length of 10 s, were applied to selected contacts of two NW networks with nominally identical characteristics. Contacts selected for stimulation (6 and 15) are highlighted in insets. The effective conductance in between pulses was monitored by applying a read voltage of \\(10\\mathrm{mV}\\) .",
+    "bbox": [
+      [
+        137,
+        264,
+        872,
+        556
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R4. Mean and standard deviation \\((\\times 100)\\) of measured ERT patterns evaluated by repeating the ERT measurement protocol 10 times on a NW network in the pristine state. A standard deviation in transresistance values \\(< 0.5\\%\\) was observed, showing that the measurement protocol maximizes the signal-to-noise ratio while preventing the onset of sample alterations.",
+    "bbox": [
+      [
+        203,
+        395,
+        780,
+        701
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R5. Experimental investigation of 16-electrode ERT spatial resolution. a. Fluorinated tin oxide (FTO) thin film with a thin linear cut (white marker of about \\(50 \\mu \\mathrm{m}\\) ). Before the linear cut, the FTO sample was characterized by a uniform conductivity of \\(150 \\mathrm{mS}\\) [10]. b. Conductivity dip observed in the diagonal conductivity profile of the sample (in the direction of the black arrow in the map of panel a), where the full width at high maximum corresponds to \\(\\approx 1.7 \\mathrm{mm}\\) .",
+    "bbox": [
+      [
+        166,
+        584,
+        825,
+        815
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R6. Emergent behavior of the NW network connectome at the micro/nanoscale. a. NW network topology simulated by dispersing 1D objects (1800 NWs) on a 2D plane ( \\(500 \\times 500 \\mu \\mathrm{m}^2\\) ), where red dots represent NW midpoints while blue dots represent NW junctions, and b. corresponding graph representation. c. Electrical backbone of the network when stimulated in between source (red marked node, upper left) and ground node (black marked node, bottom right), d. corresponding visualization of the potential distribution across graph nodes when a voltage difference is applied between these nodes, and e. corresponding voltage distribution across the 2D plane. f. Activation pattern of the network after stimulation in between source and ground nodes with a voltage pulse, showing the emergence of a conductive pathway composed of multiple branches that connects source and ground nodes. Red intensity is proportional to edge conductance, blue intensity is proportional to node voltage.",
+    "bbox": [
+      [
+        115,
+        81,
+        863,
+        480
+      ]
+    ],
+    "page_idx": 11
+  }
+]
\ No newline at end of file
diff --git a/0f53f235b4a4752abcaedf609239441b9d31028d1d99283e898eeccffc45847a/peer_review/images_list.json b/0f53f235b4a4752abcaedf609239441b9d31028d1d99283e898eeccffc45847a/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..a35a31af90a7a81b80fd0f60e897d469a0ff49cb
--- /dev/null
+++ b/0f53f235b4a4752abcaedf609239441b9d31028d1d99283e898eeccffc45847a/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1R.jpg",
+    "caption": "Figure 1R. Optional figure for Figure 3.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R2. Linear circular relationship of body mass and activity at the regional level. If the fitted line lays outside the confidence values (grey area) of a null hypothesis, the alternative hypothesis is accepted. We found that in general, large carnivores and omnivores are more likely active during hours of the day, and we find the opposite for herbivores. Larger species active most likely during the night. We found that insectivores are inconsistent, in the Neotropics large species were more active during the day, while in the Indo-Malayan tropics large species tended to be nocturnal. It was insufficient observation to test with this framework the relationship of body mass with the activity of omnivores and insectivores in the Afrotropics.",
+    "bbox": [
+      [
+        150,
+        81,
+        848,
+        616
+      ]
+    ],
+    "page_idx": 16
+  }
+]
\ No newline at end of file
diff --git a/0f745b53b8d610d773dbf0842737391c232bf0a0fc9deaf4bfc7b95eed387f41/peer_review/images_list.json b/0f745b53b8d610d773dbf0842737391c232bf0a0fc9deaf4bfc7b95eed387f41/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0f745b53b8d610d773dbf0842737391c232bf0a0fc9deaf4bfc7b95eed387f41/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/0fd7bf2d7f831d1a3b7d9566fb122ad01884bdfaa3b2f055ab331e163c2eb3b4/peer_review/images_list.json b/0fd7bf2d7f831d1a3b7d9566fb122ad01884bdfaa3b2f055ab331e163c2eb3b4/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/0fd7bf2d7f831d1a3b7d9566fb122ad01884bdfaa3b2f055ab331e163c2eb3b4/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/102766b9bb929349cdfe41e51096eab9d4d4fc17d0e7d22fde3259083a7685db/peer_review/images_list.json b/102766b9bb929349cdfe41e51096eab9d4d4fc17d0e7d22fde3259083a7685db/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/102766b9bb929349cdfe41e51096eab9d4d4fc17d0e7d22fde3259083a7685db/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1103f0c1154c833258a4d83941847ab20ef16bb5ab3b10088b2975845c7fcecd/peer_review/images_list.json b/1103f0c1154c833258a4d83941847ab20ef16bb5ab3b10088b2975845c7fcecd/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..b056db1c546a04b99d35d0f826f9b580ac24abd1
--- /dev/null
+++ b/1103f0c1154c833258a4d83941847ab20ef16bb5ab3b10088b2975845c7fcecd/peer_review/images_list.json
@@ -0,0 +1,310 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1Q1 a. Forest plot showing the expression level of CD137/CD137L (TNFRSF9/TNFSF9) associated with prognosis of ICB in seven datasets, involving three cancer types. Cox regression was performed (likelihood pvalue \\(< 0.05\\) ). b. Performance of predicting immunotherapy response based on the expression levels of TNFRSF9/TNFSF9 (red), PD-L1/CD274, green) and CD8 (average expression of CD8A and CD8B, blue). The AUC of the ROC curves were calculated.",
+    "bbox": [
+      [
+        160,
+        138,
+        828,
+        428
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R1Q3. Figure s2d, Correlation analysis between HLTF and CD137L in 33 tumors (last row). a. CD137L in 33 tumors is classified by high and low expression, red for high CD137L, blue for low, and green for medium. b.HLTF knockdown sequences were used to knock down HLTF in different cell lines A549 lung cancer, MDA-MB231 breast cancer, and HCT116 colon cancer. Western blotting was used to detect the expression of HLTF and CD137L, and GAPDH was used as a loading control.",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R1Q4",
+    "bbox": [
+      [
+        149,
+        325,
+        848,
+        520
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R1Q5 Using Cibersort (a) and MCPcounter (b), HLTF and CD137L were grouped according to high and low levels. The correlation between CD137L and HLTF in different groups and different immune cells was calculated. \\(^{NS}p > 0.05\\) , \\(^{*}p < 0.05\\) , \\(^{**}p < 0.01\\) , \\(^{***}p< 0.001\\) .",
+    "bbox": [
+      [
+        152,
+        120,
+        844,
+        793
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R1Q6",
+    "bbox": [
+      [
+        150,
+        262,
+        792,
+        565
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R1Q7. a. HE staining results of mouse tissues (heart, liver, spleen, lung, kidney, skin) treated with AICAR alone or in combination. b. Liver function test of ALT (glutamic pyruvic transaminase) and AST (glutamic oxaloacetic transaminase) and kidney function test of BUN (blood urea nitrogen) in mice treated with AICAR alone or in combination. c. RBC (red blood cell), WBC (white blood cell) and HGB (hemoglobin) content in blood cell count. d. Liver and kidney weights.",
+    "bbox": [
+      [
+        150,
+        87,
+        835,
+        737
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure R1Q8",
+    "bbox": [
+      [
+        150,
+        530,
+        840,
+        700
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure R2Q1 a. Forest plot showing the expression level of CD137/CD137L (TNFRSF9/TNFSF9) associated with prognosis of ICB in seven datasets, involving three cancer types. Cox regression was performed (likelihood pvalue \\(< 0.05\\) ). b. Performance of predicting immunotherapy response based on the expression levels of TNFRSF9/TNFSF9 (red), PD-L1/CD274, green) and CD8 (average expression of CD8A and CD8B, blue). The AUC of the ROC curves were calculated",
+    "bbox": [
+      [
+        163,
+        130,
+        795,
+        420
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure R2Q2",
+    "bbox": [
+      [
+        170,
+        125,
+        820,
+        404
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1g.jpg",
+    "caption": "Original Figure 1g",
+    "bbox": [
+      [
+        155,
+        153,
+        812,
+        370
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "FigureR2Q3 The left panel shows the labeling of different cells in a single cell UMAP, the middle panel shows the expression distribution of TNFSF9 at the single cell level, and the right panel shows the level and proportion of TNFSF9 expression in different cells.",
+    "bbox": [
+      [
+        164,
+        420,
+        710,
+        748
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Figure R2Q4",
+    "bbox": [
+      [
+        305,
+        130,
+        825,
+        820
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "FigureR2Q5 CD137L immunofluorescence staining of nevus and melanoma tissues (red), blue is the cell nucleus, and right is the HE staining result of the corresponding area.",
+    "bbox": [
+      [
+        228,
+        222,
+        748,
+        485
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "FigureR2Q8 The CD137L membrane protein content and mRNA level of B16F10, metformin (0.5 and 1mM), AICAR (0.25 and \\(0.5\\mathrm{mM}\\) ), and GSK621 (5 and \\(10\\mathrm{uM}\\) ) treated with different AMPK agonists, and the expression level of CD137L in mice tumor derived from knockout HLTF cell.",
+    "bbox": [
+      [
+        153,
+        281,
+        833,
+        608
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Figure R2Q16 a. A375 cells were treated with different concentrations of metformin (0, 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4 mM) and p-AMPK, AMPK and CD137L were detected. GAPDH was used as a loading control. b. Different melanoma cell lines (A375, SK-MEL-28, B16F10) were treated with different concentrations of metformin, the level of CD137L on the cell membrane was determined by flow cytometry.",
+    "bbox": [
+      [
+        159,
+        130,
+        839,
+        264
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Figure R2Q17 The CD137L membrane protein content and mRNA level of B16F10, metformin (0.5 and 1mM), AICAR (0.25 and 0.5mM), and GSK621 (5 and 10uM) treated with different AMPK agonists.",
+    "bbox": [
+      [
+        245,
+        560,
+        636,
+        816
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Figure R3Q2",
+    "bbox": [
+      [
+        172,
+        123,
+        825,
+        404
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Figure R3Q4 B16F10 cells were overexpressed with CD137L and transfected with empty vectors to construct stable expression strains, which were then used to generate tumors in immunocompetent mice. Different cell types (NK, DC, CD45+, macrophages) were detected, as well as PD-1, TCF, TOX, Ki67 and TIM3 in CD8+ T cells. \\(^{*}p< 0.05\\) , \\(^{**}p< 0.01\\) , \\(^{***}p< 0.001\\) .",
+    "bbox": [
+      [
+        152,
+        179,
+        844,
+        409
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_17.jpg",
+    "caption": "Figure R3Q5 a. HE staining results of mouse tissues (heart, liver, spleen, lung, kidney, skin) treated with AICAR alone or in combination. b. Liver function test of ALT (glutamic pyruvic transaminase) and AST (glutamic oxaloacetic transaminase) and kidney function test of BUN (blood urea nitrogen) in mice treated with AICAR alone or in combination. c. RBC (red blood cell), WBC (white blood cell) and HGB (hemoglobin) content in blood cell count. d. Liver and kidney weights.",
+    "bbox": [
+      [
+        226,
+        90,
+        770,
+        630
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_18.jpg",
+    "caption": "Figure R3Q7. AICAR treatment increases CD137L expression on different cell populations in B16F10 tumor-bearing mice. Flow cytometric analysis showing the percentage of CD137L-",
+    "bbox": [],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1 A. The bar graph represents the expression of CD137L in the control group and B16F10 cells with sgRNA knockout of CD137L detected by flow cytometry. B. Tumor growth curves of CD137L knockout and control groups with and without AICAR treatment. C and D. Endpoint of tumor graph and tumor weight. E. Body weight of tumor-bearing mice at different time points. F. Flow cytometric detection of the ratio of \\(\\mathrm{CD3^{+}}\\) T cells to \\(\\mathrm{CD45^{+}}\\) cells in mouse tumors. G and H, The ratio of \\(\\mathrm{CD4^{+}}\\) and \\(\\mathrm{CD8^{+}}\\) T cells to \\(\\mathrm{CD3^{+}}\\) T cells in tumors of each treatment group. I, the proportion of GZMB+ cells in \\(\\mathrm{CD8^{+}}\\) T cells in tumors of each treatment group. ( \\(^{**}p< 0.01\\) , \\(^{*}p< 0.05\\) )",
+    "bbox": [
+      [
+        163,
+        111,
+        870,
+        404
+      ]
+    ],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2 A. The bar graph represents the expression of CD137L in the control group and sgRNA knockout of CD137L with and without AICAR treatment as detected by flow cytometry. B. After treatment of immunocompetent tumor-bearing mice with different concentrations of AICAR (low dose: \\(300\\mathrm{mg / kg / day}\\) , high dose: \\(600\\mathrm{mg / kg / day}\\) ) for 14 days, the expression of CD137L in CD45 cells, CD4+ and CD8+ T cells, NK cells, DC cells, B cells and M2 macrophages in the tumor was detected by flow cytometry. (\\\\*\\\\*\\\\* \\(p< 0.001\\) , \\\\*\\\\* \\(p< 0.01\\) , \\\\* \\(p< 0.05\\) ).",
+    "bbox": [
+      [
+        163,
+        119,
+        840,
+        460
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure 3 A. Tumor growth curve of immunocompetent tumor-bearing mice treated with different concentrations of AICAR (low dose: \\(300\\mathrm{mg / kg / day}\\) , high dose: \\(600\\mathrm{mg / kg / day}\\) ), B and C. Endpoint mouse tumor images and tumor weight. D. Changes in mouse body weight at different time points. E. Flow cytometric detection of the proportion of CD3+, CD4+ and CD8+ T cells and activated GZMB+ T cells in the tumor. F. Flow cytometric detection of the content of NK cells, DC cells, B cells and M2 macrophages in the tumor after AICAR treatment. (\\\\*\\\\*\\\\* \\(p< 0.001\\) , \\\\*\\\\* \\(p< 0.01\\) , \\\\* \\(p< 0.05\\) ).",
+    "bbox": [
+      [
+        156,
+        118,
+        844,
+        543
+      ]
+    ],
+    "page_idx": 37
+  }
+]
\ No newline at end of file
diff --git a/11268c6e941fa8862c8347d3f39feb5cfe492b57c21063051d1bf8105cdf75bd/peer_review/images_list.json b/11268c6e941fa8862c8347d3f39feb5cfe492b57c21063051d1bf8105cdf75bd/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..56c9f654cc071b0ff6b995c7c9a586568a3f9cd3
--- /dev/null
+++ b/11268c6e941fa8862c8347d3f39feb5cfe492b57c21063051d1bf8105cdf75bd/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Figure 7 for reviewer. Knock-down of TEAD2 in HEK293A cells.",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/1137f7e32f4339a6475be8ea1d339e15a48494fb6355650d1c8664464b43f068/peer_review/images_list.json b/1137f7e32f4339a6475be8ea1d339e15a48494fb6355650d1c8664464b43f068/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..2b2b909fd8f470c3f114d92878b8cccaa8472fb0
--- /dev/null
+++ b/1137f7e32f4339a6475be8ea1d339e15a48494fb6355650d1c8664464b43f068/peer_review/images_list.json
@@ -0,0 +1,219 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_6B.jpg",
+    "caption": "Figure 6B and Figure S6A. Western blot analysis to analyze the proteins in TP63-overexpressing BEP2D (BEP2DOE) cells. Western blot to determine the levels of proteins induced by TP63-overexpressing (Figure 6B). Western blot to measure the levels of proteins (Figure S6A). Significance: *** \\(P< 0.0001\\) , **** \\(P< 0.00001\\) , t-test.",
+    "bbox": [],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2E.jpg",
+    "caption": "Figure 2E. Examples of A/B compartment switching with chromatin accessibility and gene expression tracks, where the shadings correspond to genomic regions with compartment switching that associate with alterations in chromatin accessibility and transcriptional activity.",
+    "bbox": [
+      [
+        147,
+        102,
+        848,
+        420
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. An example of aggregated region mediated by two TP63 CUT&Tag peaks. The TP63-TP63 contact was located at focal point of two blue dashed lines. The aggregated region was highlighted by blue square frame.",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6E.jpg",
+    "caption": "Figure 6E. APA of contact mediated by different group of TP63 peaks.",
+    "bbox": [
+      [
+        147,
+        88,
+        848,
+        433
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6E.jpg",
+    "caption": "Figure S6F. Biological repeat for Figure 6E. APA of contact mediated by different group of TP63 peaks.",
+    "bbox": [
+      [
+        149,
+        474,
+        848,
+        821
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. Strong CTCF motif in novel CTCF sites. A) Classification of TP63-mediated CTCF sites. TP63 CUT&Tag signal profile (left) and CTCF CUT&Tag signal profile (right) in different TP63-mediated CTCF sites. B) Strong CTCF motif ratio in different TP63-mediated CTCF sites. chi-square test. \\*\\*\\*: \\(p< 0.0001\\) .",
+    "bbox": [
+      [
+        150,
+        496,
+        850,
+        711
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6D.jpg",
+    "caption": "Figure 6D. TP63 CUT&Tag, ATAC-seq, CTCF CUT&Tag and Cohesin CUT&Tag heatmap before and after TP63 overexpression. According to ATCA-seq signal foldchange, TP63 peaks were divided into 4 groups, including strongly increase (foldchange \\(\\geq 4\\) ), slightly increase \\((2\\leq\\) foldchange \\(< 4\\) ), not significant \\((0.5<\\) foldchange \\(< 2\\) ) and decrease (foldchange \\(\\leq 0.5\\) ).",
+    "bbox": [
+      [
+        150,
+        81,
+        848,
+        288
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R3 GO pathway analysis of genes located in B-to-A switching regions (A) and SDOC increase regions (B).",
+    "bbox": [
+      [
+        275,
+        90,
+        790,
+        856
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R4 Consistent changes of compartments and SDOC in BERP35T1 and BERP35T4. A) overlap of the compartments from B-to-A. B) overlap of the SDOC increased TADs in",
+    "bbox": [
+      [
+        155,
+        700,
+        850,
+        848
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1B.jpg",
+    "caption": "Figure 1B. Heatmap showing significantly enriched GO terms of up-regulated genes in BERP35T1 and BERP35T4 tumour cells.",
+    "bbox": [
+      [
+        150,
+        456,
+        808,
+        858
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2F.jpg",
+    "caption": "Figure S2D. Zoom-out Hi-C heatmaps and Pearson correlation transformed matrices of Figure 2F. The shadings represent genomic regions with compartment switching. Black",
+    "bbox": [
+      [
+        160,
+        90,
+        830,
+        848
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6E.jpg",
+    "caption": "Figure 6E. APA of contact mediated by different group of TP63 peaks.",
+    "bbox": [
+      [
+        152,
+        550,
+        848,
+        875
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6E.jpg",
+    "caption": "Figure S6G. Biological repeat for Figure 6E. APA of contact mediated by different group of TP63 peaks.",
+    "bbox": [
+      [
+        150,
+        93,
+        848,
+        425
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Page 12 of figuren-56.pdf",
+    "bbox": [
+      [
+        310,
+        88,
+        686,
+        460
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Page 16 of figure-56.pdf",
+    "bbox": [],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Page 17 of figure-56.pdf",
+    "bbox": [
+      [
+        536,
+        90,
+        916,
+        375
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Duplicated Area",
+    "bbox": [
+      [
+        52,
+        525,
+        940,
+        978
+      ]
+    ],
+    "page_idx": 26
+  }
+]
\ No newline at end of file
diff --git a/113878bfef6eddfb7f78bb5196efa7fd7f3d22e96721e20d0cb59a1275f28c56/peer_review/images_list.json b/113878bfef6eddfb7f78bb5196efa7fd7f3d22e96721e20d0cb59a1275f28c56/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..f654a5ffb7aa9c7b2dd5a70e99779c7b9c1212e8
--- /dev/null
+++ b/113878bfef6eddfb7f78bb5196efa7fd7f3d22e96721e20d0cb59a1275f28c56/peer_review/images_list.json
@@ -0,0 +1,303 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. R2. (a) The structures of BDPs and TPPs. Size distribution of the nanostructures of (b) BDPs (5 μM) and (c) TPPs measured by DLS. Representative photocurrent response of the lyophilized nanostructures of (d) BDPs and (e) TPPs on an ITO glass electrode with the interval of 20 s. Electrochemical impedance spectroscopy of the lyophilized nanostructures of (f) BDPs and (g) TPPs. The lyophilized nanostructures adhered ITO",
+    "bbox": [],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. R3. HRMS spectrum of NanoNMe (10 \\(\\mu \\mathrm{M}\\) ) irradiated with 685 nm laser (0.5 W·cm⁻²) for 10 min.",
+    "bbox": [
+      [
+        164,
+        81,
+        833,
+        336
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. R4. HRMS spectrum of NanoNMe (10 \\(\\mu \\mathrm{M}\\) ) without laser irradiation.",
+    "bbox": [
+      [
+        167,
+        400,
+        830,
+        650
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. R5. The absorption spectra of NanoNMe (10 \\(\\mu \\mathrm{M}\\) ) before and after 10 min of 685 nm laser (0.5 W·cm⁻²) irradiation.",
+    "bbox": [
+      [
+        352,
+        696,
+        640,
+        858
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. R6. Schematic representation of the photocatalytic system for the production of \\(\\mathsf{H}_2\\mathsf{O}_2\\) (Angew. Chem. Int. Ed. 2020, 59, 17356 – 17376, Copyright 2020 Wiley).",
+    "bbox": [
+      [
+        319,
+        82,
+        675,
+        321
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. R7. fs-TA spectra of NMe within 1 ps in THF upon excitation by 694 nm pulses. \\* represents excited state species.",
+    "bbox": [
+      [
+        345,
+        423,
+        650,
+        595
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. R8. EDS analysis of (a) NanoNMe and (b) NanoNMO and their quantitative elemental analysis results.",
+    "bbox": [
+      [
+        220,
+        238,
+        810,
+        574
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. R9. Biochemical analysis of CRT, ATP and HMGB-1 in the serum of mice 24 h after different treatments. (1) treated with saline (control); (2) treated with saline followed by laser irradiation (685 nm, 100 mW·cm⁻²) 8 h after injection; (3) treated with NanoNMO (200 μM, 100 μL); (4) treated with NanoNMO (200 μM, 100 μL) followed by laser irradiation (685 nm, 100 mW·cm⁻²) 8 h after injection.",
+    "bbox": [
+      [
+        228,
+        517,
+        767,
+        615
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Fig. R10. Flow cytometry examination and the quantitative population of DC maturation (CD11c+ CD80+ CD86+) in primary tumors, distant tumors and lymph nodes of mice after the different treatments. Group 1: treated with saline; Group 2: treated with saline followed by laser irradiation (685 nm, 100 mW·cm-2) 8 h after injection; Group 3: treated with NanoNMO (200 μM, 100 μL); Group 4: treated with NanoNMO (200 μM, 100 μL) followed by laser irradiation (685 nm, 100 mW·cm-2) on the primary tumor 8 h after",
+    "bbox": [
+      [
+        170,
+        415,
+        822,
+        787
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Fig. R11. Size distribution of self-assembled NanoPcs (5 \\(\\mu \\mathrm{M}\\) ) in water detected using DLS.",
+    "bbox": [
+      [
+        147,
+        380,
+        845,
+        545
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Fig. R12. Average particle size of the NanoPcs (5 \\(\\mu \\mathrm{M}\\) ) under different ultrasonic power condition for 10 s.",
+    "bbox": [
+      [
+        345,
+        608,
+        652,
+        781
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Fig. R13. Blood routine indexes (white blood cell count (WBC), neutrophils percentage (NE%), lymphocyte percentage (LY%), monocyte percentage (MO%), eosinophils percentage (EO%), basophils percentage (BA%), neutrophils (NE), lymphocyte (LY), monocyte (MO), eosinophils (EO), basophils (BA), red blood cell count (RBC), hemoglobin (Hb), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular concentration (MCHC), red blood cell distribution width (RDW), platelets (PLT), and mean platelet volume (MPV)) of the mice with the treatment of Saline or NanoNMO+Laser (n = 5).",
+    "bbox": [
+      [
+        150,
+        272,
+        848,
+        598
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "Fig. R14. Liver and kidney function indexes (alanine transaminase (ALT), aspartate transaminase (AST), albumin (ALB), \\(\\gamma\\) -glutamyl transpeptidase (y-GT), uric acid (UA), total bile acid (TBA), creatinine (CRE), and blood urea nitrogen (BUN)) of the mice with the treatment of Saline or NanoNMO+Laser \\((n = 5)\\) .",
+    "bbox": [
+      [
+        255,
+        83,
+        738,
+        228
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Fig. R15. Representative H&E staining of heart, liver, spleen, lung and kidney of 4T1 tumor bearing mice with the treatment of Saline or NanoNMO+Laser \\((n = 3)\\) .",
+    "bbox": [
+      [
+        150,
+        325,
+        847,
+        466
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Fig. R16. Representative image of hemolysis experiments of NanoNMO.",
+    "bbox": [
+      [
+        262,
+        535,
+        731,
+        690
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Fig. R17. Size distribution of NanoNMe, NanoOMe, NanoCl and NanoCN (5 \\(\\mu \\mathrm{M}\\) ) in water detected using DLS after 3 parallel tests.",
+    "bbox": [
+      [
+        157,
+        85,
+        841,
+        192
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Fig. R18. (a) In vivo fluorescence imaging and (b) ex vivo fluorescence imaging of 4T1 tumor bearing mice injected with NMO and NanoNMO (excited at \\(640~\\mathrm{nm}\\) , \\(\\times 10^{7}\\) \\(\\mathrm{ps}^{-1}\\cdot \\mathrm{cm}^{-1}\\cdot \\mathrm{sr}^{-1}\\cdot \\mu \\mathrm{W}^{-1}\\cdot \\mathrm{cm}^{2}\\) , white ellipses representing the tumor area). (c) In vivo photoacoustic imaging (excited at \\(690\\) and \\(700~\\mathrm{nm}\\) , yellow ellipses representing the tumor area) of 4T1 tumor bearing mice before and after intravenous injection of NMO or NanoNMO.",
+    "bbox": [
+      [
+        248,
+        88,
+        748,
+        300
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_17.jpg",
+    "caption": "Fig. R19. Biochemical analysis of CRT, ATP, HMGB-1, IL-2, IL-6, TNF-\\(\\alpha\\) and IFN-\\(\\gamma\\) in the serum of mice 24 h after different treatments. (1) treated with saline (control); (2) treated with saline followed by laser irradiation (685 nm, 100 mW·cm\\(^{-2}\\)) 8 h after injection; (3) treated with NanoNMO (200 \\(\\mu\\) M, 100 \\(\\mu\\) L); (4) treated with NanoNMO (200 \\(\\mu\\) M, 100 \\(\\mu\\) L) followed by laser irradiation (685 nm, 100 mW·cm\\(^{-2}\\)) 8 h after injection.",
+    "bbox": [
+      [
+        164,
+        589,
+        832,
+        762
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_18.jpg",
+    "caption": "Fig. R20. Flow cytometry examination and the quantitative population of DC maturation (CD11c+ CD80+ CD86+) in primary tumors, distant tumors and lymph nodes of mice after the different treatments. Group 1: treated with saline; Group 2: treated with saline followed by laser irradiation (685 nm, 100 mW·cm-2) 8 h after injection; Group 3: treated with NanoNMO (200 μM, 100 μL); Group 4: treated with NanoNMO (200 μM, 100 μL) followed by laser irradiation (685 nm, 100 mW·cm-2) on the primary tumor 8 h after injection; Group 5: treated with αPD-1 twice (2.5 mg·kg-1) on day 1 and day 3, respectively;",
+    "bbox": [
+      [
+        168,
+        398,
+        822,
+        770
+      ]
+    ],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_19.jpg",
+    "caption": "Fig. R21. Schematic illustration of the PIT synergistic process of NanoNMO and αPD-1.",
+    "bbox": [
+      [
+        265,
+        330,
+        730,
+        595
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_20.jpg",
+    "caption": "Fig. R22. Tumor growth plots of 4T1 tumor bearing mice following various treatments (n = 5). Data were expressed as mean ± SD, \\(^{**}p < 0.001\\) , determined by Student's t test.",
+    "bbox": [
+      [
+        370,
+        608,
+        622,
+        764
+      ]
+    ],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_21.jpg",
+    "caption": "Fig. R23. (a) Ex vivo fluorescence imaging of 4T1 tumor bearing mice injected with NMO and NanoNMO ( \\(\\times 10^{7}\\) ps \\(^{-1}\\) .cm \\(^{-1}\\) .sr \\(^{-1}\\) . \\(\\mu W^{-1}\\) .cm \\(^{2}\\) ) and (b) quantitative fluorescence intensities. H., heart; Li., liver; Sp., spleen; Lu., lung; K., kidney; T., tumor; Sk., skin.",
+    "bbox": [
+      [
+        222,
+        235,
+        780,
+        377
+      ]
+    ],
+    "page_idx": 29
+  }
+]
\ No newline at end of file
diff --git a/11450fa9ba8ad4ac35d6ba92cae4c1ef639e4f9611a42f36f420cded64d770cc/peer_review/images_list.json b/11450fa9ba8ad4ac35d6ba92cae4c1ef639e4f9611a42f36f420cded64d770cc/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/11450fa9ba8ad4ac35d6ba92cae4c1ef639e4f9611a42f36f420cded64d770cc/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/11459c43982341b47fb8dbca4bc8efe9e06b4e50f42be77cb206f1801f73379f/peer_review/images_list.json b/11459c43982341b47fb8dbca4bc8efe9e06b4e50f42be77cb206f1801f73379f/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/11459c43982341b47fb8dbca4bc8efe9e06b4e50f42be77cb206f1801f73379f/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/11c4e7b8330ef7d1c799a2bf30fed6610d587d35e086ce772f6fd8bf674ee78b/peer_review/images_list.json b/11c4e7b8330ef7d1c799a2bf30fed6610d587d35e086ce772f6fd8bf674ee78b/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..130f430c3ff41bd8e2a7092295e44b631287c785
--- /dev/null
+++ b/11c4e7b8330ef7d1c799a2bf30fed6610d587d35e086ce772f6fd8bf674ee78b/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1: Representative plane from the \\(S^2\\) measurement experiment, showing the raw data processed by Topspin.",
+    "bbox": [
+      [
+        213,
+        110,
+        780,
+        500
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2. Representative plane for methyl-CPMG experiments, showing the raw data processed by Topspin.",
+    "bbox": [
+      [
+        198,
+        545,
+        790,
+        867
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3. Example of Multiple Spectral Overlays and Analysis for Assigning Complex, Split Resonances in AMP-PNP-Bound HtpG: This figure demonstrates our strategy for assigning a large number of residues in complex resonance split scenarios. Spectral overlays, essential for assigning a large number of residues, are shown in the right column. In cases where the origin of a split peak is ambiguous, we analyze intensity ratios relative to the nucleotide-free state, depicted in overlays in the left column. The",
+    "bbox": [
+      [
+        175,
+        270,
+        840,
+        820
+      ]
+    ],
+    "page_idx": 12
+  }
+]
\ No newline at end of file
diff --git a/11cd319677e83c4b0e4fba5350771679f6eeecedf0ddf34ed8118541e63176d5/peer_review/images_list.json b/11cd319677e83c4b0e4fba5350771679f6eeecedf0ddf34ed8118541e63176d5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/11cd319677e83c4b0e4fba5350771679f6eeecedf0ddf34ed8118541e63176d5/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/11f6c16372ce7c29045c796d01a333a7609863f1cbfb8b91216c632b4ba301f5/peer_review/images_list.json b/11f6c16372ce7c29045c796d01a333a7609863f1cbfb8b91216c632b4ba301f5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..793d6d94e9c95de2d6ffcdcf980ab2f08d76e66b
--- /dev/null
+++ b/11f6c16372ce7c29045c796d01a333a7609863f1cbfb8b91216c632b4ba301f5/peer_review/images_list.json
@@ -0,0 +1,51 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S9. Histograms of quantitative biochemical compositions. (a) Lipid/protein ratio; (b) Collagen area ratio.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S8. Demonstration of the two misclassified non-cancer cases. (a) case #54 with degraded tissues; (b) case #186 with dense macrophage-like cells. Red squares: predicted cancer: cyan squares: predicted non-cancer.",
+    "bbox": [
+      [
+        147,
+        95,
+        847,
+        523
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. R1. SRH images of a human brain tumor tissue taken at two representative tissue sites (a) and (b). Scale bars: \\(30 \\mu \\mathrm{m}\\) .",
+    "bbox": [
+      [
+        148,
+        237,
+        848,
+        468
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. R2. CNN diagnostic predictions using single-channel femto-SRS images. (a-d) Prediction results on test dataset. (e) Comparison between the accuracies using U-Net converted SRH and femto-SRS images.",
+    "bbox": [
+      [
+        230,
+        170,
+        775,
+        740
+      ]
+    ],
+    "page_idx": 11
+  }
+]
\ No newline at end of file
diff --git a/11fc2a502b84c947958d35fb5cb514243fd9816e6da97bb2d9c3847481e0dce2/peer_review/images_list.json b/11fc2a502b84c947958d35fb5cb514243fd9816e6da97bb2d9c3847481e0dce2/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..b151cf9fbce86a8a5fc24447ec04eb8333b3b507
--- /dev/null
+++ b/11fc2a502b84c947958d35fb5cb514243fd9816e6da97bb2d9c3847481e0dce2/peer_review/images_list.json
@@ -0,0 +1,65 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure 3. Mapping of our SHAPE-MaP reactivities from the WT SARS-CoV-2 virus genome onto predicted structure models.",
+    "bbox": [],
+    "page_idx": 3
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Figure 4. Distribution of the distances captured on the 18S and 28S rRNA crystal structure using SPLASH. Most of the SPLASH chimeras are within 30A.",
+    "bbox": [
+      [
+        150,
+        686,
+        460,
+        844
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Figure 8. Scatterplots showing the correlation between two biological replicates of PORE-cupine reactivity for each subgenomic RNA.",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Figure 8. Scatterplot showing the correlation between virus-host SPLASH interactions and host cellular abundance for WT (left) and \\(\\Delta 382\\) (right) genome. The orange line indicates the best fit line. The grey line indicates the 95% confidence interval of the best fit line. The yellow line indicates 2 standard deviations from the best fit line. Interactions above the yellow have higher SPLASH interactions with virus than would be expected from their abundance.",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "Figure 9. Probability of the presence of Isoleucine codons (top) and \\(2^{\\prime}\\) -O-methylation sites (bottom) along the SARS-CoV-2 genome",
+    "bbox": [
+      [
+        152,
+        301,
+        844,
+        448
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_10.jpg",
+    "caption": "Figure 10. Left: Violinplots showing the distribution of the distance between \\(2^{\\prime}\\) OMe site on host RNAs to virus-host RNA SPLASH interaction site, before and after SARS-CoV-2 virus infection. Right: Violin plots showing the distribution of the distance between \\(2^{\\prime}\\) OMe sites and SPLASH interactions for \\(2^{\\prime}\\) OMe sites that are found only in uninfected cells, newly gained in infected cells and in both.",
+    "bbox": [
+      [
+        150,
+        730,
+        523,
+        884
+      ]
+    ],
+    "page_idx": 9
+  }
+]
\ No newline at end of file
diff --git a/120e4f62fb48fa6e44402e36571a9f3090248722192b23412902e544007bfa9e/peer_review/images_list.json b/120e4f62fb48fa6e44402e36571a9f3090248722192b23412902e544007bfa9e/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/120e4f62fb48fa6e44402e36571a9f3090248722192b23412902e544007bfa9e/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1860c1110668d418e560d07a0d1e24d403746fd4d1d4179bfdca1a17997bdf06/peer_review/images_list.json b/1860c1110668d418e560d07a0d1e24d403746fd4d1d4179bfdca1a17997bdf06/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..309aba141c9551cafe4697d06b523e469cacb61b
--- /dev/null
+++ b/1860c1110668d418e560d07a0d1e24d403746fd4d1d4179bfdca1a17997bdf06/peer_review/images_list.json
@@ -0,0 +1,114 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure sources:",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Reply Fig 1. Annotated figure based on the comment (ESP_012914_1515).",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Reply Fig 2. Margin/slope of the sheet unit on the left side of ms Fig 1. Note that abundant breccia is present in contrasting to the slope of ms Fig 4. The sheet unit is smooth and apparently drapes the underly topography (i.e., fractured basement, see Reply Fig 1).",
+    "bbox": [
+      [
+        144,
+        88,
+        852,
+        460
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Reply Fig 5 Spectrum of the material shown in Reply Fig 4 (the false \"sheet?\" in Reply Fig 1). The deep 1.0 band and wide 2.0 band suggest the material is unaltered mafic rocks (Fe-rich pyroxene).",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Reply Fig 6: Identified pits",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Reply Fig 7. Small blocks/breccia embedded in the wall of the pits.",
+    "bbox": [
+      [
+        145,
+        548,
+        458,
+        710
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Reply Fig 5 Spectrum of the material shown in Reply Fig 4 (the false \"sheet?\" in Reply Fig 1). The deep 1.0 band and wide 2.0 band suggest the material is unaltered mafic rocks (Fe-rich pyroxene).",
+    "bbox": [
+      [
+        144,
+        265,
+        738,
+        550
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_12.jpg",
+    "caption": "Reply Fig 12. Stratigraphic relation of channels and sheet unit on the eastern rim of Ritchey.",
+    "bbox": [],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_15.jpg",
+    "caption": "Reply Fig 15: Northern wall. R: BD2355, G: D2300; B: BD2290. There is no clear evidence of phyllosilicate that is associated with the suggested channels and fan deposits.",
+    "bbox": [],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_16.jpg",
+    "caption": "Reply Fig 16: Eastern wall to rim. R: BD2355, G: D2300; B: BD2290. There is no clear evidence of phyllosilicate that is associated with the suggested channels and fan deposits.",
+    "bbox": [
+      [
+        143,
+        497,
+        673,
+        814
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_17.jpg",
+    "caption": "Reply Fig 17: Southern wall to rim. R: BD2355, G: D2300; B: BD2290. There is no clear evidence of phyllosilicate that is associated with the suggested channels and fan deposits.",
+    "bbox": [
+      [
+        144,
+        88,
+        673,
+        400
+      ]
+    ],
+    "page_idx": 23
+  }
+]
\ No newline at end of file
diff --git a/18b9b9b376f1a3ec4e5710fdb4a034bac7bd94e4dcc889c783b6559b31fe1fb0/peer_review/images_list.json b/18b9b9b376f1a3ec4e5710fdb4a034bac7bd94e4dcc889c783b6559b31fe1fb0/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..6d2a1aeb1ff1bb71faae8000a3b69096c0eae08b
--- /dev/null
+++ b/18b9b9b376f1a3ec4e5710fdb4a034bac7bd94e4dcc889c783b6559b31fe1fb0/peer_review/images_list.json
@@ -0,0 +1,79 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S8: Current ratios between two potentials cannot distinguish four states of analyte combinations. A. Schematic representation of the redox potentials for the CymA and Flavin-Channels. B. Current ratios calculated from responses at 0.2 V and \\(-0.2\\mathrm{V}\\) vs. Ag/AgCl under different analyte combinations.",
+    "bbox": [],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S9: Two current ratios (j0.2v/j0v and j-0.4v/j-0.2v) calculated from four potentials, enable to distinguish individual channels across four states in inducer-E.coli and heavy metal-E. coli.",
+    "bbox": [
+      [
+        115,
+        68,
+        884,
+        240
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. S10. The normalized current ratios ( \\(\\mathrm{R}_{\\mathrm{CymA}}\\) and \\(\\mathrm{R}_{\\mathrm{FL}}\\) ) and the defined threshold to encode digital signal outputs across four states with both inducer- \\(E\\) . coli and heavy metal- \\(E\\) . coli.",
+    "bbox": [
+      [
+        156,
+        68,
+        825,
+        290
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig S2. Workflow for evaluating engineered E. coli strains as bioelectronic sensors.",
+    "bbox": [
+      [
+        184,
+        402,
+        765,
+        770
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig S4. The comparison of background current across different E. coli strains and conditions.",
+    "bbox": [
+      [
+        316,
+        675,
+        686,
+        881
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. S13. \\(\\mathrm{R}_{\\mathrm{CymA}}\\) and \\(\\mathrm{R}_{\\mathrm{FL}}\\) from heavy metal-E. coli remain stable in detecting and distinguishing arsenic and cadmium during sequential passaging experiments.",
+    "bbox": [
+      [
+        208,
+        302,
+        794,
+        502
+      ]
+    ],
+    "page_idx": 11
+  }
+]
\ No newline at end of file
diff --git a/190a4388929b8779af02254bb67ddef9a4c2cde8ae491827123a197c6170fbf1/peer_review/images_list.json b/190a4388929b8779af02254bb67ddef9a4c2cde8ae491827123a197c6170fbf1/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..63e855d1595266f3e5d9da9c3f07f9dda769fbdd
--- /dev/null
+++ b/190a4388929b8779af02254bb67ddef9a4c2cde8ae491827123a197c6170fbf1/peer_review/images_list.json
@@ -0,0 +1,37 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "https://www.invivogen.com/hek-blue-htlr9",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1. The size distribution of cfDNA fragments in saliva and serum and serum cfDNA detected after histone H3 pull-down (Fig. S13 in the revised manuscript)",
+    "bbox": [
+      [
+        213,
+        103,
+        784,
+        625
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 The effect of periodontal microinjection on alveolar bone resorption and gingival tissue destruction",
+    "bbox": [
+      [
+        144,
+        386,
+        847,
+        616
+      ]
+    ],
+    "page_idx": 9
+  }
+]
\ No newline at end of file
diff --git a/190ba341df86a34adc51aa7db037aa0b0ec5596928011a6509d9b29bceaadaf7/peer_review/images_list.json b/190ba341df86a34adc51aa7db037aa0b0ec5596928011a6509d9b29bceaadaf7/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0c23ef882d0a5fcb7672d1f43800c8ee0bc5bb11
--- /dev/null
+++ b/190ba341df86a34adc51aa7db037aa0b0ec5596928011a6509d9b29bceaadaf7/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Rebuttal Fig. 1: Patient survival analysis in Group 3 MB only. (a) Kaplan-Meier survival curve of patients in Group 3 MBs based on SMARCD3 mRNA expression levels used the Cavalli dataset. (b) Kaplan-Meier survival curve of patients in Group 3 MBs based on SMARCD 3 protein expression levels by IHC analysis used the inhouse TMA.",
+    "bbox": [
+      [
+        222,
+        384,
+        808,
+        575
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Rebuttal Fig 4: The distributions of SMARCD3 gene expression in patient MBs with/without metastasis. Histograms showing the number of differentially expressed genes between patients with metastasis and without metastasis by the \\(\\log_2(\\text{fold change})\\) . The arrows denote where SMARCD3 is located. The data from Group 3 only (right) and all subgroups of human MBs (left) were analyzed.",
+    "bbox": [],
+    "page_idx": 15
+  }
+]
\ No newline at end of file
diff --git a/191000b260bfbafd7cd910cbda76212b900e11a9db79841c635e4555ba8c3672/peer_review/images_list.json b/191000b260bfbafd7cd910cbda76212b900e11a9db79841c635e4555ba8c3672/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..5b9cb0463e3e80a6c167d75578831a14dd3a43d5
--- /dev/null
+++ b/191000b260bfbafd7cd910cbda76212b900e11a9db79841c635e4555ba8c3672/peer_review/images_list.json
@@ -0,0 +1,184 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. R1-1. Electron probes (left: amplitude; right: phase) reconstructed from the simulated 4D-STEM datasets for 50-nm thick Zr-BTB, at a dose of \\(100 \\text{e} / \\text{Å}^2\\) , a defocus value of \\(60 \\text{nm}\\) , and different convergence semi-angles.",
+    "bbox": [
+      [
+        162,
+        365,
+        833,
+        587
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Fig. R1-2. Reconstructed ptychography images of MOF Zr-BTB from 4D-STEM datasets simulated at 21 mrad with finer reciprocal space sampling compared with Supplementary Fig. 2 (0.0063 vs. 0.0250 Å<sup>-1</sup>/pixel).",
+    "bbox": [
+      [
+        288,
+        500,
+        707,
+        611
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. R1-3 Comparison of ptychographic reconstructions from simulated 4D-STEM datasets collected at a consistent electron dose of \\(100\\mathrm{e}^{-} / \\mathrm{\\AA}^2\\) , using probes with the same probe size but different convergence semi-angles: (a) 10 mrad, (b) 15 mrad, and (c) 21 mrad. The probe size is maintained at \\(\\sim 7.8\\mathrm{\\AA}\\) across different convergence angles by adjusting the defocus.",
+    "bbox": [
+      [
+        218,
+        88,
+        785,
+        330
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. R1-4 (a) Reconstructed ptychography images of MOF Zr-BTB from 4D-STEM datasets simulated under the indicated conditions. The red box marks the optimal reconstruction result. The images were reconstructed using the LSQ-ML algorithm, which incorporates multislice and mixed-state methods. The images were typically generated after 200 iteration cycles, except for those labeled 'iter. 60'. This label indicates that these images resulted from only 60 iteration cycles, after which the iterative processes failed to converge and subsequently crashed. (b) Atomic structural model used in simulations. (c) Simulated electrostatic potential map corresponding to (b).",
+    "bbox": [
+      [
+        152,
+        295,
+        842,
+        692
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. R2-1. Statistical analysis of electron distributions in a CBED pattern randomly selected from a 4D-STEM dataset acquired at \\(100 \\text{e} /\\text{Å}^2\\) .",
+    "bbox": [
+      [
+        177,
+        536,
+        820,
+        698
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. R4-1. Analysis of the information transfer achieved in Nat. Commun., 2022, 13, 5197.",
+    "bbox": [
+      [
+        175,
+        728,
+        822,
+        886
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. R4-2. (a) Reconstructed ptychography images from the 4D-STEM data simulated with \\(100 \\mathrm{e}^{-} / \\mathrm{\\AA}^{2}\\) and \\(110 \\mathrm{e}^{-} / \\mathrm{\\AA}^{2}\\) , as indicated, alongside the structural model used for simulation. (b) Reconstructed probes (left: amplitude; right: phase) after 100 iterations at \\(100 \\mathrm{e}^{-} / \\mathrm{\\AA}^{2}\\) and 200 iterations at \\(110 \\mathrm{e}^{-} / \\mathrm{\\AA}^{2}\\) . At \\(100 \\mathrm{e}^{-} / \\mathrm{\\AA}^{2}\\) , the probe cannot be optimized to a reasonable state after 100 iterations, leading to a breakdown in the reconstruction process.",
+    "bbox": [
+      [
+        181,
+        81,
+        808,
+        350
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. R5-1. (a) Reconstructed ptychography images of CH3NH3PbI3 from 4D-STEM datasets simulated under indicated conditions. The images were reconstructed using the LSQ-ML algorithm, which incorporates multislice and mixed-state methods. (b) Atomic structural model used in simulations. (c) Simulated electrostatic potential map corresponding to (b). Red dashed circles highlight donut-shaped artifacts on Pb/I observed at a 10 mrad convergence semi-angle, which are absent at larger convergence semi-angles. Yellow arrows indicate the diminished contrast of \\(\\mathrm{CH_3NH_3}\\) as the convergence semi-angle increases.",
+    "bbox": [
+      [
+        163,
+        365,
+        830,
+        680
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. R5-2. (a) Reconstructed ptychography images of ZIF-8 from 4D-STEM datasets simulated under the indicated conditions. The red box marks the optimal reconstruction result. The images were reconstructed using the LSQ-ML algorithm, which incorporates multislice and mixed-state methods. The images were typically generated after 200 iteration cycles, except for those labeled 'iter. 60' (or 'iter. 30'), which resulted from only 60 (or 30) iteration cycles, as the iterative processes failed to converge and subsequently crashed. (b) Atomic structural model used in simulations. (c) Simulated electrostatic potential map corresponding to (b).",
+    "bbox": [
+      [
+        169,
+        410,
+        826,
+        782
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Fig. R5-3. (a) Schematic illustration of 4D-STEM utilized for multi-slice electron ptychography on a thick specimen.",
+    "bbox": [
+      [
+        386,
+        507,
+        608,
+        710
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Fig. R6-1. Comparison of the achieved resolution with the resolutions needed to identify various structural features in NU-1000, alongside the corresponding spatial frequencies.",
+    "bbox": [
+      [
+        160,
+        729,
+        777,
+        871
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Fig. R4-1. Comparison of in-focus iCOM-STEM (left) and unfocused multi-slice ptychography (right) images, both acquired from the MOF NU-1000 specimen with an approximate thickness of 50 nm, using an electron dose of \\(\\sim 100 \\text{e} / \\text{Å}^2\\) .",
+    "bbox": [
+      [
+        288,
+        81,
+        707,
+        388
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Fig. R4-2. Simulated in-focus iCOM-STEM images of MOF Zr-BTB at varying specimen thicknesses and electron doses, demonstrating that metal atoms within clusters become indistinguishable when the specimen thickness exceeds 20 nm, regardless of the electron dose. Simulation parameters: 300 kV accelerating voltage, 10 mrad convergence semi-angle, and a scan step size of 0.5 Å.",
+    "bbox": [
+      [
+        280,
+        472,
+        712,
+        776
+      ]
+    ],
+    "page_idx": 25
+  }
+]
\ No newline at end of file
diff --git a/191fedfa9af881c7daf9e7672a2a2d65086c734e6fe9358851339bcaef8d6798/peer_review/images_list.json b/191fedfa9af881c7daf9e7672a2a2d65086c734e6fe9358851339bcaef8d6798/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..8f88619079d2fb4f939b678acb025476adf5ddaa
--- /dev/null
+++ b/191fedfa9af881c7daf9e7672a2a2d65086c734e6fe9358851339bcaef8d6798/peer_review/images_list.json
@@ -0,0 +1,331 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. R1 (a) The positive-pressure filter device used for large-area membrane preparation. (b) The membranes obtained under different pressures. (c) The obtained membrane without usage of hard support membrane had the grid imprinting (from the grid-like filter substrate) on the surface. (d) The effect of drying duration on the uniformity of the large-area membrane.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. R2 Photographs and cross-sectional SEM images of selected regions from large-area 2D-NNF films with the same preparation conditions. (a) \\(15.97 \\pm 0.43 \\mu \\mathrm{m}\\) ; (b) \\(15.32 \\pm 0.48 \\mu \\mathrm{m}\\) ; (c) \\(16.00 \\pm 0.56 \\mu \\mathrm{m}\\) . Scale bar: \\(20 \\mu \\mathrm{m}\\) .",
+    "bbox": [
+      [
+        191,
+        197,
+        808,
+        770
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. R3 The thickness of different sites from different membranes with the same preparation conditions. (b) Average thickness of different membranes.",
+    "bbox": [
+      [
+        183,
+        93,
+        820,
+        280
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. R4 Small-angle XRD patterns of the different sites of large-area membranes with the same preparation conditions.",
+    "bbox": [
+      [
+        207,
+        100,
+        795,
+        632
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. R5 Photographs and cross-sectional SEM images of selected regions from large-area 2D-NNF films of different thicknesses (a) \\(6.36\\pm 0.38 \\mu \\mathrm{m}\\) ; (b) \\(15.32\\pm 0.48\\mu \\mathrm{m}\\) ; (c) \\(19.18\\pm 0.41 \\mu \\mathrm{m}\\) . Scale bar: \\(20 \\mu \\mathrm{m}\\) .",
+    "bbox": [
+      [
+        183,
+        85,
+        816,
+        679
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. R6 The thickness of different sites of the samples with different thickness. (b) Average thickness of different samples.",
+    "bbox": [
+      [
+        166,
+        88,
+        830,
+        284
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. R7 Evolution of nanochannel size (interlayer spacing) of the hydrated 2D-NNF in the applied solutions with different Debye lengths.",
+    "bbox": [
+      [
+        300,
+        90,
+        697,
+        377
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. R8 Zeta potential of pristine MMT and 2D-NNF (CNF intercalated MMT) as a function of pH value of 10 mM KCl solution.",
+    "bbox": [
+      [
+        355,
+        163,
+        660,
+        340
+      ]
+    ],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Fig. R9 Surface charge density and zeta potential of 2D-NNF as a function of pH value of \\(10\\mathrm{mM}\\) KCl solution.",
+    "bbox": [
+      [
+        310,
+        88,
+        688,
+        286
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Fig. R10 Ab initio molecular dynamics simulations of \\(\\mathrm{K}^{+}\\) transport in diffuse layer.",
+    "bbox": [
+      [
+        163,
+        621,
+        825,
+        808
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Fig. R11 Configurations for the hydration of \\(\\mathrm{K}^{+}\\) ion (purple) and \\(\\mathrm{Cl}^{-}\\) ion (green) exported from MD calculations.",
+    "bbox": [
+      [
+        288,
+        103,
+        707,
+        262
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Fig. R12 Schematic diagram for the microstructure of the 2D-NNF with periodic interlayer nanochannels and random enlarged nanochannels with CNFs intercalation.",
+    "bbox": [
+      [
+        168,
+        81,
+        826,
+        288
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "Figure. R13 The parameters in the MD simulations.",
+    "bbox": [
+      [
+        198,
+        523,
+        797,
+        718
+      ]
+    ],
+    "page_idx": 34
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Figure. R14 The number of ions that passed through the nanochannels in the MD simulation as a function of time.",
+    "bbox": [
+      [
+        311,
+        631,
+        681,
+        852
+      ]
+    ],
+    "page_idx": 35
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Fig. R15 (a) The current densities and (b) power densities at different salinity conditions as a function of the external resistance. Power generation and conversion efficiency (c) and long-term current output (d) under a series of artificial water resources including brackish water, desalination brines, brines from mining activities, and water from salt-lake. Error bars represent S.D.",
+    "bbox": [
+      [
+        175,
+        90,
+        812,
+        451
+      ]
+    ],
+    "page_idx": 36
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Fig. R16 Special equipment for osmotic energy harvesting study of large-area 2D-NNF membrane ( \\(\\phi\\) 30 cm).",
+    "bbox": [
+      [
+        265,
+        415,
+        728,
+        600
+      ]
+    ],
+    "page_idx": 39
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Fig. R17 (a) Typical \\(I - V\\) curve of the large-area 2D-NNF with a diameter of \\(30 \\mathrm{cm}\\) under the condition of simulated seawater/river salinity gradient ( \\(0.5 \\mathrm{M} / 0.01 \\mathrm{M} \\mathrm{NaCl}\\) ). (b) Long-term current output of the large-area 2D-NNF membrane.",
+    "bbox": [
+      [
+        163,
+        348,
+        826,
+        545
+      ]
+    ],
+    "page_idx": 41
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_17.jpg",
+    "caption": "Fig. R18 Schematic diagram for assembly of natural montmorillonite (MMT) and natural cellulose nanofibers (CNFs) into a large-area 2D-NNF membrane with selective and fast cation transport nanochannels.",
+    "bbox": [
+      [
+        155,
+        84,
+        838,
+        287
+      ]
+    ],
+    "page_idx": 42
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_18.jpg",
+    "caption": "Fig. R19 (a) Schematic of the covalent bonds formed between Si-OH or Al-OH at the edge of MMT and CNFs. XPS spectra of C1s of (a) 2D-NNF and (b) pristine MMT nanofluidics. High spectra of 2D-NNF and MMT for (d) Al2p and (e) Si2p region. The characteristic peak Si 2p originated from Si-O-Si/Si-O-Al, and the main peak of Al 2p was attributed to the Al-OH and Al-O-Si. The binding energy displacement of Al 2p and Si 2p compared with pristine MMT membrane, which was mainly attributed to the formation of covalent bonds between MMT and CNFs. (f) The survey XPS of 2D-NNF and MMT nanofluidics. For the 2D-NNF, C1s and O1s peak enhancement due to the introduction of CNFs. For pristine MMT nanofluidics, the appearance of carbon may be due to surface adsorption with weak strength and there is no obvious C=O peak in C1s region.",
+    "bbox": [
+      [
+        180,
+        242,
+        819,
+        502
+      ]
+    ],
+    "page_idx": 44
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_19.jpg",
+    "caption": "Fig. R20 FTIR spectrum of CNF, pristine MMT nanofluidics and 2D-NNF, the marked characteristic peaks correspond to the functional groups. The enhanced emerged peak at \\(3432\\mathrm{cm}^{-1}\\) and \\(1627\\mathrm{cm}^{-1}\\) corresponds to -OH and \\(\\mathrm{C} = \\mathrm{O}\\) group vibrations, respective, which confirmed the successful introduction of CNFs. Besides, the decrease of free OH on the surface of 2D-NNF at \\(3621\\mathrm{cm}^{-1}\\) indicates the occurrence of dehydration condensation reaction.",
+    "bbox": [
+      [
+        232,
+        87,
+        764,
+        323
+      ]
+    ],
+    "page_idx": 49
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_20.jpg",
+    "caption": "Fig. R21 Ab initio molecular dynamics simulations of rapid \\(\\mathrm{K}^{+}\\) transport in diffuse layer according to hopping mechanism.",
+    "bbox": [
+      [
+        165,
+        410,
+        825,
+        595
+      ]
+    ],
+    "page_idx": 50
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_21.jpg",
+    "caption": "Fig. R22 Schematic diagram of surface charge and space charge incorporated into the interlamellar nanochannels.",
+    "bbox": [
+      [
+        195,
+        525,
+        800,
+        716
+      ]
+    ],
+    "page_idx": 51
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_22.jpg",
+    "caption": "Fig. R23 (a) Current density and (b) power density output at different temperature. (c) Maximum power generation and energy conversion efficiency under different temperature (concentration gradient is \\(0.5 \\mathrm{M} / 0.01 \\mathrm{M} \\mathrm{NaCl}\\) ). (d) Lifetime of power output stability under the load resistance of \\(\\sim 6 \\mathrm{k} \\Omega\\) at \\(313 \\mathrm{K}\\) . Error bars represent S.D.",
+    "bbox": [
+      [
+        200,
+        154,
+        789,
+        492
+      ]
+    ],
+    "page_idx": 52
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_23.jpg",
+    "caption": "Fig. R24 (a) The current densities and (b) power densities at different salinity conditions as a function of the external resistance. Power generation and conversion efficiency (c) and long-term current output (d) under a series of artificial water resources including brackish water, desalination brines, brines from mining activities, and water from salt-lake. Error bars represent S.D.",
+    "bbox": [
+      [
+        190,
+        209,
+        800,
+        553
+      ]
+    ],
+    "page_idx": 60
+  }
+]
\ No newline at end of file
diff --git a/19ef687807fe8cfb2bce838b7c0be598ebd1bff01b7ee9f95a94c125609fbdc1/peer_review/images_list.json b/19ef687807fe8cfb2bce838b7c0be598ebd1bff01b7ee9f95a94c125609fbdc1/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..7474290d06bbb6124a435573564e549e237ace5c
--- /dev/null
+++ b/19ef687807fe8cfb2bce838b7c0be598ebd1bff01b7ee9f95a94c125609fbdc1/peer_review/images_list.json
@@ -0,0 +1,114 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Response Figure 1. (also added to Revised Fig. S2) Re-examination the morphology of \\(Pum1 / 2^{CKO}\\) intestine. (A) The colon and rectum of control \\((Pum1^{flox/flox}::Pum2^{flox/flox})\\) and \\(Pum1 / 2^{CKO}\\) \\((Lgr5^{Cre}::Pum1^{flox/flox}::Pum2^{flox/flox})\\) mice in the absence of AOM/DSS. (B) Representative micrographs of the colon in control and \\(Pum1 / 2^{CKO}\\) mice in the absence of AOM/DSS, as revealed by H&E staining. (C) The colon length of control and \\(Pum1 / 2^{CKO}\\) mice in the absence of AOM/DSS. Error bars represent SD. ns: not significant, Student's t-test. (D) The weight of control and \\(Pum1 / 2^{CKO}\\) mice in the absence of AOM/DSS. Error bars represent SD. ns: not significant, Student's t-test.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Response Figure 2. Testing the off-tarte effect of PUM2 knockout. (A) Growth curve of WT+Con (pcDNA3.1 empty vector), \\(Pum2^{/-}2+\\) Con and \\(Pum2^{/-}2+\\) Pum2 (pcDNA3.1 with \\(Pum2\\) gene vector) in HCT116 cells \\((n = 3)\\) . Error bars represent SD. ns: not significant, \\(^{*}P< 0.05\\) , Student's t-test. (B) Colony formation assay of WT+Con (pcDNA3.1 empty vector), \\(Pum2^{/-}2+\\) Con and \\(Pum2^{/-}2+\\) Pum2 (pcDNA3.1 with \\(Pum2\\) gene vector) in HCT116 cells \\((n = 3)\\) . Error bars represent SD. ns: not significant, \\(^{*}P< 0.05\\) , Student's t-test. (C) Cell cycle analysis of WT+Con (pcDNA3.1 empty vector), \\(Pum2^{/-}2+\\) Con and \\(Pum2^{/-}2+\\) Con and \\(Pum2^{/-} 2+\\) Pum2 (pcDNA3.1 with \\(Pum2\\) gene vector) in HCT116 cells \\((n = 3)\\) . Error bars represent SD. ns: not significant, \\(^{*}P< 0.05\\) , Student's t-test.",
+    "bbox": [
+      [
+        225,
+        563,
+        757,
+        770
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Response Figure 4. Attempts to knockout both PUM1 and PUM2 simultaneously. (A) Western blot showing the PUM2 protein levels in Pum1 KO and Pum1 KO cells transfected with Cas9/sgRNAs that targeted all isoforms of Pum2. Actin was used as a loading control. (B) DNA agarose gel showing the representative clones genotyped by genome PCR. Red line indicates Pum2 WT alleles, the bands above the red line indicates mutant alleles. (C) Western blot showing the PUM2 protein levels in representative potential Pum1 and Pum2 double knockout clones. GAPDH was used as a loading control.",
+    "bbox": [],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_10.jpg",
+    "caption": "Response Figure 10. (also added to Revised Fig. 3) Scatterplot of log2FoldChange on mRNA and protein level upon PUM1 (A) or PUM2 (B) knockout. X-axis and Y-axis show the log2FoldChange on the mRNA and protein level (X- and Y-axis respectively).",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_11.jpg",
+    "caption": "Response Figure 11. Relationship between binding affinity by PUM1 (PAR-CLIP) and its altered level of expression upon \\(Pum1\\) knockout (RNA-Seq). X-axis shows the log2ConversionCount, an indicator of the",
+    "bbox": [
+      [
+        280,
+        584,
+        710,
+        860
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_13.jpg",
+    "caption": "Response Figure 13. The p21 mRNA levels in WT, \\(Pum1^{+/ - }\\) or \\(Pum2^{+/ - }\\) HCT116 cells treated with actinomycin",
+    "bbox": [],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_16.jpg",
+    "caption": "Response Figure 16. (Revised Fig. S14 in the manuscript) Representative immunochemistry staining of PUM1, PUM2, and p21 in siNC@MSN and siPum1/2@MSN group.",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_18.jpg",
+    "caption": "Response Figure 18. (Revised Fig. S6F and H in the manuscript) (A) CD133<sup>+</sup>CD44<sup>+</sup> subpopulations were drastically reduced in Pum1 or Pum2-depleted HCT116 cells by FACS analyses; (B) Bar graph showing the percentage of CD44 and/or CD133 positive cells in HCT116 wt, Pum1<sup>-/-1</sup>, Pum1<sup>-/-2</sup>, Pum2<sup>-/-1</sup> and Pum2<sup>-/-2</sup> cells (n=3). Error bars represent SD. ns: not significant, **P < 0.01, ***P < 0.001, Student's t-test.",
+    "bbox": [],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_20.jpg",
+    "caption": "Response Figure 20. (Revised Fig. S16 in the manuscript) Representative H&E staining in siNC@MSN and siPum1/2@MSN group.",
+    "bbox": [],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_21.jpg",
+    "caption": "Response Figure 21. (Revised Fig. S14 in the manuscript) Representative immunochemistry staining of Ki-67 in siNC@MSN and siPum1/2@MSN group.",
+    "bbox": [
+      [
+        277,
+        502,
+        718,
+        689
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_22.jpg",
+    "caption": "Response Figure 22. Representative immunochemistry staining of TUNEL, CD44, E-cadherin, and N-cadherin in siNC and siPum1&2 group.",
+    "bbox": [
+      [
+        260,
+        75,
+        745,
+        691
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Response Figure 1. The experimental designs of the TMT experiments before this revision and the label-free mass spec experiments added for this revision. WT, \\(Pum1^{- / - }\\) and \\(Pum2^{- / - }\\) were grown in parallel. Proteins were extracted from cell cultures and digested into peptides, which were measured using LC-MS/MS. In TMT, peptides from the different samples were mixed after isobaric chemical labeling. In the label-free method, the samples were prepared and measured separately.",
+    "bbox": [],
+    "page_idx": 20
+  }
+]
\ No newline at end of file
diff --git a/1a19c8a7da8df5d46f7f037a94474976d9582103d4e2e80989d2af8086578c4c/peer_review/images_list.json b/1a19c8a7da8df5d46f7f037a94474976d9582103d4e2e80989d2af8086578c4c/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1a19c8a7da8df5d46f7f037a94474976d9582103d4e2e80989d2af8086578c4c/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1a1d6600cfc1d17d606d864fcbd852f1ad81951546d472385416fdfa7df2d537/peer_review/images_list.json b/1a1d6600cfc1d17d606d864fcbd852f1ad81951546d472385416fdfa7df2d537/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1a1d6600cfc1d17d606d864fcbd852f1ad81951546d472385416fdfa7df2d537/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1a247187c2c016091951d79be96564298658aac4aeb3eba0dd74da214b5744ed/peer_review/images_list.json b/1a247187c2c016091951d79be96564298658aac4aeb3eba0dd74da214b5744ed/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1a247187c2c016091951d79be96564298658aac4aeb3eba0dd74da214b5744ed/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1a43ad12429441c8b3e0915b85c3abadd5d85f3c8b4e601eac82ccca674d2a7a/peer_review/images_list.json b/1a43ad12429441c8b3e0915b85c3abadd5d85f3c8b4e601eac82ccca674d2a7a/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1a43ad12429441c8b3e0915b85c3abadd5d85f3c8b4e601eac82ccca674d2a7a/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1a6984e310935268a34427031076405a230eba7a6126a8bf2ab3fcbc999e864f/peer_review/images_list.json b/1a6984e310935268a34427031076405a230eba7a6126a8bf2ab3fcbc999e864f/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..2c5120b686cae10061bb08fd94ce7e4768c5476c
--- /dev/null
+++ b/1a6984e310935268a34427031076405a230eba7a6126a8bf2ab3fcbc999e864f/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig.1. Migration of small intestine-derived immune cells to meninges.",
+    "bbox": [],
+    "page_idx": 16
+  }
+]
\ No newline at end of file
diff --git a/1a9e75828ee8761aa7ea9f8e037530f9dd6bbd4803512d77f5866158b30823ed/peer_review/images_list.json b/1a9e75828ee8761aa7ea9f8e037530f9dd6bbd4803512d77f5866158b30823ed/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..c13571c18b597f419467c7b186f35c6e148686e8
--- /dev/null
+++ b/1a9e75828ee8761aa7ea9f8e037530f9dd6bbd4803512d77f5866158b30823ed/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Figure 7. Schematic of key findings. The dopaminergic drugs methylphenidate and sulpiride boosted outcome surprise signals in the caudate nucleus and stimulus-specific visual association cortex in 'low striatal dopamine' participants (top row panels). This was accompanied by the drugs boosting punishment compared with reward-based reversal learning in the 'low striatal dopamine' participants compared with the 'high striatal dopamine' participants (bottom left panel). By contrast, the drugs boosted relative reward-based reversal learning to a greater degree in 'high striatal dopamine' participants (bottom left panel), and methylphenidate also boosted the associated prefrontal BOLD signal to a greater degree in 'high striatal dopamine' participants (bottom right panel). MPH: methylphenidate; SUL: sulpiride.",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/1bae5d339bf76fb34d52926b9f5514bbcf3e94dc09400cc8e86b6b4386fe8717/peer_review/images_list.json b/1bae5d339bf76fb34d52926b9f5514bbcf3e94dc09400cc8e86b6b4386fe8717/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1bae5d339bf76fb34d52926b9f5514bbcf3e94dc09400cc8e86b6b4386fe8717/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1bf8e5ee2e0f6a149eb0b7aaf52836fb64d681077724b56b41c86234f3b34d31/peer_review/images_list.json b/1bf8e5ee2e0f6a149eb0b7aaf52836fb64d681077724b56b41c86234f3b34d31/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..1437a75bd8171979ad6a8a6450e0320f524b3c4a
--- /dev/null
+++ b/1bf8e5ee2e0f6a149eb0b7aaf52836fb64d681077724b56b41c86234f3b34d31/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure A: Stockholm monitoring using SYBRGreen method and N3 primers. Clinical cases peak on week 3, 2022 and wastewater SARS-CoV-2 content peak on week 3, 2022",
+    "bbox": [
+      [
+        123,
+        85,
+        875,
+        419
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure B: Stockholm monitoring using TaqMan and N1 primers. Clinical cases peak on week 3, 2022 and wastewater SARS-CoV-2 content peak on week 4, 2022",
+    "bbox": [
+      [
+        130,
+        480,
+        739,
+        759
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure C: Uppsala monitoring using TaqMan and N1 primers. Clinical cases peak on week 4, 2022 and wastewater SARS-CoV-2 content peak on week 6, 2022",
+    "bbox": [
+      [
+        122,
+        85,
+        877,
+        432
+      ]
+    ],
+    "page_idx": 31
+  }
+]
\ No newline at end of file
diff --git a/1c00cb1d935eabd9624f5a3c82bd94b86cc079049312b90a21d3682e6f56b3f9/peer_review/images_list.json b/1c00cb1d935eabd9624f5a3c82bd94b86cc079049312b90a21d3682e6f56b3f9/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ecf84feb249adce04569fefe064e034345ac0f36
--- /dev/null
+++ b/1c00cb1d935eabd9624f5a3c82bd94b86cc079049312b90a21d3682e6f56b3f9/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Attached Fig. 3. Diagram of \\(Hmgcs2^{fl/fl}\\) mouse.",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Attached Fig. 8. Violin plots showing the expression of \\(Foxo3a\\) in different cell types of the testis.",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "Attached Fig. 9. Foxo3a and FOXO3a target genes expression levels in corresponding animal models.",
+    "bbox": [
+      [
+        168,
+        169,
+        819,
+        380
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_14.jpg",
+    "caption": "Attached Fig. 14. Clearance of senescent LCs by Senolytics",
+    "bbox": [],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Attached Fig. 2. Cellular ketone body concentrations of LCs, MCs and Ms isolated from young and aged testes",
+    "bbox": [],
+    "page_idx": 13
+  }
+]
\ No newline at end of file
diff --git a/1c176e722a0f988fb75db64275906a93f8082236402a49c0040483b25e101c41/peer_review/images_list.json b/1c176e722a0f988fb75db64275906a93f8082236402a49c0040483b25e101c41/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1c176e722a0f988fb75db64275906a93f8082236402a49c0040483b25e101c41/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/1c39a37d851ea520277727af336d41a0156169932f71d23093070111d2d1980a/peer_review/images_list.json b/1c39a37d851ea520277727af336d41a0156169932f71d23093070111d2d1980a/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..a1782d451ffb06b89d6469f1e0e332bc6f5665f1
--- /dev/null
+++ b/1c39a37d851ea520277727af336d41a0156169932f71d23093070111d2d1980a/peer_review/images_list.json
@@ -0,0 +1,58 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 | Present-day urban estimates across datasets from regional to grid scale | Sub-figure a shows the urban percentage across eight datasets for four selected regions in the world. The extent and location of these regions is shown in the inset. Sub-figure b shows the coefficient of variation (standard deviation divided by mean) among those urban estimates for \\(0.9^{\\circ}\\) x \\(1.25^{\\circ}\\) grids. The legend value ranges exclude the upper bound.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4a.jpg",
+    "caption": "Fig. S3 | Urban percentage and its long-term changes across datasets (including GHSL) | Same as Fig. 4a of the main text, but includes the estimates of degree of urbanization ('Semi-dense urban cluster', 'Dense urban cluster', and 'Urban centre') every 5 years (from 1985 to 2020) and the 2018 \\(10 \\text{m}\\) estimate of built spaces (labelled as GHSL10) from the latest version of the Global Human Settlement (GHSL) layer (P2023A).",
+    "bbox": [
+      [
+        172,
+        210,
+        866,
+        380
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S1 | Urban area and its long-term changes across datasets | Urban area from 12 global data products for a World, b Africa, c Asia, d Europe, e North America, f Oceania, and g South America. Long-term changes are shown for datasets that span multiple successive years.",
+    "bbox": [],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S1 | Urban area and its long-term changes across datasets | Urban area from 12 global data products for a World, b Africa, c Asia, d Europe, e North America, f Oceania, and g South America. Long-term changes are shown for datasets that span multiple successive years.",
+    "bbox": [
+      [
+        174,
+        88,
+        936,
+        533
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 | Present-day urban estimates across datasets from regional to grid scale | Sub-figure a shows the urban percentage across eight datasets for four selected regions in the world. The extent and location of these regions is shown in the inset. Sub-figure b shows the coefficient of variation (standard deviation divided by mean) among those urban estimates for \\(0.9^{\\circ} \\times 1.25^{\\circ}\\) grids. The legend value ranges exclude the upper bound.",
+    "bbox": [
+      [
+        174,
+        95,
+        800,
+        460
+      ]
+    ],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/1c3ed79ff25f1ec475922860f3487a5585c8046095ab4e9e2891de46f3d52a9c/peer_review/images_list.json b/1c3ed79ff25f1ec475922860f3487a5585c8046095ab4e9e2891de46f3d52a9c/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..04a11e96eef0fb619d103ba30a6381822fc469aa
--- /dev/null
+++ b/1c3ed79ff25f1ec475922860f3487a5585c8046095ab4e9e2891de46f3d52a9c/peer_review/images_list.json
@@ -0,0 +1,16 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary Figure 3. The quantitative results of our system among these HPV-positive women. a, The ROC of the RNN model for classifying the 395 HPV-positive patient-wise WSIs (cytology positive 169, negative 226). b, The frequency histogram of slide scores from",
+    "bbox": [
+      [
+        201,
+        605,
+        785,
+        858
+      ]
+    ],
+    "page_idx": 5
+  }
+]
\ No newline at end of file
diff --git a/1c6f3475f2004f3794d5419f712cf20c81286fe81fc8b2bc3408dacb766855ce/peer_review/images_list.json b/1c6f3475f2004f3794d5419f712cf20c81286fe81fc8b2bc3408dacb766855ce/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/1c6f3475f2004f3794d5419f712cf20c81286fe81fc8b2bc3408dacb766855ce/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/2690032f347e150765f0bde87edd266118169f98354818c848889e5c69f4ad3c/peer_review/images_list.json b/2690032f347e150765f0bde87edd266118169f98354818c848889e5c69f4ad3c/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..547384626704350bb5736182f473e5fc884d4e5c
--- /dev/null
+++ b/2690032f347e150765f0bde87edd266118169f98354818c848889e5c69f4ad3c/peer_review/images_list.json
@@ -0,0 +1,331 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 a The lattice parameters of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) decreases with the increase of K-doping according to the PXRD and PND data. b The EDS analysis of K in \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) . c The XPS of K \\(2P\\) in \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) .",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 The lattice parameters of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Br}\\) ( \\(0 \\leq x \\leq 0.1\\) ) decreases with the increase of K-doping according to the PXRD.",
+    "bbox": [
+      [
+        364,
+        470,
+        627,
+        635
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3 a The simulated PXRD according to the assumed structure model of K substitution for Li sites in antiperovskite lattice. b The observed PXRD for comparison.",
+    "bbox": [
+      [
+        234,
+        702,
+        761,
+        855
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4 a The activation energy of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) increases with the increase of K-doping. b The ionic conductivity of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) decreases with the increase of K-doping. c The Li-O bond distance of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) decreases with the increase of K-doping according to the PDF data.",
+    "bbox": [
+      [
+        180,
+        423,
+        816,
+        555
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5 a MSD of different atoms in cubic K-doped antiperovskite lattice. b Trajectories of Li and K atoms in cubic K-doped antiperovskite lattice.",
+    "bbox": [
+      [
+        300,
+        389,
+        696,
+        524
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig. 6 a DSC curve of \\(\\mathrm{Li_2OHCl}\\) . b DSC curve of \\((\\mathrm{Li_2OH})_{0.99}\\mathrm{K}_{0.01}\\mathrm{Cl}\\) .",
+    "bbox": [
+      [
+        280,
+        258,
+        715,
+        400
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Fig. 7 a Arrhenius plot of the self-diffusivity of Ta-doped LLZO as a function of Ta dopant concentration [9]. b Ionic conductivities of \\(\\mathrm{LiBH_4}\\) and \\(\\mathrm{LiBH_4 - LiX}\\) [10].",
+    "bbox": [
+      [
+        279,
+        108,
+        719,
+        246
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Fig. 8 The CV curve of \\((\\mathrm{Li}_2\\mathrm{OH})_{0.99}\\mathrm{K}_{0.01}\\mathrm{Cl}\\) in the range of -0.5-3.5 V (versus \\(\\mathrm{Li / Li^{+}}\\) ).",
+    "bbox": [
+      [
+        364,
+        719,
+        629,
+        881
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "Fig. 9 a The cycling performance of LFP | \\((\\mathrm{Li}_2\\mathrm{OH})_{0.99}\\mathrm{K}_{0.01}\\mathrm{Cl}\\) | Li ASSLB. b The Voltage profiles of LFP | \\((\\mathrm{Li}_2\\mathrm{OH})_{0.99}\\mathrm{K}_{0.01}\\mathrm{Cl}\\) | Li ASSLB at the current density of \\(80\\mathrm{mA}\\mathrm{g}^{-1}\\) .",
+    "bbox": [
+      [
+        185,
+        369,
+        812,
+        496
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 The lattice parameters of \\(\\mathrm{(Li_2OH)_{1 - x}K_xBr}\\) \\((0 \\leq \\mathrm{x} \\leq 0.1)\\) decreases with the increase of K-doping according to the PXRD.",
+    "bbox": [
+      [
+        352,
+        681,
+        635,
+        857
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 The EDS analysis of K in \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\)",
+    "bbox": [
+      [
+        360,
+        405,
+        633,
+        586
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3 The morphology of \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - x}\\mathrm{K}_x\\mathrm{Cl}\\) \\((x = 0.01, 0.05, 0.1)\\) powder observed by SEM, and EDS mapping images of oxygen, chlorine, and potassium in red, green, and cyan, respectively.",
+    "bbox": [
+      [
+        296,
+        631,
+        700,
+        852
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4 The AIMD calculations: a Trajectories of Li atoms in orthorhombic lattice. b Trajectories of Li atoms in cubic K-doped lattice.",
+    "bbox": [
+      [
+        270,
+        563,
+        718,
+        678
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5 MSD of different atoms in a orthorhombic lattice; b cubic K-doped lattice.",
+    "bbox": [
+      [
+        278,
+        737,
+        716,
+        874
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig. 6 2D nuclear density maps of \\(\\mathrm{Li}_2\\mathrm{OHCl}\\) and \\((\\mathrm{Li}_2\\mathrm{OH})_{0.99}\\mathrm{K}_{0.01}\\mathrm{Cl}\\) deducted from maximum entropy method analysis. The isosurface level is between \\(-0.02\\) and \\(0.04 \\mathrm{fm} \\mathrm{\\AA}^{-3}\\) in a-c plane, and the arrows indicate the preferable \\(\\mathrm{Li}^{+}\\) ions pathways in both structures. The positive density (O atoms) is displayed as red, and the H atoms with negative density (blue) surround the O atoms. The Li atoms with negative density is also displayed as blue, and marked in the figure by \\(\\mathrm{Li1}\\) or \\(\\mathrm{Li2}\\) .",
+    "bbox": [
+      [
+        213,
+        112,
+        785,
+        260
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig.1 The XRD patterns of \\(\\mathrm{Li}_2\\mathrm{OHCl}\\) , \\(10\\%\\) K-doping sample and \\(20\\%\\) K-doping sample respectively.",
+    "bbox": [
+      [
+        312,
+        614,
+        675,
+        850
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig.2 The XRD patterns of \\(\\mathrm{Li}_2\\mathrm{OHCl}\\) and \\((\\mathrm{Li}_2\\mathrm{OH})_{1 - \\mathrm{x}}\\mathrm{K}_\\mathrm{x}\\mathrm{Cl}\\) \\((0.01 \\leq \\mathrm{x} \\leq 0.1)\\) .",
+    "bbox": [
+      [
+        288,
+        369,
+        704,
+        620
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig.3 The crystal structures of cubic \\(\\mathrm{Li}_{2}\\mathrm{OHCl}\\) , \\((\\mathrm{Li}_{2}\\mathrm{OH})_{1 - x}\\mathrm{K}_{x}\\mathrm{Cl}\\) , and KCl \\((\\mathrm{Pm}\\overline{3}\\mathrm{m})\\)",
+    "bbox": [
+      [
+        188,
+        393,
+        808,
+        537
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig.4 a The partial PDF analysis of K-Cl in \\((\\mathrm{Li}_{2}\\mathrm{OH})_{1 - x}\\mathrm{K}_{x}\\mathrm{Cl}\\) . b The K-Cl bond distance according to partial PDF.",
+    "bbox": [
+      [
+        220,
+        595,
+        781,
+        772
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig.5 a Evolution of total energy of the proposed K-doped structure. b-d The extracted structure during the AIMD simulation at 0, 20, and 60 ps.",
+    "bbox": [
+      [
+        213,
+        113,
+        792,
+        476
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig.6 a The XRD patterns of \\(\\mathrm{Li_2OHCl}\\) , \\(10\\%\\) Cs-doping sample and \\(10\\%\\) K-doping sample respectively. b The XRD peaks between 40 and 60 degree to illustrate the lattice expansion caused by Cs-doping.",
+    "bbox": [
+      [
+        182,
+        147,
+        812,
+        345
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig.1 a The crystal structure of cubic \\(\\mathrm{Li_2OHCl}\\) including \\(\\mathrm{[Li_6OH]}\\) octahedra. b The unit cell structure of cubic \\(\\mathrm{Li_2OHCl}\\) . c, d The crystal structure of cubic \\(\\mathrm{(Li_2OH)_{1 - x}K_xCl}\\) and \\(\\mathrm{KCl(Pm\\bar{3}m)}\\) .",
+    "bbox": [
+      [
+        266,
+        147,
+        737,
+        442
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig.2 a Evolution of total energy of the proposed K-doped structure. b-d The extracted structure during the AIMD simulation at 0, 20, and 60 ps.",
+    "bbox": [
+      [
+        220,
+        496,
+        785,
+        845
+      ]
+    ],
+    "page_idx": 28
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig.3 a The partial PDF analysis of K-Cl in \\((\\mathrm{Li}_{2}\\mathrm{OH})_{1 - x}\\mathrm{K}_{x}\\mathrm{Cl}\\) . b The K-Cl bond distance according to partial PDF.",
+    "bbox": [
+      [
+        222,
+        285,
+        781,
+        460
+      ]
+    ],
+    "page_idx": 29
+  }
+]
\ No newline at end of file
diff --git a/269e6ab5a42c417e3970fc94d8b43a798220987aa99faa5495344408b30e30ec/peer_review/images_list.json b/269e6ab5a42c417e3970fc94d8b43a798220987aa99faa5495344408b30e30ec/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/269e6ab5a42c417e3970fc94d8b43a798220987aa99faa5495344408b30e30ec/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/26a1bb18379b6c127d3cd81af55ed98b963e738e9bb4c0c4ee394d14b4f137ed/peer_review/images_list.json b/26a1bb18379b6c127d3cd81af55ed98b963e738e9bb4c0c4ee394d14b4f137ed/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..c5e2d6b257a887d6e9766333ce5cc10af0fdd5d5
--- /dev/null
+++ b/26a1bb18379b6c127d3cd81af55ed98b963e738e9bb4c0c4ee394d14b4f137ed/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Fig. 2 The comparison of the formation of N-ylides from \\(\\mathrm{NH_3}\\) and \\(\\mathrm{NH_3\\cdot H_2O}\\)",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/26a880b5969ef7348afee470574f983c49eaf1116d177ac56dbf7131c24c2098/peer_review/images_list.json b/26a880b5969ef7348afee470574f983c49eaf1116d177ac56dbf7131c24c2098/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..69ad8a5f1a3dfa5233480fd7987f5380ce8e6477
--- /dev/null
+++ b/26a880b5969ef7348afee470574f983c49eaf1116d177ac56dbf7131c24c2098/peer_review/images_list.json
@@ -0,0 +1,86 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure. The plasma viral suppression of LBNP-RPV and LBNP-RPV-CCR5 on day 14 after treatment.",
+    "bbox": [
+      [
+        375,
+        635,
+        572,
+        825
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure. The plasma viral suppression efficiency of LBNP-RPV and LBNP-RPV-CCR5 on day 14.",
+    "bbox": [
+      [
+        400,
+        621,
+        600,
+        828
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure. The plasma viral suppression efficiency of LBNP-RPV and LBNP-RPV-CCR5 at day 14.",
+    "bbox": [
+      [
+        305,
+        619,
+        504,
+        808
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure. TEM images of LBNP-RPV and LBNP-RPV-CCR5 without and with encapsulated nanoprobe.",
+    "bbox": [
+      [
+        490,
+        210,
+        907,
+        546
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure. RPV quantification in different organs of mice treated with (A) LBNP-RPV and (B) LBNP-RPV-CCR5 without nanoprobe, and (C) LBNP-RPV and (D) LBNP-RPV-CCR5 with nanoprobe. (E) Plasma RPV levels in mice treated with LBNPs (E) without and (F) with nanoprobe are shown at 6 and 24 h post-injection.",
+    "bbox": [
+      [
+        215,
+        275,
+        830,
+        616
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure. TEM images of LBNP-RPV and LBNP-RPV-CCR5 without and with encapsulated nanoprobe",
+    "bbox": [
+      [
+        308,
+        555,
+        713,
+        869
+      ]
+    ],
+    "page_idx": 25
+  }
+]
\ No newline at end of file
diff --git a/26aa9b8703faa8f0c63356d5ebaf1f262ff4e5e04957b87b97e3766c8d40bd64/peer_review/images_list.json b/26aa9b8703faa8f0c63356d5ebaf1f262ff4e5e04957b87b97e3766c8d40bd64/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/26aa9b8703faa8f0c63356d5ebaf1f262ff4e5e04957b87b97e3766c8d40bd64/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/26c9c47531daba990bda3dc4edd23a2e0a73ebe882ac06ed9fde98b609425855/peer_review/images_list.json b/26c9c47531daba990bda3dc4edd23a2e0a73ebe882ac06ed9fde98b609425855/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..d0925e5a3932a9d1c3f532aa4761236ff8bc531f
--- /dev/null
+++ b/26c9c47531daba990bda3dc4edd23a2e0a73ebe882ac06ed9fde98b609425855/peer_review/images_list.json
@@ -0,0 +1,23 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Author Response Figure 5| Possible binding sites of 2,6-DTBP in the transmembrane domain (TM). A288 and F388 of the a3 subunits are shown as spheres. a, Top view of TM sectioned near A288, with potential 2,6-DTBP sites indicated by arrows. Sideview of b, \\(\\alpha 3(+)\\beta (-)\\) and c, \\(\\alpha 3(-)\\beta (+)\\) interfaces.",
+    "bbox": [],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Author Response Figure 6| (a)-(d). AlphaFold 3 predictions of (a) and (b) wild type, and (c) and (d) S346E mutation of the GlyR \\(\\alpha 3\\) subunit (a) and (c) are colored according to prediction confidence levels. (b) and (d) are overlays of top 5 models of each. (e) Overlay of top wild-type and S346E models.",
+    "bbox": [
+      [
+        153,
+        100,
+        852,
+        475
+      ]
+    ],
+    "page_idx": 12
+  }
+]
\ No newline at end of file
diff --git a/26fe19d47889be0bd0d342ea25cdca89f71aa0507f43842d511f04b4264fc0d8/peer_review/images_list.json b/26fe19d47889be0bd0d342ea25cdca89f71aa0507f43842d511f04b4264fc0d8/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..14fd8ffa99b099fffe82959618c8aedc5cefa709
--- /dev/null
+++ b/26fe19d47889be0bd0d342ea25cdca89f71aa0507f43842d511f04b4264fc0d8/peer_review/images_list.json
@@ -0,0 +1,163 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1c.jpg",
+    "caption": "Figure 1c. TEM images of M. luteus (ML) or E. coli (EC) treated by \\(1.0\\mathrm{mgmL}^{-1}\\) of diazirine and chlorin e6 (Ce6)-modified gold nanoparticles (AuNPs) (dAuNPs@Ce6) or GP (e.g, poly[4-O-(α-D-glucopyranosyl)-D-glucopyranose]), diazirine and Ce6-modified gold nanoparticles (AuNPs) (GP-dAuNPs@Ce6) at \\(37^{\\circ}\\mathrm{C}\\) for \\(2\\mathrm{h}\\) . After incubation, the treated bacteria were rinsed with PBS buffer for several times. GP-dAuNPs@Ce6-treated bacteria were subjected with or without laser irradiation (405 nm, \\(1.0\\mathrm{Wcm}^{-2}\\) , 25 min). The bacterial cell concentration is \\(\\sim 1.0\\times 10^{7}\\) CFU. Scale bars, \\(200\\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "Supplementary Fig. 1. a, UV-vis absorption spectra of Ce6 with various concentrations ranged from 10 to \\(100\\mu \\mathrm{g}\\mathrm{mL}^{-1}\\) . b, corresponding calibration curve.",
+    "bbox": [
+      [
+        148,
+        95,
+        840,
+        296
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2g.jpg",
+    "caption": "Figure 2g. Evaluation of \\(^{1}\\mathrm{O}_{2}\\) generation by PBS, free Ce6, non-aggregated GP-dAuNPs@Ce6 and aggregated GP-dAuNPs@Ce6 by using the SOSG assay. The concentration of Ce6 in each group is \\(25\\mu \\mathrm{g / mL}\\) .",
+    "bbox": [
+      [
+        319,
+        373,
+        664,
+        583
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2e.jpg",
+    "caption": "Figure 2e. Fluorescence intensity of \\(0.5 \\mathrm{mg} \\mathrm{mL}^{-1}\\) GP-dAuNPs@Ce6 with (+) and without laser irradiation (-).",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3e.jpg",
+    "caption": "Fig. 3e Confocal fluorescence images of pure human blood, the mixture of human blood and EC or SA after incubation with GP-dAuNPs@Ce6. Scale bar: \\(25\\mu \\mathrm{m}\\) .",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4 Aggregation-enhanced imaging of bacteria in superficial tissues based on the proposed strategy. a, In vivo photoacoustic imaging of PA (right side) and SA (left side)-infected sites of mice treated by GP-dAuNPs@Ce6 with or without the irradiation of 405-nm laser and corresponding histograms of fluorescence intensity at two different sites. The bacterial cell concentration during imaging is \\(\\sim 1.0 \\times 10^{7} \\mathrm{CFU}\\) . b, In vivo photoacoustic imaging of the mixture of PA and SA (PA + SA, right side) and PBS (left side)-infected sites of mice injected by GP-dAuNPs@Ce6 with or without the irradiation of 405-nm laser and corresponding histograms of fluorescence intensity at two sites. The bacterial cell concentration during imaging is \\(\\sim 1.0 \\times 10^{7} \\mathrm{CFU}\\) .",
+    "bbox": [
+      [
+        250,
+        220,
+        745,
+        744
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig.5. Aggregation-enhanced imaging of bacteria in tumour and gut based on the developed strategy. a, In vivo photoacoustic imaging of SA-infected sites and tumour sites (containing no SA) of mice treated by GP-dAuNPs@Ce6 with or without the 405-nm laser irradiations and corresponding histograms of photoacoustic intensity at two different sites. b, In vivo",
+    "bbox": [
+      [
+        245,
+        222,
+        752,
+        814
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_15.jpg",
+    "caption": "Supplementary Fig. 15. In vivo toxicity assessments of GP-dAuNPs@Ce6. a, H & E staining of histological evaluation of different organs (heart, liver, spleen, lung, kidney, and brain) harvested from treated mice for 30 days. Scale bars, \\(50 \\mu \\mathrm{m}\\) . The mice in group 1 (G1) are treated with GP-dAuNPs@Ce6+660-nm laser ( \\(12 \\mathrm{mW} \\mathrm{cm}^{-2}\\) , \\(5 \\mathrm{min}\\) ); The mice in group 2 (G2) are treated with GP-dAuNPs@Ce6+808-nm laser ( \\(1.0 \\mathrm{W} \\mathrm{cm}^{-2}\\) , \\(5 \\mathrm{min}\\) ); the mice in group 3 (G3) are treated by GP-dAuNPs@Ce6+660-nm laser ( \\(12 \\mathrm{mW} \\mathrm{cm}^{-2}\\) , \\(5 \\mathrm{min}\\) )+ 808-nm laser ( \\(1.0 \\mathrm{W} \\mathrm{cm}^{-2}\\) , \\(5 \\mathrm{min}\\) ); the mice in group 4 (G4) are treated by GP-dAuNPs@Ce6+405-nm laser ( \\(1.0 \\mathrm{W} \\mathrm{cm}^{-2}\\) , \\(25 \\mathrm{min}\\) )+ 660-nm laser",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig. 6. Aggregation-enhanced in vitro antibacterial activity based on strategy. a, SEM images of SA or EC treated with PBS or GP-dAuNPs@Ce6 with or without irradiation. Scale bars, 300 nm. b, Photographs of agar plates of SA, ML, EC, PA treated by PBS, AuNPs, dAuNPs@Ce6, GP-AuNPs@Ce6 and GP-dAuNPs@Ce6 (with different irradiations of 405, 660 and 808 nm laser) and vancomycin (with various concentration). c-f, Corresponding histograms of bacterial amounts of SA (Fig. 6c), ML (Fig. 6d), EC (Fig. 6e), PA (Fig. 6f) bacteria treated by PBS, AuNPs, dAuNPs@Ce6, GP-AuNPs@Ce6 and GP-dAuNPs@Ce6 (with different irradiation of the 405, 660 and 808 nm laser) and vancomycin (with various concentration). 405-nm laser:1.0 W cm⁻², 25 min; 660-nm laser:12 mW cm⁻², 5 min; 808-nm laser:1.0 W cm⁻², 5 min.",
+    "bbox": [],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_5.jpg",
+    "caption": "Supplementary Fig. 5. The photoluminescence quantum yield (PLQY) of GP-dAuNPs@Ce6 during the laser irradiation.",
+    "bbox": [
+      [
+        170,
+        234,
+        825,
+        775
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "SA: Staphylococcus aureus EC: Escherichia coli",
+    "bbox": [],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5. Aggregation-enhanced imaging of bacteria in tumour and gut based on the developed strategy. a, Schematic illustrating the mice with different treatments: Tumour (right side) and SA (left side), \\(\\sim 1.0 \\times 10^{7}\\) CFU during imaging (I);",
+    "bbox": [],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig. 6. Aggregation-enhanced in vitro antibacterial activity based on strategy. b, Photographs of agar plates of S. aureus (SA), M. luteus (ML), E. coli (EC), P. aeruginosa (PA) treated by PBS, AuNPs, dAuNPs@Ce6, GP-AuNPs@Ce6 and GP-dAuNPs@Ce6 (with different irradiations of 405, 660 and 808 nm laser) and vancomycin (with various concentration) and cefepime (with various concentration). c-f, Corresponding histograms of bacterial amounts of SA (Fig. 6c), ML (Fig. 6d), EC (Fig. 6e), PA (Fig. 6f) bacteria treated by PBS, AuNPs, dAuNPs@Ce6, GP-AuNPs@Ce6 and GP-dAuNPs@Ce6 (with different irradiation of the 405, 660 and 808 nm laser) and vancomycin (with various concentration) and cefepime (with various",
+    "bbox": [],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "EC: Escherichia coli ML: Micrococcus luteus",
+    "bbox": [
+      [
+        237,
+        476,
+        740,
+        742
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Fig. 2. High-angle annular dark field-scanning transmission electron microscope (HAADF-STEM) images of E. coli (EC) or M. luteus (ML) treated by PBS (control), \\(1.0\\mathrm{mgmL^{-1}}\\) of dAuNPs@Ce6 or GP-dAuNPs@Ce6 at \\(37^{\\circ}\\mathrm{C}\\) for \\(2\\mathrm{h}\\) . After incubation, the treated bacteria were rinsed with PBS buffer for several times. The bacterial cell concentration is \\(\\sim 1.0\\times 10^{7}\\) CFU. Scale bars, \\(200\\mathrm{nm}\\) .",
+    "bbox": [
+      [
+        156,
+        98,
+        835,
+        777
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1c.jpg",
+    "caption": "Figure 1c. TEM images of M. luteus (ML) or E. coli (EC) treated by \\(1.0\\mathrm{mg}\\mathrm{mL}^{-1}\\) of diazirine and chlorin e6 (Ce6)-modified gold nanoparticles (AuNPs) (dAuNPs@Ce6) or GP (e.g, poly[4-O-(α-D-glucopyranosyl)-D-glucopyranose]), diazirine and Ce6-modified gold nanoparticles (AuNPs) (GP-dAuNPs@Ce6) at \\(37^{\\circ}\\mathrm{C}\\) for \\(2\\mathrm{h}\\) . After incubation, the treated bacteria were rinsed with PBS buffer for several times. GP-dAuNPs@Ce6-treated bacteria were subjected with or without laser irradiation (405 nm, \\(1.0\\mathrm{W}\\mathrm{cm}^{-2}\\) , \\(25\\mathrm{min}\\) ). The bacterial cell concentration is \\(\\sim 1.0\\times 10^{7}\\mathrm{CFU}\\) . Scale bars, \\(200\\mathrm{nm}\\) .",
+    "bbox": [],
+    "page_idx": 32
+  }
+]
\ No newline at end of file
diff --git a/3150f66396280b33dcf56fa17238c71ab255c0760c4d1d5fa9d14e400dc6b337/peer_review/images_list.json b/3150f66396280b33dcf56fa17238c71ab255c0760c4d1d5fa9d14e400dc6b337/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/3150f66396280b33dcf56fa17238c71ab255c0760c4d1d5fa9d14e400dc6b337/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/317be35cec5dcb7529d586a8a876a9fb573eed3c309c3753ec71677a76ceb18d/peer_review/images_list.json b/317be35cec5dcb7529d586a8a876a9fb573eed3c309c3753ec71677a76ceb18d/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..aabe1ba8afa388e31f6ea55e025568abf010e84f
--- /dev/null
+++ b/317be35cec5dcb7529d586a8a876a9fb573eed3c309c3753ec71677a76ceb18d/peer_review/images_list.json
@@ -0,0 +1,37 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S14. Combination analysis of ChIP sequencing/RNA sequencing data and the specificity of transcription factor binding motifs associated with H3K9cr.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S7. Global genetic knock out of ACSS2 influenced crotonylation and acetylation levels of several histone lysine residues in UUO-induced fibrotic kidneys.",
+    "bbox": [
+      [
+        185,
+        92,
+        792,
+        710
+      ]
+    ],
+    "page_idx": 43
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. S8. Overexpression of ACSS2 in tubular epithelial cells treated with TGFβ1 influenced crotonylation and acetylation levels of several histone lysine residues.",
+    "bbox": [
+      [
+        184,
+        103,
+        757,
+        725
+      ]
+    ],
+    "page_idx": 45
+  }
+]
\ No newline at end of file
diff --git a/31c881eb3ab662e8be55c8cc0ba6a8261c8b852fd7bbef99f961b6c12049d6d6/peer_review/images_list.json b/31c881eb3ab662e8be55c8cc0ba6a8261c8b852fd7bbef99f961b6c12049d6d6/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..d11aa538e7f38ee0b095c1f4185d9cac803445b7
--- /dev/null
+++ b/31c881eb3ab662e8be55c8cc0ba6a8261c8b852fd7bbef99f961b6c12049d6d6/peer_review/images_list.json
@@ -0,0 +1,233 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. LSV curves of a new activated SRO crystal in 1M KOH electrolyte.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. a. Bode plots of SRO catalyst before and after HER testing, \\(20\\%\\) Pt/C, and Ru SAC (Wu et al Inorg. Chem. 2022, 61, 11011). b. illustration of the role of Ru clusters and SRO support.",
+    "bbox": [
+      [
+        185,
+        380,
+        860,
+        580
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R3. (a) LSV curves of the SRO/Ru catalyst with (w) and without (w/o) considering the ohmic drop at \\(70^{\\circ}\\mathrm{C}\\) . (b) Comparison of the Nyquist plots of SRO/Ru catalyst before and after HER testing at room temperature and \\(70^{\\circ}\\mathrm{C}\\) . (c) Tafel slope analysis of the SRO/Ru at \\(70^{\\circ}\\mathrm{C}\\) . (d) Hydrogen bubble release process at \\(70^{\\circ}\\mathrm{C}\\) .",
+    "bbox": [
+      [
+        230,
+        350,
+        764,
+        670
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R4. a and b: SEM images of the SRO crystal surface after long-term testing at \\(70^{\\circ}\\mathrm{C}\\) . c. EDS spectrum recorded at the same crystal after catalysis. Elemental mapping of the cross section d. Ru element, and e. Sr element. f. Ru 3d spectrum of the SRO crystal after catalysis.",
+    "bbox": [
+      [
+        147,
+        453,
+        840,
+        750
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R5. Comparison of the fresh and re-constructed SRO catalysts with reported state-of-the-art catalysts.",
+    "bbox": [
+      [
+        340,
+        392,
+        644,
+        570
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R6. Comparison of the ECSAs between the developed SRO/Ru catalysts with recently reported state-of-the-art catalysts.",
+    "bbox": [
+      [
+        319,
+        253,
+        671,
+        450
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure R7. (a) LSV curves of overall water electrolysis with the SRO as the cathode and commercial Ir/C as the anode in 1M KOH and the current density reaches \\(1000\\mathrm{mAcm}^{-2}\\) . (b) Long-term test of water electrolysis with SRO as the cathodes, and commercial Ir/C as the anode, indicating high electrochemical stability.",
+    "bbox": [
+      [
+        178,
+        106,
+        827,
+        298
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure R8. (a) SEM image of the cross-section of the SRO bulk single crystal. (b). TEM image of the activated SRO bulk single crystal. The depth of the in-situ Ru layer is estimated to be 30 nm. (c) Parameters to calculate the mass activity of the reconstructed Ru cluster.",
+    "bbox": [
+      [
+        222,
+        285,
+        789,
+        570
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure R9. (a) LSV curves of overall water electrolysis with the SRO as the cathode and commercial Ir/C as the anode in 1M KOH and the current density reaches \\(1000\\mathrm{mAcm}^{-2}\\) (iR corrected). (b) Long-term test of water electrolysis with SRO as the cathodes, and commercial Ir/C as the anode, indicating high electrochemical stability.",
+    "bbox": [
+      [
+        175,
+        273,
+        827,
+        465
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Figure R10. A photo was taken during the stability test. A graphite rod was used during the measurements (Taken on \\(3^{\\text{rd}}\\) Dec. 2021, more details- can be provided in the request).",
+    "bbox": [
+      [
+        312,
+        283,
+        682,
+        478
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Figure R11. (a) XPS survey spectrum of SRO/Ru catalyst after stability test at \\(70^{\\circ}\\text{C}\\) . (b) XPS spectrum of the Pt 4f component.",
+    "bbox": [
+      [
+        263,
+        686,
+        732,
+        834
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Figure R12. Comparison of mass activities between the reconstructed SRO/Ru and state-of-the-art noble metal based HER catalysts.",
+    "bbox": [
+      [
+        287,
+        85,
+        705,
+        324
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "Figure R13. LSV curves of Cu and silver paint at different measurement conditions (room temperature in \\(1\\mathrm{M}\\) KOH and \\(0.5\\mathrm{M}\\mathrm{H}_2\\mathrm{SO}_4\\) , and \\(70^{\\circ}\\mathrm{C}\\) in \\(1\\mathrm{M}\\) KOH).",
+    "bbox": [
+      [
+        345,
+        377,
+        629,
+        542
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Figure R14. Adsorption geometry of Ru 1 and Ru 10 clusters at the SRO (001) surface and the corresponding hydrogen adsorption configurations. Green, red, grey, and blue balls represent Sr, Ru, H, and Ru clusters, respectively. Ru cluster structures of a. Ru single atom, and b. Ru10 cluster. Adsorption geometry of b. Ru1/SRO, and f. Ru10/Ru. Top view of the hydrogen adsorption geometry for c. Ru1/SRO, and g. Ru10/SRO. d and h are the corresponding side view of hydrogen adsorption.",
+    "bbox": [
+      [
+        152,
+        85,
+        841,
+        377
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Figure R14. Illustration of the relationship between charge transfer direction and HER activities.",
+    "bbox": [
+      [
+        268,
+        620,
+        725,
+        821
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Figure R16. Electrical equivalent circuits with a two-time constant model to simulate catalysts without (a) and with (b) heavy surface reconstruction.",
+    "bbox": [
+      [
+        327,
+        166,
+        672,
+        370
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Figure R17. The energetically favorable configuration for \\(Ru_{6}\\) /SRO catalysts that are covered by two H atoms.",
+    "bbox": [
+      [
+        377,
+        581,
+        620,
+        755
+      ]
+    ],
+    "page_idx": 29
+  }
+]
\ No newline at end of file
diff --git a/320923420763f8bc864ecc4f0e673a7c70a03a1395b31f83bce12acdf0859e33/peer_review/images_list.json b/320923420763f8bc864ecc4f0e673a7c70a03a1395b31f83bce12acdf0859e33/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..87a3434086dbe3e2532d2fdfd35c8f7f17c3dac0
--- /dev/null
+++ b/320923420763f8bc864ecc4f0e673a7c70a03a1395b31f83bce12acdf0859e33/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Figure 6. (a,b) \\(^{1}\\mathrm{H}\\) NMR spectra of liquid-phase products of aqueous-phase photocatalytic conversion of methane over \\(\\mathrm{TiO_2(001) - C_3N_4 - 0.1}\\) under the",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/3238aacab246a08014c90db4ea130ce0ca3a9fecbca4d962883f5a1814cf778b/peer_review/images_list.json b/3238aacab246a08014c90db4ea130ce0ca3a9fecbca4d962883f5a1814cf778b/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/3238aacab246a08014c90db4ea130ce0ca3a9fecbca4d962883f5a1814cf778b/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/32cc9b20d063e428cb72fea2ee5742fcb422ce4b81cacb415111a21e240467ba/peer_review/images_list.json b/32cc9b20d063e428cb72fea2ee5742fcb422ce4b81cacb415111a21e240467ba/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/32cc9b20d063e428cb72fea2ee5742fcb422ce4b81cacb415111a21e240467ba/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/32ce5cb8bf91cc8d1b87cd0c8e9fab5629e889c8ce4ce0d0a3916f1da8f3d615/peer_review/images_list.json b/32ce5cb8bf91cc8d1b87cd0c8e9fab5629e889c8ce4ce0d0a3916f1da8f3d615/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ed9bae5bc1bd588cc6575cceebabc76f01c692f3
--- /dev/null
+++ b/32ce5cb8bf91cc8d1b87cd0c8e9fab5629e889c8ce4ce0d0a3916f1da8f3d615/peer_review/images_list.json
@@ -0,0 +1,18 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1 miR159 controls cell division and flower opening in rose.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Figure 2 miR159 influences transcript accumulation of cytokinin catabolism genes.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 9
+  }
+]
\ No newline at end of file
diff --git a/332e454b289f21d2896af462c58287b7a803e707ce2ee1dbfd5469a667666e1f/peer_review/images_list.json b/332e454b289f21d2896af462c58287b7a803e707ce2ee1dbfd5469a667666e1f/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/332e454b289f21d2896af462c58287b7a803e707ce2ee1dbfd5469a667666e1f/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/332eaef6f2a04a82806e5273dc5fd96e332fe6e034758ca6c3ddafef1041a5a5/peer_review/images_list.json b/332eaef6f2a04a82806e5273dc5fd96e332fe6e034758ca6c3ddafef1041a5a5/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..1e9d7e5f50036a2e87c633b0a8ff6a8497524fc0
--- /dev/null
+++ b/332eaef6f2a04a82806e5273dc5fd96e332fe6e034758ca6c3ddafef1041a5a5/peer_review/images_list.json
@@ -0,0 +1,152 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure A. Distribution of AAV receptor mRNA expression in CNS models. (A,B) Violin plots showing the expression level of known AAV receptors on mixed CNS cultures at the end of the differentiation protocol (day 24) (A) as well as brain spheroids (day 150) (B). Plots contain pooled data from two biological replicates of mixed cultures or spheroids respectively, each performed in technical duplicate.",
+    "footnote": [],
+    "bbox": [
+      [
+        130,
+        98,
+        896,
+        558
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure B. GFP expression in mixed cultures and brain spheroids. FACS analysis of the percentage of GFP+ cells in mixed cultures and brain spheroids transduced with the indicated vectors.",
+    "footnote": [],
+    "bbox": [
+      [
+        149,
+        606,
+        600,
+        818
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure C. Time course of GFP expression. FACS analysis of GFP expression in iPSC-derived neurons transduced with the indicated serotypes at multiple time-points. Each dot corresponds to data from 1-3 independent transductions.",
+    "footnote": [],
+    "bbox": [
+      [
+        128,
+        283,
+        653,
+        491
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure D. Conditioned media transfer experiment in iPSC-derived neurons. iPSC-derived untransduced (UT) neurons were incubated for 48h with conditioned media (CM) from astrocytes previously transduced with AAV2 for 24h, washed with PBS following media replacement and cultured for another 48h before collecting the supernatant. Panels A and B show IF staining on neurons of yH2AX and cc3 respectively as markers of cell toxicity. Panels C and D show the analysis of GFP and p21 mRNA on untransduced neurons incubated with transduced astrocyte culture supernatants.",
+    "footnote": [],
+    "bbox": [
+      [
+        130,
+        103,
+        865,
+        336
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure E. Violin plots of common genes between human and murine datasets. Violin plot representation of example common genes significantly upregulated across human mixed cultures, brain spheroids and murine striatum datasets contributing to different pathways such as DNA stress response (yellow), pro-inflammatory signalling (purple), type I IFN signalling (green) and mitochondrial stress (orange).",
+    "footnote": [],
+    "bbox": [
+      [
+        118,
+        148,
+        789,
+        499
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure F. Analysis of selected p53-dependent genes (p21, TRIM22, APOBEC3H) and innate immunity markers (IL1b, CXCL8, ISG15) by qPCR in iNSCs transduced with full AAV9 for 6h or 24h.",
+    "footnote": [],
+    "bbox": [
+      [
+        130,
+        100,
+        697,
+        399
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure G. Measurement of GFP-expression levels in iPSC-derived neurons transduced with AAV9.",
+    "footnote": [],
+    "bbox": [
+      [
+        125,
+        465,
+        264,
+        617
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure H. Analysis of AAV-derived signalling in iPSC-derived neurons transduced with full and empty AAV9 at 24h and 48h post-transduction.",
+    "footnote": [],
+    "bbox": [
+      [
+        128,
+        660,
+        870,
+        789
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure I. cc3 staining in iPSC derived neurons. Quantification of cc3 staining by IF imaging in iPSC-derived neurons transduced with AAV9-CAG-GFP during 48 and 72h. Dots correspond to data from 3 pooled experiments.",
+    "footnote": [],
+    "bbox": [
+      [
+        124,
+        99,
+        399,
+        238
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Figure J. Phospho-TBK1 staining in iPSC-derived neurons. Representative IF images of phospho-TBK1 staining (red) in iPSC-derived neurons transduced with AAV9 at MOI 100,000 for 72 h. Images are from one experiment.",
+    "footnote": [],
+    "bbox": [
+      [
+        173,
+        348,
+        725,
+        601
+      ]
+    ],
+    "page_idx": 27
+  }
+]
\ No newline at end of file
diff --git a/33306b23e955a69377a2b9fd4a790f7b5a2a4b3873afaf51206bc0f2c5134481/peer_review/images_list.json b/33306b23e955a69377a2b9fd4a790f7b5a2a4b3873afaf51206bc0f2c5134481/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/33306b23e955a69377a2b9fd4a790f7b5a2a4b3873afaf51206bc0f2c5134481/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/3330d1cba317d38a3dbbbdfbc82ddb986482ff055a13daa4bcc89c14ef195f9c/peer_review/images_list.json b/3330d1cba317d38a3dbbbdfbc82ddb986482ff055a13daa4bcc89c14ef195f9c/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..88801fc99d90a9ea4403dbf4a6d7a8c6e02df624
--- /dev/null
+++ b/3330d1cba317d38a3dbbbdfbc82ddb986482ff055a13daa4bcc89c14ef195f9c/peer_review/images_list.json
@@ -0,0 +1,48 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Large range dl/dV spectra of D4 and D5.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 Large range dl/dV spectra of D6",
+    "footnote": [],
+    "bbox": [
+      [
+        150,
+        551,
+        601,
+        813
+      ]
+    ],
+    "page_idx": 3
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3 The dl/dV (top) and second dl/dV (bottom) spectra of D1 and D2.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4 The dl/dV spectra measured with different lock-in modulation voltages.",
+    "footnote": [],
+    "bbox": [
+      [
+        122,
+        600,
+        637,
+        765
+      ]
+    ],
+    "page_idx": 5
+  }
+]
\ No newline at end of file
diff --git a/347efcc1100703fe62211262a5930efa03644c77c069bbb699843b4ddc143f41/peer_review/images_list.json b/347efcc1100703fe62211262a5930efa03644c77c069bbb699843b4ddc143f41/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/347efcc1100703fe62211262a5930efa03644c77c069bbb699843b4ddc143f41/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/34886832d0d7cf637d11a7dc2250cbcb4f811480e8274314d4fd82662a5cd1e0/peer_review/images_list.json b/34886832d0d7cf637d11a7dc2250cbcb4f811480e8274314d4fd82662a5cd1e0/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..045774c676dbd2da9aabff1247e7bcd49d4ec09d
--- /dev/null
+++ b/34886832d0d7cf637d11a7dc2250cbcb4f811480e8274314d4fd82662a5cd1e0/peer_review/images_list.json
@@ -0,0 +1,170 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_8.jpg",
+    "caption": "Supplementary fig. 8 Exemplary temporal waveform-shape features. Different characteristics of band-pass filtered oscillations or raw-signal can be extracted: peak and troughs amplitudes, prominence of troughs to peaks, intervals between troughs or peaks, sharpness, decay and rise times of identified peaks and troughs, and the 5 ms width of peaks and troughs.",
+    "footnote": [],
+    "bbox": [
+      [
+        245,
+        140,
+        777,
+        560
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure from Köhler et al. Dopamine and DBS accelerate the neural dynamics of volitional action in Parkinson's disease. bioRxiv (Cold Spring Harbor Laboratory) (2023). doi:10.1101/2023.10.30.564700. Under review. (A) Features of a single motor cortex channel averaged across trials. (B) Classifier outputs averaged across subjects. Classifier outputs of electrocorticography (ECoG) and subthalamic local field potentials (STN-LFP) differed between \\(-2.2\\) to \\(1.7\\) s (OFF therapy), \\(-1.6\\) to \\(1.6\\) s (ON levodopa) and \\(-1.0\\) to \\(0.9\\) s (ON subthalamic deep brain stimulation [STN-DBS]; all \\(P\\leq 0.05\\) , cluster corrected). Data are represented as mean \\(\\pm\\) SEM. (C) Time of motor intention of single subjects derived from ECoG classifier outputs. (D) Time of motor intention derived from single-channel ECoG classifier outputs. Left hemispheric channels were flipped onto the right hemisphere. \\(*P\\leq 0.05\\) ; \\(**P\\leq 0.01\\) ; \\(***P\\leq 0.001\\)",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "Supplementary fig. 1: Individual differences in ECoG electrode contact localizations across cohorts.",
+    "footnote": [],
+    "bbox": [
+      [
+        120,
+        315,
+        878,
+        481
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R1: Real-time single trial decoding is shown using true analog rotameter movements, classification probability predictions and binary classification outputs.",
+    "footnote": [],
+    "bbox": [
+      [
+        118,
+        420,
+        575,
+        711
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R2: Movement label transformation. Raw movement traces (a) were transformed by investigating visually the EMG movement onset and offset, which resulted (b) in a binary movement vector. For contrastive learning, the binary movement was filtered using a Gaussian window. This function was beneficial for training the non-linear embedding layer and subsequent movement classification. The Gaussian filtered movement signal closely resembles the movement characteristics of the acquired raw signal.",
+    "footnote": [],
+    "bbox": [
+      [
+        120,
+        430,
+        872,
+        664
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary fig. 3 Stimulation ON/OFF power spectra and cross-prediction movement decoding performances for different stimulation artifact rejection methods. (a) Exemplary power spectra of a single subject without stimulation artifact rejection, and for two artifact rejection methods: PARRM (Period-based",
+    "footnote": [],
+    "bbox": [
+      [
+        184,
+        380,
+        808,
+        844
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R3: (a) New classification results on sensory cortex signals for which the positive movement intention (positive) class was defined as the time-period -2 s prior to movement onset, and the rest (negative) class was defined as -4 till -2 s before movement onset. We excluded the movement period for classifier training, to investigate the single effect of somatosensory cortex related decoding for movement intention. We tested the movement intention decoding using a class-weight balanced and lasso-regularized logistic regression model within a three-fold non-shuffled cross-validation. Sensory cortex prediction performances rose above chance level as early as 2 seconds before motor onset (b) leading to a total balanced accuracy of movement intention classification of \\(0.6 \\pm 0.05\\) (c).",
+    "footnote": [],
+    "bbox": [
+      [
+        120,
+        525,
+        880,
+        700
+      ]
+    ],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_5.jpg",
+    "caption": "Supplementary fig. 5 Connectomics-based neural decoding without patient-individual training. (a) Estimation of a patient-individual \"fingerprint\". For each electrode location, the Region of Interest (ROI) is estimated to identify voxels surrounding the location of the recording contact. The connectivity (e.g. fMRI BOLD correlation) between the ROI voxels to all other voxels is estimated. This correlation brain map is called \"fingerprint\" and represents the brain-wide connectivity of that recording contact. (b) Construction of the neural decoding connectivity map: Connectivity values of the \"fingerprint\" profiles are correlated for each voxel with the machine learning based brain signal decoding performances, resulting in a connectivity",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_4.jpg",
+    "caption": "Supplementary fig. 4 Comparison of different approaches for neural decoding without patient-individual training. (a) Grid-point interpolation: Individual recording contact locations are estimated in a standardized",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 35
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary fig. 2 Sum of linear model absolute value coefficients shows feature importances for all movement decoding patients.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 36
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_9.jpg",
+    "caption": "Supplementary fig. 9 Responsive Neurostimulation (RNS) device artifact annotations and corresponding features. (a) Raw time-series including annotated stimulation and clipping artifacts and (b) corresponding FFT features. The RNS does not allow for simultaneous stimulation and recording. The device parameters allow for specifying a \"gain\" setting that can omit the clipping artifact.",
+    "footnote": [],
+    "bbox": [
+      [
+        131,
+        281,
+        880,
+        580
+      ]
+    ],
+    "page_idx": 38
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Revision Figure 1: Correlation of decoding performances and embedding consistencies. a) Optimal functional connectivity is shown computed based on training data subjects. b) For an exemplar patient (Berlin subject 008), leave-one-patient out cross validation performances were computed. For each test-subject channel, the embeddings were computed given the training data CEBRA non-linear encoding model. The embedding correlations of each channel and the training data is color-coded for the test patients' channels. The embedding consistencies were computed by correlating the training data embedding by other patients' optimal decoding connectivity channels and the left-out test patient embeddings. c) A significant correlation could be found between left-out decoding performances and channel-individual embedding correlations.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 43
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Revision Figure 3: Electrode localizations color-coded by patient ID.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 46
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Revision Figure 4: Optimal structural seizure decoding network (a) predicts seizure detection performance in leave one subject out cross-validation (b).",
+    "footnote": [],
+    "bbox": [
+      [
+        122,
+        170,
+        925,
+        444
+      ]
+    ],
+    "page_idx": 54
+  }
+]
\ No newline at end of file
diff --git a/3496b010fadd7d3394e5b61e1c2c42ff7e5a30126c294ca855e71942bda8ed27/peer_review/images_list.json b/3496b010fadd7d3394e5b61e1c2c42ff7e5a30126c294ca855e71942bda8ed27/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/3496b010fadd7d3394e5b61e1c2c42ff7e5a30126c294ca855e71942bda8ed27/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/34bda91a6f84b62537b925a8aba36041ed674afc3669d6aec8f5a9dba296bad4/peer_review/images_list.json b/34bda91a6f84b62537b925a8aba36041ed674afc3669d6aec8f5a9dba296bad4/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..065e9bf8bd65568cf3f03667340913119b874800
--- /dev/null
+++ b/34bda91a6f84b62537b925a8aba36041ed674afc3669d6aec8f5a9dba296bad4/peer_review/images_list.json
@@ -0,0 +1,93 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Optimized structures for the adsorption of PEA cation on the perovskite surface; (a) through -NH3 and (b) through phenyl group.",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure R2. Schematic illustration of 2D perovskite and organic halide salt-assembled perovskite surface.",
+    "bbox": [
+      [
+        345,
+        184,
+        652,
+        360
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure R3. \\(J - V\\) characteristics of the PEAI-passivated devices with and without thermal annealing.",
+    "bbox": [
+      [
+        315,
+        432,
+        675,
+        650
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure R4. Tauc plot of the perovskite films without and with \\(o\\) -PDEAI₂ passivation.",
+    "bbox": [
+      [
+        320,
+        540,
+        664,
+        761
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure R5. Illustration of proposed energy band bending of the perovskite film with \\(o\\) -PDEAI₂ passivation.",
+    "bbox": [
+      [
+        200,
+        142,
+        800,
+        370
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure R6. Optimized structures for the adsorption of (a-b) ortho-, (c-d) meta- and (e-f) para cation on the perovskite surface. Left and right panel represents the adsorption through ammonium and phenyl group, respectively.",
+    "bbox": [
+      [
+        240,
+        297,
+        770,
+        747
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure R7. Molecule Structure of the organic halide salts.",
+    "bbox": [
+      [
+        280,
+        144,
+        714,
+        450
+      ]
+    ],
+    "page_idx": 13
+  }
+]
\ No newline at end of file
diff --git a/34f7befbd20dae5c695338ff41653b8cd42a39e97aca4a39019001bb2d49d423/peer_review/images_list.json b/34f7befbd20dae5c695338ff41653b8cd42a39e97aca4a39019001bb2d49d423/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..41f19d7aa267c2c5c77add9506dc455dd7fec16d
--- /dev/null
+++ b/34f7befbd20dae5c695338ff41653b8cd42a39e97aca4a39019001bb2d49d423/peer_review/images_list.json
@@ -0,0 +1,79 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_21.jpg",
+    "caption": "Supplementary Fig. 21 | PL and TOF-SIMS map of pristine \\((\\mathbf{FA}_{1 - x}\\mathbf{MA}_x)\\mathbf{Pb}(\\mathbf{I}_{1 - y}\\mathbf{Br}_y)_3\\) perovskite film. a PL intensity map (750 nm) for perovskite composition \\(\\{x / y\\} = 0.75\\colon 0.50\\) Dashed square represents sample area was used for TOF-SIMS measurement. b Corresponding TOF-SIMS map of \\(\\Gamma /\\mathrm{Br}^{-}\\) ratio.",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5 | Heterogeneity in photoluminescence emission. Hyperspectral luminescence of perovskite thin films with compositions. \\(\\mathbf{a} - \\mathbf{d}\\{x / y\\} = 0.25[0.40. \\mathbf{e} - \\mathbf{h}\\{x / y\\} = 0.75;0.40. \\mathbf{i} - \\mathbf{l}\\{x / y\\} = 0.75;0.50\\) . Here, 2D emission maps in panels a, e, and i represent the wavelength at emission maximum for pristine films. 2D maps in panels b, f, and j show the wavelength change \\((\\Delta \\lambda)\\) upon continuous illumination (450 nm, 5 min.). Spectra in panels c, g, and k are averaged over the scanned area of pristine (red line) and illuminated (blue shaded) films. Panels d, h, and l show histogram of maximum emission wavelengths in pristine (red) and illuminated (blue) thin films. The maps show that emission heterogeneity increases with increasing MA and Br content and that",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Fig. 6 | Three-dimensional atomic force microscopy height profiles of \\((\\mathbf{FA}_{1 - x}\\mathbf{MA}_x)\\mathbf{Pb}(\\mathbf{I}_{1 - y}\\mathbf{Br}_y)_3\\) perovskite thin films. a \\(\\{x / y\\} = 0.25|0.40\\) . b \\(\\{x / y\\} = 0.50|0.40\\) . c \\(\\{x / y\\} = 0.75|0.40\\) . d \\(\\{x / y\\} = 0.25|0.50\\) . e \\(\\{x / y\\} = 0.50|0.50\\) . f \\(\\{x / y\\} = 0.75|0.50\\) . g \\(\\{x / y\\} = 0.25|0.60\\) . h \\(\\{x / y\\} = 0.50|0.60\\) . i \\(\\{x / y\\} = 0.75|0.60\\) .",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Fig. 2 | Surface SEM images of \\((\\mathrm{FA}_{1 - x}\\mathrm{MA}_x)\\mathrm{Pb}(\\mathrm{I}_{1 - y}\\mathrm{Br}_y)_3\\) perovskite films with \\(50\\%\\) Br content and different MA contents. \\(a x = 0.25\\) . \\(b.x = 0.50\\) . \\(c.x = 0.75\\)",
+    "footnote": [],
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_5.jpg",
+    "caption": "Supplementary Fig. 5 | Atomic force microscopy height profiles of \\((\\mathrm{FA}_{1 - x}\\mathrm{MA}_x)\\mathrm{Pb}(\\mathrm{I}_{1 - y}\\mathrm{Br}_y)_3\\) perovskite thin films. a \\(\\{x / y\\} = 0.25 / 0.40\\) . b \\(\\{x / y\\} = 0.50 / 0.40\\) . c \\(\\{x / y\\} = 0.75 / 0.40\\) . d \\(\\{x / y\\} = 0.25 / 0.50\\) . e \\(\\{x / y\\} = 0.50 / 0.50\\) . f \\(\\{x / y\\} = 0.75 / 0.50\\) . g \\(\\{x / y\\} = 0.25 / 0.60\\) . h \\(\\{x / y\\} = 0.50 / 0.60\\) . i \\(\\{x / y\\} = 0.75 / 0.60\\) . Scale bars are \\(10\\mu \\mathrm{m}\\) . Height range is from \\(0 - 2.0\\mu \\mathrm{m}\\) .",
+    "footnote": [],
+    "bbox": [
+      [
+        141,
+        383,
+        863,
+        629
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Fig. 6 | Three-dimensional atomic force microscopy height profiles of \\((\\mathbf{FA}_{1 - x}\\mathbf{MA}_x)\\mathbf{Pb}(\\mathbf{I}_{1 - y}\\mathbf{Br}_y)_3\\) perovskite thin films. a \\(\\{x / y\\} = 0.25|0.40\\) . b \\(\\{x / y\\} = 0.50|0.40\\) . c \\(\\{x / y\\} = 0.75|0.40\\) . d \\(\\{x / y\\} = 0.25|0.50\\) . e \\(\\{x / y\\} = 0.50|0.50\\) . f \\(\\{x / y\\} = 0.75|0.50\\) . g \\(\\{x / y\\} = 0.25|0.60\\) . h \\(\\{x / y\\} = 0.50|0.60\\) . i \\(\\{x / y\\} = 0.75|0.60\\) .",
+    "footnote": [],
+    "bbox": [
+      [
+        127,
+        132,
+        856,
+        462
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Supplementary Fig. 7 | Film roughness as a function of \\((\\mathbf{FA}_{1 - x}\\mathbf{MA}_x)\\mathbf{Pb}(\\mathbf{I}_{1 - y}\\mathbf{Br}_y)_3\\) perovskite composition. a Average maximum peak profile height. b Root mean square average roughness.",
+    "footnote": [],
+    "bbox": [
+      [
+        200,
+        556,
+        787,
+        711
+      ]
+    ],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/34ffb1e94670869a16ed0eef08f47f95dd3fdaca90dc0993f3df911d43abf1fb/peer_review/images_list.json b/34ffb1e94670869a16ed0eef08f47f95dd3fdaca90dc0993f3df911d43abf1fb/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..8559a1fab9ea88ad7aa6b47b6e8865bfaba8d125
--- /dev/null
+++ b/34ffb1e94670869a16ed0eef08f47f95dd3fdaca90dc0993f3df911d43abf1fb/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Table R1. Initial studies of nucleophilesa.",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/35059ef94958142f7bba3bb7b7bd64cdfb02d847ce795d1a5fb6e0d488bd1269/peer_review/images_list.json b/35059ef94958142f7bba3bb7b7bd64cdfb02d847ce795d1a5fb6e0d488bd1269/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..02920fcda5027ff344542c2774edae150e6361e4
--- /dev/null
+++ b/35059ef94958142f7bba3bb7b7bd64cdfb02d847ce795d1a5fb6e0d488bd1269/peer_review/images_list.json
@@ -0,0 +1,86 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure 3: Characterization of the NIR threshold dose and the printed voxel size. (A) Schematic illustration of the method for printing and characterizing a 'voxel'. Because of the small refractive index mismatch between crosslinked and unpolymerized gelMA, the beam is scanned on the \\(x\\) -axis to increase the phase change and improve the imaging contrast in the \\(y\\) -plane. (B) For the characterization, the prints are imaged with a DPC microscope. The acquired images enable the reconstruction of the phase of the samples with sufficient contrast to extract features like the voxel size. (C) DPC images of voxels (marked with arrows) with different doses of NIR light (NIR intensity: \\(1.1 \\times 10^{5} \\mathrm{W / cm^{2}}\\) , exposure time: 6–12 s). The dose used to print the voxel indicated by the red arrow corresponds to the polymerization threshold dose at this excitation intensity. (D) Profile along \\(y\\) -direction across the center of the voxels (highlighted in yellow), and (E) the corresponding CNR. The gray dotted line indicates the CNR of the image we choose for the polymerization threshold, and the red dotted line indicates the threshold dose. (F) Polymerization threshold dose versus the excitation intensity. (G) Reconstructed phase of voxels printed at different excitation intensities with CNR =15 in DPC images (for a similar refractive index change). Lateral (H) and axial (I) size of the fluorescence and the printed voxels versus the excitation intensity. The dashed line marks the focal spot size of the NIR beam in each direction.",
+    "bbox": [
+      [
+        156,
+        90,
+        760,
+        565
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Figure 4: Fabrication of a butterfly of tunable feature sizes with UCNP-assisted multi-photon printing. (A) Butterfly model and its projections in two orthogonal directions. The model is printed at different excitation intensities based on the axial feature size. The NIR light dose is adjusted for each voxel to change its size while preserving a uniform degree of polymerization across the whole structure. DPC images of xy-plane (B) and yz-plane (C) show the scanning range and the feature size, respectively. The body and the antenna of the butterfly are printed with a larger scanning range, resulting in higher contrast in the xy-plane projection.",
+    "bbox": [
+      [
+        167,
+        100,
+        777,
+        256
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Re-Figure 2 (a) Figure 4 of the article (Nanophotonics 12, no:1527-1536). (b) SEM image of the 3D woodpile structure photoresist sample printed via CUCPP.",
+    "bbox": [
+      [
+        167,
+        348,
+        840,
+        615
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Re-Figure 5 Figure 5(b) in the article",
+    "bbox": [],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_7.jpg",
+    "caption": "Re-Figure 7 Original and modified images of figure 1(b, c) in article.",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "Re-Figure 9 Original and modified images of Figure 2(a) in article.",
+    "bbox": [],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_14.jpg",
+    "caption": "Re-Figure 14 Figure 5(b) in the article",
+    "bbox": [],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Re-Figure 2 Original and modified images of figure 1(b, c) in article.",
+    "bbox": [],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Gray-scale image data acquisition",
+    "bbox": [],
+    "page_idx": 17
+  }
+]
\ No newline at end of file
diff --git a/35669e218a8450fbf60cba53e6ae3b818e8834251f0adf0904504d7571774ffe/peer_review/images_list.json b/35669e218a8450fbf60cba53e6ae3b818e8834251f0adf0904504d7571774ffe/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..9f8963e38f1d8276e0fd63feffee3487b19a19af
--- /dev/null
+++ b/35669e218a8450fbf60cba53e6ae3b818e8834251f0adf0904504d7571774ffe/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1: Knockout of \\(\\Delta\\) LRP5/6 does not affect FZD/DVL activation by WNT-16B. \\(\\Delta\\) BRET traces of HEK293 cells and \\(\\Delta\\) LRP5/6 cells transfected with a FZD5-DEP-Clamp conformational biosensor, stimulated with WNT-16B (1000 ng/ml). Data points are average \\(\\pm\\) SEM of three independent experiments performed in triplicate.",
+    "bbox": [],
+    "page_idx": 14
+  }
+]
\ No newline at end of file
diff --git a/3571b727770c1dfc63ba1f399fc53b7d558bebd35a3fcc2b012d6e469520b5e0/peer_review/images_list.json b/3571b727770c1dfc63ba1f399fc53b7d558bebd35a3fcc2b012d6e469520b5e0/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..67376c5c08981b64d4f7fe8463c424617705c8d4
--- /dev/null
+++ b/3571b727770c1dfc63ba1f399fc53b7d558bebd35a3fcc2b012d6e469520b5e0/peer_review/images_list.json
@@ -0,0 +1,72 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Figure 1 The paired factor t-test results of two sets of data from 2020 to 2029 and 2090 to 2099 in the C/N ratio (predicted data set).",
+    "bbox": [
+      [
+        241,
+        101,
+        737,
+        362
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1. (a) The correlation of each index to these three variables. (b) The feature importance of each index to these three variables. It depends on the use, chemical properties, and migration trend of the elements.",
+    "bbox": [
+      [
+        147,
+        119,
+        816,
+        337
+      ]
+    ],
+    "page_idx": 63
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2. Trends in simulated results (blue line) and measured values (purple line) of the receptor model (2015–2022). Error bars represent parallel samples of multiple sampling points. Part (a) represents nutrients, and part (b) represents TMs.",
+    "bbox": [
+      [
+        196,
+        120,
+        763,
+        740
+      ]
+    ],
+    "page_idx": 64
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3. The trend of dissolved phase concentration of some water quality indices in 2015–2099. Error bars represent parallel samples of multiple sampling points.",
+    "bbox": [
+      [
+        198,
+        120,
+        763,
+        820
+      ]
+    ],
+    "page_idx": 65
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4.jpg",
+    "caption": "Fig. 4 The monthly variation of metal concentrations in the aqueous phase of the study area. The annual range of concentrations represents the ratio of the difference between the maximum and",
+    "bbox": [
+      [
+        150,
+        92,
+        842,
+        551
+      ]
+    ],
+    "page_idx": 66
+  }
+]
\ No newline at end of file
diff --git a/359be6d6c657f2bb73f69e34475b015ae9d191307880072bd39d16def002ec0d/peer_review/images_list.json b/359be6d6c657f2bb73f69e34475b015ae9d191307880072bd39d16def002ec0d/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/359be6d6c657f2bb73f69e34475b015ae9d191307880072bd39d16def002ec0d/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/35b9b1b3a183dd4ef4b74a0537151a3804476f6cbfa6b4b04991fd8262be8a60/peer_review/images_list.json b/35b9b1b3a183dd4ef4b74a0537151a3804476f6cbfa6b4b04991fd8262be8a60/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..e8e5d86b87f93aea6450a4ac7c9a13545256de60
--- /dev/null
+++ b/35b9b1b3a183dd4ef4b74a0537151a3804476f6cbfa6b4b04991fd8262be8a60/peer_review/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "8PPU Model vs map FSC",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "8PPV model vs map FSC",
+    "bbox": [
+      [
+        135,
+        325,
+        421,
+        461
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "8PPU",
+    "bbox": [],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "8PPV",
+    "bbox": [
+      [
+        118,
+        223,
+        848,
+        315
+      ]
+    ],
+    "page_idx": 8
+  }
+]
\ No newline at end of file
diff --git a/35c1fb3d5b0846d4e3f04f2107ff1cd05f08c63a01fb6459020f7235886fabcd/peer_review/images_list.json b/35c1fb3d5b0846d4e3f04f2107ff1cd05f08c63a01fb6459020f7235886fabcd/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..dec749f1d69fa51521e84bea13e87be24807ccec
--- /dev/null
+++ b/35c1fb3d5b0846d4e3f04f2107ff1cd05f08c63a01fb6459020f7235886fabcd/peer_review/images_list.json
@@ -0,0 +1,9 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "The full MS spectra is shown on page S28",
+    "bbox": [],
+    "page_idx": 0
+  }
+]
\ No newline at end of file
diff --git a/35e3e8f18161fd3b00618bd240d474f1565005f106a10cc0f5c5412ea7c2b678/peer_review/images_list.json b/35e3e8f18161fd3b00618bd240d474f1565005f106a10cc0f5c5412ea7c2b678/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ff672d55e20a832e7a34951951f15a8d5c8e958f
--- /dev/null
+++ b/35e3e8f18161fd3b00618bd240d474f1565005f106a10cc0f5c5412ea7c2b678/peer_review/images_list.json
@@ -0,0 +1,65 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure R1. Cl \\(2p\\) XPS spectra of the cathode before and after cycling. Adopted from (Nat. Commun., 2024, 15, 1481).",
+    "bbox": [
+      [
+        257,
+        92,
+        770,
+        261
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_13.jpg",
+    "caption": "Supplementary Figure 13. \\(^{23}\\mathrm{Na}\\) solid-state nuclear magnetic resonance (ss-NMR) of \\(\\mathrm{Na_2ZrCl_6}\\) , \\(\\mathrm{Na_0.5ZrCl_4.5}\\) , and \\(\\mathrm{Na_0.5ZrCl_4F_{0.5}}\\) electrolytes.",
+    "bbox": [
+      [
+        339,
+        535,
+        694,
+        772
+      ]
+    ],
+    "page_idx": 31
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure S14. a Normalized Zr K-edge XANES spectra of HNiSEs. The schematic local structures of ZrCl4 and ZrF4 are also displayed. b FT of \\(\\mathbf{k}^3\\) -weighted Zr K-edge EXAFS spectra of HNiSEs. ZrCl4 and ZrF4 are reference samples. WT-EXAFS spectrum of (c) \\(\\mathrm{Na_{0.5}ZrCl_{4}F_{0.5}}\\) , and (d) \\(\\mathrm{Na_{0.5}ZrCl_{4.5}}\\) at the Zr K-edge. A \\(\\mathbf{k}^3\\) -weighted was employed.",
+    "bbox": [],
+    "page_idx": 32
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure S15. Computed structure of amorphous \\(\\mathrm{Na_{0.5}ZrCl_{4}F_{0.5}}\\) SEs from melt-and-annealing AIMD simulations. a Radial distribution function (RDF) of Na-F in \\(\\mathrm{Na_{0.5}ZrCl_{4}F_{0.5}}\\) at different simulation temperatures. Static Na-F bond lengths at 1800 K (b), 1000 K (c), and 300 K (d). e Comparison of Na-F bond lengths in crystalline \\(\\mathrm{Na_{2}ZrF_{6}}\\) reference.",
+    "bbox": [
+      [
+        174,
+        105,
+        816,
+        360
+      ]
+    ],
+    "page_idx": 38
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure S13. \\(^{23}\\mathrm{Na}\\) solid-state nuclear magnetic resonance (ss-NMR) of \\(\\mathrm{Na_{2}ZrCl_{6}}\\) , \\(\\mathrm{Na_{0.5}ZrCl_{4.5}}\\) , and \\(\\mathrm{Na_{0.5}ZrCl_{4}F_{0.5}}\\) electrolytes.",
+    "bbox": [
+      [
+        325,
+        605,
+        680,
+        840
+      ]
+    ],
+    "page_idx": 43
+  }
+]
\ No newline at end of file
diff --git a/35ff6090b22a6d9c22b3398fb33b669f25eec754edf1f49fc8fb286237cd8689/peer_review/images_list.json b/35ff6090b22a6d9c22b3398fb33b669f25eec754edf1f49fc8fb286237cd8689/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/35ff6090b22a6d9c22b3398fb33b669f25eec754edf1f49fc8fb286237cd8689/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/4bfaaebf9e9347a73ef3f9da4d1c23835d4a53f76880e1566ba702ba7326cbb2/peer_review/images_list.json b/4bfaaebf9e9347a73ef3f9da4d1c23835d4a53f76880e1566ba702ba7326cbb2/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..e0d366fec1b561e3cea98a37b65c47a79773e1f8
--- /dev/null
+++ b/4bfaaebf9e9347a73ef3f9da4d1c23835d4a53f76880e1566ba702ba7326cbb2/peer_review/images_list.json
@@ -0,0 +1,177 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_21.jpg",
+    "caption": "New Supplementary Fig. 21 | a, Calculated residual \\(\\mathrm{NaBiV}_3\\mathrm{O}_9\\) -PEG concentrations in sodium-free potassium phosphate buffer at different pH values based on the measured \\(\\mathrm{Na}^+\\) concentrations by ICP-MS. b, First order reaction kinetics fitting of \\(\\mathrm{NaBiV}_3\\mathrm{O}_9\\) -PEG concentration versus time. Data in a were shown as mean ± s.d.",
+    "bbox": [
+      [
+        100,
+        91,
+        904,
+        320
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "New Fig. 9 | a, Long-term biodistribution of \\(\\mathsf{NaBiV}O_3\\) -PEG in the main organs of mice at each time point after systematic administration \\((n = 3\\) mice). Data were shown as mean ± s.d.",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_13.jpg",
+    "caption": "New Supplementary Fig. 13 | Raman spectra of \\(\\mathrm{NaBi^{IV}O_3}\\) -PEG after dispersed in SBF at pH 5.5 for 54, 60, 66, and 72 h.",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "New Fig. 8 | f. Cell cycle states of 4T1 cells under different treatments.",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "New Fig. 2 | TEM images (j) and the corresponding BF image, HADDF image, and elemental mapping images (k) of NaBiVO<sub>3</sub>-PEG.",
+    "bbox": [],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 |1, FTIR spectra of \\(\\mathrm{NaBi^{IV}O_3}\\) , DSPE-mPEG5k, and \\(\\mathrm{NaBi^{IV}O_3}\\) -PEG.",
+    "bbox": [],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "New Fig. 2 | TEM images (j) and the corresponding BF image, HADDF image, and elemental mapping images (k) of \\(\\mathrm{NaBi^{IV}O_3}\\) -PEG.",
+    "bbox": [
+      [
+        111,
+        416,
+        895,
+        614
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "New Fig. 5 | h, Representative ROS staining images of primary tumor slices collected on day 2 from mice after receiving different treatments.",
+    "bbox": [],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_6.jpg",
+    "caption": "Fig. 6 | In vivo immune mechanism study of NaBiVO-PEG. a-f, Flow cytometric analyses of the percentage of major immune cells, including mature DCs in tumor-draining lymph node (a,b), CD4+ T cells (c,d), and CD8+ T cells (e,f) in distant tumor (n = 3 biologically independent mice). g-j, Secretion of cytokines in sera measured by ELISA assay (n = 3 biologically independent mice). Data in b, d, f, g, h, i, and j were shown as mean ± s.d. The P values were analyzed by one-way ANOVA with Tukey's multiple comparison test. \\*P < 0.05, \\*\\*P < 0.01, \\*\\*\\*P < 0.001, \\*\\*\\*\\*P < 0.0001, and n.s., not significant.",
+    "bbox": [],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_9.jpg",
+    "caption": "New Fig. 9 | b, Bismuth amounts measured in urine and feces collected at different time points \\((n = 3\\) mice). Data in b were shown as mean \\(\\pm\\) s.d.",
+    "bbox": [],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "New Fig. 2 | TEM images (I) and the corresponding BF image, HADDF image, and elemental mapping images (k) of \\(\\mathrm{NaBi}^{IV}\\mathrm{O}_3\\) -PEG.",
+    "bbox": [],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Supplementary Fig. 7 | Dynamic light scattering (DLS) data of \\(\\mathrm{Bi}^{III}\\mathrm{O}_x\\) , \\(\\mathrm{NaBi}^{IV}\\mathrm{O}_3\\) and",
+    "bbox": [
+      [
+        339,
+        700,
+        654,
+        875
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Fig. 3 | l,m, Time-dependent fluorescence intensity of \\(\\mathsf{NaBi}^{1}\\mathsf{O}_3\\) -PEG recorded at \\(525 \\text{nm}\\) after incubation with APF (I) or SOSG (m) in PBS with or without \\(\\mathsf{H}_2\\mathsf{O}_2\\) (1 mM). n, EPR spectra of DMPO mixed with \\(\\mathsf{NaBi}^{1}\\mathsf{O}_3\\) -PEG in methanol-contained PBS (pH 5.5) with or without \\(\\mathsf{H}_2\\mathsf{O}_2\\) (1 mM).",
+    "bbox": [
+      [
+        125,
+        400,
+        875,
+        564
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_33.jpg",
+    "caption": "New Supplementary Fig. 33 | Morphology of MB49 cells under different treatments.",
+    "bbox": [],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_34.jpg",
+    "caption": "New Supplementary Fig. 34 | a, Cell viabilities of 4T1 cells after incubated with different concentrations of \\(\\mathrm{NaBiV_3O_3}\\) -PEG with Vitamin C (1 mM) added as the ROS scavenger. b,",
+    "bbox": [
+      [
+        92,
+        516,
+        890,
+        855
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Response Fig. 1 | Representative photographs taken at day 14 of mice with both primary and distant tumors after intratumorally injected with 4, 8, and 16 mg kg<sup>-1</sup> of NaBi<sup>IV</sup>O<sub>3</sub>-PEG, respectively.",
+    "bbox": [
+      [
+        255,
+        85,
+        731,
+        283
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_8.jpg",
+    "caption": "Fig. 8 | b, Bio-TEM images of \\(\\text{NaBi}^{V} \\text{O}_{3} - \\text{PEG}\\) after i.v. administrated for 24, 48, and 72 h.",
+    "bbox": [],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_46.jpg",
+    "caption": "New Supplementary Fig. 46 | Uncropped Western blot results of DNA damage repair proteins of 53BP1 and RAD51 in cells after different treatments.",
+    "bbox": [
+      [
+        191,
+        85,
+        808,
+        336
+      ]
+    ],
+    "page_idx": 19
+  }
+]
\ No newline at end of file
diff --git a/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/peer_review/images_list.json b/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/preprint/supplementaries/SupplementaryFig.110/images_list.json b/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/preprint/supplementaries/SupplementaryFig.110/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ffb115773fc947cf116153c8bfaafa4ceb73bb95
--- /dev/null
+++ b/4c16b9c05d6fd67eacbe656aefb11332a7ebbf8f638ba0ee5d72682fbee2a48b/preprint/supplementaries/SupplementaryFig.110/images_list.json
@@ -0,0 +1,65 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Fig. 2 | Population structure of BSI-derived S. aureus in 1994-2000. Midpoint-rooted ML tree showing the phylogenetic structure of 183 S. aureus isolates in 1994-2000. Scale bar represents the number of nucleotide substitutions per site. Matrix of metadata 1, 2, and 4 show the same as those of Fig. 1. Metadata 3 indicates S. aureus isolation year. The color tone is shown in the same pattern as Fig. 1. Metadata information of 183 S. aureus isolates in 1994-2000 is summarized in Supplementary Table 2.",
+    "bbox": [
+      [
+        30,
+        255,
+        707,
+        642
+      ]
+    ],
+    "page_idx": 1
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "1994-2000 (n=183)",
+    "bbox": [],
+    "page_idx": 1
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "2019-2020 (n=580)",
+    "bbox": [
+      [
+        28,
+        550,
+        966,
+        757
+      ]
+    ],
+    "page_idx": 1
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "a.",
+    "bbox": [
+      [
+        45,
+        120,
+        600,
+        280
+      ]
+    ],
+    "page_idx": 1
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "a. CC1",
+    "bbox": [],
+    "page_idx": 2
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_8.jpg",
+    "caption": "Supplementary Fig. 8 | Stepwise acquisition of genomic islands or SCCmec composition island during the replacement of ST5-MSA ancestor by ST764-SCCmecl (see parallel with Fig. 4c). a. Genetic structure around genomic island vSa3. Vertical lines indicate the position of the direct repeat (DR): DR1, GTTTTACATCATTCCCGGCAT; DR2, GTTTTACATCATTCCCGGCAT. b. Genetic structure around tet(M)-harboring Tn916-like transposable unit. Vertical lines indicate the position of the inverted repeat (IR): IR1, GCTTTTTTTA; IR2, GCTTTTTTA. c Genetic structure around genomic island vSa4. Vertical lines indicate the position of the direct repeat (DR): DR5, repeat (DR): DR3, AAATCCCGCCGTTCTCCAT; DR4, AACTCCGCCGCTCTCCAT. d Genetic structure around genomic island vSa1. Vertical lines indicate the position of the direct repeat (DR): DR5, AAATGGATAAAGAAATCA; DR6, AAATGGCTGGAGGAATCA. e Genetic structure around SCCmec region. Vertical lines indicate the position of the direct repeat (DR): DR7, GGAGAAGCATATCATATA; DR8, GCAGAGGCTGATCATATA; IR1, TAAGACATCAC; IR3, GAGATGTATTA; DR9, AGAAGGTCACCACA; DR10, GAAGGCTATCATAAAGTGAA.",
+    "bbox": [],
+    "page_idx": 2
+  }
+]
\ No newline at end of file
diff --git a/4c4cd26e40c760830dad129bd03915bd0db4748f9a3bea633e11bfafe58df3ba/peer_review/images_list.json b/4c4cd26e40c760830dad129bd03915bd0db4748f9a3bea633e11bfafe58df3ba/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/4c4cd26e40c760830dad129bd03915bd0db4748f9a3bea633e11bfafe58df3ba/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/peer_review/images_list.json b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..fc563ae07a5cb1269e01123be60f7257f23fdb8f
--- /dev/null
+++ b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/peer_review/images_list.json
@@ -0,0 +1,317 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1B.jpg",
+    "caption": "Fig. 1B",
+    "bbox": [
+      [
+        206,
+        560,
+        620,
+        688
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Fig. S21 Representative images of sperm from \\(Tex44^{+/+}\\) and \\(Tex44^{+/+}\\) mice stained with eosin-nigrosine. Live sperm appear unstained (yellow arrowheads), while dead sperm are stained red (red arrowheads).",
+    "bbox": [
+      [
+        220,
+        88,
+        780,
+        375
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1K.jpg",
+    "caption": "Fig. 1K",
+    "bbox": [
+      [
+        220,
+        504,
+        496,
+        656
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 Transmission electron microscopy of longitudinal sperm flagellar midpiece sections from fertile controls and individuals with biallelic TEX44 variants. Red arrows indicate sloughed-off mitochondria; yellow arrowheads indicate the annulus. Scale bar: 500 nm.",
+    "bbox": [
+      [
+        230,
+        684,
+        771,
+        789
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Fig. S2B Western blot confirming the absence of TEX44 expression in the testis of \\(T e x4^{4 - }\\) male mice compared to the expression observed in male \\(T e x4^{4 + }\\) mice. \\(\\beta\\) -Actin was used as a loading control. Fig. S8A Western blot analysis of TEX44 expression in testicular lysates from control and Cpt1b gKO mice. \\(\\beta\\) -Tubulin served as a loading control. Fig. S8C Western blot analysis of TEX44 expression in spermatozoa collected from the cauda epididymis of control and Cpt1b gKO mice. TEX44 is undetectable in spermatozoa from Cpt1b gKO mice.",
+    "bbox": [],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Fig. S3K",
+    "bbox": [
+      [
+        227,
+        555,
+        770,
+        720
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Fig. S3D",
+    "bbox": [
+      [
+        180,
+        250,
+        820,
+        496
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Fig. S3D",
+    "bbox": [
+      [
+        170,
+        115,
+        812,
+        350
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Fig. S5E",
+    "bbox": [
+      [
+        214,
+        100,
+        455,
+        202
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Fig. S5G",
+    "bbox": [
+      [
+        214,
+        220,
+        692,
+        330
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Fig. S5D Immunofluorescence of HeLa cells transfected with TEX44-EGFP alone (upper) or with CPT1B-HA (lower). TEX44 (green), TOMM20 (magenta in upper, blue in lower), and nuclei (Hoechst, grey) were detected with corresponding antibodies. Insets show enlarged views of the regions outlined with white dashed boxes. TEX44 alone fails to localize to mitochondria, while co-expression with CPT1B promotes co-localization with TOMM20. Scale bars: \\(10 \\mu \\mathrm{m}\\) (main), \\(2 \\mu \\mathrm{m}\\) (inset).",
+    "bbox": [
+      [
+        214,
+        364,
+        794,
+        540
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Fig. S5A",
+    "bbox": [
+      [
+        316,
+        290,
+        620,
+        360
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Fig. S4A–B Co-immunoprecipitation assays in HEK293T cells co-expressing TEX44-FLAG and TEX44-HA. Immunoprecipitation was performed with anti-FLAG (A) or anti-HA (B) antibodies, followed by immunoblotting with tag-specific antibodies. Reciprocal pulldown confirms that TEX44 can form homodimers in cells.",
+    "bbox": [
+      [
+        247,
+        100,
+        686,
+        380
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Fig. S7E",
+    "bbox": [
+      [
+        258,
+        592,
+        732,
+        816
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4E.jpg",
+    "caption": "Fig. 4E",
+    "bbox": [
+      [
+        355,
+        291,
+        633,
+        508
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Fig. S8A Western blot analysis of TEX44 expression in testicular lysates from control and Cpt1b gKO mice. \\(\\beta\\) -Tubulin served as a loading control. Fig. S8B Quantification of TEX44 expression in testis, normalized to \\(\\beta\\) -Tubulin (ns, not significant, \\(n = 3\\) ). Fig. S8C Western blot analysis of TEX44 expression in spermatozoa collected from the cauda epididymis of control and Cpt1b gKO mice. TEX44 is undetectable in spermatozoa from Cpt1b gKO mice. Fig. S8D Quantification of TEX44 expression in spermatozoa, normalized to \\(\\beta\\) -Tubulin \\((^{**}P< 0.001\\) , \\(n = 3\\) ). \\(n\\) values represent the number of biologically independent experiments.",
+    "bbox": [
+      [
+        312,
+        100,
+        647,
+        444
+      ]
+    ],
+    "page_idx": 20
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1B.jpg",
+    "caption": "Fig. 1B",
+    "bbox": [
+      [
+        205,
+        250,
+        616,
+        371
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1H.jpg",
+    "caption": "Fig.1H Western Blot analysis of TEX44 in spermatozoa from a fertile control and patients harboring biallelic TEX44 variants. TEX44 is missing in spermatozoa from patients, with \\(\\beta\\) -Tubulin as a loading control.",
+    "bbox": [],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1l.jpg",
+    "caption": "Fig.1l",
+    "bbox": [
+      [
+        515,
+        380,
+        749,
+        550
+      ]
+    ],
+    "page_idx": 29
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "RNA expression profile of C11ORF21, DMBT1 and TEX44 across human tissues.",
+    "bbox": [],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1H.jpg",
+    "caption": "Fig.1H Western Blot analysis of TEX44 in spermatozoa from a fertile control and patients harboring biallelic TEX44 variants. TEX44 is missing in spermatozoa from patients, with \\(\\beta\\) -Tubulin as a loading control.",
+    "bbox": [
+      [
+        245,
+        368,
+        450,
+        540
+      ]
+    ],
+    "page_idx": 30
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_11.jpg",
+    "caption": "Fig.11",
+    "bbox": [
+      [
+        515,
+        384,
+        749,
+        550
+      ]
+    ],
+    "page_idx": 33
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Fig. S21 Representative images of sperm from \\(Tex44^{+/ - }\\) and \\(Tex44^{+/ - }\\) mice stained with eosin-nigrosine. Live sperm appear unstained (yellow arrowheads), while dead sperm are stained red (red arrowheads).",
+    "bbox": [
+      [
+        270,
+        563,
+        712,
+        789
+      ]
+    ],
+    "page_idx": 36
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Figure. Fertilization outcomes in Tex44 \\(7^{\\prime \\prime}\\) and Tex44 \\(7^{\\prime}\\) mice using IVF and ICSI. (A, C) Representative images of zygotes obtained from in vitro fertilization (IVF, A) and intracytoplasmic sperm injection (ICSI, C) using spermatozoa from Tex44 \\(7^{\\prime \\prime}\\) and Tex44 \\(7^{\\prime}\\) mice. (B, D) Quantification of fertilization rate \\((\\%)\\) in IVF (B) and ICSI (D) groups. A significant reduction in fertilization rate was observed in Tex44 \\(7^{\\prime \\prime}\\) mice under IVF conditions, whereas fertilization rate was comparable under ICSI conditions. Data are presented as mean \\(\\pm\\) s.e.m. \\(^*P< 0.05\\) , ns \\(=\\) not significant (two-tailed Student's \\(t\\) - test).",
+    "bbox": [
+      [
+        217,
+        483,
+        710,
+        775
+      ]
+    ],
+    "page_idx": 37
+  }
+]
\ No newline at end of file
diff --git a/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/1.nreditorialpolicychecklistSL/images_list.json b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/1.nreditorialpolicychecklistSL/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/1.nreditorialpolicychecklistSL/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/2.nrreportingsummarySL/images_list.json b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/2.nrreportingsummarySL/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/2.nrreportingsummarySL/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/rs/images_list.json b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/rs/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/4c6a679dcf85aa8e1924bc438f48709d6408ae5b030e499a220186a2465de2d9/preprint/supplementaries/rs/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/SI/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/SI/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..2e84e8ec97868c496953c1f6c9e8e8bc9438bf1f
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/SI/images_list.json
@@ -0,0 +1,310 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Figure S1. Experimental powder X-ray diffraction pattern obtained for \\(\\mathrm{K_4[Mo^{III}(CN)_7] \\cdot 2H_2O}\\) (1) at 296(2) K (black line) and the calculated pattern for the single-crystal structure at 90(2) K (grey line) reported by Ohkoshi et al.¹",
+    "bbox": [
+      [
+        215,
+        105,
+        761,
+        427
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "Figure S2. a, Solid state infrared spectrum of 1 recorded at room temperature and b, magnification of the 2300-1850 cm⁻¹ region of the spectrum showing the cyanide stretching band.",
+    "bbox": [
+      [
+        113,
+        565,
+        884,
+        777
+      ]
+    ],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "Figure S3. Mo-C bond length analysis in 1, 2, \\(Li_{3}[Mo^{III}(CN)_{6}]·6DMF\\) 3 and \\([K(crypt-222)]_{3}[Mo^{III}(CN)_{6}]·2CH_{3}CN(3).\\)",
+    "bbox": [
+      [
+        171,
+        495,
+        777,
+        800
+      ]
+    ],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_3.jpg",
+    "caption": "Figure S4. Schematic representation of the photochemical transformation from 1 to 3 in acetonitrile solution at room temperature.",
+    "bbox": [
+      [
+        133,
+        78,
+        860,
+        384
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_4.jpg",
+    "caption": "Figure S5. UV-vis spectra for \\(0.5 \\mathrm{mM}\\) solutions of 1 in \\(\\mathrm{CH}_3\\mathrm{CN}\\) (solubilized with four equivalents of crypt-222) recorded at room temperature before irradiation (green line) and after irradiation (blue line): a, after 20 minutes of violet light irradiation \\((\\lambda = 420 - 430 \\mathrm{nm})\\) and b, 5 minutes of white LED light irradiation.",
+    "bbox": [
+      [
+        118,
+        528,
+        835,
+        730
+      ]
+    ],
+    "page_idx": 9
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_5.jpg",
+    "caption": "Figure S6. Asymmetric unit of [K(crypt-222)]3[MoII(CN)6]·2CH3CN (3) at 100 K. Ellipsoids are depicted at 50% probability level.",
+    "bbox": [
+      [
+        188,
+        440,
+        810,
+        707
+      ]
+    ],
+    "page_idx": 10
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_6.jpg",
+    "caption": "Figure S7. Experimental powder X-ray diffraction pattern recorded for 3 at 296(2) K (black line) and calculated pattern from the single crystal structure studied at 293(2) K (gray line).",
+    "bbox": [
+      [
+        264,
+        115,
+        714,
+        380
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_7.jpg",
+    "caption": "Figure S8. Comparison of the UV-vis spectra of 3 in the solid state (black line) and as a 0.5 mM solution in anhydrous acetonitrile (blue line) at room temperature.",
+    "bbox": [
+      [
+        258,
+        472,
+        720,
+        744
+      ]
+    ],
+    "page_idx": 13
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_8.jpg",
+    "caption": "Figure S9. Selected optical reflectivity spectra for 1 between 400 and 1000 nm at selected temperature between 295 and 10 K recorded in the dark and at a scan rate of 4 K min \\(^{-1}\\) in a, cooling mode and b, heating mode. c, Variation of the absolute optical reflectivity ( \\(\\Delta AR\\) ) recorded at 550 nm for 1 comparing before and after excitation with different LEDs ( \\(\\Delta AR = AR_{\\text{after}} - AR_{\\text{before}}\\) ; 10 minutes, at 2 mW cm \\(^{-2}\\) ) at 10 K (after a fast cooling of the sample from room temperature in the dark). d, Optical reflectivity spectra for 1 at 10 K before and after excitation with a 405-nm LED (10 minutes, at 2 mW·cm \\(^{-2}\\) ). e, Selected optical reflectivity spectra for 1 at 10 K recorded during a 2-hours irradiation with 405-nm LED (at 5 mW·cm \\(^{-2}\\) ). In insert, time evolution of the 550-nm AR signal during 405-nm irradiation (10 K; 5 mW·cm \\(^{-2}\\) ). f, Thermal variation of the 550-nm reflectivity signal in the dark (in blue, almost temperature independent around 0.2), during irradiation at 10 K with 405 nm LED (2 mW·cm \\(^{-2}\\) ; in violet), and after irradiation in the dark (in red). A spectroscopic white light of 0.08 mW·cm \\(^{-2}\\) was used for these measurements.",
+    "bbox": [
+      [
+        123,
+        87,
+        856,
+        680
+      ]
+    ],
+    "page_idx": 14
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_9.jpg",
+    "caption": "Figure S10. a, Variation of the absolute optical reflectivity ( \\(\\Delta AR\\) ) for 1 recorded at \\(550~\\mathrm{nm}\\) and at \\(10~\\mathrm{K}\\) (after a fast cooling of the sample from room temperature in the dark and a 385-nm excitation during 10 minutes at \\(2\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ) comparing before and after desexcitation with different LEDs ( \\(\\Delta AR = AR_{\\mathrm{after}}\\) - \\(AR_{\\mathrm{before}}\\) ; 10 minutes, at \\(10\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ). b, Time evolution of the 550-nm \\(AR\\) signal during four irradiation cycles of 385-nm excitation (10 K; 1 hour, \\(5\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ; in violet) and 660-nm desexcitation (10 K; 2 hours, \\(10\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ; in red). c, Selected optical reflectivity spectra for 1 at 10 K recorded in the dark (blue trace), after one 385-nm irradiation (10 K; 1 hour, \\(5\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ; violet trace) and a subsequent 660-nm irradiation (10 K; 2 hours, \\(10\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) ; red trace). A spectroscopic white light of \\(0.08\\mathrm{mW}\\cdot \\mathrm{cm}^{-2}\\) was used for these measurements.",
+    "bbox": [
+      [
+        130,
+        92,
+        860,
+        476
+      ]
+    ],
+    "page_idx": 15
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_10.jpg",
+    "caption": "Figure S11. a, IR spectrum of 3 recorded in the solid state at room temperature and b, close-up of the cyanide stretching region.",
+    "bbox": [
+      [
+        207,
+        100,
+        721,
+        675
+      ]
+    ],
+    "page_idx": 16
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_11.jpg",
+    "caption": "Figure S12. Mo \\(L_{3}\\) -edge XANES spectra at room temperature of 1 in the solid state (solid line) and in water solution (dashed line) (a) and 3 in the solid state (solid line) and in the acetonitrile solution (dashed line).",
+    "bbox": [
+      [
+        212,
+        100,
+        725,
+        671
+      ]
+    ],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_12.jpg",
+    "caption": "Figure S13. Comparison of Mo···CN distances (for the dissociated CN- ligand) obtained by geometry optimization of structures 2 and $1\\longrightarrow 2$ for studied DFT functionals. Please note that in most cases the circles and squares overlap.",
+    "bbox": [
+      [
+        246,
+        303,
+        743,
+        567
+      ]
+    ],
+    "page_idx": 21
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_13.jpg",
+    "caption": "Figure S14. Figure of Merit (defined as described above) obtained by geometry optimization of structures 1→2 and 2→1 for studied DFT functionals.",
+    "bbox": [
+      [
+        225,
+        100,
+        748,
+        393
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_14.jpg",
+    "caption": "Figure S15. Mo···CN distances (blue; right axis) and unit cell volumes (black; left axis) for the optimized geometries of 1, 1→2, 2 and 2→1 for HISS functional.",
+    "bbox": [
+      [
+        248,
+        505,
+        750,
+        760
+      ]
+    ],
+    "page_idx": 22
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_15.jpg",
+    "caption": "Figure S16. Overlay of the crystal structures: a, experimental 2 (black) and optimized \\(1 \\rightarrow 2\\) (blue) and b, experimental 1 (black) and optimized \\(2 \\rightarrow 1\\) (red), for HISS functional.",
+    "bbox": [
+      [
+        169,
+        78,
+        832,
+        314
+      ]
+    ],
+    "page_idx": 23
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_16.jpg",
+    "caption": "Figure S17. a, Temperature \\((T)\\) dependence of the \\(\\chi T\\) product at \\(0.1 \\mathrm{T}\\) for 1 (where \\(\\chi = M / H\\) is the molar magnetic susceptibility normalized per complex) and \\(\\mathbf{b}\\) , field \\((H)\\) dependence of the magnetization \\((M)\\) for 1 at \\(1.8 \\mathrm{K}\\) .",
+    "bbox": [
+      [
+        258,
+        90,
+        680,
+        590
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_17.jpg",
+    "caption": "Figure S18. a, Temperature \\((T)\\) dependence of the molar magnetic susceptibility, \\(\\chi\\) , at \\(0.1 \\mathrm{T}\\) for 1 (black points) and fit to Bonner-Fisher model for a uniform chain of antiferromagnetically coupled \\(S = 1 / 2\\) Heisenberg spins (green line; vide supra). b, Temperature dependence of the heat capacity, \\(C_{\\mathrm{p}}(T)\\) , for 1 under zero magnetic field (open circles), Debye model used to determine the nonmagnetic phonon contribution to the heat capacity (Cbackground, red line), and the magnetic contribution to the heat capacity, \\(C_{\\mathrm{pm}}\\) , defined as \\(C_{\\mathrm{p}} - C_{\\mathrm{background}}\\) (full circles).",
+    "bbox": [
+      [
+        267,
+        80,
+        730,
+        585
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_18.jpg",
+    "caption": "Figure S19. Fragments of the crystal structures at 30 K of 1 (a) and 2 (b) highlighting the supramolecular chain arrangement in 1, and its disappearance in 2 due to the cyanide dissociation.",
+    "bbox": [
+      [
+        140,
+        78,
+        860,
+        465
+      ]
+    ],
+    "page_idx": 26
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_19.jpg",
+    "caption": "Figure S20. Temperature \\((T)\\) dependence of the \\(\\chi T\\) product at 0.1 T for 3 (where \\(\\chi = M / H\\) is the molar magnetic susceptibility normalized per complex). The solid purple line is the best fit of the data to a \\(S = 3 / 2\\) Curie law (with \\(g_{\\mathrm{Mo}}\\) being the only ajustable parameter).",
+    "bbox": [
+      [
+        275,
+        231,
+        701,
+        479
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_20.jpg",
+    "caption": "Figure S21. Field \\((H)\\) dependence of the magnetization \\((M)\\) for 3 at \\(2.0\\mathrm{K}\\) . The solid purple line is the simulated \\(S = 3 / 2\\) Brillouin function with \\(g_{\\mathrm{Mo}} = 1.97\\) .",
+    "bbox": [
+      [
+        275,
+        568,
+        692,
+        818
+      ]
+    ],
+    "page_idx": 27
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3.jpg",
+    "caption": "Figure S22. Photomagnetic studies of 1 after irradiation at 100 K. a, Time evolution of the \\(\\chi T\\) product (at 0.1 T) of 1 during 4 consecutive cycles of 405 nm irradiation at 100 K, each followed by thermal relaxation at 220 K, confirming reversible photo-induced transformation \\(1 \\rightarrow 2\\) ; b, Temperature dependence of the \\(\\chi T\\) product at 0.1 T before (1) and after 405 nm irradiation (2) at 100 K in four consecutive irradiation and heating cycles as shown in Fig. S22a; c, Magnetization (M) versus magnetic field (H) plots for 1 (before irradiation) and 2 (after 405 nm irradiation) recorded at 2.0 K after four consecutive irradiation and heating cycles as shown in Fig. S22a. Dashed lines in all three plots indicate the \\(\\chi T\\) (a and b) or M (c) values reached after the analogous irradiation experiments performed at 10 K presented in Figure 3.",
+    "bbox": [
+      [
+        113,
+        80,
+        884,
+        560
+      ]
+    ],
+    "page_idx": 29
+  }
+]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1CCDC2352257checkcif/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1CCDC2352257checkcif/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1CCDC2352257checkcif/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1relaxed200KCCDC2352262checkcif/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1relaxed200KCCDC2352262checkcif/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound1relaxed200KCCDC2352262checkcif/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352261checkcif/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352261checkcif/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352261checkcif/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352263checkcif/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352263checkcif/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compound2CCDC2352263checkcif/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compoundKcryptMoCN6293KCCDC2352266checkcif/images_list.json b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compoundKcryptMoCN6293KCCDC2352266checkcif/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e8e853f0ce1acf93a822ab84b9033252a156594e48687bb26dc7fefcea8c8e6/preprint/supplementaries/compoundKcryptMoCN6293KCCDC2352266checkcif/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/peer_review/images_list.json b/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/preprint/supplementaries/FigureS113/images_list.json b/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/preprint/supplementaries/FigureS113/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..e9cd626bb02e553749a9927885df6002f8d6be8f
--- /dev/null
+++ b/5e918b0904b8f902f68be4e1d2f4ab5fabbc0ff2d250123eee2ac227a430de02/preprint/supplementaries/FigureS113/images_list.json
@@ -0,0 +1,121 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_1.jpg",
+    "caption": "Supplementary Figure 1: X-coverage profile of genomes sequenced. Samples with at least 10X coverage were considered for downstream analysis.",
+    "bbox": [
+      [
+        245,
+        46,
+        700,
+        370
+      ]
+    ],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_2.jpg",
+    "caption": "Supplementary Figure 2: PCA analysis. Principal components 2 and 3 describe the variability within East Cambodian samples. The pattern of clustering supports the distinguished clades from phylogenetic analysis.",
+    "bbox": [
+      [
+        137,
+        40,
+        930,
+        410
+      ]
+    ],
+    "page_idx": 1
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_3.jpg",
+    "caption": "Supplementary Figure 3: Admixture population analysis of parasite population. The bar graph (at the bottom) shows the mixture of ancestries within parasites collected from three collection sites. The bar graph (on the top) shows the estimated parasite clearance half-life of each individual isolate. Strikingly a group of parasites from east Cambodia (left side of the plots) with more ancestral components marked by green bar was found mostly to have \\(\\mathrm{PC}^{1 / 2}< 5\\) hours (susceptible parasites).",
+    "bbox": [
+      [
+        123,
+        75,
+        870,
+        270
+      ]
+    ],
+    "page_idx": 2
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_4.jpg",
+    "caption": "Supplementary Figure 4: Non-PCRTs' position across the chromosomes. A significant bias was observed for the localization of detected noncoding RNAs (ncRNAs) compared to detected alternatively spliced PCRTs (altPCRTs) and anti-sense PCRTs (asPCRTs). Most of the ncRNAs detected were found to be in the subtelomeric repeat region.",
+    "bbox": [
+      [
+        50,
+        20,
+        730,
+        832
+      ]
+    ],
+    "page_idx": 3
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_6.jpg",
+    "caption": "Supplementary Figure 6: Differentially expressed transcripts from hr0 transcriptomes. Heatmap of differentially expressed transcripts between susceptible and resistant parasites with FDR <0.05 totaling 100 PCRTs and 37 non-PCRTs.",
+    "bbox": [],
+    "page_idx": 4
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_7.jpg",
+    "caption": "Supplementary Figure 7: In-vivo repressed PCRTs from IDC. Expression profiles of the PCRTs from intra-erythrocytic development cycle (IDC) repressed in resistant parasites upon 6 hours of exposure to ACT/TACT.",
+    "bbox": [
+      [
+        255,
+        45,
+        560,
+        386
+      ]
+    ],
+    "page_idx": 5
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_8.jpg",
+    "caption": "Supplementary Figure 8: In-vivo transcriptome response to drug through non-PCRTs. Induction or repression of non-PCRTs upon treatment with artemisinin combination therapy in susceptible (left) and resistant (right) parasite groups. Any transcripts with FDR \\(< 1\\mathrm{e} - 05\\) considered as significant and commonly induced/repressed transcripts are marked as un-filled red colored circles. The background and point color of the volcano plots is to differentiate the resistant parasites from susceptible parasites and PCRTs from non-PCRTs respectively. White and beige background signifies the parasite groups as Susceptible and resistant respectively, whereas red circles here represent significantly up-down-regulated non-PCRTs.",
+    "bbox": [
+      [
+        40,
+        46,
+        846,
+        328
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_9.jpg",
+    "caption": "Supplementary Figure 9: Association between PfRAD5 mutations and altPfRAD5 expression. GWAS analysis detected two PfRAD5 mutations (N821K and N1131I) associated with parasite clearance half-life (PC<sup>1/2</sup>). (a) An eQTL-like association was found for PfRAD5 N821K with expression of alternatively spliced PfRAD5 transcripts (left panel). Moreover, the expression of altPfRAD5 was repressed upon drug exposure in both resistant and susceptible parasites with a lower level of statistical significance for resistance parasites (right panel). (b) The second mutation, PfRAD5 N1131I, was found to be associated in an exactly similar way as PfRAD5 N821L.",
+    "bbox": [
+      [
+        184,
+        40,
+        860,
+        600
+      ]
+    ],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Supplementary_Figure_11.jpg",
+    "caption": "Supplementary Figure 11: Expression profile of the PfWDI11 from qPCR experiment. Expression changes of the susceptible parasites and resistant parasites from 0 hours to 6 hours as groups (left) and as a pair (middle) respectively. Foldchange comparison between susceptible and resistant groups by Pairwise t-test. Point to be noted: that all qPCR validations on field isolates are solely performed with the purpose of detecting their presence not for expression correlation, as expression correlation depends on multiple factors parasite's age, the expression profile of the housekeeping genes, etc.",
+    "bbox": [],
+    "page_idx": 8
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "Complete structure of PfWD11",
+    "bbox": [],
+    "page_idx": 9
+  }
+]
\ No newline at end of file
diff --git a/5e99c4af9c4a327da8d0c22249bfd979823149640248f9795bbf2ea0e68f1c29/peer_review/images_list.json b/5e99c4af9c4a327da8d0c22249bfd979823149640248f9795bbf2ea0e68f1c29/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..0637a088a01e8ddab3bf3fa98dbe804cbde1a0dc
--- /dev/null
+++ b/5e99c4af9c4a327da8d0c22249bfd979823149640248f9795bbf2ea0e68f1c29/peer_review/images_list.json
@@ -0,0 +1 @@
+[]
\ No newline at end of file
diff --git a/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/peer_review/images_list.json b/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/peer_review/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..9def44827d467fccc12830ac3d50e138fde0f823
--- /dev/null
+++ b/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/peer_review/images_list.json
@@ -0,0 +1,128 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 (D) Decoding analysis: we used machine learning analysis to investigate whether WM load could be decoded by encoding-encoding dissimilarity (EED), encoding-maintenance similarity (EMS), or Granger Causality (GC) features. (Figure legends, page 33)",
+    "bbox": [],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5 Decoding accuracy of WM load using SVM classifier. (A) Decoding accuracy using the EED patterns within the amygdala (red) and the hippocampus (blue). Only using the features from the amygdala rather than the hippocampus was able to decode the WM load. \\* \\(p < 0.05\\). (B) Decoding accuracy using the EMS patterns within the amygdala (red) and the hippocampus (blue). Only using the features from the hippocampus rather than the amygdala could decode the WM load. \\* \\(p < 0.05\\). (C)",
+    "bbox": [
+      [
+        368,
+        477,
+        617,
+        752
+      ]
+    ],
+    "page_idx": 6
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 (D) Decoding analysis: we used machine learning analysis to investigate whether WM load could be decoded by encoding-encoding dissimilarity (EED), encoding-maintenance similarity (EMS), or Granger Causality (GC) features. (Figure legends, page 33)",
+    "bbox": [],
+    "page_idx": 7
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2.jpg",
+    "caption": "Fig. 2 (B) Accuracy of load 4, 6 and 8 across all participants. Each dot denotes each participant and each dotted line connects an individual. \\(^{**} p < 0.01\\) (Figure legends, page 34)",
+    "bbox": [
+      [
+        418,
+        141,
+        580,
+        290
+      ]
+    ],
+    "page_idx": 11
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_5.jpg",
+    "caption": "Fig. 5 Decoding accuracy of WM load using SVM classifier. (A) Decoding accuracy using the EED patterns within the amygdala (red) and the hippocampus (blue). Only using the features from the amygdala rather than the hippocampus was able to decode the WM load. \\* \\(p < 0.05\\). (B) Decoding accuracy using the EMS patterns within the amygdala (red) and the hippocampus (blue). Only using the features from the hippocampus rather than the amygdala could decode the WM load. \\* \\(p < 0.05\\). (C) Decoding accuracy using the GC features from both directions during encoding (left)",
+    "bbox": [
+      [
+        368,
+        451,
+        617,
+        725
+      ]
+    ],
+    "page_idx": 12
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig.1 (A-B): An illustration on methods we used to compute the indices of the EED and the EMS within the amygdala and the hippocampus. Blue dotted box denotes the EED index was calculated between any two trials, and red dotted box represents the EMS index was computed across the same trials.",
+    "bbox": [],
+    "page_idx": 17
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_1.jpg",
+    "caption": "Fig. 1 d Decoding analysis: we used machine-learning analyses to investigate whether WM load (load 4, 6 and 8) could be predicted by encoding-encoding dissimilarity (EED), encoding-maintenance similarity (EMS), or phase slope index (PSI) features.",
+    "bbox": [
+      [
+        123,
+        84,
+        874,
+        196
+      ]
+    ],
+    "page_idx": 18
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2h.jpg",
+    "caption": "Fig. 2h When using the EED patterns, the decoding accuracy within the amygdala (red) is higher than in the hippocampus (blue). Dotted lines indicate the median. Broken lines above and below denote the quartiles. \\(^{**} p < 0.01\\) .",
+    "bbox": [
+      [
+        404,
+        481,
+        571,
+        643
+      ]
+    ],
+    "page_idx": 19
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_3d.jpg",
+    "caption": "Fig. 3d The decoding accuracy by using the EMS patterns within the amygdala (red) and the hippocampus (blue). Dotted lines indicate the median. Broken lines above and below denote the quartiles. \\*\\* \\(p < 0.001\\).",
+    "bbox": [
+      [
+        408,
+        88,
+        570,
+        255
+      ]
+    ],
+    "page_idx": 24
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_4c.jpg",
+    "caption": "Fig. 4c-d The decoding accuracy by using the PSI features from the amygdala leads (red), from the hippocampus leads (blue) during encoding and maintenance periods. Dotted lines indicate the median. Broken lines above and below denote the quartiles. \\*\\* \\(p < 0.001\\).",
+    "bbox": [
+      [
+        288,
+        366,
+        720,
+        572
+      ]
+    ],
+    "page_idx": 25
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_2g.jpg",
+    "caption": "Fig. 2g. EED values averaged over the significant cluster in b was extracted within the hippocampus (blue) and amygdala (red) for each participant, respectively. 12 of 14 participants showed higher EED values within the amygdala than within the hippocampus.",
+    "bbox": [],
+    "page_idx": 34
+  }
+]
\ No newline at end of file
diff --git a/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/preprint/supplementaries/Fig.S2/images_list.json b/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/preprint/supplementaries/Fig.S2/images_list.json
new file mode 100644
index 0000000000000000000000000000000000000000..ed28e636cbfee6355c7afdfa000d8da77427ab38
--- /dev/null
+++ b/5ec39cb2774a9d64e907bf7c90ccfe5332c9b57dc97bb6438f914e6586bd3d46/preprint/supplementaries/Fig.S2/images_list.json
@@ -0,0 +1,44 @@
+[
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_0.jpg",
+    "caption": "(C)",
+    "bbox": [
+      [
+        232,
+        70,
+        484,
+        375
+      ]
+    ],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_1.jpg",
+    "caption": "(B)",
+    "bbox": [
+      [
+        232,
+        440,
+        484,
+        904
+      ]
+    ],
+    "page_idx": 0
+  },
+  {
+    "type": "image",
+    "img_path": "images/Figure_unknown_2.jpg",
+    "caption": "(D)",
+    "bbox": [
+      [
+        512,
+        110,
+        760,
+        375
+      ]
+    ],
+    "page_idx": 0
+  }
+]
\ No newline at end of file