# From https://github.com/DLS5-Omics/multimolecule/blob/master/multimolecule/models/calm/modeling_calm.py # MultiMolecule # Copyright (C) 2024-Present MultiMolecule # This file is part of MultiMolecule. # MultiMolecule is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # any later version. # MultiMolecule is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see . # For additional terms and clarifications, please refer to our License FAQ at: # . from __future__ import annotations import torch from torch import Tensor, nn from torch.nn import functional as F from transformers import PretrainedConfig from transformers.activations import ACT2FN from transformers.modeling_outputs import BaseModelOutputWithPastAndCrossAttentions, BaseModelOutputWithPoolingAndCrossAttentions from transformers.modeling_utils import PreTrainedModel from transformers.pytorch_utils import apply_chunking_to_forward from typing import Tuple, Union, List, Dict, Optional from warnings import warn from .calm_utils import RotaryEmbedding, RnaTokenizer from .base_tokenizer import BaseSequenceTokenizer class CaLmConfig(PretrainedConfig): r""" This is the configuration class to store the configuration of a [`CaLmModel`][multimolecule.models.CaLmModel]. It is used to instantiate a CaLM model according to the specified arguments, defining the model architecture. Instantiating a configuration with the defaults will yield a similar configuration to that of the CaLM [oxpig/CaLM](https://github.com/oxpig/CaLM) architecture. Configuration objects inherit from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig] and can be used to control the model outputs. Read the documentation from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig] for more information. Args: vocab_size: Vocabulary size of the CaLM model. Defines the number of different tokens that can be represented by the `inputs_ids` passed when calling [`CaLmModel`]. Defaults to 131 if `codon=True` else 26. codon: Whether to use codon tokenization. hidden_size: Dimensionality of the encoder layers and the pooler layer. num_hidden_layers: Number of hidden layers in the Transformer encoder. num_attention_heads: Number of attention heads for each attention layer in the Transformer encoder. intermediate_size: Dimensionality of the "intermediate" (often named feed-forward) layer in the Transformer encoder. hidden_act: The non-linear activation function (function or string) in the encoder and pooler. If string, `"gelu"`, `"relu"`, `"silu"` and `"gelu_new"` are supported. hidden_dropout: The dropout probability for all fully connected layers in the embeddings, encoder, and pooler. attention_dropout: The dropout ratio for the attention probabilities. max_position_embeddings: The maximum sequence length that this model might ever be used with. Typically set this to something large just in case (e.g., 512 or 1024 or 2048). initializer_range: The standard deviation of the truncated_normal_initializer for initializing all weight matrices. layer_norm_eps: The epsilon used by the layer normalization layers. position_embedding_type: Type of position embedding. Choose one of `"absolute"`, `"relative_key"`, `"relative_key_query"`, `"rotary"`. For positional embeddings use `"absolute"`. For more information on `"relative_key"`, please refer to [Self-Attention with Relative Position Representations (Shaw et al.)](https://arxiv.org/abs/1803.02155). For more information on `"relative_key_query"`, please refer to *Method 4* in [Improve Transformer Models with Better Relative Position Embeddings (Huang et al.)](https://arxiv.org/abs/2009.13658). is_decoder: Whether the model is used as a decoder or not. If `False`, the model is used as an encoder. use_cache: Whether or not the model should return the last key/values attentions (not used by all models). Only relevant if `config.is_decoder=True`. emb_layer_norm_before: Whether to apply layer normalization after embeddings but before the main stem of the network. token_dropout: When this is enabled, masked tokens are treated as if they had been dropped out by input dropout. head: The configuration of the head. lm_head: The configuration of the masked language model head. Examples: >>> from multimolecule import CaLmConfig, CaLmModel >>> # Initializing a CaLM multimolecule/calm style configuration >>> configuration = CaLmConfig() >>> # Initializing a model (with random weights) from the multimolecule/calm style configuration >>> model = CaLmModel(configuration) >>> # Accessing the model configuration >>> configuration = model.config """ model_type = "calm" def __init__( self, vocab_size: int | None = None, codon: bool = True, hidden_size: int = 768, num_hidden_layers: int = 12, num_attention_heads: int = 12, intermediate_size: int = 3072, hidden_act: str = "gelu", hidden_dropout: float = 0.1, attention_dropout: float = 0.1, max_position_embeddings: int = 1026, initializer_range: float = 0.02, layer_norm_eps: float = 1e-12, position_embedding_type: str = "rotary", is_decoder: bool = False, use_cache: bool = True, emb_layer_norm_before: bool = False, token_dropout: bool = False, head: None = None, lm_head: None = None, **kwargs, ): super().__init__(**kwargs) if vocab_size is None: vocab_size = 131 if codon else 26 self.vocab_size = vocab_size self.codon = codon self.hidden_size = hidden_size self.num_hidden_layers = num_hidden_layers self.num_attention_heads = num_attention_heads self.intermediate_size = intermediate_size self.hidden_act = hidden_act self.hidden_dropout = hidden_dropout self.attention_dropout = attention_dropout self.max_position_embeddings = max_position_embeddings self.initializer_range = initializer_range self.layer_norm_eps = layer_norm_eps self.position_embedding_type = position_embedding_type self.is_decoder = is_decoder self.use_cache = use_cache self.emb_layer_norm_before = emb_layer_norm_before self.token_dropout = token_dropout self.head = head self.lm_head = lm_head class CaLmPreTrainedModel(PreTrainedModel): """ An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained models. """ config_class = CaLmConfig all_tied_weights_keys = {} base_model_prefix = "model" supports_gradient_checkpointing = True _no_split_modules = ["CaLmLayer", "CaLmEmbeddings"] # Copied from transformers.models.bert.modeling_bert.BertPreTrainedModel._init_weights def _init_weights(self, module: nn.Module): """Initialize the weights""" if isinstance(module, nn.Linear): # Slightly different from the TF version which uses truncated_normal for initialization # cf https://github.com/pytorch/pytorch/pull/5617 module.weight.data.normal_(mean=0.0, std=self.config.initializer_range) if module.bias is not None: module.bias.data.zero_() elif isinstance(module, nn.Embedding): module.weight.data.normal_(mean=0.0, std=self.config.initializer_range) if module.padding_idx is not None: module.weight.data[module.padding_idx].zero_() elif isinstance(module, nn.LayerNorm): module.bias.data.zero_() module.weight.data.fill_(1.0) # transformers v5 no longer exposes get_head_mask on this base in our setup. # Keep local compatibility for CaLM attention masking. def _convert_head_mask_to_5d(self, head_mask: Tensor, num_hidden_layers: int) -> Tensor: if head_mask.dim() == 1: head_mask = head_mask.unsqueeze(0).unsqueeze(0).unsqueeze(-1).unsqueeze(-1) head_mask = head_mask.expand(num_hidden_layers, -1, -1, -1, -1) elif head_mask.dim() == 2: head_mask = head_mask.unsqueeze(1).unsqueeze(-1).unsqueeze(-1) assert head_mask.dim() == 5, f"head_mask.dim != 5, got {head_mask.dim()}" head_mask = head_mask.to(dtype=self.dtype) return head_mask def get_head_mask( self, head_mask: Tensor | None, num_hidden_layers: int, is_attention_chunked: bool = False, ) -> Tensor | List[None]: if head_mask is None: return [None] * num_hidden_layers head_mask = self._convert_head_mask_to_5d(head_mask, num_hidden_layers) if is_attention_chunked: head_mask = head_mask.unsqueeze(-1) return head_mask class CaLmModel(CaLmPreTrainedModel): """ Examples: >>> import torch >>> from multimolecule import CaLmConfig, CaLmModel, RnaTokenizer >>> config = CaLmConfig() >>> model = CaLmModel(config) >>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/rna") >>> input = tokenizer("ACGUN", return_tensors="pt") >>> output = model(**input) >>> output["last_hidden_state"].shape torch.Size([1, 7, 768]) >>> output["pooler_output"].shape torch.Size([1, 768]) """ def __init__(self, config: CaLmConfig, add_pooling_layer: bool = True): super().__init__(config) self.pad_token_id = config.pad_token_id self.embeddings = CaLmEmbeddings(config) self.encoder = CaLmEncoder(config) self.pooler = CaLmPooler(config) if add_pooling_layer else None # Initialize weights and apply final processing self.post_init() def get_input_embeddings(self): return self.embeddings.word_embeddings def set_input_embeddings(self, value): self.embeddings.word_embeddings = value def forward( self, input_ids: Tensor | None = None, attention_mask: Tensor | None = None, position_ids: Tensor | None = None, head_mask: Tensor | None = None, inputs_embeds: Tensor | None = None, encoder_hidden_states: Tensor | None = None, encoder_attention_mask: Tensor | None = None, past_key_values: Tuple[Tuple[Tensor, Tensor, Tensor, Tensor], ...] | None = None, use_cache: bool | None = None, output_attentions: bool | None = None, output_hidden_states: bool | None = None, return_dict: bool | None = None, **kwargs, ) -> Tuple[Tensor, ...] | BaseModelOutputWithPoolingAndCrossAttentions: r""" Args: encoder_hidden_states: Shape: `(batch_size, sequence_length, hidden_size)` Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if the model is configured as a decoder. encoder_attention_mask: Shape: `(batch_size, sequence_length)` Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used in the cross-attention if the model is configured as a decoder. Mask values selected in `[0, 1]`: - 1 for tokens that are **not masked**, - 0 for tokens that are **masked**. past_key_values: Tuple of length `config.n_layers` with each tuple having 4 tensors of shape `(batch_size, num_heads, sequence_length - 1, embed_size_per_head) Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up decoding. If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those that don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of all `decoder_input_ids` of shape `(batch_size, sequence_length)`. use_cache: If set to `True`, `past_key_values` key value states are returned and can be used to speed up decoding (see `past_key_values`). """ if kwargs: warn( f"Additional keyword arguments `{', '.join(kwargs)}` are detected in " f"`{self.__class__.__name__}.forward`, they will be ignored.\n" "This is provided for backward compatibility and may lead to unexpected behavior." ) output_attentions = output_attentions if output_attentions is not None else self.config.output_attentions output_hidden_states = ( output_hidden_states if output_hidden_states is not None else self.config.output_hidden_states ) return_dict = return_dict if return_dict is not None else self.config.use_return_dict if self.config.is_decoder: use_cache = use_cache if use_cache is not None else self.config.use_cache else: use_cache = False if input_ids is not None and inputs_embeds is not None: raise ValueError("You cannot specify both input_ids and inputs_embeds at the same time") if input_ids is not None: self.warn_if_padding_and_no_attention_mask(input_ids, attention_mask) input_shape = input_ids.size() elif inputs_embeds is not None: input_shape = inputs_embeds.size()[:-1] else: raise ValueError("You have to specify either input_ids or inputs_embeds") batch_size, seq_length = input_shape device = input_ids.device if input_ids is not None else inputs_embeds.device # type: ignore[union-attr] # past_key_values_length past_key_values_length = past_key_values[0][0].shape[2] if past_key_values is not None else 0 if attention_mask is None: if input_ids is not None and self.pad_token_id is not None: attention_mask = input_ids.ne(self.pad_token_id) else: attention_mask = torch.ones(((batch_size, seq_length + past_key_values_length)), device=device) warn( "attention_mask is not specified, and cannot be inferred from input_ids." "Assuming all tokens are not masked." ) # We can provide a self-attention mask of dimensions [batch_size, from_seq_length, to_seq_length] # ourselves in which case we just need to make it broadcastable to all heads. extended_attention_mask: Tensor = self.get_extended_attention_mask(attention_mask, input_shape) # If a 2D or 3D attention mask is provided for the cross-attention # we need to make broadcastable to [batch_size, num_heads, seq_length, seq_length] if self.config.is_decoder and encoder_hidden_states is not None: encoder_batch_size, encoder_sequence_length, _ = encoder_hidden_states.size() encoder_hidden_shape = (encoder_batch_size, encoder_sequence_length) if encoder_attention_mask is None: encoder_attention_mask = torch.ones(encoder_hidden_shape, device=device) encoder_extended_attention_mask = self.invert_attention_mask(encoder_attention_mask) else: encoder_extended_attention_mask = None # Prepare head mask if needed # 1.0 in head_mask indicate we keep the head # attention_probs has shape bsz x n_heads x N x N # input head_mask has shape [num_heads] or [num_hidden_layers x num_heads] # and head_mask is converted to shape [num_hidden_layers x batch x num_heads x seq_length x seq_length] head_mask = self.get_head_mask(head_mask, self.config.num_hidden_layers) embedding_output = self.embeddings( input_ids=input_ids, position_ids=position_ids, attention_mask=attention_mask, inputs_embeds=inputs_embeds, past_key_values_length=past_key_values_length, ) encoder_outputs = self.encoder( embedding_output, attention_mask=extended_attention_mask, head_mask=head_mask, encoder_hidden_states=encoder_hidden_states, encoder_attention_mask=encoder_extended_attention_mask, past_key_values=past_key_values, use_cache=use_cache, output_attentions=output_attentions, output_hidden_states=output_hidden_states, return_dict=return_dict, ) sequence_output = encoder_outputs[0] pooled_output = self.pooler(sequence_output) if self.pooler is not None else None if not return_dict: return (sequence_output, pooled_output) + encoder_outputs[1:] return BaseModelOutputWithPoolingAndCrossAttentions( last_hidden_state=sequence_output, pooler_output=pooled_output, past_key_values=encoder_outputs.past_key_values, hidden_states=encoder_outputs.hidden_states, attentions=encoder_outputs.attentions, cross_attentions=encoder_outputs.cross_attentions, ) class CaLmEmbeddings(nn.Module): """ Same as BertEmbeddings with a tiny tweak for positional embeddings indexing. """ def __init__(self, config: CaLmConfig): super().__init__() self.word_embeddings = nn.Embedding(config.vocab_size, config.hidden_size, padding_idx=config.pad_token_id) if config.emb_layer_norm_before: self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps) else: self.layer_norm = None # position_ids (1, len position emb) is contiguous in memory and exported when serialized self.position_embedding_type = getattr(config, "position_embedding_type", "absolute") self.register_buffer( "position_ids", torch.arange(config.max_position_embeddings).expand((1, -1)), persistent=False ) self.padding_idx = config.pad_token_id if self.position_embedding_type == "absolute": self.position_embeddings = nn.Embedding( config.max_position_embeddings, config.hidden_size, padding_idx=self.padding_idx ) else: self.position_embeddings = None self.token_dropout = config.token_dropout self.mask_token_id = config.mask_token_id self.pad_token_id = config.pad_token_id def forward( self, input_ids: Tensor | None = None, attention_mask: Tensor | None = None, position_ids: Tensor | None = None, inputs_embeds: Tensor | None = None, past_key_values_length: int = 0, ): if inputs_embeds is None: inputs_embeds = self.word_embeddings(input_ids) embeddings = inputs_embeds if self.token_dropout: if input_ids is None: raise ValueError("Token dropout is only supported when input_ids are provided") embeddings = embeddings.masked_fill((input_ids == self.mask_token_id).unsqueeze(-1), 0.0) mask_ratio_train = 0.15 * 0.8 # Hardcoded as the ratio used in all CaLM model training runs src_lengths = attention_mask.sum(-1) # type: ignore[union-attr] mask_ratio_observed = (input_ids == self.mask_token_id).sum(-1).float() / src_lengths embeddings = (embeddings * (1 - mask_ratio_train) / (1 - mask_ratio_observed)[:, None, None]).to(embeddings) if self.position_embedding_type == "absolute": if position_ids is None: if input_ids is not None: position_ids = create_position_ids_from_input_ids( input_ids, self.padding_idx, past_key_values_length ) else: position_ids = create_position_ids_from_inputs_embeds(inputs_embeds, self.padding_idx) # This is a bug in the original implementation position_ids = position_ids + 1 position_embeddings = self.position_embeddings(position_ids) embeddings += position_embeddings if self.layer_norm is not None: embeddings = self.layer_norm(embeddings) if attention_mask is not None: embeddings = (embeddings * attention_mask.unsqueeze(-1)).to(embeddings.dtype) return embeddings class CaLmEncoder(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.config = config self.layer = nn.ModuleList([CaLmLayer(config) for _ in range(config.num_hidden_layers)]) self.emb_layer_norm_after = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps) self.gradient_checkpointing = False def forward( self, hidden_states: Tensor, attention_mask: torch.FloatTensor | None = None, head_mask: torch.FloatTensor | None = None, encoder_hidden_states: torch.FloatTensor | None = None, encoder_attention_mask: torch.FloatTensor | None = None, past_key_values: Tuple[Tuple[torch.FloatTensor, ...], ...] | None = None, use_cache: bool | None = None, output_attentions: bool = False, output_hidden_states: bool = False, return_dict: bool = True, ) -> Tuple[Tensor, ...] | BaseModelOutputWithPastAndCrossAttentions: all_hidden_states = () if output_hidden_states else None all_self_attentions = () if output_attentions else None all_cross_attentions = () if output_attentions and self.config.add_cross_attention else None if self.gradient_checkpointing and self.training and use_cache: warn("`use_cache=True` is incompatible with gradient checkpointing. Setting `use_cache=False`...") use_cache = False next_decoder_cache = () if use_cache else None for i, layer_module in enumerate(self.layer): if output_hidden_states: all_hidden_states = all_hidden_states + (hidden_states,) # type: ignore[operator] layer_head_mask = head_mask[i] if head_mask is not None else None past_key_value = past_key_values[i] if past_key_values is not None else None if self.gradient_checkpointing and self.training: layer_outputs = self._gradient_checkpointing_func( layer_module.__call__, hidden_states, attention_mask, layer_head_mask, encoder_hidden_states, encoder_attention_mask, past_key_value, output_attentions, ) else: layer_outputs = layer_module( hidden_states, attention_mask, layer_head_mask, encoder_hidden_states, encoder_attention_mask, past_key_value, output_attentions, ) hidden_states = layer_outputs[0] if use_cache: next_decoder_cache = next_decoder_cache + (layer_outputs[-1],) # type: ignore[operator] if output_attentions: all_self_attentions = all_self_attentions + (layer_outputs[1],) # type: ignore[operator] if self.config.add_cross_attention: all_cross_attentions = all_cross_attentions + (layer_outputs[2],) # type: ignore[operator] if self.emb_layer_norm_after: hidden_states = self.emb_layer_norm_after(hidden_states) if output_hidden_states: all_hidden_states = all_hidden_states + (hidden_states,) # type: ignore[operator] if not return_dict: return tuple( v for v in [ hidden_states, next_decoder_cache, all_hidden_states, all_self_attentions, all_cross_attentions, ] if v is not None ) return BaseModelOutputWithPastAndCrossAttentions( last_hidden_state=hidden_states, past_key_values=next_decoder_cache, hidden_states=all_hidden_states, attentions=all_self_attentions, cross_attentions=all_cross_attentions, ) class CaLmLayer(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.chunk_size_feed_forward = config.chunk_size_feed_forward self.seq_len_dim = 1 self.attention = CaLmAttention(config) self.is_decoder = config.is_decoder self.add_cross_attention = config.add_cross_attention if self.add_cross_attention: if not self.is_decoder: raise ValueError(f"{self} should be used as a decoder model if cross attention is added") self.crossattention = CaLmAttention(config, position_embedding_type="absolute") self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps) self.intermediate = CaLmIntermediate(config) self.output = CaLmOutput(config) def forward( self, hidden_states: Tensor, attention_mask: torch.FloatTensor | None = None, head_mask: torch.FloatTensor | None = None, encoder_hidden_states: torch.FloatTensor | None = None, encoder_attention_mask: torch.FloatTensor | None = None, past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None, output_attentions: bool = False, ) -> Tuple[Tensor, ...]: # decoder uni-directional self-attention cached key/values tuple is at positions 1,2 self_attn_past_key_value = past_key_value[:2] if past_key_value is not None else None self_attention_outputs = self.attention( hidden_states, attention_mask, head_mask, output_attentions=output_attentions, past_key_value=self_attn_past_key_value, ) attention_output = self_attention_outputs[0] # if decoder, the last output is tuple of self-attn cache if self.is_decoder: outputs = self_attention_outputs[1:-1] present_key_value = self_attention_outputs[-1] else: outputs = self_attention_outputs[1:] # add self attentions if we output attention weights cross_attn_present_key_value = None if self.is_decoder and encoder_hidden_states is not None: if not hasattr(self, "crossattention"): raise AttributeError( f"If `encoder_hidden_states` are passed, {self} has to be instantiated" " with cross-attention layers by setting `config.add_cross_attention=True`" ) # cross_attn cached key/values tuple is at positions 3,4 of past_key_value tuple cross_attn_past_key_value = past_key_value[-2:] if past_key_value is not None else None cross_attention_outputs = self.crossattention( attention_output, attention_mask, head_mask, encoder_hidden_states, encoder_attention_mask, cross_attn_past_key_value, output_attentions, ) attention_output = cross_attention_outputs[0] outputs = outputs + cross_attention_outputs[1:-1] # add cross attentions if we output attention weights # add cross-attn cache to positions 3,4 of present_key_value tuple cross_attn_present_key_value = cross_attention_outputs[-1] present_key_value = present_key_value + cross_attn_present_key_value layer_output = apply_chunking_to_forward( self.feed_forward_chunk, self.chunk_size_feed_forward, self.seq_len_dim, attention_output ) outputs = (layer_output,) + outputs # if decoder, return the attn key/values as the last output if self.is_decoder: outputs = outputs + (present_key_value,) return outputs def feed_forward_chunk(self, attention_output): attention_output_ln = self.layer_norm(attention_output) intermediate_output = self.intermediate(attention_output_ln) layer_output = self.output(intermediate_output, attention_output) return layer_output class CaLmAttention(nn.Module): def __init__(self, config: CaLmConfig, position_embedding_type: str | None = None): super().__init__() self.self = CaLmSelfAttention(config, position_embedding_type=position_embedding_type) self.output = CaLmSelfOutput(config) self.pruned_heads: set = set() self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps) def forward( self, hidden_states: Tensor, attention_mask: torch.FloatTensor | None = None, head_mask: torch.FloatTensor | None = None, encoder_hidden_states: torch.FloatTensor | None = None, encoder_attention_mask: torch.FloatTensor | None = None, past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None, output_attentions: bool = False, ) -> Tuple[Tensor, ...]: hidden_states_ln = self.layer_norm(hidden_states) self_outputs = self.self( hidden_states_ln, attention_mask, head_mask, encoder_hidden_states, encoder_attention_mask, past_key_value, output_attentions, ) attention_output = self.output(self_outputs[0], hidden_states) outputs = (attention_output,) + self_outputs[1:] # add attentions if we output them return outputs class CaLmSelfAttention(nn.Module): def __init__(self, config: CaLmConfig, position_embedding_type: str | None = None): super().__init__() if config.hidden_size % config.num_attention_heads != 0 and not hasattr(config, "embedding_size"): raise ValueError( f"The hidden size ({config.hidden_size}) is not a multiple of the number of attention " f"heads ({config.num_attention_heads})" ) self.num_attention_heads = config.num_attention_heads self.attention_head_size = int(config.hidden_size / config.num_attention_heads) self.all_head_size = self.num_attention_heads * self.attention_head_size self.query = nn.Linear(config.hidden_size, self.all_head_size) self.key = nn.Linear(config.hidden_size, self.all_head_size) self.value = nn.Linear(config.hidden_size, self.all_head_size) self.dropout = nn.Dropout(config.attention_dropout) self.position_embedding_type = position_embedding_type or getattr(config, "position_embedding_type", "absolute") self.rotary_embeddings = None if self.position_embedding_type == "relative_key" or self.position_embedding_type == "relative_key_query": self.max_position_embeddings = config.max_position_embeddings self.distance_embedding = nn.Embedding(2 * config.max_position_embeddings - 1, self.attention_head_size) elif self.position_embedding_type == "rotary": self.rotary_embeddings = RotaryEmbedding(embedding_dim=self.attention_head_size) self.is_decoder = config.is_decoder def transpose_for_scores(self, x: Tensor) -> Tensor: new_x_shape = x.size()[:-1] + (self.num_attention_heads, self.attention_head_size) x = x.view(new_x_shape) return x.transpose(1, 2) def forward( self, hidden_states: Tensor, attention_mask: torch.FloatTensor | None = None, head_mask: torch.FloatTensor | None = None, encoder_hidden_states: torch.FloatTensor | None = None, encoder_attention_mask: torch.FloatTensor | None = None, past_key_value: Tuple[torch.FloatTensor, torch.FloatTensor] | None = None, output_attentions: bool = False, ) -> Tuple[Tensor, ...]: mixed_query_layer = self.query(hidden_states) # If this is instantiated as a cross-attention module, the keys # and values come from an encoder; the attention mask needs to be # such that the encoder's padding tokens are not attended to. is_cross_attention = encoder_hidden_states is not None if is_cross_attention and past_key_value is not None: # reuse k,v, cross_attentions key_layer = past_key_value[0] value_layer = past_key_value[1] attention_mask = encoder_attention_mask elif is_cross_attention: key_layer = self.transpose_for_scores(self.key(encoder_hidden_states)) value_layer = self.transpose_for_scores(self.value(encoder_hidden_states)) attention_mask = encoder_attention_mask elif past_key_value is not None: key_layer = self.transpose_for_scores(self.key(hidden_states)) value_layer = self.transpose_for_scores(self.value(hidden_states)) key_layer = torch.cat([past_key_value[0], key_layer], dim=2) value_layer = torch.cat([past_key_value[1], value_layer], dim=2) else: key_layer = self.transpose_for_scores(self.key(hidden_states)) value_layer = self.transpose_for_scores(self.value(hidden_states)) query_layer = self.transpose_for_scores(mixed_query_layer) query_layer = query_layer * self.attention_head_size**-0.5 use_cache = past_key_value is not None if self.is_decoder: # if cross_attention save Tuple(Tensor, Tensor) of all cross attention key/value_states. # Further calls to cross_attention layer can then reuse all cross-attention # key/value_states (first "if" case) # if uni-directional self-attention (decoder) save Tuple(Tensor, Tensor) of # all previous decoder key/value_states. Further calls to uni-directional self-attention # can concat previous decoder key/value_states to current projected key/value_states (third "elif" case) # if encoder bi-directional self-attention `past_key_value` is always `None` past_key_value = (key_layer, value_layer) if self.position_embedding_type == "rotary": query_layer, key_layer = self.rotary_embeddings(query_layer, key_layer) # type: ignore[misc] # Take the dot product between "query" and "key" to get the raw attention scores. attention_scores = torch.matmul(query_layer, key_layer.transpose(-1, -2)) # type: ignore[attr-defined] if self.position_embedding_type == "relative_key" or self.position_embedding_type == "relative_key_query": query_length, key_length = query_layer.shape[2], key_layer.shape[2] # type: ignore[attr-defined] if use_cache: position_ids_l = torch.tensor(key_length - 1, dtype=torch.long, device=hidden_states.device).view(-1, 1) else: position_ids_l = torch.arange(query_length, dtype=torch.long, device=hidden_states.device).view(-1, 1) position_ids_r = torch.arange(key_length, dtype=torch.long, device=hidden_states.device).view(1, -1) distance = position_ids_l - position_ids_r positional_embedding = self.distance_embedding(distance + self.max_position_embeddings - 1) positional_embedding = positional_embedding.to(dtype=query_layer.dtype) # fp16 compatibility if self.position_embedding_type == "relative_key": relative_position_scores = torch.einsum("bhld,lrd->bhlr", query_layer, positional_embedding) attention_scores = attention_scores + relative_position_scores elif self.position_embedding_type == "relative_key_query": relative_position_scores_query = torch.einsum("bhld,lrd->bhlr", query_layer, positional_embedding) relative_position_scores_key = torch.einsum("bhrd,lrd->bhlr", key_layer, positional_embedding) attention_scores = attention_scores + relative_position_scores_query + relative_position_scores_key if attention_mask is not None: # Apply the attention mask is (precomputed for all layers in CaLmModel forward() function) attention_scores = attention_scores + attention_mask # Normalize the attention scores to probabilities. attention_probs = F.softmax(attention_scores, dim=-1) # This is actually dropping out entire tokens to attend to, which might # seem a bit unusual, but is taken from the original Transformer paper. attention_probs = self.dropout(attention_probs) # Mask heads if we want to if head_mask is not None: attention_probs = attention_probs * head_mask context_layer = torch.matmul(attention_probs.to(value_layer.dtype), value_layer) context_layer = context_layer.transpose(1, 2).contiguous() new_context_layer_shape = context_layer.size()[:-2] + (self.all_head_size,) context_layer = context_layer.view(new_context_layer_shape) outputs = (context_layer, attention_probs) if output_attentions else (context_layer,) if self.is_decoder: outputs = outputs + (past_key_value,) return outputs class CaLmSelfOutput(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.dense = nn.Linear(config.hidden_size, config.hidden_size) self.dropout = nn.Dropout(config.hidden_dropout) def forward(self, hidden_states, input_tensor): hidden_states = self.dense(hidden_states) hidden_states = self.dropout(hidden_states) hidden_states = hidden_states + input_tensor return hidden_states class CaLmIntermediate(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.dense = nn.Linear(config.hidden_size, config.intermediate_size) if isinstance(config.hidden_act, str): self.activation = ACT2FN[config.hidden_act] else: self.activation = config.hidden_act def forward(self, hidden_states: Tensor) -> Tensor: hidden_states = self.dense(hidden_states) hidden_states = self.activation(hidden_states) return hidden_states class CaLmOutput(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.dense = nn.Linear(config.intermediate_size, config.hidden_size) self.dropout = nn.Dropout(config.hidden_dropout) def forward(self, hidden_states: Tensor, input_tensor: Tensor) -> Tensor: hidden_states = self.dense(hidden_states) hidden_states = self.dropout(hidden_states) hidden_states = hidden_states + input_tensor return hidden_states # Copied from transformers.models.bert.modeling_bert.BertPooler class CaLmPooler(nn.Module): def __init__(self, config: CaLmConfig): super().__init__() self.dense = nn.Linear(config.hidden_size, config.hidden_size) self.activation = nn.Tanh() def forward(self, hidden_states: Tensor) -> Tensor: # We "pool" the model by simply taking the hidden state corresponding # to the first token. first_token_tensor = hidden_states[:, 0] pooled_output = self.dense(first_token_tensor) pooled_output = self.activation(pooled_output) return pooled_output def create_position_ids_from_inputs_embeds(inputs_embeds: torch.FloatTensor, padding_idx: int = 0) -> torch.LongTensor: input_shape = inputs_embeds.size()[:-1] sequence_length = input_shape[1] position_ids = torch.arange( padding_idx + 1, sequence_length + padding_idx + 1, dtype=torch.long, device=inputs_embeds.device ) return position_ids.unsqueeze(0).expand(input_shape) def create_position_ids_from_input_ids( input_ids: torch.LongTensor, padding_idx: int = 0, past_key_values_length: int = 0 ) -> torch.LongTensor: # The series of casts and type-conversions here are carefully balanced to both work with ONNX export and XLA. mask = input_ids.ne(padding_idx).int() incremental_indices = ( (torch.cumsum(mask, dim=1, dtype=mask.dtype) + past_key_values_length) * mask + past_key_values_length ) * mask return incremental_indices.long() + padding_idx presets = { 'CaLM': 'multimolecule/calm', } def _normalize_calm_preset(preset: str) -> str: if preset in presets: return preset if 'calm' in preset.lower(): return 'CaLM' raise ValueError(f"Model {preset} not supported") def _load_calm_backbone(model_path: str, add_pooling_layer: bool = False, dtype: torch.dtype = None) -> CaLmModel: model, loading_info = CaLmModel.from_pretrained( model_path, dtype=dtype, add_pooling_layer=add_pooling_layer, output_loading_info=True, ) missing_keys = loading_info["missing_keys"] unexpected_keys = loading_info["unexpected_keys"] mismatched_keys = loading_info["mismatched_keys"] error_msgs = loading_info["error_msgs"] disallowed_unexpected_keys = [key for key in unexpected_keys if not key.startswith("lm_head.")] assert len(missing_keys) == 0, ( f"CaLM load had missing keys: {missing_keys}" ) assert len(mismatched_keys) == 0, ( f"CaLM load had mismatched keys: {mismatched_keys}" ) assert len(disallowed_unexpected_keys) == 0, ( "CaLM load had unexpected keys outside lm_head.*: " f"{disallowed_unexpected_keys}" ) assert len(error_msgs) == 0, ( f"CaLM load had loader errors: {error_msgs}" ) return model class CaLMTokenizerWrapper(BaseSequenceTokenizer): def __init__(self, tokenizer: RnaTokenizer): super().__init__(tokenizer) def __call__(self, sequences: Union[str, List[str]], **kwargs) -> Dict[str, torch.Tensor]: if isinstance(sequences, str): sequences = [sequences] kwargs.setdefault('return_tensors', 'pt') kwargs.setdefault('padding', 'longest') kwargs.setdefault('add_special_tokens', True) tokenized = self.tokenizer(sequences, **kwargs) return tokenized class CaLmForEmbedding(nn.Module): def __init__(self, model_path: str, dtype: torch.dtype = None): super().__init__() self.calm = _load_calm_backbone(model_path, add_pooling_layer=False, dtype=dtype) def forward( self, input_ids: torch.Tensor, attention_mask: Optional[torch.Tensor] = None, output_attentions: Optional[bool] = None, output_hidden_states: Optional[bool] = False, **kwargs, ) -> torch.Tensor: if output_attentions: out = self.calm(input_ids=input_ids, attention_mask=attention_mask, output_attentions=output_attentions) return out.last_hidden_state, out.attentions else: return self.calm(input_ids=input_ids, attention_mask=attention_mask).last_hidden_state def get_calm_tokenizer(preset: str, model_path: str = None): normalized_preset = _normalize_calm_preset(preset) return CaLMTokenizerWrapper(RnaTokenizer.from_pretrained(model_path or presets[normalized_preset])) def build_calm_model(preset: str, masked_lm: bool = False, dtype: torch.dtype = None, model_path: str = None, **kwargs): normalized_preset = _normalize_calm_preset(preset) path = model_path or presets[normalized_preset] if masked_lm: raise ValueError(f"Model {preset} does not support masked language modeling") else: model = CaLmForEmbedding(path, dtype=dtype).eval() tokenizer = get_calm_tokenizer(normalized_preset, model_path=model_path) return model, tokenizer def get_calm_for_training(preset: str, tokenwise: bool = False, num_labels: int = None, hybrid: bool = False, dtype: torch.dtype = None, model_path: str = None): normalized_preset = _normalize_calm_preset(preset) model_path = model_path or presets[normalized_preset] if hybrid: model = _load_calm_backbone(model_path, add_pooling_layer=False, dtype=dtype).eval() else: raise ValueError(f"Model {preset} does not support training") tokenizer = get_calm_tokenizer(normalized_preset) return model, tokenizer if __name__ == '__main__': # py -m src.protify.base_models.calm model, tokenizer = build_calm_model('CaLM') print(model) print(tokenizer) tokenized = tokenizer('GCCAGTCGCTGACAGCCGCGG') print(model(**tokenized).shape) print(tokenized)