Adding LCA tokenizer source code
Browse files- config_utils.py +769 -0
- general_utils.py +309 -0
- sequtils.py +980 -0
- tokenizer.py +363 -0
- tokenizer_config.json +6 -0
config_utils.py
ADDED
|
@@ -0,0 +1,769 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
# Config utils
|
| 2 |
+
import yaml
|
| 3 |
+
import pathlib
|
| 4 |
+
from os.path import join
|
| 5 |
+
import os
|
| 6 |
+
import numpy as np
|
| 7 |
+
import torch
|
| 8 |
+
import argparse
|
| 9 |
+
from multiprocessing import cpu_count
|
| 10 |
+
from transformers import TrainingArguments
|
| 11 |
+
from copy import deepcopy
|
| 12 |
+
import re
|
| 13 |
+
import sys
|
| 14 |
+
|
| 15 |
+
def add_hf_args_to_parser(parser):
|
| 16 |
+
# Create a temporary TrainingArguments to access default values and descriptions
|
| 17 |
+
hf_args = TrainingArguments(output_dir="/tmp") # Dummy output_dir
|
| 18 |
+
# Iterate over all public attributes
|
| 19 |
+
for attr in dir(hf_args):
|
| 20 |
+
if not attr.startswith("_"):
|
| 21 |
+
default = getattr(hf_args, attr)
|
| 22 |
+
# You can add more sophisticated handling based on attribute types here
|
| 23 |
+
if isinstance(default, (int, float, str, bool)):
|
| 24 |
+
help_str = f"Auto-generated help for {attr}"
|
| 25 |
+
parser.add_argument(f"--{attr}", type=type(default), default=default, help=help_str)
|
| 26 |
+
|
| 27 |
+
return parser
|
| 28 |
+
|
| 29 |
+
class BaseConfig:
|
| 30 |
+
"""Base class for managing and validating configurations."""
|
| 31 |
+
|
| 32 |
+
numpy_dtype_mapping = {1: np.int8,
|
| 33 |
+
2: np.int16,
|
| 34 |
+
8: np.int64,
|
| 35 |
+
4: np.int32}
|
| 36 |
+
|
| 37 |
+
def __init__(self):
|
| 38 |
+
super().__init__()
|
| 39 |
+
|
| 40 |
+
def cast_to_expected_type(self, parameter_class: str, parameter_name: str, value: any) -> any:
|
| 41 |
+
"""
|
| 42 |
+
Cast the given value to the expected type.
|
| 43 |
+
|
| 44 |
+
:param parameter_class: The class/category of the parameter.
|
| 45 |
+
:type parameter_class: str
|
| 46 |
+
:param parameter_name: The name of the parameter.
|
| 47 |
+
:type parameter_name: str
|
| 48 |
+
:param value: The value to be casted.
|
| 49 |
+
:type value: any
|
| 50 |
+
:return: Value casted to the expected type.
|
| 51 |
+
:rtype: any
|
| 52 |
+
:raises ValueError: If casting fails.
|
| 53 |
+
"""
|
| 54 |
+
expected_type = self.parameters[parameter_class][parameter_name]['type']
|
| 55 |
+
|
| 56 |
+
if expected_type in ["integer", "int"]:
|
| 57 |
+
try:
|
| 58 |
+
return int(value)
|
| 59 |
+
except ValueError:
|
| 60 |
+
raise ValueError(f"Failed to cast value '{value}' to integer for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 61 |
+
elif expected_type == "float":
|
| 62 |
+
try:
|
| 63 |
+
return float(value)
|
| 64 |
+
except ValueError:
|
| 65 |
+
raise ValueError(f"Failed to cast value '{value}' to float for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 66 |
+
elif expected_type in ["string", "str"]:
|
| 67 |
+
return str(value)
|
| 68 |
+
elif expected_type in ["boolean", "bool"]:
|
| 69 |
+
if isinstance(value, bool):
|
| 70 |
+
return value
|
| 71 |
+
elif str(value).lower() == "true":
|
| 72 |
+
return True
|
| 73 |
+
elif str(value).lower() == "false":
|
| 74 |
+
return False
|
| 75 |
+
else:
|
| 76 |
+
raise ValueError(f"Failed to cast value '{value}' to boolean for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 77 |
+
elif expected_type == "type":
|
| 78 |
+
# For this type, we will simply return the value without casting.
|
| 79 |
+
# It assumes the configuration provides valid Python types.
|
| 80 |
+
return value
|
| 81 |
+
elif expected_type == "list":
|
| 82 |
+
if isinstance(value, list):
|
| 83 |
+
return value
|
| 84 |
+
else:
|
| 85 |
+
raise ValueError(f"Failed to validate value '{value}' as a list for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 86 |
+
elif expected_type == "tuple":
|
| 87 |
+
if isinstance(value, tuple):
|
| 88 |
+
return value
|
| 89 |
+
else:
|
| 90 |
+
raise ValueError(f"Failed to validate value '{value}' as a tuple for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 91 |
+
elif expected_type == "set":
|
| 92 |
+
if isinstance(value, set):
|
| 93 |
+
return value
|
| 94 |
+
else:
|
| 95 |
+
raise ValueError(f"Failed to validate value '{value}' as a set for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 96 |
+
elif expected_type == "dict":
|
| 97 |
+
if isinstance(value, dict):
|
| 98 |
+
return value
|
| 99 |
+
else:
|
| 100 |
+
raise ValueError(f"Failed to validate value '{value}' as a dict for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 101 |
+
else:
|
| 102 |
+
raise ValueError(f"Unknown expected type '{expected_type}' for parameter '{parameter_name}' in class '{parameter_class}'.")
|
| 103 |
+
|
| 104 |
+
|
| 105 |
+
|
| 106 |
+
def get_parameter(self, parameter_class: str, parameter_name: str) -> any:
|
| 107 |
+
"""
|
| 108 |
+
Retrieve the default value of a specified parameter.
|
| 109 |
+
|
| 110 |
+
:param parameter_class: The class/category of the parameter (e.g., 'segmentation').
|
| 111 |
+
:type parameter_class: str
|
| 112 |
+
:param parameter_name: The name of the parameter.
|
| 113 |
+
:type parameter_name: str
|
| 114 |
+
:return: Default value of the parameter, casted to the expected type.
|
| 115 |
+
:rtype: any
|
| 116 |
+
"""
|
| 117 |
+
default_value = self.parameters[parameter_class][parameter_name]['default']
|
| 118 |
+
return self.cast_to_expected_type(parameter_class, parameter_name, default_value)
|
| 119 |
+
|
| 120 |
+
|
| 121 |
+
|
| 122 |
+
def validate_type(self, parameter_class: str, parameter_name: str, value: any) -> bool:
|
| 123 |
+
"""
|
| 124 |
+
Validate the type of a given value against the expected type.
|
| 125 |
+
|
| 126 |
+
:param parameter_class: The class/category of the parameter.
|
| 127 |
+
:type parameter_class: str
|
| 128 |
+
:param parameter_name: The name of the parameter.
|
| 129 |
+
:type parameter_name: str
|
| 130 |
+
:param value: The value to be validated.
|
| 131 |
+
:type value: any
|
| 132 |
+
:return: True if the value is of the expected type, otherwise False.
|
| 133 |
+
:rtype: bool
|
| 134 |
+
"""
|
| 135 |
+
expected_type = self.parameters[parameter_class][parameter_name]['type']
|
| 136 |
+
|
| 137 |
+
if expected_type == "integer" and not isinstance(value, int):
|
| 138 |
+
return False
|
| 139 |
+
elif expected_type == "float" and not isinstance(value, float):
|
| 140 |
+
return False
|
| 141 |
+
elif expected_type == "string" and not isinstance(value, str):
|
| 142 |
+
return False
|
| 143 |
+
else:
|
| 144 |
+
return True
|
| 145 |
+
|
| 146 |
+
def validate_value(self, parameter_class: str, parameter_name: str, value: any) -> bool:
|
| 147 |
+
"""
|
| 148 |
+
Validate the value of a parameter against its constraints.
|
| 149 |
+
|
| 150 |
+
:param parameter_class: The class/category of the parameter.
|
| 151 |
+
:type parameter_class: str
|
| 152 |
+
:param parameter_name: The name of the parameter.
|
| 153 |
+
:type parameter_name: str
|
| 154 |
+
:param value: The value to be validated.
|
| 155 |
+
:type value: any
|
| 156 |
+
:return: True if the value meets the constraints, otherwise False.
|
| 157 |
+
:rtype: bool
|
| 158 |
+
"""
|
| 159 |
+
constraints = self.parameters[parameter_class][parameter_name].get('constraints', {})
|
| 160 |
+
|
| 161 |
+
if 'options' in constraints and value not in constraints['options']:
|
| 162 |
+
return False
|
| 163 |
+
if 'min' in constraints and value < constraints['min']:
|
| 164 |
+
return False
|
| 165 |
+
if 'max' in constraints and value > constraints['max']:
|
| 166 |
+
return False
|
| 167 |
+
return True
|
| 168 |
+
|
| 169 |
+
|
| 170 |
+
def validate(self, parameter_class: str, parameter_name: str, value: any):
|
| 171 |
+
"""
|
| 172 |
+
Validate both the type and value of a parameter.
|
| 173 |
+
|
| 174 |
+
:param parameter_class: The class/category of the parameter.
|
| 175 |
+
:type parameter_class: str
|
| 176 |
+
:param parameter_name: The name of the parameter.
|
| 177 |
+
:type parameter_name: str
|
| 178 |
+
:param value: The value to be validated.
|
| 179 |
+
:type value: any
|
| 180 |
+
:raises TypeError: If the value is not of the expected type.
|
| 181 |
+
:raises ValueError: If the value does not meet the parameter's constraints.
|
| 182 |
+
"""
|
| 183 |
+
if not self.validate_type(parameter_class, parameter_name, value):
|
| 184 |
+
raise TypeError(f"Invalid type for {parameter_name} for parameter class '{parameter_class}'. Expected {self.parameters[parameter_class][parameter_name]['type']}.")
|
| 185 |
+
|
| 186 |
+
if not self.validate_value(parameter_class, parameter_name, value):
|
| 187 |
+
raise ValueError(f"Invalid value for {parameter_name} for parameter class '{parameter_class}'. Constraints: {self.parameters[parameter_class][parameter_name].get('constraints', {})}.")
|
| 188 |
+
|
| 189 |
+
def describe(self, parameter_class: str, parameter_name: str) -> str:
|
| 190 |
+
"""
|
| 191 |
+
Retrieve the description of a parameter.
|
| 192 |
+
|
| 193 |
+
:param parameter_class: The class/category of the parameter.
|
| 194 |
+
:type parameter_class: str
|
| 195 |
+
:param parameter_name: The name of the parameter.
|
| 196 |
+
:type parameter_name: str
|
| 197 |
+
:return: Description of the parameter.
|
| 198 |
+
:rtype: str
|
| 199 |
+
"""
|
| 200 |
+
return self.parameters[parameter_class][parameter_name]['description']
|
| 201 |
+
|
| 202 |
+
@staticmethod
|
| 203 |
+
def rename_non_unique_parameters(config: dict) -> tuple[dict, dict, dict]:
|
| 204 |
+
"""
|
| 205 |
+
Rename parameters in the configuration to ensure uniqueness across different groups.
|
| 206 |
+
|
| 207 |
+
This method identifies parameters with the same name across different groups and renames them
|
| 208 |
+
by prefixing the group name. This is to prevent conflicts when parameters are used in a context
|
| 209 |
+
where the group name is not specified.
|
| 210 |
+
|
| 211 |
+
:param config: A dictionary where each key is a group name and each value is a dict
|
| 212 |
+
of parameters for that group.
|
| 213 |
+
:type config: dict
|
| 214 |
+
|
| 215 |
+
:return: A tuple containing:
|
| 216 |
+
- renamed_config: A dictionary with the same structure as the input, but with non-unique parameter
|
| 217 |
+
names renamed. The structure is {group_name: {param_name: param_info}}.
|
| 218 |
+
- cmd_argument2group_param: A dictionary mapping the new parameter names to their original group
|
| 219 |
+
and parameter name. The structure is {new_param_name: [group_name, original_param_name]}.
|
| 220 |
+
- group2param2cmdarg: A dictionary mapping each group to a dict that maps the original parameter
|
| 221 |
+
names to the new parameter names. The structure is {group_name: {original_param_name: new_param_name}}.
|
| 222 |
+
:rtype: tuple[dict, dict, dict]
|
| 223 |
+
"""
|
| 224 |
+
|
| 225 |
+
# Identify non-unique parameter names
|
| 226 |
+
param_counts = {}
|
| 227 |
+
for group_name, parameters in config.items():
|
| 228 |
+
for param_name in parameters.keys():
|
| 229 |
+
param_counts[param_name] = param_counts.get(param_name, 0) + 1
|
| 230 |
+
|
| 231 |
+
non_unique_params = {param for param, count in param_counts.items() if count > 1}
|
| 232 |
+
|
| 233 |
+
cmd_argument2group_param = {}
|
| 234 |
+
group2param2cmdarg = {}
|
| 235 |
+
for group_name, parameters in config.items():
|
| 236 |
+
group2param2cmdarg[group_name]={}
|
| 237 |
+
for param_name in parameters.keys():
|
| 238 |
+
group2param2cmdarg[group_name][param_name] = param_name
|
| 239 |
+
|
| 240 |
+
|
| 241 |
+
# Rename only the non-unique parameters
|
| 242 |
+
renamed_config = {}
|
| 243 |
+
for group_name, parameters in config.items():
|
| 244 |
+
renamed_group = {}
|
| 245 |
+
for param_name, param_info in parameters.items():
|
| 246 |
+
|
| 247 |
+
new_param_name = f"{group_name}_{param_name}" if param_name in non_unique_params else param_name
|
| 248 |
+
cmd_argument2group_param[new_param_name] = [group_name, param_name]
|
| 249 |
+
group2param2cmdarg[group_name][param_name]=new_param_name
|
| 250 |
+
|
| 251 |
+
renamed_group[new_param_name] = param_info
|
| 252 |
+
renamed_config[group_name] = renamed_group
|
| 253 |
+
return renamed_config, cmd_argument2group_param, group2param2cmdarg
|
| 254 |
+
|
| 255 |
+
@staticmethod
|
| 256 |
+
def create_parser(config: dict) -> argparse.ArgumentParser:
|
| 257 |
+
"""
|
| 258 |
+
Create and configure an argparse parser based on the given configuration.
|
| 259 |
+
|
| 260 |
+
This method sets up a command-line argument parser with arguments defined in the configuration.
|
| 261 |
+
Each top-level key in the configuration represents a group of related arguments.
|
| 262 |
+
|
| 263 |
+
:param config: A dictionary where each key is a group name and each value is a dict
|
| 264 |
+
of parameters for that group. Each parameter's information should include
|
| 265 |
+
its type, default value, and help description.
|
| 266 |
+
:type config: dict
|
| 267 |
+
|
| 268 |
+
:return: Configured argparse.ArgumentParser instance with arguments added as specified
|
| 269 |
+
in the configuration.
|
| 270 |
+
:rtype: argparse.ArgumentParser
|
| 271 |
+
|
| 272 |
+
:raises ValueError: If an unknown or unsupported type is specified for a parameter.
|
| 273 |
+
"""
|
| 274 |
+
parser = argparse.ArgumentParser(description="Command-line parser for project settings")
|
| 275 |
+
# Mapping of type strings to Python types
|
| 276 |
+
type_mapping = {
|
| 277 |
+
'integer': int,
|
| 278 |
+
'int': int,
|
| 279 |
+
'float': float,
|
| 280 |
+
'string': str,
|
| 281 |
+
'str': str,
|
| 282 |
+
'bool': bool,
|
| 283 |
+
'boolean': bool,
|
| 284 |
+
'list': list
|
| 285 |
+
# Complex types like 'dict' and 'type' are intentionally excluded
|
| 286 |
+
}
|
| 287 |
+
|
| 288 |
+
# List of types to handle as strings
|
| 289 |
+
handle_as_string = ['dict', 'type', 'list']
|
| 290 |
+
excluded_parameters = ['vocabmap', 'np_tokentype', 'pretraining_dataset_data', 'optim']
|
| 291 |
+
|
| 292 |
+
|
| 293 |
+
for group_name, parameters in config.items():
|
| 294 |
+
group = parser.add_argument_group(group_name)
|
| 295 |
+
for param_name, param_info in parameters.items():
|
| 296 |
+
param_type_str = param_info['type']
|
| 297 |
+
description = param_info['description']
|
| 298 |
+
escaped_description = re.sub(r"([^%])%", r"\1%%", description)
|
| 299 |
+
if param_name in excluded_parameters:
|
| 300 |
+
continue
|
| 301 |
+
if param_type_str in handle_as_string:
|
| 302 |
+
# Handle these types as strings in argparse, conversion will be done later in the program
|
| 303 |
+
param_type = str
|
| 304 |
+
elif param_type_str not in type_mapping:
|
| 305 |
+
raise ValueError(f"Unknown or unsupported type '{param_type_str}' for parameter '{param_name}'")
|
| 306 |
+
else:
|
| 307 |
+
param_type = type_mapping[param_type_str]
|
| 308 |
+
|
| 309 |
+
#print(f'The current type is: {param_type}')
|
| 310 |
+
default_param = param_info['default']
|
| 311 |
+
description = param_info['description']
|
| 312 |
+
kwargs = {
|
| 313 |
+
'type': param_type,
|
| 314 |
+
'default': param_info['default'],
|
| 315 |
+
'help': escaped_description
|
| 316 |
+
} # Add constraints if they exist
|
| 317 |
+
"""
|
| 318 |
+
if 'constraints' in param_info:
|
| 319 |
+
constraints = param_info['constraints']
|
| 320 |
+
if 'min' in constraints:
|
| 321 |
+
kwargs['type'] = lambda x: eval(param_type_str)(x) if eval(param_type_str)(x) >= constraints['min'] else sys.exit(f"Value for {param_name} must be at least {constraints['min']}")
|
| 322 |
+
if 'max' in constraints:
|
| 323 |
+
kwargs['type'] = lambda x: eval(param_type_str)(x) if eval(param_type_str)(x) <= constraints['max'] else sys.exit(f"Value for {param_name} must be at most {constraints['max']}")
|
| 324 |
+
if 'options' in constraints:
|
| 325 |
+
kwargs['choices'] = constraints['options']
|
| 326 |
+
"""
|
| 327 |
+
# Add argument to the group
|
| 328 |
+
group.add_argument(f'--{param_name}', **kwargs)
|
| 329 |
+
#parser = add_hf_args_to_parser(parser)
|
| 330 |
+
|
| 331 |
+
return parser
|
| 332 |
+
|
| 333 |
+
|
| 334 |
+
|
| 335 |
+
class SeqConfig(BaseConfig):
|
| 336 |
+
"""Class to manage and validate sequence processing configurations."""
|
| 337 |
+
|
| 338 |
+
def __init__(self):
|
| 339 |
+
super().__init__()
|
| 340 |
+
self.default_seq_config_file = self._get_default_sequence_processing_config_file()
|
| 341 |
+
with open(self.default_seq_config_file, 'r') as file:
|
| 342 |
+
self.parameters = yaml.safe_load(file)
|
| 343 |
+
|
| 344 |
+
# Some postprocessing steps
|
| 345 |
+
self.parameters['tokenization']['shift']['constraints']['max'] = self.parameters['tokenization']['kmer']['default']-1
|
| 346 |
+
# Ha valaki update-li a k-mer paramter-t, akkor triggerelni kellene, hogy mi legyen.
|
| 347 |
+
|
| 348 |
+
self.get_and_set_segmentation_parameters()
|
| 349 |
+
self.get_and_set_tokenization_parameters()
|
| 350 |
+
self.get_and_set_computational_parameters()
|
| 351 |
+
|
| 352 |
+
def _get_default_sequence_processing_config_file(self) -> str:
|
| 353 |
+
"""
|
| 354 |
+
Retrieve the default sequence processing configuration file.
|
| 355 |
+
|
| 356 |
+
:return: Path to the configuration file.
|
| 357 |
+
:rtype: str
|
| 358 |
+
"""
|
| 359 |
+
current_path = pathlib.Path(__file__).parent
|
| 360 |
+
prokbert_seq_config_file = join(current_path, 'configs', 'sequence_processing.yaml')
|
| 361 |
+
self.current_path = current_path
|
| 362 |
+
|
| 363 |
+
try:
|
| 364 |
+
# Attempt to read the environment variable
|
| 365 |
+
prokbert_seq_config_file = os.environ['SEQ_CONFIG_FILE']
|
| 366 |
+
except KeyError:
|
| 367 |
+
# Handle the case when the environment variable is not found
|
| 368 |
+
pass
|
| 369 |
+
# print("SEQ_CONFIG_FILE environment variable has not been set. Using default value: {0}".format(prokbert_seq_config_file))
|
| 370 |
+
return prokbert_seq_config_file
|
| 371 |
+
|
| 372 |
+
|
| 373 |
+
def get_and_set_segmentation_parameters(self, parameters: dict = {}) -> dict:
|
| 374 |
+
"""
|
| 375 |
+
Retrieve and validate the provided parameters for segmentation.
|
| 376 |
+
|
| 377 |
+
:param parameters: A dictionary of parameters to be validated.
|
| 378 |
+
:type parameters: dict
|
| 379 |
+
:return: A dictionary of validated segmentation parameters.
|
| 380 |
+
:rtype: dict
|
| 381 |
+
:raises ValueError: If an invalid segmentation parameter is provided.
|
| 382 |
+
"""
|
| 383 |
+
segmentation_params = {k: self.get_parameter('segmentation', k) for k in self.parameters['segmentation']}
|
| 384 |
+
|
| 385 |
+
for param, param_value in parameters.items():
|
| 386 |
+
if param not in segmentation_params:
|
| 387 |
+
raise ValueError(f"The provided {param} is an INVALID segmentation parameter! The valid parameters are: {list(segmentation_params.keys())}")
|
| 388 |
+
self.validate('segmentation', param, param_value)
|
| 389 |
+
segmentation_params[param] = param_value
|
| 390 |
+
self.segmentation_params = segmentation_params
|
| 391 |
+
|
| 392 |
+
|
| 393 |
+
return segmentation_params
|
| 394 |
+
|
| 395 |
+
|
| 396 |
+
def get_and_set_tokenization_parameters(self, parameters: dict = {}) -> dict:
|
| 397 |
+
# Updating the other parameters if necesseary, i.e. if k-mer has-been changed, then the shift is updated and we run a parameter check at the end
|
| 398 |
+
|
| 399 |
+
tokenization_params = {k: self.get_parameter('tokenization', k) for k in self.parameters['tokenization']}
|
| 400 |
+
for param, param_value in parameters.items():
|
| 401 |
+
if param not in tokenization_params:
|
| 402 |
+
raise ValueError(f"The provided {param} is an INVALID tokenization parameter! The valid parameters are: {list(tokenization_params.keys())}")
|
| 403 |
+
self.validate('tokenization', param, param_value)
|
| 404 |
+
tokenization_params[param] = param_value
|
| 405 |
+
|
| 406 |
+
# Loading and check the vocab file. It is assumed that its ordered dictionary
|
| 407 |
+
vocabfile=tokenization_params['vocabfile']
|
| 408 |
+
act_kmer = tokenization_params['kmer']
|
| 409 |
+
if vocabfile=='auto':
|
| 410 |
+
vocabfile_path = join(self.current_path, 'data/prokbert_vocabs/', f'prokbert-base-dna{act_kmer}', 'vocab.txt')
|
| 411 |
+
tokenization_params['vocabfile'] = vocabfile_path
|
| 412 |
+
else:
|
| 413 |
+
vocabfile_path = vocabfile
|
| 414 |
+
with open(vocabfile_path) as vocabfile_in:
|
| 415 |
+
vocabmap = {line.strip(): i for i, line in enumerate(vocabfile_in)}
|
| 416 |
+
tokenization_params['vocabmap'] = vocabmap
|
| 417 |
+
|
| 418 |
+
# Loading the vocab
|
| 419 |
+
self.tokenization_params = tokenization_params
|
| 420 |
+
return tokenization_params
|
| 421 |
+
|
| 422 |
+
def get_and_set_computational_parameters(self, parameters: dict = {}) -> dict:
|
| 423 |
+
""" Reading and validating the computational paramters
|
| 424 |
+
"""
|
| 425 |
+
|
| 426 |
+
computational_params = {k: self.get_parameter('computation', k) for k in self.parameters['computation']}
|
| 427 |
+
core_count = cpu_count()
|
| 428 |
+
|
| 429 |
+
if computational_params['cpu_cores_for_segmentation'] == -1:
|
| 430 |
+
computational_params['cpu_cores_for_segmentation'] = core_count
|
| 431 |
+
|
| 432 |
+
if computational_params['cpu_cores_for_tokenization'] == -1:
|
| 433 |
+
computational_params['cpu_cores_for_tokenization'] = core_count
|
| 434 |
+
|
| 435 |
+
|
| 436 |
+
|
| 437 |
+
for param, param_value in parameters.items():
|
| 438 |
+
if param not in computational_params:
|
| 439 |
+
raise ValueError(f"The provided {param} is an INVALID computation parameter! The valid parameters are: {list(computational_params.keys())}")
|
| 440 |
+
self.validate('computation', param, param_value)
|
| 441 |
+
computational_params[param] = param_value
|
| 442 |
+
|
| 443 |
+
np_tokentype= SeqConfig.numpy_dtype_mapping[computational_params['numpy_token_integer_prec_byte']]
|
| 444 |
+
computational_params['np_tokentype'] = np_tokentype
|
| 445 |
+
self.computational_params = computational_params
|
| 446 |
+
return computational_params
|
| 447 |
+
|
| 448 |
+
|
| 449 |
+
def get_maximum_segment_length_from_token_count_from_params(self):
|
| 450 |
+
"""Calculating the maximum length of the segment from the token count """
|
| 451 |
+
max_token_counts = self.tokenization_params['token_limit']
|
| 452 |
+
shift = self.tokenization_params['shift']
|
| 453 |
+
kmer = self.tokenization_params['kmer']
|
| 454 |
+
return self.get_maximum_segment_length_from_token_count(max_token_counts, shift, kmer)
|
| 455 |
+
|
| 456 |
+
def get_maximum_token_count_from_max_length_from_params(self):
|
| 457 |
+
"""Calculating the maximum length of the segment from the token count """
|
| 458 |
+
|
| 459 |
+
|
| 460 |
+
max_segment_length = self.tokenization_params['max_segment_length']
|
| 461 |
+
shift = self.tokenization_params['shift']
|
| 462 |
+
kmer = self.tokenization_params['kmer']
|
| 463 |
+
max_token_count = self.get_maximum_token_count_from_max_length(max_segment_length, shift, kmer)
|
| 464 |
+
|
| 465 |
+
return max_token_count
|
| 466 |
+
|
| 467 |
+
def get_cmd_arg_parser(self) -> tuple[argparse.ArgumentParser, dict, dict]:
|
| 468 |
+
"""
|
| 469 |
+
Create and return a command-line argument parser for ProkBERT configurations, along with mappings
|
| 470 |
+
between command-line arguments and configuration parameters.
|
| 471 |
+
|
| 472 |
+
This method combines sequence configuration parameters with training configuration parameters
|
| 473 |
+
and sets up a command-line argument parser using these combined settings. It ensures that parameter
|
| 474 |
+
names are unique across different groups by renaming any non-unique parameters.
|
| 475 |
+
|
| 476 |
+
:return: A tuple containing:
|
| 477 |
+
- Configured argparse.ArgumentParser instance for handling ProkBERT configurations.
|
| 478 |
+
- A dictionary mapping new command-line arguments to their original group and parameter name.
|
| 479 |
+
- A dictionary mapping each group to a dict that maps the original parameter names
|
| 480 |
+
to the new command-line argument names.
|
| 481 |
+
:rtype: tuple[argparse.ArgumentParser, dict, dict]
|
| 482 |
+
|
| 483 |
+
Note: The method assumes that the configuration parameters for training and sequence configuration
|
| 484 |
+
are available within the class.
|
| 485 |
+
"""
|
| 486 |
+
combined_params = deepcopy(self.parameters)
|
| 487 |
+
combined_params['Sequence'] = {}
|
| 488 |
+
combined_params['Sequence']['fasta_file_dir'] = {'default': 'None',
|
| 489 |
+
'description' : 'Directory where the input fasta file are located for the pretraining',
|
| 490 |
+
'type': 'string'}
|
| 491 |
+
combined_params['Sequence']['out'] = {'default': 'pretrain.h5',
|
| 492 |
+
'description' : 'Output path',
|
| 493 |
+
'type': 'string'}
|
| 494 |
+
|
| 495 |
+
|
| 496 |
+
combined_params, cmd_argument2group_param, group2param2cmdarg = BaseConfig.rename_non_unique_parameters(combined_params)
|
| 497 |
+
|
| 498 |
+
parser = BaseConfig.create_parser(combined_params)
|
| 499 |
+
return parser,cmd_argument2group_param, group2param2cmdarg
|
| 500 |
+
|
| 501 |
+
|
| 502 |
+
@staticmethod
|
| 503 |
+
def get_maximum_segment_length_from_token_count(max_token_counts, shift, kmer):
|
| 504 |
+
"""Calcuates how long sequence can be covered
|
| 505 |
+
"""
|
| 506 |
+
|
| 507 |
+
max_segment_length = (max_token_counts-3)*shift + kmer
|
| 508 |
+
return max_segment_length
|
| 509 |
+
|
| 510 |
+
@staticmethod
|
| 511 |
+
def get_maximum_token_count_from_max_length(max_segment_length, shift, kmer):
|
| 512 |
+
"""Calcuates how long sequence can be covered
|
| 513 |
+
"""
|
| 514 |
+
max_token_count = int(np.ceil((max_segment_length - kmer)/shift+3))
|
| 515 |
+
return max_token_count
|
| 516 |
+
|
| 517 |
+
class ProkBERTConfig(BaseConfig):
|
| 518 |
+
"""Class to manage and validate pretraining configurations."""
|
| 519 |
+
|
| 520 |
+
torch_dtype_mapping = {1: torch.uint8,
|
| 521 |
+
2: torch.int16,
|
| 522 |
+
8: torch.int64,
|
| 523 |
+
4: torch.int32}
|
| 524 |
+
|
| 525 |
+
def __init__(self):
|
| 526 |
+
super().__init__()
|
| 527 |
+
|
| 528 |
+
self.default_pretrain_config_file = self._get_default_pretrain_config_file()
|
| 529 |
+
with open(self.default_pretrain_config_file, 'r') as file:
|
| 530 |
+
self.parameters = yaml.safe_load(file)
|
| 531 |
+
|
| 532 |
+
# Load and validate each parameter set
|
| 533 |
+
self.data_collator_params = self.get_set_parameters('data_collator')
|
| 534 |
+
self.model_params = self.get_set_parameters('model')
|
| 535 |
+
self.dataset_params = self.get_set_parameters('dataset')
|
| 536 |
+
self.pretraining_params = self.get_set_parameters('pretraining')
|
| 537 |
+
self.finetuning_params = self.get_set_parameters('finetuning')
|
| 538 |
+
# Getting the sequtils params as well
|
| 539 |
+
|
| 540 |
+
self.def_seq_config = SeqConfig()
|
| 541 |
+
self.segmentation_params = self.def_seq_config.get_and_set_segmentation_parameters(self.parameters['segmentation'])
|
| 542 |
+
self.tokenization_params = self.def_seq_config.get_and_set_tokenization_parameters(self.parameters['tokenization'])
|
| 543 |
+
self.computation_params = self.def_seq_config.get_and_set_computational_parameters(self.parameters['computation'])
|
| 544 |
+
|
| 545 |
+
self.default_torchtype = ProkBERTConfig.torch_dtype_mapping[self.computation_params['numpy_token_integer_prec_byte']]
|
| 546 |
+
|
| 547 |
+
hf_training_args = TrainingArguments("working_dir")
|
| 548 |
+
self.hf_training_args_dict = hf_training_args.to_dict()
|
| 549 |
+
|
| 550 |
+
|
| 551 |
+
def _get_default_pretrain_config_file(self) -> str:
|
| 552 |
+
"""
|
| 553 |
+
Retrieve the default pretraining configuration file.
|
| 554 |
+
|
| 555 |
+
:return: Path to the configuration file.
|
| 556 |
+
:rtype: str
|
| 557 |
+
"""
|
| 558 |
+
current_path = pathlib.Path(__file__).parent
|
| 559 |
+
pretrain_config_file = join(current_path, 'configs', 'pretraining.yaml')
|
| 560 |
+
|
| 561 |
+
try:
|
| 562 |
+
# Attempt to read the environment variable
|
| 563 |
+
pretrain_config_file = os.environ['PRETRAIN_CONFIG_FILE']
|
| 564 |
+
except KeyError:
|
| 565 |
+
# Handle the case when the environment variable is not found
|
| 566 |
+
pass
|
| 567 |
+
# print(f"PRETRAIN_CONFIG_FILE environment variable has not been set. Using default value: {pretrain_config_file}")
|
| 568 |
+
return pretrain_config_file
|
| 569 |
+
|
| 570 |
+
def get_set_parameters(self, parameter_class: str, parameters: dict = {}) -> dict:
|
| 571 |
+
"""
|
| 572 |
+
Retrieve and validate the provided parameters for a given parameter class.
|
| 573 |
+
|
| 574 |
+
:param parameter_class: The class/category of the parameter (e.g., 'data_collator').
|
| 575 |
+
:type parameter_class: str
|
| 576 |
+
:param parameters: A dictionary of parameters to be validated.
|
| 577 |
+
:type parameters: dict
|
| 578 |
+
:return: A dictionary of validated parameters.
|
| 579 |
+
:rtype: dict
|
| 580 |
+
:raises ValueError: If an invalid parameter is provided.
|
| 581 |
+
"""
|
| 582 |
+
class_params = {k: self.get_parameter(parameter_class, k) for k in self.parameters[parameter_class]}
|
| 583 |
+
|
| 584 |
+
|
| 585 |
+
# First validatiading the class parameters as well
|
| 586 |
+
for param, param_value in class_params.items():
|
| 587 |
+
|
| 588 |
+
self.validate(parameter_class, param, param_value)
|
| 589 |
+
|
| 590 |
+
|
| 591 |
+
for param, param_value in parameters.items():
|
| 592 |
+
if param not in class_params and (parameter_class!='pretraining'):
|
| 593 |
+
raise ValueError(f"The provided {param} is an INVALID {parameter_class} parameter! The valid parameters are: {list(class_params.keys())}")
|
| 594 |
+
else:
|
| 595 |
+
if parameter_class == 'pretraining' or parameter_class == 'finetuning' :
|
| 596 |
+
if param in self.hf_training_args_dict or param in class_params:
|
| 597 |
+
if param in class_params:
|
| 598 |
+
self.validate(parameter_class, param, param_value)
|
| 599 |
+
class_params[param] = param_value
|
| 600 |
+
else:
|
| 601 |
+
raise ValueError(f"The provided {param} is an INVALID {parameter_class} parameter! In addition is not a valid training argument.")
|
| 602 |
+
else:
|
| 603 |
+
self.validate(parameter_class, param, param_value)
|
| 604 |
+
class_params[param] = param_value
|
| 605 |
+
|
| 606 |
+
return class_params
|
| 607 |
+
|
| 608 |
+
def get_and_set_model_parameters(self, parameters: dict = {}) -> dict:
|
| 609 |
+
""" Setting the model parameters """
|
| 610 |
+
|
| 611 |
+
# Here we include the additional training arguments available for the trainer
|
| 612 |
+
|
| 613 |
+
self.model_params = self.get_set_parameters('model', parameters)
|
| 614 |
+
|
| 615 |
+
return self.model_params
|
| 616 |
+
|
| 617 |
+
def get_and_set_dataset_parameters(self, parameters: dict = {}) -> dict:
|
| 618 |
+
""" Setting the dataset parameters """
|
| 619 |
+
|
| 620 |
+
self.dataset_params = self.get_set_parameters('dataset', parameters)
|
| 621 |
+
|
| 622 |
+
return self.dataset_params
|
| 623 |
+
|
| 624 |
+
def get_and_set_pretraining_parameters(self, parameters: dict = {}) -> dict:
|
| 625 |
+
""" Setting the model parameters """
|
| 626 |
+
self.pretraining_params = self.get_set_parameters('pretraining', parameters)
|
| 627 |
+
|
| 628 |
+
return self.pretraining_params
|
| 629 |
+
|
| 630 |
+
|
| 631 |
+
def get_and_set_datacollator_parameters(self, parameters: dict = {}) -> dict:
|
| 632 |
+
""" Setting the model parameters """
|
| 633 |
+
self.data_collator_params = self.get_set_parameters('data_collator', parameters)
|
| 634 |
+
return self.data_collator_params
|
| 635 |
+
|
| 636 |
+
def get_and_set_segmentation_parameters(self, parameters: dict = {}) -> dict:
|
| 637 |
+
self.segmentation_params = self.def_seq_config.get_and_set_segmentation_parameters(parameters)
|
| 638 |
+
|
| 639 |
+
return self.segmentation_params
|
| 640 |
+
def get_and_set_tokenization_parameters(self, parameters: dict = {}) -> dict:
|
| 641 |
+
self.tokenization_params = self.def_seq_config.get_and_set_tokenization_parameters(parameters)
|
| 642 |
+
|
| 643 |
+
return self.tokenization_params
|
| 644 |
+
def get_and_set_computation_params(self, parameters: dict = {}) -> dict:
|
| 645 |
+
self.computation_params = self.def_seq_config.get_and_set_computational_parameters(parameters)
|
| 646 |
+
return self.computation_params
|
| 647 |
+
|
| 648 |
+
def get_and_set_finetuning_parameters(self, parameters: dict = {}) -> dict:
|
| 649 |
+
""" Setting the finetuning parameters """
|
| 650 |
+
|
| 651 |
+
# Here we include the additional training arguments available for the trainer
|
| 652 |
+
|
| 653 |
+
self.finetuning_params = self.get_set_parameters('finetuning', parameters)
|
| 654 |
+
|
| 655 |
+
return self.finetuning_params
|
| 656 |
+
|
| 657 |
+
|
| 658 |
+
def get_inference_parameters(self):
|
| 659 |
+
# Instantiate TrainingArguments to access default values
|
| 660 |
+
hf_defaults = TrainingArguments(output_dir="/tmp") # Dummy output_dir for initialization
|
| 661 |
+
|
| 662 |
+
return {
|
| 663 |
+
'inference': {
|
| 664 |
+
'fastain': {
|
| 665 |
+
'default': None,
|
| 666 |
+
'type': 'str',
|
| 667 |
+
'description': 'Path to the input data for inference.'
|
| 668 |
+
},
|
| 669 |
+
'out': {
|
| 670 |
+
'default': None,
|
| 671 |
+
'type': 'str',
|
| 672 |
+
'description': 'Output path for the inference results.'
|
| 673 |
+
},
|
| 674 |
+
'per_device_eval_batch_size': {
|
| 675 |
+
'default': hf_defaults.per_device_eval_batch_size,
|
| 676 |
+
'type': 'int',
|
| 677 |
+
'description': 'Batch size per device during evaluation.'
|
| 678 |
+
},
|
| 679 |
+
'ddp_backend': {
|
| 680 |
+
'default': hf_defaults.ddp_backend,
|
| 681 |
+
'type': 'str',
|
| 682 |
+
'description': 'The backend to use for distributed training.'
|
| 683 |
+
},
|
| 684 |
+
'dataloader_drop_last': {
|
| 685 |
+
'default': hf_defaults.dataloader_drop_last,
|
| 686 |
+
'type': 'bool',
|
| 687 |
+
'description': 'Drop the last incomplete batch if it is not divisible by the batch size.'
|
| 688 |
+
},
|
| 689 |
+
'torch_compile': {
|
| 690 |
+
'default': getattr(hf_defaults, 'torch_compile', False), # Fallback for compatibility
|
| 691 |
+
'type': 'bool',
|
| 692 |
+
'description': 'Whether to use TorchScript’s JIT compilation to accelerate training.'
|
| 693 |
+
},
|
| 694 |
+
'torch_compile_mode': {
|
| 695 |
+
'default': getattr(hf_defaults, 'torch_compile_mode', 'eager'), # Fallback for compatibility
|
| 696 |
+
'type': 'str',
|
| 697 |
+
'description': 'The JIT mode to use for compiling PyTorch operations.'
|
| 698 |
+
}
|
| 699 |
+
}
|
| 700 |
+
}
|
| 701 |
+
|
| 702 |
+
|
| 703 |
+
def get_cmd_arg_parser(self, keyset=[]) -> tuple[argparse.ArgumentParser, dict, dict]:
|
| 704 |
+
"""
|
| 705 |
+
Create and return a command-line argument parser for ProkBERT configurations, along with mappings
|
| 706 |
+
between command-line arguments and configuration parameters.
|
| 707 |
+
|
| 708 |
+
This method combines sequence configuration parameters with training configuration parameters
|
| 709 |
+
and sets up a command-line argument parser using these combined settings. It ensures that parameter
|
| 710 |
+
names are unique across different groups by renaming any non-unique parameters.
|
| 711 |
+
|
| 712 |
+
:return: A tuple containing:
|
| 713 |
+
- Configured argparse.ArgumentParser instance for handling ProkBERT configurations.
|
| 714 |
+
- A dictionary mapping new command-line arguments to their original group and parameter name.
|
| 715 |
+
- A dictionary mapping each group to a dict that maps the original parameter names
|
| 716 |
+
to the new command-line argument names.
|
| 717 |
+
:rtype: tuple[argparse.ArgumentParser, dict, dict]
|
| 718 |
+
|
| 719 |
+
Note: The method assumes that the configuration parameters for training and sequence configuration
|
| 720 |
+
are available within the class.
|
| 721 |
+
"""
|
| 722 |
+
if len(keyset) ==0:
|
| 723 |
+
trainin_conf_keysets = ['data_collator', 'model', 'dataset', 'pretraining', 'finetuning']
|
| 724 |
+
else:
|
| 725 |
+
trainin_conf_keysets = keyset
|
| 726 |
+
|
| 727 |
+
inference_params = self.get_inference_parameters()
|
| 728 |
+
seq_config = deepcopy(self.def_seq_config.parameters)
|
| 729 |
+
default_other_config = deepcopy(self.parameters)
|
| 730 |
+
combined_params = {}
|
| 731 |
+
for k,v in seq_config.items():
|
| 732 |
+
combined_params[k] = v
|
| 733 |
+
for k in trainin_conf_keysets:
|
| 734 |
+
combined_params[k] = default_other_config[k]
|
| 735 |
+
combined_params.update(inference_params)
|
| 736 |
+
combined_params, cmd_argument2group_param, group2param2cmdarg = BaseConfig.rename_non_unique_parameters(combined_params)
|
| 737 |
+
parser = BaseConfig.create_parser(combined_params)
|
| 738 |
+
|
| 739 |
+
return parser,cmd_argument2group_param, group2param2cmdarg
|
| 740 |
+
|
| 741 |
+
|
| 742 |
+
def get_user_provided_args(args, parser):
|
| 743 |
+
"""
|
| 744 |
+
Extract arguments provided by the user from the parsed arguments.
|
| 745 |
+
|
| 746 |
+
Args:
|
| 747 |
+
args (argparse.Namespace): Parsed command-line arguments.
|
| 748 |
+
parser (argparse.ArgumentParser): The argument parser instance.
|
| 749 |
+
|
| 750 |
+
Returns:
|
| 751 |
+
dict: A dictionary of user-provided arguments and their values.
|
| 752 |
+
"""
|
| 753 |
+
|
| 754 |
+
user_provided_args = {}
|
| 755 |
+
for action in parser._actions:
|
| 756 |
+
arg_name = action.dest
|
| 757 |
+
default_value = action.default
|
| 758 |
+
user_value = getattr(args, arg_name, None)
|
| 759 |
+
if user_value != default_value:
|
| 760 |
+
user_provided_args[arg_name] = user_value
|
| 761 |
+
|
| 762 |
+
return user_provided_args
|
| 763 |
+
|
| 764 |
+
|
| 765 |
+
|
| 766 |
+
|
| 767 |
+
|
| 768 |
+
|
| 769 |
+
|
general_utils.py
ADDED
|
@@ -0,0 +1,309 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
# coding=utf-8
|
| 2 |
+
|
| 3 |
+
import pandas as pd
|
| 4 |
+
import os
|
| 5 |
+
import numpy as np
|
| 6 |
+
import subprocess
|
| 7 |
+
import shutil
|
| 8 |
+
""" Library for general utils, such as dataframe properties checking,
|
| 9 |
+
creating directories, checking files, etc.
|
| 10 |
+
"""
|
| 11 |
+
|
| 12 |
+
|
| 13 |
+
def check_expected_columns(df: pd.DataFrame, expected_columns: list) -> bool:
|
| 14 |
+
"""Checks if a DataFrame contains the expected columns.
|
| 15 |
+
|
| 16 |
+
:param df: The input DataFrame to be checked.
|
| 17 |
+
:type df: pd.DataFrame
|
| 18 |
+
:param expected_columns: A list of columns that are expected to be present in the DataFrame.
|
| 19 |
+
:type expected_columns: list
|
| 20 |
+
:param df: pd.DataFrame:
|
| 21 |
+
:param expected_columns: list:
|
| 22 |
+
:returns: True if all expected columns are present in the DataFrame, False otherwise.
|
| 23 |
+
:rtype: bool
|
| 24 |
+
:raises ValueError: If any of the expected columns are not present in the DataFrame.
|
| 25 |
+
|
| 26 |
+
Examples
|
| 27 |
+
--------
|
| 28 |
+
>>> df = pd.DataFrame({'A': [1, 2], 'B': [3, 4]})
|
| 29 |
+
>>> check_expected_columns(df, ['A', 'B'])
|
| 30 |
+
True
|
| 31 |
+
|
| 32 |
+
>>> check_expected_columns(df, ['A', 'C'])
|
| 33 |
+
ValueError: The following columns are missing: ['C']
|
| 34 |
+
"""
|
| 35 |
+
|
| 36 |
+
missing_columns = [col for col in expected_columns if col not in df.columns]
|
| 37 |
+
|
| 38 |
+
if missing_columns:
|
| 39 |
+
raise ValueError(f"The following columns are missing: {missing_columns}")
|
| 40 |
+
|
| 41 |
+
return True
|
| 42 |
+
|
| 43 |
+
|
| 44 |
+
def is_valid_primary_key(df: pd.DataFrame, column_name: str) -> bool:
|
| 45 |
+
"""Checks if a specified column in a DataFrame can serve as a valid primary key.
|
| 46 |
+
|
| 47 |
+
:param df: The input DataFrame to be checked.
|
| 48 |
+
:type df: pd.DataFrame
|
| 49 |
+
:param column_name: The name of the column to check.
|
| 50 |
+
:type column_name: str
|
| 51 |
+
:returns: True if the column can serve as a valid primary key, False otherwise.
|
| 52 |
+
:rtype: bool
|
| 53 |
+
:raises ValueError: If the specified column does not exist in the DataFrame.
|
| 54 |
+
|
| 55 |
+
Examples
|
| 56 |
+
--------
|
| 57 |
+
>>> df = pd.DataFrame({'A': [1, 2, 3], 'B': [4, 5, 6]})
|
| 58 |
+
>>> is_valid_primary_key(df, 'A')
|
| 59 |
+
True
|
| 60 |
+
|
| 61 |
+
>>> df = pd.DataFrame({'A': [1, 2, 2], 'B': [4, 5, 6]})
|
| 62 |
+
>>> is_valid_primary_key(df, 'A')
|
| 63 |
+
False
|
| 64 |
+
"""
|
| 65 |
+
|
| 66 |
+
if column_name not in df.columns:
|
| 67 |
+
raise ValueError(f"Column '{column_name}' does not exist in the DataFrame.")
|
| 68 |
+
|
| 69 |
+
# Check for NaN values
|
| 70 |
+
if df[column_name].isnull().any():
|
| 71 |
+
return False
|
| 72 |
+
|
| 73 |
+
# Check for unique values
|
| 74 |
+
if not df[column_name].is_unique:
|
| 75 |
+
return False
|
| 76 |
+
|
| 77 |
+
return True
|
| 78 |
+
|
| 79 |
+
def get_non_empty_files(start_path: str, extensions: tuple = ('.fasta', '.fna')) -> str:
|
| 80 |
+
"""Generator that yields non-empty files from a specified directory and its subdirectories based on the given extensions.
|
| 81 |
+
|
| 82 |
+
:param start_path: The path to the directory from which to start the search.
|
| 83 |
+
:type start_path: str
|
| 84 |
+
:param extensions: A tuple of file extensions to look for (default is ('.fasta', '.fna')).
|
| 85 |
+
The function also automatically checks for compressed versions with '.gz'.
|
| 86 |
+
:type extensions: tuple
|
| 87 |
+
:returns: Yields filenames that match the specified extensions and are non-empty.
|
| 88 |
+
:rtype: str
|
| 89 |
+
|
| 90 |
+
"""
|
| 91 |
+
|
| 92 |
+
for dirpath, _, filenames in os.walk(start_path):
|
| 93 |
+
for filename in filenames:
|
| 94 |
+
filepath = os.path.join(dirpath, filename)
|
| 95 |
+
if any(filename.endswith(ext) or filename.endswith(ext + '.gz') for ext in extensions) and os.path.getsize(filepath) > 0:
|
| 96 |
+
yield filename
|
| 97 |
+
|
| 98 |
+
|
| 99 |
+
|
| 100 |
+
def truncate_zero_columns(arr: np.ndarray) -> np.ndarray:
|
| 101 |
+
"""Truncate all trailing columns composed entirely of zeros in a given 2D numpy array.
|
| 102 |
+
|
| 103 |
+
:param arr: Input 2D numpy array.
|
| 104 |
+
:type arr: np.ndarray
|
| 105 |
+
:returns: A new array with trailing zero columns removed.
|
| 106 |
+
:rtype: np.ndarray
|
| 107 |
+
|
| 108 |
+
"""
|
| 109 |
+
|
| 110 |
+
# Iterate over columns from the end
|
| 111 |
+
for idx in range(arr.shape[1]-1, -1, -1):
|
| 112 |
+
if np.any(arr[:, idx]):
|
| 113 |
+
return arr[:, :(idx+1)]
|
| 114 |
+
return np.empty((arr.shape[0], 0))
|
| 115 |
+
|
| 116 |
+
|
| 117 |
+
import os
|
| 118 |
+
|
| 119 |
+
def create_directory_for_filepath(filepath: str) -> None:
|
| 120 |
+
"""Given a file path, creates the underlying directory structure if it doesn't already exist.
|
| 121 |
+
|
| 122 |
+
:param filepath: The path to the file for which the directory structure should be created.
|
| 123 |
+
:type filepath: str
|
| 124 |
+
:raises ValueError: If the provided path is empty or None.
|
| 125 |
+
:raises OSError: If there's an error creating the directory structure.
|
| 126 |
+
|
| 127 |
+
"""
|
| 128 |
+
|
| 129 |
+
if not filepath:
|
| 130 |
+
raise ValueError("The provided filepath is empty or None.")
|
| 131 |
+
|
| 132 |
+
directory = os.path.dirname(filepath)
|
| 133 |
+
|
| 134 |
+
if directory and not os.path.exists(directory):
|
| 135 |
+
try:
|
| 136 |
+
os.makedirs(directory)
|
| 137 |
+
print(f"Directory structure {directory} created successfully.")
|
| 138 |
+
except OSError as e:
|
| 139 |
+
raise OSError(f"Error creating directory structure {directory}. Error: {e}")
|
| 140 |
+
|
| 141 |
+
# Example usage:
|
| 142 |
+
# create_directory_for_filepath("/path/to/directory/that/might/not/exist/filename.txt")
|
| 143 |
+
|
| 144 |
+
def check_file_exists(file_path: str) -> bool:
|
| 145 |
+
"""Checks if the provided file path exists.
|
| 146 |
+
|
| 147 |
+
:param file_path: Path to the file.
|
| 148 |
+
:type file_path: str
|
| 149 |
+
:returns: True if the file exists, raises ValueError otherwise.
|
| 150 |
+
:rtype: bool
|
| 151 |
+
|
| 152 |
+
"""
|
| 153 |
+
if os.path.exists(file_path):
|
| 154 |
+
return True
|
| 155 |
+
else:
|
| 156 |
+
raise ValueError(f"The provided file path '{file_path}' does not exist.")
|
| 157 |
+
|
| 158 |
+
def count_gpus(method="clinfo"):
|
| 159 |
+
"""
|
| 160 |
+
Count the number of available GPUs using the specified method.
|
| 161 |
+
|
| 162 |
+
This function counts the number of NVIDIA and AMD GPUs using the chosen method. By default, it uses the 'clinfo'
|
| 163 |
+
method for AMD GPUs.
|
| 164 |
+
|
| 165 |
+
:param method: The method to use for GPU counting. Choose between 'clinfo' (default) and 'rocm'.
|
| 166 |
+
:type method: str, optional
|
| 167 |
+
|
| 168 |
+
:return: The total number of GPUs detected.
|
| 169 |
+
:rtype: int
|
| 170 |
+
|
| 171 |
+
:raises ValueError: If an unknown method is provided.
|
| 172 |
+
|
| 173 |
+
:raises Exception: If an error occurs while querying AMD GPUs using the specified method.
|
| 174 |
+
|
| 175 |
+
.. note::
|
| 176 |
+
- The 'clinfo' method queries AMD GPUs by running the 'clinfo' command.
|
| 177 |
+
- The 'rocm' method queries AMD GPUs by running 'rocm-smi --list' command.
|
| 178 |
+
|
| 179 |
+
"""
|
| 180 |
+
import torch
|
| 181 |
+
import subprocess
|
| 182 |
+
|
| 183 |
+
# Count NVIDIA GPUs
|
| 184 |
+
nvidia_gpu_count = torch.cuda.device_count()
|
| 185 |
+
|
| 186 |
+
# Count AMD GPUs
|
| 187 |
+
amd_gpu_count = 0
|
| 188 |
+
try:
|
| 189 |
+
if method == "clinfo":
|
| 190 |
+
clinfo_output = subprocess.check_output('clinfo').decode('utf-8')
|
| 191 |
+
amd_gpu_count = clinfo_output.lower().count('device type: gpu')
|
| 192 |
+
elif method == "rocm":
|
| 193 |
+
rocm_output = subprocess.check_output('rocm-smi --list', shell=True).decode('utf-8')
|
| 194 |
+
amd_gpu_count = len(rocm_output.strip().split('\n'))
|
| 195 |
+
else:
|
| 196 |
+
raise ValueError("Unknown method provided. Choose between 'clinfo' and 'rocm'.")
|
| 197 |
+
except Exception as e:
|
| 198 |
+
print(f"Error querying AMD GPUs using method '{method}': {e}")
|
| 199 |
+
|
| 200 |
+
total_gpus = nvidia_gpu_count + amd_gpu_count
|
| 201 |
+
|
| 202 |
+
return total_gpus
|
| 203 |
+
|
| 204 |
+
|
| 205 |
+
|
| 206 |
+
def create_hard_links(source_directory: str, target_directory: str, blacklist: list = []) -> None:
|
| 207 |
+
"""Creates hard links for all files from the source directory to the target directory.
|
| 208 |
+
|
| 209 |
+
:param source_directory: The directory containing the original files.
|
| 210 |
+
:type source_directory: str
|
| 211 |
+
:param target_directory: The directory where hard links will be created.
|
| 212 |
+
:type target_directory: str
|
| 213 |
+
:param blacklist: List of filenames to exclude from creating hard links.
|
| 214 |
+
:type blacklist: list
|
| 215 |
+
:returns: None
|
| 216 |
+
|
| 217 |
+
"""
|
| 218 |
+
|
| 219 |
+
# Ensure the provided directories exist
|
| 220 |
+
if not os.path.exists(source_directory):
|
| 221 |
+
raise ValueError(f"The source directory '{source_directory}' does not exist.")
|
| 222 |
+
if not os.path.exists(target_directory):
|
| 223 |
+
os.makedirs(target_directory)
|
| 224 |
+
|
| 225 |
+
# Iterate through the files in the source directory
|
| 226 |
+
for filename in os.listdir(source_directory):
|
| 227 |
+
source_file_path = os.path.join(source_directory, filename)
|
| 228 |
+
target_file_path = os.path.join(target_directory, filename)
|
| 229 |
+
|
| 230 |
+
# Check for files to skip
|
| 231 |
+
if (filename.startswith('.') or
|
| 232 |
+
filename.startswith('_') or
|
| 233 |
+
os.path.isdir(source_file_path) or
|
| 234 |
+
filename in blacklist):
|
| 235 |
+
continue
|
| 236 |
+
|
| 237 |
+
# Create a hard link
|
| 238 |
+
os.link(source_file_path, target_file_path)
|
| 239 |
+
|
| 240 |
+
return f"Hard links created in {target_directory} from {source_directory}."
|
| 241 |
+
|
| 242 |
+
# Example usage
|
| 243 |
+
# create_hard_links("/path/to/source_directory", "/path/to/target_directory", blacklist=["file_to_skip.txt"])
|
| 244 |
+
|
| 245 |
+
def create_selected_hard_links(source_directory: str, target_directory: str, filenames: list) -> None:
|
| 246 |
+
"""Creates hard links for the specified files from the source directory to the target directory.
|
| 247 |
+
|
| 248 |
+
:param source_directory: The directory containing the original files.
|
| 249 |
+
:type source_directory: str
|
| 250 |
+
:param target_directory: The directory where hard links will be created.
|
| 251 |
+
:type target_directory: str
|
| 252 |
+
:param filenames: List of filenames for which hard links should be created.
|
| 253 |
+
:type filenames: list
|
| 254 |
+
:returns: None
|
| 255 |
+
|
| 256 |
+
"""
|
| 257 |
+
|
| 258 |
+
# Ensure the provided directories exist
|
| 259 |
+
if not os.path.exists(source_directory):
|
| 260 |
+
raise ValueError(f"The source directory '{source_directory}' does not exist.")
|
| 261 |
+
if not os.path.exists(target_directory):
|
| 262 |
+
os.makedirs(target_directory)
|
| 263 |
+
|
| 264 |
+
# Iterate through the specified filenames
|
| 265 |
+
for filename in filenames:
|
| 266 |
+
source_file_path = os.path.join(source_directory, filename)
|
| 267 |
+
target_file_path = os.path.join(target_directory, filename)
|
| 268 |
+
|
| 269 |
+
# Ensure the file exists in the source directory
|
| 270 |
+
if not os.path.isfile(source_file_path):
|
| 271 |
+
print(f"Warning: {filename} does not exist in the source directory. Skipping.")
|
| 272 |
+
continue
|
| 273 |
+
|
| 274 |
+
# Create a hard link
|
| 275 |
+
try:
|
| 276 |
+
os.link(source_file_path, target_file_path)
|
| 277 |
+
except FileExistsError:
|
| 278 |
+
print(f'The target hard link {target_file_path} exist. Skipping...')
|
| 279 |
+
|
| 280 |
+
return f"Hard links for specified files created in {target_directory} from {source_directory}."
|
| 281 |
+
|
| 282 |
+
def remove_hidden_files(directory: str) -> None:
|
| 283 |
+
"""Removes all files recursively in a folder that start with '.' or '_'.
|
| 284 |
+
|
| 285 |
+
:param directory: The directory from which hidden files should be removed.
|
| 286 |
+
:type directory: str
|
| 287 |
+
:returns: None
|
| 288 |
+
|
| 289 |
+
"""
|
| 290 |
+
|
| 291 |
+
# Ensure the directory exists
|
| 292 |
+
if not os.path.exists(directory):
|
| 293 |
+
raise ValueError(f"The directory '{directory}' does not exist.")
|
| 294 |
+
|
| 295 |
+
# Use os.walk to iterate through all subdirectories and files
|
| 296 |
+
for dirpath, dirnames, filenames in os.walk(directory, topdown=False):
|
| 297 |
+
|
| 298 |
+
# Filter out directories starting with '.' or '_'
|
| 299 |
+
dirnames[:] = [d for d in dirnames if not d.startswith('.') and not d.startswith('_')]
|
| 300 |
+
|
| 301 |
+
# Remove files starting with '.' or '_'
|
| 302 |
+
for filename in filenames:
|
| 303 |
+
if filename.startswith('.') or filename.startswith('_'):
|
| 304 |
+
file_path = os.path.join(dirpath, filename)
|
| 305 |
+
os.remove(file_path)
|
| 306 |
+
print(f"Removed: {file_path}")
|
| 307 |
+
|
| 308 |
+
print(f"All hidden files removed from {directory}.")
|
| 309 |
+
|
sequtils.py
ADDED
|
@@ -0,0 +1,980 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
|
| 2 |
+
import logging
|
| 3 |
+
|
| 4 |
+
logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(levelname)s - %(message)s')
|
| 5 |
+
# coding=utf-8
|
| 6 |
+
|
| 7 |
+
""" Library for sequence processing """
|
| 8 |
+
|
| 9 |
+
|
| 10 |
+
import os
|
| 11 |
+
import sys
|
| 12 |
+
import pandas as pd
|
| 13 |
+
from multiprocessing import Pool
|
| 14 |
+
import multiprocessing
|
| 15 |
+
from os.path import join, isfile, splitext
|
| 16 |
+
from os import listdir
|
| 17 |
+
import random
|
| 18 |
+
from Bio import SeqIO
|
| 19 |
+
import numpy as np
|
| 20 |
+
import math
|
| 21 |
+
import gzip
|
| 22 |
+
from mimetypes import guess_type
|
| 23 |
+
from functools import partial
|
| 24 |
+
import operator
|
| 25 |
+
import pathlib
|
| 26 |
+
#from typing import Dict, List, Type, Tuple
|
| 27 |
+
from itertools import product
|
| 28 |
+
from typing import List, Union, Dict, Any, Optional, Tuple, Type, Set
|
| 29 |
+
from .general_utils import *
|
| 30 |
+
from Bio.Seq import Seq
|
| 31 |
+
from Bio.SeqRecord import SeqRecord
|
| 32 |
+
from scipy.ndimage import convolve1d
|
| 33 |
+
import h5py
|
| 34 |
+
|
| 35 |
+
def load_contigs(
|
| 36 |
+
fasta_files_list: Union[List[str], str],
|
| 37 |
+
adding_reverse_complement: bool = True,
|
| 38 |
+
IsAddHeader: bool = False,
|
| 39 |
+
AsDataFrame: bool = False,
|
| 40 |
+
to_uppercase: bool = False,
|
| 41 |
+
is_add_sequence_id: bool = False
|
| 42 |
+
) -> Union[List[Union[str, List[str]]], pd.DataFrame]:
|
| 43 |
+
"""
|
| 44 |
+
Loads contigs from a list of FASTA files.
|
| 45 |
+
|
| 46 |
+
:param fasta_files_list: List of paths to FASTA files or a single file path. Compressed (gz) FASTA files are accepted.
|
| 47 |
+
:type fasta_files_list: Union[List[str], str]
|
| 48 |
+
:param adding_reverse_complement: If True, adds the reverse complement of each sequence. Defaults to True.
|
| 49 |
+
:type adding_reverse_complement: bool
|
| 50 |
+
:param IsAddHeader: If True, includes the FASTA ID and description in the output. Defaults to False.
|
| 51 |
+
:type IsAddHeader: bool
|
| 52 |
+
:param AsDataFrame: If True, returns the sequences as a pandas DataFrame. Defaults to False.
|
| 53 |
+
:type AsDataFrame: bool
|
| 54 |
+
:param to_uppercase: If True, converts sequences to uppercase. Defaults to False.
|
| 55 |
+
:type to_uppercase: bool
|
| 56 |
+
:param is_add_sequence_id: If True, adds a unique integer sequence ID to each sequence. Defaults to False.
|
| 57 |
+
:type is_add_sequence_id: bool
|
| 58 |
+
:return: The loaded sequences. Each sequence is represented as a string if IsAddHeader is False, or as a list
|
| 59 |
+
[sequence_id, fasta_id, description, source_file, sequence, orientation] if IsAddHeader is True and is_add_sequence_id is True.
|
| 60 |
+
If AsDataFrame is True, the sequences are returned as a DataFrame.
|
| 61 |
+
:rtype: Union[List[Union[str, List[str]]], pd.DataFrame]
|
| 62 |
+
|
| 63 |
+
Example:
|
| 64 |
+
>>> fasta_files = ['path/to/file1.fasta', 'path/to/file2.fasta.gz']
|
| 65 |
+
>>> load_contigs(fasta_files, adding_reverse_complement=False, IsAddHeader=True, AsDataFrame=True, to_uppercase=True, is_add_sequence_id=True)
|
| 66 |
+
# Returns a DataFrame with the sequences from the specified FASTA files, all in uppercase, with unique sequence IDs.
|
| 67 |
+
"""
|
| 68 |
+
|
| 69 |
+
logging.info('Loading sequence data into memory!')
|
| 70 |
+
if isinstance(fasta_files_list, str):
|
| 71 |
+
logging.info('Since the fasta_files_list is a string, not a list, we convert it to a list.')
|
| 72 |
+
fasta_files_list = [fasta_files_list]
|
| 73 |
+
|
| 74 |
+
sequences = []
|
| 75 |
+
sequence_id = 0
|
| 76 |
+
df_cols = ['sequence_id', 'fasta_id', 'description', 'source_file', 'sequence', 'orientation'] if (IsAddHeader and is_add_sequence_id) else ['fasta_id', 'description', 'source_file', 'sequence', 'orientation'] if IsAddHeader else ['sequence']
|
| 77 |
+
for act_assembly in fasta_files_list:
|
| 78 |
+
# Determine the file encoding based on the file extension
|
| 79 |
+
encoding = guess_type(act_assembly)[1]
|
| 80 |
+
_open = partial(gzip.open, mode='rt') if encoding == 'gzip' else open
|
| 81 |
+
with _open(act_assembly) as f_assembly:
|
| 82 |
+
# Parse the fasta file
|
| 83 |
+
contigs = list(SeqIO.parse(f_assembly, "fasta"))
|
| 84 |
+
for contig in contigs:
|
| 85 |
+
act_seq = str(contig.seq)[:] if not to_uppercase else str(contig.seq).upper()[:]
|
| 86 |
+
act_header = str(contig.id)
|
| 87 |
+
act_description = str(contig.description)
|
| 88 |
+
if adding_reverse_complement:
|
| 89 |
+
# Compute the reverse complement of the sequence
|
| 90 |
+
act_reverse_complement = str(contig.seq.reverse_complement()) if not to_uppercase else str(contig.seq.reverse_complement()).upper()
|
| 91 |
+
|
| 92 |
+
if IsAddHeader:
|
| 93 |
+
# Include sequence ID (if applicable), fasta ID, description, source file, sequence, and orientation in the output
|
| 94 |
+
entry = [sequence_id] if is_add_sequence_id else []
|
| 95 |
+
entry.extend([act_header, act_description, act_assembly, act_seq, 'forward'])
|
| 96 |
+
sequences.append(entry)
|
| 97 |
+
if adding_reverse_complement:
|
| 98 |
+
entry = [sequence_id + 1] if is_add_sequence_id else []
|
| 99 |
+
entry.extend([act_header, act_description, act_assembly, act_reverse_complement, 'reverse'])
|
| 100 |
+
sequences.append(entry)
|
| 101 |
+
if is_add_sequence_id:
|
| 102 |
+
sequence_id += 2
|
| 103 |
+
else:
|
| 104 |
+
sequence_id+=1
|
| 105 |
+
else:
|
| 106 |
+
# Only include the sequence in the output
|
| 107 |
+
sequences.append(act_seq)
|
| 108 |
+
if adding_reverse_complement:
|
| 109 |
+
sequences.append(act_reverse_complement)
|
| 110 |
+
|
| 111 |
+
if AsDataFrame:
|
| 112 |
+
# Convert the sequences to a DataFrame
|
| 113 |
+
sequences = pd.DataFrame(sequences, columns=df_cols)
|
| 114 |
+
return sequences
|
| 115 |
+
|
| 116 |
+
|
| 117 |
+
def segment_sequence_contiguous(
|
| 118 |
+
sequence: str,
|
| 119 |
+
params: Dict[str, Any],
|
| 120 |
+
sequence_id: Optional[Any] = np.nan
|
| 121 |
+
) -> List[Dict[str, Any]]:
|
| 122 |
+
"""
|
| 123 |
+
Creates end-to-end, disjoint segments of a sequence without overlaps.
|
| 124 |
+
|
| 125 |
+
Segments smaller than the predefined minimum length will be discarded.
|
| 126 |
+
This function returns a list of segments along with their positions in the original sequence.
|
| 127 |
+
|
| 128 |
+
:param sequence: The input nucleotide sequence to be segmented.
|
| 129 |
+
:type sequence: str
|
| 130 |
+
:param params: Dictionary containing the segmentation parameters. Must include 'min_length' and 'max_length' keys
|
| 131 |
+
specifying the minimum and maximum lengths of the segments, respectively. Can contain other parameters.
|
| 132 |
+
:type params: Dict[str, Any]
|
| 133 |
+
:param sequence_id: An identifier for the sequence, optional. Defaults to NaN.
|
| 134 |
+
:type sequence_id: Optional[Any]
|
| 135 |
+
:return: A list of dictionaries, each representing a segment. Each dictionary contains the segment's sequence,
|
| 136 |
+
start position, end position, and sequence ID.
|
| 137 |
+
:rtype: List[Dict[str, Any]]
|
| 138 |
+
|
| 139 |
+
Example:
|
| 140 |
+
>>> params = {'min_length': 0, 'max_length': 100}
|
| 141 |
+
>>> segment_sequence_contiguous('ATCGATCGA', params)
|
| 142 |
+
[{'segment': 'ATCGATCGA', 'segment_start': 0, 'segment_end': 9, 'sequence_id': np.nan}]
|
| 143 |
+
"""
|
| 144 |
+
|
| 145 |
+
# Extract segmentation parameters
|
| 146 |
+
min_segment_len = params['min_length']
|
| 147 |
+
max_segment_len = params['max_length']
|
| 148 |
+
|
| 149 |
+
# Ensure the sequence is treated as a string
|
| 150 |
+
if isinstance(sequence, str):
|
| 151 |
+
act_seq = sequence
|
| 152 |
+
L = len(sequence)
|
| 153 |
+
|
| 154 |
+
segments = []
|
| 155 |
+
for i in range(0, L, max_segment_len):
|
| 156 |
+
act_start_pos = i
|
| 157 |
+
act_end_pos = min(i + max_segment_len, L)
|
| 158 |
+
act_segment = sequence[act_start_pos:act_end_pos]
|
| 159 |
+
|
| 160 |
+
|
| 161 |
+
|
| 162 |
+
# Add segment to the list if it's longer than the minimum length
|
| 163 |
+
if len(act_segment) >= min_segment_len:
|
| 164 |
+
new_record = {
|
| 165 |
+
'segment': act_segment,
|
| 166 |
+
'segment_start': act_start_pos,
|
| 167 |
+
'segment_end': act_end_pos,
|
| 168 |
+
'sequence_id': sequence_id
|
| 169 |
+
}
|
| 170 |
+
segments.append(new_record)
|
| 171 |
+
|
| 172 |
+
return segments
|
| 173 |
+
|
| 174 |
+
|
| 175 |
+
|
| 176 |
+
def segment_sequences_random(
|
| 177 |
+
sequences: Union[pd.DataFrame, List[str]],
|
| 178 |
+
params: Dict[str, Union[int, float, str, Dict, List, Tuple]]
|
| 179 |
+
) -> List[Dict[str, Union[int, str]]]:
|
| 180 |
+
"""
|
| 181 |
+
Randomly segments the input sequences.
|
| 182 |
+
|
| 183 |
+
This function accepts either a list of sequences or a DataFrame containing sequences.
|
| 184 |
+
If a DataFrame is provided, it's assumed to have preprocessed sequences with "sequence" and "sequence_id" columns,
|
| 185 |
+
where "sequence_id" is a valid primary key. The function returns a list of dictionaries,
|
| 186 |
+
each containing details of a segment including its sequence, start position, end position,
|
| 187 |
+
associated sequence ID, and a segment ID (not generated in this function).
|
| 188 |
+
|
| 189 |
+
:param sequences: A DataFrame containing sequences with "sequence" and "sequence_id" columns or a list of sequences.
|
| 190 |
+
:type sequences: Union[pd.DataFrame, List[str]]
|
| 191 |
+
:param params: Dictionary containing segmentation parameters such as 'coverage', 'min_length', and 'max_length'.
|
| 192 |
+
:type params: Dict[str, Union[int, float, str, Dict, List, Tuple]]
|
| 193 |
+
:return: A list of dictionaries with each containing details of a segment.
|
| 194 |
+
:rtype: List[Dict[str, Union[int, str]]]
|
| 195 |
+
|
| 196 |
+
Notes:
|
| 197 |
+
- The actual number of segments may differ from the expected number due to random sampling and sequences
|
| 198 |
+
being shorter than the specified segment size.
|
| 199 |
+
- Segment IDs are not generated by this function.
|
| 200 |
+
"""
|
| 201 |
+
|
| 202 |
+
# Calculate sequence lengths and cumulative sum of lengths
|
| 203 |
+
sequences['seq_lengths'] = sequences.apply(lambda x: len(x['sequence']), axis=1)
|
| 204 |
+
sequences['lenght_cum_sum'] = sequences['seq_lengths'].cumsum()
|
| 205 |
+
Lseqs = sum(sequences['seq_lengths'])
|
| 206 |
+
|
| 207 |
+
# Calculate the number of segments to sample based on expected coverage.
|
| 208 |
+
# Note: The actual number might be biased if many sequences are "short" compared to the segment sizes.
|
| 209 |
+
N_segments = int(np.ceil(params['coverage'] * Lseqs / params['max_length']))
|
| 210 |
+
logging.info(f'Sampling {N_segments} segments from {len(sequences)} sequences.')
|
| 211 |
+
|
| 212 |
+
# Generate random starting coordinates for segments
|
| 213 |
+
start_coords = list(np.sort(np.int64(np.random.uniform(0, sequences['lenght_cum_sum'].max(), N_segments))))
|
| 214 |
+
segmentdb = []
|
| 215 |
+
|
| 216 |
+
for sid, act_sampling_coord in enumerate(start_coords):
|
| 217 |
+
|
| 218 |
+
diff = act_sampling_coord - sequences['lenght_cum_sum']
|
| 219 |
+
|
| 220 |
+
# Find the sequence in which the current segment starts
|
| 221 |
+
for i in range(len(sequences['lenght_cum_sum'])):
|
| 222 |
+
if diff[i] < 0:
|
| 223 |
+
break
|
| 224 |
+
|
| 225 |
+
act_sequence_id = sequences['sequence_id'].iloc[i]
|
| 226 |
+
rel_coord = act_sampling_coord - sequences['lenght_cum_sum'].iloc[i] + sequences['seq_lengths'].iloc[i]
|
| 227 |
+
|
| 228 |
+
segment_end = min(rel_coord + params['max_length'], sequences['seq_lengths'].iloc[i])
|
| 229 |
+
|
| 230 |
+
# Skip the segment if it's shorter than the minimum segment length
|
| 231 |
+
if segment_end - rel_coord < params['min_length']:
|
| 232 |
+
pred_seqgment = sequences['sequence'].iloc[i][rel_coord:segment_end]
|
| 233 |
+
minimum_len = params['min_length']
|
| 234 |
+
logging.info(f'Too short segment, skip! Sampled segment: {pred_seqgment}, Segment end coordinate: {segment_end}, relative coordinate: {rel_coord}, minimum length is: {minimum_len}')
|
| 235 |
+
continue
|
| 236 |
+
|
| 237 |
+
new_segment = sequences['sequence'].iloc[i][rel_coord:segment_end]
|
| 238 |
+
new_record = {
|
| 239 |
+
'sequence_id': act_sequence_id,
|
| 240 |
+
'segment_start': rel_coord,
|
| 241 |
+
'segment_end': segment_end,
|
| 242 |
+
'segment': new_segment,
|
| 243 |
+
'segment_id': str(sid)
|
| 244 |
+
}
|
| 245 |
+
|
| 246 |
+
segmentdb.append(new_record)
|
| 247 |
+
|
| 248 |
+
return segmentdb
|
| 249 |
+
|
| 250 |
+
def segment_sequences(
|
| 251 |
+
sequences: Union[List[str], pd.DataFrame],
|
| 252 |
+
params: Dict[str, Union[int, float, str, ]],
|
| 253 |
+
AsDataFrame: bool = False
|
| 254 |
+
) -> Union[List[str], pd.DataFrame]:
|
| 255 |
+
"""
|
| 256 |
+
Segments sequences based on the provided parameters.
|
| 257 |
+
|
| 258 |
+
This function assumes that the sequence is quality controlled and preprocessed, i.e., it is a valid nucleotide sequence.
|
| 259 |
+
If sequences are provided as a DataFrame, then it is assumed that there is a "sequence_id" and
|
| 260 |
+
a "sequence" attribute. The "sequence_id" should be a valid primary key.
|
| 261 |
+
If the output is requested as a DataFrame, then the IDs are added as well.
|
| 262 |
+
|
| 263 |
+
:param sequences: A list of sequences or a DataFrame containing sequences.
|
| 264 |
+
If a DataFrame, it must have "sequence_id" and "sequence" attributes.
|
| 265 |
+
:type sequences: Union[List[str], pd.DataFrame]
|
| 266 |
+
:param params: Dictionary containing the segmentation parameters.
|
| 267 |
+
- 'type' (str): The type of segmentation ('contiguous' or 'random').
|
| 268 |
+
- 'min_length' (int): Minimum length of a segment.
|
| 269 |
+
- 'max_length' (int): Maximum length of a segment.
|
| 270 |
+
- 'coverage' (float): Coverage percentage for random segmentation.
|
| 271 |
+
:type params: Dict[str, Union[int, float, str, Dict[str, int], List[int], Tuple[int, int]]]
|
| 272 |
+
:param AsDataFrame: If True, the output will be a DataFrame. If False, it will be a list. Defaults to False.
|
| 273 |
+
:type AsDataFrame: bool
|
| 274 |
+
:return: List of segmented sequences or a DataFrame with segmented sequences and their corresponding information based on the `AsDataFrame` parameter.
|
| 275 |
+
:rtype: Union[List[str], pd.DataFrame]
|
| 276 |
+
:raises ValueError: If the provided sequences DataFrame does not have the required attributes.
|
| 277 |
+
:raises ValueError: If the "sequence_id" column is not a valid primary key.
|
| 278 |
+
|
| 279 |
+
Examples:
|
| 280 |
+
>>> segment_sequences(['AATCAATTTTATTT', 'AGCCGATTCAATTGCATTATTT'], {'type': 'contiguous', 'min_length': 1, 'max_length': 1000, 'coverage': 1.0})
|
| 281 |
+
"""
|
| 282 |
+
|
| 283 |
+
segmentation_type = params['type']
|
| 284 |
+
|
| 285 |
+
# Checking for primary key and sequence attribute???
|
| 286 |
+
expected_attributes = ['sequence_id', 'sequence']
|
| 287 |
+
return_cols = ['segment_id', 'sequence_id', 'segment_start', 'segment_end', 'segment']
|
| 288 |
+
|
| 289 |
+
if isinstance(sequences, list):
|
| 290 |
+
logging.info('Sequences is a list, therefore ignoring ids and tracking information. ')
|
| 291 |
+
IsSequenceId = None
|
| 292 |
+
IsSeqList = True
|
| 293 |
+
elif isinstance(sequences, pd.DataFrame):
|
| 294 |
+
#logging.info('Sequences is a list, therefore adding tracking information.')
|
| 295 |
+
logging.info('Checking input DataFrame!')
|
| 296 |
+
check_expected_columns(sequences, expected_attributes)
|
| 297 |
+
logging.info('Checking input sequence_id is valid primary key in the DataFrame')
|
| 298 |
+
is_valid_primary_key(sequences, 'sequence_id')
|
| 299 |
+
IsSequenceId = True
|
| 300 |
+
IsSeqList=False
|
| 301 |
+
|
| 302 |
+
segments = []
|
| 303 |
+
if segmentation_type == 'contiguous':
|
| 304 |
+
if IsSeqList:
|
| 305 |
+
if IsSequenceId:
|
| 306 |
+
for act_seq_id, seq in enumerate(sequences):
|
| 307 |
+
act_segments = segment_sequence_contiguous(seq, params, act_seq_id)
|
| 308 |
+
segments.extend(act_segments)
|
| 309 |
+
else:
|
| 310 |
+
for seq in sequences:
|
| 311 |
+
act_segments = segment_sequence_contiguous(seq, params)
|
| 312 |
+
segments.extend(act_segments)
|
| 313 |
+
else:
|
| 314 |
+
for _, rec in sequences.iterrows():
|
| 315 |
+
act_seq = rec['sequence']
|
| 316 |
+
act_seq_id = rec['sequence_id']
|
| 317 |
+
act_segments = segment_sequence_contiguous(act_seq, params, act_seq_id)
|
| 318 |
+
segments.extend(act_segments)
|
| 319 |
+
|
| 320 |
+
elif segmentation_type == 'random':
|
| 321 |
+
if IsSeqList:
|
| 322 |
+
seqeunce_df = pd.DataFrame(sequences,
|
| 323 |
+
columns = ['sequence'])
|
| 324 |
+
seqeunce_df['sequence_id'] = list(range(len(sequences)))
|
| 325 |
+
segments = segment_sequences_random(seqeunce_df, params)
|
| 326 |
+
|
| 327 |
+
else:
|
| 328 |
+
segments = segment_sequences_random(sequences, params)
|
| 329 |
+
if AsDataFrame:
|
| 330 |
+
#logging.info('Creating a DataFrame from the segments. ')
|
| 331 |
+
segment_db = pd.DataFrame(segments)
|
| 332 |
+
segment_ids = list(range(len(segment_db)))
|
| 333 |
+
segment_db['segment_id'] = segment_ids
|
| 334 |
+
segment_db = segment_db[return_cols]
|
| 335 |
+
|
| 336 |
+
else:
|
| 337 |
+
segment_db = [seg['segment'] for seg in segments]
|
| 338 |
+
return segment_db
|
| 339 |
+
|
| 340 |
+
def lca_kmer_tokenize_segment(segment: str, offset: int, params: Dict[str, Dict[str, int] | int | float]):
|
| 341 |
+
# calculate the tokenization for one offset value
|
| 342 |
+
shift = params['shift']
|
| 343 |
+
max_segment_length = params['max_segment_length']
|
| 344 |
+
max_unknown_token_proportion = params['max_unknown_token_proportion']
|
| 345 |
+
kmer = params['kmer']
|
| 346 |
+
token_limit = params['token_limit']
|
| 347 |
+
vocabmap = params['vocabmap']
|
| 348 |
+
add_special_token = params['add_special_token']
|
| 349 |
+
if len(segment) > max_segment_length:
|
| 350 |
+
raise(ValueError(f'The segment is longer {len(segment)} then the maximum allowed segment length ({max_segment_length}). '))
|
| 351 |
+
|
| 352 |
+
kmers = [segment[i:i + kmer] for i in range(offset, len(segment) - kmer + 1, shift)]
|
| 353 |
+
|
| 354 |
+
return kmers
|
| 355 |
+
|
| 356 |
+
|
| 357 |
+
|
| 358 |
+
|
| 359 |
+
|
| 360 |
+
def lca_tokenize_segment(segment: str, params: Dict[str, Dict[str, int] | int | float]) -> Tuple[List[List[int]], List[List[str]]]:
|
| 361 |
+
"""
|
| 362 |
+
Tokenizes a single segment using Local Context Aware (LCA) tokenization.
|
| 363 |
+
The segment is first split into k-mers with specified shifts and then tokenized into token vectors.
|
| 364 |
+
|
| 365 |
+
:param segment: The input nucleotide sequence segment to be tokenized.
|
| 366 |
+
:type segment: str
|
| 367 |
+
:param params: Dictionary containing the tokenization parameters.
|
| 368 |
+
- 'shift' (int): The k-mer shift parameter.
|
| 369 |
+
- 'max_segment_length' (int): Maximum allowable segment length.
|
| 370 |
+
- 'max_unknown_token_proportion' (float): Maximum allowable proportion of unknown tokens in a segment.
|
| 371 |
+
- 'kmer' (int): Size of the k-mer.
|
| 372 |
+
- 'token_limit' (int): Maximum number of tokens allowed in the tokenized output.
|
| 373 |
+
- 'vocabmap' (dict[str, int]): Dictionary mapping k-mers to their respective token values.
|
| 374 |
+
:type params: dict
|
| 375 |
+
:returns: A tuple containing:
|
| 376 |
+
- list[list[int]]: List of tokenized segments (each segment as a list of integers).
|
| 377 |
+
- list[list[str]]: List of k-merized segments with different shifts (each segment as a list of strings).
|
| 378 |
+
:rtype: Tuple[List[List[int]], List[List[str]]]
|
| 379 |
+
:raises ValueError: If the segment length exceeds the `max_segment_length`.
|
| 380 |
+
|
| 381 |
+
Examples:
|
| 382 |
+
>>> vocabmap_example = {"[CLS]": 2, "[SEP]": 3, "[UNK]": 0, "TCTTT": 4, "CTTTG": 5, "TTTGC": 6, "TTGCT": 7}
|
| 383 |
+
>>> segment_example = 'TCTTTGCTAAG'
|
| 384 |
+
>>> params_example = {'shift': 1, 'max_segment_length': 512, 'max_unknown_token_proportion': 0.2, 'kmer': 5, 'token_limit': 10, 'vocabmap': vocabmap_example}
|
| 385 |
+
>>> lca_tokenize_segment(segment_example, params_example)
|
| 386 |
+
([[2, 4, 5, 6, 7, 3]], [['TCTTT', 'CTTTG', 'TTTGC', 'TTGCT']])
|
| 387 |
+
"""
|
| 388 |
+
|
| 389 |
+
|
| 390 |
+
#logging.info('Tokenizing a segment')
|
| 391 |
+
shift = params['shift']
|
| 392 |
+
max_segment_length = params['max_segment_length']
|
| 393 |
+
max_unknown_token_proportion = params['max_unknown_token_proportion']
|
| 394 |
+
kmer = params['kmer']
|
| 395 |
+
token_limit = params['token_limit']
|
| 396 |
+
vocabmap = params['vocabmap']
|
| 397 |
+
add_special_token = params['add_special_token']
|
| 398 |
+
if len(segment) > max_segment_length:
|
| 399 |
+
raise(ValueError(f'The segment is longer {len(segment)} then the maximum allowed segment length ({max_segment_length}). '))
|
| 400 |
+
|
| 401 |
+
kmers_offset = []
|
| 402 |
+
# For every pssoble offset and window we should get a k-mer vector.
|
| 403 |
+
# If the segmen is too short or non-existent, then we might have a problem. So, please ensure the segment
|
| 404 |
+
for offset in range(shift):
|
| 405 |
+
kmers = [segment[i:i + kmer] for i in range(offset, len(segment) - kmer + 1, shift)]
|
| 406 |
+
kmers_offset.append(kmers)
|
| 407 |
+
# Mapping the k-mers into numbers
|
| 408 |
+
tokenized_segments = tokenize_kmerized_segment_list(kmers_offset, vocabmap, token_limit, max_unknown_token_proportion, add_special_token)
|
| 409 |
+
return tokenized_segments, kmers_offset
|
| 410 |
+
|
| 411 |
+
|
| 412 |
+
|
| 413 |
+
def tokenize_kmerized_segment_list(kmerized_segments: List[List[str]],
|
| 414 |
+
vocabmap: Dict[str, int],
|
| 415 |
+
token_limit: int,
|
| 416 |
+
max_unknown_token_proportion: float,
|
| 417 |
+
add_special_tokens: bool = True) -> List[List[int]]:
|
| 418 |
+
"""Tokenizes or vectorizes a list of k-merized segments into a list of token vectors. If the expected number of
|
| 419 |
+
tokens in a segment exceeds the maximum allowed tokens (`token_limit`), the function raises an error. For segments
|
| 420 |
+
where unknown k-mers exceed the proportion set by `max_unknown_token_proportion`, the output is a special token
|
| 421 |
+
sequence indicating an empty sentence.
|
| 422 |
+
|
| 423 |
+
:param kmerized_segments: List containing k-merized segments.
|
| 424 |
+
:type kmerized_segments: List[List[str]]
|
| 425 |
+
:param vocabmap: Dictionary that maps k-mers to their respective token values.
|
| 426 |
+
:type vocabmap: Dict[str, int]
|
| 427 |
+
:param token_limit: Maximum number of tokens allowed in the tokenized output.
|
| 428 |
+
:type token_limit: int
|
| 429 |
+
:param max_unknown_token_proportion: Maximum allowable proportion of unknown tokens in a segment.
|
| 430 |
+
:type max_unknown_token_proportion: float
|
| 431 |
+
:param add_special_tokens: Whether to add special tokens (`[CLS]` and `[SEP]`) to the tokenized segments.
|
| 432 |
+
:type add_special_tokens: bool, optional (default=True)
|
| 433 |
+
:returns: List containing tokenized segments.
|
| 434 |
+
:rtype: List[List[int]]
|
| 435 |
+
:raises ValueError: If the expected number of tokens in a segment exceeds `token_limit`.
|
| 436 |
+
|
| 437 |
+
Examples
|
| 438 |
+
--------
|
| 439 |
+
|
| 440 |
+
>>> vocabmap_example = {"[CLS]": 2, "[SEP]": 3, "[UNK]": 0, "TCTTTG": 4, "CTTTGC": 5, "TTTGCT": 6, "TTGCTA": 7}
|
| 441 |
+
>>> kmerized_segment_example = [['TCTTTG', 'CTTTGC', 'TTTGCT', 'TTGCTA']]
|
| 442 |
+
>>> tokenize_kmerized_segment_list(kmerized_segment_example, vocabmap_example, 10, 0.2)
|
| 443 |
+
[[2, 4, 5, 6, 7, 3]]
|
| 444 |
+
"""
|
| 445 |
+
|
| 446 |
+
tokenized_segments = []
|
| 447 |
+
if add_special_tokens:
|
| 448 |
+
empty_sentence = [2, 3]
|
| 449 |
+
else:
|
| 450 |
+
empty_sentence = []
|
| 451 |
+
|
| 452 |
+
for act_kmer_list in kmerized_segments:
|
| 453 |
+
if add_special_tokens:
|
| 454 |
+
tokenized_kmerized_segment = [vocabmap['[CLS]']]
|
| 455 |
+
else:
|
| 456 |
+
tokenized_kmerized_segment = []
|
| 457 |
+
unkcount=0
|
| 458 |
+
L_kmerized_segment = len(act_kmer_list)
|
| 459 |
+
unkw_tsh_count = int(L_kmerized_segment*max_unknown_token_proportion)
|
| 460 |
+
if len(act_kmer_list)+2 > token_limit:
|
| 461 |
+
raise(ValueError(f'The expected number of tokens in the segment ({L_kmerized_segment+2}) is larger, then the maximum allowed number of tokens = ({token_limit}). '))
|
| 462 |
+
if L_kmerized_segment == 0:
|
| 463 |
+
logging.info('Its and empty sentence')
|
| 464 |
+
tokenized_kmerized_segment = empty_sentence
|
| 465 |
+
tokenized_segments.append(empty_sentence)
|
| 466 |
+
continue
|
| 467 |
+
for kmer in act_kmer_list:
|
| 468 |
+
try:
|
| 469 |
+
tokenized_kmerized_segment.append(vocabmap[kmer.upper()])
|
| 470 |
+
except KeyError:
|
| 471 |
+
tokenized_kmerized_segment.append(vocabmap['[UNK]'])
|
| 472 |
+
unkcount+=1
|
| 473 |
+
if unkcount > unkw_tsh_count:
|
| 474 |
+
tokenized_segments.append(empty_sentence)
|
| 475 |
+
continue
|
| 476 |
+
if add_special_tokens:
|
| 477 |
+
tokenized_kmerized_segment.append(vocabmap['[SEP]'])
|
| 478 |
+
tokenized_segments.append(tokenized_kmerized_segment)
|
| 479 |
+
|
| 480 |
+
return tokenized_segments
|
| 481 |
+
|
| 482 |
+
def process_batch_tokenize_segments_with_ids(
|
| 483 |
+
segments: List[str],
|
| 484 |
+
segment_ids: List[Any],
|
| 485 |
+
tokenization_params: Dict[str, Any],
|
| 486 |
+
np_token_type: type = np.uint16
|
| 487 |
+
) -> Dict[Any, List[np.ndarray]]:
|
| 488 |
+
"""
|
| 489 |
+
Tokenizes a batch of segments and associates them with their provided IDs.
|
| 490 |
+
|
| 491 |
+
This function generates vector representations for a collection of segments, assuming the segments
|
| 492 |
+
have undergone quality control. The result is a dictionary where the keys are segment IDs, and the values
|
| 493 |
+
are lists of potential vector representations for the segment, with each list element corresponding to
|
| 494 |
+
a specific shift.
|
| 495 |
+
|
| 496 |
+
The vector representations are converted to numpy arrays. The output is not a 2D rectangular array but
|
| 497 |
+
a dictionary mapping each segment ID to its tokenized representations.
|
| 498 |
+
|
| 499 |
+
:param segments: A list of preprocessed and validated segments.
|
| 500 |
+
:type segments: List[str]
|
| 501 |
+
:param segment_ids: A list of segment IDs corresponding to each segment in `segments`.
|
| 502 |
+
:type segment_ids: List[Any]
|
| 503 |
+
:param tokenization_params: A dictionary containing tokenization parameters.
|
| 504 |
+
:type tokenization_params: Dict[str, Any]
|
| 505 |
+
:param np_token_type: Numpy data type for the tokenized segments. Defaults to np.uint16.
|
| 506 |
+
:type np_token_type: type, optional
|
| 507 |
+
:return: A dictionary with segment IDs as keys and lists of numpy arrays representing tokenized segments as values.
|
| 508 |
+
:rtype: Dict[Any, List[np.ndarray]]
|
| 509 |
+
|
| 510 |
+
Example:
|
| 511 |
+
>>> segments = ['ACTG', 'TGCA']
|
| 512 |
+
>>> segment_ids = [1, 2]
|
| 513 |
+
>>> tokenization_params = {'max_segment_length': 50, ...}
|
| 514 |
+
>>> tokenized_segments = process_batch_tokenize_segments_with_ids(
|
| 515 |
+
segments, segment_ids, tokenization_params
|
| 516 |
+
)
|
| 517 |
+
"""
|
| 518 |
+
tokenized_segments_with_ids = {}
|
| 519 |
+
for i, segment in enumerate(segments):
|
| 520 |
+
act_id = segment_ids[i]
|
| 521 |
+
tokenized_segments_with_ids[act_id] = []
|
| 522 |
+
max_segment_length = tokenization_params['max_segment_length']
|
| 523 |
+
if len(segment) > max_segment_length:
|
| 524 |
+
raise ValueError(f'The segment is longer ({len(segment)}) than the maximum allowed segment length ({max_segment_length}).')
|
| 525 |
+
|
| 526 |
+
tokenized_segment, _ = lca_tokenize_segment(segment, tokenization_params)
|
| 527 |
+
tokenized_segment = [np.array(act_segment, dtype=np_token_type) for act_segment in tokenized_segment]
|
| 528 |
+
tokenized_segments_with_ids[act_id] = tokenized_segment
|
| 529 |
+
return tokenized_segments_with_ids
|
| 530 |
+
|
| 531 |
+
def batch_tokenize_segments_with_ids(
|
| 532 |
+
segment_data: Union[Tuple[List[str], List[Any]], pd.DataFrame],
|
| 533 |
+
tokenization_params: Dict[str, Any],
|
| 534 |
+
num_cores: int = 1,
|
| 535 |
+
batch_size: int = 10000,
|
| 536 |
+
np_token_type: type = np.uint16
|
| 537 |
+
) -> Dict[Any, List[np.ndarray]]:
|
| 538 |
+
"""
|
| 539 |
+
Parallel tokenization of segments with associated IDs.
|
| 540 |
+
|
| 541 |
+
This function splits the input data into batches and uses multiprocessing to tokenize
|
| 542 |
+
the segments in parallel. It supports both list/tuple inputs and pandas DataFrames.
|
| 543 |
+
|
| 544 |
+
:param segment_data: Either a tuple/list containing two elements (segments, segment_ids),
|
| 545 |
+
or a pandas DataFrame with 'segment' and 'segment_id' columns.
|
| 546 |
+
:type segment_data: Union[Tuple[List[str], List[Any]], pd.DataFrame]
|
| 547 |
+
:param tokenization_params: Dictionary containing tokenization parameters.
|
| 548 |
+
:type tokenization_params: Dict[str, Any]
|
| 549 |
+
:param num_cores: Number of CPU cores to use for parallel processing. Defaults to 1.
|
| 550 |
+
:type num_cores: int, optional
|
| 551 |
+
:param batch_size: Number of segments to process in each batch. Defaults to 10,000.
|
| 552 |
+
:type batch_size: int, optional
|
| 553 |
+
:param np_token_type: Numpy data type for the tokenized segments. Defaults to np.uint16.
|
| 554 |
+
:type np_token_type: type, optional
|
| 555 |
+
:return: A dictionary where keys are segment IDs and values are lists of numpy arrays representing tokenized segments.
|
| 556 |
+
:rtype: Dict[Any, List[np.ndarray]]
|
| 557 |
+
:raises ValueError: If the input data is neither a tuple/list nor a pandas DataFrame.
|
| 558 |
+
|
| 559 |
+
Example:
|
| 560 |
+
>>> segments = ['ACTG', 'TGCA']
|
| 561 |
+
>>> segment_ids = [1, 2]
|
| 562 |
+
>>> tokenization_params = {'max_segment_length': 50, ...}
|
| 563 |
+
>>> tokenized_data = batch_tokenize_segments_with_ids(
|
| 564 |
+
(segments, segment_ids),
|
| 565 |
+
tokenization_params,
|
| 566 |
+
num_cores=4,
|
| 567 |
+
batch_size=1000
|
| 568 |
+
)
|
| 569 |
+
"""
|
| 570 |
+
if isinstance(segment_data, tuple) or isinstance(segment_data, list):
|
| 571 |
+
segments = segment_data[0]
|
| 572 |
+
segment_ids = segment_data[1]
|
| 573 |
+
elif isinstance(segment_data, pd.DataFrame):
|
| 574 |
+
segments = list(segment_data['segment'])
|
| 575 |
+
segment_ids = list(segment_data['segment_id'])
|
| 576 |
+
else:
|
| 577 |
+
raise ValueError(f'The input should be either pandas DataFrame or a tuple instead of {type(segment_data)}')
|
| 578 |
+
|
| 579 |
+
Ndata = len(segments)
|
| 580 |
+
batch_intervals = [(i, min(i + batch_size, Ndata)) for i in range(0, Ndata, batch_size)]
|
| 581 |
+
params = [
|
| 582 |
+
(segments[interval[0]:interval[1]],
|
| 583 |
+
segment_ids[interval[0]:interval[1]],
|
| 584 |
+
tokenization_params,
|
| 585 |
+
np_token_type)
|
| 586 |
+
for interval in batch_intervals
|
| 587 |
+
]
|
| 588 |
+
with Pool(processes=num_cores) as pool:
|
| 589 |
+
result_list = pool.starmap(process_batch_tokenize_segments_with_ids, params)
|
| 590 |
+
|
| 591 |
+
tokenized_sets = {}
|
| 592 |
+
for d in result_list:
|
| 593 |
+
tokenized_sets.update(d)
|
| 594 |
+
|
| 595 |
+
return tokenized_sets
|
| 596 |
+
|
| 597 |
+
|
| 598 |
+
def get_rectangular_array_from_tokenized_dataset(tokenized_segments_data: Dict[int, List[np.ndarray]], shift: int, max_token_count: int, truncate_zeros: bool = True, randomize: bool = True, numpy_dtype: Type = np.uint16) -> Tuple[np.ndarray, pd.DataFrame]:
|
| 599 |
+
"""Create a rectangular numpy array that can be used as input to a Language Model (LM) from tokenized segment data.
|
| 600 |
+
|
| 601 |
+
:param tokenized_segments_data: A dictionary where keys are segment ids and values are lists of possible LCA tokenized vectors.
|
| 602 |
+
:type tokenized_segments_data: Dict[int, List[np.ndarray]]
|
| 603 |
+
|
| 604 |
+
:param shift: Number of LCA offsets.
|
| 605 |
+
:type shift: int
|
| 606 |
+
|
| 607 |
+
:param max_token_count: Maximum allowed token count in the output numpy array.
|
| 608 |
+
:type max_token_count: int
|
| 609 |
+
|
| 610 |
+
:param truncate_zeros: If True, truncate columns from the end of the numpy array that only contain zeros. (default=True)
|
| 611 |
+
:type truncate_zeros: bool, optional
|
| 612 |
+
|
| 613 |
+
:param randomize: If True, randomize the order of the rows in the output numpy array. (default=True)
|
| 614 |
+
:type randomize: bool, optional
|
| 615 |
+
|
| 616 |
+
:param numpy_dtype: Data type of the values in the output numpy array. (default=np.uint16)
|
| 617 |
+
:type numpy_dtype: Type, optional
|
| 618 |
+
|
| 619 |
+
:returns: A rectangular numpy array suitable for input to an LM.
|
| 620 |
+
:rtype: np.ndarray
|
| 621 |
+
|
| 622 |
+
:returns: A dataframe that describes which row in the numpy array corresponds to which segment and its LCA offset.
|
| 623 |
+
Columns are: ['torch_id', 'segment_id', 'offset']
|
| 624 |
+
:rtype: pd.DataFrame
|
| 625 |
+
|
| 626 |
+
"""
|
| 627 |
+
|
| 628 |
+
|
| 629 |
+
expected_length = len(tokenized_segments_data)*shift
|
| 630 |
+
X=np.full((expected_length,max_token_count),0, dtype=numpy_dtype)
|
| 631 |
+
torch_db = []
|
| 632 |
+
torch_id = 0
|
| 633 |
+
for segment_id, tokenized_vectors in tokenized_segments_data.items():
|
| 634 |
+
for offset in range(shift):
|
| 635 |
+
segment_vector = tokenized_vectors[offset]
|
| 636 |
+
X[torch_id,0:segment_vector.shape[0]] = segment_vector
|
| 637 |
+
torch_db.append([torch_id, segment_id, offset])
|
| 638 |
+
torch_id+=1
|
| 639 |
+
torch_tokenized_segment_db = pd.DataFrame(torch_db,
|
| 640 |
+
columns = ['torch_id', 'segment_id', 'offset'])
|
| 641 |
+
|
| 642 |
+
if randomize:
|
| 643 |
+
logging.info('Doing randomization!')
|
| 644 |
+
perm = np.random.permutation(expected_length)
|
| 645 |
+
X = X[perm,:]
|
| 646 |
+
torch_tokenized_segment_db.rename({'torch_id': 'original_torch_id'}, axis=1, inplace=True)
|
| 647 |
+
torch_tokenized_segment_db = torch_tokenized_segment_db.iloc[perm,:].reset_index().drop('index', axis=1).reset_index().rename({'index' : 'torch_id'}, axis=1)
|
| 648 |
+
|
| 649 |
+
if truncate_zeros:
|
| 650 |
+
logging.info('Tuncating all zeros column')
|
| 651 |
+
X = truncate_zero_columns(X)
|
| 652 |
+
return X, torch_tokenized_segment_db
|
| 653 |
+
|
| 654 |
+
|
| 655 |
+
def pretty_print_overlapping_sequence(segment, segment_kmers, tokenizer_params):
|
| 656 |
+
"""
|
| 657 |
+
Format the sequence for pretty printing with overlapping k-mers.
|
| 658 |
+
|
| 659 |
+
:param segment: DNA sequence.
|
| 660 |
+
:type segment: str
|
| 661 |
+
|
| 662 |
+
:param segment_kmers: List of k-mers in the segment.
|
| 663 |
+
:type segment_kmers: list
|
| 664 |
+
|
| 665 |
+
:param tokenizer_params: Dictionary containing tokenization parameters.
|
| 666 |
+
:type tokenizer_params: dict
|
| 667 |
+
|
| 668 |
+
:return: List of formatted strings representing the sequence with overlapping k-mers.
|
| 669 |
+
:rtype: list
|
| 670 |
+
"""
|
| 671 |
+
|
| 672 |
+
shift = tokenizer_params['shift']
|
| 673 |
+
k = tokenizer_params['kmer']
|
| 674 |
+
sep_c = 2
|
| 675 |
+
lines = []
|
| 676 |
+
base_offset = len(str( int((k+3)/shift))) + 3
|
| 677 |
+
first_line = ' '*base_offset + segment
|
| 678 |
+
lines.append(first_line)
|
| 679 |
+
nr_lines = int(np.ceil((k+sep_c)/shift))
|
| 680 |
+
logging.info('Nr. line to cover the seq: {0}'.format(nr_lines))
|
| 681 |
+
|
| 682 |
+
for line_id in range(nr_lines):
|
| 683 |
+
|
| 684 |
+
line_mers = [k_mer for j, k_mer in enumerate(segment_kmers) if j%nr_lines== line_id]
|
| 685 |
+
act_line = str(line_id) + '. ' + ' '*(line_id*shift) + (' '*(sep_c)).join(line_mers)
|
| 686 |
+
lines.append(act_line)
|
| 687 |
+
lines = '\n'.join(lines)
|
| 688 |
+
return lines
|
| 689 |
+
|
| 690 |
+
|
| 691 |
+
def generate_kmers(abc: Set[str], k: int) -> List[str]:
|
| 692 |
+
"""
|
| 693 |
+
Generates all possible k-mers from a given alphabet.
|
| 694 |
+
|
| 695 |
+
:param abc: The alphabet.
|
| 696 |
+
:type abc: Set[str]
|
| 697 |
+
:param k: Length of the k-mers.
|
| 698 |
+
:type k: int
|
| 699 |
+
:return: List of all possible k-mers.
|
| 700 |
+
:rtype: List[str]
|
| 701 |
+
"""
|
| 702 |
+
return [''.join(p) for p in product(abc, repeat=k)]
|
| 703 |
+
|
| 704 |
+
def save_to_hdf(X: np.ndarray, hdf_file_path: str, database: pd.DataFrame = None, compression: bool = False, pd_chunksize: int = 10_000_000) -> None:
|
| 705 |
+
"""Save a numpy array and an optional pandas DataFrame to an HDF5 file.
|
| 706 |
+
|
| 707 |
+
:param X: 2D numpy array to be saved.
|
| 708 |
+
:type X: np.ndarray
|
| 709 |
+
:param hdf_file_path: Path to the HDF5 file.
|
| 710 |
+
:type hdf_file_path: str
|
| 711 |
+
:param database: Pandas DataFrame to be saved. Defaults to None.
|
| 712 |
+
:type database: pd.DataFrame
|
| 713 |
+
:param compression: Whether to apply compression. Defaults to False.
|
| 714 |
+
:type compression: bool
|
| 715 |
+
:param pd_chunksize: Number of rows per chunk for saving the DataFrame. Defaults to 10,000,000.
|
| 716 |
+
:type pd_chunksize: int
|
| 717 |
+
:raises ValueError: If the provided numpy array is not 2D.
|
| 718 |
+
:raises OSError: If there's an error creating the directory structure or removing an existing HDF5 file.
|
| 719 |
+
Example:
|
| 720 |
+
|
| 721 |
+
>>> import numpy as np
|
| 722 |
+
>>> import pandas as pd
|
| 723 |
+
>>> array = np.random.random((100, 100))
|
| 724 |
+
>>> df = pd.DataFrame({'A': range(1, 101), 'B': range(101, 201)})
|
| 725 |
+
>>> save_to_hdf(array, "sample.hdf5", database=df, compression=True)
|
| 726 |
+
"""
|
| 727 |
+
|
| 728 |
+
# Check if X is a 2D numpy array
|
| 729 |
+
if len(X.shape) != 2:
|
| 730 |
+
raise ValueError("The provided numpy array is not 2D.")
|
| 731 |
+
|
| 732 |
+
# If HDF5 file exists, attempt to delete it
|
| 733 |
+
if os.path.exists(hdf_file_path):
|
| 734 |
+
try:
|
| 735 |
+
os.remove(hdf_file_path)
|
| 736 |
+
logging.info(f"Existing HDF5 file {hdf_file_path} removed successfully.")
|
| 737 |
+
except Exception as e:
|
| 738 |
+
raise OSError(f"Error removing existing HDF5 file {hdf_file_path}. Error: {e}")
|
| 739 |
+
|
| 740 |
+
# Create directory structure for HDF5 file
|
| 741 |
+
create_directory_for_filepath(hdf_file_path)
|
| 742 |
+
|
| 743 |
+
# Save the numpy array to HDF5
|
| 744 |
+
with h5py.File(hdf_file_path, 'w') as hdf:
|
| 745 |
+
try:
|
| 746 |
+
grp = hdf.create_group("training_data")
|
| 747 |
+
except ValueError:
|
| 748 |
+
del hdf['training_data']
|
| 749 |
+
|
| 750 |
+
if compression:
|
| 751 |
+
grp.create_dataset("X", data=X, compression="lzf", chunks=True)
|
| 752 |
+
else:
|
| 753 |
+
grp.create_dataset("X", data=X, chunks=True)
|
| 754 |
+
|
| 755 |
+
logging.info(f"Numpy array saved to {hdf_file_path} successfully.")
|
| 756 |
+
|
| 757 |
+
# Save the pandas DataFrame to HDF5, if provided
|
| 758 |
+
if database is not None:
|
| 759 |
+
logging.info("Adding database into the HDF5 file!")
|
| 760 |
+
num_chunks = int(np.ceil(len(database) / pd_chunksize))
|
| 761 |
+
logging.info(f'Number of chunks: {num_chunks}')
|
| 762 |
+
chunk_grouping = np.arange(len(database)) // pd_chunksize
|
| 763 |
+
chunkseqs = database.groupby(chunk_grouping)
|
| 764 |
+
for i, (_, chunk) in enumerate(chunkseqs):
|
| 765 |
+
logging.info(f'Writing database chunk {i} into {hdf_file_path}')
|
| 766 |
+
if compression:
|
| 767 |
+
chunk.to_hdf(hdf_file_path, f'database_{i}', format='table', data_columns=True, mode='a', complib='lzo')
|
| 768 |
+
else:
|
| 769 |
+
chunk.to_hdf(hdf_file_path, f'database_{i}', format='table', data_columns=True, mode='a')
|
| 770 |
+
|
| 771 |
+
logging.info('Database addition finished!')
|
| 772 |
+
|
| 773 |
+
|
| 774 |
+
|
| 775 |
+
def dataframe_to_seqrecords(
|
| 776 |
+
df: pd.DataFrame,
|
| 777 |
+
fastaidcol: str = 'test_fastaid',
|
| 778 |
+
sequencecol: str = 'sequence'
|
| 779 |
+
) -> List[SeqRecord]:
|
| 780 |
+
"""
|
| 781 |
+
Convert a DataFrame with sequence information into a list of SeqRecord objects.
|
| 782 |
+
|
| 783 |
+
:param df: DataFrame containing at least two columns: one for sequence IDs and one for sequences.
|
| 784 |
+
:type df: pd.DataFrame
|
| 785 |
+
:param fastaidcol: Name of the column in `df` that contains sequence IDs. Defaults to 'test_fastaid'.
|
| 786 |
+
:type fastaidcol: str, optional
|
| 787 |
+
:param sequencecol: Name of the column in `df` that contains nucleotide sequences. Defaults to 'sequence'.
|
| 788 |
+
:type sequencecol: str, optional
|
| 789 |
+
:return: A list of SeqRecord objects constructed from the DataFrame.
|
| 790 |
+
:rtype: List[SeqRecord]
|
| 791 |
+
|
| 792 |
+
Example:
|
| 793 |
+
>>> import pandas as pd
|
| 794 |
+
>>> data = {'test_fastaid': ['seq1', 'seq2'], 'sequence': ['ATCG', 'GGTA']}
|
| 795 |
+
>>> df = pd.DataFrame(data)
|
| 796 |
+
>>> seq_records = dataframe_to_seqrecords(df)
|
| 797 |
+
>>> seq_records[0].id
|
| 798 |
+
'seq1'
|
| 799 |
+
"""
|
| 800 |
+
seq_records = []
|
| 801 |
+
for _, row in df.iterrows():
|
| 802 |
+
seq = Seq(row[sequencecol])
|
| 803 |
+
record = SeqRecord(seq, id=str(row[fastaidcol]), description="")
|
| 804 |
+
seq_records.append(record)
|
| 805 |
+
return seq_records
|
| 806 |
+
|
| 807 |
+
|
| 808 |
+
def write_seqrecords_to_fasta(
|
| 809 |
+
seq_records: List[SeqRecord],
|
| 810 |
+
file_name: str
|
| 811 |
+
) -> None:
|
| 812 |
+
"""
|
| 813 |
+
Write a list of SeqRecord objects to a FASTA file.
|
| 814 |
+
|
| 815 |
+
:param seq_records: List of SeqRecord objects to be written to file.
|
| 816 |
+
:type seq_records: List[SeqRecord]
|
| 817 |
+
:param file_name: Name or path of the file to write the FASTA records.
|
| 818 |
+
:type file_name: str
|
| 819 |
+
:return: None
|
| 820 |
+
:rtype: None
|
| 821 |
+
|
| 822 |
+
Example:
|
| 823 |
+
>>> from Bio.Seq import Seq
|
| 824 |
+
>>> from Bio.SeqRecord import SeqRecord
|
| 825 |
+
>>> seq_records = [SeqRecord(Seq('ATCG'), id='seq1'), SeqRecord(Seq('GGTA'), id='seq2')]
|
| 826 |
+
>>> write_seqrecords_to_fasta(seq_records, 'output.fasta')
|
| 827 |
+
"""
|
| 828 |
+
SeqIO.write(seq_records, file_name, "fasta")
|
| 829 |
+
|
| 830 |
+
|
| 831 |
+
def dump_records_to_files(
|
| 832 |
+
seq_records: List[SeqRecord],
|
| 833 |
+
folder_path: str
|
| 834 |
+
) -> None:
|
| 835 |
+
"""
|
| 836 |
+
Write each SeqRecord to a separate FASTA file in the specified folder.
|
| 837 |
+
|
| 838 |
+
:param seq_records: List of SeqRecord objects to be written individually.
|
| 839 |
+
:type seq_records: List[SeqRecord]
|
| 840 |
+
:param folder_path: Path to the folder where the files should be saved.
|
| 841 |
+
The folder will be created if it does not exist.
|
| 842 |
+
:type folder_path: str
|
| 843 |
+
:return: None
|
| 844 |
+
:rtype: None
|
| 845 |
+
|
| 846 |
+
Example:
|
| 847 |
+
>>> from Bio.Seq import Seq
|
| 848 |
+
>>> from Bio.SeqRecord import SeqRecord
|
| 849 |
+
>>> seq_records = [SeqRecord(Seq('ATCG'), id='seq1'), SeqRecord(Seq('GGTA'), id='seq2')]
|
| 850 |
+
>>> dump_records_to_files(seq_records, 'sequences_folder')
|
| 851 |
+
"""
|
| 852 |
+
# Ensure the folder exists
|
| 853 |
+
os.makedirs(folder_path, exist_ok=True)
|
| 854 |
+
|
| 855 |
+
for record in seq_records:
|
| 856 |
+
file_path = os.path.join(folder_path, f"{record.id}.fasta")
|
| 857 |
+
SeqIO.write(record, file_path, "fasta")
|
| 858 |
+
|
| 859 |
+
|
| 860 |
+
def split_seqrecords_to_fasta_chunks(
|
| 861 |
+
seq_records: List[SeqRecord],
|
| 862 |
+
output_folder: str,
|
| 863 |
+
chunk_size_mb: int = 10
|
| 864 |
+
) -> None:
|
| 865 |
+
"""
|
| 866 |
+
Splits a list of SeqRecord objects into multiple FASTA files, each less than a specified size in MB.
|
| 867 |
+
|
| 868 |
+
:param seq_records: List of SeqRecord objects to be split into chunks.
|
| 869 |
+
:type seq_records: List[SeqRecord]
|
| 870 |
+
:param output_folder: The output folder where the FASTA files will be saved.
|
| 871 |
+
:type output_folder: str
|
| 872 |
+
:param chunk_size_mb: Maximum size of each FASTA file in megabytes. Defaults to 10 MB.
|
| 873 |
+
:type chunk_size_mb: int, optional
|
| 874 |
+
:return: None
|
| 875 |
+
:rtype: None
|
| 876 |
+
|
| 877 |
+
Example:
|
| 878 |
+
>>> seq_records = [...] # A list of SeqRecord objects
|
| 879 |
+
>>> split_seqrecords_to_fasta_chunks(seq_records, 'output_chunks', chunk_size_mb=5)
|
| 880 |
+
|
| 881 |
+
Notes:
|
| 882 |
+
- The last chunk may be smaller than the specified `chunk_size_mb`.
|
| 883 |
+
- The function approximates the size of each record for chunking.
|
| 884 |
+
"""
|
| 885 |
+
# Ensure output folder exists
|
| 886 |
+
os.makedirs(output_folder, exist_ok=True)
|
| 887 |
+
|
| 888 |
+
current_chunk = []
|
| 889 |
+
current_chunk_size = 0 # in bytes
|
| 890 |
+
chunk_id = 1 # Identifier for chunks/files
|
| 891 |
+
for record in seq_records:
|
| 892 |
+
# Approximate size of the record in bytes
|
| 893 |
+
record_size = len(str(record.seq)) + len(record.id) + 2 # Adding buffer for '>' and '\n'
|
| 894 |
+
|
| 895 |
+
# Check if adding this record exceeds the chunk size
|
| 896 |
+
if current_chunk_size + record_size > chunk_size_mb * 1024 * 1024:
|
| 897 |
+
file_path = os.path.join(output_folder, f"chunk_{chunk_id}.fasta")
|
| 898 |
+
SeqIO.write(current_chunk, file_path, "fasta")
|
| 899 |
+
current_chunk = []
|
| 900 |
+
current_chunk_size = 0
|
| 901 |
+
chunk_id += 1
|
| 902 |
+
|
| 903 |
+
current_chunk.append(record)
|
| 904 |
+
current_chunk_size += record_size
|
| 905 |
+
|
| 906 |
+
# Write any remaining records to the last chunk
|
| 907 |
+
if current_chunk:
|
| 908 |
+
file_path = os.path.join(output_folder, f"chunk_{chunk_id}.fasta")
|
| 909 |
+
SeqIO.write(current_chunk, file_path, "fasta")
|
| 910 |
+
|
| 911 |
+
|
| 912 |
+
def filter_short_sequences(
|
| 913 |
+
seq_records: List[SeqRecord],
|
| 914 |
+
length_threshold: int
|
| 915 |
+
) -> List[SeqRecord]:
|
| 916 |
+
"""
|
| 917 |
+
Filters out SeqRecord objects with sequences shorter than a specified threshold.
|
| 918 |
+
|
| 919 |
+
:param seq_records: List of SeqRecord objects.
|
| 920 |
+
:type seq_records: List[SeqRecord]
|
| 921 |
+
:param length_threshold: The minimum length of sequences to be retained.
|
| 922 |
+
:type length_threshold: int
|
| 923 |
+
:return: A list of SeqRecord objects that meet or exceed the length threshold.
|
| 924 |
+
:rtype: List[SeqRecord]
|
| 925 |
+
|
| 926 |
+
Example:
|
| 927 |
+
>>> from Bio.Seq import Seq
|
| 928 |
+
>>> from Bio.SeqRecord import SeqRecord
|
| 929 |
+
>>> records = [
|
| 930 |
+
... SeqRecord(Seq('ATCG'), id='seq1'),
|
| 931 |
+
... SeqRecord(Seq('AT'), id='seq2')
|
| 932 |
+
... ]
|
| 933 |
+
>>> filtered_records = filter_short_sequences(records, 3)
|
| 934 |
+
>>> len(filtered_records)
|
| 935 |
+
1
|
| 936 |
+
>>> filtered_records[0].id
|
| 937 |
+
'seq1'
|
| 938 |
+
"""
|
| 939 |
+
filtered_records = [record for record in seq_records if len(record.seq) >= length_threshold]
|
| 940 |
+
return filtered_records
|
| 941 |
+
|
| 942 |
+
|
| 943 |
+
|
| 944 |
+
def get_token_counts_for_segment(Lseg, kmer, shift, offset):
|
| 945 |
+
nr_tokens = int((Lseg -kmer)/shift + 1)
|
| 946 |
+
return nr_tokens
|
| 947 |
+
|
| 948 |
+
def get_seq_coordinates(token_pos, kmer, shift, offset):
|
| 949 |
+
seq_start = int(token_pos*shift + offset)
|
| 950 |
+
seq_end = int(token_pos*shift+kmer + offset)
|
| 951 |
+
return seq_start, seq_end
|
| 952 |
+
|
| 953 |
+
def get_token_coordinates(seq_pos, kmer, shift, offset, Lseg):
|
| 954 |
+
|
| 955 |
+
nrtokens = get_token_counts_for_segment(Lseg, kmer, shift, offset)
|
| 956 |
+
|
| 957 |
+
token_pos_end = int((seq_pos+offset - kmer) / shift)
|
| 958 |
+
token_pos_start = int((seq_pos + offset) / shift)
|
| 959 |
+
|
| 960 |
+
if token_pos_end<0:
|
| 961 |
+
token_pos_end=0
|
| 962 |
+
if token_pos_start >= nrtokens:
|
| 963 |
+
token_pos_start = nrtokens-1
|
| 964 |
+
|
| 965 |
+
return token_pos_start, token_pos_end
|
| 966 |
+
|
| 967 |
+
def sliding_window_average(arr, window_size=6):
|
| 968 |
+
# Create a window for averaging
|
| 969 |
+
window = np.ones(window_size) / window_size
|
| 970 |
+
# Use 'valid' mode to slide the window over the array without padding
|
| 971 |
+
result = np.convolve(arr, window, mode='valid')
|
| 972 |
+
return result
|
| 973 |
+
|
| 974 |
+
def convolve_expression_array(expression_array, window_size=6, step=2):
|
| 975 |
+
# Define the averaging window
|
| 976 |
+
window = np.ones(window_size) / window_size
|
| 977 |
+
# Apply convolution along each column (axis=0)
|
| 978 |
+
convolved_array = convolve1d(expression_array, window, axis=1, mode='reflect')
|
| 979 |
+
# Downsample by step size
|
| 980 |
+
return convolved_array[:, ::step]
|
tokenizer.py
ADDED
|
@@ -0,0 +1,363 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
import collections
|
| 2 |
+
import os
|
| 3 |
+
import json
|
| 4 |
+
from copy import deepcopy
|
| 5 |
+
from typing import List, Optional, Tuple, Dict
|
| 6 |
+
from transformers import PreTrainedTokenizer
|
| 7 |
+
from transformers.utils.hub import cached_file, hf_hub_url
|
| 8 |
+
|
| 9 |
+
from .config_utils import SeqConfig
|
| 10 |
+
from .sequtils import generate_kmers, lca_kmer_tokenize_segment
|
| 11 |
+
|
| 12 |
+
# Define the names of the vocabulary files
|
| 13 |
+
VOCAB_FILES_NAMES = {"vocab_file": "vocab.txt"}
|
| 14 |
+
|
| 15 |
+
# Define the mapping for pretrained vocabulary files
|
| 16 |
+
PRETRAINED_VOCAB_FILES_MAP = {
|
| 17 |
+
"vocab_file": {
|
| 18 |
+
"lca-mini-k6s1": "lca-base-dna6/vocab.txt",
|
| 19 |
+
"lca-mini-k6s2": "lca-base-dna6/vocab.txt",
|
| 20 |
+
"lca-mini-k1s1": "lca-base-dna1/vocab.txt",
|
| 21 |
+
}
|
| 22 |
+
}
|
| 23 |
+
|
| 24 |
+
# Define positional embedding sizes for pretrained models
|
| 25 |
+
PRETRAINED_POSITIONAL_EMBEDDINGS_SIZES = {
|
| 26 |
+
"lca-mini-k6s1": 1024,
|
| 27 |
+
"lca-mini-k1s1": 1024,
|
| 28 |
+
"lca-mini-k6s2": 2048,
|
| 29 |
+
}
|
| 30 |
+
|
| 31 |
+
# Define initial configuration for pretrained models
|
| 32 |
+
PRETRAINED_INIT_CONFIGURATION = {
|
| 33 |
+
"lca-mini-k6s1": {"do_upper_case": True},
|
| 34 |
+
"lca-mini-k1s1": {"do_upper_case": True},
|
| 35 |
+
"lca-mini-k6s2": {"do_upper_case": True},
|
| 36 |
+
}
|
| 37 |
+
|
| 38 |
+
# Utility function to load vocabulary from a file
|
| 39 |
+
def load_vocab(vocab_file):
|
| 40 |
+
"""Loads a vocabulary file into a dictionary."""
|
| 41 |
+
vocab = collections.OrderedDict()
|
| 42 |
+
with open(vocab_file, "r", encoding="utf-8") as reader:
|
| 43 |
+
tokens = reader.readlines()
|
| 44 |
+
for index, token in enumerate(tokens):
|
| 45 |
+
vocab[token.rstrip("\n")] = index
|
| 46 |
+
return vocab
|
| 47 |
+
|
| 48 |
+
class LCATokenizer(PreTrainedTokenizer):
|
| 49 |
+
"""
|
| 50 |
+
Custom tokenizer for LCA (Local Context Aware) tasks.
|
| 51 |
+
Handles specific tokenization processes, including k-mer tokenization with configurable shifts.
|
| 52 |
+
|
| 53 |
+
Attributes:
|
| 54 |
+
vocab_files_names (dict): Mapping of vocabulary file names.
|
| 55 |
+
pretrained_vocab_files_map (dict): Mapping of pretrained vocabulary files.
|
| 56 |
+
pretrained_init_configuration (dict): Initial configuration for pretrained models.
|
| 57 |
+
max_model_input_sizes (dict): Maximum input sizes for pretrained models.
|
| 58 |
+
"""
|
| 59 |
+
|
| 60 |
+
vocab_files_names = VOCAB_FILES_NAMES
|
| 61 |
+
pretrained_vocab_files_map = PRETRAINED_VOCAB_FILES_MAP
|
| 62 |
+
pretrained_init_configuration = PRETRAINED_INIT_CONFIGURATION
|
| 63 |
+
max_model_input_sizes = PRETRAINED_POSITIONAL_EMBEDDINGS_SIZES
|
| 64 |
+
|
| 65 |
+
nucleotide_abc = {"A", "T", "C", "G"}
|
| 66 |
+
extended_nucleotide_abc = {"A", "T", "C", "G", "*"}
|
| 67 |
+
sequence_unk_token = 'N'
|
| 68 |
+
|
| 69 |
+
default_unk_token = "[UNK]"
|
| 70 |
+
default_sep_token = "[SEP]"
|
| 71 |
+
default_pad_token = "[PAD]"
|
| 72 |
+
default_cls_token = "[CLS]"
|
| 73 |
+
default_mask_token = "[MASK]"
|
| 74 |
+
|
| 75 |
+
def __init__(
|
| 76 |
+
self,
|
| 77 |
+
config: Dict = {},
|
| 78 |
+
operation_space: str = "kmer",
|
| 79 |
+
**kwargs,
|
| 80 |
+
):
|
| 81 |
+
"""
|
| 82 |
+
Initializes the LCATokenizer with configuration and operation space.
|
| 83 |
+
|
| 84 |
+
Args:
|
| 85 |
+
config (dict): Tokenization parameters like k-mer size and shift.
|
| 86 |
+
operation_space (str): Defines operation mode ('kmer' or 'sequence').
|
| 87 |
+
kwargs: Additional arguments for PreTrainedTokenizer.
|
| 88 |
+
"""
|
| 89 |
+
self.defconfig = SeqConfig()
|
| 90 |
+
config = self.defconfig.get_and_set_tokenization_parameters(config)
|
| 91 |
+
self.config = config
|
| 92 |
+
self.operation_space = operation_space
|
| 93 |
+
|
| 94 |
+
# Set default tokens
|
| 95 |
+
kwargs.setdefault("cls_token", self.default_cls_token)
|
| 96 |
+
kwargs.setdefault("unk_token", self.default_unk_token)
|
| 97 |
+
kwargs.setdefault("sep_token", self.default_sep_token)
|
| 98 |
+
kwargs.setdefault("pad_token", self.default_pad_token)
|
| 99 |
+
kwargs.setdefault("mask_token", self.default_mask_token)
|
| 100 |
+
|
| 101 |
+
# Load vocabulary
|
| 102 |
+
vocab_file = self.config["vocabfile"]
|
| 103 |
+
self.vocab = self.config["vocabmap"]
|
| 104 |
+
self.id2token = {v: k for k, v in self.vocab.items()}
|
| 105 |
+
self.max_len = self.config["max_segment_length"]
|
| 106 |
+
|
| 107 |
+
super().__init__(**kwargs)
|
| 108 |
+
|
| 109 |
+
# Handle extended vocabulary for sequence mode
|
| 110 |
+
if self.operation_space == 'sequence':
|
| 111 |
+
token_extension = sorted(list(set(generate_kmers(LCATokenizer.extended_nucleotide_abc, self.config['kmer'])) - \
|
| 112 |
+
set(generate_kmers(LCATokenizer.nucleotide_abc, self.config['kmer'])) ))
|
| 113 |
+
self.extended_vocab = deepcopy(self.vocab)
|
| 114 |
+
for token in token_extension:
|
| 115 |
+
self.extended_vocab[token] = 4
|
| 116 |
+
|
| 117 |
+
self.unk_token = LCATokenizer.sequence_unk_token * self.config['shift']
|
| 118 |
+
self.mask_token = '*'
|
| 119 |
+
self.extended_vocab[self.mask_token] = self.vocab['[MASK]']
|
| 120 |
+
|
| 121 |
+
full_unk = 'N' * self.config['kmer']
|
| 122 |
+
self.vocab[full_unk] = 1
|
| 123 |
+
self.id2token[1] = full_unk
|
| 124 |
+
self.full_unk_token = full_unk
|
| 125 |
+
|
| 126 |
+
else:
|
| 127 |
+
self.extended_vocab = self.vocab
|
| 128 |
+
self.unk_token = '[UNK]'
|
| 129 |
+
|
| 130 |
+
self.unkown_tokenid = self.vocab['[UNK]']
|
| 131 |
+
self.sep_token = '[SEP]'
|
| 132 |
+
self.cls_token = '[CLS]'
|
| 133 |
+
self.pad_token = '[PAD]'
|
| 134 |
+
self.mask_token = '[MASK]'
|
| 135 |
+
self.special_tokens = list(self.special_tokens_map.values())
|
| 136 |
+
|
| 137 |
+
|
| 138 |
+
|
| 139 |
+
def _tokenize(self, text, **kwargs):
|
| 140 |
+
"""
|
| 141 |
+
Tokenizes the input text using LCA tokenization with an optional offset.
|
| 142 |
+
|
| 143 |
+
Args:
|
| 144 |
+
text (str): The input DNA sequence to tokenize.
|
| 145 |
+
kwargs: Additional arguments, including:
|
| 146 |
+
- offset (int): The starting position for tokenization. Default is 0.
|
| 147 |
+
|
| 148 |
+
Returns:
|
| 149 |
+
List[str]: A list of tokens generated from the input text.
|
| 150 |
+
"""
|
| 151 |
+
offset = kwargs.get("offset", 0)
|
| 152 |
+
#if offset < 0 or offset >= self.config.get("shift", 1):
|
| 153 |
+
# raise ValueError(f"Invalid offset: {offset}. Must be between 0 and {self.config['shift'] - 1}.")
|
| 154 |
+
|
| 155 |
+
return lca_kmer_tokenize_segment(text, offset, self.config)
|
| 156 |
+
|
| 157 |
+
def _convert_token_to_id(self, token: str) -> int:
|
| 158 |
+
"""
|
| 159 |
+
Converts a token to its corresponding ID using the vocabulary.
|
| 160 |
+
|
| 161 |
+
Args:
|
| 162 |
+
token (str): The token to convert.
|
| 163 |
+
|
| 164 |
+
Returns:
|
| 165 |
+
int: Token ID, or the unknown token ID if the token is not in the vocabulary.
|
| 166 |
+
"""
|
| 167 |
+
return self.extended_vocab.get(token, self.unkown_tokenid)
|
| 168 |
+
|
| 169 |
+
def _convert_id_to_token(self, index: int) -> str:
|
| 170 |
+
"""
|
| 171 |
+
Converts an ID to its corresponding token using the vocabulary.
|
| 172 |
+
|
| 173 |
+
Args:
|
| 174 |
+
index (int): The ID to convert.
|
| 175 |
+
|
| 176 |
+
Returns:
|
| 177 |
+
str: Corresponding token, or the unknown token if the ID is not in the vocabulary.
|
| 178 |
+
"""
|
| 179 |
+
|
| 180 |
+
|
| 181 |
+
return self.id2token.get(index, self.unk_token)
|
| 182 |
+
|
| 183 |
+
def __len__(self) -> int:
|
| 184 |
+
"""
|
| 185 |
+
Returns the length of the tokenizer's vocabulary.
|
| 186 |
+
|
| 187 |
+
The length returned is one less than the actual number of items in the vocabulary
|
| 188 |
+
to account for a specific offset or adjustment in token indexing.
|
| 189 |
+
|
| 190 |
+
:return: The adjusted length of the vocabulary.
|
| 191 |
+
:rtype: int
|
| 192 |
+
"""
|
| 193 |
+
return len(self.vocab)
|
| 194 |
+
|
| 195 |
+
|
| 196 |
+
|
| 197 |
+
def tokenize(self, text: str, **kwargs) -> List[str]:
|
| 198 |
+
"""
|
| 199 |
+
Tokenizes the input text using LCA tokenization.
|
| 200 |
+
|
| 201 |
+
Args:
|
| 202 |
+
text (str): The input DNA sequence to tokenize.
|
| 203 |
+
kwargs: Additional arguments, including:
|
| 204 |
+
- offset (int): The starting position for tokenization. Default is 0.
|
| 205 |
+
|
| 206 |
+
Returns:
|
| 207 |
+
List[str]: A list of tokens generated from the input text.
|
| 208 |
+
"""
|
| 209 |
+
return self._tokenize(text, **kwargs)
|
| 210 |
+
|
| 211 |
+
def encode(self, text: str, **kwargs) -> List[int]:
|
| 212 |
+
"""
|
| 213 |
+
Extends the base `encode` method to support an `offset` parameter for custom tokenization logic.
|
| 214 |
+
|
| 215 |
+
Args:
|
| 216 |
+
text (str): Input text (DNA sequence).
|
| 217 |
+
offset (int): Offset parameter for the LCA tokenization. Defaults to 0.
|
| 218 |
+
kwargs: Additional arguments passed to the base `encode` method.
|
| 219 |
+
|
| 220 |
+
Returns:
|
| 221 |
+
List[int]: Encoded token IDs.
|
| 222 |
+
"""
|
| 223 |
+
# Inject the offset into kwargs for the tokenizer
|
| 224 |
+
offset = kwargs.get("offset", 0)
|
| 225 |
+
kwargs["offset"] = offset
|
| 226 |
+
return super().encode(text, **kwargs)
|
| 227 |
+
|
| 228 |
+
def build_inputs_with_special_tokens(
|
| 229 |
+
self, token_ids_0: List[int], token_ids_1: Optional[List[int]] = None
|
| 230 |
+
) -> List[int]:
|
| 231 |
+
"""
|
| 232 |
+
Builds inputs by adding special tokens to a sequence or pair of sequences.
|
| 233 |
+
|
| 234 |
+
Args:
|
| 235 |
+
token_ids_0 (List[int]): List of token IDs for the first sequence.
|
| 236 |
+
token_ids_1 (List[int], optional): List of token IDs for the second sequence.
|
| 237 |
+
|
| 238 |
+
Returns:
|
| 239 |
+
List[int]: Input IDs with special tokens.
|
| 240 |
+
"""
|
| 241 |
+
if token_ids_1 is None:
|
| 242 |
+
return [self.cls_token_id] + token_ids_0 + [self.sep_token_id]
|
| 243 |
+
|
| 244 |
+
input_ids = [self.cls_token_id] + token_ids_0 + [self.sep_token_id] + token_ids_1 + [self.sep_token_id]
|
| 245 |
+
#token_type_ids = [0 for i in range(len(input_ids))]
|
| 246 |
+
return input_ids
|
| 247 |
+
|
| 248 |
+
def create_token_type_ids_from_sequences(
|
| 249 |
+
self, token_ids_0: List[int], token_ids_1: Optional[List[int]] = None
|
| 250 |
+
) -> List[int]:
|
| 251 |
+
"""
|
| 252 |
+
Create the token type IDs corresponding to the sequences passed. [What are token type
|
| 253 |
+
IDs?](../glossary#token-type-ids)
|
| 254 |
+
|
| 255 |
+
Should be overridden in a subclass if the model has a special way of building those.
|
| 256 |
+
|
| 257 |
+
Args:
|
| 258 |
+
token_ids_0 (`List[int]`): The first tokenized sequence.
|
| 259 |
+
token_ids_1 (`List[int]`, *optional*): The second tokenized sequence.
|
| 260 |
+
|
| 261 |
+
Returns:
|
| 262 |
+
`List[int]`: The token type ids.
|
| 263 |
+
"""
|
| 264 |
+
if token_ids_1 is None:
|
| 265 |
+
return (len(token_ids_0)+2) * [0]
|
| 266 |
+
return [0] * len(token_ids_0) + [1] * len(token_ids_1)
|
| 267 |
+
|
| 268 |
+
def batch_encode_plus(self, *args, **kwargs):
|
| 269 |
+
"""
|
| 270 |
+
Extends the base `batch_encode_plus` method to add custom functionality if needed.
|
| 271 |
+
|
| 272 |
+
Args:
|
| 273 |
+
*args: Positional arguments passed to the base method.
|
| 274 |
+
**kwargs: Keyword arguments passed to the base method.
|
| 275 |
+
|
| 276 |
+
Returns:
|
| 277 |
+
dict: A dictionary containing the results of batch encoding.
|
| 278 |
+
"""
|
| 279 |
+
# Call the parent method to handle the batch encoding
|
| 280 |
+
#print('Running batch encoding with ids')
|
| 281 |
+
act_outputs = super().batch_encode_plus(*args, **kwargs)
|
| 282 |
+
return act_outputs
|
| 283 |
+
|
| 284 |
+
|
| 285 |
+
def save_vocabulary(self, save_directory: str, filename_prefix: Optional[str] = None) -> Tuple[str]:
|
| 286 |
+
"""
|
| 287 |
+
Saves the tokenizer's vocabulary to a file.
|
| 288 |
+
|
| 289 |
+
Args:
|
| 290 |
+
save_directory (str): Directory to save the vocabulary file.
|
| 291 |
+
filename_prefix (str, optional): Prefix for the filename. Default is None.
|
| 292 |
+
|
| 293 |
+
Returns:
|
| 294 |
+
Tuple[str]: Path to the saved vocabulary file.
|
| 295 |
+
"""
|
| 296 |
+
if filename_prefix is None:
|
| 297 |
+
filename_prefix = ""
|
| 298 |
+
vocab_file_path = os.path.join(save_directory, filename_prefix + "vocab.txt")
|
| 299 |
+
with open(vocab_file_path, "w") as f:
|
| 300 |
+
for token in self.vocab:
|
| 301 |
+
f.write(token + "\n")
|
| 302 |
+
return (vocab_file_path,)
|
| 303 |
+
|
| 304 |
+
def save_pretrained(self, save_directory: str, **kwargs):
|
| 305 |
+
"""
|
| 306 |
+
Saves the tokenizer configuration and vocabulary to a directory.
|
| 307 |
+
|
| 308 |
+
Args:
|
| 309 |
+
save_directory (str): Directory to save the tokenizer files.
|
| 310 |
+
"""
|
| 311 |
+
if not os.path.exists(save_directory):
|
| 312 |
+
os.makedirs(save_directory)
|
| 313 |
+
super().save_pretrained(save_directory, **kwargs)
|
| 314 |
+
|
| 315 |
+
tokenizer_config_path = os.path.join(save_directory, "tokenizer_config.json")
|
| 316 |
+
if os.path.exists(tokenizer_config_path):
|
| 317 |
+
with open(tokenizer_config_path, "r") as f:
|
| 318 |
+
tokenizer_config = json.load(f)
|
| 319 |
+
else:
|
| 320 |
+
tokenizer_config = {}
|
| 321 |
+
|
| 322 |
+
tokenizer_config.update({
|
| 323 |
+
"kmer": self.config.get("kmer", 6),
|
| 324 |
+
"shift": self.config.get("shift", 1),
|
| 325 |
+
})
|
| 326 |
+
|
| 327 |
+
with open(tokenizer_config_path, "w") as f:
|
| 328 |
+
json.dump(tokenizer_config, f, indent=2)
|
| 329 |
+
|
| 330 |
+
@classmethod
|
| 331 |
+
def from_pretrained(cls, pretrained_model_name_or_path, **kwargs):
|
| 332 |
+
"""
|
| 333 |
+
Loads a tokenizer from the pretrained model directory or Hugging Face Hub.
|
| 334 |
+
|
| 335 |
+
Args:
|
| 336 |
+
pretrained_model_name_or_path (str): Path or model name on Hugging Face Hub.
|
| 337 |
+
kwargs: Additional arguments for initialization.
|
| 338 |
+
|
| 339 |
+
Returns:
|
| 340 |
+
LCATokenizer: The loaded tokenizer instance.
|
| 341 |
+
"""
|
| 342 |
+
tokenizer_config_file = hf_hub_url(
|
| 343 |
+
pretrained_model_name_or_path, filename="tokenizer_config.json"
|
| 344 |
+
)
|
| 345 |
+
resolved_tokenizer_config_file = cached_file(
|
| 346 |
+
pretrained_model_name_or_path, filename="tokenizer_config.json"
|
| 347 |
+
)
|
| 348 |
+
|
| 349 |
+
with open(resolved_tokenizer_config_file, "r") as f:
|
| 350 |
+
tokenizer_config = json.load(f)
|
| 351 |
+
|
| 352 |
+
kmer = tokenizer_config.pop("kmer", 6)
|
| 353 |
+
shift = tokenizer_config.pop("shift", 1)
|
| 354 |
+
base_tokenization_config = {'kmer': kmer, 'shift': shift}
|
| 355 |
+
defconfig = SeqConfig()
|
| 356 |
+
config = defconfig.get_and_set_tokenization_parameters(base_tokenization_config)
|
| 357 |
+
|
| 358 |
+
tokenizer = super().from_pretrained(pretrained_model_name_or_path, **kwargs)
|
| 359 |
+
tokenizer.config = config
|
| 360 |
+
|
| 361 |
+
return tokenizer
|
| 362 |
+
|
| 363 |
+
|
tokenizer_config.json
CHANGED
|
@@ -1,4 +1,10 @@
|
|
| 1 |
{
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 2 |
"clean_up_tokenization_spaces": true,
|
| 3 |
"cls_token": "[CLS]",
|
| 4 |
"mask_token": "[MASK]",
|
|
|
|
| 1 |
{
|
| 2 |
+
"auto_map": {
|
| 3 |
+
"AutoTokenizer": [
|
| 4 |
+
"tokenizer.LCATokenizer",
|
| 5 |
+
null
|
| 6 |
+
]
|
| 7 |
+
},
|
| 8 |
"clean_up_tokenization_spaces": true,
|
| 9 |
"cls_token": "[CLS]",
|
| 10 |
"mask_token": "[MASK]",
|