Update README.md

README.md

@@ -23,7 +23,7 @@ size_categories:
 
 ### Dataset Summary
 This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences.
-This dataset generally include five type of regions including regulator, repeat region, mRNA, tRNA, rRNA and 'CDS'
+
 
 
 ### Supported Tasks and Leaderboards
@@ -40,7 +40,7 @@ This dataset generally include five type of regions including regulator, repeat
 ```python
 {DNA id: AP013063.1  
 Organism: Serratia marcescens SM39  
-gene id: SM39_0001  
+year: 
 region type:coding  
 coding type: BAO32072.1  
 sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA