--- metrics: - matthews_correlation - f1 tags: - biology - medical --- This is the official pre-trained baseline model introduced in [Fast and Low-Cost Genomic Foundation Models via Outlier Removal ](https://arxiv.org/abs/2505.00598). We sincerely appreciate the MosaicML team for the [MosaicBERT](https://openreview.net/forum?id=5zipcfLC2Z) implementation, which serves as the base of DNABERT-2 development. DNABERT-2 is a transformer-based genome foundation model trained on multi-species genome. To load the model from huggingface: ``` import torch from transformers import AutoTokenizer, AutoModel tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) ``` To calculate the embedding of a dna sequence ``` dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC" inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"] hidden_states = model(inputs)[0] # [1, sequence_length, 768] # embedding with mean pooling embedding_mean = torch.mean(hidden_states[0], dim=0) print(embedding_mean.shape) # expect to be 768 # embedding with max pooling embedding_max = torch.max(hidden_states[0], dim=0)[0] print(embedding_max.shape) # expect to be 768 ```