text
stringlengths 26
99.8k
| meta
dict |
|---|---|
#####################################################
# World Cup Brazil 2014 - Asia (w/ Australia) Quali
# -- Fourth Stage, 3 June 2012 to 18 June 2013
##
# fix: change Group I to A.2 ?? or A2 or ??
# change Group J to B.2 ?? or B2 or ??
Group I | Iran South Korea Uzbekistan Qatar Lebanon
Group J | Japan Australia Jordan Oman Iraq
(11) Matchday IV.1 | Jun/3 2012
(12) Matchday IV.2 | Jun/8 2012
(13) Matchday IV.3 | Jun/12 2012
(14) Matchday IV.4 | Sep/11 2012
(15) Matchday IV.5 | Oct/16 2012
(16) Matchday IV.6 | Nov/14 2012
(17) Matchday IV.7 | Mar/26 2013
(18) Matchday IV.8 | Jun/4 2013
(19) Matchday IV.9 | Jun/11 2013
(20) Matchday IV.10 | Jun/18 2013
Group I:
Jun/3 2012 Uzbekistan 0-1 Iran @ Toshkent
Jun/3 2012 Lebanon 0-1 Qatar @ Beirut
Jun/8 2012 Lebanon 1-1 Uzbekistan @ Beirut
Jun/8 2012 Qatar 1-4 South Korea @ Doha
Jun/12 2012 South Korea 3-0 Lebanon @ Goyang
Jun/12 2012 Iran 0-0 Qatar @ Tehran
Sep/11 2012 Uzbekistan 2-2 South Korea @ Toshkent
Sep/11 2012 Lebanon 1-0 Iran @ Beirut
Oct/16 2012 Qatar 0-1 Uzbekistan @ Doha
Oct/16 2012 Iran 1-0 South Korea @ Tehran
Nov/14 2012 Qatar 1-0 Lebanon @ Doha
Nov/14 2012 Iran 0-1 Uzbekistan @ Tehran
Mar/26 2013 South Korea 2-1 Qatar @ Seoul
Mar/26 2013 Uzbekistan 1-0 Lebanon @ Toshkent
Jun/4 2013 Qatar 0-1 Iran @ Doha
Jun/4 2013 Lebanon 1-1 South Korea @ Beirut
Jun/11 2013 South Korea 1-0 Uzbekistan @ Seoul
Jun/11 2013 Iran 4-0 Lebanon @ Tehran
Jun/18 2013 South Korea 0-1 Iran @ Ulsan
Jun/18 2013 Uzbekistan 5-1 Qatar @ Toshkent
Group J:
Jun/3 2012 Japan 3-0 Oman @ Saitama
Jun/3 2012 Jordan 1-1 Iraq @ Amman
Jun/8 2012 Japan 6-0 Jordan @ Saitama
Jun/8 2012 Oman 0-0 Australia @ Muscat
Jun/12 2012 Australia 1-1 Japan @ Brisbane
Jun/12 2012 Iraq 1-1 Oman @ Doha
Sep/11 2012 Japan 1-0 Iraq @ Saitama
Sep/11 2012 Jordan 2-1 Australia @ Amman
Oct/16 2012 Oman 2-1 Jordan @ Muscat
Oct/16 2012 Iraq 1-2 Australia @ Doha
Nov/14 2012 Oman 1-2 Japan @ Muscat
Nov/14 2012 Iraq 1-0 Jordan @ Doha
Mar/26 2013 Australia 2-2 Oman @ Sydney
Mar/26 2013 Jordan 2-1 Japan @ Amman
Jun/4 2013 Japan 1-1 Australia @ Saitama
Jun/4 2013 Oman 1-0 Iraq @ Muscat
Jun/11 2013 Australia 4-0 Jordan @ Melbourne
Jun/11 2013 Iraq 0-1 Japan @ Doha
Jun/18 2013 Australia 1-0 Iraq @ Sydney
Jun/18 2013 Jordan 1-0 Oman @ Amman
(21) Fifth place playoff / 1st leg
Sep/6 2013 Jordan 1-1 Uzbekistan @ Amman
(22) Fifth place playoff / 2nd leg
Sep/10 2013 Uzbekistan 8-9iE 1-1nV 1-1 Jordan @ Toshkent
|
{
"pile_set_name": "Github"
}
|
{
"keyboard": "winkeyless/bminiex",
"keymap": "default_f0edc99",
"commit": "f0edc993b7beb15cc9c0443677801daddcae710b",
"layout": "LAYOUT",
"layers": [
[
"KC_ESC", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12", "KC_PSCR", "KC_HOME", "KC_END", "KC_NO", "KC_NO", "KC_NO", "KC_NO",
"KC_GRV", "KC_1", "KC_2", "KC_3", "KC_4", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_MINS", "KC_EQL", "KC_BSPC", "KC_DEL", "KC_NLCK", "KC_PSLS", "KC_PAST", "KC_PMNS",
"KC_TAB", "KC_Q", "KC_W", "KC_E", "KC_R", "KC_T", "KC_Y", "KC_U", "KC_I", "KC_O", "KC_P", "KC_LBRC", "KC_RBRC", "KC_NO", "KC_INS", "KC_P7", "KC_P8", "KC_P9",
"KC_LCAP", "KC_A", "KC_S", "KC_D", "KC_F", "KC_G", "KC_H", "KC_J", "KC_K", "KC_L", "KC_SCLN", "KC_QUOT", "KC_NUHS", "KC_ENT", "KC_PGUP", "KC_P4", "KC_P5", "KC_P6", "KC_PPLS",
"KC_LSFT", "KC_NUBS", "KC_Z", "KC_X", "KC_C", "KC_V", "KC_B", "KC_N", "KC_M", "KC_COMM", "KC_DOT", "KC_SLSH", "KC_RSFT", "KC_UP", "KC_PGDN", "KC_P1", "KC_P2", "KC_P3",
"KC_LCTL", "KC_LGUI", "KC_LALT", "KC_SPC", "KC_RALT", "KC_APP", "KC_RCTL", "KC_LEFT", "KC_DOWN", "KC_RGHT", "KC_P0", "KC_PDOT", "KC_PENT"
]
]
}
|
{
"pile_set_name": "Github"
}
|
["do",
["`", "Utility Functions"],
["def", "_cmp_seqs", ["fn", ["a", "b"],
["if", ["not", ["=", ["count", "a"], ["count", "b"]]],
false,
["if", ["empty?", "a"],
true,
["if", ["equal?", ["get", "a", 0], ["get", "b", 0]],
["_cmp_seqs", ["rest", "a"], ["rest", "b"]],
false]]]]],
["def", "_check_hash_map_keys", ["fn", ["ks", "a", "b"],
["if", ["empty?", "ks"],
true,
["let", ["k", ["first", "ks"]],
["if", ["equal?", ["get", "a", "k"], ["get", "b", "k"]],
["_check_hash_map_keys", ["rest", "ks"], "a", "b"],
false]]]]],
["def", "_cmp_hash_maps", ["fn", ["a", "b"],
["let", ["aks", ["keys", "a"]],
["if", ["not", ["=", ["count", "aks"], ["count", ["keys", "b"]]]],
false,
["_check_hash_map_keys", "aks", "a", "b"]]]]],
["def", "equal?", ["fn", ["a", "b"],
["if", ["sequential?", "a"],
["if", ["sequential?", "b"],
["_cmp_seqs", "a", "b"],
false],
["if", ["map?", "a"],
["if", ["map?", "b"],
["_cmp_hash_maps", "a", "b"],
false],
["if", ["symbol?", "a"],
["if", ["symbol?", "b"],
["=", ["get", "a", ["`", "val"]], ["get", "b", ["`", "val"]]],
false],
["=", "a", "b"]]]]]],
["def", "_clone", ["fn", ["obj"],
["if", ["list?", "obj"],
["slice", "obj", 0],
["if", ["vector?", "obj"],
["let", ["new-obj", ["slice", "obj", 0]],
["do",
["set", "new-obj", ["`", "__vector?__"], true],
"new-obj"]],
["if", ["map?", "obj"],
["let", ["new-obj", ["hash-map"]],
["do",
["map", ["fn", ["k"],
["if", [".", "obj", ["`", "hasOwnProperty"], "k"],
["set", "new-obj", "k", ["get", "obj", "k"]],
null]],
["keys", "obj"]],
"new-obj"]],
["if", ["malfunc?", "obj"],
["let", ["new-obj", ["malfunc", ["get", "obj", ["`", "fn"]],
["get", "obj", ["`", "ast"]],
["get", "obj", ["`", "env"]],
["get", "obj", ["`", "params"]]]],
["do",
["set", "new-obj", ["`", "macro?"], ["get", "obj", ["`", "macro?"]]],
["set", "new-obj", ["`", "__meta__"], ["get", "obj", ["`", "__meta__"]]],
"new-obj"]],
["throw", "clone of unsupported type"]]]]]]],
["def", "clone", ["fn", ["obj"],
["let", ["new-obj", ["_clone", "obj"]],
["do",
[".", "Object", ["`", "defineProperty"], "new-obj", ["`", "__meta__"],
{"enumerable": false, "writable": true}],
"new-obj"]]]],
["def", "assoc!", ["fn", ["a", "b", "c"], ["do", ["set", "a", "b", "c"], "a"]]],
["def", "assocs!", ["fn", ["hm", "kvs"],
["if", ["empty?", "kvs"],
"hm",
["do",
["assoc!", "hm", ["get", "kvs", 0], ["get", "kvs", 1]],
["assocs!", "hm", ["slice", "kvs", 2]]]]]],
["def", "Symbol", ["fn", [], null]],
["def", "symbol", ["fn", ["name"],
["assoc!", ["new", "Symbol"], ["`", "val"], "name"]]],
["def", "symbol?", ["fn", ["a"],
["isa", "a", "Symbol"]]],
["def", "keyword", ["fn", ["name"],
["str", ["`", "\u029e"], "name"]]],
["def", "keyword?", ["fn", ["kw"],
["and", ["=", ["`", "[object String]"], ["classOf", "kw"]],
["=", ["`", "\u029e"], ["get", "kw", 0]]]]],
["`", "Override some list defs to account for Vectors"],
["def", "sequential?", ["fn", ["a"],
[".", "Array", ["`", "isArray"], "a"]]],
["def", "list?", ["fn", ["a"],
["if", [".", "Array", ["`", "isArray"], "a"],
["if", [".-", "a", ["`", "__vector?__"]],
false,
true],
false]]],
["def", "empty?", ["fn", ["a"],
["if", ["sequential?", "a"],
["if", ["=", 0, [".-", "a", ["`", "length"]]],
true,
false],
["=", "a", null]]]],
["def", "vectorl", ["fn", ["lst"],
["let", ["vec", ["slice", "lst", 0]],
["do",
["set", "vec", ["`", "__vector?__"], true],
"vec"]]]],
["def", "vector", ["fn", ["&", "args"], ["vectorl", "args"]]],
["def", "vector?", ["fn", ["a"],
["if", [".", "Array", ["`", "isArray"], "a"],
["if", [".-", "a", ["`", "__vector?__"]],
true,
false],
false]]],
["def", "HashMap", ["fn", [], null]],
["def", "hash-map", ["fn", ["&", "a"],
["assocs!", ["new", "HashMap"], "a"]]],
["def", "map?", ["fn", ["a"],
["isa", "a", "HashMap"]]],
["def", "MalFunc", ["fn", [], null]],
["def", "malfunc", ["fn", ["fn", "ast", "env", "params"],
["assocs!", ["new", "MalFunc"],
["list", ["`", "fn"], "fn",
["`", "ast"], "ast",
["`", "env"], "env",
["`", "params"], "params",
["`", "macro?"], false]]]],
["def", "malfunc?", ["fn", ["a"],
["isa", "a", "MalFunc"]]],
["def", "Atom", ["fn", [], null]],
["def", "atom", ["fn", ["a"],
["let", ["atm", ["new", "Atom"]],
["do",
["set", "atm", ["`", "val"], "a"],
"atm"]]]],
["def", "atom?", ["fn", ["a"],
["isa", "a", "Atom"]]],
null
]
|
{
"pile_set_name": "Github"
}
|
{
"pagination": {
"ListObjectParentPaths": {
"result_key": "PathToObjectIdentifiersList",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListFacetNames": {
"result_key": "FacetNames",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListPublishedSchemaArns": {
"result_key": "SchemaArns",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListDirectories": {
"result_key": "Directories",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListDevelopmentSchemaArns": {
"result_key": "SchemaArns",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListTypedLinkFacetNames": {
"result_key": "FacetNames",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListIndex": {
"result_key": "IndexAttachments",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListFacetAttributes": {
"result_key": "Attributes",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListObjectPolicies": {
"result_key": "AttachedPolicyIds",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListTagsForResource": {
"result_key": "Tags",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListAttachedIndices": {
"result_key": "IndexAttachments",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"LookupPolicy": {
"result_key": "PolicyToPathList",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListPolicyAttachments": {
"result_key": "ObjectIdentifiers",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListObjectAttributes": {
"result_key": "Attributes",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListAppliedSchemaArns": {
"result_key": "SchemaArns",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
},
"ListTypedLinkFacetAttributes": {
"result_key": "Attributes",
"output_token": "NextToken",
"input_token": "NextToken",
"limit_key": "MaxResults"
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"pagination": {
"ListConferenceProviders": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListDeviceEvents": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListSkills": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListSkillsStoreCategories": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListSkillsStoreSkillsByCategory": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListSmartHomeAppliances": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"ListTags": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchAddressBooks": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchContacts": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchDevices": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchProfiles": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchRooms": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchSkillGroups": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
},
"SearchUsers": {
"input_token": "NextToken",
"output_token": "NextToken",
"limit_key": "MaxResults"
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"AWSTemplateFormatVersion": "2010-09-09",
"Description": "A load balancer instance running a local HAproxy",
"Parameters": {
"KeyName": {
"Description": "Name of an existing EC2 KeyPair to enable SSH access to the instances",
"Type": "String"
},
"Server1": {
"Description": "Server1 to load balance <ip:port>",
"Type": "String"
},
"InstanceType": {
"Description": "HAProxy server EC2 instance type",
"Default": "m1.small",
"Type": "String",
"AllowedValues": [ "m1.tiny", "m1.small", "m1.medium", "m1.large", "m1.xlarge" ],
"ConstraintDescription": "must be a valid EC2 instance type."
},
"LinuxDistribution": {
"Default": "F17",
"Description" : "Distribution of choice",
"Type": "String",
"AllowedValues" : [ "F17" ]
}
},
"Mappings" : {
"AWSInstanceType2Arch" : {
"m1.tiny" : { "Arch" : "32" },
"m1.small" : { "Arch" : "64" },
"m1.medium" : { "Arch" : "64" },
"m1.large" : { "Arch" : "64" },
"m1.xlarge" : { "Arch" : "64" }
},
"DistroArch2AMI": {
"F17" : { "32" : "F17-i386-cfntools", "64" : "F17-x86_64-cfntools" }
}
},
"Resources": {
"LoadBalancerInstance": {
"Type": "AWS::EC2::Instance",
"Metadata": {
"AWS::CloudFormation::Init": {
"config": {
"packages": {
"yum": {
"haproxy" : []
}
},
"services": {
"systemd": {
"haproxy" : { "enabled": "true", "ensureRunning": "true" }
}
},
"files": {
"/etc/haproxy/haproxy.cfg": {
"content": { "Fn::Join": ["", [
" global\n",
" daemon\n",
" maxconn 256\n",
"\n",
" defaults\n",
" mode http\n",
" timeout connect 5000ms\n",
" timeout client 50000ms\n",
" timeout server 50000ms\n",
"\n",
" frontend http-in\n",
" bind *:80\n",
" default_backend servers\n",
"\n",
" backend servers\n",
" balance roundrobin\n",
" option http-server-close\n",
" option forwardfor\n",
" server server1 ", { "Ref" : "Server1" }, "\n"
]]},
"mode": "000644",
"owner": "root",
"group": "root"
}
}
}
}
},
"Properties": {
"ImageId" : {
"Fn::FindInMap" : [ "DistroArch2AMI",
{ "Ref" : "LinuxDistribution" },
{ "Fn::FindInMap" : [ "AWSInstanceType2Arch",
{ "Ref" : "InstanceType" },
"Arch" ] } ]
},
"InstanceType": { "Ref": "InstanceType" },
"KeyName": { "Ref": "KeyName" },
"UserData": { "Fn::Base64": { "Fn::Join": ["", [
"#!/bin/bash -v\n",
"/opt/aws/bin/cfn-init -s ",
{ "Ref": "AWS::StackName" },
" --region ", { "Ref": "AWS::Region" }, "\n"
]]}}
}
}
},
"Outputs": {
"PublicIp": {
"Value": { "Fn::GetAtt": [ "LoadBalancerInstance", "PublicIp" ] },
"Description": "instance IP"
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"type" : "fusnowball",
"shortdescription" : "Icewalker",
"description" : "Their loathing of the Fireballs is unmatched.",
"categories" : [ "fusnowball" ],
"parts" : [ "body" ],
"animation" : "fusnowball.animation",
"dropPools" : [
{
"default" : "empty"
}
],
"baseParameters" : {
"scripts" : [
"/monsters/monster.lua"
],
"behavior" : "flyingcritter",
"metaBoundBox" : [-0.5, -0.5, 0.5, 0.5],
"scale" : 1.0,
"movementSettings" : {
"collisionPoly" : [ [-1.0, -1.0], [1.0, -1.0], [1.0, 1.0], [-1.0, 1.0] ],
"mass" : 0.5,
"walkSpeed" : 5,
"runSpeed" : 5,
"flySpeed" : 16,
"airForce" : 500,
"airFriction" : 0,
"gravityEnabled" : false,
"jumpSpeed" : 5
},
"bodyMaterialKind" : "organic",
"knockoutTime" : 0.1,
"knockoutEffect" : "",
"deathParticles" : "deathPoof",
"damageTeamType" : "passive",
"statusSettings" : {
"statusProperties" : {
"targetMaterialKind" : "organic"
},
"appliesWeatherStatusEffects" : true,
"appliesEnvironmentStatusEffects" : false,
"minimumLiquidStatusEffectPercentage" : 0.1,
"primaryScriptSources" : [
"/stats/monster_primary.lua"
],
"primaryScriptDelta" : 0,
"stats" : {
"grit" : {
"baseValue" : 1.0
},
"maxHealth" : {
"baseValue" : 1
},
"protection" : {
"baseValue" : 1.0
},
"healthRegen" : {
"baseValue" : 0.0
}
},
"resources" : {
"health" : {
"maxStat" : "maxHealth",
"deltaStat" : "healthRegen",
"defaultPercentage" : 100
}
}
},
"mouthOffset" : [0, 0],
"feetOffset" : [0, -8],
"relocatable" : true
}
}
|
{
"pile_set_name": "Github"
}
|
/* This file is generated by gen_zigzag32.m */
/* clang-format off */
#include "odintrin.h"
OD_EXTERN const unsigned char OD_ZIGZAG32_DCT_DCT[768][2] = {
{ 16, 0 }, { 17, 0 }, { 18, 0 }, { 19, 0 },
{ 16, 1 }, { 17, 1 }, { 20, 0 }, { 16, 2 },
{ 18, 1 }, { 21, 0 }, { 17, 2 }, { 16, 3 },
{ 19, 1 }, { 22, 0 }, { 18, 2 }, { 17, 3 },
{ 20, 1 }, { 16, 4 }, { 23, 0 }, { 19, 2 },
{ 24, 0 }, { 16, 5 }, { 21, 1 }, { 17, 4 },
{ 18, 3 }, { 20, 2 }, { 17, 5 }, { 16, 6 },
{ 19, 3 }, { 18, 4 }, { 25, 0 }, { 22, 1 },
{ 16, 7 }, { 21, 2 }, { 17, 6 }, { 20, 3 },
{ 26, 0 }, { 18, 5 }, { 19, 4 }, { 17, 7 },
{ 23, 1 }, { 22, 2 }, { 18, 6 }, { 27, 0 },
{ 19, 5 }, { 24, 1 }, { 21, 3 }, { 28, 0 },
{ 20, 4 }, { 18, 7 }, { 19, 6 }, { 23, 2 },
{ 29, 0 }, { 25, 1 }, { 21, 4 }, { 30, 0 },
{ 20, 5 }, { 22, 3 }, { 31, 0 }, { 19, 7 },
{ 24, 2 }, { 26, 1 }, { 20, 6 }, { 21, 5 },
{ 22, 4 }, { 23, 3 }, { 27, 1 }, { 25, 2 },
{ 20, 7 }, { 28, 1 }, { 24, 3 }, { 21, 6 },
{ 22, 5 }, { 23, 4 }, { 26, 2 }, { 21, 7 },
{ 29, 1 }, { 25, 3 }, { 30, 1 }, { 27, 2 },
{ 22, 6 }, { 23, 5 }, { 31, 1 }, { 24, 4 },
{ 26, 3 }, { 28, 2 }, { 22, 7 }, { 23, 6 },
{ 25, 4 }, { 24, 5 }, { 29, 2 }, { 30, 2 },
{ 27, 3 }, { 23, 7 }, { 31, 2 }, { 24, 6 },
{ 26, 4 }, { 25, 5 }, { 28, 3 }, { 24, 7 },
{ 27, 4 }, { 29, 3 }, { 25, 6 }, { 26, 5 },
{ 30, 3 }, { 31, 3 }, { 28, 4 }, { 27, 5 },
{ 25, 7 }, { 29, 4 }, { 26, 6 }, { 28, 5 },
{ 30, 4 }, { 26, 7 }, { 27, 6 }, { 31, 4 },
{ 29, 5 }, { 27, 7 }, { 30, 5 }, { 28, 6 },
{ 31, 5 }, { 29, 6 }, { 28, 7 }, { 30, 6 },
{ 31, 6 }, { 29, 7 }, { 30, 7 }, { 31, 7 },
{ 0, 16 }, { 0, 17 }, { 1, 16 }, { 0, 18 },
{ 1, 17 }, { 0, 19 }, { 2, 16 }, { 1, 18 },
{ 0, 20 }, { 2, 17 }, { 3, 16 }, { 1, 19 },
{ 2, 18 }, { 0, 21 }, { 3, 17 }, { 4, 16 },
{ 1, 20 }, { 2, 19 }, { 0, 22 }, { 3, 18 },
{ 4, 17 }, { 5, 16 }, { 0, 23 }, { 3, 19 },
{ 2, 20 }, { 1, 21 }, { 4, 18 }, { 6, 16 },
{ 5, 17 }, { 3, 20 }, { 2, 21 }, { 1, 22 },
{ 0, 24 }, { 0, 25 }, { 4, 19 }, { 7, 16 },
{ 6, 17 }, { 5, 18 }, { 0, 26 }, { 3, 21 },
{ 2, 22 }, { 1, 23 }, { 4, 20 }, { 5, 19 },
{ 6, 18 }, { 1, 24 }, { 7, 17 }, { 0, 27 },
{ 2, 23 }, { 3, 22 }, { 4, 21 }, { 1, 25 },
{ 5, 20 }, { 7, 18 }, { 0, 28 }, { 6, 19 },
{ 2, 24 }, { 1, 26 }, { 0, 29 }, { 4, 22 },
{ 3, 23 }, { 2, 25 }, { 5, 21 }, { 0, 31 },
{ 7, 19 }, { 6, 20 }, { 0, 30 }, { 1, 27 },
{ 3, 24 }, { 2, 26 }, { 4, 23 }, { 5, 22 },
{ 7, 20 }, { 1, 28 }, { 6, 21 }, { 3, 25 },
{ 2, 27 }, { 1, 29 }, { 4, 24 }, { 2, 28 },
{ 1, 30 }, { 7, 21 }, { 5, 23 }, { 3, 26 },
{ 6, 22 }, { 1, 31 }, { 4, 25 }, { 7, 22 },
{ 3, 27 }, { 2, 29 }, { 2, 30 }, { 5, 24 },
{ 2, 31 }, { 6, 23 }, { 4, 26 }, { 3, 28 },
{ 5, 25 }, { 3, 29 }, { 6, 24 }, { 7, 23 },
{ 3, 30 }, { 4, 27 }, { 3, 31 }, { 5, 26 },
{ 6, 25 }, { 4, 28 }, { 7, 24 }, { 4, 29 },
{ 5, 27 }, { 4, 30 }, { 4, 31 }, { 6, 26 },
{ 5, 28 }, { 7, 25 }, { 6, 27 }, { 5, 29 },
{ 7, 26 }, { 5, 30 }, { 5, 31 }, { 6, 28 },
{ 7, 27 }, { 6, 29 }, { 6, 30 }, { 7, 28 },
{ 6, 31 }, { 7, 29 }, { 7, 30 }, { 7, 31 },
{ 8, 16 }, { 9, 16 }, { 8, 17 }, { 10, 16 },
{ 9, 17 }, { 16, 8 }, { 8, 18 }, { 16, 9 },
{ 10, 17 }, { 11, 16 }, { 17, 8 }, { 9, 18 },
{ 8, 19 }, { 16, 10 }, { 11, 17 }, { 12, 16 },
{ 10, 18 }, { 17, 9 }, { 9, 19 }, { 16, 11 },
{ 8, 20 }, { 18, 8 }, { 17, 10 }, { 10, 19 },
{ 12, 17 }, { 11, 18 }, { 9, 20 }, { 16, 12 },
{ 18, 9 }, { 8, 21 }, { 13, 16 }, { 17, 11 },
{ 19, 8 }, { 18, 10 }, { 13, 17 }, { 16, 13 },
{ 11, 19 }, { 12, 18 }, { 10, 20 }, { 17, 12 },
{ 9, 21 }, { 19, 9 }, { 8, 22 }, { 14, 16 },
{ 18, 11 }, { 11, 20 }, { 10, 21 }, { 20, 8 },
{ 13, 18 }, { 16, 14 }, { 12, 19 }, { 17, 13 },
{ 19, 10 }, { 14, 17 }, { 9, 22 }, { 18, 12 },
{ 8, 23 }, { 17, 14 }, { 20, 9 }, { 15, 16 },
{ 16, 15 }, { 13, 19 }, { 10, 22 }, { 19, 11 },
{ 11, 21 }, { 14, 18 }, { 12, 20 }, { 18, 13 },
{ 20, 10 }, { 21, 8 }, { 15, 17 }, { 9, 23 },
{ 19, 12 }, { 11, 22 }, { 8, 24 }, { 21, 9 },
{ 17, 15 }, { 16, 16 }, { 14, 19 }, { 18, 14 },
{ 12, 21 }, { 13, 20 }, { 20, 11 }, { 10, 23 },
{ 19, 13 }, { 15, 18 }, { 16, 17 }, { 21, 10 },
{ 22, 8 }, { 9, 24 }, { 8, 25 }, { 20, 12 },
{ 15, 19 }, { 11, 23 }, { 17, 16 }, { 18, 15 },
{ 14, 20 }, { 12, 22 }, { 10, 24 }, { 22, 9 },
{ 21, 11 }, { 19, 14 }, { 13, 21 }, { 16, 18 },
{ 9, 25 }, { 17, 17 }, { 8, 26 }, { 20, 13 },
{ 23, 8 }, { 12, 23 }, { 13, 22 }, { 22, 10 },
{ 19, 15 }, { 15, 20 }, { 16, 19 }, { 21, 12 },
{ 11, 24 }, { 14, 21 }, { 8, 27 }, { 18, 16 },
{ 10, 25 }, { 9, 26 }, { 22, 11 }, { 20, 14 },
{ 23, 9 }, { 18, 17 }, { 17, 18 }, { 17, 19 },
{ 19, 16 }, { 21, 13 }, { 10, 26 }, { 12, 24 },
{ 23, 10 }, { 24, 8 }, { 8, 28 }, { 16, 20 },
{ 9, 27 }, { 15, 21 }, { 22, 12 }, { 14, 22 },
{ 13, 23 }, { 20, 15 }, { 11, 25 }, { 24, 9 },
{ 18, 18 }, { 19, 17 }, { 23, 11 }, { 10, 27 },
{ 8, 29 }, { 12, 25 }, { 9, 28 }, { 8, 30 },
{ 21, 14 }, { 13, 24 }, { 11, 26 }, { 25, 8 },
{ 24, 10 }, { 20, 16 }, { 19, 18 }, { 14, 23 },
{ 22, 13 }, { 8, 31 }, { 17, 20 }, { 9, 29 },
{ 23, 12 }, { 15, 22 }, { 25, 9 }, { 11, 27 },
{ 10, 28 }, { 20, 17 }, { 21, 15 }, { 18, 19 },
{ 16, 21 }, { 24, 11 }, { 9, 30 }, { 12, 26 },
{ 10, 29 }, { 22, 14 }, { 14, 24 }, { 9, 31 },
{ 26, 8 }, { 13, 25 }, { 25, 10 }, { 18, 20 },
{ 19, 19 }, { 11, 28 }, { 15, 23 }, { 20, 18 },
{ 10, 30 }, { 12, 27 }, { 17, 21 }, { 23, 13 },
{ 24, 12 }, { 21, 16 }, { 16, 22 }, { 26, 9 },
{ 27, 8 }, { 13, 26 }, { 22, 15 }, { 10, 31 },
{ 14, 25 }, { 12, 28 }, { 25, 11 }, { 21, 17 },
{ 26, 10 }, { 20, 19 }, { 11, 29 }, { 15, 24 },
{ 23, 14 }, { 27, 9 }, { 11, 30 }, { 13, 27 },
{ 19, 20 }, { 24, 13 }, { 28, 8 }, { 11, 31 },
{ 22, 16 }, { 17, 22 }, { 16, 23 }, { 25, 12 },
{ 18, 21 }, { 12, 29 }, { 21, 18 }, { 28, 9 },
{ 27, 10 }, { 26, 11 }, { 29, 8 }, { 14, 26 },
{ 15, 25 }, { 13, 28 }, { 12, 30 }, { 23, 15 },
{ 30, 8 }, { 16, 24 }, { 13, 29 }, { 25, 13 },
{ 24, 14 }, { 20, 20 }, { 31, 8 }, { 12, 31 },
{ 14, 27 }, { 28, 10 }, { 26, 12 }, { 22, 17 },
{ 21, 19 }, { 17, 23 }, { 18, 22 }, { 29, 9 },
{ 27, 11 }, { 19, 21 }, { 27, 12 }, { 30, 9 },
{ 31, 9 }, { 13, 30 }, { 24, 15 }, { 23, 16 },
{ 15, 26 }, { 14, 28 }, { 29, 10 }, { 28, 11 },
{ 26, 13 }, { 17, 24 }, { 13, 31 }, { 25, 14 },
{ 22, 18 }, { 16, 25 }, { 30, 10 }, { 14, 29 },
{ 15, 27 }, { 19, 22 }, { 21, 20 }, { 20, 21 },
{ 27, 13 }, { 29, 11 }, { 18, 23 }, { 23, 17 },
{ 16, 26 }, { 31, 10 }, { 24, 16 }, { 14, 30 },
{ 22, 19 }, { 14, 31 }, { 28, 12 }, { 26, 14 },
{ 30, 11 }, { 15, 28 }, { 25, 15 }, { 17, 25 },
{ 23, 18 }, { 18, 24 }, { 15, 30 }, { 29, 12 },
{ 31, 11 }, { 16, 27 }, { 24, 17 }, { 28, 13 },
{ 19, 23 }, { 15, 29 }, { 25, 16 }, { 17, 26 },
{ 27, 14 }, { 22, 20 }, { 15, 31 }, { 20, 22 },
{ 21, 21 }, { 16, 28 }, { 17, 27 }, { 30, 12 },
{ 26, 15 }, { 19, 24 }, { 18, 25 }, { 23, 19 },
{ 29, 13 }, { 31, 12 }, { 24, 18 }, { 26, 16 },
{ 25, 17 }, { 16, 29 }, { 28, 14 }, { 20, 23 },
{ 18, 26 }, { 21, 22 }, { 19, 25 }, { 22, 21 },
{ 27, 15 }, { 17, 28 }, { 16, 30 }, { 26, 17 },
{ 23, 20 }, { 16, 31 }, { 25, 18 }, { 27, 16 },
{ 20, 24 }, { 24, 19 }, { 31, 13 }, { 30, 13 },
{ 29, 14 }, { 18, 27 }, { 28, 15 }, { 17, 29 },
{ 19, 26 }, { 17, 30 }, { 21, 23 }, { 22, 22 },
{ 30, 14 }, { 20, 25 }, { 23, 21 }, { 17, 31 },
{ 18, 28 }, { 25, 19 }, { 24, 20 }, { 28, 16 },
{ 31, 14 }, { 26, 18 }, { 19, 27 }, { 29, 15 },
{ 27, 17 }, { 30, 15 }, { 21, 24 }, { 22, 23 },
{ 26, 19 }, { 23, 22 }, { 28, 17 }, { 29, 16 },
{ 18, 30 }, { 24, 21 }, { 25, 20 }, { 18, 31 },
{ 18, 29 }, { 20, 26 }, { 19, 28 }, { 27, 18 },
{ 31, 15 }, { 20, 27 }, { 30, 16 }, { 19, 29 },
{ 29, 17 }, { 31, 16 }, { 27, 19 }, { 21, 25 },
{ 28, 18 }, { 26, 20 }, { 22, 24 }, { 25, 21 },
{ 19, 30 }, { 24, 22 }, { 30, 17 }, { 21, 26 },
{ 23, 23 }, { 19, 31 }, { 20, 28 }, { 31, 17 },
{ 28, 19 }, { 27, 20 }, { 21, 27 }, { 29, 18 },
{ 30, 18 }, { 25, 22 }, { 26, 21 }, { 20, 29 },
{ 22, 25 }, { 24, 23 }, { 29, 19 }, { 23, 24 },
{ 20, 31 }, { 20, 30 }, { 28, 20 }, { 21, 28 },
{ 22, 26 }, { 31, 18 }, { 27, 21 }, { 30, 19 },
{ 22, 27 }, { 29, 20 }, { 23, 25 }, { 24, 24 },
{ 26, 22 }, { 21, 29 }, { 25, 23 }, { 31, 19 },
{ 21, 30 }, { 23, 26 }, { 28, 21 }, { 21, 31 },
{ 22, 28 }, { 30, 20 }, { 25, 24 }, { 27, 22 },
{ 29, 21 }, { 26, 23 }, { 24, 25 }, { 31, 20 },
{ 23, 27 }, { 22, 29 }, { 30, 21 }, { 28, 22 },
{ 24, 26 }, { 25, 25 }, { 27, 23 }, { 22, 30 },
{ 23, 28 }, { 22, 31 }, { 26, 24 }, { 31, 21 },
{ 24, 27 }, { 29, 22 }, { 27, 24 }, { 30, 22 },
{ 25, 26 }, { 28, 23 }, { 23, 30 }, { 23, 29 },
{ 24, 28 }, { 25, 27 }, { 31, 22 }, { 23, 31 },
{ 26, 25 }, { 28, 24 }, { 29, 23 }, { 24, 29 },
{ 24, 30 }, { 27, 25 }, { 25, 28 }, { 26, 26 },
{ 30, 23 }, { 26, 27 }, { 31, 23 }, { 28, 25 },
{ 27, 26 }, { 25, 29 }, { 24, 31 }, { 29, 24 },
{ 30, 24 }, { 27, 27 }, { 29, 25 }, { 26, 28 },
{ 31, 24 }, { 25, 30 }, { 25, 31 }, { 28, 26 },
{ 27, 28 }, { 26, 29 }, { 30, 25 }, { 29, 26 },
{ 28, 27 }, { 26, 30 }, { 31, 25 }, { 27, 29 },
{ 26, 31 }, { 30, 26 }, { 28, 28 }, { 31, 26 },
{ 29, 27 }, { 27, 30 }, { 28, 29 }, { 27, 31 },
{ 30, 27 }, { 31, 27 }, { 28, 30 }, { 29, 28 },
{ 30, 28 }, { 29, 29 }, { 30, 29 }, { 31, 28 },
{ 28, 31 }, { 29, 30 }, { 29, 31 }, { 31, 29 },
{ 30, 30 }, { 30, 31 }, { 31, 30 }, { 31, 31 }
};
|
{
"pile_set_name": "Github"
}
|
[[
"start",
["text.xml","test: header 1 "]
],[
"start",
["markup.heading.1","#"],
["heading","f"]
],[
"start",
["text.xml","test: header 2"]
],[
"start",
["markup.heading.2","##"],
["heading"," foo"]
],[
"start",
["text.xml","test: header ends with ' #'"]
],[
"start",
["markup.heading.1","#"],
["heading"," # # "]
],[
"start",
["text.xml","test: header ends with '#'"]
],[
"start",
["markup.heading.1","#"],
["heading","foo# "]
],[
"start",
["text.xml","test: 6+ #s is not a valid header"]
],[
"start",
["text.xml","####### foo"]
],[
"start",
["text.xml","test: # followed be only space is not a valid header"]
],[
"start",
["text.xml","# "]
],[
"start",
["text.xml","test: only space between #s is not a valid header"]
],[
"start",
["text.xml","# #"]
],[
"allowBlock"
],[
"start",
["markup.heading.1","#"],
["heading"," test links "],
["text","["],
["string","Cloud9 IDE"],
["text","]("],
["markup.underline","http://www.c9.io/"],
["text",")"],
["heading"," #"]
],[
"listblock",
["markup.list","* "],
["text","["],
["string","demo"],
["text","]("],
["markup.underline","http://ajaxorg.github.com/ace/"],
["text",")"],
["list"," "],
["text","["],
["string","+"],
["text","]("],
["markup.underline","escape(\\) "],
["text",")"],
["list"," "],
["text","["],
["string","+"],
["text","]("],
["markup.underline","a"],
["string"," \"title\""],
["text",")"],
["list"," "],
["text","["],
["string","+"],
["text","]("],
["markup.underline","a"],
["string"," \"space\" "],
["text",")"]
],[
"listblock",
["markup.list","* "],
["list","usually "],
["string.emphasis","*work*"],
["list"," fine ("],
["string.emphasis","_em_"],
["list",")"]
],[
"listblock",
["list","in lists"]
],[
"start"
],[
"start",
["text.xml","in plain text "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","b"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","http://ace.ajaxorg.com"],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","b"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"allowBlock"
],[
"allowBlock"
]]
|
{
"pile_set_name": "Github"
}
|
{
"keyboard": "handwired/hnah40",
"keymap": "default_d4ff836",
"commit": "d4ff836d6449b442e6f5ddc31678a489d0f6b3d6",
"layout": "LAYOUT",
"layers": [
[
"KC_ESC", "KC_Q", "KC_W", "KC_E", "KC_R", "KC_T", "KC_Y", "KC_U", "KC_I", "KC_O", "KC_P", "KC_BSPC",
"LT(2,KC_CAPS)", "KC_A", "KC_S", "KC_D", "KC_F", "KC_G", "KC_H", "KC_J", "KC_K", "KC_L", "KC_ENT",
"KC_LSFT", "KC_Z", "KC_X", "KC_C", "KC_V", "KC_B", "KC_N", "KC_M", "KC_COMM", "KC_DOT", "KC_RSFT",
"KC_LCTL", "KC_LGUI", "KC_LALT", "KC_SPC", "KC_SPC", "KC_APP", "MO(1)", "KC_RCTL"
],
[
"RESET", "KC_1", "KC_2", "KC_3", "KC_4", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_DEL",
"MO(2)", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_MINS", "KC_EQL", "KC_SCLN", "KC_QUOT",
"KC_LSFT", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12", "KC_COMM", "KC_DOT", "KC_SLSH", "KC_SLSH",
"KC_LCTL", "KC_LGUI", "KC_LALT", "KC_SPC", "KC_SPC", "KC_APP", "KC_TRNS", "KC_RCTL"
],
[
"RESET", "KC_1", "KC_UP", "RGB_TOG", "RGB_MOD", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_DEL",
"KC_TRNS", "KC_LEFT", "KC_DOWN", "KC_RGHT", "RGB_HUI", "RGB_HUD", "RGB_SAI", "RGB_SAD", "RGB_VAI", "RGB_VAD", "KC_ENT",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_UP", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_SPC", "KC_SPC", "KC_LEFT", "KC_DOWN", "KC_RGHT"
]
]
}
|
{
"pile_set_name": "Github"
}
|
[kernel] Parsing tests/aorai/assigns.c (with preprocessing)
[aorai] Welcome to the Aorai plugin
[kernel] Parsing /tmp/aorai_assigns1.i (no preprocessing)
[wp] Collecting axiomatic usage
[wp] warning: Missing RTE guards
[wp] [Qed] Goal typed_f_post_func_assign_part2 : Valid
[wp] [Qed] Goal typed_f_post_func_assign_part1 : Valid
[wp] [Qed] Goal typed_f_post_func_post_2 : Valid
[wp] [Qed] Goal typed_f_post_func_post : Valid
[wp] [Qed] Goal typed_f_post_func_buch_state_S2_out_post : Valid
[wp] [Qed] Goal typed_f_post_func_buch_state_S1_out_post : Valid
[wp] [Qed] Goal typed_f_post_func_assign_part4 : Valid
[wp] [Qed] Goal typed_f_post_func_assign_part3 : Valid
[wp] [Qed] Goal typed_f_post_func_buch_state_in_main_out_post : Valid
[wp] [Qed] Goal typed_f_post_func_buch_state_Sf_out_post : Valid
[wp] [Qed] Goal typed_f_pre_func_assign_part2 : Valid
[wp] [Qed] Goal typed_f_pre_func_assign_part1 : Valid
[wp] [Qed] Goal typed_f_pre_func_post_2 : Valid
[wp] [Qed] Goal typed_f_pre_func_post : Valid
[wp] [Qed] Goal typed_f_pre_func_assign_part3 : Valid
[wp] [Qed] Goal typed_main_post_func_assign_part2 : Valid
[wp] [Qed] Goal typed_main_post_func_assign_part1 : Valid
[wp] [Qed] Goal typed_main_post_func_post_2 : Valid
[wp] [Qed] Goal typed_main_post_func_post : Valid
[wp] [Qed] Goal typed_main_post_func_buch_state_S1_out_post : Valid
[wp] [Qed] Goal typed_main_post_func_assign_part4 : Valid
[wp] [Qed] Goal typed_main_post_func_assign_part3 : Valid
[wp] [Qed] Goal typed_main_post_func_buch_state_Sf_out_post : Valid
[wp] [Qed] Goal typed_main_post_func_buch_state_S_in_f_out_post : Valid
[wp] [Qed] Goal typed_main_post_func_buch_state_S2_out_post : Valid
[wp] [Qed] Goal typed_main_pre_func_assign_part2 : Valid
[wp] [Qed] Goal typed_main_pre_func_assign_part1 : Valid
[wp] [Qed] Goal typed_main_pre_func_post_2 : Valid
[wp] [Qed] Goal typed_main_pre_func_post : Valid
[wp] [Qed] Goal typed_main_pre_func_assign_part3 : Valid
/* Generated by Frama-C */
enum aorai_States {
aorai_reject_state = -2,
S1 = 0,
S2 = 1,
S_in_f = 2,
Sf = 3,
in_main = 4
};
enum aorai_ListOper {
op_f = 1,
op_main = 0
};
enum aorai_OpStatusList {
aorai_Terminated = 1,
aorai_Called = 0
};
/*@ lemma in_main_deterministic_trans{L}: \true;
*/
/*@ lemma Sf_deterministic_trans{L}: \true;
*/
/*@ lemma S_in_f_deterministic_trans{L}: \true;
*/
/*@ lemma S2_deterministic_trans{L}: \true;
*/
/*@ lemma S1_deterministic_trans{L}: \true;
*/
int X;
/*@ ghost enum aorai_ListOper aorai_CurOperation = op_main; */
/*@ ghost enum aorai_OpStatusList aorai_CurOpStatus = aorai_Called; */
/*@ ghost int aorai_CurStates = S1; */
/*@ ensures aorai_CurOpStatus ≡ aorai_Called;
ensures aorai_CurOperation ≡ op_f;
assigns aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior buch_state_S1_out:
ensures aorai_CurStates ≢ S1;
behavior buch_state_S2_out:
ensures aorai_CurStates ≢ S2;
behavior buch_state_S_in_f_in:
assumes aorai_CurStates ≡ Sf;
ensures aorai_CurStates ≡ S_in_f;
behavior buch_state_S_in_f_out:
assumes aorai_CurStates ≢ Sf;
ensures aorai_CurStates ≢ S_in_f;
behavior buch_state_Sf_out:
ensures aorai_CurStates ≢ Sf;
behavior buch_state_in_main_out:
ensures aorai_CurStates ≢ in_main;
*/
void f_pre_func(void)
{
/*@ ghost int aorai_CurStates_tmp; */
aorai_CurOpStatus = aorai_Called;
aorai_CurOperation = op_f;
aorai_CurStates_tmp = aorai_CurStates;
if (3 == aorai_CurStates) aorai_CurStates_tmp = S_in_f;
aorai_CurStates_tmp = aorai_CurStates;
return;
}
/*@ requires aorai_CurStates ≡ S_in_f;
ensures aorai_CurOpStatus ≡ aorai_Terminated;
ensures aorai_CurOperation ≡ op_f;
assigns aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior buch_state_S1_out:
ensures aorai_CurStates ≢ S1;
behavior buch_state_S2_out:
ensures aorai_CurStates ≢ S2;
behavior buch_state_S_in_f_out:
ensures aorai_CurStates ≢ S_in_f;
behavior buch_state_Sf_out:
ensures aorai_CurStates ≢ Sf;
behavior buch_state_in_main_in:
assumes aorai_CurStates ≡ S_in_f;
ensures aorai_CurStates ≡ in_main;
behavior buch_state_in_main_out:
assumes aorai_CurStates ≢ S_in_f;
ensures aorai_CurStates ≢ in_main;
*/
void f_post_func(void)
{
/*@ ghost int aorai_CurStates_tmp; */
aorai_CurOpStatus = aorai_Terminated;
aorai_CurOperation = op_f;
aorai_CurStates_tmp = aorai_CurStates;
if (2 == aorai_CurStates) aorai_CurStates_tmp = in_main;
aorai_CurStates_tmp = aorai_CurStates;
return;
}
/*@ requires aorai_CurStates ≡ Sf;
behavior Buchi_property_behavior:
ensures aorai_CurStates ≡ in_main;
*/
void f(void)
{
f_pre_func();
X ++;
f_post_func();
return;
}
/*@ ensures aorai_CurOpStatus ≡ aorai_Called;
ensures aorai_CurOperation ≡ op_main;
assigns aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior buch_state_S1_out:
ensures aorai_CurStates ≢ S1;
behavior buch_state_S2_out:
ensures aorai_CurStates ≢ S2;
behavior buch_state_S_in_f_out:
ensures aorai_CurStates ≢ S_in_f;
behavior buch_state_Sf_in:
assumes aorai_CurStates ≡ S1;
ensures aorai_CurStates ≡ Sf;
behavior buch_state_Sf_out:
assumes aorai_CurStates ≢ S1;
ensures aorai_CurStates ≢ Sf;
behavior buch_state_in_main_out:
ensures aorai_CurStates ≢ in_main;
*/
void main_pre_func(void)
{
/*@ ghost int aorai_CurStates_tmp; */
aorai_CurOpStatus = aorai_Called;
aorai_CurOperation = op_main;
aorai_CurStates_tmp = aorai_CurStates;
if (0 == aorai_CurStates) aorai_CurStates_tmp = Sf;
aorai_CurStates_tmp = aorai_CurStates;
return;
}
/*@ requires aorai_CurStates ≡ in_main;
ensures aorai_CurOpStatus ≡ aorai_Terminated;
ensures aorai_CurOperation ≡ op_main;
assigns aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior buch_state_S1_out:
ensures aorai_CurStates ≢ S1;
behavior buch_state_S2_in:
assumes aorai_CurStates ≡ in_main;
ensures aorai_CurStates ≡ S2;
behavior buch_state_S2_out:
assumes aorai_CurStates ≢ in_main;
ensures aorai_CurStates ≢ S2;
behavior buch_state_S_in_f_out:
ensures aorai_CurStates ≢ S_in_f;
behavior buch_state_Sf_out:
ensures aorai_CurStates ≢ Sf;
behavior buch_state_in_main_out:
ensures aorai_CurStates ≢ in_main;
*/
void main_post_func(int res)
{
/*@ ghost int aorai_CurStates_tmp; */
aorai_CurOpStatus = aorai_Terminated;
aorai_CurOperation = op_main;
aorai_CurStates_tmp = aorai_CurStates;
if (4 == aorai_CurStates) aorai_CurStates_tmp = S2;
aorai_CurStates_tmp = aorai_CurStates;
return;
}
/*@ requires aorai_CurStates ≡ S1;
assigns X, aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior foo:
assigns X, aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates;
behavior Buchi_property_behavior:
ensures aorai_CurStates ≡ S2;
*/
int main(void)
{
main_pre_func();
/*@ assigns X; */
X ++;
/*@ assigns aorai_CurOpStatus, aorai_CurOperation, aorai_CurStates, X; */
f();
main_post_func(X);
return X;
}
|
{
"pile_set_name": "Github"
}
|
<?php
$type = 'Core';
$name = 'ZapfDingbats';
$up = -100;
$ut = 50;
$cw = array(
chr(0)=>0,chr(1)=>0,chr(2)=>0,chr(3)=>0,chr(4)=>0,chr(5)=>0,chr(6)=>0,chr(7)=>0,chr(8)=>0,chr(9)=>0,chr(10)=>0,chr(11)=>0,chr(12)=>0,chr(13)=>0,chr(14)=>0,chr(15)=>0,chr(16)=>0,chr(17)=>0,chr(18)=>0,chr(19)=>0,chr(20)=>0,chr(21)=>0,
chr(22)=>0,chr(23)=>0,chr(24)=>0,chr(25)=>0,chr(26)=>0,chr(27)=>0,chr(28)=>0,chr(29)=>0,chr(30)=>0,chr(31)=>0,' '=>278,'!'=>974,'"'=>961,'#'=>974,'$'=>980,'%'=>719,'&'=>789,'\''=>790,'('=>791,')'=>690,'*'=>960,'+'=>939,
','=>549,'-'=>855,'.'=>911,'/'=>933,'0'=>911,'1'=>945,'2'=>974,'3'=>755,'4'=>846,'5'=>762,'6'=>761,'7'=>571,'8'=>677,'9'=>763,':'=>760,';'=>759,'<'=>754,'='=>494,'>'=>552,'?'=>537,'@'=>577,'A'=>692,
'B'=>786,'C'=>788,'D'=>788,'E'=>790,'F'=>793,'G'=>794,'H'=>816,'I'=>823,'J'=>789,'K'=>841,'L'=>823,'M'=>833,'N'=>816,'O'=>831,'P'=>923,'Q'=>744,'R'=>723,'S'=>749,'T'=>790,'U'=>792,'V'=>695,'W'=>776,
'X'=>768,'Y'=>792,'Z'=>759,'['=>707,'\\'=>708,']'=>682,'^'=>701,'_'=>826,'`'=>815,'a'=>789,'b'=>789,'c'=>707,'d'=>687,'e'=>696,'f'=>689,'g'=>786,'h'=>787,'i'=>713,'j'=>791,'k'=>785,'l'=>791,'m'=>873,
'n'=>761,'o'=>762,'p'=>762,'q'=>759,'r'=>759,'s'=>892,'t'=>892,'u'=>788,'v'=>784,'w'=>438,'x'=>138,'y'=>277,'z'=>415,'{'=>392,'|'=>392,'}'=>668,'~'=>668,chr(127)=>0,chr(128)=>390,chr(129)=>390,chr(130)=>317,chr(131)=>317,
chr(132)=>276,chr(133)=>276,chr(134)=>509,chr(135)=>509,chr(136)=>410,chr(137)=>410,chr(138)=>234,chr(139)=>234,chr(140)=>334,chr(141)=>334,chr(142)=>0,chr(143)=>0,chr(144)=>0,chr(145)=>0,chr(146)=>0,chr(147)=>0,chr(148)=>0,chr(149)=>0,chr(150)=>0,chr(151)=>0,chr(152)=>0,chr(153)=>0,
chr(154)=>0,chr(155)=>0,chr(156)=>0,chr(157)=>0,chr(158)=>0,chr(159)=>0,chr(160)=>0,chr(161)=>732,chr(162)=>544,chr(163)=>544,chr(164)=>910,chr(165)=>667,chr(166)=>760,chr(167)=>760,chr(168)=>776,chr(169)=>595,chr(170)=>694,chr(171)=>626,chr(172)=>788,chr(173)=>788,chr(174)=>788,chr(175)=>788,
chr(176)=>788,chr(177)=>788,chr(178)=>788,chr(179)=>788,chr(180)=>788,chr(181)=>788,chr(182)=>788,chr(183)=>788,chr(184)=>788,chr(185)=>788,chr(186)=>788,chr(187)=>788,chr(188)=>788,chr(189)=>788,chr(190)=>788,chr(191)=>788,chr(192)=>788,chr(193)=>788,chr(194)=>788,chr(195)=>788,chr(196)=>788,chr(197)=>788,
chr(198)=>788,chr(199)=>788,chr(200)=>788,chr(201)=>788,chr(202)=>788,chr(203)=>788,chr(204)=>788,chr(205)=>788,chr(206)=>788,chr(207)=>788,chr(208)=>788,chr(209)=>788,chr(210)=>788,chr(211)=>788,chr(212)=>894,chr(213)=>838,chr(214)=>1016,chr(215)=>458,chr(216)=>748,chr(217)=>924,chr(218)=>748,chr(219)=>918,
chr(220)=>927,chr(221)=>928,chr(222)=>928,chr(223)=>834,chr(224)=>873,chr(225)=>828,chr(226)=>924,chr(227)=>924,chr(228)=>917,chr(229)=>930,chr(230)=>931,chr(231)=>463,chr(232)=>883,chr(233)=>836,chr(234)=>836,chr(235)=>867,chr(236)=>867,chr(237)=>696,chr(238)=>696,chr(239)=>874,chr(240)=>0,chr(241)=>874,
chr(242)=>760,chr(243)=>946,chr(244)=>771,chr(245)=>865,chr(246)=>771,chr(247)=>888,chr(248)=>967,chr(249)=>888,chr(250)=>831,chr(251)=>873,chr(252)=>927,chr(253)=>970,chr(254)=>918,chr(255)=>0);
$uv = array(32=>32,33=>array(9985,4),37=>9742,38=>array(9990,4),42=>9755,43=>9758,44=>array(9996,28),72=>9733,73=>array(10025,35),108=>9679,109=>10061,110=>9632,111=>array(10063,4),115=>9650,116=>9660,117=>9670,118=>10070,119=>9687,120=>array(10072,7),128=>array(10088,14),161=>array(10081,7),168=>9827,169=>9830,170=>9829,171=>9824,172=>array(9312,10),182=>array(10102,31),213=>8594,214=>array(8596,2),216=>array(10136,24),241=>array(10161,14));
?>
|
{
"pile_set_name": "Github"
}
|
{
"lib_version" : "v0.3-106-g6f8837d",
"first_frame" : 1,
"last_frame" : 100,
"buffer_frames" : 1,
"merger" : {
"type" : "gradient"
},
"output" : {
"type" : "png",
"filename" : "ff_stereo_hfov_45_0-v2"
},
"pano" : {
"width" : 2048,
"height" : 1024,
"pad_top" : 0,
"pad_bottom" : 0,
"hfov" : 45,
"blend_zenith" : true,
"blend_nadir" : true,
"proj" : "stereographic",
"global_yaw" : 0,
"global_pitch" : 0,
"global_roll" : 0,
"inputs" : [
{
"width" : 1920,
"height" : 1080,
"hfov" : 275.871,
"filename" : "procedural:checker(size=120,color1=000000,color2=ee2222,color3=222222)",
"proj" : "ff_fisheye",
"yaw" : 0,
"pitch" : 7.03159,
"roll" : -50.4692,
"crop_left" : 341,
"crop_right" : 1547,
"crop_top" : -60,
"crop_bottom" : 1142,
"viewpoint_model" : "hugin",
"translation_x" : 0,
"translation_y" : 0,
"translation_z" : 0,
"viewpoint_pan" : 0,
"viewpoint_tilt" : 0,
"ev" : 0,
"red_corr" : 1,
"blue_corr" : 1,
"response" : "emor",
"emor_a" : 0,
"emor_b" : 0,
"emor_c" : 0,
"emor_d" : 0,
"emor_e" : 0,
"gamma" : 1,
"relative_to_cropped_area" : false,
"lens_dist_a" : 0,
"lens_dist_b" : -0.0899085,
"lens_dist_c" : 0,
"dist_center_x" : -15.7932,
"dist_center_y" : 3.3929,
"vign_a" : 1,
"vign_b" : 0,
"vign_c" : 0,
"vign_d" : 0,
"vign_x" : 0,
"vign_y" : 0,
"frame_offset" : 0
},
{
"width" : 1920,
"height" : 1080,
"hfov" : 275.871,
"filename" : "procedural:checker(size=120,color1=000000,color2=33ee33,color3=333333)",
"proj" : "ff_fisheye",
"yaw" : 120.996,
"pitch" : 9.37486,
"roll" : -47.1854,
"crop_left" : 341,
"crop_right" : 1547,
"crop_top" : -60,
"crop_bottom" : 1142,
"viewpoint_model" : "hugin",
"translation_x" : 0,
"translation_y" : 0,
"translation_z" : 0,
"viewpoint_pan" : 0,
"viewpoint_tilt" : 0,
"ev" : 0,
"red_corr" : 1,
"blue_corr" : 1,
"response" : "emor",
"emor_a" : 0,
"emor_b" : 0,
"emor_c" : 0,
"emor_d" : 0,
"emor_e" : 0,
"gamma" : 1,
"relative_to_cropped_area" : false,
"lens_dist_a" : 0,
"lens_dist_b" : -0.0899085,
"lens_dist_c" : 0,
"dist_center_x" : -15.7932,
"dist_center_y" : 3.3929,
"vign_a" : 1,
"vign_b" : 0,
"vign_c" : 0,
"vign_d" : 0,
"vign_x" : 0,
"vign_y" : 0,
"frame_offset" : 0
},
{
"width" : 1920,
"height" : 1080,
"hfov" : 275.871,
"filename" : "procedural:checker(size=120,color1=000000,color2=4444dd,color3=444444)",
"proj" : "ff_fisheye",
"yaw" : 61.0095,
"pitch" : 174.595,
"roll" : 133.23,
"crop_left" : 341,
"crop_right" : 1547,
"crop_top" : -60,
"crop_bottom" : 1142,
"viewpoint_model" : "hugin",
"translation_x" : 0,
"translation_y" : 0,
"translation_z" : 0,
"viewpoint_pan" : 0,
"viewpoint_tilt" : 0,
"ev" : 0,
"red_corr" : 1,
"blue_corr" : 1,
"response" : "emor",
"emor_a" : 0,
"emor_b" : 0,
"emor_c" : 0,
"emor_d" : 0,
"emor_e" : 0,
"gamma" : 1,
"relative_to_cropped_area" : false,
"lens_dist_a" : 0,
"lens_dist_b" : -0.0899085,
"lens_dist_c" : 0,
"dist_center_x" : -15.7932,
"dist_center_y" : 3.3929,
"vign_a" : 1,
"vign_b" : 0,
"vign_c" : 0,
"vign_d" : 0,
"vign_x" : 0,
"vign_y" : 0,
"frame_offset" : 0
}
]
}
}
|
{
"pile_set_name": "Github"
}
|
{
"$schema": "http://json-schema.org/schema",
"id": "timepicker-scrollto",
"title": "timepicker-scrollto",
"type": "object",
"properties": {
"path": {
"type": "string",
"format": "path",
"description": "The path to create the component.",
"visible": false
},
"project": {
"type": "string",
"description": "The name of the project.",
"$default": {
"$source": "projectName"
}
},
"name": {
"type": "string",
"description": "The name of the component.",
"$default": {
"$source": "argv",
"index": 0
}
},
"inlineStyle": {
"description": "Specifies if the style will be in the ts file.",
"type": "boolean",
"default": false,
"alias": "s"
},
"inlineTemplate": {
"description": "Specifies if the template will be in the ts file.",
"type": "boolean",
"default": false,
"alias": "t"
},
"viewEncapsulation": {
"description": "Specifies the view encapsulation strategy.",
"enum": [
"Emulated",
"Native",
"None",
"ShadowDom"
],
"type": "string",
"alias": "v"
},
"changeDetection": {
"description": "Specifies the change detection strategy.",
"enum": [
"Default",
"OnPush"
],
"type": "string",
"default": "Default",
"alias": "c"
},
"prefix": {
"type": "string",
"description": "The prefix to apply to generated selectors.",
"alias": "p",
"oneOf": [
{
"maxLength": 0
},
{
"minLength": 1,
"format": "html-selector"
}
]
},
"styleext": {
"description": "The file extension to be used for style files.",
"type": "string",
"default": "css"
},
"spec": {
"type": "boolean",
"description": "Specifies if a spec file is generated.",
"default": true
},
"flat": {
"type": "boolean",
"description": "Flag to indicate if a dir is created.",
"default": false
},
"skipImport": {
"type": "boolean",
"description": "Flag to skip the module import.",
"default": false
},
"selector": {
"type": "string",
"format": "html-selector",
"description": "The selector to use for the component."
},
"module": {
"type": "string",
"description": "Allows specification of the declaring module.",
"alias": "m"
},
"export": {
"type": "boolean",
"default": false,
"description": "Specifies if declaring module exports the component."
},
"entryComponent": {
"type": "boolean",
"default": false,
"description": "Specifies if the component is an entry component of declaring module."
},
"lintFix": {
"type": "boolean",
"default": false,
"description": "Specifies whether to apply lint fixes after generating the component."
}
},
"required": [
"name"
]
}
|
{
"pile_set_name": "Github"
}
|
= Using Solr From Ruby
// Licensed to the Apache Software Foundation (ASF) under one
// or more contributor license agreements. See the NOTICE file
// distributed with this work for additional information
// regarding copyright ownership. The ASF licenses this file
// to you under the Apache License, Version 2.0 (the
// "License"); you may not use this file except in compliance
// with the License. You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing,
// software distributed under the License is distributed on an
// "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
// KIND, either express or implied. See the License for the
// specific language governing permissions and limitations
// under the License.
Solr has an optional Ruby response format that extends the <<response-writers.adoc#json-response-writer,JSON output>> to allow the response to be safely eval'd by Ruby's interpreter
This Ruby response format differs from JSON in the following ways:
* Ruby's single quoted strings are used to prevent possible string exploits
** `\` and `'` are the only two characters escaped...
** unicode escapes not used... data is written as raw UTF-8
* nil used for null
* `\=>` used as the key/value separator in maps
Here's an example Ruby response from Solr, for a request like `\http://localhost:8983/solr/techproducts/select?q=iPod&wt=ruby&indent=on` (with Solr launching using `bin/solr start -e techproducts`):
[source,ruby]
----
{
'responseHeader'=>{
'status'=>0,
'QTime'=>0,
'params'=>{
'q'=>'iPod',
'indent'=>'on',
'wt'=>'ruby'}},
'response'=>{'numFound'=>3,'start'=>0,'docs'=>[
{
'id'=>'IW-02',
'name'=>'iPod & iPod Mini USB 2.0 Cable',
'manu'=>'Belkin',
'manu_id_s'=>'belkin',
'cat'=>['electronics',
'connector'],
'features'=>['car power adapter for iPod, white'],
'weight'=>2.0,
'price'=>11.5,
'price_c'=>'11.50,USD',
'popularity'=>1,
'inStock'=>false,
'store'=>'37.7752,-122.4232',
'manufacturedate_dt'=>'2006-02-14T23:55:59Z',
'_version_'=>1491038048794705920},
{
'id'=>'F8V7067-APL-KIT',
'name'=>'Belkin Mobile Power Cord for iPod w/ Dock',
'manu'=>'Belkin',
'manu_id_s'=>'belkin',
'cat'=>['electronics',
'connector'],
'features'=>['car power adapter, white'],
'weight'=>4.0,
'price'=>19.95,
'price_c'=>'19.95,USD',
'popularity'=>1,
'inStock'=>false,
'store'=>'45.18014,-93.87741',
'manufacturedate_dt'=>'2005-08-01T16:30:25Z',
'_version_'=>1491038048792608768},
{
'id'=>'MA147LL/A',
'name'=>'Apple 60 GB iPod with Video Playback Black',
'manu'=>'Apple Computer Inc.',
'manu_id_s'=>'apple',
'cat'=>['electronics',
'music'],
'features'=>['iTunes, Podcasts, Audiobooks',
'Stores up to 15,000 songs, 25,000 photos, or 150 hours of video',
'2.5-inch, 320x240 color TFT LCD display with LED backlight',
'Up to 20 hours of battery life',
'Plays AAC, MP3, WAV, AIFF, Audible, Apple Lossless, H.264 video',
'Notes, Calendar, Phone book, Hold button, Date display, Photo wallet, Built-in games, JPEG photo playback, Upgradeable firmware, USB 2.0 compatibility, Playback speed control, Rechargeable capability, Battery level indication'],
'includes'=>'earbud headphones, USB cable',
'weight'=>5.5,
'price'=>399.0,
'price_c'=>'399.00,USD',
'popularity'=>10,
'inStock'=>true,
'store'=>'37.7752,-100.0232',
'manufacturedate_dt'=>'2005-10-12T08:00:00Z',
'_version_'=>1491038048799948800}]
}}
----
Here is a simple example of how one may query Solr using the Ruby response format:
[source,ruby]
----
require 'net/http'
h = Net::HTTP.new('localhost', 8983)
http_response = h.get('/solr/techproducts/select?q=iPod&wt=ruby')
rsp = eval(http_response.body)
puts 'number of matches = ' + rsp['response']['numFound'].to_s
#print out the name field for each returned document
rsp['response']['docs'].each { |doc| puts 'name field = ' + doc['name'] }
----
For simple interactions with Solr, this may be all you need! If you are building complex interactions with Solr, then consider the libraries mentioned in the https://cwiki.apache.org/confluence/display/solr/Ruby+Response+Format#RubyResponseFormat-Libraries[Solr Wiki].
|
{
"pile_set_name": "Github"
}
|
["暗班"
,"安插"
,"按額"
,"紅牌"
,"後勤"
,"屘"
,"貿工"
,"賣場"
,"賣出"
,"美編"
,"美商"
,"面談"
,"面試"
,"民營"
,"民營化"
,"盟友"
,"名片"
,"舞男"
,"武士"
,"文案"
,"文宣"
,"樂迷"
,"樂手"
,"儀器"
,"義工"
,"議程"
,"業界"
,"業者"
,"業主"
,"業餘"
,"外包"
,"外銷"
,"原廠"
,"下班"
,"海報"
,"孩"
,"行業"
,"行員"
,"合約"
,"合股"
,"效益"
,"賢"
,"現任"
,"協理"
,"行文"
,"刑警"
,"型錄"
,"行銷"
,"行政"
,"歇工"
,"兇手"
,"休館"
,"好人"
,"復工"
,"復職"
,"戶名"
,"後衛"
,"副業"
,"花花公子"
,"販仔白"
,"繁榮"
,"法人"
,"發包"
,"發票"
,"發達"
,"貨物"
,"貨櫃"
,"會報"
,"會長"
,"會員"
,"匪"
,"廢標"
,"分行"
,"分局"
,"分店"
,"份子"
,"醫界"
,"夜勤"
,"影迷"
,"影星"
,"譯者"
,"引頭路"
,"英商"
,"應徵"
,"榮民"
,"營建"
,"營收"
,"營造"
,"營運"
,"藥廠"
,"勇者"
,"遊民"
,"忍者"
,"任職"
,"人力"
,"人士"
,"人選"
,"人質"
,"弱者"
,"日產"
,"日商"
,"加盟"
,"改途"
,"監工"
,"幹事"
,"工商"
,"工商界"
,"工事"
,"工頭"
,"工讀生"
,"工錢"
,"工作"
,"交貨"
,"價差"
,"開基"
,"開辦"
,"開設"
,"開除"
,"楷模"
,"牽公"
,"刊載"
,"客源"
,"企管"
,"騎士"
,"傾銷"
,"考核"
,"考察"
,"課長"
,"擴建"
,"空服"
,"庫存"
,"權勢"
,"開標"
,"開店"
,"機房"
,"技術"
,"機電"
,"機長"
,"基層"
,"奇美"
,"旗下"
,"兼任"
,"兼職"
,"減產"
,"建商"
,"見習"
,"筊仙"
,"金主"
,"經營"
,"經銷"
,"警界"
,"警廣"
,"警官"
,"警消"
,"警長"
,"警政"
,"警衛"
,"叫客"
,"局長"
,"求職"
,"高階"
,"高檔"
,"各行各業"
,"國營"
,"各界"
,"公安"
,"公營"
,"功利"
,"光臨"
,"功臣"
,"公事"
,"股長"
,"購併"
,"歌迷"
,"歌星"
,"掛名"
,"館長"
,"券商"
,"縣民"
,"官方"
,"決標"
,"內勤"
,"內銷"
,"難民"
,"老鳥"
,"理監事"
,"履歷"
,"履歷表"
,"里長"
,"離職"
,"利害"
,"連任"
,"聯播"
,"連鎖"
,"鄰長"
,"零售"
,"量產"
,"錄用"
,"名號"
,"硬體"
,"年會"
,"領標"
,"學工夫"
,"罷工"
,"罷市"
,"排班"
,"排版"
,"牌照"
,"版面"
,"辦公"
,"辦理"
,"放工"
,"包贌"
,"包商"
,"弊案"
,"弊端"
,"拍片"
,"標頭"
,"品管"
,"品牌"
,"聘"
,"聘約"
,"聘任"
,"聘書"
,"聘請"
,"評審"
,"片商"
,"片廠"
,"票價"
,"票房"
,"判刑"
,"販貨"
,"批准"
,"閉幕"
,"編制"
,"編輯"
,"變態"
,"稟"
,"稟告"
,"筆者"
,"保安"
,"保戶"
,"保固"
,"報價"
,"部門"
,"本業"
,"產物"
,"產能"
,"產量"
,"產品"
,"產銷"
,"產地"
,"散會"
,"三肢手"
,"姓"
,"詩人"
,"施工"
,"辭"
,"辭頭路"
,"時報"
,"辭職"
,"視察"
,"社長"
,"先鋒"
,"𫝛途"
,"設廠"
,"銷量"
,"辛勞"
,"申報"
,"生化"
,"生力軍"
,"生產"
,"升遷"
,"成交"
,"承攬"
,"承辦"
,"承包"
,"成品"
,"承接"
,"成就"
,"小工"
,"商務"
,"商機"
,"商隊"
,"常務"
,"上班"
,"失業"
,"收發"
,"收工"
,"囚犯"
,"受害者"
,"受訓"
,"售價"
,"受託人"
,"訴求"
,"素材"
,"署長"
,"士"
,"事務所"
,"事業"
,"士官"
,"選單"
,"散戶"
,"散工"
,"巡邏"
,"巡視"
,"代言人"
,"代工"
,"代價"
,"代銷"
,"擔任"
,"擔當"
,"動工"
,"底價"
,"塌跤"
,"頭路"
,"退還"
,"退休"
,"退股"
,"替手"
,"提案"
,"提拔"
,"天價"
,"天王"
,"聽友"
,"停工"
,"通告"
,"通路"
,"傳媒"
,"團長"
,"推案"
,"店長"
,"典範"
,"電台"
,"調動"
,"調查"
,"特約"
,"特價"
,"特權"
,"徵召"
,"訂戶"
,"訂貨"
,"訂製"
,"訂單"
,"中鋒"
,"中油"
,"中生代"
,"重建"
,"值班"
,"直播"
,"直銷"
,"長"
,"倒會"
,"倒店"
,"道行"
,"盜版"
,"黨員"
,"同業"
,"同仁"
,"徒"
,"才女"
,"在職"
,"層級"
,"摠頭"
,"製藥"
,"製品"
,"製片"
,"製成"
,"炒作"
,"採訪"
,"菜鳥"
,"裁判"
,"裁員"
,"插代誌"
,"市面"
,"車迷"
,"車價"
,"車商"
,"車主"
,"簽訂"
,"倩"
,"超人"
,"撨摵"
,"請辭"
,"請示"
,"促銷"
,"沖銷"
,"廠商"
,"廠長"
,"匠"
,"創業"
,"創立"
,"創辦"
,"初學者"
,"粗工"
,"取景"
,"處長"
,"揣頭路"
,"出貨"
,"出勤"
,"出品"
,"出師"
,"出頭天"
,"出張"
,"出差"
,"出廠"
,"指令"
,"志工"
,"食家己"
,"食頭路"
,"僭位"
,"前鋒"
,"前途"
,"接管"
,"接班"
,"接手"
,"接單"
,"截稿"
,"績效"
,"進貨"
,"進用"
,"菁英"
,"偵探"
,"精裝"
,"整建"
,"贈品"
,"獎券"
,"執業"
,"執勤"
,"執照"
,"職訓"
,"職缺"
,"職能"
,"職責"
,"酒家"
,"酒仙"
,"酒店"
,"就業"
,"就職"
,"上目"
,"上任"
,"做官"
,"造船"
,"作為"
,"總務"
,"組別"
,"組長"
,"助理"
,"資深"
,"主任"
,"主播"
,"專訪"
,"專任"
,"專人"
,"專櫃"
,"專職"
,"專員"
,"轉任"
,"轉入"
,"轉進"
,"全職"
,"罪犯"
,"水利"
,"水手"
,"尊"
,"除名"
,"大賣場"
,"大名"
,"單跤手"
,"完工"
,"熨金"
]
|
{
"pile_set_name": "Github"
}
|
{
"keyboard": "naked64/rev1",
"keymap": "default_85688f9",
"commit": "cec391df70197a63b12a69c0e08927ecb156e341",
"layout": "LAYOUT",
"layers": [
[
"KC_PGUP", "KC_ESC", "KC_1", "KC_2", "KC_3", "KC_4", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_MINS", "KC_BSPC",
"KC_PGDN", "KC_TAB", "KC_Q", "KC_W", "KC_E", "KC_R", "KC_T", "KC_Y", "KC_U", "KC_I", "KC_O", "KC_P", "KC_LCBR", "KC_RCBR",
"KC_LCTL", "KC_A", "KC_S", "KC_D", "KC_F", "KC_G", "KC_H", "KC_J", "KC_K", "KC_L", "KC_SCLN", "KC_QUOT", "KC_ENT",
"KC_LSFT", "KC_Z", "KC_X", "KC_C", "KC_V", "KC_B", "KC_N", "KC_M", "KC_COMM", "KC_DOT", "KC_SLSH", "KC_UP", "KC_RSFT",
"MO(4)", "KC_LALT", "KC_SPC", "MO(2)", "MO(3)", "KC_SPC", "KC_LGUI", "KC_LEFT", "KC_DOWN","KC_RGHT"
],
[
"TG(1)", "KC_ESC", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS"
],
[
"KC_TRNS", "KC_ESC", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12",
"KC_TRNS", "KC_TILD", "KC_EXLM", "KC_AT", "KC_HASH", "KC_DLR", "KC_PERC", "KC_CIRC", "KC_AMPR", "KC_ASTR", "KC_LPRN", "KC_RPRN", "KC_DEL", "KC_TRNS",
"KC_TRNS", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_UNDS", "KC_PLUS", "KC_LCBR", "KC_RCBR", "KC_PIPE", "KC_TRNS",
"KC_TRNS", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12","LSFT(KC_NUHS)","LSFT(KC_NUBS)","KC_TRNS","KC_TRNS","KC_VOLU","KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_MNXT", "KC_VOLD", "KC_MPLY"
],
[
"KC_TRNS", "KC_ESC", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12",
"KC_TRNS", "KC_TAB", "KC_1", "KC_2", "KC_3", "KC_4", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_MINS", "KC_BSPC",
"KC_TRNS", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_MINS", "KC_EQL", "KC_LBRC", "KC_RBRC", "KC_BSLS", "KC_TRNS",
"KC_TRNS", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12", "KC_NUHS", "KC_NUBS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS"
],
[
"TG(1)", "RESET", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12",
"KC_TRNS", "KC_TRNS", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_TRNS",
"KC_TRNS", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "RGB_TOG", "RGB_MOD", "KC_NO","LCA(KC_DEL)","LALT(KC_PSCR)","KC_PSCR", "KC_NO",
"KC_TRNS", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "KC_NO", "RGB_VAD", "RGB_VAI", "RGB_HUD", "RGB_HUI", "RGB_SAD", "RGB_SAI", "KC_NO",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS"
]
]
}
|
{
"pile_set_name": "Github"
}
|
["do",
["load", ["`", "miniMAL-core.json"]],
["load", ["`", "types.json"]],
["load", ["`", "reader.json"]],
["load", ["`", "printer.json"]],
["load", ["`", "env.json"]],
["load", ["`", "core.json"]],
["def", "READ", ["fn", ["strng"], ["read-str", "strng"]]],
["def", "starts-with", ["fn", ["ast", "sym"],
["and", ["not", ["empty?", "ast"]],
["let", ["a0", ["first", "ast"]],
["and", ["symbol?", "a0"],
["=", "sym", ["get", "a0", ["`", "val"]]]]]]]],
["def", "quasiquote-loop", ["fn", ["xs"],
["if", ["empty?", "xs"],
["list"],
["let", ["elt", ["first", "xs"],
"acc", ["quasiquote-loop", ["rest", "xs"]]],
["if", ["and", ["list?", "elt"],
["starts-with", "elt", ["`", "splice-unquote"]]],
["list", ["symbol", ["`", "concat"]], ["nth", "elt", 1], "acc"],
["list", ["symbol", ["`", "cons"]], ["quasiquote", "elt"], "acc"]]]]]],
["def", "quasiquote", ["fn", ["ast"],
["if", ["list?", "ast"],
["if", ["starts-with", "ast", ["`", "unquote"]],
["nth", "ast", 1],
["quasiquote-loop", "ast"]],
["if", ["vector?", "ast"],
["list", ["symbol", ["`", "vec"]], ["quasiquote-loop", "ast"]],
["if", ["or", ["map?", "ast"], ["symbol?", "ast"]],
["list", ["symbol", ["`", "quote"]], "ast"],
"ast"]]]]],
["def", "macro?", ["fn", ["ast", "env"],
["and", ["list?", "ast"],
["symbol?", ["first", "ast"]],
["not", ["=", null, ["env-find", "env", ["first", "ast"]]]],
["let", ["fn", ["env-get", "env", ["first", "ast"]]],
["and", ["malfunc?", "fn"],
["get", "fn", ["`", "macro?"]]]]]]],
["def", "macroexpand", ["fn", ["ast", "env"],
["if", ["macro?", "ast", "env"],
["let", ["mac", ["get", ["env-get", "env", ["first", "ast"]], ["`", "fn"]]],
["macroexpand", ["apply", "mac", ["rest", "ast"]], "env"]],
"ast"]]],
["def", "eval-ast", ["fn", ["ast", "env"],
["if", ["symbol?", "ast"],
["env-get", "env", "ast"],
["if", ["list?", "ast"],
["map", ["fn", ["x"], ["EVAL", "x", "env"]], "ast"],
["if", ["vector?", "ast"],
["vectorl", ["map", ["fn", ["x"], ["EVAL", "x", "env"]], "ast"]],
["if", ["map?", "ast"],
["let", ["new-hm", ["hash-map"]],
["do",
["map", ["fn", ["k"], ["set", "new-hm",
["EVAL", "k", "env"],
["EVAL", ["get", "ast", "k"], "env"]]],
["keys", "ast"]],
"new-hm"]],
"ast"]]]]]],
["def", "LET", ["fn", ["env", "args"],
["if", [">", ["count", "args"], 0],
["do",
["env-set", "env", ["nth", "args", 0],
["EVAL", ["nth", "args", 1], "env"]],
["LET", "env", ["rest", ["rest", "args"]]]]]]],
["def", "EVAL", ["fn", ["ast", "env"],
["if", ["not", ["list?", "ast"]],
["eval-ast", "ast", "env"],
["let", ["ast", ["macroexpand", "ast", "env"]],
["if", ["not", ["list?", "ast"]],
["eval-ast", "ast", "env"],
["if", ["empty?", "ast"],
"ast",
["let", ["a0", ["get", ["first", "ast"], ["`", "val"]]],
["if", ["=", ["`", "def!"], "a0"],
["env-set", "env", ["nth", "ast", 1],
["EVAL", ["nth", "ast", 2], "env"]],
["if", ["=", ["`", "let*"], "a0"],
["let", ["let-env", ["env-new", "env"]],
["do",
["LET", "let-env", ["nth", "ast", 1]],
["EVAL", ["nth", "ast", 2], "let-env"]]],
["if", ["=", ["`", "quote"], "a0"],
["nth", "ast", 1],
["if", ["=", ["`", "quasiquoteexpand"], "a0"],
["quasiquote", ["nth", "ast", 1]],
["if", ["=", ["`", "quasiquote"], "a0"],
["EVAL", ["quasiquote", ["nth", "ast", 1]], "env"],
["if", ["=", ["`", "defmacro!"], "a0"],
["let", ["func", ["EVAL", ["nth", "ast", 2], "env"]],
["do",
["set", "func", ["`", "macro?"], true],
["env-set", "env", ["nth", "ast", 1], "func"]]],
["if", ["=", ["`", "macroexpand"], "a0"],
["macroexpand", ["nth", "ast", 1], "env"],
["if", ["=", ["`", "do"], "a0"],
["do",
["eval-ast", ["slice", "ast", 1, ["-", ["count", "ast"], 1]], "env"],
["EVAL", ["nth", "ast", ["-", ["count", "ast"], 1]], "env"]],
["if", ["=", ["`", "if"], "a0"],
["let", ["cond", ["EVAL", ["nth", "ast", 1], "env"]],
["if", ["or", ["=", "cond", null], ["=", "cond", false]],
["if", [">", ["count", "ast"], 3],
["EVAL", ["nth", "ast", 3], "env"],
null],
["EVAL", ["nth", "ast", 2], "env"]]],
["if", ["=", ["`", "fn*"], "a0"],
["malfunc",
["fn", ["&", "args"],
["let", ["e", ["env-new", "env", ["nth", "ast", 1], "args"]],
["EVAL", ["nth", "ast", 2], "e"]]],
["nth", "ast", 2], "env", ["nth", "ast", 1]],
["let", ["el", ["eval-ast", "ast", "env"],
"f", ["first", "el"],
"args", ["rest", "el"]],
["if", ["malfunc?", "f"],
["EVAL", ["get", "f", ["`", "ast"]],
["env-new", ["get", "f", ["`", "env"]],
["get", "f", ["`", "params"]],
"args"]],
["apply", "f", "args"]]]]]]]]]]]]]]]]]]]],
["def", "PRINT", ["fn", ["exp"],
["pr-str", "exp", true]]],
["def", "repl-env", ["env-new"]],
["def", "rep", ["fn", ["strng"],
["try",
["PRINT", ["EVAL", ["READ", "strng"], "repl-env"]],
["catch", "exc",
["str", ["`", "Error: "],
["if", ["isa", "exc", "Error"],
[".", "exc", ["`", "toString"]],
["pr-str", "exc", true]]]]]]],
["`", "core.mal: defined using miniMAL"],
["map", ["fn", ["k"], ["env-set", "repl-env",
["symbol", "k"],
["get", "core-ns", "k"]]],
["keys", "core-ns"]],
["env-set", "repl-env", ["symbol", ["`", "eval"]],
["fn", ["ast"], ["EVAL", "ast", "repl-env"]]],
["env-set", "repl-env", ["symbol", ["`", "*ARGV*"]],
["slice", "ARGS", 1]],
["`", "core.mal: defined using mal itself"],
["rep", ["`", "(def! not (fn* (a) (if a false true)))"]],
["rep", ["`", "(def! load-file (fn* (f) (eval (read-string (str \"(do \" (slurp f) \"\nnil)\")))))"]],
["rep", ["`", "(defmacro! cond (fn* (& xs) (if (> (count xs) 0) (list 'if (first xs) (if (> (count xs) 1) (nth xs 1) (throw \"odd number of forms to cond\")) (cons 'cond (rest (rest xs)))))))"]],
["if", ["not", ["empty?", "ARGS"]],
["rep", ["str", ["`", "(load-file \""], ["get", "ARGS", 0], ["`", "\")"]]],
["repl", ["`", "user> "], "rep"]],
null
]
|
{
"pile_set_name": "Github"
}
|
{
"type": "excalidraw",
"version": 2,
"source": "https://excalidraw.com",
"elements": [
{
"type": "text",
"version": 137,
"versionNonce": 1707748325,
"isDeleted": false,
"id": "o9-ugmQsi6z6M0k9Q4ijw",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 619,
"y": 304,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 238,
"height": 32,
"seed": 1349359589,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.getCanonicalLocales",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 20,
"versionNonce": 2038122629,
"isDeleted": false,
"id": "6k13Zx4eRwAGNkFfH0Y8q",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 354.5,
"y": 409,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 147,
"height": 32,
"seed": 1613737995,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.PluralRules",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 318,
"versionNonce": 2049106145,
"isDeleted": false,
"id": "8JU_rpvx7MfwgqhErMnuj",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 148.5,
"y": 687,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 235,
"height": 32,
"seed": 1696542283,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.RelativeTimeFormat",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 43,
"versionNonce": 853307691,
"isDeleted": false,
"id": "zhrH4GALW-FOtpySVgx-q",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 799.5,
"y": 406,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 103,
"height": 32,
"seed": 514487147,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.Locale",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 115,
"versionNonce": 1634975941,
"isDeleted": false,
"id": "w9XvzMllLfvOn1deWsoIb",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 569.5,
"y": 412,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 173,
"height": 32,
"seed": 1718717893,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.DisplayNames",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 223,
"versionNonce": 1719157807,
"isDeleted": false,
"id": "lnz2EAa32ZjkSTSCDSQVC",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 347.5,
"y": 543,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 175,
"height": 32,
"seed": 732189413,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.NumberFormat",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "text",
"version": 104,
"versionNonce": 1866669157,
"isDeleted": false,
"id": "qZR72Ok_NQrQGZp802E0q",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 954.5,
"y": 405,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 147,
"height": 32,
"seed": 901849131,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.ListFormat",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "arrow",
"version": 133,
"versionNonce": 55597029,
"isDeleted": false,
"id": "Rmaj7D2Ylf6ixejzosIfI",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 593.7951605800539,
"y": 332.9488447237946,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 144.7951605800539,
"height": 75.0511552762054,
"seed": 1134049733,
"groupIds": [],
"points": [
[
0,
0
],
[
-144.7951605800539,
75.0511552762054
]
]
},
{
"type": "arrow",
"version": 227,
"versionNonce": 1398155055,
"isDeleted": false,
"id": "4Q9MqGqoxmosaxUakowQ8",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 377.66183958612385,
"y": 590.8586617831141,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 99.78746498446463,
"height": 82.365678012371,
"seed": 1703564427,
"groupIds": [],
"points": [
[
0,
0
],
[
-99.78746498446463,
82.365678012371
]
]
},
{
"type": "arrow",
"version": 46,
"versionNonce": 935529291,
"isDeleted": false,
"id": "KgQhYlzhjHyduUI9xJ8ii",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 660.1746351854131,
"y": 348.0985772971064,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 11.17463518541308,
"height": 64.90142270289363,
"seed": 1899584011,
"groupIds": [],
"points": [
[
0,
0
],
[
-11.17463518541308,
64.90142270289363
]
]
},
{
"type": "arrow",
"version": 45,
"versionNonce": 452776805,
"isDeleted": false,
"id": "rQltDFwVOgI_ze5EjYR5t",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 791.479036701098,
"y": 346.6198090807535,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 45.52096329890196,
"height": 60.3801909192465,
"seed": 1557263909,
"groupIds": [],
"points": [
[
0,
0
],
[
45.52096329890196,
60.3801909192465
]
]
},
{
"type": "arrow",
"version": 28,
"versionNonce": 1604882085,
"isDeleted": false,
"id": "WFy9XDr8AYhcX-54VLA_N",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 876,
"y": 331,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 116,
"height": 69,
"seed": 1048068459,
"groupIds": [],
"points": [
[
0,
0
],
[
116,
69
]
]
},
{
"type": "text",
"version": 197,
"versionNonce": 1308769263,
"isDeleted": false,
"id": "wU6q-18jJJ_8YhXv-1uKQ",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 478,
"y": 686,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 212,
"height": 32,
"seed": 106787643,
"groupIds": [],
"fontSize": 20,
"fontFamily": 1,
"text": "Intl.DateTimeFormat",
"baseline": 23,
"textAlign": "left",
"verticalAlign": "top"
},
{
"type": "arrow",
"version": 94,
"versionNonce": 1507186881,
"isDeleted": false,
"id": "x7M2r6i4CyQ6KaNx1mw_r",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"angle": 0,
"x": 499,
"y": 599,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"width": 60,
"height": 68,
"seed": 2068784571,
"groupIds": [],
"points": [
[
0,
0
],
[
60,
68
]
]
},
{
"id": "1xaKOH-wh-NF5xS7H73pq",
"type": "arrow",
"x": 418,
"y": 461,
"width": 5,
"height": 71,
"angle": 0,
"strokeColor": "#000000",
"backgroundColor": "transparent",
"fillStyle": "hachure",
"strokeWidth": 1,
"strokeStyle": "solid",
"roughness": 1,
"opacity": 100,
"groupIds": [],
"seed": 966905807,
"version": 33,
"versionNonce": 262197711,
"isDeleted": false,
"points": [
[
0,
0
],
[
5,
71
]
],
"lastCommittedPoint": null
}
],
"appState": {
"viewBackgroundColor": "#ffffff",
"gridSize": null
}
}
|
{
"pile_set_name": "Github"
}
|
{
"id": 5342,
"name": "Undead one",
"incomplete": true,
"members": true,
"release_date": "2003-01-27",
"combat_level": 68,
"size": 1,
"hitpoints": 47,
"max_hit": 7,
"attack_type": [
"slash"
],
"attack_speed": 4,
"aggressive": true,
"poisonous": false,
"immune_poison": false,
"immune_venom": false,
"attributes": [
"undead"
],
"category": [
"skeleton"
],
"slayer_monster": true,
"slayer_level": 1,
"slayer_xp": 50.0,
"slayer_masters": [
"turael",
"spria",
"mazchna"
],
"duplicate": false,
"examine": "A minion of Rashiliyia.",
"icon": null,
"wiki_name": "Undead one (Level 68 (Skeletal))",
"wiki_url": "https://oldschool.runescape.wiki/w/Undead_one#Level_68_(Skeletal)",
"attack_level": 63,
"strength_level": 63,
"defence_level": 63,
"magic_level": 0,
"ranged_level": 0,
"attack_stab": 0,
"attack_slash": 0,
"attack_crush": 0,
"attack_magic": 0,
"attack_ranged": 0,
"defence_stab": 0,
"defence_slash": 0,
"defence_crush": 0,
"defence_magic": 0,
"defence_ranged": 0,
"attack_accuracy": 0,
"melee_strength": 0,
"ranged_strength": 0,
"magic_damage": 0,
"drops": [
{
"id": 526,
"name": "Bones",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 1.0,
"drop_requirements": null
},
{
"id": 6806,
"name": "Skeleton champion scroll",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.0002,
"drop_requirements": null
},
{
"id": 6807,
"name": "Zombie champion scroll",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.0002,
"drop_requirements": null
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"ordering": [
["A1", "B1", "C1"],
["A2", "B2", "C2"],
["A3", "B3"],
["A4", "B4"]
],
"schemaVersion": 2,
"version": 1,
"namespace": "opentrons",
"metadata": {
"displayName": "Opentrons 10 Tube Rack with Falcon 4x50 mL, 6x15 mL Conical",
"displayCategory": "tubeRack",
"displayVolumeUnits": "mL",
"tags": []
},
"dimensions": {
"xDimension": 127.75,
"yDimension": 85.5,
"zDimension": 124.35
},
"parameters": {
"format": "irregular",
"isTiprack": false,
"isMagneticModuleCompatible": false,
"loadName": "opentrons_10_tuberack_falcon_4x50ml_6x15ml_conical"
},
"wells": {
"A1": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 13.88,
"y": 67.75,
"z": 6.85
},
"B1": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 13.88,
"y": 42.75,
"z": 6.85
},
"C1": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 13.88,
"y": 17.75,
"z": 6.85
},
"A2": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 38.88,
"y": 67.75,
"z": 6.85
},
"B2": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 38.88,
"y": 42.75,
"z": 6.85
},
"C2": {
"totalLiquidVolume": 15000,
"diameter": 14.9,
"shape": "circular",
"depth": 117.5,
"x": 38.88,
"y": 17.75,
"z": 6.85
},
"A3": {
"totalLiquidVolume": 50000,
"diameter": 27.81,
"shape": "circular",
"depth": 113,
"x": 71.38,
"y": 60.25,
"z": 7.3
},
"B3": {
"totalLiquidVolume": 50000,
"diameter": 27.81,
"shape": "circular",
"depth": 113,
"x": 71.38,
"y": 25.25,
"z": 7.3
},
"A4": {
"totalLiquidVolume": 50000,
"diameter": 27.81,
"shape": "circular",
"depth": 113,
"x": 106.38,
"y": 60.25,
"z": 7.3
},
"B4": {
"totalLiquidVolume": 50000,
"diameter": 27.81,
"shape": "circular",
"depth": 113,
"x": 106.38,
"y": 25.25,
"z": 7.3
}
},
"brand": {
"brand": "Opentrons",
"brandId": [],
"links": [
"https://shop.opentrons.com/collections/opentrons-tips/products/tube-rack-set-1"
]
},
"groups": [
{
"wells": ["A1", "B1", "C1", "A2", "B2", "C2"],
"metadata": {
"displayName": "Falcon 6x15 mL Conical",
"displayCategory": "tubeRack",
"wellBottomShape": "v"
},
"brand": {
"brand": "Falcon",
"brandId": ["352095", "352096", "352097", "352099", "352196"],
"links": [
"https://ecatalog.corning.com/life-sciences/b2c/US/en/Liquid-Handling/Tubes,-Liquid-Handling/Centrifuge-Tubes/Falcon%C2%AE-Conical-Centrifuge-Tubes/p/falconConicalTubes"
]
}
},
{
"wells": ["A3", "B3", "A4", "B4"],
"metadata": {
"displayName": "Falcon 4x50 mL Conical",
"displayCategory": "tubeRack",
"wellBottomShape": "v"
},
"brand": {
"brand": "Falcon",
"brandId": ["352070", "352098"],
"links": [
"https://ecatalog.corning.com/life-sciences/b2c/US/en/Liquid-Handling/Tubes,-Liquid-Handling/Centrifuge-Tubes/Falcon%C2%AE-Conical-Centrifuge-Tubes/p/falconConicalTubes"
]
}
}
],
"cornerOffsetFromSlot": {
"x": 0,
"y": 0,
"z": 0
}
}
|
{
"pile_set_name": "Github"
}
|
{
"$schema": "http://json-schema.org/draft-07/schema#",
"type": "object",
"title": "The Root Schema",
"description": "The hemtt.json or hemtt.toml file is used to configure your HEMTT Project. All examples are done using JSON, but both files support every feature of HEMTT. hemtt.toml will be used if both files are present.",
"required": [
"name",
"prefix",
"author"
],
"properties": {
"name": {
"$id": "#/properties/name",
"type": "string",
"title": "The Name Schema",
"default": "",
"description": "Long name of your project.",
"examples": [
"Advanced Banana Environment"
],
"pattern": "^(.*)$"
},
"prefix": {
"$id": "#/properties/prefix",
"type": "string",
"title": "The Prefix Schema",
"default": "",
"description": "Prefix used for CBA macros and the release directory name.",
"examples": [
"ABE3"
],
"pattern": "^(.*)$"
},
"author": {
"$id": "#/properties/author",
"type": "string",
"title": "The Author Schema",
"default": "",
"description": "Author of the project.",
"examples": [
"ACE Mod Team"
],
"pattern": "^(.*)$"
},
"version": {
"$id": "#/properties/version",
"type": "string",
"title": "The Version Schema",
"default": "",
"description": "HEMTT will look for ```addons/main/script_version.hpp``` and use it for the version number. If you are not using the CBA project structure or do not have that file you can add a version number in the HEMTT project file.",
"examples": [
"1.0.0.0"
],
"pattern": "^(.*)$"
},
"files": {
"$id": "#/properties/files",
"type": "array",
"title": "The Files Schema",
"default": null,
"description": "HEMTT will copy the files to the release directory after a successful release build. Supports glob patterns.",
"items": {
"$id": "#/properties/files/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"mod.cpp",
"logo.paa",
"*.dll"
],
"pattern": "^(.*)$"
}
},
"include": {
"$id": "#/properties/include",
"type": "array",
"title": "The Include Schema",
"default": null,
"description": "HEMTT will include matching relative or absolute paths when building.",
"items": {
"$id": "#/properties/include/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"./include"
],
"pattern": "^(.*)$"
}
},
"exclude": {
"$id": "#/properties/exclude",
"type": "array",
"title": "The Exclude Schema",
"default": null,
"description": "HEMTT will exclude matching files when building.",
"items": {
"$id": "#/properties/exclude/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"*.psd",
"*.png",
"*.tga"
],
"pattern": "^(.*)$"
}
},
"optionals": {
"$id": "#/properties/optionals",
"type": "array",
"title": "The Optionals Schema",
"default": null,
"description": "HEMTT will build the specified addons from the ./optionals folder.",
"items": {
"$id": "#/properties/optionals/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"tracers",
"particles"
],
"pattern": "^(.*)$"
}
},
"folder_optionals": {
"$id": "#/properties/folder_optionals",
"type": "boolean",
"title": "The Folder_optionals Schema",
"description": "HEMTT will by default build optionals into their own mod folders, which can be directly launched by the user. This can be turned off to build optional PBOs directly into optionals folder.",
"default": false,
"examples": [
false
]
},
"skip": {
"$id": "#/properties/skip",
"type": "array",
"title": "The Skip Schema",
"default": null,
"description": "HEMTT will skip building the specified addons.",
"items": {
"$id": "#/properties/skip/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"hearing",
"zeus"
],
"pattern": "^(.*)$"
}
},
"headerexts": {
"$id": "#/properties/headerexts",
"type": "array",
"title": "The Headerexts Schema",
"default": null,
"description": "HEMTT will apply specified header extensions to each PBO. Supports templating.",
"items": {
"$id": "#/properties/headerexts/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"author=me"
],
"pattern": "^(.*)$"
}
},
"modname": {
"$id": "#/properties/modname",
"type": "string",
"title": "The Modname Schema",
"description": "HEMTT will use the specified mod name (without @) to form @mod folder. Supports templating.",
"default": "",
"examples": [
"my_mod"
],
"pattern": "^(.*)$"
},
"keyname": {
"$id": "#/properties/keyname",
"type": "string",
"title": "The Keyname Schema",
"description": "HEMTT will use the specified key name for .bikey and .biprivatekey names. Supports templating.",
"default": "",
"examples": [
"my_key"
],
"pattern": "^(.*)$"
},
"signame": {
"$id": "#/properties/signame",
"type": "string",
"title": "The Signame Schema",
"description": "HEMTT will use the specified signature name as part of the full signature (.bisign) name. Supports templating.",
"default": "",
"examples": [
"my_custom_name"
],
"pattern": "^(.*)$"
},
"sigversion": {
"$id": "#/properties/sigversion",
"type": "integer",
"title": "The Sigversion Schema",
"description": "HEMTT will use the specified signature version. Currently Supported: V2, V3 (Experiemental).",
"default": 2,
"examples": [
3
]
},
"reuse_private_key": {
"$id": "#/properties/reuse_private_key",
"type": "boolean",
"title": "The Reuse_private_key Schema",
"description": "If set to true, HEMTT will use (and re-use) releases/keys/{keyname}.biprivatekey. It will be generated if it doesn't exist. The default behaviour is to generate a new private key each time and discard it immediately. HEMTT strongly recommends that you only re-use the key if you are making a client-side mod where it will not matter if clients are running different versions of the mod.",
"default": false,
"examples": [
false
]
},
"postbuild": {
"$id": "#/properties/postbuild",
"type": "array",
"title": "The Postbuild Schema",
"default": null,
"items": {
"$id": "#/properties/postbuild/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
""
],
"pattern": "^(.*)$"
}
},
"prebuild": {
"$id": "#/properties/prebuild",
"type": "array",
"title": "The Prebuild Schema",
"default": null,
"items": {
"$id": "#/properties/prebuild/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
""
],
"pattern": "^(.*)$"
}
},
"releasebuild": {
"$id": "#/properties/releasebuild",
"type": "array",
"title": "The Releasebuild Schema",
"default": null,
"items": {
"$id": "#/properties/releasebuild/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
""
],
"pattern": "^(.*)$"
}
},
"scripts": {
"$id": "#/properties/scripts",
"type": "object",
"title": "The Scripts Schema",
"default": null,
"additionalProperties": {
"$id": "#/properties/scripts/properties/",
"type": "object",
"title": "The Schema",
"default": null,
"properties": {
"steps": {
"$id": "#/properties/scripts/properties//properties/steps",
"type": "array",
"title": "The Steps Schema",
"default": null,
"items": {
"$id": "#/properties/scripts/properties//properties/steps/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
"echo {{addon}} took {{time}} ms to build."
],
"pattern": "^(.*)$"
}
},
"steps_linux": {
"$id": "#/properties/scripts/properties//properties/steps_linux",
"type": "array",
"title": "The Steps_linux Schema",
"default": null,
"description": "steps_windows and steps_linux can be used to run different steps on the respective platforms.",
"items": {
"$id": "#/properties/scripts/properties//properties/steps_linux/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
""
],
"pattern": "^(.*)$"
}
},
"steps_windows": {
"$id": "#/properties/scripts/properties//properties/steps_windows",
"type": "array",
"title": "The Steps_windows Schema",
"default": null,
"description": "steps_windows and steps_linux can be used to run different steps on the respective platforms.",
"items": {
"$id": "#/properties/scripts/properties//properties/steps_windows/items",
"type": "string",
"title": "The Items Schema",
"default": "",
"examples": [
""
],
"pattern": "^(.*)$"
}
},
"show_output": {
"$id": "#/properties/scripts/properties//properties/show_output",
"type": "boolean",
"title": "The Show_output Schema",
"description": "All output is hidden by default. Setting show_output will display the command being executed and its output.",
"default": false,
"examples": [
true
]
},
"foreach": {
"$id": "#/properties/scripts/properties//properties/foreach",
"type": "boolean",
"title": "The Foreach Schema",
"default": false,
"description": "Scripts can be ran for each addons. Inside prebuild the script will be ran for each addon that HEMTT will build, including addons that will be skipped if they are already built. Inside postbuild and releasebuild only addons that were successfully built with be used, excluding addons that were skipped for being up to date.",
"examples": [
true
]
},
"parallel": {
"$id": "#/properties/scripts/properties//properties/parallel",
"type": "boolean",
"title": "The Parallel Schema",
"description": "Requires foreach to be true. If a script is thread safe parallel can be used to process multiple addons at a time.",
"default": false,
"examples": [
true
]
}
},
"allOf": [
{
"$ref": "#/definitions/parallel-requires-foreach-to-be-true"
}
]
}
}
},
"definitions": {
"parallel-requires-foreach-to-be-true": {
"anyOf": [
{
"not": {
"$ref": "#/definitions/is-parallel-true"
}
},
{
"properties": {
"foreach": {
"enum": [
true
]
}
},
"required": [
"foreach"
]
}
]
},
"is-parallel-true": {
"properties": {
"parallel": {
"enum": [
true
]
}
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "nautilus",
"version": "1.3.1",
"description": "A Docker Compose Charting Tool",
"scripts": {
"start": "cross-env NODE_ENV=production NOT_PACKAGE=true electron ./dist/main/main.js",
"dev": "cross-env NODE_ENV=development electron-webpack dev",
"compile": "cross-env NODE_ENV=production electron-webpack",
"package-all": "yarn compile && electron-builder -mwl",
"package-mac": "yarn compile && electron-builder --mac",
"package-linux": "yarn compile && electron-builder --linux",
"package-win": "yarn compile && electron-builder --win --x64",
"deploy": "yarn package-all && bash scripts/deploy.sh",
"test": "jest",
"test-f": "bash ./scripts/run-test.sh",
"up-snap": "jest --updateSnapshot"
},
"jest": {
"setupFilesAfterEnv": [
"./src/setupTests.ts"
],
"testEnvironment": "enzyme"
},
"build": {
"appId": "com.nautilus.app",
"productName": "Nautilus",
"files": [
"dist",
"static",
"package.json"
],
"linux": {
"category": "WebDevelopment",
"icon": "build/nautilus_logo.icns",
"desktop": {
"Comment": "Nautilus: A Docker Compose Charting Tool",
"Name": "Nautilus",
"StartupNotify": "true",
"Terminal": "false",
"Type": "Application",
"Categories": "WebDevelopment"
},
"executableName": "nautilus",
"maintainer": "michaelxhdinh@gmail.com",
"target": [
"AppImage"
]
},
"mac": {
"category": "public.app-category.developer-tools",
"icon": "build/nautilus_logo.icns",
"target": [
"dmg"
]
},
"dmg": {
"background": "build/background.tiff",
"contents": [
{
"x": 100,
"y": 400
},
{
"x": 550,
"y": 400,
"type": "link",
"path": "/Applications"
}
]
},
"win": {
"asar": false,
"icon": "build/nautilus_logo.ico",
"target": [
"nsis"
]
},
"nsis": {
"createStartMenuShortcut": true,
"createDesktopShortcut": true,
"runAfterFinish": true
},
"directories": {
"output": "release"
}
},
"repository": {
"type": "git",
"url": "git+https://github.com/oslabs-beta/nautilis.git"
},
"keywords": [
"docker",
"compose",
"visualizer"
],
"author": "team nautilis",
"license": "MIT",
"bugs": {
"url": "https://github.com/oslabs-beta/nautilis/issues"
},
"homepage": "https://github.com/oslabs-beta/nautilis#readme",
"dependencies": {
"d3": "^5.15.0",
"electron-devtools-installer": "^2.2.4",
"eslint": "^6.8.0",
"fix-path": "^3.0.0",
"html-loader": "1.0.0-alpha.0",
"js-yaml": "^3.13.1",
"react": "^16.13.0",
"react-dom": "^16.13.0",
"react-icons": "^3.9.0"
},
"devDependencies": {
"@babel/core": "^7.0.0-0",
"@babel/plugin-proposal-class-properties": "^7.8.3",
"@babel/preset-env": "^7.9.0",
"@babel/preset-react": "^7.9.4",
"@babel/preset-typescript": "^7.9.0",
"@types/d3": "^5.7.2",
"@types/electron-devtools-installer": "^2.2.0",
"@types/enzyme": "^3.10.5",
"@types/enzyme-adapter-react-16": "^1.0.6",
"@types/eslint": "^6.1.8",
"@types/express": "^4.17.3",
"@types/jest": "^25.1.4",
"@types/js-yaml": "^3.12.2",
"@types/node": "^13.9.1",
"@types/react": "^16.9.23",
"@types/react-dom": "^16.9.5",
"@types/react-test-renderer": "^16.9.2",
"@typescript-eslint/eslint-plugin": "^2.24.0",
"@typescript-eslint/parser": "^2.24.0",
"babel": "^6.23.0",
"babel-jest": "^25.2.4",
"concurrently": "^5.1.0",
"cross-env": "^7.0.2",
"css-loader": "^3.4.2",
"electron": "^8.1.1",
"electron-builder": "^22.4.1",
"electron-devtools-installer": "^2.2.4",
"electron-webpack": "^2.7.4",
"enzyme": "^3.11.0",
"enzyme-adapter-react-16": "^1.15.2",
"jest": "^25.2.4",
"jest-environment-enzyme": "^7.1.2",
"jest-enzyme": "^7.1.2",
"mini-css-extract-plugin": "^0.9.0",
"node-sass": "^4.13.1",
"nodemon": "^2.0.2",
"react-hot-loader": "^4.12.20",
"react-test-renderer": "^16.13.1",
"sass-loader": "^8.0.2",
"source-map-loader": "^0.2.4",
"style-loader": "^1.1.3",
"ts-loader": "^6.2.1",
"typescript": "^3.8.3",
"url-loader": "^3.0.0",
"webpack": "^4.42.0",
"webpack-cli": "^3.3.11",
"webpack-dev-server": "^3.10.3"
}
}
|
{
"pile_set_name": "Github"
}
|
$mobileBreakpoint: 768px;
$trackerFeedWidth: 530px;
$trackerFeedPadding: 30px;
$lineColor: rgb(151,216,255);
$borderRadius: 5px;
$name: 'module-city-feed';
##{$name} {
z-index: 3;
pointer-events: none;
@import "sass/_city-view.scss";
.ico {
width: 25px;
height: 25px;
background-size: contain;
background-repeat: no-repeat;
background-position: 50% 50%;
margin-right: 5px;
}
.ico-marker {
background-image: url(../img/marker.svg);
}
.ico-arrow {
background-image: url(../img/arrow.svg);
}
.ico-clock {
background-image: url(../img/city-feed-timer.svg);
width: 22px;
height: 22px;
}
.ico-weatherchanel {
background-image: url(../img/twc.svg);
width: 22px;
height: 22px;
}
.ico-arrow-yellow {
background-image: url(../img/tracker-icons_next-stop.svg);
height: 13px;
width: 16px;
display: inline-block;
}
.ico-location-yellow {
background-image: url(../img/tracker-icons_location.svg);
height: 12px;
width: 9px;
display: inline-block;
}
.ico-clock-yellow {
background-image: url(../img/clock-yellow.svg);
height: 12px;
width: 12px;
display: inline-block;
}
#items.iron-list > * {
background: #00BE7B;
}
#feed-header {
background: linear-gradient(to bottom, rgba(39,193,130,0.8) 40%, rgba(125,185,232,0) 100%);
top: 0;
width: $trackerFeedWidth;
right: 0;
height: 60px;
z-index: 100;
position: absolute;
text-align: right;
opacity: 0;
pointer-events: all;
transition: opacity 100ms ease;
a {
color: #fff;
text-transform: uppercase;
text-decoration: none;
font-size: 13px;
font-weight: 600;
line-height: 60px;
right: 24px;
position: relative;
display: block;
filter: drop-shadow(0 1px 0 rgba(0, 0, 0, 0.33));
iron-icon {
transform: rotate(90deg) scale(.8);
}
}
}
iron-list {
width: $trackerFeedWidth + $trackerFeedPadding;
box-sizing: border-box;
padding-left: $trackerFeedPadding;
height: 100%;
pointer-events: all;
right: 0;
position: absolute;
opacity: 1;
transition: opacity 250ms ease;
&::-webkit-scrollbar {
width: 0 !important;
}
}
&.fade-list {
iron-list {
opacity: 0;
}
}
.card {
width: 100%;
background: #00cc81;
margin-bottom: 14px;
border-radius: 0;
}
.card.card-santa-info {
padding-top: 10px;
margin-bottom: 14px;
height: 209px;
.santa-info-row {
display: flex;
align-items: stretch;
align-content: stretch;
justify-content: space-between;
border-top: 1px solid #2ab786;
& > div {
flex-grow: 1;
padding: 17px 30px;
position: relative;
z-index: 2;
box-sizing: border-box;
width: calc(50% - 1px);
}
.divider {
flex-grow: 0;
width: 1px;
z-index: 1;
padding: 0;
border-left: 1px solid #2ab786;
}
h2, h3, h4 {
margin: 0;
}
h4 {
text-transform: uppercase;
color: white;
font-size: 11px;
margin-bottom: 17px;
}
h2, h3 {
color: #FFFEAB;
}
h2.santa-distance {
color: #fff;
}
.santa-user-location {
white-space: nowrap;
text-overflow: ellipsis;
overflow: hidden;
}
h2 {
font-size: 30px;
}
h3 {
font-size: 16px;
text-overflow: ellipsis;
overflow: hidden;
white-space: nowrap;
}
.santa-info-distance {
.fancy-bg {
position: absolute;
width: 304px;
height: 139px;
background: url(../img/santa-distance-bg.png) center no-repeat;
background-size: contain;
left: -8px;
top: -10px;
}
.fancy-content {
position: relative;
width: 208px; // relative to .fancy-bg
.ico {
position: relative;
top: 2px;
margin-right: 0;
}
}
}
}
}
.card.card-city {
width: 100%;
$cardHeight: 325px;
$cardContentHeight: $cardHeight - 14px;
height: $cardHeight;
$padding: 25px;
$cardPurple: rgb(121,49,164);
background: #00BE7B;
box-sizing: border-box;
margin: 0 auto;
a {
text-decoration: none;
&:hover {
.card-city-bg {
iron-image {
transform: scale(1.1) translateZ(0);
}
}
.card-header {
background-color: rgba(19, 142, 96, 0.55);
box-shadow: 0 12px 33px -1px rgba(0,0,0,0.2);
}
}
}
& > div {
position: relative;
height: 100%;
}
h1, h2, h3, h4 {
margin: 0;
}
h1 {
color: #EFE8DB;
font-size: 42px;
line-height: 42px;
font-weight: 600;
margin-bottom: 18px;
}
h2 {
color: white;
font-size: 22px;
font-weight: 300;
}
h4 {
text-transform: uppercase;
color: white;
font-size: 11px;
margin-bottom: 7px;
}
.card-city-bg {
top: 0;
height: $cardContentHeight;
left: 0;
right: 0;
position: absolute;
z-index: 1;
overflow: hidden;
iron-image {
transform: scale(1) translateZ(0);
transition: transform 500ms cubic-bezier(0,.36,.07,1);
}
}
.card-header {
background-color: rgba(19, 142, 96, 0.75);
padding: $padding;
position: relative;
z-index: 2;
height: $cardContentHeight;
box-shadow: 0px 3px 7px -1px rgba(0,0,0,0.17);
box-sizing: border-box;
.card-city-attribution {
background: rgba(0, 0, 0, .7);
position: absolute;
top: 0;
right: 0;
text-align: right;
color: #fff;
border-radius: 0 0 0 4px;
line-height: 14px;
font-size: 10px;
padding: 2px 8px;
a {
text-decoration: none;
color: #fff;
}
}
}
.stats {
margin-bottom: 10px;
h4 {
color: #E5EBE4;
}
> div > div {
margin-right: 20px;
}
}
.card-icons {
position: absolute;
right: $padding;
bottom: -31px;
width: 270px; // FF
text-align: right; // FF
z-index: 2; // FF
img {
height: 50px;
margin-left: 10px;
transition: transform 200ms ease-in-out;
cursor: pointer;
&.iron-selected {
transform: scale(0.75);
}
}
}
.card-fab {
background: #E26254;
position: absolute;
left: -21px;
bottom: 20px;
&::after {
width: 241px;
height: 212px;
background: url(../img/tracker-card-elf-point.svg);
content: '';
position: absolute;
bottom: -27px;
left: 57px;
}
}
.wikipedia {
.gradientbar {
height: 60px;
width: 100%;
position: absolute;
bottom: 0;
background-image: linear-gradient(transparent, $cardPurple 100%);
pointer-events: none;
border-radius: 0 0 $borderRadius $borderRadius;
}
.wikipedia__body {
overflow: auto;
height: $cardContentHeight - 25px;
padding: 25px 25px 0 25px;
display: block;
color: #fff;
font-weight: 300;
font-size: 14px;
line-height: 1.5;
box-sizing: border-box;
}
.wikipedia__logo {
position: absolute;
bottom: 10px;
right: 15px;
width: 27px;
height: 18px;
background: url("../img/wikipedia_2x.png") no-repeat;
background-size: contain;
}
}
.corner-image {
position: absolute;
right: 0;
top: 0;
background-size: contain;
height: 100px;
width: 100px;
background: url("img/cardavatars/Cards-avatars-04_general.svg") no-repeat;
}
.card-body {
position: relative;
background-color: $cardPurple;
height: $cardContentHeight;
box-sizing: border-box;
overflow: hidden;
.attribution {
background: rgba(0,0,0,0.6);
color: white;
position: absolute;
bottom: 0;
border-radius: 0 $borderRadius 0 $borderRadius;
padding: 1px 0;
.attrib {
border-right: 1px solid rgba(255,255,255,.4);
padding: 4px 10px 4px 5px;
display: inline-block;
}
.addview {
padding: 4px 10px;
display: inline-block;
}
a {
color: #3d97ff;
}
}
a {
color: inherit;
text-decoration: none;
}
}
}
.card {
box-shadow: 0px 3px 7px -1px rgba(0,0,0,0.17);
iron-image {
height: 100%;
width: 100%;
}
}
@import "sass/_cards.scss";
@media (max-width: ($mobileBreakpoint - 1)) {
transform: none;
iron-list {
box-shadow: 0 -2px 2px rgba(0, 0, 0, 0.25);
position: absolute;
bottom: 0;
padding-left: 0;
padding-top: 60vh;
left: 0;
right: 0;
width: 100%;
#feed {
background: #00cd82;
}
}
#feed-header {
top: auto;
bottom: 0;
width: 100%;
background: linear-gradient(to top, rgba(39,193,130,0.8) 40%, rgba(125,185,232,0) 100%);
}
.card.card-santa-info {
height: auto; // mobile can work this out fine
.santa-info-row {
div.santa-info-distance {
position: absolute;
top: -80px;
.fancy-bg {
top: -30px;
width: 280px;
}
.fancy-content {
margin-top: -10px;
}
}
h4 {
margin-bottom: 4px;
}
}
}
.card.card-city {
.card-fab {
left: auto;
right: 24px;
&::after {
display: none;
}
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
[
"a",
"able",
"about",
"across",
"after",
"all",
"almost",
"also",
"am",
"among",
"an",
"and",
"any",
"are",
"as",
"at",
"be",
"because",
"been",
"but",
"by",
"can",
"cannot",
"could",
"dear",
"did",
"do",
"does",
"either",
"else",
"ever",
"every",
"for",
"from",
"get",
"got",
"had",
"has",
"have",
"he",
"her",
"hers",
"him",
"his",
"how",
"however",
"i",
"if",
"in",
"into",
"is",
"it",
"its",
"just",
"least",
"let",
"like",
"likely",
"may",
"me",
"might",
"most",
"must",
"my",
"neither",
"no",
"nor",
"not",
"of",
"off",
"often",
"on",
"only",
"or",
"other",
"our",
"own",
"rather",
"said",
"say",
"says",
"she",
"should",
"since",
"so",
"some",
"than",
"that",
"the",
"their",
"them",
"then",
"there",
"these",
"they",
"this",
"tis",
"to",
"too",
"twas",
"us",
"wants",
"was",
"we",
"were",
"what",
"when",
"where",
"which",
"while",
"who",
"whom",
"why",
"will",
"with",
"would",
"yet",
"you",
"your"
]
|
{
"pile_set_name": "Github"
}
|
[
{
"asistida":"R\u00edchard Cobo",
"clase":"Candidato",
"cod_alianza":"2",
"cod_categoria":"INT",
"cod_lista":"2.2A.2A",
"cod_partido":"2.2A",
"codigo":"2.2A.2A.9",
"id_candidatura":"2.2A.2A.9",
"id_umv":1,
"imagenes":[
"2.2A.2A.9"
],
"nombre":"Richard Cobo",
"orden_absoluto":[
1,
3,
3,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Flor Destefanis",
"clase":"Candidato",
"cod_alianza":"2",
"cod_categoria":"INT",
"cod_lista":"2.2B.2B",
"cod_partido":"2.2B",
"codigo":"2.2B.2B.6",
"id_candidatura":"2.2B.2B.6",
"id_umv":2,
"imagenes":[
"2.2B.2B.6"
],
"nombre":"Flor Destefanis",
"orden_absoluto":[
1,
4,
4,
4,
1
],
"secundarios":[
],
"sexo":"F",
"suplentes":[
]
},
{
"asistida":"Gustavo Jofre",
"clase":"Candidato",
"cod_alianza":"2",
"cod_categoria":"INT",
"cod_lista":"2.2C.2C",
"cod_partido":"2.2C",
"codigo":"2.2C.2C.8",
"id_candidatura":"2.2C.2C.8",
"id_umv":3,
"imagenes":[
"2.2C.2C.8"
],
"nombre":"Gustavo Jofre",
"orden_absoluto":[
1,
5,
5,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Gonza S\u00e1nchez",
"clase":"Candidato",
"cod_alianza":"2",
"cod_categoria":"INT",
"cod_lista":"2.2D.2D",
"cod_partido":"2.2D",
"codigo":"2.2D.2D.7",
"id_candidatura":"2.2D.2D.7",
"id_umv":4,
"imagenes":[
"2.2D.2D.7"
],
"nombre":"Gonza S\u00e1nchez",
"orden_absoluto":[
1,
6,
6,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Norma Trigo",
"clase":"Candidato",
"cod_alianza":"501",
"cod_categoria":"INT",
"cod_lista":"501.501A.501A",
"cod_partido":"501.501A",
"codigo":"501.501A.501A.1",
"id_candidatura":"501.501A.501A.1",
"id_umv":5,
"imagenes":[
"501.501A.501A.1"
],
"nombre":"Norma Trigo",
"orden_absoluto":[
4,
7,
7,
4,
1
],
"secundarios":[
],
"sexo":"F",
"suplentes":[
]
},
{
"asistida":"Daniel Jofre",
"clase":"Candidato",
"cod_alianza":"501",
"cod_categoria":"INT",
"cod_lista":"501.501B.501B",
"cod_partido":"501.501B",
"codigo":"501.501B.501B.2",
"id_candidatura":"501.501B.501B.2",
"id_umv":6,
"imagenes":[
"501.501B.501B.2"
],
"nombre":"Daniel Jofre",
"orden_absoluto":[
4,
8,
8,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Mirtha Reyes",
"clase":"Candidato",
"cod_alianza":"501",
"cod_categoria":"INT",
"cod_lista":"501.501C.501C",
"cod_partido":"501.501C",
"codigo":"501.501C.501C.3",
"id_candidatura":"501.501C.501C.3",
"id_umv":7,
"imagenes":[
"501.501C.501C.3"
],
"nombre":"Mirtha Reyes",
"orden_absoluto":[
4,
9,
9,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"D\u00e9bora Quiroga",
"clase":"Candidato",
"cod_alianza":"501",
"cod_categoria":"INT",
"cod_lista":"501.501D.501D",
"cod_partido":"501.501D",
"codigo":"501.501D.501D.4",
"id_candidatura":"501.501D.501D.4",
"id_umv":8,
"imagenes":[
"501.501D.501D.4"
],
"nombre":"D\u00e9bora Quiroga",
"orden_absoluto":[
4,
10,
10,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Daniel Carrizo",
"clase":"Candidato",
"cod_alianza":"71",
"cod_categoria":"INT",
"cod_lista":"71.71.71",
"cod_partido":"71.71",
"codigo":"71.71.71.11",
"id_candidatura":"71.71.71.11",
"id_umv":9,
"imagenes":[
"71.71.71.11"
],
"nombre":"Daniel Carrizo",
"orden_absoluto":[
3,
2,
2,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Pablo Sebasti\u00e1n Rosales",
"clase":"Candidato",
"cod_alianza":"8",
"cod_categoria":"INT",
"cod_lista":"8.8.8",
"cod_partido":"8.8",
"codigo":"8.8.8.5",
"id_candidatura":"8.8.8.5",
"id_umv":10,
"imagenes":[
"8.8.8.5"
],
"nombre":"Pablo Sebasti\u00e1n Rosales",
"orden_absoluto":[
2,
1,
1,
4,
1
],
"secundarios":[
],
"sexo":"M",
"suplentes":[
]
},
{
"asistida":"Voto en BLANCO",
"clase":"Blanco",
"cod_categoria":"INT",
"cod_lista":"",
"codigo":"BLC",
"id_candidatura":"BLC",
"id_umv":11,
"imagenes":[
"BLC"
],
"nombre":"Voto en BLANCO",
"orden_absoluto":[
994,
4
],
"secundarios":[
],
"sexo":null,
"suplentes":[
]
},
{
"asistida":"Votos IMPUGNADOS",
"clase":"Especial",
"cod_categoria":"INT",
"cod_lista":"",
"codigo":"IMP",
"id_candidatura":"IMP",
"id_umv":12,
"nombre":"Votos IMPUGNADOS",
"orden_absoluto":[
995,
4
],
"secundarios":[
],
"sexo":null,
"suplentes":[
]
},
{
"asistida":"Votos OBSERVADOS",
"clase":"Especial",
"cod_categoria":"INT",
"cod_lista":"",
"codigo":"OBS",
"id_candidatura":"OBS",
"id_umv":13,
"nombre":"Votos OBSERVADOS",
"orden_absoluto":[
996,
4
],
"secundarios":[
],
"sexo":null,
"suplentes":[
]
}
]
|
{
"pile_set_name": "Github"
}
|
[CustomMessages]
pt_br.IDP_FormCaption =Baixando arquivos
pt_br.IDP_FormDescription =Por favor aguarde, enquanto recebe arquivos adicionais...
pt_br.IDP_TotalProgress =Progresso total
pt_br.IDP_CurrentFile =Arquivo atual
pt_br.IDP_File =Arquivo:
pt_br.IDP_Speed =Velocidade:
pt_br.IDP_Status =Estado:
pt_br.IDP_ElapsedTime =Tempo decorrido:
pt_br.IDP_RemainingTime =Tempo remanescente:
pt_br.IDP_DetailsButton =Detalhes
pt_br.IDP_HideButton =Ocultar
pt_br.IDP_RetryButton =Repetir
pt_br.IDP_IgnoreButton =
pt_br.IDP_KBs =KB/s
pt_br.IDP_MBs =MB/s
pt_br.IDP_X_of_X =%.2f de %.2f
pt_br.IDP_KB =KB
pt_br.IDP_MB =MB
pt_br.IDP_GB =GB
pt_br.IDP_Initializing =Inicializando...
pt_br.IDP_GettingFileInformation=Recebendo informações do arquivo...
pt_br.IDP_StartingDownload =Iniciando o download...
pt_br.IDP_Connecting =Conectando...
pt_br.IDP_Downloading =Baixando...
pt_br.IDP_DownloadComplete =Download finalizado
pt_br.IDP_DownloadFailed =Falha no download
pt_br.IDP_CannotConnect =Não pode conectar
pt_br.IDP_CancellingDownload =Cancelando o download...
pt_br.IDP_Unknown =Desconhecido
pt_br.IDP_DownloadCancelled =Download cancelado
pt_br.IDP_RetryNext =Verifique sua conexão e clique em 'Repetir' para tentar novamente o download dos arquivos, ou clique em 'Próximo' para continuar a instalação mesmo assim.
pt_br.IDP_RetryCancel =Verifique sua conexão e clique em 'Repetir' para tentar novamente o download dos arquivos, ou clique em 'Cancel' para finalizar a Instalação.
pt_br.IDP_FilesNotDownloaded =
pt_br.IDP_HTTPError_X =erro HTTP %d
pt_br.IDP_400 =Requisição inválida (400)
pt_br.IDP_401 =Acesso negado (401)
pt_br.IDP_404 =Arquivo não encontrado (404)
pt_br.IDP_407 =Autenticação de proxy necessária (407)
pt_br.IDP_500 =Erro interno do servidor (500)
pt_br.IDP_502 =Bad Gateway (502)
pt_br.IDP_503 =Serviço temporariamente indisponível (503)
|
{
"pile_set_name": "Github"
}
|
[
"a",
"à",
"â",
"abord",
"afin",
"ah",
"ai",
"aie",
"ainsi",
"allaient",
"allo",
"allô",
"allons",
"après",
"assez",
"attendu",
"au",
"aucun",
"aucune",
"aujourd",
"aujourd'hui",
"auquel",
"aura",
"auront",
"aussi",
"autre",
"autres",
"aux",
"auxquelles",
"auxquels",
"avaient",
"avais",
"avait",
"avant",
"avec",
"avoir",
"ayant",
"b",
"bah",
"beaucoup",
"bien",
"bigre",
"boum",
"bravo",
"brrr",
"c",
"ça",
"car",
"ce",
"ceci",
"cela",
"celle",
"celle-ci",
"celle-là",
"celles",
"celles-ci",
"celles-là",
"celui",
"celui-ci",
"celui-là",
"cent",
"cependant",
"certain",
"certaine",
"certaines",
"certains",
"certes",
"ces",
"cet",
"cette",
"ceux",
"ceux-ci",
"ceux-là",
"chacun",
"chaque",
"cher",
"chère",
"chères",
"chers",
"chez",
"chiche",
"chut",
"ci",
"cinq",
"cinquantaine",
"cinquante",
"cinquantième",
"cinquième",
"clac",
"clic",
"combien",
"comme",
"comment",
"compris",
"concernant",
"contre",
"couic",
"crac",
"d",
"da",
"dans",
"de",
"debout",
"dedans",
"dehors",
"delà",
"depuis",
"derrière",
"des",
"dès",
"désormais",
"desquelles",
"desquels",
"dessous",
"dessus",
"deux",
"deuxième",
"deuxièmement",
"devant",
"devers",
"devra",
"différent",
"différente",
"différentes",
"différents",
"dire",
"divers",
"diverse",
"diverses",
"dix",
"dix-huit",
"dixième",
"dix-neuf",
"dix-sept",
"doit",
"doivent",
"donc",
"dont",
"douze",
"douzième",
"dring",
"du",
"duquel",
"durant",
"e",
"effet",
"eh",
"elle",
"elle-même",
"elles",
"elles-mêmes",
"en",
"encore",
"entre",
"envers",
"environ",
"es",
"ès",
"est",
"et",
"etant",
"étaient",
"étais",
"était",
"étant",
"etc",
"été",
"etre",
"être",
"eu",
"euh",
"eux",
"eux-mêmes",
"excepté",
"f",
"façon",
"fais",
"faisaient",
"faisant",
"fait",
"feront",
"fi",
"flac",
"floc",
"font",
"g",
"gens",
"h",
"ha",
"hé",
"hein",
"hélas",
"hem",
"hep",
"hi",
"ho",
"holà",
"hop",
"hormis",
"hors",
"hou",
"houp",
"hue",
"hui",
"huit",
"huitième",
"hum",
"hurrah",
"i",
"il",
"ils",
"importe",
"j",
"je",
"jusqu",
"jusque",
"k",
"l",
"la",
"là",
"laquelle",
"las",
"le",
"lequel",
"les",
"lès",
"lesquelles",
"lesquels",
"leur",
"leurs",
"longtemps",
"lorsque",
"lui",
"lui-même",
"m",
"ma",
"maint",
"mais",
"malgré",
"me",
"même",
"mêmes",
"merci",
"mes",
"mien",
"mienne",
"miennes",
"miens",
"mille",
"mince",
"moi",
"moi-même",
"moins",
"mon",
"moyennant",
"n",
"na",
"ne",
"néanmoins",
"neuf",
"neuvième",
"ni",
"nombreuses",
"nombreux",
"non",
"nos",
"notre",
"nôtre",
"nôtres",
"nous",
"nous-mêmes",
"nul",
"o",
"o|",
"ô",
"oh",
"ohé",
"olé",
"ollé",
"on",
"ont",
"onze",
"onzième",
"ore",
"ou",
"où",
"ouf",
"ouias",
"oust",
"ouste",
"outre",
"p",
"paf",
"pan",
"par",
"parmi",
"partant",
"particulier",
"particulière",
"particulièrement",
"pas",
"passé",
"pendant",
"personne",
"peu",
"peut",
"peuvent",
"peux",
"pff",
"pfft",
"pfut",
"pif",
"plein",
"plouf",
"plus",
"plusieurs",
"plutôt",
"pouah",
"pour",
"pourquoi",
"premier",
"première",
"premièrement",
"près",
"proche",
"psitt",
"puisque",
"q",
"qu",
"quand",
"quant",
"quanta",
"quant-à-soi",
"quarante",
"quatorze",
"quatre",
"quatre-vingt",
"quatrième",
"quatrièmement",
"que",
"quel",
"quelconque",
"quelle",
"quelles",
"quelque",
"quelques",
"quelqu'un",
"quels",
"qui",
"quiconque",
"quinze",
"quoi",
"quoique",
"r",
"revoici",
"revoilà",
"rien",
"s",
"sa",
"sacrebleu",
"sans",
"sapristi",
"sauf",
"se",
"seize",
"selon",
"sept",
"septième",
"sera",
"seront",
"ses",
"si",
"sien",
"sienne",
"siennes",
"siens",
"sinon",
"six",
"sixième",
"soi",
"soi-même",
"soit",
"soixante",
"son",
"sont",
"sous",
"stop",
"suis",
"suivant",
"sur",
"surtout",
"t",
"ta",
"tac",
"tant",
"te",
"té",
"tel",
"telle",
"tellement",
"telles",
"tels",
"tenant",
"tes",
"tic",
"tien",
"tienne",
"tiennes",
"tiens",
"toc",
"toi",
"toi-même",
"ton",
"touchant",
"toujours",
"tous",
"tout",
"toute",
"toutes",
"treize",
"trente",
"très",
"trois",
"troisième",
"troisièmement",
"trop",
"tsoin",
"tsouin",
"tu",
"u",
"un",
"une",
"unes",
"uns",
"v",
"va",
"vais",
"vas",
"vé",
"vers",
"via",
"vif",
"vifs",
"vingt",
"vivat",
"vive",
"vives",
"vlan",
"voici",
"voilà",
"vont",
"vos",
"votre",
"vôtre",
"vôtres",
"vous",
"vous-mêmes",
"vu",
"w",
"x",
"y",
"z",
"zut"
]
|
{
"pile_set_name": "Github"
}
|
{
"check_exit_status": "yes",
"customize": {
"extra_dir": "",
"git_src_dir": "src",
"install_env": {
"BLAS_TYPE": "mkl",
"BUILD_MATLAB": 0,
"BUILD_PYTHON": 0,
"BUILD_PYTHON_LAYER": 0,
"CAFFE_BUILD_PYTHON": "OFF",
"CMAKE_BUILD_SHARED_LIBS": 0,
"CMAKE_CONFIG": "Release",
"CPU_ONLY": 1,
"PACKAGE_BUILD_TYPE": "cmake",
"PACKAGE_CONFIGURE_FLAGS": "",
"PACKAGE_CONFIGURE_FLAGS_LINUX": "",
"PACKAGE_CONFIGURE_FLAGS_WINDOWS": "",
"PACKAGE_COPY": "NO",
"PACKAGE_GIT": "YES",
"PACKAGE_GIT_CHECKOUT_LINUX": "request_artifact",
"PACKAGE_PATCH": "YES",
"PACKAGE_SKIP_BUILD_ERROR": "YES",
"PACKAGE_SKIP_CLEAN_INSTALL": "NO",
"PACKAGE_SKIP_CLEAN_OBJ": "YES",
"PACKAGE_SKIP_CLEAN_SRC_DIR": "YES",
"PACKAGE_SUB_DIR": "src",
"PACKAGE_SUB_DIR1": "src",
"PACKAGE_URL_LINUX": "https://github.com/intel/caffe",
"PYTHON_EXE": "python",
"RUN_INSTALL": 0,
"RUN_LINT": 0,
"RUN_TESTS": 0,
"USE_LEVELDB": "ON",
"USE_LMDB": "ON",
"USE_OPENMP": 1,
"USE_PREBUILT_DEPENDENCIES": "OFF",
"WITH_NINJA": 0
},
"use_git_revision": "yes",
"version": "request"
},
"deps": {
"cmake": {
"force_target_as_host": "yes",
"local": "yes",
"name": "cmake",
"skip_from_bat": "yes",
"sort": 5,
"tags": "tool,cmake"
},
"compiler": {
"local": "yes",
"name": "C++ compiler",
"sort": 10,
"tags": "compiler,lang-cpp"
},
"lib-boost": {
"local": "yes",
"name": "Boost library",
"skip_default": "yes",
"sort": 25,
"tags": "lib,boost",
"version_from": [
1,
64,
0
]
},
"lib-gflags": {
"force_env_init": "yes",
"local": "yes",
"name": "GFlags library",
"skip_installed": {
"android": "yes",
"win": "yes"
},
"sort": 12,
"tags": "lib,gflags",
"update_tags_by_target_platform2": {
"android": "v2.2.0",
"win": "v2.2.0"
}
},
"lib-glog": {
"local": "yes",
"name": "GLog library",
"skip_installed": {
"android": "yes",
"win": "yes"
},
"sort": 14,
"tags": "lib,glog"
},
"lib-hdf5": {
"local": "yes",
"name": "HDF5 library",
"no_tags": "vstatic",
"only_for_target_os_tags": [
"linux",
"windows"
],
"skip_installed": {
"win": "yes"
},
"sort": 19,
"tags": "lib,hdf5"
},
"lib-lmdb": {
"local": "yes",
"name": "LMDB library",
"only_for_target_os_tags": [
"linux",
"windows"
],
"sort": 18,
"tags": "lib,lmdb",
"update_tags_by_target_platform2": {
"win": "v0.9.21"
}
},
"lib-opencv": {
"local": "yes",
"name": "OpenCV library",
"skip_installed": {
"android": "yes",
"win": "yes"
},
"sort": 20,
"tags": "lib,opencv"
},
"lib-protobuf": {
"local": "yes",
"name": "ProtoBuf library",
"only_for_target_os_tags": [
"android"
],
"skip_installed": {
"android": "yes",
"win": "yes"
},
"sort": 110,
"tags": "lib,protobuf,v3.1.0"
},
"lib-protobuf-host": {
"force_target_as_host": "yes",
"local": "yes",
"name": "ProtoBuf host compiler",
"skip_installed": {
"android": "yes",
"win": "yes"
},
"sort": 115,
"tags": "lib,protobuf-host,v3.1.0"
}
},
"end_full_path": {
"android": "install/lib/libcaffe.so",
"linux": "install/bin/caffe",
"win": "install/bin/caffe.exe"
},
"need_cpu_info": "yes",
"only_for_host_os_tags": [
"linux"
],
"only_for_target_os_tags": [
"linux"
],
"package_extra_name": " (intel, request)",
"process_script": "install",
"soft_uoa": "04ab08137582bd03",
"suggested_path": "lib-caffe-intel-request-cpu",
"tags": [
"lib",
"caffe",
"intel",
"vrequest",
"vcpu"
],
"template": "yes",
"template_type": "Caffe AI framework (rebuild for AWS and Intel)",
"use_preprocess_scripts_from_another_entry": {
"data_uoa": "34479ac968f42cfc",
"module_uoa": "84e27ad9dd12e734"
},
"use_scripts_from_another_entry": {
"data_uoa": "cd9ccc74060b3d18",
"module_uoa": "script"
}
}
|
{
"pile_set_name": "Github"
}
|
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\01 类模板语法.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\01 类模板语法.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\02 类模板与函数模板区别.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\02 类模板与函数模板区别.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\03 类模板中成员函数创建时机.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\03 类模板中成员函数创建时机.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\04 类模板对象做函数参数.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\04 类模板对象做函数参数.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\05 类模板与继承.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\05 类模板与继承.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\06 类模板成员函数类外实现.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\06 类模板成员函数类外实现.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\07 类模板分文件编写.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\07 类模板分文件编写.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\08 类模板与友元.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\08 类模板与友元.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\PERSON.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\PERSON.CPP
^F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\09 类模板案例-数组类封装.CPP
/c /ZI /JMC /nologo /W3 /WX- /diagnostics:classic /sdl /Od /Oy- /D _UNICODE /D UNICODE /Gm- /EHsc /RTC1 /MDd /GS /fp:precise /permissive- /Zc:wchar_t /Zc:forScope /Zc:inline /Fo"DEBUG\\" /Fd"DEBUG\VC141.PDB" /Gd /TP /analyze- /FC F:\VS项目\C++提高\第三阶段-录制代码\01 类模板语法\01 类模板语法\09 类模板案例-数组类封装.CPP
|
{
"pile_set_name": "Github"
}
|
{
"$schema": "https://schema.management.azure.com/schemas/2019-04-01/deploymentTemplate.json#",
"contentVersion": "1.0.0.0",
"parameters": {
"vmName": {
"type": "string",
"metadata": {
"description": "Name of the VM"
}
},
"osType": {
"type": "string",
"defaultValue": "Linux",
"allowedValues": [
"Linux"
],
"metadata": {
"description": "Type of OS on the existing vhd"
}
},
"osDiskVhdUri": {
"type": "string",
"metadata": {
"description": "URI of the existing VHD in ARM standard or premium storage"
}
},
"vmSize": {
"type": "string",
"defaultValue": "Standard_A1_v2",
"metadata": {
"description": "Size of the VM"
}
},
"vmDiskSizeGB": {
"type": "string",
"defaultValue": "150",
"allowedValues": [
"150",
"300"
],
"metadata": {
"description": "Diskspace size of the VM"
}
},
"existingVirtualNetworkResourceGroup":{
"type":"string",
"defaultValue":"[resourceGroup().name]",
"metadata":{
"description":"Name of the existing VNET resource group"
}
},
"existingVirtualNetworkName": {
"type": "string",
"metadata": {
"description": "Name of the existing VNET"
}
},
"subnetName": {
"type": "string",
"metadata": {
"description": "Name of the subnet in the virtual network you want to use"
}
},
"existingSecurityGroupName": {
"type": "string",
"metadata": {
"description": "Name of the network Security Group that needs to be assocated to virtual NIC. "
}
},
"dnsNameForPublicIP": {
"type": "string",
"metadata": {
"description": "Unique DNS Name for the Public IP used to access the Virtual Machine."
}
},
"location": {
"type": "string",
"defaultValue": "[resourceGroup().location]",
"metadata": {
"description": "Location for all resources."
}
}
},
"variables": {
"diagStorageAccountName": "[concat(uniquestring(resourceGroup().id), 'specvm')]",
"publicIPAddressType": "Dynamic",
"subnetRef": "[resourceId(parameters('existingVirtualNetworkResourceGroup'), 'Microsoft.Network/virtualNetworks/subnets', parameters('existingVirtualNetworkName'), parameters('subnetName'))]",
"nicName": "[parameters('vmName')]",
"publicIPAddressName": "[parameters('vmName')]"
},
"resources": [
{
"type": "Microsoft.Storage/storageAccounts",
"name": "[variables('diagStorageAccountName')]",
"apiVersion": "2018-02-01",
"location": "[parameters('location')]",
"sku": {
"name": "Standard_GRS"
},
"kind": "Storage",
"properties": {}
},
{
"apiVersion": "2015-06-15",
"type": "Microsoft.Network/publicIPAddresses",
"name": "[variables('publicIPAddressName')]",
"location": "[parameters('location')]",
"tags": {
"displayName": "PublicIPAddress"
},
"properties": {
"publicIPAllocationMethod": "[variables('publicIPAddressType')]",
"dnsSettings": {
"domainNameLabel": "[parameters('dnsNameForPublicIP')]"
}
}
},
{
"apiVersion": "2017-03-01",
"type": "Microsoft.Network/networkInterfaces",
"name": "[variables('nicName')]",
"location": "[parameters('location')]",
"dependsOn": [
"[concat('Microsoft.Network/publicIPAddresses/', variables('publicIPAddressName'))]"
],
"tags": {
"displayName": "NetworkInterface"
},
"properties": {
"networkSecurityGroup": {
"id": "[resourceId('Microsoft.Network/networkSecurityGroups', parameters('existingSecurityGroupName'))]"
},
"ipConfigurations": [
{
"name": "ipconfig1",
"properties": {
"privateIPAllocationMethod": "Dynamic",
"publicIPAddress": {
"id": "[resourceId('Microsoft.Network/publicIPAddresses',variables('publicIPAddressName'))]"
},
"subnet": {
"id": "[variables('subnetRef')]"
}
}
}
]
}
},
{
"type":"Microsoft.Compute/disks",
"apiVersion":"2017-03-30",
"name":"[concat(parameters('vmName'), '_OSdisk')]",
"location":"[parameters('location')]",
"properties":{
"creationData":{
"createOption":"Import",
"sourceUri":"[parameters('osDiskVhdUri')]"
},
"osType":"[parameters('osType')]"
}
},
{
"apiVersion": "2017-03-30",
"type": "Microsoft.Compute/virtualMachines",
"name": "[parameters('vmName')]",
"location": "[parameters('location')]",
"tags": {
"displayName": "VirtualMachine"
},
"dependsOn": [
"[concat('Microsoft.Network/networkInterfaces/', variables('nicName'))]",
"[concat(parameters('vmName'), '_OSdisk')]"
],
"properties": {
"hardwareProfile": {
"vmSize": "[parameters('vmSize')]"
},
"storageProfile": {
"osDisk": {
"osType": "[parameters('osType')]",
"caching": "ReadWrite",
"managedDisk":{
"id":"[resourceId('Microsoft.Compute/disks', concat(parameters('vmName'), '_OSdisk'))]"
},
"createOption": "Attach",
"diskSizeGB": "[parameters('vmDiskSizeGB')]"
}
},
"networkProfile": {
"networkInterfaces": [
{
"id": "[resourceId('Microsoft.Network/networkInterfaces',variables('nicName'))]"
}
]
},
"diagnosticsProfile": {
"bootDiagnostics": {
"enabled": true ,
"storageUri": "[concat(reference(concat('Microsoft.Storage/storageAccounts/', variables('diagStorageAccountName')), '2016-01-01').primaryEndpoints.blob)]"
}
}
}
}
]
}
|
{
"pile_set_name": "Github"
}
|
[
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (1/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":"Target value: \"1\" \\(Variable: RULE:id\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule RULE:id \"@contains test\" \"id:1,phase:3,rev:1.3,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (2/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":"Target value: \"200\" \\(Variable: RULE:rev\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule RULE:rev \"@contains test\" \"id:1,rev:200,phase:3,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (3/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":"Target value: \"2\" \\(Variable: RULE:severity\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule RULE:severity \"@contains test\" \"id:1,phase:3,severity:critical,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (4/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":"Target value: \"data123\" \\(Variable: RULE:logdata\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule RULE:logdata \"@contains test\" \"id:1,logdata:'data123',phase:3,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (5/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":" Target value: \"message123\" \\(Variable: RULE:msg\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule RULE:msg \"@contains test\" \"id:1,msg:'message123',phase:3,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (6/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":" Target value: \"message123\" \\(Variable: RULE:msg\\)"
},
"rules":[
"SecRuleEngine On",
"SecRule rule:msg \"@contains test\" \"id:1,msg:'message123',phase:3,pass,t:trim\""
]
},
{
"enabled":1,
"version_min":300000,
"title":"Testing Variables :: RULE (7/7)",
"client":{
"ip":"200.249.12.31",
"port":123
},
"server":{
"ip":"200.249.12.31",
"port":80
},
"request":{
"headers":{
"Host":"localhost",
"User-Agent":"curl/7.38.0",
"Accept":"*/*",
"Content-Length": "27",
"Content-Type": "application/x-www-form-urlencoded"
},
"uri":"/",
"method":"POST",
"body": [
"param1=value1¶m2=value2"
]
},
"response":{
"headers":{
"Date":"Mon, 13 Jul 2015 20:02:41 GMT",
"Last-Modified":"Sun, 26 Oct 2014 22:33:37 GMT",
"Content-Type":"text/html"
},
"body":[
"no need."
]
},
"expected":{
"debug_log":"Saving variable: IP:block_reason with value: message123"
},
"rules":[
"SecRuleEngine On",
"SecRule rule:msg \"@contains message\" \"id:1,msg:'message123',setvar:'ip.block_reason=%{RULE.msg}%',phase:3,pass,t:trim\""
]
}
]
|
{
"pile_set_name": "Github"
}
|
<?php
$type = 'Core';
$name = 'Times-Bold';
$up = -100;
$ut = 50;
$cw = array(
chr(0)=>250,chr(1)=>250,chr(2)=>250,chr(3)=>250,chr(4)=>250,chr(5)=>250,chr(6)=>250,chr(7)=>250,chr(8)=>250,chr(9)=>250,chr(10)=>250,chr(11)=>250,chr(12)=>250,chr(13)=>250,chr(14)=>250,chr(15)=>250,chr(16)=>250,chr(17)=>250,chr(18)=>250,chr(19)=>250,chr(20)=>250,chr(21)=>250,
chr(22)=>250,chr(23)=>250,chr(24)=>250,chr(25)=>250,chr(26)=>250,chr(27)=>250,chr(28)=>250,chr(29)=>250,chr(30)=>250,chr(31)=>250,' '=>250,'!'=>333,'"'=>555,'#'=>500,'$'=>500,'%'=>1000,'&'=>833,'\''=>278,'('=>333,')'=>333,'*'=>500,'+'=>570,
','=>250,'-'=>333,'.'=>250,'/'=>278,'0'=>500,'1'=>500,'2'=>500,'3'=>500,'4'=>500,'5'=>500,'6'=>500,'7'=>500,'8'=>500,'9'=>500,':'=>333,';'=>333,'<'=>570,'='=>570,'>'=>570,'?'=>500,'@'=>930,'A'=>722,
'B'=>667,'C'=>722,'D'=>722,'E'=>667,'F'=>611,'G'=>778,'H'=>778,'I'=>389,'J'=>500,'K'=>778,'L'=>667,'M'=>944,'N'=>722,'O'=>778,'P'=>611,'Q'=>778,'R'=>722,'S'=>556,'T'=>667,'U'=>722,'V'=>722,'W'=>1000,
'X'=>722,'Y'=>722,'Z'=>667,'['=>333,'\\'=>278,']'=>333,'^'=>581,'_'=>500,'`'=>333,'a'=>500,'b'=>556,'c'=>444,'d'=>556,'e'=>444,'f'=>333,'g'=>500,'h'=>556,'i'=>278,'j'=>333,'k'=>556,'l'=>278,'m'=>833,
'n'=>556,'o'=>500,'p'=>556,'q'=>556,'r'=>444,'s'=>389,'t'=>333,'u'=>556,'v'=>500,'w'=>722,'x'=>500,'y'=>500,'z'=>444,'{'=>394,'|'=>220,'}'=>394,'~'=>520,chr(127)=>350,chr(128)=>500,chr(129)=>350,chr(130)=>333,chr(131)=>500,
chr(132)=>500,chr(133)=>1000,chr(134)=>500,chr(135)=>500,chr(136)=>333,chr(137)=>1000,chr(138)=>556,chr(139)=>333,chr(140)=>1000,chr(141)=>350,chr(142)=>667,chr(143)=>350,chr(144)=>350,chr(145)=>333,chr(146)=>333,chr(147)=>500,chr(148)=>500,chr(149)=>350,chr(150)=>500,chr(151)=>1000,chr(152)=>333,chr(153)=>1000,
chr(154)=>389,chr(155)=>333,chr(156)=>722,chr(157)=>350,chr(158)=>444,chr(159)=>722,chr(160)=>250,chr(161)=>333,chr(162)=>500,chr(163)=>500,chr(164)=>500,chr(165)=>500,chr(166)=>220,chr(167)=>500,chr(168)=>333,chr(169)=>747,chr(170)=>300,chr(171)=>500,chr(172)=>570,chr(173)=>333,chr(174)=>747,chr(175)=>333,
chr(176)=>400,chr(177)=>570,chr(178)=>300,chr(179)=>300,chr(180)=>333,chr(181)=>556,chr(182)=>540,chr(183)=>250,chr(184)=>333,chr(185)=>300,chr(186)=>330,chr(187)=>500,chr(188)=>750,chr(189)=>750,chr(190)=>750,chr(191)=>500,chr(192)=>722,chr(193)=>722,chr(194)=>722,chr(195)=>722,chr(196)=>722,chr(197)=>722,
chr(198)=>1000,chr(199)=>722,chr(200)=>667,chr(201)=>667,chr(202)=>667,chr(203)=>667,chr(204)=>389,chr(205)=>389,chr(206)=>389,chr(207)=>389,chr(208)=>722,chr(209)=>722,chr(210)=>778,chr(211)=>778,chr(212)=>778,chr(213)=>778,chr(214)=>778,chr(215)=>570,chr(216)=>778,chr(217)=>722,chr(218)=>722,chr(219)=>722,
chr(220)=>722,chr(221)=>722,chr(222)=>611,chr(223)=>556,chr(224)=>500,chr(225)=>500,chr(226)=>500,chr(227)=>500,chr(228)=>500,chr(229)=>500,chr(230)=>722,chr(231)=>444,chr(232)=>444,chr(233)=>444,chr(234)=>444,chr(235)=>444,chr(236)=>278,chr(237)=>278,chr(238)=>278,chr(239)=>278,chr(240)=>500,chr(241)=>556,
chr(242)=>500,chr(243)=>500,chr(244)=>500,chr(245)=>500,chr(246)=>500,chr(247)=>570,chr(248)=>500,chr(249)=>556,chr(250)=>556,chr(251)=>556,chr(252)=>556,chr(253)=>500,chr(254)=>556,chr(255)=>500);
?>
|
{
"pile_set_name": "Github"
}
|
{
"pagination": {
"GetBotAliases": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetBotChannelAssociations": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetBotVersions": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetBots": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetBuiltinIntents": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetBuiltinSlotTypes": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetIntentVersions": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetIntents": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetSlotTypeVersions": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
},
"GetSlotTypes": {
"input_token": "nextToken",
"output_token": "nextToken",
"limit_key": "maxResults"
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"viewHeadSetting": {
"html": "<table border='1' cellpadding='0' cellspacing='0' styles='headTable' id='headTable'></table>"
},
"viewSetting": {
"html": "<table border='1' cellpadding='0' cellspacing='0' styles='contentTable' id='contentTable'></table>"
},
"headSetting": {
"html": "<tr styles='viewHeadNode'></tr>"
},
"documentSetting": {
"html": "<tr styles='documentNode'></tr>",
"mouseoverStyles": "documentNode_over"
},
"items": [
{
"name": "title",
"head": {
"html": "<th styles='normalThNode' index='1'><span lable='chanceName'></span><span name='resizeLine' styles='resizeLine'></span></th>",
"width": "300px"
},
"content": {
"html": "<td styles='normalTdNode' index='1'>"+
" <div item='chancename' styles='documentSubject'></div>" +
"</td>",
"width":"300px",
"items": {
"chancename":{"value":"function(d){ return (d.chancename == undefined || d.chancename=='') ? '--': d.chancename}"}
}
}
},
{
"name": "createTime",
"head": {
"html": "<th styles='normalThNode' lable='createTime'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='createTime' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"createTime":{"value":"function(d){ return (d.createTime == undefined || d.createTime=='') ? '--': d.createTime}"}
}
}
},
{
"name": "chanceType",
"head": {
"html": "<th styles='normalThNode' lable='chanceType'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chancetype' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chancetype":{"value":"function(d){ return (d.chancetype == undefined || d.chancetype=='') ? '--': d.chancetype}"}
}
}
},
{
"name": "chanceSource",
"head": {
"html": "<th styles='normalThNode' lable='chanceSource'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='source' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"source": {"value":"function(d){ return (d.source == undefined || d.source=='') ? '--': d.source}"}
}
}
},
{
"name": "chanceLevel",
"head": {
"html": "<th styles='normalThNode' lable='chanceLevel'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='level' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"level": {"value":"function(d){ return (d.level == undefined || d.level=='') ? '--': d.level}"}
}
}
},
{
"name": "chanceStatus",
"head": {
"html": "<th styles='normalThNode' lable='chanceStatus'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chanceStatus' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chanceStatus": {"value":"function(d){ return (d.state == undefined || d.state=='') ? '--': d.state}"}
}
}
},
{
"name": "chanceStatus",
"head": {
"html": "<th styles='normalThNode' lable='chanceStatus'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chanceStatus' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chanceStatus": {"value":"function(d){ return (d.state == undefined || d.state=='') ? '--': d.state}"}
}
}
},
{
"name": "chanceStatus",
"head": {
"html": "<th styles='normalThNode' lable='chanceStatus'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chanceStatus' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chanceStatus": {"value":"function(d){ return (d.state == undefined || d.state=='') ? '--': d.state}"}
}
}
},
{
"name": "chanceStatus",
"head": {
"html": "<th styles='normalThNode' lable='chanceStatus'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chanceStatus' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chanceStatus": {"value":"function(d){ return (d.state == undefined || d.state=='') ? '--': d.state}"}
}
}
},
{
"name": "chanceGrade",
"head": {
"html": "<th styles='normalThNode' lable='chanceGrade'></th>",
"width": "200px"
},
"content": {
"html": "<td styles='normalTdNode'>"+
" <div item='chanceGrade' styles='documentSubject'></div>" +
"</td>",
"width": "200px",
"items": {
"chanceGrade": {"value":"function(d){ return (d.rank == undefined || d.rank=='') ? '--': d.rank}"}
}
}
}
]
}
|
{
"pile_set_name": "Github"
}
|
[](https://clojars.org/com.paren/serene)
# Serene
Generate [clojure.spec](https://clojure.org/about/spec) with [GraphQL](https://graphql.org/) and extend GraphQL with clojure.spec.
* **100% GraphQL schema spec coverage**
* **Works with any GraphQL API**
* **Extend GraphQL with your own specs**
* **Works with Clojure & ClojureScript**
## Clojure/conj 2018 - Robust APIs with clojure.spec & GraphQL
[](https://www.youtube.com/watch?v=mgSSVTDZvkI)
<!-- markdown-toc start - Don't edit this section. Run M-x markdown-toc-refresh-toc -->
**Table of Contents**
- [Serene](#serene)
- [Clojure/conj 2018 - Robust APIs with clojure.spec & GraphQL](#clojureconj-2018---robust-apis-with-clojurespec--graphql)
- [QuickStart](#quickstart)
- [Rationale](#rationale)
- [Usage](#usage)
- [Generated Spec Names](#generated-spec-names)
- [Built-in scalars are defined: :gql/Boolean, :gql/Float , :gql/ID , :gql/Int, :gql/String](#built-in-scalars-are-defined-gqlboolean-gqlfloat--gqlid--gqlint-gqlstring)
- [-](#-)
- [`paren.serene/def-specs`](#parenserenedef-specs)
- [`paren.serene/spit-specs`](#parenserenespit-specs)
- [Getting your GraphQL Schema](#getting-your-graphql-schema)
- [`paren.serene.schema/fetch`](#parensereneschemafetch)
- [`paren.serene.schema/query`](#parensereneschemaquery)
- [Compilation Options](#compilation-options)
- [`:extend`](#extend)
- [`:alias`](#alias)
- [`:prefix`](#prefix)
- [`:gen-object-fields`](#gen-object-fields)
- [Custom Compilation Options](#custom-compilation-options)
- [How It Works](#how-it-works)
- [Status](#status)
- [License](#license)
<!-- markdown-toc end -->
## QuickStart
Serene can generate specs for an entire GraphQL API in one line of code.
Let's say you have a project called "Serenity" and a GraphQL API available at `"http://localhost:3000/graphql"`:
```clojure
(ns serenity.now
(:require
[clojure.spec.alpha :as s]
[paren.serene :as serene]
[paren.serene.schema :as schema]))
;; Define specs
(serene/def-specs (schema/fetch "http://localhost:3000/graphql"))
;; Use specs
(s/valid? ::User {:firstName "Frank" :lastName "Costanza"}) ;=> true
```
## Rationale
It is our experience that GraphQL is superior to REST for most APIs used for web and mobile applications. We also think that clojure.spec provides a good balance of expressiveness and strictness.
GraphQL's type system provides a point of leverage for API providers and consumers.
Because GraphQL schemas are introspectable, [GraphQL tooling](https://github.com/chentsulin/awesome-graphql#tools) tends to be very powerful.
Some languages, like OCaml/Reason, can even [validate queries and response code at compile time](https://github.com/mhallin/graphql_ppx).
If other languages can leverage GraphQL to this extent, Clojure should be able to as well.
Serene aims to address this.
## Usage
### Generated Spec Names
Spec names are keywords that are prefixed and namespaced by their position in the schema.
For the example below, let's assume a prefix of `:gql`, though the prefix is customizable.
```graphql
# Built-in scalars are defined: :gql/Boolean, :gql/Float , :gql/ID , :gql/Int, :gql/String
scalar Email # :gql/Email
enum Mood { # :gql/Mood
SERENE # :gql.Mood/SERENE
ANNOYED # :gql.Mood/ANNOYED
ANGRY # :gql.Mood/ANGRY
}
type User { # :gql/User
id: ID! # :gql.User/id
username: String! # :gql.User/username
email: Email! # :gql.User/email
mood: Mood # :gql.User/mood
}
type Mutation { # :gql/Mutation
createUser(
username: String!, # :gql.Mutation.createUser/username
email: Email! # :gql.Mutation.createUser/email
mood: Mood # :gql.Mutation.createUser/mood
# :gql.Mutation.createUser/&args is an anonymous `s/keys` spec for args map
): User! # :gql.Mutation/createUser
}
```
### Generating Specs
#### `paren.serene/def-specs`
**Note**: All arguments to `def-specs` are `eval`ed.
`def-specs` is a macro that will define specs for a GraphQL schema.
It takes compilation options as an optional second argument.
[Compilation options](#compilation-options) are documented below.
```clojure
(serene/def-specs gql-schema options)
```
#### `paren.serene/spit-specs`
`spit-specs` is like `def-specs`, but outputs `s/def` forms to a file.
The file path and namespace are the first two arguments to `spit-specs`.
```clojure
(serene/spit-specs "src/api/specs.cljc" 'api.specs gql-schema options)
```
### Getting your GraphQL Schema
#### `paren.serene.schema/fetch`
`fetch` takes a GraphQL server endpoint and optional configuration.
```clojure
(schema/fetch "https://api.github.com/graphql" {:headers {"Authorization" (str "bearer " gh-access-token)}})
```
#### `paren.serene.schema/query`
`query` is [this GraphQL introspection query string](https://github.com/paren-com/serene/blob/master/resources/main/paren/serene/IntrospectionQuery.graphql).
`fetch` works by asking the HTTP GraphQL server to execute `query`.
You can use `query` directly if your GraphQL API is not accessible via HTTP.
### Compilation Options
#### `:extend`
`:extend` is a function or map of spec names to spec forms. If a spec form is returned, it will be combined with default specs using `s/and`.
For example, if you have a custom `Keyword` scalar you could use the following to add custom scalar validation:
```clojure
(serene/def-specs gql-schema {:extend {:Keyword `keyword?}})
```
#### `:alias`
`:alias` is a function or map which receives unprefixed spec names and returns aliases for those names.
```clojure
(serene/def-specs gql-schema {:alias {:Query #{:api/query :api.query/root}
:Query/node :api.query/get-node}})
```
This would cause both `:api/query` and `:api.query/root` to be defined as aliases of the `:Query` type spec and would cause `:api.query/get-node` to be defined as an alias of the `:Query/node` field spec.
#### `:prefix`
`:prefix` is a wrapper around `:alias` for the common case of altering default `*ns*` prefixes.
For example, instead of having a long namespace prefix, you might want to prefix your specs with `:gql`:
```clojure
(serene/def-specs gql-schema {:prefix :gql})
```
This will produce specs like `:gql/Query`, `:gql.Query/node`, etc.
#### `:gen-object-fields`
`:gen-object-fields` will cause test.check generators for object types to generate all fields,
even though all object fields are optional.
This is necessary if you are using test.check to generate data for object, interface, or union types
because all object fields are optional (clients can query for any combination of fields).
However, generating data for map specs where all keys are optional can be frustrating because you often end up with empty or nearly empty maps.
It is also not possible to always generate all fields, because objects can be cyclic, so you have to stop after some predetermined level.
`:gen-object-fields` solves this by always generating all fields up to `n` where `n` is a configurable depth that defaults to `s/*recursion-limit*`.
```clojure
;; modify all objects to generate `s/*recursion-limit*` levels deep
(serene/def-specs gql-schema {:gen-object-fields true})
;; modify only `Query` to generate 5 levels deep
(serene/def-specs gql-schema {:gen-object-fields {:Query 5}})
```
#### Custom Compilation Options
All compilation options are implemented and documented in [`paren.serene.compiler.transducers`](https://github.com/paren-com/serene/blob/master/sources/main/paren/serene/compiler/transducers.cljc).
Custom compilation options can be added in the same way that default options are provided.
## How It Works
Serene works in much the same way as [GraphiQL](https://github.com/graphql/graphiql) and other GraphQL tools; it uses GraphQL's introspection capabilities.
GraphQL schemas are introspectable, meaning that you can query a running API to determine all of the capabilities of that API.
Serene uses [this introspection query](https://github.com/paren-com/serene/blob/master/resources/main/paren/serene/IntrospectionQuery.graphql), which is conveniently defined as `paren.serene/introspection-query`, to generate specs that match your API.
## Status
If clojure.spec is alpha, then Serene is extra alpha.
Consider everything to be an implementation detail unless it is explicitly documented here.
Serene uses [Break Versioning](https://github.com/ptaoussanis/encore/blob/master/BREAK-VERSIONING.md).
## License
Copyright © Paren, LLC
Distributed under the [Eclipse Public License version 2.0](http://www.eclipse.org/legal/epl-v20.html).
|
{
"pile_set_name": "Github"
}
|
{
"$schema": "http://schema.management.azure.com/schemas/2015-01-01/deploymentTemplate.json#",
"contentVersion": "1.0.0.0",
"parameters": {
"SubscriptionId": {
"type": "string",
"metadata": {
"description": "Subscrption Id where Org Policy is setup and monitoring dashboard needs to be setup."
}
},
"ResourceGroups": {
"type": "string",
"metadata": {
"description": "ResourceGroup name where Org Policy is present and monitoring dashboard resource need to be setup."
}
},
"AIName": {
"type": "string",
"metadata": {
"description": "Org Policy application insight Resource name."
}
},
"DashboardName":{
"type": "string",
"metadata": {
"description": "Monitoring dashboard resource name"
},
"defaultValue" : "DevOpsKitMonitoring"
},
"DashboardTitle":{
"type": "string",
"metadata": {
"description": "Monitoring dashboard Title"
},
"defaultValue" : "DevOps Kit Monitoring Dashboard"
},
"Location":{
"type": "string",
"metadata": {
"description": "Monitoring dashboard resource location"
},
"defaultValue" : "DevOps Kit Monitoring Dashboard"
}
},
"resources": [
{
"properties": {
"lenses": {
"0": {
"order": 0,
"parts": {
"0": {
"position": {
"x": 0,
"y": 0,
"colSpan": 5,
"rowSpan": 4
},
"metadata": {
"inputs": [],
"type": "Extension[azure]/HubsExtension/PartType/MarkdownPart",
"settings": {
"content": {
"settings": {
"content": "__How to use this dashboard:__\n\nThis dashboard lets you monitor the operations for various DevOps Kit workflows at your org. Each blade lets you monitor the health of some aspect of your DevOps Kit deployment (e.g., CA issues, anomalous control drifts, evaluation errors, etc.). You can click on the 'Open Chart in Analytics' link at the top right corner of any view to see the underlying data/query. (Note that some views will show 'error retrieving data' initially.)\n\n__Useful Links__: \n<br>\n[Updates on Org Policy](https://aka.ms/devopskit/orgpolicy/updates)\n<br>[Release Notes](https://aka.ms/devopskit/releasenotes)\n<br>[Org Policy Docs](https://aka.ms/devopskit/orgpolicy/docs)\n<br>[DevOps Kit Docs](http://aka.ms/devopskit/docs)\n<br>[Support](mailto:azsksup@microsoft.com)\n\n",
"title": "Monitoring your Org AzSK Setup",
"subtitle": "Instructions"
}
}
}
}
},
"1": {
"position": {
"x": 5,
"y": 0,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "customEvents\r\n| where timestamp > ago(15d) and name == \"Control Scanned\" and customDimensions.ScanSource== \"Runbook\"\r\n| summarize count() by bin(timestamp, 1d),tostring(customDimensions.SubscriptionId)\r\n| summarize TotalCount=count() by timestamp\r\n| render barchart\n"
},
{
"name": "Dimensions",
"value": {
"xAxis": {
"name": "timestamp",
"type": "DateTime"
},
"yAxis": [
{
"name": "TotalCount",
"type": "Int64"
}
],
"splitBy": [],
"aggregation": "Sum"
}
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsBarChartPart",
"settings": {
"content": {
"dashboardPartTitle": "CA - Subs Reporting Scans",
"dashboardPartSubTitle": "Number of subscriptions reporting CA scans"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"2": {
"position": {
"x": 11,
"y": 0,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "//Negative Drift\nlet ControlResults = customEvents\n| where timestamp < ago(2d) and timestamp >= ago(4d)\n| where name == \"Control Scanned\" and customDimensions.HasAttestationReadPermissions == \"True\" and customDimensions.HasRequiredAccess == \"True\"\n| summarize arg_max(timestamp, *) by tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName), tostring(customDimensions.ControlId)\n| project tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName),tostring(customDimensions.ResourceId), tostring(customDimensions.ControlId), Oldresult =tostring(customDimensions.VerificationResult)\n| join\n(\n customEvents\n | where timestamp >= ago(2d)\n | where name == \"Control Scanned\" and customDimensions.HasAttestationReadPermissions == \"True\" and customDimensions.HasRequiredAccess == \"True\"\n | summarize arg_max(timestamp, *) by tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName), tostring(customDimensions.ControlId)\n | project tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName),tostring(customDimensions.ResourceId), tostring(customDimensions.ControlId), Latestresult = tostring(customDimensions.VerificationResult)\n)\non customDimensions_SubscriptionId, customDimensions_SubscriptionName,customDimensions_ResourceId, customDimensions_ControlId\n| project tostring(customDimensions_SubscriptionId), tostring(customDimensions_SubscriptionName),tostring(customDimensions_ResourceId), tostring(customDimensions_ControlId),Oldresult,Latestresult;\nlet OldScan = ControlResults\n| where Oldresult == \"Passed\"\n| summarize OldScanCount = count() by tostring(customDimensions_ControlId);\nlet LatestScan = ControlResults\n| where Latestresult == \"Passed\"\n| summarize LatestScanCount = count() by tostring(customDimensions_ControlId);\nOldScan\n| join\n(\n LatestScan\n)\non customDimensions_ControlId\n| project ControlId=tostring(customDimensions_ControlId),OldStatusCount=OldScanCount,LatestStatusCount=LatestScanCount\n| where OldStatusCount != LatestStatusCount and LatestStatusCount < OldStatusCount\n| extend Change =OldStatusCount-LatestStatusCount\n| order by Change desc\n| project ControlId,OldStatusCount,LatestStatusCount,Change\n"
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "PartId",
"value": "038d1915-4387-402f-88e1-0b0f029afc36"
},
{
"name": "PartTitle",
"value": "Analytics"
},
{
"name": "PartSubTitle",
"value": ""
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsGridPart",
"settings": {
"content": {
"dashboardPartTitle": "Negative Drift for Controls",
"dashboardPartSubTitle": "Shows controls drifting from 'passed' to 'not passed' in the 2 Days"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"3": {
"position": {
"x": 17,
"y": 0,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "exceptions\n| where timestamp > ago(7d)\n| summarize Count=count() by tostring(outerMessage),Date=bin(timestamp,1d)\n"
},
{
"name": "Dimensions",
"value": {
"xAxis": {
"name": "Date",
"type": "DateTime"
},
"yAxis": [
{
"name": "Count",
"type": "Int64"
}
],
"splitBy": [
{
"name": "outerMessage",
"type": "String"
}
],
"aggregation": "Sum"
}
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsBarChartPart",
"settings": {
"content": {
"dashboardPartTitle": "Exceptions Summary",
"dashboardPartSubTitle": "Errors during DevOps Kit cmdlet execution"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"4": {
"position": {
"x": 23,
"y": 0,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "customEvents\r\n| where timestamp > ago(2d) and name == \"Control Scanned\" \r\n| summarize arg_max(timestamp, *) \r\n| project OrgAzSKVersion=tostring(customDimensions.OrgVersion),LatestAzSKVersion=tostring(tostring(customDimensions.LatestVersion))\r\n"
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsGridPart",
"settings": {
"content": {
"PartTitle": "Current Org AzSK Version Vs Latest AzSK Version",
"PartSubTitle": "To update org version refer: http://aka.ms/deveopskit/updateOrgAzSKVersion"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"5": {
"position": {
"x": 0,
"y": 4,
"colSpan": 5,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "resourceGroup",
"isOptional": true
},
{
"name": "id",
"value": "[concat(subscription().id,'/resourceGroups/',parameters('ResourceGroups'))]",
"isOptional": true
}
],
"type": "Extension/HubsExtension/PartType/ResourceGroupMapPinnedPart"
}
},
"6": {
"position": {
"x": 5,
"y": 4,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "customEvents\r\n| where timestamp > ago(90d) \r\n| where customDimensions.ScanSource ==\"Runbook\" and name == \"Control Scanned\"\r\n| summarize LastScanDate = max(timestamp) by tostring(customDimensions.SubscriptionId),tostring(customDimensions.SubscriptionName)\r\n| where LastScanDate <= ago(2d)\r\n| order by LastScanDate desc \r\n| project SubId = customDimensions_SubscriptionId,SubName= customDimensions_SubscriptionName,LastScanDate\n"
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsGridPart",
"settings": {
"content": {
"dashboardPartTitle": "CA - No Recent Scans",
"dashboardPartSubTitle": "Subscriptions that have not reported scan events in last the 2 days"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"7": {
"position": {
"x": 11,
"y": 4,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "//Positive Drift\nlet ControlResults = customEvents\n| where timestamp < ago(2d) and timestamp >= ago(4d)\n| where name == \"Control Scanned\" and customDimensions.HasAttestationReadPermissions == \"True\" and customDimensions.HasRequiredAccess == \"True\"\n| summarize arg_max(timestamp, *) by tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName), tostring(customDimensions.ControlId)\n| project tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName),tostring(customDimensions.ResourceId), tostring(customDimensions.ControlId), oldresult =tostring(customDimensions.VerificationResult)\n| join\n(\n customEvents\n | where timestamp >= ago(2d)\n | where name == \"Control Scanned\" and customDimensions.HasAttestationReadPermissions == \"True\" and customDimensions.HasRequiredAccess == \"True\"\n | summarize arg_max(timestamp, *) by tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName), tostring(customDimensions.ControlId)\n | project tostring(customDimensions.SubscriptionId), tostring(customDimensions.SubscriptionName),tostring(customDimensions.ResourceId), tostring(customDimensions.ControlId), Latestresult = tostring(customDimensions.VerificationResult)\n)\non customDimensions_SubscriptionId, customDimensions_SubscriptionName,customDimensions_ResourceId, customDimensions_ControlId\n| project tostring(customDimensions_SubscriptionId), tostring(customDimensions_SubscriptionName),tostring(customDimensions_ResourceId), tostring(customDimensions_ControlId),oldresult,Latestresult;\nlet oldScan = ControlResults\n| where oldresult == \"Passed\"\n| summarize oldScanCount = count() by tostring(customDimensions_ControlId);\nlet LatestScan = ControlResults\n| where Latestresult == \"Passed\"\n| summarize LatestScanCount = count() by tostring(customDimensions_ControlId);\noldScan\n| join\n(\n LatestScan\n)\non customDimensions_ControlId\n| project ControlId=tostring(customDimensions_ControlId),OldStatusCount=oldScanCount,LatestStatusCount=LatestScanCount\n| where OldStatusCount != LatestStatusCount and LatestStatusCount > OldStatusCount\n| extend Change =LatestStatusCount-OldStatusCount\n| order by Change desc\n| project ControlId,OldStatusCount,LatestStatusCount,Change\n"
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsGridPart",
"settings": {
"content": {
"dashboardPartTitle": "Positive Drift for Controls",
"dashboardPartSubTitle": "Shows controls drifting from 'not passed' to 'passed' in the 2 days"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
},
"8": {
"position": {
"x": 17,
"y": 4,
"colSpan": 6,
"rowSpan": 4
},
"metadata": {
"inputs": [
{
"name": "ComponentId",
"value": {
"SubscriptionId": "[parameters('SubscriptionId')]",
"ResourceGroup": "[parameters('ResourceGroups')]",
"Name": "[parameters('AIName')]"
}
},
{
"name": "Query",
"value": "customEvents\r\n| where name == \"CA Job Error\"\r\n| where timestamp > ago(7d)\r\n| extend SubId=tostring(customDimensions.SubscriptionId)\r\n| summarize Count=count() by tostring(customDimensions.ErrorRecord),Date=bin(timestamp,1d)\r\n| order by Date,Count"
},
{
"name": "Dimensions",
"value": {
"xAxis": {
"name": "Date",
"type": "DateTime"
},
"yAxis": [
{
"name": "Count",
"type": "Int64"
}
],
"splitBy": [
{
"name": "customDimensions_ErrorRecord",
"type": "String"
}
],
"aggregation": "Sum"
}
},
{
"name": "Version",
"value": "1.0"
},
{
"name": "DashboardId",
"value": "[resourceId(parameters('ResourceGroups'),'Microsoft.Portal/dashboards', parameters('DashboardName'))]"
},
{
"name": "resourceTypeMode",
"value": "components"
}
],
"type": "Extension/AppInsightsExtension/PartType/AnalyticsBarChartPart",
"settings": {
"content": {
"dashboardPartTitle": "CA Exceptions",
"dashboardPartSubTitle": "Errors during CA runbook execution"
}
},
"asset": {
"idInputName": "ComponentId",
"type": "ApplicationInsights"
}
}
}
}
}
}
},
"name": "[parameters('DashboardName')]",
"type": "Microsoft.Portal/dashboards",
"location": "[parameters('Location')]",
"tags": {
"hidden-title": "[parameters('DashboardTitle')]"
},
"apiVersion": "2015-08-01-preview"
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"_class": "shapePath",
"booleanOperation": -1,
"clippingMaskMode": 0,
"do_objectID": "E73DA06A-A66F-439B-9DA0-C38C1662FBC3",
"edited": true,
"exportOptions": {
"_class": "exportOptions",
"exportFormats": [
],
"includedLayerIds": [
],
"layerOptions": 0,
"shouldTrim": false
},
"frame": {
"_class": "rect",
"constrainProportions": false,
"height": 6.859999999999999,
"width": 75.655,
"x": 0.9770000000000001,
"y": 0.14
},
"hasClippingMask": true,
"isClosed": true,
"isFixedToViewport": false,
"isFlippedHorizontal": false,
"isFlippedVertical": false,
"isLocked": false,
"isVisible": true,
"layerListExpandedType": 1,
"name": "a",
"nameIsFixed": false,
"pointRadiusBehaviour": 1,
"points": [
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{1, 1}",
"curveMode": 1,
"curveTo": "{1, 1}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{1, 1}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0, 1}",
"curveMode": 1,
"curveTo": "{0, 1}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0, 1}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0, 0}",
"curveMode": 1,
"curveTo": "{0, 0}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0, 0}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{1, 0}",
"curveMode": 1,
"curveTo": "{1, 0}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{1, 0}"
}
],
"resizingConstraint": 63,
"resizingType": 0,
"rotation": 0,
"shouldBreakMaskChain": false,
"style": {
"_class": "style",
"endMarkerType": 0,
"miterLimit": 10,
"startMarkerType": 0,
"windingRule": 1
},
"userInfo": {
"com.animaapp.stc-sketch-plugin": {
"kModelPropertiesKey": {
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"id": "MAP_ROUTE110",
"name": "Route110",
"layout": "LAYOUT_ROUTE110",
"music": "MUS_ROUTE110",
"region_map_section": "MAPSEC_ROUTE_110",
"requires_flash": false,
"weather": "WEATHER_SUNNY",
"map_type": "MAP_TYPE_ROUTE",
"show_map_name": true,
"battle_scene": "MAP_BATTLE_SCENE_NORMAL",
"connections": [
{
"direction": "up",
"offset": 0,
"map": "MAP_MAUVILLE_CITY"
},
{
"direction": "down",
"offset": 0,
"map": "MAP_SLATEPORT_CITY"
},
{
"direction": "left",
"offset": 60,
"map": "MAP_ROUTE103"
}
],
"object_events": [
{
"graphics_id": "OBJ_EVENT_GFX_CAMPER",
"x": 17,
"y": 90,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9D4",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 29,
"y": 79,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9CB",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_OLD_WOMAN_1",
"x": 14,
"y": 69,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_WANDER_UP_AND_DOWN",
"movement_range_x": 0,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9C2",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 9,
"y": 57,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WANDER_AROUND",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9B0",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_OLD_MAN_1",
"x": 10,
"y": 11,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_WANDER_AROUND",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9B9",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_F",
"x": 27,
"y": 24,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WANDER_AROUND",
"movement_range_x": 1,
"movement_range_y": 3,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F9A7",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_BOY_3",
"x": 15,
"y": 7,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_WANDER_AROUND",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F99E",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_F",
"x": 16,
"y": 73,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WALK_SEQUENCE_UP_RIGHT_DOWN_LEFT",
"movement_range_x": 2,
"movement_range_y": 14,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FB7D",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 19,
"y": 31,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WALK_SEQUENCE_LEFT_UP_RIGHT_DOWN",
"movement_range_x": 10,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FB28",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_F",
"x": 30,
"y": 31,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_FACE_LEFT",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "4",
"script": "Route110_EventScript_14FB94",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 16,
"y": 55,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WALK_SEQUENCE_UP_LEFT_DOWN_RIGHT",
"movement_range_x": 4,
"movement_range_y": 4,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FB3F",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_PSYCHIC_M",
"x": 5,
"y": 39,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_ROTATE_COUNTERCLOCKWISE",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FA8E",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_LASS",
"x": 33,
"y": 15,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_LEFT",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "1",
"script": "Route110_EventScript_14FAA5",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_MANIAC",
"x": 23,
"y": 40,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN_UP_AND_RIGHT",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FABC",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_FISHERMAN",
"x": 10,
"y": 19,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "1",
"script": "Route110_EventScript_14FAFA",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_BERRY_TREE",
"x": 5,
"y": 11,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_BERRY_TREE_GROWTH",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "16",
"script": "S_BerryTree",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_BERRY_TREE",
"x": 6,
"y": 11,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_BERRY_TREE_GROWTH",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "17",
"script": "S_BerryTree",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_BERRY_TREE",
"x": 7,
"y": 11,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_BERRY_TREE_GROWTH",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "18",
"script": "S_BerryTree",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_ITEM_BALL",
"x": 30,
"y": 69,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_LOOK_AROUND",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_1B14BB",
"flag": "FLAG_ITEM_ROUTE110_2"
},
{
"graphics_id": "OBJ_EVENT_GFX_ITEM_BALL",
"x": 26,
"y": 47,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_LOOK_AROUND",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_1B14AE",
"flag": "FLAG_ITEM_ROUTE110_1"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 27,
"y": 92,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14FA53",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_1",
"x": 7,
"y": 83,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_UP",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F946",
"flag": "FLAG_HIDE_EVIL_TEAM_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_1",
"x": 8,
"y": 83,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_UP",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F95C",
"flag": "FLAG_HIDE_EVIL_TEAM_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_1",
"x": 9,
"y": 83,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_UP",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F972",
"flag": "FLAG_HIDE_EVIL_TEAM_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_1",
"x": 10,
"y": 83,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_UP",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "Route110_EventScript_14F988",
"flag": "FLAG_HIDE_EVIL_TEAM_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_1",
"x": 8,
"y": 82,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "0x0",
"flag": "FLAG_HIDE_EVIL_TEAM_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_CYCLING_TRIATHLETE_M",
"x": 21,
"y": 78,
"elevation": 4,
"movement_type": "MOVEMENT_TYPE_WALK_SEQUENCE_LEFT_UP_RIGHT_DOWN",
"movement_range_x": 7,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "2",
"script": "Route110_EventScript_14FB11",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_0",
"x": 34,
"y": 54,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_LEFT_AND_RIGHT",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "0x0",
"flag": "FLAG_HIDE_RIVAL_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_VAR_3",
"x": 34,
"y": 54,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "0x0",
"flag": "FLAG_HIDE_RIVAL_ON_BIKE_ROUTE110"
},
{
"graphics_id": "OBJ_EVENT_GFX_YOUNGSTER",
"x": 33,
"y": 69,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_LEFT_AND_RIGHT",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "3",
"script": "Route110_EventScript_14FC10",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_WOMAN_2",
"x": 11,
"y": 73,
"elevation": 3,
"movement_type": "MOVEMENT_TYPE_FACE_LEFT",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NORMAL",
"trainer_sight_or_berry_tree_id": "4",
"script": "Route110_EventScript_14FBD2",
"flag": "0"
}
],
"warp_events": [
{
"x": 35,
"y": 24,
"elevation": 3,
"dest_map": "MAP_NEW_MAUVILLE_ENTRANCE",
"dest_warp_id": 0
},
{
"x": 11,
"y": 66,
"elevation": 0,
"dest_map": "MAP_ROUTE110_TRICK_HOUSE_ENTRANCE",
"dest_warp_id": 0
},
{
"x": 15,
"y": 16,
"elevation": 0,
"dest_map": "MAP_ROUTE110_SEASIDE_CYCLING_ROAD_NORTH_ENTRANCE",
"dest_warp_id": 0
},
{
"x": 18,
"y": 16,
"elevation": 0,
"dest_map": "MAP_ROUTE110_SEASIDE_CYCLING_ROAD_NORTH_ENTRANCE",
"dest_warp_id": 2
},
{
"x": 16,
"y": 88,
"elevation": 0,
"dest_map": "MAP_ROUTE110_SEASIDE_CYCLING_ROAD_SOUTH_ENTRANCE",
"dest_warp_id": 0
},
{
"x": 19,
"y": 88,
"elevation": 0,
"dest_map": "MAP_ROUTE110_SEASIDE_CYCLING_ROAD_SOUTH_ENTRANCE",
"dest_warp_id": 2
}
],
"coord_events": [
{
"type": "trigger",
"x": 28,
"y": 92,
"elevation": 3,
"var": "VAR_CYCLING_CHALLENGE_STATE",
"var_value": "2",
"script": "Route110_EventScript_14FC27"
},
{
"type": "trigger",
"x": 29,
"y": 92,
"elevation": 3,
"var": "VAR_CYCLING_CHALLENGE_STATE",
"var_value": "2",
"script": "Route110_EventScript_14FC27"
},
{
"type": "trigger",
"x": 33,
"y": 56,
"elevation": 3,
"var": "VAR_ROUTE110_STATE",
"var_value": "0",
"script": "Route110_EventScript_14FD13"
},
{
"type": "trigger",
"x": 34,
"y": 56,
"elevation": 3,
"var": "VAR_ROUTE110_STATE",
"var_value": "0",
"script": "Route110_EventScript_14FD1E"
},
{
"type": "trigger",
"x": 35,
"y": 56,
"elevation": 3,
"var": "VAR_ROUTE110_STATE",
"var_value": "0",
"script": "Route110_EventScript_14FD29"
}
],
"bg_events": [
{
"type": "sign",
"x": 15,
"y": 25,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14F9EF"
},
{
"type": "sign",
"x": 9,
"y": 51,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA01"
},
{
"type": "sign",
"x": 14,
"y": 88,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14F9E6"
},
{
"type": "sign",
"x": 20,
"y": 94,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14F9DD"
},
{
"type": "sign",
"x": 7,
"y": 75,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14F9F8"
},
{
"type": "sign",
"x": 3,
"y": 17,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA0A"
},
{
"type": "secret_base",
"x": 16,
"y": 25,
"elevation": 0,
"secret_base_id": "SECRET_BASE_TREE3_1"
},
{
"type": "secret_base",
"x": 17,
"y": 25,
"elevation": 0,
"secret_base_id": "SECRET_BASE_TREE4_1"
},
{
"type": "sign",
"x": 35,
"y": 39,
"elevation": 3,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA13"
},
{
"type": "sign",
"x": 37,
"y": 70,
"elevation": 3,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA1C"
},
{
"type": "sign",
"x": 8,
"y": 67,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA25"
},
{
"type": "sign",
"x": 32,
"y": 93,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14FA2E"
},
{
"type": "hidden_item",
"x": 26,
"y": 40,
"elevation": 3,
"item": "ITEM_REVIVE",
"flag": "FLAG_HIDDEN_ITEM_36"
},
{
"type": "hidden_item",
"x": 34,
"y": 42,
"elevation": 3,
"item": "ITEM_GREAT_BALL",
"flag": "FLAG_HIDDEN_ITEM_35"
},
{
"type": "hidden_item",
"x": 4,
"y": 35,
"elevation": 3,
"item": "ITEM_POKE_BALL",
"flag": "FLAG_HIDDEN_ITEM_41"
},
{
"type": "hidden_item",
"x": 37,
"y": 67,
"elevation": 3,
"item": "ITEM_FULL_HEAL",
"flag": "FLAG_HIDDEN_ITEM_37"
},
{
"type": "sign",
"x": 13,
"y": 16,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "Route110_EventScript_14F9E6"
}
]
}
|
{
"pile_set_name": "Github"
}
|
[
{
"_id" : { "$oid" : "54c6a3d41c265eb3a07d58b5"},
"className" : "com.groupon.jenkins.dynamic.build.DynamicBuild",
"state" : "COMPLETED",
"timestamp" : "2015-01-26T20:30:12.217Z",
"axisList" : [
{
"className" : "hudson.matrix.Axis",
"name" : "script",
"values" : [
"unit",
"integration",
"post_build"
]
}
],
"projectId" : { "$oid" : "54c6a3cd1c265eb3a07d58b4"},
"builtOn" : "",
"workspace" : "DotCi/work/jobs/test_user/jobs/test_name/workspace",
"hudsonVersion" : "1.567",
"scm" : {
"className" : "hudson.scm.NullChangeLogParser"
},
"culprits" : [ ],
"number" : 1,
"startTime" : 1422304212849,
"result" : "SUCCESS",
"description" : "<b>master</b>",
"duration" : 10135,
"charset" : "UTF-8",
"keepLog" : false,
"actions" : [
{
"className" : "hudson.model.ParametersAction",
"parameters" : [
{
"className" : "hudson.model.StringParameterValue",
"value" : "master",
"name" : "BRANCH"
}
]
},
{
"className" : "hudson.model.CauseAction",
"causes" : [
{
"className" : "hudson.model.Cause$UserIdCause"
},
{
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
}
]
},
{
"className" : "com.groupon.jenkins.dynamic.build.commithistory.CommitHistoryView"
}
]
},
{
"_id" : { "$oid" : "54c6a3d61c265eb3a07d58b8"},
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubBuild",
"state" : "COMPLETED",
"timestamp" : "2015-01-26T20:30:14.918Z",
"cause" : {
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
},
"projectId" : { "$oid" : "54c6a3d61c265eb3a07d58b6"},
"builtOn" : "",
"workspace" : "DotCi/work/jobs/test_user/jobs/test_name/workspace@2/script=unit",
"hudsonVersion" : "1.567",
"scm" : {
"className" : "hudson.scm.NullChangeLogParser"
},
"culprits" : [ ],
"number" : 1,
"startTime" : 1422304214928,
"result" : "SUCCESS",
"duration" : 2388,
"charset" : "UTF-8",
"keepLog" : false,
"actions" : [
{
"className" : "hudson.model.ParametersAction",
"parameters" : [
{
"className" : "hudson.model.StringParameterValue",
"value" : "master",
"name" : "BRANCH"
}
]
},
{
"className" : "com.groupon.jenkins.dynamic.build.execution.SubBuildExecutionAction"
},
{
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubProject$ParentBuildAction"
},
{
"className" : "hudson.model.CauseAction",
"causes" : [
{
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
}
]
}
]
},
{
"_id" : { "$oid" : "54c6a3d91c265eb3a07d58b9"},
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubBuild",
"state" : "COMPLETED",
"timestamp" : "2015-01-26T20:30:17.352Z",
"cause" : {
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
},
"projectId" : { "$oid" : "54c6a3d61c265eb3a07d58b7"},
"builtOn" : "",
"workspace" : "DotCi/work/jobs/test_user/jobs/test_name/workspace@2/script=integration",
"hudsonVersion" : "1.567",
"scm" : {
"className" : "hudson.scm.NullChangeLogParser"
},
"culprits" : [ ],
"number" : 1,
"startTime" : 1422304217357,
"result" : "SUCCESS",
"duration" : 2023,
"charset" : "UTF-8",
"keepLog" : false,
"actions" : [
{
"className" : "hudson.model.ParametersAction",
"parameters" : [
{
"className" : "hudson.model.StringParameterValue",
"value" : "master",
"name" : "BRANCH"
}
]
},
{
"className" : "com.groupon.jenkins.dynamic.build.execution.SubBuildExecutionAction"
},
{
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubProject$ParentBuildAction"
},
{
"className" : "hudson.model.CauseAction",
"causes" : [
{
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
}
]
}
]
},
{
"_id" : { "$oid" : "54c6a3db1c265eb3a07d58bb"},
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubBuild",
"state" : "COMPLETED",
"timestamp" : "2015-01-26T20:30:19.938Z",
"cause" : {
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
},
"projectId" : { "$oid" : "54c6a3db1c265eb3a07d58ba"},
"builtOn" : "",
"workspace" : "DotCi/work/jobs/test_user/jobs/test_name/workspace@2/script=post_build",
"hudsonVersion" : "1.567",
"scm" : {
"className" : "hudson.scm.NullChangeLogParser"
},
"culprits" : [ ],
"number" : 1,
"startTime" : 1422304219942,
"result" : "SUCCESS",
"duration" : 2078,
"charset" : "UTF-8",
"keepLog" : false,
"actions" : [
{
"className" : "hudson.model.ParametersAction",
"parameters" : [
{
"className" : "hudson.model.StringParameterValue",
"value" : "master",
"name" : "BRANCH"
}
]
},
{
"className" : "com.groupon.jenkins.dynamic.build.execution.SubBuildExecutionAction"
},
{
"className" : "com.groupon.jenkins.dynamic.build.DynamicSubProject$ParentBuildAction"
},
{
"className" : "hudson.model.CauseAction",
"causes" : [
{
"className" : "com.groupon.jenkins.dynamic.build.cause.ManualBuildCause",
"branch" : {
"branch" : "master"
},
"sha" : "f43c56d7ed7b0ba7ea866d68fe63a74d08217a9a"
}
]
}
]
}
]
|
{
"pile_set_name": "Github"
}
|
{
"version" : "6.0.0",
"timestamp" : 1588893901741,
"path" : "query-validation-tests/between.json",
"schemas" : {
"CSAS_OUTPUT_0.KsqlTopic.Source" : {
"schema" : "`ID` STRING KEY, `SOURCE` STRING",
"serdeOptions" : [ ]
},
"CSAS_OUTPUT_0.OUTPUT" : {
"schema" : "`ID` STRING KEY, `THING` STRING",
"serdeOptions" : [ ]
}
},
"testCase" : {
"name" : "test BETWEEN with string values with substring",
"inputs" : [ {
"topic" : "test_topic",
"key" : "0",
"value" : {
"source" : null
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "1",
"value" : {
"source" : "a"
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "2",
"value" : {
"source" : "b"
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "3",
"value" : {
"source" : "ba"
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "4",
"value" : {
"source" : "c"
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "5",
"value" : {
"source" : "ca"
},
"timestamp" : 0
} ],
"outputs" : [ {
"topic" : "OUTPUT",
"key" : "2",
"value" : {
"THING" : "b"
},
"timestamp" : 0
}, {
"topic" : "OUTPUT",
"key" : "3",
"value" : {
"THING" : "ba"
},
"timestamp" : 0
}, {
"topic" : "OUTPUT",
"key" : "4",
"value" : {
"THING" : "c"
},
"timestamp" : 0
} ],
"topics" : [ {
"name" : "OUTPUT",
"replicas" : 1,
"numPartitions" : 4
}, {
"name" : "test_topic",
"replicas" : 1,
"numPartitions" : 4
} ],
"statements" : [ "CREATE STREAM TEST (ID STRING KEY, source string) WITH (kafka_topic='test_topic', value_format='JSON');", "CREATE STREAM OUTPUT AS SELECT ID, source AS THING FROM TEST WHERE source BETWEEN SUBSTRING('zb',2) AND 'c';" ],
"post" : {
"sources" : [ {
"name" : "OUTPUT",
"type" : "STREAM",
"schema" : "`ID` STRING KEY, `THING` STRING",
"keyFormat" : {
"format" : "KAFKA"
},
"serdeOptions" : [ ]
}, {
"name" : "TEST",
"type" : "STREAM",
"schema" : "`ID` STRING KEY, `SOURCE` STRING",
"keyFormat" : {
"format" : "KAFKA"
},
"serdeOptions" : [ ]
} ],
"topics" : {
"topics" : [ {
"name" : "test_topic",
"keyFormat" : {
"formatInfo" : {
"format" : "KAFKA"
}
},
"valueFormat" : {
"format" : "JSON"
},
"partitions" : 4
}, {
"name" : "OUTPUT",
"keyFormat" : {
"formatInfo" : {
"format" : "KAFKA"
}
},
"valueFormat" : {
"format" : "JSON"
},
"partitions" : 4
} ]
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "objc-codegenutils",
"full_name": "objc-codegenutils",
"oldname": null,
"aliases": [
],
"versioned_formulae": [
],
"desc": "Three small tools to help work with XCode",
"license": "Apache-2.0",
"homepage": "https://github.com/square/objc-codegenutils",
"versions": {
"stable": "1.0",
"head": "HEAD",
"bottle": true
},
"urls": {
"stable": {
"url": "https://github.com/square/objc-codegenutils/archive/v1.0.tar.gz",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 0,
"cellar": ":any_skip_relocation",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.catalina.bottle.tar.gz",
"sha256": "24745ae53d47e15598835ee0538c3f121c48b31b21902b1fd3fab0a8c9886543"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.mojave.bottle.tar.gz",
"sha256": "7a10354a20ef417eeb521c983f4714be063b68e6d74bec7ddf6f72b99d3cbfbe"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.high_sierra.bottle.tar.gz",
"sha256": "118c03e858a60fa17c71fbc84fb5a8b9c5f778a0c68531e3df576e1d85d9c91a"
},
"sierra": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.sierra.bottle.tar.gz",
"sha256": "d7b3d3d26970add3af78b0820f3ef8b5e0290f1b2114f5bf06acddcd8d6bdb34"
},
"el_capitan": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.el_capitan.bottle.tar.gz",
"sha256": "d7b945db595b07ee5677902586e01002ba555affdcae366f1fcbe919a6013772"
},
"mavericks": {
"url": "https://linuxbrew.bintray.com/bottles/objc-codegenutils-1.0.mavericks.bottle.tar.gz",
"sha256": "46d389e6ec12462dfbdd97822ce7c6e8156bbe9fac7a3baf04c20cb1991d9f75"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
],
"dependencies": [
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
],
"conflicts_with": [
],
"caveats": null,
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
[
{
"__type__": "cc.SceneAsset",
"_name": "",
"_objFlags": 0,
"scene": {
"__id__": 1
}
},
{
"__type__": "cc.Scene",
"_name": "",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": null,
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_contentSize": {
"__type__": "cc.Size",
"width": 0,
"height": 0
},
"_children": [
{
"__id__": 2
},
{
"__id__": 11
}
],
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "8f24fd7b-5a5a-412a-9eda-801253200f07"
},
{
"__type__": "cc.Node",
"_name": "Canvas",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 1
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 960,
"height": 640
},
"_children": [
{
"__id__": 3
}
],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 480,
"y": 320
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "88b07iG++9GSK3qDtTpsdas",
"_active": true,
"_components": [
{
"__id__": 10
}
],
"_prefab": null
},
{
"__type__": "cc.Node",
"_name": "center",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 2
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 0,
"height": 0
},
"_children": [
{
"__id__": 4
},
{
"__id__": 6
}
],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "cc249bILydDI40VyDCwf/UH",
"_active": true,
"_components": [
{
"__id__": 9
}
],
"_prefab": null
},
{
"__type__": "cc.Node",
"_name": "Title",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 3
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 200.12,
"height": 40
},
"_children": [],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 0,
"y": 248
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "48067fgVzVLP6Q6Ntyx7l0B",
"_active": true,
"_components": [
{
"__id__": 5
}
],
"_prefab": null
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 4
},
"_enabled": true,
"_useOriginalSize": false,
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_isSystemFontUsed": true,
"_N$string": "Disco 2000",
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$overflow": 0
},
{
"__type__": "cc.Node",
"_name": "CircleEffect",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 3
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 800,
"height": 480
},
"_children": [],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 0,
"y": -39
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "c1172F3GHdNb5JDS/IF8jaj",
"_active": true,
"_components": [
{
"__id__": 7
},
{
"__id__": 8
}
],
"_prefab": null
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 6
},
"_enabled": true,
"_spriteFrame": {
"__uuid__": "a23235d1-15db-4b95-8439-a2e005bfff91"
},
"_type": 0,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_atlas": null
},
{
"__type__": "ec0bddz0EhL45aBJr4t9QLx",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 6
},
"_enabled": true,
"glassFactor": 1,
"flagShader": "Effect72.fs.glsl",
"frag_glsl": "Effect10.fs.glsl"
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 3
},
"_enabled": true,
"isAlignOnce": false,
"_alignFlags": 18,
"_left": 0,
"_right": 0,
"_top": 0,
"_bottom": 0,
"_isAbsLeft": true,
"_isAbsRight": true,
"_isAbsTop": true,
"_isAbsBottom": true,
"_originalWidth": 0,
"_originalHeight": 0
},
{
"__type__": "cc.Canvas",
"_name": "",
"_objFlags": 1835008,
"node": {
"__id__": 2
},
"_enabled": true,
"_designResolution": {
"__type__": "cc.Size",
"width": 960,
"height": 640
},
"_fitWidth": false,
"_fitHeight": true
},
{
"__type__": "cc.Node",
"_name": "BtnGroups",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 1
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 0,
"height": 0
},
"_children": [
{
"__id__": 12
},
{
"__id__": 20
}
],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 480,
"y": 320
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "bedabglNy1G4694VND7MKwL",
"_active": true,
"_components": [
{
"__id__": 28
},
{
"__id__": 29
}
],
"_prefab": {
"__id__": 30
}
},
{
"__type__": "cc.Node",
"_name": "ButtonLast",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 11
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 100,
"height": 40
},
"_children": [
{
"__id__": 13
}
],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": -364,
"y": -269
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "f48c9Pu/9NAvaVpaqnpkwZ9",
"_active": true,
"_components": [
{
"__id__": 16
},
{
"__id__": 17
}
],
"_prefab": {
"__id__": 19
}
},
{
"__type__": "cc.Node",
"_name": "Label",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 0,
"g": 0,
"b": 0,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 12
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 100,
"height": 40
},
"_children": [],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 1.1368683772161603e-13,
"y": 0
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "a9d07YHkrhNrqpNO1gQJ/gw",
"_active": true,
"_components": [
{
"__id__": 14
}
],
"_prefab": {
"__id__": 15
}
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 13
},
"_enabled": true,
"_useOriginalSize": false,
"_fontSize": 20,
"_lineHeight": 40,
"_enableWrapText": false,
"_isSystemFontUsed": true,
"_N$string": "上一个",
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$overflow": 1
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 11
},
"asset": {
"__uuid__": "289e5a19-adc5-41d3-b464-6bd29a64f6ae"
},
"fileId": "3d062vcxBtIbbgesrSI+jF3"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 12
},
"_enabled": true,
"_spriteFrame": {
"__uuid__": "f0048c10-f03e-4c97-b9d3-3506e1d58952"
},
"_type": 1,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_atlas": null
},
{
"__type__": "cc.Button",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 12
},
"_enabled": true,
"transition": 2,
"pressedColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"hoverColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"duration": 0.1,
"pressedSprite": {
"__uuid__": "e9ec654c-97a2-4787-9325-e6a10375219a"
},
"hoverSprite": {
"__uuid__": "e9ec654c-97a2-4787-9325-e6a10375219a"
},
"clickEvents": [
{
"__id__": 18
}
],
"_N$interactable": true,
"_N$normalColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_N$disabledColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_N$normalSprite": {
"__uuid__": "f0048c10-f03e-4c97-b9d3-3506e1d58952"
},
"_N$disabledSprite": {
"__uuid__": "29158224-f8dd-4661-a796-1ffab537140e"
},
"_N$target": {
"__id__": 12
}
},
{
"__type__": "cc.ClickEvent",
"target": {
"__id__": 11
},
"component": "EffectManager",
"handler": "onClickLast"
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 11
},
"asset": {
"__uuid__": "289e5a19-adc5-41d3-b464-6bd29a64f6ae"
},
"fileId": "94c0ftqCdtOJKXlb0+30xhl"
},
{
"__type__": "cc.Node",
"_name": "ButtonNext",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 11
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 100,
"height": 40
},
"_children": [
{
"__id__": 21
}
],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 384,
"y": -269
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "605a0eqMc1GuKpGsbKnM85G",
"_active": true,
"_components": [
{
"__id__": 24
},
{
"__id__": 25
}
],
"_prefab": {
"__id__": 27
}
},
{
"__type__": "cc.Node",
"_name": "Label",
"_objFlags": 0,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 0,
"g": 0,
"b": 0,
"a": 255
},
"_cascadeOpacityEnabled": true,
"_parent": {
"__id__": 20
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_contentSize": {
"__type__": "cc.Size",
"width": 100,
"height": 40
},
"_children": [],
"_rotationX": 0,
"_rotationY": 0,
"_scaleX": 1,
"_scaleY": 1,
"_position": {
"__type__": "cc.Vec2",
"x": 1.1368683772161603e-13,
"y": 0
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"_globalZOrder": 0,
"_tag": -1,
"_opacityModifyRGB": false,
"_reorderChildDirty": false,
"_id": "c18b6w6gW1DZrWrbF9HB+jE",
"_active": true,
"_components": [
{
"__id__": 22
}
],
"_prefab": {
"__id__": 23
}
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 21
},
"_enabled": true,
"_useOriginalSize": false,
"_fontSize": 20,
"_lineHeight": 40,
"_enableWrapText": false,
"_isSystemFontUsed": true,
"_N$string": "下一个",
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$overflow": 1
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 11
},
"asset": {
"__uuid__": "289e5a19-adc5-41d3-b464-6bd29a64f6ae"
},
"fileId": "f5902Qirn9M/6eNkIPfz3B8"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 20
},
"_enabled": true,
"_spriteFrame": {
"__uuid__": "f0048c10-f03e-4c97-b9d3-3506e1d58952"
},
"_type": 1,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_atlas": null
},
{
"__type__": "cc.Button",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 20
},
"_enabled": true,
"transition": 2,
"pressedColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"hoverColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"duration": 0.1,
"pressedSprite": {
"__uuid__": "e9ec654c-97a2-4787-9325-e6a10375219a"
},
"hoverSprite": {
"__uuid__": "e9ec654c-97a2-4787-9325-e6a10375219a"
},
"clickEvents": [
{
"__id__": 26
}
],
"_N$interactable": true,
"_N$normalColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_N$disabledColor": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_N$normalSprite": {
"__uuid__": "f0048c10-f03e-4c97-b9d3-3506e1d58952"
},
"_N$disabledSprite": {
"__uuid__": "29158224-f8dd-4661-a796-1ffab537140e"
},
"_N$target": {
"__id__": 20
}
},
{
"__type__": "cc.ClickEvent",
"target": {
"__id__": 11
},
"component": "EffectManager",
"handler": "onClickNext"
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 11
},
"asset": {
"__uuid__": "289e5a19-adc5-41d3-b464-6bd29a64f6ae"
},
"fileId": "f000a4iipBHL7L1JmA630O4"
},
{
"__type__": "10b8cNnro5N0qUG75gHt193",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 11
},
"_enabled": true,
"lastSceneName": "Effect23",
"nextSceneName": "Effect25"
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 11
},
"_enabled": true,
"isAlignOnce": false,
"_alignFlags": 18,
"_left": 0,
"_right": 0,
"_top": 0,
"_bottom": 0,
"_isAbsLeft": true,
"_isAbsRight": true,
"_isAbsTop": true,
"_isAbsBottom": true,
"_originalWidth": 0,
"_originalHeight": 0
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 11
},
"asset": {
"__uuid__": "289e5a19-adc5-41d3-b464-6bd29a64f6ae"
},
"fileId": "83bd0wxsfhOyrAxwCVmeS2q"
}
]
|
{
"pile_set_name": "Github"
}
|
{
"$schema": "https://schema.management.azure.com/schemas/2019-04-01/deploymentTemplate.json#",
"contentVersion": "1.0.0.1",
"parameters": {
"resourceAPIVersion": {
"type": "string"
},
"networkSpec": {
"type": "object"
},
"masterNodeASName": {
"type": "string"
},
"dataNodeASName": {
"type": "string"
},
"location": {
"type": "string",
"defaultValue": "[resourceGroup().location]",
"metadata": {
"description": "Location for all resources."
}
}
},
"variables": {},
"resources": [
{
"type": "Microsoft.Compute/availabilitySets",
"apiVersion":"2017-12-01",
"name": "[parameters('masterNodeASName')]",
"location": "[parameters('location')]",
"sku": {
"name": "Aligned"
},
"properties": {
"platformFaultDomainCount": 2,
"platformUpdateDomainCount": 5
}
},
{
"type": "Microsoft.Compute/availabilitySets",
"apiVersion":"2017-12-01",
"name": "[parameters('dataNodeASName')]",
"location": "[parameters('location')]",
"sku": {
"name": "Aligned"
},
"properties": {
"platformFaultDomainCount": 2,
"platformUpdateDomainCount": 5
}
},
{
"type": "Microsoft.Network/networkSecurityGroups",
"name": "[concat(parameters('networkSpec').virtualNetworkName, '-sg')]",
"location": "[parameters('location')]",
"properties": {
"securityRules": [
{
"name": "SSH",
"properties": {
"description": "Allows SSH traffic",
"protocol": "Tcp",
"sourcePortRange": "*",
"destinationPortRange": "22",
"sourceAddressPrefix": "*",
"destinationAddressPrefix": "*",
"access": "Allow",
"priority": 100,
"direction": "Inbound"
}
}
]
}
},
{
"type": "Microsoft.Network/virtualNetworks",
"name": "[parameters('networkSpec').virtualNetworkName]",
"apiVersion": "2018-08-01",
"dependsOn": [
"[concat('Microsoft.Network/networkSecurityGroups/', parameters('networkSpec').virtualNetworkName, '-sg')]"
],
"location": "[parameters('location')]",
"properties": {
"addressSpace": {
"addressPrefixes": [
"[parameters('networkSpec').addressPrefix]"
]
},
"subnets": [
{
"name": "[parameters('networkSpec').virtualNetworkSubnetName]",
"properties": {
"addressPrefix": "[parameters('networkSpec').subnetPrefix]",
"networkSecurityGroup": {
"id": "[resourceId('Microsoft.Network/networkSecurityGroups', concat(parameters('networkSpec').virtualNetworkName, '-sg'))]"
}
}
}
]
}
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"id": 4174,
"name": "Outlaw",
"incomplete": true,
"members": false,
"release_date": "2007-03-27",
"combat_level": 32,
"size": 1,
"hitpoints": 20,
"max_hit": 3,
"attack_type": [
"crush"
],
"attack_speed": 6,
"aggressive": false,
"poisonous": false,
"immune_poison": false,
"immune_venom": false,
"attributes": [],
"category": [],
"slayer_monster": false,
"slayer_level": null,
"slayer_xp": null,
"slayer_masters": [],
"duplicate": true,
"examine": "A mean looking outlaw. Don't get too close!",
"icon": null,
"wiki_name": "Outlaw",
"wiki_url": "https://oldschool.runescape.wiki/w/Outlaw",
"attack_level": 35,
"strength_level": 25,
"defence_level": 30,
"magic_level": 1,
"ranged_level": 1,
"attack_stab": 0,
"attack_slash": 0,
"attack_crush": 0,
"attack_magic": 0,
"attack_ranged": 0,
"defence_stab": 0,
"defence_slash": 0,
"defence_crush": 0,
"defence_magic": 0,
"defence_ranged": 0,
"attack_accuracy": 0,
"melee_strength": 0,
"ranged_strength": 0,
"magic_damage": 0,
"drops": [
{
"id": 526,
"name": "Bones",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 1.0,
"drop_requirements": null
},
{
"id": 11008,
"name": "Rat's paper",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 1.0,
"drop_requirements": null
},
{
"id": 1139,
"name": "Bronze med helm",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 558,
"name": "Mind rune",
"members": false,
"quantity": "9",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 555,
"name": "Water rune",
"members": false,
"quantity": "6",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 557,
"name": "Earth rune",
"members": false,
"quantity": "5",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 617,
"name": "Coins",
"members": true,
"quantity": "10",
"noted": false,
"rarity": 0.25,
"drop_requirements": null
},
{
"id": 617,
"name": "Coins",
"members": true,
"quantity": "5",
"noted": false,
"rarity": 0.09375,
"drop_requirements": null
},
{
"id": 617,
"name": "Coins",
"members": true,
"quantity": "15",
"noted": false,
"rarity": 0.03125,
"drop_requirements": null
},
{
"id": 617,
"name": "Coins",
"members": true,
"quantity": "25",
"noted": false,
"rarity": 0.0078125,
"drop_requirements": null
},
{
"id": 954,
"name": "Rope",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.359375,
"drop_requirements": null
},
{
"id": 313,
"name": "Fishing bait",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.1171875,
"drop_requirements": null
},
{
"id": 436,
"name": "Copper ore",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 1965,
"name": "Cabbage",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.046875,
"drop_requirements": null
},
{
"id": 946,
"name": "Knife",
"members": false,
"quantity": "1",
"noted": false,
"rarity": 0.0078125,
"drop_requirements": null
},
{
"id": 199,
"name": "Grimy guam leaf",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.0625,
"drop_requirements": null
},
{
"id": 201,
"name": "Grimy marrentill",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.04687792987061691,
"drop_requirements": null
},
{
"id": 203,
"name": "Grimy tarromin",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.035156799324989454,
"drop_requirements": null
},
{
"id": 205,
"name": "Grimy harralander",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.027343322760581865,
"drop_requirements": null
},
{
"id": 207,
"name": "Grimy ranarr weed",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.02147766323024055,
"drop_requirements": null
},
{
"id": 209,
"name": "Grimy irit leaf",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.015625,
"drop_requirements": null
},
{
"id": 211,
"name": "Grimy avantoe",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.011720581340834505,
"drop_requirements": null
},
{
"id": 213,
"name": "Grimy kwuarm",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.009765625,
"drop_requirements": null
},
{
"id": 215,
"name": "Grimy cadantine",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.0078125,
"drop_requirements": null
},
{
"id": 2485,
"name": "Grimy lantadyme",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.005858917272088118,
"drop_requirements": null
},
{
"id": 217,
"name": "Grimy dwarf weed",
"members": true,
"quantity": "1",
"noted": false,
"rarity": 0.005858917272088118,
"drop_requirements": null
}
]
}
|
{
"pile_set_name": "Github"
}
|
#############################################################################
##
## This file is part of GAP, a system for computational discrete algebra.
## This file's authors include Frank Lübeck.
##
## Copyright of GAP belongs to its developers, whose names are too numerous
## to list here. Please refer to the COPYRIGHT file for details.
##
## SPDX-License-Identifier: GPL-2.0-or-later
##
## This file contains function for handling some keys in line edit mode.
## It is only used if the GAP kernel was compiled to use the GNU
## readline library.
##
## To avoid using the readline library, pass '--without-readline' to
## the configure script when compiling GAP.
##
if GAPInfo.CommandLineOptions.E then
############################################################################
## readline interface functions
GAPInfo.UseReadline := true;
## <#GAPDoc Label="readline">
## <Section Label="sec:readline">
## <Heading>Editing using the <C>readline</C> library</Heading>
##
## The descriptions in this section are valid only if your &GAP;
## installation uses the <C>readline</C> library for command line editing.
## You can check by <C>IsBound(GAPInfo.UseReadline);</C> if this is the
## case. <P/>
##
## You can use all the features of
## <C>readline</C>, as for example explained
## in <URL>https://tiswww.case.edu/php/chet/readline/rluserman.html</URL>.
## Therefore the command line editing in &GAP; is similar to the
## <C>bash</C> shell and many other programs. On a Unix/Linux system you
## may also have a manpage, try <C>man readline</C>. <P/>
##
## Compared to the command line editing which was used in &GAP; up to
## version 4.4 (or compared to not using the <C>readline</C> library)
## using <C>readline</C> has several advantages:
## <List>
## <Item>Most keys still do the same as explained in
## <Ref Sect="Line Editing"/> (in the default configuration).
## </Item>
## <Item>There are many additional commands, e.g. undoing (<B>Ctrl-_</B>,
## keyboard macros (<B>Ctrl-x(</B>, <B>Ctrl-x)</B> and <B>Ctrl-xe</B>),
## file name completion (hit <B>Esc</B> two or four times),
## showing matching parentheses,
## <C>vi</C>-style key bindings, deleting and yanking text, ...</Item>
## <Item>Lines which are longer than a physical terminal row can be edited
## more conveniently.</Item>
## <Item>Arbitrary unicode characters can be typed into string literals.
## </Item>
## <Item>The key bindings can be configured, either via your
## <File>~/.inputrc</File> file or by &GAP; commands, see <Ref
## Subsect="ssec:readlineCustom"/>.</Item>
## <Item>The command line history can be saved to and read from a file, see
## <Ref Subsect="ssec:cmdlinehistory"/>.</Item>
## <!-- <Item>demo mode <Ref Subsect="ssec:demoreadline"/>???</Item> -->
## <Item>Adventurous users can even implement completely new
## command line editing functions on &GAP; level, see <Ref
## Subsect="ssec:readlineUserFuncs"/>.</Item>
##
## </List>
## <P/>
##
## <Subsection Label="ssec:readlineCustom">
## <Index Key="ReadlineInitLine"><C>ReadlineInitLine</C></Index>
## <Heading>Readline customization</Heading>
##
## You can use your readline init file (by default <File>~/.inputrc</File>
## on Unix/Linux) to customize key bindings. If you want settings be used
## only within &GAP; you can write them between lines containing <C>$if
## GAP</C> and <C>$endif</C>. For a detailed documentation of the available
## settings and functions see <URL Text="here">
## https://tiswww.case.edu/php/chet/readline/rluserman.html</URL>.
##
## <Listing Type="From readline init file">
## $if GAP
## set blink-matching-paren on
## "\C-x\C-o": dump-functions
## "\ep": kill-region
## $endif
## </Listing>
##
## Alternatively, from within &GAP; the command
## <C>ReadlineInitLine(<A>line</A>);</C> can be used, where <A>line</A> is
## a string containing a line as in the init file.
## <P/>
##
## Caveat: &GAP; overwrites the following keys (after reading the
## <File>~/.inputrc</File> file): <C>\C-g</C>, <C>\C-i</C>, <C>\C-n</C>,
## <C>\C-o</C>, <C>\C-p</C>, <C>\C-r</C>, <C>\C-\</C>, <C>\e<</C>,
## <C>\e></C>, <C>Up</C>, <C>Down</C>, <C>TAB</C>, <C>Space</C>,
## <C>PageUp</C>, <C>PageDown</C>. So, do not redefine these in your
## <File>~/.inputrc</File>.
## <P/>
##
## Note that after pressing <B>Ctrl-v</B> the next special character is
## input verbatim. This is very useful to bind keys or key sequences.
## For example, binding the function key <B>F3</B> to the command
## <C>kill-whole-line</C> by using the sequence <B>Ctrl-v</B> <B>F3</B>
## looks on many terminals like this:
## <C>ReadlineInitLine("\"^[OR\":kill-whole-line");</C>.
## (You can get the line back later with <B>Ctrl-y</B>.)
## <P/>
##
## The <B>Ctrl-g</B> key can be used to type any unicode character by its code
## point. The number of the character can either be given as a count, or if the
## count is one the input characters before the cursor are taken (as decimal
## number or as hex number which starts with <C>0x</C>. For example, the
## double stroke character ℤ can be input by any of the three key
## sequences <B>Esc 8484 Ctrl-g</B>, <B>8484 Ctrl-g</B> or <B>0x2124
## Ctrl-g</B>.
## <P/>
##
## Some terminals bind the <B>Ctrl-s</B> and <B>Ctrl-q</B> keys to stop and
## restart terminal output. Furthermore, sometimes <B>Ctrl-\</B> quits a
## program. To disable this behaviour (and maybe use these keys for command
## line editing) you can use <C>Exec("stty stop undef; stty start undef;
## stty quit undef");</C> in your &GAP; session or your <F>gaprc</F> file
## (see <Ref Sect="sect:gap.ini"/>).
## <P/>
## </Subsection>
##
## <Subsection Label="ssec:cmdlinehistory">
## <Heading>The command line history</Heading>
##
## &GAP; can save your input lines for later reuse. The keys <B>Ctrl-p</B>
## (or <B>Up</B>), <B>Ctrl-n</B> (or <B>Down</B>),
## <B>ESC<</B> and <B>ESC></B> work as documented in <Ref
## Sect="Line Editing"/>, that is they scroll backward and
## forward in the history or go to its beginning or end.
## Also, <B>Ctrl-o</B> works as documented, it is useful for repeating a
## sequence of previous lines.
## (But <B>Ctrl-l</B> clears the screen as in other programs.)
## <P/>
##
## The command line history can be used across several instances of &GAP;
## via the following two commands.
## </Subsection>
##
## <ManSection >
## <Func Arg="[fname], [app]" Name="SaveCommandLineHistory" />
## <Returns><K>fail</K> or number of saved lines</Returns>
## <Func Arg="[fname], [app]" Name="ReadCommandLineHistory" />
## <Returns><K>fail</K> or number of added lines</Returns>
##
## <Description>
## The first command saves the lines in the command line history to the
## file given by the string <A>fname</A>. The default for <A>fname</A> is
## <F>history</F> in the user's &GAP; root path <C>GAPInfo.UserGapRoot</C>
## or <F>"~/.gap_hist"</F> if this directory does not exist.
## If the optional argument <A>app</A> is
## <K>true</K> then the lines are appended to that file otherwise the file
## is overwritten.
## <P/>
## The second command is the converse, it reads the lines from file
## <A>fname</A>. If the optional argument <A>app</A> is true the lines
## are appended to the history, else it <Emph>prepends</Emph> them.
## <P/>
## By default, the command line history stores up to 1000 input lines.
## command line history. This number may be restricted or enlarged via
## via <C>SetUserPreference("HistoryMaxLines", num);</C> which may be set
## to a non negative number <C>num</C> to store up to <C>num</C> input
## lines or to <K>infinity</K> to store arbitrarily many lines.
## An automatic storing and restoring of the command line history can
## be configured via
## <C>SetUserPreference("SaveAndRestoreHistory", true);</C>.
## <P/>
## Note that these functions are only available if your &GAP; is configured
## to use the <C>readline</C> library.
## </Description>
## </ManSection>
##
## <Subsection Label="ssec:readlineUserFuncs">
## <Index Key="InstallReadlineMacro"><C>InstallReadlineMacro</C></Index>
## <Index Key="InvocationReadlineMacro"><C>InvocationReadlineMacro</C></Index>
##
## <Heading>Writing your own command line editing functions</Heading>
## It is possible to write new command line editing functions in &GAP; as
## follows.
## <P/>
## The functions have one argument <A>l</A> which is a list with five
## entries of the form <C>[count, key, line, cursorpos, markpos]</C> where
## <C>count</C> and <C>key</C> are the last pressed key and its count
## (these are not so useful here because users probably do not want to
## overwrite the binding of a single key), then <C>line</C> is a string
## containing the line typed so far, <C>cursorpos</C> is the current
## position of the cursor (point), and <C>markpos</C> the current position
## of the mark.
## <P/>
## The result of such a function must be a list which can have various
## forms:
## <List >
## <Mark><C>[str]</C></Mark>
## <Item>with a string <C>str</C>. In this case the text <C>str</C> is
## inserted at the cursor position.</Item>
## <Mark><C>[kill, begin, end]</C></Mark>
## <Item> where <C>kill</C> is <K>true</K> or <K>false</K> and <C>begin</C>
## and <C>end</C> are positions on the input line. This removes the text
## from the lower position to before the higher position. If <C>kill</C>
## is <K>true</K> the text is killed, i.e. put in the kill ring for later
## yanking.
## </Item>
## <Mark><C>[begin, end, str]</C></Mark>
## <Item>where <C>begin</C> and <C>end</C> are positions on the input line
## and <C>str</C> is a string.
## Then the text from position <C>begin</C> to before <C>end</C> is
## substituted by <C>str</C>.
## </Item>
## <Mark><C>[1, lstr]</C></Mark>
## <Item>
## where <C>lstr</C> is a list of strings. Then these strings are displayed
## like a list of possible completions. The input line is not changed.
## </Item>
## <Mark><C>[2, chars]</C></Mark>
## <Item>where <C>chars</C> is a string. The characters from <C>chars</C>
## are used as the next characters from the input. (At most 512 characters
## are possible.)</Item>
## <Mark><C>[100]</C></Mark>
## <Item>This rings the bell as configured in the terminal.</Item>
## </List>
##
## In the first three cases the result list can contain a position as a
## further entry, this becomes the new cursor position. Or it
## can contain two positions as further entries, these become the new
## cursor position and the new position of the mark.
## <P/>
##
## Such a function can be installed as a macro for <C>readline</C> via
## <C>InstallReadlineMacro(name, fun);</C> where <C>name</C> is a string
## used as name of the macro and <C>fun</C> is a function as above.
## This macro can be called by a key sequence which is returned by
## <C>InvocationReadlineMacro(name);</C>.
## <P/>
## As an example we define a function which puts double quotes around the
## word under or before the cursor position. The space character, the
## characters in <C>"(,)"</C>, and the beginning and end of the line
## are considered as word boundaries. The function is then installed as a
## macro and bound to the key sequence <B>Esc</B> <B>Q</B>.
## <P/>
## <Example>
## gap> EditAddQuotes := function(l)
## > local str, pos, i, j, new;
## > str := l[3];
## > pos := l[4];
## > i := pos;
## > while i > 1 and (not str[i-1] in ",( ") do
## > i := i-1;
## > od;
## > j := pos;
## > while IsBound(str[j]) and not str[j] in ",) " do
## > j := j+1;
## > od;
## > new := "\"";
## > Append(new, str{[i..j-1]});
## > Append(new, "\"");
## > return [i, j, new];
## > end;;
## gap> InstallReadlineMacro("addquotes", EditAddQuotes);
## gap> invl := InvocationReadlineMacro("addquotes");;
## gap> ReadlineInitLine(Concatenation("\"\\eQ\":\"",invl,"\""));;
## </Example>
## </Subsection>
##
## </Section>
## <#/GAPDoc>
##
if not IsBound(GAPInfo.CommandLineEditFunctions) then
GAPInfo.CommandLineEditFunctions := rec(
# This is the GAP function called by the readline handler function
# handled-by-GAP (GAP_rl_func in src/sysfiles.c).
KeyHandler := function(l)
local macro, res, key;
# remember this key
key := l[2];
res:=[];
if l[2] >= 1000 then
macro := QuoInt(l[2], 1000);
if IsBound(GAPInfo.CommandLineEditFunctions.Macros.(macro)) then
res := GAPInfo.CommandLineEditFunctions.Macros.(macro)(l);
fi;
else
if IsBound(GAPInfo.CommandLineEditFunctions.Functions.(l[2])) then
res := GAPInfo.CommandLineEditFunctions.Functions.(l[2])(l);
fi;
fi;
GAPInfo.CommandLineEditFunctions.LastKey := key;
return res;
end,
Macros := rec(),
Functions := rec(),
# here we save readline init lines for post restore
RLInitLines := [],
RLKeysGAPHandler := []
);
if IsHPCGAP then
GAPInfo.CommandLineEditFunctions :=
AtomicRecord(GAPInfo.CommandLineEditFunctions);
fi;
fi;
# wrapper around kernel functions to store data for post restore function
BindGlobal("ReadlineInitLine", function(str)
READLINEINITLINE(ShallowCopy(str));
Add(GAPInfo.CommandLineEditFunctions.RLInitLines, str);
end);
BindGlobal("BindKeysToGAPHandler", function(str)
BINDKEYSTOGAPHANDLER(ShallowCopy(str));
Add(GAPInfo.CommandLineEditFunctions.RLKeysGAPHandler, str);
end);
CallAndInstallPostRestore( function()
local clef, l, a;
clef := GAPInfo.CommandLineEditFunctions;
l := clef.RLKeysGAPHandler;
clef.RLKeysGAPHandler := [];
for a in l do
BindKeysToGAPHandler(a);
od;
l := clef.RLInitLines;
clef.RLInitLines := [];
for a in l do
ReadlineInitLine(a);
od;
end);
# bind macro to a key sequence
BindGlobal("BindKeySequence", function(seq, subs)
ReadlineInitLine(Concatenation("\"", seq, "\": \"", subs, "\""));
end);
# general utility functions
# ringing bell according to terminal configuration (rl_ding)
GAPInfo.CommandLineEditFunctions.Functions.RingBell := function(arg)
return [100];
end;
# sends <Return> and so calls accept-line
GAPInfo.CommandLineEditFunctions.Functions.AcceptLine := function(arg)
return [101];
end;
# cands is list of strings, this displays them as matches for completion
# (rl_display_match_list)
GAPInfo.CommandLineEditFunctions.Functions.DisplayMatches := function(cand)
return [1, cand];
end;
# this inserts a sequence of keys given as string into the input stream
# (rl_stuff_char, up to 512 characters are accepted)
GAPInfo.CommandLineEditFunctions.Functions.StuffChars := function(str)
return [2, str];
end;
GAPInfo.CommandLineEditFunctions.Functions.UnicodeChar := function(l)
local helper, j, i, hc, hex, c, pos, k;
# same as GAPDoc's UNICODE_RECODE.UTF8UnicodeChar
helper := function ( n )
local res, a, b, c, d;
res := "";
if n < 0 then
return fail;
elif n < 128 then
Add( res, CHAR_INT( n ) );
elif n < 2048 then
a := n mod 64;
b := (n - a) / 64;
Add( res, CHAR_INT( b + 192 ) );
Add( res, CHAR_INT( a + 128 ) );
elif n < 65536 then
a := n mod 64;
n := (n - a) / 64;
b := n mod 64;
c := (n - b) / 64;
Add( res, CHAR_INT( c + 224 ) );
Add( res, CHAR_INT( b + 128 ) );
Add( res, CHAR_INT( a + 128 ) );
elif n < 2097152 then
a := n mod 64;
n := (n - a) / 64;
b := n mod 64;
n := (n - b) / 64;
c := n mod 64;
d := (n - c) / 64;
Add( res, CHAR_INT( d + 240 ) );
Add( res, CHAR_INT( c + 128 ) );
Add( res, CHAR_INT( b + 128 ) );
Add( res, CHAR_INT( a + 128 ) );
else
return fail;
fi;
return res;
end;
# if count=1 we consider the previous characters
if l[1] = 1 then
j := l[4]-1;
i := j;
hc := "0123456789abcdefABCDEF";
while i > 0 and l[3][i] in hc do
i := i-1;
od;
if i>1 and l[3][i] = 'x' and l[3][i-1] = '0' then
hex := true;
i := i-1;
else
hex := false;
i := i+1;
fi;
c := 0;
if hex then
for k in [i+2..j] do
pos := Position(hc, l[3][k]);
if pos > 16 then
pos := pos-6;
fi;
c := c*16+(pos-1);
od;
else
for k in [i..j] do
pos := Position(hc, l[3][k]);
c := c*10 + (pos-1);
od;
fi;
return [i, j+1, helper(c)];
else
return [helper(l[1])];
fi;
end;
GAPInfo.CommandLineEditFunctions.Functions.7 :=
GAPInfo.CommandLineEditFunctions.Functions.UnicodeChar;
BindKeysToGAPHandler("\007");
# The history is stored within the GAPInfo record. Several GAP level
# command line edit functions below deal with the history. The maximal
# number of lines in the history is configurable via a user preference.
# TODO: should it be made thread-local in HPC-GAP?
if not IsBound(GAPInfo.History) then
GAPInfo.History := rec(Lines := [], Pos := 0, Last := 0);
fi;
DeclareUserPreference( rec(
name:= ["HistoryMaxLines", "SaveAndRestoreHistory"],
description:= [
"HistoryMaxLines is the maximal amount of input lines held in GAPs \
command line history.",
"If SaveAndRestoreHistory is true then GAP saves its command line history \
before terminating a GAP session, and prepends the stored history when GAP is \
started. If this is enabled it is suggested to set HistoryMaxLines to some \
finite value. It is also possible to set HistoryMaxLines to infinity to keep \
arbitrarily many lines.",
"These preferences are ignored if GAP was not compiled with \
readline support.",
],
default:= [1000, false],
check:= function(max, save)
return ((IsInt( max ) and 0 <= max) or max = infinity)
and save in [true, false];
end
)
);
DeclareUserPreference( rec(
name := "Autocompleter",
description := [
"Set how names are filtered during tab-autocomplete, \
this can be: \"default\": case-sensitive matching. \"case-insensitive\": \
case-insensitive matching, or a record with two components named 'filter' and \
'completer', which are both functions which take two arguments. \
'filter' takes a list of names and a partial identifier and returns \
all the members of 'names' which are a valid extension of the partial \
identifier. 'completer' takes a list of names and a partial identifier and \
returns the partial identifier as extended as possible (it may also change \
the identifier, for example to correct the case, or spelling mistakes), or \
returns 'fail' to leave the existing partial identifier."],
default := "default",
) );
## We use key 0 (not bound) to add line to history.
GAPInfo.CommandLineEditFunctions.Functions.AddHistory := function(l)
local i, max, hist;
max := UserPreference("HistoryMaxLines");
# no history
if max <= 0 then
return [];
fi;
# no trailing white space
i := 0;
while Length(l[3]) > 0 and l[3][Length(l[3])] in "\n\r\t " do
Remove(l[3]);
i := i + 1;
od;
if Length(l[3]) = 0 then
return [false, 1, i+1, 1];
fi;
hist := GAPInfo.History.Lines;
while Length(hist) >= max do
# overrun, throw oldest line away
Remove(hist, 1);
GAPInfo.History.Last := GAPInfo.History.Last - 1;
od;
Add(hist, l[3]);
GAPInfo.History.Pos := Length(hist) + 1;
if i = 0 then
return [];
else
return [false, Length(l[3])+1, Length(l[3]) + i + 1];
fi;
end;
GAPInfo.CommandLineEditFunctions.Functions.0 :=
GAPInfo.CommandLineEditFunctions.Functions.AddHistory;
## C-p: previous line starting like current before point
GAPInfo.CommandLineEditFunctions.Functions.BackwardHistory := function(l)
local hist, n, start;
if UserPreference("HistoryMaxLines") <= 0 then
return [];
fi;
hist := GAPInfo.History.Lines;
n := GAPInfo.History.Pos;
# searching backward in history for line starting with input before cursor
if l[4] = Length(l[3]) + 1 then
start := l[3];
else
start := l[3]{[1..l[4]-1]};
fi;
while n > 1 do
n := n - 1;
if PositionSublist(hist[n], start) = 1 then
GAPInfo.History.Pos := n;
GAPInfo.History.Last := n;
return [1, Length(l[3])+1, hist[n], l[4]];
fi;
od;
# not found, delete rest of line and wrap over
GAPInfo.History.Pos := Length(hist)+1;
if Length(start) = Length(l[3]) then
return [];
else
return [false, l[4], Length(l[3])+1];
fi;
end;
# bind to C-p and map Up-key
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('P') mod 32) :=
GAPInfo.CommandLineEditFunctions.Functions.BackwardHistory;
BindKeysToGAPHandler("\020");
ReadlineInitLine("\"\\eOA\": \"\\C-p\"");
ReadlineInitLine("\"\\e[A\": \"\\C-p\"");
## C-n: next line starting like current before point
GAPInfo.CommandLineEditFunctions.Functions.ForwardHistory := function(l)
local hist, n, start;
if UserPreference("HistoryMaxLines") <= 0 then
return [];
fi;
hist := GAPInfo.History.Lines;
n := GAPInfo.History.Pos;
if n > Length(hist) then
# special case on empty line, we don't wrap to the beginning, but
# the position of the last history use
if Length(l[3]) = 0 and GAPInfo.History.Last < Length(hist) then
GAPInfo.History.Pos := GAPInfo.History.Last;
n := GAPInfo.History.Pos;
else
n := 0;
fi;
fi;
# searching forward in history for line starting with input before cursor
if l[4] = Length(l[3]) + 1 then
start := l[3];
else
start := l[3]{[1..l[4]-1]};
fi;
while n < Length(hist) do
n := n + 1;
if PositionSublist(hist[n], start) = 1 then
GAPInfo.History.Pos := n;
GAPInfo.History.Last := n;
return [1, Length(l[3])+1, hist[n], l[4]];
fi;
od;
# not found, delete rest of line and wrap over
GAPInfo.History.Pos := Length(hist)+1;
if Length(start) = Length(l[3]) then
return [];
else
return [false, l[4], Length(l[3])+1];
fi;
end;
# bind to C-n and map Down-key
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('N') mod 32) :=
GAPInfo.CommandLineEditFunctions.Functions.ForwardHistory;
BindKeysToGAPHandler("\016");
ReadlineInitLine("\"\\eOB\": \"\\C-n\"");
ReadlineInitLine("\"\\e[B\": \"\\C-n\"");
## ESC <: beginning of history
GAPInfo.CommandLineEditFunctions.Functions.BeginHistory := function(l)
if UserPreference("HistoryMaxLines") <= 0 or
Length(GAPInfo.History.Lines) = 0 then
return [];
fi;
GAPInfo.History.Pos := 1;
GAPInfo.History.Last := 1;
return [1, Length(l[3]), GAPInfo.History.Lines[1], 1];
end;
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('<')) :=
GAPInfo.CommandLineEditFunctions.Functions.BeginHistory;
BindKeysToGAPHandler("\\e<");
## ESC >: end of history
GAPInfo.CommandLineEditFunctions.Functions.EndHistory := function(l)
if UserPreference("HistoryMaxLines") <= 0 or
Length(GAPInfo.History.Lines) = 0 then
return [];
fi;
GAPInfo.History.Pos := Length(GAPInfo.History.Lines);
GAPInfo.History.Last := GAPInfo.History.Pos;
return [1, Length(l[3]), GAPInfo.History.Lines[GAPInfo.History.Pos], 1];
end;
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('>')) :=
GAPInfo.CommandLineEditFunctions.Functions.EndHistory;
BindKeysToGAPHandler("\\e>");
## C-o: line after last choice from history (for executing consecutive
## lines from the history
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('O') mod 32) := function(l)
local n, cf;
cf := GAPInfo.CommandLineEditFunctions;
if IsBound(cf.ctrlo) then
n := GAPInfo.History.Last + 1;
if UserPreference("HistoryMaxLines") <= 0 or
Length(GAPInfo.History.Lines) < n then
return [];
fi;
GAPInfo.History.Last := n;
Unbind(cf.ctrlo);
return [1, Length(l[3]), GAPInfo.History.Lines[n], 1];
else
cf.ctrlo := true;
return GAPInfo.CommandLineEditFunctions.Functions.StuffChars("\015\017");
fi;
end;
BindKeysToGAPHandler("\017");
## C-r: previous line containing text between mark and point (including
## the smaller, excluding the larger)
GAPInfo.CommandLineEditFunctions.Functions.HistorySubstring := function(l)
local hist, n, txt, pos;
if UserPreference("HistoryMaxLines") <= 0 then
return [];
fi;
hist := GAPInfo.History.Lines;
n := GAPInfo.History.Pos;
# text to search
if l[4] < l[5] then
if l[5] > Length(l[3])+1 then
l[5] := Length(l[3])+1;
fi;
txt := l[3]{[l[4]..l[5]-1]};
else
if l[5] < 1 then
l[5] := 1;
fi;
txt := l[3]{[l[5]..l[4]-1]};
fi;
while n > 1 do
n := n - 1;
pos := PositionSublist(hist[n], txt);
if pos <> fail then
GAPInfo.History.Pos := n;
return [1, Length(l[3])+1, hist[n], pos + Length(txt), pos];
fi;
od;
# not found, do nothing and wrap over
GAPInfo.History.Pos := Length(hist)+1;
return [];
end;
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('R') mod 32) :=
GAPInfo.CommandLineEditFunctions.Functions.HistorySubstring;
BindKeysToGAPHandler("\022");
############################################################################
##
#F SaveCommandLineHistory( [<fname>], [append] )
#F ReadCommandLineHistory( [<fname>] )
##
## Use the first command to write the currently saved command lines in the
## history to file <fname>. If not given the default file name 'history'
## in GAPInfo.UserGapRoot or '~/.gap_hist' is used.
## The second command prepends the lines from <fname> to the current
## command line history (as much as possible when the user preference
## HistoryMaxLines is less than infinity).
##
BindGlobal("SaveCommandLineHistory", function(arg)
local fnam, append, hist, out;
if Length(arg) > 0 then
fnam := arg[1];
else
if IsExistingFile(GAPInfo.UserGapRoot) then
fnam := Concatenation(GAPInfo.UserGapRoot, "/history");
else
fnam := UserHomeExpand("~/.gap_hist");
fi;
fi;
if true in arg then
append := true;
else
append := false;
fi;
hist := GAPInfo.History.Lines;
out := OutputTextFile(fnam, append);
if out = fail then
return fail;
fi;
SetPrintFormattingStatus(out, false);
WriteAll(out,JoinStringsWithSeparator(hist,"\n"));
WriteAll(out,"\n");
CloseStream(out);
return Length(hist);
end);
BindGlobal("ReadCommandLineHistory", function(arg)
local hist, max, fnam, s, append;
hist := GAPInfo.History.Lines;
max := UserPreference("HistoryMaxLines");
if Length(arg) > 0 and IsString(arg[1]) then
fnam := arg[1];
else
if IsExistingFile(GAPInfo.UserGapRoot) then
fnam := Concatenation(GAPInfo.UserGapRoot, "/history");
else
fnam := UserHomeExpand("~/.gap_hist");
fi;
fi;
if true in arg then
append := true;
else
append := false;
fi;
s := StringFile(fnam);
if s = fail then
return fail;
fi;
s := SplitString(s, "", "\n");
if append then
if Length(s) > max then
s := s{[1..max]};
fi;
Append(hist, s);
if Length(hist) > max then
hist := hist{[Length(hist) - max..Length(hist)]};
fi;
else
if Length(hist) >= max then
return 0;
fi;
if Length(s) + Length(hist) > max then
s := s{[Length(s)-max+Length(hist)+1..Length(s)]};
fi;
hist := Concatenation(s, hist);
fi;
GAPInfo.History.Lines := hist;
GAPInfo.History.Last := 0;
GAPInfo.History.Pos := Length(hist) + 1;
return Length(s);
end);
### Free: C-g, C-^
## This deletes the content of current buffer line, when appending a space
## would result in a sequence of space- and tab-characters followed by the
## current prompt. Otherwise a space is inserted at point.
GAPInfo.DeletePrompts := true;
GAPInfo.CommandLineEditFunctions.Functions.SpaceDeletePrompt := function(l)
local txt, len, pr, i;
if GAPInfo.DeletePrompts <> true or l[4] = 1 or l[3][l[4]-1] <> '>' then
return [" "];
fi;
txt := l[3];
len := Length(txt);
pr := CPROMPT();
Remove(pr);
i := 1;
while txt[i] in "\t " do
i := i+1;
od;
if len - i+1 = Length(pr) and txt{[i..len]} = pr then
return [false, 1, i+Length(pr), 1];
fi;
return [" "];
end;
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR(' ')) :=
GAPInfo.CommandLineEditFunctions.Functions.SpaceDeletePrompt;
BindKeysToGAPHandler(" ");
# These methods implement 'extender' for standard case sensitive and
# case insensitive matching.
# These methods take a list of candidates (cand), and the current
# partially written identifier from the command line. They return a
# replacement for 'identifier'. This extends 'identifier'
# to include all characters which occur in all members of cand.
# In the case-insensitive case this matching is done case-insensitively,
# and we also change the existing letters of the identifier to match
# identifers.
# When there is no extension or change, these methods return 'fail'.
BindGlobal("STANDARD_EXTENDERS", rec(
caseSensitive := function(cand, word)
local i, j, c, match;
i := Length(word);
while true do
if i = Length(cand[1]) then
break;
fi;
c := cand[1][i+1];
match := true;
for j in [2..Length(cand)] do
if Length(cand[j]) <= i or cand[j][i+1] <> c then
match := false;
break;
fi;
od;
if not match then
break;
else
i := i+1;
fi;
od;
if i > Length(word) then
return cand[1]{[1..i]};
else
return fail;
fi;
end,
caseInsensitive := function(cand, word)
local i, j, c, lowword, filtequal, match;
# Check if exactly 'word' exists, ignoring case.
lowword := LowercaseString(word);
# If there are several equal words, just pick the first one...
filtequal := First(cand, a -> LowercaseString(a) = lowword);
if filtequal <> fail then
return filtequal;
fi;
i := Length(word);
while true do
if i = Length(cand[1]) then
break;
fi;
c := LowercaseChar(cand[1][i+1]);
match := true;
for j in [2..Length(cand)] do
if Length(cand[j]) <= i or LowercaseChar(cand[j][i+1]) <> c then
match := false;
break;
fi;
od;
if not match then
break;
else
i := i+1;
fi;
od;
if i >= Length(word) then
return cand[1]{[1..i]};
else
return fail;
fi;
end,
));
# C-i: Completion as GAP level function
GAPInfo.CommandLineEditFunctions.Functions.Completion := function(l)
local cf, pos, word, wordplace, idbnd, i, cmps, r, searchlist, cand, c, j,
completeFilter, completeExtender, extension;
completeFilter := function(filterlist, partial)
local pref, lowpartial;
pref := UserPreference("Autocompleter");
if pref = "case-insensitive" then
lowpartial := LowercaseString(partial);
return Filtered(filterlist,
a -> PositionSublist(LowercaseString(a), lowpartial) = 1);
elif pref = "default" then
return Filtered(filterlist, a-> PositionSublist(a, partial) = 1);
elif IsRecord(pref) and IsFunction(pref.completer) then
return pref.completer(filterlist, partial);
else
ErrorNoReturn("Invalid setting of UserPreference 'Autocompleter'");
fi;
end;
completeExtender := function(filterlist, partial)
local pref;
pref := UserPreference("Autocompleter");
if pref = "case-insensitive" then
return STANDARD_EXTENDERS.caseInsensitive(filterlist, partial);
elif pref = "default" then
return STANDARD_EXTENDERS.caseSensitive(filterlist, partial);
elif IsRecord(pref) and IsFunction(pref.extender) then
return pref.extender(filterlist, partial);
else
ErrorNoReturn("Invalid setting of UserPreference 'Autocompleter'");
fi;
end;
# check if Ctrl-i was hit repeatedly in a row
cf := GAPInfo.CommandLineEditFunctions;
if Length(l)=6 and l[6] = true and cf.LastKey = 9 then
cf.tabcount := cf.tabcount + 1;
else
cf.tabcount := 1;
Unbind(cf.tabrec);
Unbind(cf.tabcompnam);
fi;
pos := l[4]-1;
# in whitespace in beginning of line \t is just inserted
while pos > 0 and l[3][pos] in " \t" do
pos := pos-1;
od;
if pos = 0 then
return ["\t"];
fi;
pos := l[4]-1;
# find word to complete
while pos > 0 and l[3][pos] in IdentifierLetters do
pos := pos-1;
od;
wordplace := [pos+1, l[4]-1];
word := l[3]{[wordplace[1]..wordplace[2]]};
# see if we are in the case of a component name
while pos > 0 and l[3][pos] in " \n\t\r" do
pos := pos-1;
od;
idbnd := IDENTS_BOUND_GVARS();
if pos > 0 and l[3][pos] = '.' then
cf.tabcompnam := true;
if cf.tabcount = 1 then
# try to find name of component object
i := pos;
while i > 0 and (l[3][i] in IdentifierLetters or l[3][i] in ".!") do
i := i-1;
od;
cmps := SplitString(l[3]{[i+1..pos]},"","!.");
if Length(cmps) > 0 and cmps[1] in idbnd then
r := ValueGlobal(cmps[1]);
if not (IsRecord(r) or IsComponentObjectRep(r)) then
r := fail;
else
for j in [2..Length(cmps)] do
if IsBound(r!.(cmps[j])) then
r := r!.(cmps[j]);
if IsRecord(r) or IsComponentObjectRep(r) then
continue;
fi;
fi;
r := fail;
break;
od;
fi;
else
r := fail;
fi;
if r <> fail then
cf.tabrec := r;
fi;
fi;
fi;
# now produce the searchlist
if IsBound(cf.tabrec) then
# the first two <TAB> hits try existing component names only first
searchlist := ShallowCopy(NamesOfComponents(cf.tabrec));
if cf.tabcount > 2 then
Append(searchlist, ALL_RNAMES());
fi;
else
# complete variable name
searchlist := idbnd;
fi;
cand := completeFilter(searchlist, word);
# in component name search we try again with all names if this is empty
if IsBound(cf.tabcompnam) and Length(cand) = 0 and cf.tabcount < 3 then
searchlist := ALL_RNAMES();
cand := completeFilter(searchlist, word);
fi;
if (not IsBound(cf.tabcompnam) and cf.tabcount = 2) or
(IsBound(cf.tabcompnam) and cf.tabcount in [2,4]) then
if Length(cand) > 0 then
# we prepend the partial word which was completed
return GAPInfo.CommandLineEditFunctions.Functions.DisplayMatches(
Concatenation([word], Set(cand)));
else
# ring the bell
return GAPInfo.CommandLineEditFunctions.Functions.RingBell();
fi;
fi;
if Length(cand) = 0 then
return [];
elif Length(cand) = 1 then
return [ wordplace[1], wordplace[2]+1, cand[1]{[1..Length(cand[1])]}];
fi;
extension := completeExtender(cand, word);
if extension = fail then
return [];
else
return [ wordplace[1], wordplace[2] + 1, extension ];
fi;
end;
GAPInfo.CommandLineEditFunctions.Functions.(INT_CHAR('I') mod 32) :=
GAPInfo.CommandLineEditFunctions.Functions.Completion;
BindKeysToGAPHandler("\011");
#############################################################################
##
## Simple utilities to create an arbitrary number of macros
##
# name a string, fun a function
InstallReadlineMacro := function(name, fun)
local cfm, pos;
cfm := GAPInfo.CommandLineEditFunctions.Macros;
if not IsBound(cfm.Names) then
cfm.Names := [];
fi;
pos := Position(cfm.Names, name);
if pos = fail then
pos := Length(cfm.Names)+1;
fi;
cfm.(pos) := fun;
cfm.Names[pos] := name;
end;
# A sequence to invoce macro name ('ESC num C-x C-g' sets GAPMacroNumber in
# kernel and then any key that calls handled-by-GAP will do it)
# We assume that 'C-xC-g' and <TAB> are not overwritten.
InvocationReadlineMacro := function(name)
local cfm, pos;
cfm := GAPInfo.CommandLineEditFunctions.Macros;
if not IsBound(cfm.Names) then
cfm.Names := [];
fi;
pos := Position(cfm.Names, name);
if pos = fail then
return fail;
fi;
return Concatenation("\033", String(pos), "\030\007\t");
end;
## # Example
## gap> InstallReadlineMacro("My Macro", function(l) return ["my text"]; end);
## gap> InvocationReadlineMacro("My Macro");
## "\0331\030\007\t"
## gap> BindKeySequence("^[OR",last); # first arg with C-v<F3>
# for compatibility with the non-readline kernel code
LineEditKeyHandlers := [];
LineEditKeyHandler := function(l)
return [l[1], l[3], l[5]];
end;
else
# some experimental code, use readline instead
ReadLib("cmdleditx.g");
fi;
|
{
"pile_set_name": "Github"
}
|
{
"title":"Shared Array Buffer",
"description":"Type of ArrayBuffer that can be shared across Workers.",
"spec":"https://tc39.github.io/ecmascript_sharedmem/shmem.html",
"status":"other",
"links":[
{
"url":"https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Global_Objects/SharedArrayBuffer",
"title":"MDN article"
}
],
"bugs":[
],
"categories":[
"JS"
],
"stats":{
"ie":{
"5.5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n"
},
"edge":{
"12":"n",
"13":"n",
"14":"n",
"15":"n",
"16":"n d #1",
"17":"n d #1",
"18":"n d #1",
"76":"y"
},
"firefox":{
"2":"n",
"3":"n",
"3.5":"n",
"3.6":"n",
"4":"n",
"5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n",
"12":"n",
"13":"n",
"14":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"n",
"24":"n",
"25":"n",
"26":"n",
"27":"n",
"28":"n",
"29":"n",
"30":"n",
"31":"n",
"32":"n",
"33":"n",
"34":"n",
"35":"n",
"36":"n",
"37":"n",
"38":"n",
"39":"n",
"40":"n",
"41":"n",
"42":"n",
"43":"n",
"44":"n",
"45":"n",
"46":"n",
"47":"n",
"48":"n",
"49":"n",
"50":"n",
"51":"n",
"52":"n",
"53":"n",
"54":"n",
"55":"n",
"56":"n",
"57":"n d #1",
"58":"n d #1",
"59":"n d #1",
"60":"n d #1",
"61":"n d #1",
"62":"n d #1",
"63":"n d #1",
"64":"n d #1",
"65":"n d #1",
"66":"n d #1",
"67":"n d #1",
"68":"n d #1",
"69":"n d #1",
"70":"n d #1"
},
"chrome":{
"4":"n",
"5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n",
"12":"n",
"13":"n",
"14":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"n",
"24":"n",
"25":"n",
"26":"n",
"27":"n",
"28":"n",
"29":"n",
"30":"n",
"31":"n",
"32":"n",
"33":"n",
"34":"n",
"35":"n",
"36":"n",
"37":"n",
"38":"n",
"39":"n",
"40":"n",
"41":"n",
"42":"n",
"43":"n",
"44":"n",
"45":"n",
"46":"n",
"47":"n",
"48":"n",
"49":"n",
"50":"n",
"51":"n",
"52":"n",
"53":"n",
"54":"n",
"55":"n",
"56":"n",
"57":"n",
"58":"n",
"59":"n",
"60":"n d #1",
"61":"n d #1",
"62":"n d #1",
"63":"n d #1",
"64":"n d #1",
"65":"n d #1",
"66":"n d #1",
"67":"n d #1",
"68":"y",
"69":"y",
"70":"y",
"71":"y",
"72":"y",
"73":"y",
"74":"y",
"75":"y",
"76":"y",
"77":"y",
"78":"y",
"79":"y"
},
"safari":{
"3.1":"n",
"3.2":"n",
"4":"n",
"5":"n",
"5.1":"n",
"6":"n",
"6.1":"n",
"7":"n",
"7.1":"n",
"8":"n",
"9":"n",
"9.1":"n",
"10":"n",
"10.1":"n d #1",
"11":"n d #1",
"11.1":"n d #1",
"12":"n d #1",
"12.1":"n d #1",
"13":"n d #1",
"TP":"n d #1"
},
"opera":{
"9":"n",
"9.5-9.6":"n",
"10.0-10.1":"n",
"10.5":"n",
"10.6":"n",
"11":"n",
"11.1":"n",
"11.5":"n",
"11.6":"n",
"12":"n",
"12.1":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"n",
"24":"n",
"25":"n",
"26":"n",
"27":"n",
"28":"n",
"29":"n",
"30":"n",
"31":"n",
"32":"n",
"33":"n",
"34":"n",
"35":"n",
"36":"n",
"37":"n",
"38":"n",
"39":"n",
"40":"n",
"41":"n",
"42":"n",
"43":"n",
"44":"n",
"45":"n",
"46":"n",
"47":"n d #1",
"48":"n d #1",
"49":"n d #1",
"50":"n d #1",
"51":"n d #1",
"52":"n d #1",
"53":"n d #1",
"54":"n d #1",
"55":"n d #1",
"56":"n d #1",
"57":"n d #1",
"58":"n d #1",
"60":"n d #1",
"62":"n d #1"
},
"ios_saf":{
"3.2":"n",
"4.0-4.1":"n",
"4.2-4.3":"n",
"5.0-5.1":"n",
"6.0-6.1":"n",
"7.0-7.1":"n",
"8":"n",
"8.1-8.4":"n",
"9.0-9.2":"n",
"9.3":"n",
"10.0-10.2":"n",
"10.3":"n d #1",
"11.0-11.2":"n d #1",
"11.3-11.4":"n d #1",
"12.0-12.1":"n d #1",
"12.2-12.3":"n d #1",
"13":"n d #1"
},
"op_mini":{
"all":"n"
},
"android":{
"2.1":"n",
"2.2":"n",
"2.3":"n",
"3":"n",
"4":"n",
"4.1":"n",
"4.2-4.3":"n",
"4.4":"n",
"4.4.3-4.4.4":"n",
"67":"u"
},
"bb":{
"7":"n",
"10":"n"
},
"op_mob":{
"10":"n",
"11":"n",
"11.1":"n",
"11.5":"n",
"12":"n",
"12.1":"n",
"46":"n"
},
"and_chr":{
"75":"n d #1"
},
"and_ff":{
"67":"n d #1"
},
"ie_mob":{
"10":"n",
"11":"n"
},
"and_uc":{
"12.12":"y"
},
"samsung":{
"4":"n",
"5.0-5.4":"n",
"6.2-6.4":"n",
"7.2-7.4":"n",
"8.2":"n",
"9.2":"n"
},
"and_qq":{
"1.2":"n"
},
"baidu":{
"7.12":"n"
},
"kaios":{
"2.5":"n"
}
},
"notes":"",
"notes_by_num":{
"1":"Has support, but was disabled across browsers in January 2018 due to Spectre & Meltdown vulnerabilities."
},
"usage_perc_y":30.41,
"usage_perc_a":0,
"ucprefix":false,
"parent":"",
"keywords":"",
"ie_id":"",
"chrome_id":"4570991992766464",
"firefox_id":"shared-array-buffer",
"webkit_id":"",
"shown":true
}
|
{
"pile_set_name": "Github"
}
|
{
"AF": {
"name": "Afghanistan"
},
"ZA": {
"name": "Afrika Selatan"
},
"AL": {
"name": "Albania"
},
"DZ": {
"name": "Algeria"
},
"US": {
"name": "Amerika Syarikat"
},
"AD": {
"name": "Andorra"
},
"AO": {
"name": "Angola"
},
"AI": {
"name": "Anguilla"
},
"AQ": {
"name": "Antartika"
},
"AG": {
"name": "Antigua dan Barbuda"
},
"SA": {
"name": "Arab Saudi"
},
"AR": {
"name": "Argentina"
},
"AM": {
"name": "Armenia"
},
"AW": {
"name": "Aruba"
},
"AU": {
"name": "Australia"
},
"AT": {
"name": "Austria"
},
"AZ": {
"name": "Azerbaijan"
},
"BS": {
"name": "Bahamas"
},
"BH": {
"name": "Bahrain"
},
"BD": {
"name": "Bangladesh"
},
"BB": {
"name": "Barbados"
},
"NL": {
"name": "Belanda"
},
"BQ": {
"name": "Belanda Caribbean"
},
"BY": {
"name": "Belarus"
},
"BE": {
"name": "Belgium"
},
"BZ": {
"name": "Belize"
},
"BJ": {
"name": "Benin"
},
"BM": {
"name": "Bermuda"
},
"BT": {
"name": "Bhutan"
},
"BO": {
"name": "Bolivia"
},
"BA": {
"name": "Bosnia dan Herzegovina"
},
"BW": {
"name": "Botswana"
},
"BR": {
"name": "Brazil"
},
"BN": {
"name": "Brunei"
},
"BG": {
"name": "Bulgaria"
},
"BF": {
"name": "Burkina Faso"
},
"BI": {
"name": "Burundi"
},
"CM": {
"name": "Cameroon"
},
"CV": {
"name": "Cape Verde"
},
"EA": {
"name": "Ceuta dan Melilla"
},
"TD": {
"name": "Chad"
},
"CL": {
"name": "Chile"
},
"CN": {
"name": "China"
},
"CO": {
"name": "Colombia"
},
"KM": {
"name": "Comoros"
},
"CG": {
"name": "Congo - Brazzaville"
},
"CD": {
"name": "Congo - Kinshasa"
},
"CR": {
"name": "Costa Rica"
},
"CI": {
"name": "Cote d’Ivoire"
},
"HR": {
"name": "Croatia"
},
"CU": {
"name": "Cuba"
},
"CW": {
"name": "Curacao"
},
"CY": {
"name": "Cyprus"
},
"DK": {
"name": "Denmark"
},
"DG": {
"name": "Diego Garcia"
},
"DJ": {
"name": "Djibouti"
},
"DM": {
"name": "Dominica"
},
"EC": {
"name": "Ecuador"
},
"SV": {
"name": "El Salvador"
},
"AE": {
"name": "Emiriah Arab Bersatu"
},
"ER": {
"name": "Eritrea"
},
"EE": {
"name": "Estonia"
},
"ET": {
"name": "Ethiopia"
},
"FJ": {
"name": "Fiji"
},
"PH": {
"name": "Filipina"
},
"FI": {
"name": "Finland"
},
"GA": {
"name": "Gabon"
},
"GM": {
"name": "Gambia"
},
"GE": {
"name": "Georgia"
},
"GH": {
"name": "Ghana"
},
"GI": {
"name": "Gibraltar"
},
"GL": {
"name": "Greenland"
},
"GD": {
"name": "Grenada"
},
"GP": {
"name": "Guadeloupe"
},
"GU": {
"name": "Guam"
},
"GT": {
"name": "Guatemala"
},
"GG": {
"name": "Guernsey"
},
"GF": {
"name": "Guiana Perancis"
},
"GN": {
"name": "Guinea"
},
"GW": {
"name": "Guinea Bissau"
},
"GQ": {
"name": "Guinea Khatulistiwa"
},
"GY": {
"name": "Guyana"
},
"HT": {
"name": "Haiti"
},
"HN": {
"name": "Honduras"
},
"HK": {
"name": "Hong Kong SAR China"
},
"HU": {
"name": "Hungary"
},
"IS": {
"name": "Iceland"
},
"IN": {
"name": "India"
},
"ID": {
"name": "Indonesia"
},
"IR": {
"name": "Iran"
},
"IQ": {
"name": "Iraq"
},
"IE": {
"name": "Ireland"
},
"IM": {
"name": "Isle of Man"
},
"IL": {
"name": "Israel"
},
"IT": {
"name": "Itali"
},
"JM": {
"name": "Jamaica"
},
"JP": {
"name": "Jepun"
},
"DE": {
"name": "Jerman"
},
"JE": {
"name": "Jersey"
},
"JO": {
"name": "Jordan"
},
"CA": {
"name": "Kanada"
},
"KZ": {
"name": "Kazakhstan"
},
"KH": {
"name": "Kemboja"
},
"KE": {
"name": "Kenya"
},
"AX": {
"name": "Kepulauan Aland"
},
"IC": {
"name": "Kepulauan Canary"
},
"KY": {
"name": "Kepulauan Cayman"
},
"CC": {
"name": "Kepulauan Cocos (Keeling)"
},
"CK": {
"name": "Kepulauan Cook"
},
"FK": {
"name": "Kepulauan Falkland"
},
"FO": {
"name": "Kepulauan Faroe"
},
"GS": {
"name": "Kepulauan Georgia Selatan & Sandwich Selatan"
},
"MP": {
"name": "Kepulauan Mariana Utara"
},
"MH": {
"name": "Kepulauan Marshall"
},
"PN": {
"name": "Kepulauan Pitcairn"
},
"SB": {
"name": "Kepulauan Solomon"
},
"UM": {
"name": "Kepulauan Terpencil A.S."
},
"TC": {
"name": "Kepulauan Turks dan Caicos"
},
"VI": {
"name": "Kepulauan Virgin A.S."
},
"VG": {
"name": "Kepulauan Virgin British"
},
"KI": {
"name": "Kiribati"
},
"KR": {
"name": "Korea Selatan"
},
"KP": {
"name": "Korea Utara"
},
"XK": {
"name": "Kosovo"
},
"VA": {
"name": "Kota Vatican"
},
"KW": {
"name": "Kuwait"
},
"KG": {
"name": "Kyrgyzstan"
},
"LA": {
"name": "Laos"
},
"LV": {
"name": "Latvia"
},
"LS": {
"name": "Lesotho"
},
"LR": {
"name": "Liberia"
},
"LY": {
"name": "Libya"
},
"LI": {
"name": "Liechtenstein"
},
"LT": {
"name": "Lithuania"
},
"LB": {
"name": "Lubnan"
},
"LU": {
"name": "Luxembourg"
},
"MO": {
"name": "Macau SAR China"
},
"MK": {
"name": "Macedonia"
},
"MG": {
"name": "Madagaskar"
},
"MA": {
"name": "Maghribi"
},
"MW": {
"name": "Malawi"
},
"MY": {
"name": "Malaysia"
},
"MV": {
"name": "Maldives"
},
"ML": {
"name": "Mali"
},
"MT": {
"name": "Malta"
},
"MQ": {
"name": "Martinique"
},
"MR": {
"name": "Mauritania"
},
"MU": {
"name": "Mauritius"
},
"YT": {
"name": "Mayotte"
},
"EG": {
"name": "Mesir"
},
"MX": {
"name": "Mexico"
},
"FM": {
"name": "Micronesia"
},
"MD": {
"name": "Moldova"
},
"MC": {
"name": "Monaco"
},
"MN": {
"name": "Mongolia"
},
"ME": {
"name": "Montenegro"
},
"MS": {
"name": "Montserrat"
},
"MZ": {
"name": "Mozambique"
},
"MM": {
"name": "Myanmar (Burma)"
},
"NA": {
"name": "Namibia"
},
"NR": {
"name": "Nauru"
},
"NP": {
"name": "Nepal"
},
"NC": {
"name": "New Caledonia"
},
"NZ": {
"name": "New Zealand"
},
"NI": {
"name": "Nicaragua"
},
"NE": {
"name": "Niger"
},
"NG": {
"name": "Nigeria"
},
"NU": {
"name": "Niue"
},
"NO": {
"name": "Norway"
},
"OM": {
"name": "Oman"
},
"PK": {
"name": "Pakistan"
},
"PW": {
"name": "Palau"
},
"PA": {
"name": "Panama"
},
"PG": {
"name": "Papua New Guinea"
},
"PY": {
"name": "Paraguay"
},
"FR": {
"name": "Perancis"
},
"PE": {
"name": "Peru"
},
"PL": {
"name": "Poland"
},
"PF": {
"name": "Polinesia Perancis"
},
"PT": {
"name": "Portugal"
},
"PR": {
"name": "Puerto Rico"
},
"AC": {
"name": "Pulau Ascension"
},
"CX": {
"name": "Pulau Krismas"
},
"NF": {
"name": "Pulau Norfolk"
},
"QA": {
"name": "Qatar"
},
"CF": {
"name": "Republik Afrika Tengah"
},
"CZ": {
"name": "Republik Czech"
},
"DO": {
"name": "Republik Dominica"
},
"RE": {
"name": "Reunion"
},
"RO": {
"name": "Romania"
},
"RU": {
"name": "Rusia"
},
"RW": {
"name": "Rwanda"
},
"EH": {
"name": "Sahara Barat"
},
"BL": {
"name": "Saint Barthélemy"
},
"SH": {
"name": "Saint Helena"
},
"KN": {
"name": "Saint Kitts dan Nevis"
},
"LC": {
"name": "Saint Lucia"
},
"MF": {
"name": "Saint Martin"
},
"PM": {
"name": "Saint Pierre dan Miquelon"
},
"VC": {
"name": "Saint Vincent dan Grenadines"
},
"WS": {
"name": "Samoa"
},
"AS": {
"name": "Samoa Amerika"
},
"SM": {
"name": "San Marino"
},
"ST": {
"name": "Sao Tome dan Principe"
},
"SN": {
"name": "Senegal"
},
"ES": {
"name": "Sepanyol"
},
"RS": {
"name": "Serbia"
},
"SC": {
"name": "Seychelles"
},
"SL": {
"name": "Sierra Leone"
},
"SG": {
"name": "Singapura"
},
"SX": {
"name": "Sint Maarten"
},
"SK": {
"name": "Slovakia"
},
"SI": {
"name": "Slovenia"
},
"SO": {
"name": "Somalia"
},
"LK": {
"name": "Sri Lanka"
},
"SD": {
"name": "Sudan"
},
"SS": {
"name": "Sudan Selatan"
},
"SR": {
"name": "Surinam"
},
"SJ": {
"name": "Svalbard dan Jan Mayen"
},
"SZ": {
"name": "Swaziland"
},
"SE": {
"name": "Sweden"
},
"CH": {
"name": "Switzerland"
},
"SY": {
"name": "Syria"
},
"TW": {
"name": "Taiwan"
},
"TJ": {
"name": "Tajikistan"
},
"TZ": {
"name": "Tanzania"
},
"TH": {
"name": "Thailand"
},
"TL": {
"name": "Timor-Leste"
},
"TG": {
"name": "Togo"
},
"TK": {
"name": "Tokelau"
},
"TO": {
"name": "Tonga"
},
"TT": {
"name": "Trinidad dan Tobago"
},
"TA": {
"name": "Tristan da Cunha"
},
"TN": {
"name": "Tunisia"
},
"TR": {
"name": "Turki"
},
"TM": {
"name": "Turkmenistan"
},
"TV": {
"name": "Tuvalu"
},
"UG": {
"name": "Uganda"
},
"UA": {
"name": "Ukraine"
},
"GB": {
"name": "United Kingdom"
},
"UY": {
"name": "Uruguay"
},
"UZ": {
"name": "Uzbekistan"
},
"VU": {
"name": "Vanuatu"
},
"VE": {
"name": "Venezuela"
},
"VN": {
"name": "Vietnam"
},
"WF": {
"name": "Wallis dan Futuna"
},
"IO": {
"name": "Wilayah Lautan Hindi British"
},
"PS": {
"name": "Wilayah Palestin"
},
"TF": {
"name": "Wilayah Selatan Perancis"
},
"YE": {
"name": "Yaman"
},
"GR": {
"name": "Yunani"
},
"ZM": {
"name": "Zambia"
},
"ZW": {
"name": "Zimbabwe"
}
}
|
{
"pile_set_name": "Github"
}
|
{
"metadata": {
"name": "",
"signature": "sha256:278e046efbf447c0419efcb74e9ce660ca855e4a9aeef3da10a80cb3ca4e11e6"
},
"nbformat": 3,
"nbformat_minor": 0,
"worksheets": [
{
"cells": [
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Installation"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"```\n",
"pip install reverse_geocoder\n",
"```\n",
"OR\n",
"```\n",
"pip install --upgrade reverse_geocoder\n",
"```"
]
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Import Library"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"import reverse_geocoder as rg"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 32
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Geocoding a Single Coordinate"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"import pprint\n",
"pp = pprint.PrettyPrinter(indent=4)\n",
"coordinate = (51.520328, -0.097712)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 33
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"result = rg.get(coordinate) # default mode = 2"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 34
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"pp.pprint(result)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"{ 'admin1': 'England',\n",
" 'admin2': 'Greater London',\n",
" 'cc': 'GB',\n",
" 'lat': '51.51988',\n",
" 'lon': '-0.09446',\n",
" 'name': 'Barbican'}\n"
]
}
],
"prompt_number": 35
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Geocoding Multiple Coordinates"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"coordinates = (51.5214588,-0.1729636),(9.936033, 76.259952),(37.38605,-122.08385)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 36
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"results = rg.search(coordinates) # default mode = 2"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 37
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"pp.pprint(results)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[ { 'admin1': 'England',\n",
" 'admin2': 'Greater London',\n",
" 'cc': 'GB',\n",
" 'lat': '51.51116',\n",
" 'lon': '-0.18426',\n",
" 'name': 'Bayswater'},\n",
" { 'admin1': 'Kerala',\n",
" 'admin2': 'Ernakulam',\n",
" 'cc': 'IN',\n",
" 'lat': '9.93988',\n",
" 'lon': '76.26022',\n",
" 'name': 'Cochin'},\n",
" { 'admin1': 'California',\n",
" 'admin2': 'Santa Clara County',\n",
" 'cc': 'US',\n",
" 'lat': '37.38605',\n",
" 'lon': '-122.08385',\n",
" 'name': 'Mountain View'}]\n"
]
}
],
"prompt_number": 38
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Single Process Geocoding"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"coordinates = (51.459185, -2.585109),(1.292697, 103.852033),(-27.450283, 153.016957)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 39
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"results_slow = rg.search(coordinates,mode=1)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 40
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"pp.pprint(results_slow)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[ { 'admin1': 'England',\n",
" 'admin2': 'Bristol',\n",
" 'cc': 'GB',\n",
" 'lat': '51.45523',\n",
" 'lon': '-2.59665',\n",
" 'name': 'Bristol'},\n",
" { 'admin1': '',\n",
" 'admin2': '',\n",
" 'cc': 'SG',\n",
" 'lat': '1.28967',\n",
" 'lon': '103.85007',\n",
" 'name': 'Singapore'},\n",
" { 'admin1': 'Queensland',\n",
" 'admin2': 'Brisbane',\n",
" 'cc': 'AU',\n",
" 'lat': '-27.46141',\n",
" 'lon': '153.02311',\n",
" 'name': 'Spring Hill'}]\n"
]
}
],
"prompt_number": 41
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"Geocoding from an Input File"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"import csv\n",
"input_filename = '/Users/ajay/Workspace/pydata_demo/coordinates_10000.csv'\n",
"output_filename = '/Users/ajay/Workspace/pydata_demo/coordinates_10000_geocoded.csv'\n",
"cities = [(row[0],row[1]) for row in csv.reader(open(input_filename,'rt'),delimiter='\\t')]"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 42
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"pp.pprint(cities[0:5])"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[ ('13.9280531', '100.3735803'),\n",
" ('13.7233157', '-89.1415332'),\n",
" ('28.6440457', '-81.122403'),\n",
" ('35.9105783', '128.817739'),\n",
" ('43.2615353', '-2.9267777')]\n"
]
}
],
"prompt_number": 43
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"results = rg.search(cities)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 44
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"rows = []\n",
"for idx, city in enumerate(cities):\n",
" write_row = []\n",
" lat = city[0]\n",
" lon = city[1]\n",
" gdata = results[idx]\n",
" rows.append([lat,lon,gdata['name'],gdata['admin1'],gdata['admin2'],gdata['cc']])\n",
"csvwriter = csv.writer(open(output_filename,'wt'),delimiter='\\t')\n",
"csvwriter.writerows(rows)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 45
},
{
"cell_type": "code",
"collapsed": false,
"input": [],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 45
}
],
"metadata": {}
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"metadata": {
"id": "urn:bbc:ares::asset:ukchina/simp/cool-britannia-38434549",
"locators": {
"assetUri": "/ukchina/simp/cool-britannia-38434549",
"cpsUrn": "urn:bbc:content:assetUri:ukchina/simp/cool-britannia-38434549",
"curie": "http://www.bbc.co.uk/asset/e802ef60-4ccb-684c-a90f-9d93fca8f411"
},
"type": "PGL",
"createdBy": "ukchina-v6",
"language": "zh-Hans",
"lastUpdated": 1563684443283,
"firstPublished": 1482728544,
"lastPublished": 1482754396,
"options": {
"isIgorSeoTagsEnabled": false,
"includeComments": false,
"allowRightHandSide": true,
"allowDateStamp": true,
"suitableForSyndication": true,
"hasNewsTracker": false,
"allowRelatedStoriesBox": true,
"isKeyContent": false,
"allowHeadline": true,
"allowAdvertising": true,
"hasContentWarning": false,
"isBreakingNews": false,
"allowPrintingSharingLinks": true
},
"analyticsLabels": {
"cps_asset_type": "pgl",
"counterName": "ukchinasimp.cool_britannia.photo_gallery.38434549.page",
"cps_asset_id": "38434549"
},
"tags": {
"about": [
{
"thingLabel": "Entertainment",
"thingUri": "http://www.bbc.co.uk/things/1c3b60a9-14eb-484b-a750-9f5b1aeaac31#id",
"thingId": "1c3b60a9-14eb-484b-a750-9f5b1aeaac31",
"thingType": ["Theme", "Thing"],
"thingSameAs": [
"http://dbpedia.org/resource/Entertainment",
"http://www.wikidata.org/entity/Q173799"
]
},
{
"thingLabel": "United Kingdom",
"thingUri": "http://www.bbc.co.uk/things/2e91364c-5c77-4660-b76e-d76202785e64#id",
"thingId": "2e91364c-5c77-4660-b76e-d76202785e64",
"thingType": ["Place", "Thing", "geoname:GeoTagConcept"],
"thingSameAs": ["http://sws.geonames.org/2635167/"]
},
{
"thingLabel": "Culture",
"thingUri": "http://www.bbc.co.uk/things/6a73afa3-ea6b-45c1-80bb-49060b99f864#id",
"thingId": "6a73afa3-ea6b-45c1-80bb-49060b99f864",
"thingType": ["Theme", "Thing"],
"thingSameAs": [
"http://dbpedia.org/resource/Culture",
"http://www.wikidata.org/entity/Q11042"
]
}
],
"mentions": [
{
"thingLabel": "Art",
"thingUri": "http://www.bbc.co.uk/things/37dcc888-51a7-4470-82d8-8ef2b811d482#id",
"thingId": "37dcc888-51a7-4470-82d8-8ef2b811d482",
"thingType": ["Theme", "Thing"],
"thingSameAs": [
"http://dbpedia.org/resource/Art",
"http://www.wikidata.org/entity/Q735"
]
},
{
"thingLabel": "China",
"thingUri": "http://www.bbc.co.uk/things/6892384e-1966-4c03-9ce3-f694a8f9f69e#id",
"thingId": "6892384e-1966-4c03-9ce3-f694a8f9f69e",
"thingType": ["Place", "Thing", "geoname:GeoTagConcept"],
"thingSameAs": [
"http://dbpedia.org/resource/China",
"http://sws.geonames.org/1814991/",
"http://www.wikidata.org/entity/Q148"
]
},
{
"thingLabel": "China-UK relations",
"thingUri": "http://www.bbc.co.uk/things/ac90f011-0779-4da9-8ac5-4de96fcc2b93#id",
"thingId": "ac90f011-0779-4da9-8ac5-4de96fcc2b93",
"thingType": ["Theme", "Thing"],
"thingSameAs": [
"http://dbpedia.org/resource/China%E2%80%93United_Kingdom_relations",
"http://www.wikidata.org/entity/Q906604"
]
}
]
},
"version": "v1.0.10",
"blockTypes": ["image"],
"includeComments": false
},
"content": {
"blocks": [
{
"id": "93125807",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/114C4/production/_93125807_bbc.jpg",
"path": "/cpsprodpb/114C4/production/_93125807_bbc.jpg",
"height": 549,
"width": 976,
"altText": "1984年的乔治·迈克尔",
"caption": "乔治·迈克尔（George Michael）在1980年代以双人组合“威猛乐队”（Wham!）走红，乐队解散后他在个人表演上也持续获得极大成功。",
"copyrightHolder": "BBC",
"type": "image"
},
{
"id": "93125969",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/17AB8/production/_93125969_whamget.jpg",
"path": "/cpsprodpb/17AB8/production/_93125969_whamget.jpg",
"height": 549,
"width": 976,
"altText": "乔治·迈克尔与安德鲁·维治利",
"caption": "乔治·迈克尔与安德鲁·维治利（Andrew Ridgeley）在中学时相识后组成双人乐队。他们有两张专辑登上排行榜冠军。热门单曲包括Last Christmas、Club Tropicana、Wake Me Up Before You Go Go",
"copyrightHolder": "Getty Images",
"type": "image"
},
{
"id": "93125971",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/4620/production/_93125971_liveaidpa.jpg",
"path": "/cpsprodpb/4620/production/_93125971_liveaidpa.jpg",
"height": 549,
"width": 976,
"altText": "乔治·迈克尔1985年",
"caption": "乔治·迈克尔1984年以Careless Whisper（无心快语）開啟他的個人職業生涯。這首歌在全世界走紅，也成為他的代表作。",
"copyrightHolder": "PA",
"type": "image"
},
{
"id": "93125975",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/E260/production/_93125975_liveaidap.jpg",
"path": "/cpsprodpb/E260/production/_93125975_liveaidap.jpg",
"height": 549,
"width": 976,
"altText": "迈克尔（左一）与格尔多夫（Bob Geldof；右二被遮蔽者）、麦卡特尼（Paul McCartney；右三）等同台演出",
"caption": "1985年7月13日，伦敦温布利球场，迈克尔（左一）参与了格尔多夫（Bob Geldof；右二被遮蔽者）筹办的LiveAid音乐会，与麦卡特尼（Paul McCartney；右三）等巨星在这场史无前例的国际筹款音乐会上同台演出。",
"copyrightHolder": "AP",
"type": "image"
},
{
"id": "93125977",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/13080/production/_93125977_arethaap.jpg",
"path": "/cpsprodpb/13080/production/_93125977_arethaap.jpg",
"height": 549,
"width": 976,
"altText": "迈克尔与艾瑞莎·弗兰克林",
"caption": "迈克尔曾与许多知名艺人合作过，包括图中的美国“灵魂歌后”艾瑞莎·弗兰克林（Aretha Franklin）以及皇后乐队（Queen）、艾尔顿·约翰爵士（Sir Elton John）等人。他和艾瑞莎·弗兰克林合唱的I Knew You Were Waiting （For Me）在大西洋两岸都是排行榜冠军。",
"copyrightHolder": "AP",
"type": "image"
},
{
"id": "93126051",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/3AD6/production/_93126051_ap89.jpg",
"path": "/cpsprodpb/3AD6/production/_93126051_ap89.jpg",
"height": 549,
"width": 976,
"altText": "1989年的迈克尔",
"caption": "威猛乐队1985年在中国开演唱会，成为第一个进军共产中国的西方乐队，但他们在1986年解散。迈克尔之后的歌曲Faith、Jesus To A Child、Fastlove也大受欢迎，亦获得许多奖项。",
"copyrightHolder": "AP",
"type": "image"
},
{
"id": "93126049",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/16F6E/production/_93126049_dianapa.jpg",
"path": "/cpsprodpb/16F6E/production/_93126049_dianapa.jpg",
"height": 549,
"width": 976,
"altText": "戴安娜王妃与迈克尔",
"caption": "戴安娜王妃也是迈克尔的歌迷，他们甚至成了朋友。迈克尔参加了1997年戴安娜王妃的葬礼。",
"copyrightHolder": "PA",
"type": "image"
},
{
"id": "56943922",
"subType": "photogallery",
"href": "http://news.bbcimg.co.uk/media/images/56943000/jpg/_56943922_003983026-1.jpg",
"path": "/mcs/media/images/56943000/jpg/_56943922_003983026-1.jpg",
"height": 549,
"width": 976,
"altText": "乔治·迈克尔",
"caption": "迈克尔在1980、1990年代初大获成功。但之后他的人生被负面消息围绕。1997年他因为在洛杉矶公共厕所与人发生性行为遭到逮捕，该事件让他公开同志身分。",
"copyrightHolder": "Getty Images",
"type": "image"
},
{
"id": "93126077",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/12D06/production/_93126077_gossafp.jpg",
"path": "/cpsprodpb/12D06/production/_93126077_gossafp.jpg",
"height": 549,
"width": 976,
"altText": "迈克尔与肯尼·戈斯",
"caption": "迈克尔的多年伴侣安塞尔莫·费莱帕（Anselmo Feleppa）在1993年因为脑溢血去世，迈克尔深受打击。三年之后，他与肯尼·戈斯（Kenny Goss）（图左）交往，两人关系持续到2009年。",
"copyrightHolder": "AFP",
"type": "image"
},
{
"id": "56944404",
"subType": "photogallery",
"href": "http://news.bbcimg.co.uk/media/images/56944000/jpg/_56944404_gm3.jpg",
"path": "/mcs/media/images/56944000/jpg/_56944404_gm3.jpg",
"height": 549,
"width": 976,
"altText": "乔治·迈克尔",
"caption": "近年来他有药物成瘾困扰。2011年他因肺炎在维也纳住院一个月。",
"copyrightHolder": "Getty Images",
"type": "image"
},
{
"id": "93126081",
"subType": "photogallery",
"href": "http://c.files.bbci.co.uk/468E/production/_93126081_olympicsreu.jpg",
"path": "/cpsprodpb/468E/production/_93126081_olympicsreu.jpg",
"height": 549,
"width": 976,
"altText": "图为他在2012年伦敦奥运会闭幕式的演出",
"caption": "他的最后一次巡回演唱会是在2012年伦敦奥运会演出之后。图为他在2012年伦敦奥运会闭幕式的演出。据报道，迈克尔过世之前仍在筹备新专辑。他的上一张专辑在12年前推出。",
"copyrightHolder": "Reuters",
"type": "image"
}
]
},
"promo": {
"headlines": {
"shortHeadline": "逝者：前威猛乐队主唱乔治·迈克尔",
"headline": "图辑：《Last Christmas》原唱乔治·迈克尔起伏一生"
},
"locators": {
"assetUri": "/ukchina/simp/cool-britannia-38434549",
"cpsUrn": "urn:bbc:content:assetUri:ukchina/simp/cool-britannia-38434549",
"curie": "http://www.bbc.co.uk/asset/e802ef60-4ccb-684c-a90f-9d93fca8f411"
},
"summary": "西方流行乐坛赴华演唱第一人，前威猛乐队主唱乔治·迈克尔（George Michael）圣诞日于英国家中辞世，终年53岁。他的经典圣诞歌曲《Last Christmas》成绝响。",
"timestamp": 1563684443283,
"passport": {},
"indexImage": {
"id": "93126194",
"subType": "index",
"href": "http://c.files.bbci.co.uk/C00A/production/_93126194_liveaidpa.jpg",
"path": "/cpsprodpb/C00A/production/_93126194_liveaidpa.jpg",
"height": 576,
"width": 1024,
"altText": "乔治·迈克尔1985年",
"copyrightHolder": "PA",
"type": "image"
},
"id": "urn:bbc:ares::asset:ukchina/simp/cool-britannia-38434549",
"type": "cps"
},
"relatedContent": {
"section": {
"subType": "index",
"name": "英伦风采",
"uri": "/ukchina/simp/cool_britannia",
"type": "simple"
},
"site": {
"subType": "site",
"name": "BBC英伦网",
"uri": "/ukchina/simp",
"type": "simple"
},
"groups": [
{
"type": "see-alsos",
"promos": [
{
"headlines": {
"shortHeadline": "英国知名唱作人乔治·迈克尔逝世",
"headline": "过不了最后圣诞 流行曲巨星乔治·迈克尔家中逝世"
},
"locators": {
"assetUri": "/zhongwen/simp/uk-38434627",
"cpsUrn": "urn:bbc:content:assetUri:/zhongwen/simp/uk-38434627"
},
"summary": "英国知名创作歌手乔治·迈克尔在牛津郡家中“安详离世”，终年53岁。他曾经随“威猛”乐队成为首批在中国演唱的西方流行歌手。",
"timestamp": 1482754385,
"cpsType": "STY",
"indexImage": {
"id": "93139024",
"subType": "index",
"href": "http://c.files.bbci.co.uk/A46D/production/_93139024_7db4993e-c35d-4f65-a505-87a2bfe5b35f.jpg",
"path": "/cpsprodpb/A46D/production/_93139024_7db4993e-c35d-4f65-a505-87a2bfe5b35f.jpg",
"height": 1152,
"width": 2048,
"altText": "悼念民众在乔治·迈克尔牛津郡家门外留下的照片（26/12/2016）",
"copyrightHolder": "AP",
"type": "image"
},
"id": "urn:bbc:ares::asset:zhongwen/simp/uk-38434627",
"type": "cps"
}
]
}
]
}
}
|
{
"pile_set_name": "Github"
}
|
[
{
"created_at": "Thu Apr 06 15:28:43 +0000 2017",
"id": 850007368138018817,
"id_str": "850007368138018817",
"text": "RT @TwitterDev: 1/ Today we’re sharing our vision for the future of the Twitter API platform!\nhttps://t.co/XweGngmxlP",
"truncated": false,
"entities": {
"hashtags": [],
"symbols": [],
"user_mentions": [
{
"screen_name": "TwitterDev",
"name": "TwitterDev",
"id": 2244994945,
"id_str": "2244994945",
"indices": [
3,
14
]
}
],
"urls": [
{
"url": "https://t.co/XweGngmxlP",
"expanded_url": "https://cards.twitter.com/cards/18ce53wgo4h/3xo1c",
"display_url": "cards.twitter.com/cards/18ce53wg…",
"indices": [
94,
117
]
}
]
},
"source": "<a href=\"http://twitter.com\" rel=\"nofollow\">Twitter Web Client</a>",
"in_reply_to_status_id": null,
"in_reply_to_status_id_str": null,
"in_reply_to_user_id": null,
"in_reply_to_user_id_str": null,
"in_reply_to_screen_name": null,
"user": {
"id": 6253282,
"id_str": "6253282",
"name": "Twitter API",
"screen_name": "twitterapi",
"location": "San Francisco, CA",
"description": "The Real Twitter API. I tweet about API changes, service issues and happily answer questions about Twitter and our API. Don't get an answer? It's on my website.",
"url": "http://t.co/78pYTvWfJd",
"entities": {
"url": {
"urls": [
{
"url": "http://t.co/78pYTvWfJd",
"expanded_url": "https://dev.twitter.com",
"display_url": "dev.twitter.com",
"indices": [
0,
22
]
}
]
},
"description": {
"urls": []
}
},
"protected": false,
"followers_count": 6172353,
"friends_count": 46,
"listed_count": 13091,
"created_at": "Wed May 23 06:01:13 +0000 2007",
"favourites_count": 26,
"utc_offset": -25200,
"time_zone": "Pacific Time (US & Canada)",
"geo_enabled": true,
"verified": true,
"statuses_count": 3583,
"lang": "en",
"contributors_enabled": false,
"is_translator": false,
"is_translation_enabled": false,
"profile_background_color": "C0DEED",
"profile_background_image_url": "http://pbs.twimg.com/profile_background_images/656927849/miyt9dpjz77sc0w3d4vj.png",
"profile_background_image_url_https": "https://pbs.twimg.com/profile_background_images/656927849/miyt9dpjz77sc0w3d4vj.png",
"profile_background_tile": true,
"profile_image_url": "http://pbs.twimg.com/profile_images/2284174872/7df3h38zabcvjylnyfe3_normal.png",
"profile_image_url_https": "https://pbs.twimg.com/profile_images/2284174872/7df3h38zabcvjylnyfe3_normal.png",
"profile_banner_url": "https://pbs.twimg.com/profile_banners/6253282/1431474710",
"profile_link_color": "0084B4",
"profile_sidebar_border_color": "C0DEED",
"profile_sidebar_fill_color": "DDEEF6",
"profile_text_color": "333333",
"profile_use_background_image": true,
"has_extended_profile": false,
"default_profile": false,
"default_profile_image": false,
"following": true,
"follow_request_sent": false,
"notifications": false,
"translator_type": "regular"
},
"geo": null,
"coordinates": null,
"place": null,
"contributors": null,
"retweeted_status": {
"created_at": "Thu Apr 06 15:24:15 +0000 2017",
"id": 850006245121695744,
"id_str": "850006245121695744",
"text": "1/ Today we’re sharing our vision for the future of the Twitter API platform!\nhttps://t.co/XweGngmxlP",
"truncated": false,
"entities": {
"hashtags": [],
"symbols": [],
"user_mentions": [],
"urls": [
{
"url": "https://t.co/XweGngmxlP",
"expanded_url": "https://cards.twitter.com/cards/18ce53wgo4h/3xo1c",
"display_url": "cards.twitter.com/cards/18ce53wg…",
"indices": [
78,
101
]
}
]
},
"source": "<a href=\"http://twitter.com\" rel=\"nofollow\">Twitter Web Client</a>",
"in_reply_to_status_id": null,
"in_reply_to_status_id_str": null,
"in_reply_to_user_id": null,
"in_reply_to_user_id_str": null,
"in_reply_to_screen_name": null,
"user": {
"id": 2244994945,
"id_str": "2244994945",
"name": "TwitterDev",
"screen_name": "TwitterDev",
"location": "Internet",
"description": "Your official source for Twitter Platform news, updates & events. Need technical help? Visit https://t.co/mGHnxZCxkt ⌨️ #TapIntoTwitter",
"url": "https://t.co/66w26cua1O",
"entities": {
"url": {
"urls": [
{
"url": "https://t.co/66w26cua1O",
"expanded_url": "https://dev.twitter.com/",
"display_url": "dev.twitter.com",
"indices": [
0,
23
]
}
]
},
"description": {
"urls": [
{
"url": "https://t.co/mGHnxZCxkt",
"expanded_url": "https://twittercommunity.com/",
"display_url": "twittercommunity.com",
"indices": [
93,
116
]
}
]
}
},
"protected": false,
"followers_count": 465425,
"friends_count": 1523,
"listed_count": 1168,
"created_at": "Sat Dec 14 04:35:55 +0000 2013",
"favourites_count": 2098,
"utc_offset": -25200,
"time_zone": "Pacific Time (US & Canada)",
"geo_enabled": true,
"verified": true,
"statuses_count": 3031,
"lang": "en",
"contributors_enabled": false,
"is_translator": false,
"is_translation_enabled": false,
"profile_background_color": "FFFFFF",
"profile_background_image_url": "http://abs.twimg.com/images/themes/theme1/bg.png",
"profile_background_image_url_https": "https://abs.twimg.com/images/themes/theme1/bg.png",
"profile_background_tile": false,
"profile_image_url": "http://pbs.twimg.com/profile_images/530814764687949824/npQQVkq8_normal.png",
"profile_image_url_https": "https://pbs.twimg.com/profile_images/530814764687949824/npQQVkq8_normal.png",
"profile_banner_url": "https://pbs.twimg.com/profile_banners/2244994945/1396995246",
"profile_link_color": "0084B4",
"profile_sidebar_border_color": "FFFFFF",
"profile_sidebar_fill_color": "DDEEF6",
"profile_text_color": "333333",
"profile_use_background_image": false,
"has_extended_profile": false,
"default_profile": false,
"default_profile_image": false,
"following": true,
"follow_request_sent": false,
"notifications": false,
"translator_type": "regular"
},
"geo": null,
"coordinates": null,
"place": null,
"contributors": null,
"is_quote_status": false,
"retweet_count": 284,
"favorite_count": 399,
"favorited": false,
"retweeted": false,
"possibly_sensitive": false,
"lang": "en"
},
"is_quote_status": false,
"retweet_count": 284,
"favorite_count": 0,
"favorited": false,
"retweeted": false,
"possibly_sensitive": false,
"lang": "en"
},
{
"created_at": "Mon Apr 03 16:09:50 +0000 2017",
"id": 848930551989915648,
"id_str": "848930551989915648",
"text": "RT @TwitterMktg: Starting today, businesses can request and share locations when engaging with people in Direct Messages. https://t.co/rpYn…",
"truncated": false,
"entities": {
"hashtags": [],
"symbols": [],
"user_mentions": [
{
"screen_name": "TwitterMktg",
"name": "Twitter Marketing",
"id": 357750891,
"id_str": "357750891",
"indices": [
3,
15
]
}
],
"urls": []
},
"source": "<a href=\"http://twitter.com\" rel=\"nofollow\">Twitter Web Client</a>",
"in_reply_to_status_id": null,
"in_reply_to_status_id_str": null,
"in_reply_to_user_id": null,
"in_reply_to_user_id_str": null,
"in_reply_to_screen_name": null,
"user": {
"id": 6253282,
"id_str": "6253282",
"name": "Twitter API",
"screen_name": "twitterapi",
"location": "San Francisco, CA",
"description": "The Real Twitter API. I tweet about API changes, service issues and happily answer questions about Twitter and our API. Don't get an answer? It's on my website.",
"url": "http://t.co/78pYTvWfJd",
"entities": {
"url": {
"urls": [
{
"url": "http://t.co/78pYTvWfJd",
"expanded_url": "https://dev.twitter.com",
"display_url": "dev.twitter.com",
"indices": [
0,
22
]
}
]
},
"description": {
"urls": []
}
},
"protected": false,
"followers_count": 6172353,
"friends_count": 46,
"listed_count": 13091,
"created_at": "Wed May 23 06:01:13 +0000 2007",
"favourites_count": 26,
"utc_offset": -25200,
"time_zone": "Pacific Time (US & Canada)",
"geo_enabled": true,
"verified": true,
"statuses_count": 3583,
"lang": "en",
"contributors_enabled": false,
"is_translator": false,
"is_translation_enabled": false,
"profile_background_color": "C0DEED",
"profile_background_image_url": "http://pbs.twimg.com/profile_background_images/656927849/miyt9dpjz77sc0w3d4vj.png",
"profile_background_image_url_https": "https://pbs.twimg.com/profile_background_images/656927849/miyt9dpjz77sc0w3d4vj.png",
"profile_background_tile": true,
"profile_image_url": "http://pbs.twimg.com/profile_images/2284174872/7df3h38zabcvjylnyfe3_normal.png",
"profile_image_url_https": "https://pbs.twimg.com/profile_images/2284174872/7df3h38zabcvjylnyfe3_normal.png",
"profile_banner_url": "https://pbs.twimg.com/profile_banners/6253282/1431474710",
"profile_link_color": "0084B4",
"profile_sidebar_border_color": "C0DEED",
"profile_sidebar_fill_color": "DDEEF6",
"profile_text_color": "333333",
"profile_use_background_image": true,
"has_extended_profile": false,
"default_profile": false,
"default_profile_image": false,
"following": true,
"follow_request_sent": false,
"notifications": false,
"translator_type": "regular"
},
"geo": null,
"coordinates": null,
"place": null,
"contributors": null,
"retweeted_status": {
"created_at": "Mon Apr 03 16:05:05 +0000 2017",
"id": 848929357519241216,
"id_str": "848929357519241216",
"text": "Starting today, businesses can request and share locations when engaging with people in Direct Messages. https://t.co/rpYndqWfQw",
"truncated": false,
"entities": {
"hashtags": [],
"symbols": [],
"user_mentions": [],
"urls": [
{
"url": "https://t.co/rpYndqWfQw",
"expanded_url": "https://cards.twitter.com/cards/5wzucr/3x700",
"display_url": "cards.twitter.com/cards/5wzucr/3…",
"indices": [
105,
128
]
}
]
},
"source": "<a href=\"https://ads.twitter.com\" rel=\"nofollow\">Twitter Ads</a>",
"in_reply_to_status_id": null,
"in_reply_to_status_id_str": null,
"in_reply_to_user_id": null,
"in_reply_to_user_id_str": null,
"in_reply_to_screen_name": null,
"user": {
"id": 357750891,
"id_str": "357750891",
"name": "Twitter Marketing",
"screen_name": "TwitterMktg",
"location": "Twitter HQ ",
"description": "Twitter’s place for marketers, agencies, and creative thinkers ⭐ Bringing you insights, news, updates, and inspiration. Visit @TwitterAdsHelp for Ads support.",
"url": "https://t.co/Tfo4moo92y",
"entities": {
"url": {
"urls": [
{
"url": "https://t.co/Tfo4moo92y",
"expanded_url": "https://marketing.twitter.com",
"display_url": "marketing.twitter.com",
"indices": [
0,
23
]
}
]
},
"description": {
"urls": []
}
},
"protected": false,
"followers_count": 924546,
"friends_count": 661,
"listed_count": 3893,
"created_at": "Thu Aug 18 21:08:15 +0000 2011",
"favourites_count": 1934,
"utc_offset": -25200,
"time_zone": "Pacific Time (US & Canada)",
"geo_enabled": true,
"verified": true,
"statuses_count": 6329,
"lang": "en",
"contributors_enabled": false,
"is_translator": false,
"is_translation_enabled": false,
"profile_background_color": "C0DEED",
"profile_background_image_url": "http://pbs.twimg.com/profile_background_images/662767273/jvmxdpdrplhxcw8yvkv2.png",
"profile_background_image_url_https": "https://pbs.twimg.com/profile_background_images/662767273/jvmxdpdrplhxcw8yvkv2.png",
"profile_background_tile": true,
"profile_image_url": "http://pbs.twimg.com/profile_images/800953549697888256/UlXXL5h5_normal.jpg",
"profile_image_url_https": "https://pbs.twimg.com/profile_images/800953549697888256/UlXXL5h5_normal.jpg",
"profile_banner_url": "https://pbs.twimg.com/profile_banners/357750891/1487188210",
"profile_link_color": "19CF86",
"profile_sidebar_border_color": "FFFFFF",
"profile_sidebar_fill_color": "DDEEF6",
"profile_text_color": "333333",
"profile_use_background_image": true,
"has_extended_profile": false,
"default_profile": false,
"default_profile_image": false,
"following": false,
"follow_request_sent": false,
"notifications": false,
"translator_type": "none"
},
"geo": null,
"coordinates": null,
"place": null,
"contributors": null,
"is_quote_status": false,
"retweet_count": 111,
"favorite_count": 162,
"favorited": false,
"retweeted": false,
"possibly_sensitive": false,
"lang": "en"
},
"is_quote_status": false,
"retweet_count": 111,
"favorite_count": 0,
"favorited": false,
"retweeted": false,
"possibly_sensitive": false,
"lang": "en"
}
]
|
{
"pile_set_name": "Github"
}
|
{
"__comment": "Generated by generateResources.py function: blockstate",
"forge_marker": 1,
"defaults": {
"textures": {
"bottom": "tfc:blocks/wood/door/lower/sycamore",
"top": "tfc:blocks/wood/door/upper/sycamore"
}
},
"variants": {
"facing=east,half=lower,hinge=left,open=false": {
"model": "door_bottom"
},
"facing=south,half=lower,hinge=left,open=false": {
"model": "door_bottom",
"y": 90
},
"facing=west,half=lower,hinge=left,open=false": {
"model": "door_bottom",
"y": 180
},
"facing=north,half=lower,hinge=left,open=false": {
"model": "door_bottom",
"y": 270
},
"facing=east,half=lower,hinge=right,open=false": {
"model": "door_bottom_rh"
},
"facing=south,half=lower,hinge=right,open=false": {
"model": "door_bottom_rh",
"y": 90
},
"facing=west,half=lower,hinge=right,open=false": {
"model": "door_bottom_rh",
"y": 180
},
"facing=north,half=lower,hinge=right,open=false": {
"model": "door_bottom_rh",
"y": 270
},
"facing=east,half=lower,hinge=left,open=true": {
"model": "door_bottom_rh",
"y": 90
},
"facing=south,half=lower,hinge=left,open=true": {
"model": "door_bottom_rh",
"y": 180
},
"facing=west,half=lower,hinge=left,open=true": {
"model": "door_bottom_rh",
"y": 270
},
"facing=north,half=lower,hinge=left,open=true": {
"model": "door_bottom_rh"
},
"facing=east,half=lower,hinge=right,open=true": {
"model": "door_bottom",
"y": 270
},
"facing=south,half=lower,hinge=right,open=true": {
"model": "door_bottom"
},
"facing=west,half=lower,hinge=right,open=true": {
"model": "door_bottom",
"y": 90
},
"facing=north,half=lower,hinge=right,open=true": {
"model": "door_bottom",
"y": 180
},
"facing=east,half=upper,hinge=left,open=false": {
"model": "tfc:door_top_tfc"
},
"facing=south,half=upper,hinge=left,open=false": {
"model": "tfc:door_top_tfc",
"y": 90
},
"facing=west,half=upper,hinge=left,open=false": {
"model": "tfc:door_top_tfc",
"y": 180
},
"facing=north,half=upper,hinge=left,open=false": {
"model": "tfc:door_top_tfc",
"y": 270
},
"facing=east,half=upper,hinge=right,open=false": {
"model": "tfc:door_top_rh_tfc"
},
"facing=south,half=upper,hinge=right,open=false": {
"model": "tfc:door_top_rh_tfc",
"y": 90
},
"facing=west,half=upper,hinge=right,open=false": {
"model": "tfc:door_top_rh_tfc",
"y": 180
},
"facing=north,half=upper,hinge=right,open=false": {
"model": "tfc:door_top_rh_tfc",
"y": 270
},
"facing=east,half=upper,hinge=left,open=true": {
"model": "tfc:door_top_rh_tfc",
"y": 90
},
"facing=south,half=upper,hinge=left,open=true": {
"model": "tfc:door_top_rh_tfc",
"y": 180
},
"facing=west,half=upper,hinge=left,open=true": {
"model": "tfc:door_top_rh_tfc",
"y": 270
},
"facing=north,half=upper,hinge=left,open=true": {
"model": "tfc:door_top_rh_tfc"
},
"facing=east,half=upper,hinge=right,open=true": {
"model": "tfc:door_top_tfc",
"y": 270
},
"facing=south,half=upper,hinge=right,open=true": {
"model": "tfc:door_top_tfc"
},
"facing=west,half=upper,hinge=right,open=true": {
"model": "tfc:door_top_tfc",
"y": 90
},
"facing=north,half=upper,hinge=right,open=true": {
"model": "tfc:door_top_tfc",
"y": 180
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"Uuid": "b84e9ee3-ddde-49ec-9a5e-62eb94d567ee",
"IsCustomNode": true,
"Category": "Clockwork.Geometry.Abstract.Actions",
"Description": "Returns the perimeter curve of a bounding box on a plane determined by a given normal and the centroid of the bounding box",
"Name": "BoundingBox.PerimeterCurvesByNormal",
"ElementResolver": {
"ResolutionMap": {
"Plane": {
"Key": "Autodesk.DesignScript.Geometry.Plane",
"Value": "ProtoGeometry.dll"
},
"List": {
"Key": "DSCore.List",
"Value": "DSCoreNodes.dll"
},
"Vector": {
"Key": "Autodesk.DesignScript.Geometry.Vector",
"Value": "ProtoGeometry.dll"
},
"BoundingBox": {
"Key": "Autodesk.DesignScript.Geometry.BoundingBox",
"Value": "ProtoGeometry.dll"
}
}
},
"Inputs": [],
"Outputs": [],
"Nodes": [
{
"ConcreteType": "Dynamo.Graph.Nodes.CustomNodes.Symbol, DynamoCore",
"NodeType": "InputNode",
"Parameter": {
"Name": "boundingbox",
"TypeName": "Autodesk.DesignScript.Geometry.BoundingBox",
"TypeRank": 0,
"DefaultValue": null,
"Description": ""
},
"Id": "4eb11c2b0ae749b0a72e596db06b022a",
"Inputs": [],
"Outputs": [
{
"Id": "f53564d5e3f844699742971b02ae99bf",
"Name": "",
"Description": "Symbol",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Disabled",
"Description": "A function parameter, use with custom nodes.\r\n\r\nYou can specify the type and default value for parameter. E.g.,\r\n\r\ninput : var[]..[]\r\nvalue : bool = false"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.CustomNodes.Output, DynamoCore",
"NodeType": "OutputNode",
"ElementResolver": null,
"Symbol": "curves",
"Id": "a042e70b1543465e8283167975ae5afd",
"Inputs": [
{
"Id": "5da307bc3b744ea888746c2a1614d172",
"Name": "",
"Description": "",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [],
"Replication": "Disabled",
"Description": "A function output, use with custom nodes"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.ZeroTouch.DSFunction, DynamoCore",
"NodeType": "FunctionNode",
"FunctionSignature": "Autodesk.DesignScript.Geometry.Plane.ByOriginNormal@Autodesk.DesignScript.Geometry.Point,Autodesk.DesignScript.Geometry.Vector",
"Id": "16cca4ebe6e54d10ac333b4296efc556",
"Inputs": [
{
"Id": "53b40b78fc0246508ccd8a4cb58b03c3",
"Name": "origin",
"Description": "Point\nDefault value : Autodesk.DesignScript.Geometry.Point.ByCoordinates(0, 0, 0)",
"UsingDefaultValue": true,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
},
{
"Id": "c74176dde61a4cdd928d70a5dc7c43a6",
"Name": "normal",
"Description": "Vector\nDefault value : Autodesk.DesignScript.Geometry.Vector.ByCoordinates(0, 0, 1)",
"UsingDefaultValue": true,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "2be26fcefc9f4dd0a81368341dde09c8",
"Name": "Plane",
"Description": "Plane",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "Create a Plane centered at root Point, with input normal Vector.\n\nPlane.ByOriginNormal (origin: Point = Autodesk.DesignScript.Geometry.Point.ByCoordinates(0, 0, 0), normal: Vector = Autodesk.DesignScript.Geometry.Vector.ByCoordinates(0, 0, 1)): Plane"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.CustomNodes.Function, DynamoCore",
"FunctionSignature": "eef82f03-2a97-41cd-986a-0ce973604ab8",
"FunctionType": "Graph",
"NodeType": "FunctionNode",
"Id": "a676216a6ad344a1a5d4554c734d5c8d",
"Inputs": [
{
"Id": "2c14eeffa8394dc6aba3735d49c4ddf7",
"Name": "points",
"Description": "Input #1",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "b3ad58f668be4ad0b50dca89880ce972",
"Name": "Point",
"Description": "Output #1",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "Determines the average of a list of points"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.ZeroTouch.DSFunction, DynamoCore",
"NodeType": "FunctionNode",
"FunctionSignature": "DSCore.List.Transpose@var[]..[]",
"Id": "ef6191a51f414e74a11e8eef4e943570",
"Inputs": [
{
"Id": "d122e80ae9e541ddbb2b2ae8f244a6ab",
"Name": "lists",
"Description": "A list of lists to be transposed.\n\nvar[]..[]",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "e26bd53f69e04c448e4e7df7d5d5727f",
"Name": "lists",
"Description": "A list of transposed lists.",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "Swaps rows and columns in a list of lists. If there are some rows that are shorter than others, null values are inserted as place holders in the resultant array such that it is always rectangular.\n\nList.Transpose (lists: var[]..[]): var[]..[]"
},
{
"ConcreteType": "CoreNodeModels.CreateList, CoreNodeModels",
"VariableInputPorts": true,
"NodeType": "ExtensionNode",
"Id": "37883d3f3d3b44feafc6cc45eb7d1774",
"Inputs": [
{
"Id": "3f72d0b32d5d46e3bbb9b0b6c25c5e2f",
"Name": "item0",
"Description": "Item Index #0",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
},
{
"Id": "d10b53b4df3a44ca8a2aa170f6fb7dd9",
"Name": "item1",
"Description": "Item Index #1",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "4062f1b287b64f52bc3115428773b60b",
"Name": "list",
"Description": "A list",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Disabled",
"Description": "Makes a new list out of the given inputs"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.ZeroTouch.DSFunction, DynamoCore",
"NodeType": "FunctionNode",
"FunctionSignature": "Autodesk.DesignScript.Geometry.BoundingBox.MinPoint",
"Id": "e3df7c49f745405780ea95fe78dbea7e",
"Inputs": [
{
"Id": "ff1a3816e4c3458ea2135d82dff08eb1",
"Name": "boundingBox",
"Description": "Autodesk.DesignScript.Geometry.BoundingBox",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "ac789ac7410b4ec3b80e89bde5e8ae47",
"Name": "Point",
"Description": "Point",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "The minimum point\n\nBoundingBox.MinPoint: Point"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.ZeroTouch.DSFunction, DynamoCore",
"NodeType": "FunctionNode",
"FunctionSignature": "Autodesk.DesignScript.Geometry.BoundingBox.MaxPoint",
"Id": "19460fe2a1494c4e8c8ef4ec8d75c96e",
"Inputs": [
{
"Id": "29f00682990c4f76b4aa812f32a6bfbb",
"Name": "boundingBox",
"Description": "Autodesk.DesignScript.Geometry.BoundingBox",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "6dc6eae10e1e4b969ebcea2b07f3ecb9",
"Name": "Point",
"Description": "Point",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "The maximum point\n\nBoundingBox.MaxPoint: Point"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.CustomNodes.Symbol, DynamoCore",
"NodeType": "InputNode",
"Parameter": {
"Name": "normal",
"TypeName": "Autodesk.DesignScript.Geometry.Vector",
"TypeRank": 0,
"DefaultValue": null,
"Description": ""
},
"Id": "6ec91bbe61aa43c98f7529b59a2885a2",
"Inputs": [],
"Outputs": [
{
"Id": "d3ffeff0e87542a9b902e84be9ebcab8",
"Name": "",
"Description": "Symbol",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Disabled",
"Description": "A function parameter, use with custom nodes.\r\n\r\nYou can specify the type and default value for parameter. E.g.,\r\n\r\ninput : var[]..[]\r\nvalue : bool = false"
},
{
"ConcreteType": "Dynamo.Graph.Nodes.CustomNodes.Function, DynamoCore",
"FunctionSignature": "7478de60-c425-4004-a9a5-3f207837feab",
"FunctionType": "Graph",
"NodeType": "FunctionNode",
"Id": "f01bb743c43d4e36b263d24f180a23fb",
"Inputs": [
{
"Id": "5b5f2196b60e4f9f99526acc942ed7d9",
"Name": "boundingbox",
"Description": "BoundingBox",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
},
{
"Id": "670fbaa9f64b46a4b59f1f5a89025c5e",
"Name": "plane",
"Description": "Plane",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Outputs": [
{
"Id": "5913b174966a48deb8d5a5bcc0d69269",
"Name": "curves",
"Description": "return value",
"UsingDefaultValue": false,
"Level": 2,
"UseLevels": false,
"KeepListStructure": false
}
],
"Replication": "Auto",
"Description": "Returns the perimeter curve of a bounding box on a given plane (assuming that the bounding box and plane intersect)"
}
],
"Connectors": [
{
"Start": "f53564d5e3f844699742971b02ae99bf",
"End": "29f00682990c4f76b4aa812f32a6bfbb",
"Id": "bc9ae69496fc44c39262f45ed4bffba6"
},
{
"Start": "f53564d5e3f844699742971b02ae99bf",
"End": "ff1a3816e4c3458ea2135d82dff08eb1",
"Id": "310a0ce8ea2f41ada11e4f52d499b615"
},
{
"Start": "f53564d5e3f844699742971b02ae99bf",
"End": "5b5f2196b60e4f9f99526acc942ed7d9",
"Id": "56586438d1cc4b5098f25d86319a34ef"
},
{
"Start": "2be26fcefc9f4dd0a81368341dde09c8",
"End": "670fbaa9f64b46a4b59f1f5a89025c5e",
"Id": "92867238c6fa4d13aa72de7e17b6236c"
},
{
"Start": "b3ad58f668be4ad0b50dca89880ce972",
"End": "53b40b78fc0246508ccd8a4cb58b03c3",
"Id": "f30fcce0679b4aff9ac5c849b3207486"
},
{
"Start": "e26bd53f69e04c448e4e7df7d5d5727f",
"End": "2c14eeffa8394dc6aba3735d49c4ddf7",
"Id": "f0ad8b9853984c5dbc0c66c6401a44cb"
},
{
"Start": "4062f1b287b64f52bc3115428773b60b",
"End": "d122e80ae9e541ddbb2b2ae8f244a6ab",
"Id": "e302bd8469de4e8896fb147e9e8c371a"
},
{
"Start": "ac789ac7410b4ec3b80e89bde5e8ae47",
"End": "d10b53b4df3a44ca8a2aa170f6fb7dd9",
"Id": "20580c6dda794021b493ab6d427a7402"
},
{
"Start": "6dc6eae10e1e4b969ebcea2b07f3ecb9",
"End": "3f72d0b32d5d46e3bbb9b0b6c25c5e2f",
"Id": "167d9d7735804f86985c9beb9bc6bc41"
},
{
"Start": "d3ffeff0e87542a9b902e84be9ebcab8",
"End": "c74176dde61a4cdd928d70a5dc7c43a6",
"Id": "4743339fa58c4922adb544223b82f136"
},
{
"Start": "5913b174966a48deb8d5a5bcc0d69269",
"End": "5da307bc3b744ea888746c2a1614d172",
"Id": "66c22b3e16a74135bda0d00cfb97ab4c"
}
],
"Dependencies": [
"eef82f03-2a97-41cd-986a-0ce973604ab8",
"7478de60-c425-4004-a9a5-3f207837feab"
],
"Bindings": [],
"View": {
"Dynamo": {
"ScaleFactor": 1.0,
"HasRunWithoutCrash": false,
"IsVisibleInDynamoLibrary": true,
"Version": "2.0.1.5055",
"RunType": "Manual",
"RunPeriod": "1000"
},
"Camera": {
"Name": "Background Preview",
"EyeX": -29.580528259277344,
"EyeY": 31.883533477783203,
"EyeZ": 40.458560943603516,
"LookX": 32.454364776611328,
"LookY": -20.619636535644531,
"LookZ": -46.888641357421875,
"UpX": 0.074285976588726044,
"UpY": 0.99144488573074341,
"UpZ": -0.10732511430978775
},
"NodeViews": [
{
"Id": "4eb11c2b0ae749b0a72e596db06b022a",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "Input",
"ShowGeometry": true,
"Excluded": false,
"X": -592.385580893397,
"Y": 504.300939284791
},
{
"Id": "a042e70b1543465e8283167975ae5afd",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "Output",
"ShowGeometry": true,
"Excluded": false,
"X": 1240.89709745433,
"Y": 495.510711841891
},
{
"Id": "16cca4ebe6e54d10ac333b4296efc556",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "Plane.ByOriginNormal",
"ShowGeometry": true,
"Excluded": false,
"X": 669.679626311542,
"Y": 552.541219302327
},
{
"Id": "a676216a6ad344a1a5d4554c734d5c8d",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "Point.Average",
"ShowGeometry": true,
"Excluded": false,
"X": 408.511843545682,
"Y": 370.101688632351
},
{
"Id": "ef6191a51f414e74a11e8eef4e943570",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "List.Transpose",
"ShowGeometry": true,
"Excluded": false,
"X": 181.391566541602,
"Y": 370.101688632351
},
{
"Id": "37883d3f3d3b44feafc6cc45eb7d1774",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "List.Create",
"ShowGeometry": true,
"Excluded": false,
"X": -1.52475011475769,
"Y": 370.101688632351
},
{
"Id": "e3df7c49f745405780ea95fe78dbea7e",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "BoundingBox.MinPoint",
"ShowGeometry": true,
"Excluded": false,
"X": -276.664742828262,
"Y": 428.659515778673
},
{
"Id": "19460fe2a1494c4e8c8ef4ec8d75c96e",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "BoundingBox.MaxPoint",
"ShowGeometry": true,
"Excluded": false,
"X": -279.26040313688,
"Y": 320.939612971026
},
{
"Id": "6ec91bbe61aa43c98f7529b59a2885a2",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "Input",
"ShowGeometry": true,
"Excluded": false,
"X": 425.813047714933,
"Y": 579.823357981978
},
{
"Id": "f01bb743c43d4e36b263d24f180a23fb",
"IsSetAsInput": false,
"IsSetAsOutput": false,
"Name": "BoundingBox.PerimeterCurvesOnPlane",
"ShowGeometry": true,
"Excluded": false,
"X": 920.803710388796,
"Y": 497.071953290483
}
],
"Annotations": [],
"X": 481.477287212814,
"Y": 16.8171347617924,
"Zoom": 0.690081829640234
}
}
|
{
"pile_set_name": "Github"
}
|
{
"itemName" : "splittergun",
"level" : 5,
"price" : 1500,
"maxStack" : 1,
"rarity" : "rare",
"description" : "The peglaci honed them, but you perfected them. A devastating weapon.",
"shortdescription" : "Fissure Splitrifle",
"tooltipKind" : "gun2",
"category" : "shotgun",
"twoHanded" : true,
"itemTags" : ["weapon","ranged","shotgun", "energy", "upgradeableWeapon"],
"inventoryIcon" : [
{ "image" : "splittergun.png:idle.1" }
],
"animation" : "splittergun.animation",
"animationParts" : {
"butt" : "",
"middle" : "splittergun.png",
"middlefullbright" : "splittergunfullbright.png",
"barrel" : "",
"muzzleFlash" : ""
},
"animationCustom" : {
"lights" : { "glow" : {
"active" : true,
"position" : [0.75, 0.5],
"color" : [10, 0, 50]
}},
"sounds" : {
"fire" : [ "/sfx/gun/plasma_shotgun3.ogg" ]
}
},
"baseOffset" : [0.87, 0.35],
"muzzleOffset" : [1.0, 0.125],
"scripts" : ["/items/active/weapons/ranged/gun.lua"],
"elementalType" : "poison",
"primaryAbility" : {
"scripts" : ["/items/active/weapons/ranged/gunfire.lua"],
"class" : "GunFire",
"fireTime" : 1.2,
"baseDps" : 6.55,
"energyUsage" : 30,
"inaccuracy" : 0.1,
"fireType" : "auto",
"projectileType" : "splittergunshot1",
"projectileParameters" : {
"knockback" : 15
},
"projectileCount" : 10,
"stances" : {
"idle" : {
"armRotation" : 0,
"weaponRotation" : 0,
"twoHanded" : true,
"allowRotate" : true,
"allowFlip" : true
},
"fire" : {
"duration" : 0,
"armRotation" : 2,
"weaponRotation" : 2,
"twoHanded" : true,
"allowRotate" : false,
"allowFlip" : false
},
"cooldown" : {
"duration" : 0.15,
"armRotation" : 3,
"weaponRotation" : 3,
"twoHanded" : true,
"allowRotate" : false,
"allowFlip" : false
}
}
},
"critChance" : 4,
"critBonus" : 6,
//recoil
"hasRecoil" : 1,
"recoilSpeed" : 200,
"recoilForce" : 200,
"altAbilityType" : "splittergunshotpower",
"builder" : "/items/buildscripts/buildunrandweapon.lua"
}
|
{
"pile_set_name": "Github"
}
|
{
"framework": "express",
"tests": [{
"default": {
"json_url": "/json",
"plaintext_url": "/plaintext",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"platform": "nodejs",
"webserver": "None",
"os": "Linux",
"database_os": "Linux",
"display_name": "express",
"versus": "nodejs"
},
"chakra": {
"json_url": "/json",
"plaintext_url": "/plaintext",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"framework": "express",
"language": "JavaScript",
"flavor": "node-chakracore",
"platform": "nodejs",
"webserver": "None",
"os": "Linux",
"database_os": "Linux",
"display_name": "express",
"versus": "nodejs"
},
"mongodb": {
"db_url": "/mongoose",
"query_url": "/mongooseq?queries=",
"update_url": "/mongoose-update?queries=",
"fortune_url": "/mongoose-fortune",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"database": "MongoDB",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"platform": "nodejs",
"webserver": "None",
"orm": "Full",
"os": "Linux",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "nodejs"
},
"mysql": {
"db_url": "/mysql-orm",
"query_url": "/mysql-orm-query?queries=",
"fortune_url": "/mysql-orm-fortune",
"update_url": "/mysql-orm-update?queries=",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"database": "MySQL",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"platform": "nodejs",
"webserver": "None",
"orm": "Full",
"os": "Linux",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "nodejs"
},
"postgres": {
"db_url": "/db",
"query_url": "/queries?queries=",
"update_url": "/updates?queries=",
"fortune_url": "/fortunes",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"database": "Postgres",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"platform": "nodejs",
"webserver": "None",
"orm": "Full",
"os": "Linux",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "nodejs"
},
"graphql-mysql": {
"json_url": "/json",
"plaintext_url": "/plaintext",
"db_url": "/db",
"query_url": "/queries?queries=",
"fortune_url": "/fortunes",
"update_url": "/updates?queries=",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"orm": "Full",
"platform": "NodeJS",
"webserver": "None",
"os": "Linux",
"database": "MySQL",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "None"
},
"graphql-postgres": {
"db_url": "/db",
"query_url": "/queries?queries=",
"update_url": "/updates?queries=",
"fortune_url": "/fortunes",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"orm": "Full",
"platform": "NodeJS",
"webserver": "None",
"os": "Linux",
"database": "Postgres",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "None"
},
"graphql-mongodb": {
"db_url": "/db",
"query_url": "/queries?queries=",
"fortune_url": "/fortunes",
"update_url": "/updates?queries=",
"port": 8080,
"approach": "Realistic",
"classification": "Micro",
"framework": "express",
"language": "JavaScript",
"flavor": "NodeJS",
"orm": "Full",
"platform": "NodeJS",
"webserver": "None",
"os": "Linux",
"database": "MongoDB",
"database_os": "Linux",
"display_name": "express",
"notes": "",
"versus": "None"
}
}]
}
|
{
"pile_set_name": "Github"
}
|
{
"id": "MAP_UNDERWATER2",
"name": "Underwater2",
"layout": "LAYOUT_UNDERWATER2",
"music": "MUS_UNDERWATER",
"region_map_section": "MAPSEC_UNDERWATER_125",
"requires_flash": false,
"weather": "WEATHER_BUBBLES",
"map_type": "MAP_TYPE_UNDERWATER",
"show_map_name": true,
"battle_scene": "MAP_BATTLE_SCENE_NORMAL",
"connections": [
{
"direction": "up",
"offset": 0,
"map": "MAP_UNDERWATER1"
},
{
"direction": "right",
"offset": 0,
"map": "MAP_UNDERWATER3"
},
{
"direction": "emerge",
"offset": 0,
"map": "MAP_ROUTE126"
}
],
"object_events": [],
"warp_events": [
{
"x": 45,
"y": 65,
"elevation": 0,
"dest_map": "MAP_UNDERWATER_SOOTOPOLIS_CITY",
"dest_warp_id": 0
}
],
"coord_events": [],
"bg_events": [
{
"type": "hidden_item",
"x": 30,
"y": 17,
"elevation": 3,
"item": "ITEM_HEART_SCALE",
"flag": "FLAG_HIDDEN_ITEM_E"
},
{
"type": "hidden_item",
"x": 41,
"y": 19,
"elevation": 3,
"item": "ITEM_ULTRA_BALL",
"flag": "FLAG_HIDDEN_ITEM_F"
},
{
"type": "hidden_item",
"x": 63,
"y": 19,
"elevation": 3,
"item": "ITEM_STARDUST",
"flag": "FLAG_HIDDEN_ITEM_10"
},
{
"type": "hidden_item",
"x": 10,
"y": 36,
"elevation": 3,
"item": "ITEM_PEARL",
"flag": "FLAG_HIDDEN_ITEM_11"
},
{
"type": "hidden_item",
"x": 11,
"y": 39,
"elevation": 3,
"item": "ITEM_IRON",
"flag": "FLAG_HIDDEN_ITEM_13"
},
{
"type": "hidden_item",
"x": 12,
"y": 35,
"elevation": 3,
"item": "ITEM_YELLOW_SHARD",
"flag": "FLAG_HIDDEN_ITEM_12"
},
{
"type": "hidden_item",
"x": 65,
"y": 60,
"elevation": 3,
"item": "ITEM_BIG_PEARL",
"flag": "FLAG_HIDDEN_ITEM_14"
},
{
"type": "hidden_item",
"x": 9,
"y": 77,
"elevation": 3,
"item": "ITEM_BLUE_SHARD",
"flag": "FLAG_HIDDEN_ITEM_C"
}
]
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>CameraPhotos</folder>
<filename>2017-12-15 14:14:23.371901.jpg</filename>
<path>/Volumes/Untitled/CameraPhotos/2017-12-15 14:14:23.371901.jpg</path>
<source>
<database>Unknown</database>
</source>
<size>
<width>352</width>
<height>240</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>171</xmin>
<ymin>177</ymin>
<xmax>217</xmax>
<ymax>225</ymax>
</bndbox>
</object>
<object>
<name>truck</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>133</xmin>
<ymin>156</ymin>
<xmax>171</xmax>
<ymax>202</ymax>
</bndbox>
</object>
<object>
<name>bus</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>1</xmin>
<ymin>176</ymin>
<xmax>90</xmax>
<ymax>240</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>94</xmin>
<ymin>163</ymin>
<xmax>120</xmax>
<ymax>187</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>110</xmin>
<ymin>145</ymin>
<xmax>130</xmax>
<ymax>165</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>152</xmin>
<ymin>150</ymin>
<xmax>174</xmax>
<ymax>163</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>203</xmin>
<ymin>155</ymin>
<xmax>230</xmax>
<ymax>173</ymax>
</bndbox>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
[
{
"__type__": "cc.Prefab",
"_name": "progressBar",
"_objFlags": 0,
"_native": "",
"data": {
"__id__": 1
},
"optimizationPolicy": 1,
"asyncLoadAssets": false
},
{
"__type__": "cc.Node",
"_name": "progressBar",
"_objFlags": 0,
"_parent": null,
"_children": [
{
"__id__": 2
}
],
"_active": true,
"_level": 1,
"_components": [
{
"__id__": 5
},
{
"__id__": 6
}
],
"_prefab": {
"__id__": 7
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 300,
"height": 15
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_position": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_scale": {
"__type__": "cc.Vec3",
"x": 1,
"y": 1,
"z": 1
},
"_rotationX": 0,
"_rotationY": 0,
"_quat": {
"__type__": "cc.Quat",
"x": 0,
"y": 0,
"z": 0,
"w": 1
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 31,
"groupIndex": 0,
"_id": ""
},
{
"__type__": "cc.Node",
"_name": "bar",
"_objFlags": 0,
"_parent": {
"__id__": 1
},
"_children": [],
"_active": true,
"_level": 0,
"_components": [
{
"__id__": 3
}
],
"_prefab": {
"__id__": 4
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 150,
"height": 15
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0.5
},
"_position": {
"__type__": "cc.Vec3",
"x": -150,
"y": 0,
"z": 0
},
"_scale": {
"__type__": "cc.Vec3",
"x": 1,
"y": 1,
"z": 1
},
"_rotationX": 0,
"_rotationY": 0,
"_quat": {
"__type__": "cc.Quat",
"x": 0,
"y": 0,
"z": 0,
"w": 1
},
"_skewX": 0,
"_skewY": 0,
"_localZOrder": 0,
"groupIndex": 0,
"_id": ""
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 2
},
"_enabled": true,
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "67e68bc9-dad5-4ad9-a2d8-7e03d458e32f"
},
"_type": 1,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_state": 0,
"_atlas": null,
"_id": "0d1d9PxUhMQaIqbEeQOMan"
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "5965ffac-69da-4b55-bcde-9225d0613c28"
},
"fileId": "38d28QPqAdC1L4aQLAAwhV2",
"sync": false
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 1
},
"_enabled": true,
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "88e79fd5-96b4-4a77-a1f4-312467171014"
},
"_type": 1,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_state": 0,
"_atlas": null,
"_id": "5f+49n5OxKvJyWj5OaPMyR"
},
{
"__type__": "cc.ProgressBar",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 1
},
"_enabled": true,
"_N$totalLength": 100,
"_N$barSprite": {
"__id__": 3
},
"_N$mode": 0,
"_N$progress": 0.5,
"_N$reverse": false,
"_id": "ce2fPfJxtCm4VSE8G2FiuV"
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "5965ffac-69da-4b55-bcde-9225d0613c28"
},
"fileId": "c8bd6EVT6lD4bVMS1d/i0BC",
"sync": false
}
]
|
{
"pile_set_name": "Github"
}
|
[
{
"__type__": "cc.SceneAsset",
"_name": "",
"_objFlags": 0,
"_native": "",
"scene": {
"__id__": 1
}
},
{
"__type__": "cc.Scene",
"_objFlags": 0,
"_parent": null,
"_children": [
{
"__id__": 2
}
],
"_active": true,
"_components": [],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 0,
"height": 0
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
0,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_is3DNode": true,
"_groupIndex": 0,
"groupIndex": 0,
"autoReleaseAssets": false,
"_id": "b23d729e-ccd3-45cc-b478-e555f5c92388"
},
{
"__type__": "cc.Node",
"_name": "Canvas",
"_objFlags": 0,
"_parent": {
"__id__": 1
},
"_children": [
{
"__id__": 3
},
{
"__id__": 5
},
{
"__id__": 8
},
{
"__id__": 12
},
{
"__id__": 16
},
{
"__id__": 20
},
{
"__id__": 24
},
{
"__id__": 28
}
],
"_active": true,
"_components": [
{
"__id__": 32
},
{
"__id__": 33
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 1334,
"height": 750
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
667,
375,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "a5esZu+45LA5mBpvttspPD"
},
{
"__type__": "cc.Node",
"_name": "Main Camera",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 4
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 960,
"height": 640
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
0,
452.93128617926146,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "e1WoFrQ79G7r4ZuQE3HlNb"
},
{
"__type__": "cc.Camera",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 3
},
"_enabled": true,
"_cullingMask": 4294967295,
"_clearFlags": 7,
"_backgroundColor": {
"__type__": "cc.Color",
"r": 0,
"g": 0,
"b": 0,
"a": 255
},
"_depth": -1,
"_zoomRatio": 1,
"_targetTexture": null,
"_fov": 60,
"_orthoSize": 10,
"_nearClip": 1,
"_farClip": 4096,
"_ortho": true,
"_rect": {
"__type__": "cc.Rect",
"x": 0,
"y": 0,
"width": 1,
"height": 1
},
"_renderStages": 1,
"_alignWithScreen": true,
"_id": "81GN3uXINKVLeW4+iKSlim"
},
{
"__type__": "cc.Node",
"_name": "bg",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 6
},
{
"__id__": 7
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 1334,
"height": 750
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
0,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "5akH20vLVILZB3AY+h5czn"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 5
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "5640ff1a-66dc-4ba9-b0e5-8be4190a3333"
},
"_type": 0,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "23v6CmhqpAuoWjx2sHrHDM"
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 5
},
"_enabled": true,
"alignMode": 1,
"_target": null,
"_alignFlags": 45,
"_left": 0,
"_right": 0,
"_top": 0,
"_bottom": 0,
"_verticalCenter": 0,
"_horizontalCenter": 0,
"_isAbsLeft": true,
"_isAbsRight": true,
"_isAbsTop": true,
"_isAbsBottom": true,
"_isAbsHorizontalCenter": true,
"_isAbsVerticalCenter": true,
"_originalWidth": 2,
"_originalHeight": 2,
"_id": "ceamLjckJC375WoluXvqiT"
},
{
"__type__": "cc.Node",
"_name": "normal",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 9
}
],
"_active": true,
"_components": [
{
"__id__": 11
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
-410,
200,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "74S/kEuPhCnoacQ1+Pf3ib"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 8
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 10
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 80,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "8cdX6B7ttOTLvr9etci3pA"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 9
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "原图",
"_N$string": "原图",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "6eqiD2gTtKO4oVx2zRA3K0"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 8
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "01NM2EHhtEAYbpUmhZA24n"
},
{
"__type__": "cc.Node",
"_name": "brown",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 13
}
],
"_active": true,
"_components": [
{
"__id__": 15
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
200,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "4c9GI7EnFPqJUXVqmvdYcd"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 12
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 14
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 226.64,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "f9ndFxuh5OjrHNLeUsPohV"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 13
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "褐色(老照片)",
"_N$string": "褐色(老照片)",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "3dC0IHbj9EwaMN499wXHEx"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 12
},
"_enabled": true,
"_materials": [
{
"__uuid__": "e697bd51-81a4-4e3a-9e4c-cdef6af6e7ca"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "8d5QhJi8ZJNJKD8ru8dei4"
},
{
"__type__": "cc.Node",
"_name": "gray",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 17
}
],
"_active": true,
"_components": [
{
"__id__": 19
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
410,
200,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "fdnNbGqQZIbLepF3cp1SDR"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 16
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 18
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 200,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "32vBnSIGNDJaWfwd/EdlUM"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 17
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "去色、灰色",
"_N$string": "去色、灰色",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "5cbJ+bbgBIabHIFL6QIkvV"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 16
},
"_enabled": true,
"_materials": [
{
"__uuid__": "d33b6c67-cde8-433f-91ed-cce8f99db941"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "a4BjykBp9FI62liMS51CaR"
},
{
"__type__": "cc.Node",
"_name": "reversal",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 21
}
],
"_active": true,
"_components": [
{
"__id__": 23
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
-410,
-140,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "aebhqiZJlFVaBbA9YHxEan"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 20
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 22
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 80,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "c2JyEb/7dHIKEMujvWITSG"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 21
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "反相",
"_N$string": "反相",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "8aw+nrFcpPJ46cUV/k5MYQ"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 20
},
"_enabled": true,
"_materials": [
{
"__uuid__": "b404cbda-3e82-403a-8202-084b5719345a"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "8fl2W172pCbqtN9Gbcho/p"
},
{
"__type__": "cc.Node",
"_name": "frozen",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 25
}
],
"_active": true,
"_components": [
{
"__id__": 27
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-140,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "6036Lc/FZER7dQGKxlL8gP"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 24
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 26
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 80,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "cfgaF4OA1J6KNbsMS5qiXa"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 25
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "冰冻",
"_N$string": "冰冻",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "f0gmrGB1RDpKIn/FKtwc3r"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 24
},
"_enabled": true,
"_materials": [
{
"__uuid__": "82d5bfd4-a190-47f0-a20e-282a0068737b"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "100yWz2/9Ihpb1UlXO3HcS"
},
{
"__type__": "cc.Node",
"_name": "cartoon",
"_objFlags": 0,
"_parent": {
"__id__": 2
},
"_children": [
{
"__id__": 29
}
],
"_active": true,
"_components": [
{
"__id__": 31
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 500,
"height": 375
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
410,
-140,
0,
0,
0,
0,
1,
0.7,
0.7,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "5cRB1/HgBGyYgExyHic/wJ"
},
{
"__type__": "cc.Node",
"_name": "label",
"_objFlags": 0,
"_parent": {
"__id__": 28
},
"_children": [],
"_active": true,
"_components": [
{
"__id__": 30
}
],
"_prefab": null,
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 80,
"height": 50.4
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
-230,
0,
0,
0,
0,
1,
1,
1,
1
]
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"_groupIndex": 0,
"groupIndex": 0,
"_id": "d2rfwfhGVIibPj+sphSqYw"
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 29
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "卡通",
"_N$string": "卡通",
"_fontSize": 40,
"_lineHeight": 40,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_styleFlags": 0,
"_underlineHeight": 0,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 1,
"_id": "1ailvRGIBPCLnAEiY+0RcO"
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 28
},
"_enabled": true,
"_materials": [
{
"__uuid__": "33274f30-e75f-40b1-ac3f-cea71b7ba496"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "47667903-c979-4668-b039-50fe9a95c12a"
},
"_type": 0,
"_sizeMode": 1,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": "99iUVmC9RGSYHbV9CyQwxB"
},
{
"__type__": "cc.Canvas",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 2
},
"_enabled": true,
"_designResolution": {
"__type__": "cc.Size",
"width": 1334,
"height": 750
},
"_fitWidth": false,
"_fitHeight": true,
"_id": "59Cd0ovbdF4byw5sbjJDx7"
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 2
},
"_enabled": true,
"alignMode": 1,
"_target": null,
"_alignFlags": 45,
"_left": 0,
"_right": 0,
"_top": 0,
"_bottom": 0,
"_verticalCenter": 0,
"_horizontalCenter": 0,
"_isAbsLeft": true,
"_isAbsRight": true,
"_isAbsTop": true,
"_isAbsBottom": true,
"_isAbsHorizontalCenter": true,
"_isAbsVerticalCenter": true,
"_originalWidth": 0,
"_originalHeight": 0,
"_id": "29zXboiXFBKoIV4PQ2liTe"
}
]
|
{
"pile_set_name": "Github"
}
|
########################
Configuring SNMP Support
########################
Keepalived provides an SNMP subsystem that can gather various metrics about the
VRRP stack and the health checker system. The keepalived MIB is in
the ``doc`` directory of the project. The base SNMP OID for the MIB is
`.1.3.6.1.4.1.9586.100.5`, which is hosted under the `Debian OID space`_
assigned by IANA.
.. _Debian OID space: https://dsa.debian.org/iana/
Prerequisites *************
Install the SNMP protocol tools and libraries onto your system. This requires
the installation of a few packages::
yum install net-snmp net-snmp-utils net-snmp-libs
Once SNMP has been installed on your system, configure keepalived with SNMP
support. When compiling keepalived, add the ``--enable-snmp`` configure
option. For example::
./configure --enable-snmp
During the configure step of the compiling process, you will get a
configuration summary before building with ``make``. For example, you may see
similar output on a CentOS 6 machine::
./configure --prefix=/usr/local/keepalived-1.2.15 --enable-snmp
Keepalived configuration
------------------------
Keepalived version : 1.2.15
Compiler : gcc
Compiler flags : -g -O2 -I/usr/include/libnl3
Extra Lib : -Wl,-z,relro -Wl,-z,now -L/usr/lib64
-lnetsnmpagent -lnetsnmphelpers -lnetsnmpmibs -lnetsnmp -Wl,-E
-Wl,-rpath,/usr/lib64/perl5/CORE -lssl -lcrypto -lcrypt -lnl-genl-3 -lnl-3
Use IPVS Framework : Yes
IPVS sync daemon support : Yes
IPVS use libnl : Yes
fwmark socket support : Yes
Use VRRP Framework : Yes
Use VRRP VMAC : Yes
SNMP support : Yes
SHA1 support : No
Use Debug flags : No
Notice the *Extra Lib* section of the configuration summary. It lists various
library flags that gcc will use to build keepalived, several of which have to do with
SNMP.
Configuring Support
*******************
Enable SNMP AgentX support by including the following line in the SNMP
daemon configuration file, typically ``/etc/snmp/snmpd.conf`` if you installed
via RPMs on a CentOS machine::
master agentx
.. note::
Be sure to reload or restart the SNMP service for the configuration change
to take effect.
Adding the MIB
**************
You can query keepalived SNMP managed objects by using the OID. For example::
snmpwalk -v2c -c public localhost .1.3.6.1.4.1.9586.100.5.1.1.0
SNMPv2-SMI::enterprises.9586.100.5.1.1.0 = STRING: "Keepalived v1.2.15 (01/10,2015)"
Alternatively, with the keepalived MIB, you can query using the MIB available
from the project. First, copy the MIB to the system's global MIB directory or
to the user's local MIB directory::
cp /usr/local/src/keepalived-1.2.15/doc/KEEPALIVED-MIB /usr/share/snmp/mibs
or::
cp /usr/local/src/keepalived-1.2.15/doc/KEEPALIVED-MIB ~/.snmp/mibs
The SNMP daemon will check both directories for the existence of the MIB. Once
the MIB is in place, the SNMP query can look as follows::
snmpwalk -v2c -c public localhost KEEPALIVED-MIB::version
KEEPALIVED-MIB::version.0 = STRING: Keepalived v1.2.15 (01/10,2015)
MIB Overview
************
There are four main sections to the keepalived MIB:
* global
* vrrp
* check
* conformance
Global
======
The global section includes objects that contain information about the
keepalived instance such as version, router ID and administrative email
addresses.
VRRP
====
The VRRP section includes objects that contain information about each
configured VRRP instance. Within each instance, there are objects that include
instance name, current state, and virtual IP addresses.
Check
=====
The Check section includes objects that contain information about each
configured virtual server. It includes server tables for virtual and real
servers and also configured load balancing algorithms, load balancing method,
protocol, status, real and virtual server network connection statistics.
Conformance
===========
.. todo::
do conformance
.. note::
Use a MIB browser, such as mbrowse, to see what managed objects are available to
query for monitoring the health of your LVS servers.
|
{
"pile_set_name": "Github"
}
|
{
"name": "libdvdread",
"full_name": "libdvdread",
"oldname": null,
"aliases": [
],
"versioned_formulae": [
],
"desc": "C library for reading DVD-video images",
"license": "GPL-2.0",
"homepage": "https://www.videolan.org/developers/libdvdnav.html",
"versions": {
"stable": "6.1.1",
"head": "HEAD",
"bottle": true
},
"urls": {
"stable": {
"url": "https://download.videolan.org/pub/videolan/libdvdread/6.1.1/libdvdread-6.1.1.tar.bz2",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 0,
"cellar": ":any",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/libdvdread-6.1.1.catalina.bottle.tar.gz",
"sha256": "83bebe58015f6f34973afa003934f183e7ac9202f5e579cfd12536f9ceac1719"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/libdvdread-6.1.1.mojave.bottle.tar.gz",
"sha256": "7405838fee2b93209c2bd0834db89c2a2334a94f7d368feb87599da1b08062f6"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/libdvdread-6.1.1.high_sierra.bottle.tar.gz",
"sha256": "c881a8c1c872d922f45bf8a692b9d79b5f6ade1a2f4a48d470d05491bc017436"
},
"x86_64_linux": {
"url": "https://linuxbrew.bintray.com/bottles/libdvdread-6.1.1.x86_64_linux.bottle.tar.gz",
"sha256": "0c5f9b444bdf360b956450b1f5cfa5e1a700abfb084fc7a472846774495c1fec"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
],
"dependencies": [
"libdvdcss"
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
],
"conflicts_with": [
],
"caveats": null,
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.zip.transit.json ===
insert-child {2 {:ret :vector}}
left {1 {:ret #{:vector :nil}}}
append-child {2 {:ret :vector}}
down {1 {:ret #{:vector :nil}}}
replace {2 {:ret :vector}}
zipper {4 {:ret :vector}}
end? {1 {:ret :boolean}}
edit {:varargs {:ret :vector, :min-arity 2}}
vector-zip {1 {:ret :vector}}
up {1 {:ret #{:vector :nil}}}
seq-zip {1 {:ret :vector}}
right {1 {:ret #{:vector :nil}}}
lefts {1 {:ret :seq}}
xml-zip {1 {:ret :vector}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.core.server.transit.json ===
thread {:varargs {:min-arity 2, :args (:nilable/string nil nil nil)}}
ex->data {2 {:ret :associative}}
remote-prepl {:varargs {:min-arity 4, :args (:nilable/string nil nil nil nil nil)}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.spec.gen.alpha.transit.json ===
qualified? {1 {:ret :boolean}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.test.transit.json ===
file-position {1 {:ret :vector}}
file-and-line {2 {:ret #{{:type :map, :val {:file {:row 341, :col 16, :end-row 341, :end-col 32}, :line {:row 341, :col 39, :end-row 341, :end-col 57}}} {:type :map, :val {:file {:row 342, :col 14, :end-row 342, :end-col 17, :tag :nil}, :line {:row 342, :col 24, :end-row 342, :end-col 27, :tag :nil}}}}}}
stacktrace-file-and-line {1 {:ret #{{:type :map, :val {:file {:row 349, :col 12, :end-row 349, :end-col 15, :tag :nil}, :line {:row 349, :col 22, :end-row 349, :end-col 25, :tag :nil}}} {:type :map, :val {:file {:row 348, :col 14, :end-row 348, :end-col 30}, :line {:row 348, :col 37, :end-row 348, :end-col 55}}}}}}
compose-fixtures {2 {:ret :fn}}
function? {1 {:ret #{:nil :boolean}}}
successful? {1 {:ret #{:nil :boolean}}}
testing-vars-str {1 {:ret :string}}
run-tests {0 {:ret :associative}, :varargs {:ret :associative, :min-arity 0}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.math.BigInteger.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Math.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.CharSequence.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.datafy.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.java.shell.transit.json ===
parse-args {1 {:ret :vector}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Double.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Thread.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.core.specs.alpha.transit.json ===
even-number-of-forms? {1 {:ret :boolean}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.core.protocols.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.test.junit.transit.json ===
suite-attrs {2 {:ret #{{:type :map, :val {:name {:row 99, :col 22, :end-row 99, :end-col 31}}}}}}
package-class {1 {:ret #{:vector}}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.pprint.transit.json ===
toks {1 {:ret :seq}}
brackets {1 {:ret #{:vector}}}
get-section {1 {:ret :vector}}
buffer-length {1 {:ret #{:number :nat-int}}}
integral? {1 {:ret #{:nil :boolean}}}
write-initial-lines {2 {:args (nil :nilable/string)}}
insert-scaled-decimal {2 {:ret #{:string}}}
round-str {4 {:ret #{:vector}}}
float-parts-base {1 {:ret #{:vector}}}
set-max-column {2 {:ret :nil}}
c-write-char {2 {:args (nil :nilable/int)}}
realize-parameter-list {2 {:ret :vector}}
get-format-arg {1 {:ret :vector}}
split-at-newline {1 {:ret :vector}}
group-by* {2 {:ret :seq}}
insert-decimal {2 {:ret #{:string}}}
realize-parameter {2 {:ret :vector}}
get-sub-section {1 {:ret :seq}}
execute-format {2 {:ret :nil}}
inc-s {1 {:args (:nilable/string)}}
unzip-map {1 {:ret :vector}}
next-arg-or-nil {1 {:ret #{:vector}}}
format-simple-ordinal {1 {:ret :string}}
start-block {4 {:args (nil :nilable/string :nilable/string :nilable/string)}}
process-directive-table-element {1 {:ret :vector}}
set-pprint-dispatch {1 {:ret :nil}}
remainders {2 {:ret :seq}}
process-bracket {2 {:ret :vector}}
translate-param {1 {:ret :vector}}
pprint-reader-macro {1 {:ret #{:nil :boolean}}}
compile-directive {2 {:ret :vector}}
two-forms {1 {:ret {:type :map, :val {}}}}
add-core-ns {1 {:ret {:type :map, :val {}}}}
format-simple-cardinal {1 {:ret :string}}
float-parts {1 {:ret #{:vector}}}
get-fixed {3 {:ret #{:string}}}
abort? {1 {:ret #{:boolean}}}
map-params {4 {:ret :nilable/map}}
p-write-char {2 {:args (nil :nilable/int)}}
tokens-fit? {2 {:ret #{:boolean}}}
tuple-map {2 {:ret {:type :map, :val {}}}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.spec.alpha.transit.json ===
alt-impl {3 {:ret :associative}}
pvalid? {2 {:ret :boolean}, 3 {:ret :boolean}}
explain-data* {5 {:ret #{{:type :map, :val {:user/problems {:row 214, :col 19, :end-row 214, :end-col 24, :tag {:call {:filename clojure/spec/alpha.clj, :type :call, :lang :clj, :base-lang :clj, :resolved-ns clojure.spec.alpha, :ns clojure.spec.alpha, :name explain*, :arity 5}}}, :user/spec {:row 215, :col 15, :end-row 215, :end-col 19}, :user/value {:row 216, :col 16, :end-row 216, :end-col 17}}} :nil}}}
fn-sym {1 {:ret #{:symbol :nil}}}
inst-in-range? {3 {:ret #{:nil :boolean}}}
accept? {1 {:ret :boolean}}
accept {1 {:ret {:type :map, :val {:user/op {:row 1375, :col 25, :end-row 1375, :end-col 33, :tag :keyword}, :ret {:row 1375, :col 39, :end-row 1375, :end-col 40}}}}}
valid? {2 {:ret :boolean}, 3 {:ret :boolean}}
int-in-range? {3 {:ret #{:nil :boolean}}}
exercise {1 {:ret :seq}, 2 {:ret :seq}, 3 {:ret :seq}}
explain-data {2 {:ret #{{:type :map, :val {:user/problems {:row 214, :col 19, :end-row 214, :end-col 24, :tag {:call {:filename clojure/spec/alpha.clj, :type :call, :lang :clj, :base-lang :clj, :resolved-ns clojure.spec.alpha, :ns clojure.spec.alpha, :name explain*, :arity 5}}}, :user/spec {:row 215, :col 15, :end-row 215, :end-col 19}, :user/value {:row 216, :col 16, :end-row 216, :end-col 17}}} :nil}}}
inck {2 {:ret :associative}}
invalid? {1 {:ret :boolean}}
amp-impl {4 {:ret {:type :map, :val {:user/op {:row 1416, :col 9, :end-row 1416, :end-col 14, :tag :keyword}, :p1 {:row 1416, :col 19, :end-row 1416, :end-col 21}, :amp {:row 1416, :col 27, :end-row 1416, :end-col 34}, :ps {:row 1416, :col 39, :end-row 1416, :end-col 44}, :forms {:row 1416, :col 52, :end-row 1416, :end-col 62}}}}}
rep-impl {2 {:ret #{{:type :map, :val {:user/op {:row 1399, :col 19, :end-row 1399, :end-col 24, :tag :keyword}, :p2 {:row 1399, :col 30, :end-row 1399, :end-col 32}, :splice {:row 1399, :col 42, :end-row 1399, :end-col 48}, :forms {:row 1399, :col 57, :end-row 1399, :end-col 61}, :id {:row 1399, :col 66, :end-row 1399, :end-col 93}}} :nil}}}
filter-alt {4 {:ret #{:vector}}}
call-valid? {3 {:ret #{:nil :boolean}}}
rep* {5 {:ret #{{:type :map, :val {:user/op {:row 1399, :col 19, :end-row 1399, :end-col 24, :tag :keyword}, :p2 {:row 1399, :col 30, :end-row 1399, :end-col 32}, :splice {:row 1399, :col 42, :end-row 1399, :end-col 48}, :forms {:row 1399, :col 57, :end-row 1399, :end-col 61}, :id {:row 1399, :col 66, :end-row 1399, :end-col 93}}} :nil}}}
maybe-impl {2 {:ret :associative}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.stacktrace.transit.json ===
print-throwable {1 {:ret #{:nil}}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.System.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.string.transit.json ===
ends-with? {2 {:args (:nilable/char-sequence :nilable/string)}}
replace-first-char {3 {:args (:nilable/char-sequence :nilable/char nil)}}
capitalize {1 {:args (:nilable/char-sequence)}}
reverse {1 {:args (:nilable/char-sequence)}}
replace-first {3 {:args (:nilable/char-sequence nil nil)}}
replace-first-str {3 {:ret #{:nilable/string :string}, :args (:nilable/char-sequence :nilable/string :nilable/string)}}
starts-with? {2 {:args (:nilable/char-sequence :nilable/string)}}
escape {2 {:args (:nilable/char-sequence nil)}}
last-index-of {2 {:args (:nilable/char-sequence nil)}, 3 {:args (:nilable/char-sequence nil :int)}}
re-quote-replacement {1 {:args (:nilable/char-sequence)}}
includes? {2 {:args (:nilable/char-sequence :nilable/char-sequence)}}
replace {3 {:args (:nilable/char-sequence nil nil)}}
split-lines {1 {:args (:nilable/char-sequence)}}
lower-case {1 {:args (:nilable/char-sequence)}}
trim-newline {1 {:args (:nilable/char-sequence)}}
replace-by {3 {:args (:nilable/char-sequence nil nil)}}
replace-first-by {3 {:ret #{:nilable/char-sequence :string}, :args (:nilable/char-sequence nil nil)}}
upper-case {1 {:args (:nilable/char-sequence)}}
split {2 {:args (:nilable/char-sequence nil)}, 3 {:args (:nilable/char-sequence nil nil)}}
trimr {1 {:args (:nilable/char-sequence)}}
index-of {2 {:args (:nilable/char-sequence nil)}, 3 {:args (:nilable/char-sequence nil :int)}}
trim {1 {:args (:nilable/char-sequence)}}
triml {1 {:args (:nilable/char-sequence)}}
blank? {1 {:args (:nilable/char-sequence)}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.set.transit.json ===
union {0 {:ret :set}}
superset? {2 {:ret #{:nil :boolean}}}
subset? {2 {:ret #{:nil :boolean}}}
rename {2 {:ret :set}}
project {2 {:ret :set}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Boolean.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.java.io.transit.json ===
append? {1 {:ret :boolean}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.java.browse-ui.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.repl.transit.json ===
namespace-doc {1 {:ret :associative}}
special-doc {1 {:ret :associative}}
stack-element-str {1 {:ret :string}}
dir-fn {1 {:ret #{:list :seq}}}
thread-stopper {0 {:ret :fn}, 1 {:ret :fn}}
apropos {1 {:ret #{:list :seq}}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.inspector.transit.json ===
atom? {1 {:ret :boolean}}
collection-tag {1 {:ret #{:keyword :nil}}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.instant.transit.json ===
validated {1 {:ret :fn}}
zero-fill-right {2 {:args (:nilable/string nil)}}
leap-year? {1 {:ret #{:nil :boolean}}}
divisible? {2 {:ret :boolean}}
read-instant-timestamp {1 {:args (:nilable/char-sequence)}}
indivisible? {2 {:ret :boolean}}
parse-int {1 {:args (:nilable/string)}}
read-instant-calendar {1 {:args (:nilable/char-sequence)}}
read-instant-date {1 {:args (:nilable/char-sequence)}}
parse-timestamp {2 {:args (nil :nilable/char-sequence)}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Long.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.tools.reader.transit.json ===
unquote-splicing? {1 {:ret #{:nil :boolean}}}
starting-line-col-info {1 {:ret #{:vector :nil}}}
wrapping-reader {1 {:ret :fn}}
read+string {0 {:ret :vector}, 1 {:ret :vector}, 3 {:ret :vector}, 2 {:ret :vector}}
read-unicode-char {4 {:args (:nilable/string :int :int :int)}}
unquote? {1 {:ret #{:nil :boolean}}}
syntax-quote-coll {2 {:ret #{:list}}}
check-eof-error {3 {:args (nil nil :int)}}
check-invalid-read-cond {3 {:args (nil nil :int)}}
map-func {1 {:ret #{:symbol}}}
ending-line-col-info {1 {:ret #{:vector :nil}}}
garg {1 {:ret :symbol, :args (:int)}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.parallel.transit.json ===
pdistinct {1 {:ret :vector}}
pvec {1 {:ret :vector}}
pa-to-vec {1 {:ret :vector}}
psummary {1 {:ret {:type :map, :val {:min {:row 156, :col 9, :end-row 156, :end-col 17}, :max {:row 156, :col 23, :end-row 156, :end-col 31}, :size {:row 156, :col 38, :end-row 156, :end-col 47}, :min-index {:row 156, :col 59, :end-row 156, :end-col 74}, :max-index {:row 156, :col 86, :end-row 156, :end-col 101}}}}, 2 {:ret {:type :map, :val {:min {:row 156, :col 9, :end-row 156, :end-col 17}, :max {:row 156, :col 23, :end-row 156, :end-col 31}, :size {:row 156, :col 38, :end-row 156, :end-col 47}, :min-index {:row 156, :col 59, :end-row 156, :end-col 74}, :max-index {:row 156, :col 86, :end-row 156, :end-col 101}}}}}
pfilter-nils {1 {:ret :vector}}
summary-map {1 {:ret {:type :map, :val {:min {:row 156, :col 9, :end-row 156, :end-col 17}, :max {:row 156, :col 23, :end-row 156, :end-col 31}, :size {:row 156, :col 38, :end-row 156, :end-col 47}, :min-index {:row 156, :col 59, :end-row 156, :end-col 74}, :max-index {:row 156, :col 86, :end-row 156, :end-col 101}}}}}
psort {1 {:ret :vector}, 2 {:ret :vector}}
pfilter-dupes {1 {:ret :vector}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.main.transit.json ===
stack-element-str {1 {:ret :string}}
core-class? {1 {:args (:nilable/string)}}
java-loc->source {2 {:ret #{:symbol}}}
load-script {1 {:args (:nilable/string)}}
skip-if-eol {1 {:ret #{:keyword :nil}}}
file-name {1 {:args (:nilable/string)}}
file-path {1 {:args (:nilable/string)}}
ex-triage {1 {:ret :associative}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.walk.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.template.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.data.json.transit.json ===
codepoint-clause {1 {:ret #{:vector :nil}}}
write-double {2 {:args (:nilable/double nil)}}
read-integer {1 {:args (:nilable/string)}}
write-string {2 {:args (:nilable/char-sequence nil)}}
write-float {2 {:args (:nilable/double nil)}}
read-decimal {1 {:args (:nilable/string)}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.xml.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.core.reducers.transit.json ===
cat {1 {:ret :fn}}
monoid {2 {:ret :fn}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.String.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/java.math.BigDecimal.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Character.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.reflect.transit.json ===
access-flag {1 {:ret {:type :map, :val {:name {:row 57, :col 10, :end-row 57, :end-col 14}, :flag {:row 57, :col 21, :end-row 57, :end-col 25}, :contexts {:row 57, :col 36, :end-row 57, :end-col 64}}}}}
declared-constructors {1 {:ret :set}}
parse-method-descriptor {1 {:ret {:type :map, :val {:parameter-types {:row 193, :col 21, :end-row 193, :end-col 67}, :return-type {:row 194, :col 17, :end-row 194, :end-col 50}}}, :args (:nilable/string)}}
field-descriptor->class-symbol {1 {:args (:nilable/string)}}
declared-fields {1 {:ret :set}}
declared-methods {1 {:ret :set}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Integer.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.edn.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.java.browse.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.uuid.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.core.transit.json ===
+' {0 {:ret :nat-int}}
sort-by {2 {:ret #{:list :seq}}, 3 {:ret #{:list :seq}}}
is-runtime-annotation? {1 {:ret :boolean}}
keep-indexed {1 {:ret :fn}}
subs {2 {:ret :nilable/string, :args (:nilable/string nil)}, 3 {:ret :nilable/string, :args (:nilable/string nil nil)}}
reader-conditional {2 {:args (nil :nilable/boolean)}}
qualified-keyword? {1 {:ret :boolean}}
satisfies? {2 {:ret :boolean}}
take-nth {1 {:ret :fn}, 2 {:ret :seq}}
newline {0 {:ret :nil}}
dedupe {0 {:ret :fn}}
pr-on {2 {:ret :nil}}
mk-bound-fn {3 {:ret :fn}}
pr {0 {:ret :nil}, 1 {:ret :nil}}
= {1 {:ret :boolean}}
take {1 {:ret :fn}, 2 {:ret :seq}}
thread-bound? {:varargs {:ret :boolean, :min-arity 0}}
any? {1 {:ret :boolean}}
rand-int {1 {:ret :int}}
map {1 {:ret :fn}, 2 {:ret :seq}, 3 {:ret :seq}, 4 {:ret :seq}, :varargs {:ret :seq, :min-arity 4}}
juxt {1 {:ret :fn}, 2 {:ret :fn}, 3 {:ret :fn}, :varargs {:ret :fn, :min-arity 3}}
< {1 {:ret :boolean}}
make-hierarchy {0 {:ret {:type :map, :val {:parents {:row 5532, :col 16, :end-row 5532, :end-col 18, :tag {:type :map, :val {}}}, :descendants {:row 5532, :col 32, :end-row 5532, :end-col 34, :tag {:type :map, :val {}}}, :ancestors {:row 5532, :col 46, :end-row 5532, :end-col 48, :tag {:type :map, :val {}}}}}}}
keep {1 {:ret :fn}, 2 {:ret :seq}}
unchecked-long {1 {:args (:nilable/number)}}
some? {1 {:ret :boolean}}
get-super-and-interfaces {1 {:ret #{:vector}}}
remove-tap {1 {:ret :nil}}
inst? {1 {:ret :boolean}}
range {0 {:ret :seq}}
sort {1 {:ret #{:list :seq}}, 2 {:ret #{:list :seq}}}
generate-class {1 {:ret :vector}}
map-indexed {1 {:ret :fn}}
comp {2 {:ret :fn}}
simple-symbol? {1 {:ret #{:nil :boolean}}}
fnil {2 {:ret :fn}, 3 {:ret :fn}, 4 {:ret :fn}}
unchecked-float {1 {:args (:nilable/number)}}
cat {1 {:ret :fn}}
StackTraceElement->vec {1 {:ret :vector}}
flush {0 {:ret :nil}}
take-while {1 {:ret :fn}, 2 {:ret :seq}}
<= {1 {:ret :boolean}}
repeatedly {1 {:ret :seq}, 2 {:ret :seq}}
remove {1 {:ret :transducer}, 2 {:ret :seq}}
* {0 {:ret :pos-int}}
nary-inline {1 {:ret :fn}, 2 {:ret :fn}}
format {:varargs {:ret :nilable/string, :min-arity 1}}
bound? {:varargs {:ret :boolean, :min-arity 0}}
parse-opts+specs {1 {:ret :vector}}
interleave {1 {:ret :seq}, 2 {:ret :seq}, :varargs {:ret :seq, :min-arity 2}}
protocol? {1 {:ret :boolean}}
into {0 {:ret :vector}}
long {1 {:args (:nilable/number)}}
double {1 {:args (:nilable/number)}}
method-sig {1 {:ret :vector}}
hash-ordered-coll {1 {:ret :int}}
deref-as-map {1 {:ret {:type :map, :val {:status {:row 445, :col 6, :end-row 455, :end-col 14, :tag #{{:tag :keyword, :row 452, :col 7, :end-row 452, :end-col 15} {:tag :keyword, :row 449, :col 7, :end-row 449, :end-col 14} :nil}}, :val {:row 457, :col 11, :end-row 457, :end-col 14}}}}}
empty? {1 {:ret :boolean}}
short {1 {:args (:nilable/number)}}
pref {0 {:ret :nil}}
add-tap {1 {:ret :nil}}
unchecked-double {1 {:args (:nilable/number)}}
not= {1 {:ret :boolean}, 2 {:ret :boolean}, :varargs {:ret :boolean, :min-arity 2}}
fits-table? {1 {:ret :boolean}}
rand {1 {:ret :number}}
> {1 {:ret :boolean}}
replace {1 {:ret :transducer}}
unchecked-int {1 {:args (:nilable/number)}}
bound-fn* {1 {:ret :fn}}
prn {:varargs {:ret #{:nil}, :min-arity 0}}
extends? {2 {:ret :boolean}}
spread {1 {:ret #{:nil :seq}}}
agent-errors {1 {:ret #{:list :nil}}}
float {1 {:args (:nilable/number)}}
concat {0 {:ret :seq}, 1 {:ret :seq}, 2 {:ret :seq}}
valid-java-method-name {1 {:ret :boolean, :args (:nilable/string)}}
mod {2 {:ret #{:number}}}
reductions {2 {:ret :seq}}
hash-set {0 {:ret :set}}
emit-hinted-impl {2 {:ret :vector}}
strip-ns {1 {:ret #{:symbol :keyword}}}
assoc-in {3 {:ret #{:associative}}}
memoize {1 {:ret :fn}}
simple-keyword? {1 {:ret #{:nil :boolean}}}
neg-int? {1 {:ret #{:nil :boolean}}}
drop {1 {:ret :fn}, 2 {:ret :seq}}
split-at {2 {:ret :vector}}
random-sample {1 {:ret :transducer}, 2 {:ret :seq}}
update {3 {:ret :associative}, 4 {:ret :associative}, 5 {:ret :associative}, 6 {:ret :associative}, :varargs {:ret :associative, :min-arity 6}}
group-by-sig {1 {:ret :seq}}
list* {1 {:ret :seq}}
*' {0 {:ret :pos-int}}
mix-collection-hash {2 {:ret :int, :args (:int :int)}}
re-find {2 {:ret :seq}}
run! {2 {:ret :nil}}
print-sequential {6 {:args (:nilable/string nil :nilable/string :nilable/string nil nil)}}
not {1 {:ret #{:boolean}}}
file-seq {1 {:ret :seq}}
ident? {1 {:ret #{:boolean}}}
qualified-ident? {1 {:ret :boolean}}
/ {1 {:ret :number}}
binding-conveyor-fn {1 {:ret :fn}}
vector {0 {:ret :vector}, 1 {:ret :vector}, 2 {:ret :vector}, 3 {:ret :vector}, 4 {:ret :vector}, 5 {:ret :vector}, 6 {:ret :vector}}
>= {1 {:ret :boolean}}
drop-last {1 {:ret :seq}, 2 {:ret :seq}}
root-directory {1 {:ret :string}}
distinct {0 {:ret :fn}}
partition {2 {:ret :seq}, 3 {:ret :seq}, 4 {:ret :seq}}
data-reader-urls {0 {:ret :seq}}
mapv {3 {:ret :vector}, 4 {:ret :vector}, :varargs {:ret :vector, :min-arity 4}}
partition-all {1 {:ret :fn, :args (:int)}, 2 {:ret :seq}, 3 {:ret :seq}}
partition-by {1 {:ret :fn}, 2 {:ret :seq}}
derive {2 {:ret :nil}}
prep-hashes {4 {:ret #{:vector}}}
subseq {5 {:ret #{:nil :seq}}}
flatten {1 {:ret :seq}}
halt-when {1 {:ret :fn}, 2 {:ret :fn}}
nat-int? {1 {:ret #{:nil :boolean}}}
subvec {2 {:ret :vector}}
partial {2 {:ret :fn}, 3 {:ret :fn}, 4 {:ret :fn}, :varargs {:ret :fn, :min-arity 4}}
replicate {2 {:ret :seq}}
unchecked-byte {1 {:args (:nilable/number)}}
every-pred {1 {:ret :fn}, 2 {:ret :fn}, 3 {:ret :fn}, :varargs {:ret :fn, :min-arity 3}}
distinct? {1 {:ret :boolean}, 2 {:ret :boolean}}
pos-int? {1 {:ret #{:nil :boolean}}}
prep-ints {2 {:ret #{:vector}}}
extenders {1 {:ret :seq}}
unchecked-short {1 {:args (:nilable/number)}}
odd? {1 {:ret :boolean}}
rsubseq {5 {:ret #{:nil :seq}}}
filter {1 {:ret :fn}, 2 {:ret :seq}}
+ {0 {:ret :nat-int}}
split-with {2 {:ret :vector}}
ctor-sigs {1 {:ret :seq}}
str {0 {:ret :nilable/string}, 1 {:ret :nilable/string}, :varargs {:ret :nilable/string, :min-arity 1}}
hash-map {0 {:ret {:type :map, :val {}}}}
underive {2 {:ret :nil}}
Throwable->map {1 {:ret :nilable/map}}
some-fn {1 {:ret :fn}, 2 {:ret :fn}, 3 {:ret :fn}, :varargs {:ret :fn, :min-arity 3}}
simple-ident? {1 {:ret #{:nil :boolean}}}
generate-interface {1 {:ret :vector}}
xml-seq {1 {:ret :seq}}
byte {1 {:args (:nilable/number)}}
== {1 {:ret :boolean}}
root-resource {1 {:ret :string}}
generate-proxy {2 {:ret :vector}}
interpose {1 {:ret :fn}, 2 {:ret :seq}}
emit-impl {1 {:ret :vector}}
rational? {1 {:ret #{:boolean}}}
clojure-version {0 {:ret :string}}
merge-hash-collisions {4 {:ret :vector}}
comparator {1 {:ret :fn}}
drop-while {1 {:ret :fn}, 2 {:ret :seq}}
complement {1 {:ret :fn}}
constantly {1 {:ret :fn}}
completing {1 {:ret :fn}, 2 {:ret :fn}}
hash-unordered-coll {1 {:ret :int}}
preserving-reduced {1 {:ret :fn}}
qualified-symbol? {1 {:ret :boolean}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.data.transit.json ===
atom-diff {2 {:ret #{:vector}}}
diff-associative-key {3 {:ret :vector}}
diff-sequential {2 {:ret :vector}}
=== resources/clj_kondo/impl/cache/built_in/clj/java.lang.Byte.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.test.tap.transit.json ===
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.java.javadoc.transit.json ===
javadoc-url {1 {:args (:nilable/string)}}
=== resources/clj_kondo/impl/cache/built_in/clj/clojure.spec.test.alpha.transit.json ===
interpret-stack-trace-element {1 {:ret :nilable/map}}
spec-checking-fn {3 {:ret :fn}}
fn-spec-name? {1 {:ret #{:nil :boolean}}}
make-check-result {3 {:ret :nilable/map}}
enumerate-namespace {1 {:ret :set}}
sym->check-map {1 {:ret {:type :map, :val {:s {:row 348, :col 9, :end-row 348, :end-col 10}, :v {:row 349, :col 9, :end-row 349, :end-col 10, :tag {:call {:filename clojure/spec/test/alpha.clj, :type :call, :lang :clj, :base-lang :clj, :resolved-ns clojure.core, :ns clojure.spec.test.alpha, :name resolve, :arity 1}}}, :spec {:row 350, :col 12, :end-row 350, :end-col 35}}}}}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>55--Sports_Coach_Trainer_55_Sports_Coach_Trainer_sportcoaching_55_572.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>768</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>109</xmin>
<ymin>202</ymin>
<xmax>137</xmax>
<ymax>243</ymax>
</bndbox>
<lm>
<x1>115.375</x1>
<y1>217.429</y1>
<x2>131.406</x2>
<y2>219.21</y2>
<x3>120.464</x3>
<y3>223.281</y3>
<x4>116.647</x4>
<y4>229.897</y4>
<x5>125.045</x5>
<y5>230.661</y5>
<visible>0</visible>
<blur>0.55</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>1</xmin>
<ymin>466</ymin>
<xmax>13</xmax>
<ymax>488</ymax>
</bndbox>
<lm>
<x1>0.929</x1>
<y1>474.714</y1>
<x2>9.214</x2>
<y2>473.714</y2>
<x3>6.643</x3>
<y3>478.0</y3>
<x4>2.5</x4>
<y4>483.571</y4>
<x5>8.071</x5>
<y5>482.571</y5>
<visible>1</visible>
<blur>0.3</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>65</xmin>
<ymin>470</ymin>
<xmax>80</xmax>
<ymax>492</ymax>
</bndbox>
<lm>
<x1>74.0</x1>
<y1>478.0</y1>
<x2>78.0</x2>
<y2>478.0</y2>
<x3>78.0</x3>
<y3>482.0</y3>
<x4>75.0</x4>
<y4>486.0</y4>
<x5>78.0</x5>
<y5>486.0</y5>
<visible>0</visible>
<blur>0.26</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>177</xmin>
<ymin>426</ymin>
<xmax>196</xmax>
<ymax>447</ymax>
</bndbox>
<lm>
<x1>183.089</x1>
<y1>432.518</y1>
<x2>191.527</x2>
<y2>433.857</y2>
<x3>187.241</x3>
<y3>437.339</y3>
<x4>183.759</x4>
<y4>441.759</y4>
<x5>188.982</x5>
<y5>442.295</y5>
<visible>1</visible>
<blur>0.42</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>221</xmin>
<ymin>424</ymin>
<xmax>237</xmax>
<ymax>444</ymax>
</bndbox>
<lm>
<x1>224.893</x1>
<y1>430.134</y1>
<x2>231.884</x2>
<y2>430.781</y2>
<x3>227.482</x3>
<y3>434.924</y3>
<x4>225.152</x4>
<y4>439.326</y4>
<x5>230.719</x5>
<y5>439.196</y5>
<visible>1</visible>
<blur>0.38</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>279</xmin>
<ymin>411</ymin>
<xmax>297</xmax>
<ymax>429</ymax>
</bndbox>
<lm>
<x1>286.0</x1>
<y1>416.0</y1>
<x2>294.0</x2>
<y2>417.0</y2>
<x3>290.0</x3>
<y3>421.0</y3>
<x4>288.0</x4>
<y4>426.0</y4>
<x5>293.0</x5>
<y5>426.0</y5>
<visible>0</visible>
<blur>0.39</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>340</xmin>
<ymin>408</ymin>
<xmax>356</xmax>
<ymax>429</ymax>
</bndbox>
<lm>
<x1>343.71</x1>
<y1>415.978</y1>
<x2>353.121</x2>
<y2>416.116</y2>
<x3>348.0</x3>
<y3>419.714</y3>
<x4>345.371</x4>
<y4>424.558</y4>
<x5>350.906</x5>
<y5>424.558</y5>
<visible>1</visible>
<blur>0.41</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>403</xmin>
<ymin>381</ymin>
<xmax>422</xmax>
<ymax>402</ymax>
</bndbox>
<lm>
<x1>407.0</x1>
<y1>388.0</y1>
<x2>417.0</x2>
<y2>387.0</y2>
<x3>411.0</x3>
<y3>391.0</y3>
<x4>409.0</x4>
<y4>396.0</y4>
<x5>416.0</x5>
<y5>395.0</y5>
<visible>0</visible>
<blur>0.39</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>495</xmin>
<ymin>116</ymin>
<xmax>527</xmax>
<ymax>154</ymax>
</bndbox>
<lm>
<x1>504.371</x1>
<y1>127.134</y1>
<x2>519.839</x2>
<y2>127.871</y2>
<x3>511.737</x3>
<y3>134.991</y3>
<x4>505.598</x4>
<y4>144.076</y4>
<x5>516.893</x5>
<y5>144.812</y5>
<visible>0</visible>
<blur>0.58</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>632</xmin>
<ymin>454</ymin>
<xmax>649</xmax>
<ymax>474</ymax>
</bndbox>
<lm>
<x1>637.875</x1>
<y1>459.75</y1>
<x2>644.625</x2>
<y2>460.0</y2>
<x3>642.25</x3>
<y3>463.375</y3>
<x4>639.0</x4>
<y4>467.875</y4>
<x5>643.75</x5>
<y5>468.0</y5>
<visible>1</visible>
<blur>0.37</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>680</xmin>
<ymin>477</ymin>
<xmax>697</xmax>
<ymax>501</ymax>
</bndbox>
<lm>
<x1>683.156</x1>
<y1>484.594</y1>
<x2>691.906</x2>
<y2>484.281</y2>
<x3>688.469</x3>
<y3>490.219</y3>
<x4>685.812</x4>
<y4>495.219</y4>
<x5>690.5</x5>
<y5>494.906</y5>
<visible>1</visible>
<blur>0.41</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>761</xmin>
<ymin>253</ymin>
<xmax>800</xmax>
<ymax>299</ymax>
</bndbox>
<lm>
<x1>787.661</x1>
<y1>268.339</y1>
<x2>794.143</x2>
<y2>266.866</y2>
<x3>799.152</x3>
<y3>276.0</y3>
<x4>787.071</x4>
<y4>286.607</y4>
<x5>793.259</x5>
<y5>284.839</y5>
<visible>1</visible>
<blur>0.27</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>866</xmin>
<ymin>207</ymin>
<xmax>900</xmax>
<ymax>247</ymax>
</bndbox>
<lm>
<x1>874.357</x1>
<y1>221.665</y1>
<x2>890.388</x2>
<y2>221.411</y2>
<x3>880.973</x3>
<y3>228.79</y3>
<x4>877.156</x4>
<y4>236.424</y4>
<x5>888.607</x5>
<y5>235.915</y5>
<visible>0</visible>
<blur>0.59</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>944</xmin>
<ymin>380</ymin>
<xmax>964</xmax>
<ymax>407</ymax>
</bndbox>
<lm>
<x1>948.911</x1>
<y1>388.25</y1>
<x2>959.429</x2>
<y2>388.08</y2>
<x3>952.982</x3>
<y3>392.661</y3>
<x4>949.759</x4>
<y4>398.768</y4>
<x5>958.071</x5>
<y5>398.598</y5>
<visible>1</visible>
<blur>0.44</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>840</xmin>
<ymin>475</ymin>
<xmax>853</xmax>
<ymax>492</ymax>
</bndbox>
<lm>
<x1>841.929</x1>
<y1>480.826</y1>
<x2>849.629</x2>
<y2>480.491</y2>
<x3>846.393</x3>
<y3>485.737</y3>
<x4>843.379</x4>
<y4>489.308</y4>
<x5>849.183</x5>
<y5>489.085</y5>
<visible>1</visible>
<blur>0.27</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
{
"version":"2.0",
"metadata":{
"apiVersion":"2017-01-06",
"endpointPrefix":"cur",
"jsonVersion":"1.1",
"protocol":"json",
"serviceFullName":"AWS Cost and Usage Report Service",
"serviceId":"Cost and Usage Report Service",
"signatureVersion":"v4",
"signingName":"cur",
"targetPrefix":"AWSOrigamiServiceGatewayService",
"uid":"cur-2017-01-06"
},
"operations":{
"DeleteReportDefinition":{
"name":"DeleteReportDefinition",
"http":{
"method":"POST",
"requestUri":"/"
},
"input":{"shape":"DeleteReportDefinitionRequest"},
"output":{"shape":"DeleteReportDefinitionResponse"},
"errors":[
{"shape":"InternalErrorException"},
{"shape":"ValidationException"}
]
},
"DescribeReportDefinitions":{
"name":"DescribeReportDefinitions",
"http":{
"method":"POST",
"requestUri":"/"
},
"input":{"shape":"DescribeReportDefinitionsRequest"},
"output":{"shape":"DescribeReportDefinitionsResponse"},
"errors":[
{"shape":"InternalErrorException"}
]
},
"ModifyReportDefinition":{
"name":"ModifyReportDefinition",
"http":{
"method":"POST",
"requestUri":"/"
},
"input":{"shape":"ModifyReportDefinitionRequest"},
"output":{"shape":"ModifyReportDefinitionResponse"},
"errors":[
{"shape":"InternalErrorException"},
{"shape":"ValidationException"}
]
},
"PutReportDefinition":{
"name":"PutReportDefinition",
"http":{
"method":"POST",
"requestUri":"/"
},
"input":{"shape":"PutReportDefinitionRequest"},
"output":{"shape":"PutReportDefinitionResponse"},
"errors":[
{"shape":"DuplicateReportNameException"},
{"shape":"ReportLimitReachedException"},
{"shape":"InternalErrorException"},
{"shape":"ValidationException"}
]
}
},
"shapes":{
"AWSRegion":{
"type":"string",
"enum":[
"af-south-1",
"ap-east-1",
"ap-south-1",
"ap-southeast-1",
"ap-southeast-2",
"ap-northeast-1",
"ap-northeast-2",
"ap-northeast-3",
"ca-central-1",
"eu-central-1",
"eu-west-1",
"eu-west-2",
"eu-west-3",
"eu-north-1",
"eu-south-1",
"me-south-1",
"sa-east-1",
"us-east-1",
"us-east-2",
"us-west-1",
"us-west-2",
"cn-north-1",
"cn-northwest-1"
]
},
"AdditionalArtifact":{
"type":"string",
"enum":[
"REDSHIFT",
"QUICKSIGHT",
"ATHENA"
]
},
"AdditionalArtifactList":{
"type":"list",
"member":{"shape":"AdditionalArtifact"}
},
"CompressionFormat":{
"type":"string",
"enum":[
"ZIP",
"GZIP",
"Parquet"
]
},
"DeleteReportDefinitionRequest":{
"type":"structure",
"members":{
"ReportName":{"shape":"ReportName"}
}
},
"DeleteReportDefinitionResponse":{
"type":"structure",
"members":{
"ResponseMessage":{"shape":"DeleteResponseMessage"}
}
},
"DeleteResponseMessage":{"type":"string"},
"DescribeReportDefinitionsRequest":{
"type":"structure",
"members":{
"MaxResults":{"shape":"MaxResults"},
"NextToken":{"shape":"GenericString"}
}
},
"DescribeReportDefinitionsResponse":{
"type":"structure",
"members":{
"ReportDefinitions":{"shape":"ReportDefinitionList"},
"NextToken":{"shape":"GenericString"}
}
},
"DuplicateReportNameException":{
"type":"structure",
"members":{
"Message":{"shape":"ErrorMessage"}
},
"exception":true
},
"ErrorMessage":{"type":"string"},
"GenericString":{
"type":"string",
"max":256,
"pattern":"[A-Za-z0-9_\\.\\-=]*"
},
"InternalErrorException":{
"type":"structure",
"members":{
"Message":{"shape":"ErrorMessage"}
},
"exception":true,
"fault":true
},
"MaxResults":{
"type":"integer",
"box":true,
"max":5,
"min":5
},
"ModifyReportDefinitionRequest":{
"type":"structure",
"required":[
"ReportName",
"ReportDefinition"
],
"members":{
"ReportName":{"shape":"ReportName"},
"ReportDefinition":{"shape":"ReportDefinition"}
}
},
"ModifyReportDefinitionResponse":{
"type":"structure",
"members":{
}
},
"PutReportDefinitionRequest":{
"type":"structure",
"required":["ReportDefinition"],
"members":{
"ReportDefinition":{"shape":"ReportDefinition"}
}
},
"PutReportDefinitionResponse":{
"type":"structure",
"members":{
}
},
"RefreshClosedReports":{
"type":"boolean",
"box":true
},
"ReportDefinition":{
"type":"structure",
"required":[
"ReportName",
"TimeUnit",
"Format",
"Compression",
"AdditionalSchemaElements",
"S3Bucket",
"S3Prefix",
"S3Region"
],
"members":{
"ReportName":{"shape":"ReportName"},
"TimeUnit":{"shape":"TimeUnit"},
"Format":{"shape":"ReportFormat"},
"Compression":{"shape":"CompressionFormat"},
"AdditionalSchemaElements":{"shape":"SchemaElementList"},
"S3Bucket":{"shape":"S3Bucket"},
"S3Prefix":{"shape":"S3Prefix"},
"S3Region":{"shape":"AWSRegion"},
"AdditionalArtifacts":{"shape":"AdditionalArtifactList"},
"RefreshClosedReports":{"shape":"RefreshClosedReports"},
"ReportVersioning":{"shape":"ReportVersioning"}
}
},
"ReportDefinitionList":{
"type":"list",
"member":{"shape":"ReportDefinition"}
},
"ReportFormat":{
"type":"string",
"enum":[
"textORcsv",
"Parquet"
]
},
"ReportLimitReachedException":{
"type":"structure",
"members":{
"Message":{"shape":"ErrorMessage"}
},
"exception":true
},
"ReportName":{
"type":"string",
"max":256,
"pattern":"[0-9A-Za-z!\\-_.*\\'()]+"
},
"ReportVersioning":{
"type":"string",
"enum":[
"CREATE_NEW_REPORT",
"OVERWRITE_REPORT"
]
},
"S3Bucket":{
"type":"string",
"max":256,
"pattern":"[A-Za-z0-9_\\.\\-]+"
},
"S3Prefix":{
"type":"string",
"max":256,
"pattern":"[0-9A-Za-z!\\-_.*\\'()/]*"
},
"SchemaElement":{
"type":"string",
"enum":["RESOURCES"]
},
"SchemaElementList":{
"type":"list",
"member":{"shape":"SchemaElement"}
},
"TimeUnit":{
"type":"string",
"enum":[
"HOURLY",
"DAILY",
"MONTHLY"
]
},
"ValidationException":{
"type":"structure",
"members":{
"Message":{"shape":"ErrorMessage"}
},
"exception":true
}
}
}
|
{
"pile_set_name": "Github"
}
|
[
{
"__type__": "cc.Prefab",
"_name": "",
"_objFlags": 0,
"_native": "",
"data": {
"__id__": 1
},
"optimizationPolicy": 0,
"asyncLoadAssets": false,
"readonly": false
},
{
"__type__": "cc.Node",
"_name": "BuildableWithCountAndLevel",
"_objFlags": 0,
"_parent": null,
"_children": [
{
"__id__": 2
},
{
"__id__": 6
},
{
"__id__": 10
}
],
"_active": true,
"_level": 1,
"_components": [
{
"__id__": 14
},
{
"__id__": 15
}
],
"_prefab": {
"__id__": 16
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 272.8,
"height": 272.8
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"groupIndex": 0,
"_id": "",
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
-3.552713678800501e-14,
0,
0,
0,
0,
0,
0,
1,
1,
1
]
}
},
{
"__type__": "cc.Node",
"_name": "Apperance",
"_objFlags": 0,
"_parent": {
"__id__": 1
},
"_children": [],
"_active": true,
"_level": 4,
"_components": [
{
"__id__": 3
},
{
"__id__": 4
}
],
"_prefab": {
"__id__": 5
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 262.8,
"height": 262.8
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0.5,
"y": 0.5
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"groupIndex": 0,
"_id": "",
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
0,
0,
0,
0,
0,
0,
0,
1,
1,
1
]
}
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 2
},
"_enabled": true,
"alignMode": 1,
"_target": null,
"_alignFlags": 45,
"_left": 5,
"_right": 5,
"_top": 5,
"_bottom": 5,
"_verticalCenter": 0,
"_horizontalCenter": 0,
"_isAbsLeft": true,
"_isAbsRight": true,
"_isAbsTop": true,
"_isAbsBottom": true,
"_isAbsHorizontalCenter": true,
"_isAbsVerticalCenter": true,
"_originalWidth": 0,
"_originalHeight": 0,
"_id": ""
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 2
},
"_enabled": true,
"_materials": [],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": null,
"_type": 0,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": null,
"_id": ""
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "e25799f9-33ec-4a36-83cb-6134868ef564"
},
"fileId": "9fwHzcr79AXLQZcrK9P+dL",
"sync": false
},
{
"__type__": "cc.Node",
"_name": "Level",
"_objFlags": 0,
"_parent": {
"__id__": 1
},
"_children": [],
"_active": true,
"_level": 4,
"_components": [
{
"__id__": 7
},
{
"__id__": 8
}
],
"_prefab": {
"__id__": 9
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 75.66,
"height": 88.2
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0.5
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"groupIndex": 0,
"_id": "",
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
-119.16000366210938,
99.93598937988281,
0,
0,
0,
0,
0,
1,
1,
1
]
}
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 6
},
"_enabled": true,
"alignMode": 1,
"_target": null,
"_alignFlags": 9,
"_left": 0.06319648093841644,
"_right": 0,
"_top": -0.02799116997792487,
"_bottom": 0,
"_verticalCenter": 0,
"_horizontalCenter": 0,
"_isAbsLeft": false,
"_isAbsRight": true,
"_isAbsTop": false,
"_isAbsBottom": true,
"_isAbsHorizontalCenter": true,
"_isAbsVerticalCenter": true,
"_originalWidth": 0,
"_originalHeight": 0,
"_id": ""
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 6
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": false,
"_string": "lv2",
"_N$string": "lv2",
"_fontSize": 60,
"_lineHeight": 70,
"_enableWrapText": true,
"_N$file": {
"__uuid__": "12395940-bcbd-49bf-8861-db2f751cd3aa"
},
"_isSystemFontUsed": false,
"_spacingX": 0,
"_batchAsBitmap": false,
"_N$horizontalAlign": 1,
"_N$verticalAlign": 1,
"_N$fontFamily": "Luminari",
"_N$overflow": 0,
"_N$cacheMode": 0,
"_id": ""
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "e25799f9-33ec-4a36-83cb-6134868ef564"
},
"fileId": "52kMzu9YFPEamjhNpp/wFN",
"sync": false
},
{
"__type__": "cc.Node",
"_name": "Count",
"_objFlags": 0,
"_parent": {
"__id__": 1
},
"_children": [],
"_active": true,
"_level": 2,
"_components": [
{
"__id__": 11
},
{
"__id__": 12
}
],
"_prefab": {
"__id__": 13
},
"_opacity": 255,
"_color": {
"__type__": "cc.Color",
"r": 255,
"g": 255,
"b": 255,
"a": 255
},
"_contentSize": {
"__type__": "cc.Size",
"width": 66.7,
"height": 75.6
},
"_anchorPoint": {
"__type__": "cc.Vec2",
"x": 1,
"y": 0.5
},
"_eulerAngles": {
"__type__": "cc.Vec3",
"x": 0,
"y": 0,
"z": 0
},
"_skewX": 0,
"_skewY": 0,
"_is3DNode": false,
"groupIndex": 0,
"_id": "",
"_trs": {
"__type__": "TypedArray",
"ctor": "Float64Array",
"array": [
119.15899658203125,
-111.66790008544922,
0,
0,
0,
0,
0,
1,
1,
1
]
}
},
{
"__type__": "cc.Widget",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 10
},
"_enabled": true,
"alignMode": 1,
"_target": null,
"_alignFlags": 36,
"_left": 0,
"_right": 0.06320014662756598,
"_top": 0,
"_bottom": -0.04790286975717443,
"_verticalCenter": 0,
"_horizontalCenter": 0,
"_isAbsLeft": true,
"_isAbsRight": false,
"_isAbsTop": true,
"_isAbsBottom": false,
"_isAbsHorizontalCenter": true,
"_isAbsVerticalCenter": true,
"_originalWidth": 0,
"_originalHeight": 0,
"_id": ""
},
{
"__type__": "cc.Label",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 10
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_useOriginalSize": true,
"_string": "x 3",
"_N$string": "x 3",
"_fontSize": 50,
"_lineHeight": 60,
"_enableWrapText": true,
"_N$file": null,
"_isSystemFontUsed": true,
"_spacingX": 0,
"_batchAsBitmap": false,
"_N$horizontalAlign": 0,
"_N$verticalAlign": 0,
"_N$fontFamily": "Arial",
"_N$overflow": 0,
"_N$cacheMode": 0,
"_id": ""
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "e25799f9-33ec-4a36-83cb-6134868ef564"
},
"fileId": "398o4oKftHm4ORUS7VQOo4",
"sync": false
},
{
"__type__": "cc.Sprite",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 1
},
"_enabled": true,
"_materials": [
{
"__uuid__": "eca5d2f2-8ef6-41c2-bbe6-f9c79d09c432"
}
],
"_srcBlendFactor": 770,
"_dstBlendFactor": 771,
"_spriteFrame": {
"__uuid__": "ab08ed09-243d-4955-a185-b8a8f80298d2"
},
"_type": 1,
"_sizeMode": 0,
"_fillType": 0,
"_fillCenter": {
"__type__": "cc.Vec2",
"x": 0,
"y": 0
},
"_fillStart": 0,
"_fillRange": 0,
"_isTrimmedMode": true,
"_atlas": {
"__uuid__": "0004914e-7f24-42d5-92b2-50e2287ab84a"
},
"_id": ""
},
{
"__type__": "88a7901WNVMQpDK/Bmdx8Lv",
"_name": "",
"_objFlags": 0,
"node": {
"__id__": 1
},
"_enabled": true,
"activeAppearanceSprite": {
"__id__": 4
},
"labelForCount": {
"__id__": 12
},
"levelLabel": {
"__id__": 8
},
"padding": 0.1,
"limitSpriteHeight": false,
"limitSpriteWidth": false,
"appearanceOnly": false,
"_id": ""
},
{
"__type__": "cc.PrefabInfo",
"root": {
"__id__": 1
},
"asset": {
"__uuid__": "e25799f9-33ec-4a36-83cb-6134868ef564"
},
"fileId": "9aBvBsMztOzbePlOtqYbDE",
"sync": false
}
]
|
{
"pile_set_name": "Github"
}
|
[[
"start",
["xml-pe.doctype.xml","<!"],
["xml-pe.doctype.xml","DOCTYPE"],
["text.whitespace.xml"," "],
["xml-pe.xml","html"],
["xml-pe.doctype.xml",">"]
],[
"start",
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","html"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","head"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","title"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Cloud9 Rocks!"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","title"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","head"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","body"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start"
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","table"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","class"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"table\""],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Name"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Size"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["keyword","if"],
["text"," "],
["paren.lparen","("],
["keyword.operator","!"],
["identifier","isRoot"],
["paren.rparen",")"],
["text"," "],
["paren.lparen","{"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.anchor.tag-name.xml","a"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","href"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"..\""],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml",".."],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.anchor.tag-name.xml","a"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["paren.rparen","}"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["identifier","entries"],
["punctuation.operator","."],
["identifier","forEach"],
["paren.lparen","("],
["storage.type","function"],
["paren.lparen","("],
["identifier","entry"],
["paren.rparen",")"],
["text"," "],
["paren.lparen","{"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","span"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","class"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"glyphicon "],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","mime"],
["text"," "],
["keyword.operator","=="],
["text"," "],
["string","'directory'"],
["text"," "],
["punctuation.operator","?"],
["text"," "],
["string","'folder'"],
["punctuation.operator",":"],
["text"," "],
["string","'file'"],
["markup.list.meta.tag","%>"],
["string.attribute-value.xml","\""],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","span"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.anchor.tag-name.xml","a"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","href"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\""],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","name"],
["text"," "],
["markup.list.meta.tag","%>"],
["string.attribute-value.xml","\""],
["meta.tag.punctuation.tag-close.xml",">"],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","name"],
["text"," "],
["markup.list.meta.tag","%>"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.anchor.tag-name.xml","a"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","size"],
["text"," "],
["markup.list.meta.tag","%>"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["paren.rparen","})"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","table"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","body"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","html"],
["meta.tag.punctuation.tag-close.xml",">"]
]]
|
{
"pile_set_name": "Github"
}
|
[[
"start",
["xml-pe.doctype.xml","<!"],
["xml-pe.doctype.xml","DOCTYPE"],
["text.whitespace.xml"," "],
["xml-pe.xml","html"],
["xml-pe.doctype.xml",">"]
],[
"start",
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","html"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","head"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","title"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Cloud9 Rocks!"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","title"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","head"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","body"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start"
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","table"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","class"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"table\""],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Name"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml","Size"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","th"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["keyword","if"],
["text"," "],
["paren.lparen","("],
["keyword.operator","!"],
["identifier","isRoot"],
["paren.rparen",")"],
["text"," "],
["paren.lparen","{"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.anchor.tag-name.xml","a"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","href"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"..\""],
["meta.tag.punctuation.tag-close.xml",">"],
["text.xml",".."],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.anchor.tag-name.xml","a"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["paren.rparen","}"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["identifier","entries"],
["punctuation.operator","."],
["identifier","forEach"],
["paren.lparen","("],
["storage.type","function"],
["paren.lparen","("],
["identifier","entry"],
["paren.rparen",")"],
["text"," "],
["paren.lparen","{"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.tag-name.xml","span"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","class"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\"glyphicon "],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","mime"],
["text"," "],
["keyword.operator","=="],
["text"," "],
["string","'directory'"],
["text"," "],
["punctuation.operator","?"],
["text"," "],
["string","'folder'"],
["punctuation.operator",":"],
["text"," "],
["string","'file'"],
["markup.list.meta.tag","%>"],
["string.attribute-value.xml","\""],
["meta.tag.punctuation.tag-close.xml",">"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","span"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.anchor.tag-name.xml","a"],
["text.tag-whitespace.xml"," "],
["entity.other.attribute-name.xml","href"],
["keyword.operator.attribute-equals.xml","="],
["string.attribute-value.xml","\""],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","name"],
["text"," "],
["markup.list.meta.tag","%>"],
["string.attribute-value.xml","\""],
["meta.tag.punctuation.tag-close.xml",">"],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","name"],
["text"," "],
["markup.list.meta.tag","%>"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.anchor.tag-name.xml","a"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.tag-open.xml","<"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"],
["markup.list.meta.tag","<%="],
["text"," "],
["identifier","entry"],
["punctuation.operator","."],
["identifier","size"],
["text"," "],
["markup.list.meta.tag","%>"],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","td"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","tr"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "],
["markup.list.meta.tag","<%"],
["text"," "],
["paren.rparen","})"],
["text"," "],
["markup.list.meta.tag","%>"]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.table.tag-name.xml","table"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["text.xml"," "]
],[
"start",
["text.xml"," "],
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","body"],
["meta.tag.punctuation.tag-close.xml",">"]
],[
"start",
["meta.tag.punctuation.end-tag-open.xml","</"],
["meta.tag.tag-name.xml","html"],
["meta.tag.punctuation.tag-close.xml",">"]
]]
|
{
"pile_set_name": "Github"
}
|
{
"title":"WOFF 2.0 - Web Open Font Format",
"description":"TrueType/OpenType font that provides better compression than WOFF 1.0.",
"spec":"http://www.w3.org/TR/WOFF2/",
"status":"cr",
"links":[
{
"url":"https://gist.github.com/sergejmueller/cf6b4f2133bcb3e2f64a",
"title":"Basics about WOFF 2.0"
},
{
"url":"http://everythingfonts.com/ttf-to-woff2",
"title":"WOFF 2.0 converter"
}
],
"bugs":[
],
"categories":[
"Other"
],
"stats":{
"ie":{
"5.5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n"
},
"edge":{
"12":"n",
"13":"n",
"14":"y",
"15":"y"
},
"firefox":{
"2":"n",
"3":"n",
"3.5":"n",
"3.6":"n",
"4":"n",
"5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n",
"12":"n",
"13":"n",
"14":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"n",
"24":"n",
"25":"n",
"26":"n",
"27":"n",
"28":"n",
"29":"n",
"30":"n",
"31":"n",
"32":"n",
"33":"n",
"34":"n",
"35":"n",
"36":"n",
"37":"n",
"38":"n",
"39":"y",
"40":"y",
"41":"y",
"42":"y",
"43":"y",
"44":"y",
"45":"y",
"46":"y",
"47":"y",
"48":"y",
"49":"y",
"50":"y",
"51":"y",
"52":"y",
"53":"y",
"54":"y"
},
"chrome":{
"4":"n",
"5":"n",
"6":"n",
"7":"n",
"8":"n",
"9":"n",
"10":"n",
"11":"n",
"12":"n",
"13":"n",
"14":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"n",
"24":"n",
"25":"n",
"26":"n",
"27":"n",
"28":"n",
"29":"n",
"30":"n",
"31":"n",
"32":"n",
"33":"n",
"34":"n",
"35":"n",
"36":"y",
"37":"y",
"38":"y",
"39":"y",
"40":"y",
"41":"y",
"42":"y",
"43":"y",
"44":"y",
"45":"y",
"46":"y",
"47":"y",
"48":"y",
"49":"y",
"50":"y",
"51":"y",
"52":"y",
"53":"y",
"54":"y",
"55":"y",
"56":"y",
"57":"y",
"58":"y",
"59":"y"
},
"safari":{
"3.1":"n",
"3.2":"n",
"4":"n",
"5":"n",
"5.1":"n",
"6":"n",
"6.1":"n",
"7":"n",
"7.1":"n",
"8":"n",
"9":"n",
"9.1":"n",
"10":"a #1",
"10.1":"a #1",
"TP":"a #1"
},
"opera":{
"9":"n",
"9.5-9.6":"n",
"10.0-10.1":"n",
"10.5":"n",
"10.6":"n",
"11":"n",
"11.1":"n",
"11.5":"n",
"11.6":"n",
"12":"n",
"12.1":"n",
"15":"n",
"16":"n",
"17":"n",
"18":"n",
"19":"n",
"20":"n",
"21":"n",
"22":"n",
"23":"y",
"24":"y",
"25":"y",
"26":"y",
"27":"y",
"28":"y",
"29":"y",
"30":"y",
"31":"y",
"32":"y",
"33":"y",
"34":"y",
"35":"y",
"36":"y",
"37":"y",
"38":"y",
"39":"y",
"40":"y",
"41":"y",
"42":"y",
"43":"y",
"44":"y",
"45":"y"
},
"ios_saf":{
"3.2":"n",
"4.0-4.1":"n",
"4.2-4.3":"n",
"5.0-5.1":"n",
"6.0-6.1":"n",
"7.0-7.1":"n",
"8":"n",
"8.1-8.4":"n",
"9.0-9.2":"n",
"9.3":"n",
"10.0-10.2":"y"
},
"op_mini":{
"all":"n"
},
"android":{
"2.1":"n",
"2.2":"n",
"2.3":"n",
"3":"n",
"4":"n",
"4.1":"n",
"4.2-4.3":"n",
"4.4":"n",
"4.4.3-4.4.4":"n",
"53":"y"
},
"bb":{
"7":"n",
"10":"n"
},
"op_mob":{
"10":"n",
"11":"n",
"11.1":"n",
"11.5":"n",
"12":"n",
"12.1":"n",
"37":"y"
},
"and_chr":{
"56":"y"
},
"and_ff":{
"51":"y"
},
"ie_mob":{
"10":"n",
"11":"n"
},
"and_uc":{
"11":"n"
},
"samsung":{
"4":"y"
},
"and_qq":{
"1.2":"y"
}
},
"notes":"",
"notes_by_num":{
"1":"Supported only on Safari for Mac OS Sierra, not El Capitan & older."
},
"usage_perc_y":72.47,
"usage_perc_a":1.46,
"ucprefix":false,
"parent":"fontface",
"keywords":"woff, fontface, webfonts",
"ie_id":"wofffileformat20",
"chrome_id":"6718644721549312",
"firefox_id":"",
"webkit_id":"specification-woff-file-format-2.0",
"shown":true
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>2--Demonstration_2_Demonstration_Demonstration_Or_Protest_2_160.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>1396</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>56</xmin>
<ymin>513</ymin>
<xmax>108</xmax>
<ymax>580</ymax>
</bndbox>
<lm>
<x1>85.696</x1>
<y1>545.161</y1>
<x2>104.161</x2>
<y2>539.286</y2>
<x3>105.42</x3>
<y3>553.554</y3>
<x4>91.152</x4>
<y4>566.562</y4>
<x5>105.0</x5>
<y5>564.045</y5>
<visible>0</visible>
<blur>0.67</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>282</xmin>
<ymin>407</ymin>
<xmax>349</xmax>
<ymax>500</ymax>
</bndbox>
<lm>
<x1>306.161</x1>
<y1>450.643</y1>
<x2>334.446</x2>
<y2>451.821</y2>
<x3>322.661</x3>
<y3>473.036</y3>
<x4>306.75</x4>
<y4>484.232</y4>
<x5>329.732</x5>
<y5>484.232</y5>
<visible>0</visible>
<blur>0.68</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>589</xmin>
<ymin>483</ymin>
<xmax>653</xmax>
<ymax>553</ymax>
</bndbox>
<lm>
<x1>631.991</x1>
<y1>514.406</y1>
<x2>650.554</x2>
<y2>513.08</y2>
<x3>651.879</x3>
<y3>525.897</y3>
<x4>635.969</x4>
<y4>538.714</y4>
<x5>649.228</x5>
<y5>536.946</y5>
<visible>0</visible>
<blur>0.66</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>386</xmin>
<ymin>896</ymin>
<xmax>457</xmax>
<ymax>1011</ymax>
</bndbox>
<lm>
<x1>422.446</x1>
<y1>940.705</y1>
<x2>444.143</x2>
<y2>937.089</y2>
<x3>454.991</x3>
<y3>956.616</y3>
<x4>432.571</x4>
<y4>984.098</y4>
<x5>444.143</x5>
<y5>981.929</y5>
<visible>1</visible>
<blur>0.65</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>795</xmin>
<ymin>929</ymin>
<xmax>851</xmax>
<ymax>1030</ymax>
</bndbox>
<lm>
<x1>832.009</x1>
<y1>969.491</y1>
<x2>838.982</x2>
<y2>965.688</y2>
<x3>849.125</x3>
<y3>985.973</y3>
<x4>842.152</x4>
<y4>1007.527</y4>
<x5>845.321</x5>
<y5>1004.991</y5>
<visible>1</visible>
<blur>0.64</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>65</xmin>
<ymin>1072</ymin>
<xmax>116</xmax>
<ymax>1162</ymax>
</bndbox>
<lm>
<x1>109.0</x1>
<y1>1106.0</y1>
<x2>102.0</x2>
<y2>1107.0</y2>
<x3>111.0</x3>
<y3>1126.0</y3>
<x4>109.0</x4>
<y4>1143.0</y4>
<x5>101.0</x5>
<y5>1142.0</y5>
<visible>1</visible>
<blur>0.33</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
{
"radio": {
"twr": "Soekarno-Hatta Tower",
"app": "Jakarta Approach",
"dep": "Jakarta Departure"
},
"icao": "WIII",
"iata": "CGK",
"magnetic_north": 0.0,
"ctr_radius": 80,
"ctr_ceiling": 30000,
"initial_alt": 6000,
"position": ["S6d7.04m0", "E106d39.7m0"],
"rangeRings": {
"enabled": true,
"center": ["S6d7.04m0", "E106d39.7m0"],
"radius_nm": 5.0
},
"has_terrain": false,
"wind": {
"angle": 240,
"speed": 8
},
"arrivalRunway": "25L",
"departureRunway": "25L",
"fixes": {
"DKI": ["S5d57.7m0", "E107d2.1m0"],
"_DKIR": ["S6d1m24.44", "E106d39m11.46"],
"CKG": ["S6d11.3m0", "E106d31.8m0"],
"HLM": ["S6d16.3m0", "E106d53.2m0"],
"PW": ["S6d34.0m0", "E107d27.0m0"],
"GL": ["S6d8.8m0", "E106d34.5m0"],
"GR": ["S6d10.4m0", "E106d34.0m0"],
"CL": ["S6d6.3m0", "E106d44.1m0"],
"CR": ["S6d5.2m0", "E106d43.4m0"],
"NOKTA": ["S5d28.4m0", "E106d51.4m0"],
"ESALA": ["S5d57.7m0", "E107d19.8m0"],
"CARLI": ["S5d15.6m0", "E106d12.8m0"],
"BUNIK": ["S4d51.7m0", "E106d37.4m0"],
"DENDY": ["S5d11.8m0", "E107d36.4m0"],
"LEPAS": ["S5d26.0m0", "E107d47.3m0"],
"SPADA": ["S5d40.7m0", "E107d54.6m0"],
"RENDA": ["S7d15.3m0", "E107d13.4m0"],
"SIKAD": ["S5d44.3m0", "E106d16.3m0"],
"DOLTA": ["S5d7.6m0", "E105d55.5m0"],
"TULIP": ["S5d25.4m0", "E105d37.8m0"],
"KASAL": ["S6d32.6m0", "E107d56.4m0"]
},
"runways": [
{
"name": ["07R", "25L"],
"name_offset": [[0, 0], [0, 0]],
"end": [["S6d8.55m0", "E106d38.62m0"], ["S6d7.82m0", "E106d40.46m0"]],
"length": 3.6,
"ils": [true, true]
},
{
"name": ["07L", "25R"],
"name_offset": [[0, 0], [0, 0]],
"end": [["S6d7.25m0", "E106d38.33m0"], ["S6d6.54m0", "E106d40.15m0"]],
"length": 3.6,
"ils": [true, true]
}
],
"sids": {
"DKI2": {
"icao": "DKI2",
"name": "Jakarta Two",
"rwy": {
"25R": ["GL", "_DKIR",["DKI","A12+"]],
"25L": ["GR", "_DKIR",["DKI","A12+"]],
"07L": ["CR", ["DKI","A12+"]],
"07R": ["CL", ["DKI","A12+"]]
},
"exitPoints": {
"DENDY": ["DENDY"],
"LEPAS": ["LEPAS"],
"SPADA": ["SPADA"]
},
"draw": [["_DKIR","DKI", "DENDY*"],["_DKIR","DKI","LEPAS*"],["_DKIR","DKI","SPADA*"]]
},
"HALIM1": {
"icao": "HALIM1",
"name": "Halim One",
"rwy": {
"25R": ["GL", "HLM"],
"25L": ["GR", "HLM"]
},
"exitPoints": {
"KASAL": ["KASAL"],
"PW": ["PW"],
"RENDA": ["RENDA"]
},
"draw": [["HLM", "KASAL*"],["HLM","PW*"],["HLM","RENDA*"]]
},
"CKG2": {
"icao": "CKG2",
"name": "Cengkareng Two",
"rwy": {
"25R": ["GL", "SIKAD"],
"25L": ["GR", "SIKAD"],
"07L": ["CR","SIKAD"],
"07R": ["CL","SIKAD"]
},
"exitPoints": {
"DOLTA": ["DOLTA"],
"TULIP": ["TULIP"]
},
"draw": [["SIKAD","DOLTA*"],["SIKAD","TULIP*"]]
}
},
"departures": {
"airlines": [
["gia", 35],
["lni",35],
["ctv",20],
["sjy", 35],
["btk",35],
["awq",20],
["eva/long",5],
["cpa",10],
["jal/long",5],
["kal/long",5]
],
"destinations": [
"HALIM1", "CKG2", "DKI2"
],
"type": "cyclic",
"offset": 0,
"period": 30,
"frequency": [13, 24]
},
"arrivals": [
{
"_name": "BUNIK",
"radial": 355,
"speed": 250,
"type": "cyclic",
"offset": 12,
"period": 23,
"frequency": [10, 20],
"altitude": 10000,
"fixes": ["NOKTA"],
"airlines": [
["gia", 35],
["lni",35],
["ctv",20],
["sjy", 35],
["btk",35],
["awq",20],
["eva/long",5],
["cpa",10],
["jal/long",5],
["kal/long",5]
]
},
{
"_name": "CARLI",
"radial": 310,
"heading": 140,
"speed": 250,
"type": "cyclic",
"offset": 10,
"period": 21,
"frequency": [5, 10],
"altitude": 10000,
"fixes": ["NOKTA"],
"airlines": [
["gia", 35],
["lni",35],
["ctv",20],
["sjy", 35],
["btk",35],
["awq",20]
]
},
{
"_name": "DENDY",
"radial": 40,
"speed": 250,
"type": "cyclic",
"offset": 15,
"period": 18,
"frequency": [10, 20],
"altitude": 10000,
"fixes": ["DKI"],
"airlines": [
["gia", 35],
["lni",35],
["ctv",20],
["sjy", 35],
["btk",35],
["awq",20]
]
},
{
"_name": "SPADA",
"radial": 90,
"speed": 250,
"type": "cyclic",
"offset": 8,
"period": 15,
"frequency": [5, 10],
"altitude": 10000,
"fixes": ["DKI"],
"airlines": [
["gia", 35],
["lni",35],
["ctv",20],
["sjy", 35],
["btk",35],
["awq",20]
]
}
]
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>imagesRaw</folder>
<filename>2017-12-15 16:16:21.331026.jpg</filename>
<path>/Users/abell/Development/other.nyc/Camera/imagesRaw/2017-12-15 16:16:21.331026.jpg</path>
<source>
<database>Unknown</database>
</source>
<size>
<width>352</width>
<height>240</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>bus</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>58</xmin>
<ymin>141</ymin>
<xmax>118</xmax>
<ymax>190</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>124</xmin>
<ymin>137</ymin>
<xmax>138</xmax>
<ymax>146</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>147</xmin>
<ymin>143</ymin>
<xmax>165</xmax>
<ymax>155</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>158</xmin>
<ymin>132</ymin>
<xmax>172</xmax>
<ymax>143</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>179</xmin>
<ymin>136</ymin>
<xmax>193</xmax>
<ymax>147</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>181</xmin>
<ymin>151</ymin>
<xmax>203</xmax>
<ymax>168</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>206</xmin>
<ymin>155</ymin>
<xmax>229</xmax>
<ymax>172</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>224</xmin>
<ymin>202</ymin>
<xmax>278</xmax>
<ymax>239</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>149</xmin>
<ymin>154</ymin>
<xmax>168</xmax>
<ymax>170</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>130</xmin>
<ymin>165</ymin>
<xmax>159</xmax>
<ymax>184</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>95</xmin>
<ymin>212</ymin>
<xmax>150</xmax>
<ymax>240</ymax>
</bndbox>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
{
"creationTimestamp": "2015-04-29T16:07:12Z",
"resultCode": 0,
"userLocale": "en_US",
"protocolVersion": "QH65B2",
"requestId": "048120d0-d6eb-49b9-9c70-dff6ee4b3373",
"requestUrl": "https://developer.apple.com:443//services-account/QH65B2/account/ios/certificate/submitCertificateRequest.action?content-type=text/x-url-arguments&accept=application/json&requestId=048120d0-d6eb-49b9-9c70-dff6ee4b3373&userLocale=en_US&teamId=S56PJTAYEL",
"responseId": "a64fde92-de9e-46d2-b184-98af3d0a6c11",
"isAdmin": true,
"isMember": false,
"isAgent": false,
"pageNumber": null,
"pageSize": null,
"totalRecords": null,
"certRequest": {
"certRequestId": "ESF52FQGU6",
"statusCode": 4,
"statusString": "Issued",
"csrPlatform": "ios",
"dateRequestedString": "Apr 29, 2015",
"dateRequested": "2015-04-29T16:07:11Z",
"expirationDate": "2016-04-28T15:57:11Z",
"expirationDateString": "Apr 28, 2016",
"certificateId": "HG3FQ9M282",
"typeString": "APNs Production iOS",
"certificateType": {
"certificateTypeDisplayId": "UPV3DW712I",
"name": "APNs Production iOS",
"platform": "ios",
"permissionType": "production",
"distributionType": "production",
"distributionMethod": "push",
"ownerType": "bundle",
"daysOverlap": 364,
"maxActive": 2
},
"certificate": {
"name": null,
"certificateId": "HG3FQ9M282",
"serialNumber": "7C4B29A2943BACA0",
"status": "Issued",
"statusCode": 0,
"expirationDate": "2016-04-28",
"certificatePlatform": "ios",
"certificateType": {
"certificateTypeDisplayId": "UPV3DW712I",
"name": "APNs Production iOS",
"platform": "ios",
"permissionType": "production",
"distributionType": "production",
"distributionMethod": "push",
"ownerType": "bundle",
"daysOverlap": 364,
"maxActive": 2
},
"hasAskKey": false
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"%matplotlib inline\n",
"\n",
"import seaborn as sns\n",
"import pandas as pd\n",
"import scipy.io as sio"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# data1"
]
},
{
"cell_type": "code",
"execution_count": 2,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/plain": [
"dict_keys(['__globals__', '__version__', '__header__', 'X'])"
]
},
"execution_count": 2,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"mat = sio.loadmat('./data/ex7data1.mat')\n",
"mat.keys()"
]
},
{
"cell_type": "code",
"execution_count": 3,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>X1</th>\n",
" <th>X2</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>3.381563</td>\n",
" <td>3.389113</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>4.527875</td>\n",
" <td>5.854178</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>2.655682</td>\n",
" <td>4.411995</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>2.765235</td>\n",
" <td>3.715414</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>2.846560</td>\n",
" <td>4.175506</td>\n",
" </tr>\n",
" </tbody>\n",
"</table>\n",
"</div>"
],
"text/plain": [
" X1 X2\n",
"0 3.381563 3.389113\n",
"1 4.527875 5.854178\n",
"2 2.655682 4.411995\n",
"3 2.765235 3.715414\n",
"4 2.846560 4.175506"
]
},
"execution_count": 3,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"data1 = pd.DataFrame(mat.get('X'), columns=['X1', 'X2'])\n",
"data1.head()"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"***"
]
},
{
"cell_type": "code",
"execution_count": 4,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"sns.set(context=\"notebook\", style=\"white\")"
]
},
{
"cell_type": "code",
"execution_count": 5,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/plain": [
"<seaborn.axisgrid.FacetGrid at 0x11279a550>"
]
},
"execution_count": 5,
"metadata": {},
"output_type": "execute_result"
},
{
"data": {
"image/png": "iVBORw0KGgoAAAANSUhEUgAAAeQAAAHmCAYAAACiZv3yAAAABHNCSVQICAgIfAhkiAAAAAlwSFlz\nAAAPYQAAD2EBqD+naQAAIABJREFUeJzt3XtwVdX9/vHnBBIIJIogCRDwAuKPYOQyBFGq2CYgo3ip\njlAUBIWCpYAMFCRRnHCJCga8YUWreKlUBoMCoh204BRFqUIUEiWONQJyCSGgIFHIOSTn94fN+RIJ\nmIScvdbe5/2acWh22IcPsZ7nrLU+ey1fMBgMCgAAGBVlugAAAEAgAwBgBQIZAAALEMgAAFiAQAYA\nwAIEMgAAFiCQAQCwAIEMAIAFCGQAACxgRSDv27dPf/rTn9SrVy+lp6fr5ZdfNl0SAACOamy6AEma\nNGmS2rdvrxUrVui///2vpk6dqqSkJPXv3990aQAAOML4CPmHH37Q1q1bNW7cOJ133nlKT0/XVVdd\npf/85z+mSwMAwDHGA7lp06aKjY3V66+/ruPHj+ubb77Rp59+qq5du5ouDQAAx/hsOO1pxYoVmj17\ntvx+vyoqKnTLLbfooYceMl0WAACOMT5ClqSioiKlpaUpNzdXc+fO1TvvvKO33nrLdFkAADjGeFPX\nxo0btXz5cr3//vuKiYlR165dtW/fPi1atEjXX3/9ae8dPny4JGnJkiVOlAoAQNgYHyF/8cUXuuCC\nCxQTExO6lpycrL179/7qvcXFxSouLg5neQAAOMJ4ICckJGjnzp06fvx46No333yj9u3bG6wKAABn\nGQ/ktLQ0NW7cWDNmzNCOHTv03nvv6dlnn9WIESNMlwYAgGOMB3JcXJxeeukllZaWavDgwZo3b57G\njx+vwYMHmy4NAADHGG/qkqROnTpp8eLFpssAAMAY4yNkAABAIAMAYAUCGQAACxDIAABYgEAGAMAC\nBDIAABYgkAEAsACBDACABQhkAAAsQCADAGABAhkAAAsQyAAAWIBABgDAAgQyAAAWIJABALAAgQwA\ngAUIZAAALEAgAwBgAQIZAAALEMgAAFiAQAYAwAIEMgAAFiCQAQCwAIEMAIAFCGQAACxAIAMAYAEC\nGQAACxDIAABYgEAGAMACBDIAABYgkAEAsACBDACABQhkAAAsQCADAGABAhkAAAsQyAAAWKCx6QIA\nINL5AxXaXFiiPaVlSmodp9TkRMVENzJdFhxGIAOAQf5AhRa+tkW79x8JXdtYUKyJQ3oQyhGGKWsA\nMGhzYUm1MJak3fuPaHNhiaGKYAqBDAAG7Sktq9N1eBeBDAAGJbWOq9N1eBeBDAAGpSYnqn1CfLVr\n7RPilZqcaKgimEJTFwAYFBPdSBOH9KDLGgQyAJgWE91Ifbu1M10GDGPKGgAACxDIAABYgEAGAMAC\nBDIAABYgkAEAsACBDACABQhkAAAsQCADAGABAhkAAAsQyAAAWIBABgDAAgQyAAAWIJABALCA8dOe\nVqxYoczMTPl8PgWDwdCvUVFR2rZtm+nyAABwhPFAHjRokPr16xf6OhAIaOTIkUpLSzNYFQAAzjIe\nyDExMWrVqlXo62effVaSNGXKFFMlAQDgOKvWkA8fPqznn39eU6dOVXR0tOlyAABwjFWB/Oqrryox\nMVEDBgwwXQoAAI6yKpCXL1+uO+64w3QZAAA4zppAzs/PV0lJia677jrTpQAA4DhrAnnDhg3q3bu3\n4uPjTZcCAIDjrAnk/Px89erVy3QZAAAYYU0gf/XVV+rYsaPpMgAAMMKaQP7uu+909tlnmy4DAAAj\njG8MUmXLli2mSwAAwBhrRsgAAEQyAhkAAAsQyAAAWIBABgDAAgQyAAAWIJABALAAgQwAgAUIZAAA\nLEAgAwBgAQIZAAALEMgAAFiAQAYAwAIEMgAAFiCQAQCwgDXHLwIA7OAPVGhzYYn2lJYpqXWcUpMT\nFRPdqMHvQXUEMgAgxB+o0MLXtmj3/iOhaxsLijVxSI9TBmx97sHJmLIGAIRsLiypFqyStHv/EW0u\nLGnQe3AyAhkAELKntKxO1+t7D05GIAMAQpJax9Xpen3vwckIZABASGpyotonxFe71j4hXqnJiQ16\nD07mCwaDQdNF1Fd6erokad26dYYrAQDvoMvaDLqsAQDVxEQ3Ut9u7cJ+D6pjyhoAAAsQyAAAWIBA\nBgDAAgQyAAAWIJABALAAXdYAworHYYDaIZABhA2HDgC1x5Q1gLDh0AGg9ghkAGHDoQNA7RHIAMKG\nQweA2iOQAYQNhw4AtUdTF4CwiYlupIlDetBlDdQCgQwgrDh0AKgdpqwBALAAgQwAgAUIZAAALEAg\nAwBgAZq6ACDCsd+4HQhkAIhg7DduD6asASCCsd+4PQhkAIhg7DduD6asAaCOvLTmyn7j9iCQAaAO\nvLbmmpqcqI0FxdX+Puw3bgaBDAB1cLo1VzduEcp+4/YgkAGgDry45sp+43agqQsA6oA1V4QLgQwA\ndcAZzwgXpqwBoA5Yc0W4EMgAUEesuSIcmLIGAMACBDIAABZgyhoAIpyXdh5zMwIZACKY13YeczOm\nrAHAAv5AhT7K36vcdV/po/y98gcqHPlzOe3JHoyQAcAwk6NUL+485lZWjJD9fr9mzZqlyy67TFde\neaUee+wx0yUBgGNMjlLZecweVoyQs7Oz9cknn+iFF15QWVmZJk+erKSkJA0ZMsR0aQAQdiZHqZz2\nZA/jgXz48GG98cYbeumll5SSkiJJGjVqlLZu3UogAzhjbuggNjlKZecxexgP5Ly8PMXHxys1NTV0\nbcyYMQYrAuAVbukgNj1KZecxOxgP5F27dikpKUkrV67Us88+q0AgoFtuuUXjxo2Tz+czXR4AF3PL\n2cWMUiFZEMg//fSTduzYodzcXM2dO1elpaV64IEH1KxZM915552mywPgYm7qIGaUCuOB3KhRI/34\n449asGCB2rRpI0nas2ePli5dSiADOCN0EMNNjD/2lJCQoCZNmoTCWJIuvPBC7du3z2BVALzA5NnF\npjb6gHsZHyH36NFD5eXl2rlzp84//3xJUlFRkZKSkgxXBsDtTK3NuqWZDHYxHsgXXHCBrr76amVk\nZCgrK0ulpaV67rnnNH78eNOlAfAAE2uzbmkmg12MB7IkzZ8/X9nZ2Ro2bJhiY2M1fPhwDRs2zHRZ\nAFAvbmomgz2sCOS4uDjNnTtXc+fONV0K4Clu2BTDi2gmQ31YEcgAGh7rmHXXUB9gTG/0AXcikAGP\nYh2zbhryAwwbfaA+CGTAo1jHPL1fjoaPV1Q26AcYNvpAXRHIgEexjnlqNY2GKyqDivL59Msde/kA\nA6cY3xgEQHiY3BTDdjVN5x8tP64fjwVO+r18gIFTGCEDHsU65qnVNOpt1rSxgsHq1/gAAycRyICH\nsY5Zs5pGvVE+n27+3UVq3CiKDzAwgkAGEHFO9VjS5SltCWAYQyADiDhM58NGBDKAiMR0PmxDlzUA\nABYgkAEAsACBDACABQhkAAAsQFMXAHgcx3C6A4EMAKfh9jDjGE73IJAB4BS8EGYcw+kerCEDwCmc\nLszcgmM43YMRMoCIdropaS+EGcdwugeBDCBi/dqUtBfC7FT7dnOKlX0IZAAR69fWV70QZuzb7R4E\nMoCI9WtT0l4JM/btdgcCGUDEqs2UNGEGp9BlDSBipSYnqn1CfLVrbpuShncwQgYQsbwyJQ1vIJAB\nRDSmpM+M23cyswmBDACoFy/sZGYT1pABAPXihZ3MbEIgAwDqxQs7mdmEKWsAnsO6pjO8sJOZTQhk\nAJ7CuqZzvLCTmU0IZACewnGDzuGxsYZFIAPwFNY1ncVjYw2HQAbguHCu8bKuCbcikAE4KtxrvPVZ\n16QJDDYgkAE4KtxrvHVd16QJDLYgkAE4yok13rqsa9IEBluwMQgAR9m2xksTGGxBIANwlG1HHtr2\nAQGRiylrAI6y7dlVNreALQhkAI6z6dlV2z4gIHIRyAAink0fEBC5WEMGAMACBDIAABYgkAEAsACB\nDACABQhkAAAsQCADAGABAhkAAAsQyAAAWIBABgDAAgQyAAAWIJABALAAe1kD8AR/oIIDIsKIn2/4\nEcgAwqrqjfzbfUd0tDyg2CaNdV6bsxr0Dd0fqNDC17ZUO0JxY0GxJg7pQWg0AH6+ziCQAYRN1Rv5\nrpIjKvn+JwUClYqOjlLCObEN+oa+ubCkWlhI0u79R7S5sIRTnBoAP19nsIYMK/gDFfoof69y132l\nj/L3yh+oMF0SGkDVG/mPxwIKBColSYFApX46djz0ht4Q9pSW1ek66oafrzOsGCGvXbtWEyZMkM/n\nUzAYlM/n0zXXXKMnnnjCdGlwANNh3lX1hl0VxlUCgQopNrrB3tCTWsfV6Trqhp+vM2o9Qt60aZMy\nMjI0btw4LV26VBUV1Ucwhw8f1ogRI+pVxNdff620tDR9+OGH+vDDD7VhwwY9+OCD9XotuM/ppsPg\nblVv2NHR1d9qov/3Qauh3tBTkxPVPiG+2rX2CfFKTU5skNePdPx8nVGrEfJ7772nCRMm6LLLLlNU\nVJTmzJmjN998U88884zOPvtsSVIgENCmTZvqVURRUZE6d+6sli1b1ut+uBvTYd6VmpyojQXF2lVy\nRGVHA6E15GZNGzfoG3pMdCNNHNKDLuAw4efrjFoF8lNPPaWJEydq3LhxkqT8/HxNmDBBd911l/7+\n978rLu7MPuUWFRXpN7/5zRm9BtyL6TDvOvGN/NuSIzp6LDxd1lV/Fg1G4cPPN/xqNWW9fft2XX/9\n9aGvu3XrppdeeknFxcWaMGGCAoHAGRWxfft2ffDBBxo4cKAGDBigBQsWnPFrwj2YDvO2qjfyoQP+\nn+66IUVDr+mivt3aMboCfqFWgdyyZUvt3Lmz2rWOHTvqr3/9qz777DPde++9J60p19bevXt17Ngx\nNWnSRE888YSmT5+u1atXKycnp16vB/epGkUNTr9Yfbu10+D0i2noAhBxfMFgMPhrv2nBggV6++23\n9Ze//EVXXXWVzjrrrND3/vWvf2ny5MlKSUnR1q1bVVhYWOcifvjhh2qv+e677+ree+/VZ599Jp/P\nd8r70tPTJUnr1q2r858JAIBNajVCnjBhgvr27auMjAx9/vnn1b43YMAAPfnkkyoqKqp3ESeGsSR1\n6tRJ5eXlOnToUL1fE4C38Kw6vK5Wgbxy5UplZ2dr06ZN6tWr10nfT0tL05o1a+pVwIYNG9SnTx+V\nl5eHrm3btk0tWrTQOeecU6/XBCJJJARV1bPqVX/H3HVfaeFrWzz5d0XkqlUgZ2dna8qUKaqoqFCT\nJk1O+v769et144031qvbumfPnoqNjdX999+v7du3a/369crJydGYMWPq/FpApImUoOJZdUSCWgXy\n0qVLVVBQoN///vf64osvQtf9fr/mzJmju+++Wx07dtSqVavqXEDz5s21ePFiff/997r11lv1wAMP\naOjQoRo1alSdXwuINJESVDyrjkhQq+eQU1JStGLFCmVmZmro0KGaOnWq+vTpo6lTp2rnzp2aOnWq\nRo8efdoGrNPp1KmTFi9eXK97gUgWKUHFs+qIBLXeyzouLk4LFy5Ubm6uZs2apcrKSnXu3Fm5ubnq\n0qVLOGsEcAqRElRVO36dOBvAs+rwmjodLlFSUqI1a9aosrJSCQkJOnjwoIqLiwlkwJBICSq2bkQk\nqHUgr1mzRllZWYqNjdWLL76o7t27a/bs2frzn/+s2267TRkZGYqJiQlnrQB+IZKCiq0b4XW12hgk\nMzNTK1eu1MCBAzV79uxqzw2vXr1aM2fOVLt27bRgwQJdfPHFYS34RGwMAgDwilp1Wb/77rt66KGH\n9Pjjj5+0iccNN9ygN954Q9HR0Ro8eHBYigTcKhKeEQbQMGo1Zb1y5Up16NDhlN8///zztWzZMj3y\nyCMNVhjgdlXPCJ+4vruxoJh9ugHUqFYj5NOFcZXo6Gjdf//9Z1wQ4BVufkaYkT3gvDp1WQOoPbc+\nI8zIHjCjViNkAHXn1meE3TyyB9yMQAbCJDU5Ue0T4qtdc8Mzwm4d2QNux5Q1ECZufUbYrSN7wO0I\nZCCM3LiZRaTs/gXYhkAGUI1bR/aA2xHIAE7ihpG9P1DBhwZ4CoEMwHV4NOtnfCjxFgIZgOuc7tEs\n20f29VFT8EriQ4nHEMgAXCcSHs2qCuFv9x3Rlq9KddQfUJTPJ+nn4O3dNTGiPpREAgIZgOt4/dGs\nE6fky44G9P0P5YqOjlLCObGK8vm0e/8RBVXzQX1e+lASadgYBHAAe0M3LLduulJbJ07JBwKVoV9/\nOnb8V+/1yoeSSMQIGQgzGpAantcfzTpxlBsdHSUd/fl/BwIVUmy0JOmyrm20SSU8L+4hBDIQZpHW\ngOQUNzyaVV8njnKbN41W2dGAAoFKRf/vA0f7hHhdntJWl6e09eyHkkhEIANhFgkNSGhYJ+6W5vNJ\niec0U9MmjdSjc2ud1+asasHr1Q8lkYhABsLMhgYknld1F69PyaNmBDIQZqb3hmYN2528PCWPmhHI\nQJiZHu2whg24A4EMOMDkaIc1bMAdCGTA42xYwz4R69lAzQhkwONMr2GfiPVs4NQIZMDjTK9hn4j1\nbODUCGQgAtjSsct6NnBq7GUNwDG2rWcDNiGQARdy62EVXj8UAjgTTFkDLuPmxiib1rMB2xDIQD2Y\nfHTH7Y1RtqxnA7YhkIE6Mj1CpTEK8CbWkIE6Ot0I1Qk0RgHeRCADdWR6hEpjFOBNTFkDdWR6hEpj\nFOBNBDJQRzZsRUljFOA9BDJQR4xQAYQDgQzUAyNUAA2Npi4AACxAIAMAYAECGQAACxDIAABYgEAG\nAMACBDIAABYgkAEAsACBDACABdgYBHCAyfOTAbgDgQyEmenzkwG4A1PWQJiZPj8ZgDsQyECYmT4/\nGYA7EMhAmJk+PxmAOxDIQJilJieqfUJ8tWtOn58MwH40dQFhxvnJAGqDQAYcwPnJAH6NVVPWY8eO\nVWZmpukyAABwnDWB/Pbbb+v99983XQYAAEZYEciHDx9WTk6OunXrZroUAACMsGINed68ebrpppu0\nf/9+06UAAGCE8RHyxo0blZeXp/Hjx5suBQAAY4wGst/v18yZM5WVlaWYmBiTpQAAYJTRKeuFCxcq\nJSVFffv2NVkGYBVOhgIiky8YDAZN/eHp6ek6ePCgfD6fJCkQCEiSYmJi9Omnn9bqfklat25d+IoE\nHFTTyVDtE+I5GQqIAEZHyEuWLNHx48dDX+fk5EiSpk2bZqokwKjTnQzFxiKAtxkN5LZt21b7unnz\n5pKkDh06mCgHMI6ToYDIZbzLGsD/4WQoIHJZ8RxylYcffth0CYBRqcmJ2lhQfNIaMidDAd5nVSAD\nNjHR7czJUEDkIpCBGtTU7byxoNiRbmdOhgIiE2vIQA1O1+3sNH+gQh/l71Xuuq/0Uf5e+QMVjtcA\nIPwYIQM1sKXb2eRIHYCzGCEDNbCl29mmkTqA8CKQgRqkJieqfUJ8tWsmup1tGakDCD+mrIEa2NLt\nbMtIHUD4EcjAKdjQ7cxzyUDkIJCBMDuT55ltGakDCD8CGQijhuiStmGkDiD8aOoCwoguaQC1xQgZ\nOAO/Nh1NlzSA2iKQgXo61XT03TdfqvyvD2hPaZnKfvIrGJR8vur30iUN4JcIZKCeapqO3lVyRNkv\nfKLywHFJUmUwqLKfjiu+WXQolOmSBlATAhmop5qmnX88FtChI8d0zllNJUlRPp/imjVW987nKq5Z\nDF3SAE6JQAbqqaZp50CgUtG/CNufQzlGg9Mvdqo0AC5ElzVQTzVtr9nm3GZq1vTkz7msGQP4NYyQ\ngXqqadOObhedq2dXFLhmZ60z2bQEQMPyBYPBoOki6is9PV2StG7dOsOVAP/HLSFXU5d4+4R4jnYE\nDGGEDDQwt+ysdbpNS9xQP+A1rCEDEYpNSwC7EMhAhOJoR8AuBDIQoWrqEre5AQ3wOtaQgQjF0Y6A\nXQhkIIK5pQENiARMWQMAYAECGQAACxDIAABYgEAGAMACBDIAABYgkAEAsACBDACABQhkAAAsQCAD\nAGABduoCIoBbzmgGIhmBDHicP1Chha9tqXb28caCYk0c0oNQBizClDXgcZsLS6qFsSTt3n9EmwtL\nDFUEoCYEMuBxe0rL6nQdgBkEMuBxSa3j6nQdgBkEMuBxqcmJap8QX+1a+4R4pSYnGqoIQE1o6gIM\nC3cHdEx0I00c0oMua8ByBDJgkFMd0DHRjdS3W7sGez0ADY8pa8AgOqABVCGQAYPogAZQhSlrOIbd\nok5GBzSAKgQyHMFuUTVLTU7UxoLiaj8XOqCByEQgwxGnWyuN5GYjOqABVCGQ4QjWSk+NDmgAEk1d\ncAhrpQBwegQyHMFuUQBwekxZwxGslQLA6RHIcAxrpQBwakxZAwBgAQIZAAALEMgAAFiAQAYAwAIE\nMgAAFiCQAQCwgBWB/O2332r06NHq2bOn0tLStHjxYtMlAQDgKOPPIQeDQY0dO1bdu3fXqlWrtGPH\nDk2ZMkVt2rTRoEGDTJcHAIAjjI+QDxw4oK5duyorK0vnnXee+vXrpyuuuEJ5eXmmSwMAwDHGA7l1\n69Z69NFH1axZM0lSXl6eNm3apD59+hiuDAAA5xifsj5RWlqaiouL9dvf/lbXXHON6XIAAHCM8RHy\niRYuXKhnnnlGhYWFevDBB02XAwCAY6wK5EsuuURXX321MjMz9dprr+n48eOmSwIAwBHGA/ngwYNa\nu3ZttWsXXXSRAoGAysrKDFUFAICzjAfy7t27NXHiRJWWloauFRQUqGXLlmrRooXBygAAcI7xQL70\n0kuVkpKizMxMFRUVaf369Zo/f77GjRtnujQAABxjvMs6KipKTz/9tObMmaOhQ4cqNjZWI0aM0PDh\nw02XBgCAY4wHsvTzs8hPPvmk6TIAADDGikBGw/MHKrS5sER7SsuU1DpOqcmJioluZLosAMApEMge\n5A9UaOFrW7R7/5HQtY0FxZo4pAehDACWMt7UhYa3ubCkWhhL0u79R7S5sMRQRQCAX0Mge9Ce0pqf\n3z7VdQCAeQSyByW1jqvTdQCAeQSyB6UmJ6p9Qny1a+0T4pWanGioIgDAr6Gpy4Niohtp4pAedFkD\ngIsQyB4VE91Ifbu1M10GAKCWmLIGAMACBDIAABYgkAEAsACBDACABQhkAAAsQCADAGABAhkAAAsQ\nyAAAWIBABgDAAgQyAAAWIJABALAAgQwAgAUIZAAALEAgAwBgAQIZAAALEMgAAFiAQAYAwAIEMgAA\nFiCQAQCwAIEMAIAFCGQAACxAIAMAYAECGQAACxDIAABYgEAGAMACBDIAABYgkAEAsACBDACABQhk\nAAAsQCADAGABAhkAAAsQyAAAWIBABgDAAgQyAAAWIJABALAAgQwAgAUIZAAALEAgAwBgAQIZAAAL\nEMgAAFiAQAYAwAIEMgAAFiCQAQCwAIEMAIAFCGQAACxAIAMAYAECGQAACxDIAABYgEAGAMACxgO5\npKRE99xzj/r06aOrr75ac+fOld/vN10WAACOamy6gHvuuUctWrTQq6++qkOHDum+++5To0aNNG3a\nNNOlAQDgGKMj5G+++Ub5+fl6+OGH1alTJ/Xq1Uv33HOP3nrrLZNlAQDgOKOB3Lp1az333HNq2bJl\n6FowGNSRI0cMVgUAgPOMBnJ8fLyuvPLK0NfBYFBLlixR3759DVYFAIDzjK8hn+iRRx7Rl19+qddf\nf71Wv3///v2qqKhQenp6mCsDAKB22rZtqyVLltT5PmsCOScnR6+88ooef/xxderUqVb3NGnShI5s\nAIAn+ILBYNB0EXPmzNGyZcuUk5Oja6+91nQ5AAA4zvgI+amnntKyZcv02GOPacCAAabLAQDACKMj\n5KKiIt144426++67dfvtt1f73rnnnmuoKgAAnGc0kP/2t7/pscceq3YtGAzK5/OpsLDQUFUAADjP\nijVkAAAinfG9rAEAAIEMAIAVCGQAACxAIAMAYAHXBrLf79d9992n3r1766qrrtKLL75ouiRH+P1+\n3XDDDdq0aZPpUsIqEs/J/vbbbzV69Gj17NlTaWlpWrx4semSHDN27FhlZmaaLiOs1q5dqy5duig5\nOTn066RJk0yXFVZ+v1+zZs3SZZddpiuvvPKkp2q8ZMWKFSf9++3SpYu6du1a69cwvjFIfc2bN0/b\ntm3TK6+8ot27d2v69OlKSkrSNddcY7q0sPH7/ZoyZYq+/vpr06WEXaSdkx0MBjV27Fh1795dq1at\n0o4dOzRlyhS1adNGgwYNMl1eWL399tt6//33dfPNN5suJay+/vprpaWlKTs7W1UPtzRp0sRwVeGV\nnZ2tTz75RC+88ILKyso0efJkJSUlaciQIaZLa3CDBg1Sv379Ql8HAgGNHDlSaWlptX4NV46Qjx49\nquXLl2vGjBnq0qWL+vfvrz/+8Y/12szbLYqKijRkyBDt3r3bdClhF4nnZB84cEBdu3ZVVlaWzjvv\nPPXr109XXHGF8vLyTJcWVocPH1ZOTo66detmupSwKyoqUufOndWyZUu1atVKrVq1UlxcnOmywubw\n4cN64403lJ2drZSUFF1++eUaNWqUtm7darq0sIiJiQn9e23VqpVWrVolSZoyZUqtX8OVgfzll1+q\noqJCPXr0CF3r1auX8vPzDVYVXp988omuuOIKLVu2TF5/dDwSz8lu3bq1Hn30UTVr1kySlJeXp02b\nNqlPnz6GKwuvefPm6aabbqr1gTJuVlRUpAsvvNB0GY7Jy8tTfHy8UlNTQ9fGjBmjBx980GBVzjh8\n+LCef/55TZ06VdHR0bW+z5WBXFpaqhYtWqhx4/+bcW/VqpXKy8v1/fffG6wsfG677TZNnz7d81Nc\nEudkp6Wlafjw4erZs6enl2A2btyovLw8jR8/3nQpjti+fbs++OADDRw4UAMGDNCCBQsUCARMlxU2\nu3btUlJSklauXKlrr71W/fv319NPP+35AYUkvfrqq0pMTKzz+QyuDOSjR48qJiam2rWqr73e+BOJ\nqs7Jnjx5sulSHLFw4UI988wzKiws9Oxowu/3a+bMmcrKyjrpv2Uv2rt3r44dO6YmTZroiSee0PTp\n07V69WomLqSUAAAFS0lEQVTl5OSYLi1sfvrpJ+3YsUO5ubmaO3euMjIy9Morr+jll182XVrYLV++\nXHfccUed73NlU1dN5yBXfR0bG2uiJIRJfc7JdrtLLrlEkpSZmalp06YpIyOj2myQFyxcuFApKSkR\nM+vRrl07ffzxxzrrrLMkSV26dFFlZaXuvfdeZWZmyufzGa6w4TVq1Eg//vijFixYoDZt2kiS9uzZ\no6VLl+rOO+80W1wY5efnq6SkRNddd12d73Xlf+WJiYk6dOiQKisrFRX18yD/wIEDatq0aej/8HC/\nE8/J7t+/v+lywurgwYP67LPPqv09L7roIgUCAZWVlalFixYGq2t4//znP3Xw4EH17NlTkkJTt++8\n844+/fRTk6WFzS/fmzp16qTy8nIdOnRI55xzjqGqwichIUFNmjQJhbEkXXjhhdq3b5/BqsJvw4YN\n6t27t+Lj4+t8ryunrJOTk9W4cWNt2bIldG3z5s1KSUkxWBUa0onnZF977bWmywm73bt3a+LEiSot\nLQ1dKygoUMuWLT0XxpK0ZMkSrV69Wm+++abefPNNpaWlKS0tLdSZ6jUbNmxQnz59VF5eHrq2bds2\ntWjRwpNhLEk9evRQeXm5du7cGbpWVFSkpKQkg1WFX35+vnr16lWve10ZyE2bNtVNN92krKwsFRQU\naO3atXrxxRc1cuRI06WhARQVFWnRokUaO3asevbsqQMHDoT+8apLL71UKSkpyszMVFFRkdavX6/5\n8+dr3LhxpksLi7Zt26pDhw6hf5o3b67mzZurQ4cOpksLi549eyo2Nlb333+/tm/frvXr1ysnJ0dj\nxowxXVrYXHDBBbr66quVkZGhL7/8Uh988IGee+453X777aZLC6uvvvpKHTt2rNe9rpyyln5eX5s1\na5ZGjhyp+Ph4TZo0yfPTmlW8uN50onXr1qmyslKLFi3SokWLJHn/nOyoqCg9/fTTmjNnjoYOHarY\n2FiNGDFCw4cPN10aGkDz5s21ePFiPfTQQ7r11lvVvHlzDR06VKNGjTJdWljNnz9f2dnZGjZsmGJj\nYzV8+HANGzbMdFlh9d133+nss8+u172chwwAgAVcOWUNAIDXEMgAAFiAQAYAwAIEMgAAFiCQAQCw\nAIEMAIAFCGQAACxAIAMAYAECGQAACxDIQATYtWuXevXqpczMzJO+9/nnn+vSSy/VsmXLql1fvXq1\n0tLSnCoRiHgEMhABOnTooBkzZmjlypVas2ZN6HpZWZkmT56sAQMG6A9/+EPo+tq1azVjxgzP75sO\n2IRABiLEzTffrIEDByorK0slJSWSFBoxz549W9LPAZ2RkaHJkyfX+8QaAPVDIAMRZPbs2YqNjdV9\n992n3Nxc/fvf/9bjjz+uuLg4ST+fy1xSUqLc3Fylp6cbrhaILJz2BESYjz/+WHfddZeioqI0bdq0\nU54j/tRTT2nFihVat26dwxUCkYkRMhBhunfvroSEBFVWVqpPnz6mywHwPwQyEGFmz56t48ePq3Pn\nzpo6dar8fr/pkgCIQAYiyurVq7VixQrNmTNH8+bN086dOzVv3jzTZQEQgQxEjJ07d2rmzJm67bbb\n9Lvf/U5dunTRpEmT9I9//EPr1683XR4Q8QhkIAIEAgFNnjxZ7dq1U0ZGRuj66NGj1bt3b2VmZuq7\n774zWCEAAhmIAI888oiKioq0YMECxcTEhK77fD7NmzdPgUCgWlADcB6PPQEAYAFGyAAAWIBABgDA\nAgQyAAAWIJABALAAgQwAgAUIZAAALEAgAwBgAQIZAAALEMgAAFiAQAYAwAIEMgAAFiCQAQCwwP8H\nRRfKz2P6jOAAAAAASUVORK5CYII=\n",
"text/plain": [
"<matplotlib.figure.Figure at 0x11279a9e8>"
]
},
"metadata": {},
"output_type": "display_data"
}
],
"source": [
"sns.lmplot('X1', 'X2', data=data1, fit_reg=False)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# data2"
]
},
{
"cell_type": "code",
"execution_count": 6,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>X1</th>\n",
" <th>X2</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>1.842080</td>\n",
" <td>4.607572</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>5.658583</td>\n",
" <td>4.799964</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>6.352579</td>\n",
" <td>3.290854</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>2.904017</td>\n",
" <td>4.612204</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>3.231979</td>\n",
" <td>4.939894</td>\n",
" </tr>\n",
" </tbody>\n",
"</table>\n",
"</div>"
],
"text/plain": [
" X1 X2\n",
"0 1.842080 4.607572\n",
"1 5.658583 4.799964\n",
"2 6.352579 3.290854\n",
"3 2.904017 4.612204\n",
"4 3.231979 4.939894"
]
},
"execution_count": 6,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"mat = sio.loadmat('./data/ex7data2.mat')\n",
"data2 = pd.DataFrame(mat.get('X'), columns=['X1', 'X2'])\n",
"data2.head()"
]
},
{
"cell_type": "code",
"execution_count": 7,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/plain": [
"<seaborn.axisgrid.FacetGrid at 0x11294b8d0>"
]
},
"execution_count": 7,
"metadata": {},
"output_type": "execute_result"
},
{
"data": {
"image/png": "iVBORw0KGgoAAAANSUhEUgAAAeQAAAHmCAYAAACiZv3yAAAABHNCSVQICAgIfAhkiAAAAAlwSFlz\nAAAPYQAAD2EBqD+naQAAIABJREFUeJzs3Xl8W9WdP/zPvdKVJVl24uAlzsaWpCTjhAQChECBYtqh\ny7wYZgovZmDagU7hmZbQlkJLgA4F0pV2WqBTytNpmafQjbRlmaU8v9Z9pixZSCCJE+LgOEA227Id\nO7ZlbVe65/nj+l5rtyxLvlfy5/16/V7zi2zLR0rJR+d7vuccSQghQERERJaSrR4AERERMZCJiIhs\ngYFMRERkAwxkIiIiG2AgExER2QADmYiIyAYYyERERDbAQCYiIrIBBjIREZENOK0ewGSee+45bNq0\nCZIkQQhh/l9ZlnHgwAGrh0dERFQUtg/kj370o7jsssvMP6uqik9+8pO48sorLRwVERFRcdk+kF0u\nF0477TTzz08++SQA4M4777RqSEREREVXVmvIw8PD+Pd//3fcddddUBTF6uEQEREVTVkF8i9+8Qs0\nNTXhgx/8oNVDISIiKqqyCuTf/OY3+Id/+Aerh0FERFR0ZRPI7e3t8Pv9+MhHPjKln7vppptw0003\nlWhURERExWH7pi7Dq6++igsuuAA1NTVT+rmenp4SjYiIiKh4ymqGfP7551s9DCIiopIom0Du7OzE\nWWedZfUwiIiISqJsAnlwcBBz5syxehhEREQlUTZryHv27LF6CERERCVTNjNkIiKiSsZAJiIisgEG\nMhERkQ0wkImIiGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0w\nkImIiGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0wkImIiGyA\ngUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0wkImIiGyAgUxERGQD\nDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0wkImIiGyAgUxERGQDDGQiIiIb\nYCATERHZAAOZiIjIBsoikKPRKB588EFceOGFuPTSS/G9733P6iEREREVldPqAeRj8+bNeP311/HT\nn/4UgUAAX/jCF7Bw4UJcf/31Vg+NiIioKGw/Qx4eHsbvfvc7bN68GS0tLVi/fj1uueUW7N271+qh\nERERFY3tZ8hvvPEGampqsG7dOvOxT3/60xaOiIiIqPhsP0M+duwYFi5ciOeffx4f/vCHcdVVV+GH\nP/whhBBWD42IiKhobD9DDgaDeO+997BlyxZ885vfRH9/P77yla/A6/XiH//xH60eHhERUVHYPpAd\nDgfGxsbw3e9+F/PnzwcAnDhxAr/85S8ZyEREVDFsX7JubGxEVVWVGcYAcOaZZ6K3t9fCURERERWX\n7QN5zZo1iEQiOHLkiPnY4cOHsXDhQgtHRUREVFy2D+QzzjgDl19+Oe655x4cPHgQr7zyCn784x/j\n7//+760eGhERUdHYfg0ZAL7zne9g8+bNuPHGG+HxeHDTTTfhxhtvtHpYRERERSOJCt8/1NraCgBo\na2uzeCRERETZ2b5kTURENBswkImIiGyAgUxERGQDZdHURTSbRdU4dnX4caI/gIUNPqxb0QSX4rB6\nWERUZAxkIhuLqnE8/uweHO8bNR/btq8HG69fw1AmqjAsWVeIqBrH1vZubGnrxNb2bkTVuNVDoiLY\n1eFPCmMAON43il0dfotGRESlwhlyBSiXWRRLr1N3oj8wpceJqHwxkCtArlnUhtULLBpVsnL50GA3\nCxt8U3qciMoXS9YVoBxmUSy9FmbdiiYsaqxJemxRYw3WrWiyaEREVCqcIVeAcphFlcOHBjtyKQ5s\nvH4NS/1EswADuQKsW9GEbft6kmagdptFlcOHBrtyKQ7bLD0QUekwkCtAOcyi7Pyhgc1mRGQHvFyC\nZowdgy9Ts9mixhpbNJvZ8f0iotLhDJlmldSQi8U1W3aoZ/qg8NreblzUMh/+wSADmqgCMZBpRthh\n21OmMcQ1AUkCZElK+l6rm81Su9KFAN7s7EPnsSH4PAoAbhsjqjTc9kQZFfvkLztse8o0hlAkhmA4\nlva9pWg2m8p7mvqBYCysQlU1qAk/w21jRJWFM2RKU4rZrB22PWX6XdVuBVpKG0Upms2m+p6mfiBQ\nVQ0AoKR8r9UzeSIqHgYypSnFyV922PaU6XdJEvDxDyyD0yGXtHlqqu9pale6oshQYjK87uT/ZCtl\n2xgb2IgYyJRBKWazdtj2lG0M61uaS/6P/1Tf09StbE3zvNi+vxc9AxPfb5dtY9Nlh/4CIjtgIFOa\nUsxm7bBXOp8xlGqmVsh7mnogyPqW5oqcRZbDWexEM4GBTGlKNZu1w4lTucZQyq1GxXhP7fD+lYId\n+guI7ICBTGnsMJu1Qim3Gs3W9zQfdugvILIDBjJlVKmzsVyybjVyxoHxQJ5OKXU2vqf5sEN/AZEd\nMJCJxnGrkTVYPSDSMZCJxq1eWo8XXzmM3oEgFEWG0ylDUSp3q5GdsHpAxECmCjXVbumoGseTz+1D\nKBKDoshQ1Tga51Vj2aK56B0cM7+PpVQiKhUGMlWcQva1Gg1dsiTpDVweBWosjotXN5f80JDp4IEa\nRJWDgUwVp5B9rdnWhf2DQVzXurzoYywGHqhBVFkYyGTrWVYhYytkX2viurAmBILhGKJqHIFgFFE1\nbpv3IxEP1CCqLAzkWc7Os6xCxmaE6NBIBIoio9qtwLhZMVczlrH15qh/BH2DIYSjccgy8Fp7DwZO\nhfG5G9Za/n6k4oEaRJWF1y/OcpNdi1jsaxgLHZsmBAIhFe1d/fj5Sx0Zx2EE+J5D/YjE4hgaicA/\nFIQQkzdjGVtvVp1dj2hMf24JEk6NRvBmZx+27+/JOdZ836divp88UIOosnCGPMvlmmVNZYZairK3\nMTZNCPQNhcx9wX9+8wQGRyJp40hszGqs8yAYjkFV4zh3WT1uvHpFzlm1MfZDx04BAnDIkvl1VdWw\n84Afl61dlPXn83mfcn2fMf6pvH88UIOosjCQZ7lcs6x81yinW/bOFubG2PRg1czvVxQ54zgSP1wk\ndkv7vK6cYZw49t7BIGJxAacDkKSJUBYQGX8eSJ/JB8Mxcyaf+EEg2/u5fX8Pdh7wT/n944EaRJWF\ngTzL5ZplvfDy4Yw/kzqrnk5zUa4wN8bW3tVvfs1YF840jkJKuIljF+MzYwGBmAYoDsn8nReunJ/1\nOYxxxDQNvQNBqDENkiTh/+w4it2d/fj4lcuwvqU5azXi9QO9ONGX/LV83z8eqEFUORjIs1yuWVa+\nATed5qLJwnzj9Wvw85c68Oc3T0zapFVICdcYoxCAfyiIqBqHBABCnxXX1bixfEkd1rc0Z32OhQ0+\naEKgdyCIyPiasNAExsIaov1xPP37Duw84McFK6dWSmZzFtHswkCmrLOsfANuOs1Fk4W5S3HgxqtX\nYHAkMuk4CinhGmM0LpKQIMHplOGtcsIhS7hkdXPO9WdAf59efPkdqDG9rC4SqtuaBqhqHMf7RnHB\nyiYsaqxJex0XrGzCc31dWcdGRLMDA5mySg24pnleAMALLx9OCrvpNBflE+b5BG3qOvQ1l51tfj1X\nw5kx9n1dA0m/b94ct74OnWP9OfH71yxvwIn+UYwGVQgJEOOpLIQwL6fwDwYzvg4AaWvIbM4imn0k\nIUT2bpUK0NraCgBoa2uzeCTlLdNa76LGGrPxqNAu68med7pjAzDp80fV+HhZ/DgUxQGv2wl5vC5+\nXevyvNZot7Z349d/fBt9QyGEI3HENX22XKU4sKChGgCwZlkDfF5XXh8o2JxFNPtwhkx5mWytt9Dm\nomJ0Ck+2l3qyhrOplMWzMWbaADAWimFoNAxZkjC/Xq8qBIIx7D00YK5/b9vXg9uuXYX2roGk1z3T\nDVr8IEBkHwxkykspT4WabqdwIWNL/dpUPhhkC7FM5X3/YBCBYDQpjAHgqH8Em5/agUh04mCQmT4h\nzc6ntBHNRmURyH/84x9x++23Q5IkCCEgSRI+9KEP4dFHH7V6aLOGHU6Fmmy/8lTGlulrqR8MjFO1\nUtd7c4VYpg8WW9o6k8IY0PdWD49GUVdbZT420+dQ8yxsInspi0Du6urClVdeic2bN5vNMlVVVZP8\nFBWT1adCZZrNvba3Gxe1zEd3fwBVLgfCkbgZfIljK2Tc2WaPF6xsmnKIZQr/bBdWzORWJ56FTWQv\nZRHIhw8fxrJlyzBv3jyrhzJr5dtxnY9C1i1TZ3NCAG929qHz2BB8HgWaEPC4FKx5XwOWNNUkPefG\n69dg+/4evH6gFwDy2g+cbfYoIJJug3KNN4HlCrFMH2aaT/MhHI2lfe9MVhzsUPUgogllE8iXXHKJ\n1cOY9YyS7HTWHo2fPeofMUPtxZd9uP+WC+HzurL+3NHeEQRCqhmCQgioqgbVGQc8CmRJQkSNYUlT\nTcaZ6vb9vTh0bAhRNY63jwxh+/5efD7DDU7Gh4WXtr2HQEiF163/J2KM1emQ0TcYMvccj4ViCIRU\n8wNKtvctdX169dJ6PPncvuSQrvchFtewpa1zRhqsrK56EFGysgjkd999F6+88gqeeOIJaJqGq6++\nGnfccQcURbF6aLPSdNYed3X49SsOEy6L6Dp+Cpuf2oGHbt2QtYlqz6F+DI1EAOghKPSjtMw9voZM\nM9Xt+3uwu7PP/H1joRh2j9/glHhhROIHjUBIxdBIBKPBKCRIZgD3aGMIR+NJl0/kI9P6cmrFYcf+\nXjz3vxMHhJS6wSpbIxuAtLVzNnkRlZ7tA7m7uxvhcBhVVVV49NFHcfz4cWzevBmRSAT33nuv1cOb\nlaaz9niiP5B2WQQA9A4Eswb6rg4/wpE4FEU2f07TAKdDMmewhkzl1tcP9Kb9PlXV8PqB3qRATvyg\nUe1WEAipCEfiZiOhLAPxuAZJEvBUKXDIknmcp38wOOlrT5UY0lvbu9E9MPH+CQEcPDKIx57djQ2r\nFpQsFDM1srHzmsgatg/kBQsWYMeOHaitrQUAnHPOOdA0DV/60pewadOmpBt5aGZMZ+1xYYMv4x3A\niiLnDHpJAprqvOYRl06nDE/VxAEewNTLrRKS/7eT+PsFBKrdCiLRGDRND2QJEsJRDZoGyBKSOqSn\nu+6a9LvHz9VWVQ37uwZw3B/Ai68cxpplDVgyv7akM1Z2XhNZx/aBDMAMY8PZZ5+NSCSCU6dOoa6u\nzqJRzV7TWXvUz332oev4KfMxY5ZphFpq05exPitJGL9SUf+5a69YCqdDnrS0euHK+XjjYF/aFY6p\nzV3G70+8fzkWFxACEJoGWZYhy4Am9O9Jfe3TOWQjMdCNDx0A4HQ6zHA+ORyGz6OUdMbKzmsi69g+\nkF999VV88YtfxMsvv2xudTpw4ADmzp3LMLaAEToLG6oxr7YKHreS1tWci0tx4P5bLsTmp3agdyBo\nhvHipolQSy2ZNtf7sKDel1TSXdRYg/UtzXn9zvUtzdixvxedx4agqhoURcbyxek3OBkfNA4eGURU\njUONaeZFEUIAakyDy+mAt8qB1UsbcMaC2rz3J08m8UOOEcaKIgMQ5p9VVW9gK+WMlZ3XRNaxfSCv\nXbsWHo8H9913Hz772c/i6NGjeOSRR/DpT3/a6qHNGkYIH+0dwZ5D/Wn7ff/miqVTmq35vC48dOuG\njLPJre3daSXTnoFA3rPhTFyKA5+7YS227+/BzgN+CIiM9xsbTU7f/9Wb2LavF5lOefdUOXHaHDcu\nOXdBUiBmGvdUgjOxwcr4UOB1OzE8GjW/J7GBrVQzVnZeE1nH9oFcXV2Nn/zkJ/j617+Oj3/846iu\nrsYNN9yAW265xeqhzQqZOo8VRUZTnReSNBE661Y0Talcm+1Uq2xB4x8M4rrW5Wljy/d3RtU4/ue1\n99BzMgCX4sAx/yh2HvCnzWBdigPzat1JJWmDLElwyJI5m89n3FMJTuM9WbeiyXzPFUUGQvpsObGB\nrVQz1mKcLU5EhbF9IAP6mvFPfvITq4cxKyU2+RjNWKqqYSys6uu5AI76R9NmVZOVa6d7DOZUuoGj\nahybn9qBruPDACb2DhuvL7XLeM+hfqRegiYBcDllXH7ewoz3Ixez1JsYiu92D+O1vd0IhFUEwzF4\n3U4saaot6Yx1umeLE1FhZKsHQPaWOMNLDKHEBqlQWM1521IqI0y3tHVia3s3trR14vFn9yCqxrFu\nRRMWNdYkfX+mkmniBwUhgEBIxb6uAfz8pY60Lu5dHX70DiRvS1JVDcFwLG0Gu6vDj0g0Dqec3IMt\nyxLOWjQnYxgDyHvc2d4P433Y2t5tHn6yemk99h0ewFg4BqHp3+epcuK2a1dxxkpUgcpihkzWSZzh\ned1OBEKq2RgF6KHjqcr8P6Ns5drJttbkUzI1njtxixAA/PnN4xgciSTNlE/0B8zSbyJVjafNYE/0\nB/Q9yFUqpGgcmgCEEDhtjhv333xR1juMm+Z5sXZ5g35gCfTO7nyazqJqHN//1W7zFDGX4sCre7vx\nmb9djc0/fd2c1QN62TociaO9a4AzWKIKxECmnBKbfGRJQmOdJ+3M6F0dfux4qzftZ7OVaydbb82n\nZGo8d+IWIUBvfEptplrY4DMP+kj83vmn+dJmsAsbfGl7nhVFxj98eEXS0Z6JJXNjmxQAc219J/xp\nXdyZZDtF7Fd/eBs9J5PfJ2OpgFuQCsf7n8nOGMiUUz5NPlPtzC3Geuu6FU14bW833uzsQyyuQZIk\nuF0Os/EpMbSM8QETAT6/3ov7b74QLsWRNtNtrvehZyBg7nk2tlglSpzlJ548Zqyt59thne0Usfau\nAbgUB8ZCsbSvcQtSYXgKGdkdA5kmNdmMdaqducXaWiMAOBPOlBYQ5ulbiaGVa3yZ/pFeUO/DtVcs\nhX8wmPV856O9I+b3J65Zq6pmHlwynZmst0qBJCF9Vl/v5RakAvEUMrI7BvIslU/pbirlval05hZj\na82uDj96BgKYN8eNmKYfnhGLCYyFVZxz+ry00Mo2vkz/SHcPBOB0yOY2q0yhXeVyQBMCsiQlzWSN\ntXUgvxl/tlPEPrR+CXa/3Q/AmIHHMf80nzmrn47ZWrblKWRkdwzkWSif0l2py3vT3Vpj/CNqrGsb\nofW+0+umNMZ8/pHOFNrhSBwel4KIGjOb3QD9Ugog/xl/tlPELj13IS49d2HRg3M2l215ChnZHQN5\nFsqndGf38l7iP6KyJI2v9yrYsGrBlIIln3+kM4W2JMFsbDPWngEklbnzPUr0czeszRq8xX6v7f73\nWko8hYzsjoE8C+UzK5zp8l4gGMWWtk682z2CMxfU4rrW5UldzamK9Y+r8TzH/KNJDV+rl9ab35Mt\ntJc01RQlxFyKwxy38f6Wqow8m8u2PIWM7I6BPAvlMyucyfJeIBjF5/71zxgORAAAB94dxKt7e/Do\nnZdnDeVi/ePqUhy47dpV2PzT13FqNAxFcSAUieHJ5/aZZdxSz6xmsow828u2PIWM7IyBPAvlEzAz\nEUJGmL59ZBCnAuGk+4mHAxFsaevEzX/VkvU5Ev9xnU6jUnvXACJqDHW1bvOxxDJuqWdWM1lGZtmW\nyL4YyLNQPgFTyhBKnRF2948hFhdwOpAUyu/2jGR7ipzPB0xthpmrjJsa9NdcdnbR3gPjeY/0jkAI\nmDdoTTau6WDZlsi+GMizVD6lu1KV91JnhC5FRigag6ZJcCScrn5mc+2Un08I/XAO41zrG69eAUA/\nEev1A/ppYqnHWmYr1zbN85aklJz6ASIQUhEIqeYpX4ZS3ujEsi2R/TCQacalzvzqat0IhFQIoZ8E\nrWn6Pt/Tm2vN852B7GXpXOda958KQ9ME9nb1m4+/cbAP2/f34vM3rM25RgygJKXk1A8kxrapxBu0\nWEYmmn0YyDTjUmd+xh3D9XM96Dp2CkII1NW68Z+vvIPdb/dj4/VrACDrbDXXudaHjg0hHIknPa6q\nGg4dG5p0jfiFlw9nHP90S8mpP2/spV7cVIPT59eyjEw0SzGQacZlmpGePr8WF6xswtBIOOl7E69x\nzDZbNZ5vX9eA+TVFkeF1O3FqNIJIynWMgH7TU+rVkqmz3lJ1JGf6eVmSsGHVApaSiWYx3odMM86Y\nkV7XuhwbVi/Ada3LsfH6NfAPBjN+/4n+QM7GK+P5Lj9vIXweJ+pqq9BY5zGPtazKMNNUFMekwTqd\nO46teF4iKm+cIZMlijUjNb7mUhy48eoVGByJJM2kly2uS1tDVhQZyxbXTRqApepIZqczEWXCQCbb\nmGyP7GT7Z7MFHaB3We884IeASOuyzqVUHcnsdCaiVJIQQlg9iFJqbW0FALS1tVk8EspHrgM+Zust\nRUQ0O3CGTLaSa+bIWSURVTIGMs1KnG0Tkd0wkGnWSTwpSxMCwXAMv/rD2/j4lcvyXlsmIio2bnui\nWcc4KUsTAn1DIQyNRNDdP4anf9+Bx5/dg2iGfctERKXGQKZZx9jTHAzH0k7wSjyIhIhoJjGQadYx\n9i6nzoQVRf/PoRS3LBERTYaBTLOOcVJW4lqxosiodusXO5TqliUiolwYyDTrGAeI/MOHV2BBQzXq\naqvMqw95hCURWYVd1jQruRQHLlu7COtbmrn9iYhsgYFMsxoPGyEiu2DJmoiIyAYYyERERDbAQCYi\nIrIBBjIREZENMJCJiIhsgIFMRERkA9z2RERlgVdmUqVjIBOR7SVemWnYtq8HG69fw1CmisGSNRHZ\nnnFlZiLezEWVhoFMRLaX7QYu3sxFlaSsAvnWW2/Fpk2brB4GEc2wbDdw8WYuqiRlE8j//d//jZdf\nftnqYVAZiKpxbG3vxpa2Tmxt706795jKj3FlZiLezEWVpiyauoaHh/HII49g9erVVg+FbI7NP5XJ\nuDKTXdZUycoikL/1rW/hmmuuQV9fn9VDIZvL1fzDW53KG2/mokpn+5L1tm3b8MYbb+Czn/2s1UOh\nMsDmHyIqV7YO5Gg0iq9+9at44IEH4HK5rB4OlQE2/xBRubJ1ID/++ONoaWnBhg0brB4KlQk2/xBR\nuZKEEMLqQWTT2tqKkydPQpIkAICqqgAAl8uFN998M+/nAIC2trbSDJJsh0csElE5snVT1zPPPINY\nLGb++ZFHHgEA3H333VYNicoAm3+IqBzZOpCbm5uT/lxdXQ0AWLx4sRXDISIiKhlbryETERHNFrae\nIaf6xje+YfUQiIiISoIzZCIiIhtgIBMREdkAA5mIiMgGGMhEREQ2wEAmIiKyAQYyERGRDTCQiYiI\nbICBTEREZAMMZCIiIhtgIBMREdkAA5mIiMgGGMhEREQ2wEAmIiKyAQYyERGRDTCQiYiIbICBTERE\nZAMMZCIiIhtgIBMREdmA0+oBEBFR8UXVOHZ1+HGiP4CFDT6sW9EEl+KweliUAwOZiKjCRNU4Hn92\nD475RzEWVqGqGl585TDuv/ki+Lwuq4dHWbBkTURUYXZ1+HHMPwr/UBBDIxEEQiq6jg1j809fR1SN\nWz08yoKBTERUYU70B8yZcaLekwHs6vBbNCqaDEvWRERlKts68cIGX1oYA4CiOHCiP2DBSCkfDGQi\nojJkrBMf7xs1H3t1bzfWt8xHd/8YvB4nRoNRSJIEAFAUGV63EwsbfFYNmSbBQCYimiHF7Hze1eFP\nCmNNCOzu7MOhY0PweRQ4HTI8VU44ZMDlcsLrdmJJUy3WrWgq1suhImMgExGNK2Zgpj7X6qX1ePK5\nfUkhum1fDzZev6ag35Faeg6GY1BVDapTAzyAQ5ZQP9eDc5fVw+d1cetTGWAgE1HJWL0XNqrGsX1/\nD14/0AsAuHDlfKxvac44hkwl4EIDM9NzvfjyOwhHYxivIAMAjveNYleHHxtWL5jiK0Na6dnonlaU\niV5dSQJ8Xheua10+5eenmcdAJqKSKGbAFfr7H/3VbrzZ2Wc2OL1xsA/b9/fi8zesTRtDagkYmFpg\nJn74CASjOOofgZyQvj0nA3ApDvg8StLPFdpktW5FE7bt6zHH7FIciMY0VLuTn59rxuWDgUxEJTHd\ngCvG7+88NpTUbayqGg4dGzLHkBiiR3pHoAmRFKJA5sDMVo42DuIYDkQhhEBzfTUcsv58LsWhj8WT\n/FyFBqZLcWDj9WvMcTTN82LH/l50D0yMd1FjDdeMywgDmYhKItvMb6a23ZzoD2Tc+qOqcZzoD6TN\n4AMhFYGQisY6T1IoZyoNZypHByMq+k+FoKoa4ppAXNPQMzCGhQ0+SBLgdTvhmeNEJDpxMMd0A9Ol\nOJI+3KxvaeZxmWWMgUxEJZFt5jdTJdSFDT4oigwRFNAEIISAJElwOmUsbPClzeA9VU6cGo2gbygE\nn0fJ2pWcaebfczIATYP5AUCWAU1IUGMaxsIqfB4FS5pqcdu1q9DeNVCywEwNaCovDGQiKonUNU5g\nZkuo61Y04ZXdJ7D9VA/imgAASAA0AaxeWo/fb3vP/F5NCPSfCkHo3wZV1eCZ48Rt165KC8xMM3yX\n4sBwIGr+WYIEpwPwVjnRXF+Nq9efYYYvA5OyYSATUUmkrnHOdAnVpThw8epmHDp+CmNhFQBQ7Vbg\n8yho7xpImqkbW4bimoACvVM5HImjvWsgLUAzzfC9bicUh4y+oVDS7583x42r158xaQhb3Y1O9sBA\nJqKSmakZYbZA8w8GUeNVUONN72y+5rKzzRl8VI1DjWvmcw2pGgIhFUf9o9iQ8rsyzfyXNNXi5o+t\nxLeffgO9JwNQFEfeB3Fk60YvdXmb7IeBTERlLdf2qlzr2Ikz+BdffgcjY0OQZb3cDOhl69D4zDpR\npu5mAGjbdQwfueQMAIB/MGg+/sLLh3MGqrEmrQmBYDiGqBrHaDCKh36yHWpsoiltJreMkTUYyERU\n1oyrBo3bjRRFxjG/vr1qsnVsYwZ/tHcER/wjSV3ZiqIfPZmJ8XOZPgwsaqzBbdeuynoqlzFmY+Z7\ndHy7Vd9QyPz9cU1gaDSCRY0+s+N7JraMsXRuLQYyEZW1o736vb9mmIYwUW5evSDnOrYRQMf7A6h2\nOwG3hFj15UZbAAAgAElEQVQsPlFynl+b83dn22u9pa0z4+Pb9/dg54Hkn6lyOTAWSr4qUQgBTZMQ\nDMeSDhIp5ZYxqw9yIQYyEZW5UCT93l9V1RAYi2Bre7cZxNdcdnZSsCQGkCYExsIxAEBTnReSlF9H\neLaAfLdnJOPjqWEMAOFIHEIkH0aiOGUIoe+ZRkIgl3LLmNUHuRADmYjKnKfKCUWRk0LZ6ZSwt2sA\nb707aD6WOtvbvr8HB48MIqrG4VIcqJ/rRjgSx+KmGly8qjmvcm22gDyzuRbtXQNpjwuItMckCXjf\n6XU4NH6qmFEq7z8VgpLw+0u9Zczqg1yoTAL56NGjePDBB/Hmm2+irq4ON954Iz71qU9ZPSwimmGZ\n1jiXzK9FY51nfOuSXm4WQiAcjcPnmbhoIXG2F1Xj+M2fDmFwODx+aEgUilPG/HovlsyvyXtGmG2N\n+rrW5RgciaQ9vvZ9DXj7yETwVrsVSBKwvmU+HLKU9P3nLW/ERS3z4R8Mzsh6rtUHudAUAnnnzp34\n7W9/i+HhYVx22WW4/vrr4XBM/I9jeHgYGzduxM9+9rOiDlAIgVtvvRXnnnsuXnjhBbz33nu48847\nMX/+fHz0ox8t6u8ioqmZySagXNuDzFAcL+/GtfQzqYGJ2d6uDj+CYRWxuDBnrRE1jt6Bie7ofOTa\na536+Oql9fjhb9sRGF8vjo8JDMphnL1wLlrOOg2APoOWIOGClU1Zb6UqFasPcqE8A/lPf/oTbr/9\ndlx44YWQZRkPP/wwXnzxRfzoRz/CnDlzAACqqmLnzp1FH+DAwABWrlyJBx54AF6vF0uWLMHFF1+M\nN954g4FMZKGZbgLKtsb5+lu9mONz4UivgKfKib9cfzqcDhnP/W9X0vcKAQSCUWxp68S73cMIRWIQ\nEBBCP8ELkn5i11Rl22ud+vjW9m70DATQMNeDnoExs3Hr5HAQdz/+Kmq8StLVjOtbmqc8lumw+iAX\nyjOQf/CDH2Djxo3453/+ZwBAe3s7br/9dtx888342c9+Bp+vdCWNhoYG/Ou//qv55zfeeAM7d+7E\ngw8+WLLfSUSTm+kmoExrmXFN4P9+YT9iCft1f/7S23hk46VJDVRCAKNBFXsO9UOChBP9AUSi8YkV\nXQlwyBLqatzwDwYBFH/2b4zfmJkbxkIqYnH9/Gujo9qqZioe7WmtvAL53Xffxcc+9jHzz6tXr8Z/\n/Md/4MYbb8Ttt9+OH//4xyUbYKIrr7wSPT09uOKKK/ChD31oRn4nEWU2001AmdYyh0YiiETj5hWH\nADAciOCFlw8nzfYCwSj2HOqHLEkIhFT9zGoJgIA5K3U69PXmI70jeHn38bSrDKc7+1/Y4IMm9P3F\ncW38A4QQCEf1w0hGxs/C9rqdkCWJzVSzkDz5twDz5s3DkSNHkh4766yz8G//9m/YvXs3vvSlLyEe\nj2f56eJ5/PHH8aMf/QgdHR342te+VvLfR0TZlbIJKKrGsbW9G1vaOrG1vRtRNY51K5qwqLEm6fsk\nCZDTl4rxbs+IOdu7rnU5fF4XJOhhPByI6mdWO2U4HRJkSYJDlse3Pqk45h/F07/vwJudfUisYBuz\n1kKtW9EEj0uBlnIjpCaAmCYQjWkYGtFvm9KESHofM70fVHnymiF/5CMfwb/8y7/gi1/8It7//vej\ntlbfLH/eeefhO9/5Dr7whS+gp6enpAMFgL/4i78AAGzatAl333037rnnHjidZdEoTlRxStUElGtt\nOnWN88A7A3hp+9G05zizOflAj6Z5XviHgoiqccTjAnFNQNKA+jluOBwyAiEVTlnCvDluyJKkn22t\nTlydaJjOrNWlOLBmeQMGhkMYGg2PB7MwG9CMWb6qavC4FPN9zGetnidsVYa80uz222/H0NAQ7rnn\nHjz55JPYsGHiuPUPfvCDeOyxx/DlL3+5JAM8efIkdu/ejauuusp8bOnSpVBVFYFAAHPnzi3J7yWi\n3ErVBDTZ2nTiGufqpfXYtt+P4UDEfGyOrwrXtS5Pf2IBvat6/CpGIYCh0QgWN9XAU+Ucn21L5msb\nC+k3QMGjf+9YWMWR3hFsbe8u+HUumV+DGq9+49RYWMVIIIpoTMO82irIsmRuh1rzvgbz+Sd7P3jC\nVuXIq2T9/PPPY/Pmzdi5cyfOP//8tK9feeWVeOmll4o+OAA4fvw4Nm7ciP7+fvOxffv2Yd68eQxj\nIoslloU3rF5QlAAwZqFC6EdgDo1EzKMwU/m8Ljx65+X46CVnYOVZ8/DRS87Ao3deDp/XlfR9/sEg\nqj3OtH/w4ppALK7hry8/O2mblNetHzaiKPqJWf6hIAIhvZy9pa0Tjz+7p6CysVF2lyS9gavW54K7\nyoEarws+j4K62ir4PAqWNE2U5idbq88V2FRe8pohb968GTt27MDDDz+M6urqtK//+c9/xr333luS\nbutVq1ahpaUFmzZtwqZNm3D8+HF85zvfMTu+iahyRNU4AsEoBkfCCIZj0DQBSZKAELDn7X78zRVL\n00Lf53Xh5r9qyfm8Cxt8+s1JkgRIAkb0OmQZwVAMToeMRY01OOofMW9cWtxYg6svPh273+7HWFg1\nm62A3F3QucrHmW6KSm0eSy37T7ZWzxO2KkdeM+Rf/vKX2LdvH/76r/8ab731lvl4NBrFww8/jNtu\nuw1nnXUWXnjhheIPUJbxwx/+EF6vFzfccAO+8pWv4BOf+ARuuummov8uIspsJpqKjNLr3kMDCIZj\niKhxvcQsBBRFRiiqFjzrW7eiCc2n+SASurSMUI7E4th5wI+bP7YSnionVFWDS3Egqsax++1+LGyo\nhs+jpB00kinwjNdgvE+ZZtNGVeGay86G0yFjcZN+aMhFLc24rnW5eSOU8fOxuIYF9cmhnBjaPGGr\ncuQ1Q25pacFzzz2HTZs24YYbbsBdd92Fiy66CHfddReOHDmCu+66C5/61Kf0T7Il0NDQgMcee6wk\nz01Euc3UGqVRepUkvWRshLHX7TSbrQqd9bkUB+6/5UJ86QevoLt/DJIEaJp+EIiqajh4ZBDffvoN\nhKNxzK2pwlhYxanRCMbCKub4XBmfM1Pg5bs3O9u1jX9zxVIASPtac70P116xNOMxmtNprmMzmL3k\n3aLs8/nw+OOPY8uWLXjwwQehaRqWLVuGLVu24JxzzinlGInIQjN1AEhi2LoUBxxyDIDefWzMTqcz\n6/N5Xfj27e/H5qd24EjvKMIRff+yosjwup3oORmA4nSY9yoDAELA3kMDWNxUg56BADQhEAzH4Kly\nIhbXzIspMr2GbK8NmHzdN/VrPQMBOB1yxma1fJvrUsN39dL6rHc2M5StMaU9Q36/Hy+99BI0TUNj\nYyNOnjyJnp4eBjJRBTvRHzC7jBMvRSj2GmVi2Fa7FfPMZ+PGo0yzPiNkjvaOIhRR4anS7zDONtPz\neV146NYNeOzZ3djfNWDeeyxLElyKw/ydicLRGNa3zAcA/OZPhwDo3djP/W8Xdh7wJwVYvuXjQtZ9\nc31tshO2Ms3IX3z5HYSjsaTjOnndorXyDuSXXnoJDzzwADweD5566imce+65eOihh/CZz3wGf/d3\nf4d77rkHLlfm0g4RlS9jD2/irDEQUqd0CUM+EkuvkqTfS+yucmDNsoaMIWuEzDH/qDk+RZHRWOfJ\nOdNzKQ5sWLUAJ/qSA87rdkLTBIbVqPmYcRXizgN+CAiEIjHzhiYhgINHBvHYs7uxYdUCrFvRlHf5\nuJB13+lUBzLNyHtOBuBSHEn7rAE2g1kpr0DetGkTnn/+efzlX/4lHnroIfNgkK9//eu4+OKL8dWv\nfhU7d+7Ed7/7XSxfnmH/HxHNSpnKpO1dA1n/fNu1q5L+nGtN0wiZxBKzqmoIhmOTzvQyBeeSplqs\nfV8Dfvl/3javcTTuJQ5F9M7rsVAMgZCKhrke9J8KQVU1vHGwD/u7TuLFVw7j/psvyqt8PFlwF/vA\nlUwh61Ic5j7rRGwGs44kxOTXm5x//vm4//77ce2112b8+pEjR/CFL3wBhw8fxt69e4s+yOlobW0F\nALS1tVk8EqLytKWtE6/uPZF037DX7cSl5y7MfADHuNQyqXHBg8+rl4g1IRAIxpJuOVrUWJP3GqbR\nyWzsUzb4PE7U1brN/dG5xpcanEByQ1UgpCIQUs37lodG9ANIPFVOhCIxqHENsiRBlvUmsXm1Vfjk\nR1fmdXViroaqYjdbGR3biTSh344ViU50gE/l/afiy2uG/Pzzz2Px4sVZv3766afj17/+Nb797W8X\nbWBEZA8LG3yQJUkvbSaUNyebSaWWScfCKoYDEfNWo2A4lvRnIP0EqlyhZPx+RZGB0MTvVSZZzzVk\nW3dNnOG+2z2CzqODGB6NwumUoDhlqDENETWOuCb0yylkgVhcv7v95HAYT/++I21tOVHq67rmsrPT\nvq/QW5eyvWfZKgJTqUhQ6eUVyLnC2KAoCu67775pD4iIZl6u8Ct0W01qmXSirBwHPIq5Nze1bHqi\nP5DXVitjXMf8owkNYHrH9HRKvEYYRtU47vvha+g/FYYQ+gElbkXG3Joq1M9x40jvKCJqTN8+NX4c\npyTpryfbB4tMB4FMt7M5sbFtT2c/QlHV7EpPfO5spXQ2cNkHb2YgmuUmC79Cz6xOnaEaM1ljBmuc\nF60octrP5bPVKnFcR/2jCIUn77Keilf3nsChE6fMsBVCIBiJY3FTFe6/5SI89JMdePvokPl1QD+K\n0+nUwzDTBwujBN5U5zXL9NPpbE58fuOYUaOxTZakpOdm+NofA5mozE13vTHf8JvqP+apM+tqt371\noNet/7OjdzXrjxuMme0LLx/O+Jyps25jXBsyfneyqb5P/+/2I/rRnQASG20kSd8+dfXFp+Pd7mFE\nVQ3aeCuOJEswzgDL9MGi2LdIJT5/amOb8fzsmi4fDGSiMlaMU7RKdRZyppn1ZF3WRkgW+zjIQt6n\nUCQGiOQwBoBjfaOIqnH0DYYwx1eFsZCK8HhjlEOWEIvFsaC+DrG4hj++fhSBkGpulUq9RWq6ryvx\n7yhxLd1YFpjOc9PMYyATlbFinKJVyrOQM82sJ/szUPy7lgt5n1Yvrcd7PSNpiex0yNi+vwd7Ovtx\nalTvupZl/bAQr1vBxauacfjEKfz0xbcQ1zSEInGzTO11OxEIqUll+um8rkIOUyH7YiATlbFizG6L\nHX7FUIy7lhNL1Ed6R6AJkdcFEYYbPvg+/PH1YxgLT2ypcjokzKt1Y+cBP0JRPVhVVYMECULoh6gc\nPj6Md7pHAOjrzpoQgAqzTL12eSPWt8zPeC71VE31MBWyNwYyURkrxuy2GOFXCtNpQsrWTGU0Oxly\nvU8+rwu3XtuCp/7zLURVDYpTQpXLieFABH1DQQAw9ycb+7Pr57rx1jsnzeeQJAkyAE+VA8311bh6\n/RlFfW/t+ndHhWEgE5WxYs1uK60DN7VEXe1WMBqMYnA4DFnWz61etrhu0vfp0nMXYvfb/TjqH0Hf\nUAjDgSgURcbJ4TDGwnrAJ+7PNp57LBQzn0OSJDhkGVevP6Mk73Gl/d3NZgxkojLGGVJmqaVoAQEJ\nEmKaQJWsr9/mc1ms8f7+/KUO/PnNE/B5FLMrfCysJnUzL2qswQUrm5L2RRvm13u5lkuTYiATlTnO\nkNKllqKD4RjUmIa62iozQLsHAnk1v7kUB3xeF+pqq5Ieb6rzYnFTDZbMr0k6enPH/l6MhVSMiRgE\nBOp8brScVY9dHX5+WKKc5Mm/hYiovKxb0YRFjTXmn6Nq3Lw2MlG+zW+Z1polCbh4VTOua11uHrwB\n6E3ZkiTB5ZQQjwucCkSwq8OPLW2dePzZPeYJZUSpGMhEVHGMUrMRllectyjpdCxDvs1vqQEPZF6r\n39XhR89AAD6PApfLCSEANaaZndrGViuiTFiyJqKKlFjKj6pxDI7sKbj5Ld+1+sQZd+JMOPEgEJ6c\nRdkwkImo4hWj+S2ftfrEGXdit3XiQSA8OYuyYSAT0awwE81vidvQjFO5gInzuq0+cIXsjYFMRGVv\nuhdsFEvqTLxpnhcAinIqF1U+BjIRlbViXLBRTLN1G5pdPhSVMwYyEZW1YlywMdMqLbzs9qGoXDGQ\niaisler6yFKpxPAqxw9FdsR9yERU1kp5fWQp5AqvclVuH4rsioFMRGUt30M77KISw6vcPhTZFUvW\nRFTWyu2CjUoMLzveqV2OGMhEVPbKqbO5EsOr3D4U2RUDmYhoBlVqeJXThyK7YiATUUUop61EDC/K\nhIFMRGXPyq1E5fRBgOyNgUxEZc+qfbCVuKeYrMNtT0RU9qzaSlSJe4rJOpwhE5HtTVYWtmorUSXu\nKSbrMJCJyNbyKQtbtZWoEvcUk3UYyERka/msD1u1lagS9xSTdRjIRGRr+ZaFrdhKVKl7iskaDGQi\nsjW7l4W5p5iKhV3WRGRr5XZ5BFGhymKG7Pf78bWvfQ07duyA2+3Ghz/8Ydx5551wuVxWD42ISoxl\nYZotyiKQ77jjDsydOxe/+MUvcOrUKdx7771wOBy4++67rR4aEc0AloVpNrB9yfqdd95Be3s7vvGN\nb+Dss8/G+eefjzvuuAP/9V//ZfXQiIiIisb2gdzQ0IAf//jHmDdvnvmYEAKjo6M5foqIiKi82D6Q\na2pqcOmll5p/FkLgmWeewYYNGywcFRERUXGVxRpyom9/+9s4ePAgfvvb31o9FCIioqIpq0B+5JFH\n8PTTT+P73/8+zj77bKuHQ0REVDRlE8gPP/wwfv3rX+ORRx7BVVddZfVwiIiIiqosAvkHP/gBfv3r\nX+N73/sePvjBD1o9HCIioqKzfSAfPnwYTzzxBG677TasXbsWAwMD5tfq6+stHBkREVHx2D6Q29ra\noGkannjiCTzxxBMA9E5rSZLQ0dFh8eiIiIiKQxJCCKsHUUqtra0A9GAnIiKyK9vvQyYiIpoNGMhE\nREQ2wEAmIiKyAQYyERGRDTCQiYiIbMD2256ISBdV49jV4ceJ/gAWNviwbkUTXIrD6mERUZEwkInK\nQFSN4/Fn9+B438S1o9v29WDj9WsYykQVgiVrojKwq8OfFMYAcLxvFLs6/BaNiIiKjYFMVAZO9Aem\n9DgRlR8GMlEZWNjgm9LjRFR+GMhEZWDdiiYsaqxJemxRYw3WrWiyaEREVGxs6iIqAy7FgY3Xr5lS\nlzW7sonKCwOZqEy4FAc2rF6Q1/eyK5uo/LBkTVSB2JVNVH44QyayiWKWmNmVTVR+GMhENlDsEjO7\nsonKD0vWRDZQ7BIzu7KJyg9nyEQ2UOwScyFd2URkLQYykQ2UosQ8la5sIrIeS9ZENsASMxFxhkxk\nAzNVYs7UyQ2ApW0iG2AgE01BIVuT8v2ZUpeYM3Vyv7q3GxKA7oGJtWoeIEJkDQYyUZ4K2Zo03e1M\nxdybnKmT+9CxIQCAz6OYjxnd3Vx/JppZDGSiPOXampQtvAr5GUOx9yZn6tiOqnFIkADP5N9LRKXF\npi6iPBWyNWk625kSw1wTAoGQivaufvz8pQ5E1XgeI06WqWPbpTigKOn/DPAAEaKZxxkyUZ4K2ZqU\n789kKk0boa0Jgb6hEFRVAwD8+c0TGByJTHmmvG5FE7bt60macS9bXJe2hszubiJrMJCp7M3UNYOZ\nAm2y8MrnZ1JL05oQePHldzBvThUCIRVCCDOMAUBR5ILWebN1cgPssiayA0kIIaweRCm1trYCANra\n2iweCZVCpnXWRY01k84eCw3xUnRZb23vxpa2TgDJs+G5NVUYC6t6eVoAkiRBUWQ01XkhScCG1Qtw\nXevyScdMROWBM2Qqa4U0TU3WLJUrQAvZmjTZzySuJwfDMXM2rMY0VLsVxGIaIAFzfFXweRRIkv69\nXOclqiwMZCprhTRN5QrxdSuaitrZnI/EYDWatQQERoNRaJqAJOmz47GwCk+VE6dGI5Ak4MA7A1i9\ntB4+ryvj8+Yzm5+pcj8RTY6BTGWtkEaryUK80G1KhUpcZ3YpDgRCKuJxAc1YTRJAlSLD7ZLRc3IM\n8biALAEvbT+Kbfv9ePTOy9NCOZ8tU8XeVkVE08NtT1TWCjkDOleI5zPjjqpxc913a3t3QVuQEhnN\nVte1LkfrusVoqvMmfV2CBE0TCIbjiMU0OGQJ0njdejgQMdefE+VznWM+31Ps10pE2XGGTGWtkDOg\n161owqt7u3Ho2BCiahwuxYFli+vyCvFsx0+ub5kP/2Cw4LKvsc5szML/+7V3MRpUIUkS5PGSdVSN\nm0Gc6N2ekbTHEj9ACAGMhVWoqoZt+3rM8U324YMzaKKZxUCmsldIo5Vk/l8p6c+TbVNKnVVqQmB3\nZx8OHRsyj5+cTmhF1ThCkRhkWYbilKEJYY5xTrW+DSrVmc21aY8ZHyCEAPxDQbNR7OCRQTz+7B5s\nvH7NpOX+6ZwyRkRTx0CmipFvg9KuDj+6BwJ6gI4fGdk9EDCDJteMO3VWaXRFq07NfK5CQ8uYkR71\njyAai0MIQJYkeN1ONNdX4/M3rMV9T2zDcCBi/swcX1XGrU/GB4uDRwbNMFYUGV63M6mBLdeHj2wz\n6KO9I+bX2QhGVDwMZJpRperqnUp5NVPQaEJg677upHFlCtRMJ2wBSDt+spCzoI0ZqSxJaKzzjId9\nHJeftwg3Xr0CLsWBR++8HFvaOvFuzwiWNPpw1sK5+P229zJuz9p4/Ro89uxu7O8agKI44HU7IY+X\nvE/0B7Bh9QLcdu0q/fm6R3Dmglpcc9nZ5t9PIBiFEEBilVwTAnsO9WPHW73mYyxjExUHA5lmTCnX\nJKdSXk0NVU0I9A2GMDgcwf6uk1AUGa/t7cbnblibNq7UWaVLcSA6vl841+/IR2KIy5I0PoNX4HEr\nSR9ibrx6BQDg8Wf34D9ffcf8mdT30qU4sGHVApzoS/9wsLDBh6gax5PP7TNfy95DA3h1bw98Xj24\nNSEQCMZQ453Y++xxKQhHYkkhzTI2UXEwkGnGlHJNcir7kVNDdSykIhyNwyHrpd34mMDgSA/q/qcK\nn/jIyqRQTm0ia5rnxY79vUU5CzpTiAsB7Hm7Hzv295iPbdvXgwtWNiW9l0Lo68OPPbsbG1YtMH9/\nLK4hrgmEIjFUu/VgNcaX+vcxFlYxHIhAlvXrGGVJgs/rxLnL9L3OCxt8ONo7ih1vTYzFwNuhiKaP\ngUwzZjo3H2WSWP4eHg1jNKhCjeld00Z5NtsNR4mh+kaHH6dGowAANa5BCIG4BrTtOobhQDTnDN7p\nkPHPf7sa7V0DGcvwUynRZ1rTdVc5EIqoZqkZ0D/ECEyceCsE4B8MIhyNYzjQi4PvDeF3/18XwmoM\nkWgcnir9P3NNCHz8A8uwvqU5Y5e1eUKYGgfGG9T0UHYlrFN3Y8dbPdCEQDAcM7vUm+Ylb9Uioqlj\nINOMKeQQj0SJ4ZY4MzVKzvosV8JYKIZASMXa5Y1ZZ6qJndlHekfQdXwYcU0g6Wh3IdJm8LnK7qmz\n/KmW6F2KY2JNt2cEZzbXwuV0YGeHH4GQvm1JUeS08nggpCIYieljj8noPxVC31AQsiTB6ZARUFTz\n/GunQzZ/d+r7rigyEAKUlLElfp+xZWx3Z58Z4NGYhh37e82gJ6LClNXBINFoFH/1V3+FnTt3Wj0U\nKkAhh3gYjHAzDqh4+vcdeLOzD0KMdzrHNMgy4KlywudR4PMoWN8yP6+AuHDlfCiKnBTGEiRUj88S\nE2eS+RymUcj3Gq/xyef2ob1rAKNjUbR3DaC9awD+wSCGRiIIhFQMjUTgHwrivPc1mu/lWFi/EUqC\nBCHE+P+D+XpUVcNYWE17Lal/H9VuBXN8VfC6Jz6np/79uBQH1rfMN9/jutoqNNV5zS51Iipc2cyQ\no9Eo7rzzTnR1dVk9FCpQIYd4GFLDLarGzaAxOp0lSHDIEupqqwDoZdx8rG9pxvb9vdjX1W8exlHl\nks1ATpwhTqXsPtUSfaYAPzkSQiyupX2v0yGb7+Wv/vA2wpE4ZAmIa4mXt02UuVVV35aV+Foy/X2s\nXlqftfxu8A8Gk7aMTfa6iCg/ZRHIhw8fxhe/+EWrh0FFUMghHkD6P/YuxYGxkL4H2Pj/A8nbj/It\nhbsUBz5/w1ps39+D3/zpEEKRmLkGnTpDnErZfbLvTV1fNvb3JlJVDQ5ZP6kLkgRvlQOSJOGPrx+F\n0yFj3YomxOIanvhdO1RV07ufhYAsSVAUCcZSs6LIGasRmf4+Jvv7SXxdiaeABYJRc02ZiKauLAL5\n9ddfx8UXX4zPf/7zOPfcc60eDlkgNdy8bicCIdU87MI4wcpYX00Nn8maq1yKA5etXYT1Lc05v2+y\nwzQS5fpeowR/pHcEQyMRRNQ4vG4nqr1OuBz679OEQDASQywu4JABITSEIzHI42dZb2nrxLZ9Pbjt\n2lU4b3kjOo8NIapqCIZVOB0y6uvcCEf0pq6PX7ks6xrvVPeGG6/rmH/UPAVMUWTsOdSPwZEI9yQT\nFUgSSV0s9nfOOefg6aefxgUXXJDX97e2tgIA2traSjksKrFMDVLN9T7zDGmjyzfTedKZfnZRY820\njrdMDTBALzkf7R1FKKJfk7hkfq1ZAj7qH0UoPPF4LK7hN386hGP+AOLaREna4ZCxqLEaTllGIKQi\nENQ/aKgxfftSXNNQpTiwsMFn7gW+rnW5uY3JaHjL9l7k877m895E1Th+/lIH/vzm8bRDR65rXc49\nyUQFKIsZMlEx15+B6e1/Ti3zGqGWOmNsrPOYM9jEmfKOt3oR1wQGR8JJYQwAQhNoqvNi6eI67Hm7\nD1E1DsWpv8bRsSiiMcDrVpIO5jBO3SrktRT63rgUB3xeF+pq3Wlf41oyUWEYyFQ2irX+nO3xQo/1\n3NXhxzH/KE4OhxEKx/T1XlVDMBzD8b5RbGnrTAu9UCSGUCSW9lySJCGiajjRF8DJkfD42ngMiiKj\nptqFU6MRuFKO6SzkVDDDdPaGT3cbGxElYyBTxcsnOKZzrOfRXn1mHArHoOn7jaAJ/bpEeBS8253e\nrI7xf8YAABU/SURBVOV1OxEKO6HGouZjEvSrFqsUGcf7Rs21cVXV9C5pt8AcX1XSPuRCTwXL9B7k\n83iiqaynE9HkGMhU8fIJjumUtUMRdbzDWdLbjqHvAdbGtyCduaAW7V0DST8jSxI+8ZEV+H/+pwNj\noYl7j+fWuHFmcy1ODofTLpk454x5+L+uzX4qWKnem2yms4xAROkYyFTx8gmO6ZRuPVVO/WARNQ5N\nSOYhHca2qetal2NwJJIWelecvxjrVjThh7/di6P+AJY0+fCZvz0XB48MYdfBPgDJl0xsWLUAPq+r\nqA1TUw3VTGV9NnARFUfZBbKU2M1ClKfJ1p+nU7pdMr/WnMmGozFEVQ1C07BsyVzcdu0q+LyujKEH\nAE/91wGcHA6j2u3EyeEwnvqvA2lNYEBpS8GZ3ptsneSluq2LiMowkDs6OqweAlWgqZZuU8/VXthQ\ngxP9owiEVMTjAoriwMCpMJ58bp8ZWKmht7W9O2OZvL1roOBScDHum862np56w5QxXl69SFQcZRfI\nRKUwldJtpsBaUO/DqrNO0+8T9ijmVYe5AitXmbyQbUzTaUxLDPJAMIqj/pGcN0zl8zqIaGoYyETj\n8t1WlakBrHsgAEn2medoJ8oWWMXeNlRoY1ogGMXmn76OnpMBuBQHotE4onENjXWepFDOhtuciIqD\ngUw0LqrGsX1/D14/0AtAvwUq03GT2QJWQubwSg0sYzZ6tHcUVYoToejEfcfTWSueSmPaxBhG8PLu\nE+gbCgEAxkIxSBKgafp9xz7PxBarC1fOx074uc2JqEQYyETQA+r7v9qddM/vGwf7sGN/Lz53w9qk\nUDYCNvFiBUWRsXZ5AwDkDKzUsrIQepf2mmUNWDK/dlrbhvKdcSeOIRBS0T8UggCgOGRzTLIsQR3f\nR228jvUtzZOe9U1EhWMgk+WK0Yg0Xbs6/Dh0bMgMY0C/aanz2FBayXfdiia8trcbbyaEtxKTsetg\nHz7zt7n3CRuneiUGOaB3ak+3MSrfxrTE0nZUjUOSJGiafla2Q9Zn6l63E5eftwg+ryvtdbCBi6g0\nGMhkqek0IhXTif6Aea9yIlXVMl79eFHLfHQeG4LqjJuXK/QMBNDeNZAzsIxTvczgDwGBkIqj/lFs\nKMLruGBlEwT0fdAXrGyatOTuUhyQZdXcP23codx8mg83Xr2Cs1+iGcRAJksV++KHQi1s8CXdq2xQ\nFDljKdg/GDQP7Eg0WcexcapXIlXVEAqrGb8/3+pBpg82ALC+pTntexNfj348pwNAHN4qBQ5Zwvx6\nL+6/+UKGMdEMYyCTpaZzQlYxrVvRhFf3dietISuKjOWL6zI2LRXaIW2c6pUYyooiw1OV/p/iVKoH\nU/lgk1jaNo7n9LgUrHlfA5Y01XBdmMgiDGSyVClvDJrK2rRLceDzN6w1u6xzlXyBws+ATjzVS1Un\nyt1L5tcmjXv7/h7892vv4qh/FNVuJ6o9CmRJyhqyU/lgwzOoieyJgUyWKtWNQYWsTbsUBy5buwiX\nrV006fMXGmpJrzehg9l4vYnd3sbtUcFwDGOhGBrn6fuCM4XsVD/YFHqVJRGVDgOZLFWq2Vox16az\nzbQLCbXJXm9it7dxe5QQAuFo3NwXnClkeRUiUfljIJPlSjFbK9badCm6wHNd5vDStvcQCOkNXg5Z\nMrufhRBQ1TgWnT4vY8iWSxnaDlvciOyKgUwVqVhr0zPRBZ56UEc4EocmBBSHDMUhI64JuKscuPy8\nRTm3IpWqDF2sELXLFjciu2IgU0UqVgl3JrrAE0Pf63aiyiUjFI6bB3W4qxw4b3mjJfuCixmidtni\nRmRXDGSqSMUq4ZayC9yQGO6yJKFpnhdjIRVet4LT59fm7PYutWKGqF22uBHZFQOZKlYxSrgz0SyV\nGu6yJKHG68J1rcstnznmG6L5lLVn4sMNUTljIBPlMBPNUnbrkE69G1kIIPUWxsQQzbesbbfXSWQ3\nDGSiSZR6z66dOqRTw1UTAoFgDDVexQzl1BDNt6xtp9dJZEcMZKISyrdD2S4HdaSGqyxJ8HmdOHdZ\nfcabn4CpnxJmh9dJZEcMZKISKcdtPplCVA9lfU07E64NExUHA5lmtVIeVGGnbT75vs5sIdo0z4ut\n7d0Zf55rw0TFwUCmWavUM9iZ2uYzWdhO5XVmCtfmeh927O9F90Ag489zbZioOBjINGuVegY7E6Xc\nfMJ2Kq8zU7jG4hqe+9+unD/PtWGi6WMg06yVaaYqhB5oxZjpzUQpN5+wnepMPTVct7R1Tunniagw\nDGSatVJnqkIA/qEgxsKqGXLTKWHPRCk3n7Cd7kzdzk1bvKyCKols9QCIrLJuRRMWNdaYfx4L67cs\ned0Tn1ON2WYhZiIs8gnL1NcJTG2mPt2fLxWjXL+lrRNb27uxpa0Tjz+7B1E1bum4iArFGTLNWqkz\n2CO9IzjmH4WccixVIaXZmdrylE9ZfLozdbs2bdmpi52oGBjINKslrpdube/Glr709dJCSrPFDots\ns+18w3K6TVd2bNriZRVUaRjIROOK2YRVzLCYbLZtx7CcCXZe2yYqBAOZaFwxS7PFDAuWZjPjgSRU\naRjIRAmKNdvMFharl9ZnPfEqG5ZmM7Pr2jZRoRjINGNm0xaVTGGxemk9nnxu35QbvViazW62luup\nMjGQaUaU40UL05UaFlvbuwsqPbM0SzQ7MJBpRnAdtPDSs9Wl2dlU2SCyEgOZZgTXQadXeraqNDsb\nKxtEVuFJXTQjuA5q3xOvcslV2SCi4uIMmWYE10GtLz0XgpUNopnDQKYZUY5hVArl1hXMygbRzGEg\n04wptzAiVjaIZhIDmYiyYmWDaOaURSBHo1F89atfxR/+8Ae43W7ccsstuPnmm60eFtGswMoG0cwo\ni0D+1re+hQMHDuDpp5/G8ePH8eUvfxkLFy7Ehz70IauHRkREVBS23/YUCoXwm9/8Bvfffz/OOecc\nXHXVVfinf/onPPPMM1YPjYiIqGhsH8gHDx5EPB7HmjVrzMfOP/98tLe3WzgqIiKi4rJ9IPf392Pu\n3LlwOieq66eddhoikQiGhoYsHBkREVHx2D6QQ6EQXC5X0mPGn6PRqBVDIiIiKjrbB3JVVVVa8Bp/\n9ng8VgyJiIio6GwfyE1NTTh16hQ0TTMfGxgYgNvtRm1trYUjIyIiKh7bB/KKFSvgdDqxZ88e87Fd\nu3ahpaXFwlEREREVl+0D2e1245prrsEDDzyAffv24Y9//COeeuopfPKTn7R6aEREREVTFgeDbNq0\nCQ8++CA++clPoqamBp/73Odw1VVXWT0sIiKiopGEEMLqQZRSa2srAKCtrc3ikRAREWVn+5I1ERHR\nbMBAJiIisgEGMhERkQ0wkImIiGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIi\nsgEGMhERkQ0wkImIiGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhER\nkQ0wkImIiGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0wkImI\niGyAgUxERGQDDGQiIiIbYCATERHZAAOZiIjIBhjIRERENsBAJiIisgEGMhERkQ0wkImIiGyAgUxE\nRGQDDGQiIiIbYCATERHZAAOZiIjIBsoqkD/1qU/h+eeft3oYRERERVcWgSyEwMMPP4ytW7daPRQi\nIqKScFo9gMn4/X7cfffdOH78OGpra60eDhERUUnYfoZ84MABLFiwAL/73e9QXV1t9XCIiIhKwvYz\n5A984AP4wAc+YPUwiIiISsryQI5EIvD7/Rm/1tDQAI/HM63n7+vrQzweR2tr67Seh4iIKJPm5mY8\n88wz034eywN57969+MQnPgFJktK+9oMf/GDaQVpVVYVoNDqt5yAiIio1ywP5wgsvxMGDB0v2/Lt2\n7SrZcxMRERWL7Zu6iIiIZgMGMhERkQ2UVSBnWmcmIiKqBJIQQlg9CCIiotmurGbIRERElYqBTERE\nZAMMZCIiIhtgIBMREdnArAjk0dFR3Hfffbjkkktw8cUXY9OmTRgdHbV6WDMuGo3i3nvvxQUXXID3\nv//9eOqpp6wekqX8fj/uuOMOXHTRRbj88svxzW9+k6e6jbv11lv///buPCSq9Q8D+JOZS+ZFisas\nLCsil0rNdqRIjTAsK4pQWmkhshJbaNzSnLZxKSOxVCwqW8xEwZIs2ykp02RskXJEqcDISsEsx+X8\n/ojmNnTjl3CZ91zP84H5Y77Iy/PHeJ45x+N5ERkZKTqGUAaDAXv37sXUqVPh6+uLI0eOiI4kXGNj\nIzZt2gQfHx/4+/vj9OnToiMJYTAYsGDBApSXlxtnb9++xdq1a+Ht7Y2goCA8ePCgx+sqopD37NmD\nV69eISsrCydPnoRer0dsbKzoWGan1Wrx4sULnD17FnFxcUhLS8P169dFxxJm27ZtaG9vx/nz53H4\n8GHcvn0bR48eFR1LuKtXr+LevXuiYwi3b98+lJWV4eTJk0hOTsalS5dw6dIl0bGECg8Ph52dHQoK\nChAVFYXU1FSUlpaKjmVWBoMB27dvR21trck8LCwMKpUK+fn5WLhwIbZs2YLGxsaeLS71cm1tbZKH\nh4ek0+mMs6dPn0oeHh5Se3u7wGTm1dbWJk2cOFEqLy83ztLT06WVK1cKTCWOXq+XXF1dpY8fPxpn\nV65ckWbNmiUwlXjNzc3S7NmzpWXLlklqtVp0HGGam5slDw8Pk9+XzMxMKSoqSmAqsVpaWqRx48ZJ\nr1+/Ns62bt0qaTQaganMq7a2VgoODpaCg4MlV1dX6fHjx5IkSdLDhw8lb29v6du3b8afXbNmjXTs\n2LEerd/rz5AtLCxw4sQJuLq6GmeSJKGrqwttbW0Ck5lXTU0Nurq64OXlZZz5+PhAp9MJTCXO4MGD\nkZWVhYEDBxpnkiQp8k8ZP9NqtQgODsaYMWNERxGqoqIC9vb2mDx5snG2YcMG7N+/X2AqsWxsbGBr\na4v8/Hx0dnairq4OlZWVcHd3Fx3NbB4/fowZM2YgNzcX0k+P8NDpdPDw8IC1tbVx5uPjg6qqqh6t\n3+sL2draGr6+vujXr59xdubMGYwbNw4ODg4Ck5nXhw8f4ODgAEvLv/cTGTRoENrb2/H582eBycSw\nt7eHr6+v8b0kScjJycHMmTMFphKrrKwMFRUVCAsLEx1FuDdv3mDYsGEoLCxEYGAgAgICkJ6ebnIQ\nVhorKyvs2bMHFy9ehKenJ+bPn49Zs2ZhyZIloqOZTUhICHbv3m1SvMD346tKpTKZDRo06LdbC/+O\n8N2e/g092VM5JycHJSUlyM7ONlc8Wfj69SusrKxMZj/e80YmIDExETU1NcjPzxcdRQiDwYD4+HjE\nxcX98jlRora2NtTX1yMvLw+HDh3Chw8fEBsbi/79+2PNmjWi4wmj1+vh5+eHdevW4dWrV9BoNJg5\ncyaCgoJERxPqd8fXnh5be0Uh/+meyufOncP+/fsRHR2NGTNmmDumUP+0L/SP9z9/YVGipKQknD17\nFqmpqYq9VHvs2DGMHz9e0VcIfta3b198+fIFKSkpGDJkCADg3bt3uHDhgmILuaysDJcvX8a9e/dg\nZWUFd3d3NDY24vjx44ovZGtra7S0tJjMDAYDbGxserROryjkP9lTOTs7G0lJSVCr1VixYoWZksmH\no6Mjmpub0d3dDQuL73+paGpqgo2NDf766y/B6cTRaDTIzc1FUlISAgICRMcRpri4GB8/foS3tzcA\noKOjAwBQUlKCyspKkdGEUKlUsLa2NpYxAIwaNarnd832Is+fP4eLi4vJmaCbmxsyMjIEppIHR0fH\nX+66bmpqwuDBg3u0Tq8o5P+noKAAycnJiI6OxsqVK0XHEcLNzQ2WlpaoqqrCpEmTAABPnjzB+PHj\nBScTJy0tDbm5uThy5Ajmzp0rOo5QOTk56OzsNL5PSkoCAOzatUtUJKG8vLzQ3t6OhoYGjBw5EsD3\ny7XDhg0TnEwclUqFhoYGdHZ2Gu9Fqaurw/DhwwUnE8/T0xNZWVkwGAzGLywVFRUmNwX+iV5/U1dL\nSws0Gg0WLVqEwMBANDU1GV/d3d2i45mNjY0NgoODERcXh+rqapSWluLUqVNYvXq16GhC6PV6HD9+\nHBs3boS3t7fJ50KJnJyc4OzsbHzZ2dnBzs4Ozs7OoqMJ4eLigtmzZ0OtVqOmpgb3799HVlYWQkND\nRUcTxs/PD5aWloiJiUF9fT1u3bqFjIwMrFq1SnQ04aZOnQonJyeo1WrU1tYiMzMT1dXVWLp0aY/W\n6fXbLxYXF2PHjh0mM0mS0KdPH9y8eRNDhw4VlMz8vn37hr1796KkpAT29vZYv369Yq8YZGZm/vLk\npR+fi5cvXwpKJR8/ntJ18OBBwUnEaW1txb59+3Djxg3Y2toiNDQUmzdvFh1LKL1ejwMHDkCn02Hg\nwIFYsWKFYo8hbm5uOHPmDKZMmQLg+535UVFR0Ol0GDFiBKKjozF9+vQerdnrC5mIiOi/oNdfsiYi\nIvovYCETERHJAAuZiIhIBljIREREMsBCJiIikgEWMhERkQywkImIiGSAhUxERCQDLGQiIiIZYCET\nKcibN2/g4+NjfDTmz549e4YJEyYgNzfXZF5UVAQ/Pz9zRSRSLBYykYI4OzsjJiYGhYWFuHbtmnHe\n2tqKiIgIzJ07F8uXLzfOS0tLERMT8497jRPRv4uFTKQwixcvxrx58xAXF4f3798D+HsziYSEBADf\nC1qtViMiIgKjR48WlpVISVjIRAqUkJAAW1tbREVFIS8vD3fu3EFqaioGDBgAAHj79i3ev3+PvLw8\n+Pv7C05LpAzc7YlIoR49eoS1a9fCwsICu3bt+u3e2GlpaSgoKMDNmzfNnJBIWXiGTKRQnp6eUKlU\n6O7uxrRp00THIVI8FjKRQiUkJKCzsxNjx47Fzp07YTAYREciUjQWMpECFRUVoaCgABqNBlqtFg0N\nDdBqtaJjESkaC5lIYRoaGhAfH4+QkBDMmTMHrq6uCA8Px7lz53D37l3R8YgUi4VMpCAdHR2IiIjA\n0KFDoVarjfN169ZhypQpiIyMxKdPnwQmJFIuFjKRgiQmJkKv1yMlJQVWVlbGeZ8+faDVatHR0WFS\n1ERkPvy3JyIiIhngGTIREZEMsJCJiIhkgIVMREQkAyxkIiIiGWAhExERyQALmYiISAZYyERERDLA\nQiYiIpIBFjIREZEMsJCJiIhkgIVMREQkAyxkIiIiGfgfZ/sgAYrF1u0AAAAASUVORK5CYII=\n",
"text/plain": [
"<matplotlib.figure.Figure at 0x11499a9b0>"
]
},
"metadata": {},
"output_type": "display_data"
}
],
"source": [
"sns.lmplot('X1', 'X2', data=data2, fit_reg=False)"
]
},
{
"cell_type": "code",
"execution_count": null,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": []
}
],
"metadata": {
"anaconda-cloud": {},
"kernelspec": {
"display_name": "Python [default]",
"language": "python",
"name": "python3"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.5.2"
}
},
"nbformat": 4,
"nbformat_minor": 1
}
|
{
"pile_set_name": "Github"
}
|
######################################################################
# This file should be kept compatible with Python 2.3, see PEP 291. #
######################################################################
"""
dyld emulation
"""
import os
from framework import framework_info
from dylib import dylib_info
from itertools import *
__all__ = [
'dyld_find', 'framework_find',
'framework_info', 'dylib_info',
]
# These are the defaults as per man dyld(1)
#
DEFAULT_FRAMEWORK_FALLBACK = [
os.path.expanduser("~/Library/Frameworks"),
"/Library/Frameworks",
"/Network/Library/Frameworks",
"/System/Library/Frameworks",
]
DEFAULT_LIBRARY_FALLBACK = [
os.path.expanduser("~/lib"),
"/usr/local/lib",
"/lib",
"/usr/lib",
]
def ensure_utf8(s):
"""Not all of PyObjC and Python understand unicode paths very well yet"""
if isinstance(s, unicode):
return s.encode('utf8')
return s
def dyld_env(env, var):
if env is None:
env = os.environ
rval = env.get(var)
if rval is None:
return []
return rval.split(':')
def dyld_image_suffix(env=None):
if env is None:
env = os.environ
return env.get('DYLD_IMAGE_SUFFIX')
def dyld_framework_path(env=None):
return dyld_env(env, 'DYLD_FRAMEWORK_PATH')
def dyld_library_path(env=None):
return dyld_env(env, 'DYLD_LIBRARY_PATH')
def dyld_fallback_framework_path(env=None):
return dyld_env(env, 'DYLD_FALLBACK_FRAMEWORK_PATH')
def dyld_fallback_library_path(env=None):
return dyld_env(env, 'DYLD_FALLBACK_LIBRARY_PATH')
def dyld_image_suffix_search(iterator, env=None):
"""For a potential path iterator, add DYLD_IMAGE_SUFFIX semantics"""
suffix = dyld_image_suffix(env)
if suffix is None:
return iterator
def _inject(iterator=iterator, suffix=suffix):
for path in iterator:
if path.endswith('.dylib'):
yield path[:-len('.dylib')] + suffix + '.dylib'
else:
yield path + suffix
yield path
return _inject()
def dyld_override_search(name, env=None):
# If DYLD_FRAMEWORK_PATH is set and this dylib_name is a
# framework name, use the first file that exists in the framework
# path if any. If there is none go on to search the DYLD_LIBRARY_PATH
# if any.
framework = framework_info(name)
if framework is not None:
for path in dyld_framework_path(env):
yield os.path.join(path, framework['name'])
# If DYLD_LIBRARY_PATH is set then use the first file that exists
# in the path. If none use the original name.
for path in dyld_library_path(env):
yield os.path.join(path, os.path.basename(name))
def dyld_executable_path_search(name, executable_path=None):
# If we haven't done any searching and found a library and the
# dylib_name starts with "@executable_path/" then construct the
# library name.
if name.startswith('@executable_path/') and executable_path is not None:
yield os.path.join(executable_path, name[len('@executable_path/'):])
def dyld_default_search(name, env=None):
yield name
framework = framework_info(name)
if framework is not None:
fallback_framework_path = dyld_fallback_framework_path(env)
for path in fallback_framework_path:
yield os.path.join(path, framework['name'])
fallback_library_path = dyld_fallback_library_path(env)
for path in fallback_library_path:
yield os.path.join(path, os.path.basename(name))
if framework is not None and not fallback_framework_path:
for path in DEFAULT_FRAMEWORK_FALLBACK:
yield os.path.join(path, framework['name'])
if not fallback_library_path:
for path in DEFAULT_LIBRARY_FALLBACK:
yield os.path.join(path, os.path.basename(name))
def dyld_find(name, executable_path=None, env=None):
"""
Find a library or framework using dyld semantics
"""
name = ensure_utf8(name)
executable_path = ensure_utf8(executable_path)
for path in dyld_image_suffix_search(chain(
dyld_override_search(name, env),
dyld_executable_path_search(name, executable_path),
dyld_default_search(name, env),
), env):
if os.path.isfile(path):
return path
raise ValueError("dylib %s could not be found" % (name,))
def framework_find(fn, executable_path=None, env=None):
"""
Find a framework using dyld semantics in a very loose manner.
Will take input such as:
Python
Python.framework
Python.framework/Versions/Current
"""
try:
return dyld_find(fn, executable_path=executable_path, env=env)
except ValueError, e:
pass
fmwk_index = fn.rfind('.framework')
if fmwk_index == -1:
fmwk_index = len(fn)
fn += '.framework'
fn = os.path.join(fn, os.path.basename(fn[:fmwk_index]))
try:
return dyld_find(fn, executable_path=executable_path, env=env)
except ValueError:
raise e
def test_dyld_find():
env = {}
assert dyld_find('libSystem.dylib') == '/usr/lib/libSystem.dylib'
assert dyld_find('System.framework/System') == '/System/Library/Frameworks/System.framework/System'
if __name__ == '__main__':
test_dyld_find()
|
{
"pile_set_name": "Github"
}
|
{
"plan" : [ {
"@type" : "ksqlPlanV1",
"statementText" : "CREATE STREAM INPUT (K STRING KEY, V0 BOOLEAN) WITH (KAFKA_TOPIC='input', VALUE_FORMAT='JSON');",
"ddlCommand" : {
"@type" : "createStreamV1",
"sourceName" : "INPUT",
"schema" : "`K` STRING KEY, `V0` BOOLEAN",
"topicName" : "input",
"formats" : {
"keyFormat" : {
"format" : "KAFKA"
},
"valueFormat" : {
"format" : "JSON"
}
}
}
}, {
"@type" : "ksqlPlanV1",
"statementText" : "CREATE STREAM OUTPUT AS SELECT *\nFROM INPUT INPUT\nEMIT CHANGES",
"ddlCommand" : {
"@type" : "createStreamV1",
"sourceName" : "OUTPUT",
"schema" : "`K` STRING KEY, `V0` BOOLEAN",
"topicName" : "OUTPUT",
"formats" : {
"keyFormat" : {
"format" : "KAFKA"
},
"valueFormat" : {
"format" : "JSON"
}
}
},
"queryPlan" : {
"sources" : [ "INPUT" ],
"sink" : "OUTPUT",
"physicalPlan" : {
"@type" : "streamSinkV1",
"properties" : {
"queryContext" : "OUTPUT"
},
"source" : {
"@type" : "streamSelectV1",
"properties" : {
"queryContext" : "Project"
},
"source" : {
"@type" : "streamSourceV1",
"properties" : {
"queryContext" : "KsqlTopic/Source"
},
"topicName" : "input",
"formats" : {
"keyFormat" : {
"format" : "KAFKA"
},
"valueFormat" : {
"format" : "JSON"
}
},
"sourceSchema" : "`K` STRING KEY, `V0` BOOLEAN"
},
"keyColumnNames" : [ "K" ],
"selectExpressions" : [ "V0 AS V0" ]
},
"formats" : {
"keyFormat" : {
"format" : "KAFKA"
},
"valueFormat" : {
"format" : "JSON"
}
},
"topicName" : "OUTPUT"
},
"queryId" : "CSAS_OUTPUT_0"
}
} ],
"configs" : {
"ksql.extension.dir" : "ext",
"ksql.streams.cache.max.bytes.buffering" : "0",
"ksql.security.extension.class" : null,
"ksql.transient.prefix" : "transient_",
"ksql.persistence.wrap.single.values" : "true",
"ksql.authorization.cache.expiry.time.secs" : "30",
"ksql.schema.registry.url" : "",
"ksql.streams.default.deserialization.exception.handler" : "io.confluent.ksql.errors.LogMetricAndContinueExceptionHandler",
"ksql.output.topic.name.prefix" : "",
"ksql.streams.auto.offset.reset" : "earliest",
"ksql.query.pull.enable.standby.reads" : "false",
"ksql.connect.url" : "http://localhost:8083",
"ksql.service.id" : "some.ksql.service.id",
"ksql.internal.topic.min.insync.replicas" : "1",
"ksql.streams.shutdown.timeout.ms" : "300000",
"ksql.internal.topic.replicas" : "1",
"ksql.insert.into.values.enabled" : "true",
"ksql.query.pull.max.allowed.offset.lag" : "9223372036854775807",
"ksql.query.pull.max.qps" : "2147483647",
"ksql.streams.default.production.exception.handler" : "io.confluent.ksql.errors.ProductionExceptionHandlerUtil$LogAndFailProductionExceptionHandler",
"ksql.access.validator.enable" : "auto",
"ksql.streams.bootstrap.servers" : "localhost:0",
"ksql.streams.commit.interval.ms" : "2000",
"ksql.metric.reporters" : "",
"ksql.query.pull.metrics.enabled" : "false",
"ksql.streams.auto.commit.interval.ms" : "0",
"ksql.metrics.extension" : null,
"ksql.streams.topology.optimization" : "all",
"ksql.hidden.topics" : "_confluent.*,__confluent.*,_schemas,__consumer_offsets,__transaction_state,connect-configs,connect-offsets,connect-status,connect-statuses",
"ksql.streams.num.stream.threads" : "4",
"ksql.timestamp.throw.on.invalid" : "false",
"ksql.authorization.cache.max.entries" : "10000",
"ksql.metrics.tags.custom" : "",
"ksql.pull.queries.enable" : "true",
"ksql.udfs.enabled" : "true",
"ksql.udf.enable.security.manager" : "true",
"ksql.connect.worker.config" : "",
"ksql.sink.window.change.log.additional.retention" : "1000000",
"ksql.readonly.topics" : "_confluent.*,__confluent.*,_schemas,__consumer_offsets,__transaction_state,connect-configs,connect-offsets,connect-status,connect-statuses",
"ksql.udf.collect.metrics" : "false",
"ksql.persistent.prefix" : "query_",
"ksql.query.persistent.active.limit" : "2147483647"
}
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "nanopb",
"version": "0.3.8",
"summary": "Protocol buffers with small code size.",
"description": "Nanopb is a plain-C implementation of Google's\n[Protocol Buffers][pb] data format. It is targeted at\n32 bit microcontrollers, but is also fit for\nother embedded systems with tight (2-10 kB ROM,\n<1 kB RAM) memory constraints.\n\n [pb]: https://developers.google.com/protocol-buffers/",
"homepage": "https://github.com/nanopb/nanopb",
"license": {
"type": "zlib",
"file": "LICENSE.txt"
},
"authors": {
"Petteri Aimonen": "jpa@nanopb.mail.kapsi.fi"
},
"source": {
"http": "https://github.com/nanopb/nanopb/archive/0.3.8.tar.gz"
},
"requires_arc": false,
"xcconfig": {
"GCC_PREPROCESSOR_DEFINITIONS": "$(inherited) PB_FIELD_32BIT=1 PB_NO_PACKED_STRUCTS=1"
},
"source_files": "*.{h,c}",
"public_header_files": "*.h",
"platforms": {
"osx": null,
"ios": null,
"tvos": null,
"watchos": null
},
"subspecs": [
{
"name": "encode",
"public_header_files": [
"pb.h",
"pb_encode.h",
"pb_common.h"
],
"source_files": [
"pb.h",
"pb_common.h",
"pb_common.c",
"pb_encode.h",
"pb_encode.c"
]
},
{
"name": "decode",
"public_header_files": [
"pb.h",
"pb_decode.h",
"pb_common.h"
],
"source_files": [
"pb.h",
"pb_common.h",
"pb_common.c",
"pb_decode.h",
"pb_decode.c"
]
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"009BA758-7060-4479-8EE8-FB9B40C8FB97": {
"name": "Korea y Japon de noche"
},
"B1B5DDC5-73C8-4920-8133-BACCE38A08DE": {
"name": "De Ciudad de México a Nueva York"
},
"7719B48A-2005-4011-9280-2F64EEC6FD91": {
"name": "Del Norte de California a Baja"
},
"B876B645-3955-420E-99DF-60139E451CF3": {
"name": "Parque Nacional de Wulingyuan 1"
},
"9CCB8297-E9F5-4699-AE1F-890CFBD5E29C": {
"name": "Las terrazas de arroz de Longsheng"
},
"D5E76230-81A3-4F65-A1BA-51B8CADED625": {
"name": "Parque Nacional de Wulingyuan 2"
},
"F0236EC5-EE72-4058-A6CE-1F7D2E8253BF": {
"name": "La Gran Muralla 1"
},
"22162A9B-DB90-4517-867C-C676BC3E8E95": {
"name": "La Gran Muralla 2"
},
"044AD56C-A107-41B2-90CC-E60CCACFBCF5": {
"name": "La Gran Muralla 3"
},
"876D51F4-3D78-4221-8AD2-F9E78C0FD9B9": {
"name": "Carretera Sheikh Zayed"
},
"E991AC0C-F272-44D8-88F3-05F44EDFE3AE": {
"name": "Marina 1"
},
"00BA71CD-2C54-415A-A68A-8358E677D750": {
"name": "Downtown"
},
"3FFA2A97-7D28-49EA-AA39-5BC9051B2745": {
"name": "Marina 2"
},
"9680B8EB-CE2A-4395-AF41-402801F4D6A6": {
"name": "Acercándose a Burj Khalifa"
},
"2F11E857-4F77-4476-8033-4A1E4610AFCC": {
"name": "Carretera Sheikh Zayed"
},
"B8F204CE-6024-49AB-85F9-7CA2F6DCD226": {
"name": "Península de Nuussuaq"
},
"2F52E34C-39D4-4AB1-9025-8F7141FAA720": {
"name": "Fiordo de Ilulissat"
},
"EE01F02D-1413-436C-AB05-410F224A5B7B": {
"name": "Fiordo de Ilulissat"
},
"499995FA-E51A-4ACE-8DFD-BDF8AFF6C943": {
"name": "Valle Waimanu"
},
"12E0343D-2CD9-48EA-AB57-4D680FB6D0C7": {
"name": "Laupāhoehoe Nui"
},
"b2-2": {
"name": "Valle Honopū"
},
"258A6797-CC13-4C3A-AB35-4F25CA3BF474": {
"name": "Pu‘u O ‘Umi"
},
"3D729CFC-9000-48D3-A052-C5BD5B7A6842": {
"name": "La costa de Kohala"
},
"82BD33C9-B6D2-47E7-9C42-AA3B7758921A": {
"name": "Pu‘u O ‘Umi"
},
"FE8E1F9D-59BA-4207-B626-28E34D810D0A": {
"name": "Puerto Victoria 1"
},
"C8559883-6F3E-4AF2-8960-903710CD47B7": {
"name": "Cumbre Victoria"
},
"024891DE-B7F6-4187-BFE0-E6D237702EF0": {
"name": "Wan Chai"
},
"64EA30BD-C4B5-4CDD-86D7-DFE47E9CB9AA": {
"name": "Puerto Victoria 2"
},
"E99FA658-A59A-4A2D-9F3B-58E7BDC71A9A": {
"name": "Puerto Victoria"
},
"001C94AE-2BA4-4E77-A202-F7DE60E8B1C8": {
"name": "El oasis de Liwa 1"
},
"AFA22C08-A486-4CE8-9A13-E355B6C38559": {
"name": "El oasis de Liwa 2"
},
"58754319-8709-4AB0-8674-B34F04E7FFE2": {
"name": "Río Támesis"
},
"A5AAFF5D-8887-42BB-8AFD-867EF557ED85": {
"name": "Palacio de Buckingham"
},
"F604AF56-EA77-4960-AEF7-82533CC1A8B3": {
"name": "El río Támesis al atardecer"
},
"7F4C26C2-67C2-4C3A-8F07-8A7BF6148C97": {
"name": "El río Támesis al anochecer"
},
"CE279831-1CA7-4A83-A97B-FF1E20234396": {
"name": "Aeropuerto Internacional de Los Angeles"
},
"35693AEA-F8C4-4A80-B77D-C94B20A68956": {
"name": "Harbor Freeway"
},
"92E48DE9-13A1-4172-B560-29B4668A87EE": {
"name": "Playa de Santa Monica"
},
"89B1643B-06DD-4DEC-B1B0-774493B0F7B7": {
"name": "Observatorio Griffith"
},
"EC67726A-8212-4C5E-83CF-8412932740D2": {
"name": "Hollywood Hills"
},
"F5804DD6-5963-40DA-9FA0-39C0C6E6DEF9": {
"name": "El Downtown de Los Ángeles"
},
"3BA0CFC7-E460-4B59-A817-B97F9EBB9B89": {
"name": "Central Park"
},
"b1-3": {
"name": "Bajo Manhattan"
},
"840FE8E4-D952-4680-B1A7-AC5BACA2C1F8": {
"name": "Upper East Side"
},
"44166C39-8566-4ECA-BD16-43159429B52F": {
"name": "Séptima Avenida"
},
"640DFB00-FBB9-45DA-9444-9F663859F4BC": {
"name": "Bajo Manhattan"
},
"b8-2": {
"name": "Marin Headlands"
},
"EE533FBD-90AE-419A-AD13-D7A60E2015D6": {
"name": "Marin Headlands en la niebla"
},
"DE851E6D-C2BE-4D9F-AB54-0F9CE994DC51": {
"name": "Bahía de San Francisco y el Golden Gate"
},
"b8-3": {
"name": "Alamo Square"
},
"85CE77BF-3413-4A7B-9B0F-732E96229A73": {
"name": "Embarcadero, Market Street"
},
"b4-3": {
"name": "De Presidio al Golden Gate"
},
"72B4390D-DF1D-4D51-B179-229BBAEFFF2C": {
"name": "El Golden Gate desde San Francisco"
},
"b6-4": {
"name": "Downtown y la Torre Coit"
},
"29BDF297-EB43-403A-8719-A78DA11A2948": {
"name": "Fisherman’s Wharf"
},
"b5-3": {
"name": "Embarcadero, Market Street"
},
"3E94AE98-EAF2-4B09-96E3-452F46BC114E": {
"name": "Puente de la Bahía"
},
"b2-4": {
"name": "Downtown y la Torre Sutro"
},
"4AD99907-9E76-408D-A7FC-8429FF014201": {
"name": "Bahía de San Francisco y Embarcadero"
},
"03EC0F5E-CCA8-4E0A-9FEC-5BD1CE151182": {
"name": "Antártida"
},
"737E9E24-49BE-4104-9B72-F352DE1AD2BF": {
"name": "Aurora Boreal Norteamericana"
},
"A837FA8C-C643-4705-AE92-074EFDD067F7": {
"name": "Noche Africana"
},
"2F72BC1E-3D76-456C-81EB-842EBA488C27": {
"name": "Africa y Oriente Medio"
},
"12318CCB-3F78-43B7-A854-EFDCCE5312CD": {
"name": "De California a Las Vegas"
},
"D5CFB2FF-5F8C-4637-816B-3E42FC1229B8": {
"name": "El Caribe"
},
"4F881F8B-A7D9-4FDB-A917-17BF6AC5A589": {
"name": "El Caribe de dia"
},
"7825C73A-658F-48EE-B14C-EC56673094AC": {
"name": "China"
},
"E5DB138A-F04E-4619-B896-DE5CB538C534": {
"name": "De Italia a Asia"
},
"F439B0A7-D18C-4B14-9681-6520E6A74FE9": {
"name": "Irán y Afganistán"
},
"7C643A39-C0B2-4BA0-8BC2-2EAA47CC580E": {
"name": "De Irlanda a Asia"
},
"63C042F0-90EF-4A95-B7CC-CC9A64BF8421": {
"name": "De África Occidental a los Alpes"
},
"78911B7E-3C69-47AD-B635-9C2486F6301D": {
"name": "Nueva Zelanda"
},
"E556BBC5-D0A0-4DB1-AC77-BC76E4A526F4": {
"name": "El Sahara e Italia"
},
"64D11DAB-3B57-4F14-AD2F-E59A9282FA44": {
"name": "Del Océano Atlántico a España y Francia"
},
"81337355-E156-4242-AAF4-711768D30A54": {
"name": "Australia"
},
"1088217C-1410-4CF7-BDE9-8F573A4DBCD9": {
"name": "Del Caribe a América Central"
},
"3C4678E4-4D3D-4A40-8817-77752AEA62EB": {
"name": "Delta del Nilo"
},
"87060EC2-D006-4102-98CC-3005C68BB343": {
"name": "De Sudáfrica al Norte de Asia"
},
"F07CC61B-30FC-4614-BDAD-3240B61F6793": {
"name": "Corales en Palau"
},
"6143116D-03BB-485E-864E-A8CF58ACF6F1": {
"name": "Algas en Sudáfrica"
},
"2B30E324-E4FF-4CC1-BA45-A958C2D2B2EC": {
"name": "Barracuda"
},
"581A4F1A-2B6D-468C-A1BE-6F473F06D10B": {
"name": "Estrellas de mar"
},
"687D03A2-18A5-4181-8E85-38F3A13409B9": {
"name": "Pez Loro Búfalo"
},
"537A4DAB-83B0-4B66-BCD1-05E5DBB4A268": {
"name": "Jureles"
},
"27A37B0F-738D-4644-A7A4-E33E7A6C1175": {
"name": "Delfines de California"
},
"EB3F48E7-D30F-4079-858F-1A61331D5026": {
"name": "Bosque de Algas de California"
},
"CE9B5D5B-B6E7-47C5-8C04-59BF182E98FB": {
"name": "Delfines de Costa Rica"
},
"58C75C62-3290-47B8-849C-56A583173570": {
"name": "Mantarrayas"
},
"3716DD4B-01C0-4F5B-8DD6-DB771EC472FB": {
"name": "Tiburones Grises de Arrecife"
},
"DD47D8E1-CB66-4C12-BFEA-2ADB0D8D1E2E": {
"name": "Ballena Jorobada"
},
"82175C1F-153C-4EC8-AE37-2860EA828004": {
"name": "Coral del Mar Rojo"
},
"391BDF6E-3279-4CE1-9CA5-0F82811452D7": {
"name": "Focas"
},
"BA4ECA11-592F-4727-9221-D2A32A16EB28": {
"name": "Medusas en Palau 1"
},
"E580E5A5-0888-4BE8-A4CA-F74A18A643C3": {
"name": "Medusas en Palau 2"
},
"EC3DC957-D4C2-4732-AACE-7D0C0F390EC8": {
"name": "Medusas en Palau 3"
},
"C7AD3D0A-7EDF-412C-A237-B3C9D27381A1": {
"name": "Medusas en Alaska 1"
},
"C6DC4E54-1130-44F8-AF6F-A551D8E8A181": {
"name": "Medusas en Alaska 2"
},
"149E7795-DBDA-4F5D-B39A-14712F841118": {
"name": "Olas de Tahití 1"
},
"8C31B06F-91A4-4F7C-93ED-56146D7F48B9": {
"name": "Olas de Tahití 2"
}
}
|
{
"pile_set_name": "Github"
}
|
{
"id": "MAP_BATTLE_FRONTIER_BATTLE_FACTORY_LOBBY",
"name": "BattleFrontier_BattleFactoryLobby",
"layout": "LAYOUT_BATTLE_FRONTIER_BATTLE_FACTORY_LOBBY",
"music": "MUS_B_FACTORY",
"region_map_section": "MAPSEC_BATTLE_FRONTIER",
"requires_flash": false,
"weather": "WEATHER_NONE",
"map_type": "MAP_TYPE_INDOOR",
"allow_cycling": false,
"allow_escaping": false,
"allow_running": false,
"show_map_name": false,
"battle_scene": "MAP_BATTLE_SCENE_NORMAL",
"connections": null,
"object_events": [
{
"graphics_id": "OBJ_EVENT_GFX_SCIENTIST_1",
"x": 4,
"y": 7,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_SinglesAttendant",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_WOMAN_1",
"x": 3,
"y": 11,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_WANDER_AROUND",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_Woman",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_CAMPER",
"x": 14,
"y": 11,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 0,
"movement_range_y": 0,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_Camper",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_PICNICKER",
"x": 13,
"y": 11,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_FACE_RIGHT",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_Picnicker",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_FAT_MAN",
"x": 6,
"y": 10,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_LOOK_AROUND",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_FatMan",
"flag": "0"
},
{
"graphics_id": "OBJ_EVENT_GFX_SCIENTIST_1",
"x": 14,
"y": 7,
"elevation": 0,
"movement_type": "MOVEMENT_TYPE_FACE_DOWN",
"movement_range_x": 1,
"movement_range_y": 1,
"trainer_type": "TRAINER_TYPE_NONE",
"trainer_sight_or_berry_tree_id": "0",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_DoublesAttendant",
"flag": "0"
}
],
"warp_events": [
{
"x": 9,
"y": 11,
"elevation": 0,
"dest_map": "MAP_BATTLE_FRONTIER_OUTSIDE_WEST",
"dest_warp_id": 2
},
{
"x": 10,
"y": 11,
"elevation": 0,
"dest_map": "MAP_BATTLE_FRONTIER_OUTSIDE_WEST",
"dest_warp_id": 2
}
],
"coord_events": [],
"bg_events": [
{
"type": "sign",
"x": 2,
"y": 7,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_NORTH",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_ShowSinglesResults"
},
{
"type": "sign",
"x": 11,
"y": 7,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_NORTH",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_ShowDoublesResults"
},
{
"type": "sign",
"x": 9,
"y": 4,
"elevation": 0,
"player_facing_dir": "BG_EVENT_PLAYER_FACING_ANY",
"script": "BattleFrontier_BattleFactoryLobby_EventScript_RulesBoard"
}
]
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>7--Cheering_7_Cheering_Cheering_7_359.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>464</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>870</xmin>
<ymin>0</ymin>
<xmax>902</xmax>
<ymax>35</ymax>
</bndbox>
<lm>
<x1>877.786</x1>
<y1>4.866</y1>
<x2>879.223</x2>
<y2>4.25</y2>
<x3>872.857</x3>
<y3>13.491</y3>
<x4>879.634</x4>
<y4>19.036</y4>
<x5>881.688</x5>
<y5>16.982</y5>
<visible>0</visible>
<blur>0.42</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>986</xmin>
<ymin>11</ymin>
<xmax>1009</xmax>
<ymax>41</ymax>
</bndbox>
<lm>
<x1>989.929</x1>
<y1>26.0</y1>
<x2>1000.929</x2>
<y2>20.5</y2>
<x3>994.839</x3>
<y3>28.75</y3>
<x4>996.214</x4>
<y4>35.821</y4>
<x5>1003.875</x5>
<y5>31.696</y5>
<visible>0</visible>
<blur>0.5</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>700</xmin>
<ymin>89</ymin>
<xmax>737</xmax>
<ymax>133</ymax>
</bndbox>
<lm>
<x1>706.469</x1>
<y1>105.438</y1>
<x2>719.125</x2>
<y2>98.969</y2>
<x3>713.219</x3>
<y3>111.344</y3>
<x4>719.125</x4>
<y4>121.75</y4>
<x5>726.438</x5>
<y5>116.688</y5>
<visible>0</visible>
<blur>0.52</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>782</xmin>
<ymin>238</ymin>
<xmax>838</xmax>
<ymax>302</ymax>
</bndbox>
<lm>
<x1>789.509</x1>
<y1>262.17</y1>
<x2>815.625</x2>
<y2>254.938</y2>
<x3>797.946</x3>
<y3>268.196</y3>
<x4>795.938</x4>
<y4>285.071</y4>
<x5>812.411</x5>
<y5>282.661</y5>
<visible>0</visible>
<blur>0.66</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>564</xmin>
<ymin>278</ymin>
<xmax>579</xmax>
<ymax>301</ymax>
</bndbox>
<lm>
<x1>568.161</x1>
<y1>285.205</y1>
<x2>569.982</x2>
<y2>284.902</y2>
<x3>566.491</x3>
<y3>290.518</y3>
<x4>569.375</x4>
<y4>295.071</y4>
<x5>570.589</x5>
<y5>294.92</y5>
<visible>1</visible>
<blur>0.46</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>492</xmin>
<ymin>251</ymin>
<xmax>521</xmax>
<ymax>289</ymax>
</bndbox>
<lm>
<x1>493.482</x1>
<y1>268.071</y1>
<x2>502.161</x2>
<y2>265.661</y2>
<x3>494.205</x3>
<y3>274.821</y3>
<x4>496.616</x4>
<y4>282.054</y4>
<x5>500.955</x5>
<y5>280.366</y5>
<visible>1</visible>
<blur>0.46</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>522</xmin>
<ymin>343</ymin>
<xmax>551</xmax>
<ymax>385</ymax>
</bndbox>
<lm>
<x1>528.768</x1>
<y1>360.25</y1>
<x2>532.518</x2>
<y2>359.179</y2>
<x3>522.875</x3>
<y3>372.304</y3>
<x4>527.964</x4>
<y4>379.536</y4>
<x5>531.446</x5>
<y5>378.196</y5>
<visible>1</visible>
<blur>0.56</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>40</xmin>
<ymin>334</ymin>
<xmax>83</xmax>
<ymax>416</ymax>
</bndbox>
<lm>
<x1>58.388</x1>
<y1>364.054</y1>
<x2>59.955</x2>
<y2>364.054</y2>
<x3>40.629</x3>
<y3>383.379</y3>
<x4>49.509</x4>
<y4>396.96</y4>
<x5>51.076</x5>
<y5>396.96</y5>
<visible>1</visible>
<blur>0.61</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>imagesRaw</folder>
<filename>2017-12-19 13:14:26.858654.jpg</filename>
<path>/Users/abell/Development/other.nyc/Camera/imagesRaw/2017-12-19 13:14:26.858654.jpg</path>
<source>
<database>Unknown</database>
</source>
<size>
<width>352</width>
<height>240</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>bicycle</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>176</xmin>
<ymin>176</ymin>
<xmax>188</xmax>
<ymax>208</ymax>
</bndbox>
</object>
<object>
<name>truck</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>195</xmin>
<ymin>160</ymin>
<xmax>255</xmax>
<ymax>233</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>141</xmin>
<ymin>150</ymin>
<xmax>162</xmax>
<ymax>167</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>157</xmin>
<ymin>134</ymin>
<xmax>171</xmax>
<ymax>148</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>177</xmin>
<ymin>137</ymin>
<xmax>192</xmax>
<ymax>148</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>200</xmin>
<ymin>148</ymin>
<xmax>220</xmax>
<ymax>160</ymax>
</bndbox>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>49--Greeting_49_Greeting_peoplegreeting_49_133.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>576</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>659</xmin>
<ymin>75</ymin>
<xmax>729</xmax>
<ymax>166</ymax>
</bndbox>
<lm>
<x1>664.929</x1>
<y1>107.429</y1>
<x2>683.214</x2>
<y2>109.143</y2>
<x3>661.5</x3>
<y3>126.286</y3>
<x4>670.643</x4>
<y4>141.143</y4>
<x5>691.786</x5>
<y5>138.286</y5>
<visible>0</visible>
<blur>0.73</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>475</xmin>
<ymin>105</ymin>
<xmax>540</xmax>
<ymax>190</ymax>
</bndbox>
<lm>
<x1>518.786</x1>
<y1>135.214</y1>
<x2>534.857</x2>
<y2>131.464</y2>
<x3>541.821</x3>
<y3>148.607</y3>
<x4>526.821</x4>
<y4>168.964</y4>
<x5>538.071</x5>
<y5>165.214</y5>
<visible>1</visible>
<blur>0.72</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>287</xmin>
<ymin>111</ymin>
<xmax>353</xmax>
<ymax>190</ymax>
</bndbox>
<lm>
<x1>297.0</x1>
<y1>135.0</y1>
<x2>320.0</x2>
<y2>137.0</y2>
<x3>296.0</x3>
<y3>153.0</y3>
<x4>294.0</x4>
<y4>170.0</y4>
<x5>312.0</x5>
<y5>170.0</y5>
<visible>0</visible>
<blur>0.74</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>95</xmin>
<ymin>35</ymin>
<xmax>160</xmax>
<ymax>134</ymax>
</bndbox>
<lm>
<x1>151.375</x1>
<y1>64.0</y1>
<x2>153.25</x2>
<y2>62.125</y2>
<x3>160.125</x3>
<y3>87.125</y3>
<x4>145.125</x4>
<y4>105.25</y4>
<x5>145.75</x5>
<y5>107.125</y5>
<visible>1</visible>
<blur>0.75</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>828</xmin>
<ymin>69</ymin>
<xmax>882</xmax>
<ymax>158</ymax>
</bndbox>
<lm>
<x1>837.625</x1>
<y1>100.062</y1>
<x2>833.125</x2>
<y2>98.938</y2>
<x3>826.375</x3>
<y3>116.375</y3>
<x4>840.438</x4>
<y4>135.5</y4>
<x5>835.938</x5>
<y5>134.375</y5>
<visible>1</visible>
<blur>0.7</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
{
"name": "wireguard-ui",
"version": "1.0.0",
"description": "WireGuard VPN web UI",
"main": "index.js",
"scripts": {
"dev": "webpack-dev-server --mode=development --open --port 5000",
"build": "cross-env NODE_ENV=production webpack --mode=production --progress",
"test": "jest",
"prettier": "prettier --check ./src/**/*.{js,css,json,md}"
},
"author": "Daniel Lundin <daniel.lundin@embark-studios.com>",
"license": "ISC",
"dependencies": {
"cookie-universal": "^2.0.16"
},
"devDependencies": {
"@babel/cli": "^7.11.6",
"@babel/core": "^7.11.6",
"@babel/preset-env": "^7.11.5",
"@material/typography": "^3.1.0",
"@smui/button": "^1.0.0",
"@smui/dialog": "^1.0.0",
"@smui/fab": "^1.0.0",
"@smui/icon-button": "^1.0.0",
"@smui/paper": "^1.0.0",
"@smui/textfield": "^1.0.0",
"@smui/top-app-bar": "^1.0.0",
"babel-jest": "^24.9.0",
"babel-loader": "^8.1.0",
"clean-webpack-plugin": "^3.0.0",
"cross-env": "^6.0.3",
"css-loader": "^3.6.0",
"html-webpack-plugin": "^3.2.0",
"husky": "^3.1.0",
"jest": "^24.9.0",
"lint-staged": "^9.5.0",
"mini-css-extract-plugin": "^0.8.2",
"node-sass": "^4.14.1",
"prettier": "^1.19.1",
"sass-loader": "^8.0.2",
"style-loader": "^1.2.1",
"svelte": "^3.25.0",
"svelte-loader": "^2.13.6",
"svelte-routing": "1.4.0",
"webpack": "^4.44.1",
"webpack-cli": "^3.3.12",
"webpack-dev-server": "^3.11.0"
},
"husky": {
"hooks": {
"pre-commit": "lint-staged"
}
},
"lint-staged": {
"*.{js,css,json,md}": [
"prettier --write",
"git add"
]
}
}
|
{
"pile_set_name": "Github"
}
|
{
"type" : "aridbee",
"shortdescription" : "Arid Bee",
"description" : "A sandy bee.",
"categories" : [ "aridbee" ],
"parts" : [ "body" ],
"animation" : "aridbee.animation",
"colors" : "/monsters/colors.config",
"dropPools" : [
{
"default" : "empty",
"bugnet" : "aridqueen"
}
],
"baseParameters" : {
"scripts" : [
"/monsters/bugs/bug.lua",
"/monsters/bees/bee.lua",
"/scripts/util.lua",
"/scripts/vec2.lua"
],
"buzzing" : {
"riseSpeed" : 2,
"minGroundDistance" : 2,
"fallSpeed" : 4,
"maxGroundDistance" : 4,
"changeDirSpeed" : 2,
"wanderDistance" : 8,
"rotationSpeed" : 4,
"rotationChangeInterval" : 5,
"flySpeed" : 5
},
"metaBoundBox" : [-0.5, -0.5, 0.5, 0.5],
"scale" : 1.0,
"movementSettings" : {
"collisionPoly" : [ [-0.5, -0.5], [0.5, -0.5], [0.5, 0.5], [-0.5, 0.5] ],
"mass" : 1,
"walkSpeed" : 10,
"runSpeed" : 10,
"jumpSpeed" : 5,
"flySpeed" : 3,
"airFriction" : 0,
"airForce" : 100.0,
"gravityEnabled" : false
},
"bodyMaterialKind" : "organic",
"knockoutTime" : 0.1,
"knockoutEffect" : "",
"touchDamage" : {
"poly" : [ [-1.0, -1.125], [1.0, -1.125], [1.0, 1.0], [-1.0, 1.0] ],
"damage" : 0,
"teamType" : "enemy",
"damageSourceKind" : "bite",
"statusEffects" : [ ]
},
"statusSettings" : {
"statusProperties" : {
"targetMaterialKind" : "organic"
},
"appliesWeatherStatusEffects" : false,
"appliesEnvironmentStatusEffects" : false,
"minimumLiquidStatusEffectPercentage" : 0.1,
"primaryScriptSources" : [
"/stats/monster_primary.lua"
],
"primaryScriptDelta" : 400,
"stats" : {
"grit" : {
"baseValue" : 1.0
},
"maxHealth" : {
"baseValue" : 1
},
"protection" : {
"baseValue" : 1.0
},
"healthRegen" : {
"baseValue" : 0
}
},
"resources" : {
"health" : {
"maxStat" : "maxHealth",
"deltaStat" : "healthRegen",
"defaultPercentage" : 100
}
}
},
"mouthOffset" : [0, 0],
"feetOffset" : [0, -8]
}
}
|
{
"pile_set_name": "Github"
}
|
{
"version" : "5.5.0",
"timestamp" : 1581572105325,
"path" : "query-validation-tests/url.json",
"schemas" : {
"CSAS_OUTPUT_0.KsqlTopic.Source" : {
"schema" : "`ROWKEY` STRING KEY, `URL` STRING",
"serdeOptions" : [ ]
},
"CSAS_OUTPUT_0.OUTPUT" : {
"schema" : "`ROWKEY` STRING KEY, `Q` STRING",
"serdeOptions" : [ ]
}
},
"testCase" : {
"name" : "extract a query from a URL using URL_EXTRACT_QUERY - JSON",
"inputs" : [ {
"topic" : "test_topic",
"key" : "1",
"value" : {
"url" : "http://www.test.com?query#fragment"
},
"timestamp" : 0
}, {
"topic" : "test_topic",
"key" : "2",
"value" : {
"url" : "http://www.test.com/path?q1&q2"
},
"timestamp" : 1
}, {
"topic" : "test_topic",
"key" : "3",
"value" : {
"url" : "http://test@confluent.io:8080/nested/path?q=2"
},
"timestamp" : 2
}, {
"topic" : "test_topic",
"key" : "4",
"value" : {
"url" : "http://test@confluent.io:8080/path"
},
"timestamp" : 3
} ],
"outputs" : [ {
"topic" : "OUTPUT",
"key" : "1",
"value" : {
"Q" : "query"
},
"timestamp" : 0
}, {
"topic" : "OUTPUT",
"key" : "2",
"value" : {
"Q" : "q1&q2"
},
"timestamp" : 1
}, {
"topic" : "OUTPUT",
"key" : "3",
"value" : {
"Q" : "q=2"
},
"timestamp" : 2
}, {
"topic" : "OUTPUT",
"key" : "4",
"value" : {
"Q" : null
},
"timestamp" : 3
} ],
"topics" : [ {
"name" : "OUTPUT",
"replicas" : 1,
"numPartitions" : 4
}, {
"name" : "test_topic",
"replicas" : 1,
"numPartitions" : 4
} ],
"statements" : [ "CREATE STREAM TEST (URL STRING) WITH (KAFKA_TOPIC='test_topic', VALUE_FORMAT='JSON');", "CREATE STREAM OUTPUT AS SELECT URL_EXTRACT_QUERY(TEST.URL) Q\nFROM TEST TEST\nEMIT CHANGES;" ],
"post" : {
"sources" : [ {
"name" : "OUTPUT",
"type" : "STREAM",
"schema" : "`ROWKEY` STRING KEY, `Q` STRING",
"keyFormat" : {
"format" : "KAFKA"
},
"serdeOptions" : [ ]
}, {
"name" : "TEST",
"type" : "STREAM",
"schema" : "`ROWKEY` STRING KEY, `URL` STRING",
"keyFormat" : {
"format" : "KAFKA"
},
"serdeOptions" : [ ]
} ],
"topics" : {
"topics" : [ {
"name" : "test_topic",
"keyFormat" : {
"formatInfo" : {
"format" : "KAFKA"
}
},
"valueFormat" : {
"format" : "JSON"
},
"partitions" : 4
}, {
"name" : "OUTPUT",
"keyFormat" : {
"formatInfo" : {
"format" : "KAFKA"
}
},
"valueFormat" : {
"format" : "JSON"
},
"partitions" : 4
} ]
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"id": "00b8a28c-5116-11e7-9807-a26608126000",
"name": "New Decision Table",
"key": "NewDecisionTable",
"hitIndicator": "FIRST",
"inputExpressions": [
{
"id": "3",
"variableId": "input1",
"variableType": null,
"type": null,
"label": "input one",
"entries": null,
"newVariable": false
},
{
"id": "5",
"variableId": "input2",
"variableType": null,
"type": null,
"label": "Input Two",
"entries": null,
"newVariable": false
},
{
"id": "7",
"variableId": "input3",
"variableType": null,
"type": null,
"label": "Input Three",
"entries": null,
"newVariable": false
},
{
"id": "9",
"variableId": "input4",
"variableType": null,
"type": null,
"label": "Input Four",
"entries": null,
"newVariable": false
}
],
"outputExpressions": [
{
"id": "13",
"variableId": "output1",
"variableType": null,
"type": null,
"label": "Output One",
"entries": null,
"newVariable": false
}
],
"rules": [
{
"3": "== \"TEST\"",
"5": "== 100",
"7": "== true",
"9": "fn_date('2017-06-01')",
"13": "\"WAS TEST\""
},
{
"3": "!= \"TEST\"",
"5": "!= 100",
"7": "== false",
"9": "!= fn_date('2017-06-01')",
"13": "\"WASN'T TEST\""
},
{
"3": "",
"5": "",
"7": "",
"9": "",
"13": "\"SOMETHING ELSE\""
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "mbedtls",
"full_name": "mbedtls",
"oldname": "polarssl",
"aliases": [
],
"versioned_formulae": [
],
"desc": "Cryptographic & SSL/TLS library",
"license": "Apache-2.0",
"homepage": "https://tls.mbed.org/",
"versions": {
"stable": "2.24.0",
"head": "HEAD",
"bottle": true
},
"urls": {
"stable": {
"url": "https://github.com/ARMmbed/mbedtls/archive/mbedtls-2.24.0.tar.gz",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 0,
"cellar": ":any",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/mbedtls-2.24.0.catalina.bottle.tar.gz",
"sha256": "5b8870d06fd1d2bfb485c05e1bb424e19610d1e36f896e1eced0a6fa82fb876c"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/mbedtls-2.24.0.mojave.bottle.tar.gz",
"sha256": "20631d8cdd6f543f60753e121b6470e645a52eedf4b6289893e6a17deeff7b24"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/mbedtls-2.24.0.high_sierra.bottle.tar.gz",
"sha256": "245e4e38268cb102f21fa4b4c7d63ebe105b5941ed1edc69059a7c7395f51470"
},
"x86_64_linux": {
"url": "https://linuxbrew.bintray.com/bottles/mbedtls-2.24.0.x86_64_linux.bottle.tar.gz",
"sha256": "7c330632ecf6073fca25178aa1f0f4552be7af1a295fd2178d8178c4c2d1f7e4"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
"cmake",
"python@3.8"
],
"dependencies": [
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
],
"conflicts_with": [
],
"caveats": null,
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>44--Aerobics_44_Aerobics_Aerobics_44_711.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>1656</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>735</xmin>
<ymin>907</ymin>
<xmax>774</xmax>
<ymax>954</ymax>
</bndbox>
<lm>
<x1>741.737</x1>
<y1>926.808</y1>
<x2>756.094</x2>
<y2>923.817</y2>
<x3>747.719</x3>
<y3>933.688</y3>
<x4>742.036</x4>
<y4>940.866</y4>
<x5>757.888</x5>
<y5>939.67</y5>
<visible>0</visible>
<blur>0.48</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>648</xmin>
<ymin>854</ymin>
<xmax>682</xmax>
<ymax>895</ymax>
</bndbox>
<lm>
<x1>654.0</x1>
<y1>870.0</y1>
<x2>670.0</x2>
<y2>869.0</y2>
<x3>661.0</x3>
<y3>877.0</y3>
<x4>652.0</x4>
<y4>881.0</y4>
<x5>670.0</x5>
<y5>883.0</y5>
<visible>0</visible>
<blur>0.41</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>453</xmin>
<ymin>837</ymin>
<xmax>499</xmax>
<ymax>893</ymax>
</bndbox>
<lm>
<x1>461.357</x1>
<y1>859.714</y1>
<x2>481.714</x2>
<y2>857.929</y2>
<x3>470.643</x3>
<y3>872.571</y3>
<x4>465.643</x4>
<y4>877.214</y4>
<x5>486.0</x5>
<y5>875.071</y5>
<visible>0</visible>
<blur>0.52</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>348</xmin>
<ymin>819</ymin>
<xmax>376</xmax>
<ymax>860</ymax>
</bndbox>
<lm>
<x1>353.098</x1>
<y1>836.129</y1>
<x2>367.848</x2>
<y2>834.549</y2>
<x3>360.473</x3>
<y3>841.661</y3>
<x4>357.312</x4>
<y4>850.089</y4>
<x5>364.951</x5>
<y5>850.089</y5>
<visible>1</visible>
<blur>0.44</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>196</xmin>
<ymin>880</ymin>
<xmax>235</xmax>
<ymax>929</ymax>
</bndbox>
<lm>
<x1>202.987</x1>
<y1>901.036</y1>
<x2>219.312</x2>
<y2>900.42</y2>
<x3>208.223</x3>
<y3>908.429</y3>
<x4>202.371</x4>
<y4>916.746</y4>
<x5>219.312</x5>
<y5>915.821</y5>
<visible>1</visible>
<blur>0.5</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>816</xmin>
<ymin>718</ymin>
<xmax>830</xmax>
<ymax>736</ymax>
</bndbox>
<lm>
<x1>821.0</x1>
<y1>727.0</y1>
<x2>823.0</x2>
<y2>727.0</y2>
<x3>821.0</x3>
<y3>731.0</y3>
<x4>821.0</x4>
<y4>735.0</y4>
<x5>823.0</x5>
<y5>735.0</y5>
<visible>0</visible>
<blur>0.23</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
{
"metadata": {
"name": "",
"signature": "sha256:f27471ecbd79f2ade29af683349371a088591f10065165f2e861846e8806e995"
},
"nbformat": 3,
"nbformat_minor": 0,
"worksheets": [
{
"cells": [
{
"cell_type": "code",
"collapsed": false,
"input": [
"import os\n",
"import sys\n",
"import glob\n",
"import matplotlib.pyplot as plt\n",
"import numpy as np\n",
"import pandas as pd\n",
"%matplotlib inline\n",
"%precision 4"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 1,
"text": [
"u'%.4f'"
]
}
],
"prompt_number": 1
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**References**:\n",
"\n",
"[Functional Programming HOWTO](https://docs.python.org/2/howto/functional.html)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Functions are first class objects\n",
"----\n",
"\n",
"In Python, functions behave like any other object, such as an int or a list. That means that you can use functions as arguments to other functions, store functions as dictionary values, or return a function from another function. This leads to many powerful ways to use functions."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def square(x):\n",
" \"\"\"Square of x.\"\"\"\n",
" return x*x\n",
"\n",
"def cube(x):\n",
" \"\"\"Cube of x.\"\"\"\n",
" return x*x*x"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 2
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# create a dictionary of functions\n",
"\n",
"funcs = {\n",
" 'square': square,\n",
" 'cube': cube,\n",
"}"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 3
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"x = 2\n",
"\n",
"print square(x)\n",
"print cube(x)\n",
"\n",
"for func in sorted(funcs):\n",
" print func, funcs[func](x)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"4\n",
"8\n",
"cube 8\n",
"square 4\n"
]
}
],
"prompt_number": 4
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Function argumnents\n",
"----\n",
"\n",
"This is caution to be careful of how Python treats function arguments. \n",
"\n",
"### Call by \"object reference\"\n",
"\n",
"Some data types, such as strings and tuples, cannot be directly modified and are called immutable. Atomic variables such as integers or floats are always immutable. Other datatypes, such as lists and dictionaries, can be directly modified and are called mutable. Passing mutable variables as function arguments can have different outcomes, depedning on what is done to the variable inside the function. When we call\n",
"\n",
"```python\n",
"x = [1,2,3] # mutable\n",
"f(x)\n",
"```\n",
"\n",
"what is passsed to the function is a *copy* of the *name* `x` that refers to the content (a list) `[1, 2, 3]`. If we use this copy of the name to change the content directly (e.g. `x[0] = 999`) within the function, then `x` chanes *outside* the funciton as well. However, if we reassgne `x` within the function to a new object (e.g. another list), then the copy of the name `x` now points to the new object, but `x` outside the function is unhcanged."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def transmogrify(x):\n",
" x[0] = 999\n",
" return x\n",
"\n",
"x = [1,2,3]\n",
"print x\n",
"print transmogrify(x)\n",
"print x"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 2, 3]\n",
"[999, 2, 3]\n",
"[999, 2, 3]\n"
]
}
],
"prompt_number": 5
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def no_mogrify(x):\n",
" x = [4,5,6]\n",
" return x\n",
"\n",
"x = [1,2,3]\n",
"print x\n",
"print no_mogrify(x)\n",
"print x"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 2, 3]\n",
"[4, 5, 6]\n",
"[1, 2, 3]\n"
]
}
],
"prompt_number": 6
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"### Binding of default arguments occurs at function *definition*"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def f(x = []):\n",
" x.append(1)\n",
" return x\n",
"\n",
"print f()\n",
"print f()\n",
"print f()\n",
"print f(x = [9,9,9])\n",
"print f()\n",
"print f()"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1]\n",
"[1, 1]\n",
"[1, 1, 1]\n",
"[9, 9, 9, 1]\n",
"[1, 1, 1, 1]\n",
"[1, 1, 1, 1, 1]\n"
]
}
],
"prompt_number": 7
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Usually, this behavior is not desired and we would write\n",
"\n",
"def f(x = None):\n",
" if x is None:\n",
" x = []\n",
" x.append(1)\n",
" return x\n",
"\n",
"print f()\n",
"print f()\n",
"print f()\n",
"print f(x = [9,9,9])\n",
"print f()\n",
"print f()"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1]\n",
"[1]\n",
"[1]\n",
"[9, 9, 9, 1]\n",
"[1]\n",
"[1]\n"
]
}
],
"prompt_number": 8
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"However, sometimes in advanced usage, the behavior is intetnional. See <http://effbot.org/zone/default-values.htm> for details."
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Higher-order functions\n",
"----\n",
"\n",
"A function that uses another function as an input argument or returns a function (HOF) is known as a higher-order function. The most familiar examples are `map` and `filter`."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# The map function applies a function to each member of a collection\n",
"\n",
"map(square, range(5))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 9,
"text": [
"[0, 1, 4, 9, 16]"
]
}
],
"prompt_number": 9
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# The filter function applies a predicate to each memmber of a collection, \n",
"# retaining only those members where the predicate is True\n",
"\n",
"def is_even(x):\n",
" return x%2 == 0\n",
"\n",
"filter(is_even, range(5))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 10,
"text": [
"[0, 2, 4]"
]
}
],
"prompt_number": 10
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# It is common to combine map and filter\n",
"\n",
"map(square, filter(is_even, range(5)))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 11,
"text": [
"[0, 4, 16]"
]
}
],
"prompt_number": 11
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# The reduce function reduces a collection using a binary operator to combine items two at a time\n",
"\n",
"def my_add(x, y):\n",
" return x + y\n",
"\n",
"# another implementation of the sum function\n",
"reduce(my_add, [1,2,3,4,5])"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 12,
"text": [
"15"
]
}
],
"prompt_number": 12
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Custom functions can of couse, also be HOFs\n",
"\n",
"def custom_sum(xs, transform):\n",
" \"\"\"Returns the sum of xs after a user specified transform.\"\"\"\n",
" return sum(map(transform, xs))\n",
"\n",
"xs = range(5)\n",
"print custom_sum(xs, square)\n",
"print custom_sum(xs, cube)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"30\n",
"100\n"
]
}
],
"prompt_number": 13
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Returning a function is also useful\n",
"\n",
"# A closure\n",
"def make_logger(target):\n",
" def logger(data):\n",
" with open(target, 'a') as f:\n",
" f.write(data + '\\n')\n",
" return logger\n",
"\n",
"foo_logger = make_logger('foo.txt')\n",
"foo_logger('Hello')\n",
"foo_logger('World')"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 14
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"!cat 'foo.txt'"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"Hello\r\n",
"World\r\n",
"Hello\r\n",
"World\r\n",
"Hello\r\n",
"World\r\n",
"Hello\r\n",
"World\r\n"
]
}
],
"prompt_number": 15
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Anonymous functions\n",
"----\n",
"\n",
"When using functional style, there is often the need to create small specific functions that perform a limited task as input to a HOF such as `map` or `filter`. In such cases, these functions are often written as `anonymous` or `lambda` functions. If you find it hard to understand what a `lambda` function is doing, it should probably be rewritten as a regular function."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Using standard functions\n",
"\n",
"def square(x):\n",
" return x*x\n",
"\n",
"print map(square, range(5))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[0, 1, 4, 9, 16]\n"
]
}
],
"prompt_number": 16
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Using an anonymous function\n",
"\n",
"print map(lambda x: x*x, range(5))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[0, 1, 4, 9, 16]\n"
]
}
],
"prompt_number": 17
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# what does this function do?\n",
"s1 = reduce(lambda x, y: x+y, map(lambda x: x**2, range(1,10)))\n",
"print(s1)\n",
"print\n",
"\n",
"# functional expressions and lambdas are cool \n",
"# but can be difficult to read when over-used\n",
"# Here is a more comprehensible version\n",
"s2 = sum(x**2 for x in range(1, 10))\n",
"print(s2)\n",
"\n",
"# we will revisit map-reduce when we look at high-performance computing\n",
"# where map is used to distribute jobs to multiple processors\n",
"# and reduce is used to calculate some aggreate function of the results \n",
"# returned by map"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"285\n",
"\n",
"285\n"
]
}
],
"prompt_number": 18
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Pure functions\n",
"----\n",
"\n",
"Functions are pure if they do not have any *side effects* and do not depend on global variables. Pure functions are similar to mathematical functions - each time the same input is given, the same output will be returned. This is useful for reducing bugs and in parallel programming since each function call is independent of any other function call and hence trivially parallelizable."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def pure(xs):\n",
" \"\"\"Make a new list and return that.\"\"\"\n",
" xs = [x*2 for x in xs]\n",
" return xs"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 19
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"xs = range(5)\n",
"print \"xs =\", xs\n",
"print pure(xs)\n",
"print \"xs =\", xs"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"xs = [0, 1, 2, 3, 4]\n",
"[0, 2, 4, 6, 8]\n",
"xs = [0, 1, 2, 3, 4]\n"
]
}
],
"prompt_number": 20
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def impure(xs):\n",
" for i, x in enumerate(xs):\n",
" xs[i] = x*2\n",
" return xs"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 21
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"xs = range(5)\n",
"print \"xs =\", xs\n",
"print impure(xs)\n",
"print \"xs =\", xs"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"xs = [0, 1, 2, 3, 4]\n",
"[0, 2, 4, 6, 8]\n",
"xs = [0, 2, 4, 6, 8]\n"
]
}
],
"prompt_number": 22
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Note that mutable functions are created upon function declaration, not use.\n",
"# This gives rise to a common source of beginner errors.\n",
"\n",
"def f1(x, y=[]):\n",
" \"\"\"Never give an empty list or other mutable structure as a default.\"\"\"\n",
" y.append(x)\n",
" return sum(y)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 23
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"print f1(10)\n",
"print f1(10)\n",
"print f1(10, y =[1,2])"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"10\n",
"20\n",
"13\n"
]
}
],
"prompt_number": 24
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Here is the correct Python idiom\n",
"\n",
"def f2(x, y=None):\n",
" \"\"\"Check if y is None - if so make it a list.\"\"\"\n",
" if y is None:\n",
" y = []\n",
" y.append(x)\n",
" return sum(y)"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 25
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"print f1(10)\n",
"print f1(10)\n",
"print f1(10, y =[1,2])"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"30\n",
"40\n",
"13\n"
]
}
],
"prompt_number": 26
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Recursion\n",
"----\n",
"\n",
"A recursive function is one that calls itself. Recursive functions are extremely useful examples of the divide-and-conquer paradigm in algorithm development and are a direct expression of finite diffference equations. However, they can be computationally inefficient and their use in Python is quite rare in practice.\n",
"\n",
"Recursive functions generally have a set of *base cases* where the answer is obvious and can be returned immediately, and a set of recursive cases which are split into smaller pieces, each of which is given to the same function called recursively. A few examples will make this clearer."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# The factorial function is perhaps the simplest classic example of recursion.\n",
"\n",
"def fact(n):\n",
" \"\"\"Returns the factorial of n.\"\"\"\n",
" # base case\n",
" if n==0:\n",
" return 1\n",
" # recursive case\n",
" else:\n",
" return n * fact(n-1)\n",
"\n",
"print [fact(n) for n in range(10)]"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 1, 2, 6, 24, 120, 720, 5040, 40320, 362880]\n"
]
}
],
"prompt_number": 27
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# The Fibonacci sequence is another classic recursion example\n",
"\n",
"def fib1(n):\n",
" \"\"\"Fib with recursion.\"\"\"\n",
"\n",
" # base case\n",
" if n==0 or n==1:\n",
" return 1\n",
" # recurssive caae\n",
" else:\n",
" return fib1(n-1) + fib1(n-2)\n",
"\n",
"print [fib1(i) for i in range(10)]"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 1, 2, 3, 5, 8, 13, 21, 34, 55]\n"
]
}
],
"prompt_number": 28
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# In Python, a more efficient version that does not use recursion is\n",
"\n",
"def fib2(n):\n",
" \"\"\"Fib without recursion.\"\"\"\n",
" a, b = 0, 1\n",
" for i in range(1, n+1):\n",
" a, b = b, a+b\n",
" return b\n",
"\n",
"print [fib2(i) for i in range(10)]"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 1, 2, 3, 5, 8, 13, 21, 34, 55]\n"
]
}
],
"prompt_number": 29
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Note that the recursive version is much slower than the non-recursive version\n",
"\n",
"%timeit fib1(20)\n",
"%timeit fib2(20)\n",
"\n",
"# this is because it makes many duplicate function calls \n",
"# Note duplicate calls to fib(2) and fib(1) below\n",
"# fib(4) -> fib(3), fib(2)\n",
"# fib(3) -> fib(2), fib(1)\n",
"# fib(2) -> fib(1), fib(0)\n",
"# fib(1) -> 1\n",
"# fib(0) -> 1"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"100 loops, best of 3: 5.64 ms per loop\n",
"100000 loops, best of 3: 2.87 \u00b5s per loop"
]
},
{
"output_type": "stream",
"stream": "stdout",
"text": [
"\n"
]
}
],
"prompt_number": 30
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Use of cache to speed up the recursive version. \n",
"# Note biding of the (mutable) dictionary as a default at run-time.\n",
"\n",
"def fib3(n, cache={0: 1, 1: 1}):\n",
" \"\"\"Fib with recursion and caching.\"\"\"\n",
"\n",
" try:\n",
" return cache[n]\n",
" except KeyError:\n",
" cache[n] = fib3(n-1) + fib3(n-2)\n",
" return cache[n]\n",
"\n",
"print [fib3(i) for i in range(10)]\n",
"\n",
"%timeit fib1(20)\n",
"%timeit fib2(20)\n",
"%timeit fib3(20)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 1, 2, 3, 5, 8, 13, 21, 34, 55]\n",
"100 loops, best of 3: 5.64 ms per loop"
]
},
{
"output_type": "stream",
"stream": "stdout",
"text": [
"\n",
"100000 loops, best of 3: 2.92 \u00b5s per loop"
]
},
{
"output_type": "stream",
"stream": "stdout",
"text": [
"\n",
"1000000 loops, best of 3: 262 ns per loop"
]
},
{
"output_type": "stream",
"stream": "stdout",
"text": [
"\n"
]
}
],
"prompt_number": 31
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Recursion is used to show off the divide-and-conquer paradigm\n",
"\n",
"def almost_quick_sort(xs):\n",
" \"\"\"Almost a quick sort.\"\"\"\n",
"\n",
" # base case\n",
" if xs == []:\n",
" return xs\n",
" # recursive case\n",
" else:\n",
" pivot = xs[0]\n",
" less_than = [x for x in xs[1:] if x <= pivot]\n",
" more_than = [x for x in xs[1:] if x > pivot]\n",
" return almost_quick_sort(less_than) + [pivot] + almost_quick_sort(more_than)\n",
"\n",
"xs = [3,1,4,1,5,9,2,6,5,3,5,9]\n",
"print almost_quick_sort(xs)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 1, 2, 3, 3, 4, 5, 5, 5, 6, 9, 9]\n"
]
}
],
"prompt_number": 32
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Iterators\n",
"----\n",
"\n",
"Iterators represent streams of values. Because only one value is consumed at a time, they use very little memory. Use of iterators is very helpful for working with data sets too large to fit into RAM."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Iterators can be created from sequences with the built-in function iter()\n",
"\n",
"xs = [1,2,3]\n",
"x_iter = iter(xs)\n",
"\n",
"print x_iter.next()\n",
"print x_iter.next()\n",
"print x_iter.next()\n",
"print x_iter.next()"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1\n",
"2\n",
"3\n"
]
},
{
"ename": "StopIteration",
"evalue": "",
"output_type": "pyerr",
"traceback": [
"\u001b[0;31m---------------------------------------------------------------------------\u001b[0m\n\u001b[0;31mStopIteration\u001b[0m Traceback (most recent call last)",
"\u001b[0;32m<ipython-input-33-eb1a17442aa0>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m()\u001b[0m\n\u001b[1;32m 7\u001b[0m \u001b[0;32mprint\u001b[0m \u001b[0mx_iter\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mnext\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m 8\u001b[0m \u001b[0;32mprint\u001b[0m \u001b[0mx_iter\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mnext\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 9\u001b[0;31m \u001b[0;32mprint\u001b[0m \u001b[0mx_iter\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mnext\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
"\u001b[0;31mStopIteration\u001b[0m: "
]
}
],
"prompt_number": 33
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Most commonly, iterators are used (automatically) within a for loop\n",
"# which terminates when it encouters a StopIteration exception\n",
"\n",
"x_iter = iter(xs)\n",
"for x in x_iter:\n",
" print x"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1\n",
"2\n",
"3\n"
]
}
],
"prompt_number": 34
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Generators\n",
"----\n",
"\n",
"Generators create iterator streams."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Functions containing the 'yield' keyword return iterators\n",
"# After yielding, the function retains its previous state\n",
"\n",
"def count_down(n):\n",
" for i in range(n, 0, -1):\n",
" yield i"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 35
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"counter = count_down(10)\n",
"print counter.next()\n",
"print counter.next()\n",
"for count in counter:\n",
" print count,"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"10\n",
"9\n",
"8 7 6 5 4 3 2 1\n"
]
}
],
"prompt_number": 36
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Iterators can also be created with 'generator expressions'\n",
"# which can be coded similar to list generators but with parenthesis\n",
"# in place of square brackets\n",
"\n",
"xs1 = [x*x for x in range(5)]\n",
"print xs1\n",
"\n",
"xs2 = (x*x for x in range(5))\n",
"print xs2\n",
"\n",
"for x in xs2:\n",
" print x,\n",
"print"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[0, 1, 4, 9, 16]\n",
"<generator object <genexpr> at 0x1130d09b0>\n",
"0 1 4 9 16\n"
]
}
],
"prompt_number": 37
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Iterators can be used for infinte functions\n",
"\n",
"def fib():\n",
" a, b = 0, 1\n",
" while True:\n",
" yield a\n",
" a, b = b, a+b"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 38
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"for i in fib():\n",
" # We must have a stopping condiiton since the generator returns an infinite stream\n",
" if i > 1000:\n",
" break\n",
" print i,"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"0 1 1 2 3 5 8 13 21 34 55 89 144 233 377 610 987\n"
]
}
],
"prompt_number": 39
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Many built-in Python functions return iterators\n",
"# including file handlers\n",
"# so with the idiom below, you can process a 1 terabyte file line by line \n",
"# on your laptop without any problem\n",
"# Inn Pyhton 3, map and filter return itnrators, not lists\n",
"\n",
"for line in open('foo.txt'):\n",
" print line,"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"Hello\n",
"World\n",
"Hello\n",
"World\n",
"Hello\n",
"World\n",
"Hello\n",
"World\n"
]
}
],
"prompt_number": 40
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"### Generators and comprehensions"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# A geneeratorr expression\n",
"\n",
"print (x for x in range(10))\n",
"\n",
"# A list comprehesnnion\n",
"\n",
"print [x for x in range(10)]\n",
"\n",
"# A set comprehension\n",
"\n",
"print {x for x in range(10)}\n",
"\n",
"# A dictionary comprehension\n",
"\n",
"print {x: x for x in range(10)}"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"<generator object <genexpr> at 0x1130d0960>\n",
"[0, 1, 2, 3, 4, 5, 6, 7, 8, 9]\n",
"set([0, 1, 2, 3, 4, 5, 6, 7, 8, 9])\n",
"{0: 0, 1: 1, 2: 2, 3: 3, 4: 4, 5: 5, 6: 6, 7: 7, 8: 8, 9: 9}\n"
]
}
],
"prompt_number": 41
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"### Utilites - enumerate, zip and the ternary if-else operator\n",
"\n",
"Two useful functions and an unusual operator."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# In many programming languages, loops use an index. \n",
"# This is possible in Python, but it is more \n",
"# idiomatic to use the enumerate function.\n",
"\n",
"# using and index in a loop\n",
"xs = [1,2,3,4]\n",
"for i in range(len(xs)):\n",
" print i, xs[i]\n",
"print\n",
"\n",
"# using enumerate\n",
"for i, x in enumerate(xs):\n",
" print i, x"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"0 1\n",
"1 2\n",
"2 3\n",
"3 4\n",
"\n",
"0 1\n",
"1 2\n",
"2 3\n",
"3 4\n"
]
}
],
"prompt_number": 42
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# zip is useful when you need to iterate over matched elements of \n",
"# multiple lists\n",
"\n",
"xs = [1, 2, 3, 4]\n",
"ys = [10, 20, 30, 40]\n",
"zs = ['a', 'b', 'c', 'd', 'e']\n",
"\n",
"for x, y, z in zip(xs, ys, zs):\n",
" print x, y, z\n",
"\n",
"# Note that zip stops when the shortest list is exhausted"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1 10 a\n",
"2 20 b\n",
"3 30 c\n",
"4 40 d\n"
]
}
],
"prompt_number": 43
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# For list comprehensions, the ternary if-else operator is sometimes very useful\n",
"\n",
"[x**2 if x%2 == 0 else x**3 for x in range(10)]"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 44,
"text": [
"[0, 1, 4, 27, 16, 125, 36, 343, 64, 729]"
]
}
],
"prompt_number": 44
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Decorators\n",
"----\n",
"\n",
"Decorators are a type of HOF that take a function and return a wrapped function that provides additional useful properties. \n",
"\n",
"Examples:\n",
"\n",
"- logging\n",
"- profiling\n",
"- Just-In-Time (JIT) compilation"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Here is a simple decorator to time an arbitrary function\n",
"\n",
"def func_timer(func):\n",
" \"\"\"Times how long the function took.\"\"\"\n",
" \n",
" def f(*args, **kwargs):\n",
" import time\n",
" start = time.time()\n",
" results = func(*args, **kwargs)\n",
" print \"Elapsed: %.2fs\" % (time.time() - start)\n",
" return results\n",
" \n",
" return f"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 45
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# There is a special shorthand notation for decorating functions\n",
"\n",
"@func_timer\n",
"def sleepy(msg, sleep=1.0):\n",
" \"\"\"Delays a while before answering.\"\"\"\n",
" import time\n",
" time.sleep(sleep)\n",
" print msg\n",
"\n",
"sleepy(\"Hello\", 1.5)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"Hello\n",
"Elapsed: 1.50s\n"
]
}
],
"prompt_number": 46
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The `operator` module\n",
"----\n",
"\n",
"The `operator` module provides \"function\" versions of common Python operators (+, *, [] etc) that can be easily used where a function argument is expected."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"import operator as op\n",
"\n",
"# Here is another way to express the sum function\n",
"print reduce(op.add, range(10))\n",
"\n",
"# The pattern can be generalized\n",
"print reduce(op.mul, range(1, 10))"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"45\n",
"362880\n"
]
}
],
"prompt_number": 47
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"my_list = [('a', 1), ('bb', 4), ('ccc', 2), ('dddd', 3)]\n",
"\n",
"# standard sort\n",
"print sorted(my_list)\n",
"\n",
"# return list sorted by element at position 1 (remember Python counts from 0)\n",
"print sorted(my_list, key=op.itemgetter(1))\n",
"\n",
"# the key argument is quite flexible\n",
"print sorted(my_list, key=lambda x: len(x[0]), reverse=True)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[('a', 1), ('bb', 4), ('ccc', 2), ('dddd', 3)]\n",
"[('a', 1), ('ccc', 2), ('dddd', 3), ('bb', 4)]\n",
"[('dddd', 3), ('ccc', 2), ('bb', 4), ('a', 1)]\n"
]
}
],
"prompt_number": 48
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The `functools` module\n",
"----\n",
"\n",
"The most useful function in the `functools` module is `partial`, which allows you to create a new function from an old one with some arguments \"filled-in\"."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"from functools import partial\n",
"\n",
"sum_ = partial(reduce, op.add)\n",
"prod_ = partial(reduce, op.mul)\n",
"print sum_([1,2,3,4])\n",
"print prod_([1,2,3,4])"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"10\n",
"24\n"
]
}
],
"prompt_number": 49
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# This is extremely useful to create functions \n",
"# that expect a fixed number of arguments\n",
"\n",
"import scipy.stats as stats\n",
"\n",
"def compare(x, y, func):\n",
" \"\"\"Returne p-value for some appropriate comparison test.\"\"\"\n",
" return func(x, y)[1]"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 50
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"x, y = np.random.normal(0, 1, (100,2)).T\n",
"\n",
"print \"p value assuming equal variance =%.8f\" % compare(x, y, stats.ttest_ind)\n",
"test = partial(stats.ttest_ind, equal_var=False)\n",
"print \"p value not assuming equal variance=%.8f\" % compare(x, y, test)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"p value assuming equal variance =0.49425756\n",
"p value not assuming equal variance=0.49426047\n"
]
}
],
"prompt_number": 51
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The `itertools` module\n",
"----\n",
"\n",
"This provides many essential functions for working with iterators. The `permuations` and `combinations` generators may be particularly useful for simulations, and the `groupby` gnerator is useful for data analyiss."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"from itertools import cycle, groupby, islice, permutations, combinations\n",
"\n",
"print list(islice(cycle('abcd'), 0, 10))\n",
"print \n",
"\n",
"animals = sorted(['pig', 'cow', 'giraffe', 'elephant', \n",
" 'dog', 'cat', 'hippo', 'lion', 'tiger'], key=len)\n",
"for k, g in groupby(animals, key=len):\n",
" print k, list(g)\n",
"print\n",
"\n",
"print [''.join(p) for p in permutations('abc')]\n",
"print \n",
"\n",
"print [list(c) for c in combinations([1,2,3,4], r=2)]"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"['a', 'b', 'c', 'd', 'a', 'b', 'c', 'd', 'a', 'b']\n",
"\n",
"3 ['pig', 'cow', 'dog', 'cat']\n",
"4 ['lion']\n",
"5 ['hippo', 'tiger']\n",
"7 ['giraffe']\n",
"8 ['elephant']\n",
"\n",
"['abc', 'acb', 'bac', 'bca', 'cab', 'cba']\n",
"\n",
"[[1, 2], [1, 3], [1, 4], [2, 3], [2, 4], [3, 4]]\n"
]
}
],
"prompt_number": 52
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The `toolz`, `fn` and `funcy` modules\n",
"----\n",
"\n",
"If you wish to program in the functional style, check out the following packages\n",
"\n",
"- [toolz](https://github.com/pytoolz/toolz)\n",
"- [fn](https://github.com/kachayev/fn.py)\n",
"- [funcy](https://github.com/Suor/funcy)"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# Here is a small example to convert the DNA of a \n",
"# bacterial enzyme into the protein sequence\n",
"# using the partition function to generate \n",
"# cddons (3 nucleotides) for translation.\n",
"\n",
"codon_table = {\n",
" 'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',\n",
" 'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',\n",
" 'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K',\n",
" 'AGC':'S', 'AGT':'S', 'AGA':'R', 'AGG':'R',\n",
" 'CTA':'L', 'CTC':'L', 'CTG':'L', 'CTT':'L',\n",
" 'CCA':'P', 'CCC':'P', 'CCG':'P', 'CCT':'P',\n",
" 'CAC':'H', 'CAT':'H', 'CAA':'Q', 'CAG':'Q',\n",
" 'CGA':'R', 'CGC':'R', 'CGG':'R', 'CGT':'R',\n",
" 'GTA':'V', 'GTC':'V', 'GTG':'V', 'GTT':'V',\n",
" 'GCA':'A', 'GCC':'A', 'GCG':'A', 'GCT':'A',\n",
" 'GAC':'D', 'GAT':'D', 'GAA':'E', 'GAG':'E',\n",
" 'GGA':'G', 'GGC':'G', 'GGG':'G', 'GGT':'G',\n",
" 'TCA':'S', 'TCC':'S', 'TCG':'S', 'TCT':'S',\n",
" 'TTC':'F', 'TTT':'F', 'TTA':'L', 'TTG':'L',\n",
" 'TAC':'Y', 'TAT':'Y', 'TAA':'_', 'TAG':'_',\n",
" 'TGC':'C', 'TGT':'C', 'TGA':'_', 'TGG':'W',\n",
" }\n",
"\n",
"gene = \"\"\"\n",
">ENA|BAE76126|BAE76126.1 Escherichia coli str. K-12 substr. W3110 beta-D-galactosidase \n",
"ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT\n",
"GGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGC\n",
"GAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGC\n",
"TTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCT\n",
"GAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATC\n",
"TACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCG\n",
"ACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACG\n",
"CGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTC\n",
"GGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCC\n",
"GGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATCTGGAAGAT\n",
"CAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACT\n",
"ACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTA\n",
"CTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCT\n",
"TTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATC\n",
"GATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAA\n",
"CTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGAC\n",
"GGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAAT\n",
"GGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCAT\n",
"CATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATG\n",
"AAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTAC\n",
"ACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGC\n",
"ATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGC\n",
"GTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGG\n",
"AATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGAT\n",
"CCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATT\n",
"TGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCC\n",
"ATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCC\n",
"CACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTAT\n",
"CCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGAT\n",
"GAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGC\n",
"CAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAA\n",
"GCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACC\n",
"AGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGAT\n",
"GGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTG\n",
"ATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGC\n",
"GTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAG\n",
"TGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCAT\n",
"CTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAAC\n",
"CGCCAGTCAGGCTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCG\n",
"CTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACC\n",
"CGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAA\n",
"GCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCT\n",
"CACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGAT\n",
"GGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCG\n",
"GCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGA\n",
"TTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGAT\n",
"CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGC\n",
"GGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATC\n",
"AGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAA\n",
"GAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGG\n",
"AGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTC\n",
"TGGTGTCAAAAATAA\n",
"\"\"\"\n",
"from toolz import partition\n",
"\n",
"# convert FASTA into single DNA sequence\n",
"dna = ''.join(line for line in gene.strip().split('\\n') \n",
" if not line.startswith('>'))\n",
"\n",
"# partition DNA into codons (of length 3) and translate to amino acid\n",
"codons = (''.join(c) for c in partition(3, dna))\n",
"''.join(codon_table[codon] for codon in codons)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 53,
"text": [
"'MTMITDSLAVVLQRRDWENPGVTQLNRLAAHPPFASWRNSEEARTDRPSQQLRSLNGEWRFAWFPAPEAVPESWLECDLPEADTVVVPSNWQMHGYDAPIYTNVTYPITVNPPFVPTENPTGCYSLTFNVDESWLQEGQTRIIFDGVNSAFHLWCNGRWVGYGQDSRLPSEFDLSAFLRAGENRLAVMVLRWSDGSYLEDQDMWRMSGIFRDVSLLHKPTTQISDFHVATRFNDDFSRAVLEAEVQMCGELRDYLRVTVSLWQGETQVASGTAPFGGEIIDERGGYADRVTLRLNVENPKLWSAEIPNLYRAVVELHTADGTLIEAEACDVGFREVRIENGLLLLNGKPLLIRGVNRHEHHPLHGQVMDEQTMVQDILLMKQNNFNAVRCSHYPNHPLWYTLCDRYGLYVVDEANIETHGMVPMNRLTDDPRWLPAMSERVTRMVQRDRNHPSVIIWSLGNESGHGANHDALYRWIKSVDPSRPVQYEGGGADTTATDIICPMYARVDEDQPFPAVPKWSIKKWLSLPGETRPLILCEYAHAMGNSLGGFAKYWQAFRQYPRLQGGFVWDWVDQSLIKYDENGNPWSAYGGDFGDTPNDRQFCMNGLVFADRTPHPALTEAKHQQQFFQFRLSGQTIEVTSEYLFRHSDNELLHWMVALDGKPLASGEVPLDVAPQGKQLIELPELPQPESAGQLWLTVRVVQPNATAWSEAGHISAWQQWRLAENLSVTLPAASHAIPHLTTSEMDFCIELGNKRWQFNRQSGFLSQMWIGDKKQLLTPLRDQFTRAPLDNDIGVSEATRIDPNAWVERWKAAGHYQAEAALLQCTADTLADAVLITTAHAWQHQGKTLFISRKTYRIDGSGQMAITVDVEVASDTPHPARIGLNCQLAQVAERVNWLGLGPQENYPDRLTAACFDRWDLPLSDMYTPYVFPSENGLRCGTRELNYGPHQWRGDFQFNISRYSQQQLMETSHRHLLHAEEGTWLNIDGFHMGIGGDDSWSPSVSAEFQLSAGRYHYQLVWCQK_'"
]
}
],
"prompt_number": 53
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The `partition` function can also be used for doing statistics on sequence windows, for example, in calculating a moving average."
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"<font color=red>Exercises</font>\n",
"----"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**1**. Rewrite the following nested loop as a list comprehension\n",
"\n",
"```python\n",
"ans = []\n",
"for i in range(3):\n",
" for j in range(4):\n",
" ans.append((i, j))\n",
"print ans\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"ans = []\n",
"for i in range(3):\n",
" for j in range(4):\n",
" ans.append((i, j))\n",
"print ans"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[(0, 0), (0, 1), (0, 2), (0, 3), (1, 0), (1, 1), (1, 2), (1, 3), (2, 0), (2, 1), (2, 2), (2, 3)]\n"
]
}
],
"prompt_number": 65
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"ans = [(i,j) for i in range(3) for j in range(4)]\n",
"print ans"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[(0, 0), (0, 1), (0, 2), (0, 3), (1, 0), (1, 1), (1, 2), (1, 3), (2, 0), (2, 1), (2, 2), (2, 3)]\n"
]
}
],
"prompt_number": 63
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**2**. Rewrite the following as a list comprehension\n",
"\n",
"```python\n",
"ans = map(lambda x: x*x, filter(lambda x: x%2 == 0, range(5)))\n",
"print ans\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"ans = map(lambda x: x*x, filter(lambda x: x%2 == 0, range(5)))\n",
"print ans"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[0, 4, 16]\n"
]
}
],
"prompt_number": 67
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"ans = [x*x for x in range(5) if x%2 == 0]\n",
"print ans"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[0, 4, 16]\n"
]
}
],
"prompt_number": 64
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**3**. Convert the function below into a pure function with no global variables or side effects\n",
"\n",
"```python\n",
"x = 5\n",
"def f(alist):\n",
" for i in range(x):\n",
" alist.append(i)\n",
" return alist\n",
"\n",
"alist = [1,2,3]\n",
"ans = f(alist)\n",
"print ans\n",
"print alist # alist has been changed!\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"x = 5\n",
"def f(alist):\n",
" for i in range(x):\n",
" alist.append(i)\n",
" return alist\n",
"\n",
"alist = [1,2,3]\n",
"ans = f(alist)\n",
"print ans\n",
"print alist # alist has been changed!"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 2, 3, 0, 1, 2, 3, 4]\n",
"[1, 2, 3, 0, 1, 2, 3, 4]\n"
]
}
],
"prompt_number": 68
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"def f(alist, x=5):\n",
" \"\"\"Append range(x) to alist.\"\"\"\n",
" return alist + range(x)\n",
"\n",
"alist = [1,2,3]\n",
"ans = f(alist)\n",
"print ans\n",
"print alist "
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"[1, 2, 3, 0, 1, 2, 3, 4]\n",
"[1, 2, 3]\n"
]
}
],
"prompt_number": 72
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**4.** Write a decorator `hello` that makes every wrapped function print \"Hello!\" \n",
"\n",
"For example\n",
"\n",
"```python\n",
"@hello\n",
"def square(x):\n",
" return x*x\n",
"```\n",
"\n",
"when called will give the following result\n",
"```python\n",
"[In]\n",
"square(2)\n",
"[Out]\n",
"Hello!\n",
"4\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"def hello(f):\n",
" \"\"\"Decorator that prints Hello!\"\"\"\n",
" print 'Hello!'\n",
" def func(*args, **kwargs):\n",
" return f(*args, **kwargs)\n",
" return func\n",
"\n",
"@hello\n",
"def square(x):\n",
" return x*x\n",
"\n",
"print square(2)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"Hello!\n",
"4\n"
]
}
],
"prompt_number": 75
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**5**. Rewrite the factorial function so that it does not use recursion.\n",
"\n",
"```python\n",
"def fact(n):\n",
" \"\"\"Returns the factorial of n.\"\"\"\n",
" # base case\n",
" if n==0:\n",
" return 1\n",
" # recursive case\n",
" else:\n",
" return n * fact(n-1)\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"def fact(n):\n",
" \"\"\"Returns the factorial of n.\"\"\"\n",
" # base case\n",
" if n==0:\n",
" return 1\n",
" # recursive case\n",
" else:\n",
" return n * fact(n-1)\n",
"\n",
"for i in range(1,11):\n",
" print fact1(i),"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1 2 6 24 120 720 5040 40320 362880 3628800\n"
]
}
],
"prompt_number": 87
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"def fact1(n):\n",
" \"\"\"Returns the factorial of n.\"\"\"\n",
" return reduce(lambda x, y: x*y, range(1, n+1))\n",
"\n",
"for i in range(1,11):\n",
" print fact1(i),"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1 2 6 24 120 720 5040 40320 362880 3628800\n"
]
}
],
"prompt_number": 85
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**Exercise 6**. Rewrite the same factorail funciotn so that it uses a cache to speed up calculations"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"def fact2(n, cache={0: 1}):\n",
" \"\"\"Returns the factorial of n.\"\"\"\n",
" if n in cache:\n",
" return cache[n]\n",
" else:\n",
" cache[n] = n * fact2(n-1)\n",
" return cache[n]\n",
"\n",
"for i in range(1,11):\n",
" print fact2(i),"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"1 2 6 24 120 720 5040 40320 362880 3628800\n"
]
}
],
"prompt_number": 86
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"%timeit -n3 fact(20)\n",
"%timeit -n3 fact1(20)\n",
"%timeit -n3 fact2(20)"
],
"language": "python",
"metadata": {},
"outputs": [
{
"output_type": "stream",
"stream": "stdout",
"text": [
"3 loops, best of 3: 6.6 \u00b5s per loop\n",
"3 loops, best of 3: 6.99 \u00b5s per loop\n",
"3 loops, best of 3: 318 ns per loop\n"
]
}
],
"prompt_number": 89
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**7**. Rewrite the following anonymous functiona as a regular named fucntion.\n",
"\n",
"```python\n",
"lambda x, y: x**2 + y**2\n",
"```"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\n",
"\n",
"def f(x, y):\n",
" return x**2 + y**2"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 92
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"**8**. Find an efficient way to extrac a subset of `dict1` into a a new dictionary `dict2` that only contains entrires with the keys given in the set `good_keys`. Note that good_keys may include keys not found in dict1 - these must be excluded when building dict2."
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"import numpy as np\n",
"import cPickle\n",
"\n",
"try:\n",
" dict1 = cPickle.load(open('dict1.pic'))\n",
"except:\n",
" numbers = np.arange(1e6).astype('int') # 1 million entries\n",
" dict1 = dict(zip(numbers, numbers))\n",
" cPickle.dump(dict1, open('dict1.pic', 'w'), protocol=2)\n",
"\n",
"good_keys = set(np.random.randint(1, 1e7, 1000))"
],
"language": "python",
"metadata": {},
"outputs": [],
"prompt_number": 95
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"# YOUR CODE HERE\u00df\n",
"\n",
"# dictionary comprehension\n",
"dict2 = {key: dict1[key] for key in good_keys if key in dict1}\n",
"dict2"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 97,
"text": [
"{3798: 3798,\n",
" 38065: 38065,\n",
" 60534: 60534,\n",
" 62860: 62860,\n",
" 65901: 65901,\n",
" 69807: 69807,\n",
" 88291: 88291,\n",
" 93037: 93037,\n",
" 121629: 121629,\n",
" 141402: 141402,\n",
" 145747: 145747,\n",
" 148527: 148527,\n",
" 150344: 150344,\n",
" 152908: 152908,\n",
" 153980: 153980,\n",
" 159115: 159115,\n",
" 159816: 159816,\n",
" 166245: 166245,\n",
" 166775: 166775,\n",
" 204056: 204056,\n",
" 215282: 215282,\n",
" 217453: 217453,\n",
" 220327: 220327,\n",
" 234622: 234622,\n",
" 238067: 238067,\n",
" 240478: 240478,\n",
" 246595: 246595,\n",
" 257871: 257871,\n",
" 283049: 283049,\n",
" 291229: 291229,\n",
" 298025: 298025,\n",
" 303411: 303411,\n",
" 308318: 308318,\n",
" 314338: 314338,\n",
" 315854: 315854,\n",
" 326904: 326904,\n",
" 342248: 342248,\n",
" 351085: 351085,\n",
" 351709: 351709,\n",
" 368128: 368128,\n",
" 373994: 373994,\n",
" 382529: 382529,\n",
" 383056: 383056,\n",
" 385263: 385263,\n",
" 397214: 397214,\n",
" 402105: 402105,\n",
" 407302: 407302,\n",
" 410937: 410937,\n",
" 415658: 415658,\n",
" 419413: 419413,\n",
" 425844: 425844,\n",
" 427857: 427857,\n",
" 444312: 444312,\n",
" 452078: 452078,\n",
" 459387: 459387,\n",
" 463491: 463491,\n",
" 465533: 465533,\n",
" 476420: 476420,\n",
" 494457: 494457,\n",
" 505772: 505772,\n",
" 513386: 513386,\n",
" 533868: 533868,\n",
" 542111: 542111,\n",
" 549781: 549781,\n",
" 552654: 552654,\n",
" 554927: 554927,\n",
" 578321: 578321,\n",
" 585696: 585696,\n",
" 595181: 595181,\n",
" 598361: 598361,\n",
" 606851: 606851,\n",
" 616495: 616495,\n",
" 623269: 623269,\n",
" 623740: 623740,\n",
" 632592: 632592,\n",
" 635041: 635041,\n",
" 637283: 637283,\n",
" 649087: 649087,\n",
" 658653: 658653,\n",
" 670079: 670079,\n",
" 679081: 679081,\n",
" 687831: 687831,\n",
" 688321: 688321,\n",
" 696673: 696673,\n",
" 717431: 717431,\n",
" 740355: 740355,\n",
" 745659: 745659,\n",
" 746251: 746251,\n",
" 752638: 752638,\n",
" 759721: 759721,\n",
" 791255: 791255,\n",
" 791732: 791732,\n",
" 808228: 808228,\n",
" 809121: 809121,\n",
" 834173: 834173,\n",
" 844773: 844773,\n",
" 850271: 850271,\n",
" 851370: 851370,\n",
" 855436: 855436,\n",
" 857481: 857481,\n",
" 864807: 864807,\n",
" 870028: 870028,\n",
" 885796: 885796,\n",
" 898787: 898787,\n",
" 904119: 904119,\n",
" 906198: 906198,\n",
" 909435: 909435,\n",
" 942835: 942835,\n",
" 965580: 965580,\n",
" 974342: 974342,\n",
" 997183: 997183}"
]
}
],
"prompt_number": 97
},
{
"cell_type": "code",
"collapsed": false,
"input": [],
"language": "python",
"metadata": {},
"outputs": []
}
],
"metadata": {}
}
]
}
|
{
"pile_set_name": "Github"
}
|
{
"swagger": "2.0",
"schemes": [
"https"
],
"host": "api.opencagedata.com",
"basePath": "/geocode",
"info": {
"contact": {
"name": "OpenCage Data Ltd",
"url": "https://geocoder.opencagedata.com/contact"
},
"description": "Worldwide forward and reverse geocoding",
"termsOfService": "https://geocoder.opencagedata.com/terms",
"title": "OpenCage Geocoder",
"version": "1",
"x-apisguru-categories": [
"location"
],
"x-logo": {
"url": "https://api.apis.guru/v2/cache/logo/https_avatars0.githubusercontent.com_u_11941736.png"
},
"x-origin": [
{
"format": "swagger",
"url": "https://geocoder.opencagedata.com/swagger.yaml",
"version": "2.0"
}
],
"x-preferred": true,
"x-providerName": "opencagedata.com",
"x-datafire": {
"name": "opencagedata",
"type": "openapi"
}
},
"externalDocs": {
"description": "OpenCage Geocoder Website",
"url": "https://geocoder.opencagedata.com/api"
},
"consumes": [
"text/plain"
],
"produces": [
"application/json",
"application/xml",
"text/html"
],
"paths": {
"/v{version}/{format}": {
"get": {
"description": "geocode a query",
"parameters": [
{
"description": "API version.",
"in": "path",
"name": "version",
"required": true,
"type": "integer"
},
{
"description": "format of the response. One of 'json', 'xml' or 'map'.",
"in": "path",
"name": "format",
"required": true,
"type": "string"
},
{
"description": "string or lat,lng to be geocoded.",
"in": "query",
"name": "q",
"required": true,
"type": "string"
},
{
"description": "an application key.",
"in": "query",
"name": "key",
"required": true,
"type": "string"
},
{
"description": "when true we attempt to abbreviate the formatted field in the response.",
"in": "query",
"name": "abbrv",
"type": "boolean"
},
{
"description": "if true the request is included in the response.",
"in": "query",
"name": "add_request",
"type": "boolean"
},
{
"description": "four coordinate points forming the south-west and north-east corners of a bounding box (min long, min lat, max long, max lat).",
"in": "query",
"name": "bounds",
"type": "string"
},
{
"description": "two letter code ISO 3166-1 Alpha 2 code to limit results to that country.",
"in": "query",
"name": "countrycode",
"type": "string"
},
{
"description": "wraps the returned JSON with a function name.",
"in": "query",
"name": "jsonp",
"type": "string"
},
{
"description": "an IETF format language code (ex: 'es' or 'pt-BR').",
"in": "query",
"name": "language",
"type": "string"
},
{
"description": "maximum number of results to return. Default is 10. Maximum is 100.",
"in": "query",
"name": "limit",
"type": "integer"
},
{
"description": "integer from 1-10. Only results with at least this confidence are returned.",
"in": "query",
"name": "min_confidence",
"type": "integer"
},
{
"description": "when true annotations are not added to results.",
"in": "query",
"name": "no_annotations",
"type": "boolean"
},
{
"description": "when true results are not deduplicated.",
"in": "query",
"name": "no_dedupe",
"type": "boolean"
},
{
"description": "when true query content is not logged.",
"in": "query",
"name": "no_record",
"type": "boolean"
},
{
"description": "when true results are pretty printed. Useful for debugging.",
"in": "query",
"name": "pretty",
"type": "boolean"
}
],
"responses": {
"200": {
"description": "Successful response",
"schema": {
"$ref": "#/definitions/Response"
}
},
"400": {
"description": "Invalid request",
"schema": {
"$ref": "#/definitions/Response"
}
},
"402": {
"description": "Valid request but quota exceeded",
"schema": {
"$ref": "#/definitions/Response"
}
},
"403": {
"description": "Invalid or missing API key",
"schema": {
"$ref": "#/definitions/Response"
}
},
"404": {
"description": "Invalid API endpoint",
"schema": {
"$ref": "#/definitions/Response"
}
},
"410": {
"description": "Request too long",
"schema": {
"$ref": "#/definitions/Response"
}
},
"503": {
"description": "Internal server error",
"schema": {
"$ref": "#/definitions/Response"
}
}
},
"operationId": "vversion.format.get"
}
}
},
"definitions": {
"LatLng": {
"properties": {
"lat": {
"format": "float",
"type": "number"
},
"lng": {
"format": "float",
"type": "number"
}
},
"type": "object"
},
"Response": {
"properties": {
"documentation": {
"type": "string"
},
"licenses": {
"items": {
"properties": {
"name": {
"type": "string"
},
"url": {
"type": "string"
}
},
"type": "object"
},
"type": "array"
},
"rate": {
"properties": {
"limit": {
"type": "integer"
},
"remaining": {
"type": "integer"
},
"reset": {
"type": "integer"
}
},
"type": "object"
},
"results": {
"items": {
"properties": {
"annotations": {
"type": "object"
},
"bounds": {
"properties": {
"northeast": {
"$ref": "#/definitions/LatLng"
},
"southwest": {
"$ref": "#/definitions/LatLng"
}
},
"type": "object"
},
"components": {
"type": "object"
},
"confidence": {
"type": "integer"
},
"formatted": {
"type": "string"
},
"geometry": {
"$ref": "#/definitions/LatLng"
}
},
"type": "object"
},
"type": "array"
},
"status": {
"properties": {
"code": {
"type": "integer"
},
"message": {
"type": "string"
}
},
"type": "object"
},
"stay_informed": {
"properties": {
"blog": {
"type": "string"
},
"twitter": {
"type": "string"
}
},
"type": "object"
},
"thanks": {
"type": "string"
},
"timestamp": {
"properties": {
"created_http": {
"type": "string"
},
"created_unix": {
"type": "integer"
}
},
"type": "object"
},
"total_results": {
"type": "integer"
}
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "sleepwatcher",
"full_name": "sleepwatcher",
"oldname": null,
"aliases": [
],
"versioned_formulae": [
],
"desc": "Monitors sleep, wakeup, and idleness of a Mac",
"license": null,
"homepage": "https://www.bernhard-baehr.de/",
"versions": {
"stable": "2.2.1",
"head": null,
"bottle": true
},
"urls": {
"stable": {
"url": "https://www.bernhard-baehr.de/sleepwatcher_2.2.1.tgz",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 0,
"cellar": ":any_skip_relocation",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/sleepwatcher-2.2.1.catalina.bottle.tar.gz",
"sha256": "45c9c42ac76f9e9f85b0dbc2cb2251fe74448322196ac0ba10b93c416121db2a"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/sleepwatcher-2.2.1.mojave.bottle.tar.gz",
"sha256": "eb160c23f9d92aed8d4bdfa24607a5bb343ad65dd487cb7a8570ac479bd05dd7"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/sleepwatcher-2.2.1.high_sierra.bottle.tar.gz",
"sha256": "2c050aa5845cdf24b06f17bc1b4191941e4cf57cf1092f17fe35fe0e7f28159a"
},
"sierra": {
"url": "https://linuxbrew.bintray.com/bottles/sleepwatcher-2.2.1.sierra.bottle.tar.gz",
"sha256": "0cecea617ee9334f717a2e2e0424b944dedcc7cd403776c1cf6ff67352b96f4c"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
],
"dependencies": [
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
{
"name": "macos",
"cask": null,
"download": null,
"version": null,
"contexts": [
]
}
],
"conflicts_with": [
],
"caveats": "For SleepWatcher to work, you will need to read the following:\n\n $(brew --prefix)/Cellar/sleepwatcher/2.2.1/ReadMe.rtf\n\nIgnore information about installing the binary and man page,\nbut read information regarding setup of the launchd files which\nare installed here:\n\n \n\nThese are the examples provided by the author.\n",
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
$NetBSD: patch-ac,v 1.2 2006/08/02 19:24:55 kristerw Exp $
--- xroads.c.orig 1999-06-30 20:25:02.000000000 +0200
+++ xroads.c 2006-08-02 21:14:27.000000000 +0200
@@ -282,13 +282,13 @@
}
/*************************************************************************************************/
-int trunc( float num ) { /* Truncate a float to an int */
+int mytrunc( float num ) { /* Truncate a float to an int */
if (num>0) return (int)num;
else return (int)(num-0.5);
}
/*************************************************************************************************/
-int round( float num ) { /* Round a float to an int */
+int roundup( float num ) { /* Round a float to an int */
return (int)(num+0.5);
}
@@ -394,11 +394,11 @@
/* VacAttack */
/*
if(data[amonst->type].attack1==VACCUUM && (amonst->x==monst[targ].x
- || amonst->y==monst[targ].y) && (round(amonst->x) ==
- trunc(amonst->x) && round(amonst->y) == trunc(amonst->y))) {
+ || amonst->y==monst[targ].y) && (roundup(amonst->x) ==
+ mytrunc(amonst->x) && roundup(amonst->y) == mytrunc(amonst->y))) {
*/
- if(data[amonst->type].attack1==VACCUUM && (round(amonst->x) ==
- trunc(amonst->x) && round(amonst->y) == trunc(amonst->y)) &&
+ if(data[amonst->type].attack1==VACCUUM && (roundup(amonst->x) ==
+ mytrunc(amonst->x) && roundup(amonst->y) == mytrunc(amonst->y)) &&
clearshot(amonst, &monst[targ])) {
watchentity(amonst, &monst[targ]);
vacattack(amonst, &monst[targ]);
@@ -423,19 +423,19 @@
else amonst->frame++;
if(data[amonst->type].etype!=EFFECT) {
- maze[round(oldy)][round(oldx)]=-2; /* Blank out old space */
- maze[trunc(oldy)][trunc(oldx)]=-2;
- maze[round(amonst->y)][round(amonst->x)]=number;
- maze[trunc(amonst->y)][trunc(amonst->x)]=number;
+ maze[roundup(oldy)][roundup(oldx)]=-2; /* Blank out old space */
+ maze[mytrunc(oldy)][mytrunc(oldx)]=-2;
+ maze[roundup(amonst->y)][roundup(amonst->x)]=number;
+ maze[mytrunc(amonst->y)][mytrunc(amonst->x)]=number;
}
/* If there was something underneath the effect, redraw it */
- if(maze[trunc(amonst->y)][trunc(amonst->x)]!=-2) {
- bmonst=&monst[maze[trunc(amonst->y)][trunc(amonst->x)]];
+ if(maze[mytrunc(amonst->y)][mytrunc(amonst->x)]!=-2) {
+ bmonst=&monst[maze[mytrunc(amonst->y)][mytrunc(amonst->x)]];
draw_tilex2(mainwindow, data[bmonst->type].tile[bmonst->frame], (bmonst->x)*GRIDSIZE,
(bmonst->y)*GRIDSIZE, bmonst->color, bmonst->dir);
}
- if(maze[round(amonst->y)][round(amonst->x)]!=-2) {
- bmonst=&monst[maze[round(amonst->y)][round(amonst->x)]];
+ if(maze[roundup(amonst->y)][roundup(amonst->x)]!=-2) {
+ bmonst=&monst[maze[roundup(amonst->y)][roundup(amonst->x)]];
draw_tilex2(mainwindow, data[bmonst->type].tile[bmonst->frame], (bmonst->x)*GRIDSIZE,
(bmonst->y)*GRIDSIZE, bmonst->color, bmonst->dir);
}
@@ -558,7 +558,7 @@
else if(player->attr & PULL_R) { newx+=1; player->attr &= ~PULL_R; }
/* Only one half-step at a time */
- if(round(newx)!=trunc(newx) && round(newy)!=trunc(newy)) {
+ if(roundup(newx)!=mytrunc(newx) && roundup(newy)!=mytrunc(newy)) {
#ifdef DEBUG
printf("Damn, in two half-steps at a time...\n");
#endif
@@ -574,30 +574,30 @@
/* If we're in a half-step, eqx and eqy are the space we're moving
into */
- if(round(newx)!=trunc(newx)) {
- eqy = trunc(newy);
+ if(roundup(newx)!=mytrunc(newx)) {
+ eqy = mytrunc(newy);
if(newx > player->x)
- eqx = round(newx);
+ eqx = roundup(newx);
else if(newx < player->x)
- eqx = trunc(newx);
+ eqx = mytrunc(newx);
}
- else if(round(newy)!=trunc(newy)) {
- eqx = trunc(newx);
+ else if(roundup(newy)!=mytrunc(newy)) {
+ eqx = mytrunc(newx);
if(newy > player->y)
- eqy = round(newy);
+ eqy = roundup(newy);
else if(newy < player->y)
- eqy = trunc(newy);
+ eqy = mytrunc(newy);
}
else {
- eqx = trunc(newx);
- eqy = trunc(newy);
+ eqx = mytrunc(newx);
+ eqy = mytrunc(newy);
}
/*
switch(player->dir) {
- case LEFT: eqx = trunc(newx); break;
- case RIGHT: eqx = round(newx); break;
- case UP: eqy = trunc(newy); break;
- case DOWN: eqy = round(newy); break;
+ case LEFT: eqx = mytrunc(newx); break;
+ case RIGHT: eqx = roundup(newx); break;
+ case UP: eqy = mytrunc(newy); break;
+ case DOWN: eqy = roundup(newy); break;
default:
}
*/
@@ -610,8 +610,8 @@
printf("Destination (%0.2f, %0.2f)...\n", newx, newy);
printf("Equiv (%d, %d)\n", eqx, eqy);
printf("@ %d, %d : %d\n", eqx, eqy, maze[eqy][eqx]);
- printf("newx: %0.2f: round %d, trunc %d\n", newx, round(newx), trunc(newx));
- printf("newy: %0.2f: round %d, trunc %d\n", newy, round(newy), trunc(newy));
+ printf("newx: %0.2f: round %d, trunc %d\n", newx, roundup(newx), mytrunc(newx));
+ printf("newy: %0.2f: round %d, trunc %d\n", newy, roundup(newy), mytrunc(newy));
printf("Checkdest: %d\n", checkdest(eqx, eqy));
printf("-----\n");
}
@@ -646,8 +646,8 @@
else if(!okay) {
#ifdef DEBUG
printf("something in the way. (%d or %d)\n",
- maze[trunc(newy)][trunc(newx)],
- maze[round(newy)][round(newy)]);
+ maze[mytrunc(newy)][mytrunc(newx)],
+ maze[roundup(newy)][roundup(newy)]);
#endif
newx=player->x;
newy=player->y;
@@ -658,15 +658,15 @@
#endif
/* Destination has been set, now all we have to do is move there */
- maze[round(player->y)][round(player->x)]=-2;
- maze[trunc(player->y)][trunc(player->x)]=-2;
+ maze[roundup(player->y)][roundup(player->x)]=-2;
+ maze[mytrunc(player->y)][mytrunc(player->x)]=-2;
draw_tilex2(mainwindow, blank, player->x*GRIDSIZE, player->y*GRIDSIZE,
BLACK, RIGHT);
/* Draw player */
player->x=newx; player->y=newy;
- maze[round(player->y)][round(player->x)]=player->ind;
- maze[trunc(player->y)][trunc(player->x)]=player->ind;
+ maze[roundup(player->y)][roundup(player->x)]=player->ind;
+ maze[mytrunc(player->y)][mytrunc(player->x)]=player->ind;
draw_tilex2(mainwindow, data[datapos].tile[player->frame],
player->x*GRIDSIZE, player->y*GRIDSIZE,
player->color, player->dir);
@@ -1279,8 +1279,8 @@
player[i]->health = 0;
if(player[i]->attr & ACTIVE) {
player[i]->attr ^= ACTIVE;
- maze[round(player[i]->y)][round(player[i]->x)] = -2;
- maze[trunc(player[i]->y)][trunc(player[i]->x)] = -2;
+ maze[roundup(player[i]->y)][roundup(player[i]->x)] = -2;
+ maze[mytrunc(player[i]->y)][mytrunc(player[i]->x)] = -2;
draw_tilex2(mainwindow, blank, player[i]->x*GRIDSIZE,
player[i]->y*GRIDSIZE, BLACK, RIGHT);
#ifdef XPLOSIONS
|
{
"pile_set_name": "Github"
}
|
{
"dataset_reader": {
"class_name": "paraphraser_reader",
"data_path": "{DOWNLOADS_PATH}/paraphraser_data"
},
"dataset_iterator": {
"class_name": "siamese_iterator",
"seed": 243
},
"chainer": {
"in": ["x"],
"in_y": ["y"],
"pipe": [
{
"id": "preproc",
"class_name": "siamese_preprocessor",
"use_matrix": false,
"max_sequence_length": 28,
"fit_on": ["x"],
"in": ["x"],
"out": ["x_proc"],
"sent_vocab": {
"id": "siam_sent_vocab",
"class_name": "simple_vocab",
"save_path": "{MODELS_PATH}/paraphraser_vocabs/sent.dict",
"load_path": "{MODELS_PATH}/paraphraser_vocabs/sent.dict"
},
"tokenizer": {
"class_name": "nltk_tokenizer"
},
"vocab": {
"id": "siam_vocab",
"class_name": "simple_vocab",
"save_path": "{MODELS_PATH}/paraphraser_vocabs/tok.dict",
"load_path": "{MODELS_PATH}/paraphraser_vocabs/tok.dict"
},
"embedder": {
"id": "siam_embedder",
"class_name": "fasttext",
"load_path": "{DOWNLOADS_PATH}/embeddings/ft_native_300_ru_wiki_lenta_lower_case.bin"
}
},
{
"id": "embeddings",
"class_name": "emb_mat_assembler",
"embedder": "#siam_embedder",
"vocab": "#siam_vocab"
},
{
"id": "model",
"class_name": "mpm_nn",
"len_vocab": "#siam_vocab.len",
"use_matrix": "#preproc.use_matrix",
"attention": true,
"max_sequence_length": "#preproc.max_sequence_length",
"emb_matrix": "#embeddings.emb_mat",
"embedding_dim": "#siam_embedder.dim",
"seed": 243,
"hidden_dim": 200,
"learning_rate": 1e-3,
"triplet_loss": false,
"batch_size": 256,
"save_path": "{MODELS_PATH}/paraphraser_model/model_weights.h5",
"load_path": "{MODELS_PATH}/paraphraser_model/model_weights.h5",
"preprocess": "#preproc.__call__"
},
{
"in": ["x_proc"],
"in_y": ["y"],
"out": ["y_predicted"],
"class_name": "siamese_predictor",
"model": "#model",
"ranking": false,
"attention": true,
"batch_size": "#model.batch_size",
"preproc_func": "#preproc.__call__"
}
],
"out": ["y_predicted"]
},
"train": {
"epochs": 20,
"batch_size": 256,
"pytest_max_batches": 2,
"train_metrics": ["f1", "acc", "log_loss"],
"metrics": ["f1", "acc", "log_loss"],
"validation_patience": 10,
"val_every_n_epochs": 1,
"log_every_n_batches": 12,
"class_name": "nn_trainer",
"evaluation_targets": [
"valid",
"test"
]
},
"metadata": {
"variables": {
"ROOT_PATH": "~/.deeppavlov",
"DOWNLOADS_PATH": "{ROOT_PATH}/downloads",
"MODELS_PATH": "{ROOT_PATH}/models"
},
"requirements": [
"{DEEPPAVLOV_PATH}/requirements/tf.txt",
"{DEEPPAVLOV_PATH}/requirements/fasttext.txt"
],
"download": [
{
"url": "http://files.deeppavlov.ai/deeppavlov_data/paraphrase_ident_paraphraser_tuned.tar.gz",
"subdir": "{MODELS_PATH}/paraphraser_model"
},
{
"url": "http://files.deeppavlov.ai/datasets/paraphraser.zip",
"subdir": "{DOWNLOADS_PATH}/paraphraser_data"
},
{
"url": "http://files.deeppavlov.ai/datasets/paraphraser_gold.zip",
"subdir": "{DOWNLOADS_PATH}/paraphraser_data"
},
{
"url": "http://files.deeppavlov.ai/embeddings/ft_native_300_ru_wiki_lenta_lower_case/ft_native_300_ru_wiki_lenta_lower_case.bin",
"subdir": "{DOWNLOADS_PATH}/embeddings"
}
]
}
}
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>imagesRaw</folder>
<filename>2017-12-19 09:03:34.085648.jpg</filename>
<path>/Users/abell/Development/other.nyc/Camera/imagesRaw/2017-12-19 09:03:34.085648.jpg</path>
<source>
<database>Unknown</database>
</source>
<size>
<width>352</width>
<height>240</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>police</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>136</xmin>
<ymin>166</ymin>
<xmax>173</xmax>
<ymax>200</ymax>
</bndbox>
</object>
<object>
<name>police</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>225</xmin>
<ymin>187</ymin>
<xmax>292</xmax>
<ymax>239</ymax>
</bndbox>
</object>
<object>
<name>truck</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>45</xmin>
<ymin>157</ymin>
<xmax>85</xmax>
<ymax>192</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>160</xmin>
<ymin>136</ymin>
<xmax>175</xmax>
<ymax>147</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>192</xmin>
<ymin>141</ymin>
<xmax>209</xmax>
<ymax>153</ymax>
</bndbox>
</object>
<object>
<name>car</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>183</xmin>
<ymin>130</ymin>
<xmax>195</xmax>
<ymax>141</ymax>
</bndbox>
</object>
<object>
<name>pedestrian</name>
<pose>Unspecified</pose>
<truncated>0</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>243</xmin>
<ymin>146</ymin>
<xmax>256</xmax>
<ymax>172</ymax>
</bndbox>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
<annotation>
<folder>widerface</folder>
<filename>26--Soldier_Drilling_26_Soldier_Drilling_Soldiers_Drilling_26_73.jpg</filename>
<source>
<database>wider face Database</database>
<annotation>PASCAL VOC2007</annotation>
<image>flickr</image>
<flickrid>-1</flickrid>
</source>
<owner>
<flickrid>yanyu</flickrid>
<name>yanyu</name>
</owner>
<size>
<width>1024</width>
<height>682</height>
<depth>3</depth>
</size>
<segmented>0</segmented>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>77</xmin>
<ymin>166</ymin>
<xmax>131</xmax>
<ymax>232</ymax>
</bndbox>
<lm>
<x1>113.134</x1>
<y1>189.366</y1>
<x2>127.25</x2>
<y2>189.366</y2>
<x3>127.665</x3>
<y3>201.406</y3>
<x4>113.134</x4>
<y4>215.938</y4>
<x5>121.853</x5>
<y5>215.522</y5>
<visible>1</visible>
<blur>0.66</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>155</xmin>
<ymin>175</ymin>
<xmax>206</xmax>
<ymax>232</ymax>
</bndbox>
<lm>
<x1>189.0</x1>
<y1>192.0</y1>
<x2>202.0</x2>
<y2>192.0</y2>
<x3>205.0</x3>
<y3>201.0</y3>
<x4>195.0</x4>
<y4>215.0</y4>
<x5>200.0</x5>
<y5>214.0</y5>
<visible>1</visible>
<blur>0.6</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>266</xmin>
<ymin>198</ymin>
<xmax>314</xmax>
<ymax>263</ymax>
</bndbox>
<lm>
<x1>295.812</x1>
<y1>217.629</y1>
<x2>299.134</x2>
<y2>217.629</y2>
<x3>313.25</x3>
<y3>228.424</y3>
<x4>295.397</x4>
<y4>245.446</y4>
<x5>297.888</x5>
<y5>245.031</y5>
<visible>1</visible>
<blur>0.63</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>351</xmin>
<ymin>173</ymin>
<xmax>402</xmax>
<ymax>232</ymax>
</bndbox>
<lm>
<x1>384.25</x1>
<y1>190.75</y1>
<x2>396.25</x2>
<y2>190.375</y2>
<x3>399.25</x3>
<y3>203.125</y3>
<x4>383.875</x4>
<y4>216.25</y4>
<x5>393.25</x5>
<y5>215.125</y5>
<visible>1</visible>
<blur>0.62</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>460</xmin>
<ymin>183</ymin>
<xmax>506</xmax>
<ymax>258</ymax>
</bndbox>
<lm>
<x1>497.0</x1>
<y1>214.0</y1>
<x2>503.0</x2>
<y2>213.0</y2>
<x3>506.0</x3>
<y3>223.0</y3>
<x4>496.0</x4>
<y4>237.0</y4>
<x5>499.0</x5>
<y5>236.0</y5>
<visible>1</visible>
<blur>0.62</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>488</xmin>
<ymin>165</ymin>
<xmax>527</xmax>
<ymax>209</ymax>
</bndbox>
<lm>
<x1>501.938</x1>
<y1>179.188</y1>
<x2>509.531</x2>
<y2>178.906</y2>
<x3>510.375</x3>
<y3>185.375</y3>
<x4>502.781</x4>
<y4>195.219</y4>
<x5>509.812</x5>
<y5>193.812</y5>
<visible>1</visible>
<blur>0.5</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>549</xmin>
<ymin>208</ymin>
<xmax>591</xmax>
<ymax>266</ymax>
</bndbox>
<lm>
<x1>576.54</x1>
<y1>231.201</y1>
<x2>584.321</x2>
<y2>229.348</y2>
<x3>591.362</x3>
<y3>242.317</y3>
<x4>576.911</x4>
<y4>252.692</y4>
<x5>584.692</x5>
<y5>250.839</y5>
<visible>1</visible>
<blur>0.63</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>610</xmin>
<ymin>225</ymin>
<xmax>649</xmax>
<ymax>272</ymax>
</bndbox>
<lm>
<x1>634.585</x1>
<y1>240.022</y1>
<x2>646.549</x2>
<y2>240.92</y2>
<x3>648.344</x3>
<y3>247.799</y3>
<x4>638.473</x4>
<y4>258.567</y4>
<x5>646.25</x5>
<y5>258.268</y5>
<visible>1</visible>
<blur>0.61</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>666</xmin>
<ymin>206</ymin>
<xmax>704</xmax>
<ymax>252</ymax>
</bndbox>
<lm>
<x1>691.777</x1>
<y1>220.045</y1>
<x2>697.964</x2>
<y2>219.161</y2>
<x3>704.152</x3>
<y3>228.0</y3>
<x4>693.839</x4>
<y4>239.196</y4>
<x5>700.616</x5>
<y5>238.312</y5>
<visible>1</visible>
<blur>0.61</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>723</xmin>
<ymin>175</ymin>
<xmax>767</xmax>
<ymax>230</ymax>
</bndbox>
<lm>
<x1>748.281</x1>
<y1>195.656</y1>
<x2>762.719</x2>
<y2>197.375</y2>
<x3>761.688</x3>
<y3>204.594</y3>
<x4>747.594</x4>
<y4>216.281</y4>
<x5>763.406</x5>
<y5>216.625</y5>
<visible>1</visible>
<blur>0.65</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>797</xmin>
<ymin>200</ymin>
<xmax>835</xmax>
<ymax>244</ymax>
</bndbox>
<lm>
<x1>818.938</x1>
<y1>215.312</y1>
<x2>827.656</x2>
<y2>214.469</y2>
<x3>834.406</x3>
<y3>224.312</y3>
<x4>821.75</x4>
<y4>232.75</y4>
<x5>830.75</x5>
<y5>232.469</y5>
<visible>0</visible>
<blur>0.6</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>848</xmin>
<ymin>224</ymin>
<xmax>881</xmax>
<ymax>270</ymax>
</bndbox>
<lm>
<x1>868.714</x1>
<y1>237.161</y1>
<x2>869.893</x2>
<y2>237.455</y2>
<x3>880.5</x3>
<y3>245.411</y3>
<x4>870.482</x4>
<y4>256.607</y4>
<x5>871.366</x5>
<y5>256.607</y5>
<visible>1</visible>
<blur>0.54</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>889</xmin>
<ymin>221</ymin>
<xmax>919</xmax>
<ymax>266</ymax>
</bndbox>
<lm>
<x1>906.375</x1>
<y1>235.469</y1>
<x2>914.812</x2>
<y2>237.438</y2>
<x3>916.5</x3>
<y3>243.062</y3>
<x4>907.219</x4>
<y4>250.375</y4>
<x5>912.0</x5>
<y5>251.5</y5>
<visible>1</visible>
<blur>0.58</blur>
</lm>
<has_lm>1</has_lm>
</object>
<object>
<name>face</name>
<pose>Unspecified</pose>
<truncated>1</truncated>
<difficult>0</difficult>
<bndbox>
<xmin>941</xmin>
<ymin>215</ymin>
<xmax>980</xmax>
<ymax>260</ymax>
</bndbox>
<lm>
<x1>964.286</x1>
<y1>233.0</y1>
<x2>976.571</x2>
<y2>232.429</y2>
<x3>974.0</x3>
<y3>241.571</y3>
<x4>966.0</x4>
<y4>248.429</y4>
<x5>975.143</x5>
<y5>249.0</y5>
<visible>1</visible>
<blur>0.59</blur>
</lm>
<has_lm>1</has_lm>
</object>
</annotation>
|
{
"pile_set_name": "Github"
}
|
###############################################################################
#
# Tests for XlsxWriter.
#
# Copyright (c), 2013-2020, John McNamara, jmcnamara@cpan.org
#
from datetime import date
from ..excel_comparison_test import ExcelComparisonTest
from ...workbook import Workbook
class TestCompareXLSXFiles(ExcelComparisonTest):
"""
Test file created by XlsxWriter against a file created by Excel.
"""
def setUp(self):
self.set_filename('chart_date02.xlsx')
self.ignore_elements = {'xl/charts/chart1.xml': ['<c:formatCode']}
def test_create_file(self):
"""Test the creation of a simple XlsxWriter file."""
workbook = Workbook(self.got_filename)
worksheet = workbook.add_worksheet()
chart = workbook.add_chart({'type': 'line'})
date_format = workbook.add_format({'num_format': 14})
chart.axis_ids = [55112064, 55115136]
worksheet.set_column('A:A', 12)
dates = [date(2013, 1, 1),
date(2013, 1, 2),
date(2013, 1, 3),
date(2013, 1, 4),
date(2013, 1, 5),
date(2013, 1, 6),
date(2013, 1, 7),
date(2013, 1, 8),
date(2013, 1, 9),
date(2013, 1, 10)]
values = [10, 30, 20, 40, 20, 60, 50, 40, 30, 30]
worksheet.write_column('A1', dates, date_format)
worksheet.write_column('B1', values)
chart.add_series({
'categories': '=Sheet1!$A$1:$A$10',
'values': '=Sheet1!$B$1:$B$10',
})
chart.set_x_axis({
'date_axis': True,
'min': int(worksheet._convert_date_time(date(2013, 1, 2))),
'max': int(worksheet._convert_date_time(date(2013, 1, 9))),
'num_format': 'dd/mm/yyyy',
'num_format_linked': True,
})
worksheet.insert_chart('E9', chart)
workbook.close()
self.assertExcelEqual()
|
{
"pile_set_name": "Github"
}
|
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd">
<plist version="1.0">
<dict>
<key>A</key>
<string>A_.glif</string>
<key>B</key>
<string>B_.glif</string>
<key>C</key>
<string>C_.glif</string>
<key>D</key>
<string>D_.glif</string>
<key>E</key>
<string>E_.glif</string>
<key>F</key>
<string>F_.glif</string>
<key>G</key>
<string>G_.glif</string>
<key>H</key>
<string>H_.glif</string>
<key>I</key>
<string>I_.glif</string>
<key>J</key>
<string>J_.glif</string>
<key>K</key>
<string>K_.glif</string>
<key>L</key>
<string>L_.glif</string>
<key>M</key>
<string>M_.glif</string>
<key>N</key>
<string>N_.glif</string>
<key>O</key>
<string>O_.glif</string>
<key>P</key>
<string>P_.glif</string>
<key>Q</key>
<string>Q_.glif</string>
<key>R</key>
<string>R_.glif</string>
<key>S</key>
<string>S_.glif</string>
<key>T</key>
<string>T_.glif</string>
<key>U</key>
<string>U_.glif</string>
<key>V</key>
<string>V_.glif</string>
<key>W</key>
<string>W_.glif</string>
<key>X</key>
<string>X_.glif</string>
<key>Y</key>
<string>Y_.glif</string>
<key>Z</key>
<string>Z_.glif</string>
<key>a</key>
<string>a.glif</string>
<key>a.italic</key>
<string>a.italic.glif</string>
<key>b</key>
<string>b.glif</string>
<key>c</key>
<string>c.glif</string>
<key>c.italic</key>
<string>c.italic.glif</string>
<key>d</key>
<string>d.glif</string>
<key>d.italic</key>
<string>d.italic.glif</string>
<key>e</key>
<string>e.glif</string>
<key>f</key>
<string>f.glif</string>
<key>f.italic</key>
<string>f.italic.glif</string>
<key>flatg</key>
<string>flatg.glif</string>
<key>g</key>
<string>g.glif</string>
<key>g.italic</key>
<string>g.italic.glif</string>
<key>h</key>
<string>h.glif</string>
<key>h.italic</key>
<string>h.italic.glif</string>
<key>i</key>
<string>i.glif</string>
<key>i.italic</key>
<string>i.italic.glif</string>
<key>j</key>
<string>j.glif</string>
<key>k</key>
<string>k.glif</string>
<key>k.italic</key>
<string>k.italic.glif</string>
<key>l</key>
<string>l.glif</string>
<key>l.italic</key>
<string>l.italic.glif</string>
<key>m</key>
<string>m.glif</string>
<key>m.italic</key>
<string>m.italic.glif</string>
<key>n</key>
<string>n.glif</string>
<key>n.italic</key>
<string>n.italic.glif</string>
<key>o</key>
<string>o.glif</string>
<key>p</key>
<string>p.glif</string>
<key>q</key>
<string>q.glif</string>
<key>r</key>
<string>r.glif</string>
<key>r.italic</key>
<string>r.italic.glif</string>
<key>s</key>
<string>s.glif</string>
<key>s.italic</key>
<string>s.italic.glif</string>
<key>t</key>
<string>t.glif</string>
<key>u</key>
<string>u.glif</string>
<key>u.italic</key>
<string>u.italic.glif</string>
<key>v</key>
<string>v.glif</string>
<key>w</key>
<string>w.glif</string>
<key>w.italic</key>
<string>w.italic.glif</string>
<key>x</key>
<string>x.glif</string>
<key>x.italic</key>
<string>x.italic.glif</string>
<key>y</key>
<string>y.glif</string>
<key>y.italic</key>
<string>y.italic.glif</string>
<key>z</key>
<string>z.glif</string>
<key>z.italic</key>
<string>z.italic.glif</string>
</dict>
</plist>
|
{
"pile_set_name": "Github"
}
|
{
"name": "flatbuffers",
"full_name": "flatbuffers",
"oldname": null,
"aliases": [
],
"versioned_formulae": [
],
"desc": "Serialization library for C++, supporting Java, C#, and Go",
"license": "Apache-2.0",
"homepage": "https://google.github.io/flatbuffers",
"versions": {
"stable": "1.12.0",
"head": "HEAD",
"bottle": true
},
"urls": {
"stable": {
"url": "https://github.com/google/flatbuffers/archive/v1.12.0.tar.gz",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 0,
"cellar": ":any_skip_relocation",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/flatbuffers-1.12.0.catalina.bottle.tar.gz",
"sha256": "6af7ac37134539beb7c1003bd2cf8d1e530606cac616239acf4d2b1df31b0dbc"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/flatbuffers-1.12.0.mojave.bottle.tar.gz",
"sha256": "270bebda4048754554cd587d48db10ee5fe1a2795ef6e881cafd1b8f90c7af78"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/flatbuffers-1.12.0.high_sierra.bottle.tar.gz",
"sha256": "f45982e6ca71b10e59c607b9d984108e1b18fc84b8c52dd23325b6b9211e407f"
},
"x86_64_linux": {
"url": "https://linuxbrew.bintray.com/bottles/flatbuffers-1.12.0.x86_64_linux.bottle.tar.gz",
"sha256": "2f65e689ae162bb02cac080cc1f9ceccbbb6ed252073b1d72e2fc627937e6c3f"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
"cmake"
],
"dependencies": [
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
],
"conflicts_with": [
],
"caveats": null,
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
{
"name": "mdxmini",
"full_name": "mdxmini",
"oldname": null,
"aliases": [
],
"versioned_formulae": [
],
"desc": "Plays music in X68000 MDX chiptune format",
"license": "GPL-2.0",
"homepage": "https://clogging.web.fc2.com/psp/",
"versions": {
"stable": "1.0.0",
"head": null,
"bottle": true
},
"urls": {
"stable": {
"url": "https://github.com/mistydemeo/mdxmini/archive/v1.0.0.tar.gz",
"tag": null,
"revision": null
}
},
"revision": 0,
"version_scheme": 0,
"bottle": {
"stable": {
"rebuild": 1,
"cellar": ":any",
"prefix": "/home/linuxbrew/.linuxbrew",
"root_url": "https://linuxbrew.bintray.com/bottles",
"files": {
"catalina": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.catalina.bottle.1.tar.gz",
"sha256": "04b985db291b09f8f1c4a57e522700f9c67eadcd1074faae78ab0e2ff268d9da"
},
"mojave": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.mojave.bottle.1.tar.gz",
"sha256": "e93281dc0c64642e33763f0dc2a4cfa0a6da0dd4739222b0411e54913435ee27"
},
"high_sierra": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.high_sierra.bottle.1.tar.gz",
"sha256": "5bf36e82084146ab4604b4746bcf6634cfe4268f2044712e4d13519b21ab5165"
},
"sierra": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.sierra.bottle.1.tar.gz",
"sha256": "8e0daf3d508dad59074c567b8c8e60bd88c8026b7dfe1305e4e9c50ec5d8fbbd"
},
"el_capitan": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.el_capitan.bottle.1.tar.gz",
"sha256": "d20b94107c25833096401be6336544f283e6956758d4238e207e6a4e34fa5fdf"
},
"yosemite": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.yosemite.bottle.1.tar.gz",
"sha256": "55cf6b84d9a0e649e25db7626db954a47bf1061afd20a959972470b6e5cc9fa2"
},
"mavericks": {
"url": "https://linuxbrew.bintray.com/bottles/mdxmini-1.0.0.mavericks.bottle.1.tar.gz",
"sha256": "d08a617e3a8791b9e5dc93426f3d471408550a4a0bab85e33a726ccdcdcb683c"
}
}
}
},
"keg_only": false,
"bottle_disabled": false,
"options": [
],
"build_dependencies": [
],
"dependencies": [
"sdl"
],
"recommended_dependencies": [
],
"optional_dependencies": [
],
"uses_from_macos": [
],
"requirements": [
],
"conflicts_with": [
],
"caveats": null,
"installed": [
],
"linked_keg": null,
"pinned": false,
"outdated": false,
"deprecated": false,
"disabled": false
}
|
{
"pile_set_name": "Github"
}
|
{
"code": "function createLabel<T extends number | string>(idOrName: T): NameOrId<T> {\n throw \"unimplemented\"\n}\n\nlet a = createLabel(\"typescript\");\n\nlet b = createLabel(2.8);\n\nlet c = createLabel(Math.random() ? \"hello\" : 42);\n",
"extension": "ts",
"highlights": [],
"queries": [
{
"docs": "",
"kind": "query",
"start": 354,
"length": 16,
"text": "let a: NameLabel",
"offset": 4,
"line": 5
},
{
"docs": "",
"kind": "query",
"start": 390,
"length": 14,
"text": "let b: IdLabel",
"offset": 4,
"line": 7
},
{
"docs": "",
"kind": "query",
"start": 417,
"length": 26,
"text": "let c: IdLabel | NameLabel",
"offset": 4,
"line": 9
}
],
"staticQuickInfos": [
{
"text": "function createLabel<T extends string | number>(idOrName: T): NameOrId<T>",
"docs": "",
"start": 9,
"length": 11,
"line": 0,
"character": 9,
"targetString": "createLabel"
},
{
"text": "(type parameter) T in createLabel<T extends string | number>(idOrName: T): NameOrId<T>",
"docs": "",
"start": 21,
"length": 1,
"line": 0,
"character": 21,
"targetString": "T"
},
{
"text": "(parameter) idOrName: T extends string | number",
"docs": "",
"start": 48,
"length": 8,
"line": 0,
"character": 48,
"targetString": "idOrName"
},
{
"text": "(type parameter) T in createLabel<T extends string | number>(idOrName: T): NameOrId<T>",
"docs": "",
"start": 58,
"length": 1,
"line": 0,
"character": 58,
"targetString": "T"
},
{
"text": "type NameOrId<T extends string | number> = T extends number ? IdLabel : NameLabel",
"docs": "",
"start": 62,
"length": 8,
"line": 0,
"character": 62,
"targetString": "NameOrId"
},
{
"text": "(type parameter) T in createLabel<T extends string | number>(idOrName: T): NameOrId<T>",
"docs": "",
"start": 71,
"length": 1,
"line": 0,
"character": 71,
"targetString": "T"
},
{
"text": "let a: NameLabel",
"docs": "",
"start": 109,
"length": 1,
"line": 4,
"character": 4,
"targetString": "a"
},
{
"text": "function createLabel<\"typescript\">(idOrName: \"typescript\"): NameLabel",
"docs": "",
"start": 113,
"length": 11,
"line": 4,
"character": 8,
"targetString": "createLabel"
},
{
"text": "let b: IdLabel",
"docs": "",
"start": 145,
"length": 1,
"line": 6,
"character": 4,
"targetString": "b"
},
{
"text": "function createLabel<2.8>(idOrName: 2.8): IdLabel",
"docs": "",
"start": 149,
"length": 11,
"line": 6,
"character": 8,
"targetString": "createLabel"
},
{
"text": "let c: IdLabel | NameLabel",
"docs": "",
"start": 172,
"length": 1,
"line": 8,
"character": 4,
"targetString": "c"
},
{
"text": "function createLabel<\"hello\" | 42>(idOrName: \"hello\" | 42): IdLabel | NameLabel",
"docs": "",
"start": 176,
"length": 11,
"line": 8,
"character": 8,
"targetString": "createLabel"
},
{
"text": "var Math: Math",
"docs": "An intrinsic object that provides basic mathematics functionality and constants.",
"start": 188,
"length": 4,
"line": 8,
"character": 20,
"targetString": "Math"
},
{
"text": "(method) Math.random(): number",
"docs": "Returns a pseudorandom number between 0 and 1.",
"start": 193,
"length": 6,
"line": 8,
"character": 25,
"targetString": "random"
}
],
"errors": [],
"playgroundURL": "https://www.typescriptlang.org/play/#code/JYOwLgpgTgZghgYwgAgJIBMAycBGEA2yA3ssOgFzIgCuAtnlADTID0AVMgM4D2tKMwAuk7I2LZAF8AUKEixEKAHJw+2PIRIgVESpzBRQAc2btk3MAAtoyAUJFjJUsAE8ADku0B5KBgA8AFWQIAA9IEGEqOgZkAB8ufSMAPmQAXmRAkLCImnprAH40LFwCZEplVWL8AG4pFnF-C2ARBF4+cC4Lbmp8dCpzZDxSEAR8anQIdCla8QBaOYRqMDmZqRhqYbBgbhBkBCgIOEg1AgCg0IhwkRzouL0DEENEgAoyb3KddIBKMq8fdADkkQpMgQchLFBuAB3ZAAInWwFornwEDakHQMKk0ikyLAyDgqV2+0OEGO+CeMJc7k4e2ArjAMM+NTqIIAenkpjiBgS9gcjpUngAmAB0AA5GdNWezsRBcQhuUS+eongBZQ4WIVQODhXhPT7IAowqz4fDcGGlZAAFgF4uZyDZUiAA"
}
|
{
"pile_set_name": "Github"
}
|
{
"_class": "shapePath",
"booleanOperation": -1,
"clippingMaskMode": 0,
"do_objectID": "82EE55A7-28D5-4F50-B934-26D812A7A915",
"edited": true,
"exportOptions": {
"_class": "exportOptions",
"exportFormats": [
],
"includedLayerIds": [
],
"layerOptions": 0,
"shouldTrim": false
},
"frame": {
"_class": "rect",
"constrainProportions": false,
"height": 42.24000000000001,
"width": 56.607,
"x": 151.915,
"y": 132.566
},
"hasClippingMask": false,
"isClosed": true,
"isFixedToViewport": false,
"isFlippedHorizontal": false,
"isFlippedVertical": false,
"isLocked": false,
"isVisible": true,
"layerListExpandedType": 1,
"name": "Shape",
"nameIsFixed": false,
"pointRadiusBehaviour": 1,
"points": [
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.28425813061988814, 0.90153882575757593}",
"curveMode": 4,
"curveTo": "{0.33757309166710847, 0.88598484848484849}",
"hasCurveFrom": true,
"hasCurveTo": false,
"point": "{0.33757309166710847, 0.88598484848484849}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.17257582984436565, 0.9637310606060604}",
"curveMode": 4,
"curveTo": "{0.17257582984436565, 0.9637310606060604}",
"hasCurveFrom": false,
"hasCurveTo": true,
"point": "{0.17257582984436565, 0.9637310606060604}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.02920133552387499, 0.72535511363636307}",
"curveMode": 4,
"curveTo": "{0.035543307364813551, 0.8739109848484844}",
"hasCurveFrom": true,
"hasCurveTo": false,
"point": "{0.035543307364813551, 0.8739109848484844}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0, 0.28153409090909076}",
"curveMode": 2,
"curveTo": "{0, 0.28153409090909076}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0, 0.28153409090909076}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.31980143798470168, 0.29708806818181827}",
"curveMode": 4,
"curveTo": "{0.21954881905064741, 0.34715909090909053}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0.31980143798470168, 0.29708806818181827}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.49871923967000586, 0.3558001893939392}",
"curveMode": 4,
"curveTo": "{0.40102814139594084, 0.35404829545454569}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0.49871923967000586, 0.3558001893939392}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.48223717914745579, 0.43870738636363643}",
"curveMode": 4,
"curveTo": "{0.48096525164732329, 0.41624053030303004}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0.48223717914745579, 0.43870738636363643}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.5393325913756255, 0.45421401515151522}",
"curveMode": 4,
"curveTo": "{0.52030667585281032, 0.45421401515151522}",
"hasCurveFrom": false,
"hasCurveTo": true,
"point": "{0.5393325913756255, 0.45421401515151522}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.5266309820340247, 0.26946022727272734}",
"curveMode": 1,
"curveTo": "{0.5266309820340247, 0.26946022727272734}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0.5266309820340247, 0.26946022727272734}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.53935025703534956, 0.25904356060606071}",
"curveMode": 1,
"curveTo": "{0.53935025703534956, 0.25904356060606071}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0.53935025703534956, 0.25904356060606071}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.51521896585228011, 0.25044981060606075}",
"curveMode": 4,
"curveTo": "{0.51521896585228011, 0.25044981060606075}",
"hasCurveFrom": true,
"hasCurveTo": false,
"point": "{0.51521896585228011, 0.25044981060606075}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.66242690833289208, 0.13470643939393931}",
"curveMode": 4,
"curveTo": "{0.6091296129453958, 0.20899621212121214}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0.66242690833289208, 0.13470643939393931}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.99364036249933785, 0}",
"curveMode": 4,
"curveTo": "{0.81597682265444249, 0.11742424242424258}",
"hasCurveFrom": true,
"hasCurveTo": true,
"point": "{0.99364036249933785, 0}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.91495751408836379, 0.15887784090909118}",
"curveMode": 4,
"curveTo": "{0.97205292631653339, 0.081202651515151658}",
"hasCurveFrom": false,
"hasCurveTo": true,
"point": "{0.91495751408836379, 0.15887784090909118}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{1, 0.18482481060606096}",
"curveMode": 1,
"curveTo": "{1, 0.18482481060606096}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{1, 0.18482481060606096}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.96191283763492141, 0.91536458333333359}",
"curveMode": 1,
"curveTo": "{0.96191283763492141, 0.91536458333333359}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0.96191283763492141, 0.91536458333333359}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.83118695567685952, 0.99135890151515194}",
"curveMode": 4,
"curveTo": "{0.83118695567685952, 0.99135890151515194}",
"hasCurveFrom": true,
"hasCurveTo": false,
"point": "{0.83118695567685952, 0.99135890151515194}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.65606727083222882, 0.91536458333333359}",
"curveMode": 4,
"curveTo": "{0.73731163990319215, 0.93607954545454575}",
"hasCurveFrom": false,
"hasCurveTo": true,
"point": "{0.65606727083222882, 0.91536458333333359}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.5507622732170927, 1}",
"curveMode": 4,
"curveTo": "{0.5507622732170927, 1}",
"hasCurveFrom": true,
"hasCurveTo": false,
"point": "{0.5507622732170927, 1}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.33757309166710747, 0.91709280303030283}",
"curveMode": 4,
"curveTo": "{0.48096525164732223, 0.95338541666666676}",
"hasCurveFrom": false,
"hasCurveTo": true,
"point": "{0.33757309166710747, 0.91709280303030283}"
},
{
"_class": "curvePoint",
"cornerRadius": 0,
"curveFrom": "{0.33757309166710747, 0.88600852272727282}",
"curveMode": 1,
"curveTo": "{0.33757309166710747, 0.88600852272727282}",
"hasCurveFrom": false,
"hasCurveTo": false,
"point": "{0.33757309166710747, 0.88600852272727282}"
}
],
"resizingConstraint": 63,
"resizingType": 0,
"rotation": 0,
"shouldBreakMaskChain": false,
"style": {
"_class": "style",
"endMarkerType": 0,
"fills": [
{
"_class": "fill",
"color": {
"_class": "color",
"alpha": 1,
"blue": 0.9725490196078431,
"green": 0.9764705882352941,
"red": 0.9725490196078431
},
"fillType": 0,
"isEnabled": true,
"noiseIndex": 0,
"noiseIntensity": 0,
"patternFillType": 1,
"patternTileScale": 1
}
],
"miterLimit": 10,
"startMarkerType": 0,
"windingRule": 0
}
}
|
{
"pile_set_name": "Github"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.