File size: 9,898 Bytes
c65cf05 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/bprna-spot
library_name: multimolecule
base_model: multimolecule/rnafm
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "HIV-1"
text: "GGUC<mask>CUCUGGUUAGACCAGAUCUGAGCCU"
output:
- label: "."
score: 0.2907504141330719
- label: "*"
score: 0.2359575480222702
- label: "I"
score: 0.19035066664218903
- label: "A"
score: 0.09356562793254852
- label: "U"
score: 0.08782266825437546
- example_title: "microRNA-21"
text: "UAGC<mask>UAUCAGACUGAUGUUG"
output:
- label: "."
score: 0.24210385978221893
- label: "*"
score: 0.19574487209320068
- label: "I"
score: 0.15285496413707733
- label: "A"
score: 0.12451102584600449
- label: "U"
score: 0.11860787868499756
---
# RNA-FM
Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) by Jiayang Chen, Zhihang Hue, Siqi Sun, et al.
The OFFICIAL repository of RNA-FM is at [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM).
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNA-FM is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variants
- **[multimolecule/rnafm](https://huggingface.co/multimolecule/rnafm)**: The RNA-FM model pre-trained on non-coding RNA sequences.
- **[multimolecule/mrnafm](https://huggingface.co/multimolecule/mrnafm)**: The RNA-FM model pre-trained on messenger RNA sequences.
### Model Specification
<table>
<thead>
<tr>
<th>Variants</th>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>RNA-FM</td>
<td rowspan="2">12</td>
<td>640</td>
<td rowspan="2">20</td>
<td rowspan="2">5120</td>
<td>99.52</td>
<td>25.68</td>
<td>12.83</td>
<td rowspan="2">1024</td>
</tr>
<tr>
<td>mRNA-FM</td>
<td>1280</td>
<td>239.25</td>
<td>61.43</td>
<td>30.7</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.rnafm](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnafm)
- **Data**: [multimolecule/rnacentral](https://huggingface.co/datasets/multimolecule/rnacentral)
- **Paper**: [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062)
- **Developed by**: Jiayang Chen, Zhihang Hu, Siqi Sun, Qingxiong Tan, Yixuan Wang, Qinze Yu, Licheng Zong, Liang Hong, Jin Xiao, Tao Shen, Irwin King, Yu Li
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ESM](https://huggingface.co/facebook/esm2_t48_15B_UR50D)
- **Original Repository**: [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
#### RNA Secondary Structure Prediction
You can use this model directly with a pipeline for secondary structure prediction:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> predictor = pipeline("rna-secondary-structure", model="multimolecule/rnafm-ss")
>>> predictor("GGUCUCUCUGGUUAGACCAGAUCUGAGCCU")
{'sequence': 'GGUCUCUCUGGUUAGACCAGAUCUGAGCCU',
'secondary_structure': '.(.(((((((((...))))))...))))..'}
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaFmModel
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm-ss")
model = RnaFmModel.from_pretrained("multimolecule/rnafm-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
```
#### Sequence Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm-ss")
model = RnaFmForSequencePrediction.from_pretrained("multimolecule/rnafm-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Token Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForTokenPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm-ss")
model = RnaFmForTokenPrediction.from_pretrained("multimolecule/rnafm-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForContactPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm-ss")
model = RnaFmForContactPrediction.from_pretrained("multimolecule/rnafm-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The RNA-FM model was pre-trained on [RNAcentral](https://multimolecule.danling.org/datasets/rnacentral).
RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of [Expert Databases](https://rnacentral.org/expert-databases) representing a broad range of organisms and RNA types.
RNA-FM applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences.
RNA-FM preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### Pre-training
The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories.
- Learning rate: 1e-4
- Learning rate scheduler: Inverse square root
- Learning rate warm-up: 10,000 steps
- Weight decay: 0.01
## Citation
**BibTeX**:
```bibtex
@article{chen2022interpretable,
title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions},
author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others},
journal={arXiv preprint arXiv:2204.00300},
year={2022}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [RNA-FM paper](https://doi.org/10.1101/2022.08.06.503062) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|