File size: 13,863 Bytes
4f6fdb0 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 |
---
datasets:
- multimolecule/rnacentral
language: rna
library_name: multimolecule
license: agpl-3.0
mask_token: <mask>
pipeline_tag: fill-mask
tags:
- Biology
- RNA
- ncRNA
widget:
- example_title: microRNA 21
mask_index: 11
mask_index_1based: 12
masked_char: A
output:
- label: M
score: 0.103986
- label: <cls>
score: 0.078838
- label: D
score: 0.058049
- label: X
score: 0.053177
- label: V
score: 0.050679
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: UAGCUUAUCAG<mask>CUGAUGUUGA
- example_title: microRNA 146a
mask_index: 10
mask_index_1based: 11
masked_char: A
output:
- label: M
score: 0.080997
- label: <cls>
score: 0.068851
- label: X
score: 0.066277
- label: <pad>
score: 0.06292
- label: V
score: 0.059967
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: UGAGAACUGA<mask>UUCCAUGGGUU
- example_title: microRNA 155
mask_index: 15
mask_index_1based: 16
masked_char: A
output:
- label: M
score: 0.095831
- label: <cls>
score: 0.074774
- label: Y
score: 0.059286
- label: G
score: 0.058139
- label: S
score: 0.056089
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: UUAAUGCUAAUCGUG<mask>UAGGGGUU
- example_title: metastasis associated lung adenocarcinoma transcript 1
mask_index: 12
mask_index_1based: 13
masked_char: A
output:
- label: X
score: 0.086578
- label: M
score: 0.073134
- label: V
score: 0.067197
- label: N
score: 0.056214
- label: <cls>
score: 0.055831
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: AGGCAUUGAGGC<mask>GCCAGCGCAGGGGCUUCUGCUGAGGGGGCAGGCGGAGCUUGAGGAAA
- example_title: Pvt1 oncogene
mask_index: 17
mask_index_1based: 18
masked_char: A
output:
- label: X
score: 0.093164
- label: V
score: 0.076787
- label: M
score: 0.062176
- label: <cls>
score: 0.058442
- label: R
score: 0.058334
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: CCCGCGCUCCUCCGGGC<mask>GAGCGCGUGUGGCGGCCGAGCACAUGGGCCCGCGGGCCGGGC
- example_title: telomerase RNA component
mask_index: 23
mask_index_1based: 24
masked_char: A
output:
- label: D
score: 0.068369
- label: X
score: 0.067502
- label: '-'
score: 0.066542
- label: M
score: 0.064048
- label: G
score: 0.063284
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: GGGUUGCGGAGGGUGGGCCUGGG<mask>GGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAG
- example_title: vault RNA 2-1
mask_index: 12
mask_index_1based: 13
masked_char: A
output:
- label: M
score: 0.090413
- label: V
score: 0.086147
- label: X
score: 0.068885
- label: N
score: 0.055727
- label: Y
score: 0.053492
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: CGGGUCGGAGUU<mask>GCUCAAGCGGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUUAUGCAA
- example_title: brain cytoplasmic RNA 1
mask_index: 18
mask_index_1based: 19
masked_char: A
output:
- label: X
score: 0.15337
- label: M
score: 0.098655
- label: V
score: 0.076971
- label: .
score: 0.060902
- label: W
score: 0.052402
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: GGCCGGGCGCGGUGGCUC<mask>CGCCUGUAAUCCCAGCUCUCAGGGAGGCUAAGAGGCGGGAGGAUAGCUUGAGCCCAGGAGUUCGAGACCUGCCUGGGCAAUAUAGCGAGACCCCGUUCUCCAGAAAAAGGAAAAAAAAAAACAAAAGACAAAAAAAAAAUAAGCGUAACUUCCCUCAAAGCAACAACCCCCCCCCCCCUUU
- example_title: HIV-1 TAR-WT
mask_index: 13
mask_index_1based: 14
masked_char: A
output:
- label: M
score: 0.085836
- label: X
score: 0.076455
- label: N
score: 0.061546
- label: V
score: 0.059804
- label: R
score: 0.055397
pipeline_tag: fill-mask
sequence_type: ncRNA
task: fill-mask
text: GGUCUCUCUGGUU<mask>GACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACC
---
# RNAErnie
Pre-trained model on non-coding RNA (ncRNA) using a multi-stage masked language modeling (MLM) objective.
## Statement
_Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning_ is published in [Nature Machine Intelligence](https://doi.org/10.1038/s42256-024-00836-4), which is a Closed Access / Author-Fee journal.
> Machine learning has been at the forefront of the movement for free and open access to research.
>
> We see no role for closed access or author-fee publication in the future of machine learning research and believe the adoption of these journals as an outlet of record for the machine learning community would be a retrograde step.
The MultiMolecule team is committed to the principles of open access and open science.
We do NOT endorse the publication of manuscripts in Closed Access / Author-Fee journals and encourage the community to support Open Access journals and conferences.
Please consider signing the [Statement on Nature Machine Intelligence](https://openaccess.engineering.oregonstate.edu).
## Disclaimer
This is an UNOFFICIAL implementation of the RNAErnie: An RNA Language Model with Structure-enhanced Representations by Ning Wang, Jiang Bian,
Haoyi Xiong, et al.
The OFFICIAL repository of RNAErnie is at [CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie).
> [!WARNING]
> The MultiMolecule team is unable to confirm that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
> This is because
>
> The proposed method is published in a Closed Access / Author-Fee journal.
**The team releasing RNAErnie did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNAErnie is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
Note that during the conversion process, additional tokens such as `[IND]` and ncRNA class symbols are removed.
### Model Specification
| Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
| ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- |
| 12 | 768 | 12 | 3072 | 86.06 | 22.37 | 11.17 | 512 |
### Links
- **Code**: [multimolecule.rnaernie](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnaernie)
- **Weights**: [multimolecule/rnaernie](https://huggingface.co/multimolecule/rnaernie)
- **Data**: [multimolecule/rnacentral](https://huggingface.co/datasets/multimolecule/rnacentral)
- **Paper**: Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning
- **Developed by**: Ning Wang, Jiang Bian, Yuchen Li, Xuhong Li, Shahid Mumtaz, Linghe Kong, Haoyi Xiong.
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ERNIE](https://huggingface.co/nghuyong/ernie-3.0-base-zh)
- **Original Repository**: [CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
#### Masked Language Modeling
You can use this model directly with a pipeline for masked language modeling:
```python
import multimolecule # you must import multimolecule to register models
from transformers import pipeline
predictor = pipeline("fill-mask", model="multimolecule/rnaernie")
output = predictor("gguc<mask>cucugguuagaccagaucugagccu")
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaErnieModel
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnaernie")
model = RnaErnieModel.from_pretrained("multimolecule/rnaernie")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
```
#### Sequence Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnaernie")
model = RnaErnieForSequencePrediction.from_pretrained("multimolecule/rnaernie")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Token Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForTokenPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnaernie")
model = RnaErnieForTokenPrediction.from_pretrained("multimolecule/rnaernie")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForContactPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnaernie")
model = RnaErnieForContactPrediction.from_pretrained("multimolecule/rnaernie")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNAErnie used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The RNAErnie model was pre-trained on [RNAcentral](https://multimolecule.danling.org/datasets/rnacentral).
RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of [Expert Databases](https://rnacentral.org/expert-databases) representing a broad range of organisms and RNA types.
RNAErnie used a subset of RNAcentral for pre-training. The subset contains 23 million sequences.
RNAErnie preprocessed all tokens by replacing "T"s with "S"s.
Note that [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNAErnie used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### Pre-training
RNAErnie used a special 3-stage training pipeline to pre-train the model, each with a different masking strategy:
Base-level Masking: The masking applies to each nucleotide in the sequence.
Subsequence-level Masking: The masking applies to subsequences of 4-8bp in the sequence.
Motif-level Masking: The model is trained on motif datasets.
The model was trained on 4 NVIDIA V100 GPUs with 32GiB memories.
- Batch size: 50
- Steps: 2,580,000
- Optimizer: AdamW
- Learning rate: 1e-4
- Learning rate warm-up: 129,000 steps
- Learning rate cool-down: 129,000 steps
- Minimum learning rate: 5e-5
- Weight decay: 0.01
## Citation
Citation information is not available for papers published in Closed Access / Author-Fee journals.
> [!NOTE]
> The artifacts distributed in this repository are part of the MultiMolecule project.
> If you use MultiMolecule in your research, you must cite the MultiMolecule project as follows:
```bibtex
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the RNAErnie paper for questions or comments on the paper/model.
## License
This model is licensed under the [GNU Affero General Public License](license.md).
For additional terms and clarifications, please refer to our [License FAQ](license-faq.md).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
``` |