reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 2 380 | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 357
values | new_affinity stringlengths 3 193 ⌀ |
|---|---|---|---|---|---|---|---|---|---|
Simmons, SC, et al. Development of novel single-stranded nucleic acid aptamers against the pro-angiogenic and metastatic enzyme heparanase (HPSE1). PLoS One (2012) 7:e37938.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Heparanase (3M NaSCN) (ID# 7789) | Heparanase (HPSE1) | GGGAGACAAGAATAAACGCTCAATTTAACGTATTTATTCAAGCTCGTATTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 13 nM |
Simmons, SC, et al. Development of novel single-stranded nucleic acid aptamers against the pro-angiogenic and metastatic enzyme heparanase (HPSE1). PLoS One (2012) 7:e37938.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Heparanase (1.5M NaCl) (ID# 7790) | Heparanase (HPSE1) | GGGAGACAAGAATAAACGCTCAAATGGACTTTTGAATGTGGCAACAAATTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 12 nM nM |
J.G. Bruno et al. Development of DNA aptamers for cytochemical detection of acetylcholine. In Vitro Cell. Dev. Biol.-Anim. 44(2008):63-72.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Acetylcholine (ACh 6R) (ID# 7807) | Acetylcholine | ATCCGTCACACCTGCTCTCAGGGGATCACATTCTTGACGGTGTGATACAGTGCCTGGTGTTGGCTCCCGTAT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
C Ferreira et al. DNA aptamers against the MUC1 tumour marker: design of aptamer-antibody sandwich ELISA for the early diagnosis of epithelial tumors. Anal. Bioanal. Chem. 390(2008):1039-1050.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | MUC1 Tumor Marker (MUC1-5TR-1) (ID# 7810) | MUC1 recombinant protein with five repeats of the variable tandem repeat region | GGGAGACAAGAATAAACGCTCAAGAAGTGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 47.3 nM |
Bruno, J. G. and Carrillo, M. P. "Development of aptamer beacons for rapid presumptive detection of Bacillus spores." J Fluoresc, 22 (2012): 915-924.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Bacillus anthracis spores (BAS-6F) (ID# 7851) | Bacillus anthracis spores | ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT | https://www.aptagen.com/apta-index/ | Other | null | null | Not Mentioned in Database |
Hongcheng Mei, Tao Bing, Xiaojuan Yang, Cui Qi, Tianjun Chang, Xiangjun Liu, Zehui Cao, and Dihua Shangguan. 2012. Functional-Group Specific Aptamers Indirectly Recognizing Compounds with Alkyl Amino Group. Anal. Chem. 2012, 84, 7323-7329Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M13a (ID# 7911) | PSL | ACGCTCGGATGCCACTACAGCTAAGCAGGAAGGTATGGATTGGTTGCATTAGCTCATGGACGTGCTGGTGAC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 4.59 µM |
John R. Stecker, Alissa A. Savage, John G. Bruno, Dana M. Garcia, Joseph R. Koke. "Dynamics and Visualization of MCF7 Adenocarcinoma Cell Death by Aptamer-C1q-Mediated Membrane Attack" Nucleic Acid Therapeutics, Vol.22, Num.4 (2012)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | MUC1-5TR-1 (ID# 7916) | human breast adenocarcinoma (MCF7) | GGGAGACAAGAATAAACGCTCAAGAAGTGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Cells | null | null | 47.3 nM |
de Araujo FF, Nagarkatti R, Gupta C, Marino AP, Debrabant A (2015) Aptamer-Based Detection of Disease Biomarkers in Mouse Models for Chagas Drug Discovery. PLoS Negl Trop Dis 9(1): e3451. doi:10.1371/journal.pntd.0003451Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Chagas Apt-79 (ID# 7949) | T. cruzi Excreted Secreted Antigens (TESA) | GGGAGATAATGGTAACGGTUCUUUGUATAAGAATGCACGACACTTCTATAGTGTCACCTAAATGAATTCCGG | https://www.aptagen.com/apta-index/ | Protein | null | null | See source nM |
J Li et al. On chip, aptamer-based sandwich assay for detection of glycated hemoglobins via magnetic beads. Biosensors and Bioelectronics 79 (2016): 887-893Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Hemoglobin Aptamer (ID# 7968) | Hemoglobin | GGCAGGAAGACAAACACCAGGTGAGGGAGACGACGCGAGTGTTAGATGGTAGCTGTTGGTCTGTGGTGCTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.6 nM |
J Li et al. On chip, aptamer-based sandwich assay for detection of glycated hemoglobins via magnetic beads. Biosensors and Bioelectronics 79 (2016): 887-893Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Glycated Hemoglobin Aptamer (ID# 7969) | Glycated Hemoglobin | TGGCAGGAAGACAAACACATCGTCGCGGCCTTAGGAGGGGCGGACGGGGGGGGGCGTGGTCTGTGGTGCTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.3 nM |
Boyacioglu, O., Stuart, C. H., Kulik, G., & Gmeiner, W. H. (2013). Dimeric DNA Aptamer Complexes for High-capacity-targeted Drug Delivery Using pH-sensitive Covalent Linkages. Molecular therapy. Nucleic acids, 2(7), e107. https://doi.org/10.1038/mtna.2013.37Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PSMA Dimeric Aptamer (ID# 8027) | Prostate Specific Membrane Antigen (PSMA) | GCGTTTTCGCTTTTGCGTTTTGGGTCATCTGCTTACGATAGCAATGCTCGGCAAAAAAAAAAAAAAAAGCCG | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Tezuka-Kagajo, Mari et al. “Development of Human CBF1-Targeting Single-Stranded DNA Aptamers with Antiangiogenic Activity In Vitro.” Nucleic acid therapeutics vol. 30,6 (2020): 365-378. doi:10.1089/nat.2020.0875Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt-3 (ID# 8116) | C promoter binding factor 1 (CBF1) | ATAGGAGTCGACCGACCAGACCAACCCTACGCGTACCAACCAGATGACCTACGTGCGTCTACATCTAGACTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 34 nM |
Ogawa, A., & Itoh, Y. (2020). In Vitro Selection of RNA Aptamers Binding to Nanosized DNA for Constructing Artificial Riboswitches. ACS Synthetic Biology. doi:10.1021/acssynbio.0c00384Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | nDNA-547 (ID# 8141) | nano-sized DNA | ACCACAACGGTTTCCCAGGACGGATGCTTCCGTAATGACGCTTCCCATTACCCGTCCAATCAACTCAACTTC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 363 ± 135 nM nM |
Fukuda, et al. "Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease." European Journal of Biochemistry, 267(2000): 3685-3694.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Hepatitis C Virus Non-Structural Protein 3 (G9-1) (ID# 7529) | Hepatitis C Virus Non-Structural Protein 3 | GGGAGAAUUCCGACCAGAAGCUUCGGGAUUUGAGGGUAGAAUGGGACUACCUUUCCUCUCUCCUUCCUCUUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 11.6 nM |
Blind, M., et al. "Cytoplasmic RNA modulators of an inside-out signaltransduction cascade." Proceedings of National Academy of Sciences of the United States of America, 96(1999):3606ƒ??3610.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Beta 2-Integrin (D20) (ID# 7543) | Beta 2-Integrin | GGGCGCUAAGUCCUCGCUCAUGCGCGUCCCAUGGGGUAUAGAGGGGUCGAAGUGGACGCGCGACUCGGAUCCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 500 nM |
Malhotra, S., Pandey, A., Rajput, S. and Sharma, R. "Selection of aptamers for Aflatoxin M1 and their characterization." Journal of Molecular Recognition 27 (2014): 493-500.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aflatoxin M1 Aptamer (AFAS3) (ID# 7889) | Aflatoxin M1 | ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGAAATCGCATTCCCCTGTGGTGTTGGCTCCCGTAT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 35.6 nM |
Zhi-Man Liang, et al. “The BACE1-Specific DNA Aptamer A1 Rescues Amyloid-b Pathology and Behavioral Deficits in a Mouse Model of Alzheimer’s Disease”. 00. 00. 2019.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt A1 (ID# 8000) | BACE1 | GCAATGGTACGGTACTTCCGTCATCAGCTTGTGATGTGGATGCGAACTGCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 68.6 nM |
Liu, Y., Liu, J., ChemBioChem 2023, 24, e202200564.https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/cbic.202200564Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | UA-Mg-1 (ID# 8237) | Uric acid (UA) | GGAGGCTCTCGGGACGACGGGCAAGAGGTTTTACTTACCTAAGGAATGTCGTGTCGTCCCGACTCTATGATGACTGT | https://www.aptagen.com/apta-index/ | Other | null | null | 7-8 nM |
Kang, Jonghoon, et al. "Combinatorial selection of a single stranded DNA thioaptamer targeting TGF-??1 protein." Bioorganic & Medicinal Chemistry Letters, 18 (2008): 1835-1839.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | TGF-??1 (T18_1_3) (ID# 7475) | Transforming Growth Factor-??1 (TGF-??1) | CGCTCGGCTTCACGAGATTCGTGTCGTTGTGTCCTGTACCCGCCTTGACCAGTCACTCTAGAGCATCCGGACTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 94 nM |
Gopinath, S., et al. "An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits haemagglutinin-mediated membrane fusion." Journal of General Virology, 87(2005): 479-487.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Human Influenza A virus H3N2 (P30-10-16) (ID# 7527) | Human Influenza A virus H3N2 | GGGAGAAUUCCGACCAGAAGGGUUAGCAGUCGGCAUGCGGUACAGACAGACCUUUCCUCUCUCCUUCCUCUUCU | https://www.aptagen.com/apta-index/ | Cells | null | null | 0.188 nM |
Melo, M.; Correa, C.; Cunha, P.; Goes, A.; Gomes, D.; Andrade, A. DNA aptamers selection for carcinoembryonic antigen (CEA). Bioorg. Med. Chem. Lett. 2020 May 23; 30(15): 127278. DOI: 10.1016/j.bmcl.2020.127278Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apta 5 (ID# 8124) | Carcinoembryonic antigen (CEA) | TCGCGCGAGTCGTCTGGGAGCTACGTTTAGCGAGTCCGACGCTCGGTGCCTCTTCCCGCATCGTCCTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 37.8 nM |
Misono, T.S. and Kumar, P.K., 2005. Selection of RNA aptamers against human influenza virus hemagglutinin using surface plasmon resonance. Analytical biochemistry, 342(2), pp.312-317.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HA Clone B (ID# 8182) | Hemagglutinin of H3N2 | GGGAGAAUUCCGACCAGAAGGGUUAGCGGUCGUCUUAAGUAGUUUUUGGUCCUUUCCUCUCUCCUUCCUCUUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 115 pM |
Wang, Hongyu et al. “Morph-X-Select: Morphology-based tissue aptamer selection for ovarian cancer biomarker discovery.” BioTechniques vol. 61,5 249-259. 1 Nov. 2016, doi:10.2144/000114473Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | V5 (ID# 8187) | Ovarian cancer vessels | CGCTCGGATCGATAAGCTTCGCATAGACCCAGCTGGTCCGGAAAATAAGATGTCACGGATCCTCTAGAGCACTG | https://www.aptagen.com/apta-index/ | Tissue | null | null | Not Mentioned in Database |
Tucker, W., Kinghorn, A., Fraser, L., Cheung, Y.-W., & Tanner, J. (2018). Selection and Characterization of a DNA Aptamer Specifically Targeting Human HECT Ubiquitin Ligase WWP1. International Journal of Molecular Sciences, 19(3), 763. doi:10.3390/ijms19030763Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | C3A WWP1 E3 ligase (ID# 8188) | C-lobe, HECT domain, WWP1 E3 ligase | CCGTAATACGACTCACTATAGGTATGTGACGCGCGTCAATCGCTGTCCTACCAAGCTTTGCAGAGAGGATCCTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.9 nM |
Mallikaratchy, P., et al. "Selection of DNA ligands for protein kinase C-d." Chemical Communications, 2006 (2006): 3229-3231.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Protein Kinase C-d (ID# 7489) | Protein Kinase C-d | GCCAGGGGTTCCACTACGTAGAACACGACGGGAATACTGACTCTCCCCCATGTACCAGGGGGCAGAGAGAAGGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 122 nM |
Vaish et al. "Monitoring post-translational modifications of proteins with allosteric ribozymes." Nature Biotechnology, 20(2002): 810-815.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Unphosphorylated ERK2 (ID# 7655) | Unphosphorylated ERK2 | GGCGUGACCUGAUGAGUCACGCUAAGGAGGAUUUCCGAAAGCGGCUACGGUCCGCCAGUGUUACGAAACGUUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | theophylline-inhibited molecular switch (ID# 7763) | theophylline | GGGCGACCCUGAUGAGAUGAUACCAGCCGAAAGGCCCUUGGCAGCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | na nM |
SJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Vaspin binding aptamer (VBA) (ID# 7774) | Vaspin | ATACCAGCTTATTCAATTGGGCGGTGGGGGGGGTAGTGGGTGTTATGGCGATCGTGGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 303 nM |
Shwetha, N. et al. "Aptamerƒ??nanoparticle-based chemiluminescence for p53 protein." Analytical Biochemistry 2013, 441: 73-79.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-O-Me-RNA | 2′-O-Methyl modified RNA aptamer (ID# 7874) | p53 | GGGCGAAUUCGGGUUGGAUAGUAGGCGCAUAUGGCAUCUUCGUGGUUGUGUAUUGCCCUUUAGUGAGGGUUAAUU | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Julia D. Toscano-Garibay, Maria L. Benitez-Hess, and Luis M. Alvarez-Salas. 2011. Isolation and Characterization of an RNA Aptamer for the HPV-16 E7 Oncoprotein. Archives of Medical Research 42 (2011) 88-96Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | G5a3N.4 (ID# 7910) | HPV-16E7 protein | TAATACGACTCACTATAGGGAGACCCAAGCCGATTTATTTTGTGCAGCTTTTGTTCCCTTTAGTGAGGGTTAATT | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.9 µM |
Discovery of Aptamers Targeting Receptor-Binding Domain of the SARS-CoV-2 Spike Glycoprotein (2020)Yanling Song,*a Jia Song,b Xinyu Wei,a Mengjiao Huang,a Miao Sun,a Lin Zhu,a Bingqian Lin,a Haicong Shen,a Zhi Zhu,a Chaoyong Yang *a,b *a. The MOE Key Laboratory of Spectrochemical Analysis and Instrumentation, State Key Laboratory of Physical Chemistry of Solid Surfaces, Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005, China *b. Institute of Molecular Medicine, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, 200127, ChinaMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SARS-CoV-2 RBD-4C (ID# 8008) | SARS CoV-2 | ATCCAGAGTGACGCAGCATTTCATCGGGTCCAAAAGGGGCTGCTCGGGATTGCGGATATGGACACGT | https://www.aptagen.com/apta-index/ | Other | null | null | 19.9 nM |
Li S, Clarkson M, McNatty K. Selection and characterisation of triclosan-specific aptamers using a fluorescence microscope-imaging assay. Anal Bioanal Chem. 2020 Oct;412(26):7285-7294. doi: 10.1007/s00216-020-02863-7. Epub 2020 Aug 11. PMID: 32780154.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | H6 (ID# 8140) | Triclosan | ATACGAGCTTGTTCAATAGTCTGAAGGGATTGAGTATCCGGGGAGATGATGTCGTTGGTGATAGTAAGAGCAATC | https://www.aptagen.com/apta-index/ | Protein | null | null | 369.82 nM |
Misono, T. S., and P. K. R. Kumar. (2005). Selection of RNA aptamers against human influenza virus hemagglutinin using surface plasmon resonance. Analytical Biochemistry, 342(2), 312–317. doi:10.1016/j.ab.2005.04.013Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Anti HA Influenza Virus Clone B (ID# 8181) | human infuenza virus hemagglutinin | GGGAGAAUUCCGACCAGAAGGGUUAGCGGUCGUCUUAAGGUAGUUUUUGGUCCUUUCCUCUCUCCUUCCUCUUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 115 pM |
Wang, Hongyu et al. “Morph-X-Select: Morphology-based tissue aptamer selection for ovarian cancer biomarker discovery.” BioTechniques vol. 61,5 249-259. 1 Nov. 2016, doi:10.2144/000114473Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | T3 (ID# 8186) | Ovarian cancer tumor cells | CGCTCGGATCGATAAGCTTCGAGCCTGAGTTTTTGCCGCGATCTCGACCTCCGTCACGGATCCTCTAGAGCACTG | https://www.aptagen.com/apta-index/ | Tissue | null | null | Not Mentioned in Database |
Rajeev K Chaudhary, Kinjal A Patel, Milan K Patel, Radha H Joshi, Ipsita Roy, Inhibition of Aggregation of Mutant Huntingtin by Nucleic Acid Aptamers In Vitro and in a Yeast Model of Huntington's Disease, Molecular Therapy, Volume 23, Issue 12, 2015, Pages 1912-1926, ISSN 1525-0016.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | mHtt2.2.47 (ID# 8221) | 51Q-htt | GGGAGAGAGAGACAGUCUGCCCCGAUUAAAAUAGCACAGCAACCAACGCCCCCCCAAGCAACGUCAACUCCAGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 388.3 nM |
Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEXLili. Dong, et. al. (2015)https://www.nature.com/articles/srep15552Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AP273 (Alpha-fetoprotein) (ID# 8229) | Alpha Fetoprotein (AFP) | GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC | https://www.aptagen.com/apta-index/ | Protein | null | null | 17.4 nM |
S Oney, BA Sullenger, et al. (2007) "Antidote-Controlled Platelet Inhibition Targeting von Willebrand Factor with Aptamers." Oligonucleotides, 17:265-274.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | von Willebrand Factor (VWF R9.3) (ID# 7579) | von Willebrand Factor (VWF) | GGGAGGACGAUGCGGAUCGCGCUCUCCUGCUUAAGCAGCUAUCAAAUAGCCCACUCAGACGACUCGCUGAGGAUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.2 nM |
Blake et al. "Antimetastatic Potential of PAI-1-Specific RNA Aptamers." Oligonucleotides, 19(2009): 117-128.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Human Wild-type PAI-1 (WT-15) (ID# 7619) | Human Wild-type PAI-1 | GGGAGGACGAUGCGGAUCAACUCACCGUAGGUCUAGUGAGAACUUCAAGUCUACUCAGACGACUCGCUGAGGAUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 177 pM |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | theophylline-induced molecular switch (ID# 7762) | theophylline | GGGCGACCCUGAUGAGCCUUAUACCAGCCGAAAGGCCCUUGGCAGACGUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | na nM |
SJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | RBP4 binding aptamer (RBA) (ID# 7773) | Retinol-binding protein-4 (RBP4) | ATACCAGCTTATTCAATTACAGTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 201 nM |
Park, J.-W., Tatavarty, R., Kim, D. W., Jung, H.-T., & Gu, M. B. (2012). Immobilization-free screening of aptamers assisted by graphene oxide. Chem. Commun., 48(15), 2071–2073. doi:10.1039/c2cc16473fSJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Nampt binding aptamer (NBA) (ID# 7775) | Nampt/Nicotinamide phosphoribosyltransferase | ATACCAGCTTATTCAATTGGGCAGGACAGGTGTCGGCTTGATAGGCTGGGGTGTGTGTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 72.52 nM |
S Oney, BA Sullenger, et al. (2007) "Antidote-Controlled Platelet Inhibition Targeting von Willebrand Factor with Aptamers." Oligonucleotides, 17:265-274.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | von Willebrand Factor (VWF R9.14) (ID# 7846) | von Willebrand Factor (VWF) | GGGAGGACGAUGCGGUGGACGAACUGCCCUCAGCUACUUUCAUGUUGCUGACGCACAGACGACUCGCUGAGGAUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 12 nM |
Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | U2 (ID# 7882) | U87-EGFRvIII | ATCCAGAGTGACGCAGCATTTTGACGCTTTATCCTTTTCTTATGGCGGGATAGTTTCGTGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 3.37 nM |
"Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | U8 (ID# 7883) | U87-EGFRvIII | ATCCAGAGTGACGCAGCATGAATCTTTTCTTTTGGTTTTGATATTTATAGTTGGTGAATGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 4.35 nM |
Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | U19 (ID# 7884) | U87-EGFRvIII | ATCCAGAGTGACGCAGCATTTGTATCCTATTTTGTTTATGTAATTGTCGTTGATCATGTGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 16.7 nM |
Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | U31 (ID# 7885) | U87-EGFRvIII | ATCCAGAGTGACGCAGCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGTTGTGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 8.1 nM |
Niazi, J. H., Lee, S. J., Kim, Y. S., & Gu, M. B. (2008). ssDNA aptamers that selectively bind oxytetracycline. Bioorganic & Medicinal Chemistry, 16(3), 1254–1261. doi:10.1016/j.bmc.2007.10.073Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Oxytetracycline binding aptamer (OTC-4) (ID# 8002) | Oxytetracycline | CGTACGGAATTCGCTAGCCGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGTGGATCCGAGCTCCACGTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 9.61 nM |
DOI: 10.1021/jacs.7b07241J. Am. Chem. Soc. 2017, 139, 13977−13980Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Diversely Functionalized Human alpha-Thrombin Aptamer (ID# 8028) | Human alpha-Thrombin | GGATCCGAGCTCCACGTGACTGCATCTAATTCCAACCTATCCAATCCTATTCGATGCTTGCGACGGCAGGCGAATC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.6 nM |
Dua, P., Kang, H. S., Hong, S.-M., Tsao, M.-S., Kim, S., & Lee, D. -k. (2013). Alkaline Phosphatase ALPPL-2 Is a Novel Pancreatic Carcinoma-Associated Protein. Cancer Research, 73(6), 1934–1945. doi:10.1158/0008-5472.can-12-3682Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | SQ-2 (ID# 8066) | ALPPL-2 | AUACCAGCUUAUUCAAUUGCCUGAAAAGCUAUCGCCCAAUUCGCAGUGAUAUCCUUUAAGAUAGUAAGUGCAAUCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 22.25-24.74 nM |
Yang, L., Gao, T., Li, W., Luo, Y., Ullah, S., Fang, X., … Pei, R. (2020). Ni-Nitrilotriacetic Acid Affinity SELEX Method for Selection of DNA Aptamers Specific to the N-Cadherin Protein. ACS Combinatorial Science. doi:10.1021/acscombsci.0c00165 Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | NC23 (ID# 8075) | N‑Cadherin Protein | ATACCAGCTTATTCAATTAGACGAGTTTTATTCATTTTCCATGTCGTAGCTTACCGTGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 174 nM |
https://doi.org/10.1002/anie.202100345Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer-6 (ID# 8170) | S/RBD receptor binding | ATCTAGAGTGACGCAGCAGGGCTTGGGTTGGGAATAAAGATGTGGGAGGCGGCGAACATGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 27.6 nM |
Kaur SJ, Gilman V, Duong M, Asher DM, Gregori L. Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates. Biotechniques. 2018 Dec;65(6):331-338. doi: 10.2144/btn-2018-0081. PMID: 30477331.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SE43 (ID# 8191) | Staphylococcus epidermidis | TACGACTCACTATAGGGATCCGTGACTGTACGGGCTCAGTCGTTACTTGAGAGTTGAATTCCCTTTAGTGAGGGTT | https://www.aptagen.com/apta-index/ | Cells | null | null | Not Mentioned in Database |
Niazi, J. H., Lee, S. J., & Gu, M. B. (2008). Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorganic & medicinal chemistry, 16(15), 7245–7253. https://doi.org/10.1016/j.bmc.2008.06.033https://pubmed.ncbi.nlm.nih.gov/18617415/Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | T20 (ID# 8233) | Tetracycline | CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 63.6 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | apHAT610 (ID# 8238) | Histone acetyltransferase 1 (HAT1) | GTTGCTCGTATTTAGGGCGGGGGGGCGGGGGAGGAGGTGGCGGGAATATCCATTGTCTACACCAGTCTTCATCCGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 28.11 nM |
Allen, P., et al. "Isolation of High-Affinity RNA Ligands to HIV-1 Integrase from a Random Pool." Virology, 209(1995): 327-336.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HIV-1 Integrase (P5) (ID# 7534) | HIV-1 Integrase | GGGAGCUCAGAAUAAACGCUCAACCAGUCUUGUGGCUUUGAAAGAGAGGAGUGUUCGACAUGAGGCCCGGAUCCGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 10 nM |
Hesselberth et al. "Simultaneous detection of diverse analytes with an aptazyme ligase array." Analytical Biochemistry, 312(2003): 106-112.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Rev Peptide (ID# 7649) | Rev Peptide | GGACCUCGGCGAAAGCCGGUAACGCCACAAGUCGGAGGGUAAGAUCUGACAGGAACUGGGUGACGGAGGUUAGGUGC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 18 µM |
A. K. Dey et. al. Structural characterization of an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. RNA 11:873-884Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | HIV-1 R5 SU Glycoprotein gp120 (B40t77) (ID# 7732) | HIV-1 R5 gp120 | GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUUACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 31 nM |
Hesslberth et al. "Simultaneous Detection of Diverse Analytes with an Aptazyme Ligase Array." Analytical Biochemistry, 312, (2003):106-112.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HIV-1 Rev Peptide (L1-Rev) (ID# 7778) | HIV-1 Rev Peptide | GGACCUCGGCGAAAGCCGGUAACGCCACAAGUCGGAGGGUAAGAUCUGACAGGAACUGGGUGACGGAGGUUAGGUGC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 18 µM |
Wang Y, Li Z, Yu H. Aptamer-Based Western Blot for Selective Protein Recognition. Front Chem. 2020 Oct 29;8:570528. doi: 10.3389/fchem.2020.570528. PMID: 33195056; PMCID: PMC7658645.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | G1 (ID# 8087) | Glutathione S-transferase (GST) | ATACGACTCACTATTAGGGACAAAGCTGACAACCCTTTCATAATCTAACTACATTTATGTGCTAGACTACTGACTAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 59 nM |
Mendonsa, Shaun D. and Bowser, Michael T. "In Vitro Selection of High-Affinity DNA Ligands for Human IgE Using Capillary Electrophoresis." Analytical Chemistry, 76 (2004): 5387-5392.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | IgE (4.4.12) (ID# 7467) | IgE | AGCAGCACAGAGGTCAGATGTGAAACATAGCATATTTACTTATGTCGCCTTGCCGGTTCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 23 nM |
Murphy et al. "An improved method for the in vitro evolution of aptamers and applications in protein detection and purification." Nucleic Acids Research, 31 (2003): e110.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | TTF1 (A) (ID# 7468) | Thyroid Transcription Factor 1 | GGTATTGAGGGTCGCATCTCAAAAGGGGTGATTGCTTGCACAATGACAGGGTAGGACAGATGGCTCTAACTCTCCTCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.36 nM |
Sumedha and Dang. "Oligonucleotide inhibitors of Taq DNA polymerase facilitate detection of low copy number targets by PCR." Journal of Molecular Biology, 264 (1996): 268-78.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Taq DNA polymerase (TQ21) (ID# 7486) | Taq DNA polymerase | TTCTCGGTTGGTCTCTGGCGGAGCGATCATCTCAGAGCATTCTTAGCGTTTTGTTCTTGTGTATGATTCGCTTTTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 36 pM |
Hamula et al. "Selection of Aptamers against Live Bacterial Cells." Analytical Chemistry, 80(2008): 7812-7819.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lactobacillum acidophilius (hemag1P) (ID# 7607) | Lactobacillum acidophilius | AGCAGCACAGAGGTCAGATGTAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTGCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Cells | null | null | 13 nM |
DeGrasse, J. (2012). A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin b. PloS One, 7(3): e33410. doi: 10.1371/journal.pone.0033410Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Enterotoxin B (APT SEB1) (ID# 7685) | Staphylococcus aureus Enterotoxin B | GGTATTGAGGGTCGCATCCACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGTGATGGCTCTAACTCTCCTCT | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Rink, S. M. et al. "Creation of RNA molecules that recognize the oxidative lesion 7,8-dihydro-8-hydroxy-2*-deoxyguanosine (8-oxodG) in DNA." Proc. Natl. Acad. Sci., 95 (1998):11619-11624.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Terminal 8-oxodG DNA Lesion (R10-B35) (ID# 7852) | DNA Lesion 7,8-dihydro-8-hydroxy-2'-deoxyguanosine (8-oxodG) | GGGCGAAUUCCCGAGGACCAAAUAGUACCACCCGGGAAAACAGCUAAUGCCGAAACGGAGAUUUUUUCUGCAGAAGCU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5 µM |
Yang, M. et al. "Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery." Journal of Hematology & Oncology 2014, 7:5.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | JH6 (ID# 7875) | NB4 AML cell line | GACGCTTACTCAGGTGTGACTCGGTACGCCGCAAGACGAGTTGTGTATAAGCCGGCCGAAGGACGCAGATGAAGTCTC | https://www.aptagen.com/apta-index/ | Cells | null | null | 2.77 nM |
Zhang, X. et al. "A cell-based single-stranded DNA aptamer specifically targets gastric cancer." The International Journal of Biochemistry & Cell Biology 2014, 46: 1-8.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | ACG03 (ID# 7892) | gastric cancer cell-line HGC-27 | ACGCTCGGATGCCACTACAGGGGGGTGGTCCTGAGGGTGGTGTGGTTGGTTTGGTTTCCTCATGGACGTGCTGGTGAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 16.49 nM |
Weill L., Louis D., and Sargueil B., 2004.Selection and Evolution of NTP-Specific Aptamers. Nucleic Acids Research, 2004 Vol. 32 No. 17, 5045-5058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP C20 (ID# 7926) | ATP | GGUUGGCAGCAGAAGAUAGCAGCCUGUCGUUCGCUUCUUGUCCGACUCCCCAUUCGCAGUCGAAGUGGUAACUAUCUUUAAGGGUCGGUCAAGGGAGGGAUCCUA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 39 µM |
Jennifer M. Binning, Tianjiao Wang, Priya Luthra, Reed S. Shabman, Dominika M. Borek, Gai Liu, Wei Xu, Daisy W. Leung, Christopher F. Basler, and Gaya K. Amarasinghe, ƒ??Development of RNA aptamers targeting ebolavirus VP35ƒ? Biochemistry 2013, 52, 8406-8419.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 2F11-14 (ID# 7935) | Ebola virus inhibitory domain (eVP35 IID) (EBOV) (eVP35) | GGGAGACAAGAAUAAACGCUCAACGUUCAGUAUAACAGUCCGAGUCUAACACACAAUGGGACACUGAAUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.1 nM |
Walters RD, McSwiggen DT, Goodrich JA, Kugel JF (2014) Selection and Characterization of a DNA Aptamer That Can Discriminate between cJun/cJun and cJun/cFos. PLoS ONE 9(6): e101015. doi:10.1371/journal.pone.0101015Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AP-1 cJun/cJun Aptamer-19 (ID# 7940) | Activator Protein-1 Family cJun/cJun Homodimer | GGGAGATCACTTACGGCACCGTATAGTCGTACATGAACGAGTGTGAGTGTTAAGCCTTTGGCGACAGGGCTCGGAACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM |
Wang, Guodong, et al. "Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX". Nature: Scientific Reports (7): 7179. DOI:10.1038/s41598-017-05840-wMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GR-3 (ID# 7984) | glucagon receptor (GCGR) | ATCCAGAGTGACGCAGCAGATAAGTAGGTATCCGTTTGAAAAACTTTTCTGACCGTCCGACTATGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 52.7?ñ5.1 nM |
https://patents.google.com/patent/CN105063056A/enMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GWDB-30 (ID# 8042) | Calreticulin | ACGTTCGGATCGCACTAGAGCCCAAATCTCAGAAACCCATTCTCTACACACCTTGTACCTTCTGAACGTTCTCACGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Hicke, Brain, et al. "DNA Aptamers Block L-Selectin Function In Vivo Inhibition of Human Lymphocyte Traf?cking in SCID Mic." Journal of Clinical Investigation, 98 (1996): 2688-2692.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | L-Selectin (LD201) (ID# 7466) | L-Selectin | CTACCTACGATCTGACTAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTACTCTCATGTAGTTCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.8 nM |
Chi-Hong et al. "Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3." Proceedings of the National Academy of Sciences of the United States of America 100,(2003):9226-9231.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HER3 (A30) (ID# 7478) | HER3 | GAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 45 nM |
Cox and Ellington. "Automated Selection of Anti-Protein Aptamers." Bioorganic & Medicinal Chemsitry, 9 (2001): 2525-2531/Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Lysozyme (ID# 7563) | Lysozyme | GGGAAUGGAUCCACAUCUACGAAUUCAUCAGGGCUAAAGAGTGCAGAGUUACUUAGUUCACUGCAGACUUGACGAAGCUU | https://www.aptagen.com/apta-index/ | Protein | null | null | 31 nM |
Lau et al. "Evolution and Protein Packaging of Small-Molecule RNA Aptamers." ACS NANO, 5(2011): 7722-7729.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Heteroaryl dihydropyrimidine (Aptamer 21) (ID# 7596) | Heteroaryldihydropyrimidine (HAP) | GGGUAGGCCAGGCAGCCAACUAGCGAGAGCUUAAAUCUCUGAGCCCGAGAGGGUUCAGUGCUGCUUAUGUGGACGGCUU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 50 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Apramycin (LGA11) (ID# 7791) | Apramycin and other aminolycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 28.4 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Apramycin (LS13) (ID# 7792) | Apramycin and other aminolycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 35.9 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Gentamicin (LGA11) (ID# 7793) | Gentamicin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 22.3 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Kanamycin (LGA11) (ID# 7794) | Kanamycin and other aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 52.8 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Neomycin (LGA11) (ID# 7795) | Neomycin and other aminogycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 40.3 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Paromomycin (LGA11) (ID# 7796) | Paromomycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 21.4 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Streptomycin (LGA11) (ID# 7797) | Streptomycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 49.9 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Tobramycin (LGA11) (ID# 7798) | Tobramycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUAGGCCCGACAUUCCCCUAAAAAAGCUUGUUCUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 19.2 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Gentamycin (LS13) (ID# 7799) | Gentamycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 26.7 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Kanamycin (LS13) (ID# 7800) | Kanamycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 69.9 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Neomycin (LS13) (ID# 7801) | Neomycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 37 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Paromomycin (LS11) (ID# 7802) | Paromomycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 19.8 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Streptomycin (LS11) (ID# 7803) | Streptomycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 19.8 nM |
N. Derbyshire et al. Toggled RNA aptamers against aminoglycosides allowing facile detection of antibiotics using gold nanoparticle assays. Anal. Chem. (2012) 84: 6595-6602.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Tobramycin (ID# 7804) | Tobramycin and other Aminoglycosides (AMGs) | GGGAGAAGGCGGCGCGUAGGCGAGCUUUACCAGUUUUAUUUGUUUUAUUGUUAUAUGCUUAUUCGUGGACGAUGCGCAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 24.8 nM |
E F Neufeld et al. Aptamer-based endocytosis of a lysosomal enzyme. Proc. Natl. Acad. Sci. USA 105(2008): 15908-15913Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Mouse Transferrin Receptor (FB4) (ID# 7816) | Mouse Transferrin Receptor (mTfR) | GGGCGAAUUCCGCGUGUGCUGAGGGCGGAAGAACUAAUUUGGGACGGAUUGCGGCCGUUGUCUGUGGCGUCCGUUCGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Madsen, J.B., et al. "RNA Aptamers as Conformational Probes and Regulatory Agents for Plasminogen Activator Inhibitor-1." Biochemistry, 49, (2010), 4103-4115.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Plasminogen Activator Inhibitor-1 (paionap-5) (ID# 7829) | Plasminogen Activator Inhibitor-1 | GGGGCCACCAACGACAUUGAACCACGUAGGCUCGUUUCUGAGCCGAUCUCGAUGUUGAUAUAAAUAGUGCCCAUGGAUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.58 nM |
Madsen, J.B., et al. "RNA Aptamers as Conformational Probes and Regulatory Agents for Plasminogen Activator Inhibitor-1." Biochemistry, 49, (2010), 4103-4115.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Plasminogen Activator Inhibitor-1 (paionap-40) (ID# 7830) | Plasminogen Activator Inhibitor-1 | GGGGCCACCAACGACAUUUAUCGAAUUGAUAACCUUACGCGAGAGCGUAGUUCGUUGAUAUAAAUAGUGCCCAUGGAUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.23 nM |
Daniel Miotto Dupont, Jeppe Buur Madsen, Roland Karl Hartmann, et al. Serum-stable RNA aptamers to urokinase-type plasminogen activator blocking receptor binding. RNA 2010 16: 2360-2369Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | upanap-12 (ID# 7837) | Urokinase-type plasminogen activator | GGGGCCACCAACGACAUUUGCGACUGUUAUAACCUAACAGCGACGUAAAGAUAGUUGAUAUAAAUAGUGCCCAUGGAUC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Williams, R.; Crihfield, C.; Gattu, S.; Holland, L.; Sooter, L. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine. International Journal of Molecular Sciences, 2014, 15, 14332-14347. ISSN 1422-0067 doi: 10.3990/ijms150814332Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Atrazine R12.23 (ID# 7936) | Atrazine | TGTACCGTCTGAGCGATTCGTACGAACGGCTTTGTACTGTTTGCACTGGCGGATTTAGCCAGTCAGTGTTAAGGAGTGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.62 nM |
Williams, R.; Crihfield, C.; Gattu, S.; Holland, L.; Sooter, L. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine. International Journal of Molecular Sciences, 2014, 15, 14332-14347. ISSN 1422-0067 doi: 10.3990/ijms150814332Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Atrazine R12.28 (ID# 7937) | Atrazine | TGTACCGTCTGAGCGATTCGTACCATTAGTGGGTGCTCCTTACCTGATGGTCATCTAGCCAGTCAGTGTTAAGGAGTGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5.1 nM |
Zhang, Wei Yun, et al. “Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.” Analytical Chemistry 84, (2012): 350-355.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 21st clone (ID# 8039) | Shp2 | AGCGTCGAATACCACTACAGCCCGCACTCAACCACCGTTCCTTTGTTTAATTTTGCACATCTAATGGAGCTCGTGGTCAG | https://www.aptagen.com/apta-index/ | Protein | null | null | 24.9 nM |
Wang Y, Li Z, Yu H. Aptamer-Based Western Blot for Selective Protein Recognition. Front Chem. 2020 Oct 29;8:570528. doi: 10.3389/fchem.2020.570528. PMID: 33195056; PMCID: PMC7658645.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M1 (ID# 8085) | Maltose-binding protein (MBP) | ATACGACTCACTATTAGGGACCACATAAACATGCATCGCTCAATAACGGGATATTGTTGTGCTAGACTACTGACTACAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 173 nM |
Wang Y, Li Z, Yu H. Aptamer-Based Western Blot for Selective Protein Recognition. Front Chem. 2020 Oct 29;8:570528. doi: 10.3389/fchem.2020.570528. PMID: 33195056; PMCID: PMC7658645.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | H1 (ID# 8086) | Poly(histidine) tag (His-tag) | ATACGACTCACTATTAGGGATGTCCACCATATAGATCGATTTAAGTCCCTCGTTATTAATGCTAGACTACTGACTACAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 86 nM |
Cheung YW, Röthlisberger P, Mechaly AE, et al. Evolution of abiotic cubane chemistries in a nucleic acid aptamer allows selective recognition of a malaria biomarker. Proc Natl Acad Sci U S A. 2020;117(29):16790-16798. doi:10.1073/pnas.2003267117Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | T2 (ID# 8139) | Plasmodium vivax lactate dehydrogenase (PvLDH) | CACTCACGTCAGTGACATGCATGCCGATGACTAGTCGTCACTAGTGCACGTAACGTGCTAGTCAGAAATTTCGCACCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 670 nM |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.