Update README.md

README.md

@@ -1,3 +1,74 @@
 ---
 license: openrail
 ---
+DEEPBIND v0.11
+--------------
+
+The deepbind command-line executable can be used to score DNA/RNA sequences
+according to any RBP/TF model listed in the DeepBind web repository:
+
+   http://tools.genes.toronto.edu/deepbind
+
+For each input sequence, the deepbind executable scores each subsequence
+of a pre-determined length (e.g. 20) and returns only the maximum or the
+average over these per-position scores.
+
+Larger scores indicated stronger binding. The scores themselves are on an 
+arbitrary scale, and vary from model to model due to variation in the 
+quality of training data for different proteins.
+
+
+EXAMPLE
+-------
+
+To generate predictions with DeepBind, you need two things:
+
+  1) a list of model IDs, and
+  2) a list of DNA/RNA sequences.
+
+The file example.ids contains 4 example model IDs, one
+on each line, reproduced here:
+
+   D00210.001 # RBFOX1 (RNAcompete)
+   D00120.001 # MBNL1  (RNAcompete)
+   D00410.003 # GATA3  (SELEX)
+   D00328.003 # CTCF   (SELEX)
+
+The file example.seq contains 4 example sequences, which
+were chosen such that the nth sequence scores highly for
+the nth model. The file example.seq is reproduced here:
+
+   AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
+   AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
+   GAGGTTACGCGGCAAGATAA
+   TACCACTAGGGGGCGCCACC
+
+To generate 16 predictions (4 models, 4 sequences), run
+the deepbind executable as follows:
+
+   % deepbind example.ids < example.seq
+   D00210.001   D00120.001   D00410.003   D00328.003
+    7.451420    -0.166146    -0.408751    -0.026180
+   -0.155398     4.113817     0.516956    -0.248167
+   -0.140683     0.181295     5.885349    -0.026180
+   -0.174985    -0.152521    -0.379695    17.682623
+
+To see details of each ID, use the --dump-info flag:
+
+   % deepbind --dump-info example.ids
+   ID          Protein  Type  Species       Family   Class  Experiment  ...
+   D00210.001  RBFOX1   RBP   Homo sapiens  RRM             RNAcompete  ...
+   D00120.001  MBNL1    RBP   Homo sapiens  Znf             RNAcompete  ...
+   D00410.003  GATA3    TF    Homo sapiens  GATA            SELEX       ...
+   D00328.003  CTCF     TF    Homo sapiens  C2H2 ZF         SELEX       ...
+
+
+
+CHANGES v0.1 -> v0.11
+---------------------
+
+- Fixed bug where last position in input sequence was 
+  not evaluated for a score; suggested by Irene Kaplow.
+
+- Added --window-size and --average flags based on feedback.
+