Add pipeline tag, library name and license
Browse filesThis PR adds the `pipeline_tag` and `library_name` to the model card metadata. It also adds the missing license information.
README.md
CHANGED
|
@@ -5,16 +5,20 @@ metrics:
|
|
| 5 |
tags:
|
| 6 |
- biology
|
| 7 |
- medical
|
|
|
|
|
|
|
|
|
|
| 8 |
---
|
|
|
|
| 9 |
This is the official pre-trained baseline model introduced in [Fast and Low-Cost Genomic Foundation Models via Outlier Removal
|
| 10 |
-
](https://
|
| 11 |
|
| 12 |
We sincerely appreciate the MosaicML team for the [MosaicBERT](https://openreview.net/forum?id=5zipcfLC2Z) implementation, which serves as the base of DNABERT-2 development.
|
| 13 |
|
| 14 |
DNABERT-2 is a transformer-based genome foundation model trained on multi-species genome.
|
| 15 |
|
| 16 |
To load the model from huggingface:
|
| 17 |
-
```
|
| 18 |
import torch
|
| 19 |
from transformers import AutoTokenizer, AutoModel
|
| 20 |
|
|
@@ -23,7 +27,7 @@ model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code
|
|
| 23 |
```
|
| 24 |
|
| 25 |
To calculate the embedding of a dna sequence
|
| 26 |
-
```
|
| 27 |
dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC"
|
| 28 |
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
|
| 29 |
hidden_states = model(inputs)[0] # [1, sequence_length, 768]
|
|
|
|
| 5 |
tags:
|
| 6 |
- biology
|
| 7 |
- medical
|
| 8 |
+
pipeline_tag: feature-extraction
|
| 9 |
+
library_name: transformers
|
| 10 |
+
license: mit
|
| 11 |
---
|
| 12 |
+
|
| 13 |
This is the official pre-trained baseline model introduced in [Fast and Low-Cost Genomic Foundation Models via Outlier Removal
|
| 14 |
+
](https://huggingface.co/papers/2505.00598).
|
| 15 |
|
| 16 |
We sincerely appreciate the MosaicML team for the [MosaicBERT](https://openreview.net/forum?id=5zipcfLC2Z) implementation, which serves as the base of DNABERT-2 development.
|
| 17 |
|
| 18 |
DNABERT-2 is a transformer-based genome foundation model trained on multi-species genome.
|
| 19 |
|
| 20 |
To load the model from huggingface:
|
| 21 |
+
```python
|
| 22 |
import torch
|
| 23 |
from transformers import AutoTokenizer, AutoModel
|
| 24 |
|
|
|
|
| 27 |
```
|
| 28 |
|
| 29 |
To calculate the embedding of a dna sequence
|
| 30 |
+
```python
|
| 31 |
dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC"
|
| 32 |
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
|
| 33 |
hidden_states = model(inputs)[0] # [1, sequence_length, 768]
|