File size: 46,010 Bytes
714cf46 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 | # From https://github.com/DLS5-Omics/multimolecule/blob/master/multimolecule/models/calm/modeling_calm.py
# MultiMolecule
# Copyright (C) 2024-Present MultiMolecule
# This file is part of MultiMolecule.
# MultiMolecule is free software: you can redistribute it and/or modify
# it under the terms of the GNU Affero General Public License as published by
# the Free Software Foundation, either version 3 of the License, or
# any later version.
# MultiMolecule is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU Affero General Public License for more details.
# You should have received a copy of the GNU Affero General Public License
# along with this program. If not, see <http://www.gnu.org/licenses/>.
# For additional terms and clarifications, please refer to our License FAQ at:
# <https://multimolecule.danling.org/about/license-faq>.
from __future__ import annotations
import torch
from torch import Tensor, nn
from torch.nn import functional as F
from transformers import PretrainedConfig
from transformers.activations import ACT2FN
from transformers.modeling_outputs import BaseModelOutputWithPastAndCrossAttentions, BaseModelOutputWithPoolingAndCrossAttentions
from transformers.modeling_utils import PreTrainedModel
from transformers.pytorch_utils import apply_chunking_to_forward
from typing import Tuple, Union, List, Dict, Optional
from warnings import warn
from .calm_utils import RotaryEmbedding, RnaTokenizer
from .base_tokenizer import BaseSequenceTokenizer
class CaLmConfig(PretrainedConfig):
r"""
This is the configuration class to store the configuration of a [`CaLmModel`][multimolecule.models.CaLmModel]. It
is used to instantiate a CaLM model according to the specified arguments, defining the model architecture.
Instantiating a configuration with the defaults will yield a similar configuration to that of the CaLM
[oxpig/CaLM](https://github.com/oxpig/CaLM) architecture.
Configuration objects inherit from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig] and can be used to
control the model outputs. Read the documentation from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig]
for more information.
Args:
vocab_size:
Vocabulary size of the CaLM model. Defines the number of different tokens that can be represented by the
`inputs_ids` passed when calling [`CaLmModel`].
Defaults to 131 if `codon=True` else 26.
codon:
Whether to use codon tokenization.
hidden_size:
Dimensionality of the encoder layers and the pooler layer.
num_hidden_layers:
Number of hidden layers in the Transformer encoder.
num_attention_heads:
Number of attention heads for each attention layer in the Transformer encoder.
intermediate_size:
Dimensionality of the "intermediate" (often named feed-forward) layer in the Transformer encoder.
hidden_act:
The non-linear activation function (function or string) in the encoder and pooler. If string, `"gelu"`,
`"relu"`, `"silu"` and `"gelu_new"` are supported.
hidden_dropout:
The dropout probability for all fully connected layers in the embeddings, encoder, and pooler.
attention_dropout:
The dropout ratio for the attention probabilities.
max_position_embeddings:
The maximum sequence length that this model might ever be used with. Typically set this to something large
just in case (e.g., 512 or 1024 or 2048).
initializer_range:
The standard deviation of the truncated_normal_initializer for initializing all weight matrices.
layer_norm_eps:
The epsilon used by the layer normalization layers.
position_embedding_type:
Type of position embedding. Choose one of `"absolute"`, `"relative_key"`, `"relative_key_query"`,
`"rotary"`.
For positional embeddings use `"absolute"`. For more information on `"relative_key"`, please refer to
[Self-Attention with Relative Position Representations (Shaw et al.)](https://arxiv.org/abs/1803.02155).
For more information on `"relative_key_query"`, please refer to *Method 4* in [Improve Transformer Models
with Better Relative Position Embeddings (Huang et al.)](https://arxiv.org/abs/2009.13658).
is_decoder:
Whether the model is used as a decoder or not. If `False`, the model is used as an encoder.
use_cache:
Whether or not the model should return the last key/values attentions (not used by all models). Only
relevant if `config.is_decoder=True`.
emb_layer_norm_before:
Whether to apply layer normalization after embeddings but before the main stem of the network.
token_dropout:
When this is enabled, masked tokens are treated as if they had been dropped out by input dropout.
head:
The configuration of the head.
lm_head:
The configuration of the masked language model head.
Examples:
>>> from multimolecule import CaLmConfig, CaLmModel
>>> # Initializing a CaLM multimolecule/calm style configuration
>>> configuration = CaLmConfig()
>>> # Initializing a model (with random weights) from the multimolecule/calm style configuration
>>> model = CaLmModel(configuration)
>>> # Accessing the model configuration
>>> configuration = model.config
"""
model_type = "calm"
def __init__(
self,
vocab_size: int | None = None,
codon: bool = True,
hidden_size: int = 768,
num_hidden_layers: int = 12,
num_attention_heads: int = 12,
intermediate_size: int = 3072,
hidden_act: str = "gelu",
hidden_dropout: float = 0.1,
attention_dropout: float = 0.1,
max_position_embeddings: int = 1026,
initializer_range: float = 0.02,
layer_norm_eps: float = 1e-12,
position_embedding_type: str = "rotary",
is_decoder: bool = False,
use_cache: bool = True,
emb_layer_norm_before: bool = False,
token_dropout: bool = False,
head: None = None,
lm_head: None = None,
**kwargs,
):
super().__init__(**kwargs)
if vocab_size is None:
vocab_size = 131 if codon else 26
self.vocab_size = vocab_size
self.codon = codon
self.hidden_size = hidden_size
self.num_hidden_layers = num_hidden_layers
self.num_attention_heads = num_attention_heads
self.intermediate_size = intermediate_size
self.hidden_act = hidden_act
self.hidden_dropout = hidden_dropout
self.attention_dropout = attention_dropout
self.max_position_embeddings = max_position_embeddings
self.initializer_range = initializer_range
self.layer_norm_eps = layer_norm_eps
self.position_embedding_type = position_embedding_type
self.is_decoder = is_decoder
self.use_cache = use_cache
self.emb_layer_norm_before = emb_layer_norm_before
self.token_dropout = token_dropout
self.head = head
self.lm_head = lm_head
class CaLmPreTrainedModel(PreTrainedModel):
"""
An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained
models.
"""
config_class = CaLmConfig
all_tied_weights_keys = {}
base_model_prefix = "model"
supports_gradient_checkpointing = True
_no_split_modules = ["CaLmLayer", "CaLmEmbeddings"]
# Copied from transformers.models.bert.modeling_bert.BertPreTrainedModel._init_weights
def _init_weights(self, module: nn.Module):
"""Initialize the weights"""
if isinstance(module, nn.Linear):
# Slightly different from the TF version which uses truncated_normal for initialization
# cf https://github.com/pytorch/pytorch/pull/5617
module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
if module.bias is not None:
module.bias.data.zero_()
elif isinstance(module, nn.Embedding):
module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
if module.padding_idx is not None:
module.weight.data[module.padding_idx].zero_()
elif isinstance(module, nn.LayerNorm):
module.bias.data.zero_()
module.weight.data.fill_(1.0)
# transformers v5 no longer exposes get_head_mask on this base in our setup.
# Keep local compatibility for CaLM attention masking.
def _convert_head_mask_to_5d(self, head_mask: Tensor, num_hidden_layers: int) -> Tensor:
if head_mask.dim() == 1:
head_mask = head_mask.unsqueeze(0).unsqueeze(0).unsqueeze(-1).unsqueeze(-1)
head_mask = head_mask.expand(num_hidden_layers, -1, -1, -1, -1)
elif head_mask.dim() == 2:
head_mask = head_mask.unsqueeze(1).unsqueeze(-1).unsqueeze(-1)
assert head_mask.dim() == 5, f"head_mask.dim != 5, got {head_mask.dim()}"
head_mask = head_mask.to(dtype=self.dtype)
return head_mask
def get_head_mask(
self,
head_mask: Tensor | None,
num_hidden_layers: int,
is_attention_chunked: bool = False,
) -> Tensor | List[None]:
if head_mask is None:
return [None] * num_hidden_layers
head_mask = self._convert_head_mask_to_5d(head_mask, num_hidden_layers)
if is_attention_chunked:
head_mask = head_mask.unsqueeze(-1)
return head_mask
class CaLmModel(CaLmPreTrainedModel):
"""
Examples:
>>> import torch
>>> from multimolecule import CaLmConfig, CaLmModel, RnaTokenizer
>>> config = CaLmConfig()
>>> model = CaLmModel(config)
>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/rna")
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input)
>>> output["last_hidden_state"].shape
torch.Size([1, 7, 768])
>>> output["pooler_output"].shape
torch.Size([1, 768])
"""
def __init__(self, config: CaLmConfig, add_pooling_layer: bool = True):
super().__init__(config)
self.pad_token_id = config.pad_token_id
self.embeddings = CaLmEmbeddings(config)
self.encoder = CaLmEncoder(config)
self.pooler = CaLmPooler(config) if add_pooling_layer else None
# Initialize weights and apply final processing
self.post_init()
def get_input_embeddings(self):
return self.embeddings.word_embeddings
def set_input_embeddings(self, value):
self.embeddings.word_embeddings = value
def forward(
self,
input_ids: Tensor | None = None,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | None = None,
encoder_hidden_states: Tensor | None = None,
encoder_attention_mask: Tensor | None = None,
past_key_values: Tuple[Tuple[Tensor, Tensor, Tensor, Tensor], ...] | None = None,
use_cache: bool | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | BaseModelOutputWithPoolingAndCrossAttentions:
r"""
Args:
encoder_hidden_states:
Shape: `(batch_size, sequence_length, hidden_size)`
Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if
the model is configured as a decoder.
encoder_attention_mask:
Shape: `(batch_size, sequence_length)`
Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used
in the cross-attention if the model is configured as a decoder. Mask values selected in `[0, 1]`:
- 1 for tokens that are **not masked**,
- 0 for tokens that are **masked**.
past_key_values:
Tuple of length `config.n_layers` with each tuple having 4 tensors of shape
`(batch_size, num_heads, sequence_length - 1, embed_size_per_head)
Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up
decoding.
If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those
that don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of
all `decoder_input_ids` of shape `(batch_size, sequence_length)`.
use_cache:
If set to `True`, `past_key_values` key value states are returned and can be used to speed up decoding
(see `past_key_values`).
"""
if kwargs:
warn(
f"Additional keyword arguments `{', '.join(kwargs)}` are detected in "
f"`{self.__class__.__name__}.forward`, they will be ignored.\n"
"This is provided for backward compatibility and may lead to unexpected behavior."
)
output_attentions = output_attentions if output_attentions is not None else self.config.output_attentions
output_hidden_states = (
output_hidden_states if output_hidden_states is not None else self.config.output_hidden_states
)
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
if self.config.is_decoder:
use_cache = use_cache if use_cache is not None else self.config.use_cache
else:
use_cache = False
if input_ids is not None and inputs_embeds is not None:
raise ValueError("You cannot specify both input_ids and inputs_embeds at the same time")
if input_ids is not None:
self.warn_if_padding_and_no_attention_mask(input_ids, attention_mask)
input_shape = input_ids.size()
elif inputs_embeds is not None:
input_shape = inputs_embeds.size()[:-1]
else:
raise ValueError("You have to specify either input_ids or inputs_embeds")
batch_size, seq_length = input_shape
device = input_ids.device if input_ids is not None else inputs_embeds.device # type: ignore[union-attr]
# past_key_values_length
past_key_values_length = past_key_values[0][0].shape[2] if past_key_values is not None else 0
if attention_mask is None:
if input_ids is not None and self.pad_token_id is not None:
attention_mask = input_ids.ne(self.pad_token_id)
else:
attention_mask = torch.ones(((batch_size, seq_length + past_key_values_length)), device=device)
warn(
"attention_mask is not specified, and cannot be inferred from input_ids."
"Assuming all tokens are not masked."
)
# We can provide a self-attention mask of dimensions [batch_size, from_seq_length, to_seq_length]
# ourselves in which case we just need to make it broadcastable to all heads.
extended_attention_mask: Tensor = self.get_extended_attention_mask(attention_mask, input_shape)
# If a 2D or 3D attention mask is provided for the cross-attention
# we need to make broadcastable to [batch_size, num_heads, seq_length, seq_length]
if self.config.is_decoder and encoder_hidden_states is not None:
encoder_batch_size, encoder_sequence_length, _ = encoder_hidden_states.size()
encoder_hidden_shape = (encoder_batch_size, encoder_sequence_length)
if encoder_attention_mask is None:
encoder_attention_mask = torch.ones(encoder_hidden_shape, device=device)
encoder_extended_attention_mask = self.invert_attention_mask(encoder_attention_mask)
else:
encoder_extended_attention_mask = None
# Prepare head mask if needed
# 1.0 in head_mask indicate we keep the head
# attention_probs has shape bsz x n_heads x N x N
# input head_mask has shape [num_heads] or [num_hidden_layers x num_heads]
# and head_mask is converted to shape [num_hidden_layers x batch x num_heads x seq_length x seq_length]
head_mask = self.get_head_mask(head_mask, self.config.num_hidden_layers)
embedding_output = self.embeddings(
input_ids=input_ids,
position_ids=position_ids,
attention_mask=attention_mask,
inputs_embeds=inputs_embeds,
past_key_values_length=past_key_values_length,
)
encoder_outputs = self.encoder(
embedding_output,
attention_mask=extended_attention_mask,
head_mask=head_mask,
encoder_hidden_states=encoder_hidden_states,
encoder_attention_mask=encoder_extended_attention_mask,
past_key_values=past_key_values,
use_cache=use_cache,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
)
sequence_output = encoder_outputs[0]
pooled_output = self.pooler(sequence_output) if self.pooler is not None else None
if not return_dict:
return (sequence_output, pooled_output) + encoder_outputs[1:]
return BaseModelOutputWithPoolingAndCrossAttentions(
last_hidden_state=sequence_output,
pooler_output=pooled_output,
past_key_values=encoder_outputs.past_key_values,
hidden_states=encoder_outputs.hidden_states,
attentions=encoder_outputs.attentions,
cross_attentions=encoder_outputs.cross_attentions,
)
class CaLmEmbeddings(nn.Module):
"""
Same as BertEmbeddings with a tiny tweak for positional embeddings indexing.
"""
def __init__(self, config: CaLmConfig):
super().__init__()
self.word_embeddings = nn.Embedding(config.vocab_size, config.hidden_size, padding_idx=config.pad_token_id)
if config.emb_layer_norm_before:
self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
else:
self.layer_norm = None
# position_ids (1, len position emb) is contiguous in memory and exported when serialized
self.position_embedding_type = getattr(config, "position_embedding_type", "absolute")
self.register_buffer(
"position_ids", torch.arange(config.max_position_embeddings).expand((1, -1)), persistent=False
)
self.padding_idx = config.pad_token_id
if self.position_embedding_type == "absolute":
self.position_embeddings = nn.Embedding(
config.max_position_embeddings, config.hidden_size, padding_idx=self.padding_idx
)
else:
self.position_embeddings = None
self.token_dropout = config.token_dropout
self.mask_token_id = config.mask_token_id
self.pad_token_id = config.pad_token_id
def forward(
self,
input_ids: Tensor | None = None,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
inputs_embeds: Tensor | None = None,
past_key_values_length: int = 0,
):
if inputs_embeds is None:
inputs_embeds = self.word_embeddings(input_ids)
embeddings = inputs_embeds
if self.token_dropout:
if input_ids is None:
raise ValueError("Token dropout is only supported when input_ids are provided")
embeddings = embeddings.masked_fill((input_ids == self.mask_token_id).unsqueeze(-1), 0.0)
mask_ratio_train = 0.15 * 0.8 # Hardcoded as the ratio used in all CaLM model training runs
src_lengths = attention_mask.sum(-1) # type: ignore[union-attr]
mask_ratio_observed = (input_ids == self.mask_token_id).sum(-1).float() / src_lengths
embeddings = (embeddings * (1 - mask_ratio_train) / (1 - mask_ratio_observed)[:, None, None]).to(embeddings)
if self.position_embedding_type == "absolute":
if position_ids is None:
if input_ids is not None:
position_ids = create_position_ids_from_input_ids(
input_ids, self.padding_idx, past_key_values_length
)
else:
position_ids = create_position_ids_from_inputs_embeds(inputs_embeds, self.padding_idx)
# This is a bug in the original implementation
position_ids = position_ids + 1
position_embeddings = self.position_embeddings(position_ids)
embeddings += position_embeddings
if self.layer_norm is not None:
embeddings = self.layer_norm(embeddings)
if attention_mask is not None:
embeddings = (embeddings * attention_mask.unsqueeze(-1)).to(embeddings.dtype)
return embeddings
class CaLmEncoder(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.config = config
self.layer = nn.ModuleList([CaLmLayer(config) for _ in range(config.num_hidden_layers)])
self.emb_layer_norm_after = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
self.gradient_checkpointing = False
def forward(
self,
hidden_states: Tensor,
attention_mask: torch.FloatTensor | None = None,
head_mask: torch.FloatTensor | None = None,
encoder_hidden_states: torch.FloatTensor | None = None,
encoder_attention_mask: torch.FloatTensor | None = None,
past_key_values: Tuple[Tuple[torch.FloatTensor, ...], ...] | None = None,
use_cache: bool | None = None,
output_attentions: bool = False,
output_hidden_states: bool = False,
return_dict: bool = True,
) -> Tuple[Tensor, ...] | BaseModelOutputWithPastAndCrossAttentions:
all_hidden_states = () if output_hidden_states else None
all_self_attentions = () if output_attentions else None
all_cross_attentions = () if output_attentions and self.config.add_cross_attention else None
if self.gradient_checkpointing and self.training and use_cache:
warn("`use_cache=True` is incompatible with gradient checkpointing. Setting `use_cache=False`...")
use_cache = False
next_decoder_cache = () if use_cache else None
for i, layer_module in enumerate(self.layer):
if output_hidden_states:
all_hidden_states = all_hidden_states + (hidden_states,) # type: ignore[operator]
layer_head_mask = head_mask[i] if head_mask is not None else None
past_key_value = past_key_values[i] if past_key_values is not None else None
if self.gradient_checkpointing and self.training:
layer_outputs = self._gradient_checkpointing_func(
layer_module.__call__,
hidden_states,
attention_mask,
layer_head_mask,
encoder_hidden_states,
encoder_attention_mask,
past_key_value,
output_attentions,
)
else:
layer_outputs = layer_module(
hidden_states,
attention_mask,
layer_head_mask,
encoder_hidden_states,
encoder_attention_mask,
past_key_value,
output_attentions,
)
hidden_states = layer_outputs[0]
if use_cache:
next_decoder_cache = next_decoder_cache + (layer_outputs[-1],) # type: ignore[operator]
if output_attentions:
all_self_attentions = all_self_attentions + (layer_outputs[1],) # type: ignore[operator]
if self.config.add_cross_attention:
all_cross_attentions = all_cross_attentions + (layer_outputs[2],) # type: ignore[operator]
if self.emb_layer_norm_after:
hidden_states = self.emb_layer_norm_after(hidden_states)
if output_hidden_states:
all_hidden_states = all_hidden_states + (hidden_states,) # type: ignore[operator]
if not return_dict:
return tuple(
v
for v in [
hidden_states,
next_decoder_cache,
all_hidden_states,
all_self_attentions,
all_cross_attentions,
]
if v is not None
)
return BaseModelOutputWithPastAndCrossAttentions(
last_hidden_state=hidden_states,
past_key_values=next_decoder_cache,
hidden_states=all_hidden_states,
attentions=all_self_attentions,
cross_attentions=all_cross_attentions,
)
class CaLmLayer(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.chunk_size_feed_forward = config.chunk_size_feed_forward
self.seq_len_dim = 1
self.attention = CaLmAttention(config)
self.is_decoder = config.is_decoder
self.add_cross_attention = config.add_cross_attention
if self.add_cross_attention:
if not self.is_decoder:
raise ValueError(f"{self} should be used as a decoder model if cross attention is added")
self.crossattention = CaLmAttention(config, position_embedding_type="absolute")
self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
self.intermediate = CaLmIntermediate(config)
self.output = CaLmOutput(config)
def forward(
self,
hidden_states: Tensor,
attention_mask: torch.FloatTensor | None = None,
head_mask: torch.FloatTensor | None = None,
encoder_hidden_states: torch.FloatTensor | None = None,
encoder_attention_mask: torch.FloatTensor | None = None,
past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None,
output_attentions: bool = False,
) -> Tuple[Tensor, ...]:
# decoder uni-directional self-attention cached key/values tuple is at positions 1,2
self_attn_past_key_value = past_key_value[:2] if past_key_value is not None else None
self_attention_outputs = self.attention(
hidden_states,
attention_mask,
head_mask,
output_attentions=output_attentions,
past_key_value=self_attn_past_key_value,
)
attention_output = self_attention_outputs[0]
# if decoder, the last output is tuple of self-attn cache
if self.is_decoder:
outputs = self_attention_outputs[1:-1]
present_key_value = self_attention_outputs[-1]
else:
outputs = self_attention_outputs[1:] # add self attentions if we output attention weights
cross_attn_present_key_value = None
if self.is_decoder and encoder_hidden_states is not None:
if not hasattr(self, "crossattention"):
raise AttributeError(
f"If `encoder_hidden_states` are passed, {self} has to be instantiated"
" with cross-attention layers by setting `config.add_cross_attention=True`"
)
# cross_attn cached key/values tuple is at positions 3,4 of past_key_value tuple
cross_attn_past_key_value = past_key_value[-2:] if past_key_value is not None else None
cross_attention_outputs = self.crossattention(
attention_output,
attention_mask,
head_mask,
encoder_hidden_states,
encoder_attention_mask,
cross_attn_past_key_value,
output_attentions,
)
attention_output = cross_attention_outputs[0]
outputs = outputs + cross_attention_outputs[1:-1] # add cross attentions if we output attention weights
# add cross-attn cache to positions 3,4 of present_key_value tuple
cross_attn_present_key_value = cross_attention_outputs[-1]
present_key_value = present_key_value + cross_attn_present_key_value
layer_output = apply_chunking_to_forward(
self.feed_forward_chunk, self.chunk_size_feed_forward, self.seq_len_dim, attention_output
)
outputs = (layer_output,) + outputs
# if decoder, return the attn key/values as the last output
if self.is_decoder:
outputs = outputs + (present_key_value,)
return outputs
def feed_forward_chunk(self, attention_output):
attention_output_ln = self.layer_norm(attention_output)
intermediate_output = self.intermediate(attention_output_ln)
layer_output = self.output(intermediate_output, attention_output)
return layer_output
class CaLmAttention(nn.Module):
def __init__(self, config: CaLmConfig, position_embedding_type: str | None = None):
super().__init__()
self.self = CaLmSelfAttention(config, position_embedding_type=position_embedding_type)
self.output = CaLmSelfOutput(config)
self.pruned_heads: set = set()
self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
def forward(
self,
hidden_states: Tensor,
attention_mask: torch.FloatTensor | None = None,
head_mask: torch.FloatTensor | None = None,
encoder_hidden_states: torch.FloatTensor | None = None,
encoder_attention_mask: torch.FloatTensor | None = None,
past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None,
output_attentions: bool = False,
) -> Tuple[Tensor, ...]:
hidden_states_ln = self.layer_norm(hidden_states)
self_outputs = self.self(
hidden_states_ln,
attention_mask,
head_mask,
encoder_hidden_states,
encoder_attention_mask,
past_key_value,
output_attentions,
)
attention_output = self.output(self_outputs[0], hidden_states)
outputs = (attention_output,) + self_outputs[1:] # add attentions if we output them
return outputs
class CaLmSelfAttention(nn.Module):
def __init__(self, config: CaLmConfig, position_embedding_type: str | None = None):
super().__init__()
if config.hidden_size % config.num_attention_heads != 0 and not hasattr(config, "embedding_size"):
raise ValueError(
f"The hidden size ({config.hidden_size}) is not a multiple of the number of attention "
f"heads ({config.num_attention_heads})"
)
self.num_attention_heads = config.num_attention_heads
self.attention_head_size = int(config.hidden_size / config.num_attention_heads)
self.all_head_size = self.num_attention_heads * self.attention_head_size
self.query = nn.Linear(config.hidden_size, self.all_head_size)
self.key = nn.Linear(config.hidden_size, self.all_head_size)
self.value = nn.Linear(config.hidden_size, self.all_head_size)
self.dropout = nn.Dropout(config.attention_dropout)
self.position_embedding_type = position_embedding_type or getattr(config, "position_embedding_type", "absolute")
self.rotary_embeddings = None
if self.position_embedding_type == "relative_key" or self.position_embedding_type == "relative_key_query":
self.max_position_embeddings = config.max_position_embeddings
self.distance_embedding = nn.Embedding(2 * config.max_position_embeddings - 1, self.attention_head_size)
elif self.position_embedding_type == "rotary":
self.rotary_embeddings = RotaryEmbedding(embedding_dim=self.attention_head_size)
self.is_decoder = config.is_decoder
def transpose_for_scores(self, x: Tensor) -> Tensor:
new_x_shape = x.size()[:-1] + (self.num_attention_heads, self.attention_head_size)
x = x.view(new_x_shape)
return x.transpose(1, 2)
def forward(
self,
hidden_states: Tensor,
attention_mask: torch.FloatTensor | None = None,
head_mask: torch.FloatTensor | None = None,
encoder_hidden_states: torch.FloatTensor | None = None,
encoder_attention_mask: torch.FloatTensor | None = None,
past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None,
output_attentions: bool = False,
) -> Tuple[Tensor, ...]:
mixed_query_layer = self.query(hidden_states)
# If this is instantiated as a cross-attention module, the keys
# and values come from an encoder; the attention mask needs to be
# such that the encoder's padding tokens are not attended to.
is_cross_attention = encoder_hidden_states is not None
if is_cross_attention and past_key_value is not None:
# reuse k,v, cross_attentions
key_layer = past_key_value[0]
value_layer = past_key_value[1]
attention_mask = encoder_attention_mask
elif is_cross_attention:
key_layer = self.transpose_for_scores(self.key(encoder_hidden_states))
value_layer = self.transpose_for_scores(self.value(encoder_hidden_states))
attention_mask = encoder_attention_mask
elif past_key_value is not None:
key_layer = self.transpose_for_scores(self.key(hidden_states))
value_layer = self.transpose_for_scores(self.value(hidden_states))
key_layer = torch.cat([past_key_value[0], key_layer], dim=2)
value_layer = torch.cat([past_key_value[1], value_layer], dim=2)
else:
key_layer = self.transpose_for_scores(self.key(hidden_states))
value_layer = self.transpose_for_scores(self.value(hidden_states))
query_layer = self.transpose_for_scores(mixed_query_layer)
query_layer = query_layer * self.attention_head_size**-0.5
use_cache = past_key_value is not None
if self.is_decoder:
# if cross_attention save Tuple(Tensor, Tensor) of all cross attention key/value_states.
# Further calls to cross_attention layer can then reuse all cross-attention
# key/value_states (first "if" case)
# if uni-directional self-attention (decoder) save Tuple(Tensor, Tensor) of
# all previous decoder key/value_states. Further calls to uni-directional self-attention
# can concat previous decoder key/value_states to current projected key/value_states (third "elif" case)
# if encoder bi-directional self-attention `past_key_value` is always `None`
past_key_value = (key_layer, value_layer)
if self.position_embedding_type == "rotary":
query_layer, key_layer = self.rotary_embeddings(query_layer, key_layer) # type: ignore[misc]
# Take the dot product between "query" and "key" to get the raw attention scores.
attention_scores = torch.matmul(query_layer, key_layer.transpose(-1, -2)) # type: ignore[attr-defined]
if self.position_embedding_type == "relative_key" or self.position_embedding_type == "relative_key_query":
query_length, key_length = query_layer.shape[2], key_layer.shape[2] # type: ignore[attr-defined]
if use_cache:
position_ids_l = torch.tensor(key_length - 1, dtype=torch.long, device=hidden_states.device).view(-1, 1)
else:
position_ids_l = torch.arange(query_length, dtype=torch.long, device=hidden_states.device).view(-1, 1)
position_ids_r = torch.arange(key_length, dtype=torch.long, device=hidden_states.device).view(1, -1)
distance = position_ids_l - position_ids_r
positional_embedding = self.distance_embedding(distance + self.max_position_embeddings - 1)
positional_embedding = positional_embedding.to(dtype=query_layer.dtype) # fp16 compatibility
if self.position_embedding_type == "relative_key":
relative_position_scores = torch.einsum("bhld,lrd->bhlr", query_layer, positional_embedding)
attention_scores = attention_scores + relative_position_scores
elif self.position_embedding_type == "relative_key_query":
relative_position_scores_query = torch.einsum("bhld,lrd->bhlr", query_layer, positional_embedding)
relative_position_scores_key = torch.einsum("bhrd,lrd->bhlr", key_layer, positional_embedding)
attention_scores = attention_scores + relative_position_scores_query + relative_position_scores_key
if attention_mask is not None:
# Apply the attention mask is (precomputed for all layers in CaLmModel forward() function)
attention_scores = attention_scores + attention_mask
# Normalize the attention scores to probabilities.
attention_probs = F.softmax(attention_scores, dim=-1)
# This is actually dropping out entire tokens to attend to, which might
# seem a bit unusual, but is taken from the original Transformer paper.
attention_probs = self.dropout(attention_probs)
# Mask heads if we want to
if head_mask is not None:
attention_probs = attention_probs * head_mask
context_layer = torch.matmul(attention_probs.to(value_layer.dtype), value_layer)
context_layer = context_layer.transpose(1, 2).contiguous()
new_context_layer_shape = context_layer.size()[:-2] + (self.all_head_size,)
context_layer = context_layer.view(new_context_layer_shape)
outputs = (context_layer, attention_probs) if output_attentions else (context_layer,)
if self.is_decoder:
outputs = outputs + (past_key_value,)
return outputs
class CaLmSelfOutput(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.dense = nn.Linear(config.hidden_size, config.hidden_size)
self.dropout = nn.Dropout(config.hidden_dropout)
def forward(self, hidden_states, input_tensor):
hidden_states = self.dense(hidden_states)
hidden_states = self.dropout(hidden_states)
hidden_states = hidden_states + input_tensor
return hidden_states
class CaLmIntermediate(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.dense = nn.Linear(config.hidden_size, config.intermediate_size)
if isinstance(config.hidden_act, str):
self.activation = ACT2FN[config.hidden_act]
else:
self.activation = config.hidden_act
def forward(self, hidden_states: Tensor) -> Tensor:
hidden_states = self.dense(hidden_states)
hidden_states = self.activation(hidden_states)
return hidden_states
class CaLmOutput(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.dense = nn.Linear(config.intermediate_size, config.hidden_size)
self.dropout = nn.Dropout(config.hidden_dropout)
def forward(self, hidden_states: Tensor, input_tensor: Tensor) -> Tensor:
hidden_states = self.dense(hidden_states)
hidden_states = self.dropout(hidden_states)
hidden_states = hidden_states + input_tensor
return hidden_states
# Copied from transformers.models.bert.modeling_bert.BertPooler
class CaLmPooler(nn.Module):
def __init__(self, config: CaLmConfig):
super().__init__()
self.dense = nn.Linear(config.hidden_size, config.hidden_size)
self.activation = nn.Tanh()
def forward(self, hidden_states: Tensor) -> Tensor:
# We "pool" the model by simply taking the hidden state corresponding
# to the first token.
first_token_tensor = hidden_states[:, 0]
pooled_output = self.dense(first_token_tensor)
pooled_output = self.activation(pooled_output)
return pooled_output
def create_position_ids_from_inputs_embeds(inputs_embeds: torch.FloatTensor, padding_idx: int = 0) -> torch.LongTensor:
input_shape = inputs_embeds.size()[:-1]
sequence_length = input_shape[1]
position_ids = torch.arange(
padding_idx + 1, sequence_length + padding_idx + 1, dtype=torch.long, device=inputs_embeds.device
)
return position_ids.unsqueeze(0).expand(input_shape)
def create_position_ids_from_input_ids(
input_ids: torch.LongTensor, padding_idx: int = 0, past_key_values_length: int = 0
) -> torch.LongTensor:
# The series of casts and type-conversions here are carefully balanced to both work with ONNX export and XLA.
mask = input_ids.ne(padding_idx).int()
incremental_indices = (
(torch.cumsum(mask, dim=1, dtype=mask.dtype) + past_key_values_length) * mask + past_key_values_length
) * mask
return incremental_indices.long() + padding_idx
presets = {
'CaLM': 'multimolecule/calm',
}
def _normalize_calm_preset(preset: str) -> str:
if preset in presets:
return preset
if 'calm' in preset.lower():
return 'CaLM'
raise ValueError(f"Model {preset} not supported")
def _load_calm_backbone(model_path: str, add_pooling_layer: bool = False, dtype: torch.dtype = None) -> CaLmModel:
model, loading_info = CaLmModel.from_pretrained(
model_path,
dtype=dtype,
add_pooling_layer=add_pooling_layer,
output_loading_info=True,
)
missing_keys = loading_info["missing_keys"]
unexpected_keys = loading_info["unexpected_keys"]
mismatched_keys = loading_info["mismatched_keys"]
error_msgs = loading_info["error_msgs"]
disallowed_unexpected_keys = [key for key in unexpected_keys if not key.startswith("lm_head.")]
assert len(missing_keys) == 0, (
f"CaLM load had missing keys: {missing_keys}"
)
assert len(mismatched_keys) == 0, (
f"CaLM load had mismatched keys: {mismatched_keys}"
)
assert len(disallowed_unexpected_keys) == 0, (
"CaLM load had unexpected keys outside lm_head.*: "
f"{disallowed_unexpected_keys}"
)
assert len(error_msgs) == 0, (
f"CaLM load had loader errors: {error_msgs}"
)
return model
class CaLMTokenizerWrapper(BaseSequenceTokenizer):
def __init__(self, tokenizer: RnaTokenizer):
super().__init__(tokenizer)
def __call__(self, sequences: Union[str, List[str]], **kwargs) -> Dict[str, torch.Tensor]:
if isinstance(sequences, str):
sequences = [sequences]
kwargs.setdefault('return_tensors', 'pt')
kwargs.setdefault('padding', 'longest')
kwargs.setdefault('add_special_tokens', True)
tokenized = self.tokenizer(sequences, **kwargs)
return tokenized
class CaLmForEmbedding(nn.Module):
def __init__(self, model_path: str, dtype: torch.dtype = None):
super().__init__()
self.calm = _load_calm_backbone(model_path, add_pooling_layer=False, dtype=dtype)
def forward(
self,
input_ids: torch.Tensor,
attention_mask: Optional[torch.Tensor] = None,
output_attentions: Optional[bool] = None,
output_hidden_states: Optional[bool] = False,
**kwargs,
) -> torch.Tensor:
if output_attentions:
out = self.calm(input_ids=input_ids, attention_mask=attention_mask, output_attentions=output_attentions)
return out.last_hidden_state, out.attentions
else:
return self.calm(input_ids=input_ids, attention_mask=attention_mask).last_hidden_state
def get_calm_tokenizer(preset: str, model_path: str = None):
normalized_preset = _normalize_calm_preset(preset)
return CaLMTokenizerWrapper(RnaTokenizer.from_pretrained(model_path or presets[normalized_preset]))
def build_calm_model(preset: str, masked_lm: bool = False, dtype: torch.dtype = None, model_path: str = None, **kwargs):
normalized_preset = _normalize_calm_preset(preset)
path = model_path or presets[normalized_preset]
if masked_lm:
raise ValueError(f"Model {preset} does not support masked language modeling")
else:
model = CaLmForEmbedding(path, dtype=dtype).eval()
tokenizer = get_calm_tokenizer(normalized_preset, model_path=model_path)
return model, tokenizer
def get_calm_for_training(preset: str, tokenwise: bool = False, num_labels: int = None, hybrid: bool = False, dtype: torch.dtype = None, model_path: str = None):
normalized_preset = _normalize_calm_preset(preset)
model_path = model_path or presets[normalized_preset]
if hybrid:
model = _load_calm_backbone(model_path, add_pooling_layer=False, dtype=dtype).eval()
else:
raise ValueError(f"Model {preset} does not support training")
tokenizer = get_calm_tokenizer(normalized_preset)
return model, tokenizer
if __name__ == '__main__':
# py -m src.protify.base_models.calm
model, tokenizer = build_calm_model('CaLM')
print(model)
print(tokenizer)
tokenized = tokenizer('GCCAGTCGCTGACAGCCGCGG')
print(model(**tokenized).shape)
print(tokenized)
|