--- datasets: - multimolecule/gencode-human library_name: multimolecule license: agpl-3.0 mask_token: pipeline_tag: fill-mask tags: - Biology - DNA widget: - example_title: prion protein (Kanno blood group) mask_index: 21 mask_index_1based: 22 masked_char: A output: - label: TGGG score: 0.997512 - label: TTGG score: 0.002321 - label: TGTG score: 3.8e-05 - label: TGAG score: 2.0e-05 - label: GTGG score: 1.7e-05 pipeline_tag: fill-mask sequence_type: cDNA task: fill-mask text: ATGGCGAACCTTGGCTGCTGGTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGC - example_title: interleukin 10 mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: CCTG score: 0.545174 - label: CTTG score: 0.30855 - label: CTCG score: 0.113374 - label: CTGG score: 0.006968 - label: CTCT score: 0.005987 pipeline_tag: fill-mask sequence_type: cDNA task: fill-mask text: ATGCACAGCTCCTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC - example_title: Zaire ebolavirus mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: AAGT score: 0.528247 - label: ATGT score: 0.236202 - label: AACT score: 0.223933 - label: AAAT score: 0.004506 - label: AATT score: 0.003129 pipeline_tag: fill-mask sequence_type: cDNA task: fill-mask text: AATGTTCAAACTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTCACAGAGCGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAGCATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGTTTACAGCACCTTTTATAGAATATTGTAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTATACAATCCCACAGTGTTAT - example_title: SARS coronavirus mask_index: 14 mask_index_1based: 15 masked_char: A output: - label: CTTT score: 0.999999 - label: CTTC score: 0.0 - label: TTTT score: 0.0 - label: CTTG score: 0.0 - label: CTTA score: 0.0 pipeline_tag: fill-mask sequence_type: cDNA task: fill-mask text: ATGTTTATTTTCTTTTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAAATGCACTTTCGAGTACATATCT --- # DNABERT Pre-trained model on human genome using a masked language modeling (MLM) objective with k-mer tokenization. ## Disclaimer This is an UNOFFICIAL implementation of the [DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome](https://doi.org/10.1093/bioinformatics/btab083) by Yanrong Ji, Zhihan Zhou, et al. The OFFICIAL repository of DNABERT is at [jerryji1993/DNABERT](https://github.com/jerryji1993/DNABERT). > [!TIP] > The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation. **The team releasing DNABERT did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details DNABERT is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on the human genome with k-mer tokenization in a self-supervised fashion. This means that the model was trained on the raw nucleotides of DNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. ### Variants - **[multimolecule/dnabert-4mer-3mer](https://huggingface.co/multimolecule/dnabert-4mer-3mer)**: The DNABERT model pre-trained on 3-mer data. - **[multimolecule/dnabert-4mer-4mer](https://huggingface.co/multimolecule/dnabert-4mer-4mer)**: The DNABERT model pre-trained on 4-mer data. - **[multimolecule/dnabert-4mer-5mer](https://huggingface.co/multimolecule/dnabert-4mer-5mer)**: The DNABERT model pre-trained on 5-mer data. - **[multimolecule/dnabert-4mer-6mer](https://huggingface.co/multimolecule/dnabert-4mer-6mer)**: The DNABERT model pre-trained on 6-mer data. ### Model Specification
Variants Num Layers Hidden Size Num Heads Intermediate Size Num Parameters (M) FLOPs (G) MACs (G) Max Num Tokens
dnabert-6mer 12 768 12 3072 89.19 96.86 48.43 512
dnabert-5mer 86.83
dnabert-4mer 86.24
dnabert-3mer 86.10
### Links - **Code**: [multimolecule.dnabert](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/dnabert) - **Data**: [multimolecule/gencode-human](https://huggingface.co/datasets/multimolecule/gencode-human) - **Paper**: [DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome](https://doi.org/10.1093/bioinformatics/btab083) - **Developed by**: Yanrong Ji, Zhihan Zhou, Han Liu, Ramana V Davuluri - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - **Original Repositories**: [jerryji1993/DNABERT](https://github.com/jerryji1993/DNABERT) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use #### Masked Language Modeling > [!WARNING] > Default transformers pipeline does not support K-mer tokenization. You can use this model directly with a pipeline for masked language modeling: ```python import multimolecule # you must import multimolecule to register models from transformers import pipeline predictor = pipeline("fill-mask", model="multimolecule/dnabert-4mer") output = predictor("ATCGTGCA") ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import DnaBertModel from transformers import AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-4mer") model = DnaBertModel.from_pretrained("multimolecule/dnabert-4mer") text = "ATCGATCGATCGATCG" input = tokenizer(text, return_tensors="pt") output = model(**input) ``` #### Sequence Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import DnaBertForSequencePrediction from transformers import AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-4mer") model = DnaBertForSequencePrediction.from_pretrained("multimolecule/dnabert-4mer") text = "ATCGATCGATCGATCG" input = tokenizer(text, return_tensors="pt") label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Token Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import DnaBertForTokenPrediction from transformers import AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-4mer") model = DnaBertForTokenPrediction.from_pretrained("multimolecule/dnabert-4mer") text = "ATCGATCGATCGATCG" input = tokenizer(text, return_tensors="pt") label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import DnaBertForContactPrediction from transformers import AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-4mer") model = DnaBertForContactPrediction.from_pretrained("multimolecule/dnabert-4mer") text = "ATCGATCGATCGATCG" input = tokenizer(text, return_tensors="pt") label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details DNABERT used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. ### Training Data The DNABERT model was pre-trained on the human genome. The training data consists of DNA sequences from the human reference genome (GRCh38.p13), with all sequences containing only the four canonical nucleotides (A, T, C, G). ### Training Procedure #### Preprocessing DNABERT used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT: - 15% of the tokens are masked. In the last 20,000 steps, the masking rate is increased to 20%. - In 80% of the cases, the masked tokens are replaced by ``. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace. - In the 10% remaining cases, the masked tokens are left as is. Since DNABERT used k-mer tokenizer, it masks the entire k-mer instead of individual nucleotides to avoid information leakage. For example, if the k-mer is 3, the sequence `"TAGCGTAT"` will be tokenized as `["TAG", "AGC", "GCG", "CGT", "GTA", "TAT"]`. If the nucleotide `"C"` is masked, the adjacent tokens will also be masked, resulting `["TAG", "", "", "", "GTA", "TAT"]`. #### Pre-training The model was trained on 8 NVIDIA RTX 2080Ti GPUs. - Batch size: 2,000 - Steps: 120,000 - Learning rate: 4e-4 - Learning rate scheduler: Linear - Learning rate warm-up: 10,000 steps ## Citation ```bibtex @ARTICLE{Ji2021-cj, title = "{DNABERT}: pre-trained Bidirectional Encoder Representations from Transformers model for {DNA-language} in genome", author = "Ji, Yanrong and Zhou, Zhihan and Liu, Han and Davuluri, Ramana V", abstract = "MOTIVATION: Deciphering the language of non-coding DNA is one of the fundamental problems in genome research. Gene regulatory code is highly complex due to the existence of polysemy and distant semantic relationship, which previous informatics methods often fail to capture especially in data-scarce scenarios. RESULTS: To address this challenge, we developed a novel pre-trained bidirectional encoder representation, named DNABERT, to capture global and transferrable understanding of genomic DNA sequences based on up and downstream nucleotide contexts. We compared DNABERT to the most widely used programs for genome-wide regulatory elements prediction and demonstrate its ease of use, accuracy and efficiency. We show that the single pre-trained transformers model can simultaneously achieve state-of-the-art performance on prediction of promoters, splice sites and transcription factor binding sites, after easy fine-tuning using small task-specific labeled data. Further, DNABERT enables direct visualization of nucleotide-level importance and semantic relationship within input sequences for better interpretability and accurate identification of conserved sequence motifs and functional genetic variant candidates. Finally, we demonstrate that pre-trained DNABERT with human genome can even be readily applied to other organisms with exceptional performance. We anticipate that the pre-trained DNABERT model can be fined tuned to many other sequence analyses tasks. AVAILABILITY AND IMPLEMENTATION: The source code, pretrained and finetuned model for DNABERT are available at GitHub (https://github.com/jerryji1993/DNABERT). SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.", journal = "Bioinformatics", publisher = "Oxford University Press (OUP)", volume = 37, number = 15, pages = "2112--2120", month = aug, year = 2021, copyright = "https://academic.oup.com/journals/pages/open\_access/funder\_policies/chorus/standard\_publication\_model", language = "en" } ``` > [!NOTE] > The artifacts distributed in this repository are part of the MultiMolecule project. > If you use MultiMolecule in your research, you must cite the MultiMolecule project as follows: ```bibtex @software{chen_2024_12638419, author = {Chen, Zhiyuan and Zhu, Sophia Y.}, title = {MultiMolecule}, doi = {10.5281/zenodo.12638419}, publisher = {Zenodo}, url = {https://doi.org/10.5281/zenodo.12638419}, year = 2024, month = may, day = 4 } ``` ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the [DNABERT paper](https://doi.org/10.1093/bioinformatics/btab083) for questions or comments on the paper/model. ## License This model is licensed under the [GNU Affero General Public License](license.md). For additional terms and clarifications, please refer to our [License FAQ](license-faq.md). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```